patient_id
int64 0
167k
| patient_uid
stringlengths 8
10
| PMID
int64 1.34M
35M
| file_path
stringlengths 31
35
| title
stringlengths 7
377
| patient
stringlengths 55
95.4k
| age
stringlengths 14
33
| gender
stringclasses 2
values | relevant_articles
stringlengths 15
20.5k
| similar_patients
stringlengths 2
1.26k
|
|---|---|---|---|---|---|---|---|---|---|
163,300 |
3778540-1
| 24,062,860 |
noncomm/PMC003xxxxxx/PMC3778540.xml
|
Perioperative Management of Patients with Rheumatic Diseases
|
This patient was a 51 year-old female, a known case of long-standing RA and hypertension. She had significant small joint involvement that caused disabling deformities in both hands with ulnar deviation and swan neck deformity involving multiple fingers. Hand x-rays revealed extensive peripheral joint erosions bilaterally. At baseline, she was sedentary because her painful knees limited her level of activity. She was on MTX 7.5mg weekly, Prednisolone 5 mg daily, Infliximab 3mg/kg IV every 8 weeks, Lisinopril 10 mg. Amlodipine 5 mg and Aspirin 81 mg. She was scheduled for reconstructive hand surgery.\nThe female was screened for C1-2 subluxation. Intraoperatively, it is important to avoid musculoskeletal trauma. Therefore, padding, careful joint positioning and avoidance of sudden movements of the neck and torso are important to prevent injury, including neurovascular compromise or fracture. PFT was indicated to screen for pulmonary fibrosis, given the severity of rheumatoid arthritis. She was instructed to stop Aspirin 1 week before Anti-hypertensive medications continued with sips of water perioperatively. Methotrexate was suggested to continue, with no increased risk of infection, wound healing or flare. Infliximab, an anti-TNF blocker was with held one week before and re-started at least one week after surgery. If Infliximab was being administered every 8 weeks, it was surgery. Anti-hypertensive medications were continued with sips of water perioperatively. MTX was continued, with no increased risk of infection, wound healing or flare. Infliximab, an anti-TNF blocker was held one week before and re-started at least one week after surgery. If Infliximab was being administered every 8 weeks, it was recommended that this elective surgery be scheduled in the middle of the eight-week period. With regards to Prednisolone, as the patient had only been taking 5mg/day of Prednisolone daily, there was no need to screen for suppression of her hypothalamic-pituitary-adrenal axis, nor to administer stress doses of steroids. The current dose was continued perioperatively. Since this was a clean procedure of relatively short duration, prophylactic antibiotics were not indicated. Early ambulation was adequate for VTE prophylaxis.
|
[[51.0, 'year']]
|
F
|
{'23594897': 1, '11878732': 1, '22083219': 1, '22315278': 1, '10477528': 1, '11454370': 1, '20033813': 1, '11171680': 1, '31312678': 1, '18322972': 1, '23137580': 1, '21800113': 1, '22432360': 1, '20472923': 1, '25491208': 1, '9420722': 1, '21596198': 1, '2136808': 1, '9876790': 1, '20415353': 1, '28913596': 1, '18390484': 1, '19917174': 1, '10713868': 1, '26236339': 1, '20068416': 1, '9494984': 1, '18751827': 1, '19009324': 1, '23264422': 1, '24884884': 1, '6482932': 1, '24062860': 2}
|
{'3778540-2': 2}
|
163,301 |
3778540-2
| 24,062,860 |
noncomm/PMC003xxxxxx/PMC3778540.xml
|
Perioperative Management of Patients with Rheumatic Diseases
|
This patient is a 55 year-old female, known case of lupus nephritis on Mycophenolate 2g daily, Hydroxychloroquine 300 mg daily and Prednisolone 10mg daily. She was admitted to the orthopedic service for a right total hip replacement due to avascular necrosis of the right hip.\nThe patient was on Prednisolone more than 5mg/d chronically and was scheduled to undergo a moderate stress procedure, thus stress dose steroids in the form of Hydrocortisone 50 mg IV, then postoperatively 20mg IV every 8 hours for 3 doses, then pre-operative dose was resumed on post-operative day 2.\nFurthermore, THR is a major surgery, thus the patient required a chest x-ray, ECG and persantine thallium for pulmonary and cardiac screening. Hydroxychloroquine and mycophenolate were continued to the morning of surgery, and resumed with oral intake and because SLE patients who have renal involvement and are on steroids are considered to be at higher risk for developing perioperative complications. Screening laboratory investigations should include CBC, renal profile and urinalysis. If the patient is found to be anemic, preparations for autologous blood donation including iron and erythropoietin may be appropriate, as substantial blood loss often occurs perioperatively. Even an asymptomatic urinary tract infection should be treated before proceeding with THR.\nDual VTE prophylaxis was recommended to be initiated, preferably with LMWH at least 12 hours before surgery and extended to 35 days after; intermittent pneumatic compression device was recommended to be used during the hospital stay along with perioperative antibiotics, such as IV Cefazolin.
|
[[55.0, 'year']]
|
F
|
{'23594897': 1, '11878732': 1, '22083219': 1, '22315278': 1, '10477528': 1, '11454370': 1, '20033813': 1, '11171680': 1, '31312678': 1, '18322972': 1, '23137580': 1, '21800113': 1, '22432360': 1, '20472923': 1, '25491208': 1, '9420722': 1, '21596198': 1, '2136808': 1, '9876790': 1, '20415353': 1, '28913596': 1, '18390484': 1, '19917174': 1, '10713868': 1, '26236339': 1, '20068416': 1, '9494984': 1, '18751827': 1, '19009324': 1, '23264422': 1, '24884884': 1, '6482932': 1, '24062860': 2}
|
{'3778540-1': 2}
|
163,302 |
3778594-1
| 24,082,701 |
noncomm/PMC003xxxxxx/PMC3778594.xml
|
Cytochrome P450 2C9 gene polymorphism in phenytoin induced gingival enlargement: A case report
|
A 18-year-old male patient came to Department of Periodontics, Mahatma Gandhi Post Graduate Institute of Dental Sciences, Pondicherry, with a complain of swelling of upper and lower teeth gums for the past 10 months. Patient's medical history revealed that he had been on long-term phenytoin therapy (10 years) for primary generalized epilepsy at a daily dose of 300-mg/day. On intraoral clinical examination, there was generalized gingival enlargement involving marginal, attached, interdental papilla of upper and lower anterior teeth both labial and lingual/palatal aspects [Figures -] and on the buccal aspects of upper and lower premolars and first and second molars. The enlargement was pale pink in color, firm, resilient with minutely lobulated surface and no tendency to bleed on probing. There was also presence of supra and subgingival deposits. There were no any other significant dental findings. Based on these clinical findings a provisional diagnosis of Phenytoin induced gingival enlargement with superimposed inflammatory component was made.\nRoutine blood investigations were done which were found to be within normal limits. Gingival enlargement was due to phenytoin toxicity. This phenytoin toxicity prompted appropriate pharamacogenomics studies. Patient was informed verbally and written informed consent was obtained. 5 ml of venous blood was collected from the antecubital vein into ethylenediaminetetraacetic acid tubes. Plasma was separated by centrifugation and stored at −20°C until the assay. After separation of plasma, the cellular fraction was subjected to DNA extraction from leukocytes by the standard phenol: Chloroform procedure and genotyping of CYP2C9 was performed by a polymerase chain reaction-restriction fragment length polymorphism method. The CYP2C9* (Arg144 Cys) was detected using the forward and reverse primers 5´ TACAAATACAATGAAAATATCATG 3´ and 5´ CTAACAACCAGA CTCATAATG 3´, respectively and the genotype result was found to be homozygous CYP2C9*3*3.
|
[[18.0, 'year']]
|
M
|
{'31584773': 1, '34067134': 1, '14504850': 1, '11927841': 1, '9333104': 1, '29242684': 1, '26015682': 2, '14659971': 1, '18040121': 1, '29472822': 2, '24082701': 2}
|
{'4439641-1': 1, '5820983-1': 1}
|
163,303 |
3778607-1
| 24,082,659 |
noncomm/PMC003xxxxxx/PMC3778607.xml
|
Case report on spontaneous ovarian hyperstimulation syndrome following natural conception associated with primary hypothyroidism
|
A 22 year old primigravida with spontaneous conception, regular menstrual cycles, married for 3 months and no relevant past medical illness, no clinical or subclinical evidence of hypothyroidism in the past; attended the Department of Obstetrics at 7 weeks of gestation. She was asymptomatic, and ultrasound scan also revealed single live intrauterine pregnancy at 7 weeks and normal appearing ovaries. At 9 weeks of gestation, she developed vomiting, diarrhoea and lower abdominal discomfort. Abdominal examination revealed a non-tender, mobile mass of approximately 10 cm × 10 cm in the right iliac fossa with no clinical evidence of ascites.\nUltrasound scan performed at 9 weeks of gestation revealed a single live intrauterine gestation corresponding to 9 weeks of gestation, bilaterally enlarged multicystic ovaries with right ovary measuring 10 cm × 8 cm, left ovary 8 cm × 6 cm and no ultrasonological evidence of ascites, pleural or pericardial effusion [Figures and ].\nStarted with levothyroxin 150 μg daily. The abdominal discomfort reduced from 14th week onward and the size of the ovaries normalized at 20 weeks. At 17 weeks of gestation, triple screening was performed, and the report showed low risk (1/6500) for chromosomal aneuploidies. Anomaly scan done at 20 weeks showed no fetal or placental anomalies and bilateral maternal ovaries were normal sized.\nThe patient delivered a term female baby weighing 3300 g at 39 weeks of gestation.
|
[[22.0, 'year']]
|
F
|
{'25920736': 1, '10927070': 1, '28371633': 1, '19012103': 1, '19573286': 1, '18020917': 1, '18283448': 1, '20485578': 1, '25960820': 1, '18238999': 1, '17356048': 1, '14687752': 1, '9061633': 1, '1442911': 1, '10912402': 1, '11518117': 1, '15003269': 1, '34934984': 1, '12930928': 1, '27034864': 2, '8894317': 1, '20171619': 1, '16521882': 1, '19499413': 1, '21861901': 2, '16278261': 1, '26752859': 2, '2729396': 1, '24082659': 2}
|
{'3184057-1': 1, '4789410-1': 1, '4691976-1': 1}
|
163,304 |
3778608-1
| 24,082,660 |
noncomm/PMC003xxxxxx/PMC3778608.xml
|
Magnetic resonance imaging in obstructive Müllerian anomalies
|
A 13-years-old female presented with a history of severe abdomino-pelvic pain, which increased with each of her menstrual cycles lasting 2–7 days. Gynecological history indicated menarche 3 months back. However, there was no abnormal vaginal bleeding, nausea, vomiting, or diarrhoea. A bimanual physical examination indicated a right-sided cystic and tender pelvic mass, movable, and mildly tender to palpation. Ultrasound showed the absence of right kidney, uterine didelphis, and a caudal cystic lesion with internal echogenicities adjacent to it [Figure and ]. Magnetic resonance imaging (MRI) was performed in order to evaluate the possible genito-urinary anomaly.\nMRI showed evidence of uterine didelphis, the left segment draining normally through a collapsed left hemivagina, and seen to communicate with left cervix and corresponding uterine horn. The right hemivagina was markedly distended (5.63 cm). Its lower end was convex and placed 4.75 cm above the introitus []. The upper end communicated with the right uterine horn, which was distended through the right cervix. Signal intensity of the contents of distended right hemi vagina and uterine horn appeared iso-intense on T1WI and hyperintense on T2WI [Figure and ], with thick mucoid collection (hemicolpos and hemimetra). The right kidney was not visualized and the left kidney was marginally enlarged [].
|
[[13.0, 'year']]
|
F
|
{'9663283': 1, '11641165': 1, '10869793': 1, '22405336': 2, '18778460': 1, '17503029': 1, '28191231': 1, '15050991': 1, '11284660': 1, '24082660': 2}
|
{'3314562-1': 1, '3314562-2': 1, '3314562-3': 1}
|
163,305 |
3778634-1
| 24,082,581 |
noncomm/PMC003xxxxxx/PMC3778634.xml
|
Management of mandibular first molar with four canals in mesial root
|
A 37-year-old male patient with a noncontributory medical history reported to our department with discomfort and pain in the right mandibular region. History of present illness showed that there were few episodes of recurrent pain in that region for the past 1 year. There was a large carious lesion and a draining sinus in relation to left mandibular first molar with pain on palpation in the periapical region. Pulp testing with cold and electric pulse tester (EPT) was nonresponsive. Intraoral periapical (IOPA) radiograph revealed a large radiolucency around the periapex of left mandibular first molar []. Gutta-percha tracing of sinus showed that the sinus originated from the periapical radiolucency around the tooth. It was diagnosed as pulpal necrosis with symptomatic apical periodontitis. Treatment plan was explained to the patient and endodontic treatment was initiated under rubber dam isolation. Three canals were located, two in the mesial and one in the distal. Under magnification, it was evident that the mesiobuccal (MB) and mesiolingual (ML) were placed well apart with an isthmus joining the two canals. With the above mentioned pulpal floor anatomy over the mesial root, a possibility of MMcanalwas anticipated in the isthmus between MB and ML. On exploration with DG-16, there was a “catch” or a “stick” feeling where a MM canal was located close to MB canal. The distance between the MM canal and ML canal with a prominent isthmus between the two, prompted us to look for a second MM canal. Further exploration on the isthmus revealed one more “stick” feeling which on penetration with profinder revealed to be a second MM located closer to the ML canal []. IOPA radiograph revealed one MM joining the MB canal and another joining the ML canal in the middle third []. The orifices were enlarged using #2 GatesGlidden Drill (Mani, Japan) to enhance access and visualization. After confirming the working length with an apex locator (Root ZX, J Morita, Tokyo, Japan), the mesial canals were enlarged up to size 25-6% (M two, DentsplyMaillefer) and the distal canal was instrumented with hand K-files (DentsplyMaillefer) by crown down method with apex enlarged to size40. Intracanal medicament of 2% chlorhexidine was placed and closed dressing was given. Since the anatomy was unusual, a cone beam computed tomography (CBCT) image was taken to confirm the anatomy []. CBCT image confirmed the presence of two MM canals of which one joined the MB and another joined the ML canal at the middle third and exited as a single canal at the apex. This was followed by an intracanal medication with CaOH (Dentocal, Anabond Stedman) with chlorhexidine (Asep-RC, Anabond Stedman) after a week for 3 weeks. CaOH was not placed in the first sitting as the radiopaque CaOH may obscure the CBCT image. Obturation was performed at the third appointment using cold lateral compaction of gutta-percha and AH-26 (Dentsply Maillefer) as a root canal sealer. Figure and shows the IOPA images immediately after obturation in buccal and distal view. is 6 month follow-up image showing a good healing of the periapical lesion.
|
[[37.0, 'year']]
|
M
|
{'4523925': 1, '15055654': 1, '17697250': 1, '12126376': 1, '18059249': 1, '3867722': 1, '2056340': 1, '24944458': 2, '26430309': 2, '11307374': 1, '9693579': 1, '12702122': 1, '25685156': 2, '6985549': 1, '30294115': 1, '18822010': 1, '4533939': 1, '15167464': 1, '25829700': 2, '9248689': 1, '24715990': 2, '2094761': 1, '11482136': 1, '11482719': 1, '23130041': 2, '21092807': 1, '27217638': 1, '30158775': 1, '24082581': 2}
|
{'3471583-1': 1, '4312998-1': 1, '4578190-1': 1, '4379661-1': 1, '3970076-1': 1, '4056406-1': 1}
|
163,306 |
3778635-1
| 24,082,582 |
noncomm/PMC003xxxxxx/PMC3778635.xml
|
Endodontic management of an unusual foreign body in a maxillary central incisor
|
A 14-year-old boy presented with the complaint of broken upper front teeth. The patient wanted esthetic restoration of his anterior teeth. He had a history of fall from steps while playing 2 years ago.\nClinical examination revealed a complicated crown fracture (Ellis class III) on upper right central incisor and an Ellis class II fracture on upper left central incisor [Figure and ]. There was a mild discoloration of 11. He had negative history of pain, swelling, or pus discharge. On examination, an open root canal was seen on 11.\nAn intraoral periapical radiograph revealed the presence of a radio-opaque object (foreign body) inside the root canal of 11, which resembled a bent stapler pin []. It was present at the junction of middle and cervical thirds of the root canal. There was periapical radiolucency in relation to 11.\nThe tooth 11 was isolated and a conventional access cavity was prepared. A thin, tapering, diamond fissure bur on an air rotor hand piece was used to slightly widen the orifice to facilitate access for instrumentation. An ultrasonic scaler was used to clear the debris from root canal orifice and also to facilitate loosening of the stapler pin. Root canal was irrigated with 5.2% sodium hypochlorite solution. A no. 20 H file was used to bypass and engage the foreign body. After a series of attempts, the object was moved coronally and pulled out with a mosquito forceps []. The canal was then irrigated with normal saline, which helped to remove the debris including small wooden pieces. Working length was established and biomechanical preparation done using step-back technique. Calcium hydroxide was used as the intracanal medicament. In the next appointment, obturation of the tooth was done with gutta-percha using lateral condensation technique []. Final restoration was done with metal ceramic crown. The tooth 21 was restored with composite [].
|
[[14.0, 'year']]
|
M
|
{'2356092': 1, '25489203': 1, '16238659': 1, '4507481': 1, '4625809': 1, '4891168': 1, '10635138': 1, '24082582': 2}
|
{}
|
163,307 |
3778636-1
| 24,082,583 |
noncomm/PMC003xxxxxx/PMC3778636.xml
|
Endodontic treatment of hypertaurodontism with multiple bilateral taurodontism
|
A 31-year-old male patient applied to the endodontic clinic with decayed left maxillary first molar. Medical and family histories were non-contributory. The tooth was asymptomatic and was not sensitive to percussion or palpation. However, several times, he had experienced pain in his tooth after drinking hot liquids. Intraoral examination revealed a deep carious lesion in the maxillary left first molar (tooth 26). An intraoral periapical radiograph showed the presence of a coronal radiolucency close to the pulp chamber, confirming the diagnosis of asymptomatic irreversible pulpitis and a large pulp chamber, as well as extremely short roots, signifying hypertaurodontism. A panoramic radiograph was recommended to look for multiple taurodonts and revealed bilateral hypertaurodontism in the maxillary and mandibular molars. Root canal therapy was advised for tooth 26. The tooth was anesthetized using 2% articaine with 1:200 000 epinephrine, and the pulp chamber of tooth 26 was accessed under rubber-dam isolation. Five canals, including two mesial, two distal, and a palatal were located. Working lengths were determined with a #15 K file (Dentsply Maillefer; Ballaigues, Switzerland) and confirmed by an electronic apex locator (Root ZX; Morita, Japan). Root canals were prepared using Revo-S (Micro-Mega, Besançon, France) rotary files. An SC1 (25.06) file was used at 2/3 of the working length. SC2 (25.04) and SU (25.06) files were used at the working length. Passive ultrasonic irrigation and 2.5% sodium hypochlorite were also used between each file, and the final flush was performed with ethylenediaminetetraacetic acid (EDTA) 15%, following 2.5% sodium hypochlorite. After drying the canals, the root canals were filled with traditional lateral compaction and the elongated pulp chamber was obturated using the vertical compaction method with AH Plus (Dentsply International) and gutta-percha cones. The final radiograph confirmed a well-condensed filling of the five root canals, and the tooth was then restored with a composite resin [].
|
[[31.0, 'year']]
|
M
|
{'14178921': 1, '28808451': 1, '22432825': 1, '17201755': 1, '3162941': 1, '11543709': 1, '278704': 1, '15735461': 1, '791224': 1, '12775010': 1, '17442017': 1, '3861764': 1, '1298802': 1, '18363703': 1, '3255774': 1, '25407030': 1, '33384498': 2, '2791517': 1, '6928171': 1, '15273645': 1, '3862706': 1, '15347291': 1, '7996099': 1, '24082583': 2}
|
{'7720748-1': 1}
|
163,308 |
3778776-1
| 24,082,181 |
noncomm/PMC003xxxxxx/PMC3778776.xml
|
Primary Cutaneous Diffuse Large B-Cell Lymphoma of the Upper Limb: A Fascinating Entity
|
A male patient, aged 82, retired accountant by profession, sought medical assistance in October 2011, complaining of a nodular skin swelling on the upper medial arm []. The patient initially reported the appearance of small swellings in the right arm, which slowly progressed to a nodular growth over a period of many months. He denied any history of developing a rash, fever, night sweats, or weight loss. Clinical examination revealed a nodular swelling, reddish in appearance, mobile, non-tender, firm in consistency, and measuring 5 cm × 3 cm in size. Neither any axillary or generalized lymphadenopathy nor hepatosplenomegaly were detected. His systemic examination did not reveal any abnormality. Investigations revealed him to have a normal hematological profile, i.e., hemoglobin (13.9 g/dL), platelet count (2,20,000/mm3), ESR –11 mm fall at the end of 1st h, TLC (8,200/mm3), DLC P (64) L (32) M (01) E (03), and Prothrombin time 15/14 s. His biochemical parameters did not show any abnormality, i.e., blood urea – 56 mg/dL, serum creatinine-1.2 mg/dL, normal blood sugar profile, serum sodium – 139 mEq/L, potassium – 4 mEq/L, total bilirubin – 0.6 mg/dL, serum total proteins – 6.5 mg/dL, albumin – 4.3 mg/dL, globulin – 2.2 mg/dL, serum AST – 22 IU/L, and serum ALT – 16 IU/dL. He was found to be non-reactive for HBsAg, HCV, and HIV antigens. Urine routine and microscopic examination was unremarkable. He underwent a wide local excision of the lesion on 25 October 2011 at a civil hospital with a clinical diagnosis of an abscess. The histopathological review done at our center showed an unencapsulated tumor in the superficial dermis, with distortions of the natural architecture of the skin and destruction of the cutaneous appendages. The tumor was composed of large cells arranged in sheets. These cells were round to oval, had scant cytoplasm, pleomorphic vesicular nuclei, and prominent nucleoli []. Dispersed among these large cells were few small lymphoid cells. An initial opinion of poorly differentiated round cell tumor was offered. Immunohistochemistry (IHC) was carried out using monoclonal antibodies against CD45, pancytokeratin (CK), human melanoma black (HMB) 45, Carcinoembryonic antigen (CEA) [Figure and ], and S100 protein. The IHC was positive for CD45 [] and negative for CK, HMB 45, CEA, and S100, thereby proving the lymphoid origin of the tumor cells. The subtyping of the tumor by IHC showed the predominant large cells were positive for CD 20 [] with the intervening small cells staining for CD 3, thereby delineating the B-cell lineage of tumor cells. The tumor cells revealed Bcl2 [], Bcl6 positivity, and a high (Mindbomb homolog) MIB-1 labeling index []. Co-relating histomorphology and immunohistochemistry, a final diagnosis of Primary cutaneous diffuse large B-cell lymphoma – leg type was made.
|
[[82.0, 'year']]
|
M
|
{'30881709': 2, '11806505': 1, '15692063': 1, '10892715': 1, '17289214': 1, '33240026': 1, '25364569': 1, '24082181': 2}
|
{'6383425-1': 1}
|
163,309 |
3778779-1
| 24,082,184 |
noncomm/PMC003xxxxxx/PMC3778779.xml
|
Docetaxel-induced Hand and Foot Syndrome in a Patient with Metastatic Breast Carcinoma
|
A 52-yr-old female patient with metastatic breast carcinoma was referred with painful red skin lesions and tingling sensation over the palms and soles for four days duration. She presented with extensive metastasis over the liver and lungs. After surgical removal of the tumor by modified radical mastectomy, the patient received salvage chemotherapy using docetaxel regimen. She successfully completed two cycles of weekly chemotherapy regimen with injection docetaxel 60 mg/m2 after premedication with injection dexamethasone, injection ranitidine, and anti-histamines. Ten days after her second dose, she reported severe erythema and tingling sensation over the palms and soles. On examination, symmetrical diffuse erythema and swelling with tenderness was noted in the palms and soles [Figures -]. There was no blistering, ulceration, and limitation of movements. Nails were normal. Based on the clinical findings, a diagnosis of grade 3 HFS was made according to WHO grading system []. Subsequently, the patient received parenteral steroids and the chemotherapy regimen to be restarted after resolution of her symptoms. Her symptoms resolved in a period of four days. Unfortunately, the patient rapidly succumbed to the disease before the next drug cycle could be restarted because of extensive metastasis in the lungs and liver.
|
[[52.0, 'year']]
|
F
|
{'18070211': 1, '22629102': 2, '6497196': 1, '26609297': 1, '11702367': 1, '18341672': 1, '20161873': 1, '24678393': 2, '31245190': 2, '24082184': 2}
|
{'3356968-1': 1, '6559678-1': 1, '3965723-1': 1}
|
163,310 |
3778780-1
| 24,082,185 |
noncomm/PMC003xxxxxx/PMC3778780.xml
|
Hallermann-Streiff Syndrome
|
A 12-year-old girl brought by her mother was seen for abnormal appearance and skin changes. She was the second child of consanguineous parents (cousins from second rank) and was born preterm on 7th month of eventful normal delivery. Her medical history revealed the presence of bilateral direct congenital hernia, delayed closure of fontanelles, delayed milestones and hypothyroidism. Examination revealed facial characteristics typical of the “bird face” in HSS []. The nose appeared thin, sharp and hooked; hypoplastic mandible; high arched palate, mal implantation of teeth []. Propotionate dwarfism was present. Dermatological examination revealed sparse scalp hair, alopecia along lines of suture [], atrophy of skin in central part of face. A large port wine stain of size 10 cm was present on left side of neck []. Her eyes were normal and there was no tracheomalacia.\nBoth the parents were counseled. Detailed oral hygiene instructions and dietary recommendations were given to the parents. Laser treatment is being planned for the port wine stain. The child is being followed up by us, the dentist and pediatrician.
|
[[12.0, 'year']]
|
F
|
{'13582329': 1, '30627696': 2, '26170830': 1, '34021162': 1, '5755729': 1, '10740699': 1, '26865807': 1, '28652825': 1, '14259273': 1, '24082185': 2}
|
{'6311540-1': 1}
|
163,311 |
3778781-1
| 24,082,186 |
noncomm/PMC003xxxxxx/PMC3778781.xml
|
Ichthyosiform Large Plaque Parapsoriasis: Report of a Rare Entity
|
A 36 year old male patient presented to us with almost asymptomatic ichthyosiform lesions of three years’ duration which appeared gradually involving mostly the trunk and extremities. [Figures -] At the time of reporting lesions also started appearing over the sides of the face. The lesions were ichthyosiform patches of varying sizes measuring five to ten centimeters in diameter, the borders of which merged with intervening normal skin. The dry adherent pigmented scales were of varying shapes and sizes with mild telangiectasia noted over few lesions. There was no anesthesia either over the lesions or peripherally in glove and stocking distribution. There was history of application of emollient and topical corticosteroids with neither any change in the morphology of the lesions nor their size. There was no history of systemic medication prior to or during the course of the disease. No abnormalities were detected in general survey and systemic examination including absence of lymphadenopathy. A provisional diagnosis of ichthyosiform MF was made. Routine investigations including complete hemogram, chest X-ray, Mantoux test were within normal limits as was his thyroid profile. Histopathological examination of biopsy specimen revealed mild hyperkeratosis with localized parakeratosis, irregular acanthosis and mild spongiosis. [] Upper dermis contained dense lymphocytic infiltrate without any evidence of nuclear atypia or epidermotropism []. There was no granuloma formation. Immunohistochemical study of infiltrate expressed CD3, CD2, CD5 and CD4 but was negative for CD20, CD8, CD7 and CD30.\nThe above findings prompted us to reconsider our diagnosis to ichthyosiform LPP. The patient was put on systemic phototherapy, but without any improvement even after three months of treatment.
|
[[36.0, 'year']]
|
M
|
{'16191852': 1, '7026622': 1, '19439874': 1, '7503364': 1, '12653708': 1, '24082186': 2}
|
{}
|
163,312 |
3778782-1
| 24,082,187 |
noncomm/PMC003xxxxxx/PMC3778782.xml
|
Generalized Lichenoid Drug Eruption Associated with Imatinib Mesylate Therapy
|
A 63-year-old man was referred to the dermatology department with a 3-week history of acute onset, raised, itchy, purple-colored fairly generalized skin lesions over his body. There was no history of blistering or ulceration over the lesions. Two months before the onset of the skin lesions the patient was put on monotherapy with imatinib mesylate (IM) (400 mg/day) for the treatment of CML. There was no history of allogenic bone marrow transplantation. Considering the skin eruption, IM had been discontinued ten days prior to his first dermatological consultation. According to the patient, stoppage of the drug led to mild improvement of the skin lesions. Cutaneous examination revealed numerous, well-defined, violaceous, discrete and coalescing papules and plaques over the limbs, abdomen, chest, and the back. A few scattered hyperkeratotic papules were present on his palms. The lesions exhibited koebnerisation on the chest wall. There was fine scaling but no evident vesiculation, oozing or crusting [Figures and ]. The mucosae as well as the nails and hair were uninvolved.\nLesional punch biopsy specimens were obtained from two different sites. Histopathological examination [Figures and ] of both the specimens showed similar features. Epidermis showed hyperkeratosis with focal parakeratosis, irregular acanthosis and focal wedge-shaped hypergranulosis. Focal basal cell degeneration and pigment incontinence were found. An upper dermal band-like infiltrate comprising mononuclear cells and eosinophils was present at the dermoepidermal junction. Multiple colloid bodies were noticed. Sparse perivascular infiltrates were also seen in the dermis. Serological tests for human immunodeficiency virus (HIV) and hepatitis B and C were negative.\nBased on the clinical presentation and histopathological examination, a diagnosis of generalized LDE associated with IM was made. According to the Naranjo probability scale for adverse drug reaction, this diagnosis was “highly probable”.[]\nThe patient was treated with topical clobetasol propionate (0.1%) cream application over the active skin lesions as well as oral antihistamines. Within a couple of weeks, almost all the lesions healed with residual post-inflammatory hyperpigmentation [] and new lesions stopped appearing. Since the type of the adverse cutaneous drug reaction was not life- threatening, IM was gradually re-introduced to achieve a dose of 400 mg/day by hemato-oncologists. The patient was advised regular dermatological follow-up. After re-introduction of imatinib, he had a few new lesions of LP over the next couple of months. However, he was being maintained on intermittent topical steroid application over the active lesions with excellent control of the skin condition.
|
[[63.0, 'year']]
|
M
|
{'21772613': 1, '16394444': 1, '34429995': 2, '25664274': 2, '29440948': 1, '19265627': 1, '19479144': 1, '19456782': 1, '17498448': 1, '16573254': 1, '22211996': 1, '17184272': 1, '24728220': 1, '19037666': 1, '7249508': 1, '19891921': 1, '16704665': 1, '20107730': 1, '19736448': 1, '15169982': 1, '15764042': 1, '12218235': 1, '19825526': 1, '24082187': 2}
|
{'8365549-1': 1, '4318107-1': 1}
|
163,313 |
3778783-1
| 24,082,188 |
noncomm/PMC003xxxxxx/PMC3778783.xml
|
Papular Acantholytic Dyskeratosis Localized to the Perineal and Perianal Area in a Young Male
|
A 26-year-old man presented with discomfort in his perianal area for the past 6 months. He reported that he had first noticed an asymptomatic eruption that he could feel as rough skin and ignored it. He later showed it to his wife who described it as several small grayish bumps. Over the past 2 months, he started getting a burning and itching sensation in that area. On examination, he had grayish-white areas perianally with multiple firm, coalescent papules extending a little posterior toward the natal fold and anteriorly on the perineum []. There were some excoriations and maceration in some areas. There were no vesicles, oozing, or bleeding. Gram staining and 10% KOH mount did not show any organism. Proctoscopy performed by a surgeon showed normal anal mucosa. All other mucosae were normal. Penis, scotum, and groin were normal. No other area on his body was affected. He was a healthy man with a negative personal or family history of atopy or any other pre-existing dermatosis. He had no relevant sexual history. He had taken treatment from two dermatologists in the past 2 months who had given potent topical steroids and oral antihistamines, which did not benefit him. A 3-mm punch biopsy showed circumscribed foci of hyperkeratosis with acantholytic dyskeratosis and subrabasal cleft formation []. Within the foci, the epidermis showed scattered acantholytic dyskeratotic cells (corps ronds) []. The stratum corneum showed a column of parakeratotic dyskeratotic cells (grains). Underlying dermis showed sparse superficial perivascular lymphohistiocytic infiltrate. Mild papillomatosis was seen as well. Clinicopathological correlation ruled in favor of papular acantholytic dyskeratosis of the perianal area.
|
[[26.0, 'year']]
|
M
|
{'27051853': 1, '20012979': 1, '19467973': 1, '6524638': 1, '8188931': 1, '3766927': 1, '22229453': 1, '19426624': 1, '12619194': 1, '26154588': 1, '33165405': 1, '11270294': 1, '4635801': 1, '30504989': 1, '24082188': 2}
|
{}
|
163,314 |
3778785-1
| 24,082,190 |
noncomm/PMC003xxxxxx/PMC3778785.xml
|
Epidermotropic Metastatic Melanoma with Perilesional Depigmentation in an Indian Male
|
A 78 year old male presented to us with complaints of multiple, small, dark colored raised lesions over the left leg which were gradually increasing in size and number over a period of two months. A few of them occasionally ulcerated, bled, discharged pus and were associated with pain. The patient also complained of multiple asymptomatic swellings in left groin region since one month. A darkly pigmented scar was seen over the heel of left foot.\nOn enquiry, he gave history of single, small, dark colored pea sized raised lesion on the sole of left foot which over a period of two years gradually increased in size to ulcerate and form a non healing ulcer which would bleed occasionally. Complete excision with skin grafting of the lesion was done at his hometown six months prior and was reported as acral lentiginous malignant melanoma on histopathological examination. He gave no history of abdominal pain, bony pain, vomiting, chest pain, convulsions or breathlessness. He had been operated for varicosities of left leg three years back and was a known hypertensive on treatment since two years.\nClinical examination of the patient revealed multiple, soft, friable, well defined, jet black colored, firm papulonodular lesions ranging in size from 3 mm to 6 cm in dimension. These lesions extended from dorsa of left foot up to the knee. Many of these papulonodular lesions showed a surrounding rim of depigmentation. A few of these had undergone ulceration with overlying crusting []. A single well defined dark colored plaque of 5 × 6 cm was also seen on the heel of the left sole []. The left sided inguinal region showed three enlarged lymph nodes which were mobile, 2-3 cm sized, hard and non tender.\nComplete blood count showed mild anemia (Hb-12.3 gms/dl). Platelet count, total leukocyte count and differential leukocyte count was normal except for mild eosinophilia. ESR was raised significantly (92 mm) at the end of one hour. Findings of liver and renal function tests were within normal limits. The serum lactate dehydrogenase levels were found to be raised (506 IU/L).\nBiopsy done from a jet back papule revealed an asymmetric melanocytic neoplasm with irregular distribution of melanocytes and nests of variable size. There was epidermal flattening overlying the dermal nests of atypical melanocytes extending up to mid reticular dermis []. Several melanocytes were present in solitary units above basal layer of the epidermis. Neoplastic melanocytes showed mild to moderate atypia with occasional mitotic figures with haphazard pigment distribution in both normal and atypical melanocytes. Several neoplastic melanocytes were present within some of the dilated capillaries in the deep dermis suggestive of angioinvasion.\nBiopsy from a papule showing peripheral rim of depigmentation revealed melanocytic neoplasm made up of irregular shaped and sized nests within the mid and upper dermis with numerous solitary melanocytes scattered throughout the surrounding epidermis including the stratum corneum with epidermal flattening. Atypical melanocytes were noted in the deep dermal capillaries. Moderately dense superficial perivascular lymphocytic and plasma cellular infiltrate underlying the dermal nests were seen in addition which were responsible for the depigmented halo clinically [].\nUltrasonography of abdomen and pelvis showed normal sized liver with multiple hypo echoic lesions involving both lobes, measuring 2.3 by 2.2 cm in size suggestive of secondary metastatic deposits. Chest X ray was reported to be within normal limits. Fine needle aspiration cytology of the left inguinal lymph nodes confirmed metastasis. Reports of Positron emission tomography (PET) revealed presence of metastatic deposits in the lungs, liver, spleen, left para-aortic group of lymph nodes, left inguinal group of lymph nodes and in the subcutaneous tissue over left thigh region []. Computed tomography of the brain was normal.\nOn co-relating the above findings we reached a diagnosis of epidermotropic metastatic melanoma stage IV (T2N3M1c) with peri-metastatic depigmentation. The patient, however refused further treatment and succumbed to death over a span of two months.
|
[[78.0, 'year']]
|
M
|
{'7059198': 1, '16029417': 1, '11504745': 1, '12923915': 1, '6388769': 1, '17012920': 1, '7943535': 1, '1794178': 1, '3242411': 1, '27559525': 1, '17571079': 1, '619785': 1, '9711667': 1, '15195788': 1, '6643768': 1, '1928623': 1, '10594748': 1, '7358882': 1, '8364867': 1, '3631983': 1, '6643767': 1, '24082190': 2}
|
{}
|
163,315 |
3778789-1
| 24,082,194 |
noncomm/PMC003xxxxxx/PMC3778789.xml
|
A Case of Syringocystadenoma Papilliferum on Lower Leg: A Rare Location
|
An 18 years old male reported to skin outpatient department with complaints of slowly progressive multiple raised nodular lesions on the medial side of his left leg since birth. At birth the lesions were slightly raised and reddish in color. The lesions were asymptomatic and gradually increased in size and thickness. The growth of lesion was relatively faster after the onset of puberty.\nOn examination, there were 4 skin colored papulonodular lesions measuring from 0.6 × 0.6 cm to 1.2 × 1.2 cm in size on medial side of middle 1/3 of left leg. The lesions were firm and non-tender. Thick crusting noted on 2 of the 4 lesion []. Hairs were sparse on the lesions and surrounding skin. There was some atrophic scarring of skin near the larger nodule because of some trauma sustained during childhood. There was history of occasional serous discharge from the lesion since 8 years of age. There was no other finding noted on local examination. On systemic examination, the patient was clinically normal. The routine laboratory investigation including hemogram, Monteux test and X-ray chest was found to be normal. A provisional diagnosis of appendageal tumor was kept in mind. Excision biopsy of one of the nodule was done for histopathological examination (HPE).\nOn HPE the epidermis showed papillomatosis. There were cystic invaginations extending downwards from the epidermis. There were multiple papillomatous projections projecting into cystic invaginations []. The papillary projections and lower part of invaginations were lined by two rows of glandular epithelium []. The outer row consisted of small cuboidal cells and inner row displaying columner cells. Some columner cells were also showing decapitation secretion. The papillary projections and dermis had dense infiltration of plasma cells []. A final diagnosis of SCAP was considered.
|
[[18.0, 'year']]
|
M
|
{'1661711': 1, '19293506': 1, '15729871': 1, '16222893': 1, '17036946': 1, '12410704': 1, '13137601': 1, '10848760': 1, '24082194': 2}
|
{}
|
163,316 |
3778790-1
| 24,082,195 |
noncomm/PMC003xxxxxx/PMC3778790.xml
|
Hyperkeratotic Palmoplantar Lichen Planus in a child
|
A 4-year-old male child was brought to our outpatient clinic with multiple pruritic, erythematous to violaceous, flat-topped papules and hyperkeratotic plaques on his both palms and soles since the last 4 months. The parents had also noticed some violaceous raised lesions on the upper back over the same period. There was no history suggestive of hepatitis and the child had not received any vaccination recently. On examination, multiple erythematous to violaceous plane-topped papules were present on the upper back []. Yellowish hyperkeratotic papules and plaques were noticed on both his palms and soles, with a few of the plaques showing a central crateriform depression []. Oral and genital examination was normal for his age. His routine laboratory investigations, including complete blood count (Hb: 13.8 g/dl, total leukocyte count: 5600/mm3), serum chemistry (BUN: 6.0 mg/dl, creatinine: 0.4 mg/dl, SGOT: 53 IU/l, SGPT: 19.0 IU/l), and urinalysis, were normal.\nScreening for hepatitis B and hepatitis C was negative. Dermatoscopy of a papule on his back revealed Wickham striae, whereas dermatoscopy of a plantar plaque showed a well-defined lesion topped with scales [Figures and ]. Skin biopsy was obtained from two sites (upper back and sole). Histopathology of the papule from the back showed a band- like lymphocytic infiltrate along the upper part of the dermis; vacuolar alteration of the basal layer; focal hypergranulosis; and necrotic keratinocytes, with saw tooth- like appearance of rete ridges []. Skin specimen from the plantar plaque showed compact hyperkeratosis, with focal parakeratosis, focal hypergranulosis, and colloid bodies []. A diagnosis of childhood LP with prominent palmoplantar involvement was made.\nThe patient was started on oral dapsone 25 mg (2 mg/ kg) daily, along with twice daily application of clobetasol propionate 0.05% cream and emollients.
|
[[4.0, 'year']]
|
M
|
{'3793360': 1, '26538690': 1, '12121559': 1, '28035216': 1, '20523841': 1, '20548881': 1, '2225535': 1, '15492196': 1, '10730766': 1, '16060862': 1, '12047638': 1, '11052233': 1, '20061732': 1, '24082195': 2}
|
{}
|
163,317 |
3778791-1
| 24,082,196 |
noncomm/PMC003xxxxxx/PMC3778791.xml
|
Pilomatrixoma – Presented as Hypopigmented Tender Nodule: Diagnosed by FNAC: A Case Report with Review of Literature
|
An 18-year-old girl presented to the surgical outpatient department with complaints of tender swelling over left mid-arm of one-year duration. The swelling gradually increased in size to attain present size. We received requisition for cytological examination with clinical probable diagnosis of neurofibroma. On inspection, swelling measured 3 × 2 cm, seen over left arm with overlying skin showing atrophic changes and hypopigmentation, giving an appearance of a small patch of vitiligo []. There was no history of trauma. There was also no history of topical application of any steroids or other medications. On palpation, swelling was firm to hard, tender, mobile, and situated in the subcutaneous plane.\nFNA was carried out, and all slides were issued to junior and senior faculties in the department of pathology for their independent opinion and discussion. Different diagnoses were obtained like giant cell tumor of tendon sheath, epidermal inclusion cyst with giant cell reaction, granulomatous inflammatory lesion, basi-squamous carcinoma, and pilomatricoma were obtained. The smears studied revealed cell-rich aspirate containing predominantly basaloid cells in tight clusters, scattered squamous cells and anucleate squames, shadow cells, plenty of multinucleated giant cells [], and focal areas of calcification. In view of presence of all the diagnostic criteria required to diagnosis pilomatrixoma were present, we offered final diagnosis of PMX and requested for excision and histopathological confirmation. The tumor was excised and sent.\nGrossly, the tumor measured 3 × 2 cm, well-encapsulated, nodular, with surface showing multiple chalky white powdery deposits scattered throughout []. The tumor was gritty to cut, showed powdery, chalky white areas of calcification. Slices were decalcified in decalcifying solution, and sections were prepared and stained with hematoxylin and eosin. Histopathological examination revealed encapsulated tumor mass, composed of nests of peripheral basaloid cells admixed with squamous cells showing transition phase to anucleate squamous cells and then to ghost cells [Figures and ]. The stroma showed multinucleated foreign body type of giant cell response [] to the tumor keratin. Focal areas of calcifications were also seen. All the features correlated with cytological findings, and diagnosis of PMX was issued. The patient is asymptomatic during post-operative follow up with no local recurrence.
|
[[18.0, 'year']]
|
F
|
{'17718128': 1, '27127379': 1, '17377471': 1, '22615520': 1, '21430899': 1, '14676160': 1, '21552399': 1, '30284072': 1, '32908727': 1, '19742099': 1, '24082196': 2}
|
{}
|
163,318 |
3778792-1
| 24,082,197 |
noncomm/PMC003xxxxxx/PMC3778792.xml
|
A Case of Adult-Onset Still's Disease Presenting with Urticated Plaques and Acute Myopericarditis
|
A 23-year-old male was admitted for acute viral myopericarditis with heart failure in which he presented with chest pain associated with dyspnoea, persistent spiking fever with temperature more than 39°C, sore throat, productive cough, and arthralgia. In addition, he developed transient non-pruritic rashes over the neck, axillae, and limbs. Clinical examination revealed a febrile patient who was in heart failure. He had cervical lymphadenopathy, hepatosplenomegaly, and non-scaly orange red plaques and papules over the neck, axillae, and limbs [Figures and ].\nLaboratory investigations revealed raised cardiac enzymes, positive Troponin I, ECG changes consistent with pericarditis, marked leucocytosis with neutrophil predominance, hyperferritinemia, and elevated erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP). The rheumatoid factor (RF), anti-nuclear antibody (ANA), and anti-dsDNA were negative. Blood and urine cultures were also negative. Histopathological examination of the skin biopsy revealed features of a neutrophilic dermatosis []. He was diagnosed with AOSD as he had four major and three minor criteria for this entity according to the Yamaguchi's criteria [].\nHe was treated with steroids, diclofenac and azathioprine, which controlled the rash and improved the arthralgia. Subsequently, the patient was out of heart failure and myopericarditis resolved.
|
[[23.0, 'year']]
|
M
|
{'1578458': 1, '16882603': 1, '9858428': 1, '11246670': 1, '26423534': 1, '17414447': 1, '28296747': 1, '24737284': 1, '31745741': 1, '24082197': 2}
|
{}
|
163,319 |
3778793-1
| 24,082,198 |
noncomm/PMC003xxxxxx/PMC3778793.xml
|
Toxic Epidermal Necrolysis Due to Concomitant Use of Lamotrigine and Valproic Acid
|
A 47-year-old female presented with fever, oral erosions and blisters all over the body for ten days. Patient was a known epileptic, on valproic acid 300 mg/day since four months. Two weeks prior to onset of symptoms she had been initiated on lamotrigine 50 mg twice daily by her physician. About 6 months ago, she had had carbamazepine induced maculopapular rash. Examination revealed multiple, flat target-like lesions, diffuse erythema, flaccid blisters and erosions over face, trunk and extremities including palms and soles []. Body surface involvement was around 60%. Nikolsky's sign was positive. Severe oral and genital erosions were noted along with conjunctivitis and eyelid oedema. Patient was febrile with normal systemic examination. Hemogram, liver and renal function tests, blood sugar and urinalysis were normal. The diagnosis of lamotrigine induced toxic epidermal necrolysis was established using the Naranjo adverse drug reaction probability scale.[] Patient was admitted to intensive care unit, and lamotrigine and valproic acid were discontinued. Clobazam 20 mg/day was begun for seizure prophylaxis. In addition to supportive care, she was given prednisolone 60 mg/day. After a tumultuous course in the hospital extending up to 45 days, patient made an eventual recovery but was left with pigmentary changes, nail dystrophy, bilateral ectropion and corneal scarring.
|
[[47.0, 'year']]
|
F
|
{'9798758': 1, '9674940': 1, '16499755': 1, '33688237': 1, '10403224': 1, '17484761': 1, '25957602': 1, '25327504': 1, '11092611': 1, '8628341': 1, '17502552': 1, '26173940': 1, '29166503': 1, '33294176': 2, '17386054': 1, '7249508': 1, '24082198': 2}
|
{'3778793-2': 2, '7691122-1': 1}
|
163,320 |
3778793-2
| 24,082,198 |
noncomm/PMC003xxxxxx/PMC3778793.xml
|
Toxic Epidermal Necrolysis Due to Concomitant Use of Lamotrigine and Valproic Acid
|
A 26 year old female was under treatment with valproic acid 750 mg/day, propranolol 10 mg/day, clomipramine 10 mg/day, and risperidone 2 mg/day for bipolar mood disorder and obsessive compulsive disorder since two years. Four weeks prior to presentation, she had been initiated on lamotrigine at 25 mg/day, which was rapidly increased to 50 mg BD over 2 weeks and 100 mg BD over another 2 weeks, at which time she developed skin rash and oral erosions. Examination revealed a rash typical of toxic epidermal necrolysis with erythematous macules, papules, flaccid blisters, targetoid lesions, and erosions over face, trunk and palms involving around 30% of body surface area []. Nikolsky's sign was positive. Genital and oral erosions with hemorrhagic crusting over lips and severe conjunctival congestion were observed. Systemic examination was unremarkable. A causality assessment of this adverse event revealed a probable association between lamotrigine and toxic epidermal necrolysis based on the Naranjo probability scale.[] Blood counts and basic biochemistry were normal. Lamotrigine and other drugs, except valproic acid, were stopped. She was given prednisolone 40 mg/day, in addition to supportive care. Prednisolone was tapered gradually, and the patient made an uneventful recovery and was discharged.
|
[[26.0, 'year']]
|
F
|
{'9798758': 1, '9674940': 1, '16499755': 1, '33688237': 1, '10403224': 1, '17484761': 1, '25957602': 1, '25327504': 1, '11092611': 1, '8628341': 1, '17502552': 1, '26173940': 1, '29166503': 1, '33294176': 2, '17386054': 1, '7249508': 1, '24082198': 2}
|
{'3778793-1': 2, '7691122-1': 1}
|
163,321 |
3778795-1
| 24,082,200 |
noncomm/PMC003xxxxxx/PMC3778795.xml
|
Acrokeratosis Verruciformis of Hopf Along Lines of Blaschko
|
A 24-year-old female presented to skin OPD with lesions over the left side of body since 5 years. Initially, few lesions started over the left thigh, which gradually progressed to involve the left side of lower limb, feet, arm, forearm, and back in the span of 5 years. No history of any complaints in the form of itching, burning, or pain present. No history of similar complaints in any of the family members. No seasonal variation or any other systemic complaints present. On examination, multiple hyperkeratotic, hyperpigmented warty papules arranged unilaterally over the left side of body, i.e., back of thigh, lateral aspect of thigh, back of knee joint, and dorsum of ankle joint were present. On the back of thigh, lesions were seen in multiple bands []. Multiple such discrete papules were present over left upper back, shoulder [], axilla, medial, and lateral aspect of the left arm [] and forearm in the distribution lines of Blaschko []. Few warty papules were also present over the left side of labia majora. Nails and oral cavity were normal.\nBiopsy taken from back of the thigh showed hyperkeratosis, acanthosis, papillomatosis with circumscribed elevation of epidermis resembling church spires []. Rete ridges were slightly elevated extending to the uniform level. Dermis showed perivascular lymphocytic infiltrate and unremarkable adenexa structure. Changes were suggestive of AKV.
|
[[24.0, 'year']]
|
F
|
{'20944368': 1, '34934739': 1, '788770': 1, '871401': 1, '20161869': 1, '27828639': 2, '22028575': 2, '20953022': 1, '8040398': 1, '16150218': 1, '24082200': 2}
|
{'3199425-1': 1, '5087224-1': 1}
|
163,322 |
3778796-1
| 24,082,201 |
noncomm/PMC003xxxxxx/PMC3778796.xml
|
Multiple Sub-Epidermal Calcified Nodule Mimicking Eruptive Xanthoma: A Case Report and Review of the Literature
|
A 22-year-old healthy White man presented with asymptomatic, multiple nodules on the bilateral dorsum of hands since he was 10 years old. There was no history of pain, ulceration, or discoloration. Clinical examination was remarkable for 13 lesions (range in diameter 0.2-1 cm), white to yellowish, hard, non-sensitive nodules on the bilateral dorsum of hands []. The case was misdiagnosed as verruca vulgaris and was treated with cryotherapy at different centers. There was no history of preceding lesion or trauma. One of the patient's lesions was excised. Our clinical impression was xanthoma and calcinosis cutis. Histopathology showed homogeneous basophilic masses and granules in the upper dermis, which were surrounded by foreign body reaction and epidermal hyperplasia, an appearance consistent with cutaneous calcinosis [].\nRoutine laboratory tests and metabolic evaluations (calcium, phosphate, and parathyroid hormone), hematological parameters, and blood sedimentation rate were within normal limits. Anti-nuclear antibody was negative. X-ray of the affected hands showed small radio-opaque focuses, but the bony structure did not show any pathology.
|
[[22.0, 'year']]
|
M
|
{'22040302': 1, '14649113': 1, '11438007': 1, '12165227': 1, '686732': 1, '19033855': 1, '19935258': 1, '14943266': 1, '14576672': 1, '20409413': 1, '2269376': 1, '15283797': 1, '8747574': 1, '19882024': 1, '1574310': 1, '11972715': 1, '15802937': 1, '2457897': 1, '8806130': 1, '15235189': 1, '9211554': 1, '20101349': 1, '7577611': 1, '20597952': 1, '20738792': 1, '11438004': 1, '15816992': 1, '24082201': 2}
|
{}
|
163,323 |
3778797-1
| 24,082,202 |
noncomm/PMC003xxxxxx/PMC3778797.xml
|
Erythema Nodosum as Azathioprine Hypersensitivity Reaction in a Patient with Bullous Pemphigoid
|
A 65-year-old woman had been recently diagnosed as having BP on the basis of a generalized pruriginous bullous eruption affecting predominantly the trunk and the limbs, and a compatible biopsy. Treatment with prednisone (60 mg Q.D.) was started and the skin lesions progressively improved within 3 weeks. After checking that thiopurine methyltransferase (TPMT) activity was normal, AZA (50 mg Q.D.) was introduced as a corticosteroid-sparing agent. One week later, well-tolerated fever along with several tender, dusky red-purple nodular subcutaneous lesions appeared on both lower legs []. There was no evidence of any other symptoms or clinical findings. Complete blood count, laboratory tests, and chest radiograph showed no abnormalities. Mantoux test was negative. Biopsy of a skin nodule was performed and histological examination revealed septal panniculitis with lymphocytic infiltration of the hypodermis [], findings highly suggestive of EN. Aside from prednisone and AZA, no other medications were administered at that time. Hypersensitivity reaction to AZA was suspected and the drug was discontinued, observing complete remission of the fever and EN within 2 weeks.
|
[[65.0, 'year']]
|
F
|
{'15167706': 1, '17576940': 1, '18832255': 1, '9598858': 1, '11436860': 1, '24082202': 2}
|
{}
|
163,324 |
3778798-1
| 24,082,203 |
noncomm/PMC003xxxxxx/PMC3778798.xml
|
Progressive Systemic Sclerosis in a Child
|
An 11 year old girl, born of a non-consanguineous marriage, presented with thickening and tightening of skin, which started around her fingers one year back and gradually extended to hands, forearms, feet, lower limbs, face and back over the year. She gave a history of irregular low grade fever and difficulty in swallowing of both solid and liquid diet for last nine months. She also experienced shortness of breath on exertion for last four months and joint pain involving both knees and ankles for three months.\nExamination showed hide bound skin around fingers and hands (sclerodactyly), cutaneous sclerosis of forearms, feet, legs and back of trunk. Ulceration of finger tips was not found. There was mild flexion deformity of all her fingers. There was difficulty in dressing, combing and holding objects. Raynaud's phenomenon was positive. Face revealed pinched nose, microstomia (on maximal opening of mouth, the interincisal distance was reduced to 35 mm) and loss of facial expression []. There was salt-pepper appearance of skin over back of trunk and all four extremities [].\nInvestigation revealed mild anemia and elevated erythrocyte sedimentation rate. Barium studies showed hypo motility of esophagus. X-rays of chest, knees, and elbows were normal. But X-rays of hands showed reduced peri-articularbone density. Lung function test indicated restrictive pattern of lung disease with decreased viral capacity. High resolution CT scan indicated interstitial lung disease. ECG showed sinus tachycardia and Echocardiography was normal. Blood for antinuclear antibody (ANA), Anti-ds DNA, Rheumatoid factor, VDRL, LE cell tests were normal. But blood for Antitopoisomerase1 (originally called anti-Scl-70) was strongly positive. Blood for anticentromere antibody and anti-URNP were negative. As the parents declined to give consent, we could not perform skin biopsy.\nWith these evidences of proximal diffuse sclerosis along with sclerodactyly, restrictive lung disease, esophageal dysmotility, positive Raynaud's phenomenon and strongly positive test of blood for antitopoisomerase1 (originally called anti-Scl-70), diagnosis of progressive systemic sclerosis was made.
|
[[11.0, 'year']]
|
F
|
{'6838673': 1, '3871330': 1, '6090661': 1, '7378088': 1, '9018462': 1, '3532005': 1, '24082203': 2}
|
{}
|
163,325 |
3778799-1
| 24,082,204 |
noncomm/PMC003xxxxxx/PMC3778799.xml
|
Vitamin K Deficiency Bleeding Presenting as Nodular Purpura in Infancy: A Rare and Life-Threatening Entity
|
An 8-month-old exclusively breastfed male infant presented in casualty with multiple skincolored to bluish, raised swellings on trunk and upper extremities of 4 days duration. This was associated with malena for last 2 days. There was no history of fever, excessive cry, jaundice, bleeding diathesis, vomiting, breathlessness, or any drug intake in recent past. The lesions were acute in onset and progressive in nature. The infant was a product of non-consanguineous marriage and was born at term in a primary health center. There were no perinatal complications. History of vitamin K prophylaxis at birth was not forthcoming. There were two elder healthy male siblings. Mother denied any history of drug intake recently by infant or herself. Cutaneous examination revealed multiple firm to soft, non-collapsible, subcutaneous, non-tender, skin colored to bluish nodules of 1-6.5 cm in diameter on the chest, elbow, and knees [Figures and ]. General examination revealed a grade III malnourished child (as per classification of Indian Academy of Pediatrics) with normal developmental milestones. General and systemic examination failed to reveal any abnormality, except pallor. Investigations revealed raised APTT and PT levels along with microcytic, hypochromic anemia. Fibrinogen level, platelet count, routine urine microscopy, and other hematological and biochemical parameters were within normal range. Blood culture was sterile, and skin biopsy was not performed as FNAC from a large purpuric nodule revealed frank blood. Vitamin K level estimation could not be done due to financial constraints.\nA provisional diagnosis of late idiopathic vitamin K deficiency bleeding (VKDB) disorder was made, and the child was given 7.5 mg vitamin K1 intra-muscularly once-daily for 3 days. The infant improved dramatically. Prolonged APTT and PT normalized within 10 hours of first dose. All the lesions subsided by 6th day. The infant was put on proper complementary feeding, and no recurrence was noted during follow-up even 6 months after the initial episode.
|
[[8.0, 'month']]
|
M
|
{'20626632': 1, '18046559': 1, '21928065': 1, '8588159': 1, '10102477': 1, '7111112': 1, '12657759': 1, '9366814': 1, '19255988': 1, '24082204': 2}
|
{}
|
163,326 |
3778800-1
| 24,082,205 |
noncomm/PMC003xxxxxx/PMC3778800.xml
|
Abrikossoff's Tumor: An Unusual Presentation
|
We report a 53-year-old lady who presented to us with a hyperpigmented depressed plaque over her right upper arm of 3 cm × 2 cm of 2 years duration []. It was firm with mild tenderness and was gradually increasing in size. There was no history of discharge from the lesion neither were there any systemic complaints. There was no regional lymphadenopathy. A clinical differential diagnosis of subcutaneous morphea or subcutaneous granuloma annulare was made.\nHistopathology of the lesion revealed a non-encapsulated tumor mass in the dermis and subcutaneous tissue composed of irregularly arranged sheets of large polyhedral cells with indistinct cytoplasmic membranes []. They were found to have an abundant eosinophilic granular cytoplasm, round to oval nucleus, and a small nucleolus. In some places, the granules had formed larger masses called ‘pustulo-ovoid bodies of milian,’ which were surrounded by a clear halo []. The granules were diastase-resistant and PAS-positive []. The overlying epidermis was normal and did not show hyperplasia. Hence, a histological diagnosis of a benign granular cell tumor was made. Our patient underwent a surgical resection of the tumor.
|
[[53.0, 'year']]
|
F
|
{'19426900': 1, '9212295': 1, '11314193': 1, '32823546': 1, '9158404': 1, '6094739': 1, '27730035': 2, '7962829': 1, '19098584': 1, '9569790': 1, '6704900': 1, '10091364': 1, '15214825': 1, '29127127': 1, '21043356': 1, '16055991': 1, '24082205': 2}
|
{'5038100-1': 1}
|
163,327 |
3778801-1
| 24,082,206 |
noncomm/PMC003xxxxxx/PMC3778801.xml
|
A Case of Congenital Erythropoietic Porphyria without Hemolysis
|
An eleven month old female child, born of a primigravida mother of non-consanguinous marriage came to us with history of recurrent blisters face and upper limbs since two months of age. Gradually blisters appeared on scalp, feet, neck and shoulders. Some of the blisters were at the healing stage []. Mother also noticed red colored urine for last three months. Birth and developmental history were normal. There was no similar illness in the family.\nHer pulse rate was 102/min, blood pressure was 84/58 mm of Hg. and respiratory rate was 25/min. Her weight was 7.9 kg, length was 70 cm and head circumference was 45 cm. There was some pallor. Blisters were present on scalp, face, upper and lower limbs with atrophic scars on scalp and upper limbs along with alopecia. Copper-red discoloration of the two erupted teeth was noted []. There was no hepatosplenomegaly. Neurological examination was normal. On the basis of infancy-onset blistering over sun-exposed areas, atrophic scars, red colored urine and teeth without neurological involvement and evidence of arthritis, we reached the provisional diagnosis of CEP.\nComplete blood count showed mild anemia; Hb-9.2 mg/dl, total leucocyte count-8,200 and platelet count of 1.4 lac/cumm. On peripheral smear anemia was microcytic, hypochromic in type. But, reticulocyte count was 1.2% of circulating erythrocytes (normal upto 2%). Liver and renal function tests were normal. ELISA for HIV was negative. Urinary porphobolinogen was absent. But, on screening test with a spectrophotometer urinary total porphyrin level was 1023 nmol/mmol of creatinine (normal < 35 nmol/mmol). Twenty four hours urinary and faecal level of uroporphyrin and coproporphyrin were also significantly elevated. The erythrocyte porphyrin level was 115.3 mcg/100 ml using the haematofluorometric method (normal value < 40 mcg/100 ml). Bright red fluorescence was also noted in the urine, teeth and blood under wood's lamp. So, a final diagnosis of congenital erythropoietic porphyria was made. Demonstration of deficiency of UROS activity and genetic study could not be performed due to lack of laboratory facilities.
|
[[11.0, 'month']]
|
F
|
{'4451391': 1, '21716940': 1, '2037278': 1, '15304101': 1, '28899405': 2, '2331520': 1, '27512208': 2, '21572804': 2, '11254675': 1, '3821794': 1, '24082206': 2}
|
{'5596485-1': 1, '4966423-1': 1, '3088948-1': 1}
|
163,328 |
3778802-1
| 24,082,207 |
noncomm/PMC003xxxxxx/PMC3778802.xml
|
Oral Hemorrhagic Blister: An Enigma
|
A 48-year-old woman presented with asymptomatic recurrent blood filled blister in the oral cavity with a history of irregular and intermittent appearance since 25 years. In most instances, lesion appeared singly on the lateral aspect of tongue but also involved soft palate occasionally. Each episode lasted for an average of three to four days. Lesions healed spontaneously without any sequel but lesion recurred every year once or twice without any seasonal predilection. No history of similar lesions elsewhere on the body. No history of intake of any other drugs, No history suggestive of precipitating factors like trauma, steroid inhalation, blood dyscrasias. Not a known diabetic, hypertensive or asthamatic. No significant family history.\nOn examination, there was solitary oval tense hemorrhagic bulla measuring about 2 × 1.5 cm over the lateral margin of tongue on the right side []. Surrounding mucosa was normal without any evidence of erythema or scarring. Lesion ruptured on manipulation with oozing of clear and thin blood mixed fluid.
|
[[48.0, 'year']]
|
F
|
{'30100658': 2, '10328203': 1, '17890919': 1, '11128928': 1, '16916681': 1, '14722186': 1, '6029172': 1, '24082207': 2}
|
{'3778802-2': 2, '6044132-1': 1}
|
163,329 |
3778802-2
| 24,082,207 |
noncomm/PMC003xxxxxx/PMC3778802.xml
|
Oral Hemorrhagic Blister: An Enigma
|
A 50 years old male patient with chronic renal failure since two years, on haemodialysis since 8months with blood pressure, developed hemorrhagic blister at the junction of buccal mucosa and alveolar ridge on right side. Over a period of 12 hrs it ruptured discharging thin clear blood mixed fluid and healed within four days without any scarring or other squeal.\nOn examination, there was solitary oval tense hemorrhagic bulla measuring about 2.5 × 2 cm present at the junction of buccal mucosa and alveolar ridge on right side. On manipulation it ruptured easily [].\nTzanck smear in both cases showed numerous RBC's and there was no acantholytic or multi-nucleated giant cell. Biopsy from case -1 of the ruptured blister revealed sub-epithelial split with minimal perivascular infiltrate. Biopsy could not be done in case -2, since the patient did not consent. Routine blood and urine tests including Bleeding and clotting time, Liver function test, Renal function test, thyroid function test, lipid profile, Ultra sound examination of abdomen and pelvis, chest – X ray were within normal limits in Case-1. In case-2, all the investigations were normal except for high blood pressure (130/90 mm Hg) and elevated serum urea and creatinine levels (50 and 2.5 mg/dl respectively).\nSpontaneous onset, isolated nature, constant presence of blood in the blister fluid and rapid healing in the absence of an identifiable local cause or systemic disorder differentiates ABH from mucous membrane pemphigoid, bullous pemphigoid, bullous lichen planus, epidermolysis bullosa, dermatitis herpetiformis, linear IgA disease and oral amyloidosis. The classical history and morphology of lesions helped us to arrive at the clinical diagnosis of angina bullosa hemorrhagica in both the presenting cases.
|
[[50.0, 'year']]
|
M
|
{'30100658': 2, '10328203': 1, '17890919': 1, '11128928': 1, '16916681': 1, '14722186': 1, '6029172': 1, '24082207': 2}
|
{'3778802-1': 2, '6044132-1': 1}
|
163,330 |
3778803-1
| 24,082,208 |
noncomm/PMC003xxxxxx/PMC3778803.xml
|
Cutaneous Schwannoma Masquerading as Trichilemmal Cyst Over Scalp in a Young Male
|
A 28-year-old male presented with asymptomatic cystic growth over vertex area of scalp of 6 years duration. The lesion started as small pea- sized cystic growth and gradually increased to the present size. There was no history of trauma, previous surgery, and similar growth over scalp. The growth was painless and there was no history of any surface changes over the cystic growth. Family history of similar complaints was negative. Examination revealed a 3 × 4 cm sized, mobile, soft to firm cystic growth over right vertex region with normal hairs over the surface []. Palpation revealed no tenderness and the cyst was not attached to the underlying fascia or bone. The growth was excised under local anesthesia. During excision, when skin was incised, a bilobed tumor with capsule was found and the tumor was sent for histopathology examination []. Histopathology showed, capsulated tumor with mixed Antoni A and Antoni B patterns in dermis. The Antoni A component is cellular, and Verocay bodies are a prominent feature. The loosely cellular, pale zones are Antoni B patterns [Figures and ].
|
[[28.0, 'year']]
|
M
|
{'12792904': 1, '31543538': 2, '12859395': 1, '33911711': 2, '793411': 1, '16006798': 1, '6427303': 1, '4685580': 1, '17169091': 1, '11236222': 1, '28257911': 1, '8872158': 1, '21860160': 1, '25284882': 1, '9185909': 1, '17721192': 1, '962697': 1, '2471540': 1, '20028402': 1, '24082208': 2}
|
{'7992636-1': 1, '6749764-1': 1}
|
163,331 |
3778806-1
| 24,082,211 |
noncomm/PMC003xxxxxx/PMC3778806.xml
|
A Rare Case of Familial Reactive Perforating Collagenosis
|
A 4 year old boy presented with complaints of multiple, recurrent, dark coloured raised lesions on face, elbows and outer aspect of both legs of 2 years duration. The lesions would start as skin coloured papules which later developed dark central material. Some of the lesions would heal on its own in about a month leaving behind residual hyperpigmentation. Associated severe itching was present in all lesions. Patient's mother complained that she had noticed new lesions occurring at sites of trauma. There was history of similar complaints in his elder brother who was staying with his grandparents. There was no parental consanguinity.\nDermatological examination revealed multiple, discrete, symmetrical, hyperpigmented, hyperkeratotic papules distributed over face, both elbows and lateral aspect of both legs []. Most of the lesions showed a central keratotic plug. There was evidence of koebnerisation at multiple sites []. Systemic examination was essentially normal.\nRoutine lab investigations were normal. Skin biopsy from the lesion showed stratified squamous keratinised epidermis. Epidermis showed a hyperkeratotic crater filled with keratin, few polymorphonuclear leucocytes and occasional acellular basophilic fibrous strands. The shoulder of the crater shows marked acanthosis. The adjacent papillary dermis showed vertically oriented collagen bundles perforating the epidermis []. Moderate perivascular chronic mononuclear cell infiltrate was seen. The perforating collagen bundles were better delineated on Van Gieson stain []. Based on clinical and histopathological features, a diagnosis of reactive perforating collagenosis was made. The patient was started on topical tretinoin 0.05% cream and intralesional corticosteroids. The lesions showed some flattening with therapy but the patient continued to get new lesions at sites of minor trauma.
|
[[4.0, 'year']]
|
M
|
{'4425619': 1, '421489': 1, '17567305': 1, '27057507': 1, '8157784': 1, '4166922': 1, '8959899': 1, '3160676': 1, '2430879': 1, '5456020': 1, '32477998': 1, '8977664': 1, '16536825': 1, '24082211': 2}
|
{}
|
163,332 |
3778807-1
| 24,082,212 |
noncomm/PMC003xxxxxx/PMC3778807.xml
|
Chronic Osteomyelitis of Humerus Presenting as Scrofuloderma
|
A 22 year old female presented with discharging sinuses and swelling over the right arm of 18 months duration. She received courses of antibiotics at a local clinic. The nodulo-ulcerative discharging sinuses were initially small sized but failed to heal and continued to increase in size. On local examination multiple crater like ulcers with few papulo-pustular lesions on the dorso-lateral aspect of the lower two-third of right arm were seen []. The ulcer had indurated margin surrounded by a zone of hyperpigmentation with mild seropurulent discharge and crust formation at the base of the ulcer [Figrue 2]. Features of eczematization were seen on the surrounding margins of the ulcer. There was local rise of temperature on the overlying skin. No regional lymphadenopathy was detected. Systemic examination did not reveal any abnormalities. There was no history of recent loss of weight and night sweats. There was no history of trauma or immune suppressive therapy. But the family history revealed a treated case of pulmonary tuberculosis in one of the family members. Routine investigations showed normal blood counts with raised Erythrocyte sedimentation rate (ESR) which was 58 mm/after 1 hr and raised C-reactive protein (CRP). Routine urine tests and blood biochemistry were within normal limits. HIV, VDRL tests were negative and Mantoux test showed positive reaction. Primary staining of discharge was negative for bacteria, fungi and mycobacteria. Skin biopsy from the lesion was subjected to culture on LJ media and histopathological examination. On culture there was yellowish, rough colony which grew after 21 days of inoculation which was confirmed as Mycobacterium tuberculosis by PCR []. Histopathology study of skin biopsy revealed epithelioid granuloma with inflammatory cell infiltrates in the dermis []. The chest X-ray of anterior-posterior (AP) and lateral view showed no infiltration. X-ray of the right humerus AP/lateral view showed features of periosteal reaction with new bone formation and soft tissue showed irregular radiolucent areas in the margin []. These findings were suggestive of chronic osteomyelitis. Basing on the above positive findings the case was diagnosed as scrofuloderma associated with chronic osteomyelitis of the right arm.\nPatient was put on anti tubercular therapy showed improvement and complete cure occurred after one year.
|
[[22.0, 'year']]
|
F
|
{'22363159': 2, '16409910': 1, '16209227': 1, '19882018': 1, '27278237': 1, '24082212': 2}
|
{'3283855-1': 1}
|
163,333 |
3778808-1
| 24,082,213 |
noncomm/PMC003xxxxxx/PMC3778808.xml
|
Nosocomial Urinary Tract Aspergilloma in an Immunocompetent Host: An Unusual Occurrence
|
A 32-year-old man of average built, visited a private hospital for surgical consult, with the complaints of recurrent, colicky abdominal pain of 6 months duration. On the basis of radiological investigations, he was diagnosed to have a right sided ureteric stone of 0.5 cm at the junction of upper 1/3rd and lower 2/3rd of the right ureter. He was also found to have significant bacteriuria with E. coli, for which he was treated with norfloxacin and amikacin. The ureteric stone was extracted by trans-urethral approach.\nThe removal of the stone led to subsidence of his symptoms. However, 3 weeks later, patient had recurrence of abdominal pain with low grade fever and malaise. He then presented to the department of surgery in our hospital. The pain was milder in intensity and accompanied by the passage of small, pinkish white soft balls per urethra during the process of urination. The pain subsided significantly following passage of these masses. The episodes of pain and subsequent passage of masses were intermittent, varying from twice a day to twice per week. His repeated urine cultures were sterile despite 2-3 neutrophils per high power field on microscopic examination. There were no signs of uretric obstruction, renal compromise or sepsis. He was reassured and prescribed antispasmodics with only temporary relief. He was then referred for dermatology opinion. The patient was asked to urinate in an open container to visualize the masses. On examination, these masses appeared fleshy, of variable size and shape, maximum being 2 cm in length and soft in consistency []. These masses were subjected to microscopic examination in 10% potassium hydroxide (KOH), fungal culture and histopathological examination. KOH examination revealed dense collection of septate hyaline hyphae with dichotomous branching at places []. For fungal culture, the specimen was inoculated on sabouraud dextrose agar (SDA) medium with antibiotics (chloramphenicol-0.4 gm/l, gentamicin-0.04 gm/l) and without cyclohexamide at 25°C. After 3-4 days, growth of colonies was observed which were green to grey in colour with a mat – like surface. Microscopically on lacto phenol cotton blue (LPCB) mount hyaline septate, relatively broad hyphae with long conidiophores were seen []. Vesicles were spherical, large with biseriate phialides bearing chains of conidia over most of the surface morphologically correlating with Aspergillus flavus. Histopathology too, was corroborative and revealed dense masses of interweaving septate filamentous hyphae.\nThe patient underwent hematological investigations to rule out underlying diabetes, HIV or any other cause of immunodeficiency. His renal functions were within normal limits. Blood sample for bacterial and fungal cultures were sterile and X-ray chest did not reveal any focus of infection. He was started on oral itraconazole at a dose of 200 mg twice a day. Patient became afebrile and reported a feeling of well being within two weeks of therapy. The last fungal mass was passed 12 days after start of therapy but the treatment was continued for a period of three months. The patient has been well and asymptomatic for more than 6 months after discontinuation of therapy.
|
[[32.0, 'year']]
|
M
|
{'15337343': 1, '2304151': 1, '3125579': 1, '7578735': 1, '31587699': 1, '11966588': 1, '33364688': 1, '15964354': 1, '371013': 1, '17544611': 1, '16724902': 1, '15827878': 1, '24082213': 2}
|
{}
|
163,334 |
3778809-1
| 24,082,214 |
noncomm/PMC003xxxxxx/PMC3778809.xml
|
Nevoid Hyperkeratosis of the Nipple and/or Areola: Treatment with Topical Steroid
|
A 20-year-old female was referred to the dermatology outpatient clinic of Razi hospital, Tehran, Iran in August 2010. She suffered from a 2-year history of asymptomatic discoloration and thickening of the both areolas []. It initiated with a pink, scaly, and eczematous plaque of areola, which gradually became darker. Worsening during the past 2 months, disturbed and encouraged her to seek medical care. There was no history of atopy, bloody discharge, breast malignancy, or drug intake.\nOn examination, there was a diffuse brownish pigmentation and verrucous thickening of the whole right and upper part of the left areola with overlying scale-crust. No abnormal findings including palpable mass, lymphadenopathies, nipple retraction, or discharge were encountered.\nOther dermatologic examination was unremarkable. She was not obese at all. Routine laboratory tests were within normal limits.\nA skin biopsy specimen showed marked thickening of the epidermis with slight papillomatosis and downward filiform rete ridges, anastomizing to each other. The basal layer of the epidermis was hyper pigmented without associated melanocytic proliferation. Slight fibrosis of upper dermis was identified [].\nConsidering clinical and histopathological findings, our patient highly probable, had NHNA.\nShe was reassured about the benign nature of the disease and was advised to use topical Mometasone furoate cream 0.1% (Elocom®) and emollient. One month later, she responded to therapy partially, with an acceptable cosmetic result []. In a period of 8 months follow-up, she experienced several recurrences and benefited from the prescribed topical steroid and emollient. However, she never had a complete clearance.
|
[[20.0, 'year']]
|
F
|
{'11862178': 1, '10730786': 1, '11756960': 1, '15996425': 1, '17050940': 1, '16880580': 1, '10642060': 1, '15962756': 1, '28004028': 1, '20427810': 1, '24082214': 2}
|
{}
|
163,335 |
3778810-1
| 24,082,215 |
noncomm/PMC003xxxxxx/PMC3778810.xml
|
Multiple Familial Trichoepithelioma with Malignant Transformation
|
A 38-year-old female presented with a 27 years history of asymptomatic, skin colored papules. Lesions were firm in consistency, ranging from 5 to 10 mms in diameter and were distributed on her face; around eyes, on the nose, nasolabial folds and upper lip [Figure and ]. General examination revealed no abnormality. Dermatological examination revealed normal skin and mucous membranes. Patient's father had similar lesions but there was no affection of other family members. Routine investigations including hemogram, urine analysis, liver and renal function tests were non contributary.\nExcisional biopsy of a representative lesion was done after taking patient consent. Histopathological examination of hematoxylin and eosin (H and E)-stained sections revealed superficial dermal, well circumscribed, non capsulated, symmetrical lesion. This lesion was formed of solid aggregates of uniform basaloid cells with peripheral palisading but lacked epidermal connection, pilar differentiation and retraction artifacts. They were surrounded by a stroma with increased number of fibroblasts []. Cells were uniform, with large nuclei and scanty cytoplasm and lacked cytological atypia, mitoses or necrosis []. Aggregations of fibroblasts, representing abortive attempts to form papillary mesenchyme (papillary mesenchymal bodies), were detected, that are characteristic of TE []. Small foreign body granuloma was detected [].\nBased on clinical and histopathological criteria, the diagnosis of immature TE was reached. However the presence of solid basaloid aggregates with peripheral palisading may lead to a misdiagnosis of BCC. Thus, we performed immunohistochemical (IHC) staining for Bcl2, CD10, CD34 and androgen receptor (AR) antibodies. The outermost epithelial cells showed positivity for Bcl2 []. Both CD10 and CD34 stained the stromal cells but not the basaloid cells [Figure and ]. Both tumor cells and stroma did not show any AR immunoreactivity []. The final diagnosis was TE. The patient was treated by CO2 laser with no recurrence for one year.
|
[[38.0, 'year']]
|
F
|
{'21572788': 1, '8752837': 1, '13832267': 1, '3692539': 1, '10815860': 1, '20499764': 1, '31380124': 2, '26955100': 2, '19570076': 1, '26288412': 2, '19911186': 1, '27293274': 1, '15086550': 1, '7513986': 1, '3722518': 1, '15798431': 1, '24082215': 2}
|
{'3778810-2': 2, '4763700-1': 1, '4533542-1': 1, '6662247-1': 1}
|
163,336 |
3778810-2
| 24,082,215 |
noncomm/PMC003xxxxxx/PMC3778810.xml
|
Multiple Familial Trichoepithelioma with Malignant Transformation
|
A 65-year-old male, the father of the first patient, was presented similarly by papulo-nodular lesions with the same distribution and morphology described in his daughter but larger in size []. These lesions appeared since 57 years but were neglected as they were asymptomatic. One month before reaching us, one of those nodules enlarged markedly to reach a size of 6 cm with repeated bleeding, ulceration and crustation [].\nExcisional biopsy was taken from a representative papule and incisional biopsy was taken from the enlarging nodule after taking patient consent.\nFor the former biopsy, examination of H and E-stained sections and immunohistochemical-stained sections of the same antibodies revealed the same results as the first case.\nFor the latter biopsy, islands of basaloid cells extending from the epidermis to the dermis with peripheral palisading and prominent stromal epithelial retraction artifacts were observed. Cells were large, with uniform large nuclei and scanty cytoplasm. So the diagnosis of BCC was suggested. Immunohistochemical staining revealed that, the basaloid cells stained diffusely with Bcl2 [], CD10 [] and focally with AR antibodies []. CD34 immunostaining was negative [].
|
[[65.0, 'year']]
|
M
|
{'21572788': 1, '8752837': 1, '13832267': 1, '3692539': 1, '10815860': 1, '20499764': 1, '31380124': 2, '26955100': 2, '19570076': 1, '26288412': 2, '19911186': 1, '27293274': 1, '15086550': 1, '7513986': 1, '3722518': 1, '15798431': 1, '24082215': 2}
|
{'3778810-1': 2, '4763700-1': 1, '4533542-1': 1, '6662247-1': 1}
|
163,337 |
3778811-1
| 24,082,216 |
noncomm/PMC003xxxxxx/PMC3778811.xml
|
Thrombosis Warning in Children Suffering from Henoch-Schonlein Purpura
|
A 14-year-old boy with no significant past medical or family history was admitted to our hospital complaining of abdominal pain for the previous 14 days. He had passed dark red and black stool for 7 days, and had an erythematous rash over the anterior aspect of the lower legs for 2 days with a day of bilateral ankle arthralgia. On general examination, his vital signs were stable and he had a palpable purpuric rash that predominantly affected the anterior aspect of his lower legs []; the bilateral ankles were swollen. Abdominal examination revealed generalized tenderness that was more obvious in the supraumbilical region. Per rectal examination revealed dark red stool. The fecal occult blood test was positive.\nThe laboratory results were as follows: hemoglobin level: 14.5 g/dL; leucocyte count: 25.27 × 109/L with 81% polymorphonuclear leukocytes; lymphocyte count: 13%; platelet count: 492/mm3. Serum electrolytes, blood urea nitrogen and creatinine, liver function tests, urine analysis, erythrocyte sedimentation rate, antinuclear antibody and anticardiolipin antibody levels and the coagulation profile were all within their normal ranges. An abdominal computed tomography (CT) scan showed thickening of the proximal small intestinal wall with a peritoneal effusion. The mesenteric CT venography was reported as a suspected SMV thrombosis with edema of the proximal intestinal wall [].\nAccording to the clinical manifestations, laboratory results and radiological findings, the patient was diagnosed with HSP and suspected SMV thrombosis. He was treated with mezlocillin sodium, methylprednisolone and heparin. After 7 days, his abdominal pain resolved and a repeated abdominal CT scan revealed that the intestinal wall edema and peritoneal accumulation had improved. On the 10th day of hospitalization, follow-up CT venography revealed homogeneous contrast throughout the SMV and no signs of venous thrombosis []. The pat ient had no abdominal pain, no new rash and no swollen joints. He was discharged from hospital on the 12th day of admission. During the 2-month follow-up period, he had no new complaints.
|
[[14.0, 'year']]
|
M
|
{'11304653': 1, '22361720': 1, '25883536': 1, '12354274': 1, '12709141': 1, '17949560': 1, '11101753': 1, '17509470': 1, '18283464': 1, '11827910': 1, '32557258': 1, '16133584': 1, '15820376': 1, '24082216': 2}
|
{}
|
163,338 |
3778813-1
| 24,082,218 |
noncomm/PMC003xxxxxx/PMC3778813.xml
|
Isolated, Localised Extragenital Bullous Lichen Sclerosus et Atrophicus: A Rare Entity
|
A 38 year old male patient, engineer by an occupation, presented with minimally pruritic white colored lesions over anterior aspect of neck since 3 months. Lesions were gradually increasing in size as well as number. There was associated mild stinging sensation and minimal watery discharge from the pre-existing lesions since last two weeks. There was no history suggestive of involvement of oral or genital mucosa. The lesions were untreated till date. There were no systemic co morbidities or concurrent medication.\nDermatological examination revealed multiple atrophic papules with follicular plugging []. Closer examination revealed few lesions having a superficial wrinkled appearance which on palpation appeared to be due to the presence of atrophic epidermis overlying a collection of fluid which was confirmed after puncturing the lesion with needle []. At certain areas atrophic papules were coalescing to form plaques and few papules were studded with vesicles at their margins. Mucosae, palms, soles, nails, scalp were normal. Hematological investigations including the complete blood count, liver, renal and thyroid profiles were within normal limits. Biopsy findings from a representative lesion revealed presence of an atrophic epidermis with hydropic degeneration of basal cell layer forming a subepidermal split with pronounced dermal edema and homogenization of collagen in upper dermis and dense lymphocytic periappendageal infiltrate in the mid dermis []. A diagnosis of Bullous variant of LSA was thus established. Considering bullous nature of lesions a short course of oral and then topical superpotent steroids (clobetasol dipropionate 0.05% cream) with tacrolimus ointment (0.1%) was administered. There was clearance of lesions without any recurrence till 6 months follow up. Lesions healed with post-inflammatory hypopigmentation and scarring [].
|
[[38.0, 'year']]
|
M
|
{'17367620': 1, '6383731': 1, '11044817': 1, '1458645': 1, '26009734': 2, '6736322': 1, '32850217': 2, '28292152': 1, '169874': 1, '15109275': 1, '19281711': 1, '26312692': 2, '24082218': 2}
|
{'4540526-1': 1, '4439768-1': 1, '4439768-2': 1, '4439768-3': 1, '7444889-1': 1}
|
163,339 |
3778814-1
| 24,082,219 |
noncomm/PMC003xxxxxx/PMC3778814.xml
|
Linear Syringocystadenoma Papilliferum: A Case Report with Review of Literature
|
A 10-year-old girl presented with multiple asymptomatic papules over right lower abdomen present since the age of 2 months. The lesions were gradually progressive with a rapid enlargement in the last 1 year. There was no history of any neurological, ocular or skeletal abnormality. On examination there were multiple erythematous papules and coalescent plaques (0.5 cm to 5 cm) in a linear pattern over the right lower abdomen []. Most papules were discrete, pink, dome shaped with a few papules showing central umblication and crusting. The papules coalesced to form numerous papillomatous plaques of varying sizes (1 to 5 cm). Yellowish slough and crusting was seen on some of the lesions. The discharge from the lesions foul smelt. No regional lymphadenopathy was present. The routine hematological and biochemical tests, chest radiograph and abdominal ultrasonography were normal.\nThe skin biopsy revealed cystic invagination of epidermis with papillary projection lined by two rows of cells. There were columnar cells towards the lumen and cuboidal cells in the outer layer. Decapitation was seen in the luminal columnar cell layer. The fibrovascular core of papillae showed mixed inflammatory infiltrate comprising of plasma cells, lymphocytes and neutrophils. The underlying deep dermis showed apocrine sweat glands []. The histopathologic features were consistent with the diagnosis of syringocystadenoma papilliferum. Immunohistochemistry (IHC) staining using epithelial membrane antigen (EMA), CD56, CK 19, CK 5, P 63 and smooth muscle antigen (SMA) revealed EMA positivity in columnar cells. Focal positivity of CD 56 was seen in columnar cells. CK 19 was positive in both columnar and basal cells. CK 5 and p63 were positive in basal cells. SMA was focally positive in basal cells []. These findings were consistent with the diagnosis of SCAP of apocrine origin. There was no evidence of malignant transformation. The patient was referred to Plastic surgery for surgical excision with skin grafting. However, the patient was lost to follow up.
|
[[10.0, 'year']]
|
F
|
{'21572788': 1, '19015430': 1, '18779904': 1, '21062598': 1, '19293506': 1, '19439899': 1, '22199089': 1, '29204402': 1, '14349382': 1, '19758371': 1, '25364565': 1, '21276059': 1, '12410704': 1, '13137601': 1, '29445572': 1, '16674787': 1, '24082219': 2}
|
{}
|
163,340 |
3778815-1
| 24,082,220 |
noncomm/PMC003xxxxxx/PMC3778815.xml
|
Cutaneous Benign Epithelioid Peripheral Nerve Sheath Tumour: A Rare Entity
|
A male patient aged 47 years, gives history of sudden increase in the size of a nodular lesion over the knee, following a minor trauma. The swelling had been present for the last 35 years and was slowly increasing in size. A history of trauma sustained to the site at the age of 12 was elicited, which healed with a small bleb sized lesion over the lateral end of scar. It was associated with pain following pressure at that site with full range of movements of the knee joint. Presently, the swelling had become painful following trauma to the lesion. The surgeon noted a nodular cutaneous lesion over the lateral aspect of the knee joint measuring 2.5 cm across, which was freely movable over the underlying structures. Skin over the lesion was stretched, hypopigmented and smooth []. A clinical diagnosis of sebaceous cyst was made and local excision performed. Specimen received in the pathology department was a single skin covered nodular tissue measuring 2 × 1 cm. Cut section showed a single cyst with luminal areas of haemorrhage and thick wall with solid white areas. Histopathological examination (HPE) showed a mid to deep dermal lesion with central cystic degeneration and coagulative necrosis. Short fascicles of spindle and epithelioid cells were seen [Figures and ], with moderate eosinophilic cytoplasm, vesicular fusiform nucleus, prominent eosinophilic nucleolus and an occasional mitotic figure, vaguely resembling Antoni A areas []. Areas of haemorrhage rimmed by hemosiderrin laden macrophages, stromal hyalinisation and chronic inflammation were noted. Tumor cells were S100 positive diffusely [inset [], and SMA and CD68 negative. MIB count was low. Based on these findings, a diagnosis of Cutaneous Benign Epithelioid Peripheral Nerve sheath tumor was offered.
|
[[47.0, 'year']]
|
M
|
{'9630185': 1, '18190449': 1, '9508344': 1, '15613855': 1, '8181804': 1, '18494828': 1, '15677978': 1, '9557795': 1, '24082220': 2}
|
{}
|
163,341 |
3779386-1
| 24,083,067 |
noncomm/PMC003xxxxxx/PMC3779386.xml
|
A Rare Cause of Crazy-Paving and Mediastinal Lymphadenopathy: Congestive Heart Failure
|
A 44-year-old man presented to our department with a 1-month history of dyspnea and cough. There was no history of sputum, fever, loss of weight, and chest pain. He had smoked one pack cigarettes a day for 35 years. He had had mitral valve replacement 10-years ago and pericardiectomy 5-years ago. His current medications included diltiazem, warfarin, and digoxin.\nOn physical examination, he appeared cyanotic. Blood pressure was 100/70 mmHg, heart rate was 116 beats/min, body temperature was 36.7°C. His arterial oxygen saturation on room air was 84%. Auscultation of the chest revealed inspiratory crackles bilaterally. His abdominal examination was unremarkable. There was obvious (+2) pitting edema on pretibial region. Laboratory findings revealed were normal except Na: 121 mmol/L, K: 4.8 mmol/L, aspartate aminotransferase (AST): 204 U/L, alanine aminotransferase (ALT): 203 U/L, lactate dehydrogenase (LDH): 808 U/L.\nThe plain chest radiograph demonstrated diffuse opacities affecting both lungs. Thorax computed tomography (CT) scans revealed multiple mediastinal lymphadenopathies up to 22 mm []. In both upper lobes; there were diffuse, multifocal, patchy, ground-glass opacities resulting in a crazy-paving appearance [].\nThere was no pathological finding of 18-fluorodeoxyglucose (18-FDG) uptake on positron emission tomography (PET) scan.\nThere were biatrial dilatation, prosthetic mitral valve, and second-degree tricuspid insufficiency on his echocardiography. Pulmonary artery pressure was 45-50 mmHg, ejection fraction of the left ventricle was 60%, and so confirmed diastolic dysfunction.\nThe patient underwent endobronchial ultrasound (EBUS) with bronchoalveolar lavage and lymph node transbronchial fine needle aspiration biopsies (TBNA) were performed to mediastinal lymph nodes bigger than 2 cm []. The lavage fluid was evaluated for routine cytology, gram stain and bacterial culture, acid fast stain and mycobacterial culture; all tests were negative. The cytology of bronchoalveolar lavage showed inflammatory features. Periodic acid Schiff (PAS) stain was performed for differential diagnosis of pulmonary alveolar proteinosis, but did not stain. The lymphadenopathy biopsies demonstrated no pathological changes. There were blood cells, bronchus epithelium cells, and lymphocytes.\nThe patient was treated with intravenous furosemide and he improved rapidly. The largest lymphadenopathy size decreased to 9 mm and the ground-glass opacities disappeared on CT scan obtained 1 month after the diagnosis [].
|
[[44.0, 'year']]
|
M
|
{'27890991': 2, '11171755': 1, '20547710': 1, '9041997': 1, '14689226': 1, '27488496': 2, '17517945': 1, '14615561': 1, '20669122': 1, '16896429': 1, '24083067': 2}
|
{'5112819-1': 1, '4973081-1': 1}
|
163,342 |
3779388-1
| 24,083,072 |
noncomm/PMC003xxxxxx/PMC3779388.xml
|
Semantic Dementia Diagnosed by F-18 FDG PET/MRI: Co-registered Images
|
A 61-year-old, right-handed male presented with a sudden change in mental status preceded by a significant decline in functionality over the past 2 years. He was previously a highly functional person and worked as an executive for a Fortune 500 company. His change in mental status was characterized by several behavioral changes; including cruelty toward family members and pets, promiscuity, adultery, drug abuse, wild spending habits, and lack of empathy. His family had also noticed a change in his speech patterns in terms of phonation and pronunciation of words.\nHis initial diagnosis was bipolar disorder; however, he did not respond to mood stabilizing drugs. After losing his job, he was admitted to the psychiatric ward with suicidal tendencies. MRI and magnetic resonance angiography (MRA) were ordered to evaluate for dementia. The MRI [] demonstrated diffuse parenchymal atrophy, which was slightly more extensive in the temporal lobes. There was a lacunar infarct in the right thalamus that was suggestive of vascular dementia. However, the MRA portion was unremarkable and did not support this diagnosis.\nA FDG PET scan was performed the same day for functional metabolic evaluation. The images were co-registered with the MRI using the Institute of Electrical and Electronics Engineers (IEEE) mutual information algorithm.[] The resultant PET/MR images [] demonstrated a pattern of decreased FDG uptake that was predominantly confined to the temporal lobes and was particularly severe in the amygdalae and hippocampi. The decrease in activity was greater on the left side and extended superoposteriorly toward the parietal lobe and Wernicke's area. The other atrophic areas and white matter changes seen on the MRI had intact glucose metabolism. The lacunar infarct also had decreased FDG uptake, but that was considered to be an incidental finding. The decreased glucose metabolism affecting only the temporal lobes (worse on the left side) with the concordant areas of atrophy on the MRI were highly specific for semantic dementia and allowed for a definitive diagnosis to be made.[] Unfortunately, the only management available for this condition is supportive care.
|
[[61.0, 'year']]
|
M
|
{'11805245': 1, '19501654': 1, '16401855': 1, '11310620': 1, '8618666': 1, '21325651': 1, '17565679': 1, '11181853': 1, '18002094': 1, '15212830': 1, '24083072': 2}
|
{}
|
163,343 |
3779389-1
| 24,083,070 |
noncomm/PMC003xxxxxx/PMC3779389.xml
|
Localized Cystic Disease of the Kidney: A Rare Cause of Hypertension in a Young Adult
|
A 16-year-old male presented with a right abdominal and groin pain. There was no gross hematuria, fever, or lower urinary tract symptoms. Palpation of his right flank area was normal. He had hypertension for 2 years and his blood pressure (BP) measured 190/100 mm Hg at presentation. He had been taking antihypertensive drugs including valsartan hydrochlorothiazide (160/12.5 mg capsule once daily). No other abnormalities were found in the patient's history and on physical examination. Family screening was performed and no abnormalities were found. There was no family history of renal failure or cerebrovascular accident. His chest radiography and electrocardiography findings, urinanalysis, blood urea nitrogen, and serum creatinine levels were within normal limits. Other laboratory tests including lipid profile and liver functions were with in the normal range. His body mass index (BMI) was also in normal range (BMI: 22.1).\nAn abdominal ultrasound showed multiple variable-sized cysts in the upper pole of the right kidney with normal left kidney and lower pole of the right kidney []. Renal arterial color Doppler ultrasonography was normal. Abdominal computed tomography confirmed the ultrasound findings that the upper pole of the right kidney was filled with multiple cysts of different sizes with enhancing normal renal tissue between the cysts. There were no cysts in the other intra-abdominal organs. A renin blood test showed that the plasma renin level was moderately elevated (46 pg/ml, normal limits: 11-33 pg/ml). Selective intrarenal catheterization was performed to obtain venous blood samples. His drug was withdrawn four days before the selective renal vein studies and he was given 10 mg furasemide orally in the afternoon prior to the study. The procedure was started after placing the patient in a supine position for at least two hours. A catheter was introduced through the femoral vein and it was advanced using fluoroscopic guidance. Blood samples for plasma renin level were drawn from both main renal veins and from the upper and lower segmental draining veins of each kidney. The highest renin level was measured in the right upper segmental vein (92 pg/ml). Renin levels of the right lower segmental vein and the left renal veins are shown on .\nIn order to further characterize the lesions, MRI was performed. A gadolinium-enhanced MRI revealed that the upper pole of the right kidney was completely filled with multiple round, well-marginated cysts of varying size without capsule formation []. There were no solid areas within the cysts and renal parenchyma between the cysts was normally enhancing. Technetium-99m-dimercaptosuccinic acid (Tc-99m DMSA) renal scintigraphy showed decreased renal uptake at the upper half of the right kidney. After discussion with the physicians and the parents, a decision was made to perform partial nephrectomy to eliminate the source of the apparent renin-dependant hpertension. The patient underwent right upper pole heminephrectomy with a histopathological result confirming LCDK. Nephrectomy specimen on macroscopic examination showed conglomerate cysts of various sizes in the kidney []. Microscopy examination showed cysts containing dark brown or clear serous fluid and surrounded by mono-layered flat-cuboidal epithelium without evidence of tumor or papillary formation [].\nAfter surgery the patient's blood pressure returned to normal levels without any need for antihypertensive medication. The patient is under follow-up on outpatient basis and has maintained good renal function during the last two years. Follow-up ultrasound examinations showed normally appearing residual right kidney and left kidney.
|
[[16.0, 'year']]
|
M
|
{'25964835': 1, '11264061': 1, '23211292': 1, '9321739': 1, '19962806': 1, '23365710': 1, '10646978': 1, '25165175': 1, '28536669': 1, '14580105': 1, '32922709': 2, '9930078': 1, '24083070': 2}
|
{'7461636-1': 1}
|
163,344 |
3779390-1
| 24,083,069 |
noncomm/PMC003xxxxxx/PMC3779390.xml
|
Functioning Adrenocortical Carcinoma with Extension upto the Right Atrium Producing Cushing's Syndrome
|
A 40-year-old female presented with a 7-month history of intermittent right flank pain in the loin region and features of Cushing's syndrome such as weight gain, central obesity, bipedal edema, moon facies, hirsutism, oligomenorrhea, recent onset of hypertension and diabetes mellitus (treated with insulin). There was no history of persistent headache, vomiting, and focal neurological symptoms. Her electrolytes, renal and liver function tests were within normal limits. Hormonal profile testing revealed markedly elevated serum 8 AM cortisol (1177 nmol/L) with loss of diurnal variation (11 PM cortisol - 800 nmol/L) which was not suppressible by Dexamethasone (LDDST {low dose dexamethasone suppression test} - 917.1 nmol/L; HDDST {high dose dexamethasone suppression test}- 812.9 nmol/L). Adrenocorticotropic hormone (ACTH) was suppressed (1.89 pg/mL), serum testosterone was elevated (6.3 nmol/L) with suppressed luteinizing hormone (LH) 1.14 mIU/mL (normal in follicular phase 2.4-12.6mIU/L) and follicle-stimulating hormone (FSH) 1.15 mIU/mL (normal in follicular phase 3.3-12.5 mIU/L). Ultrasound abdomen revealed a hypoechoic lesion in the right lobe of liver of size 10.1 × 8.2 cm. On contrast enhanced computed tomography (CECT) abdomen there was a well-defined heterogeneously enhancing mass lesion 10 × 9 cm with necrotic areas in right suprarenal location with infiltration into the segment VI and V of the liver and tumor thrombus in the IVC reaching up to the right atrium []. Left adrenal gland was normal. positron emission tomography (PET CT) with computed tomography scan showed intense FDG uptake {standardized uptake values} (SUV) max 8.6) [].\nThe patient underwent a bilateral subcostsal incision with midline sternotomy for excision of tumor mass with removal of intracaval and right atrial extension for which she required a cardiopulmonary bypass. Tumor planes with the inferior surface of the liver were lost and during resection there was liver parenchymal injury from where she had severe bleeding. Packing of the abdominal cavity and abdomen closure had to be done with plans for pack removal 48 hours later, by which time bleeding had subsided. Specimen excised revealed complete removal of tumor with the thrombus []. Post-operation the patient was kept on a ventilator and inotropic support, which was gradually withdrawn. Histopathology of the specimen confirmed the diagnosis of adrenocortical carcinoma with tumor thrombosis [].
|
[[40.0, 'year']]
|
F
|
{'31765326': 1, '16778409': 2, '12478091': 1, '28471969': 1, '7771009': 1, '9366311': 1, '24083069': 2}
|
{'2729971-1': 1}
|
163,345 |
3779396-1
| 24,083,068 |
noncomm/PMC003xxxxxx/PMC3779396.xml
|
A Rare Cause of Acute Abdomen: Jejunal Diverticulosis with Perforation
|
A 74-year-old female patient was admitted to the Emergency Room with sudden onset of abdominal pain, nausea, and vomiting. Her physical examination revealed diffuse abdominal tenderness and abdominal rebound tenderness. Her laboratory tests were normal, except for elevated white blood cell count (WBC 13200/mm≥). Abdominal X-ray image in upright position showed two gas fluid lesions in the small intestine []. A computed tomography (CT) scan with intravenous (IV) contrast revealed multiple diverticula on the mesenteric wall of the small intestine and dilated intestinal loops proximal to the diverticula, but no free air or fluid []. Due to the acute symptoms, exploratory laparotomy surgery was performed. Multiple diverticula were seen located between 40th and 100th cm distal to the ligament of Treitz. A necrotic, perforated diverticulum was present in the distal part of the jejunal segment []. The 60-cm long jejunal segment was excised and end-to-end anastomosis was performed. The patient did not experience any postoperative complications, recovered completely and was discharged on Day 7. Histopathological examination showed multiple diverticula on the small intestinal wall closer to the mesenteric side as well as necrosis and a 5-mm perforation hole on one of the diverticula. The area of perforation was filled with fibrinous exudate. The diverticula were false diverticula, and only the mucosa and submucosa were herniated.
|
[[74.0, 'year']]
|
F
|
{'23133166': 1, '27853337': 2, '23049633': 2, '9382070': 1, '18430845': 1, '9100684': 1, '21528094': 1, '18807676': 1, '7940172': 1, '32632508': 2, '824970': 1, '10829530': 1, '24083068': 2}
|
{'5106572-1': 1, '7338329-1': 1, '3464999-1': 1}
|
163,346 |
3779398-1
| 24,083,063 |
noncomm/PMC003xxxxxx/PMC3779398.xml
|
Clinico-radiologic Findings in Group II Caudal Regression Syndrome
|
A 10-year-old girl presented with progressive lower extremity weakness, difficulty in walking, and urinary incontinence. She had urinary incontinence since infancy and had undergone surgery for neurogenic bladder 5 years earlier. She now had progressively increasing urinary incontinence,, increased weakness of the lower limbs, and bowel incontinence. Her legs showed wasting of both proximal and distal muscles. Scoliotic deformity was seen along with impairment in walking. No cutaneous stigmata were noted in the back. Blood investigation findings were normal. She underwent technetium dimercaptosuccinic acid scans, which revealed bilateral atrophic kidneys with impaired renal function and parenchymal scarring.\nMagnetic resonance imaging (MRI) examination of the lumbosacral spine revealed scoliotic deformity, bilateral sacral agenesis (S2 level), low lying spinal cord (L5 level), and syringohydromelia of the caudal spinal cord. Associated findings include anterior epidural lipoma, anterior lipomyelocystocele, an irregular trabeculated urinary bladder, bilateral hydronephrosis, and bilateral hydroureter [Figures -]. Based on the clinical and radiologic findings, a diagnosis of CRS Group 2 was made.
|
[[10.0, 'year']]
|
F
|
{'2512786': 1, '3280777': 1, '33194235': 1, '17963219': 1, '30574238': 1, '8073969': 1, '3128080': 1, '8492851': 1, '12813764': 1, '33833979': 2, '16752437': 1, '24083063': 2}
|
{'8007840-1': 1}
|
163,347 |
3779402-1
| 24,083,062 |
noncomm/PMC003xxxxxx/PMC3779402.xml
|
Spontaneous Biliary Peritonitis in Children
|
A one-and-half-year-old male child presented with a 7-day history of fever, acholic stools, and vomiting and progressive abdominal distension for 3 days. Clinical examination revealed fever, icterus, abdominal distension, sluggish bowel sounds, tender hepatomegaly, guarding with rebound tenderness and fluid thrill. Total Leucocyte Count (TLC) was 17,000/dl with 83% neutrophils and Serum Bilirubin was 6.8 mg/dl. Ultrasound (USG) revealed ascites with dilatation of common bile duct (CBD), common hepatic duct (CHD), and intra-hepatic biliary radicals. Contrast Enhanced Computed Tomography (CECT) and Magnetic Resonance Imaging (MRI) confirmed the USG findings and also showed sudden tapering of distal CBD, distended gall bladder, peri-cholecystic fluid, and marked ascites. A disproportionately large fluid collection was seen in left posterior peri-hepatic space [Figures and ]. There was no evidence of pneumo-peritoneum. A provisional diagnosis of biliary perforation was made and the child was referred to a tertiary pediatric surgery centre, where abdominal paracentesis revealed bile. Two USG-guided pigtail drains were placed which drained nearly 800 ml of bile. The child was kept on antibiotics and nutritional support and subsequently taken up for definitive surgery. Exploratory laparotomy with adhesionolysis and cholecystectomy with Roux-en-Y hepatico-jejunostomy was performed []. The child recovered and has had an uneventful post-operative period over the last two years.
|
[[1.5, 'year']]
|
M
|
{'466017': 1, '17526970': 1, '11149391': 1, '6668781': 1, '17219005': 1, '10941979': 1, '27062138': 1, '21386641': 1, '7627384': 1, '20400907': 1, '1008596': 1, '24083062': 2}
|
{'3779402-2': 2}
|
163,348 |
3779402-2
| 24,083,062 |
noncomm/PMC003xxxxxx/PMC3779402.xml
|
Spontaneous Biliary Peritonitis in Children
|
A 3-year-old male child presented with complaints of abdominal pain and high-grade intermittent fever, mild jaundice without cholestatic features, vomiting, and a lump in the right upper abdomen for 6-7 days. Initial imaging investigations, comprising of two sonograms were done elsewhere prior to admission at our center. First USG revealed large cystic area in the region of the gall bladder (GB) that was likely to be a distended GB/choledochal cyst. Second USG showed similar findings but suggested ruptured left liver lobe abscess as a differential as the cystic area was subjacent predominantly to the left lobe, alongwith presence of free fluid in right iliac fossa. The child had been started on antibiotics and anti-pyretics by a private clinician, which was continued even after his admission. However, USG-guided abdominal paracentesis from right iliac fossa revealed the presence of bile in the fluid collection. This led to a revised diagnosis of biliary perforation and subsequently a Computed Tomography (CT) scan was done []. It revealed hydrops of gall bladder (GB) with the neck of the GB going across the midline from right to left, crossing anterior to common bile duct and possibly compressing it, as there was dilatation of the right and left hepatic ducts and the common hepatic duct. There was no evidence of thickening of GB wall. A small collection of fluid was seen in the posterior left peri-hepatic space around the neck of GB along with some free fluid in right paracolic gutter, indicative of localized biliary perforation [Figure and ]. Hemogram revealed leukocytosis (TLC was 17300/dl and an elevated Serum Bilirubin level of 2.8 mg/dl.. The child was continued on conservative management. MRI of upper abdomen done about 7 days later [] showed reduction in diameter of GB from 5 cm to approximately 2.8 cm. Dilatation of hepatic ducts persisted with smooth transition in region of proximal CBD which was normal in caliber. Inflammatory stranding was seen in left sub-hepatic space with no free fluid. A diagnosis of hydrops of gall bladder with dilatation of central hepatic ducts and common hepatic duct and recovering biliary perforation was made. A follow-up MRI done a year-and-a-half later showed partially distended GB in similar location, and persisting dilatation of central hepatic ducts and common hepatic duct, which tapered smoothly into a normal caliber CBD [Figure and ]. The child improved with conservative management and is currently asymptomatic on follow-up investigation.
|
[[3.0, 'year']]
|
M
|
{'466017': 1, '17526970': 1, '11149391': 1, '6668781': 1, '17219005': 1, '10941979': 1, '27062138': 1, '21386641': 1, '7627384': 1, '20400907': 1, '1008596': 1, '24083062': 2}
|
{'3779402-1': 2}
|
163,349 |
3779405-1
| 24,082,912 |
noncomm/PMC003xxxxxx/PMC3779405.xml
|
Macrofollicular variant of papillary carcinoma, a potential diagnostic pitfall: A report of two cases including a review of literature
|
A 33-year-old woman presented with a 5-year history of thyroid nodule. She noted a recent increase in the size of the nodule. Although she had a family history of thyroid disease, there was no history of radiation exposure or prior malignancy. Thyroid stimulating hormone levels were normal.\nAn ultrasound of the thyroid gland showed a 3.9 cm solid, isoechoic nodule almost replacing the right lobe. An ultrasound guided fine needle aspiration (FNA) was performed. Air-dried smears were stained with Diff-Quik and ethanol fixed smears with Papanicolaou stain.\nThe Diff-Quik smears showed abundant thin colloid and moderate amount of follicular cells arranged in a honeycombed and syncytial pattern []. Some of the follicular cells showed nuclear overlapping enlarged round to ovoid nuclei, small prominent nucleoli and few nuclear grooves []. Rare intranuclear inclusions were also identified []. Few multinucleated giant cells were present. Nuclei with fine powdery chromatin pattern and small nucleoli were present on Papanicolaou stained smears []. The FNA was reported as suspicious for papillary thyroid carcinoma.\nA total thyroidectomy was performed. The right lobe weighed 42 g and measured 7.0 cm × 4.2 cm × 3.0 cm. Cut section showed a 4.0 cm × 3.8 cm × 3.0 cm well circumscribed encapsulated tan-pink nodule located at the inferior lobe. Microscopic examination showed an encapsulated tumor with predominance of macrofollicles lined by overlapping follicular cells with enlarged, optically clear nuclei, containing few nuclear grooves and rare intranuclear inclusions. The tumor was positive for Hector Battifora mesothelial cell-1 (HBME-1).
|
[[33.0, 'year']]
|
F
|
{'14692811': 1, '19302958': 1, '12040653': 1, '9850657': 1, '11393092': 1, '24671758': 1, '33600764': 1, '9723599': 1, '30987707': 1, '9755680': 1, '19355832': 1, '12114801': 1, '17703452': 1, '1748427': 1, '24082912': 2}
|
{'3779405-2': 2}
|
163,350 |
3779405-2
| 24,082,912 |
noncomm/PMC003xxxxxx/PMC3779405.xml
|
Macrofollicular variant of papillary carcinoma, a potential diagnostic pitfall: A report of two cases including a review of literature
|
A 55-year-old woman presented with a clinical history of hyperparathyroidism. An ultrasound of the thyroid gland revealed a right-sided 2.9 cm mixed echogenic nodule and a 0.6 cm isthmic nodule containing fine internal calcifications.\nAn ultrasound guided FNA of the right lobe was performed. Air dried smears were stained with Diff-Quik and ethanol fixed smears with Papanicolaou stain. The Diff-Quik smears showed abundant thin colloid and predominantly benign-appearing follicular cells arranged in monolayered pattern. However, other areas showed enlarged round to ovoid follicular cells with nuclear crowding and rare grooves []. Few follicular cells with occasional small nucleoli were also present []. No intranuclear inclusions were identified. Occasional multinucleated giant cells were present. The final diagnosis was atypia of undetermined significance (AUS). Although the Bethesda Recommendation for AUS is repeat FNA after a period of observation, based on the clinical presentation of patient and imaging studies, a total thyroidectomy was performed. The right lobe showed a 2.2 cm encapsulated nodule and two smaller ill-defined white firm nodules measuring 0.3 cm and 0.5 cm. No tumor was seen in the left lobe. Histologic sections from the 2.2 cm right lobe revealed a well-encapsulated tumor composed of colloid-filled macrofollicles occupying more than 50% of the nodule and admixed with smaller follicles. The epithelium of both small and large follicles showed nuclear overlapping, fine chromatin pattern, small eccentrically located nucleoli and few nuclear grooves. No intranuclear inclusions were identified. Capsular or vascular invasion was not identified. Immunohistochemical stain for HBME-1 was positive. The remaining two smaller nodules showed classic micropapillary thyroid carcinoma.
|
[[55.0, 'year']]
|
F
|
{'14692811': 1, '19302958': 1, '12040653': 1, '9850657': 1, '11393092': 1, '24671758': 1, '33600764': 1, '9723599': 1, '30987707': 1, '9755680': 1, '19355832': 1, '12114801': 1, '17703452': 1, '1748427': 1, '24082912': 2}
|
{'3779405-1': 2}
|
163,351 |
3779407-1
| 24,082,670 |
noncomm/PMC003xxxxxx/PMC3779407.xml
|
Complimentary imaging technologies in blunt ocular trauma
|
A 40-year-old African American man presented with a past ocular history of blunt force trauma with a projectile object (stone) at age nine. No surgical intervention was recommended at that time. Vision deteriorated to counting fingers (CF) within a few weeks. At the screening examination, uncorrected visual acuity (VA) was 20/30 and CF, and IOP was 14 mm Hg and 22 mm Hg in the right and left eyes, respectively. FDT visual field testing showed a central scotoma.\nThe right eye fundus imaging was within the normal limits (not shown). Color fundus photo of the affected left eye showed an approximately two-disc diameter chorioretinal scar in the macular region []. Image analysis was then performed using the digital red wavelength filter (610 nm) to better illustrate outer retinal pathology (including the retinal pigment epithelium [RPE] and choroidal findings) and showed extensive fibrosis and macular hypopigmentation []. A topographical monochromatic filter created an “embossed” image of retinal elevations and depressions that highlighted topographic macular changes []. Both images illustrated extensive fibrosis in the macula. The subject declined further evaluation with FAF and OCT or microperimetry for a more detailed assessment of the visual field.
|
[[40.0, 'year']]
|
M
|
{'19906085': 1, '9747684': 1, '17632299': 1, '4820984': 1, '18766361': 1, '17258530': 1, '18660739': 1, '2191381': 1, '23215640': 1, '21191446': 1, '24082670': 2}
|
{'3779407-2': 2}
|
163,352 |
3779407-2
| 24,082,670 |
noncomm/PMC003xxxxxx/PMC3779407.xml
|
Complimentary imaging technologies in blunt ocular trauma
|
A 58-year-old Caucasian man presented with a past ocular history of blunt force trauma with a tennis ball at age 17. As in the first case, surgical intervention was not recommended at the time of injury and vision deteriorated to hand motions shortly thereafter. On examination, uncorrected VA in the affected eye was 20/800 and IOP was 13 mm Hg. The VA and IOP in the unaffected eye were within normal limits.\nColor fundus imaging of the affected right eye [] showed a crescentric area of choroidal rupture with fibrosis and reactive hyperpigmentation involving the macula and extending to the vascular arcades with peripapillary atrophy. The digital red filter [] and monochromatic “emboss” filter [] showed good correlation with the extensive fibrosis noted on color imaging []. FAF imaging [] delineated an area of hypofluorescence greater than that originally defined in Figure -. OCT [] showed chorioretinal atrophy in the macula and temporal retina (in contrast to the unaffected normal appearing nasal retina). Microperimetry testing of the central 10° field [] showed an absolute scotoma with no response to maximal stimuli at 0 dB. The central scotoma corresponded to the involved retina.
|
[[58.0, 'year']]
|
M
|
{'19906085': 1, '9747684': 1, '17632299': 1, '4820984': 1, '18766361': 1, '17258530': 1, '18660739': 1, '2191381': 1, '23215640': 1, '21191446': 1, '24082670': 2}
|
{'3779407-1': 2}
|
163,353 |
3779408-1
| 24,082,671 |
noncomm/PMC003xxxxxx/PMC3779408.xml
|
Surgery for macular holes associated with unusual concomitant pathologies
|
A 55-years-old woman, known to have RP and CME, sought an opinion concerning recent decrease in vision of the right eye. Best corrected visual acuity (BCVA) in the right eye was 20/800. Fundus examination demonstrated multiple bony spicule-like pigmentation in the mid-peripheral region. A full thickness macular hole (FTMH) 350 microns in diameter with surrounding cuff of subretinal fluid and yellowish deposits at the base, was noted in the right eye []. The left eye showed retinal pigment alterations in the macular area []. Electroretinogram in both eyes showed reduced scotopic and photopic responses []. Optical coherence tomography (OCT) showed a FTMH with cystic spaces in the right eye [] and inner lamellar defect with epiretinal membrane in the left eye [] The patient underwent 23 G pars plana vitrectomy. After posterior vitreous detachment induction, the ILM was stained with trypan blue dye (0.06%) for a contact time of 2 min. ILM peeling was carried out from arcade to arcade. Gas tamponade with C3F8 (14%) was used. The patient was advised prone positioning for 14 h/day for 2 weeks. At 2 months follow-up, visual acuity improved to 20/200. Post-operative OCT showed closure of MH with regaining of foveal contour []. However, thinning of inner segment/outer segment junction of the photoreceptors, and retinal pigment epithelial alterations were noted.
|
[[55.0, 'year']]
|
F
|
{'26858486': 1, '11476694': 1, '12719070': 1, '34488687': 2, '32566994': 2, '3337708': 1, '16761258': 1, '9097749': 1, '25390128': 1, '18398364': 1, '1765292': 1, '17123621': 1, '11217937': 1, '28791069': 2, '24082671': 2}
|
{'3779408-2': 2, '3779408-3': 2, '3779408-4': 2, '3779408-5': 2, '5525505-1': 1, '7406580-1': 1, '8422608-1': 1}
|
163,354 |
3779408-2
| 24,082,671 |
noncomm/PMC003xxxxxx/PMC3779408.xml
|
Surgery for macular holes associated with unusual concomitant pathologies
|
A 54-years-old man was diagnosed with RP 30 years back. He presented with recent onset of decreased vision in the left eye. BCVA was 20/80 in the left eye. Fundus examination revealed typical RP features. A FTMH was noted in the left eye. Same technique as in case one was followed for the surgical repair. At 2 months, follow-up ophthalmoscopy showed non-closure of MH; BCVA was 20/120 in the left eye.
|
[[54.0, 'year']]
|
M
|
{'26858486': 1, '11476694': 1, '12719070': 1, '34488687': 2, '32566994': 2, '3337708': 1, '16761258': 1, '9097749': 1, '25390128': 1, '18398364': 1, '1765292': 1, '17123621': 1, '11217937': 1, '28791069': 2, '24082671': 2}
|
{'3779408-1': 2, '3779408-3': 2, '3779408-4': 2, '3779408-5': 2, '5525505-1': 1, '7406580-1': 1, '8422608-1': 1}
|
163,355 |
3779408-3
| 24,082,671 |
noncomm/PMC003xxxxxx/PMC3779408.xml
|
Surgery for macular holes associated with unusual concomitant pathologies
|
A 32-year-old man with high myopia had a history of RP in both the eyes since 6 years of age. He presented with diminution of vision in the right eye of 1 year duration. BCVA in the right eye was 20/120. Typical RP features were associated with a FTMH in the right eye and retinal pigment epithelial (RPE) atrophy at central macula in the left eye. Same technique as in case one was followed for the surgical repair. At 2 months follow-up, ophthalmoscopy showed type 2 closures of the MH with flat edges. BCVA noted was 20/200 in the right eye. One year later he underwent phacoemulsification with intraocular lens (IOL) implantation and yttrium aluminium garnet laser (YAG) capsulotomy 4 years later. Last follow-up at 5½ years from the surgery showed type 2 closure of MH; BCVA was 20/2000 in the right eye.
|
[[32.0, 'year']]
|
M
|
{'26858486': 1, '11476694': 1, '12719070': 1, '34488687': 2, '32566994': 2, '3337708': 1, '16761258': 1, '9097749': 1, '25390128': 1, '18398364': 1, '1765292': 1, '17123621': 1, '11217937': 1, '28791069': 2, '24082671': 2}
|
{'3779408-1': 2, '3779408-2': 2, '3779408-4': 2, '3779408-5': 2, '5525505-1': 1, '7406580-1': 1, '8422608-1': 1}
|
163,356 |
3779408-4
| 24,082,671 |
noncomm/PMC003xxxxxx/PMC3779408.xml
|
Surgery for macular holes associated with unusual concomitant pathologies
|
A 22-year-old man presented with blurring of vision in the right eye for 1 month. BCVA was 20/800 in the right eye. He had no perception of light in the left eye. Dilated right eye fundus examination demonstrated inferior choroidal coloboma involving the disc with a FTMH at the edge of the coloboma in the uninvolved macula []. The MH was horizontally oval in shape, 625 microns in size with surrounding cuff of subretinal fluid. OCT showed large FTMH with shallow retinal detachment nasal to the hole []. A 20 G vitrectomy with lensectomy was performed. Posterior vitreous detachment was induced from the superior part of the attached retina. Vitreous was an adherent at the edge of coloboma. ILM was stained using trypan blue (0.06%) for contact time of 2 min. ILM peeling was carried out using ILM peeling forceps. Two to three rows of endolaser were applied along the edge of choroidal coloboma as a prophylactic measure considering that the patient has only one functioning eye. Encircling scleral band was secured followed by silicon oil injection. At 2 months and 4 months follow-up, OCT showed flat edges of MH with decreased diameter (type 2 closure) [Figure and ]. At 7 months silicon oil removal was carried out. OCT showed type 1 closure of MH with a thin neuronal tissue bridging across the fovea []. With low-vision aid BCVA was 20/160.
|
[[22.0, 'year']]
|
M
|
{'26858486': 1, '11476694': 1, '12719070': 1, '34488687': 2, '32566994': 2, '3337708': 1, '16761258': 1, '9097749': 1, '25390128': 1, '18398364': 1, '1765292': 1, '17123621': 1, '11217937': 1, '28791069': 2, '24082671': 2}
|
{'3779408-1': 2, '3779408-2': 2, '3779408-3': 2, '3779408-5': 2, '5525505-1': 1, '7406580-1': 1, '8422608-1': 1}
|
163,357 |
3779408-5
| 24,082,671 |
noncomm/PMC003xxxxxx/PMC3779408.xml
|
Surgery for macular holes associated with unusual concomitant pathologies
|
A 33-year-old man presented with gradual, progressive diminution of vision in the right eye for 1 year. BCVA was 20/60 in the right eye. The left eye showed clinical anophthalmos. Fundus examination of the right eye showed optic disc pit in the temporal part of the optic nerve head. A large FTMH with surrounding neurosensory detachment was noted []. FFA confirmed optic disc pit with no evidence of leakage from any other point []. OCT showed FTMH with schisis like separation of outer and inner retinal layers with large subretinal fluid collection [Figure and ]. The apex diameter of the hole was 526 microns. The patient underwent three-port pars plana vitrectomy. After inducing posterior vitreous detachment, the ILM was stained using 0.25 mg/ml Brilliant Blue G for 2 min and then peeled. C3F8 (14%) was used as a tamponade. At 3 months follow-up, fundus examination showed non-closure of MH. Spectral domain optical coherence tomography (SD-OCT) showed flattening of the edges of the hole as well as the neurosensory elevation []. However, the isolated pockets of intraretinal fluid persisted. At last follow-up BCVA was 20/80.
|
[[33.0, 'year']]
|
M
|
{'26858486': 1, '11476694': 1, '12719070': 1, '34488687': 2, '32566994': 2, '3337708': 1, '16761258': 1, '9097749': 1, '25390128': 1, '18398364': 1, '1765292': 1, '17123621': 1, '11217937': 1, '28791069': 2, '24082671': 2}
|
{'3779408-1': 2, '3779408-2': 2, '3779408-3': 2, '3779408-4': 2, '5525505-1': 1, '7406580-1': 1, '8422608-1': 1}
|
163,358 |
3779409-1
| 24,082,672 |
noncomm/PMC003xxxxxx/PMC3779409.xml
|
American joint committee on cancer staging of uveal melanoma
|
A 55-year-old White male noticed a pigmented spot on the iris left eye (OS). Examination revealed visual acuity of 20/20 in the right eye (OD) and 20/50 OS. Intraocular pressures were 18 mmHg OD and 15 mmHg OS. There was no ocular melanocytosis. The right eye was unremarkable.\nThe anterior segment OS revealed dilated episcleral sentinel vessels superotemporally leading to a brown iris tumor []. The tumor originated in the ciliary body with extension into the iris and with no extrascleral component. There was minor tumor seeding into the anterior chamber angle. The tumor measured 14 mm in diameter and 10.3 mm in thickness by ultrasonography. The final diagnosis was ciliochoroidal melanoma with secondary iris invasion and the tumor was classified according to the AJCC as a T3b N0 M0 with an anatomic stage IIIA and histologic grade GX. The patient was treated with an 18 mm custom-designed round I-125 radioactive plaque with an apex dose of 7000 cGy. Fine needle aspiration biopsy was performed at the time of plaque placement for cytogenetic testing.
|
[[55.0, 'year']]
|
M
|
{'12359604': 1, '33558707': 1, '22813447': 1, '22965011': 1, '17719643': 1, '34134723': 1, '33897784': 1, '30071857': 1, '29209985': 1, '29844657': 1, '27171272': 1, '19667335': 1, '30884881': 1, '33737269': 1, '24082672': 2}
|
{}
|
163,359 |
3779410-1
| 24,082,673 |
noncomm/PMC003xxxxxx/PMC3779410.xml
|
Leber's miliary aneurysms
|
A 22-year-old male patient presented to the Ophthalmology clinic with a chief complaint of right eye floater. His past medical and ocular history were unremarkable. He gave no history of any systemic illness.\nOn examination, his visual acuity was 20/20 in the right eye (OD) and 20/25 in the left eye (OS). Intra ocular pressure was 19 and 13 mmHg. Anterior segment exam was normal in both eyes. Dilated fundus exam of the right eye was unremarkable. The left eye demonstrated a physiologic appearing optic nerve. However, the presence of multiple hard exudates in the inferior temporal retinal of the left eye was noticed. There were also multiple aneurysms in the temporal retina with vascular dilations, neovascularisation and very mild macular edema [].\nIntravenous fluorescein angiography showed early and late leakage as well as capillary dropout with late hypofluorescence in the temporal macula based on that picture we decided to treat him with laser photocoagulation although he was asymptomatic [].\nOptical coherence tomography (OCT) showed mild retinal thickening in the inferior macular region.\nThe patient was instructed to regularly follow up and to return to the clinic if he noticed any changes.
|
[[22.0, 'year']]
|
M
|
{'13468856': 1, '33921646': 1, '5820068': 1, '19006020': 1, '13339898': 1, '8414413': 1, '17295151': 1, '12825404': 1, '6019808': 1, '13478225': 1, '21146470': 1, '24082673': 2}
|
{}
|
163,360 |
3779411-1
| 24,082,674 |
noncomm/PMC003xxxxxx/PMC3779411.xml
|
Keratomycosis after incidental spillage of vegetative material into the eye: Report of two cases
|
A 26-year-old male patient presented with gradual loss of vision in the right eye over the last 2 weeks. The patient had a history of incidental spillage of corn milk while eating corn into his right eye before the onset of his symptoms. There was no history of eye redness or mucopurulant eye discharge after the trauma. He had no history of drug consumption over the last 2 weeks and past medical history was also negative. Visual acuity (VA) had decreased to hand motion in the involved eye. A 5.5 × 6 mm central ulcer with a gray-white dry appearing infiltrate, feathery margin, and satellite lesions characteristic for fungal keratitis was found during eye exam. An additional 1 mm hypopyon was also noted []. Other ocular exams were normal.\nCorneal scraping was done to obtain smear and culture. Although the direct smear stained with gram staining revealed fungal mycelia, the culture became negative for fungus species within Sabouraud's environment.\nThe patient was treated with a high suspicion for filamentous fungal keratitis. Oral ketoconazole (400 mg/day), fortified antibiotic eye drop (voriconazole and amphotricin), topical steroid eye drop (betamethasone, twice daily), and dicloptin eye drop (every 6 h) were prescribed for two weeks. Due to the lack of response to the initial treatment, two intrastromal injections of voriconazole (50 μg/0.1 cm3) were performed within 8 days. The patient was discharged with the aforementioned drugs after relative response with corneal epithelialization and decreased infiltration. Follow-up session after 2 and 4 weeks revealed no better VA than hand motion after the initiation of therapy. The enlargement of the previous ulcer (6.5 × 7 mm) with central thinning, hypopyon of 0.5 mm, and protective ptosis were also evident. Due to no obvious improvement, direct smear and culture was obtained again, which became positive for mycelia and Fusarium species, respectively []. The patient underwent two intrastromal injections of variconazole in 5 days. VA was only light perception afterwards. Two weeks after the last injection, tectonic penetrating keratoplasty was done and the patient was treated with fortified eye drop including amphotericin and natamycin and topical flucortison and chloramphenicol eye drops. Forty days later, the graft was rejected. VA appeared to be as equal to 1 m finger count. Examination revealed suture loosening, corneal edema, infiltration, and keratic precipitates (KPs). The patient was again treated by fortified natamycin, prednisolone (oral: 75 mg/day), and non-preservative steroid eye drop. The next day, suture removal and resuturing was done and topical prednisolone and ciprofloxacin eye drops were added to previously administered drugs. The patient was on treatment for 4 weeks. By the end of the month, edema and infiltration were subsided, VA was increased to 2 m finger count and the patient was discharged with cyclosporine (oral: 200 mg/day) and fortified eye drop (natamycin). During a 2 year follow-up, VA remained unchanged.
|
[[26.0, 'year']]
|
M
|
{'10420689': 1, '15746569': 1, '8534648': 1, '12386069': 1, '7650585': 1, '15184418': 1, '7927819': 1, '9505820': 1, '4929071': 1, '17592884': 1, '1096622': 1, '12208257': 1, '10448232': 1, '12785170': 1, '14748803': 1, '15355406': 1, '9143801': 1, '12515932': 1, '16575115': 1, '14557297': 1, '14998400': 1, '17699648': 1, '7395957': 1, '8536721': 1, '16488946': 1, '12024926': 1, '20699545': 1, '12355697': 1, '1985498': 1, '25388601': 1, '14686987': 1, '2615780': 1, '7917262': 1, '14760489': 1, '10832689': 1, '15829742': 1, '10474540': 1, '17657018': 1, '24082674': 2}
|
{'3779411-2': 2}
|
163,361 |
3779411-2
| 24,082,674 |
noncomm/PMC003xxxxxx/PMC3779411.xml
|
Keratomycosis after incidental spillage of vegetative material into the eye: Report of two cases
|
A 48-year-old female patient presented with redness and pain in the right eye. She had a history of incidental spillage of nut water into her right eye while eating nuts 11 days ago. She was also on medication as a diabetic case from several years ago. Over the last 11 days, she had been treated in another center with homatropin, NaCl, gentamycin eye drops, and ketoconazole (oral). Examination revealed decreased VA to be as equal as hand motion in the right and 6/10 in her left eye. A 4 + injection was noted within conjunctiva. A 4 × 5 mm central corneal ulcer with feathery margin and dry appearance was noted. Associated hypopyon was less than 0.5 mm [].\nDirect smear and culture from the ulcer was positive for mycelia and Aspergillus species, respectively.\nThe patient was treated with ketoconazole (200 mg/day, oral), doxycyclin (100 mg/12 h, oral), amphotricin, homatropin, and vitamin C eye drops. Follow-up session at one month showed resolved fungal keratitis and partial improvement in right VA (1/10). Due to the development of neurotrophic ulcer and persistent epithelial defect (PED) in the cornea, the patient underwent amniotic membrane transplantation (AMT) and was discharged. Follow-up at 1 year revealed no further improvement in VA.
|
[[48.0, 'year']]
|
F
|
{'10420689': 1, '15746569': 1, '8534648': 1, '12386069': 1, '7650585': 1, '15184418': 1, '7927819': 1, '9505820': 1, '4929071': 1, '17592884': 1, '1096622': 1, '12208257': 1, '10448232': 1, '12785170': 1, '14748803': 1, '15355406': 1, '9143801': 1, '12515932': 1, '16575115': 1, '14557297': 1, '14998400': 1, '17699648': 1, '7395957': 1, '8536721': 1, '16488946': 1, '12024926': 1, '20699545': 1, '12355697': 1, '1985498': 1, '25388601': 1, '14686987': 1, '2615780': 1, '7917262': 1, '14760489': 1, '10832689': 1, '15829742': 1, '10474540': 1, '17657018': 1, '24082674': 2}
|
{'3779411-1': 2}
|
163,362 |
3779413-1
| 24,082,676 |
noncomm/PMC003xxxxxx/PMC3779413.xml
|
Asymmetric presentations of familial exudative vitreoretinopathy
|
A 15-year-old boy presented with poor vision in his left eye since birth. His best corrected visual acuity (BCVA) was 20/63 in the right eye and finger counting close to face (FCCF) in the left eye. Left eye had enophthalmos with exotropia of 30°. Anterior segment was normal in both eyes. Right fundus showed mild temporal dragging of disc, straightening of temporal vessels, subretinal exudations and scarring at the periphery of temporal retina []. Left fundus showed dragging of the disc with a falciform retinal fold and an aberrant retinal vascular pattern []. Pigmentation and scarring of retina were seen. Fundus fluorescein angiography [FFA] showed abrupt cessation of vasculature at the temporal retina of right eye []. There was brush like anastomoses and shunts at the vascular-avascular border with mild leakage from the vessels. Left eye showed mild leakage from the disc and falciform retinal fold.\nThere was no history of prematurity. The parents and four siblings were normal.
|
[[15.0, 'year']]
|
M
|
{'21868098': 1, '10366074': 1, '14750620': 1, '21872202': 1, '24082676': 2}
|
{'3779413-2': 2}
|
163,363 |
3779413-2
| 24,082,676 |
noncomm/PMC003xxxxxx/PMC3779413.xml
|
Asymmetric presentations of familial exudative vitreoretinopathy
|
A 17-year-old girl presented with poor vision in her left eye since birth. Her BCVA was 20/80 in the right eye and FCCF in the left eye. Left eye had exotropia of 30°. There was nystagmus in both eyes. Anterior segment was normal in the right eye whereas the left eye had an early posterior subcapsular cataract. Right fundus was grossly normal except mild straightening of vessels in the periphery. Left fundus showed dragging of disc with a broad falciform retinal fold, macular detachment, peripheral retinal tears and subretinal exudations []. There was a clear vascular-avascular border in peripheral retina temporally [].\nFFA in right eye showed grossly normal retinal vasculature except for mild straightening of vessels in the periphery. Left retina showed abrupt cessation of vessels in the temporal retina [].\nOnly one of the 11 siblings and the child's mother were available for examination and were found to be normal.
|
[[17.0, 'year']]
|
F
|
{'21868098': 1, '10366074': 1, '14750620': 1, '21872202': 1, '24082676': 2}
|
{'3779413-1': 2}
|
163,364 |
3779416-1
| 24,082,679 |
noncomm/PMC003xxxxxx/PMC3779416.xml
|
Walker Warburg syndrome associated with microphthalmos and megalophthalmos: A rare combination
|
A 1-day-old term female baby of primigravida was admitted with chief complaints of dehydration, inability to feed, and abnormal eye features.\nOn examination, she was found to have small anterior fossa with overriding of sutures, depressed nasal bridge, low set ears, pedal edema, skin fold at the nape of neck, widely spaced nipples, vulval anus, bilateral cortical thumb, retrognathia, short neck, generalized hypotonia. Further evaluation revealed congenital dislocation of both hip joint, hydrocephalus and hyperbilirubinemia.\nOcular examination showed right eye-microphthalmia, left eye-megalophthalmos [], flat anterior chamber (corneo endothelial touch), and non-dilating non-reacting 1.00 mm pupil. B-scan right eye shows axial length of 12 mm, left eye shows axial length of 24 mm. Intraocular pressure left eye was 18 mm Hg (perkins applanation).\nUSG skull showed hydrocephalus. Magnetic resonance imaging was suggestive of Dandy-Walker variant with small posterior fossa cyst communicating with 4th ventricle associated with gross communicating hydrocephalus []. Serum creatinine kinase level: 147 units/L (Normal range 0-25 units/L). Above findings confirm the case as WWS.
|
[[1.0, 'day']]
|
F
|
{'12825057': 1, '16887026': 1, '26265907': 2, '31146719': 2, '4950916': 1, '27350950': 1, '10707144': 1, '8786062': 1, '2494887': 1, '24082679': 2}
|
{'4519600-1': 1, '6543662-1': 1}
|
163,365 |
3779618-1
| 24,058,729 |
noncomm/PMC003xxxxxx/PMC3779618.xml
|
Development of IgG4-related disease in a patient diagnosed with idiopathic membranous nephropathy
|
A 59-year-old male was hospitalized because of edema of the lower extremities. He had previously been well and had no significant medical history. His serum total protein level was 46 g/L (4.6 g/dL), serum albumin 17 g/L (1.7 g/dL), urinary protein excretion 4.3 g/day without occult blood and the 24-h creatinine clearance was normal at 1.51 mL/s (90.5 mL/min) (Table ). The anti-nuclear antibody was negative, and serum immunoglobulins G, A and M were all within normal limits at 11.98 g/L (1198 mg/dL), 11.37 g/L (1137 mg/dL) and 0.48 g/L (48 mg/dL), respectively. Complement levels were also within normal limits: C3 1.12 g/L (112 mg/dL), C4 0.314 g/L (31.4 mg/dL) and CH50 30 U/mL. Hepatitis-B surface antigen, hepatitis C antibody and cryoglobulin were all negative. Contrast-enhanced computed tomography (CT) demonstrated small, non-specific nodules in the right lung, and a hemangioma of the liver.\nPercutaneous kidney biopsy was performed, and the histology revealed diffuse membranous changes on the glomerular basement membrane without tubulointerstitial lesions (A and B). No mesangial hypercellularity, endocapillary proliferation or glomerular basement membrane duplication was observed. An immunofluorescence study showed diffuse, fine-granular staining of IgG, C3, fibrinogen, kappa- and lambda-chain in the glomerular capillary loops. There were no deposits in other areas including mesangeal matrix, subendothelial aspects and tubular basement membrane. An additional immunofluorescence study of IgG subclasses showed predominant positive staining for IgG4 and IgG1 and weak positive staining for IgG2 and IgG3 in the glomeruli (C). An electron microscopy examination revealed diffuse, homogenous, small electron-dense deposits in the subepithelial aspects of the glomerular basement membrane, which corresponded to Ehrenreich and Churg stage 2. Subendothelial deposits were not present, and endothelial cells did not contain any tubuloreticular structure. The mesangial matrix and tubular basement membrane did not contain electron-dense deposits.\nA systemic work-up revealed no other disease or malignancy, and the patient was diagnosed as having idiopathic MN. Prednisolone was administered at 40 mg daily, but the patient suffered repeated cerebral infarction attacks after starting the therapy. Prednisolone was tapered and discontinued 6 months after the start of the therapy, without any significant effect. The patient's proteinuria persisted at around 3 g/day and he was followed up while receiving diuretics and the angiotensin receptor blocker, olmesartan.\nTwo years after discontinuation of glucocorticoid therapy, the patient developed epigastric discomfort and was hospitalized again. Laboratory examinations revealed elevated serum levels of AST, ALT, ALP, total bilirubin and γ-GTP [64 IU/L, 106 IU/L, 1948 IU/L, 111 μmol/L (6.5 mg/dL) and 1544 IU/L, respectively] accompanied by a slight increase in serum creatinine at 100 μmol/L (1.13 mg/dL) and a normal serum amylase level of 111 IU/L. Abdominal CT revealed swelling of the pancreatic head, dilatation of the main pancreatic duct and stenosis of the common bile duct. Tumor markers including CEA and CA19-9 were all within the normal ranges, while hypergammaglobulinemia was observed and the serum IgG level was elevated at 39.21 g/dL (3921 mg/dL) with marked elevation of IgG4 at 19.2 g/L (1920 mg/dL). The patient was transferred to our hospital because of suspected type 1 autoimmune pancreatitis.\nA physical examination demonstrated jaundice and upper abdominal tenderness. Swelling of the bilateral lacrimal and parotid glands was observed. Hypergammaglobulinemia persisted, and serum IgA, IgM and complement studies showed that all were within normal limits. Serum anti-nuclear antibody was negative, whereas the rheumatoid factor was positive at 120.6 IU/mL. Urinary protein excretion was 2.1 g/day without occult blood and 24-h creatinine clearance was mildly deteriorated at 1 mL/s (60.0 mL/min) (Table ). Excretion of urinary β2-microglobulin (β2-MG) and N-acetyl-β-d-glucosaminidase was markedly elevated at 11 636 μg/day and 25.0 IU/day, respectively. Contrast-enhanced CT showed bronchial thickening in the bilateral lungs, pancreatic swelling with stenosis of the main pancreatic duct and bile duct, bilateral swollen kidneys with multiple lesions exhibiting low attenuation, periaortic and periarterial mass lesions, diffuse swelling of the prostate gland and systemic lymphadenopathy, compatible with the radiologic abnormalities characteristic of IgG4-RD ().\nPercutaneous kidney biopsy was not performed since we could not obtain the patient's agreement. Instead, percutaneous needle biopsies from the pancreas and prostate gland were performed to rule out malignancies and confirm the diagnosis. Specimens obtained by biopsy from the prostate gland and pancreas revealed dense lymphoplasmacytic infiltration with storiform fibrosis and infiltration of numerous IgG4-positive plasma cells (IgG4/ IgG-positive plasma cell ratio >50%) without malignancy ().\nBased on these findings, the patient was definitively diagnosed with IgG4-RD []. Western blot analysis of the patient's serum for the detection of serum autoantibodies against the M-type phospholipase A2 receptor (anti-PLA2R) was performed, as described previously [], and was negative. Oral administration of prednisolone was initiated at 40 mg daily, and the patient's clinical symptoms including jaundice and anorexia improved rapidly. The laboratory data and multiple organ lesions also improved, while proteinuria persisted at around 3 g/day.
|
[[59.0, 'year']]
|
M
|
{'22218969': 1, '22316447': 1, '22487688': 1, '21705127': 1, '25337295': 1, '29881283': 1, '19203510': 1, '20182413': 1, '20420800': 1, '15954921': 1, '21084054': 1, '19571279': 1, '20720530': 1, '21870078': 1, '21566055': 1, '32557252': 1, '21658826': 1, '21898030': 1, '29063068': 1, '23254897': 1, '22654915': 1, '31311519': 2, '21474589': 1, '25878779': 2, '25594543': 1, '24105363': 1, '22736240': 1, '24058729': 2}
|
{'4379336-1': 1, '6635993-1': 1}
|
163,366 |
3779775-1
| 24,066,219 |
noncomm/PMC003xxxxxx/PMC3779775.xml
|
Tuberculosis Affecting Multiple Vertebral Bodies
|
The patient was a 77-year-old woman. Other than oral medication for hypertension, her medical history was unremarkable. Lower back pain had begun 11 months prior. This gradually worsened, and fever also appeared. Nine months before she was referred to our department, she was admitted to a general hospital because of difficulty sitting. A fever ranging from 37.5℃ to under 39℃ was observed. Laboratory data showed no elevation of white blood cell (WBC, 3600/µL), but C-reactive protein (CRP) levels were elevated (3.33 mg/dL). Both miliary tuberculosis and multiple bone tuberculosis at levels Th7, 12, L3, 4, 5, the ribs, right ilium, and left ischium were evident. Tuberculosis drug therapy was initiated with four agents. Her fever subsided as the miliary tuberculosis improved, but the lower back pain persisted, and she was referred to our department due to experiencing difficulty in sitting and standing.\nThere was pronounced tenderness in the lumbar vertebrae despite the absence of neurological abnormalities. Radiographic imaging showed osteolytic changes to the vertebral bodies of the lumbar spine, and multiple osteolytic changes at levels Th12, L3, L4, and L5 were evident on computed tomography (CT), which were particularly pronounced in the L4 vertebral body (). Magnetic resonance imaging (MRI) also showed the same inflammatory granulation or abscesses in Th12, L3, L4, and L5 observed on CT (). On the pathological examination of a bone biopsy, Langhans giant cells, caseous necrosis, and acid-fast bacteria were seen, and a diagnosis of spinal tuberculosis was made.\nSurgery was performed because the patient had difficulty sitting due to lower back pain. The surgery involved posterolateral fusion with pedicle screws from L2 to S1 (). Compared to L3, 4, and 5, the vertebral osteolysis in Th12 was mild and not the cause of the lower back pain. Furthermore, as the osteolysis was mild, the probability of vertebral fracture occurring in the future was judged to be low, and, therefore, Th12 was not fused. The patient's postoperative course was uneventful, and her lower back pain improved. As of 18 months postoperatively, the patient was ambulatory.
|
[[77.0, 'year']]
|
F
|
{'12698134': 1, '18185888': 1, '19182762': 1, '19359113': 1, '16789468': 1, '11807585': 1, '19882018': 1, '16972219': 1, '17879905': 1, '24066219': 2}
|
{'3779775-2': 2}
|
163,367 |
3779775-2
| 24,066,219 |
noncomm/PMC003xxxxxx/PMC3779775.xml
|
Tuberculosis Affecting Multiple Vertebral Bodies
|
The patient was a 29-year-old Indonesian man. His pre vious medical history was unremarkable. He began to experience back pain 14 months earlier. This gradually worsened, and since fever also appeared, he was admitted to a general hospital 6 months before he was referred to our department. The patient had a persistent fever, ranging from 39℃ to under 41℃. Laboratory data showed no elevation of WBC (WBC, 8200/µL), but inflammatory findings were seen (CRP 12.2 mg/dL; erythrocyte sedimentation rate [ESR], 128/142 mm). He was diagnosed with multiple bone tuberculosis. Furthermore, the patient tested negative on the anti-HIV antibody test and did not have AIDS. Tuberculosis drug therapy was initiated with four agents. Since testing showed that the organism exhibited good sensitivity to the four types of tuberculostatic agents, and the abscesses improved markedly following the start of treatment, the patient did not have multi-drug resistant tuberculosis. The back pain and fever gradually improved, but from 5 months prior to the referral, reduced sensation in both legs and a sense of weakness appeared, and the patient became incapable of walking unaided. His symptoms subsequently progressed further, and he was examined in our department.\nLoss of muscular strength was pronounced, particularly in the right leg, and the patient exhibited difficulty standing. Hypesthesia below Th10 and urinary and defecatory disturbances were evident. The tendon reflex was enhanced in all four limbs, and the Babinski reflex and ankle clonus were both present bilaterally. Radiographic imaging showed widespread osteolytic lesions in the vertebral bodies of the thoracolumbar spine. The CT showed 17 affected vertebral bodies: C3, C4, C6, C7, Th1-8, Th10, L1-3, and L5. Multiple osteolytic changes were evident in C4, C6, Th1, Th3, Th4, Th7, Th8, Th10, L1, and L2, and they were particularly marked in C4, Th1, Th3, Th4, Th7, Th10, and L1 (). MRI also demonstrated the same destruction of multiple vertebral bodies evident on the CT, with compression of the spinal cord by inflammatory granulation and abscesses at Th1/2 and Th3/4 (). Pathological findings from bone biopsy examination showed Langhans giant cells, caseous necrosis, and acid-fast bacteria, and a diagnosis of spinal tuberculosis was made.\nSurgery was performed two months after he was referred to our department due to the paralysis of both legs. Inflammatory granulation and abscesses were seen primarily in the spinal canal and were not observed in the vertebral bodies. We therefore judged that the probability of vertebral osteolysis progressing in the future was low, and that anterior reconstruction was not necessary. We also judged that long fusion would enable the prevention of sequential collapse, and that the posterior single approach was indicated. Therefore, the surgery involved posterolateral fusion with pedicle screws from C6 to Th6 after laminectomy (). The patient's postoperative course was uneventful, and his paralysis improved. Four months after surgery, he was capable of independent gait, and the urinary and defecatory disturbance had also improved. Since the tuberculous spondylitis had resolved one year after use of tuberculostatic agents, treatment regarding the use of these agents was discontinued.
|
[[29.0, 'year']]
|
M
|
{'12698134': 1, '18185888': 1, '19182762': 1, '19359113': 1, '16789468': 1, '11807585': 1, '19882018': 1, '16972219': 1, '17879905': 1, '24066219': 2}
|
{'3779775-1': 2}
|
163,368 |
3779776-1
| 24,066,220 |
noncomm/PMC003xxxxxx/PMC3779776.xml
|
Giant Invasive Sacral Schwannoma Showing Chromosomal Numerical Aberrations [-14,+18,+22]
|
A 58-year-old woman had a 6-year history of progressive left buttock pain radiating to the limb. The pain was aggravated by walking, while relieved by lumbar flexion. She had no history of antecedent trauma or constitutional symptoms. She had objective weakness of the bilateral extensor hallucis longs, graded as 4/5 by manual muscle testing. Sensory deficit was observed in the left S1-3 area. Deep tendon reflexes were preserved and were normal bilaterally at the knees and ankles. The patient had no fasciculation, atrophy, or upper motor neuron signs. No cutaneous stigmata of neurofibromatosis were observed.\nIn the computed tomography (CT) scans, a large mass was found in the upper sacrum (). Angiogram showed evidence of hypervascularity (). Magnetic resonance imaging (MRI) revealed a tumorous cystic lesion (9.5×8.0×4.5 cm) occupying most of the left upper sacrum. The cystic wall showed a hypointense signal on the T1-weighted images and a moderately high signal on the T2-weighted images. Homogeneous rim enhancement of the cystic lesion was observed following administration of gadolinium contrast (). A tru-cut bone biopsy determined a histological diagnosis of schwannoma.\nBilateral laminectomy (L4-S3) was performed using a posterior midline approach to expose the spinal canal. The cystic tumor was found to be firmly adherent to the arachnoid and nerve roots. Histopathological examination showed an Antoni A schwannoma (hypercellular) in most areas. The tumor cells were richly cellular but with a low mitotic count (). Smaller areas showed the presence of an Antoni B schwannoma (hypocellular). No anaplasia or necrosis was detected. Immunohistochemical staining showed strong expression of the S-100 protein and glial fibrillary acidic protein (GFAP) (). There was no evidence of nerve infiltration or mitoses to suggest malignancy. The tumor was confirmed as a giant invasive spinal schwannoma (GISS) composed of spindle cells with elongated, hyperchromatic nuclei and abundant cytoplasm.\nCytogenetic analyses were performed on primary cultures obtained from the first surgical sample. Standard culture and harvesting procedures described previously were utilized []. Karyotype designation was established in accordance with the International System for Human Cytogenetic Nomenclature 2009 []. Twenty cells were analyzed of which 8 cells represented an abnormal clone characterized by a chromosomal numerical aberration, 47,XX,-14,+18,+22 (). Ten cells showed various abnormal patterns, which were derived from -14, +18, or +22, where the remaining 2 cells were found to be normal female cells (46,XX).\nAlthough the tumor was incompletely excised, the patient was generally in good condition without disease progression for 3.3 years after surgery.
|
[[58.0, 'year']]
|
F
|
{'7685622': 1, '1967977': 1, '15041228': 1, '26208496': 1, '7337161': 1, '22353794': 1, '18453671': 1, '11302622': 1, '24066220': 2}
|
{}
|
163,369 |
3779777-1
| 24,066,221 |
noncomm/PMC003xxxxxx/PMC3779777.xml
|
Delayed Diagnosis of Cauda Eqina Syndrome with Perineural Cyst after Combined Spinal-Epidural Anesthesia in Hemodialysis Patient
|
A 53-year-old female who had been on maintenance hemodialysis due to diabetes mellitus developed an infection in her left femoral prosthesis and needed removal surgery.\nIn consideration of her general status, general anesthesia was not undertaken. We performed removal surgery successfully under combined spinal-epidural anesthesia by puncturing L3/4, 3 mL of 0.5%-bupivacaine was administered into the subarachoid cavity and continuous injection of 2%-mepivacaine was performed at a rate of 3.3 mL per hour for 24 hours postoperatively. Pain relief was quite satisfactory during and after operation as this combination technique provides a rapid onset and spinal block reliability with high-quality analgesia by supplemented by the epidural catheter during and after surgery. Postoperative rehabilitation was started on the seventh postoperative day as no paresis of the four extremities was observed.\nFor the first time, on the 14th postoperative day, she complained that she was feeling hypoesthesia in the perianal area and loss of stool sensation. The client noted that she recognized the inability to sense stool but hesitated to inform us due to embarrassment. She seemed to manifest the symptom of fecal incontinence.\nWe immediately conducted neurological and radiological examinations to determine the source of her symptoms.\nThe plain MRI revealed at least two perineural cysts inside the spinal canal at the L5/S1 level, that were considered to be S2 root cysts (). The myelography showed a blockade of the contrast medium (). Afterward, the computed tomography was taken which showed a delayed filling of the right S2 root cysts and an inflated dural sheath of the S2 or S3 roots which could be expressed as cysts.\nWe supposed that her symptoms were caused by a volume effect or a prolonged analgesic effect entrapped in root cysts [,]. We conducted an S1 to S5 laminectomy in order to decompress whole root cysts and sampled spinal fluid captured in left-side S2 root cyst then irrigated it with extracellular fluid. The intraoperative finding gave the impression that the blockage of the spinal flow due to stenosis had been alleviated ().\nSensation loss and urinary incontinence caused by sphincter disturbance subsided gradually and on the fifth postoperative day, her symptoms had almost disappeared. However, the residual existence of analgesics was not detected in the sampled spinal fluid.
|
[[53.0, 'year']]
|
F
|
{'10917349': 1, '8419716': 1, '15197609': 1, '16508691': 1, '12053609': 1, '19143297': 1, '1337620': 1, '17688070': 1, '24066221': 2}
|
{}
|
163,370 |
3779778-1
| 24,066,222 |
noncomm/PMC003xxxxxx/PMC3779778.xml
|
Lumbar Spinal Stenosis Due to a Large Calcified Mass in the Ligamentum Flavum
|
A 68-year-old male had a 12-month history of right leg pain and intermittent claudication. He developed increasing right lateral thigh and calf pain with walking and squatting. The pain was severe and caused limitation in his daily life; he had difficulty in walking and standing for more than 10 minutes. Motor function of the right extensor hallucis longus revealed weakness, but sensory disturbance was not evident. He had no bowel or bladder dysfunction. Straight-leg-raising tests were negative in both limbs. The patellar and Achilles tendon reflexes were within the normal range and pathological reflexes were not identified. The patient had a history of bronchial asthma, and he had been prescribed nonsteroidal anti-inflammatory drugs and vasodilatory agents for lumbar spinal stenosis.\nAlthough the plain radiographs of flexion and extension in the lumbar spine showed no evidence of instability, a myelogram demonstrated spinal stenosis at the L4/5 level (). A computed tomography scan was performed for analysis of the affected area (), revealing a huge calcified mass on the ligamentum flavum at the right-hand side of the lumbar spinal canal. Magnetic resonance imaging (MRI) revealed compression of the cauda equina at the L4/5 level, the compression mass showed low intensity with T1- and T2-weighted MRI ().\nWe performed a laminotomy at the L4/5 level with resection of the calcified mass from the ligamentum flavum. The mass had compressed the nerve root on the right-hand side at the L5 nerve root of in the foramina of the spinal canal (). The calcified mass in ligamentum flavum is 13 mm long and 8 mm wide (). The macro-specimen, which was dried in air, revealed a white, hard mass () with a chalky appearance. Scanning electron microscopy (SEM) and electron probe microanalysis (EPMA) of the mass were performed with the Hitachi S-3500N Natural-SEM (Hitachi, Tokyo, Japan) and Horiba EMAX-7000 X-ray microanalyzer (Horiba, Kyoto, Japan) (). Based on EPMA, 2 chemical elements showed peaks-calcium (Ca) and phosphorus (P) (), with all 4 areas () showing the same 2 peaks. Subsequently, fourier-transformed infrared microspectroscopy (FTIR) was performed using JEOL WINSPEC-50 (JEOL, Tokyo, Japan) and IR-MAU (JEOL, Tokyo, Japan), to reveal the chemical structure of the calcified mass (). The FTIR peaks were determined as being approximately 1,033, 1,417, and 1,652 in this material. The peak of approximately 1033 showed mainly calcium triphosphate (Ca3[PO4]2) and calcium phosphate (CaHPO4), referring to our data for pure Ca3(PO4)2. The peaks of approximately 1,417 and 1,652 showed proteins, referring to our data for pure proteins. Collectively, the SEM, EPMA, and FTIR findings suggest that the calcified mass consisted mostly of Ca3(PO4)2 and CaHPO4 intermixed with protein and water (H2O). Histological examination of the elastic fibers and calcified mass was performed with hematoxylin and eosin, elastica Van Gieson, and Azan staining (). The calcified mass was located in the degenerated ligamentum flavum, with a well-delineated margin (). Degeneration of elastic fibers was accompanied by a proliferation of collagen fibers among the elastic fibers (). Loss of elastic fibers was defined as a focal loss of elastic fibers replaced by a cicatricial proliferation of collagen fibers ().
|
[[68.0, 'year']]
|
M
|
{'28389931': 1, '9259783': 1, '32256869': 1, '11324932': 1, '19604435': 1, '16284581': 1, '10483836': 1, '3791745': 1, '8658256': 1, '6886767': 1, '14527130': 1, '6270724': 1, '17709270': 1, '2832553': 1, '27917333': 2, '1994435': 1, '8472402': 1, '15284518': 1, '26587248': 1, '32375359': 1, '2738632': 1, '24066222': 2}
|
{'5099304-1': 1}
|
163,371 |
3779779-1
| 24,066,223 |
noncomm/PMC003xxxxxx/PMC3779779.xml
|
Gorham's Disease of Spine
|
A 15-year-old boy presented at with a history of progressive deformity of the back and dull continuous back ache for the past six months, exertional dyspnoea for one month, progressive weakness of both lower limbs for the past 15 days, and loss of bladder and bowel control for the past two days. He gave a history of trauma (fall from a height of 3 feet) 7 years previously, following which he noticed progressive deformity of the chest.\nOn examination he showed a kyphoscoliotic deformity in the upper thoracic region, where the third to seventh ribs were absent on the left side, with visible cardiac pulsations. Complete loss of motor power was apparent in both lower limbs with complete absence of sensations from below the umbilicus with exaggerated deep tendon reflexes, extensor plantar, and clonus bilaterally.\nRadiological featuresof the thoracic spine and chest are described in , . A chest X-ray taken four years previously at 11 years of age showed almost normal appearing ribs with normal thoracic vertebrae, indicating that the disease was not congenital and was progressive. All the biochemical investigations performed were within normal limits, ruling out any metabolic or endocrine pathology. All the imaging modalities were consistent with angiomatosis lesions affecting the bone.\nThe patient underwent Pedicle screw fixation, laminectomyand deformity correction. The resected bone samples were sent for histopathological examination (). Intraoperatively, the bones were found to have a thin cortex and appeared to be honeycomb-like. Increased vascularity of the bones was observed and the morphology of the posterior elements was altered. The hold of the screws in the diseased vertebra was reasonably good. Good cord pulsations were seen after decompression. A chest tube was inserted on the left side due to an incidental pleural tear. On the second postoperative day, the drain was removed and the patient was made to sit up-right. The patient was administered bisphosphonates and was referred to Physical Medicine and Rehabilitation ().\nThe patient recovered well postoperatively. At 4 weeks he was able to sit on his own, was able to walk with minimal support, and the neurology improved to American Spinal Injury Association (ASIA) grade D. The patient was reviewed at 1 year follow up. He was asymptomatic without any progression of the disease clinically or radiologically.
|
[[15.0, 'year']]
|
M
|
{'30024550': 2, '5795345': 1, '16012123': 1, '20972870': 1, '4721360': 1, '12483010': 1, '29398896': 1, '31770198': 2, '27398124': 1, '13263344': 1, '31143648': 1, '28216760': 2, '3968152': 1, '31234820': 2, '30961601': 2, '29941719': 1, '15673977': 1, '24066223': 2}
|
{'3779779-2': 2, '6086544-1': 1, '6890279-1': 1, '6591827-1': 1, '6454674-1': 1, '5296840-1': 1}
|
163,372 |
3779779-2
| 24,066,223 |
noncomm/PMC003xxxxxx/PMC3779779.xml
|
Gorham's Disease of Spine
|
A 23-year-old male patient presented to us in June 2011 with a deformity of the back, weakness of both lower limbs, and with a history of multiple surgeries on the back. At three years of age, spontaneous disappearance of the right clavicle and upper humerus was noticed without any preceding trauma. Biopsy was taken from the lesion and diagnosis of Gorham's disease was made based on the histopathological examination of the tissue. The disease was subsequently not progressive. In May 2010, he noticed progressive deformity of the upper back, spasticity, and an altered gait. He was diagnosed with myelopathy and kyphotic deformity of the spine. On August ninth 2010 he pedicle screw instrumentation with decompression of the cord. The patient experienced an uneventful post-op period. His spasticity reduced and his gait improved over a period of two months and he was then able to walk normally. On May 25th 2011, a routine follow up X-ray showed breaking of the implant for which a revision surgery was performed the same day. Post-surgically, the patient developed complete weakness of both lower limbs with loss of bladder and bowel control. He was taken for immediate decompression. As the patient's neurology did not improve, a revision decompression was performed on 3 days later. The patient noticed the return of some movement in his right lower limb a few days after surgery. His bladder control returned one month later. He was referred to us for rehabilitation (, ).\nOn examination, the patient showed dyspnoea, tachypnoea, and paradoxical breathing. Neurological examination revealed complete absence of motor power on the left lower limb and the power in the right lower limb was 1-2/5. Sensation was decreased from T5 below. Deep tendon reflexes were exaggerated with ankle clonus and extensor plantars. A loss of the rounded contour was observed on the right shoulder with painless exaggerated passive movements. A chest X-ray revealed pleural effusion on the left side. Chylous looking fluid was aspirated from the left side of the chest and on examination showed lymphocytes. The patient was booked for a thoracic duct ligation. He was also given the option of radiotherapy and pleural ablation. The patient refused any of these treatments. Since the patient's condition remained stable and the osteolysis was not progressing, he was kept under observation.\nAfter 8 months of rehabilitation, the motor power in the lower limbs gradually improved and he was able to stand and walk in parallel bars with the help of left Anklefoot Orthrosisand bilateral knee gaiters. The disease did not show any progression clinically.
|
[[23.0, 'year']]
|
M
|
{'30024550': 2, '5795345': 1, '16012123': 1, '20972870': 1, '4721360': 1, '12483010': 1, '29398896': 1, '31770198': 2, '27398124': 1, '13263344': 1, '31143648': 1, '28216760': 2, '3968152': 1, '31234820': 2, '30961601': 2, '29941719': 1, '15673977': 1, '24066223': 2}
|
{'3779779-1': 2, '6086544-1': 1, '6890279-1': 1, '6591827-1': 1, '6454674-1': 1, '5296840-1': 1}
|
163,373 |
3780826-1
| 24,524,057 |
noncomm/PMC003xxxxxx/PMC3780826.xml
|
A Case of Nutritional Osteomalacia in Young Adult Male
|
Patient: 30-year-old, male\nChief complaint: walking disturbance, hip-joint pains, cramps in both pelvic limbs\nCurrent medical history: The patient is vegetarian without any unusual medical history. He owns a private business; he usually transfers light objects within 10 kg. Since about 1-2 years ago, he had pain on his legs when walking and difficulties to run and walk up stairs. Also, he sometimes had cramps at hip-joint and hip muscles but he didn't experience much inconvenience in daily life. Three months before visiting a hospital, he did intensive work to carry things while moving so he had more serious pains at hip-joint part. Then the patient experienced difficulties in walking and abnormalities and oppressive pains around coccyx. He was disturbed while in sleep since he couldn't lie down due to the severe pains and cramps occurred as he spread his legs more. A half month before the hospital visit, he couldn't sleep due to serious cramps without specific reasons and then he came into neurology department out-patient clinic of the hospital in order to have additional examination and treatments.\nPast history: The patient had no special past history such as hypertension, diabetes, hepatitis, and tuberculosis etc.\nFamily history: No one in his family had special past history including hypertension, diabetes, hepatitis, and tuberculosis etc. All family members (parents and five brothers and sisters) except for the patient are normal dieters who eat meats and had normal height and body weight.\nSocial history: The patient is a non-drinker and non-smoker. He is single and works at home as he owns his private business. He was reluctant to go out since his walking had changed. He didn't go out for about a year and he went out at night if necessary.\nSystemic review and physical examination findings: In bio-vitality index from body examination, systolic blood pressure, diastolic blood pressure, pulse, breathing, and temperature were 118 mmHg, 58 mmHg, 84 times per minute, 20 times per minute, and 36.8℃, respectively. Height and body weight were 168.0 cm and 50.9 kg, respectively, the body weight had not been changed for several years. Deformation on upper pelvic limb or body was not observed. The patient claimed pains in both hip joints when walking or carrying heavy stuff. As he had pain like pulling behind of both legs when walking fast, he couldn't run and exhibited waddling gait. In neurologic examination, left and right were symmetric and strength index showed 4+, indicating slight muscle weakness.\nExamination findings: In peripheral blood examination, leukocyte, hemoglobin, and thrombocyte were 8,100/mm3, 13.8 g/dL, and 268,000/mm3, respectively. In serum biochemical examination, total protein (7.9 g/dL), albumin (4.3 g/dL), blood urea nitrogen (15.9 mg/dL), creatinine (0.7 mg/dL), sodium (138 mmol/L), potassium (4.1 mmol/L), chlorine (102 mmol/L), and carbon dioxide (24 mmol/L) exhibited normal. Phosphorus (2.4 mg/dL; reference value 2.7-4.5), calcium (6.0 mg/dL; reference value 8.2-10.2), and ionized calcium (3.3 mg/dL; reference value 4.4-5.2) were decreased and alkaline phosphatase (313 U/L; reference value 35-129) was increased. Serum parathyroid hormone (268 pg/mL; reference value 13-54), 25(OH)D measured by radioimmunoassay (Diasorin kit) (less than 4.0 ng/mL; reference value 4.8-52.8), 1,25(OH)D (7.51 pg/mL; reference value 19.60-54.30), osteocalcin (32.9 ng/mL; reference value 11.3-37.0), N-telopeptide (NTx; 100 nMBCE/mMCr; reference value 14-81), urine calcium (0.6 mg/dL), and urine phosphorus (29.1 mg/dL) indicated vitamin D deficiency and secondary hyperparathyroidism.\nRadiologic examination findings: In spinal X-ray scanning, diffuse osteopenia was observed overall. Pseudofracture was not exhibited in femur, pelvic bone, and costal bone. In bone mineral density examination utilizing dual energy X-ray absorptiometry, severe diffuse osteopenia was observed with Z values of lumbar spine (L1-L4) (-5.4) and femoral neck (-4.0) (). In whole body bone scan, multiple increased uptakes including costal bone were exhibited and it was in agreement with the finding of osteomalacia ().\nClinical progress: In order to evaluate and find the causes of vitamin D deficiency in the patient, listening of medical history and environment investigation were carried out in detail. The patient had been vegetarian since 8 years ago; he had meals three times a day with general meals but he was vegan, the strictest type of vegetarian, who didn't eat meats, fish, eggs, and milk etc at all. He had a bowl of rice per meal and vegetables and legumes as side dishes. The patient hardly went out for the last 6 months and stayed and worked at home using internet. Therefore, we performed bone mineral density examination, serum hormone examination, and electrolyte examination in the patient who came into the hospital due to the walking impairment and were under examination in neurology department. Based upon the examination, the authors diagnosed osteomalacia caused by vitamin D deficiency due to undernutrition and lack of exposure to sunlight. The patient started taking calcitriol, 0.5 µg per day, and calcium carbonate, 1,000 mg per day. After a week, serum ionized calcium (4.0 mg/dL) and serum phosphorus (2.9 mg/dL) were observed to be increased. Serum ionized calcium was back to normal, 4.5 mg/dL, 12 days after the injection. As the patient got better after a week, bone biopsy was not carried out. We recommended him to have sufficient nutrition including vitamin D and to go out in order to be exposed to sunlight daily. The patient was prescribed calcitriol, 0.5 µg per day, and calcium carbonate, 1,000 mg per day, when he was discharged from the hospital. In follow up from out-patient clinic 3 months later, strength index, 5, was back to normal and pains at hip joint and walking impairment were improved. Serum calcium (8.7 mg/dL), phosphoric acid (4.3 mg/dL), ionized calcium (4.5 mg/dL), and 25(OH) D (5.9 ng/mL) were improved as well. Alkaline phosphatase and serum parathyroid hormone exhibited 391 U/L and 295 pg/mL, respectively.
|
[[30.0, 'year']]
|
M
|
{'29623355': 1, '15585788': 1, '2839537': 1, '4124250': 1, '32326229': 1, '19216251': 1, '26104797': 1, '24524057': 2}
|
{}
|
163,374 |
3780829-1
| 24,524,058 |
noncomm/PMC003xxxxxx/PMC3780829.xml
|
A Case of CATCH22 Syndrome Diagnosed in Postmenopausal Woman
|
Patient: 57-year-old female\nChief complaint: Mental change and spasm\nCurrent medical history: Above 57-year-old female patient didn't have an unusual medical history in the past and visited a neurosurgical clinic in another hospital a month before visiting the hospital because she couldn't open both of her hands. With a consideration of Parkinson's disease, she was prescribed with levodopa and then the course was going to be observed in an outpatient clinic. However, the symptom became worse after she started taking levodopa and then she visited the outpatient clinic of the hospital again in a week. The course was going to be examined after stopping to take levodopa but the symptom seemed to get worse gradually even if she stopped taking levodopa. After 5 days, the patient visited an emergency room in the hospital and brain magnetic resonance (MR), brain computed tomography (CT), and C-spine MR were performed; since there was no special opinion with an exception of spinal stenosis, she was discharged from the hospital again. But, the symptom was still lasted; she had been found as tumbling and lying down on the floor a week before visiting the hospital. Since the patient still had the symptoms, she wanted to visit the other hospital. However, she had spasm and a mental change in a car while driving to the other hospital to visit. Then she visited an emergency room in our hospital; she showed low serum calcium, 5.3 mg/dL (reference: 8.2-10.2), in the blood test at that time so she was hospitalized in division of endocrinology and metabolism, department of internal medicine.\nMedical history in the past: The patient graduated an elementary school which was not well-educated. From the medical history in the past, no unusual medical history was found in the patient with an exception of taking antihypertensives due to the hypertension that was diagnosed 2 years ago.\nFamily history: There was no unusual disease or abnormality in the family history.\nPhysical examination: The patient was in lethargic at the time of visiting the hospital and showed hypocalcemic tetany in both hands with 144 cm of height and 42.6 kg of body weight. There was no noise detected when examining the heart with a stethoscope. Exophthalmos or goiter was not present but she had a high ached plate and a nasal voice. In the neurologic examination, the patient showed positive on Chvostek sign and Trousseau sign and had normal muscle strength.\nLaboratory test: The tests were performed at the time of visiting our hospital; serum calcium was 5.3 mg/dL (reference value: 8.2-10.2), phosphorus was 5.5 mg/dL (reference value: 2.7-4.5), magnesium was 1.8 mEq/L (reference value: 1.5-2.4), alkaline phosphatase was 89 U/L (reference value: 20-120). Serum parathyroid hormone and 25-OH-Vitamin D3 were 8 pg/mL (reference value: 11-62) and 2.1 ng/mL (reference value: 9.0-37.6), respectively. According to the bone mineral density test utilizing dual energy X-ray absorptiometry (iDXA; GE Healthcare, Madison, WI, USA), indicating that the patient seemed to have osteoporosis (). Since the patient was considered to have abdominal enlargement, abdominal computerized tomography was carried out and single kidney was observed in the patient (). In the thyroid ultrasonography, no unusual opinion was shown with an exception of thyroid nodule and thyroid hormone seemed to be normal. The patient had a problem with understanding what people said and showed decreased hearing in both ears from the audiometry as the patient appealed. According to Wechsler intelligence test, the intelligence score of the patient was 85 which were below the average and language development was particularly retarded. Since the patient had kidney anomaly, short height, hypocalcemia caused by hypoparathyroidism, decreased hearing, and the retardation of language development, CATCH22 syndrome was considered so that chromosome test was carried out; fluorescence in situ hybridization (FISH) was performed utilizing TUPLE1 probe in the DiGeorge/VCFS region. As a result of the analysis, we were able to confirm diagnosing that the patient had CATCH22 syndrome because the TUPLE1 probe signal that was normally present was not observed in one of the chromosome 22 (). After diagnosing CATCH22 syndrome, Lymphocyte T cell subset was carried out in order to evaluate immunity and the result showed that the patient had normal immunity.\nTreatment and course: The patient recovered her consciousness after taking vitamin D and calcium and the low calcium tetany improved. Currently, the patient takes oral vitamin D and calcium (calcitriol 0.5 µg, elemental calcium 800 mg) and the course is still examined. The patient responded well to the treatments and she is on follow-up by outpatient clinic in division of endocrinology and metabolism, department of internal medicine and genetics clinic.
|
[[57.0, 'year']]
|
F
|
{'9350810': 1, '12642839': 1, '10191425': 1, '12436034': 1, '17950858': 1, '8230155': 1, '24524058': 2}
|
{}
|
163,375 |
3780833-1
| 24,524,056 |
noncomm/PMC003xxxxxx/PMC3780833.xml
|
Osteoporotic Lumbar Compression Fracture in Patient with Ankylosing Spondylitis Treated with Kyphoplasty
|
A 73-year-old male patient had lower back and both buttock pain that was occurred after fall from standing position 2 weeks before, the symptoms progressed and became intolerable in spite of analgesia. In the past medical history, no special diseases such as diabetes, hypertension and cerebrovascular diseases were present and he was a non-smoker and a non-drinker. He had 171 cm of height, 70 kg of body weight, 23.9 kg/m2 of body mass index. Laboratory test showed the result of white blood cell (WBC) count of 4,440/mm3, erythrocyte sedimentation rate (ESR) 33 mm/hr, C-reactive protein (CRP) 0.04 mg/dL, uric acid 2.1 mg/dL, RA factor 12.29 U/mL, and HLA-B27 positive. BMD was measured utilizing peripheral-quantitative computed tomography (P-QCT; Somatom sensation 16, Simens, Erlangen, Germany). In result, severe osteoporosis was considered with BMD and T-score of lumbar vertebrae (L1-4) were 11.2 mg/cm3 and -6.17 (). At the time of visiting, simple spine radiography showed syndesmophytes of the spine, suggesting a bamboo spine coexist with ankylosis, but spine fracture was not clearly depicted in lumbar spine (). Three dimensional (3-D) CT and magnetic resonance imaging (MRI) of the lumbar spine reveled ankylosed of ligaments, intervertebral discs, endplate, and of apophyseal structures and 2 column compression fracture on L3 through the vertebral body ().\nKyphoplasty polymethylmetacrylate (PMMA) vertebral augmentation procedure was performed because of progressive vertebral collapsing during the follow-up. Patients were placed in the prone position under bi-plane fluoroscopic guidance and local anesthesia with bilateral transpedicular approach using simultaneous anteroposterior and lateral fluoroscopy. The balloon tamp was situated under collapsed end plate and slowly inflated until it abutted the cortical margins. PMMA was then injected into void of the vertebral body, 3 mL of PMMA was used (). Post-operative thoracolumbosacral orthosis (TLSO) applying, patients encourage to resume all his normal daily activities without any restrictions. The visual analogue scale (VAS) was 10 for the first time. The last VAS was 3 after post-operative 9 months, there were no complication. Last follow-up after post-operative 12 months, the patient is active and satisfied with the treatment including osteoporosis medication. This report was informed to a patient.
|
[[73.0, 'year']]
|
M
|
{'1810568': 1, '21996023': 1, '16850954': 1, '22569245': 1, '18791749': 1, '126380': 1, '20421858': 1, '19442629': 1, '17448825': 1, '19705703': 1, '24524056': 2}
|
{}
|
163,376 |
3780919-1
| 24,524,045 |
noncomm/PMC003xxxxxx/PMC3780919.xml
|
Bisphosphonate-induced Severe Hypocalcemia - A Case Report -
|
A 78-year-old female patient who had loss of appetite, lethargy, disorientation, and speech disturbance for several days came to our hospital in emergency room due to mental deterioration. About a month before the hospital visit, the patient had femur neck fracture caused by hitting on a table and then received hip arthroplasty under spinal anesthesia. At the time of the visit, blood pressure, body temperature, pulse rate, and respiratory rate were 120/70 mmHg, 36.5℃, 70 times/minute, and 20 times/minute, respectively, and the patient responded to pains but couldn't communicate. Brain magnetic resonance imaging (MRI) was carried out in order to check the occurrence of cerebrovascular event but acute lesion was not observed. Laboratory test showed the result of leukocyte count 6,530/µL, hemoglobin 11.3 g/dL, platelet count 197,000/µL, blood urea nitrogen 36.9 mg/dL (8-23), serum creatinine 3.67 mg/dL (0.6-1.2), fractional excretion of sodium (FENa) 5.9%, serum albumin 3.3 g/dL (3.2-4.5), sodium 143.4 mEq/L (136-142), potassium 3.3 mEq/L (3.8-5.0), corrected calcium concentration 3.96 mg/dL (9-11), phosphorus 2.5 mg/dL (2.3-4.7), parathyroid hormone (PTH) 486.6 pg/mL (12-88), ionized calcium 1.8 mg/dL (4-4.8), and magnesium 1.4 mg/dL (1.3-2.1). The corrected calcium concentration was calculated utilizing equation of 'total calcium concentration in serum (mg/dL) + (0.8 × (4.0 - serum albumin concentration [g/dL])'. On electrocardiography, corrected QT interval (519 msec) was prolonged, but Trousseau's phenomenon or Chvostek's sign was not exhibited. In the past medical history, no special diseases such as hypertension and diabetes were present and the patient was a non-smoker and a non-drinker. When the patient had femur neck fracture about a month ago, bone mineral density (BMD) was measured utilizing dual-energy X-ray absorptiometry (DXA; Hologic QDR-4500W; Hologic, Inc., Bedford, MA, USA). In result, osteoporosis was considered with T-scores of -3.9 and -3.4 in lumbar spine (L1-4) and hip, respectively (). Therefore, 5 mg of zoledronate (Aclasta®) was injected intravenously for 15 minutes on the day after the surgery and then calcium supplements were continuously being given until visiting the emergency room. In the blood test at the time of injecting zoledronate intravenously, serum creatinine concentration was 2.83 mg/dL and corrected calcium concentration was 8.4 mg/dL.\nThe patient was diagnosed intravenous zoledronate-induced hypocalcemia and then 20 mL of calcium gluconate (diluted in 100 mL of normal saline) and 1 µg/day of vitamin D (calcitriol, Bonky®) were started to inject intravenously. From the day after the intravenous injection of calcium, the patient showed gradual improvement in consciousness as well as lethargy and fatigue. However, in spite of continuous supplying of oral calcium carbonate, 3 g/day, and oral vitamin D, 0.5 µg/day, serum calcium concentration was not improved as much with 4.68 mg/dL of corrected calcium concentration in 2 weeks after the hospital visit. In the follow up examination performed in out-patient clinic after discharging from the hospital, serum creatinine concentration was 3.14 mg/dL and calcium concentration was 7.2 mg/dL (4 weeks after the symptom occurrence) and 9.3 mg/dL (4 months after the symptom occurrence) ().
|
[[78.0, 'year']]
|
F
|
{'16524863': 1, '19570737': 1, '2205749': 1, '9467547': 1, '19528309': 1, '21232648': 1, '17243862': 1, '15738536': 1, '9351080': 1, '33739919': 1, '12359855': 1, '12915606': 1, '7625419': 1, '17878149': 1, '14764499': 1, '29197953': 1, '31900542': 1, '2881152': 1, '28512123': 2, '8823335': 1, '16294264': 1, '33574753': 1, '20410614': 1, '21151620': 1, '18987295': 1, '24524045': 2}
|
{'5753734-1': 1}
|
163,377 |
3780922-1
| 24,524,043 |
noncomm/PMC003xxxxxx/PMC3780922.xml
|
Is It a Simple Stress Fracture or Bisphosphonate-related Atypical Fracture?
|
A 76-year old woman visited our out-patient clinic in May 2010 complaining of a left thigh pain while walking. Medical history taking revealed a diagnosis of a left femur neck fracture fixed with a DHS in July 2006, and in January 2010, she had undergone surgery due to a right distal radius and ulnar fracture and a right femoral intertrochanteric fracture. She had been treated with 70 mg alendronate per week since 2006. A physical examination revealed no limitation of range of motion of the left hip joint, and a radiologic evaluation, including a computed tomography scan, showed no suspicious lesion, such as, hypertrophied cortical bone or a fracture line on the left proximal femoral shaft area. However, a bone scan showed increased uptake in the proximal femoral area just below the fixed plate (). The average T-score of bone mineral density was -3.9 for lumber spine. She was managed conservative treatment using analgesics, and the anti-osteoporosis medication was continued.\nIn June 2011, she was transferred from a local hospital due to left thigh pain. The pain started after rising from a sitting position without any trauma history. Pelvic plain anteroposterior radiography revealed a displaced subtrochanteric fracture at the left femur. The fracture site was located at the contact margin at the end of the plate. The characteristics of fracture were cortical hypertrophy, medical spike, and a transverse fracture line, which are features commonly associated with atypical femoral subtrochanteric fracture. On the other hand, the fracture line is just distal to the DHS plate where the maximal stress is concentrated which is a definite feature commonly presented at stress related fatigue fracture. The fracture was fixed by replacing the 2 hole DHS plate with a with a 6 hole plate. Alendronate was stopped after reoperation, and six months after the reoperation the patient was asymptomatic and the fracture had united without any complication ().
|
[[76.0, 'year']]
|
F
|
{'20865463': 1, '17356148': 1, '29805339': 1, '21561306': 1, '15598694': 1, '19884427': 1, '21652250': 1, '18222447': 1, '18522980': 1, '24524043': 2}
|
{}
|
163,378 |
3780923-1
| 24,524,046 |
noncomm/PMC003xxxxxx/PMC3780923.xml
|
Parathyroid Hormone 1-34(Teriparatide) Treatment in Pelvic Insufficiency Fractures - A Report of Two Cases -
|
The patient was a 76 year old female and visited outpatient clinic due to the left hip pain that was occurred after a fall (slip down). Fractures in left pubic ramus were observed on simple radiograph at the admission and fractures in sacrum left side were found in bone single photon emission computed tomography (SPECT) and computed tomography (CT) scan (). In bone mineral density examination utilizing dual-energy X-ray absorptiometry (DXA; Prodigy Advance™, GE-Lunar Corp., Madison, WI, USA), osteoporosis was diagnosed with T-score -5.2 (L1-4) but the patient didn't have history of diagnosis and treatments in osteoporosis before the injury. Although teriparatide was only allowed for the treatment of osteoporosis in Korea, the patient was given 20 µg of teriparatide (1-34 PTH, Forsteo®) subcutaneously once a day in order to promote fracture healing as well as treat osteoporosis. Teriparatide was administered for 8 weeks. Bed rest and medication for pain relief was combined at the same time; tramadol 50 mg (Tridol®) was injected intravenously twice, morning and night, a day for seven days and transdermal fentanyl patch 12 µg/hr (Durogesic® DTrans®) was administered every 72 hours for 4 weeks. Pain visual analogue scale (VAS) was 7 at the time of admission and then decreased to 3 two weeks after the administration. The patient was able to move using a wheelchair a week after the injury and walked using a walker 10 days after the injury. Then, the patient was able to walk herself without pain six weeks after the injury. On simple radiograph a month after the injury, callus formation was observed in left pubic ramus and then it was even definitely denser on 3 months follow-up x-ray ().
|
[[76.0, 'year']]
|
F
|
{'15805200': 1, '21915572': 1, '19515622': 1, '8303455': 1, '33532082': 1, '29263722': 1, '32911581': 1, '17551882': 1, '20521061': 1, '16096714': 1, '17492442': 1, '15365697': 1, '11480610': 1, '27112766': 1, '24524046': 2}
|
{'3780923-2': 2}
|
163,379 |
3780923-2
| 24,524,046 |
noncomm/PMC003xxxxxx/PMC3780923.xml
|
Parathyroid Hormone 1-34(Teriparatide) Treatment in Pelvic Insufficiency Fractures - A Report of Two Cases -
|
Eighty two years old female visited outpatient clinic due to the pain on the right buttock that was occurred after a fall (slip down) on her behind. Simple radiograph at the time of her visiting indicated fractures in right pubic ramus and CT scan showed fractures in sacrum left side (). Osteoporosis with T-score -3.3 (L1-4) was observed, but the patient had never diagnosed and treated for osteoporosis before the injury.\nThe patient was injected with 20 µg of teriparatide (1-34 PTH, Forsteo®) subcutaneously once a day for 8 weeks and bed rest and medication for pain relief was combined at the same time; tramadol 50 mg (Tridol®) was injected intravenously twice, morning and night, a day for two weeks and transdermal fentanyl patch 12 µg/hr (Durogesic® DTrans®) was administered every 72 hours for three weeks. VAS was 7 at the time of admission and then decreased to 2 two weeks after the administration (three weeks after the injury). The patient was able to ambulate with a wheelchair three weeks after the injury and walked independently without a walker four weeks after the injury. On simple radiograph four weeks after the injury, callus formation was observed in right pubic ramus and then it was even definitely denser on 3 months follow-up x-ray ().
|
[[82.0, 'year']]
|
F
|
{'15805200': 1, '21915572': 1, '19515622': 1, '8303455': 1, '33532082': 1, '29263722': 1, '32911581': 1, '17551882': 1, '20521061': 1, '16096714': 1, '17492442': 1, '15365697': 1, '11480610': 1, '27112766': 1, '24524046': 2}
|
{'3780923-1': 2}
|
163,380 |
3780924-1
| 24,524,048 |
noncomm/PMC003xxxxxx/PMC3780924.xml
|
Insufficiency Fracture of Ipsilateral Femur Neck in Patient Treated with Long Term Bisphosphonate Treatment - A Case Report -
|
A 78-year old female patient had a history of lumbar compression fracture 6 years ago and was taking 91.37 mg of bisphosphonate-type sodium alendronate (alendronic acid 70 mg) every week without taking other medication. She had not been exposed to excessive bearing except the regular walking as a housewife. However, she visited our hospital due to gradually intensifying pain in the right inguinal area from three days before the admission. Before the manifestation of pain, she was not restricted in her daily activity and the pain only appeared during body weight loading. According to the physical findings, no specific findings were observed other than pain in the right inguinal area. The finding of stiffening was detected around partial fracture and the fractured area of the upper end of the femur in her radiograph (). T-score was -2.1 in the femoral region according to dual-energy X-ray absorptiometry (DXA). In addition, she exhibited the normal findings of a 9.0 (reference range: 8.4-10.5) mg/dL of serum calcium, a 4.0 (reference range: 2.5-4.5) mg/dL of phosphatate, a 39 (reference range: 10-57) pg/mL of parathyroid hormone, and 72 (reference range: 30-120) IU/L of alkaline phosphatase along with a decrease at a 7.01 (reference range: 11-40) ng/mL of osteocalcin. In addition, C-telopeptide bone resorption marker was measured at 0.33 (reference range: 0.01-1.00) ng/mL of a normal finding. Based on the past medical history and other clinical findings, the patient was diagnosed as insufficiency fracture in the femoral neck which was thought to be resulted from the long-term use of bisphosphonate. Thus, multiple pin fixation was implemented (). The patient was postoperatively prohibited to take bisphosphonate and prescribed from taking calcium-vitamin D (calcium 600 mg + Vitamin D 400 IU) complex every day. She was allowed for partial weight bearing using a walking frame until the second postoperative month and for the entire weight bearing after the second postoperative month. In the 4th postoperative month of follow-up period, the findings of bone reduction and pain loss were confirmed. Up to this time, physical examinations were regularly performed, including radiography and the presence of pain ().
|
[[78.0, 'year']]
|
F
|
{'25528039': 1, '29080052': 1, '12486478': 1, '17356148': 1, '11220790': 1, '19670917': 1, '32417741': 1, '18334027': 2, '15598694': 1, '19884427': 1, '32586069': 2, '7292024': 1, '18222447': 1, '27536613': 2, '24524048': 2}
|
{'4972626-1': 1, '7385268-1': 1, '2276224-1': 1}
|
163,381 |
3780926-1
| 24,524,047 |
noncomm/PMC003xxxxxx/PMC3780926.xml
|
A Case of Cushing Syndrome Diagnosed by Recurrent Pathologic Fractures in a Young Woman
|
Sacrum of the 28 year old female patient were fractured while moving an object seven months before visiting a hospital so she received conservative treatment. Two months before visiting the hospital, thoracic vertebra radiography was performed since she claimed lower back pain. Compression fractures were diagnosed on 12th thoracic vertebra and then she visited orthopedics in our hospital. A dual energy X-ray absorptiometry (DXA) of lumbar spine and femur revealed relatively low BMD for her age and she was referred to endocrinology department for further investigation. There was no medication history of taking calcium, vitamin D supplement, and oriental medicine etc. Menarche was began when she was 13 years old but menstruation was stopped one year before the hospital visit; but there was no unusual finding in obstetrics examination so she was still being monitored. There was no alcohol drinking and smoking history, family history of osteoporosis and fractures, and other unusual findings.\nAt the time of her visiting, she complained severe back to pain and had 154.4 cm of height, 45.2 kg of body weight, 19 kg/m2 of body mass index (BMI), 130/100 mmHg of blood pressure, 87 times/minute of pulse, 18 times/minute of breathing, and 36.9℃ of body temperature. Moon face was not clearly shown but mild edema on the face and truncal obesity. The upper and bottom limbs were relatively thin and skin became thin as well. Purple spots were exhibited.\nA blood test, leukocyte, hemoglobin, platelets were 7,630 mm3 (neutrophils 84.7%, lymphocyte 8.7%, eosinocyte 0.3%), 13.4 g/dL, 169,000/µL. Fasting glucose, albumin, aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, and creatinine were 112 mg/dL, 4.1 g/dL, 19 IU/L, 27 IU/L, 409 IU/L, and 0.8 mg/dL, respectively. Total calcium and phosphate were 9.1 mg/dL and 2.7 mg/dL, respectively, and albumin/globulin ratio was not reversed. In addition, serum intact parathyroid hormone, osteocalcin, C-telopeptide, and concentration of plasma 25-hydroxy vitamin D were 36.43 pg/mL (normal range: 13-54), 5 ng/mL (normal range: 4-20), 0.83 ng/mL (normal range: < 0.573), and 33.18 ng/mL, respectively. Thyroid function tests resulted in free T4 1.3 ng/dL, thyroid stimulating hormone (TSH) 0.43 mIU/L, and T3 57.2 ng/dL, indicating a normal range.\nA compression fracture were observed at 12th thoracic vertebra in spine x-ray () and Z-score of lumbar vertebrae (L1-4) and femoral neck were -2.9 and -2.1 on DXA, respectively, representing below the expected range for age ().\nWhile being hospitalized, the patient put on brace for conservative treatment with regards to the vertebral compression fracture. As the patient claimed chest pain during the treatment, plain radiography was performed. In the result, fractures were exhibited at right 7th and 10th ribs. Cushing's syndrome was considered due to repetitive pathologic fractures, low BMD regarding age, and the gross findings. Then, free cortisol in urine and 17-hydroxycorticosteroid were tested and then resulted 1,062 µg/day and 17.3 mg/day (normal range: 3-15), respectively, indicating cortisol excess. In order to confirm the diagnosis, a low-dose dexamethasone suppression test was carried out. As a result, we confirmed diagnosis of Cushing's syndrome because basal cortisol was 29.34 µg/dL and cortisol on 3rd day was 28.40 µg/dL indicating that it was not suppressed. Since adrenocorticotrophic hormone was relatively low (10.26 pg/mL), abdomen computed tomography (CT) was performed without a high-dose dexamethasone suppression test considering Cushing's syndrome caused by adrenal adenoma. A 2.7 × 2.4 sized adenoma was observed on left adrenal gland (), so that the patient received laparoscopic left adreanalectomy and was given 30 mg of hydrocortisone a day after the operation. However, after 2 months, the patient visited the hospital again due to severe pain on the lower back again and new compression fractures were taken place at 6th, 8th, 9th, and 11th thoracic vertebrae and 2th and 3rd lumbar vertebrae. Then, 750 mg of calcium citrate and 10 µg of cholecalciferol were given once a day and 20 µg of 1-34 parathyroid hormone (teriparatide) was injected once a day for 6 months total. In DXA performed 11 months after the treatment, BMD of lumbar vertebrae (L1-4) and femoral neck were increased by 4.5%, 1.9%, and 5.5%, respectively. Serum alkaline phosphatase, intact parathyroid hormone, osteocalcin, and concentration of blood 25-hydroxyl vitamin D were 304 IU/L, 28.57 pg/mL (normal range: 13-54), 16.1 ng/mL (normal range: 4-20), and 21.5 ng/mL, respectively. Currently, hydrocortisone was reduced to 10 mg a day; the patient is still being monitored without further fracture occurrences.
|
[[28.0, 'year']]
|
F
|
{'12138988': 1, '15050888': 1, '12577188': 1, '1563076': 1, '18003959': 1, '16010458': 1, '12733704': 1, '16678739': 1, '22885424': 1, '14671138': 1, '33394454': 1, '25489577': 2, '9666879': 1, '28377951': 1, '24524047': 2}
|
{'4255049-1': 1}
|
163,382 |
3780929-1
| 24,524,044 |
noncomm/PMC003xxxxxx/PMC3780929.xml
|
A Case with Multiple Punched-out Lesions in the Skull and Generalized Fractures Associated with Steroid-induced Osteoporosis
|
A 56-year-old Korean male was referred to our hematology department for the evaluation of multiple myeloma. He had an extensive history of repeated and multiple vertebral fractures. Three years ago, the patient experienced pain in his lower back and on his bilateral hip pain without any particular injury history and was treated with analgesics. Six months ago, the symptoms progressed and became intolerable in spite of analgesia. Magnetic resonance imaging (MRI) confirmed compression fractures at 9th and 12th thoracic vertebrae and a percutaneous vertebroplasty was performed to help relieve the pain. A month ago, radiographs showed new compression fractures at 8th and 9th thoracic vertebrae and the percutaneous vertebroplasty was performed again (). Unfortunately, ten days ago, back pain redeveloped and lower extremity weakness occurred. MRI showed spinal cord compression as well as mass effect at 8th and 9th thoracic vertebrae. Also, compression fractures at 10th thoracic vertebra were newly observed. According to the patient's medical history, he was diagnosed with hypertension 3 years ago and he has been taking medications occasionally. He tended to drink alcohol of 160 g per week for about 20 years and had a habit of smoking about 20 pack-year. Although, the patient had stable vital signs, his physical examination had shown that he had chronic ill-looking appearance and a Cushingoid appearance with moon face, easy bruising, thin skin and atrophy of upper leg muscles. Manual muscle testing of lower extremity showed weakness of grade 3-3+ out of 5.\nOur laboratory work-up including complete blood cell count, liver and renal function test, serum electrolytes and blood glucose did not show any abnormal results except the neutrophilia and elevation of erythrocyte sedimentation rate (ESR) (hemoglobin: 14.5 g/dL, thrombocyte: 192,000/mm3, white blood cell: 6,9701/mm3 [neutrophil; 80%], ESR: 32 mm/h [reference value: 0-15], blood urea nitrogen: 11 mg/dL, creatinine: 0.63 mg/dL, total protein: 6.5 g/dL, albumin: 3.8 g/dL, calcium: 8.9 mg/dL [reference value: 8.0-10.0], phosphate: 2.9 mg/dL [reference value: 2.6-4.5], intactparathyroid hormone: 27.23 pg/mL [reference value: 13.0-54.0]). Simple radiography revealed calcified granuloma on the right upper lung, multiple punched-out lesions in the skull, healed fracture of the left febula, multiple rib fractures, kyphosis of the thoracic vertebrae and lesions of bone cement injections at 8th, 9th, and 12th thoracic vertebrae (). Computed tomography (CT) and MRI of the spine showed multiple compression fractures and spondylitis with left paraspinal and anterior subligamentous abscesses (). In the evaluation of the multiple myeloma, serum and urine protein electrophoresis were normal and bone marrow biopsy revealed only granuloma consistent with mycobacterial infection. Tumor markers (alpha-fetoprotein [AFP], prostate-specific antigen [PSA], cancer antigen [CA]125, CA19-9, carcinoembryonic antigen [CEA]) were normal. On the CT of chest and abdomen, there were small nodules and branching linear structure, suggesting pulmonary tuberculosis, on the both sides of upper lung, calcified granuloma on the right apex, and multiple osteolytic lesions with vertebral collapse. In bone biopsy, necrotic bone fragment and hemorrhage was seen and tuberculosis (TB)-polymerase chain reaction (PCR) was positive.\nThe patient was referred to the endocrinology because there was no evidence of multiple vertebral compression fractures cause by multiple myeloma and malignancy and he had a Cushingoid appearance. We found that he had past medical history included psoriasis managed by intramuscular self-injection of triamcinolone since 5 years ago; 6 cc of triamcinolone injected 5 times in the first year and then 3 cc of triamcinolone was injected twice per month for the following 4 years. Values of 30 and 60 minutes post-250 µg-injection adrenocorticotropic hormone were 0.94 µg/dL and 4.42 µg/dL, respectively, indicating adrenal insufficiency. A dual-energy X-ray absorptiometry (DXA) revealed osteoporosis (L2-L4 T-scores = -4.7, femur neck T-score = -3.8) (). In bone turnover maker, bone-specific alkaline phosphatase (ALP) was raised (36.00 µg/L, reference value: 6.00-30.00) and osteocalcin was decreased (8.79 ng/mL reference value: 13.0-28.0). 25(OH) vitamin D3 measured by enzyme-linked immunosorbent assay (ELISA) was 5.4 ng/mL, indicating vitamin D deficiency.\nThe patient was received non-steroid anti-inflammatory analgesic drugs (NSAIDs) in order to relieve pain and 7.5 mg of prednisolone orally to manage adrenal insufficiency. For the treatment of osteoporosis, vitamin D3 (1,000 IU daily), elementary calcium (500 mg daily) and risedronate (35 mg weakly) were given. Also, he was treated with antituberculosis medication. Unfortunately, six days after his discharge from the hospital, and on his way back home from the first out-patient visit, he had fallen down on his right side and had the proximal humerus fracture. Then, he received conservative treatment (). Two months after the medical treatment, osteocalcin decreased (5.27 ng/mL) and serum C-terminal telopeptide (CTx) was lower than the normal value (0.375, reference value < 0.7 ng/mL) and 25(OH) vitamin D3 increased 14.3 ng/mL.
|
[[56.0, 'year']]
|
M
|
{'21732837': 1, '22377504': 1, '12819474': 1, '11529635': 1, '21570035': 1, '18349741': 1, '20662044': 1, '20977115': 1, '12378366': 1, '22298803': 1, '20542010': 1, '12004995': 1, '24524044': 2}
|
{}
|
163,383 |
3780930-1
| 24,265,957 |
noncomm/PMC003xxxxxx/PMC3780930.xml
|
Serratia marcescens Peritonitis in a Diabetic Patient Receiving Continuous Ambulatory Peritoneal Dialysis
|
A 45-year-old male on CAPD with end-stage renal disease (ESRD) secondary to diabetes mellitus presented with abdominal pain and a dialysate WBC count of 9,070/mm3 (97% neutrophils). The patient had a history of hypertension and insulin-dependent diabetes mellitus for over 20 years, and had been maintained on CAPD since 2001. He had experienced two episodes of CAPD-associated peritonitis caused by coagulase-negative staphylococci 10 years earlier. He had not taken immunosuppressive drugs or steroids. The patient's blood sugar had been well controlled, and his hemoglobin A1c was 6.7%.\nA 50 mL sample of peritoneal fluid was centrifuged at 3,000 g for 15 minutes, followed by resuspension of the sediment in 5 ml of sterile saline and inoculation on solid culture medium. Immediately after sampling, the patient was treated empirically with intraperitoneal cefazolin (15 mg/kg/day) and ceftazidime (1 g/day). His body weight was 52.0 kg, his creatinine level was 10.0 mg/dL, and his urine output was < 100 mL/day. After 5 days of aerobic incubation on blood agar, the pathogenic organism was identified as S. marcescens. In vitro susceptibility, tested by the disk diffusion method, demonstrated that the organism was resistant to cefoxitin, imipenem, and ampicillin/sulbactam, but susceptible to gentamicin, ciprofloxacin, levofloxacin, and ceftazidime. At the same time, blood cultures that were performed were positive for an organism identified as S. marcescens via bacterial recombinant DNA sequencing. At this point, the patient's clinical symptoms and cloudy dialysate had not shown significant improvement. His peritoneal WBC count was 8,750/mm3 (98% neutrophils), and he continued to complain persistent abdominal distension and pain. On the basis of culture and antibiotic susceptibility results, cefazolin was discontinued and intraperitoneal gentamicin (40 mg/day) was started. Oral ciprofloxacin was also begun at a dose of 500 mg daily, which has been known to be effective in S. marcescens peritonitis []. Despite appropriate antibiotic therapy, however, the patient still complained of abdominal pain, and the peritoneal dialysate remained cloudy and continued to demonstrate a high WBC count, consisting mainly of neutrophils. The CAPD catheter was removed 10 days after the initiation of intraperitoneal antibiotic treatment. After removal of the catheter, the patient's abdominal pain was relieved and his C-reactive protein level decreased from 13.80 mg/dL to 8.07 mg/dL. His total hospital stay was 20 days, and oral ciprofloxacin was continuously prescribed for 10 days following removal of the CAPD catheter.
|
[[45.0, 'year']]
|
M
|
{'9181286': 1, '11054367': 1, '12455568': 1, '8636679': 1, '20505659': 1, '3677574': 1, '33598247': 1, '2085597': 1, '2195268': 1, '2896684': 1, '16022095': 1, '3301892': 1, '9368530': 1, '26933500': 1, '16153259': 1, '24265957': 2}
|
{}
|
163,384 |
3780944-1
| 24,265,956 |
noncomm/PMC003xxxxxx/PMC3780944.xml
|
Endobronchial Mycobacterium avium Infection in an Immunocompetent Patient
|
A 59-year-old woman was referred to the pulmonary department for evaluation of an abnormal finding detected on chest radiography and chest computed tomography (CT) during routine long-term follow-up for cancer. The patient had been diagnosed with cervical cancer and received surgery and adjuvant chemotherapy 10 years earlier. She had also undergone endoscopic mucosal resection for early stage rectal cancer two years ago. Since then, she has shown no evidence of recurrence of these cancers. Initially, during the routine follow-up, the patient displayed no abnormalities either in subjective symptoms or on physical examination. However, chest radiography and chest CT revealed multiple pulmonary infiltrates in the left lingular division and left lower lobe (). The complete blood cell count (CBC) and blood chemistry revealed the following: white blood cell (WBC) count of 4.87 × 103/mm3, with 69.8% neutrophils and 17.9% lymphocytes; platelet count of 283 × 103/mm3; hemoglobin level of 10.9 g/dL; aspartate transaminase level of 25 U/L; alanine transaminase level of 16 U/L; and total bilirubin level of 0.6 mg/dL. Anti-HIV antibody was negative. The patient was treated with empirically with antibiotics (amoxicillin/clavulanate), but did not show any interval changes on chest radiography. We recommended regular check-ups to monitor for any changes in the pulmonary lesions or other symptoms. Six months later, we performed follow-up chest radiography and chest CT. Although the patient still had no respiratory symptoms, chest images showed that the multiple pulmonary infiltrates had worsened (). We performed a bronchoscopic evaluation to obtain a differential diagnosis. Bronchoscopic examination revealed a white- and yellow-colored irregular mucosal lesion in the bronchus of the left lingular division (). Bronchoscopic biopsy of the endobronchial lesion showed chronic granulomatous inflammation with caseous necrosis, a typical and consistent feature of mycobacterial histopathology (). Acid-fast bacilli (AFB) staining was positive in bronchial washing fluid. However, the result of a real-time polymerase chain reaction (PCR) assay to detect M. tuberculosis was negative despite the use of a specimen that stained positive for AFB. Cytology for bronchial washing fluid was normal. Considering the slowly progressing nature of NTM pulmonary disease, we decided to postpone treatment, pending the results of AFB cultures. After two months, cultures of sputum and bronchial washing fluid grew NTM, and M. avium was identified in both of the specimens. In the meantime, the patient developed respiratory symptoms, including cough, sputum, and slight hemoptysis. Thus, antimycobacterial therapy was initiated with 500 mg of clarithromycin, 450 mg of rifampicin, and 800 mg of ethambutol daily. After two months of treatment, the patient no longer had respiratory symptoms and the infiltration of the left lower lobe on chest radiography had decreased. At time of this study, the patient was continuing to receive antimycobacterial therapy, without significant adverse reactions.
|
[[59.0, 'year']]
|
F
|
{'20626955': 1, '20425861': 1, '30818784': 1, '17277290': 1, '14830798': 1, '22015322': 1, '9042656': 1, '12962459': 1, '33896863': 1, '26508935': 2, '16361797': 1, '10669679': 1, '32009092': 1, '10996239': 1, '25620110': 1, '15942302': 1, '28740687': 1, '14682404': 1, '11961434': 1, '24265956': 2}
|
{'4620341-1': 1}
|
163,385 |
3780949-1
| 24,265,971 |
noncomm/PMC003xxxxxx/PMC3780949.xml
|
A Case of Acute Cerebral Aspergillosis Complicating Influenza A/H1N1pdm 2009
|
In October 2009, a 24-year-old man was admitted to our hospital with decreased mental status. The patient had been diagnosed with type 1 diabetes mellitus 5 years before admission but was not followed-up. He was generally in good health until 5 days before admission, when cough and sore throat occured. He was tested for the influenza A/H1N1pdm 2009 by reverse transcription polymerase chain reaction (RT-PCR), and the result was positive 1 day before admission. Therefore, the patient was administered oseltamivir. The following day, his family reported him exhibiting mental confusion and unusual behavior including walking around naked and being unable to make eye contact during conversation.\nUpon examination, the patient's blood pressure was 151/97 mmHg, pulse was 122 beats per minute, temperature was 36.0℃, and respiratory rate was 28 breaths per minute. The patient exhibited labored breathing, and a coarse breathing sound with rales heard in both lung fields. A complete blood count showed a white cell count of 25,370/mm3 with 76.4% neutrophils. His C-reactive protein level was 43.8 mg/dL. Serum chemistry and arterial blood gas analysis showed high anion gap metabolic acidosis (pH, 6.864; pCO2, 19.9 mmHg; HCO3-, 3.5 mEq/L; and anion gap, 28), a glucose level of 532 mg/dL, and a serum creatinine level of 1.6 mg/dL. Chest radiography showed left lower lung field haziness (). Hemoglobin A1c was 16.2%.\nInitial fluid resuscitation and insulin therapy were started for diabetic ketoacidosis. The dose of oseltamivir was increased to 150 mg twice per day, and ampicillin, ceftriaxone and levofloxacin were administered as empirical antibiotics. The following day, the diabetic ketoacidosis improved, but his breathing was difficult and his mentality was drowsy. Respiratory oxygenation deteriorated, and mechanical ventilation was started. A nasopharyngeal swab tested positive for influenza A/H1N1pdm 2009 by RT-PCR on hospital day 2. Blood culture from day 1 and sputum culture from day 3 were positive for methicillin-sensitive Staphylococcus aureus(MSSA); therefore, the antibacterial agents were changed to nafcillin, ceftriaxone and levofloxacin still accompanied by oseltamivir. Corticosteroids were not administered. Over the next 4 days, the patient's renal function gradually worsened, resulting in pulmonary congestion and increased body weight. Therefore, continuous renal replacement therapy was started.\nThe patient's condition began improving with mechanical ventilation and continuous renal replacement therapy, but he did not regain consciousness. On hospital day 8, brain magnetic resonance imaging (MRI) showed diffuse leptomeningeal enhancement and multifocal infarction in the fronto-parietal cortical and subcortical white matter (). Therefore, lumbar puncture was performed. The opening pressure was 30 cmH2O, and cerebrospinal fluid (CSF) contained a white cell count of 207/mm3 (94% neutrophils), a protein concentration of 120.4 mg/dL, and a glucose concentration of 109 mg/dL (serum glucose: 110 mg/dL). Intravenous acyclovir and oral amantadine were added to his therapeutic regimen to treat possible combined viral encephalitis. The remaining antibacterial agents were changed to nafcillin and meropenem. The PCR results of the CSF were negative for cytomegalovirus, herpes simplex virus, varicella zoster virus, enterovirus, and influenza A/H1N1pdm 2009. The bacterial culture of the CSF was sterile. CSF analysis and MRI results were suggestive of meningitis and arterial infarction. Transthoracic echocardiography was normal. The antiviral agents oseltamivir, acyclovir, and amantadine and antibacterial agents nafcillin and meropenem were continued. On hospital day 10, the patient began regaining consciousness. He could answer questions by nodding but could not move his arms or legs. On hospital day 14, follow-up CSF analysis showed a white cell count of 310/mm3 (64% neutrophils and 2% lymphocytes) and a protein concentration of 316 mg/dL. The patient still had intermittent fever and chilling, but his general condition continued to improve. Mechanical ventilator and continuous renal replacement therapy were eventually ceased. His cognitive function improved but muscle strength in all 4 extremities showed limited improvement; on the basis of a 5-point muscle power scale, the right and left sides were assigned scores of 1 and 3 points, respectively.\nOn hospital day 27, the patient exhibited sleeping tendencies, and his motor power decreased further. MRI of the brain was repeated to evaluate the previous cerebral lesions. The results showed newly developed multiple rim-enhancing mass lesions in the cortical and subcortical white matter of fronto-pariental lobe, right cerebellum, and left upper medulla (). The level of diffusion restriction in the MRI was variable, suggestive of fungal origin. On hospital day 29, surgical drainage of the frontal cerebral abscess was performed. Gomori methenamine-silver stain and periodic acid-Schiff stain of the surgical specimen revealed a few degenerating fungal hyphae (). Culture of the aspirated abscess indicated the presence of A. fumigatus. Serum galactomannan assay result was negative. A single culture of transtracheal aspiration performed one month after admission was positive for A. fumigatus. Chest computed tomography scan showed multifocal bronchiectasis in the right middle lobe and lingular segment of the left upper lobe. Bronchoscopy was not performed.\nAfter an initial 2 days of amphotericin B deoxycholate, intravenous voriconazole 240 mg twice per day was started. After 4 weeks of therapy, voriconazole was changed to liposomal amphotericin B with 3 mg/kg/day owing to elevated liver enzymes. After 3 weeks, the antifungal agent was switched to oral voriconazole 200 mg twice per day, which was continued for 11 weeks. Voriconazole was subsequently discontinued because of recurrent Clostridium difficile-associated diarrhea, and the patient was followed-up without antifungal therapy. The patient's medical condition was stabilized with clear mental awareness and wheel chair ambulation. However, right hemiparesis persisted. He was followed-up for 2 years and showed no evidence of recurred aspergillosis by both clinical assessment and brain imaging during this period ().
|
[[24.0, 'year']]
|
M
|
{'10941354': 1, '21865184': 1, '21881144': 1, '10070575': 1, '29858759': 2, '25981228': 1, '32828989': 1, '21978476': 1, '20304252': 1, '10188766': 1, '9084011': 1, '16162796': 1, '21605188': 1, '20463249': 1, '27704024': 1, '6783787': 1, '29454654': 1, '15229094': 1, '6631519': 1, '15987390': 1, '21985304': 1, '20507748': 1, '2431043': 1, '6708169': 1, '21651732': 1, '22004266': 1, '24265971': 2}
|
{'6096900-1': 1}
|
163,386 |
3780951-1
| 24,265,973 |
noncomm/PMC003xxxxxx/PMC3780951.xml
|
Cervical Lymphadenitis Caused by Group D Non-typhoidal Salmonella Associated with Concomitant Lymphoma
|
A 66-year-old woman was admitted to Samsung Medical Center on August 13, 2012, with a 10-day history of a palpable mass in the right supraclavicular area. The lesion had grown in size to 5 cm over 10 days and was complicated with pain, redness, and purulent discharge. Chest computed tomography (CT), which was performed in a other hospital on August 11, had shown a mass extending from the right cervical area to the anterior mediastinum. The patient was transferred to our hospital for further evaluation.\nThe patient had been treated for hypertension for 10 years. Two years prior to admission, she had undergone partial thyroidectomy for treating papillary thyroid carcinoma. Thyroid cancer had been localized to the right lobe of the thyroid with a size of 0.4 cm. The pathologic findings had shown no evidence of lymph node metastasis of thyroid cancer. The patient was examined periodically by a surgeon. There was no abnormal finding on a thyroid ultrasonography performed in January 2012.\nThe patient had complained of febrile sensation for 3 days. She had experienced weight loss of approximately 7 kg over the 6 previous months. On physical examination, her body weight was 54.6 kg and height was 153.4 cm. Her vital signs were as follows: blood pressure of 110/73 mmHg, body temperature of 36.6℃, heart rate of 71 beats per minute, and respiration rate of 18 breaths per minute. The size of the palpable mass was approximately 5 cm; it was located in the right supraclavicular area and complicated with redness, tenderness, and discharge.\nHer complete blood count revealed the following: white blood cells (WBC), 4,330/mm3 (neutrophils, 68.7%); hemoglobin, 12.1 g/dL; and platelets, 183,000/mm3. Chemistry profiles showed the following: aspartate transaminase (AST), 61 IU/L; alanine aminotransferase (ALT), 40 IU/L; C-reactive protein (CRP), 13.86 mg/dL; procalcitonin, 1.56 ng/mL; and lactate dehydrogenase, 661 IU/L. Thyroid function tests showed the following: triiodothyronine (T3), 42.26 ng/dL; thyroxine (T4), 8.6 ug/dL; thyroid-stimulating hormone (TSH), 0.01 uIU/mL; and free thyroxine, 1.53 ng/dL. The test result for anti-hepatitis B surface (HBs) antibody was positive. Anti-human immunodeficiency virus (HIV) antibody test were also negative. Amoxicillin/clavulanate was given empirically at a dose of 1.0 g/0.2 g, 3 times per day intravenously.\nThe chest CT showed a mass that was 66 mm in size, extending from the right supraclavicular area through the anterior mediastinum with extensive necrotic lymphadenopathy (). As the chest CT findings suggested probability of thymic carcinoma and right supraclavicular nodal metastasis, 18F-fluorodeoxyglucose positron emission tomography-computed tomography (PET-CT) was performed to assess potential cancer. PET-CT showed a visible mass in the anterior mediastinum that was seen as high 18F-2-fluoro-2-deoxy-glucose (FDG) uptake, the maximum standardized uptake value (SUVmax) of the lesion being 7.3. Further, there was high FDG uptake in the right prevascular lymph node, left mediastinal lymph node, both supraclavicular lymph nodes, and right infraclavicular lymph node; soft tissue swelling was also observed in the right supraclavicular area. These findings suggested a probability of cancer associated with infection ().\nTo confirm a diagnosis of infection and cancer, ultrasonography-guided biopsy and culture were performed. Multiple enlarged lymph nodes were observed in both supraclavicular areas. Their size was measured to range from 1.5 cm to 4 cm, and they were found to contain a variety of materials including fluid and debris (). Cultures for bacteria, mycobacteria, and fungi were performed. On hospital day 4, Gram stain results of the lymph node revealed that there were a few gram-negative bacilli. Pathologically, both of the cervical lymph nodes and the mass in the mediastinum showed infarction and granulation tissue with focal viable lymphoid cells and no bacteria observable by light microscopy (). On hospital day 7, tissue samples from the cervical lymph nodes and the mass in the anterior mediastinum were finally confirmed as diffuse large B-cell lymphoma by immunohistochemical staining.\nOn the same day, group D non-typhoidal Salmonella was isolated from cultures obtained from the lymph nodes. Growth of cultured organisms that were oxidase negative was observed on MacConkey agar, necessitating the use of an automated microbial analyzing system (Microscan system, gram negative combo panel type 53, Siemens Healthcare, Sacramento, CA, USA) to identify Salmonella to the genus level. The pathogen was confirmed to be group D non-typhoidal Salmonella using polyvalent antisera (Joongkyeom, Kyungki, Korea). Group D non-typhoidal Salmonella isolated from culture was sensitive to most antibiotics except for ampicillin/sulbactam, ticarcillin, and colistin. The results of the drug sensitivity test revealed that the minimal inhibitory concentration (MIC) for the various drugs were as follows: ampicillin/sulbactam, > 16/8 mg/L; amikacin, ≤ 8 mg/L; aztreonam, ≤ 1 mg/L; ceftazidime, ≤ 1 mg/L; colistin, > 4 mg/L; ciprofloxacin, ≤ 0.5 mg/L; cefepime, ≤ 1 mg/L; fosfomycin, ≤ 16 mg/L; gentamicin, ≤ 1 mg/L; imipenem, ≤ 1 mg/L; levofloxacin, ≤ 1 mg/L; meropenem, ≤ 1 mg/L; minocycline, ≤ 4 mg/L; piperacillin/tazobactam, ≤ 8 mg/L; trimethoprim/sulfamethoxazole, ≤ 2/38 mg/L; tigecycline, ≤ 0.5 mg/L; ticarcillin, > 64 mg/L; and tobramycin, ≤ 2 mg/L.\nOn the basis of antimicrobial susceptibility results, the antibiotic treatment was changed to ciprofloxacin. Oral ciprofloxacin (500 mg twice daily) was administered to the patient for 14 days. The mass in the right supraclavicular area improved after the administration of ciprofloxacin and the initiation of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemotherapy. The PET-CT after 2 months of treatment showed small mild hypermetabolic tumors in the right anterior mediastinum (SUVmax = 2.1) and right supraclavicular lymph node, (SUVmax = 2.4), a marked improvement compared to that in the previous scans. The patient has been receiving chemotherapy without serious complication.
|
[[66.0, 'year']]
|
F
|
{'4206946': 1, '2404407': 1, '11453601': 1, '28261270': 2, '6379334': 1, '13768469': 1, '9170014': 1, '11926059': 1, '1888450': 1, '11170916': 1, '13812052': 1, '17222172': 1, '3306260': 1, '20213287': 1, '7578746': 1, '7888569': 1, '12070955': 1, '24265973': 2}
|
{'5316438-1': 1}
|
163,387 |
3780960-1
| 24,265,972 |
noncomm/PMC003xxxxxx/PMC3780960.xml
|
Detection of an Infected N-butyl-2-cyanoacrylate Plug by F-18 FDG PET/CT Scan in a Patient Who Received Endoscopic Intervention for Gastric Variceal Bleeding
|
A 63 year-old male with a history of hepatitis B associated liver cirrhosis (Child-Pugh Class A) was admitted to the emergency room with upper gastrointestinal bleeding. The hemoglobin level was 11.8 g/dL. Emergency upper endoscopy showed active bleeding from the cardiac varix (Gastro-esophageal varices-2 according to the Sarin classification). Hemostasis was achieved by injection of 2 mL of N-butyl-2-cyanoacrylate and he was discharged without complications.\nThe patient was readmitted one month later because of fever and myalgia, which started 10 days after discharge. The patient's vital signs at admission were as follows: temperature of 38.2℃, blood pressure of 126/70 mmHg, pulse rate of 124 beats/min, and a respiratory rate of 20 breaths/min. Physical examination showed no abnormalities. Results of laboratory tests were as follows: white blood cell 6,500/mm3 (neutrophil 84.9%), hemoglobin 10.4 g/dL, and platelet count 70,000/mm3. Erythrocyte sedimentation rate and C-reactive protein were elevated at 31 mm/hr and 3.89 mg/dL. Albumin was slightly decreased to 2.9 g/dL, aspartate aminotransferase (AST) was slightly increased to 42 IU/L, and other blood chemistry results were within the normal range: alanine aminotransferase (ALT) 28 IU/L, blood urea nitrogen (BUN) 8.4 mg/dL, and creatinine 0.80 mg/dL. Prothrombin time (PT) and activated partial thromboplastin time (aPTT) were prolonged at INR 1.38 and 45 seconds. Because the patient had a history of of N-butyl-2-cyanoacrylate injection for gastic variceal bleeding control, infection through the N-butyl-2-cyanoacrylate plug was suspected and piperacillin/tazobactam and amikacin were started empirically. Abdominal CT () and follow up gastroscopy () showed an N-butyl-2-cyanoacrylate plug. Leukocyte scintigraphy showed only hypersplenism. Both TTE and TEE were performed in order to exclude infective endocarditis; both findings were negative. F-18 FDG (FDG) PET/CT performed on a Siemens/Biography Duo PET/CT scanner 60 minutes after intravenous injection of 12 mCi (444 MBq) of FDG showed focal FDG uptake (maximum SUV = 3.41) around the N-butyl-2-cyanoacrylate plug in the stomach cardia on fusion transverse images of FDG PET/CT (). Viridans streptococcus was isolated from three separate blood cultures on the same day. It was suspected that the infected N-butyl-2-cyanoacrylate plug in the gastric varices was the source of bacteremia and antibiotics were changed to penicillin G and gentamicin. Follow up blood culture after one week of intravenous antibiotic treatment was negative for Viridans streptococcus. Follow up FDG PET/CT performed after two weeks of treatment with intravenous antibiotics showed a marked decrease in FDG uptake around the N-butyl-2-cyanoacrylate plug (). Treatment consisted of only intravenous antibiotics, without surgery or endoscopic intervention. The patient was discharged without fever or any sign of infection after four weeks of intravenous antibiotics. The patient visited the outpatient department five days after discharge without any sign of relapse.
|
[[63.0, 'year']]
|
M
|
{'3872240': 1, '17614066': 1, '11170907': 1, '9832658': 1, '6618116': 1, '9260698': 1, '19038599': 1, '11567949': 1, '15173814': 1, '6870408': 1, '10952494': 1, '26581748': 2, '1955129': 1, '24265972': 2}
|
{'4652425-1': 1}
|
163,388 |
3781233-1
| 24,069,523 |
noncomm/PMC003xxxxxx/PMC3781233.xml
|
Primary Burkitt's Lymphoma in the Nasal Cavity and Paranasal Sinuses
|
A 25-year-old man presented with a 2-month history of nasal obstruction and right facial pain. The patient also had rhinorrhea, anosmia and headache. The patient had no specific past history. A physical examination revealed a pinkish, irregularly shaped mass in both nasal cavities (). A computed tomography (CT) showed an enhanced mass filling both ethmoid sinuses, the right nasal cavity and nasopharynx, with secondary destruction of the ethmoidal roof, both medial orbital walls and the anterior wall of the sphenoid sinuses. An endoscopic biopsy was taken. Pathologic evaluation showed "starry-sky" pattern of tightly packed, medium sized uniform lymphoid cells interspersed with large pale histiocytes. In immunohistochemical staining, cells were positive for CD10, CD20, and Bcl-6, and negative for CD3, CD5, and Bcl-2. Ninety percent of the cells were positive for Ki-67 antigen. The serum was negative for Epstein-Barr virus (EBV) and human immunodeficiency virus (HIV). Chest and abdominopelvic CT and bone scan showed no evidence of metastasis. Positron-emission tomography (PET) showed lymphoid invasion of the sphenoid, mandible, both humeri and the right proximal femur. Examination of cerebrospinal fluid (CSF) and bone marrow (BM) showed normal pathological and chromosomal findings. He was initiated on chemotherapy, consisting of cyclophosphamide, vincristine, methotrexate, ifosfamide, etoposide, and cytarabine. After three cycles, he was in complete remission on follow-up CT and PET. Five months after the end of chemotherapy, there was no evidence of recurrence on PET.
|
[[25.0, 'year']]
|
M
|
{'29892537': 1, '11077358': 1, '17084232': 1, '16614233': 1, '27213067': 2, '17141106': 1, '19615595': 1, '24069523': 2}
|
{'3781233-2': 2, '4860250-1': 1}
|
163,389 |
3781233-2
| 24,069,523 |
noncomm/PMC003xxxxxx/PMC3781233.xml
|
Primary Burkitt's Lymphoma in the Nasal Cavity and Paranasal Sinuses
|
A 44-year-old man presented with a 2-month history of right nasal obstruction. The patient had underwent functional endoscopic sinus surgery, after failure of 2 month medical therapy at other institution. Since frozen sections during the sinus surgery revealed malignant cells, he was referred to our hospital. The patient had no specific past history. A physical examination revealed postoperative synechia in the right nasal cavity. Magnetic resonance imaging (MRI) showed a large mass infiltrating the posterior aspect of the right maxillary sinus with extension into the posterior portion of the bilateral nasal cavity, nasopharynx, and right parapharyngeal, masticator and buccal spaces (). Biopsy slides from the first hospital revealed a typical "starry-sky" pattern. In immunohistochemical staining, cells were positive for CD10 and CD20 and negative for CD3. All cells were positive for Ki-67 antigen. Chest X-rays, abdominopelvic CT and bone scan showed no evidence of metastasis. A PET, CSF, and BM examination revealed no specific findings. The patient was seronegative for HIV. He was initiated on chemotherapy, consisting of cyclophosphamide, vincristine, doxorubicin, methotrexate, ifosfamide, etoposide, and cytarabine. He received a total of four cycles of chemotherapy. Nine months after chemotherapy, follow-up MRI showed no evidence of remnant tumor (). After 5 years, there was no recurrence on MRI and chest X-ray.
|
[[44.0, 'year']]
|
M
|
{'29892537': 1, '11077358': 1, '17084232': 1, '16614233': 1, '27213067': 2, '17141106': 1, '19615595': 1, '24069523': 2}
|
{'3781233-1': 2, '4860250-1': 1}
|
163,390 |
3781234-1
| 24,069,524 |
noncomm/PMC003xxxxxx/PMC3781234.xml
|
A Thyroglossal Duct Cyst Causing Obstructive Sleep Apnea in Adult
|
A 51-year-old man visited the Sleep Center with a 2-year history of snoring and voice change. He had complaints about loud snoring and had been witnessed to have obstructive sleep apnea with excessive daytime somnolence. His Epworth sleepiness scale (ESS) score was 13. He denied any history of dyspnea. His medical history included mild hypertension and diabetes. His height was 160 cm, his weight was 62 kg and his body mass index was 24.2 kg/m2.\nOn physical examination, his Friedman tongue position [] was grade III (only the soft palate is visible) and the tonsils were hidden in the tonsillar fossa. On flexible laryngoscopy, about a 20×20 mm sized round cystic mass at the base of tongue was identified. The cyst bended the epiglottis posteriorly, which made the airway narrow. The vocal cords could not be observed because of the lesion ().\nHe underwent a full-night laboratory nocturnal polysomnography (PSG). PSG revealed that the respiratory disturbance index (RDI) was 32.2 events per hour of sleep with the supine RDI of 105.8 events/h. The longest apnea duration was 39.7 seconds. The lowest SaO2 was 89%, and the average SaO2 saturation was 97.2%.\nThe computed tomograms showed a 33×31×27 mm sized well-defined cystic lesion located at the midline of the tongue base, compressing the oropharyngeal airway (). The epiglottis was displaced posteriorly by the cystic lesion.\nTo evaluate the upper airway obstruction and to find any other obstructive lesion, sleep videofluoroscopy (SVF) was performed with administration of 0.05 mg/kg of midazolam as described previously []. SVF showed that the pharyngeal airway was completely obstructed during both inspiratory and expiratory phase when the mass pulled the epiglottis down and backward. The tip of epiglottis was in contact with the posterior pharyngeal wall irrespective of respiratory cycle ().\nSistrunk operation was performed via external approach instead of oral approach, because the mass was somewhat large. Round cystic mass was removed uneventfully. Soon after the operation, the signs and symptoms of OSA such as snoring and daytime sleepiness ceased and his voice was normalized. His ESS score reached 4.\nPostoperative flexible laryngoscopy showed that the mass was disappeared completely (). Postoperative PSG (3 months after operation) showed that all the parameters were nearly normalized or improved. The RDI decreased to 4.0 events per hour and the supine RDI decreased to 13.4 events per hour. The longest apnea duration was 26.5 sec. The lowest SaO2 was 92%, and the average SaO2 saturation was 97.8%.\nPostoperative SVF showed that the displaced epiglottis returned to normal position and the pharyngeal airway was not collapsed, however, during inspiration the hypopharyngeal airway was partially obstructed at the level of the epiglottis, which could explain the remnant RDI of 4.0 ().\nThe histopathology showed that the cyst was lined by stratified squamous epithelium, and that the deeper tissue showed fibrosis, skeletal muscle fragments and laryngeal gland cysts, which was consistent with a TGDC (). There has been no evidence of recurrence for 1 year.
|
[[51.0, 'year']]
|
M
|
{'15453537': 1, '16713345': 1, '2584857': 1, '12352671': 1, '20411693': 1, '19620596': 1, '19221245': 1, '17141104': 1, '11827591': 1, '6699603': 1, '9925396': 1, '17803016': 1, '15511710': 1, '9466231': 1, '7339697': 1, '18725783': 1, '15091218': 1, '15643322': 1, '17027318': 1, '19770424': 1, '4051405': 1, '24069524': 2}
|
{}
|
163,391 |
3781259-1
| 23,982,805 |
noncomm/PMC003xxxxxx/PMC3781259.xml
|
Electronic collimation and radiation protection in paediatric digital radiography: revival of the silver lining
|
A 6-month-old baby boy was referred for a pelvic X-ray because of restricted abduction of the right hip. On the presented image (Fig. ), there were no signs of dysplasia and the hips appeared normal. Because the image had clearly been electronically collimated, the radiologist asked for the original image. On the original non-collimated radiograph, a left distal femur fracture was suspected (Fig. ). An additional lateral view of the femur was made, confirming the fracture (Fig. ). This was followed by the non-accidental injury protocol.
|
[[6.0, 'month']]
|
M
|
{'26002133': 1, '21491201': 1, '29544343': 1, '22358387': 1, '33655939': 1, '19345030': 1, '33267052': 1, '22988267': 1, '11159059': 1, '21491196': 1, '34150373': 1, '21491200': 1, '23982805': 2}
|
{'3781259-2': 2, '3781259-3': 2}
|
163,392 |
3781259-2
| 23,982,805 |
noncomm/PMC003xxxxxx/PMC3781259.xml
|
Electronic collimation and radiation protection in paediatric digital radiography: revival of the silver lining
|
A 3-year-old girl was referred for an X-ray of the cervical spine, because of mild torticollis after a fall. On the electronically collimated images (Fig. ) the fracture of the right clavicle, responsible for the torticollis would be missed (Fig. ).
|
[[3.0, 'year']]
|
F
|
{'26002133': 1, '21491201': 1, '29544343': 1, '22358387': 1, '33655939': 1, '19345030': 1, '33267052': 1, '22988267': 1, '11159059': 1, '21491196': 1, '34150373': 1, '21491200': 1, '23982805': 2}
|
{'3781259-1': 2, '3781259-3': 2}
|
163,393 |
3781259-3
| 23,982,805 |
noncomm/PMC003xxxxxx/PMC3781259.xml
|
Electronic collimation and radiation protection in paediatric digital radiography: revival of the silver lining
|
An 11-month-old baby girl was referred for abdominal X-ray, in addition to abdominal ultrasound, because of continuous crying and a painful abdomen (Fig. ). In the initially presented radiographs no abnormalities were found and the child was admitted to the hospital for observation. The following day a swollen left upper leg was noted by a nurse. An X-ray of the left femur was made, demonstrating a distal femoral fracture (Fig. ). When asked for the original non-collimated X-ray of the abdomen, the distal femoral fracture could be seen retrospectively, thereby confirming that the fracture was already present at first presentation and probably the cause of the initial crying (Fig. ). This was followed by the non-accidental injury protocol.
|
[[11.0, 'month']]
|
F
|
{'26002133': 1, '21491201': 1, '29544343': 1, '22358387': 1, '33655939': 1, '19345030': 1, '33267052': 1, '22988267': 1, '11159059': 1, '21491196': 1, '34150373': 1, '21491200': 1, '23982805': 2}
|
{'3781259-1': 2, '3781259-2': 2}
|
163,394 |
3782506-1
| 24,068,870 |
noncomm/PMC003xxxxxx/PMC3782506.xml
|
Alteration of liver function due to H1N1 infection: a case report
|
A 22-month-old male was admitted to our hospital due to fever and cough. The fever was subjective and intermittent for 4 days. The cough was described as dry and of 5 days duration. There was no vomiting, diarrhea, rash, or seizures. The mother denied witnessing any ingestion of acetaminophen or toxic material. Past medical history and family medical history were unremarkable. Immunization, including influenza/H1N1, was reported as up to date per parents.\nVitals on admission were as follows: temperature 39°C, respiratory rate 50 breaths per minute, blood pressure 100/70 mmHg, pulse rate 110 beats per minute, oxygen saturation 90% in room air, weight 12.3 kg (50th percentile), height 88 cm (75th percentile), and head circumference 48.2 cm (50th percentile).\nOn examination, the child was drowsy; oral mucosa was dry; pharynx was erythematous with no associated cervical lymphadenopathy; the respiratory exam showed bilateral diffuse coarse crepitations and no wheezing; the abdomen was soft and mildly distended, with audible bowel sounds; the liver was palpated 3 cm below the right costal margin, with possible tenderness in the right upper quadrant, but there was no rebound. The rest of the physical exam was unremarkable.\nInitial laboratory investigations were as follows: complete blood count showed a white blood count of 3,500/uL, hemoglobin 12.5 g/dL, platelets of 195,000/uL; erythrocyte sedimentation rate 17 mm/hour; creatinine of 66 umol/L, albumin 25 g/L, alanine aminotransferase (ALT) 2,106 U/L, aspartate aminotransferase (AST) 850 units/L, alkaline phosphatase (ALP) 291 units/L, gamma glutamyl transferase (GGT) 107 units/L, and total bilirubin 13 umol/L; the rest of the chemistry results were unremarkable, as were the coagulation profile, ammonia, and lactate. His venous blood gas was pH 7.2, carbon dioxide partial pressure (pCO2) 44 mmHg, partial pressure of oxygen (pO2) 29 mmHg, bicarbonates (HCO3) 17 mEq/L, with a base excess of 11. Polymerase chain reaction (PCR) was conducted on the nasopharyngeal secretion and was positive for H1N1. Cerebrospinal fluid studies were normal, and urine and blood culture did not grow any organisms. Hepatitis A immunoglobin (Ig)-M was negative, hepatitis B surface antigen and core antibody were negative, hepatitis B surface antibodies were positive, and hepatitis C IgM was negative. Furthermore, and because of the fever and mildly enlarged liver, PCR was conducted on a blood sample to check for herpes simplex virus, adenovirus, Epstein–Barr virus, and cytomegalovirus; results were negative.\nA chest radiograph showed bilateral streaky infiltrates with no focal consolidation. An ultrasound of the abdomen showed mild coarse hepatic echo texture with no focal lesion.
|
[[22.0, 'month']]
|
M
|
{'20405304': 1, '21951624': 1, '19540158': 1, '20308733': 1, '34873882': 1, '22347885': 1, '19189197': 1, '19797457': 1, '24068870': 2}
|
{}
|
163,395 |
3782584-1
| 24,082,776 |
noncomm/PMC003xxxxxx/PMC3782584.xml
|
Acute Bilateral Visual Loss Related to Orthostatic Hypotension
|
A 50-year-old man was referred to us due to decreased visual acuity in both eyes. The patient had spondylolisthesis and had undergone a lumbar laminectomy three months prior to these symptoms. After the operation, he had been bed-ridden in the supine position. The day before the visit, the patient had sat up for the first time and experienced momentary dizziness, nausea and facial pallor. Blood pressure decreased from 135 / 85 mmHg to 90 / 60 mmHg. A few hours later, the patient complained of blurred vision in both eyes. The next day, we measured a best-corrected visual acuity (BCVA) of 0.3 in both eyes. The pupillary light reflex was decreased in both eyes. Fundus examination revealed optic disc edema in both eyes and a peripapillary flame-shaped hemorrhage in the left eye (). The Humphrey visual field test demonstrated generally decreased sensitivity in both eyes. Fluorescein angiography showed definite delayed dye filling of both of the optic discs. Contrast-enhanced orbital magnetic resonance imaging did not show remarkable findings, and there was no retrobulbar pain. The patient had iron deficiency anemia, and his hemoglobin level was 10.5 g/dL. He also had benign prostate hypertrophy and was prescribed tamsulosin (0.2 mg daily). Systemic evaluations including laboratory and cardiovascular work-up showed no other abnormal findings. The cardiovascular work-up included echocardiogram and magnetic resonance angiography of the carotid arteries. Methylprednisolone pulse therapy was initiated. However, the next day, vision in the right eye further decreased to 0.05. Vision stabilized for the next 10 days. Two weeks after the initial visit, fluorescein angiography showed improved dye filling on both optic discs. However, improvement was not complete in the right optic disc (). Vision slowly improved and, after six months, BCVA was 0.4 and 0.6 in the right and left eyes, respectively. Both optic discs were pale, and retinal nerve fiber layer thinning was prominent (). The visual field remained severely constricted.
|
[[50.0, 'year']]
|
M
|
{'11730278': 1, '90906': 1, '8600889': 1, '3728463': 1, '3501558': 1, '3337706': 1, '8031272': 1, '717525': 1, '17163302': 1, '3500445': 1, '2804033': 1, '2526159': 1, '476403': 1, '5772614': 1, '8325406': 1, '28768527': 2, '8116753': 1, '4360271': 1, '19063989': 1, '10482108': 1, '7225307': 1, '24082776': 2}
|
{'5541695-1': 1}
|
163,396 |
3782585-1
| 24,082,777 |
noncomm/PMC003xxxxxx/PMC3782585.xml
|
Acute Central Retinal Artery Occlusion Associated with Livedoid Vasculopathy: A Variant of Sneddon's Syndrome
|
A 32-year-old Korean woman found that she had visual loss in her right eye when she woke up in the morning and was referred to our clinic for acute CRAO 16 hours after symptom occurrence. Eight years prior, she had presented with itching and tender violaceous erythematous non-elevated patches with central necrotic vesicle on the dorsum of both the lower legs and feet () The lesions were improved by colchicines 0.6 mg/day, hydroxyzine, and methylprednisolone 4 to 8 mg/day. Biopsy showed obliterative vasculopathy consistent with LV (). A segmental limb pressure test with a bidirectional Doppler test showed normal blood pressures in all four extremities. She was intermittently treated with pentoxifylline and mupirocin ointment for skin lesions for three years. She was in good medical condition except for the skin lesions and had no experience of smoking. She was not taking oral contraceptives or suffering from migraine. She had one son and no history of spontaneous abortion.\nAt presentation, her visual acuity was hand motion in the right eye and 20 / 20 in the left eye. Fundus examination of the right eye showed whitish edematous retina, a cherry-red spot, and narrowing and segmentation of retinal arteries suggesting acute CRAO () Laboratory test results, including rheumatological tests such as anti-nuclear antibody; anti-Ro and anti-La antibodies; anti-neutrophil cytoplasmic antibody; anti-DNA antibodies; rheumatoid factor; cryoglobulin; antithrombin activity; protein C and S activity; D-dimer; anti-beta2-glycoprotein; anticardiolipin antibody; lupus anticoagulant; prothrombin gene mutation; factor V Leiden gene mutation; and homocysteine, were all within normal limits except for slightly elevated C-reactive protein (0.62 mg/dL) and fibrinogen (425 mg/dL). The serology tests were positive for hepatitis B antigen while other serology tests were normal. Echocardiography and Holter monitoring showed normal findings.\nShe consented to receive intra-arterial thrombolysis after being informed of the possible risks and benefits of the intervention. Cerebral angiography showed severe focal vasospasm of the right internal carotid artery as soon as the catheter was placed (), which was subsequently relieved by continuous intra-arterial infusion of nimodipine 5 mg. Selective angiography of the origin of the right ophthalmic artery showed no definite thrombus or steno-occlusive lesion within the ophthalmic artery (). The ophthalmic artery was infused with a fibrinolytic agent (500,000 units of urokinase) until the maximal dose of fibrinolytics was reached as based on our protocol, but there was no visual improvement during the procedure. Seven hours after intra-arterial thrombolysis, retinal arterial perfusion on fundus fluorescein angiography (FFA) did not improve (arm to retina time, 29 seconds; arteriovenous transit time: about 4 minutes) (). FFA three days after intra-arterial thrombolysis showed nearly complete restoration of retinal arterial perfusion (arm to retina time, 17 seconds; arteriovenous transit time, about 30 seconds) with the exception of the macular area (no reflow phenomenon). Six weeks after thrombolysis, her visual acuity remained hand motion and fundus photography showed severe retinal atrophy in the macula and disc pallor (). Retinal perfusion was restored sparing macula on FFA () and macular photoreceptor disruption was observed on optical coherence tomography.
|
[[32.0, 'year']]
|
F
|
{'19577305': 1, '3524244': 1, '10766154': 1, '25551694': 1, '8540551': 1, '3826753': 1, '9781555': 1, '7243224': 1, '1424259': 1, '1434852': 1, '12892393': 1, '24505209': 1, '11756961': 1, '10215783': 1, '2502566': 1, '4678141': 1, '7887321': 1, '2109736': 1, '10624439': 1, '18541809': 1, '17895823': 1, '11340401': 1, '31853171': 1, '14278790': 1, '19874344': 1, '10768337': 1, '24082777': 2}
|
{}
|
163,397 |
3782586-1
| 24,082,778 |
noncomm/PMC003xxxxxx/PMC3782586.xml
|
A Case of Susac Syndrome
|
An 18-year-old female came to our clinic reporting blurred vision of the left eye for 2 days. She also complained of decreased hearing with tinnitus of the right ear and mild headache. She was previously healthy and had no remarkable medical or ocular history. Best-corrected visual acuity (BCVA) was 20 / 50 in the left eye, and 20 / 20 in the right eye. The anterior segments of both eyes were unremarkable. Fundus examination and fluorescein angiography of the left eye showed ischemic retina with signs of branch retinal artery obstruction ().\nWe performed brain magnetic resonance imaging (MRI) and lumbar puncture to evaluate any brain or central nervous system lesions. The MRI scan showed a T2-weighted, high-signal, discrete area around the periventricular region, in the white matter and in the corpus callosum (). The lumbar puncture revealed a high protein level (1.8 g/L), but no oligoclonal bands.\nBlood pressure, echocardiography, carotid ultrasonography, full blood count, erythrocyte sedimentation rate, fasting lipids and glucose, autoantibody screen including anti-cardiolipin antibody, protein S and C levels, and antithrombin III level were all normal. An audiogram showed moderate sensorineural hearing loss in the right ear.\nThe patient was treated with intravenous prednisolone 1 g/kg for 3 days followed by oral steroid tapering. Three months after treatment, BCVA recovered to 20 / 25 in the left eye. A mild residual auditory defect remained, but no remaining tinnitus or headache were observed.
|
[[18.0, 'year']]
|
F
|
{'20920828': 1, '11097286': 1, '571975': 1, '9465860': 1, '9627654': 1, '14694047': 1, '15037459': 1, '10844072': 1, '12654364': 1, '24082778': 2}
|
{}
|
163,398 |
3782587-1
| 24,082,779 |
noncomm/PMC003xxxxxx/PMC3782587.xml
|
Choroidal Venous Pulsations at an Arterio-venous Crossing in Polypoidal Choroidal Vasculopathy
|
A 66-year-old Japanese woman was referred to us with a 6-month history of decreased vision and metamorphopsia in the left eye. Visual acuity was 20 / 16 for the right eye and 20 / 32 for the left eye. Fundus examination showed mild epiretinal membrane in the macula of the right eye, and an elevated, oval, 1-disc-diameter, reddish-orange lesion accompanied by serous detachment of the neurosensory retina in the macula of the left eye (). During the choroidal arteriolar filling phase of ICG angiography (HRA2; Heidelberg Engineering, Heidelberg, Germany), branching vessels (arterioles) appeared in blocked fluorescence, and a few dilated choroidal venules with dye leakage manifested in the early choroidal venular filling phase (). The dye proceeded extremely slowly in the choroidal venules, leaking to form polypoidal vessels. Notably, the early choroidal venular filling phase revealed pulsatile movements as subtle rhythmic variations in the caliber of the choroidal venule at an A-V crossing (, yellow arrowhead), where the venule (, blue arrowheads) crossed over the arteriole (, red arrowheads). In the later choroidal venular filling phase, the polypoidal lesion filled with dye (). Her left eye was diagnosed as PCV and treated with photodynamic therapy using verteporfin (Visudyne; Novartis AG, Basel, Switzerland) according to the standard protocol (698-nm laser system, 50 J/mm2, 83-s exposure time, 2,650 µm spot size). Within 3 months after treatment, the polypoidal vessel ceased to leak and the pulsation vanished (). The reddish-orange lesion gradually decreased in size with complete disappearance of the retinal detachment ().
|
[[66.0, 'year']]
|
F
|
{'30128371': 1, '15180844': 1, '12234885': 1, '9828153': 1, '15996735': 1, '15834093': 1, '12486256': 1, '6178389': 1, '24082779': 2}
|
{}
|
163,399 |
3782588-1
| 24,082,780 |
noncomm/PMC003xxxxxx/PMC3782588.xml
|
Gyrate Atrophy of the Choroid and Retina Diagnosed by Ornithine-δ-aminotransferase Gene Analysis: A Case Report
|
A pair of 19-year-old female identical twins presented with complaints of gradual visual loss and progressive night vision deterioration occurring over the past several years. The older twin's best-corrected visual acuity (BCVA) was 20 / 32 in both eyes. The refractive error was -17.75 diopter (D) in the right eye and -17.25 D in the left eye. She had bilateral posterior subcapsular cataracts. On examination, her fundus exhibited bilateral severe chorioretinal atrophy involving the midperiphery (). Fundus fluorescein angiography revealed leakage at the margin of chorioretinal atrophy and dye accumulation in the maculae of both eyes (). Disclosed cystoid macular edema was evident in both eyes on optical coherence tomography (). Dynamic Goldmann perimetry demonstrated visual field constriction in both eyes, and a full-field electroretinogram showed markedly impaired photopic and scotopic responses. On plasma amino acid analysis, she had markedly elevated plasma levels of ornithine (783 µmol/L; normal range, 48 to 195 µmol/L). Screening for inherited metabolic disorder by tandem mass spectrometry (MS/MS) revealed plasma ornithine levels of 380 µmol/L (cutoff, 290 µmol/L).\nThe younger twin's BCVA was 20 / 25 in the right eye and 20 / 32 in the left eye. The refractive error was -17.0 D in the right eye and -16.0 D in the left eye. Her fundoscopy, fluorescein angiography, optical coherence tomography, Goldmann perimetry and full-field electroretinogram findings were similar to those of her older twin. Accordingly, her plasma levels of ornithine on amino acids analysis and MS/MS were 831 µmol/L and 424 µmol/L, respectively.\nThe clinical diagnosis of both patients was consistent with OAT deficiency and GA of the choroid and retina. OAT gene analysis resulted in the detection of two mutations in both patients: c.425G>A, a known mutation, and c.199+11_199+16dupAATTAA, a previously unclassified mutation. Both patients were treated with vitamin B6 (pyridoxine) 300 mg daily and an arginine-restricted diet. After three months of treatment, plasma ornithine levels as measured by MS/MS were 254 µmol/L in the older twin and 365 µmol/L in the younger twin. Their visual acuities in each eye were preserved with no progression of chorioretinal atrophy on fundoscopy after 15 months, and the plasma ornithine levels were controlled at 386 µmol/L and 408 µmol/L, respectively.
|
[[19.0, 'year']]
|
F
|
{'3456579': 1, '4122112': 1, '1737786': 1, '29757052': 1, '3816496': 1, '7254775': 1, '6789268': 1, '24082780': 2}
|
{}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.