patient_id
int64 0
167k
| patient_uid
stringlengths 8
10
| PMID
int64 1.34M
35M
| file_path
stringlengths 31
35
| title
stringlengths 7
377
| patient
stringlengths 55
95.4k
| age
stringlengths 14
33
| gender
stringclasses 2
values | relevant_articles
stringlengths 15
20.5k
| similar_patients
stringlengths 2
1.26k
|
|---|---|---|---|---|---|---|---|---|---|
164,900 | 3873319-3 | 24,380,070 | noncomm/PMC003xxxxxx/PMC3873319.xml | Pericoronal radiolucency associated with incomplete crown | A 12-year-old female patient was referred from a private dental clinic for evaluation of a cystic lesion at the right mandibular posterior region. On clinical examination, there were no specific symptoms, but the patient complained of having had a pus taste for the previous 6 months. A panoramic radiograph revealed a well-defined round unilocular radiolucency surrounding the transversely positioned crown of the lower right third molar (). The CBCT images showed a bucco-lingually expanded cystic lesion associated with the buccally displaced, developing right lower third molar, but the cemento-enamel junction of the crown was incomplete. The mandibular canal was displaced downward due to the lesion (). A provisional diagnosis of odontogenic keratocyst was made, and the lesion was excised with the extraction of the involved tooth. The histopathological diagnosis proved to be an odontogenic keratocyst. | [[12.0, 'year']] | F | {'21731287': 2, '18230385': 1, '7018647': 1, '12022092': 1, '11402292': 1, '12405469': 1, '23120487': 1, '22442592': 1, '23714999': 1, '24380070': 2} | {'3873319-1': 2, '3873319-2': 2, '3873319-4': 2, '3873319-5': 2, '3873319-6': 2, '3873319-7': 2, '3873319-8': 2, '3125666-1': 1} |
164,901 | 3873319-4 | 24,380,070 | noncomm/PMC003xxxxxx/PMC3873319.xml | Pericoronal radiolucency associated with incomplete crown | A 12-year-old female patient was referred from a private dental clinic for the evaluation of a cystic lesion at the left mandibular ramus region. On clinical examination, there was a moderately painful swelling of the left mandibular angle area. The pain had started 2 weeks earlier, and mouth opening was limited. A panoramic radiograph revealed a large well-defined round unilocular radiolucency surrounding the developing crown of the lower left third molar, which was displaced upward to the sigmoid notch. The cemento-enamel junction of the involved tooth was incomplete (). The CBCT images showed a bucco-lingually expanded cortical plate associated with the lesion that surrounded the underdeveloped crown of the left lower third molar. The mandibular canal was identified inferior and lingual to the lesion (). A provisional diagnosis of odontogenic keratocyst was made, and the lesion was excised with the extraction of the involved tooth. The histopathological diagnosis proved to be an odontogenic keratocyst. | [[12.0, 'year']] | F | {'21731287': 2, '18230385': 1, '7018647': 1, '12022092': 1, '11402292': 1, '12405469': 1, '23120487': 1, '22442592': 1, '23714999': 1, '24380070': 2} | {'3873319-1': 2, '3873319-2': 2, '3873319-3': 2, '3873319-5': 2, '3873319-6': 2, '3873319-7': 2, '3873319-8': 2, '3125666-1': 1} |
164,902 | 3873319-5 | 24,380,070 | noncomm/PMC003xxxxxx/PMC3873319.xml | Pericoronal radiolucency associated with incomplete crown | A 6-year-old female patient was referred from a private dental clinic to evaluate the swelling at the left lower posterior region. On clinical examination, there was a 1-month duration of swelling of the left lower molar region. The patient's systemic medical history included unspecified thrombocytopenia and a bleeding tendency. A panoramic radiograph revealed multiple bilateral radiolucencies of the mandible and another separate well-defined round radiolucency involving the developing crown of the lower left second molar (). The left mandibular multilocular radiolucency involving the left lower second primary molar, the lower part of the developing premolars, and the mesial part of the lower left first molar had been operated on 1 year earlier, and the lesion was a giant cell granuloma. This time the unilocular cystic radiolucency-associated developing crown of the left lower second molar was to be managed. The cemento-enamel junction of the involved tooth was incomplete. The CBCT images showed bucco-lingually expanded cortical plates associated with the lesion and the mandibular canal was displaced inferiorly and lingually (). A provisional diagnosis of odontogenic keratocyst was made, and the lesion was excised with removal of the developing lower left second molar after platelet transfusion. The histopathological diagnosis proved to be a dentigerous cyst. | [[6.0, 'year']] | F | {'21731287': 2, '18230385': 1, '7018647': 1, '12022092': 1, '11402292': 1, '12405469': 1, '23120487': 1, '22442592': 1, '23714999': 1, '24380070': 2} | {'3873319-1': 2, '3873319-2': 2, '3873319-3': 2, '3873319-4': 2, '3873319-6': 2, '3873319-7': 2, '3873319-8': 2, '3125666-1': 1} |
164,903 | 3873319-6 | 24,380,070 | noncomm/PMC003xxxxxx/PMC3873319.xml | Pericoronal radiolucency associated with incomplete crown | A 9-year-old male patient was referred from a private dental clinic for evaluation of a hard mass in the left mandibular angle region. On clinical examination, there was a painful swelling of the left mandibular angle. The pain and swelling had first been noticed 1 year earlier, but only medication was applied, and then pus drainage through the gingival swelling of the lower left first and second molar area had been started 1 month before presentation to our clinic. A panoramic radiograph revealed a well-defined round unilocular radiolucency surrounding the developing crown of the lower left third molar, which was displaced distally to the mandibular ramus, and the cemento-enamel junction of the tooth was incomplete (). The CBCT images showed a bucco-lingually expanded cortical plate associated with the lesion, which surrounded the underdeveloped crown of the lower left third molar (). A provisional diagnosis of odontogenic keratocyst was made, and the lesion was excised with the extraction of the involved tooth. The histopathological diagnosis proved to be a dentigerous cyst. | [[9.0, 'year']] | M | {'21731287': 2, '18230385': 1, '7018647': 1, '12022092': 1, '11402292': 1, '12405469': 1, '23120487': 1, '22442592': 1, '23714999': 1, '24380070': 2} | {'3873319-1': 2, '3873319-2': 2, '3873319-3': 2, '3873319-4': 2, '3873319-5': 2, '3873319-7': 2, '3873319-8': 2, '3125666-1': 1} |
164,904 | 3873319-7 | 24,380,070 | noncomm/PMC003xxxxxx/PMC3873319.xml | Pericoronal radiolucency associated with incomplete crown | A 12-year-old male patient was referred from a private dental clinic to evaluate a cystic lesion at the left mandibular posterior region. On clinical examination, there was a painful mild swelling of the left mandibular angle area. The pain and swelling had started 3 days earlier but had subsided somewhat after the medication. A panoramic radiograph revealed a well-defined round unilocular radiolucency surrounding the developing crown of the left lower third molar without completion of the cemento-enamel junction (). The CBCT images showed a well-defined round radiolucency with no cortical expansion surrounding the underdeveloped crown of the lower left third molar. The mandibular canal was identified inferior and lingual to the lesion (). A provisional diagnosis of odontogenic keratocyst was made, and the lesion was excised with the extraction of the involved tooth. The histopathological diagnosis proved to be a dentigerous cyst. | [[12.0, 'year']] | M | {'21731287': 2, '18230385': 1, '7018647': 1, '12022092': 1, '11402292': 1, '12405469': 1, '23120487': 1, '22442592': 1, '23714999': 1, '24380070': 2} | {'3873319-1': 2, '3873319-2': 2, '3873319-3': 2, '3873319-4': 2, '3873319-5': 2, '3873319-6': 2, '3873319-8': 2, '3125666-1': 1} |
164,905 | 3873319-8 | 24,380,070 | noncomm/PMC003xxxxxx/PMC3873319.xml | Pericoronal radiolucency associated with incomplete crown | A 12-year-old male patient was referred from a private dental clinic for evaluation of a cystic lesion at the left mandibular posterior region. On clinical examination, there was a painful mild swelling of the left mandibular angle area. The pain and swelling had started 1 week earlier but had subsided after medication was administered. A panoramic radiograph revealed a well-defined round unilocular radiolucency surrounding the crown of the left lower third molar before the completion of the cemento-enamel junction (). CBCT images showed a well-defined round radiolucency with no cortical expansion surrounding the underdeveloped crown of a lower left third molar. The mandibular canal was identified inferior and lingual to the lesion (). A provisional diagnosis of odontogenic keratocyst was made, and the lesion was excised with the extraction of the involved tooth. The histopathological examination showed flattened squamous epithelium and inflamed stroma showing extensive odontogenic epithelial remnants, consistent with a dentigerous cyst. | [[12.0, 'year']] | M | {'21731287': 2, '18230385': 1, '7018647': 1, '12022092': 1, '11402292': 1, '12405469': 1, '23120487': 1, '22442592': 1, '23714999': 1, '24380070': 2} | {'3873319-1': 2, '3873319-2': 2, '3873319-3': 2, '3873319-4': 2, '3873319-5': 2, '3873319-6': 2, '3873319-7': 2, '3125666-1': 1} |
164,906 | 3873320-1 | 24,380,071 | noncomm/PMC003xxxxxx/PMC3873320.xml | Multiple calcifying hyperplastic dental follicles: A case report | A 31-year-old female visited our clinic with the complaints of pain and gingival swelling on the left maxillary alveolar region and consequent difficulty of eating. Her dental history revealed that she had a dental visit due to her carious and crowded teeth when she was 17 years old. Her carious molar teeth had been extracted and she had applied for orthodontic treatment. The palatally positioned left maxillary incisor teeth were treated for a four-year period. At that time, her impacted teeth were diagnosed on routine radiographs, and she had a surgical operation for the extraction of one of her impacted right mandibular teeth at the age of 18. Her orthodontist followed up on the eruption of the other impacted teeth yearly until she was 21 years old, but then she interrupted her dental treatment and follow-up visits until our examination.\nThe patient had also been diagnosed with hypothyroidism when she was five years old. She was undergoing levothyroxine sodium (Levotiron®, Abdi İbrahim, Istanbul, Turkey) therapy, and her T3, T4, and TSH hormone levels were normal. On extraoral examination, she was approximately 1.50 meters tall and had sparse hair. Intraoral examination revealed missing teeth, diastemata, macroglossia, and buccolingual expansion of the alveolar bone ().\nA panoramic radiograph revealed six impacted permanent teeth: the third molar teeth in all quadrants and the maxillary canine teeth. The crowns of these impacted teeth were surrounded with cyst-like lesions containing radiopaque foci, and well-defined corticated borders. The impacted mandibular molar teeth were located in the apical direction near the inferior cortex of the mandible, and the impacted maxillary teeth were located close to the floor of the maxillary sinus (). For further information, computed tomography was performed. Axial sections of the mandible revealed rounded radiolucent lesions associated with the crowns of the right and left mandibular molar teeth. These lesions contained radiopaque foci and were interpreted as calcification (). In axial sections of the maxilla, the mixed appearance of the lesions with well-defined borders was noteworthy ().\nAfter surgically exposing the impacted left mandibular third molar tooth, an incisional biopsy specimen was obtained from the center of the lesion, under direct vision. Subsequent to biopsy, histopathological examination of the specimen obtained from the follicle of the tooth was made. Microscopic examination revealed loose to moderately dense collagenous connective tissue with abundant calcified material and sparse epithelial islands. The calcifications were mostly acellular type 1 calcification but scanty cellular type II calcifications were also detected. Inflammatory cell infiltration was not observed (). A diagnosis of dental follicles with calcifications was made.\nThe patient refused a surgical operation for removal of the impacted teeth, and she was scheduled for a follow-up visit. One year later, there was not any alteration in the radiographic appearance of the lesions, and then the patient was lost to follow-up. Five years later, the patient showed up for a follow-up appointment. A new panoramic radiograph revealed slight enlargement of the calcified follicles and an increase in the density of the calcifications. A focal increase in the radiopacity associated with the crown of the right mandibular third molar tooth, a small radiopaque prominence associated with the inferomedial aspect of the follicle of the left mandibular third molar tooth, and irregularity of the contours of the hyperplastic follicles were detectable on the radiograph made five years after initial presentation (). The patient refused any surgical operation or prosthetic restoration again. | [[31.0, 'year']] | F | {'22285332': 1, '2005490': 1, '21059105': 1, '2216359': 1, '18452654': 1, '20936196': 1, '15829874': 1, '7600224': 1, '9725571': 1, '12604894': 1, '19131147': 1, '20339249': 1, '11027378': 1, '3165518': 1, '275470': 1, '16270916': 2, '8065735': 1, '15470346': 1, '10889914': 1, '17630096': 1, '32487188': 2, '19419449': 1, '24380071': 2} | {'1266042-1': 1, '7268393-1': 1, '7268393-2': 1} |
164,907 | 3873321-1 | 24,380,072 | noncomm/PMC003xxxxxx/PMC3873321.xml | Cone beam CT findings of retromolar canals: Report of cases and literature review | A 39-year-old male visited the Yonsei University Dental Hospital for extraction of the left mandibular third molar. On a sagittal CBCT image, a curving branch of the mandibular canal with a recurrent path at the right retromolar area was found. The passage of RMC, which branches from the mandibular canal, ended in a round radiolucent foramen of the retromolar fossa (RMF) as it moved superiorly approaching the most posterior molar area (). The RMC was not detected on his panoramic radiograph (). | [[39.0, 'year']] | M | {'22099895': 1, '16982307': 1, '19344041': 1, '5575310': 1, '12839412': 1, '3303955': 1, '5234232': 1, '23601225': 1, '21161224': 1, '3864112': 1, '6943482': 1, '3860553': 1, '17172961': 1, '1872586': 1, '34072906': 1, '22809124': 1, '268217': 1, '28573345': 1, '17356369': 1, '29255660': 1, '32211048': 1, '24380072': 2} | {'3873321-2': 2} |
164,908 | 3873321-2 | 24,380,072 | noncomm/PMC003xxxxxx/PMC3873321.xml | Cone beam CT findings of retromolar canals: Report of cases and literature review | A 30-year-old male visited the Yonsei University Dental Hospital with a chief complaint of inflammation in the right mandibular third molar area. Routine panoramic radiography and CBCT scans were performed for the extraction of the right third molar. It was observed that there was RMC branching from the mandibular canal that passed superiorly and in the reverse direction of the right retromolar area on sagittal images of CBCT (). Two radiolucent canals surrounded by cortical bone were found on cross-sectional images perpendicular to the alveolar ridge (). RMC was not detected on routine panoramic radiograph (). | [[30.0, 'year']] | M | {'22099895': 1, '16982307': 1, '19344041': 1, '5575310': 1, '12839412': 1, '3303955': 1, '5234232': 1, '23601225': 1, '21161224': 1, '3864112': 1, '6943482': 1, '3860553': 1, '17172961': 1, '1872586': 1, '34072906': 1, '22809124': 1, '268217': 1, '28573345': 1, '17356369': 1, '29255660': 1, '32211048': 1, '24380072': 2} | {'3873321-1': 2} |
164,909 | 3873354-1 | 24,379,948 | noncomm/PMC003xxxxxx/PMC3873354.xml | Rapid Progression of Cerebral Infarction after Intraventricular Hemorrhage in Adult Moyamoya Disease | A healthy 39-year-old woman visited our hospital with sudden headache and a decreased level of consciousness. On admission, she was drowsy with mild tetraparesis [manual muscle testing (MMT) score 4/5] and dysarthria. Her blood pressure was 230/100 mm Hg. Magnetic resonance imaging (MRI) revealed IVH on diffusion-weighted imaging in addition to small cerebral infarction in the bilateral frontal lobe (), and MR angiography revealed bilateral occlusion at the terminal of the ICA (). There was asymptomatic, old cerebral infarction in the left frontal lobe on fluid-attenuated inversion recovery imaging (). No old hemorrhage was detected on T2-star-weighted imaging (). Routine laboratory tests were normal. We diagnosed that ischemic-type moyamoya disease had changed into hemorrhagic-type. After admission, the patient underwent conservative treatment with edaravone, a free radical scavenger. Anti-platelet therapy was not performed because of the possibility of progression of IVH. Because there was old cerebral infarction, dehydration might occur ischemia. Hence, hyperosmotic agent such as glycerol was not given. To maintain adequate cerebral hemodynamics, her systolic blood pressure was kept at 180-200 mm Hg, and she received hypervolemia and hemodilution. Her body temperature was around 37.0℃, and her urine output was adequate. Nevertheless, on the second hospital day, the right hemiparesis deteriorated (MMT score 1/5) with motor aphasia, and the infarction area continued to expand without progression of IVH (). On the 7th day, the left hemiparesis deteriorated (MMT score 1/5) and she became apallic. On the 14th day, repeated MRI revealed massive cerebral infarction in the bilateral frontal lobes and expansion of the cerebral infarction stopped at last (). | [[39.0, 'year']] | F | {'21873742': 1, '12217680': 1, '22688074': 1, '21212995': 1, '1615376': 1, '19035718': 1, '19329149': 1, '18035479': 1, '16648003': 1, '17566207': 1, '21494367': 1, '29285177': 1, '22412278': 2, '11593973': 1, '24379948': 2} | {'3299077-1': 1} |
164,910 | 3873355-1 | 24,379,949 | noncomm/PMC003xxxxxx/PMC3873355.xml | Meningeal Supratentorial Hemangioblastoma in a Patient with Von Hippel-Lindau Disease Mimicking Angioblastic Menigioma | A 51-year-old female patient presented to our hospital with severe dizziness and right facial paresthesia. Five years previously, magnetic resonance imaging (MRI) had shown 2 small masses on the right cerebellum and 1 large mass on the left cerebellum. At that time, lateral vertebral artery digital subtraction angiography (DSA) had shown a highly vascular tumor nodule supplied by the posterior inferior cerebellar artery. Lateral internal carotid artery (ICA) and external carotid artery (ECA) DSA had shown no vascular abnormalities. T1-weighted gadolinium enhancement MRI had shown no abnormal findings in the supratentorial region (). The patient had undergone craniotomy, and the left cerebellar tumor was removed. The pathological diagnosis was HB. Abdominal computed tomography, an evaluation of the patient's family history, and genetic screening had been employed to evaluate the presence of VHL disease. Computed tomography had revealed cysts in the pancreas, liver, and both kidneys. Three of the patient's 6 siblings and 1 of her 2 children were diagnosed with VHL disease. Genetic analysis had shown the presence of a VHL gene mutation; thus, the patient's condition had been diagnosed as HB associated with VHL disease.\nFollow-up MRI performed 1 and 12 months after the first operation had shown no evidence of recurrence or abnormal findings in the supratentorial region. However, MRI performed 5 years after the first operation showed a 4.0×3.6×4.0-cm cystic mass with strong enhancement, dural base thickening, and peritumoral edema on the left frontal surface. However, no tumor recurrence was observed in the cerebellum. Left ICA DSA showed pial blood supply to the rim of the tumor. Left ECA DSA showed tumor staining from the middle meningeal artery ().\nThe tumor was completely removed after preoperative embolization. It was a vascular tumor with extensive dural attachment. Histopathological examination with hematoxylin and eosin staining showed lipid-containing vacuoles and abundant vascular cells (). The tumor cells were negative for epithelial membrane antigen (EMA), glial fibrillary acidic protein (GFAP), CD34, and S100, but positive for neuron-specific enolase (NSE) and vimentin (). The patient was definitively diagnosed with HB with meningeal involvement. The patient's dizziness resolved postoperatively. There was no recurrence of the supratentorial tumor or change in the size of the multiple small right cerebellar tumors during the 12-month follow-up period. | [[51.0, 'year']] | F | {'18181838': 1, '566874': 1, '9458097': 1, '29477104': 1, '2916647': 1, '16794350': 1, '17219830': 1, '34513160': 1, '17919131': 1, '5167344': 1, '29527395': 2, '20647972': 1, '10809480': 1, '7815112': 1, '12546356': 1, '21042692': 1, '2113758': 1, '16206984': 1, '5951226': 1, '17284108': 1, '3394496': 1, '11013633': 1, '9158701': 1, '24960680': 1, '27698835': 1, '7786433': 1, '9755665': 1, '15081659': 1, '17558459': 1, '17877533': 1, '22723428': 1, '24379949': 2} | {'5838845-1': 1} |
164,911 | 3873356-1 | 24,379,950 | noncomm/PMC003xxxxxx/PMC3873356.xml | Lymphomatosis Cerebri | A 64-year-old male patient presented with gait disturbance and slowness of behavior. At another hospital, cerebrospinal fluid (CSF) analysis and cytology were performed to differentiate several diseases such as ischemic diseases, infectious diseases, infiltrative tumors, and neurodegenerative disorders. But, there were no positive results among the tested. Conservative treatments including antiplatelet drug without steroids under the impression of ischemic diseases were applied for about 2 months. However, his neurological symptoms were aggravated gradually and cognitive functions declined too. He was transferred to our hospital for further evaluation. On neurological examinations, he was drowsy deeply and obeyed only simple commands. He could not stand by himself, even sitting. Kanofsky performance status (KPS) score was 30. He was severely disabled and needed special cares for daily living activities. We had reviewed the clinical data including several images taken from outside meticulously. Brain computed tomography (CT) revealed no specific findings. Brain MRIs showed extensive, diffuse hyper-intense lesions without enhancement involving bilateral cerebral hemispheres and brainstem on both T2 and fluid attenuated inversion recovery (FLAIR)-weighted MRIs (). MR angiograms were normal. Follow-up brain MRIs taken from our hospital revealed further progression of T2 and FLAIR hyper-intense lesions involving the gray and white matters together extending into both thalamus and periventricular deep white matters (). Definite focal enhancement lesions were not seen on enhanced T1-weighted MRI (). Initially, infiltrative tumors such as gliomatosis cerebri were suspected. Since it was difficult to confirm diagnosis with those clinical studies only, a stereotactic biopsy was performed for pathological diagnosis. Two separated targets to avoid false-negative results were selected. One was the lesion within the deep white matter of left frontal lobe and the other was the lesion close to the left frontal horn which showed brighter T2 signal intensity than first one. Both separated targets for biopsy were targeted on the T2 and FLAIR images. Scattered atypical lymphocytes and perivascular lymphoid cells were found in the two specimens. These tumor cells were strongly immunoreactive with CD20 which was consistent with diffuse large B lymphoma (). Despite subsequent high dose corticosteroids for 1 week, there were no further neurological improvements up to 3 months. | [[64.0, 'year']] | M | {'7048129': 1, '11150363': 1, '30319205': 1, '10963643': 1, '22806340': 1, '20345746': 1, '30008825': 1, '34447347': 2, '26415875': 1, '17611716': 1, '17210623': 1, '30732171': 1, '23185172': 1, '23341100': 1, '21927864': 1, '15791573': 1, '24379950': 2} | {'8384121-1': 1} |
164,912 | 3873357-1 | 24,379,951 | noncomm/PMC003xxxxxx/PMC3873357.xml | Tapia's Syndrome after Posterior Cervical Spine Surgery under General Anesthesia | The patient of first case is a 53-year-old man who presented right shoulder drop and right shoulder pain. On motor examination, weakness of 0/5 right in shoulder abduction was found. Magnetic resonance imaging revealed C4/5 foraminal herniated nucleus pulposus (). The patient was placed in the concord position under general endotracheal anesthesia and the head was secured in the Mayfield head clamp. The patient underwent a posterior foraminotomy with discectomy. Immediate postoperatively, weakness of right shoulder abduction was improved from 0/5 to 3/5. On postoperative day 1, he complained of hoarseness, hypesthesia of left side tongue, buccal cavity and deviation of the tongue to the left during protrusion. There was no definitive lesion in postoperative brain magnetic resonance imaging. In laryngeal electromyography with 37 mm monopolar needle, there was no motor unit action potential on left thyroarytenoid muscle which is innervated by the recurrent laryngeal branch of the vagus nerve. Six months after surgery, symptoms were resolved.\nThe patient of second case is a 56-year-old man who presented gait disturbance. Fifteen years prior to admission, he had a cervical injury from a traffic accident and underwent C5/6 anterior cervical discectomy and fusion. On neurologic examination, ankle clonus was found. Magnetic resonance imaging and computed tomography revealed spinal stenosis on C2/3/4/5 and ossified yellow ligament in right C2/3 (). The patient was placed in the concord position under general endotracheal anesthesia and the head was secured in the Mayfield head clamp. He underwent right C2 hemilaminectomy and C3/4/5 laminoplasty under general anesthesia. Surgery was uneventful. Postoperatively, he complained of hoarseness, hypesthesia of left side tongue, and deviation of the tongue to the left during protrusion. On postoperative day 4, all symptoms except hoarseness were resolved. Two months later, hoarseness was also completely resolved. | [[53.0, 'year']] | M | {'29851851': 2, '22179851': 1, '15599532': 1, '31781403': 2, '32026971': 2, '1880535': 1, '14504349': 1, '20098201': 1, '28393059': 2, '26809980': 2, '30963014': 2, '33970580': 2, '28451489': 1, '25523320': 1, '17087848': 1, '7955729': 1, '18236639': 1, '29948324': 1, '12173208': 1, '28083087': 2, '7373407': 1, '24379951': 2} | {'7434030-1': 1, '6431363-1': 1, '5380397-1': 1, '6966963-1': 1, '5192556-1': 1, '6855057-1': 1, '6855057-2': 1, '6855057-3': 1, '4727387-1': 1, '4727387-2': 1, '4727387-3': 1, '6392620-1': 1} |
164,913 | 3873358-1 | 24,379,952 | noncomm/PMC003xxxxxx/PMC3873358.xml | Rapid Progression of Solitary Plasmacytoma to Multiple Myeloma in Lumbar Vertebra | A 48-year-old man visited the neurosurgery department for right leg pain. He had experienced low back pain and hyperesthesia in the right leg for six weeks without a trauma history. One week prior to presentation, he experienced right hip flexion weakness. Neurological evaluation revealed right hip flexion (G3/5) and extension weakness (G4/5), and the patient showed an abnormal increased sensitivity in the right leg L3 dermatome, and he had continuous lower back pain with tenderness.\nComputed tomography (CT) scanning and magnetic resonance imaging (MRI) showed a geographic osteolytic lesion involving the right mid-posterior element of the L3 vertebra and the right psoas muscle, and an epidural mass with dural sac compression (). Subsequently, the patient underwent F-18 FDG whole body PET/CT examination, which revealed a destructive bone lesion and a paravertebral soft tissue mass with mild increased FDG tracer uptake (SUVmax=4.6)(). There was no evidence of metastasis.\nWe performed a total corpectomy of L3 to remove the destructive column and dural sac mass and stabilized the vertebrae with an expandable interbody cage (Synex System®, SYNTHES, USA) and posterior pedicle screw fixation L1/2/4 (Varian medical system®, VARIANS, USA) (). The patient's neurologic symptoms were improved to normal neurologic function after surgery.\nHistological diagnosis of the resected tumor was plasmacytoma. The immunohistochemical (IHC) staining of the neoplastic plasma cells revealed only weak Immunoglobulin (Ig) kappa chain restriction and CD138 positive expression (). Bone marrow aspiration biopsy was performed when the plasmacytoma was diagnosed, and normal marrow proliferation was observed. Serologic studies of immunofixation and protein electrophoporesis revealed weak monoclonal gammopathy, IgG-kappa type. The serum free light chain (SFLC) ratio was 1.16 (normal reference range; 0.26-1.65). The patient had no rapid progression factors and underwent local fractional radiotherapy (RT) at a dose of 45 Gy.\nLess than two months after pathologic diagnosis, he noted a painful, soft mass, 3×3 cm in diameter in the left wrist. There was also a palpable right inguinal mass. A repeat PET/CT also demonstrated multiple bony masses with moderately increased FDG uptake in the left distal ulna, right parietal skull, right and left clavicle, right and left humerus, right radius, sternum, left 8th rib, right and left ilium, left acetabulum, and left proximal femur, due to spread of malignant tumor. A soft tissue mass with increased FDG uptake was noted in the right proximal thigh with lymph node enlargement seen in the right and left external iliac, left pericolic, and right inguinal lymph nodes (). The right inguinal mass was excised for evaluation for multiple myeloma, and IHC staining of the mass revealed a strong kappa chain positive reaction. The mass was CD138 positive and there was high proliferative activity of Ki-67 detected. The SFLC ratio was elevated to 32.3.\nThe patient was diagnosed with MM and underwent adjuvant chemotherapy, and thalidomide and dexamethasone were administered. | [[48.0, 'year']] | M | {'11920511': 1, '19387333': 1, '15296213': 1, '15487132': 1, '16677383': 1, '12393501': 1, '23135787': 1, '15809451': 1, '18543343': 1, '17404683': 1, '2912957': 1, '20691039': 2, '2343147': 1, '11316553': 1, '11100346': 1, '21195330': 1, '21292778': 1, '20233540': 1, '28868185': 2, '16741249': 1, '9719116': 1, '25207332': 1, '18596742': 1, '6668499': 1, '15009059': 1, '15855274': 1, '16680331': 1, '10580871': 1, '18645990': 1, '17121318': 1, '10979944': 1, '1540888': 1, '30774986': 1, '29806412': 1, '24379952': 2} | {'5569402-1': 1, '2923176-1': 1} |
164,914 | 3873359-1 | 24,379,953 | noncomm/PMC003xxxxxx/PMC3873359.xml | Spontaneously Rapid Resolution of Acute Subdural Hemorrhage with Severe Midline Shift | A 40-year-old female patient presented with decrease of consciousness following accident. Initially, she was stuporous and measured as glasgow coma scale (GCS) score of 6. Both pupils were dilated as 5 mm and reactive to light. Brain computed tomography (CT) revealed an acute subdural hematoma with a thickness of 10 mm in the right frontotemporoparietal region. Midline shift caused by mass effects was 15 mm (). Craniotomy for hematoma removal was considered during close observation. However, an unexpected neurological improvement was noted within 1 hour following the accident. The patient was obeyed and GCS score was 10 even though intubated. A follow-up brain CT showed a decrease in the thickness of hematoma and improvement of the midline shift (). On the third day following the accident, brain CT showed a remarkable reduction of acute subdural hematoma and mass effect. The hemorrhages of subdural space around falx, tentorium, posterior fossa, and upper cervical spinal canal were not found (). The patient recovered her consciousness completely without any neurosurgical interventions. | [[40.0, 'year']] | F | {'22111954': 1, '28468224': 1, '34211864': 2, '18807104': 1, '27169049': 2, '34760828': 2, '10996759': 1, '33163437': 2, '15687739': 1, '11372558': 1, '16035574': 1, '21030807': 1, '27847781': 2, '24379953': 2} | {'8558017-1': 1, '4852602-1': 1, '7607027-1': 1, '8202355-1': 1, '8202355-2': 1, '8202355-3': 1, '8202355-4': 1, '8202355-5': 1, '5104862-1': 1} |
164,915 | 3873360-1 | 24,379,954 | noncomm/PMC003xxxxxx/PMC3873360.xml | Isolated Oculomotor Nerve Palsy Following Minor Head Trauma : Case Illustration and Literature Review | A 36-year-old woman with no past medical history was admitted to hospital after slipping on the ice. The patient did not lose consciousness, but she immediately noted drooping of her right eyelid and double vision when she elevated the lid. There was a 3 cm laceration wound on the chin and some abrasions over the neck and the central region of her face ().\nThe right pupil was fixed and dilated, and there was complete right ptosis. The patient could not elevate, depress, or adduct the right eye, but the eye intorted on attempted downgaze (). The right pupil measured 5 mm in diameter and was sluggish reactive to light. Ophthalmologic tests of vision and intraocular pressure were within normal ranges in both eyes. Further physical and neurological examinations were normal. Skull X-rays and orbital computed tomography (CT) scans immediately after the accident failed to show fractures. MRI and MR angiography of the brain did not reveal any pathology on admission (). Contrast-enhanced spoiled gradient-recalled (SPGR) MR sequences with multiplanar reconstruction (MPR) was subsequently performed to produce high-resolution images of the cisternal portions of the cranial nerves. The 3D MR studies indicated a slightly rough-shaped ON near the the posterior petroclinoid ligament (PCL), but no nerve enhancement (). The patient's history, along with the ophthalmologic symptoms and the radiologic findings strongly suggested the diagnosis of an isolated lesion in the course of the ON without further damage in the right oculomotor nucleus.\nShe was then treated with oral prednisone in a tapering dose over several weeks. MPR of contrast-enhanced 3D MRI taken 2 weeks after the event clearly demonstrated strong enhancement and enlargement over the whole length of the right ON (). At the time of follow-up two months after trauma, her ptosis slightly improved. Three months later, ptosis was completely resolved, and there was some restoration of ocular motion in the direction of adduction. Follow-up MRI 6 months post-injury showed complete resolution of the enhancement and swelling of the right ON (). Nine months after the injury, the patient still suffered from symptomatic glare and blurred vision for near objects, although complete recovery of diplopia was seen. Four months later, spontaneous improvement of pupillary dilatation was observed, and ophthalmology examination also revealed no paralysis of accommodation. | [[36.0, 'year']] | F | {'11435377': 1, '33343777': 1, '26858506': 1, '16046322': 1, '26396626': 2, '28163060': 1, '27904500': 1, '16518159': 1, '16518167': 1, '11338412': 1, '3795318': 1, '6743622': 1, '5133594': 1, '33976940': 1, '27928379': 1, '4537257': 1, '9874541': 1, '26770280': 1, '33913847': 1, '16978866': 1, '17577867': 1, '15181969': 1, '16009916': 1, '2718803': 1, '28228900': 1, '18797373': 1, '8290050': 1, '20799883': 1, '24379954': 2} | {'4553751-1': 1} |
164,916 | 3873361-1 | 24,379,955 | noncomm/PMC003xxxxxx/PMC3873361.xml | Shunt-Responsive Idiopathic Normal Pressure Hydrocephalus Patient with Delayed Improvement after Tap Test | A 68-year-old man presented to our hospital for evaluation of progressive impairment of gait, balance, and memory. Twenty months earlier, he had developed a short-stepped gait and impaired balance without urinary symptoms. There was progressive deterioration in his gait, and he suffered a few falls recently. His daughter described a 12-month gradual decline in his ability to express himself and, more recently, difficulties in carrying out complex tasks. She reported that his short-term memory had been functionally impaired over the past few months. There was reduced interest in completing instrumental activities of daily living.\nHe had accumulated a 40-pack-year smoking habit, but he had stopped smoking 5 years before presentation. His alcohol intake was restricted to social functions. He did not have a history of stroke or other neurological, metabolic, or neoplastic disorders which might produce dementia symptoms, or parkinsonism, or a history of hospitalization for depression. The patient was positive for diabetes mellitus.\nOn initial examination, the patient's cognitive function was impaired [Korean Mini-Mental State Examination (K-MMSE) score 23 out of 30 and Clinical Dementia Rating Scale 1], and a frontal release sign (palmomental reflex) was present,. He exhibited a short-stride gait with shuffling. The patient had no rigidity in the limbs or neck. His postural reflexes were slightly impaired. Formal neuropsychological evaluation showed a deficit in visuospatial function (copy of the Rey-Osterrieth Complex Figure) and memory (Korean Hopkins Verbal Learning Test and recall and recognition of the Rey-Osterrieth Complex Figure) with frontal dysfunctions (Frontal Assessment Battery). All laboratory test results, including a blood-chemistry panel, complete blood count, thyroid function tests, measurement of vitamin B12 levels, and screening for inflammatory and infectious diseases such as neurosyphilis, were unremarkable. Brain magnetic resonance imaging revealed communicating hydrocephalus with an Evans' ratio of 0.35, and also showed CSF signal void in the cerebral aqueduct and enlargement of the temporal horns of the lateral ventricles (). He showed no evidence of a related antecedent event, such as head trauma, intracerebral hemorrhage, meningitis, or another known cause of secondary hydrocephalus. He was diagnosed as having iNPH following the consensus criteria of Relkin et al..\nThe following several psychological tests and walking tests were applied following the CSFTT. The iNPH Grading Scale (iNPHGS) is a clinician-rated scale for assessing the severity of each of the 3 disorders of iNPH (cognitive impairment, gait disturbance and urinary disturbance). A five-point subscale was used to rate the severity of each fundamental symptom of iNPH after an interview with patients and caregivers. The gait assessment included measurements of time and number of steps on the Timed Up and Go Test (TUG) and the 10-m walking test,. These are valid tests of functional mobility used in many studies to evaluate walking ability,. Both tests were separately performed four times, and the mean score was used.\nAt first hospitalization, a lumbar tap with removal of 40 mL of CSF was performed. Before and after the tap, he was evaluated using the iNPHGS, K-MMSE, TUG, and 10-m walking tests (). Change in gait was evaluated 24 hours after the tap,, while change in cognition and urination was evaluated at one week. All trials were videotaped and analyzed by 2 experienced neurologists. Response to the CSFTT was evaluated using three major scales : iNPHGS, TUG and K-MMSE. The following criteria were used to identify responders : improvement of one point or more on the iNPHGS, more than 10% improvement in time on TUG, or more than 3 points improvement on the K-MMSE. These criteria were frequently used in previous studies,. He did not show sufficient improvement by these criteria, and was judged as a non-responder (). The subjective impression of the patient and his family members, as well as 2 experienced neurologists, regarding overall change in gait after the CSFTT was 'no improvement' within 24 hours. However, his daughter reported that his gait appeared to improve 2 or 3 days after the tap, and again became progressively worse at one week when he visited our clinic for the follow-up cognition test. At that time, the patient and his family wanted conservative treatment with observation instead of operation.\nOver the next 3 months, there was deterioration in his gait and balance again. Trials of levodopa, with dosage up to 600 mg/day, offered no benefit. He suffered multiple falls during the ensuing month. He finally required assistance when walking on an uneven road.\nAt the second hospitalization for the CSFTT, we examined his change in gait over seven days in more detail, considering the findings from the first hospitalization (). It was noticed that his gait began to improve 24 hours after tap and more so 48 hours after tap, and eventually he did show improvement by the criteria : more than 10% improvement in time on TUG. His gait got worse again at one week. The patient and his family were repeatedly asked about their subjective impressions regarding overall improvement after the CSFTT. They agreed that there was temporary improvement 72 hours after tap. The diagnosis was then confirmed as a responder and he underwent shunt surgery. After the operation he improved gradually. The gait difficulties were almost fully resolved, and the balance problem disappeared after 1 month (). The K-MMSE score also improved to 25. | [[68.0, 'year']] | M | {'16160425': 1, '7062072': 1, '11909911': 1, '14303656': 1, '1991946': 1, '11856064': 1, '18408356': 1, '1154252': 1, '18359152': 1, '12438477': 1, '27486933': 1, '22239832': 1, '20512347': 1, '8085427': 1, '33921142': 1, '7639630': 1, '21082054': 1, '19713705': 1, '21801282': 1, '16160426': 1, '18025828': 1, '9629375': 1, '27530884': 1, '24379955': 2} | {} |
164,917 | 3873362-1 | 24,379,956 | noncomm/PMC003xxxxxx/PMC3873362.xml | Multiple Liver Abscesses Associated with Ventriculoperitoneal Shunt Infection: Case Report and Review of the Literature | A 50-year-old woman who had been in a vegetative state for two months due to a spontaneous intracerebral and intraventricular hemorrhage was transferred to our hospital. A brain computed tomography (CT) scan revealed severe hydrocephalus without intracerebral hemorrhage and intraventricular hemorrhage. Five days after admission, a VP shunt was implanted. Fifteen days later, the patient had a temperature over 38℃ and a chest X-ray showed patchy consolidation with partial collapse in the right lung. A sputum culture isolated Pseudomonas aeruginosa and Staphylococcus aureus. Cerebrospinal fluid (CSF) and blood cultures were negative.\nThe patient received an initial regimen of intravenous antibiotics (piperacillin/tazobactam and fluconazole), which was shifted to ciprofloxane due to a sustained high fever until the fever subsided. However, the patient became febrile again 6 days later. Liver function tests yielded an alanine aminotransferase level of 115 U/L and an alkaline phosphatase level of 702 IU/L. Fortunately, a chest X-ray showed gradual improvement of the right lung compared to the previous study. At that time, an ultrasonography of the liver revealed two 6-cm-sized hypoechoic masses. A subsequent abdominal CT showed multiple irregular-walled and diverse-sized cysts, including two large ones, which were not enhanced (). The long segment of the distal shunt tube was found going through the subcapsular portion of the right hepatic lobe and the tip of the tube was embedded in the lower large cyst (). Ultrasonography-guided needle aspiration of the upper lesion and percutaneous catheter drainage of the lower lesion resulted in continuous gushing of yellowish pus. Culture of the abscess isolated Staphylococcus capitis (S. capitis), which was sensitive to vancomycin. The patient became afebrile with the administration of intravenous vancomycin at a dose of 500 mg every 12 hours for several days. The patient was unremarkable neurologically and neuroradiologically. A subsequent abdominal CT showed a marked shrinkage of the liver abscesses. A VP shunt revision was then performed with the distal shunt tube extracted uneventfully from the liver, which was enveloped in yellowish pus. The result of CSF culture was negative. Follow-up examinations have been unremarkable, with normal shunt function without the recurrence of liver abscesses. | [[50.0, 'year']] | F | {'8273791': 1, '12709741': 1, '27407950': 1, '6728151': 1, '11528137': 1, '9402391': 1, '9391193': 1, '1905800': 1, '2119130': 1, '18097191': 1, '3310253': 1, '24379956': 2} | {} |
164,918 | 3874376-1 | 24,396,366 | noncomm/PMC003xxxxxx/PMC3874376.xml | A Rare Case of Congenital Heart Disease with Bifid Cardiac Apex: A Unique Finding in Left Ventricle | The patient was a 34-year-old man, who had a history of previous cardiac corrective surgery due to ventricular septal defect (VSD) and subvalvular pulmonary stenosis about 22 years before he was referred to our center for evaluation of new-onset progressive dyspnea on exertion of 3 months’ duration.\nAt presentation, he suffered from dyspnea on exertion (New York Heart Association [NYHA] function class II–III) and easy fatigability. On physical examination, a thrill in the left sternal border was palpable. Both heart sounds (S1 and S2) were diminished in intensity. There was diastolic murmur in the left second intercostals area, consistent with pulmonary regurgitation, and 4/6 holosystolic murmur best heard in the left sternal border, consistent with VSD. Electrocardiography showed atrial fibrillation rhythm with rapid ventricular response (heart rate about 110–120 beat/min), normal axis, right bundle branch block (RBBB) pattern, secondary ST-T changes, and right ventricular hypertrophy (RVH) criteria ().\nEchocardiography revealed a normal left ventricle (LV) size with a mildly reduced LV ejection fraction (LVEF = 50%), as well as a large muscular ridge (3 × 1.5 cm) in the apical portion, highly suspicious of an abnormally located papillary muscle resulting in a double-orifice (bifid) apex ( and ). There was only a chordal attachment to the posteromedial papillary muscle, and no any chordal attachment to the anterior mitral leaflet was found.\nThere was severe right ventricular (RV) enlargement with moderate to severe systolic dysfunction and a large muscle (moderator) band in mid RV with moderate systolic obstruction by color flow Doppler. Other echocardiographic findings were mild mitral regurgitation, moderate tricuspid regurgitation, and moderate pulmonary artery hypertension (estimated systolic pulmonary artery pressure about 50–55 mmHg). The pulmonary valve leaflet was seen to flail, and there was severe pulmonary insufficiency without residual pulmonary stenosis.\nA large residual VSD in both proximal and distal sides of the surgical patch was found; it resulted in LV-to-RV and LV-to-right atrium (RA) shunts (Gerbode defect). There were also an additional mid-muscular septum VSD (5.5 mm) and a large serpiginous apical VSD (15mm), which connected to the RV at the septal insertion of the moderator band with a left-to-right shunt (peak pressure gradient of 40 mm Hg). Another finding was a moderate-sized (10 mm) secundum type atrial septal defect (ASD) with a left-to-right shunt.\nThe patient underwent cardiac catheterization and O2 saturation study. Oximetry showed a significant O2 step-up at two levels in the low superior vena cava to the high RA, in favor of an atrial shunt through the ASD and in mid RA-to-RV, in favor of a ventricular shunt via the VSD with a significant left to right shunt in sum (pulmonary-to-systemic flow ratio [Qp/Qs] = 2.8), moderately increased pulmonary artery pressure (40/15 mmHg), and ventricularized pulmonary artery pressure tracing, in favor of severe pulmonary insufficiency.\nLeft ventriculography demonstrated multiple (VSDs) in mid septal and around the previous VSD patch, which immediately visualized the RV. Left ventriculography in right anterior oblique view showed a bifid apex () with mild mitral regurgitation.\nThe patient was referred for re-do surgery for ASD and VSD closure along with pulmonary valve replacement. | [[34.0, 'year']] | M | {'28770035': 1, '16434284': 1, '24396366': 2} | {} |
164,919 | 3874377-1 | 24,396,367 | noncomm/PMC003xxxxxx/PMC3874377.xml | Single Coronary Artery with Anomalous Origin of the Right Coronary Artery from the Distal Portion of Left Circumflex Artery: A Very Rare Case | A 47-year-old man referred to the Cardiac Center of Boushehr University Hospital with atypical chest pain of one-week duration. One year previously, he had developed chronic stable angina, as is defined by the Canadian classification II.\nThe patient’s atherosclerotic risk factors included untreated hypertension and smoking. Serial electrocardiograms (ECG) did not show significant changes, while cardiac troponin I test was positive. Transthoracic echocardiography revealed normal chamber sizes, mild mitral regurgitation, and slightly decreased left ventricular function (ejection fraction = 50%).\nThe patient’s symptoms were relieved with the prescription of anti-ischemic medication. Coronary angiography demonstrated a single coronary artery from the left Valsalva sinus. Moreover, LAD and LCx arteries were in normal position, and there was significant stenosis in the mid-portion of the LAD and the distal portion of the LCx (). A large branch originated from the distal portion of the LCx and tapered toward its proximal portion.\nAortic root contrast injection showed a single coronary artery, which took off from the left coronary sinus, and the right coronary artery (RCA) originated from the distal portion of the LCx. This finding is a rare coronary anomaly with no ischemic result. The patient’s clinical symptoms were due to coronary lesions. Angioplasty and stenting of the LAD and LCx was done. Before discharge, medical therapy (Clopidogrel, Aspirin, Atorvastatin, and Metoprolol) was prescribed for the patient. He was asymptomatic in follow-up visits. The stent was intact in an 8-month follow-up coronary angiography. | [[47.0, 'year']] | M | {'19155663': 1, '34232213': 2, '16549600': 1, '8184022': 1, '20967149': 2, '15227247': 1, '25031830': 1, '15583223': 1, '12878568': 1, '12021235': 1, '24396367': 2} | {'2957636-1': 1, '8270598-1': 1} |
164,920 | 3874378-1 | 24,396,368 | noncomm/PMC003xxxxxx/PMC3874378.xml | Recurrence of Takotsubo Cardiomyopathy: Role of Multi-Detector Computed Tomography Coronary Angiography | A 58-year-old woman with a history of TCM was admitted to the emergency department due to severe dyspnea accompanied by a sudden-onset, prolonged, burning chest pain and palpitation, similar to those she had experienced in her initial admission, while she was on β-blocker. The occurrence and recurrence of TCM were triggered by emotional and physical stress (anger and prolonged dancing at a wedding ceremony), respectively. At the time, transthoracic echocardiography had revealed akinesia of the LV, with the exception of the basal regions, and in addition, cardiac catheterization had demonstrated minimal coronary artery disease and follow-up transthoracic echocardiography had shown normalization of the LV wall motion abnormalities (ejection fraction = 60%). This time on arrival, the patient had a blood pressure of 120/80 mmHg, pulse rate of 117 beats per minute, and respiratory rate of 35 breaths/minute. The only finding on physical examination was bilateral coarse crackles over both lung bases. The admission surface electrocardiogram (ECG) showed sinus tachycardia, slight ST elevation in V1 through V4 with shallow inverted T waves, and slow R progression (). Although the patient’s symptoms subsided to a great extent on the first day of admission, serial ECGs showed marked dynamic changes: deeply inverted T waves were formed and QT intervals became significantly prolonged ().\nTransthoracic echocardiography on admission revealed a normal LV size with severe LV systolic dysfunction (ejection fraction = 20–25%) and akinesia of the LV with the exception of the basal regions. The serum levels of CK-MB and high sensitive troponin T were 6.32 ng/mL (reference range for females < 3.77 ng/mL) and 213.8 ng/L (reference range < 14 ng/L).\nClinical presentation, compatible TCM past history, and paraclinical findings were all in favor of this diagnosis. Given her previous normal cardiac-catheterization, conducted five months previously, coronary arteries were evaluated via a less invasive procedure, namely MDCT, which revealed no significant findings in the epicardial coronary arteries ().\nThe patient’s hospital course was uneventful, and she was discharged in good condition on hospital day 9. On the follow-up visit, 3 months later, she was symptom free and all of the ECG () and transthoracic echocardiography abnormalities were almost completely resolved. | [[58.0, 'year']] | F | {'11451258': 1, '21864371': 2, '20622740': 1, '19057088': 1, '20117439': 1, '19106400': 1, '18160769': 1, '24396368': 2} | {'3177926-1': 1} |
164,921 | 3874892-1 | 24,339,318 | noncomm/PMC003xxxxxx/PMC3874892.xml | Renovascular Hypertension Treated by Renal Artery Embolization | A 9-year-old boy was referred to our hospital due to uncontrollable arterial hypertension. He was the second baby from twin gestation in a female who underwent in vitro fertiliazation pre-embryo transfer and was prematurely born at 30 weeks and 1 day gestational age with birth weight of 1580 gm. On the 10th day of admission in the neonatal intensive care unit, he presented with elevated blood pressure which was attributed to umbilical cord catheterization. Elimination of the umbilical catheterization and three-day medication with captopril led the high blood pressure to subside. Renal ultrasonography including Doppler interrogation revealed that the size of both kidneys was different from each other (right kidney 4.4×1.7 cm, left kidney 3.6×1.5 cm) and the renal blood flow was decreased in the left kidney. He was discharged with medication of hydralazine and captopril. Although he was recommended to regularly attend outpatient clinic, he was follow-up lost since then.\nSeven years later, he visited a local clinic due to repetitive epistaxis and was referred to the department of pediatric nephrology for the evaluation of uncontrollable hypertension, measuring between 220/100 and 140/90 mm Hg. 274On admission, his body weight was 25 kg (10th percentile) with a height of 132.9 cm (25-50th percentile), a pulse rate of 96 beats per minute, and a blood pressure of 120/75-122/85 mm Hg in all four limbs at rest. There were no abdominal or carotid murmur and no palpable masses in his abdomen. The clinical and neurological examination was normal. The echocardiography showed left ventricular hypertrophy with a left ventricular mass of 116 g/m2 (range, 70-80). The left ventricular function was normal with ejection fraction of 73%, and the aortic arch showed no abnormality. There was no evidence of aortic coarctation or no obvious diastolic dysfunction.\nBlood chemistry values including creatinine, sodium, potassium, and chloride were unremarkable. Additional endocrine tests showed normal values for thyroid hormones. The renin level was >20 ng/mL/hr (range, erect 1.9-6.0), aldosterone level of 44.84 pg/mL (range, 12-340 for age), cortisol level of 10.2 ug/dL (range, 3.1-12.7), vanillylmandellic acid level of 2.68 mg/day (range, 0.0-8.0), and homovanillic acid level of 5 mg/day (range, 0.0-8.0). Urinalysis was within normal limit without proteinuria, hematuria, and renal tubular dysfunction.\nIn abdomenal computed tomography (CT), the left hypoplastic kidney was observed, with narrow and tortuous left renal artery, indicating congenital left renal hypoplasia or secondary contracted left kidney (). On the captopril-primed diethylene triamine pentaacetic acid scan, the early uptake, perfusion, parenchymal transition time, and excretion were all delayed in the left kidney, as well as the decreased left kidney in size (). In contrast, all the values in the right kidney were normal.\nTaking a renal arteriogram, coil embolization was performed in the left two renal arteries. At the end of the procedure, another arteriogram confirmed the complete suppression of arterial flow to the left kidney (). While performing renal arterial embolization, blood was sampled in both renal veins to measure renin levels again. The renin levels in the right and left renal veins were 6.67 ng/mL/hr and above 20 ng/mL/hr, respectively. After the procedure, there was no uptake in the left kidney on dimercaptosuccinic acid (DMSA) scan, showing complete occlusion of the left renal artery (). The embolization caused mild pain in the left flank and slight fever in the patient, which were resolved in one week. Before discharge, we remeasured renin level, and it was 6.76 ng/mL/hr. His blood pressure was maintained between 125/75 and 135/85 mm Hg, and he was discharged with oral medication (amlodipine 5 mg q.d. and angiotensin receptor blocker 50 mg q.d.) for one month.\nOne month later, his blood pressure returned to normal, 95/66-125/75 mm Hg. His renin and aldosterone levels were 7.71 ng/mL/hr and 23.94 pg/mL, respectively. Follow-up abdominal CT showed enhancement in the cortex of the left contracted kidney, suggesting collateral blood that supplies to the left kidney. However, his blood pressure was maintained in the normal range without any antihypertensive medications. | [[9.0, 'year']] | M | {'21722784': 1, '183521': 1, '19649626': 1, '22402318': 1, '17166242': 1, '9271651': 1, '17692611': 1, '22547359': 1, '24339318': 2} | {} |
164,922 | 3874893-1 | 24,339,319 | noncomm/PMC003xxxxxx/PMC3874893.xml | A Five-Year Survivor without Recurrence Following Robotic Anterior Radical Antegrade Modular Pancreatosplenectomy for a Well-Selected Left-Sided Pancreatic Cancer | A 72 year-old man (hight-172 cm, weight-78 kg, body mass index-26.37) with a three-month history of weight loss of 5 kg was admitted to the Department of Surgery in Severance Hospital, Seoul, Korea. On preoperative axial imaging, he had a suspicious mass-like lesion confined to the pancreas, which was suggestive of pancreatic cancer (). The tumor seemed not to invade retroperitoneal space and it was apart from celiac axis. The patient's CA 19-9 was elevated to 60 IU/mL. After careful consideration, a decision to perform minimally invasive pancreatectomy was made based on the concept of anterior RAMPS, and a robotic surgical system was subsequently used.\nThe complete procedure is described in a multimedia article published previously., In brief, surgery was performed with the patient placed in the supine position. After division of both the gastrocolic and gastrosplenic ligaments, the whole pancreas was exposed. Following the main outline of the original RAMPS, a complete window could be made via the avascular plane between the pancreatic neck and superior mesenteric vein-portal vein-splenic vein (SMV-PV-SV) confluence. This facilitated dissection of the lymph nodes around the common hepatic artery. Division of the pancreas was performed by endo-GIA at the pancreatic neck portion. The left gastric vein with soft tissue around celiac trunk and common hepatic artery were dissected (). The splenic artery and vein were controlled at the origin of the celiac trunk and t the junction of the SV and SMV, respectively. The robotic surgical system is thought to be helpful for these dissectional processes. The superior mesenteric artery and left renal vessels were not aggressively dissected. The distal part of the pancreas was dissected with soft tissue around the celiac trun and the fascia layer covering the adrenal gland and perinephric soft tissue in a right-to-left fashion. An endo-pouch was introduced and surgical specimen was retrieved through a small vertical abdominal wound. The total operation time was eight hours and the intraoperative blood loss was 700 mL.\nThe patient recovered without any complications. He returned to an oral diet on the first day and was discharged on the tenth day after operation. Pathologic examination revealed a pancreatic ductal adenocarcinoma with extension into the peripancreatic soft tissue (pT3). Regional lymph node metastasis was not identified (pN0, 0/2). Both the pancreatic resection margin and the tangential posterior margin were free of carcinoma (). No evidence of perineural and lymphovascular invasion was noted. The patient received only postoperative adjuvant radiotherapy around the tumor bed (total 55.67 Gy/19 fractions, daily 2.93 Gy) (). His CA 19-9 remained within normal limits after surgery (), and the patient survived for more than five years without cancer recurrence. | [[72.0, 'year']] | M | {'18695757': 1, '18791364': 1, '14712875': 1, '20054579': 1, '17896167': 1, '21298529': 1, '22258879': 1, '17254928': 1, '22192922': 1, '21556993': 1, '20868976': 1, '22284762': 1, '19071061': 1, '28389802': 1, '25248464': 1, '22868357': 1, '33568109': 1, '15650632': 1, '28583142': 1, '24339319': 2} | {} |
164,923 | 3874924-1 | 24,339,317 | noncomm/PMC003xxxxxx/PMC3874924.xml | A Case of Pneumomediastinum and Parapneumonic Effusions Following Pharyngeal Perforation Caused by Shouting | A 43-year-old man presented with a 2-day history of dyspnea and chest pain after shouting in a quarrel with his wife. He had presented to a local clinic with fever, cough, sputum, and odynophagia 3 days previously, and was treated for acute pharyngitis. Before the onset of symptoms, he was in good health and had no significant past medical history except for 50 pack-years smoking history. Vital signs on admission were blood pressure 120/70 mm Hg, heart rate 100/min, respiration rate 28/min, and body temperature 38.7℃. On physical examination, there was swelling and tenderness in the left cervical area. Crackles were noted in both cervical areas. Coarse breath sounds were noted in both lung fields, and crackles were noted in the left lower lung field.\nLeukocyte count was 13000/mm3 (85.2% neutrophils, 9.4% lymphocytes, 4.7% monocytes, 0.2% eosinophils), hemoglobin 13.0 g/dL, and platelet count 229000/mm3. The results of arterial blood gas analysis in room air were pH 7.491, PaCO2 25.2 mm Hg, PaO2 62.4 mm Hg, HCO3- 21.8 mmol/L, and SaO2 94.2%. Liver function tests were normal. Serum total protein was 6.5 g/dL, albumin 3.5 g/dL, blood urea nitrogen 20.0 mg/dL, creatinine 1.2 mg/dL, sodium 135 mmol/L, potassium 4.2 mmol/L, creatine phosphokinase 431 IU/L, lactate dehydrogenase 658 IU/L, and high sensitivity C-reactive protein 30.7 mg/dL. Urinalysis was normal.\nAn initial chest radiography showed linear air trapping parallel to the border of the trachea, bilateral pleural effusion that was more severe on the left side, and consolidations in both lower lungs (). A chest computed tomography (CT) scan revealed air collection around the airway and mediastinum, infiltration around the mediastinum, and bilateral pleural effusions ().\nLaryngoscopy was performed by an otolaryngologist, and a small pharyngeal perforation in the right side of the vallecula was seen. A cervical CT scan also showed lacerations in the same area (). Analysis of the pleural fluid on the left side was consistent with parapneumonic effusions (pH 8.0, red blood cell count 3840/mm3, white blood cell count 2880/mm3, neutrophils 95%, total protein 4.6 g/dL, albumin 2.5 g/dL, lactate dehydrogenase 27198 IU/L, glucose 27 mg/dL). Intravenous moxifloxacin was started. In addition, chest tubes were inserted on both sides and supplemental oxygen was administered. Laryngoscopy was repeated 2 days later, and the previously-noted small pharyngeal perforation was not seen. Blood and pleural fluid cultures were negative, but fever and leukocytosis persisted. Antibiotics were broadened to piperacillin-tazobactam and amikacin. Fifteen days after admission, a follow-up chest radiography showed resolution of air trapping around the mediastinum and regression of parapneumonic effusions. The patient's symptoms and laboratory results continuously improved, and the patient was discharged 29 days after admission. | [[43.0, 'year']] | M | {'16381138': 1, '6375617': 1, '14725137': 1, '16304275': 1, '15064640': 1, '8779147': 1, '1416301': 1, '10354894': 1, '11769580': 2, '25784502': 1, '33304808': 1, '11180677': 1, '15154580': 1, '24339317': 2} | {'4531731-1': 1} |
164,924 | 3874988-1 | 24,453,688 | noncomm/PMC003xxxxxx/PMC3874988.xml | Extensor mechanism allograft in total knee arthroplasty | Male patient, 85 years old, with previous total left patellectomy due to patellofemoral arthritis at age 60 who subsequently underwent left TKA at age 79 ( surgeries performed in a different hospital ). He developed pain and progressive limitation of active and passive knee extension causing restriction of activities of daily living. He became accompanied by the Knee group from IOT-HC/FMUSP in December 2008, at that time four years and nine months after arthroplasty. On physical examination the patient had restriction on knee extension with lag of 40 degrees in active extension and 20 degrees in passive extension. The patient only walked with the aid of a walker, with no load on the compromised member. He did not show any ligament instability. Radiographs showed loosening of the tibial component with significant tear of the polyethylene insert. The inflammatory markers (ESR and CRP) were normal and bone scan was not suggestive of an infectious process. In April 2009 the patient underwent revision arthroplasty and allograft extensor mechanism transplant. The graft consisted of quadriceps tendon - patella (full) - patellar tendon - anterior tibial tuberosity (ATT). The graft was obtained from the IOT-HC/FMUSP Tissue Bank, having been previously prepared and frozen, without viable cartilage. The graft placement was based on the lower pole of the patella, which was kept 2.5 cm above the joint line. A pin in the tibia was inserted in the topography of the anterior tuberosity, where the previously molded plug bone allograft (ATT) was fitted under pressure and fixed with a large fragments screw. The articular surface of the patella graft was not replaced for being insensitive; replacement could be an unnecessary source of complications (such as fracture). The quadriceps tendon graft was then sutured to the patient's quadriceps, tensing toward the graft proximal and distal quadriceps, through Kracow technique with high strength nonabsorbable multifilament wire, keeping the knee in full extension. The capsule and what remained of the remnant extensor apparatus were sutured over the graft with simple absorbable wire, covering it in an attempt to increase its vascularization. ( and ) Postoperatively the patient was maintained immobilized in extension for six weeks performing only isometric strengthening exercises and assisted passive range of motion gain. After the sixth week active exercises with progressive weight were allowed until the third month, when immobilization was discontinued. | [[85.0, 'year']] | M | {'10546606': 1, '10537270': 1, '10565649': 1, '7673904': 1, '18534509': 1, '975665': 1, '26911538': 1, '2587446': 1, '15590855': 1, '8194257': 1, '2743664': 1, '3412795': 1, '3612139': 1, '16140793': 1, '18922372': 1, '14584836': 1, '24453688': 2} | {'3874988-2': 2, '3874988-3': 2} |
164,925 | 3874988-2 | 24,453,688 | noncomm/PMC003xxxxxx/PMC3874988.xml | Extensor mechanism allograft in total knee arthroplasty | Female oriental 80 years old patient underwent primary total knee arthroplasty for osteoarthritis in 1997 by another hospital. It initially evolved well, but later presented infection leading to septic loosening of the prosthesis, which was diagnosed in 2006. In 2007 she started being followed-up in our hospital. She presented, at this time, range of motion of 10-80°.\nAs the patient presented symptoms of chronic infection associated with loosening of the components, treatment with review in two-steps was chosen according to our hospital protocol.\n,\n The patient underwent removal of the prosthesis, thorough debridement and spacer with cement associated with vancomycin.\nDuring the procedure, it was necessary to resect a large part of the patellar tendon that was found damaged by the infection, the extensor mechanism becoming consequently compromised. Throughout her treatment, she was also accompanied by the hospital's infection service that indicated antibiotic therapy. The cultures the first cleaning showed no bacterial growth and the infection was controlled, with normalization of inflammatory activity (ESR and CRP). Thus, the patient was submitted two months after the second time with revision arthroplasty and transplantation of the extensor mechanism allograft.\nThe graft consisted of quadriceps tendon-patella (full) - patellar tendon-anterior tibial tuberosity (ATT). The graft was obtained from the Tissue Bank of IOT-HC/FMUSP, having been previously prepared and frozen, without viable cartilage. The technical details of the surgery and the initial postoperative were similar to those of case 1. We point out the differences between them: the bone plug fixation was performed with ATT flexible steel wires and we chose to perform patellar allograft replacement by a technique identical to that of a patellar component in a primary arthroplasty. | [[80.0, 'year']] | F | {'10546606': 1, '10537270': 1, '10565649': 1, '7673904': 1, '18534509': 1, '975665': 1, '26911538': 1, '2587446': 1, '15590855': 1, '8194257': 1, '2743664': 1, '3412795': 1, '3612139': 1, '16140793': 1, '18922372': 1, '14584836': 1, '24453688': 2} | {'3874988-1': 2, '3874988-3': 2} |
164,926 | 3874988-3 | 24,453,688 | noncomm/PMC003xxxxxx/PMC3874988.xml | Extensor mechanism allograft in total knee arthroplasty | Female white 81 years old retired patient. She underwent total right knee arthroplasty in 2007. On the 4th postoperative day, when leaving the hospital after being discharged, she felt to the ground with trauma in the anterior knee that caused wound dehiscence and exposure of the prosthesis with loss of patellar component. The patient was again hospitalized and underwent aggressive surgical procedure for cleaning and collection of cultures and antibiotic therapy for six weeks to control a local infectious process, multi - sensitive Staphylococcus aureus having been detected. Intraoperatively, resection of 60% of the patella was required due to its fragmentation. The patient recovered well from the clinical point of view, and local infection.\nProgressively during the follow-up, she started to present pain and disability of knee extension due to lateral dislocation of the extensor mechanism to active quadriceps contraction due to the lack of restraint on the local soft parts after surgical debridement. Due to the lateralization of the extensor mechanism, she slowly progressed to medial instability and large valgus opening between 2007 and 2011. The patient did not present any evidence of loosening of the femoral and tibial components of the arthroplasty. The functional limitation became important, and surgical treatment was the option elected.\nIn October 2011 she underwent reconstruction of the extensor mechanism and the medial collateral ligament with homologous graft from a tissue bank using a complete extensor mechanism (quadriceps tendon - patella - patellar tendon - tibial tuberosity) and two flexor tendons to medial ligament complex. A channel in region of the anterior tibial tuberosity was performed to accommodate a "press fit" plug bone graft associated with 4.5- mm cortical screw with washer.\nIntraoperatively it was observed that the tibial and femoral components were fixed and well positioned and exchange was not performed.\nPatient developed an active knee extension at the immediate postoperative period. The post-operative procedures were also similar to those of cases 1 and 2. | [[81.0, 'year']] | F | {'10546606': 1, '10537270': 1, '10565649': 1, '7673904': 1, '18534509': 1, '975665': 1, '26911538': 1, '2587446': 1, '15590855': 1, '8194257': 1, '2743664': 1, '3412795': 1, '3612139': 1, '16140793': 1, '18922372': 1, '14584836': 1, '24453688': 2} | {'3874988-1': 2, '3874988-2': 2} |
164,927 | 3875513-1 | 24,396,358 | noncomm/PMC003xxxxxx/PMC3875513.xml | An Unusual Case of Bilateral Maxillary and Mandibular Para Premolar: A Case Report | A 35-year-old man came to the Department of Conservative Dentistry and Endodontics, Bhabha College of Dental Sciences, Bhopal with a chief complaint of pain in relation to the lower left first molar. The family, medical and dental history was negative. The patient was healthy with no mental retardation.The facial appearance was normal and presented no skeletal or other abnormalities suggestive of any syndrome ().\nExtra oral examination did not reveal any abnormalities. Intra oral examination revealed presence of full complement of permanent teeth except for the lower third molars, and supernumerary teeth were present in all four quadrants. A deep carious lesion with pulpal involvement was present in relation to 36. Another finding was a grossly decayed 18.\nIn the upper arch, supernumerary teeth resembling conical or triangular shaped crown were present in between normally appearing 14 and 15, 24 and 25 without any displacement of the permanent teeth.\nIn the lower arch, four erupted supplemental teeth resembling premolars were present. Two were located lingual to 34 and 35 and subsequently displacing same. On the right side, two supplemental teeth were present; of which one was lingual to 44 and 45 and the other was between 45 and 46 ( and ).\nA panoramic radiograph was taken to rule out any underlying pathology or unerupted supernumerary teeth that showed unerupted 13 present at the floor of the right maxillary sinus and apex of 14 and 15.\nSupplemental supernumerary teeth showed a small crown-root proportion with a conical-shaped root and no bone or root resorption. Panoramic radiograph showed impacted 38 and 48 with over-retained deciduous canine in relation to 13 (). 36 was treated endodontically, followed by a full metal crown.18 was extracted under local anesthesia. Supernumerary teeth were not causing any kind of discomfort for the patient and patient was informed about the position of his teeth and importance of regular follow-ups. | [[35.0, 'year']] | M | {'9604503': 1, '16202084': 1, '8477864': 1, '21243544': 1, '21998774': 1, '16618853': 1, '16012216': 1, '19055087': 1, '19300360': 1, '12515064': 1, '10658390': 1, '18571018': 1, '16459518': 1, '12121534': 1, '24396358': 2} | {} |
164,928 | 3875514-1 | 24,396,359 | noncomm/PMC003xxxxxx/PMC3875514.xml | An Unusual Bone Loss Around Implants | The patient was a 57-year-old man who had lost his teeth because of caries, and had been referred to the dental school of Tehran university to replace them by implants in 2005. He had a history of controlled high blood pressure and controlled diabetes. Clinical examination showed that teeth number 18, 19, 30 and 31 had been lost. A comprehensive treatment plan was given to the patient and he was first referred for endodontic, periodontal and restorative treatment of the remaining teeth, and then for placement of dental implants.\nImplant surgery was preformed under local anesthesia (2% lidocaine, 1:100000 epinephrine). On the right side of the mandible, two Replace Select wide platform implants (10mm × 5mm), were placed in teeth 30 and 31 positions. A 10mm × 4.3mm Replace Select regular platform implant was placed in tooth number 19 position on the left side of the mandible and for position 18, a Replace wide platform implant (10mm × 5mm) was inserted.\nThere were no complications during implant placement. The type of bone in the implant areas was type 1.\nA post-operative antibiotic regime of 500mg amoxicillin was prescribed three times daily for 7 days, 400mg gelofen 4 times a day for 3 days and a chlorhexidine mouth rinse 2 times a day for 14 days was also prescribed for the patient. The sutures were removed 10 days later. After initial healing and taking a panoramic radiograph an appointment was set for the patient for impression taking, but he did not refer until 6 years later, in 2011, to continue the treatment. After clinical examination, the implants on the left mandibular side were healthy, BOP was negative without suppuration, with a pocket depth of 2 to 3 mm and without a radiographic sign of bone loss. However, on the right mandibular side, implants 30 and 31 had 7 to 9 millimeter pockets, respectively and were BOP and suppuration positive. Wide crater-like lesions were seen on radiographic images around both implants (). Scaling was performed and after 2 weeks open flap surgery was carried out in the involved area.. A sulcular incision was made from the distal area to the mesial of tooth number 28 with a #15 blade. A sulcular incision was made from the distal area to the mesial area of tooth number 28 with a #15 blade. All around the implants were debrided. Then the implants were taken out and the remaining sockets were decorticated with a round bur and grafting material was placed (0.5 gr bio-oss large particle) in the area and covered by a membrane (bio guide 25 × 25mm) by a saddle shape technique. The flap was coronally replaced and sealed with a horizontal mattress and figure-c sutures (silk 3-0). After surgery, 500mg amoxicillin three times daily for 7 days and also 400mg gelofen 4 times a day for 3 days and a chlorhexidine mouth rinse 2 times a day for 2 weeks was prescribed. | [[57.0, 'year']] | M | {'30479991': 1, '15978246': 1, '7640341': 1, '12755783': 1, '12787222': 1, '18724857': 1, '12795785': 1, '11564101': 1, '10337314': 1, '2002427': 1, '18698626': 1, '8336254': 1, '24396359': 2} | {} |
164,929 | 3875700-1 | 24,385,995 | noncomm/PMC003xxxxxx/PMC3875700.xml | Repeated Aborted Sudden Cardiac Death with Long QT Syndrome in a Patient with Anomalous Origin of the Right Coronary Artery from the Left Coronary Cusp | A 15-year-old female with a prior history of aborted cardiac death and surgical correction of anomalous origin of the RCA was referred to the cardiology department due to repeated aborted sudden cardiac death after physical exertion with boxing. The initial electrocardiogram (ECG) showed polymorphic ventricular tachycardia (). Biphasic 200 joules defibrillation restored the heart to sinus rhythm and cardiopulmonary function recovered without neurologic sequelae. Two years prior to this event, she experienced chest discomfort followed by aborted sudden cardiac death after heavy exercise for the first time. Initial ECG at the emergency room showed pulseless electrical activity. She was successfully resuscitated after basic life support maneuvers and fully recovered with hypothermic treatment after being admitted to the emergency department. Her family history of structural heart disease, syncope or sudden cardiac death was unremarkable. Several cardiac examinations were performed at that time. Echocardiography demonstrated no structural heart disease with a normal left ventricular ejection fraction. Cardiac computed tomography revealed anomalous origin of the RCA from the left coronary cusp coursing between the pulmonary artery and the aorta (). Her follow-up ECGs after stabilization showed a sinus rhythm with an inverted T wave and a prolonged QT interval which was suggestive of congenital LQTS (). She was not taking any medications which can prolong the QT interval and laboratory findings did not show electrolyte abnormalities. But this finding was overlooked and anomalous origin of the RCA was provisionally considered as the cause of the aborted cardiac arrest. She underwent surgery to re-implant the anomalous RCA from the left to the right sinus of Valsalva. After receiving surgical correction of anomalous origin of the RCA, she had been doing well before the second event of aborted cardiac death developed. Coronary angiogram with a provocation test using ergonovine was done after the second event, and it revealed no significant abnormalities and the re-implantation site of the RCA ostium was intact. An electrophysiologic study was performed to rule out possible causes of other arrhythmias leading to cardiac arrest. However no other arrhythmia was induced and also polylmorphic ventricular tachycardia was not inducible with programmed stimulation. The ECG after restoring the heart to sinus rhythm showed still significant prolongation of the QT interval, resulting in the diagnosis of LQTS, probably type I, regarding her clinical presentation, even though the ECG pattern showed a prolonged QT interval and a notched T wave suggesting LQTS type 2. Gene studies were recommended, but declined by her family. ECGs of her parents showed no significant QT prolongation. Medication with a β-blocker (atenolol) was started and the dose was titrated up to 1.3 mg/kg (50 mg bid, regarding her body weight; 78 kg). A follow-up exercise tolerance test revealed blunting of the heart rate response during maximal exertion and she was instructed to avoid heavy exercise. She remained free from ventricular arrhythmias while she was on a β-blocker medication during the follow-up of more than 6 months. Her serial follow-up ECGs showed significant QTc prolongation of >500 ms consistently. | [[15.0, 'year']] | F | {'29258620': 2, '16487842': 1, '12484611': 1, '27826330': 1, '28870013': 1, '8026057': 1, '18328336': 1, '9323097': 1, '9416909': 1, '11320458': 1, '24385995': 2} | {'5735880-1': 1} |
164,930 | 3875701-1 | 24,385,996 | noncomm/PMC003xxxxxx/PMC3875701.xml | Inverted-Takotsubo Cardiomyopathy in a Patient with Pulmonary Embolism | A 38-year-old woman with no history of cardiac diseases or cardiac risk factors was referred to our emergency department because of chest discomforts, arrhythmia and shortness of breath after the surgery. A few days before she had fallen off the ladder and underwent surgery for right lateral malleolar fracture under spinal anesthesia. Physical examination revealed vital signs as follows: blood pressure 90/60 mm Hg, heart rate 75 beats/min, body temperature 36.7℃, respiratory rate 22/min and oxygen saturation 88% on room air. Oxygen saturation was increased to 94% after giving 3 L O2 via nasal prongs. The electrocardiogram (ECG) recording showed sinus rhythm, ST-segment depression in V3 through V5, and there were no typical features of ECG abnormalities associated with PE such as sinus tachycardia, S1Q3T3 pattern, complete and incomplete RBBB, and T wave inversion (). Chest radiography showed diffuse increased bronchovascular lung markings with mild congestion and edema, D-dimer was elevated to 1572 ng/mL (normal reference range 0-243 ng/mL) and altered results of the arterial blood gas analysis (pH 7.42/pCO2 25.8 mm Hg/pO2 69.7 mm Hg/HCO3 16.4 mmol/L) aroused suspicion of PE. It was confirmed by computed tomography and thus, therapy with heparin infusion was initiated (). Other laboratory findings indicated white blood cell counts of 10000/mm3; hemoglobin 9.7 g/dL; platelet count 275000/mm3; C-reactive protein 0.0 mg/dL; alanine aminotransferase 18 U/L; aspartate aminotransferase 39 U/L; total bilirubin 0.46 mg/dL; and serum creatinine 0.7 mg/dL. The cardiac enzyme levels were elevated with a peak level of creatine kinase-MB isoform 27 ng/mL (normal reference range 0-3.6 ng/mL) and troponin I 5.30 ng/mL (normal reference range 0-0.1 ng/mL). Transthoracic echocardiography showed hypokinesia of mid/base segments of LV with hypercontraction of apical segments and reduced ejection fractions estimated at 47% with no significant valvular dysfunctions. Right ventricular systolic dysfunction or dilated right ventricle was not found, and yet an estimated systolic pulmonary artery pressure increased mildly to 43 mm Hg on the assumption of right arterial pressure of 10 mm Hg (tricuspid regurgitation peak velocity: 2.87 m/s) (). Coronary angiography was immediately performed within an hour of admission and ruled out obstructive atherosclerotic diseases. She was managed with medical therapy using β-blocker and diuretics. Angiotensin converting enzyme inhibitors was not indicated because of mild hypotensions. After the medical treatment, the patient was presented free of symptoms for the following few days. Transthoracic echocardiography was undergone 1 week after her admission and showed improvements in ejection fractions of 58% with no wall motion abnormalities (). ECG was normalized within 10 days. The patient was discharged in good clinical conditions and remained well after 3 months of follow-up. | [[38.0, 'year']] | F | {'18294473': 1, '16875987': 1, '19763195': 2, '20195267': 1, '26131342': 1, '17283269': 1, '18035091': 1, '16216613': 1, '25278992': 1, '21413433': 1, '17120407': 1, '21890469': 1, '21091614': 1, '30526522': 2, '19120144': 1, '23510078': 2, '24385996': 2} | {'3668300-1': 1, '3668300-2': 1, '2735159-1': 1, '6288948-1': 1} |
164,931 | 3875702-1 | 24,385,997 | noncomm/PMC003xxxxxx/PMC3875702.xml | Ventricular Fibrillation in a Patient with Tachycardia-Induced Cardiomyopathy after Liver Transplantation | A 41-year-old man with end-stage liver failure due to hepatitis B virus-associated liver cirrhosis underwent orthotopic liver transplantation (OLT). He had underlying diabetes mellitus and did not have a history of exertional angina, dyspnea on exertion, and paroxysmal palpitations. Preoperative 12-lead electrocardiography showed normal sinus rhythms. Preoperative echocardiographic evaluation showed normal biventricular size and function. Paroxysmal AF with rapid ventricular responses developed on the first postoperative day (; in the online-only Data Supplement). Given the stable vital status with no signs of heart failures or myocardial ischemia, the sinus conversion was not attempted. The patient required a prolonged in-hospital recovery period, during which, continuous renal replacement therapy, mechanical ventilation, and tracheostomy were performed. Flecainide and diltiazem were administered to control recurrent AF after normalization of liver and renal function, 5 weeks after OLT. But, such drugs had to be discontinued after development of congestive heart failures with severe ventricular dysfunction (ejection fraction, 30%) () 9 weeks after OLT. During the hospital stay, the left ventricular ejection fraction increased to 38% after administration of ramipril, carvedilol, and diuretics. The patient was discharged with these medications on top of immunosuppressive drugs including FK 506 and mycofenolate mofetil 11 weeks after OLT. Acute renal failure occurred 3 months after surgery, but resolved after discontinuation of heart failure medications. Repeated echocardiography showed improved left ventricular ejection fraction of 42%.\nSix months after OLT, the patient collapsed while he was walking. The patient was transported to the emergency room under cardiopulmonary resuscitation and ventricular fibrillation was noted on electrocardiogram ( in the online-only Data Supplement). After an immediate defibrillation, AF with rapid ventricular response was noted ( in the online-only Data Supplement). He recovered without neurologic impairments. Coronary angiography showed no significant stenosis. Echocardiography showed severe left ventricular dysfunction with a left ventricular ejection fraction of 21% (). A single-chamber implantable cardioverter-defibrillator (ICD) was implanted. Heart failure treatments, including a β-blocker and an oral anticoagulant, were continued. Ventricular tachycardia with palpitation (cycle length of 290 ms, 18 beats for 5.2 seconds) was detected and terminated by antitachycardia pacing 2 months after the ICD implantation ( in the online-only Data Supplement).\nComplete conversion to sinus rhythm was recorded on ICD after 5-months of alternation between AF and sinus rhythm. Echocardiography showed normalized left ventricular systolic function 8 months after the ICD implantation (). Thereafter, only a β-blocker was administered to prevent tachycardia for 18 months with no recurrences of ventricular arrhythmias. | [[41.0, 'year']] | M | {'8645890': 1, '17600351': 1, '23026629': 1, '10943231': 1, '21475067': 1, '21680166': 1, '19295324': 1, '11839344': 1, '17526993': 1, '15575053': 1, '20557332': 1, '21846890': 1, '17763390': 1, '18434899': 1, '21094837': 1, '15226218': 1, '24385997': 2} | {} |
164,932 | 3875703-1 | 24,385,998 | noncomm/PMC003xxxxxx/PMC3875703.xml | Large Thrombus Formation from Right Atrial Incision Site after Closure of Atrial Septal Defect | A 24-year-old female patient with a history of primary repair for ASD performed 8 years ago admitted to our clinic for her annual checkups. In her previous primary repair surgery, the defect was closed directly with an atriotomy incision followed by 5/0 polypropylene and 4/0 polypropylene sutures. The patient had attended her ensuing controls every three months for a period of one year, and no pathological findings were identified during this period. There was no history of any drugs being used recently. Physical examination was normal, and routine hematological and biochemical laboratory analysis were within normal levels. Electrocardiogram revealed normal sinus rhythm and right bundle branch block. Transthoracic echocardiography (TTE) revealed normal left ventricular systolic functions, mildly dilated right chambers, minimal mitral regurgitation, mild tricuspid regurgitation, systolic pulmonary artery pressure of 30 mm Hg, and an irregular-shaped mass in the right atrium. On her transesophageal echocardiography (TEE) examination, a 3.7×3.5 cm sized giant pedunculated mobile mass was observed being attached to the septum in the right atrium (). After the procedure, the patient was hospitalized. Chest computed tomography (CT) showed no evidence of pulmonary embolism, and ventilation/perfusion scans indicated no problems. Protein C, protein S, and antithrombin III levels were within the normal range. Venous bilateral Doppler of lower extremity and abdominal ultrasonography results were normal. The patient was scheduled for excision of the mass. Surgery was performed via a median sternotomy by utilizing the cardiopulmonary bypass. Venous drainage was via the superior vena cava and the right femoral vein. The right atrium was being opened, and a large mass filling the entire atrium and obstructing the tricuspid valve was observed. The mass was intimately attached to the free atrial wall, it was irregularly-shaped, and 2.2×4.1 cm in dimension. It had a tanned, gelatinous appearance, and showed multifocal areas of calcification. The entire free wall of the right atrium mass was resected. The patient was weaned off with cardiopulmonary bypass without any difficulty. The mass consistent with thrombus formation originating from the suture line was excised (). Histopathological evaluation was consistent with the organized thrombus. | [[24.0, 'year']] | F | {'30746330': 2, '18997169': 1, '10456727': 1, '5792972': 1, '19156241': 1, '17954102': 1, '11174437': 1, '12859367': 1, '10351972': 1, '11897451': 1, '7570449': 1, '3365048': 1, '8054802': 1, '24385998': 2} | {'3875703-2': 2, '6341848-1': 1} |
164,933 | 3875703-2 | 24,385,998 | noncomm/PMC003xxxxxx/PMC3875703.xml | Large Thrombus Formation from Right Atrial Incision Site after Closure of Atrial Septal Defect | A 42-year-old female, without cardiac complaints, was admitted to our clinic presented with chest discomforts, one month history of exertional dyspnea and persistent dry coughs. She had a history of primary ASD repair 3 years ago, and quitted routine follow-ups. In her previous primary repair surgery, the defect was closed directly with an atriotomy incision followed by 5/0 polypropylene and 4/0 polypropylene sutures. The patient had attended her ensuing controls every two months for a period of one year, and no pathological findings were identified during this period. Biochemical and hematological values were within normal limits. Cardiovascular examination was normal and no pathologic sounds or murmurs were detected. The patient was in normal sinus rhythm and not on any medications. Chest examination elicited few scattered crepitations bilaterally. An image from contrast-enhanced CT pulmonary angiogram demonstrated multiple bilateral pulmonary emboli. TTE revealed normal left ventricular systolic functions, heart chambers within normal size, and a mass in the right atrium. On TEE examination, a 3.2×2.4 cm mobile and irregularly-shaped mass was observed in the right atrium. The patient's bilateral Doppler of lower extremity, abdominal ultrasonography, and hypercoagulability screening panel was negative. Excision of the mass with redo sternotomy was decided for treatment. During the surgery, exploration of the right atrium revealed a 3.2×2.3 cm globular mass with a tanned, gelatinous appearance and multifocal areas of calcification. The mass was attached to the free wall of the right atrium by a 1-cm stalk. This mass originating from the free wall of the right atrium was then excised and its histological examination later revealed it to be an organized thrombus. Both patients had uneventful postoperative courses, and were discharged with warfarin (international normalized ratio: 2-3) combined with acetylsalicylic acid therapy on postoperative seventh and sixth day, respectively. The TTE and TEE showed no thrombus after 6 months of follow-up for both patients. | [[42.0, 'year']] | F | {'30746330': 2, '18997169': 1, '10456727': 1, '5792972': 1, '19156241': 1, '17954102': 1, '11174437': 1, '12859367': 1, '10351972': 1, '11897451': 1, '7570449': 1, '3365048': 1, '8054802': 1, '24385998': 2} | {'3875703-1': 2, '6341848-1': 1} |
164,934 | 3875704-1 | 24,385,999 | noncomm/PMC003xxxxxx/PMC3875704.xml | A Case of Partial Congenital Pericardial Defect Presenting as Acute Coronary Syndrome | A 61-year-old man visited our hospital with the chief complaints of chest pain on exertion and an intermittent chest pain that was aggravated when he rested in a left decubitus position. He had risk factors for coronary artery disease: dyslipidemia, hypertension, and diabetes. He also had a history of chest trauma, a left rib fracture that occurred in a traffic accident 15 years previously. An initial evaluation of his chest radiograph showed levoposition of his heart and an unusual cardiac contour with a bulging left ventricle (). An electrocardiography showed an incomplete right bundle branch block and a clockwise rotation in the precordial leads. An echocardiography showed an estimated left ventricular ejection fraction of 50-55%, with regional wall motion abnormalities of the basal to mid inferior and inferolateral walls. It also showed a focal external compression of the basal posterolateral wall. His serum troponin-T level was also slightly elevated (0.023 ng/mL). As he had coronary risk factors including elevation of the serum troponin-T level and complained of chest pain on exertion with echocardiographic regional wall motion abnormalities, we performed early elective coronary angiography without noninvasive testing. The angiogram showed two-vessel coronary artery disease involving the left anterior descending artery (LAD) and left circumflex artery (LCX), with a geographically circumferential phasic diastolic compression of three obtuse marginal branches, right ventricular branches, and the posterior descending artery (PDA) ().\nAt first, we considered stenting the LAD as the significant culprit lesion. However, there was a possibility that phasic diastolic obstruction of the epicardial coronary arteries could have caused the chest pain. This feature was consistent with the echocardiographic findings showing regional wall motion abnormalities of the LCX and right coronary artery territories. In addition, a geographically circumferential phasic diastolic compression of the coronary arteries like myocardial bridging suggested a linear extracardiac constriction like a band strangulating the heart between the basal and the mid-ventricular level. Because he had a previous chest trauma history, there was a possibility that cicatrical changes could have caused extracardiac constriction. We decided against performing percutaneous coronary intervention for the mid-LAD lesion. Therefore, to confirm our assumption, a computed tomography (CT) was done, which showed a left-sided movement of the heart, adherence of the heart to the chest wall, and a partial pericardial defect around the mid-ventricular level with strangulation of the mid-LAD, LCX, and PDA (). There was no specific intracardiac abnormality other than the pericardial defect on cardiac CT. Myocardial single photon emission computerized tomography was also done and it showed a reversible perfusion defect at the mid anterior, entire anterolateral and mid inferolateral walls.\nThe operative findings revealed a partial congenital pericardial defect just around the middle ventricular level. Both ventricles were herniated to the left pleural cavity, and there was no epicardial adhesion or scar change. There were also multiple coronary arteries strangulated on the epicardial surface of both ventricles caused by the thickened hard circumferential pericardial edge (). The anterior portion of this band-like thickened pericardial edge was excised in order to release the external compression of multiple coronary arteries. The posterior portion of the pericardial edge was left to prevent phrenic nerve injury. An off-pump coronary artery bypass surgery (CABG) of the left internal thoracic artery (free graft to ascending aorta) to the mid-LAD was done concomitantly considering the presence of significant stenosis with heavy calcification of the mid-LAD, which can cause ischemia.\nAfter the CABG with partial pericardiectomy, a follow-up coronary angiogram was performed to evaluate the possibility of remaining strangulation by chronic cicatricial changes of the epicardium beneath the thickened hard circumferential pericardial edge, but there was no finding of previous dynamic obstruction of the coronary arteries (). A follow-up transthoracic echocardiography was also done and the regional wall motion abnormalities and external compression which were observed in the previous study were no longer seen. The patient was discharged without complications, and he is currently symptom free. | [[61.0, 'year']] | M | {'14107223': 1, '32076559': 1, '11603467': 1, '7710755': 1, '15258691': 1, '2617506': 1, '10026367': 1, '24385999': 2} | {} |
164,935 | 3875847-1 | 24,386,602 | noncomm/PMC003xxxxxx/PMC3875847.xml | Radiological anatomical consideration of conjoined nerve root with a case review | A 71-year-old man presented with acute low back pain and radiating pain in the right leg, with a positive straight-leg raising sign at 30°. He had a history of minor trauma suggestive of a lumbar sprain. His symptoms had gradually worsened, and he was unable to walk due to aggravation of pain in the back and leg upon standing or walking. On manual muscle testing, muscle weakness was not detected in the extremities. His patellar tendon reflexes were normal. On neurological examination, L5 nerve root compression was identified. On plain lumbar spine radiographs, spinal abnormalities, except for spondylolisthesis, were difficult to detect. Slight disc space narrowing at L4-5 was noted in lateral view (). Computed tomography showed no definite bone abnormalities. MRI revealed disc herniation at both root exits at the L4-5 intervertebral disc level (). Based on these observations, we diagnosed the patient with spondylolisthesis and lumbar disc herniation at L4-5.\nIntraoperatively, disc sequestration was noted, and the herniated disc was found to be incarcerated to the adjacent conjoined L5 nerve roots. Upon further investigation, we discovered that the L5 nerve root originated from the caudal level of the L5 pedicle and was conjoined with the S1 nerve root (). The disc herniation at L4-5 migrated bilaterally and was found beneath the abnormal conjoined nerve roots. After removal of the disc herniation and unroofing of the nerve root, we did not observe any obvious mobility of the conjoined nerve root. After surgery, the patient's leg pain immediately disappeared and no muscle weakness was recorded. Upon retrograde imaging review, we observed several signs of conjugated nerve roots on routine MRI images (): the "sagittal shoulder sign," a vertical structure connecting two consecutive nerve roots and the overlying herniated disc on the parasagittal MRI which represents a combination of a protruded or extruded disc adjacent to a conjoined nerve root; "corner sign," asymmetric structure of the anterolateral corner of the dural sac with one side being angulated compared with the other; "fat crescent sign," the presence of extradural fat between the conjoined nerve root and the asymmetric dural sac; and "parallel sign," an unusual course of the entire nerve root at the disc level, running parallel to the disc plane. | [[71.0, 'year']] | M | {'15260089': 1, '22749652': 1, '8460568': 1, '18087746': 1, '18157722': 1, '26113909': 1, '8355852': 1, '20602242': 1, '7085697': 1, '7054404': 1, '16565781': 1, '24386602': 2} | {} |
164,936 | 3875849-1 | 24,386,604 | noncomm/PMC003xxxxxx/PMC3875849.xml | Right sided descending and sigmoid colon: its embryological basis and clinical implications | During a routine cadaveric dissection at the Department of Anatomy, Lady Hardinge Medical College and SSK Hospital, New Delhi, India, the abdomen of a 54-year-old man of Indian origin showed a right-sided descending colon and sigmoid colon loop with a common mesentery. The colon was carefully dissected. The morphology was studied in detail with special reference to its position, attachment of sigmoid mesocolon, and location of other viscera close to the sigmoid colon.\nFor convenience of description, the anomalous colon was divided into four parts (). The first part stretched obliquely from the splenic flexure to the right side along the root of the mesentery, traversing the umbilical quadrant, 3.5 cm to the right of midline at the level of L5. The second part turned upward and toward the right, ascending up to the level of L2. The third part descended obliquely on the right side of the ascending limb up to the pelvic brim. The fourth part was in the lesser pelvis extending from the right sacroiliac joint to third sacral body ().\nThe first part of the colon with its oblique course was related posteriorly to the anterior surface of left kidney and suprarenal gland (obliquely from left to right), gonadal vessels, and lateral end of renal vessels. It continued to descend obliquely and crossed the midline in front of the bifurcation of the aorta. On the right side just above the pelvic brim, it was related posteriorly to the right common iliac vessels, ureter, gonadal vessels, and psoas major. The cecum, appendix, and ileocecal junction were posterior to the second part of the colon in the right lumbar region, 3.5 cm above the transtubercular plane (). The third part was in the right iliac fossa related to the psoas major and iliacus muscle, posteriorly. The fourth part was anterior to the right ureter, and external and internal iliac vessels, at the pelvic brim. Within the lesser pelvis, the fourth part was related to the piriformis and superior rectal artery posteriorly.\nThe inferior mesenteric artery (IMA) supplied this anomalous colon and had an unusual course. It was found to arise 3.5 cm below the lower border of the horizontal part of duodenum. In front of the aortic bifurcation, the IMA turned to the right instead of the left, crossing the right common iliac artery, lying medial to the right ureter, with the inferior mesenteric vein on its left (). It gave off the following three branches: The first branch (left colic artery) supplied the proximal segment of the first part of the anomalous colon forming a marginal artery. The distal segment of the first part was supplied by the second branch of the IMA (superior sigmoid artery). The second, third, and fourth parts of the colon were supplied by the inferior sigmoid branch of the IMA, which arose from the right side of the IMA instead of the left (). | [[54.0, 'year']] | M | {'6992309': 1, '21897567': 1, '11824134': 1, '1816717': 1, '29655020': 1, '11274541': 1, '25548728': 1, '21480385': 1, '615801': 1, '6332483': 1, '32111788': 1, '33867645': 1, '27134852': 1, '31711517': 2, '15264041': 1, '27574354': 1, '20014390': 1, '24386604': 2} | {'6849268-1': 1, '6849268-2': 1} |
164,937 | 3875887-1 | 24,409,446 | noncomm/PMC003xxxxxx/PMC3875887.xml | First Report of Pharyngostomy Wound Myiasis Caused by Chrysomya bezziana (Diptera: Calliphoridae) in Iran | A 3-year-old girl who resides in a rural area in Sirik District, Hormozgan Province, south of Iran referred to the Pediatric Hospital in Bandar Abbas, in July 2011. She ingested aluminum hydroxide powder by accident. Patient underwent flexible pediatric endoscopy by a gastroenterologist on arrival, which showed severe burns of oral cavity and esophagus. She received anti-secretory agent, antibiotics, and hydrocortisone. Physicians devised a pharyngostomy tube in right side of her neck by number 32 mushroom catheter and the esophagus was closed by a prolene mesh plug which completely was filled with cyanoacrylate glue to prevent swallowing of saliva ().\nNine months after the first diagnosis, the patient referred to hospital for pharyngological follow-up. During examination of the patient, with a lateral motion of the flange of the pharyngostomy tube, many larvae observed between the tube and the pharyngeal wall. The lesion was macroscopically cleared of visible larvae by mechanical removal. The procedure had to be repeated three more times to extract all larvae. A total of 23 third-instar larvae were collected from the patient, the bed and the floor of the ward. The patient received antibiotics, anti-secretory agent and then transferred to surgical ICU for respiratory care.\nLarvae were preserved in 70% methanol and sent to the Entomology Laboratory, School of Health, Hormozgan University of Medical Sciences for identification. The larvae were 12–15 mm long, whitish and without prominent papilla. Other morphological characters of the specimens included, open peritreme, slightly pigmented tracheal trunks, posterior margin of segment 11 with dorsal spines, anterior spiracles with 4–6 papillae, and each posterior spiracles encircled by a heavily sclerotised peritreme which is incomplete ventrally and with 3 slit-like spiracular opening at about 45 degrees to the horizontal (). The full grown larvae were identified using the morphological characters based standard key (). | [[3.0, 'year']] | F | {'25843573': 1, '19059829': 1, '20883399': 1, '14660813': 1, '19335830': 1, '1542979': 1, '10761570': 1, '15958023': 1, '2519672': 1, '18485982': 1, '21122252': 1, '1313617': 1, '26114125': 1, '1529507': 1, '22243525': 1, '22454736': 2, '22808374': 2, '31618203': 1, '24409446': 2} | {'3306096-1': 1, '3385523-1': 1} |
164,938 | 3875963-1 | 24,346,924 | noncomm/PMC003xxxxxx/PMC3875963.xml | Allogeneic hematopoietic stem cell transplantation in mycosis\nfungoides | A 44-year-old white woman observed an erythema in the sternal region that progressed to\ninvolvement of the whole body in the form of urticarial plaques. The picture remained\nstable with topical and systemic steroids for eight years. Progression was observed with\nelevated and pruritic patches and plaques with purulent discharge from secondary\ninfection on an extensive portion of the body surface.\nWhen the patient came to our service, we performed a skin biopsy with\nimmunohistochemistry that revealed cutaneous lymphoproliferative disease compatible with\nanaplastic large T-cell lymphoma focally CD30+ or Histiocytic sarcoma. Bone marrow\nbiopsy was normal. CHOEP (cyclophosphamide, doxorubicin, etoposide, vincristine and\nprednisone) chemotherapy was initiated, totaling eight cycles, with minimal initial\nresponse in plaques and pruritus, but reappearing at the end of the eighth cycle. A new\nskin biopsy showed cutaneous T-cell lymphoma with epidermotropism, CD45+ and CD3+\n(suggesting MF). Staged as IIB (T3-N0-M0), with 80% affected area, and presenting the\nmost advanced lesions in the trunk, breasts and legs.\nSubcutaneous interferon 3,000,000U was initiated, three times a week, gradually\nincreasing to 12,000,000U and radiotherapy in tougher skin areas in the right groin.\nMajor improvement of the lesions was obtained with interferon, but this had to be\nsuspended because of non-hematological toxicity and disease progression. Gemcitabine,\n1000mg/m² per week, was initiated. There was a significant regression of lesions, but\nrecurrence was noticed at the end of the sixth cycle.\nHer condition progressively worsened despite partial and temporary improvements with the\nvarious treatment modalities. The patient's skin was diffusely infiltrated ( and ) with patches, plaques, and tumors. The patient was referred to Euryclides de\nJesus Zerbini Transplants Hospital, in São Paulo, and a reduced-intensity conditioning\n(RIC) allogeneic HLA matched sibling transplant was performed. After conditioning with\nfludarabine and melfalan she received peripheral blood stem-cells from her brother.\nGraft-versus-host-disease (GVHD) prophylaxis was done with mycophenolate mofetil and\ncyclosporine.\nEngraftment took place on D+11 and the patient was discharged from the hospital on D+14,\nwith complete remission. Skin biopsy of residual hyperpigmented patches () showed GVHD without evidence of lymphocyte\natypia. The patient has been in complete remission ( and ) for more than one year\nwithout treatment or any signs of GVHD, and peripheral blood mononuclear cells are 100%\ndonor. | [[44.0, 'year']] | F | {'22258991': 1, '19589488': 1, '23197199': 1, '16135483': 1, '20697072': 1, '10768649': 1, '21252059': 1, '3379722': 1, '17275192': 1, '12873880': 1, '24346924': 2} | {} |
164,939 | 3875965-1 | 24,346,874 | noncomm/PMC003xxxxxx/PMC3875965.xml | Primary systemic amyloidosis, acquired cutis laxa and cutaneous mucinosis\nin a patient with multiple myeloma | A fifty-seven year old, female informed the presence of bilateral eyelid hyperchromia\nfor the last fifteen years, followed by an increase in palpebral volume that started\nthree years after the first symptoms. Six years ago, she observed cutaneous laxity in\nskin-fold areas and bilateral palpebral ptosis. In the last four years, the patient\nreports pain and paresthesia in a stocking-like pattern affecting the lower limbs. The\npatient denied any familial history of cutaneous lesions.\nShe had a previous history of bilateral carpal tunnel syndrome and blepharoplasties\nperformed in two different occasions, 2008 and 2009.\nDermatologic examination of eyelids showed hyperchromia, increase of local volume,\ncutaneous laxity and bilateral ptosis with periorbital ecchymoses (). We observed cutaneous laxity, hyper-chromic papules and\ncomedones over the skinfolds, such as the armpits, cervical and inframammary regions\n(). Biopsies of both axillary and\npalpebral lesions were performed.\nHistopathological examination of the axillary lesion did not show any significant\nalteration with hematoxiline-eosine stain, detecting only one epidermic cyst,\ncorresponding to the observed papule. Orcein staining showed the fragmentation of\nelastic fibers and von Kossa staining was negative, i.e., without evidence of calcium,\nthus establishing the diagnosis of acquired cutis laxa ().\nHistological exam of the palpebral material showed an amorphous eosinophilic substance,\nlocated on the superior and vascular dermises, positive for red Congo staining and with\ngreen birefringence to polarized light, which confirmed the diagnosis of amyloidosis\n().\nLaboratory exams demonstrated normocytic and normochromic anemia, an inversion of the\nalbumin-globulin ratio, IgG-Kappa monoclonal gammopathy, Bence-Jones proteinuria and 40%\nof plasma cells in the bone marrow specimen, prompting a diagnosis of multiple myeloma.\nThe patient evolved with citrine-content blisters on the inframammary region. A plaque,\nwith severe edema, located on the left arm was biopsied, showing dermic edema with\nmoderate fibroblast proliferation, some of which were stellate ( and ). Colloidal\niron staining determined the presence of mucin, and the diagnosis of papular mucinosis,\nwhich was not in agreement with the clinical presentation, thus making it difficult to\nclassify the disease in this case ( and\n). A negative result for red Congo stain\ndiscarded bullous amyloidosis.\nThe final diagnoses were, accordingly, primary systemic amyloidosis, acquired cutis laxa\nand cutaneous mucinosis, all dermatologic manifestations associated to MM. | [[57.0, 'year']] | F | {'2470799': 1, '32099688': 2, '16476341': 1, '11868975': 1, '8727781': 1, '25831005': 2, '22481660': 1, '12048699': 1, '24346874': 2} | {'7037480-1': 1, '4371684-1': 1} |
164,940 | 3875966-1 | 24,346,916 | noncomm/PMC003xxxxxx/PMC3875966.xml | Epidermodysplasia Verruciformis in a young man with HIV since birth -\nCase report | 22-year-old male reporting non-pruriginous lesions which appeared in the pre-adolescent\nperiod, initially on the neck, with later dissemination. He denied relatives with a\nsimilar condition and consanguinity between his parents. HIV was present since birth,\nand the patient was under non-regular treatment with antiretroviral drugs.\nDermatological examination showed isolated flat and some confluent, erythematous\npapulae, discreetly desquamative on the neck, trunk, and limbs. (-)\nLaboratory examinations showed positive anti-HIV, CD4: 84; Viral Load: 4.188.\nThe histopathological examination revealed wide grayish-blue keratinocytes with pyknotic\nnucleus on the upper third of the epiderm. These findings were compatible with EV.\n( and )\nThe in situ hybridization was negative to the\n6-1116-18-31-33-35-39-45-51-52-56-58-59-68 HPVs. These were not present in the EV, thus\nallowing an accurate diagnosis to be made.\nTreatment with oral acitretine was proposed but the patient missed follow-up at our\ndermatology clinic. | [[22.0, 'year']] | M | {'19281706': 1, '2990354': 1, '22474219': 2, '22068772': 1, '24346916': 2} | {'3334361-1': 1} |
164,941 | 3875967-1 | 24,346,912 | noncomm/PMC003xxxxxx/PMC3875967.xml | Pyoderma gangrenosum: skin grafting and hyperbaric oxygen as adjuvants in\nthe treatment of a deep and extensive ulcer | A fifty year-old male presented with an erythemato-violaceous nodule on the anterior\npart of the left leg, which evolved to an ulcer with local pain after a surgical\nintervention. After three surgical debridements and progressive worsening of the ulcer,\nhe was referred to the emergency room of a tertiary hospital. Physical examination\nshowed a deep and extensive ulcer on the left leg, with exposure of muscular tissue and\nareas of purulent secretion and necrosis; the borders were altered by the recent\nsurgical intervention ().\nAfter the exclusion of vascular and infectious causes, and based on clinical and\nhistological findings, the diagnosis of pyoderma gangrenosum (PG) was established (). The patient responded well to the therapy\ninitially started: antibiotics for the secondary infection and immunosuppression with\ncorticosteroid in a dose equivalent to 1mg/kg/day prednisone. Considering the extension\nof the lesion and the aggressive behavior of the disease, azathioprine was introduced\nearly on, 20 days after the start of the corticosteroid therapy, with the goal of\nweaning from the corticosteroids in a medium time frame. Because of the wound extension,\nHBO was introduced concomitantly, to help in the cicatrization process. Forty-five days\nafter treatment beginning, there was a prominent superficial neovascularization on the\nulcer ().\nCorticosteroid therapy was maintained until significant improvement in the aspect of the\nlesion was achieved, followed by a slow and gradual reduction of dosage after 40 days of\nuse, and complete suspension 90 days after the medication was introduced.\nDue to incomplete re-epithelization of the wound, and considering its large dimensions\nand the presence of well-vascularized granular tissue, we opted, five months after the\nstarting of the treatment, for a partial autologous skin graft on the ulcer bed. The\ngraft was performed whilst the patient was still receiving azathioprine and HBO. There\nwas graft take and complete closure of the wound ( and ). The patient is still using\nazathioprine, and in 10 months of follow-up did not have relapses or complications.\nThe final diagnosis of ulcerative PG without subjacent disease was established after\nextensive complementary investigation, after excluding intestinal inflammatory diseases,\nhematologic and rheumatologic illnesses and neoplasia. | [[50.0, 'year']] | M | {'23106966': 1, '34900493': 2, '30024539': 1, '30564995': 1, '22281912': 1, '19470075': 1, '19903431': 1, '21276167': 1, '3543980': 1, '32320362': 1, '31392345': 1, '22356259': 1, '18189061': 1, '24346912': 2} | {'8649613-1': 1} |
164,942 | 3875968-1 | 24,346,891 | noncomm/PMC003xxxxxx/PMC3875968.xml | Granuloma faciale: a rare disease from a dermoscopy perspective | Male patient, 40 years old, referred an erythematous-edematous asymptomatic lesion in\nthe right malar region for 4 years. He denied other skin lesions, systemic symptoms and\ncomorbidities. He was using topical steroids (betamethasone dipropionate 0.05% cream)\nand prednisone 60 mg / day for 2 months. Physical examination showed erythematous\nplaque, infiltrated, on the right malar region, with prominent follicular orifices,\nassuming a "peau d'orange" appearance. ().\nThe dermoscopic examination showed a pink background, with some areas blackened, white\nstriations in different directions and prominent follicular orifices ().\nHistopathological examination showed intense mixed inflammatory infiltrate of\nmicronodular aspect, composed of lymphocytes, histiocytes, neutrophils and numerous\neosinophils. The described infiltration had not reached the subepidermal region (Grenz\nzone) and there was no evidence of vasculitis (). Immunohistochemistry suggested polyclonality (CD3 +, CD4 +, CD8 +, CD30\n+).\nGF was diagnosed based on clinical examination, dermoscopy and histopathological\naspects. Laboratory tests were within normal limits, and ANA (antinuclear factor), VDRL\n(Venereal Disease Research Laboratory) and smear lymph, negatives. Dapsone was\nprescribed 100 mg / day. Intralesional corticosteroid and prednisone were suspended. The\npatient returned after nine months of treatment with partial improvement (). | [[40.0, 'year']] | M | {'15280847': 1, '20040253': 1, '25876839': 1, '20579460': 1, '19060460': 1, '14511001': 1, '20375489': 1, '26752188': 1, '27613297': 1, '22353159': 1, '19289790': 1, '26752060': 1, '26560220': 2, '30066773': 1, '34430492': 1, '29599681': 1, '22309198': 1, '24346891': 2} | {'4631240-1': 1} |
164,943 | 3875969-1 | 24,346,889 | noncomm/PMC003xxxxxx/PMC3875969.xml | Nodular fasciitis on the zygomatic region: a rare presentation | A 24-year-old, brown-skinned female presented with a nodule on the right zygomatic\nregion, of progressive growth for 3 months, without previous traumas, inflammatory\nprocesses or local symptoms.\nPhysical examination revealed a nodule measuring around one centimeter in diameter, of\nfirm consistency, regular shape and movable in relation to the skin and deep tissues. No\nlymphadenomegaly was observed. Patient was in good health, with no evidence of systemic\ninvolvement. Main diagnostic hypotheses were epidermoid cyst, trichilemmal cyst and\npilomatrixoma.\nExcisional biopsy was carried out and macroscopically pointed to a irregularly-shaped\nwhite-yellow mass 1.0 x 0.6 cm in diameter ().\nHistopathological examination showed a non-encapsulated proliferation of mesenchymal\ntissue with irregular edges and spiky contours, extending from the dermis to hypodermis.\nThe lesion consisted of thin spindle cells forming bundles in several directions,\ninterposed by thick and hyaline collagen fibers, without cell atypias. Areas of myxoid\naspect, extravasation of erythrocytes and discrete lymphoid infiltrate were also\nobserved. ()\nImmunohistochemical studies were performed with antibodies to CD34, desmin,\nmuscle-specific actin (HHF35), smooth muscle actin (SMA) and Ki-67. The lesion\ndemonstrated immunopositivity for HHF35 and SMA and was slightly positive for Ki-67\n( to ).\nClinical, anatomopathological and immunohistochemical findings taken together led to the\nconclusion that the excised lesion was nodular fasciitis. | [[24.0, 'year']] | F | {'19469872': 1, '19949508': 1, '26719638': 1, '22858790': 1, '5519024': 1, '24346889': 2} | {} |
164,944 | 3875970-1 | 24,346,876 | noncomm/PMC003xxxxxx/PMC3875970.xml | Acral pseudolymphomatous angiokeratoma: case report and literature\nreview | White, female patient, aged 11, complaining of "small lumps on the left wrist since the\nage of two". The dermatological exam revealed erythematous-violaceous papules on the\nleft wrist, which appeared fainter during the vitropression test (). The condition had been evolving for 9 years, without any\nchanges in clinical characteristics, local symptomatology or previous trauma. The\nhistopathological exam revealed an integral epidermis without atypia; and, in the\ndermis, inflammatory infiltrate of superficial and deep, perivascular location, around\nthe pilo-erector muscles, hair follicles, eccrine glands and nerves ( and ). The infiltrate was made up of lymphocytes, some histiocytes, a moderate\nnumber of plasmocytes and small basophilic granulations in the cytoplasmas of the\nhistiocytic cells. Infiltration was noticed in the hypodermal lobules. The search for\nalcohol-acid resistant bacilli using the Ziehl-Neelsen staining procedure culminated in\na negative result. In regard to the inflammatory infiltrate, abundant in plasmocytes, a\nclinical and laboratory investigation was conducted to rule out leishmaniasis and\nsyphilis, with the following findings: non-reactive VDRL and FTA-Abs results (). Surveys for micobacteria, treponema and\nleishmania, by immunohistochemistry, produced negative results. In addition: hemogram,\nhepatic and renal function, ESR, dosage of immunoglobulins and protein electrophoresis,\nwithout changes.\nThus, total excision of the lesions was initiated, to diagnostic and therapeutic ends.\nThe histopathological exam revealed the same histopatholoogical pattern as before. The\nimmunohistochemical study of the biopsy material revealed histological characteristics\nof dermal lymphoid proliferation of small, perivascular and adnexal, T and B\nlymphocytes, with a low proliferative index ( and ).\nThe patient is undergoing outpatient follow-up, with no signs of recurrence at present. | [[11.0, 'year']] | F | {'11531852': 1, '34449607': 1, '12100634': 1, '20465644': 1, '2241217': 1, '11712061': 1, '23169421': 1, '24346876': 2} | {} |
164,945 | 3875971-1 | 24,346,872 | noncomm/PMC003xxxxxx/PMC3875971.xml | Exacerbation of recalcitrant cutaneous sarcoidosis with adalimumab - a\nparadoxical effect? A case report | A 50-year-old female was observed due to erythematous, infiltrated, sometimes ulcerated\nplaques, on the frontal and left preauricular areas lasting for 2 years. (). The patient had high blood pressure and\nwas treated with bisoprolol 5mg/day.\nThe plaque on the left preauricular area was biopsied. Biopsy was performed showing\ndermal granuloma, without central caseous necrosis and numerous Langhans multinucleated\ngiant cells. () Acid-fast bacteria stains\nwere negative as well as tissue cultures for mycobacteria, bacteria and fungi.\nInfectious etiology was excluded and the diagnosis of cutaneous sarcoidosis was made.\nExcept for cutaneous involvement, the patient was in good health with no systemic\nsymptoms. Further evaluations included a complete blood cell count and complete\nmetabolic panel, both of which revealed no significant abnormal findings.\nC-reactive-protein, angiotensin-converting-enzyme (ACE) and calcium were in the normal\nrange. Further investigation for systemic involvement was negative. Local therapy with\ntopical and intralesional corticosteroids (momethasone furoate and clobetasol propionate\ncreams; betamethasone dipropionate and betamethasone phosphate sodium aqueous\nsuspension, successively) and topical tacrolimus failed. Hydroxychloroquine sulfate (400\nmg daily), pentoxifylline (400 mg daily), methylprednisolone (up to 25 mg daily),\nazathioprine (100 mg daily) and methotrexate (up to 27,5 mg /week until cumulative dosis\nof 733 mg) produced no significant effect.\nLong-term treatment with systemic corticosteroids, azathioprine or methotrexate was felt\nto be unwarranted because of the risk of serious long-term sequelae. Treatment with\nadalimumab was proposed as an alternative to treatment with methotrexate.\nTuberculin skin test was performed before initiating the biological agent and revealed a\n1.1 millimeter papule. Therefore isoniazid (300mg/day) was started.\nMethotrexate was gradually tapered to 7.5 mg/week and methylprednisolone (4 mg/day) and\nthen stopped. Adalimumab (40 mg subcutaneously at week 1, 3 and 5) was started two\nmonths after the start of isoniazid. Adalimumab was then suspended (after the third\ninjection) because the lesions became more erythematous, infiltrated, ulcerated and\nassociated to retroauricular adenopathies (). Shortly after suspension, the lesions improved. | [[50.0, 'year']] | F | {'34680599': 1, '20831604': 1, '20477038': 1, '28223750': 2, '32389943': 1, '22106129': 1, '21677887': 1, '20185892': 1, '16243166': 1, '29433571': 2, '33108647': 1, '29892670': 1, '21635863': 1, '19468200': 1, '19337437': 1, '24346872': 2} | {'5318531-1': 1, '5810034-1': 1, '5810034-2': 1, '5810034-3': 1} |
164,946 | 3875972-1 | 24,346,892 | noncomm/PMC003xxxxxx/PMC3875972.xml | Perforating granuloma annulare mimicking papulonecrotic tuberculid | A 19-year-old female patient was referred to the dermatologist because of lesions on the\nhands, elbows and knees of three-year duration. On examination, the patient presented\nerythematous papules, with a crusted umbilicated center, localized on the extensor\nsurfaces of the limbs and dorsal aspect of the hands. She also had some pustules on the\npalmar surface of the fingers ( and ).\nAs comorbidity, she has had a diagnosis of systemic lupus erythematous ten years\npreviously, conforming to the following criteria: discoid and malar rash,\nphotosensitivity, coarse speckled nuclear antinuclear antibody and thrombocytopenia. She\nhad previously been treated with oral corticosteroids, cyclosporine and\nmethylprednisolone pulse therapy. Over the last six years, the disease was controlled\nand maintenance therapy was being performed with hydroxychloroquine.\nSimultaneously to the skin changes, the patient had developed cervical adenomegaly,\noriginating a 5centimeters diameter conglomerate. Fine-needle aspiration diagnosed a\nchronic granulomatous lymphadenitis with caseous necrosis. Ziehl-Neelsen stain and\nculture of mycobacteria resulted both negative in the aspirate. The patient showed a\nstrong reaction to tuberculin (28mm), leading to the formation of bullae, necrosis and a\nresidual atrophic scar ().\nThe initial diagnostic hypothesis was papulonecrotic tuberculid secondary to lymph node\ntuberculosis.\nThe patient was referred to the infectology clinic and was started on antituberculous\npolychemotherapy standardized in Brazil, consisting of rifampicin, isoniazid,\npyrazinamide and ethambutol.\nHistopathology of the skin revealed a palisading granuloma in communication with the\nepidermal surface and constituting an area of perforation. The granuloma was surrounded\nby a peripheral infiltrate of histiocytes and lymphocytes and had a central area of\nmucinous degeneration of collagen. The absence of necrosis and vascular involvement and\nthe typical histological findings of perforating granuloma annulare undermined the\ninitial clinical hypothesis that this was papulonecrotic tuberculid (-).\nPCR-based detection of Mycobacterium tuberculosis resulted negative in\na sample of a palmar pustule.\nIn the first weeks of antituberculous therapy, new papules or pustules stopped\nappearing. After six months, complete regression of the adenomegaly and cutaneous\nlesions was observed, including the palmar pustules.\nThroughout the evolution of the disease and its treatment the patient showed no signs of\nlupus activity and remained on maintenance therapy with anti-malarial. | [[19.0, 'year']] | F | {'17376204': 1, '9199980': 1, '15569033': 1, '12063498': 1, '33911514': 2, '21603816': 1, '14616383': 1, '24346892': 2} | {'7992463-1': 1} |
164,947 | 3875973-1 | 24,346,882 | noncomm/PMC003xxxxxx/PMC3875973.xml | Congenital multiple clustered dermatofibroma and multiple eruptive\ndermatofibromas - unusual presentations of a common entity | A 12-year-old girl presented with a congenital asymptomatic cutaneous lesion on the\nright thigh. According to the patient, the lesion had been stable for years, but had\ngrown in the previous year and developed new papular areas. She was otherwise healthy\nand was on no regular medication. Physical examination revealed multiple firm\nred-to-brown papules measuring 5-8 mm in diameter, clustered on the lateral aspect of\nthe right thigh, some coalescing to form one large plaque. The lesions progressed to\nthe posterior aspect of the thigh in a linear arrangement (). A cutaneous biopsy was performed and histopathological\nexamination revealed a hyperplastic epidermis with hyperpigmentation of the basal\nlayer and a dermal proliferation of interlacing fascicles of spindle cells that\ndissociated the collagen ( and ). Immunohistochemistry tests were positive for\nvimentin and negative for α-actin, desmin and CD34. The diagnosis of congenital\nmultiple clustered dermatofibroma was made, and a conservative attitude was adopted,\nkeeping the patient under surveillance. | [[12.0, 'year']] | F | {'19758955': 1, '17498841': 1, '17097372': 1, '10809870': 1, '11122056': 1, '34449581': 2, '19614987': 1, '22211625': 1, '20520936': 1, '9920988': 1, '24346882': 2} | {'3875973-2': 2, '8395948-1': 1} |
164,948 | 3875973-2 | 24,346,882 | noncomm/PMC003xxxxxx/PMC3875973.xml | Congenital multiple clustered dermatofibroma and multiple eruptive\ndermatofibromas - unusual presentations of a common entity | A 42-year-old woman presented with a 3month history of rapidly-developing generalized\nbrown papules and nodules. She complained that some of these lesions were painful.\nHer past medical history included a Sjögren Syndrome diagnosed the previous year\n(xerophthalmia, xerostomia, positive anti-SSA antibodies, Schirmer test, salivary\nscintigraphy and minor salivary gland biopsy), for which she was on artificial tears\nand regular oral fluoride treatments. Physical examination revealed multiple (20-30)\nfirm brown papules and nodules of 5-15 mm in diameter, with positive dimple sign,\ndistributed on the trunk, upper and lower limbs ( and ). Histopathological\nexamination showed features similar to the ones found on the previous patient: a\nspindle cell proliferation in the dermis that dissociated the collagen, superimposed\nby a hyperplastic epidermis with hyperpigmented basal layer; these features were\ncompatible with a dermatofibroma. Laboratory tests revealed the changes expected to\nbe found in a patient with Sjögren's Syndrome - increased erythrocyte sedimentation\nrate (38 mm, normal 0-19), anti-SSA antibodies (240,0 U/µL, normal < 10) and\nantinuclear antibodies (1/640, normal < 1/80). The diagnosis of multiple eruptive\ndermatofibromas in a patient with Sjögren's Syndrome was made. Surgical excision of\nthe painful lesions was performed and the patient has been kept under\nsurveillance. | [[42.0, 'year']] | F | {'19758955': 1, '17498841': 1, '17097372': 1, '10809870': 1, '11122056': 1, '34449581': 2, '19614987': 1, '22211625': 1, '20520936': 1, '9920988': 1, '24346882': 2} | {'3875973-1': 2, '8395948-1': 1} |
164,949 | 3875974-1 | 24,346,926 | noncomm/PMC003xxxxxx/PMC3875974.xml | Use of the bilobed flap in the pubic region after tumoral lesion\nexcision | A fifty-one years old African-American female patient, working as a caregiver for an\nelderly patient, had clinic and histopathological diagnosis of HPV lesions in the pubic\nregion. During 18 months she was submitted to several sessions of electrocoagulation,\ncryotherapy and 5% imiquimod cream, without success. After a two-month absence, the\npatient returned reporting an accelerated growth of the lesion, which on examination\npresented as a tumoral lesion, measuring 5 cm in diameter, with regular, well-defined\nerythematous borders, and a verrucous yellow surface, painful to palpation ().\nThe patient was positive to human immunodeficiency virus (HIV) since 1996, in treatment\nwith antiretroviral drugs, with an undetectable viral load and a CD4 count over 1,000\ncells/ml.\nDue to the therapeutic resistance of the lesion, the co-infection by HIV, the\naccelerated growth and clinical characteristics of the injury, the hypothesis of\ntransformation to spinocellular carcinoma was suggested.\nAn excisional biopsy, with 3 mm security margins was performed. Histopathological\nexamination showed papillomatous epithelial hyperplasia associated to cytophatic viral\neffects, without cellular atypia, with free margins. The hypothesis of local malignant\nneoplasm was excluded, thus confirming the diagnosis of HPV.\nThe residual surgical defect had 6.8 cm in diameter and to reconstruct it a bilobed flap\nwas used, preserving the function, anatomy and the aesthetics of the pubic and genital\nareas ( and ).\nThe surgery was performed under local anesthesia with 2% lidocaine (4 ml), epinephrine\n1mg/ml (0.2 ml), sodium bicarbonate 8.4% (4 ml) and saline solution 0.9% (31.8 ml), plus\nperioperative application of 1 g intravenous cephazolin.\nAfter lobes flap transposition, it was necessary to add two compensatory triangles, the\nfirst one close to the right inguinal fold and the second one on the right suprapubic\nregion. The latter facilitated the closing of the flap on its proximal portion. The\nsimple, interrupted sutures, using 4.0-monofilament nylon were performed without\nresidual tension ().\nWith a satisfactory an uncomplicated postoperatory period, the drain was removed in 48\nhours and the sutures in 21 days. On the 13th month of ambulatory follow-up,\nthe patient remained without recurrent lesions (). | [[51.0, 'year']] | F | {'20606582': 1, '20946655': 1, '21603814': 1, '1848248': 1, '19110737': 1, '17113512': 1, '23242943': 1, '27252948': 2, '21169832': 1, '21490616': 1, '15620619': 1, '24346926': 2} | {'4627107-1': 1} |
164,950 | 3875975-1 | 24,346,925 | noncomm/PMC003xxxxxx/PMC3875975.xml | Propranolol for treatment of infantile hemangiomas | A 2-month-old girl born at term was referred to our clinic with a protuberant\nhemangioma on face, impinging on the superior right eyelid (). Propranolol was introduced, and the lesion reduced in\nsize and had largely healed within 6 months (). This infant had an eye examination and impairment of visual function,\nstrabismus, astigmatism or amblyopia were ruled out. At the age of 9 months, she\ndeveloped a red telangiectatic macula in the previous hemangioma area (). It is being planned to taper off\npropranolol after the child is 1 year and 6 months of age. | [[2.0, 'month']] | F | {'9789259': 1, '18794478': 1, '19840322': 1, '19106042': 1, '10403856': 1, '20055816': 1, '26528043': 1, '27747719': 2, '18550886': 1, '9361190': 1, '21569113': 1, '24346925': 2} | {'3875975-2': 2, '3875975-3': 2, '3875975-4': 2, '3875975-5': 2, '3875975-6': 2, '5005742-1': 1, '5005742-2': 1, '5005742-3': 1, '5005742-4': 1} |
164,951 | 3875975-2 | 24,346,925 | noncomm/PMC003xxxxxx/PMC3875975.xml | Propranolol for treatment of infantile hemangiomas | A 5-month-old boy born at term was referred to our clinic with a left arm hemangioma\nof 8.0 x 6.0 cm, presenting a lateral ulceration measuring 1.0 x 1.0 cm (). Despite management with gentamicin\nointment dressings, the ulceration failed to heal. One month later it became larger\nand started to bleed, causing pain and discomfort to the infant (). Propranolol was initiated at the age of 6 months and\nthere was a significant reduction in size of the ulcer within a week. Seven months\nlater, the deep component was much reduced and the superficial part healed (). It is planned to wean off propranolol\nwhen the child is at least 1 year and 6 months of age. | [[5.0, 'month']] | M | {'9789259': 1, '18794478': 1, '19840322': 1, '19106042': 1, '10403856': 1, '20055816': 1, '26528043': 1, '27747719': 2, '18550886': 1, '9361190': 1, '21569113': 1, '24346925': 2} | {'3875975-1': 2, '3875975-3': 2, '3875975-4': 2, '3875975-5': 2, '3875975-6': 2, '5005742-1': 1, '5005742-2': 1, '5005742-3': 1, '5005742-4': 1} |
164,952 | 3875975-3 | 24,346,925 | noncomm/PMC003xxxxxx/PMC3875975.xml | Propranolol for treatment of infantile hemangiomas | A 2-month old girl born at term was referred for management of a nasal IH, also known\nas "Cyrano's hemangioma" ().\nPropranolol was started and there was significant reduction in size and color of\nlesion within one month (). She is at\nthe sixth month of oral propranolol treatment, and the lesion is still improving\n(). | [[2.0, 'month']] | F | {'9789259': 1, '18794478': 1, '19840322': 1, '19106042': 1, '10403856': 1, '20055816': 1, '26528043': 1, '27747719': 2, '18550886': 1, '9361190': 1, '21569113': 1, '24346925': 2} | {'3875975-1': 2, '3875975-2': 2, '3875975-4': 2, '3875975-5': 2, '3875975-6': 2, '5005742-1': 1, '5005742-2': 1, '5005742-3': 1, '5005742-4': 1} |
164,953 | 3875975-4 | 24,346,925 | noncomm/PMC003xxxxxx/PMC3875975.xml | Propranolol for treatment of infantile hemangiomas | A 6-month old girl born at 35 weeks, was referred with a combined superficial and\ndeep segmental IH (S3 and S4 involvement of PHACES syndrome) (). Recently she underwent a successful cardiac surgery\nfor correction of an interventricular wall defect. We decided to investigate\nneurological and ophthalmological abnormalities, suspecting PHACES syndrome, and she\nwas diagnosed with strabismus. We started propranolol at 8 months, with a rapid\nimprovement of the hemangioma and strabismus within a month (). She was treated with propranolol until 1 year and 8\nmonths of age, and four months later, the hemangioma remains without signs of\nrecurrence (). | [[6.0, 'month']] | F | {'9789259': 1, '18794478': 1, '19840322': 1, '19106042': 1, '10403856': 1, '20055816': 1, '26528043': 1, '27747719': 2, '18550886': 1, '9361190': 1, '21569113': 1, '24346925': 2} | {'3875975-1': 2, '3875975-2': 2, '3875975-3': 2, '3875975-5': 2, '3875975-6': 2, '5005742-1': 1, '5005742-2': 1, '5005742-3': 1, '5005742-4': 1} |
164,954 | 3875975-5 | 24,346,925 | noncomm/PMC003xxxxxx/PMC3875975.xml | Propranolol for treatment of infantile hemangiomas | A 2-month-old girl born at 33 weeks was referred for treatment of a large facial\nhemangioma, with total occlusion of the left eye (). Ophthalmological examination revealed no abnormalities, and\npropranolol was introduced at this age. The lesion reduced in size and had largely\nhealed in 2 months (). She received\npropranolol until 1 year and 9 months of age, and 8 months later she remains free of\nthe hemangioma, with only a few residual telangiectasias (). | [[2.0, 'month']] | F | {'9789259': 1, '18794478': 1, '19840322': 1, '19106042': 1, '10403856': 1, '20055816': 1, '26528043': 1, '27747719': 2, '18550886': 1, '9361190': 1, '21569113': 1, '24346925': 2} | {'3875975-1': 2, '3875975-2': 2, '3875975-3': 2, '3875975-4': 2, '3875975-6': 2, '5005742-1': 1, '5005742-2': 1, '5005742-3': 1, '5005742-4': 1} |
164,955 | 3875975-6 | 24,346,925 | noncomm/PMC003xxxxxx/PMC3875975.xml | Propranolol for treatment of infantile hemangiomas | A 5-month-old girl born at term was referred for investigation of a "beard\nhemangioma", which was progressively increasing in size, causing deformity in the\nneck area (). There was no difficulty\nin breathing or hoarseness, but radiological exams were performed to rule out\ninternal hemangiomas, such as in the subglottic area. Ultrasound revealed parotid\ninvolvement of hemangioma, and the otorhinolaryngological examination was otherwise\nnormal. We started oral propranolol at this age, and 2 months later she showed great\nresponse with decrease of neck volume and of the hemangioma located over the\nmandibular area (). Its is planned to\nwean off propranolol when she is 1 year and 6 months of age. | [[5.0, 'month']] | F | {'9789259': 1, '18794478': 1, '19840322': 1, '19106042': 1, '10403856': 1, '20055816': 1, '26528043': 1, '27747719': 2, '18550886': 1, '9361190': 1, '21569113': 1, '24346925': 2} | {'3875975-1': 2, '3875975-2': 2, '3875975-3': 2, '3875975-4': 2, '3875975-5': 2, '5005742-1': 1, '5005742-2': 1, '5005742-3': 1, '5005742-4': 1} |
164,956 | 3875977-1 | 24,346,900 | noncomm/PMC003xxxxxx/PMC3875977.xml | Primary cutaneous anaplastic large-cell lymphoma - Case report | A woman, aged 57, female, from Campina Grande-PB, has had skin lesions since 2001. The\nlesions began as eczema located in upper and lower limbs that have evolved to a\nwidespread scaly and quite pruritic rash with papules and nodules which ulcerated and\nspontaneously regressed, leaving permanent hypochromic stains ( and ).\nShe did outpatient treatment with a specialist since the onset of disease, but she only\nreceived a definitive diagnosis in 2007 (after six years of evolution). Until the\ndiagnosis, she had been given oral antihistamines and topical steroids, without\nimprovement. She also needed hospitalizations for secondary infections.\nShe underwent three skin biopsies (in 2004, 2006 and 2007); the first two were not\nconclusive.\nThe lesion biopsy performed in 2007 showed infiltration of atypical lymphoid cells of\nmedium and large sizes in the superficial and reticular dermis and in the subcutaneous\ntissue with significant eosinophilia ()\nsuggesting the creation of a immunohistochemical panel for cancer that was positive for\nCD30 , CD3 and CD15 markers and negative for Ki67 and ALK.\nAs for the diagnosis, tomography of the chest showed several nodules scattered\nthroughout the parenchyma of both lungs ().\nTreatment was initiated with methotrexate in weekly doses and achieved good clinical\nresponse. | [[57.0, 'year']] | F | {'28225962': 2, '21552770': 1, '19548068': 1, '20026848': 1, '14639383': 1, '20669795': 1, '21841159': 1, '31700858': 2, '29369180': 2, '20043465': 1, '10845893': 1, '29177692': 1, '24346900': 2} | {'6827451-1': 1, '5794364-1': 1, '5312184-1': 1, '5312184-2': 1, '5312184-3': 1, '5312184-4': 1} |
164,957 | 3875978-1 | 24,346,901 | noncomm/PMC003xxxxxx/PMC3875978.xml | Primary cutaneous centrofollicular lymphoma with a good response to\nradiotherapy | A 45 year-old white male, previously healthy, presented infiltrated plaques and\ncoalescent nodules on the left parietal region one year ago. He reported history of\nlocal trauma six months before the onset of the lesion. He denied local or systemic\nsymptomatology (fever, night sweat or weight loss). On the dermatological exam were\nfound plaques and erythematous nodules of hard consistency, measuring about 8x4cm (). Palpable lymphadenopathy was absent. The\nhistopathological exam demonstrated a large diffuse dermal infiltrate that spared the\nepidermis, with a partial follicular component (). The infiltrate was composed of a population of central follicle cells,\npredominantly with multilobed nuclei, associated with large centroblasts and mixed\ncentrocytes and surrounded by a great quantity of small reactive T lymphocytes ( and ).\nImmunohistochemistry was positive for CD5 and CD20 and negative for CD30. After the\ncentrofollicular lymphoma diagnosis, the patient was referred for hematologic evaluation\nfor research on systemic disease, which was negative; the classification was TNM TxN0M0.\nHe was submitted to radiotherapy with 3,060 cGy in 17 fractions on the scalp lesion,\nwith the 9 MeV direct electronic fields technique for 25 days, with good local response. | [[45.0, 'year']] | M | {'10577681': 1, '20797521': 1, '14966086': 1, '31799268': 1, '18567836': 1, '10811681': 1, '24346901': 2} | {} |
164,958 | 3875979-1 | 24,346,919 | noncomm/PMC003xxxxxx/PMC3875979.xml | Classic Kaposi's sarcoma treated with elastic stockings and outpatient\nfollow-up of a 90-year-old patient | Female patient, 90 years old, of Italian descent, presented with a history of\nmaculo-papular, nodular, violaceous lesions in the middle third of her left leg for two\nyears, associated with swelling and heaviness in her lower limbs. With the suspicion of\nKaposi's sarcoma, biopsy was performed, and the diagnosis was confirmed by histology and\nimmunohistochemistry. The fact that she was HIV-negative and had no history of exogenous\nimmunosuppression led to the diagnosis of classic Kaposi's sarcoma.\nWe decided to use medium compression stockings and periodically monitored the patient.\nResults were satisfactory after 20 months. Although the total area affected increased,\nthere was a significant improvement of the edema, discrete reduction of lesion volume,\nwhich changed from plaques and nodules to macules, and the patient reported a marked\nimprovement of the symptoms (). | [[90.0, 'year']] | F | {'12716490': 1, '12609790': 1, '16848816': 1, '18615774': 1, '20098857': 1, '24346919': 2} | {} |
164,959 | 3875980-1 | 24,346,917 | noncomm/PMC003xxxxxx/PMC3875980.xml | Sacroiliitis after use of oral isotretinoin - association\nwith acne fulminans or adverse effect? | An 18-year-old male patient had the onset of acne 3 years ago, with worsening in the 40\ndays that preceded the examination at the outpatient clinic. He presented fever and\narthralgias for 7 days, more intense on the sternal region and left shoulder, associated\nwith pustules and confluent nodules which formed crusted erythematous plaques in the\nmalar region, with formation of fistulous tracts in the bilateral mandibular region,\nextending to the preauricular area with purulent secretion (). However, there were no thorax nor dorsum lesions.\nLaboratory exams showed leucocytosis 22,640/mm3 with 78.8% neutrophils,\nwithout hepatic or lipid profile alterations. The drugs in use (topic betamethasone,\ngentamicin and benzoyl peroxide) were suspended and dapsone 100mg/day and minocycline\n100mg/day prescribed for 21 days. With the clinical improvement and normalization of the\nhemogram, oral isotretinoin, 40mg/day (0.67mg/Kg/day) was prescribed. After 30 days\nthere was significant improvement of cutaneous lesions, with pustules more concentrated\non the perioral region, in addition to papules and erythema in the malar and mandibular\nregion, which already showed healing of the fistulous tracts (). At the same time, the patient reported intense lumbar\npain of quick progression, which prevented ambulation, resulting in hospitalization,\nsuspension of isotretinoin and use of analgesics and non-steroidal anti-inflammatory.\nThe lumbar spine radiography and MRI, performed during hospitalization, did not show\nalterations that could explain the clinical condition. After hospital discharge, the\npatient returned to the outpatient clinic using a wheelchair, and an orthopedic\nevaluation was requested. The non-steroidal anti-inflammatory was continued and a bone\nscintigraphy was requested. Bone scintigraphy, done after hospitalization, when the\npatient was already walking with the aid of crutches, detected the radiopharmaceutical\ntrapped in the sacroiliac articulations, which was conclusive for light bilateral\nsacroiliitis (). The HLA-B27 antigen was\nnegative. The patient maintained improvement of the articular condition, with\nprogressive recovery of ambulation after the use of orthesis and physical therapy. The\nacne condition presented excellent results with the use of oral isotretinoin for 30 days\nand after its suspension, benzoyl peroxide 5% associated with adapalene 0.1% and\nintermittent oral antibiotic therapy, showing few inflammatory lesions and residual\nerythema (). | [[18.0, 'year']] | M | {'9094477': 1, '20465675': 1, '31455984': 1, '17725657': 1, '32410688': 2, '31180372': 2, '33187546': 2, '19533139': 1, '26847855': 1, '1828308': 1, '12673094': 1, '22068759': 1, '24346917': 2} | {'7663872-1': 1, '6526982-1': 1, '6526982-2': 1, '6526982-3': 1, '6526982-4': 1, '6526982-5': 1, '6526982-6': 1, '6526982-7': 1, '6526982-8': 1, '6526982-9': 1, '7227041-1': 1} |
164,960 | 3875981-1 | 24,346,910 | noncomm/PMC003xxxxxx/PMC3875981.xml | Congenital agminated melanocytic nevus - case report | A nine-year-old male patient, phototype V, student, was referred to the dermatology\nclinic for evaluation of multiple pigmented lesions on his left thigh. He was\naccompanied by his father, who informed that the child had had a cluster of melanocytic\nlesions since birth. The cluster increased in size following the growth of the patient\nand the minor lesions became somewhat closer together over the years. The family\nbackground of skin cancer was negative. The father has a history of congenital nevi on\nthe face and left lumbar region. The patient presented epilepsy and was in treatment\nwith carbamazepine, imipramine and risperidone.\nOn physical examination, the patient had a cluster of approximately 20 maculopapular,\nlightly palpable blackened lesions of different sizes on the anterior part of his left\nthigh, forming a cluster of nevi ( and\n). The diameter of the total lesion was 9.2cm\nx 7.6cm. The largest isolated lesion measured 2.6 cm x 1.3cm. Dermoscopy revealed\npredominantly homogeneous pattern with diffuse brownish areas, regular network at the\nperiphery and numerous regularly distributed small dots (). No background pigmentation was noted on clinical or dermoscopic\nexamination between lesions.\nA single lesion was excised for histological evaluation with a 2 mm border of normal\nskin. The histopathological findings revealed an intradermal melanocytic nevus without\nhistological melanocytic hyperplasia or hyperpigmentation in clinically normal\nperipheral skin ( and ).\nConsidering the clinical and histopathological diagnosis of the lesion and treatment\nlimitations due to the size of the total lesion, it was decided to keep dermoscopic\nmonitoring of the patient every 4 months. It has enhanced to the family the importance\nof sun protection and guidance for the observation of changes such as modification of\ncolor, palpation (such as nodularity), shape and rapid growth. | [[9.0, 'year']] | M | {'7547407': 1, '14636187': 1, '17721654': 1, '18974631': 1, '21710107': 1, '11453811': 1, '12056974': 1, '11167706': 1, '7971559': 1, '9335246': 1, '24346910': 2} | {} |
164,961 | 3875982-1 | 24,346,895 | noncomm/PMC003xxxxxx/PMC3875982.xml | Tufted angioma in ear auricle: importance of the differential\ndiagnosis | A 12-year-old male patient, a student from Ananindeua, Pará, looked for medical care,\naccompanied by his father, due to right ear auricle volume increase that had started 5\nyears ago. He reported that the increase in volume began associated with a "red" (sic)\nspot, which progressively expanded causing a large volume increase of the large helix of\nthe right ear, with light local itching, without other symptoms. He denied previous\ntreatments, local traumatism or comorbidities.\nConsidering the epidemiology of the region and the infiltrative aspect of the external\near size increase, as well as a weakly-positive anti-PGL1 test done previously, the\npatient was referred from another service with a diagnosis of Lepromatous Leprosy, to\nstart polychemotherapy. However, the rate of evolution, the clinical condition and the\nclinical lesion were not consistent with this diagnosis, so a biopsy of the lesion was\ndone for better clarification.\nThe dermatological exam showed volume increase of the large helix of the right ear,\nwell-defined erythematous macules with irregular contours, the largest one measuring 07\nx 06 cm; two erythematous papules on the anterior portion of the helix, besides\nincreased local temperature on the right ear large helix and retroauricular region\n( and ).\nThe histopathological exam showed dermis with proliferation of vascular nature,\norganized in lobes, composed of capillaries, venules and harder endothelial ovoid cell\naggregates. The stroma presented a desmoplastic aspect, with scarce focal lymphocytic\ninflammatory infiltrate. The diagnosis was Hemangioma, variant tufted hemangioma ( and ).\nSince it was a benign lesion, expectant management was adopted and no other vascular\nmalformation was evident after imaging exams. | [[12.0, 'year']] | M | {'18032876': 1, '19061619': 1, '29166525': 1, '28667388': 1, '21437533': 1, '22421680': 1, '22307233': 1, '20492819': 1, '19915265': 1, '28761971': 1, '24346895': 2} | {} |
164,962 | 3875983-1 | 24,346,870 | noncomm/PMC003xxxxxx/PMC3875983.xml | Extra ocular sebaceous adenocarcinoma in HIV-positive patient - case\nreport | A forty-two year old male patient, diagnosed with AIDS on the previous year, sought\nmedical attention after presenting with daily fever, watery diarrhea, generalized\nmyalgia and weight loss for a week.\nBesides these symptoms, the patient reported an asymptomatic facial mass, growing in the\nlast four weeks.\nOn physical examination the patient had a poor general status, was emaciated and\nfebrile. On the right mandibular region an exophytic tumor (3 x 1.5 cm) was noticeable,\npresenting with an infiltrated base and exulcerated areas (). The exam also detected generalized lymphadenomegaly.\nLaboratory exams showed: HIV viral load: 55,986; CD4 count: 96; anemia (hemoglobin:\n9.2mg/dl) and lactic dehydrogenase (LDH): 1,965mg/dl.\nTissue obtained from the excisional biopsy was stained with hematoxiline eosine (HE) and\nrevealed an ulcerated neoplasm, formed by stacks of basaloid cells with eosinophilic\ncytoplasm, centered by a population of cells with micro vacuolated cytoplasm and\nirregular, hyperchromic nuclei with mitotic Figures and necrotic areas, characteristics\nconsistent with ACS ( and ).\nTo confirm the diagnosis, we performed an immunohistochemistry study (IMQ) that revealed\nexpression of cytokeratin and protein p63 on the basaloid cells and EMA on the micro\nvacuolated cells, findings that were consonant with ACS ().\nDuring admission, a computerized tomography of the chest showed signs suggestive of\neither bronchiolitis or endobronchial dissemination of pulmonary tuberculosis.\nTherefore, treatment with antiretroviral therapy, antibiotics and COXCIP 4 (rifampicin,\nisoniazid, pyrazinamide and ethambutol) were initiated, however, there was a progressive\ndeterioration on the clinical status and the patient died due to respiratory failure,\nafter seventy days of hospitalization. | [[42.0, 'year']] | M | {'19751879': 1, '19114864': 1, '19810102': 1, '18932259': 1, '19349851': 1, '10826761': 1, '24346870': 2} | {} |
164,963 | 3875984-1 | 24,346,868 | noncomm/PMC003xxxxxx/PMC3875984.xml | A case of Paraneoplastic Pemphigus associated with Castleman's\ndisease | A 49-year-old man presented with oral erosions, erythema and blistering rashes over his\ntrunk and limbs for 3 months. The patient first developed painful oral mucosal blisters\nand ulcers, which became progressively severe and gradually spread to the eyes, perineum\nand anus. The patient was admitted to our department for further diagnosis and\ntreatment. On physical examination, we found several small lymph nodes on his neck with\ndiameters of under 1 cm. Dermatologic examination revealed hyperemia on the bilateral\nconjunctiva, extensive ulcers and erosions on the oral mucosa, erythema and blisters\nscattered on the chest, back, perineum and anus, but with no obvious ulcers ( and ).\nOne week prior to admission, the patient had attended another hospital where\nhistological examination, serum direct immunofluorescence (DIF) and indirect\nimmunofluorescence (IIF) were performed. Histological examination of a skin biopsy taken\nfrom a lesion on his left arm showed epidermal acantholysis, suprabasal cleft formation,\nerythrocyte extravasation and vacuolar changes at the dermal epidermal junction and\nlymphohistiocytic infiltrate in the upper dermis (). DIF revealed IgG, IgM, and C3 deposit in the basement membrane zone (BMZ).\nIIF revealed IgG reticular staining with an antibody titer of 1:20. CT revealed a\nprominent solid lesion in the right anterior superior mediastinum ().\nThe results of laboratory tests, including full blood count, urea, creatinine,\nelectrolytes, liver function, tumor markers and tests for infectious diseases were\nnormal. Percutaneous mediastinum biopsy guided by CT revealed lymph hematopoietic\nhyperplasia. Immunohistological examination revealed CD20++, Pax-5++, CD43++, CD3+,\nCD163+, CD68 scattered+, Mum-1-, CD30-, CD10-, EMA-, CKpan-, TdT-, Ki673%+, CD5\nscattered +.\nPCR analysis of Ig heavy chain genes, gene clonal rearrangement (IGH, IGK, IGL,\nTCRβ, TCRγ, TCRδ) was detected by using\nBIOMED-2 protocols. DNA extraction from formalin-fixed tissues was performed using\nstandard methods. All the results were negative ( and ).\nDiagnosis: 1. Paraneoplastic Pemphigus 2. Castleman's Disease.\nUpon hospitalization, the patient was given an intravenous methylprednisolone injection\n60mg per day and other supportive therapy. A few days later, the lesions started to dry\nup and form crusts, except for the oral mucosa. According to the advice from the\nCardiothoracic Surgery Department, the lesion in the right anterior superior mediastinum\nwas too large to be completely resected, since abundant blood vessels were present and\nit was too close to the pulmonary artery. In any case, since the patient rejected\nsurgery, conservative treatment was recommended. Considering that the erythema and\ncrusting on the patient's chest and back could perhaps further aggravate after\nradiotherapy, the Radiotherapy Department attempted to use stereotactic radiosurgery,\nwith an irradiated DT:32Gy/2fx and isodose line 80%. After the end of treatment, the\npatient's lesions aggravated and new erythema and blisters appeared. However, these\nrecovered during the following week, and no new lesions manifested during the short\nfollow-up period. | [[49.0, 'year']] | M | {'22221261': 1, '22181577': 1, '19663833': 1, '19494160': 1, '17118850': 1, '33787583': 2, '26462645': 1, '26528023': 1, '19067241': 1, '2247105': 1, '17804551': 1, '16230567': 1, '21097540': 1, '24346868': 2} | {'8021385-1': 1} |
164,964 | 3875986-1 | 24,346,893 | noncomm/PMC003xxxxxx/PMC3875986.xml | Indeterminate leprosy and lepromatous index case: four cases in the same\nfamily | Patient A was 8 years old, female, and HIV +. She was using no medications and presented\na single hypochromic lesion on the left forearm. Biopsy of the lesion was compatible\nwith indeterminate leprosy (). During the\nchild's consultation, the mother (patient B), who was 34 years old, had been HIV + for 8\nyears and on antiretroviral therapy for 7, complained of a macule on the left arm which\nhad appeared about 1 year earlier and which had started to show elevated borders 1 month\nbefore the consultation, with reduction of thermal sensitivity (). On the next consultation, the mother brought another\ndaughter (patient C), who was 19 years old and presented a hypochromic macula with\nreduced thermal sensitivity in the lateral region of the right knee (). Biopsies of lesions from patients B and C\nwere also compatible with indeterminate leprosy. There was no thickening of nerves in\npatients A, B or C. The three patients were diagnosed with indeterminate leprosy, and\npaucibacillary-multidrug therapy was started. We did not perform the Mitsuda test\nbecause it was not available in our service.\nConsidering the 3 cases, we sought to identify a possible source of infection among\nclose family members. The patients initially denied knowing about anyone close who had\nskin lesions. When we showed them a photo of a lepromatous patient in a book, the\npatients reported on a relative who presented similar lesions. Patient D, who is male,\npatient B's brother and patients A and C's uncle, was then brought by the family. He\npresented weakness and numbness in both hands, in addition to nasal obstruction. On\nexamination, he showed nodules and tubercles on the face and pinnas, bilateral\nmadarosis, diffuse infiltration in the trunk and lower limbs (). There was cubital and auricular nerve thickening, which\noccurred bilaterally. There was hypoesthesia in bilateral legs and feet, hypoesthesia of\nthe whole left arm and right arm (). Skin\nsmears were positive. Multibacillary multidrug therapy was initiated.\nThe four patients are from Laguna, Santa Catarina. Patients A, B and C live in the same\nhouse. Patient D lives close, on the same street, and often visits the other patients.\nFour people were considered close contacts of the patients. These contacts did not want\nto be examined in our service, so they were advised to seek examination in the health\ncenter of their city of origin. Patients A and B completed treatment and were discharged\nas cured, presenting the characteristics they showed on the first physical examination.\nPatients C and D received 5 doses and asked to finish the treatment in their hometown.\nThe cases were then transferred. | [[8.0, 'year']] | F | {'29487601': 1, '20492832': 1, '20676467': 1, '11705247': 1, '16388481': 1, '5950347': 1, '17090777': 1, '16728321': 1, '12908039': 1, '24346893': 2} | {} |
164,965 | 3875988-1 | 24,346,886 | noncomm/PMC003xxxxxx/PMC3875988.xml | Diffuse systemic sclerosis with bullous lesions without systemic\nmanifestations | Male, aged 61, presenting cutaneous sclerosis involving acute onset, progressive\nevolution, of centrifugal character, for 3 months, associated with functional limitation\nof joint movements and oral opening. The dermatological exam revealed hyperpigmentation\nand diffuse cutaneous thickening, sparing the nipples, an increase in hand volume\nwithout any vasospastic phenomena or sclerodactyly, and tense bullous lesions in the\nlower limbs (, and ). He did not present\ncomorbidity, was a smoker and social drinker, and worked as a general assistant. He\npresented no exposure to chemical products like vinyl chloride, silica, etc. Additional\ntests did not reveal abnormalities, except for elevated ESR and ANA 1:320 with fine\nspeckled cytoplasmatic pattern, negative results for rheumatoid factor,\nanti-topoisomerase, anti-centromere and anti-RNP. Capillaroscopy of the nail bed with\nhairpin-shaped capillary loops, without pathological megacapillaries, ramifications or\nintersections, corresponding to discrete microcirculatory changes of nonspecific\ncharacter. The histopathological analysis showed an area of intense subepidermal edema,\nforming multiocular bullae, moderate perivascular mononuclear infiltrate, collagen\ncompression, incarceration of annexes and lymphangiectasias ( and ). Colloidal\niron staining was weakly positive for mucin in the dermis. Given the rapid evolution of\nthe disease, treatment was started using cyclophosphamide 1g/kg/month and prednisone. In\noutpatient follow-up, after 5 cycles, there was partial improvement in the cutaneous\nsclerosis, without any specific organic involvement. | [[61.0, 'year']] | M | {'8075444': 1, '12100687': 1, '21091117': 1, '9512104': 1, '15258510': 1, '24346886': 2} | {} |
164,966 | 3875991-1 | 24,346,918 | noncomm/PMC003xxxxxx/PMC3875991.xml | Systemic sarcoidosis induced by etanercept: first Brazilian case\nreport | A fifty year-old female patient, Caucasian, born in Rio de Janeiro, was diagnosed with\nrheumatoid arthritis 10 years ago. She started treatment with weekly etanercept 50 mg\nsubcutaneously over one year ago, due to a poor therapeutic response to methotrexate,\nsulphasalazine and corticoids. Prior to starting the immunobiologic therapy, the patient\nwas screened with thoracic radiographies, PPD and HIV and hepatitis serologic tests, all\nwith normal results.\nAfter 6 months of treatment with etanercept, infiltrated erythematous lesions appeared\nsurrounding a scar on the posterior region of the right thigh and right gluteal area,\nfollowed by the emergence of painful erythematous nodules on lower limbs and an increase\nof volume on the neck ( and ). Our patient denied fever, weight loss and\ndyspnea. At this point, thoracic and cervical computerized tomography scans were\nperformed, showing pulmonary perihilar lymphadenomegaly and bilateral augmentation of\nparotids without lymphadenomegaly, respectively (). Histopathological examination of the right thigh skin lesion demonstrated\nthe presence of noncaseating granulomas formed by histiocytes and giant cells in the\ndermis and hypodermis ( and ).\nSkin cultures for mycobacteria and fungi were negative and angiotensin converting enzyme\nlevels were 61 U/L (reference value: < 60 U/L).\nEtanercept was suspended after the diagnosis of sarcoidosis, and treatment with\nprednisone 30mg/day p.o. was initiated resulting in an improvement of skin, cervical and\npulmonary lesions within approximately 30 days.\nThe dose of prednisone was gradually reduced after 3 months, and no relapse of symptoms\nwas observed after 6 months of follow-up. | [[50.0, 'year']] | F | {'22527429': 1, '28223750': 2, '21477572': 1, '23157794': 1, '32389943': 1, '19147181': 1, '22885144': 1, '7911491': 1, '20638761': 1, '34641810': 2, '22398084': 1, '28124746': 1, '21811048': 1, '30375550': 1, '29610700': 2, '24346918': 2} | {'8513323-1': 1, '5828086-1': 1, '5318531-1': 1} |
164,967 | 3875992-1 | 24,346,871 | noncomm/PMC003xxxxxx/PMC3875992.xml | Biological agents: investigation into leprosy and other infectious\ndiseases before indication | Male patient, aged 49, white, mason, from the municipality of Auriflama, State of São\nPaulo, Brazil. The patient underwent follow-up in the rheumatology department at the\nBase Hospital of São José do Rio Preto, diagnosed with rheumatoid arthritis 15 years\nago, refractory to conventional treatments. Therapy was initiated using infliximab and,\nafter four doses of this anti-TNF a biological agent, with a total dose of 1600mg,\nduring the physical exam, erythematous plaques were discovered in the dorsal region and\nthe left forearm, with respective diameters of 8 and 5cm; and erythematous violaceous\nplaques in the left thigh, with diameters of 4 x 6cm, and diminished sensitivity in\nthese lesions ( and ). The patient experienced increases in the number and diameter of\nthe erythematous violaceous plaques in the midsection and limbs. The patient presented\npositive family epidemiology for leprosy.\nThe biopsy of the cutaneous lesions on the back and left thigh revealed borderline\nleprosy, with a tendency toward the lepromatous pole, with whole, resistant alcohol-acid\nresistant bacilli (particularly in nerves), a lymph smear (AARB) and positive Mitsuda\ntest, with a diameter of 11mm (). The\nclinical classification, following the result of the Mitsuda test, was reactional\ntuberculoid leprosy and the patient developed a clinical, downgrading reverse reaction,\nsimilar anatomopathologically to dimorphous leprosy. The anti-TNF therapy was\ninterrupted and a specific treatment for leprosy was started with multibacillary\npolychemotherapy (PCT/MB/WHO), presenting significant improvement in the clinical\nleprosy. | [[49.0, 'year']] | M | {'17075599': 1, '33849463': 1, '9864247': 1, '22460407': 1, '21125169': 1, '29387582': 1, '15127338': 1, '29141716': 1, '25431725': 2, '29234318': 1, '18576299': 1, '16779736': 1, '32157993': 1, '24346871': 2} | {'4238274-1': 1, '4238274-2': 1} |
164,968 | 3875993-1 | 24,346,902 | noncomm/PMC003xxxxxx/PMC3875993.xml | Linear lichen planus in children - Case report | A female patient aged two years and eight months, with a three-month history of\nasymptomatic lesions affecting the abdominal region. Examination indicated multiple\nviolaceous papules with hyperkeratosical surfaces, distributed along the lines of\nBlaschko on the abdominal region, buttocks and right thigh ( and ). No mucosal\nlesions or ungueal alterations were discovered. Hepatitis C serology was negative.\nHistopathological examination indicated vacuolar and lichenoid interface dermatitis with\npigment incontinence, consistent with linear lichen planus ( and ). Treatment\nwas initiated with topical steroids, to which there was a good response, with persistent\nresidual hyperchromic stains (). | [[2.0, 'year'], [8.0, 'month']] | F | {'12121559': 1, '11207960': 1, '12437560': 1, '11455151': 1, '28491978': 1, '1792200': 1, '28658889': 1, '20849467': 1, '30386529': 1, '16761964': 1, '19061615': 1, '24346902': 2} | {} |
164,969 | 3875994-1 | 24,346,869 | noncomm/PMC003xxxxxx/PMC3875994.xml | Clinical and surgical therapeutic approach in Erithema Elevatum Diutinum\n- case report | Male patient, 56 years old, white, 18 months ago reported the development of soft and\nulcerated erythematous papules on his hands, which when squeezed, eliminated purulent\nexudate. He also presented with nodular lesions on his elbows. Physical examination\nrevealed yellowish, hardened erythematous nodules on the extensor surface of his elbows,\nmeasuring 1.7 cm in the right elbow and 3.5 cm in the left elbow (). On the dorsal surface of his right hand, linear\npapular-nodular lesions were observed ()\nand in the palmar region, there were numerous small ulcerations with purulent exudate\n(). Histopathological examination of\nthe biopsy of the nodule on his right elbow revealed irregular acanthosis, extensive\nfibrosis in the reticular dermis, interspersed with lymphohistiocytic inflammatory\ninfiltrate and focal areas of neutrophils with leukocytoclasia (). Culture of the purulent exudate showed no growth of\nmicroorganisms. The clinical and histopathological correlation led to the diagnosis of\nEED, late stage. Due to the frequent association with systemic diseases, laboratory and\nradiological exams (complete blood count with differential and platelet count, BUN,\ncreatinine, liver function tests, ESR, C-reactive protein, RF, ASO, ANA, ANCA, protein\nelectrophoresis, G6PD, VDRL, Fta-Abs, serology for viral hepatitis and HIV, tuberculin\ntest, hands and chest radiographs, urinalysis and 24h urine) were carried out, without\nany changes.\nTreatment with dapsone 100mg/day was initiated, and the palmar ulcerations healed. After\n4 months, the dose was reduced to 50mg/day. As the nodules in the elbows did not heal,\nfive sessions of infiltrations with dexamethasone 10mg/ml, 2 ml in each nodule, were\nperformed every fifteen days. However, the nodules on the elbows persisted, bothering\nthe patient while he performed his usual activities, so we opted for the surgical\nexcision of the nodules with excellent results (). One year after the surgery, the patient continued to use dapsone 50mg/day,\nwithout the development of new lesions. | [[56.0, 'year']] | M | {'21781074': 1, '21358872': 1, '16148408': 1, '21883365': 1, '26375227': 2, '18477231': 1, '32173140': 2, '10856661': 1, '1516248': 1, '10468812': 1, '24346869': 2} | {'7175035-1': 1, '4560547-1': 1} |
164,970 | 3875995-1 | 24,346,887 | noncomm/PMC003xxxxxx/PMC3875995.xml | Eumycetoma by Madurella mycetomatis with 30 years of\nevolution: therapeutic challenge | We describe a case of a white 49-year-old male patient, from the state of Ceará, Brazil,\nwho presented asymptomatic cutaneous lesions, in the thighs and gluteus, for 30 years,\nwith progressive swelling of the affected areas. The patient reported the onset of the\nlesion after a local trauma, caused by sliding down a waterfall of his home state.\nPhysical examination revealed multiple erythematous nodules, both palpable and visible,\nassociated with fistulas with exudation of serosanguineous material and black grains,\nlocated on the anterior, lateral and posterior face of the proximal third of the thigh\nand in the infragluteal regions (). Edema\nand local erythema were present, with no palpable lymphadenopathy. The patient was in\ngood general condition, with no systemic signs or symptoms.\nThe histopathological study of one of the lesions, with hematoxylin-eosin and Grocott's\nmethenamine silver stains, showed amorphous brownish grain-like material with\neosinophilic edges and septal hyphae at its core (). The culture of the grain, in Sabouraud Agar, grew Madurella myce\ntomatis. Radiological evaluation by computed tomography showed a\nconsiderable amount of nodular thickening at the skin and subcutaneous levels, with\nunaffected muscle and bone.\nThe patient was treated with fluconazole 200mg/day and itraconazole 200mg/day for four\nyears, undergoing five semiannual surgical procedures aimed at excision of the\nsubcutaneous nodules. Medical discharge was achieved two months after the last surgery,\nwith no clinical or radiological evidence of residual lesions.\nEighth year of follow-up, a new asymptomatic, well delimited skin-colored nodule, of\napproximately 2 cm in seize, without a fis- tula was observed in the right infragluteal\nregion (). After excisional biopsy of the\nlesion, with observation of black grains and Madurella mycetomatis\ngrowth in culture, the diagnosis of eumycetoma was confirmed (). After new image tests showed no remaining\nlesions, the patient was kept under follow-up, without antifungal chemotherapy. | [[49.0, 'year']] | M | {'22334597': 1, '21781072': 1, '20110198': 1, '18211487': 1, '30755254': 2, '17172376': 1, '31918687': 2, '32614267': 2, '31637988': 1, '21263050': 1, '11558006': 1, '20452871': 1, '28192433': 1, '24346887': 2} | {'6371586-1': 1, '6953183-1': 1, '7333505-1': 1} |
164,971 | 3875996-1 | 24,346,921 | noncomm/PMC003xxxxxx/PMC3875996.xml | Vohwinkel syndrome, ichthyosiform variant - by Camisa - Case report | A 52-year-old healthy woman, sought assistance for thickened palms and soles which began\nin her childhood, as well as changes in one of her toes, which began a few years ago.\nShe was the third of five generations involved. Her mother had a finger amputated due to\nthe evolution of the same disease. Physical examination detected transgredient, diffuse\npalmoplantar hyperkeratosis, with constrictive bands on the fifth toe (left)\n(pseudo-ainhum) - generalized ichthyosiform dermatosis with no hearing loss (, \nand ). Anatomopathological examination of the\npalmar region found hyperkeratosis with orthokeratosis and parakeratosis (). | [[52.0, 'year']] | F | {'12072018': 1, '32695713': 1, '19282408': 1, '15102081': 1, '20465619': 1, '24898504': 1, '33633820': 2, '21426869': 1, '34721860': 2, '30156625': 1, '26902751': 1, '26871826': 1, '24346921': 2} | {'7883105-1': 1, '8538013-1': 1} |
164,972 | 3875997-1 | 24,346,873 | noncomm/PMC003xxxxxx/PMC3875997.xml | Psoriatic scarring alopecia | A 42-year-old Caucasian woman with a 22-year history of severe scalp psoriasis presented\nto our outpatient clinic complaining of itchy scalp and diffuse hair loss for the last\nfive years. Increased hair shedding was associated with episodes of greater inflammation\nand pruritus. Nail and articular psoriasis were absent. Psoriatic lesions had always\nbeen confined to her scalp. Topical clobetasol, oral cyclosporine, methotrexate, UVB-NB\nphototherapy and antibiotics had been used as treatment with only temporary relief.\nOn physical examination, diffuse erythema, infiltration, scales and crusts were present\nall over the scalp. Decreased hair density in the fronto-parietal area was observed. The\nright parietal side was the most severely affected, so both dermoscopy and skin biopsies\nwere performed in this area ( and ). Fungal assessment, from both scalp scales and\nhair shafts, were negative.\nDermoscopy showed interfollicular twisted red loops characteristic of scalp psoriasis\nand lack of follicular openings (). No\npustules or tufted hairs were observed.\nHorizontal sectioning of the biopsy specimen showed follicular drop-out with only one\nfollicle at the subcutaneous level and 3 vellus follicles at the dermis level ( and ). Sebaceous glands were not visualized at all, but isolated pili erector\nmuscles were present and fibrosis could also be observed (). No signs of androgenic alopecia were detected.\nVertical analysis showed epidermal changes compatible with psoriasis and a moderate\nchronic inflammatory infiltrate around vessels and eccrine glands, associated with\nfibrous tracts (). No interface changes\nwere observed at the dermal-epidermal level or affecting the follicular epithelium.\nDirect immunofluorescence was negative for IgG, IgM, IgA and complement.\nFindings were consistent with scarring alopecia associated with psoriasiform epidermal\nchanges. | [[42.0, 'year']] | F | {'30607042': 2, '5043203': 1, '10561048': 1, '1610698': 1, '1421635': 1, '33911817': 2, '33997211': 1, '11705093': 1, '11189843': 1, '19715638': 1, '1969203': 1, '24346873': 2} | {'6290290-1': 1, '7875225-1': 1} |
164,973 | 3875998-1 | 24,346,923 | noncomm/PMC003xxxxxx/PMC3875998.xml | Sporadic Kindler Syndrome with a novel mutation | A 28-year-old woman from Porto Alegre reported that since childhood she had widespread\nskin pigmentary changes and photosensitivity, as well as fragility of the skin and\nmucous membranes. No other cases were reported in her family. Skin examination revealed\nmarked atrophy of the skin on the back of the hands and feet, as well as a few scattered\nerosions/resolving blisters (). There was\nextensive dyschromia on the limbs and trunk (). We also noted a loss of dermatoglyphics on her fingers. Examination of her\nmouth showed erosive stomatitis. She also reported esophageal, vaginal and anal\ninflammation, leading to stricture formation, requiring surgical correction. A skin\nbiopsy showed disruption of dermal collagen bundles and a focal reduction in elastic\nfibers (). DNA was extracted from\nperipheral leucocytes and used to sequence the FERMT1 gene. Two\nheterozygous mutations were identified: the change c.328C>T results in the creation\nof a nonsense mutation, p.Arg110X and the insertion c.866insGG leads to a frameshift and\na premature termination codon 7 amino acids downstream, p.Ala289GlufsX7 (). | [[28.0, 'year']] | F | {'20507384': 1, '19945623': 1, '32973952': 1, '17916195': 1, '33202040': 1, '26375235': 1, '21936020': 1, '19945624': 1, '20938162': 1, '21308310': 1, '17854379': 1, '19200189': 1, '19067879': 1, '24346923': 2} | {} |
164,974 | 3875999-1 | 24,346,888 | noncomm/PMC003xxxxxx/PMC3875999.xml | Phacomatosis pigmentovascularis type IIa - Case report | We evaluated a male patient, 2 years and 5 months old, white, born full-term through\nvaginal delivery, weighing 3330g. Apgar score was 9 at first and fifth minutes. He\npresented since birth erythema-to-violaceous spots on the face, anterior trunk and upper\nand lower limbs that did not stop at midline ( and ). Moreover, aberrant Mongolian\nspots on the back, abdomen, buttocks and lower limbs ( and ) were noted. The\nlesions were asymptomatic and did not change over time.\nThe child was not suffering from chronic diseases and there was no history of parental\nconsanguinity or similar cases in the family. He was not taking any medication. During\nthe exam no alterations in the neuropsychomotor development were observed and the\nextremities were symmetrical, without atrophy or hypertrophy signs in the soft tissues.\nThe opthalmic exam revealed Nevus of Ota on the left, without criteria for diagnosis of\nglaucoma or other anomalies (). Laboratory\nexams were normal. Furthermore, bilateral head and orbital magnetic resonance imaging,\ntotal abdominal ultrasonography, electroencephalogram during sleep and vigil and\nechocardiogram did not show alterations. | [[2.0, 'year'], [5.0, 'month']] | M | {'12786710': 1, '30920161': 1, '3994413': 1, '30007908': 1, '18045734': 1, '20609155': 1, '17355231': 1, '28300894': 2, '12588390': 1, '26312661': 2, '15781681': 1, '24346888': 2} | {'5324993-1': 1, '4540495-1': 1} |
164,975 | 3876001-1 | 24,346,904 | noncomm/PMC003xxxxxx/PMC3876001.xml | Lichen planus pigmentosus inversus | A twenty-five year old male patient, brown-skinned, informed that for the past 9 months\nhe had noticed the appearance of asymptomatic brown spots, on the cervical region,\naxillary, inguinal and popliteal folds. He denied the appearance of other cutaneous\nlesions, pruritus, systemic symptoms, previous diseases or the use of illicit drugs or\nmedications. On examination, we observed hyperchromic, smooth-surfaced macules, with\nwell-delimited edges, measuring from millimeters to centimeters in diameter and often of\nan oval shape ( to ). There were not other lesions either on skin, nails, scalp, or\nmucosae, nor signs of lymphadenomegaly.\nOver the affected skin areas, the direct exams and cultures for fungi and bacteria were\nall negative. Complete blood counts, liver tests and electrolyte results were all within\nthe normal range. Hepatitis C serology was negative. Anatomopathological exams of the\nlesions were performed from distinct samples (right and left axilla), and repeated on a\nthree-month interval with identical characteristics: discreet rectification of\nepithelial cones in the epidermis, irregular hydropic degeneration on the basal layer,\nmarked pigmentary incontinence with the presence of melanophages on the superficial\ndermis and light to moderate inflammatory lymphocytic infiltrate surrounding the\ncapillary vessels of the papillary and reticular dermises ( and ).\nBased on the clinical and histopathological features we reached the diagnosis of lichen\nplanus pigmentosus inversus. Afterwards, we initiated treatment with systemic corticoid\nusing prednisone 20mg/day for 30 days, without any therapeutic response. After four\nmonths, without any further treatment, the patient presented with a discreet improvement\non the cervical and popliteal regions, whilst axillary lesions remained unaltered. | [[25.0, 'year']] | M | {'22481670': 1, '33751292': 1, '22035127': 1, '28491978': 1, '17614807': 1, '31444667': 1, '32806720': 1, '11763389': 1, '28300883': 2, '21738364': 1, '22398232': 1, '24346904': 2} | {'5324982-1': 1} |
164,976 | 3876002-1 | 24,346,879 | noncomm/PMC003xxxxxx/PMC3876002.xml | Cowden Syndrome: report of a case and brief review of literature | A 59-year-old female patient presented with a lifelong history of carcinoma and unclear\ncutaneous and mucocutaneous lesions. Clinical investigation showed firm, flat-topped,\nyellowish papules in the periorbital region and tiny whitish papules of the oral mucosa\n(). Multiple hyperkeratotic verruciform\nlesions on the back of the hand and palmar pits were found (). A macrocephaly above the 97th percentile was\ndiagnosed. The patient's history included breast cancer at the age of 34, an endometrial\ncarcinoma at age 46 and a recently diagnosed malignant melanoma. Furthermore, the\npatient reported adenomas of thyroid, recurrent gastrointestinal polyps and cutaneous\nlipomas and trichilemmomas. She also suffered from kidney cysts, cysts of the fallopian\ntube, cataract, osteoporosis and diffuse hair loss. Her family history showed no\nincidence of multiple hamartoma syndrome.\nLaboratory testing and organ examination did not show any pathologic findings. Histology\nof one periorbital lesion showed a symmetrical epithelial nodular proliferation with\nmild papillomatosis, overlying hiperkeratosis and downgrowth of epithelial cells with\nclear cell differentiation. Histology of one back-of-hand lesion showed regular\northo-and hyperkeratosis ( and ). Genetic analysis finally confirmed heterozygous\ndeletion of nucleotide 968 in exon 8 of the PTEN gene, located on chromosome 10. | [[59.0, 'year']] | F | {'32807196': 1, '21506964': 1, '22503188': 1, '22846627': 2, '34824704': 2, '15748573': 1, '26307392': 1, '27570815': 1, '34106409': 1, '24898504': 1, '23171017': 1, '23335809': 1, '21886759': 1, '18972196': 1, '21394636': 1, '24346879': 2} | {'8601691-1': 1, '3459741-1': 1} |
164,977 | 3876003-1 | 24,346,880 | noncomm/PMC003xxxxxx/PMC3876003.xml | Cutaneous metastasis of colon adenocarcinoma: case report and review of\nthe literature | An 80-year-old male presented at the outpatient clinic with a growing mass on the\nabdominal skin. (). On clinical\nexamination, a diffuse erythematous multinodular cauliflower-like lesion was evident,\nwith satellite nodules located in the periumbilical and lower abdominal region. A zone\nof pink indurated erythema surrounded the central mass. A large scar was evident at the\nbase of the mass suggesting previous abdominal surgery and possible initial eruption of\nthe mass on the scarred site.\nThe patient had a history of colorectal adenocarcinoma. He was initially hospitalized\nfor hematochezia 12 months previously. Colonoscopy showed a cauliflower-like mass at the\nright flexure of the colon, and various polyps. A right hemi-colectomy was performed and\nhistopathology showed a mucinous adenocarcinoma, with vascular and lymphatic emboli. No\ndistant metastasis was found. The adenocarcinoma was staged T3N1M0. A month later, the\npatient started receiving 5-fluorouracil-based adjuvant chemotherapy for six months.\nFour months after the first cycle of chemotherapy was concluded, a chest X-ray was\nperformed. This revealed shadows at the base of the right lung. It was interpreted by\nthe radiologists as a possible spread of the known adenocarcinoma.\nWe obtained a biopsy specimen of the abdominal lesion. On microscopic examination the\ndermis was infiltrated by a number of adenomatous glands with obvious atypia and\nmucinous content, which was consistent with a metastatic focus of the known mucinous\ncolon adenocarcinoma ( and ).\nComputerized axial tomography was unremarkable with the exception of the right lung\nshadow.\nThe patient is currently receiving his second cycle of chemotherapy and is in good\noverall condition. | [[80.0, 'year']] | M | {'30671523': 1, '22068789': 1, '34406516': 2, '30484536': 1, '32964198': 2, '30675306': 1, '29854493': 2, '34909592': 2, '32190453': 2, '15237593': 1, '2298962': 1, '12630642': 1, '19056145': 1, '30870738': 2, '8335743': 1, '33898148': 2, '21738971': 1, '9335247': 1, '30693133': 1, '29184882': 2, '26890850': 1, '27579752': 2, '30948869': 1, '33137665': 1, '31293305': 2, '32446230': 2, '14657227': 1, '18205267': 1, '26884742': 1, '24346880': 2} | {'5694720-1': 1, '5952443-1': 1, '7243000-1': 1, '6593942-1': 1, '6424055-1': 1, '8630731-1': 1, '4999115-1': 1, '8062121-1': 1, '7504877-1': 1, '8374022-1': 1, '7058390-1': 1} |
164,978 | 3876004-1 | 24,346,883 | noncomm/PMC003xxxxxx/PMC3876004.xml | Linear IgA bullous dermatosis: report of an exuberant case | We report the case of a ten-month old white male patient from Guarulhos presenting with\nisolated and grouped tense serum-filled vesicles and bullae on healthy skin or on an\nerythematous base, mostly in a rosette pattern ( and ). The patient did not present\nmucosal lesions or fever, and there was no impairment of the patient's general\ncondition. There was intense pruritus. His complete blood count was normal. We raised a\nsuspicion of linear IgA dermatosis and of erythema multiforme. An anatomopathological\nexamination of a bullous lesion showed subepidermal cleavage with neutrophilic\ninflammatory infiltrate ( and ). Direct immunofluorescence (DIF) of perilesional\nskin showed intense linear deposition of IgA at the BMZ (). As we awaited the results of the anatomopathological examination,\nDIF, and of the glucose-6-phosphate dehydrogenase test, we initiated treatment with\nprednisolone 1mg/kg and observed partial improvement of the patient's condition. After\nconfirming the diagnosis of linear IgA dermatosis and detecting normal levels of glucose\n6-phosphate dehydrogenase, we added dapsone 2mg/kg and maintained the oral\ncorticosteroid therapy, with the patient achieving complete remission (). | [[10.0, 'month']] | M | {'20944909': 1, '20500772': 1, '28300887': 1, '11604308': 1, '21605811': 1, '11705681': 1, '21987142': 1, '20137744': 1, '22137225': 1, '24346883': 2} | {} |
164,979 | 3876005-1 | 24,346,911 | noncomm/PMC003xxxxxx/PMC3876005.xml | Pyoderma gangrenosum in a newborn - Case report | A twenty-three days old, female patient, born and living in Primavera (Pará State), was\nadmitted to the neonatal intensive care unit (NICU) presenting with "wounds" on the\nabdomen, genital area and buttocks for the last 10 days. The mother informed that the\nproblem started with a "swelling" and blisters that ruptured, originating the "wounds"\non the aforementioned areas. Dermatological examination showed ulcerated lesions, some\nwith a granular hemorrhagic base others with purulent and necrotic ones; with irregular\nand excavated borders, located on the torso and genital-inguinal-crural areas, extending\nto the buttocks ( and ). The anatomopathological examination of the biopsy\nspecimen showed an epidermis with parakeratosis, without other significant associated\nalterations. The dermis presented with a vascular ectasia and a perivascular,\ninterstitial inflammatory infiltrate of a lymphohistiocytic nature, scattered with\neosinophils and rare neutrophils. No histological marker of vasculitis was observed. The\ninfiltrate extended to the subcutaneous interstice, both in the lobular and septal\nsectors, giving the diagnoses of sub-acute superficial and deep inflammatory processes.\nWe performed cultures for bacteria on the ulcers' secretion, with a negative result. The\npatient was treated with wide-spectrum antibiotics, cephalosporin and imipenem, for\nseven days without response, at which point a dermatologic consultation was solicited,\nleading to the diagnosis of pyoderma gangrenosum. Systemic corticoid therapy (prednisone\n0.5 mg/kg/day) was then initiated with marked improvement of the lesions after ten days.\nThe patient was rapidly discharged and sent to the outpatient clinic for corticosteroid\nweaning. Presently she has only atrophic scars. () | [[23.0, 'day']] | F | {'15165216': 1, '30805472': 1, '16354258': 1, '15533059': 1, '16918628': 1, '19067867': 1, '21070329': 1, '24346911': 2} | {} |
164,980 | 3876006-1 | 24,346,875 | noncomm/PMC003xxxxxx/PMC3876006.xml | Analysis of mutations in the PIK3CA and FGFR3 genes in verrucous\nepidermal nevus | A three-year old black female patient from Rio de Janeiro presented with diffuse\nhyperchromic macules which were present at birth and became darker and keratotic over\ntime. She was born by vaginal term delivery and presented psychomotor development\ncompatible with her age. Dermatological examination revealed presence of velvety\nhyperchromic papules on the face, neck, trunk, and limbs ( and ). Distribution of the\nlesions follows the Blaschko lines in the posterior area of the trunk (). No other changes were observed on physical\nexamination.\nHistopathological examination of the cervical region showed hyperkeratosis, acanthosis,\nand papillomatosis, which is compatible with verrucous nevus. Genetic analysis of\nperipheral blood and of the skin lesion detected a mutation in the Aa542-545 region of\nthe PIK3CA gene, despite the aspect of deletion. Additional tests will be conducted for\nclarification. For amplification of the Aa542-545 region, we used downstream\n5'CCAGAGGGGAAAAATATGACAAAG3' and upstream 5'CCCTTTCATTTTTCTTTTTTCTTACG'3 primers at the\nfollowing final concentrations of reagents: 1x Buffer, MgCl2 2.5 mM, dNTPs 0.2mM,\nprimers 0.5µM; polymerase 0.03 U/ µL; Sample ~ 100ng. Thermocycling\nconditions were 50ºC for 2 minutes; 95ºC for 10 minutes; 40 cycles of\n95ºC for 30 seconds, 58ºC for 1 minute, 72ºC for 1 minute, and\n72ºC for 10 minutes.\nThe patient is being regularly monitored and using adapalene gel 0.1% on the face,\nshowing little response. | [[3.0, 'year']] | F | {'21152805': 1, '21639936': 2, '17673550': 1, '16841094': 1, '16847462': 1, '31360755': 1, '25031014': 1, '29299693': 1, '24346875': 2} | {'3119182-1': 1} |
164,981 | 3876007-1 | 24,346,909 | noncomm/PMC003xxxxxx/PMC3876007.xml | Diffuse neurofibroma - an uncommon cause of alopecia | A 42-year-old Caucasian male presented with an asymptomatic swelling in the frontal and\nleft temporal regions of the scalp. The swelling had been present since he was 17 years\nold, gradually enlarging since then. The first skin biopsy, at the age of 29, was\ninconclusive and the patient was lost to follow-up; however, due to the continued growth\nof the swelling and loss of overlying hair, he returned years later for reevaluation.\nHe had no relatives with history of neurofibromatosis (NF).\nPhysical examination revealed a multicentric tumor with ill-defined borders composed of\nthree confluent plaques with 9cm, 8cm and 6cm diameter located in the frontal and left\ntemporal regions of the scalp (). The\ntumor was soft on palpation and there was loss of hair on the overlying, hyperpigmented\nskin. There were no changes in the underlying bone nor was there any bruit. The\nremaining physical examination aspects were unremarkable and no other NF features were\nfound. Ophthalmologic examination excluded the presence of Lysch nodules. The patient\nshowed no cognitive impairment. At this time, the diagnostic hypotheses were lipoma,\nvenous malformation and low-grade malignancy.\nUltrasound showed an ill defined, diffusely hyperechoic mass with 0.9cm thickness.\nDoppler revealed multiple vascular structures, suggestive of hemangioma. Cranial\ncomputed tomography (CT) showed no intracranial extension (). A biopsy specimen of the tumor revealed spindle cells\nwith oval nuclei in a myxoid background. The lesion was located in the dermis and\nsubcutaneous tissue; skin appendages were scarce in the deeper dermis. No Meissner\nbodies were seen. ( and ) These findings were suggestive of a diffuse\nneurofibroma and the patient was submitted to surgical excision of the tumor with a\ntemporal rotation flap and a free skin graft. The tumor was completely excised and the\npostoperative period was uneventful. Histopathological examination confirmed a diffuse\nneurofibroma. No recurrence was recorded during the first 6 months of follow-up. | [[42.0, 'year']] | M | {'30363148': 1, '10697196': 1, '32656233': 1, '26677270': 2, '34584604': 1, '7528474': 1, '15855151': 1, '20548855': 1, '12789188': 1, '16983449': 1, '25081636': 1, '9817094': 1, '8729511': 1, '18287425': 1, '21188030': 2, '24346909': 2} | {'4681195-1': 1, '3002418-1': 1} |
164,982 | 3876008-1 | 24,346,894 | noncomm/PMC003xxxxxx/PMC3876008.xml | Borderline tuberculoid leprosy and type 1 leprosy reaction in a hepatitis\nC patient during treatment with interferon and ribavirin | A 57-year-old male with hepatitis C using pegylated interferon and ribavirin for\ntreatment of hepatitis C. Four months after the start of the treatment, disseminated\ncutaneous lesions appeared, as well as intense pain along the course of the cubital and\nfibular nerves. Dermatologic examination revealed small and large, highly infiltrated\nerythematous plaques on his back, arms and legs (). Physical examination revealed thickened cubital and fibular nerves that\nwere highly painful to palpation. The patient reported that he had developed a small\nerythematous plaque on his back two years previously, which had been treated\nunsuccessfully as dermatophytosis. In light of the clinical history and the results of\nthe dermatological examination, a hypothesis of borderline tuberculoid leprosy with type\nI reaction was put forward and an incisional biopsy was performed. A histological exam\nrevealed granulomatous inflammatory infiltrate in the upper dermis and around blood\nvessels and hair follicles, but Wade staining and bacteriological examination were\nnegative (). The Mitsuda reaction was\npositive. As the diagnosis was confirmed, six months of multidrug therapy for\npaucibacillary (PB) leprosy was started, together with an initial 80 mg/day dose of\nprednisolone, which was then gradually reduced. After the case was discussed with the\nhepatology team, the decision was taken to interrupt the interferon and ribavirin\ntreatment until the treatment for PB leprosy was completed. There was a clinical\nimprovement in the patient's leprosy reaction (), and he was discharged as cured after completing MDT for PB leprosy (). Six months ago, the patient again began\ntreatment for hepatitis C with interferon and ribavirin, but obtained no sustained\nvirological response and awaiting this release for use of pegylated interferon and\nribavirin associated with protease inhibitor (telaprevir or boceprevir). At the time of\nwriting, the patient is undergoing follow-up at the dermatology and hepatology services\nand has not presented with any clinical manifestations of leprosy reaction. | [[57.0, 'year']] | M | {'14697814': 1, '11174373': 1, '21884670': 1, '12170333': 1, '12170878': 1, '14739110': 1, '17992411': 1, '33029193': 1, '26312679': 2, '24346894': 2} | {'4540513-1': 1} |
164,983 | 3876009-1 | 24,346,922 | noncomm/PMC003xxxxxx/PMC3876009.xml | Bazex Syndrome | Seventy-three year-old female, dark-skinned, farm worker sought medical attention due to\npruritus and the presence of skin lesions in hands and feet for the last 40 days. She\npresented with edema and a well-delimited violet coloration extending through the distal\nhalf of the dorsal area of the hands to the tips of the digits. The fingers were swollen\nand the nails presented a yellow hyperchromia and onychomadesis (). Edema and violet coloration repeated the same pattern on\nthe feet, appearing more pronounced at the distal half, and extending over the dorsal\narea of the toes. Onychomadesis and hyperchromia were also present on the feet.\nThe patient was reluctant, responding only vaguely to the questions on the anamnesis.\nShe declared herself a former smoker and a former drinker. Physical examination did not\nshow any alterations besides voluntary guarding during the abdominal palpation. The main\nhypothesis proposed was of acrokeratosis paraneoplastica with differential diagnoses of\ntinea or psoriasis. Laboratory exams showed discreet normocytic and normochromic anemia,\nkidney and liver functions were normal and fungal tests on skin scrapings were positive\nfor dermatophytes on the dorsal area of the feet. Subsequently we ordered abdominal and\npelvic ultrasounds, chest x-rays, upper digestive endoscopy and colonoscopy, and a\ncourse of ketoconazole was prescribed for systemic use.\nAfter thirty days, the patient returned, showing violet, slightly infiltrated,\ndesquamative lesions, located on the nose, auricular pavilions, dorsal area of hands,\nfeet and toes (). Symmetric palmoplantar\nkeratoderma, with lamellar desquamation was also present (). There was a worsening on hand and feet pruritus. Also noticeable\nwere the rare blisters over the violet lesions on the dorsal areas of the hands and feet\n(). The patient's lips were also\naffected by the violet discoloration ().\nAbdominal examination evidenced painful hepatomegaly; the liver border was located 10 cm\nfrom the right costal margin, with blunt and irregular edges. Abdominal ultrasound\nshowed hepatic nodules and lymphadenomegaly. Pelvic ultrasound was normal.\nAnatomopathological examination of the skin on the dorsal area of the hand found\ndiscreet superficial psoriasiform chronic dermatitis, with pigmentary dispersion (). Contrasted esophageal x-rays detected\nZenker's diverticulum and distal esophageal stenosis. Upper digestive endoscopy\ndemonstrated cancer of the esophagus and the biopsy confirmed a poorly differentiated\nesophageal squamous cell carcinoma. The patient died a few days after the diagnosis was\ncompleted. | [[73.0, 'year']] | F | {'19833419': 1, '18838705': 1, '19932048': 1, '34055903': 1, '17292773': 1, '17254036': 1, '17727081': 1, '28101384': 2, '21054710': 1, '18775590': 1, '21855730': 1, '24346922': 2} | {'5215458-1': 1} |
164,984 | 3876010-1 | 24,346,920 | noncomm/PMC003xxxxxx/PMC3876010.xml | Birt-Hogg-Dubé syndrome | A 45-year-old woman with a prior history of: 1) total right nephrectomy due\nto clear cell carcinoma (T1, N0, M0) at 41 years of age; 2) multinodular\ngoiter; 3) fibrocystic mammary disease; was referred to our department for\nevaluation of long-standing multiple facial, cervical and upper thoracic small,\nflesh-colored papules (). Scarce\nimprovement was noted in the past with topical aluminum oxide or alpha-hydroxy-acids\ntreatment.\nThe patient denied any respiratory signs or symptoms and mentioned a family history of\nsimilar dermatological findings (father, brother and paternal aunts). Her father died of\ncolon cancer and her brother had a history of repeated episodes of spontaneous\npneumothoraxes.\nComputerized tomography scan (CT-scan) of the chest, abdomen and pelvis revealed\nmultiple small-sized cysts in both lungs. Thyroid ultrasonography and scintigraphy were\nperformed and cytology of otherwise suspicious nodules did not reveal any cancer\nfindings. Colonoscopy was normal.\nSkin biopsies of the face, neck and abdomen revealed findings consistent with\nangiofibroma, cellular fibroma and fibroma (acrochordon). Only one biopsy of a lesion of\nthe face showed a discrete dermal proliferation of basaloid epithelial nests around a\nnormal hair follicle, with surrounding fibrosis, consistent with perifollicular fibroma\n().\nDespite the absence of FF or TD identification, a clinical diagnosis of BHDS was made,\ncorroborated by the identification of a previously undescribed, frameshift\nc.573delGAinsT (p.G191fsX31) mutation in heterozygosity on exon 6 of the FLCN\ngene ().\nCarbon-dioxide laser ablation produced unsatisfactory results in the patient's opinion,\nwho declined further treatment. The patient and her immediate family are annually\nscreened for the development of renal neoplasia. The patient's brother refused medical\ncare. | [[45.0, 'year']] | F | {'7868760': 1, '16021156': 1, '10189247': 1, '28539984': 1, '29066638': 1, '19674199': 1, '19959076': 1, '596896': 1, '22725638': 1, '17149965': 1, '32171268': 2, '24346920': 2} | {'7071710-1': 1} |
164,985 | 3876011-1 | 24,346,908 | noncomm/PMC003xxxxxx/PMC3876011.xml | Optic neuritis due to immunobiologics: first Brazilian case report | A female, 62-year-old patient, white, widow, retired housekeeper, originally from\nPresidente Prudente - SP was under treatment for psoriasis vulgaris in plaques, which\nhad started 9 years ago. She was hypertensive, a condition controlled with the daily use\nof captopril. She used low potency corticosteroids and topic moisturizers, acitretin and\nmethotrexate orally, but there was no response to these treatments. The use of\nimmunobiologics was subsequentely prescribed. No Psoriasis Area and Severity\nIndex (PASI) or the Life Quality Index reports were available. Previous\nroutine exams (PPD, chest radiography, complete blood count, biochemical profile and\nliver enzymes) did not show alterations. Live virus vaccination was not advised. Three\nintravenous infusions of diluted infliximab, at 5mg/kg, were applied in 3 hours and\nrepeated 2 and 6 weeks later. Three days after the third infusion, the patient presented\nlow visual acuity in the left eye, which required an emergency appointment with an\nophthalmologist of a private clinic in the city of Presidente Prudente. At the clinical\nexamination, lowering of visual acuity (counting of fingers at 3 meters) and blurring of\nperipheral region of the optic disc were noticed during fundoscopy. Optic neuritis was\nthen hypothesized and she was submitted to retinography. The findings confirmed the\nproposed hypothesis (). The patient was\nreferred to the emergency ophthalmologic center at the Regional Hospital of Presidente\nPrudente - SP, where the same findings were confirmed. Immediate hospitalization was\ndecided and pulse therapy started with intravenous methylprednisolone, without previous\nprescription of oral corticosteroids. Head tomography was done to rule out other causes,\nsuch as tumors and cerebrovascular accident, with normal results (). To better evaluate the optic nerve and exclude other\nsources of demyelination (common in multiple sclerosis cases), a head MRI was performed,\nwhich found a hypersignal of the left optic nerve in comparison with the right optic\nnerve in T2. This supported the diagnostic hypothesis of optic neuritis in the left eye\n(). To objectively translate the sight\nalterations felt by the patient, a visual campimetry was performed, which showed a\nnormal visual field for the right eye and alterations in the left eye: dense cecocentral\nabsolute scotoma, with relative augmentation with smaller targets (). The central target only presented an island of peripheral\nvision, localized on the lower hemifield. The computerized visual field exam, central\n30-2 threshold test revealed the following: Right eye: average sensitivity of visual\nfield normal for this age bracket. Left eye: (MD = -1.49 dB) > blind spot with\nrelative growth. CPSD = 2.46 dB, P< 10%, indicating there is a localized defect which\noccurs in less than 10% of the normal population. The collaboration of the patient was\nreasonably good. Variations in answers in 10 standard sites studied were normal\n(SF=1.91dB). After 3 years of follow-up, there was no improvement of the patient's\nvisual acuity. | [[62.0, 'year']] | F | {'22713194': 1, '21603808': 1, '20495815': 1, '20654269': 1, '17456525': 1, '19916016': 1, '24346908': 2} | {} |
164,986 | 3876012-1 | 24,346,878 | noncomm/PMC003xxxxxx/PMC3876012.xml | Inguinal ulcerated sebaceous carcinoma: an unusual presentation | A 63-year-old male patient, with a two-year history of painful inguinal mass,\nprogressively increasing in volume. Subsequently, the inguinal mass to the left\nfistulized and the ulcerated lesion grew, reaching 12cm. The pathological background\nincluded reports of pulmonary tuberculosis treated 15 years before. The physical\nexamination revealed an ulcer in the left inguinal region with malodorous and purulent\nexudate containing live larvae; hard right inguinal lymph node, adhered to deep plans,\nalong with multiple yellowish papules in the posterior region of the penis ( and ). Serology tests were carried out for syphilis, HIV and Chlamydia\ntrachomatis, as well as screening for acid-alcohol-resistant bacilli and a\nPPD exam, and all the tests were negative. A histology of the ulcer's border revealed\natypical cells with prominent nucleoli, eosinophilic cytoplasm with multiple\nmicro-vacuolizations and atypical mitoses ( and ). A Sudan III test showed\nvacuoles containing fat inside the tumoral cells (). The immunohistochemical exam came back positive for the epithelial\nmembrane antigen (EMA) and CK-7. The EMA revealed transmembrane positivity in sebaceous\ncells (). The biopsies of the papules\nlocated on the penis and the right lymph node, revealed the presence of atypical cells\nwith similar characteristics. Thus, our diagnostic conclusion was moderately\ndifferentiated sebaceous carcinoma with lymphatic and skin of the penis metastases as\nwell as secondary myiasis associated with the ulceration brought about by sebaceous\ncarcinoma. An investigation was conducted to check for Muir-Torre syndrome. A complete\ncolonoscopy, thorax radiograph and urine analysis did not show any pathological\nalterations. The possibility of neoplasias in other organs was explored and then\ndiscarded. However, the abdominal and pelvic computerized axial tomography showed\nextensive damage to retroperitoneal lymphatic chains and multiple contralateral inguinal\nadenopathies and the tumor inside the deep muscular plan. | [[63.0, 'year']] | M | {'4016704': 1, '26904445': 2, '8698372': 1, '7681028': 1, '10605594': 1, '7601925': 1, '2289300': 1, '24346878': 2} | {'4738511-1': 1} |
164,987 | 3876013-1 | 24,346,914 | noncomm/PMC003xxxxxx/PMC3876013.xml | Cutaneous protothecosis - Case report | A 61-year-old white woman, housewife by occupation, born in the state of Rio de Janeiro\nand raised in Araruama, a coastal city in an oceanic lakes region, reported the\nappearance of an erythematous and painful lesion in the right leg. It had developed 15\ndays before on an excoriation caused by local trauma that occurred during\nhospitalization for investigation of muscle weakness in the arms and legs. She was\ntreated with cephalexin 500mg, four times a day, for a week, without improvement of the\nlesion and was referred to the dermatology service. Her medical history disclosed\nhypertension and allergic rhinitis in prolonged treatment with systemic corticosteroids\nin anti-inflammatory doses, since the age of 14-year-old (in the last year,\nintramuscular injections of betamethasone 7mg/week). During hospitalization, a motor and\nsensory neuropathy and type II diabetes mellitus were diagnosed and the treatment with\nmetformin 850mg, 3 times a day, was started, with control of glucose blood level. The\npatient was discharged and the investigation of skin lesions continued in the\ndermatology service.\nDermatological examination revealed an erythematous, tender and painful plaque covered\nby pustules and scabs on the right leg ().\nThe clinical picture suggested the diagnosis of erysipela, staphylococcal folliculitis,\ndermatophytosis and sporotrichosis.\nHematologic and biochemical laboratory findings were normal, except for high glucose\nlevels (150mg/dL) before the introduction of metformin. HIV and hepatitis tests were\nnegative.\nA swab was collected from the pustules in addition to biopsy of the lesion. Cultures\nfrom the swab were performed for bacteria and fungi and were negative or both. Fifteen\ndays after sowing, the cultures on Sabouraud dextrose agar and blood agar, developed\nwhite, creamy, yeast-like colonies ().\nCulture microscopy showed sporangiospores within the sporangia, with morula-like aspect,\nconsistent with Prototheca sp.\nHistopathology revealed a suppurative and granulomatous inflammation in the dermis. The\nperiodic acid-Schiff stain (PAS) revealed morula-like structures in the suppurative area\n(). The same structures were colored in\nblack by the Grocott silver stain ().\nFor species identification, a suspension of the culture was submitted to the\ncarbohydrate assimilation test by the Vitek automated system, indicating P.\nwickerhamii as the causative species.\nAfter the diagnosis of cutaneous protothecosis, treatment was started with itraconazole\nat a dose of 200 mg daily for 3 months with complete healing of the lesion. | [[61.0, 'year']] | F | {'15124862': 1, '21732787': 1, '33912392': 1, '28752062': 1, '32059817': 2, '12757247': 1, '20092420': 1, '16445501': 1, '17876472': 1, '30449922': 1, '29376895': 2, '17428884': 1, '7722022': 1, '34266685': 2, '11966707': 1, '17944171': 1, '24346914': 2} | {'7175028-1': 1, '8441448-1': 1, '5770008-1': 1} |
164,988 | 3876014-1 | 24,346,907 | noncomm/PMC003xxxxxx/PMC3876014.xml | Blastic plasmacytoid dendritic cell neoplasm | A 76-year-old man was referred for evaluation of various cutaneous lesions. He had a\nprior history of total prostatectomy due to prostate adenocarcinoma 6 years before the\ncurrent observation and myelodys plastic syndrome (MDS) presenting with neutropenia\nfollowed-up in hematology for 4 years. His neutropenia had been extensively studied\nthrough imaging studies and bone marrow aspirate and biopsy. MDS of the refractory\ncytopenia with multilineage dysplasia subtype was diagnosed and an expectant approach\nwith careful observation was undertaken.\nTwo months before referral, he progressively developed multiple violaceous plaques and\nnodules on the face and scalp. He denied any constitutional symptoms and mentioned just\na prior episode of minor head trauma. The physical examination revealed multiple\nwell-demarcated, indurated plaques and nodules scattered throughout the right\nfrontotemporal and biparietal areas as well as a 7 cm wide tumor in the anterior\ninterparietal area ( and ). Several mandibular, cervical and supraclavicular\nlymphadenopathies were noted. He was otherwise well, which contrasted with the severity\nof the cutaneous findings. Laboratory results revealed hemoglobin 127 g/L, white blood\ncell count 6.0 x 109 /L with 55% lymphocytes; an additional decrease in\nneutrophils (0.7 x 109 /L) and platelet count of 241 x 109 /L were\nnoted. Lactate dehydrogenase was elevated at 1139 U/L. Chest radiography was\nunremarkable. Thoracoabdomino-pelvic computerized tomography revealed enlargement of\nseveral mediastinal, axillary, celiac, retroperitoneal, obturator and inguinofemoral\nlymph nodes (some larger than 25 mm).\nHistology of skin and 2 cervical lymph nodes revealed a monomorphous, non-epidermotropic\ndiffuse infiltration of small-to-medium sized cells with pleomorphic nuclei () in the skin. This dense infiltrate effaced\nthe nodal architecture and was located in the dermis and hypodermis, separated from the\nepidermis by a grenz zone.\nBy immunohistochemistry, the cells coexpressed CD4, CD43, CD45 CD56, showed partial\npositivity for CD68 ( and ) and were negative for CD3, CD5, CD8, CD20, CD30,\nCD34, CD38, CD117, TDT, myeloperoxidase, light IgG chains and PAX5 (). The proliferative index (Ki-67) was high, approximately\n60%.\nBone marrow biopsy showed a markedly hypercellular marrow, with CD4+, CD43+,CD45+,\nCD56+, CD123+ and HLA-DR+ small blast cells accounting for 80% of cellularity. No\nexpressions of other T or B cell lineage were observed.\nBased on clinical and laboratory findings, the patient was diagnosed with BPDCN with\nextensive cutaneous, nodal and bone marrow involvement.\nSix cycles of CHOP (cyclophosphamide, adryamicine, vincristine, and prednisolone) were\nprescribed, with remission. Only post-therapy inflammatory reactive lesions remained on\nthe face and scalp.\nTwo months later, the disease relapsed. Left-sided brachial monoparesis developed and a\nparavertebral cervical (C2-C3) mass with medullary compromise through the intervertebral\nforamen was detected on magnetic resonance imaging. The patient was hospitalized in a\nstatus of rapid progression of the disease, with enlargement of the cervical mass,\nhyperleukocytosis (> 100.000/ml), mental status deterioration and died 7 months after\nthe diagnosis (9 months after onset of the first clinical symptoms). | [[76.0, 'year']] | M | {'29760611': 1, '32300426': 2, '29735506': 1, '25663917': 2, '27347056': 1, '18091395': 1, '9989839': 1, '15981806': 1, '11861268': 1, '12651292': 1, '12131152': 1, '7526680': 1, '25120824': 1, '24346907': 2} | {'7155830-1': 1, '4314974-1': 1} |
164,989 | 3876015-1 | 24,346,903 | noncomm/PMC003xxxxxx/PMC3876015.xml | Agminate lichen aureus | Male, 28-year-old, presenting a brownish 3cm lesion on the dorsal region of the right\nwrist, noted about 10 years ago (). Its\nonset could not be correlated with trauma, medication or contact with any substance. The\nlesion appeared as an insect bite, initially reddish, and subsequently brownish in the\ncenter. There was no itching, soreness, discharge or other similar lesions on the body.\nThe patient denied other diseases.\nDermoscopy showed a copper-coloured amorphous area and absence of pigmented network\n(). The histopathology evaluation\nshowed sparse capillaries, associated with heavy subepidermal mononuclear inflammatory\nreaction in a lichenoid pattern (). The\nhistochemical staining demonstrated diffuse deposition of hemosiderin (). | [[28.0, 'year']] | M | {'3314974': 1, '3978038': 1, '15492206': 1, '21821311': 1, '21798621': 1, '7137793': 1, '29166512': 2, '18794462': 1, '3421736': 1, '21771015': 1, '24346903': 2} | {'5674707-1': 1} |
164,990 | 3876016-1 | 24,346,927 | noncomm/PMC003xxxxxx/PMC3876016.xml | Livedoid vasculopathy associated with peripheral neuropathy: a report of\ntwo cases | Case 1: A 58-year-old woman, hypertensive, presented with a 6-month history\nof painful ulcers in the lower extremities, associated with paresthesia and hypoesthesia\nin the feet. A biopsy specimen, with representation of the dermo-hypodermic junction,\nwas compatible with LV. Laboratory evaluations revealed a positive anticardiolipin IgG\nantibody. Nerve biopsy (sural nerve) showed axonal degenerative alterations, consistent\nwith chronic axonal neuropathy ().\nElectromyography (EMG) demonstrated an axonal polyneuropathy with a sensory\npredominance. | [[58.0, 'year']] | F | {'20175830': 1, '22259622': 2, '12752140': 1, '11328402': 1, '22147037': 1, '14571469': 1, '16415390': 1, '17116831': 1, '19793098': 1, '24346927': 2} | {'3876016-2': 2, '3259500-1': 1} |
164,991 | 3876016-2 | 24,346,927 | noncomm/PMC003xxxxxx/PMC3876016.xml | Livedoid vasculopathy associated with peripheral neuropathy: a report of\ntwo cases | Case 2: A 46-year-old woman, previously healthy, presented with an episode\nof syncope, paresis and paresthesia of the extremities. Examination revealed livedo on\nthe distal lower limbs and an ulcer of the medial left malleolus (). A deep biopsy specimen revealed thrombotic vasculopathy,\nsuggesting LV (). Laboratorial evaluation\nwas normal. EMG demonstrated sensitive and motor axonal neuropathy, with an asymmetric\ndistribution, consistent with mononeuropathy multiplex. | [[46.0, 'year']] | F | {'20175830': 1, '22259622': 2, '12752140': 1, '11328402': 1, '22147037': 1, '14571469': 1, '16415390': 1, '17116831': 1, '19793098': 1, '24346927': 2} | {'3876016-1': 2, '3259500-1': 1} |
164,992 | 3876017-1 | 24,346,913 | noncomm/PMC003xxxxxx/PMC3876017.xml | Porokeratosis of Mibelli - literature review and a case report | This is a five year-old, brown-skinned female patient, with a history of developing\nerythematoushyperchromic plaques with slightly elevated edges and atrophic center\nlocated on the face (malar areas bilaterally, inferior eyelids, nose and chin) since the\nage of one and a half years ( and ). Similar lesions were presented, although with\nmore elevated borders, on the dorsal area of the left-hand and the lateral region of the\nsecond right-hand digit (). Dermatologic\nexamination showed that the inferior palpebral lesions extended to the mucosa of the\neye, starting an ectropion growth and in the left nasal lesion there was a meliceric\ncrust, by a recent impetigo process (already in treatment). There were not any relevant\npersonal antecedents. Family members were also examined and no important cutaneous\nalterations were found.\nHistopathological examination of the material collected from the dorsal area of left\nhand revealed cornoid lamella and hypogranulosis, confirming the diagnosis of\nporokeratosis (). | [[5.0, 'year']] | F | {'17642665': 1, '25834375': 1, '30374539': 1, '16882170': 1, '21929548': 1, '26525967': 1, '20695858': 1, '24346913': 2} | {} |
164,993 | 3876018-1 | 24,346,890 | noncomm/PMC003xxxxxx/PMC3876018.xml | Lucio's Phenomenon. Case study of an exceptional response to treatment\nexclusively with multibacillary multidrug therapy | A sixty-three year old male patient informed the gradual appearance of painless\nhemorrhagic blisters on limbs, earlobes and torso one year ago. These lesions later\nregressed spontaneously, leaving only atrophic scars on their previous sites. He also\nreported several bouts of recurring sinusitis, hoarseness and progressive worsening of\nthe cutaneous lesions. This patient had a previous history of Chronic Obstructive\nPulmonary Disease (COPD), hyperuricemia and high blood pressure treated with an\nirregular use of nifedipine. He denied smoking, drinking or the use of illicit drugs and\nhe also had no family history of dermatologic diseases similar to his own. During\nadmission, the patient status was cachectic; he was dehydrated, asthenic, dyspneic and\nafebrile (). Physical examination showed\nan infiltrated face, with madarosis, besides ulceronecrotic geometrically shaped lesions\naffecting the limbs, torso and face. In some segments, these lesions would converge;\nleaving large denuded areas (). Neurologic\nexamination demonstrated bilaterally thickened fibular nerves, which were painless to\npalpation. Laboratory exams revealed anemia (hemoglobin: 9.5 g/dL; hematocrit: 29.9%;\nMVC: 76.5 fL), bandemia (10%), hypoproteinemia (5.1g/dL), and elevated levels of C\nreactive protein (CRP) and erythrocyte sedimentation rate (ESR) (27.4 mg/L and 82 mm/h\nrespectively); Anti-HIV, VDRL, Antinuclear Factor (ANF), Anti-DNA e anti-cardiolipin\nantibodies (ACA) were all negative. Skin smear bacilloscopy demonstrated a bacilloscopic\nlevel of 5 (i.e. the presence of an average of 100 to 1,000 bacilli per examined field).\nThe results of a biopsy on a forearm opened lesion showed an ulcerated epidermis,\naccompanied by a dense histiocitary infiltrate with peri-adnexal and interstitial\ndistribution; the presence of vascular fibrinoid necrosis with neutrophilic infiltrate\nand associated edema; also the presence of numerous granular bacilli by the Fite-Faraco\nstain, often arranged in a cluster-like formation (). The histopathological findings were compatible with the diagnosis of\nVirchowian hanseniasis, exhibiting Lucio's phenomenon reaction. Radiographies of the\nhands showed bone resorption on the right fifth digit; rhinoscopy visualized a nasal\nseptal perforation; a decrease of diameter in the glottic region was detected by the\nvideolaringoscopy; and the Mitsuda test was negative. The treatment of choice was\nexclusively with multibacillary multidrug therapy leading to a marked improvement in the\ncutaneous signs and symptoms after one month of use (). | [[63.0, 'year']] | M | {'33759935': 1, '26566619': 2, '28300896': 2, '33580945': 1, '25831531': 1, '18700113': 1, '18035776': 1, '24346890': 2} | {'5324995-1': 1, '4643505-1': 1} |
164,994 | 3876019-1 | 24,346,885 | noncomm/PMC003xxxxxx/PMC3876019.xml | Systemic sclerosis with keloidal nodules | A 44 years old female patient of afro-descendant origin seeks medical help with a 12\nyears history of Raynaud's phenomenon associated with painful digital ulcers. Six years\nago she developed arthralgia in both hands, alopecia and dyspnea on exertion. One year\nago she noted skin lesions "similar to keloid", of approximately 2 to 3 cm in trunk,\nback and neck that gradually increased in number. Prior treatment with local\ncorticosteroid injections was done without any improvement.\nOn physical examination she had microstomia, narrowing of hand fingertips with small\nscars and an active ulcer in 2nd right finger of 5 mm. Skin thickness was\nseen in skin of the hands forearms and face. In the regions of the neck, trunk and back\nshe had numerous nodular lesions, 2 to 3 cm in diameter, not painful (). Heart, lung and abdomen examinations were\nnormal. A periungueal capillaroscopy was performed and showed a SD pattern (SD=systemic\nsclerosis pattern). Radiographs of hands, echocardiography, barium swallow and CT of the\nchest were normal. A respiratory function test showed restrictive ventilatory defect.\nLaboratory showed a positive ANA (1/640; with fine speckled pattern) and negatives tests\nfor antiScl-70 and anti-centromere. Sedimentation rate, C reactive protein, complete\nblood count, liver and kidney function tests were normal.\nThe patient underwent biopsy of two nodular lesions in the chest, which findings are\nshown at and . In and , it can be seen that the epidermis presents with\nacanthosis and hyperpigmentation at basal layer. Superficial dermis is preserved and\nreticular dermis has increased thickness and sclerosis of collagen bundles. Collagen\nfibers exhibit parallel distribution. There is, also, a discrete perivascular\ninflammatory process. The interstices between collagen fibers is decreased and there is\nentrapment of eccrine glands and nerves. ( and ). In the elastic fibers (darker) can be seen. They do not exist in\nkeloids.\nBased on clinical and pathological report was diagnosed with scleroderma, in its variant\nnodular/keloid.\nTreatment was started with nifedipine 20 mg/day and aspirin 100 mg/day for Raynaud's\nphenomenon. To treat scleroderma nodular lesions we added systemic corticosteroids, oral\nmethotrexate and phototherapy (PUVA). | [[44.0, 'year']] | F | {'16471471': 1, '14677198': 1, '26697236': 2, '12920359': 1, '22383359': 1, '9767323': 1, '9689313': 1, '16205066': 1, '19005241': 1, '27920682': 2, '12362259': 1, '24346885': 2} | {'4677178-1': 1, '5126599-1': 1} |
164,995 | 3876020-1 | 24,346,905 | noncomm/PMC003xxxxxx/PMC3876020.xml | Pyoderma gangrenosum with renal and splenic impairment - Case report | A 22-year-old female patient was referred for evaluation of tender bullae and nodules on\nher lower limbs that rapidly progressed to ulcers with purulent and necrotic base and\nirregular and undermined borders ().\nLesions had been present for the previous four months and the patient also complained of\nfever (38º C) and abdominal pain. Her medical history revealed a persistent anemia since\nchildhood. On physical examination, splenomegaly and pallor of ocular mucosa were\ndetected.\nClinical diagnosis of PG was corroborated by the histopathologic finding of a dermal\nlymphocytic and histiocytic infiltrate with some perivascular neutrophils and\nplasmocytes. Subcutaneous fat tissue was densely infiltrated with lymphocytes and\nhistiocytes and numerous interlobular polymorphonuclear leukocytes (). Gram stain and KOH examination of the ulcer discharge\nyielded negative results.\nLaboratory workup showed a positive ANA (titer 1:160; nuclear, fine, speckled pattern)\nnormocytic and normochromic anemia, low serum iron and high ferritin levels. Bone marrow\naspiration displayed hypercellularity and 23% of sideroblasts, but no ringed\nsideroblast. Normal or negative exams included anti-SM, anti-Ro, anti-La, P-ANCA,\nC-ANCA, rheumatoid factor, antiphospholipid antibodies, cryoagglutinins, anti-HIV,\nhepatitis serology, blood and urine cultures, complement fractions C3 and C4.\nMultiple splenic nodular structures were detected on abdominal US. MRI showed\nintrasplenic and subphrenic collections (). Gram staining and bacterial culture of needle aspirated material from the\nspleen were negative (cold abscess).\nTreatment with an association of corticosteroid, cyclosporine and sulfasalazine resulted\nin significant improvement (). A control\nUS detected reduction of the dimensions of both the spleen and intrasplenic collections.\nLesions recurred upon tapering of corticosteroid and withdrawal of cyclosporine. A\nsecond MRI detected intrasplenic and subdiaphragmatic collections and an altered sign on\nthe right kidney upper pole (). Gram\nstaining and bacterial cultrure from material obtained by renal biopsy was negative.\nHistopathologic findings were consistent with PG adjacent to the renal parenchyma with a\ndense granular and mononuclear infiltrate, xanthomatous macrophages and a large area of\nnecrosis (). | [[22.0, 'year']] | F | {'20227565': 1, '27900062': 1, '22570038': 1, '19171230': 1, '12641787': 1, '8609250': 1, '10863234': 1, '31789268': 1, '21824126': 1, '3889978': 1, '10583064': 1, '33890227': 1, '9492798': 1, '24346905': 2} | {} |
164,996 | 3876021-1 | 24,346,884 | noncomm/PMC003xxxxxx/PMC3876021.xml | Vulvoperineal Crohn's disease responsive to metronidazole | A 47-year-old woman presented for evaluation of multiple persistent painful\nvulvoperineal lesions that had appeared in the last 5 years. She went on several\nantibiotic courses without any improvement. She denied bowel complaints or weight loss.\nHer past medical history was only remarkable for hypertension. On physical examination,\nan exuberant inflammation of the vulva with aftoid ulcers of the labia minor and majora,\nand linear ulcerations in the inguinocrural folds were observed. A deep linear fissure\nabove the clitoris and a "knife-cut" ulcer with sharp margins on the buttocks fold were\nalso present (). A skin biopsy revealed an\nulcerated epidermis with a fistulous tract and aspects of chronic inflammation with\nlymphocytes, hystiocytes and multinucleated giant cells in a non- caseating\ngranulomatous pattern on the dermis ().\nFungal and mycobacterial elements were not detected by histology or in tissue culture.\nLaboratory investigations were normal except for C-reactive protein of 41 mg/dl (<5).\nSyphilis, HIV serologies and Mantoux test were negative. PCR testing for herpes simplex\nvirus was negative. Chest X-ray showed no abnormalities. Based on the clinical and\nhistological findings a vulvoperineal cutaneous Crohn's disease (CD) diagnosis was made.\nThe patient was referred to gastroenterology for evaluation of bowel involvement.\nEndoscopic studies of the digestive tract and biopsies from the ileum, colon and rectum\nshowed no abnormalities, so that a diagnosis of vulvoperineal cutaneous CD without\ndigestive involvement was assumed. The patient went on daily metronidazole (1000 mg) and\nciprofloxacin (1000 mg) with a striking improvement. Antibiotherapy was discontinued at\n3 months and azathioprine (50 mg daily) was introduced. However, the condition worsened\nand metronidazole (1000 mg daily) was added to azathioprine and marked improvement was\nobserved after 12 days. At 2 months of combined therapy (metronidazole 1000 mg plus\nazathioprine 150 mg daily) sustained clinical improvement was observed (). | [[47.0, 'year']] | F | {'32185060': 2, '21238840': 1, '19443301': 1, '20191177': 1, '15913511': 1, '7084615': 1, '21137614': 1, '21508582': 1, '19800432': 1, '24346884': 2} | {'7069867-1': 1} |
164,997 | 3876022-1 | 24,346,896 | noncomm/PMC003xxxxxx/PMC3876022.xml | Mosaic epidermolytic ichthyosis - Case report | Female patient, 37 years old, has presented with blisters and erosions in her axilla,\ngroin, gluteal region and left flank since she was 3 months old. Lesions later became\nhyperkeratotic and verrucous. The patient has a healthy son without similar lesions. She\nreported no previous diseases, use of medication, previous hospitalizations, surgeries,\ndrug allergies or similar diseases in the family.\nOn examination, hyperchromic plaques with verrucous papules were observed in her axilla,\ngroin and gluteal region, following Blaschko's lines. Palmoplantar hyperkeratosis (-)\nwas also seen. All lesions were located in her left hemibody.\nThe patient underwent a biopsy procedure. Histopathologic examination revealed an\nepidermis with extensive foci of hyperkeratosis and parakeratosis, under which there\nwere hypergranulosis and vacuolar degeneration of the granular layer and the upper\nlayers of the stratum spinosum (). The\npattern described confirmed the clinical hypothesis of epidermolytic ichthyosis.\nThe patient was treated with topical retinoic acid with improvement of the lesions on\nthe trunk and persistence of the other lesions. | [[37.0, 'year']] | F | {'18360110': 1, '18571597': 1, '15663649': 1, '26734873': 2, '19443303': 1, '22068776': 1, '19200214': 1, '26396540': 2, '20643494': 1, '18429807': 1, '30787815': 2, '18498407': 1, '32478000': 1, '24346896': 2} | {'6196674-1': 1, '4576893-1': 1, '4689080-1': 1} |
164,998 | 3876310-1 | 24,381,687 | noncomm/PMC003xxxxxx/PMC3876310.xml | Uncommon Etiology of Chest Pain: Pulmonary Sequestration | A previously healthy 26 year old male presented to the emergency department (ED) with chest pain for 1 hour. The patient stated the substernal pain was 10/10 in severity, non-radiating and worse with deep inspiration. He experienced intermittent left arm numbness that started after the onset of the chest pain but denied heart palpitations, diaphoresis, shortness of breath, hemoptysis, cough or recent fevers. On physical exam, vital signs were unremarkable, and he was cooperative and able to speak in full sentences. Chest auscultation did not detect any abnormalities. An electrocardiogram was read as normal. A chest radiograph revealed a lung lesion in the left lower lobe. A computed tomography (CT) of the chest showed a 11 cm × 9 cm × 10.5 cm round, well-defined, heterogeneous mass consistent in location with the lesion noted on the chest radiograph. The patient’s chest pain was well controlled on oral analgesics, and after consultation with the surgical service he was scheduled for an outpatient appointment for follow up and treatment. The patient was discharged and prescribed acetaminophen-hydrocodone 500 mg-5 mg oral tablets to be taken as needed for pain 1–2 tablets every 4–6 hours with a maximum of 8 tablets per day. He was advised to return to the ED if symptoms persisted or worsened.\nThe patient returned to the ED 1 day later with recurrent chest pain that was now more localized around his left lower ribs and rated as 8 out of 10 in severity. His vital signs remained within normal limits and his physical exam was unchanged from discharge. A repeat chest CT showed no changes. His pain management therapy was changed to acetaminophen-oxycodone 325 mg–7.5 mg oral tablets to be taken as needed for pain 1 tablet every 4 hours with a maximum of 6 tablets per day. This adjustment resulted in symptomatic relief of his chest pain. With improved symptoms and unchanged imaging, he was discharged with strict follow-up instructions.\nThe patient returned 3 days later for his scheduled outpatient appointment. The surgical service obtained a chest magnetic resonance angiogram with contrast that revealed a cystic lesion measuring 108.7 mm by 104.0 mm (). A thoracotomy with resection of an extralobar pulmonary sequestration (PS) was completed without intraoperative or post-operative complications. The non-communicating lung parenchyma was being supplied by an artery arising from the abdominal aorta. The patient was discharged home on post-operative day 4.\nAt a follow-up outpatient appointment 1 week after discharge, the patient remained asymptomatic, and a repeat chest radiograph showed resolution of the PS. The patient did not require further outpatient follow-up. | [[26.0, 'year']] | M | {'21459605': 1, '23217881': 1, '4611367': 1, '10413723': 1, '21311173': 1, '15222956': 1, '23098004': 1, '24381687': 2} | {} |
164,999 | 3876312-1 | 24,381,689 | noncomm/PMC003xxxxxx/PMC3876312.xml | Ultrasound Diagnosis of Bilateral Tubo-ovarian Abscesses in the Emergency Department | A previously healthy 30-year-old woman (gravida 1 para 1) presented to the emergency department (ED) with 5 days of lower abdominal pain, fever, and nausea. On examination, she had a temperature of 37.6° Celsius, pulse 116 beats/ minute, blood pressure 123/65 mmHg, respiratory rate 18 breaths/minute, and oxygen saturation 98% on room air. On bimanual examination, the patient exhibited bilateral adnexal tenderness, but no cervical motion tenderness. Relevant laboratory studies included negative urine beta-hCG, white blood cell count 17.4×103/μL and lactate 2.4 mmol/L.\nA bedside transabdominal pelvic ultrasound demonstrated bilateral complex adnexal masses suspicious for tubo-ovarian abscesses (). The patient received intravenous piperacillin/tazobactam, doxycycline, and clindamycin and was admitted to the gynecology service. Surgery was initially deferred and she was managed conservatively with intravenous antibiotics. By the third day of hospitalization, her symptoms had not resolved and an exploratory laparotomy demonstrated purulent ascites and necrotic uterus, ovaries, and fallopian tubes, necessitating a total abdominal hysterectomy and bilateral salpingo-oophorectomy. The patient was discharged home 3 days following the surgery without further complications. | [[30.0, 'year']] | F | {'15301846': 1, '8803731': 1, '18242924': 1, '12962350': 1, '8513637': 1, '15715539': 1, '9697286': 1, '6635426': 1, '20466506': 1, '24381689': 2} | {} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.