id
stringlengths 40
40
| source
stringclasses 9
values | title
stringlengths 2
345
| clean_text
stringlengths 35
1.63M
| raw_text
stringlengths 4
1.63M
| url
stringlengths 4
498
| overview
stringlengths 0
10k
|
|---|---|---|---|---|---|---|
b17f63e824cd156a62a75f8a859f910050d3bd64 | wikidoc | Glycemia | Glycemia
Glycemia or glycæmia is the concentration of glucose in the blood. It is usually expressed in milligrams per deciliter (mg/dl) in the US and other countries. It may also be expressed in millimol per decilitre (mmol/dl) especially in Europe. Both of these are SI units. It is one of the most important controlled variables in the internal milieu of animals (homeostasis), as it was first proposed by French physiologist Claude Bernard (1813-1878).
# Physiological regulation
Glycemia is controlled by several physiological processes. It tends to fluctuate to higher levels after meals, due to the gastric and intestinal absorption of carbohydrates of low molecular weight present in the diet or broken down from other kinds of foodstuffs, such as starches (polysaccharides), and to lower levels with usage by catabolism, particularly after stress, temperature regulation and physical exhertion. Another input to glycemia levels is gluconeogenesis, whereby glycogen stored in the liver and skeletal muscles, or aminoacids and lipids are converted to glucose via several metabolic chains. Excess glucose is converted to glycogen or to triglycerides for energy storage.
Glucose is the most important source of metabolic energy for the majority of cells, particularly for some cells (e.g., neurons and erythrocytes) which are almost totally dependent on it. The brain requires a fairly stable glycemia in order to function normally. Concentrations of less than about 30 mg/dl or greater than about 300 mg/dl can produce confusion, unconsciousness and convulsions.
Several hormones are involved in the regulation of glucose metabolism, such as insulin, glucagon (secreted by the pancreas), adrenalin (secreted by the adrenal glands), glucocorticoids and steroid hormones (secreted by the gonads and adrenal glands).
# Measurement
For clinical evaluation purposes, there are two ways of measuring glycemia:
- Fasting glycemia: measured in a blood sample taken after 8 hours of complete fasting;
- Blood glucose tolerance test (OGTT): measured in several blood samples taken at intervals following a given glucose load (oral intake of endovenous injection).
In certain conditions, it is recommended that blood glucose monitoring be performed regularly, usually by the patient himself, who is trained to do a digital venipuncture and use a small portable glucometer device to evaluate glycemia levels instantly.
Glycemia fluctuates physiologically within a narrow range. Excessively low levels (e.g. a fasting glycemia of 70 mg/dl or below) are classed as hypoglycemia. These may result from poor diet, or as a side effect of diabetes medication. Excessively high levels (e.g., 250 mg/dl or more) are classed as hyperglycemia and are a particular threat to diabetes sufferers.
- 70-100 mg/dl: Normal
- 101-125 mg/dl: Impaired fasting glucose
- 126 mg/dl and above: Risk of diabetes
# Abnormal values
Many forms of severe stress and trauma, stroke, heart attack, and surgery can temporarily increase glucose levels. Glycemia can also be increased by certain drugs such as antidepressants, corticosteroids, diuretics, estrogens, lithium, phenothiazine, phenytoin and Salicylic acids, or decreased by others, such as acetaminophen, alcohol, steroids, clofibrate, gemfibrozil.
However, the disease most directly associated to chronic increase of glycemia is diabetes mellitus, due to a decrease in the secretion of insulin, excess of its breakdown or decreased capacity of cells to transport it across its membranes (insulin resistance). | Glycemia
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Glycemia or glycæmia is the concentration of glucose in the blood. It is usually expressed in milligrams per deciliter (mg/dl) in the US and other countries. It may also be expressed in millimol per decilitre (mmol/dl) especially in Europe. Both of these are SI units. It is one of the most important controlled variables in the internal milieu of animals (homeostasis), as it was first proposed by French physiologist Claude Bernard (1813-1878).
# Physiological regulation
Glycemia is controlled by several physiological processes. It tends to fluctuate to higher levels after meals, due to the gastric and intestinal absorption of carbohydrates of low molecular weight present in the diet or broken down from other kinds of foodstuffs, such as starches (polysaccharides), and to lower levels with usage by catabolism, particularly after stress, temperature regulation and physical exhertion. Another input to glycemia levels is gluconeogenesis, whereby glycogen stored in the liver and skeletal muscles, or aminoacids and lipids are converted to glucose via several metabolic chains. Excess glucose is converted to glycogen or to triglycerides for energy storage.
Glucose is the most important source of metabolic energy for the majority of cells, particularly for some cells (e.g., neurons and erythrocytes) which are almost totally dependent on it. The brain requires a fairly stable glycemia in order to function normally. Concentrations of less than about 30 mg/dl or greater than about 300 mg/dl can produce confusion, unconsciousness and convulsions.
Several hormones are involved in the regulation of glucose metabolism, such as insulin, glucagon (secreted by the pancreas), adrenalin (secreted by the adrenal glands), glucocorticoids and steroid hormones (secreted by the gonads and adrenal glands).
# Measurement
For clinical evaluation purposes, there are two ways of measuring glycemia:
- Fasting glycemia: measured in a blood sample taken after 8 hours of complete fasting;
- Blood glucose tolerance test (OGTT): measured in several blood samples taken at intervals following a given glucose load (oral intake of endovenous injection).
In certain conditions, it is recommended that blood glucose monitoring be performed regularly, usually by the patient himself, who is trained to do a digital venipuncture and use a small portable glucometer device to evaluate glycemia levels instantly.
Glycemia fluctuates physiologically within a narrow range. Excessively low levels (e.g. a fasting glycemia of 70 mg/dl or below) are classed as hypoglycemia. These may result from poor diet, or as a side effect of diabetes medication. Excessively high levels (e.g., 250 mg/dl or more) are classed as hyperglycemia and are a particular threat to diabetes sufferers.
- 70-100 mg/dl: Normal
- 101-125 mg/dl: Impaired fasting glucose
- 126 mg/dl and above: Risk of diabetes
# Abnormal values
Many forms of severe stress and trauma, stroke, heart attack, and surgery can temporarily increase glucose levels. Glycemia can also be increased by certain drugs such as antidepressants, corticosteroids, diuretics, estrogens, lithium, phenothiazine, phenytoin and Salicylic acids, or decreased by others, such as acetaminophen, alcohol, steroids, clofibrate, gemfibrozil.
However, the disease most directly associated to chronic increase of glycemia is diabetes mellitus, due to a decrease in the secretion of insulin, excess of its breakdown or decreased capacity of cells to transport it across its membranes (insulin resistance). | https://www.wikidoc.org/index.php/Glycemia | |
83ce60f2035caf380674c0f3b4781230739a7182 | wikidoc | Glycerin | Glycerin
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Glycerin is a Laxative that is FDA approved for the treatment of constipation. Common adverse reactions include rectal discomfort or a burning sensation, diarrhea.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Indications
- relieves occasional constipation (irregularity)
- generally produces bowel movement in 1/4 to 1 hour
### Directions
- insert 1 suppository well up into rectum and retain for 15 minutes
- it need not melt to produce laxative action
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Glycerin in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Glycerin in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
### Indications
- relieves occasional constipation (irregularity)
- generally produces bowel movement in 1/4 to 1 hour
### Directions
- insert 1 suppository well up into rectum and retain for 15 minutes
- it need not melt to produce laxative action
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Glycerin in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Glycerin in pediatric patients.
# Contraindications
There is limited information regarding Glycerin Contraindications in the drug label.
# Warnings
- For rectal use only
- Do not use laxative products for longer than 1 week unless directed by a doctor
- Ask a doctor before use if you have
- stomach pain
- nausea
- vomiting
- noticed a sudden change in bowel habits that lasts over 2 weeks
- When using this product you may have rectal discomfort or a burning sensation
- Stop use and ask a doctor if you have rectal bleeding or fail to have a bowel movement after use of a laxative. These could be signs of a serious condition.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Clinical Trial Experience of Glycerin in the drug label.
## Postmarketing Experience
- rectal discomfort or a burning sensation, diarrhea
# Drug Interactions
There is limited information regarding Glycerin Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- IF PREGNANT OR BREAST FEEDING
- ask a health professional before use.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Glycerin in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Glycerin during labor and delivery.
### Nursing Mothers
- IF PREGNANT OR BREAST FEEDING
- ask a health professional before use.
### Pediatric Use
There is no FDA guidance on the use of Glycerin with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Glycerin with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Glycerin with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Glycerin with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Glycerin in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Glycerin in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Glycerin in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Glycerin in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- rectal
### Monitoring
There is limited information regarding Monitoring of Glycerin in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Glycerin in the drug label.
# Overdosage
- If swallowed, get medical help or contact a Poison Control Center right away.
# Pharmacology
## Mechanism of Action
## Structure
- ACTIVE INGREDIENT (IN EACH SUPPOSITORY)
- Glycerin, USP 2.1 grams
- INACTIVE INGREDIENT
- purified water, sodium hydroxide, stearic acid
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Glycerin in the drug label.
## Pharmacokinetics
There is limited information regarding Pharmacokinetics of Glycerin in the drug label.
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Glycerin in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Glycerin in the drug label.
# How Supplied
There is limited information regarding Glycerin How Supplied in the drug label.
## Storage
There is limited information regarding Glycerin Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
### PACKAGE LABEL.PRINCIPAL DISPLAY PANEL
### Ingredients and Appearance
# Patient Counseling Information
There is limited information regarding Patient Counseling Information of Glycerin in the drug label.
# Precautions with Alcohol
- Alcohol-Glycerin interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- GLYCERIN®
# Look-Alike Drug Names
There is limited information regarding the look alike drug names.
# Drug Shortage Status
# Price | Glycerin
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Rabin Bista, M.B.B.S. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Glycerin is a Laxative that is FDA approved for the treatment of constipation. Common adverse reactions include rectal discomfort or a burning sensation, diarrhea.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Indications
- relieves occasional constipation (irregularity)
- generally produces bowel movement in 1/4 to 1 hour
### Directions
- insert 1 suppository well up into rectum and retain for 15 minutes
- it need not melt to produce laxative action
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Glycerin in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Glycerin in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
### Indications
- relieves occasional constipation (irregularity)
- generally produces bowel movement in 1/4 to 1 hour
### Directions
- insert 1 suppository well up into rectum and retain for 15 minutes
- it need not melt to produce laxative action
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Glycerin in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Glycerin in pediatric patients.
# Contraindications
There is limited information regarding Glycerin Contraindications in the drug label.
# Warnings
- For rectal use only
- Do not use laxative products for longer than 1 week unless directed by a doctor
- Ask a doctor before use if you have
- stomach pain
- nausea
- vomiting
- noticed a sudden change in bowel habits that lasts over 2 weeks
- When using this product you may have rectal discomfort or a burning sensation
- Stop use and ask a doctor if you have rectal bleeding or fail to have a bowel movement after use of a laxative. These could be signs of a serious condition.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Clinical Trial Experience of Glycerin in the drug label.
## Postmarketing Experience
- rectal discomfort or a burning sensation, diarrhea
# Drug Interactions
There is limited information regarding Glycerin Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- IF PREGNANT OR BREAST FEEDING
- ask a health professional before use.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Glycerin in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Glycerin during labor and delivery.
### Nursing Mothers
- IF PREGNANT OR BREAST FEEDING
- ask a health professional before use.
### Pediatric Use
There is no FDA guidance on the use of Glycerin with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Glycerin with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Glycerin with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Glycerin with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Glycerin in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Glycerin in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Glycerin in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Glycerin in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- rectal
### Monitoring
There is limited information regarding Monitoring of Glycerin in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Glycerin in the drug label.
# Overdosage
- If swallowed, get medical help or contact a Poison Control Center right away.
# Pharmacology
## Mechanism of Action
-
## Structure
- ACTIVE INGREDIENT (IN EACH SUPPOSITORY)
- Glycerin, USP 2.1 grams
- INACTIVE INGREDIENT
- purified water, sodium hydroxide, stearic acid
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Glycerin in the drug label.
## Pharmacokinetics
There is limited information regarding Pharmacokinetics of Glycerin in the drug label.
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Glycerin in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Glycerin in the drug label.
# How Supplied
There is limited information regarding Glycerin How Supplied in the drug label.
## Storage
There is limited information regarding Glycerin Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
### PACKAGE LABEL.PRINCIPAL DISPLAY PANEL
### Ingredients and Appearance
# Patient Counseling Information
There is limited information regarding Patient Counseling Information of Glycerin in the drug label.
# Precautions with Alcohol
- Alcohol-Glycerin interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- GLYCERIN®[4]
# Look-Alike Drug Names
There is limited information regarding the look alike drug names.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Glycerin | |
0f62047cdcd1b3ec9775dce65e092b9cfc750524 | wikidoc | Glycogen | Glycogen
Glycogen is a polysaccharide of glucose (Glc) which functions as the primary short term energy storage in animal cells. It is made primarily by the liver and the muscles, but can also be made by the brain, uterus, and the vagina. Glycogen is the analogue of starch, a less branched glucose polymer in plants, and is commonly referred to as animal starch, having a similar structure to amylopectin. Glycogen is found in the form of granules in the cytosol in many cell types, and plays an important role in the glucose cycle. Glycogen forms an energy reserve that can be quickly mobilized to meet a sudden need for glucose, but one that is less compact than the energy reserves of triglycerides (fat). In the liver hepatocytes, glycogen can compose up to 8% of the fresh weight (100–120 g in an adult) soon after a meal. Only the glycogen stored in the liver can be made accessible to other organs. In the muscles, glycogen is found in a much lower concentration (1% of the muscle mass), but the total amount exceeds that in liver. Small amounts of glycogen are found in the kidneys, and even smaller amounts in certain glial cells in the brain and white blood cells. The uterus also stores glycogen during pregnancy to nourish the embryo.
# Structure and biochemistry
Glycogen is a highly branched polymer that is better described as a dendrimer of about 60,000 glucose residues and has a molecular weight between 106 and 107 daltons (~4.8 million). Most of Glc units are linked by α-1,4 glycosidic bonds, approximately 1 in 12 Glc residues also makes -1,6 glycosidic bond with a second Glc, which results in the creation of a branch. Glycogen does not possess a reducing end: the 'reducing end' glucose residue is not free but is covalently bound to a protein termed glycogenin as a beta-linkage to a surface tyrosine residue. Glycogenin is a glycosyltransferase and occurs as a dimer in the core of glycogen. The glycogen granules contain both glycogen and the enzymes of glycogen synthesis (glycogenesis) and degradation (glycogenolysis). The enzymes are nested between the outer branches of the glycogen molecules and act on the non-reducing ends. Therefore, the many non-reducing end-branches of glycogen facilitate its rapid synthesis and catabolism.
# Function and regulation of liver glycogen
As a carbohydrate meal is eaten and digested, blood glucose levels rise, and the pancreas secretes insulin. Glucose from the portal vein enters the liver cells (hepatocytes). Insulin acts on the hepatocytes to stimulate the action of several enzymes, including glycogen synthase. Glucose molecules are added to the chains of glycogen as long as both insulin and glucose remain plentiful. In this postprandial or "fed" state, the liver takes in more glucose from the blood than it releases.
After a meal has been digested and glucose levels begin to fall, insulin secretion is reduced, and glycogen synthesis stops. About four hours after a meal, glycogen begins to be broken down to be converted again to glucose. Glycogen phosphorylase is the primary enzyme of glycogen breakdown. For the next 8–12 hours, glucose derived from liver glycogen will be the primary source of blood glucose to be used by the rest of the body for fuel.
Glucagon is another hormone produced by the pancreas, which in many respects serves as a counter-signal to insulin. When the blood sugar begins to fall below normal, glucagon is secreted in increasing amounts. It stimulates glycogen breakdown into glucose even when insulin levels are abnormally high.
# In muscle and other cells
Muscle cell glycogen appears to function as an immediate reserve source of available glucose for muscle cells. Other cells that contain small amounts use it locally as well. Muscle cells lack the ability to pass glucose into the blood, so the glycogen they store internally is destined for internal use and is not shared with other cells, unlike liver cells.
# Glycogen debt and endurance exercise
Due to the body's inability to hold more than around 2,000 kcal of glycogen, long-distance athletes such as marathon runners, cross-country skiers, and cyclists go into glycogen debt, where almost all of the athlete's glycogen stores are depleted after long periods of exertion without enough energy consumption. This phenomenon is referred to as "hitting the wall" or "bonking". In marathon runners it normally happens around the 20 mile (32 km) point of a marathon, where around 100 kcal are spent per mile, depending on the size of the runner and the race course. However, it can be delayed by a carbohydrate loading before the task.
When experiencing glycogen debt, athletes often experience extreme fatigue to the point that it is difficult to move.
# Disorders of glycogen metabolism
The most common disease in which glycogen metabolism becomes abnormal is diabetes, in which, because of abnormal amounts of insulin, liver glycogen can be abnormally accumulated or depleted. Restoration of normal glucose metabolism usually normalizes glycogen metabolism as well.
In hypoglycemia caused by excessive insulin, liver glycogen levels are high, but the high insulin level prevents the glycogenolysis necessary to maintain normal blood sugar levels. Glucagon is a common treatment for this type of hypoglycemia.
Various inborn errors of metabolism are caused by deficiencies of enzymes necessary for glycogen synthesis or breakdown. These are collectively referred to as glycogen storage diseases.
# Synthesis
Glycogen synthesis differs from glycogen breakdown. Unlike breakdown, synthesis is endergonic, meaning that glycogen is not synthesized without the input of energy. Energy for glycogen synthesis comes from UTP, which reacts with glucose-1-phosphate, forming UDP-glucose, in reaction catalysed by UDP-glucosediphosphorylase. Glycogen is synthesized from monomers of UDP-glucose by the enzyme Glycogen synthase, which progressively lengthens the glycogen chain. As glycogen synthase can only lengthen an existing chain, the protein glycogenin is needed to initiate the synthesis of glycogen.
# Breakdown
Glycogen is cleaved from the nonreducing ends of the chain by the enzyme glycogen phosphorylase to produce monomers of glucose-1-phosphate that is then converted to Glucose 6-phosphate. A special debranching enzyme is needed to remove the alpha(1-6) branches in branched glycogen and reshape the chain into linear polymer. The G6P monomers produced have three possible fates:
- G6P can continue on the glycolysis pathway and be used as fuel.
- G6P can enter the pentose phosphate pathway via the enzyme Glucose-6-phosphate dehydrogenase to produce NADPH and 5-carbon sugars.
- In the liver and kidney, G6P can be dephosphorylated back to Glucose by the enzyme Glucose 6-phosphatase. This is the final step in the gluconeogenesis pathway. | Glycogen
Glycogen is a polysaccharide of glucose (Glc) which functions as the primary short term energy storage in animal cells. It is made primarily by the liver and the muscles, but can also be made by the brain, uterus, and the vagina.[1] Glycogen is the analogue of starch, a less branched glucose polymer in plants, and is commonly referred to as animal starch, having a similar structure to amylopectin. Glycogen is found in the form of granules in the cytosol in many cell types, and plays an important role in the glucose cycle. Glycogen forms an energy reserve that can be quickly mobilized to meet a sudden need for glucose, but one that is less compact than the energy reserves of triglycerides (fat). In the liver hepatocytes, glycogen can compose up to 8% of the fresh weight (100–120 g in an adult) soon after a meal.[citation needed] Only the glycogen stored in the liver can be made accessible to other organs. In the muscles, glycogen is found in a much lower concentration (1% of the muscle mass), but the total amount exceeds that in liver. Small amounts of glycogen are found in the kidneys, and even smaller amounts in certain glial cells in the brain and white blood cells. The uterus also stores glycogen during pregnancy to nourish the embryo.
# Structure and biochemistry
Glycogen is a highly branched polymer that is better described as a dendrimer of about 60,000 glucose residues and has a molecular weight between 106 and 107 daltons (~4.8 million).[citation needed] Most of Glc units are linked by α-1,4 glycosidic bonds, approximately 1 in 12 Glc residues also makes -1,6 glycosidic bond with a second Glc, which results in the creation of a branch. Glycogen does not possess a reducing end: the 'reducing end' glucose residue is not free but is covalently bound to a protein termed glycogenin as a beta-linkage to a surface tyrosine residue. Glycogenin is a glycosyltransferase and occurs as a dimer in the core of glycogen. The glycogen granules contain both glycogen and the enzymes of glycogen synthesis (glycogenesis) and degradation (glycogenolysis). The enzymes are nested between the outer branches of the glycogen molecules and act on the non-reducing ends. Therefore, the many non-reducing end-branches of glycogen facilitate its rapid synthesis and catabolism.
# Function and regulation of liver glycogen
As a carbohydrate meal is eaten and digested, blood glucose levels rise, and the pancreas secretes insulin. Glucose from the portal vein enters the liver cells (hepatocytes). Insulin acts on the hepatocytes to stimulate the action of several enzymes, including glycogen synthase. Glucose molecules are added to the chains of glycogen as long as both insulin and glucose remain plentiful. In this postprandial or "fed" state, the liver takes in more glucose from the blood than it releases.
After a meal has been digested and glucose levels begin to fall, insulin secretion is reduced, and glycogen synthesis stops. About four hours after a meal[citation needed], glycogen begins to be broken down to be converted again to glucose. Glycogen phosphorylase is the primary enzyme of glycogen breakdown. For the next 8–12 hours, glucose derived from liver glycogen will be the primary source of blood glucose to be used by the rest of the body for fuel.
Glucagon is another hormone produced by the pancreas, which in many respects serves as a counter-signal to insulin. When the blood sugar begins to fall below normal, glucagon is secreted in increasing amounts. It stimulates glycogen breakdown into glucose even when insulin levels are abnormally high.
# In muscle and other cells
Muscle cell glycogen appears to function as an immediate reserve source of available glucose for muscle cells. Other cells that contain small amounts use it locally as well. Muscle cells lack the ability to pass glucose into the blood, so the glycogen they store internally is destined for internal use and is not shared with other cells, unlike liver cells.
# Glycogen debt and endurance exercise
Due to the body's inability to hold more than around 2,000 kcal of glycogen,[citation needed] long-distance athletes such as marathon runners, cross-country skiers, and cyclists go into glycogen debt, where almost all of the athlete's glycogen stores are depleted after long periods of exertion without enough energy consumption. This phenomenon is referred to as "hitting the wall" or "bonking". In marathon runners it normally happens around the 20 mile (32 km) point of a marathon, where around 100 kcal are spent per mile,[citation needed] depending on the size of the runner and the race course. However, it can be delayed by a carbohydrate loading before the task.
When experiencing glycogen debt, athletes often experience extreme fatigue to the point that it is difficult to move.
# Disorders of glycogen metabolism
The most common disease in which glycogen metabolism becomes abnormal is diabetes, in which, because of abnormal amounts of insulin, liver glycogen can be abnormally accumulated or depleted. Restoration of normal glucose metabolism usually normalizes glycogen metabolism as well.
In hypoglycemia caused by excessive insulin, liver glycogen levels are high, but the high insulin level prevents the glycogenolysis necessary to maintain normal blood sugar levels. Glucagon is a common treatment for this type of hypoglycemia.
Various inborn errors of metabolism are caused by deficiencies of enzymes necessary for glycogen synthesis or breakdown. These are collectively referred to as glycogen storage diseases.
# Synthesis
Glycogen synthesis differs from glycogen breakdown. Unlike breakdown, synthesis is endergonic, meaning that glycogen is not synthesized without the input of energy. Energy for glycogen synthesis comes from UTP, which reacts with glucose-1-phosphate, forming UDP-glucose, in reaction catalysed by UDP-glucosediphosphorylase. Glycogen is synthesized from monomers of UDP-glucose by the enzyme Glycogen synthase, which progressively lengthens the glycogen chain. As glycogen synthase can only lengthen an existing chain, the protein glycogenin is needed to initiate the synthesis of glycogen.
# Breakdown
Glycogen is cleaved from the nonreducing ends of the chain by the enzyme glycogen phosphorylase to produce monomers of glucose-1-phosphate that is then converted to Glucose 6-phosphate. A special debranching enzyme is needed to remove the alpha(1-6) branches in branched glycogen and reshape the chain into linear polymer. The G6P monomers produced have three possible fates:
- G6P can continue on the glycolysis pathway and be used as fuel.
- G6P can enter the pentose phosphate pathway via the enzyme Glucose-6-phosphate dehydrogenase to produce NADPH and 5-carbon sugars.
- In the liver and kidney, G6P can be dephosphorylated back to Glucose by the enzyme Glucose 6-phosphatase. This is the final step in the gluconeogenesis pathway. | https://www.wikidoc.org/index.php/Glycogen | |
d2fabd3f77e1fd7ede6844944de011f9c2a17b44 | wikidoc | Miglitol | Miglitol
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Miglitol is a alpha-glucosidase inhibitor that is FDA approved for the treatment of type 2 diabetes mellitus. Common adverse reactions include rash, transient abdominal pain, diarrhea, flatulence, serum iron low.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
- GLYSET is indicated as an adjunct to diet and exercise to improve glycemic control in adults with type 2 diabetes mellitus.
- Initial Dosage
- The recommended starting dosage of GLYSET is 25 mg, given orally three times daily at the start of each main meal. However, some patients may benefit by starting at 25 mg once daily to minimize gastrointestinal adverse effects, and gradually increasing the frequency of administration to 3 times daily.
- Maintenance Dosage
- The usual maintenance dose of GLYSET is 50 mg taken 3 times daily, although some patients may benefit from increasing the dose to 100 mg 3 times daily. To allow adaptation to potential gastrointestinal adverse effects, it is recommended that GLYSET therapy be initiated at a dosage of 25 mg 3 times daily, then gradually titrated upward to allow adaptation. After 4 to 8 weeks of the 25 mg 3 times daily regimen, the dosage should be increased to 50 mg 3 times daily for approximately three months, following which a glycosylated hemoglobin level should be measured to assess therapeutic response. If at that time, the glycosylated hemoglobin level is not satisfactory, the dosage may be further increased to 100 mg 3 times daily, the maximum recommended dosage.
- Pooled data from controlled studies suggest a dose-response for both HbA1c and one-hour postprandial plasma glucose throughout the recommended dosage range. However, no single study has examined the effect on glycemic control of titrating patients' doses upwards within the same study. If no further reduction in postprandial glucose or glycosylated hemoglobin levels is observed with titration to 100 mg 3 times daily, consideration should be given to lowering the dose. Once an effective and tolerated dosage is established, it should be maintained.
- Maximum Dosage
- The maximum recommended dosage of GLYSET is 100 mg 3 times daily. In one clinical trial, 200 mg 3 times daily gave additional improved glycemic control but increased the incidence of the gastrointestinal symptoms described above.
- Patients Receiving Sulfonylureas
- Sulfonylurea agents may cause hypoglycemia. There was no increased incidence of hypoglycemia in patients who took GLYSET in combination with sulfonylurea agents compared to the incidence of hypoglycemia in patients receiving sulfonylureas alone in any clinical trial. However, GLYSET given in combination with a sulfonylurea will cause a further lowering of blood glucose and may increase the risk of hypoglycemia due to the additive effects of the two agents. If hypoglycemia occurs, appropriate adjustments in the dosage of these agents should be made.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Miglitol in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Miglitol in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding FDA-Labeled Use of Miglitol in pediatric patients.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Miglitol in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Miglitol in pediatric patients.
# Contraindications
- GLYSET Tablets are contraindicated in patients with:
- Diabetic ketoacidosis
- Inflammatory bowel disease, colonic ulceration, or partial intestinal obstruction, and in patients predisposed to intestinal obstruction
- Chronic intestinal diseases associated with marked disorders of digestion or absorption, or with conditions that may deteriorate as a result of increased gas formation in the intestine
- Hypersensitivity to the drug or any of its components.
# Warnings
### Precautions
- Macrovascular Outcomes
- There have been no clinical studies establishing conclusive evidence of macrovascular risk reduction with GLYSET or any other anti-diabetic drug.
- General
- Hypoglycemia
- Because of its mechanism of action, GLYSET, when administered alone, should not cause hypoglycemia in the fasted or postprandial state. Sulfonylureas and insulin can cause hypoglycemia. Because GLYSET Tablets given in combination with a sulfonylurea or insulin will cause a further lowering of blood glucose, it may increase the hypoglycemic potential of the sulfonylurea or :*insulin. Consider reducing the dose of sulfonylureas or insulin when GLYSET is used in combination with these medications.
- Oral glucose (dextrose), whose absorption is not delayed by GLYSET, should be used instead of sucrose (cane sugar) in the treatment of mild-to-moderate hypoglycemia. Sucrose, whose hydrolysis to glucose and fructose is inhibited by GLYSET, is unsuitable for the rapid correction of hypoglycemia. Severe hypoglycemia may require the use of either intravenous glucose infusion or glucagon injection.
- Loss of Control of Blood Glucose
- When diabetic patients are exposed to stress such as fever, trauma, infection, or surgery, a temporary loss of control of blood glucose may occur. At such times, temporary insulin therapy may be necessary.
- Renal Impairment
- Plasma concentrations of GLYSET in renally impaired volunteers were proportionally increased relative to the degree of renal dysfunction. Long-term clinical trials in diabetic patients with significant renal dysfunction (serum creatinine >2.0 mg/dL) have not been conducted. Therefore, treatment of these patients with GLYSET is not recommended.
# Adverse Reactions
## Clinical Trials Experience
- Gastrointestinal
- Gastrointestinal symptoms are the most common reactions to GLYSET Tablets. In U.S. placebo-controlled trials, the incidences of abdominal pain, diarrhea, and flatulence were 11.7%, 28.7%, and 41.5% respectively in 962 patients treated with GLYSET 25 100 mg 3 times daily, whereas the corresponding incidences were 4.7%, 10.0%, and 12.0% in 603 placebo-treated patients. The incidence of diarrhea and abdominal pain tended to diminish with continued treatment.
- Dermatologic
- Skin rash was reported in 4.3% of patients treated with GLYSET compared to 2.4% of placebo-treated patients. Rashes were generally transient and most were assessed as unrelated to GLYSET by physician investigators.
- Abnormal Laboratory Findings
- Low serum iron occurred more often in patients treated with GLYSET (9.2%) than in placebo-treated patients (4.2%) but did not persist in the majority of cases and was not associated with reductions in hemoglobin or changes in other hematologic indices.
## Postmarketing Experience
- The following adverse reactions have been reported during post-approval use of GLYSET. Because these reactions are reported voluntarily from a population of uncertain size, it is generally not possible to reliably estimate their frequency or establish a causal relationship to drug exposure.
- Gastrointestinal Disorders
- Ileus (including paralytic ileus), subileus, gastrointestinal pain, nausea, abdominal distention.
- Pneumatosis Cystoides Intestinalis
- There have been rare postmarketing reports of pneumatosis cystoides intestinalis associated with the use of alpha-glucosidase inhibitors, including GLYSET. Pneumatosis cystoides intestinalis may present with symptoms of diarrhea, mucus discharge, rectal bleeding, and constipation. Complications may include pneumoperitoneum, volvulus, intestinal obstruction, intussusception, intestinal hemorrhage, and intestinal perforation. If pneumatosis cystoides intestinalis is suspected, discontinue Glyset and perform the appropriate diagnostic imaging.
# Drug Interactions
- Several studies investigated the possible interaction between miglitol and glyburide. In six healthy volunteers given a single dose of 5 mg glyburide on a background of 6 days treatment with miglitol (50 mg 3 times daily for 4 days followed by 100 mg 3 times daily for 2 days) or placebo, the mean Cmax and AUC values for glyburide were 17% and 25% lower, respectively, when glyburide was given with miglitol. In a study in diabetic patients in which the effects of adding miglitol 100 mg 3 times daily for 7 days or placebo to a background regimen of 3.5 mg glyburide daily were investigated, the mean AUC value for glyburide was 18% lower in the group treated with miglitol, although this difference was not statistically significant. Information on a potential interaction with glyburide was obtained from one of the large U.S. clinical trials (Study 7) in which patients were dosed with either miglitol or placebo on a background of glyburide 10 mg twice daily. At the 6-month and 1-year clinic visits, patients taking concomitant miglitol 100 mg 3 times daily exhibited mean Cmax values for glyburide that were 16% and 8% lower, respectively, compared to patients taking glyburide alone. However, these differences were not statistically significant. Thus, although there was a trend toward lower AUC and Cmax values for glyburide when co-administered with GLYSET, no definitive statement regarding a potential interaction can be made based on the foregoing three studies.
- The effect of miglitol (100 mg 3 times daily for 7 days) on the pharmacokinetics of a single 1000 mg dose of metformin was investigated in healthy volunteers. Mean AUC and Cmax values for metformin were 12% to 13% lower when the volunteers were given miglitol as compared with placebo, but this difference was not statistically significant.
- In a study with healthy volunteers, co-administration of either 50 mg or 100 mg miglitol 3 times daily together with digoxin reduced the average plasma concentrations of digoxin by 19% and 28%, respectively. However, in diabetic patients under treatment with digoxin, plasma digoxin concentrations were not altered by co-administration of miglitol 100 mg 3 times daily for 14 days.
- Other healthy volunteer studies have demonstrated that miglitol may significantly reduce the bioavailability of ranitidine and propranolol by 60% and 40%, respectively. No effect of miglitol was observed on the pharmacokinetics or pharmacodynamics of either warfarin or nifedipine.
- Intestinal adsorbents (e.g., charcoal) and digestive enzyme preparations containing carbohydrate-splitting enzymes (e.g., amylase, pancreatin) may reduce the effect of GLYSET and should not be taken concomitantly.
- In 12 healthy males, concomitantly administered antacid did not influence the pharmacokinetics of miglitol.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- Pregnancy Category B
- The safety of GLYSET in pregnant women has not been established. Developmental toxicology studies have been performed in rats at doses of 50, 150 and 450 mg/kg, corresponding to levels of approximately 1.5, 4, and 12 times the maximum recommended human exposure based on body surface area. In rabbits, doses of 10, 45, and 200 mg/kg corresponding to levels of approximately 0.5, 3, and 10 times the human exposure were examined. These studies revealed no evidence of fetal malformations attributable to miglitol. Doses of miglitol up to 4 and 3 times the human dose (based on body surface area), for rats and rabbits respectively, did not reveal evidence of impaired fertility or harm to the fetus. The highest doses tested in these studies, 450 mg/kg in the rat and 200 mg/kg in the rabbit promoted maternal and/or fetal toxicity. Fetotoxicity was indicated by a slight but significant reduction in fetal weight in the rat study and slight reduction in fetal weight, delayed ossification of the fetal skeleton and increase in the percentage of non-viable fetuses in the rabbit study. In the peri-postnatal study in rats, the NOAEL (No Observed Adverse Effect Level) was 100 mg/kg (corresponding to approximately four times the exposure to humans, based on body surface area). An increase in stillborn progeny was noted at the high dose (300 mg/kg) in the rat peri-postnatal study, but not at the high dose (450 mg/kg) in the delivery segment of the rat developmental toxicity study. Otherwise, there was no adverse effect on survival, growth, development, behavior, or fertility in either the rat developmental toxicity or peri-postnatal studies. There are however, no adequate and well-controlled studies in pregnant women. Because animal reproduction studies are not always predictive of human response, miglitol should be used during pregnancy only if clearly needed.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Miglitol in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Miglitol during labor and delivery.
### Nursing Mothers
- Miglitol has been shown to be excreted in human milk to a very small degree. Total excretion into milk accounted for 0.02% of a 100 mg maternal dose. The estimated exposure to a nursing infant is approximately 0.4% of the maternal dose. Although the levels of miglitol reached in human milk are exceedingly low, it is recommended that GLYSET not be administered to a nursing woman.
### Pediatric Use
- Safety and effectiveness of GLYSET in pediatric patients have not been established.
### Geriatic Use
- Of the total number of subjects in clinical studies of GLYSET in the United States, patients valid for safety analyses included 24% over 65, and 3% over 75. No overall differences in safety and effectiveness were observed between these subjects and younger subjects. The pharmacokinetics of miglitol were studied in elderly and young males (n=8 per group). At the dosage of 100 mg 3 times daily for 3 days, no differences between the two groups were found.
### Gender
There is no FDA guidance on the use of Miglitol with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Miglitol with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Miglitol in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Miglitol in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Miglitol in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Miglitol in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Monitoring of Miglitol in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Miglitol in the drug label.
# Overdosage
## Acute Overdose
- Unlike sulfonylureas or insulin, an overdose of GLYSET tablets will not result in hypoglycemia. An overdose may result in transient increases in flatulence, diarrhea, and abdominal discomfort. Because of the lack of extra-intestinal effects seen with GLYSET, no serious systemic reactions are expected in the event of an overdose.
## Chronic Overdose
There is limited information regarding Chronic Overdose of Miglitol in the drug label.
# Pharmacology
There is limited information regarding Miglitol Pharmacology in the drug label.
## Mechanism of Action
- In contrast to sulfonylureas, GLYSET does not enhance insulin secretion. The antihyperglycemic action of miglitol results from a reversible inhibition of membrane-bound intestinal α-glucoside hydrolase enzymes. Membrane-bound intestinal α-glucosidases hydrolyze oligosaccharides and disaccharides to glucose and other monosaccharides in the brush border of the small intestine. In diabetic patients, this enzyme inhibition results in delayed glucose absorption and lowering of postprandial hyperglycemia.
- Because its mechanism of action is different, the effect of GLYSET to enhance glycemic control is additive to that of sulfonylureas when used in combination. In addition, GLYSET diminishes the insulinotropic and weight-increasing effects of sulfonylureas.
- Miglitol has minor inhibitory activity against lactase and consequently, at the recommended doses, would not be expected to induce lactose intolerance.
## Structure
- GLYSET Tablets contain miglitol, an oral alpha-glucosidase inhibitor for use in the management of non-insulin-dependent diabetes mellitus (NIDDM). Miglitol is a desoxynojirimycin derivative, and is chemically known as 3,4,5-piperidinetriol, 1-(2-hydroxyethyl)-2-(hydroxymethyl)-, -. It is a white to pale-yellow powder with a molecular weight of 207.2. Miglitol is soluble in water and has a pKa of 5.9. Its empirical formula is C8H17NO5 and its chemical structure is as follows:
- GLYSET is available as 25 mg, 50 mg and 100 mg tablets for oral use. The inactive ingredients are starch, microcrystalline cellulose, magnesium stearate, hypromellose, polyethylene glycol, titanium dioxide, and polysorbate 80.
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Miglitol in the drug label.
## Pharmacokinetics
- Absorption
- Absorption of miglitol is saturable at high doses: a dose of 25 mg is completely absorbed, whereas a dose of 100 mg is 50% – 70% absorbed. For all doses, peak concentrations are reached in 2 to 3 hours. There is no evidence that systemic absorption of miglitol contributes to its therapeutic effect.
- Distribution
- The protein binding of miglitol is negligible (<4.0%). Miglitol has a volume of distribution of 0.18 L/kg, consistent with distribution primarily into the extracellular fluid.
- Metabolism
- Miglitol is not metabolized in humans or in any animal species studied. No metabolites have been detected in plasma, urine or feces, indicating a lack of either systemic or pre-systemic metabolism.
- Excretion
- Miglitol is eliminated by renal excretion as unchanged drug. Following a 25 mg dose, over 95% of the dose is recovered in the urine within 24 hours. At higher doses, the cumulative recovery of drug from urine is somewhat lower due to the incomplete bioavailability. The elimination half-life of miglitol from plasma is approximately 2 hours.
- Special Populations
- Renal Impairment
- Because miglitol is excreted primarily by the kidneys, accumulation of miglitol is expected in patients with renal impairment. Patients with creatinine clearance 60 mL/min. Dosage adjustment to correct the increased plasma concentrations is not feasible because miglitol acts locally. Little information is available on the safety of miglitol in patients with creatinine clearance <25 mL/min. Therefore, treatment of these patients with miglitol is not recommended.
- Hepatic impairment
- Miglitol pharmacokinetics were not altered in cirrhotic patients relative to healthy control subjects. Since miglitol is not metabolized, no influence of hepatic function on the kinetics of miglitol is expected.
- Gender
- No significant difference in the pharmacokinetics of miglitol was observed between elderly men and women when body weight was considered.
- Race
- Several pharmacokinetic studies were conducted in Japanese volunteers, with results similar to those observed in Caucasians. A study comparing the pharmacodynamic response to a single 50 mg dose in Black and Caucasian healthy volunteers indicated similar glucose and insulin responses in both populations.
## Nonclinical Toxicology
- Miglitol was administered to mice by the dietary route at doses as high as approximately 500 mg/kg body weight (corresponding to greater than 5 times the exposure in humans based on AUC) for 21 months. In a two-year rat study, miglitol was administered in the diet at exposures comparable to the maximum human exposures based on AUC. There was no evidence of carcinogenicity resulting from dietary treatment with miglitol.
- In vitro, miglitol was found to be nonmutagenic in the bacterial mutagenesis (Ames) assay and the eukaryotic forward mutation assay (CHO/HGPRT). Miglitol did not have any clastogenic effects in vivo in the mouse micronucleus test. There were no heritable mutations detected in dominant lethal assay.
- A combined male and female fertility study conducted in Wistar rats treated orally with miglitol at dose levels of 300 mg/kg body weight (approximately 8 times the maximum human exposure based on body surface area) produced no untoward effect on reproductive performance or capability to reproduce. Survival, growth, development, and fertility of the offspring were not compromised.
# Clinical Studies
- GLYSET Tablets were evaluated in two U.S. and three non-U.S. controlled, fixed-dose, monotherapy studies, in which 735 patients treated with GLYSET were evaluated for efficacy analyses (see Table 1).
- In Study 1, a 1-year study in which GLYSET was evaluated as monotherapy and also as combination therapy, there was a statistically significantly smaller increase in mean glycosylated hemoglobin (HbA1c) over time in the miglitol 50 mg 3 times daily monotherapy arm compared to placebo. Significant reductions in mean fasting and postprandial plasma glucose levels and in mean postprandial insulin levels were observed in patients treated with GLYSET compared with the placebo group.
- In Study 2, a 14-week study, there was a significant decrease in HbA1c in patients receiving GLYSET 50 mg 3 times daily or 100 mg 3 times daily compared to placebo. In addition, there were significant reductions in postprandial plasma glucose and postprandial serum insulin levels compared to placebo.
- Study 3, was a 6-month dose-ranging trial evaluating GLYSET at doses from 25 mg 3 times daily, to 200 mg 3 times daily. GLYSET produced a greater reduction in HbA1c than placebo at all doses, although the effect was statistically significant at the 100 mg 3 times daily and 200 mg 3 times daily. In addition, all doses of GLYSET produced significant reductions in postprandial plasma glucose and postprandial insulin levels compared to placebo.
- Studies 4 and 5 were 6-month studies evaluating GLYSET at 50 and 100 mg 3 times daily, and 100 mg 3 times daily, respectively. As compared to placebo, GLYSET produced reductions in HbA1c, as well as a significant reduction in postprandial plasma glucose in both studies at the doses employed.
- GLYSET was studied as adjunctive therapy to a background of maximal or near-maximal sulfonylurea (SFU) treatment in three large, double-blind, randomized studies (two U.S. and one non-U.S.) in which 471 patients treated with GLYSET were evaluated for efficacy (see Table 2).
- Study 6 included patients under treatment with maximal doses of SFU at entry. At the end of this 14-week study, the mean treatment effects on glycosylated hemoglobin (HbA1c) were -0.82% and -0.74% for patients receiving GLYSET 50 mg 3 times daily plus SFU, and GLYSET 100 mg 3 times daily plus SFU, respectively.
- Study 7 was a 1-year study in which GLYSET at 25, 50 or 100 mg 3 times daily was added to a maximal dose of glyburide (10 mg twice daily). At the end of this study, the mean treatment effects on HbA1c of GLYSET when added to maximum glyburide therapy were -0.30%, -0.62%, and -0.73% with 25, 50 and 100 mg 3 times daily dosages of GLYSET, respectively.
- In Study 8, the addition of GLYSET 100 mg 3 times daily to a background of treatment with glyburide produced an additional mean treatment effect on HbA1c of -0.66%.
- Dose Response
- Results from controlled, fixed-dose studies of GLYSET as monotherapy or as combination treatment with a sulfonylurea were combined to derive a pooled estimate of the difference from placebo in the mean change from baseline in glycosylated hemoglobin (HbA1c) and postprandial plasma glucose as shown in Figures 1 and 2:
- Because of its mechanism of action, the primary pharmacologic effect of miglitol is manifested as a reduction in postprandial plasma glucose, as shown previously in all of the major clinical trials. GLYSET was statistically significantly different from placebo at all doses in each of the individual studies with respect to effect on mean one-hour postprandial plasma glucose, and there is a dose response from 25 to 100 mg 3 times daily for this efficacy parameter.
# How Supplied
- GLYSET Tablets are available as 25 mg, 50 mg, and 100 mg tablets.
- Store at 25°C (77°F); excursions permitted to 15°–30°C (59°–86°F).
## Storage
There is limited information regarding Miglitol Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
- The following information should be provided to patients:
- GLYSET should be taken orally three times a day at the start of each main meal. It is important to continue to adhere to dietary instructions, a regular exercise program, and regular testing of urine and/or blood glucose.
- GLYSET itself does not cause hypoglycemia when administered to patients in the fasted state. Sulfonylurea drugs and insulin, however, can lower blood sugar levels and cause symptoms or life-threatening hypoglycemia. Because GLYSET given in combination with a sulfonylurea or insulin will cause a further lowering of blood sugar, it may increase the hypoglycemic potential of these agents. The risk of hypoglycemia, its symptoms and treatment, and conditions that predispose to its development should be well understood by patients and responsible family members. Because GLYSET prevents the breakdown of table sugar, a source of glucose (dextrose, D-glucose) should be readily available to treat symptoms of low blood sugar when taking GLYSET in combination with a sulfonylurea or insulin.
- If side effects occur with GLYSET, they usually develop during the first few weeks of therapy. They are most commonly mild-to-moderate dose-related gastrointestinal effects, such as flatulence, soft stools, diarrhea, or abdominal discomfort, and generally diminish in frequency and intensity with time. Discontinuation of drug usually results in rapid resolution of these gastrointestinal symptoms.
- Physician Counseling Information for Patients
- In initiating treatment for type 2 diabetes, diet should be emphasized as the primary form of treatment. Caloric restriction and weight loss are essential in the obese diabetic patient. Proper dietary management alone may be effective in controlling the blood glucose and symptoms of hyperglycemia. The importance of regular physical activity should also be stressed, and cardiovascular risk factors should be identified and corrective measures taken where possible. Use of GLYSET or other antidiabetic medications must be viewed by both the physician and patient as a treatment in addition to diet and not as a substitution or as a convenient mechanism for avoiding dietary restraint. Furthermore, loss of blood glucose control on diet alone may be transient, thus requiring only short-term administration of GLYSET or other antidiabetic medications. Maintenance or discontinuation of GLYSET or other antidiabetic medications should be based on clinical judgment using regular clinical and laboratory evaluations.
# Precautions with Alcohol
- Alcohol-Miglitol interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- GLYSET®
# Look-Alike Drug Names
There is limited information regarding Miglitol Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Miglitol
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Vignesh Ponnusamy, M.B.B.S. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Miglitol is a alpha-glucosidase inhibitor that is FDA approved for the treatment of type 2 diabetes mellitus. Common adverse reactions include rash, transient abdominal pain, diarrhea, flatulence, serum iron low.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
- GLYSET is indicated as an adjunct to diet and exercise to improve glycemic control in adults with type 2 diabetes mellitus.
- Initial Dosage
- The recommended starting dosage of GLYSET is 25 mg, given orally three times daily at the start of each main meal. However, some patients may benefit by starting at 25 mg once daily to minimize gastrointestinal adverse effects, and gradually increasing the frequency of administration to 3 times daily.
- Maintenance Dosage
- The usual maintenance dose of GLYSET is 50 mg taken 3 times daily, although some patients may benefit from increasing the dose to 100 mg 3 times daily. To allow adaptation to potential gastrointestinal adverse effects, it is recommended that GLYSET therapy be initiated at a dosage of 25 mg 3 times daily, then gradually titrated upward to allow adaptation. After 4 to 8 weeks of the 25 mg 3 times daily regimen, the dosage should be increased to 50 mg 3 times daily for approximately three months, following which a glycosylated hemoglobin level should be measured to assess therapeutic response. If at that time, the glycosylated hemoglobin level is not satisfactory, the dosage may be further increased to 100 mg 3 times daily, the maximum recommended dosage.
- Pooled data from controlled studies suggest a dose-response for both HbA1c and one-hour postprandial plasma glucose throughout the recommended dosage range. However, no single study has examined the effect on glycemic control of titrating patients' doses upwards within the same study. If no further reduction in postprandial glucose or glycosylated hemoglobin levels is observed with titration to 100 mg 3 times daily, consideration should be given to lowering the dose. Once an effective and tolerated dosage is established, it should be maintained.
- Maximum Dosage
- The maximum recommended dosage of GLYSET is 100 mg 3 times daily. In one clinical trial, 200 mg 3 times daily gave additional improved glycemic control but increased the incidence of the gastrointestinal symptoms described above.
- Patients Receiving Sulfonylureas
- Sulfonylurea agents may cause hypoglycemia. There was no increased incidence of hypoglycemia in patients who took GLYSET in combination with sulfonylurea agents compared to the incidence of hypoglycemia in patients receiving sulfonylureas alone in any clinical trial. However, GLYSET given in combination with a sulfonylurea will cause a further lowering of blood glucose and may increase the risk of hypoglycemia due to the additive effects of the two agents. If hypoglycemia occurs, appropriate adjustments in the dosage of these agents should be made.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Miglitol in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Miglitol in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding FDA-Labeled Use of Miglitol in pediatric patients.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Miglitol in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Miglitol in pediatric patients.
# Contraindications
- GLYSET Tablets are contraindicated in patients with:
- Diabetic ketoacidosis
- Inflammatory bowel disease, colonic ulceration, or partial intestinal obstruction, and in patients predisposed to intestinal obstruction
- Chronic intestinal diseases associated with marked disorders of digestion or absorption, or with conditions that may deteriorate as a result of increased gas formation in the intestine
- Hypersensitivity to the drug or any of its components.
# Warnings
### Precautions
- Macrovascular Outcomes
- There have been no clinical studies establishing conclusive evidence of macrovascular risk reduction with GLYSET or any other anti-diabetic drug.
- General
- Hypoglycemia
- Because of its mechanism of action, GLYSET, when administered alone, should not cause hypoglycemia in the fasted or postprandial state. Sulfonylureas and insulin can cause hypoglycemia. Because GLYSET Tablets given in combination with a sulfonylurea or insulin will cause a further lowering of blood glucose, it may increase the hypoglycemic potential of the sulfonylurea or :*insulin. Consider reducing the dose of sulfonylureas or insulin when GLYSET is used in combination with these medications.
- Oral glucose (dextrose), whose absorption is not delayed by GLYSET, should be used instead of sucrose (cane sugar) in the treatment of mild-to-moderate hypoglycemia. Sucrose, whose hydrolysis to glucose and fructose is inhibited by GLYSET, is unsuitable for the rapid correction of hypoglycemia. Severe hypoglycemia may require the use of either intravenous glucose infusion or glucagon injection.
- Loss of Control of Blood Glucose
- When diabetic patients are exposed to stress such as fever, trauma, infection, or surgery, a temporary loss of control of blood glucose may occur. At such times, temporary insulin therapy may be necessary.
- Renal Impairment
- Plasma concentrations of GLYSET in renally impaired volunteers were proportionally increased relative to the degree of renal dysfunction. Long-term clinical trials in diabetic patients with significant renal dysfunction (serum creatinine >2.0 mg/dL) have not been conducted. Therefore, treatment of these patients with GLYSET is not recommended.
# Adverse Reactions
## Clinical Trials Experience
- Gastrointestinal
- Gastrointestinal symptoms are the most common reactions to GLYSET Tablets. In U.S. placebo-controlled trials, the incidences of abdominal pain, diarrhea, and flatulence were 11.7%, 28.7%, and 41.5% respectively in 962 patients treated with GLYSET 25 100 mg 3 times daily, whereas the corresponding incidences were 4.7%, 10.0%, and 12.0% in 603 placebo-treated patients. The incidence of diarrhea and abdominal pain tended to diminish with continued treatment.
- Dermatologic
- Skin rash was reported in 4.3% of patients treated with GLYSET compared to 2.4% of placebo-treated patients. Rashes were generally transient and most were assessed as unrelated to GLYSET by physician investigators.
- Abnormal Laboratory Findings
- Low serum iron occurred more often in patients treated with GLYSET (9.2%) than in placebo-treated patients (4.2%) but did not persist in the majority of cases and was not associated with reductions in hemoglobin or changes in other hematologic indices.
## Postmarketing Experience
- The following adverse reactions have been reported during post-approval use of GLYSET. Because these reactions are reported voluntarily from a population of uncertain size, it is generally not possible to reliably estimate their frequency or establish a causal relationship to drug exposure.
- Gastrointestinal Disorders
- Ileus (including paralytic ileus), subileus, gastrointestinal pain, nausea, abdominal distention.
- Pneumatosis Cystoides Intestinalis
- There have been rare postmarketing reports of pneumatosis cystoides intestinalis associated with the use of alpha-glucosidase inhibitors, including GLYSET. Pneumatosis cystoides intestinalis may present with symptoms of diarrhea, mucus discharge, rectal bleeding, and constipation. Complications may include pneumoperitoneum, volvulus, intestinal obstruction, intussusception, intestinal hemorrhage, and intestinal perforation. If pneumatosis cystoides intestinalis is suspected, discontinue Glyset and perform the appropriate diagnostic imaging.
# Drug Interactions
- Several studies investigated the possible interaction between miglitol and glyburide. In six healthy volunteers given a single dose of 5 mg glyburide on a background of 6 days treatment with miglitol (50 mg 3 times daily for 4 days followed by 100 mg 3 times daily for 2 days) or placebo, the mean Cmax and AUC values for glyburide were 17% and 25% lower, respectively, when glyburide was given with miglitol. In a study in diabetic patients in which the effects of adding miglitol 100 mg 3 times daily for 7 days or placebo to a background regimen of 3.5 mg glyburide daily were investigated, the mean AUC value for glyburide was 18% lower in the group treated with miglitol, although this difference was not statistically significant. Information on a potential interaction with glyburide was obtained from one of the large U.S. clinical trials (Study 7) in which patients were dosed with either miglitol or placebo on a background of glyburide 10 mg twice daily. At the 6-month and 1-year clinic visits, patients taking concomitant miglitol 100 mg 3 times daily exhibited mean Cmax values for glyburide that were 16% and 8% lower, respectively, compared to patients taking glyburide alone. However, these differences were not statistically significant. Thus, although there was a trend toward lower AUC and Cmax values for glyburide when co-administered with GLYSET, no definitive statement regarding a potential interaction can be made based on the foregoing three studies.
- The effect of miglitol (100 mg 3 times daily for 7 days) on the pharmacokinetics of a single 1000 mg dose of metformin was investigated in healthy volunteers. Mean AUC and Cmax values for metformin were 12% to 13% lower when the volunteers were given miglitol as compared with placebo, but this difference was not statistically significant.
- In a study with healthy volunteers, co-administration of either 50 mg or 100 mg miglitol 3 times daily together with digoxin reduced the average plasma concentrations of digoxin by 19% and 28%, respectively. However, in diabetic patients under treatment with digoxin, plasma digoxin concentrations were not altered by co-administration of miglitol 100 mg 3 times daily for 14 days.
- Other healthy volunteer studies have demonstrated that miglitol may significantly reduce the bioavailability of ranitidine and propranolol by 60% and 40%, respectively. No effect of miglitol was observed on the pharmacokinetics or pharmacodynamics of either warfarin or nifedipine.
- Intestinal adsorbents (e.g., charcoal) and digestive enzyme preparations containing carbohydrate-splitting enzymes (e.g., amylase, pancreatin) may reduce the effect of GLYSET and should not be taken concomitantly.
- In 12 healthy males, concomitantly administered antacid did not influence the pharmacokinetics of miglitol.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- Pregnancy Category B
- The safety of GLYSET in pregnant women has not been established. Developmental toxicology studies have been performed in rats at doses of 50, 150 and 450 mg/kg, corresponding to levels of approximately 1.5, 4, and 12 times the maximum recommended human exposure based on body surface area. In rabbits, doses of 10, 45, and 200 mg/kg corresponding to levels of approximately 0.5, 3, and 10 times the human exposure were examined. These studies revealed no evidence of fetal malformations attributable to miglitol. Doses of miglitol up to 4 and 3 times the human dose (based on body surface area), for rats and rabbits respectively, did not reveal evidence of impaired fertility or harm to the fetus. The highest doses tested in these studies, 450 mg/kg in the rat and 200 mg/kg in the rabbit promoted maternal and/or fetal toxicity. Fetotoxicity was indicated by a slight but significant reduction in fetal weight in the rat study and slight reduction in fetal weight, delayed ossification of the fetal skeleton and increase in the percentage of non-viable fetuses in the rabbit study. In the peri-postnatal study in rats, the NOAEL (No Observed Adverse Effect Level) was 100 mg/kg (corresponding to approximately four times the exposure to humans, based on body surface area). An increase in stillborn progeny was noted at the high dose (300 mg/kg) in the rat peri-postnatal study, but not at the high dose (450 mg/kg) in the delivery segment of the rat developmental toxicity study. Otherwise, there was no adverse effect on survival, growth, development, behavior, or fertility in either the rat developmental toxicity or peri-postnatal studies. There are however, no adequate and well-controlled studies in pregnant women. Because animal reproduction studies are not always predictive of human response, miglitol should be used during pregnancy only if clearly needed.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Miglitol in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Miglitol during labor and delivery.
### Nursing Mothers
- Miglitol has been shown to be excreted in human milk to a very small degree. Total excretion into milk accounted for 0.02% of a 100 mg maternal dose. The estimated exposure to a nursing infant is approximately 0.4% of the maternal dose. Although the levels of miglitol reached in human milk are exceedingly low, it is recommended that GLYSET not be administered to a nursing woman.
### Pediatric Use
- Safety and effectiveness of GLYSET in pediatric patients have not been established.
### Geriatic Use
- Of the total number of subjects in clinical studies of GLYSET in the United States, patients valid for safety analyses included 24% over 65, and 3% over 75. No overall differences in safety and effectiveness were observed between these subjects and younger subjects. The pharmacokinetics of miglitol were studied in elderly and young males (n=8 per group). At the dosage of 100 mg 3 times daily for 3 days, no differences between the two groups were found.
### Gender
There is no FDA guidance on the use of Miglitol with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Miglitol with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Miglitol in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Miglitol in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Miglitol in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Miglitol in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Monitoring of Miglitol in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Miglitol in the drug label.
# Overdosage
## Acute Overdose
- Unlike sulfonylureas or insulin, an overdose of GLYSET tablets will not result in hypoglycemia. An overdose may result in transient increases in flatulence, diarrhea, and abdominal discomfort. Because of the lack of extra-intestinal effects seen with GLYSET, no serious systemic reactions are expected in the event of an overdose.
## Chronic Overdose
There is limited information regarding Chronic Overdose of Miglitol in the drug label.
# Pharmacology
There is limited information regarding Miglitol Pharmacology in the drug label.
## Mechanism of Action
- In contrast to sulfonylureas, GLYSET does not enhance insulin secretion. The antihyperglycemic action of miglitol results from a reversible inhibition of membrane-bound intestinal α-glucoside hydrolase enzymes. Membrane-bound intestinal α-glucosidases hydrolyze oligosaccharides and disaccharides to glucose and other monosaccharides in the brush border of the small intestine. In diabetic patients, this enzyme inhibition results in delayed glucose absorption and lowering of postprandial hyperglycemia.
- Because its mechanism of action is different, the effect of GLYSET to enhance glycemic control is additive to that of sulfonylureas when used in combination. In addition, GLYSET diminishes the insulinotropic and weight-increasing effects of sulfonylureas.
- Miglitol has minor inhibitory activity against lactase and consequently, at the recommended doses, would not be expected to induce lactose intolerance.
## Structure
- GLYSET Tablets contain miglitol, an oral alpha-glucosidase inhibitor for use in the management of non-insulin-dependent diabetes mellitus (NIDDM). Miglitol is a desoxynojirimycin derivative, and is chemically known as 3,4,5-piperidinetriol, 1-(2-hydroxyethyl)-2-(hydroxymethyl)-, [2R-(2α,3β,4α, 5β)]-. It is a white to pale-yellow powder with a molecular weight of 207.2. Miglitol is soluble in water and has a pKa of 5.9. Its empirical formula is C8H17NO5 and its chemical structure is as follows:
- GLYSET is available as 25 mg, 50 mg and 100 mg tablets for oral use. The inactive ingredients are starch, microcrystalline cellulose, magnesium stearate, hypromellose, polyethylene glycol, titanium dioxide, and polysorbate 80.
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Miglitol in the drug label.
## Pharmacokinetics
- Absorption
- Absorption of miglitol is saturable at high doses: a dose of 25 mg is completely absorbed, whereas a dose of 100 mg is 50% – 70% absorbed. For all doses, peak concentrations are reached in 2 to 3 hours. There is no evidence that systemic absorption of miglitol contributes to its therapeutic effect.
- Distribution
- The protein binding of miglitol is negligible (<4.0%). Miglitol has a volume of distribution of 0.18 L/kg, consistent with distribution primarily into the extracellular fluid.
- Metabolism
- Miglitol is not metabolized in humans or in any animal species studied. No metabolites have been detected in plasma, urine or feces, indicating a lack of either systemic or pre-systemic metabolism.
- Excretion
- Miglitol is eliminated by renal excretion as unchanged drug. Following a 25 mg dose, over 95% of the dose is recovered in the urine within 24 hours. At higher doses, the cumulative recovery of drug from urine is somewhat lower due to the incomplete bioavailability. The elimination half-life of miglitol from plasma is approximately 2 hours.
- Special Populations
- Renal Impairment
- Because miglitol is excreted primarily by the kidneys, accumulation of miglitol is expected in patients with renal impairment. Patients with creatinine clearance <25 mL/min taking 25 mg 3 times daily, exhibited a greater than two-fold increase in miglitol plasma levels as compared to subjects with creatinine clearance >60 mL/min. Dosage adjustment to correct the increased plasma concentrations is not feasible because miglitol acts locally. Little information is available on the safety of miglitol in patients with creatinine clearance <25 mL/min. Therefore, treatment of these patients with miglitol is not recommended.
- Hepatic impairment
- Miglitol pharmacokinetics were not altered in cirrhotic patients relative to healthy control subjects. Since miglitol is not metabolized, no influence of hepatic function on the kinetics of miglitol is expected.
- Gender
- No significant difference in the pharmacokinetics of miglitol was observed between elderly men and women when body weight was considered.
- Race
- Several pharmacokinetic studies were conducted in Japanese volunteers, with results similar to those observed in Caucasians. A study comparing the pharmacodynamic response to a single 50 mg dose in Black and Caucasian healthy volunteers indicated similar glucose and insulin responses in both populations.
## Nonclinical Toxicology
- Miglitol was administered to mice by the dietary route at doses as high as approximately 500 mg/kg body weight (corresponding to greater than 5 times the exposure in humans based on AUC) for 21 months. In a two-year rat study, miglitol was administered in the diet at exposures comparable to the maximum human exposures based on AUC. There was no evidence of carcinogenicity resulting from dietary treatment with miglitol.
- In vitro, miglitol was found to be nonmutagenic in the bacterial mutagenesis (Ames) assay and the eukaryotic forward mutation assay (CHO/HGPRT). Miglitol did not have any clastogenic effects in vivo in the mouse micronucleus test. There were no heritable mutations detected in dominant lethal assay.
- A combined male and female fertility study conducted in Wistar rats treated orally with miglitol at dose levels of 300 mg/kg body weight (approximately 8 times the maximum human exposure based on body surface area) produced no untoward effect on reproductive performance or capability to reproduce. Survival, growth, development, and fertility of the offspring were not compromised.
# Clinical Studies
- GLYSET Tablets were evaluated in two U.S. and three non-U.S. controlled, fixed-dose, monotherapy studies, in which 735 patients treated with GLYSET were evaluated for efficacy analyses (see Table 1).
- In Study 1, a 1-year study in which GLYSET was evaluated as monotherapy and also as combination therapy, there was a statistically significantly smaller increase in mean glycosylated hemoglobin (HbA1c) over time in the miglitol 50 mg 3 times daily monotherapy arm compared to placebo. Significant reductions in mean fasting and postprandial plasma glucose levels and in mean postprandial insulin levels were observed in patients treated with GLYSET compared with the placebo group.
- In Study 2, a 14-week study, there was a significant decrease in HbA1c in patients receiving GLYSET 50 mg 3 times daily or 100 mg 3 times daily compared to placebo. In addition, there were significant reductions in postprandial plasma glucose and postprandial serum insulin levels compared to placebo.
- Study 3, was a 6-month dose-ranging trial evaluating GLYSET at doses from 25 mg 3 times daily, to 200 mg 3 times daily. GLYSET produced a greater reduction in HbA1c than placebo at all doses, although the effect was statistically significant at the 100 mg 3 times daily and 200 mg 3 times daily. In addition, all doses of GLYSET produced significant reductions in postprandial plasma glucose and postprandial insulin levels compared to placebo.
- Studies 4 and 5 were 6-month studies evaluating GLYSET at 50 and 100 mg 3 times daily, and 100 mg 3 times daily, respectively. As compared to placebo, GLYSET produced reductions in HbA1c, as well as a significant reduction in postprandial plasma glucose in both studies at the doses employed.
- GLYSET was studied as adjunctive therapy to a background of maximal or near-maximal sulfonylurea (SFU) treatment in three large, double-blind, randomized studies (two U.S. and one non-U.S.) in which 471 patients treated with GLYSET were evaluated for efficacy (see Table 2).
- Study 6 included patients under treatment with maximal doses of SFU at entry. At the end of this 14-week study, the mean treatment effects on glycosylated hemoglobin (HbA1c) were -0.82% and -0.74% for patients receiving GLYSET 50 mg 3 times daily plus SFU, and GLYSET 100 mg 3 times daily plus SFU, respectively.
- Study 7 was a 1-year study in which GLYSET at 25, 50 or 100 mg 3 times daily was added to a maximal dose of glyburide (10 mg twice daily). At the end of this study, the mean treatment effects on HbA1c of GLYSET when added to maximum glyburide therapy were -0.30%, -0.62%, and -0.73% with 25, 50 and 100 mg 3 times daily dosages of GLYSET, respectively.
- In Study 8, the addition of GLYSET 100 mg 3 times daily to a background of treatment with glyburide produced an additional mean treatment effect on HbA1c of -0.66%.
- Dose Response
- Results from controlled, fixed-dose studies of GLYSET as monotherapy or as combination treatment with a sulfonylurea were combined to derive a pooled estimate of the difference from placebo in the mean change from baseline in glycosylated hemoglobin (HbA1c) and postprandial plasma glucose as shown in Figures 1 and 2:
- Because of its mechanism of action, the primary pharmacologic effect of miglitol is manifested as a reduction in postprandial plasma glucose, as shown previously in all of the major clinical trials. GLYSET was statistically significantly different from placebo at all doses in each of the individual studies with respect to effect on mean one-hour postprandial plasma glucose, and there is a dose response from 25 to 100 mg 3 times daily for this efficacy parameter.
# How Supplied
- GLYSET Tablets are available as 25 mg, 50 mg, and 100 mg tablets.
- Store at 25°C (77°F); excursions permitted to 15°–30°C (59°–86°F).
## Storage
There is limited information regarding Miglitol Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
- The following information should be provided to patients:
- GLYSET should be taken orally three times a day at the start of each main meal. It is important to continue to adhere to dietary instructions, a regular exercise program, and regular testing of urine and/or blood glucose.
- GLYSET itself does not cause hypoglycemia when administered to patients in the fasted state. Sulfonylurea drugs and insulin, however, can lower blood sugar levels and cause symptoms or life-threatening hypoglycemia. Because GLYSET given in combination with a sulfonylurea or insulin will cause a further lowering of blood sugar, it may increase the hypoglycemic potential of these agents. The risk of hypoglycemia, its symptoms and treatment, and conditions that predispose to its development should be well understood by patients and responsible family members. Because GLYSET prevents the breakdown of table sugar, a source of glucose (dextrose, D-glucose) should be readily available to treat symptoms of low blood sugar when taking GLYSET in combination with a sulfonylurea or insulin.
- If side effects occur with GLYSET, they usually develop during the first few weeks of therapy. They are most commonly mild-to-moderate dose-related gastrointestinal effects, such as flatulence, soft stools, diarrhea, or abdominal discomfort, and generally diminish in frequency and intensity with time. Discontinuation of drug usually results in rapid resolution of these gastrointestinal symptoms.
- Physician Counseling Information for Patients
- In initiating treatment for type 2 diabetes, diet should be emphasized as the primary form of treatment. Caloric restriction and weight loss are essential in the obese diabetic patient. Proper dietary management alone may be effective in controlling the blood glucose and symptoms of hyperglycemia. The importance of regular physical activity should also be stressed, and cardiovascular risk factors should be identified and corrective measures taken where possible. Use of GLYSET or other antidiabetic medications must be viewed by both the physician and patient as a treatment in addition to diet and not as a substitution or as a convenient mechanism for avoiding dietary restraint. Furthermore, loss of blood glucose control on diet alone may be transient, thus requiring only short-term administration of GLYSET or other antidiabetic medications. Maintenance or discontinuation of GLYSET or other antidiabetic medications should be based on clinical judgment using regular clinical and laboratory evaluations.
# Precautions with Alcohol
- Alcohol-Miglitol interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- GLYSET®[1]
# Look-Alike Drug Names
There is limited information regarding Miglitol Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Glyset | |
f22a87ec0d8fa748cab9bff178b4f1e5ef66acd5 | wikidoc | Gradient | Gradient
In vector calculus, the gradient of a scalar field is a vector field which points in the direction of the greatest rate of increase of the scalar field, and whose magnitude is the greatest rate of change.
A generalization of the gradient, for functions on a Banach space which have vectorial values, is the Jacobian.
# Interpretations of the gradient
Consider a room in which the temperature is given by a scalar field T, so at each point (x,y,z) the temperature is T(x,y,z) (we will assume that the temperature does not change in time). Then, at each point in the room, the gradient of T at that point will show the direction in which the temperature rises most quickly. The magnitude of the gradient will determine how fast the temperature rises in that direction.
Consider a hill whose height above sea level at a point (x, y) is H(x, y). The gradient of H at a point is a vector pointing in the direction of the steepest slope or grade at that point. The steepness of the slope at that point is given by the magnitude of the gradient vector.
The gradient can also be used to measure how a scalar field changes in other directions, rather than just the direction of greatest change, by taking a dot product. Consider again the example with the hill and suppose that the steepest slope on the hill is 40%. If a road goes directly up the hill, then the steepest slope on the road will also be 40%. If instead, the road goes around the hill at an angle with the uphill direction (the gradient vector), then it will have a shallower slope. For example, if the angle between the road and the uphill direction, projected onto the horizontal plane, is 60°, then the steepest slope along the road will be 20% which is 40% times the cosine of 60°.
This observation can be mathematically stated as follows. If the hill height function H is differentiable, then the gradient of H dotted with a unit vector gives the slope of the hill in the direction of the vector. More precisely, when H is differentiable the dot product of the gradient of H with a given unit vector is equal to the directional derivative of H in the direction of that unit vector.
# Formal definition
The gradient (or gradient vector field) of a scalar function f(x) with respect to a vector variable x = (x_1,\dots,x_n) is denoted by \nabla f or \vec{\nabla} f where \nabla (the nabla symbol) denotes the vector differential operator, del. The notation \operatorname{grad}(f) is also used for the gradient.
By definition, the gradient is a vector field whose components are the partial derivatives of f. That is:
(Here the gradient is written as a row vector, but it is often taken to be a column vector; note also that when a function has a time component, the gradient often refers simply to the vector of its spatial derivatives only.)
The dot product (\nabla f)_x\cdot v of the gradient at a point x with a vector v gives the directional derivative of f at x in the direction v. It follows that the gradient of f is orthogonal to the level sets of f. This also shows that, although the gradient was defined in terms of coordinates, it is actually invariant under orthogonal transformations, as it should be, in view of the geometric interpretation given above.
Because the gradient is orthogonal to level sets, it can be used to construct a vector normal to a surface. Consider any manifold that is one dimension less than the space it is in (i.e., a surface in 3D, a curve in 2D, etc.). Let this manifold be defined by an equation e.g. F(x, y, z) = 0 (i.e., move everything to one side of the equation). We have now turned the manifold into a level set. To find a normal vector, we simply need to find the gradient of the function F at the desired point.
The gradient is an irrotational vector field and line integrals through a gradient field are path independent and can be evaluated with the gradient theorem. Conversely, an irrotational vector field in a simply connected region is always the gradient of a function.
# Expressions for the gradient in 3 dimensions
The form of the gradient depends on the coordinate system used.
In Cartesian coordinates, the above expression expands to
\left(\frac{\partial f}{\partial x},
\frac{\partial f}{\partial y},
\frac{\partial f}{\partial z}\right).
In cylindrical coordinates:
\frac{\partial f}{\partial \rho},
\frac{1}{\rho}\frac{\partial f}{\partial \theta},
\frac{\partial f}{\partial z} \right)
(where \theta is the azimuthal angle and z is the axial coordinate).
In spherical coordinates:
\frac{\partial f}{\partial r},
\frac{1}{r}\frac{\partial f}{\partial \theta},
\frac{1}{r \sin\theta}\frac{\partial f}{\partial \phi}\right)
(where \phi is the azimuth angle and \theta is the zenith angle).
## Example
For example, the gradient of the function in Cartesian coordinates
is:
\frac{\partial f}{\partial x},
\frac{\partial f}{\partial y},
\frac{\partial f}{\partial z}\right)
# The gradient and the derivative or differential
## Linear approximation to a function
The gradient of a function f from the Euclidean space \mathbb{R}^n to \mathbb{R} at any particular point x0 in \mathbb{R}^n characterizes the best linear approximation to f at x0. The approximation is as follows:
for x close to x_0, where (\nabla f)_{x_0} is the gradient of f computed at x_0, and the dot denotes the dot product on \mathbb{R}^n. This equation is equivalent to the first two terms in the multi-variable Taylor Series expansion of f at x0.
## The differential or (exterior) derivative
The best linear approximation to a function f : \mathbb{R}^n \to \mathbb{R} at a point x in \mathbb{R}^n is a linear map from \mathbb{R}^n to \mathbb{R} which is often denoted by \mathrm{d}f_x or Df(x) and called the differential or (total) derivative of f at x. The gradient is therefore related to the differential by the formula
for any v \in \mathbb{R}^n. The function \mathrm{d}f, which maps x to \mathrm{d}f_x, is called the differential or exterior derivative of f and is an example of a differential 1-form.
If \mathbb{R}^n is viewed as the space of (length n) column vectors (of real numbers), then one can regard \mathrm{d}f as the row vector
so that \mathrm{d}f_x(v) is given by matrix multiplication. The gradient is then the corresponding column vector, i.e., \nabla f = \mathrm{d} f^T.
## The covariance of the gradient
The differential is more natural than the gradient because it is invariant under all coordinate transformations (or diffeomorphisms), whereas the gradient is only invariant under orthogonal transformations (because of the implicit use of the dot product in its definition). Because of this, it is common to blur the distinction between the two concepts using the notion of covariant and contravariant vectors. From this point of view, the components of the gradient transform covariantly under changes of coordinates, so it is called a covariant vector field, whereas the components of a vector field in the usual sense transform contravariantly. In this language the gradient is the differential, as a covariant vector field is the same thing as a differential 1-form.
^ Unfortunately this confusing language is confused further by differing conventions. Although the components of a differential 1-form transform covariantly under coordinate transformations, differential 1-forms themselves transform contravariantly (by pullback) under diffeomorphism. For this reason differential 1-forms are sometimes said to be contravariant rather than covariant,
in which case vector fields are covariant rather than contravariant.
# The gradient on Riemannian manifolds
For any smooth function f on a Riemannian manifold (M,g), the gradient of f is the vector field \nabla f such that for any vector field X,
where g_x( \cdot, \cdot ) denotes the inner product of tangent vectors at x defined by the metric g and
\partial_X f (sometimes denoted X(f)) is the function that takes any point x∈M to the directional derivative of f in the direction X, evaluated at x. In other words, in a coordinate chart \varphi from an open subset of M to an open subset of Rn, (\partial_X f)(x) is given by:
where Xj denotes the jth component of X in this coordinate chart.
So, the local form of the gradient takes the form:
Generalizing the case M=Rn, the gradient of a function is related to its exterior derivative, since (\partial_X f) (x) = df_x(X_x). More precisely, the gradient \nabla f is the vector field associated to the differential 1-form df using the musical isomorphism \sharp=\sharp^g\colon T^*M\to TM (called "sharp") defined by the metric g. The relation between the exterior derivative and the gradient of a function on Rn is a special case of this in which the metric is the flat metric given by the dot product. | Gradient
In vector calculus, the gradient of a scalar field is a vector field which points in the direction of the greatest rate of increase of the scalar field, and whose magnitude is the greatest rate of change.
A generalization of the gradient, for functions on a Banach space which have vectorial values, is the Jacobian.
# Interpretations of the gradient
Consider a room in which the temperature is given by a scalar field <math>T</math>, so at each point <math>(x,y,z)</math> the temperature is <math>T(x,y,z)</math> (we will assume that the temperature does not change in time). Then, at each point in the room, the gradient of <math>T</math> at that point will show the direction in which the temperature rises most quickly. The magnitude of the gradient will determine how fast the temperature rises in that direction.
Consider a hill whose height above sea level at a point <math>(x, y)</math> is <math>H(x, y)</math>. The gradient of <math>H</math> at a point is a vector pointing in the direction of the steepest slope or grade at that point. The steepness of the slope at that point is given by the magnitude of the gradient vector.
The gradient can also be used to measure how a scalar field changes in other directions, rather than just the direction of greatest change, by taking a dot product. Consider again the example with the hill and suppose that the steepest slope on the hill is 40%. If a road goes directly up the hill, then the steepest slope on the road will also be 40%. If instead, the road goes around the hill at an angle with the uphill direction (the gradient vector), then it will have a shallower slope. For example, if the angle between the road and the uphill direction, projected onto the horizontal plane, is 60°, then the steepest slope along the road will be 20% which is 40% times the cosine of 60°.
This observation can be mathematically stated as follows. If the hill height function <math>H</math> is differentiable, then the gradient of <math>H</math> dotted with a unit vector gives the slope of the hill in the direction of the vector. More precisely, when <math>H</math> is differentiable the dot product of the gradient of H with a given unit vector is equal to the directional derivative of H in the direction of that unit vector.
# Formal definition
The gradient (or gradient vector field) of a scalar function <math>f(x)</math> with respect to a vector variable <math>x = (x_1,\dots,x_n)</math> is denoted by <math>\nabla f</math> or <math>\vec{\nabla} f</math> where <math>\nabla</math> (the nabla symbol) denotes the vector differential operator, del. The notation <math>\operatorname{grad}(f)</math> is also used for the gradient.
By definition, the gradient is a vector field whose components are the partial derivatives of <math>f</math>. That is:
(Here the gradient is written as a row vector, but it is often taken to be a column vector; note also that when a function has a time component, the gradient often refers simply to the vector of its spatial derivatives only.)
The dot product <math>(\nabla f)_x\cdot v</math> of the gradient at a point x with a vector v gives the directional derivative of f at x in the direction v. It follows that the gradient of f is orthogonal to the level sets of f. This also shows that, although the gradient was defined in terms of coordinates, it is actually invariant under orthogonal transformations, as it should be, in view of the geometric interpretation given above.
Because the gradient is orthogonal to level sets, it can be used to construct a vector normal to a surface. Consider any manifold that is one dimension less than the space it is in (i.e., a surface in 3D, a curve in 2D, etc.). Let this manifold be defined by an equation e.g. F(x, y, z) = 0 (i.e., move everything to one side of the equation). We have now turned the manifold into a level set. To find a normal vector, we simply need to find the gradient of the function F at the desired point.
The gradient is an irrotational vector field and line integrals through a gradient field are path independent and can be evaluated with the gradient theorem. Conversely, an irrotational vector field in a simply connected region is always the gradient of a function.
# Expressions for the gradient in 3 dimensions
The form of the gradient depends on the coordinate system used.
In Cartesian coordinates, the above expression expands to
\left(\frac{\partial f}{\partial x},
\frac{\partial f}{\partial y},
\frac{\partial f}{\partial z}\right).</math>
In cylindrical coordinates:
\frac{\partial f}{\partial \rho},
\frac{1}{\rho}\frac{\partial f}{\partial \theta},
\frac{\partial f}{\partial z} \right)
</math>
(where <math>\theta</math> is the azimuthal angle and <math>z</math> is the axial coordinate).
In spherical coordinates:
\frac{\partial f}{\partial r},
\frac{1}{r}\frac{\partial f}{\partial \theta},
\frac{1}{r \sin\theta}\frac{\partial f}{\partial \phi}\right)
</math>
(where <math>\phi</math> is the azimuth angle and <math>\theta</math> is the zenith angle).
## Example
For example, the gradient of the function in Cartesian coordinates
is:
\frac{\partial f}{\partial x},
\frac{\partial f}{\partial y},
\frac{\partial f}{\partial z}\right)
</math>
# The gradient and the derivative or differential
## Linear approximation to a function
The gradient of a function <math>f </math> from the Euclidean space <math>\mathbb{R}^n</math> to <math>\mathbb{R}</math> at any particular point x0 in <math>\mathbb{R}^n</math> characterizes the best linear approximation to f at x0. The approximation is as follows:
for <math>x</math> close to <math>x_0</math>, where <math>(\nabla f)_{x_0}</math> is the gradient of f computed at <math>x_0</math>, and the dot denotes the dot product on <math>\mathbb{R}^n</math>. This equation is equivalent to the first two terms in the multi-variable Taylor Series expansion of f at x0.
## The differential or (exterior) derivative
The best linear approximation to a function <math>f : \mathbb{R}^n \to \mathbb{R}</math> at a point <math>x</math> in <math>\mathbb{R}^n</math> is a linear map from <math>\mathbb{R}^n</math> to <math>\mathbb{R}</math> which is often denoted by <math>\mathrm{d}f_x</math> or <math>Df(x)</math> and called the differential or (total) derivative of <math>f</math> at <math>x</math>. The gradient is therefore related to the differential by the formula
for any <math>v \in \mathbb{R}^n</math>. The function <math>\mathrm{d}f</math>, which maps <math>x</math> to <math>\mathrm{d}f_x</math>, is called the differential or exterior derivative of <math>f</math> and is an example of a differential 1-form.
If <math>\mathbb{R}^n</math> is viewed as the space of (length <math>n</math>) column vectors (of real numbers), then one can regard <math>\mathrm{d}f</math> as the row vector
so that <math>\mathrm{d}f_x(v)</math> is given by matrix multiplication. The gradient is then the corresponding column vector, i.e., <math>\nabla f = \mathrm{d} f^T</math>.
## The covariance of the gradient
The differential is more natural than the gradient because it is invariant under all coordinate transformations (or diffeomorphisms), whereas the gradient is only invariant under orthogonal transformations (because of the implicit use of the dot product in its definition). Because of this, it is common to blur the distinction between the two concepts using the notion of covariant and contravariant vectors. From this point of view, the components of the gradient transform covariantly under changes of coordinates, so it is called a covariant vector field, whereas the components of a vector field in the usual sense transform contravariantly. In this language the gradient is the differential, as a covariant vector field is the same thing as a differential 1-form.[1]
^ Unfortunately this confusing language is confused further by differing conventions. Although the components of a differential 1-form transform covariantly under coordinate transformations, differential 1-forms themselves transform contravariantly (by pullback) under diffeomorphism. For this reason differential 1-forms are sometimes said to be contravariant rather than covariant,
in which case vector fields are covariant rather than contravariant.
# The gradient on Riemannian manifolds
For any smooth function f on a Riemannian manifold (M,g), the gradient of f is the vector field <math>\nabla f</math> such that for any vector field <math>X</math>,
where <math>g_x( \cdot, \cdot )</math> denotes the inner product of tangent vectors at x defined by the metric g and
<math>\partial_X f</math> (sometimes denoted X(f)) is the function that takes any point x∈M to the directional derivative of f in the direction X, evaluated at x. In other words, in a coordinate chart <math>\varphi</math> from an open subset of M to an open subset of Rn, <math>(\partial_X f)(x)</math> is given by:
where Xj denotes the jth component of X in this coordinate chart.
So, the local form of the gradient takes the form:
Generalizing the case M=Rn, the gradient of a function is related to its exterior derivative, since <math>(\partial_X f) (x) = df_x(X_x)</math>. More precisely, the gradient <math>\nabla f</math> is the vector field associated to the differential 1-form df using the musical isomorphism <math>\sharp=\sharp^g\colon T^*M\to TM</math> (called "sharp") defined by the metric g. The relation between the exterior derivative and the gradient of a function on Rn is a special case of this in which the metric is the flat metric given by the dot product. | https://www.wikidoc.org/index.php/Gradient | |
93bc9f0e90dbf48e818265dc4639f67e49ccf214 | wikidoc | Grafting | Grafting
Grafting is a method of plant propagation widely used in horticulture (gardening), where the tissues of one plant are encouraged to fuse with those of another. It is most commonly used for the propagation of trees and shrubs grown commercially. (Grafting is limited to dicots and gymnosperms. Monocots lack the vascular cambium required.)
In most cases, one plant is selected for its roots, and this is called the stock or rootstock. The other plant is selected for its stems, leaves, flowers, or fruits and is called the scion. The scion contains the desired genes to be duplicated in future production by the stock/scion plant.
In stem grafting, a common grafting method, a shoot of a selected, desired plant cultivar is grafted onto the stock of another type. In another common form called budding, a dormant side bud is grafted on the stem of another stock plant, and when it has fused successfully, it is encouraged to grow by cutting out the stem above the new bud.
For successful grafting to take place, the vascular cambium tissues of the stock and scion plants must be placed in contact with each other. Both tissues must be kept alive until the graft has taken, usually a period of a few weeks. Successful grafting only requires that a vascular connection takes place between the two tissues. A physical weak point often still occurs at the graft, because the structural tissue of the two distinct plants, such as wood may not fuse.
# Reasons for grafting
- Dwarfing: To induce dwarfing or cold tolerance or other characteristics to the scion. Most apple trees in modern orchards are grafted dwarf or semi-dwarf trees planted at high density. They provide more fruit per unit of land, higher quality fruit, and reduce the danger of accidents by harvest crews working on ladders.
- Ease of propagation: Because the scion is difficult to propagate vegetatively by other means, such as by cuttings. In this case, cuttings of an easily rooted plant are used to provide a rootstock. In some cases, the scion may be easily propagated, but grafting may still be used because it is commercially the most cost-effective way of raising a particular type of plant.
- Hybrid breeding: To speed maturity of hybrids in fruit tree breeding programs. Hybrid seedlings may take ten or more years to flower and fruit on their own roots. Grafting can reduce the time to flowering and shorten the breeding program.
- Hardiness: Because the scion has weak roots or the roots of the stock plants have roots tolerant of difficult conditions. e.g. many showy Western Australian plants are sensitive to dieback on heavy soils, common in urban gardens, and are grafted onto hardier eastern Australian relatives. Grevilleas and eucalypts are examples.
- Sturdiness In order to provide a strong, tall trunk for certain ornamental shrubs and trees. In these cases, a graft is made at a desired height on a stock plant with a strong stem. This is used to raise 'standard' roses, which are rose bushes on a high stem, and it is also used for some ornamental trees, such as certain weeping cherries.
- Pollen source: To provide pollenizers. For example, in tightly planted or badly planned apple orchards of a single variety, limbs of crab apple may be grafted at regularly spaced intervals onto trees down rows, say every fourth tree. This takes care of pollen needs at blossom time, yet does not confuse pickers who might otherwise mix varieties while harvesting, as the mature crab apples are so distinct from other apple varieties.
- Repair: To repair damage to the trunk of a tree which would prohibit nutrient flow, such as the stripping of the bark by rodents which completely girdles the trunk. In this case a bridge graft may be used to connect the tissues receiving flow from the roots to the tissues above the damage which have been severed from the flow. Where a watersprout, sucker or sapling of the same species is growing nearby, any of these can be grafted to the area above the damage by a method called inarch grafting. These alternatives to scions must be of the correct length to span the gap of the wound.
- Changing cultivars: To change the cultivar in a fruit orchard to a more profitable cultivar, called topworking. It may be faster to graft a new cultivar onto existing limbs of established trees than to replant an entire orchard.
- Maintain Consistency: Apples are notorious for their genetic variability, even differing in multiple characteristics, such as, size, color, and flavor, of fruits located on the same tree. In the commercial farming industry, consistency is maintained by grafting a scion with desired fruit traits onto a hardy stock.
- Curiosities
A practice sometimes carried out by gardeners is to graft related potatoes and tomatoes so that both are produced on the same plant, one above ground and one underground.
Cacti of widely different forms are sometimes grafted on to each other.
Multiple cultivars of fruits such as apples are sometimes grafted on a single tree. This so-called "family tree" provides more fruit variety for small spaces such as a suburban backyard, and also takes care of the need for pollenizers. The drawback is that the gardener must be sufficiently trained to prune them correctly, or one strong variety will usually "take over". Occasionally, a so-called "graft hybrid" or "chimaera" can occur where the tissues of the stock continue to grow within the scion. Such a plant can produce flowers and foliage typical of both plants as well as shoots intermediate between the two. The best-known example is probably +Laburnocytisus 'Adamii', a graft hybrid between laburnum and broom, which originated in a nursery near Paris, France in 1825. This small tree bears yellow flowers typical of Laburnum anagyroides, purple flowers typical of Chamaecytisus purpureus and curious coppery-pink flowers which show characteristics of both "parents".
Ornamental and functional, arborsculpture uses grafting techniques to join separate trees or parts of the same tree to itself. Furniture, hearts, entry archways are examples. Axel Erlandson was a prolific arborsculptor growing over 75 mature shaped and grafted trees.
- A practice sometimes carried out by gardeners is to graft related potatoes and tomatoes so that both are produced on the same plant, one above ground and one underground.
- Cacti of widely different forms are sometimes grafted on to each other.
- Multiple cultivars of fruits such as apples are sometimes grafted on a single tree. This so-called "family tree" provides more fruit variety for small spaces such as a suburban backyard, and also takes care of the need for pollenizers. The drawback is that the gardener must be sufficiently trained to prune them correctly, or one strong variety will usually "take over". Occasionally, a so-called "graft hybrid" or "chimaera" can occur where the tissues of the stock continue to grow within the scion. Such a plant can produce flowers and foliage typical of both plants as well as shoots intermediate between the two. The best-known example is probably +Laburnocytisus 'Adamii', a graft hybrid between laburnum and broom, which originated in a nursery near Paris, France in 1825. This small tree bears yellow flowers typical of Laburnum anagyroides, purple flowers typical of Chamaecytisus purpureus and curious coppery-pink flowers which show characteristics of both "parents".
- Ornamental and functional, arborsculpture uses grafting techniques to join separate trees or parts of the same tree to itself. Furniture, hearts, entry archways are examples. Axel Erlandson was a prolific arborsculptor growing over 75 mature shaped and grafted trees.
# Methods
## Cleft
The easiest and most common form of grafting is cleft grafting. The stock is simply split and the scion is inserted. It is best if the stock is 2-7 cm in diameter and has 3-5 buds, and the cleft is around 7cm deep. The scion is cut in a wedge shape and inserted into the tree with the cambium. The bare stock is covered with grafting compound, otherwise the cambium layer quickly dries and the graft fails.
## Stub
Stub grafting is a technique that requires less stock than cleft grafting, and retains the shape of a tree. Also scions are generally of 6-8 buds in this process.
An incision is made into the branch one centimeter above, then the scion is wedged and forced into the branch. The scion should be at an angle of at most 35° to the parent tree so that the crotch remains strong. The graft is covered with grafting compound.
## Awl
Awl grafting takes the least resources and the least time, but the most skill. There is a danger of accidentally driving the tool too far into the stock, lessening the scion's chance of survival. Awl grafting can be done by using a screwdriver to make a slit or T-shaped incision in the bark just so far as the cambium layer. Then the shield or wedged-shaped scion is inserted into the incision. Awl grafting is commonly used to graft buds.
## Veneer
Veneer grafting, or inlay grafting, is a method used for stocks larger than three centimeters in diameter. The scion is recommended to be about as thick as a pencil. Clefts are made of the same size as the scion on the side of the branch, not on top. The scion end is shaped as a wedge, inserted, and wrapped with tape to the scaffolding branches to give it more strength.
## Renewing fusion
"Renewing fusion" is a grafting method in which a small branch (at least a centimeter wide) from one plant to a main branch of another, by carefully shaving a proper amount of bark from the large branch and inserting the scion into a cut hole. The graft is taped with a thin strip of duct tape in diagonal lashings, to hold it up and to prevent insects from entering the hole.
The origin of grafting is uncertain. the peoples of ancient civilizations who grew fruit trees may have observed natural unions made by twigs and branches of compatible trees growing next to one another.
# Natural grafting
The tree roots of the same species will sometimes naturally graft where they make physical contact with each other. A group of trees can share water and mineral nutrients via root grafts, which may be advantageous to weaker trees. A problem with root grafts is that they allow transmission of certain pathogens, such as Dutch elm disease. Natural grafting also sometimes occurs where two stems on the same tree, shrub or vine make contact with each other. This is most common in plants such as strawberries and potatoes.
# Scientific uses
Grafting has been important in flowering research. Leaves or shoots from plants induced to flower can be grafted onto uninduced plants and transmit a floral stimulus that induces them to flower.
The transmission of plant viruses has been studied using grafting. Virus indexing involves grafting a symptom-less plant that is suspected of carrying a virus onto an indicator plant that is very susceptible to the virus.
# Herbaceous grafting
Grafting is often done for non-woody plants such as a tomato, cucumber, eggplant and watermelon. The main advantage of grafting is for disease-resistant rootstocks. In Japan there is an automated process using grafting robots. | Grafting
Template:Otheruses4
Grafting is a method of plant propagation widely used in horticulture (gardening), where the tissues of one plant are encouraged to fuse with those of another. It is most commonly used for the propagation of trees and shrubs grown commercially. (Grafting is limited to dicots and gymnosperms. Monocots lack the vascular cambium required.)
In most cases, one plant is selected for its roots, and this is called the stock or rootstock. The other plant is selected for its stems, leaves, flowers, or fruits and is called the scion. The scion contains the desired genes to be duplicated in future production by the stock/scion plant.
In stem grafting, a common grafting method, a shoot of a selected, desired plant cultivar is grafted onto the stock of another type. In another common form called budding, a dormant side bud is grafted on the stem of another stock plant, and when it has fused successfully, it is encouraged to grow by cutting out the stem above the new bud.
For successful grafting to take place, the vascular cambium tissues of the stock and scion plants must be placed in contact with each other. Both tissues must be kept alive until the graft has taken, usually a period of a few weeks. Successful grafting only requires that a vascular connection takes place between the two tissues. A physical weak point often still occurs at the graft, because the structural tissue of the two distinct plants, such as wood may not fuse.
# Reasons for grafting
- Dwarfing: To induce dwarfing or cold tolerance or other characteristics to the scion. Most apple trees in modern orchards are grafted dwarf or semi-dwarf trees planted at high density. They provide more fruit per unit of land, higher quality fruit, and reduce the danger of accidents by harvest crews working on ladders.
- Ease of propagation: Because the scion is difficult to propagate vegetatively by other means, such as by cuttings. In this case, cuttings of an easily rooted plant are used to provide a rootstock. In some cases, the scion may be easily propagated, but grafting may still be used because it is commercially the most cost-effective way of raising a particular type of plant.
- Hybrid breeding: To speed maturity of hybrids in fruit tree breeding programs. Hybrid seedlings may take ten or more years to flower and fruit on their own roots. Grafting can reduce the time to flowering and shorten the breeding program.
- Hardiness: Because the scion has weak roots or the roots of the stock plants have roots tolerant of difficult conditions. e.g. many showy Western Australian plants are sensitive to dieback on heavy soils, common in urban gardens, and are grafted onto hardier eastern Australian relatives. Grevilleas and eucalypts are examples.
- Sturdiness In order to provide a strong, tall trunk for certain ornamental shrubs and trees. In these cases, a graft is made at a desired height on a stock plant with a strong stem. This is used to raise 'standard' roses, which are rose bushes on a high stem, and it is also used for some ornamental trees, such as certain weeping cherries.
- Pollen source: To provide pollenizers. For example, in tightly planted or badly planned apple orchards of a single variety, limbs of crab apple may be grafted at regularly spaced intervals onto trees down rows, say every fourth tree. This takes care of pollen needs at blossom time, yet does not confuse pickers who might otherwise mix varieties while harvesting, as the mature crab apples are so distinct from other apple varieties.
- Repair: To repair damage to the trunk of a tree which would prohibit nutrient flow, such as the stripping of the bark by rodents which completely girdles the trunk. In this case a bridge graft may be used to connect the tissues receiving flow from the roots to the tissues above the damage which have been severed from the flow. Where a watersprout, sucker or sapling of the same species is growing nearby, any of these can be grafted to the area above the damage by a method called inarch grafting. These alternatives to scions must be of the correct length to span the gap of the wound.
- Changing cultivars: To change the cultivar in a fruit orchard to a more profitable cultivar, called topworking. It may be faster to graft a new cultivar onto existing limbs of established trees than to replant an entire orchard.
- Maintain Consistency: Apples are notorious for their genetic variability, even differing in multiple characteristics, such as, size, color, and flavor, of fruits located on the same tree. In the commercial farming industry, consistency is maintained by grafting a scion with desired fruit traits onto a hardy stock.
- Curiosities
A practice sometimes carried out by gardeners is to graft related potatoes and tomatoes so that both are produced on the same plant, one above ground and one underground.
Cacti of widely different forms are sometimes grafted on to each other.
Multiple cultivars of fruits such as apples are sometimes grafted on a single tree. This so-called "family tree" provides more fruit variety for small spaces such as a suburban backyard, and also takes care of the need for pollenizers. The drawback is that the gardener must be sufficiently trained to prune them correctly, or one strong variety will usually "take over". Occasionally, a so-called "graft hybrid" or "chimaera" can occur where the tissues of the stock continue to grow within the scion. Such a plant can produce flowers and foliage typical of both plants as well as shoots intermediate between the two. The best-known example is probably +Laburnocytisus 'Adamii', a graft hybrid between laburnum and broom, which originated in a nursery near Paris, France in 1825. This small tree bears yellow flowers typical of Laburnum anagyroides, purple flowers typical of Chamaecytisus purpureus and curious coppery-pink flowers which show characteristics of both "parents".
Ornamental and functional, arborsculpture uses grafting techniques to join separate trees or parts of the same tree to itself. Furniture, hearts, entry archways are examples. Axel Erlandson was a prolific arborsculptor growing over 75 mature shaped and grafted trees.
- A practice sometimes carried out by gardeners is to graft related potatoes and tomatoes so that both are produced on the same plant, one above ground and one underground.
- Cacti of widely different forms are sometimes grafted on to each other.
- Multiple cultivars of fruits such as apples are sometimes grafted on a single tree. This so-called "family tree" provides more fruit variety for small spaces such as a suburban backyard, and also takes care of the need for pollenizers. The drawback is that the gardener must be sufficiently trained to prune them correctly, or one strong variety will usually "take over". Occasionally, a so-called "graft hybrid" or "chimaera" can occur where the tissues of the stock continue to grow within the scion. Such a plant can produce flowers and foliage typical of both plants as well as shoots intermediate between the two. The best-known example is probably +Laburnocytisus 'Adamii', a graft hybrid between laburnum and broom, which originated in a nursery near Paris, France in 1825. This small tree bears yellow flowers typical of Laburnum anagyroides, purple flowers typical of Chamaecytisus purpureus and curious coppery-pink flowers which show characteristics of both "parents".
- Ornamental and functional, arborsculpture uses grafting techniques to join separate trees or parts of the same tree to itself. Furniture, hearts, entry archways are examples. Axel Erlandson was a prolific arborsculptor growing over 75 mature shaped and grafted trees.
# Methods
## Cleft
The easiest and most common form of grafting is cleft grafting. The stock is simply split and the scion is inserted. It is best if the stock is 2-7 cm in diameter and has 3-5 buds, and the cleft is around 7cm deep. The scion is cut in a wedge shape and inserted into the tree with the cambium. The bare stock is covered with grafting compound, otherwise the cambium layer quickly dries and the graft fails.
## Stub
Stub grafting is a technique that requires less stock than cleft grafting, and retains the shape of a tree. Also scions are generally of 6-8 buds in this process.
An incision is made into the branch one centimeter above, then the scion is wedged and forced into the branch. The scion should be at an angle of at most 35° to the parent tree so that the crotch remains strong. The graft is covered with grafting compound.
## Awl
Awl grafting takes the least resources and the least time, but the most skill. There is a danger of accidentally driving the tool too far into the stock, lessening the scion's chance of survival. Awl grafting can be done by using a screwdriver to make a slit or T-shaped incision in the bark just so far as the cambium layer. Then the shield or wedged-shaped scion is inserted into the incision. Awl grafting is commonly used to graft buds.
## Veneer
Veneer grafting, or inlay grafting, is a method used for stocks larger than three centimeters in diameter. The scion is recommended to be about as thick as a pencil. Clefts are made of the same size as the scion on the side of the branch, not on top. The scion end is shaped as a wedge, inserted, and wrapped with tape to the scaffolding branches to give it more strength.
## Renewing fusion
"Renewing fusion" is a grafting method in which a small branch (at least a centimeter wide) from one plant to a main branch of another, by carefully shaving a proper amount of bark from the large branch and inserting the scion into a cut hole. The graft is taped with a thin strip of duct tape in diagonal lashings, to hold it up and to prevent insects from entering the hole.
The origin of grafting is uncertain. the peoples of ancient civilizations who grew fruit trees may have observed natural unions made by twigs and branches of compatible trees growing next to one another.
# Natural grafting
The tree roots of the same species will sometimes naturally graft where they make physical contact with each other. A group of trees can share water and mineral nutrients via root grafts, which may be advantageous to weaker trees. A problem with root grafts is that they allow transmission of certain pathogens, such as Dutch elm disease. Natural grafting also sometimes occurs where two stems on the same tree, shrub or vine make contact with each other. This is most common in plants such as strawberries and potatoes.
# Scientific uses
Grafting has been important in flowering research. Leaves or shoots from plants induced to flower can be grafted onto uninduced plants and transmit a floral stimulus that induces them to flower.[1]
The transmission of plant viruses has been studied using grafting. Virus indexing involves grafting a symptom-less plant that is suspected of carrying a virus onto an indicator plant that is very susceptible to the virus.
# Herbaceous grafting
Grafting is often done for non-woody plants such as a tomato, cucumber, eggplant and watermelon.[2] The main advantage of grafting is for disease-resistant rootstocks. In Japan there is an automated process using grafting robots. | https://www.wikidoc.org/index.php/Grafting | |
85ae818fa1621091848a1618b636c19753914375 | wikidoc | Granulin | Granulin
Granulin is a protein that in humans is encoded by the GRN gene. Each granulin protein is cleaved from the precursor progranulin, a 593 amino acid long and 68.5 kDa protein. While the function of progranulin and granulin have yet to be determined, both forms of the protein have been implicated in development, inflammation, cell proliferation and protein homeostasis. The 2006 discovery of the GRN mutation in a population of patients with frontotemporal dementia has spurred much research in uncovering the function and involvement in disease of progranulin in the body. While there is a growing body of research on progranulin's role in the body, studies on specific granulin residues are still limited.
# Progranulin
Progranulin is the precursor protein for granulin. Cleavage of progranulin produces a variety of active 6 kDa granulin peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Cleavage of progranulin into granulin occurs either in the extracellular matrix or the lysosome. Elastase, proteinase 3 and matrix metalloproteinase are proteases capable of cleaving progranulin into individual granulin peptides. Progranulin and granulin can be further differentiated by their hypothesized opposing roles in the cell. While progranulin is associated with anti-inflammation, cleaved granulin peptides have been implicated in pro-inflammatory behavior. A C. elegans study showed that granulin peptides may also participate in toxic activity.
# Expression
Progranulin is expressed in a wide variety of cell types both in the periphery and in the central nervous system. Progranulin expression is low in early development, but increases as cells mature. Cell types expressing progranulin include neurons, microglia, astrocytes and endothelial cells. Progranulin has been found to be highly expressed in microglia and up-regulated during injury Within the brain, progranulin mRNA is highly expressed in pyramidal, hippocampal and Purkinje cells cells.
# Structure
Each individual granulin domain peptide is 60 amino acids in length. Granulin peptides are cysteine rich and capable of forming 6 disulfide bonds per residue. The disulfide bonds form a central rod-like core that shuttles each individual granulin peptide into a stacked β-sheet configuration. The structure of the granulin protein is similar to the structure of proteins from protein families that consist of hormones, growth factors, ion channel modulators and enzyme inhibitors. Because of progranulin's structural similarities to these proteins, much research was done to interrogate progranulin's potential role as a growth factor. When progranulin is secreted into the extracellular matrix, it is often glycosylated at 4 confirmed and 1 tentative N-linked glycosylation sites. The n-terminus of progranulin is hypothesized to be involved in the secretion of progranulin via secretory vesicles. Specifically, Progranulin may be involved in regulating exosome excretion. The C-terminus of progranulin is hypothesized to be the primary binding partner of SORT1, a receptor of extracellular progranulin. The structural differences between each individual granulin peptide have yet to be characterized.
# Interactive partners
In the extracellular matrix, progranulin binds to receptors on several cell types resulting in either activation of a signal transduction pathway or engulfment into the cell. Several studies have shown progranulin's involvement in the binding of SORT1 and the subsequent trafficking of bounded progranulin to the lysosome. One recent study has shown that progranulin may actually mediate prosaposin trafficking to the lysosome via SORT1. However, the absence of SORT1 does not prevent exogenous progranulin from promoting neurite outgrowth or enhancing cell survival of GRN knockout cells, suggesting that other receptors are involved in mediating extracellular progranulin function For example, SORT1 -/- neuronal cells are still able to bind progranulin. Other studies have suggested tumor necrosis factor and EPH receptor A2 as potential progranulin facilitators. After binding to the receptor, progranulin may induce and modulate signaling pathways such as MAPK/ERK, PI3K/Akt, and FAK. Gene ontology enrichment analysis reveals an association between progranulin and notch receptor signaling. Granulin has also been shown to interact with Cyclin T1 and TRIB3.
# Function
## Development
Although progranulin expression increases as cells mature, they are still involved in the development of multiple cell types. Progranulin is hypothesized to be a neurotrophic factor involved in corticogenisis. Induced pluripotent stem cell lines (IPSC) harboring the GRN mutation show a decrease in cortical neuronal differentiation ability. A recent mice study suggests that progranulin may be involved in regulating the early development of cerebellar tissue by selecting for individual climbing fibers as they intersect and form synapses with Purkinje cells. In addition, several studies implicate progranulin in synaptic pruning, a microglial process that occurs during development of the neural network. Cytokines, a neuronal marker for synapse elimination, is found to be upregulated in neurons with the GRN mutation. Increased cytokine tagging results in an increase in microglial density and activity around synapses. Progranulin may also be involved in sexual determination during embryonic development.
## Inflammation and wound healing
Progranulin levels are elevated when tissue is inflamed. After wounding, keratinocytes, macrophages and neutrophils increase production of progranulin. Neutrophils are capable of secreting elastase into the extracellular matrix that is capable of cleaving progranulin into granulin peptides, that promote further promote inflammation. SLPI, inhibitors of elastase, are also released by neutrophiles and macrophages to modulate progranulin cleavage. Addition of granulin B in cultured epithelial cells causes cells to secrete IL-8, a chemical that attracts monocytes and neutrophils, which further suggests the involvement of granulin peptides in promoting inflammation. The addition of exogenous SLPI and progranulin is able to alleviate the enhanced inflammatory response of mice that are unable to inhibit the cleavage of progranulin.
## Cell proliferation
Progranulin is highly expressed in cells that are highly proliferative in nature. Several studies implicate progranulin in tumorigenesis and neuronal outgrowth. Progranulin promotes mitogenesis in epithelial cultures. When two epithelial lines were cultured in media with recombinant PGRN, proliferation was stimulated. Knockout of both progranulin homologues in a zebrafish model reduces axonal outgrowth. In primary cortical and motor neurons, progranulin regulates neuronal outgrowth and survival. In primary motor neurons, progranulin has been shown to increase neurite outgrowth by regulating the glycogen synthase kinase-3 beta. Progranulin may function as an autocrine growth factor in tumorigenesis.
## Lysosomal function
The discovery of a GRN mutation leading to lysosomal storage disorder led to many studies that explored progranulin's role in regulating protein homeostasis via the lysosomal pathway. Transcriptional gene network interference study suggests that progranulin is highly involved in lysosomal function and organization. Imaging studies have shown co-localization of progranulin and lysosomal marker LAMP-1. Progranulin expression is regulated by TFEB, a transcription factor that mediates proteins involved in lysosomal biosynthesis. Progranulin may be involved in regulating protease activity. Proteases that could be regulated by progranulin include prosaposin, which is cleaved into saposin peptides in the lysosome, and cathepsin D, the primary protease involved in protein aggregate break down. GRN mutation shares similar neuropathology and clinical phenotype with CHMP2B and VCP mutations, genes that are both involved in the trafficking and breakdown of proteins involved in lysosomal function.
# Clinical significance
## Frontal temporal dementia
Heterozygous mutation of the GRN gene leading to progranulin haploinsufficiency causes Frontal Temporal Dementia. These mutations include frameshift, splice site, nonsense signal peptide, Kozak sequence disruptions and missense mutations, which result in either nonsense-mediated decay or the production of non-functional protein. Patients with GRN caused FTD (GRN-FTD) exhibit asymmetric brain atrophy, although age of onset, disease progression and clinical symptoms vary, suggesting that other genetic or environmental factors may be involved in disease expression. Pathological indicators include cytosolic ubiquitin deposits enriched in hyperphosphorylated TAR DNA Binding Protein (TDP-43), autophagy-related protein aggregates, ubiquitin-binding protein p62, lentiform intranuclear inclusions, dystrophic neurites and inflammation. Patients with the heterozygote mutation exhibit a reduction of 70-80% serum progranulin levels when compared to controls. Reprogrammed stem cells restore GRN mRNA levels to 50%, further suggesting that some other genetic or environmental factor is involved in regulating FTD disease expression. Mice exhibit reduced autophagic flux and autophagy-dependent clearance. Human FTLD-GRN derived fibroblasts show decrease lysosomal protease activity and lymphoblasts containing neuronal ceroid lipofuscinosis-like storage material. FTLD-GRN IPSC cortical Neurons have enlarged vesicles, lipofuscin accumulation and cathepsin D deficiency.
## Neuronal ceroid lipofuscinosis
Homozygous mutation of the GRN gene causes neuronal ceroid lipofuscinosis (NCL) characterized by an accumulation of autofluorescent lipofuscin, enlarged vacuoles, impairment in lysosomal activity, retinal & brain degeneration, exaggerated inflammatory responses, microgliosis, astrogliosis and behavioral dysfunction such as OCD-like and disinhibition-like behavior. Aged GRN double mutant mice have lipofuscin deposits and enlarge lysosomes, while one group found phosphorylated TDP-43.
## Other diseases
Progranulin may also be involved in cancer development, atherosclerosis and metabolic disease. Progranulin can promote cyclin D1 expression in breast cancer lines and phosphorylation of proteins through extracellular regulated kinase signaling pathways. Progranulin is highly expressed in ovarian, adrenal carcinomas and immortalized epithelial cells. There is a correlation between Progranulin concentration and cancer severity. Granulin release by macrophages has been associated with fibrotic hepatic metastasis in pancreatic cancer. The human liver fluke (Opisthorchis viverrini) contributes to the development of bile duct (liver) cancer by secreting a granulin-like growth hormone. Progranulin may also be involved in promoting the progression of atherosclerosis. While progranulin may be anti-atherogenic, granulins may be pro-atherogenic. Increased serum and plasma progranulin levels in patients with type 2 diabetes and visceral obesity implicating progranulin in metabolic diseases. | Granulin
Granulin is a protein that in humans is encoded by the GRN gene.[1][2][3] Each granulin protein is cleaved from the precursor progranulin, a 593 amino acid long and 68.5 kDa protein.[4] While the function of progranulin and granulin have yet to be determined, both forms of the protein have been implicated in development, inflammation, cell proliferation and protein homeostasis. The 2006 discovery of the GRN mutation in a population of patients with frontotemporal dementia has spurred much research in uncovering the function and involvement in disease of progranulin in the body. While there is a growing body of research on progranulin's role in the body, studies on specific granulin residues are still limited.
# Progranulin
Progranulin is the precursor protein for granulin. Cleavage of progranulin produces a variety of active 6 kDa granulin peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Cleavage of progranulin into granulin occurs either in the extracellular matrix or the lysosome. Elastase, proteinase 3 and matrix metalloproteinase are proteases capable of cleaving progranulin into individual granulin peptides.[4][5] Progranulin and granulin can be further differentiated by their hypothesized opposing roles in the cell. While progranulin is associated with anti-inflammation, cleaved granulin peptides have been implicated in pro-inflammatory behavior. A C. elegans study showed that granulin peptides may also participate in toxic activity.[5]
# Expression
Progranulin is expressed in a wide variety of cell types both in the periphery and in the central nervous system. Progranulin expression is low in early development, but increases as cells mature.[6] Cell types expressing progranulin include neurons, microglia, astrocytes and endothelial cells.[7] Progranulin has been found to be highly expressed in microglia and up-regulated during injury[7][6] Within the brain, progranulin mRNA is highly expressed in pyramidal, hippocampal and Purkinje cells cells.[4]
# Structure
Each individual granulin domain peptide is 60 amino acids in length. Granulin peptides are cysteine rich and capable of forming 6 disulfide bonds per residue.[5] The disulfide bonds form a central rod-like core that shuttles each individual granulin peptide into a stacked β-sheet configuration.[7][4] The structure of the granulin protein is similar to the structure of proteins from protein families that consist of hormones, growth factors, ion channel modulators and enzyme inhibitors.[7] Because of progranulin's structural similarities to these proteins, much research was done to interrogate progranulin's potential role as a growth factor. When progranulin is secreted into the extracellular matrix, it is often glycosylated at 4 confirmed and 1 tentative N-linked glycosylation sites.[7][5] The n-terminus of progranulin is hypothesized to be involved in the secretion of progranulin via secretory vesicles.[7] Specifically, Progranulin may be involved in regulating exosome excretion.[8] The C-terminus of progranulin is hypothesized to be the primary binding partner of SORT1, a receptor of extracellular progranulin.[9][7] The structural differences between each individual granulin peptide have yet to be characterized.
# Interactive partners
In the extracellular matrix, progranulin binds to receptors on several cell types resulting in either activation of a signal transduction pathway or engulfment into the cell. Several studies have shown progranulin's involvement in the binding of SORT1 and the subsequent trafficking of bounded progranulin to the lysosome.[7] One recent study has shown that progranulin may actually mediate prosaposin trafficking to the lysosome via SORT1.[10] However, the absence of SORT1 does not prevent exogenous progranulin from promoting neurite outgrowth or enhancing cell survival of GRN knockout cells, suggesting that other receptors are involved in mediating extracellular progranulin function[11] For example, SORT1 -/- neuronal cells are still able to bind progranulin.[11] Other studies have suggested tumor necrosis factor and EPH receptor A2 as potential progranulin facilitators.[7] After binding to the receptor, progranulin may induce and modulate signaling pathways such as MAPK/ERK, PI3K/Akt, and FAK.[5][11] Gene ontology enrichment analysis reveals an association between progranulin and notch receptor signaling.[5] Granulin has also been shown to interact with Cyclin T1[12] and TRIB3.[13]
# Function
## Development
Although progranulin expression increases as cells mature,[6] they are still involved in the development of multiple cell types. Progranulin is hypothesized to be a neurotrophic factor involved in corticogenisis. Induced pluripotent stem cell lines (IPSC) harboring the GRN mutation show a decrease in cortical neuronal differentiation ability.[14] A recent mice study suggests that progranulin may be involved in regulating the early development of cerebellar tissue by selecting for individual climbing fibers as they intersect and form synapses with Purkinje cells.[15] In addition, several studies implicate progranulin in synaptic pruning, a microglial process that occurs during development of the neural network.[16] Cytokines, a neuronal marker for synapse elimination, is found to be upregulated in neurons with the GRN mutation.[16] Increased cytokine tagging results in an increase in microglial density and activity around synapses.[16] Progranulin may also be involved in sexual determination during embryonic development.[4]
## Inflammation and wound healing
Progranulin levels are elevated when tissue is inflamed. After wounding, keratinocytes, macrophages and neutrophils increase production of progranulin.[4] Neutrophils are capable of secreting elastase into the extracellular matrix that is capable of cleaving progranulin into granulin peptides, that promote further promote inflammation.[4] SLPI, inhibitors of elastase, are also released by neutrophiles and macrophages to modulate progranulin cleavage.[4] Addition of granulin B in cultured epithelial cells causes cells to secrete IL-8, a chemical that attracts monocytes and neutrophils, which further suggests the involvement of granulin peptides in promoting inflammation.[4] The addition of exogenous SLPI and progranulin is able to alleviate the enhanced inflammatory response of mice that are unable to inhibit the cleavage of progranulin.[4]
## Cell proliferation
Progranulin is highly expressed in cells that are highly proliferative in nature.[4] Several studies implicate progranulin in tumorigenesis and neuronal outgrowth. Progranulin promotes mitogenesis in epithelial cultures.[4] When two epithelial lines were cultured in media with recombinant PGRN, proliferation was stimulated.[5] Knockout of both progranulin homologues in a zebrafish model reduces axonal outgrowth.[6] In primary cortical and motor neurons, progranulin regulates neuronal outgrowth and survival.[6] In primary motor neurons, progranulin has been shown to increase neurite outgrowth by regulating the glycogen synthase kinase-3 beta.[6] Progranulin may function as an autocrine growth factor in tumorigenesis.[11]
## Lysosomal function
The discovery of a GRN mutation leading to lysosomal storage disorder led to many studies that explored progranulin's role in regulating protein homeostasis via the lysosomal pathway. Transcriptional gene network interference study suggests that progranulin is highly involved in lysosomal function and organization.[17] Imaging studies have shown co-localization of progranulin and lysosomal marker LAMP-1.[7] Progranulin expression is regulated by TFEB, a transcription factor that mediates proteins involved in lysosomal biosynthesis.[7] Progranulin may be involved in regulating protease activity. Proteases that could be regulated by progranulin include prosaposin, which is cleaved into saposin peptides in the lysosome, and cathepsin D, the primary protease involved in protein aggregate break down.[5] GRN mutation shares similar neuropathology and clinical phenotype with CHMP2B and VCP mutations, genes that are both involved in the trafficking and breakdown of proteins involved in lysosomal function.[4]
# Clinical significance
## Frontal temporal dementia
Heterozygous mutation of the GRN gene leading to progranulin haploinsufficiency causes Frontal Temporal Dementia. [18][19][20] These mutations include frameshift, splice site, nonsense signal peptide, Kozak sequence disruptions and missense mutations, which result in either nonsense-mediated decay or the production of non-functional protein.[4] Patients with GRN caused FTD (GRN-FTD) exhibit asymmetric brain atrophy, although age of onset, disease progression and clinical symptoms vary, suggesting that other genetic or environmental factors may be involved in disease expression.[6][4] Pathological indicators include cytosolic ubiquitin deposits enriched in hyperphosphorylated TAR DNA Binding Protein (TDP-43), autophagy-related protein aggregates, ubiquitin-binding protein p62, lentiform intranuclear inclusions, dystrophic neurites and inflammation.[11][4][5] Patients with the heterozygote mutation exhibit a reduction of 70-80% serum progranulin levels when compared to controls.[11] Reprogrammed stem cells restore GRN mRNA levels to 50%, further suggesting that some other genetic or environmental factor is involved in regulating FTD disease expression.[11] Mice exhibit reduced autophagic flux and autophagy-dependent clearance.[5] Human FTLD-GRN derived fibroblasts show decrease lysosomal protease activity and lymphoblasts containing neuronal ceroid lipofuscinosis-like storage material.[5] FTLD-GRN IPSC cortical Neurons have enlarged vesicles, lipofuscin accumulation and cathepsin D deficiency.[5]
## Neuronal ceroid lipofuscinosis
Homozygous mutation of the GRN gene causes neuronal ceroid lipofuscinosis (NCL) characterized by an accumulation of autofluorescent lipofuscin, enlarged vacuoles, impairment in lysosomal activity, retinal & brain degeneration, exaggerated inflammatory responses, microgliosis, astrogliosis and behavioral dysfunction such as OCD-like and disinhibition-like behavior.[11][5] Aged GRN double mutant mice have lipofuscin deposits and enlarge lysosomes, while one group found phosphorylated TDP-43.[5]
## Other diseases
Progranulin may also be involved in cancer development, atherosclerosis and metabolic disease. Progranulin can promote cyclin D1 expression in breast cancer lines and phosphorylation of proteins through extracellular regulated kinase signaling pathways.[4] Progranulin is highly expressed in ovarian, adrenal carcinomas and immortalized epithelial cells.[4] There is a correlation between Progranulin concentration and cancer severity.[5] Granulin release by macrophages has been associated with fibrotic hepatic metastasis in pancreatic cancer.[21] The human liver fluke (Opisthorchis viverrini) contributes to the development of bile duct (liver) cancer by secreting a granulin-like growth hormone.[22] Progranulin may also be involved in promoting the progression of atherosclerosis.[11] While progranulin may be anti-atherogenic, granulins may be pro-atherogenic.[11] Increased serum and plasma progranulin levels in patients with type 2 diabetes and visceral obesity implicating progranulin in metabolic diseases.[11] | https://www.wikidoc.org/index.php/Granulin | |
ef6ec7b5e9b64c904bc6bde2529d3ac232901235 | wikidoc | Graphite | Graphite
The mineral graphite, as with diamond and fullerene, is one of the allotropes of carbon. It was named by Abraham Gottlob Werner in 1789 from the Greek γραφειν (graphein): "to draw/write", for its use in pencils, where it is commonly called lead, as distinguished from the actual metallic element lead. Unlike diamond, graphite is an electrical conductor, and can be used, for instance, in the electrodes of an arc lamp. Graphite holds the distinction of being the most stable form of carbon under standard conditions. Therefore, it is used in thermochemistry as the standard state for defining the heat of formation of carbon compounds. Graphite may be considered the highest grade of coal, just above anthracite and alternatively called meta-anthracite, although it is not normally used as fuel because it is hard to ignite.
There are three principal types of natural graphite, each occurring in different types of ore deposit: (1) Crystalline flake graphite (or flake graphite for short) occurs as isolated, flat, plate-like particles with hexagonal edges if unbroken and when broken the edges can be irregular or angular; (2) Amorphous graphite occurs as fine particles and is the result of thermal metamorphism of coal, the last stage of coalification, and is sometimes called meta-anthracite. Very fine flake graphite is sometimes called amorphous in the trade; (3) Lump graphite (also called vein graphite) occurs in fissure veins or fractures and appears as massive platy intergrowths of fibrous or acicular crystalline aggregates, and is probably hydrothermal in origin.
The name "graphite fiber" is also sometimes used to refer to carbon fibre or carbon fibre reinforced plastic.
# Occurrence
Minerals associated with graphite include quartz, calcite, micas, iron meteorites, and tourmalines. China is usually the top producer of graphite, followed by India and Brazil.
Graphite has various other characteristics. Thin flakes are flexible but inelastic, the mineral can leave black marks on hands and paper, it conducts electricity, and displays superlubricity. Its best field indicators are softness, luster, density and streak.
According to the USGS, world production of natural graphite in 2006 was 1.03 million tonnes and in 2005 was 1.04 million tonnes (revised), of which the following major exporters produced: China produced 720,000 tonnes in both 2006 and 2005, Brazil 75,600 tonnes in 2006 and 75,515 tonnes in 2005 (revised), Canada 28,000 tonnes in both years, and Mexico (amorphous) 12,500 tonnes in 2006 and 12,357 tonnes in 2005 (revised). In addition, there are two specialist producers: Sri Lanka produced 3,200 tonnes in 2006 and 3,000 tonnes in 2005 of lump or vein graphite, and Madagascar produced 15,000 tonnes in both years, a large portion of it "crucible grade" or very large flake graphite. Some other producers produce very small amounts of "crucible grade".
According to the USGS, U.S. (synthetic) graphite electrode production in 2006 was 132,000 tonnes valued at $495 million and in 2005 was 146,000 tonnes valued at $391 million, and high-modulus graphite (carbon) fiber production in 2006 was 8,160 tonnes valued at $172 million and in 2005 was 7,020 tonnes valued at $134 million.
- graphite's unit cell
graphite's unit cell
- ball-and-stick model of a graphite layer
ball-and-stick model of a graphite layer
- side view of layer stacking
side view of layer stacking
- plane view of layer stacking
plane view of layer stacking
# Detailed properties
The two known forms of graphite, alpha (hexagonal) and beta (rhombohedral), have very similar physical properties (except that the graphene layers stack slightly differently). The hexagonal graphite may be either flat or buckled. Another form called cubic might have also been discovered. Graphites that naturally occur have been found to contain up to 30% of the beta form, when synthetically-produced graphite only contains the alpha form. The alpha form can be converted to the beta form through mechanical treatment and the beta form reverts to the alpha form when it is heated above 1000 °C.
The acoustic and thermal properties of graphite are highly anisotropic, since phonons propagate very quickly along the tightly-bound planes, but are slower to travel from one plane to another.
Graphite can conduct electricity due to the vast electron delocalization within the carbon layers. These valence electrons are free to move, so are able to conduct electricity. However, the electricity is only conducted within the plane of the layers.
Graphite and graphite powder is valued in industrial applications for its self-lubricating and dry lubricating properties. There is a common belief that graphite's lubricating properties are solely due to the loose interlamellar coupling between sheets in the structure. However, it has been shown that in a vacuum environment (such as in technologies for use in space), graphite is a very poor lubricant. This observation led to the discovery that the lubrication is due to the presence of fluids between the layers, such as air and water, which are naturally adsorbed from the environment. This molecular property is unlike other layered, dry lubricants such as molybdenum disulfide. Recent studies suggest that an effect called superlubricity can also account for graphite's lubricating properties. The use of graphite is limited by its tendency to facilitate pitting corrosion in some stainless steels, and to promote galvanic corrosion between dissimilar metals (due to its electrical conductivity). It is also corrosive to aluminium in presence of moisture. For this reason, the US Air Force banned its use as a lubricant in aluminium aircraft , and discouraged its use in aluminium-containing automatic weapons . Even graphite pencil marks on aluminium parts may facilitate corrosion . Another high-temperature lubricant, hexagonal boron nitride, has the same molecular structure as graphite. It is sometimes called white graphite, due to its similar properties.
When a large number of crystallographic defects binds these planes together, graphite loses its lubrication properties and becomes what is known as pyrolytic carbon. This material is useful for blood-contacting implants such as prosthetic heart valves. It is also highly diamagnetic, thus it will float in mid-air above a strong magnet.
Graphite forms intercalation compounds with some metals and small molecules. In these compounds, the host molecule or atom gets "sandwiched" between the graphite layers, resulting in compounds with variable stoichiometry. A prominent example of an intercalation compound is potassium graphite, denoted by the formula KC8.
Natural and crystalline graphites are not often used in pure form as structural materials, due to their shear-planes, brittleness and inconsistent mechanical properties.
# History
Some time before 1565 (some sources say as early as 1500), an enormous deposit of graphite was discovered on the approach to Grey Knotts from the hamlet of Seathwaite near Borrowdale parish, Cumbria, England, which the locals found very useful for marking sheep. This particular deposit of graphite was extremely pure and solid, and could easily be sawn into sticks. This remains the only deposit of graphite found in this solid form.
# Uses of natural graphite
According to the USGS, U.S. consumption of natural graphite in 2005-06 averaged 41,850 tonnes in end uses such as refractories, steelmaking, expanded graphite, brake linings, and foundry facings-lubricants. GAN (Graphite Advocate News) import-export statistics for 2006 and 2007 indicate the consumption will continue at that level unless steelmaking carbon raiser takes a drastic drop.
## Refractories
This end-use begins before 1900 with the graphite crucible used to hold molten metal; this is now a minor part of refractories. In the mid 1980s, the carbon-magnesite brick became important, and a bit later the alumina-graphite shape. Currently the order of importance is alumina-graphite shapes, carbon-magnesite brick, monolithics (gunning and ramming mixes), and then crucibles. Crucibles began using very large flake graphite, and carbon-magnesite brick requiring not quite so large flake graphite; for these and others there is now much more flexibility in size of flake required, and amorphous graphite is no longer restricted to low-end refractories. Alumina-graphite shapes are used as continuous casting ware, such as nozzles and troughs, to convey the molten steel from ladle to mould, and carbon magnesite bricks line steel converters and electric arc furnaces to withstand extreme temperatures. High-purity monolithics are often used as a continuous furnace lining instead of the carbon-magnesite bricks. The U.S. and European refractories industry had a crisis in 2000-2003, with an indifferent market for steel and a declining refractory consumption per tonne of steel underlying firm buyouts and many plant closings. Many of the plant closings resulted from the RHI acquisition of Harbison-Walker Refractories; some plants had their equipment auctioned off. Since much of the lost capacity was for carbon-magnesite brick, graphite consumption within refractories area moved towards alumina-graphite shapes and monolithics, and away from the brick. The major source of carbon-magnesite brick is now imports from China. Almost all of the above refractories are used to make steel and account for 75% of refractory consumption; the rest is used by a variety of industries, such as cement. According to the USGS, 2006 U.S. natural graphite consumption in refractories was 11,000 tonnes and in 2005 11,800 tonnes.
## Steelmaking
Natural graphite in this end use mostly goes into carbon raising in molten steel, although it can be used to lubricate the dies used to extrude hot steel. Supplying carbon raiser is very competitive, therefore subject to cut-throat pricing from alternatives such as synthetic graphite powder, petroleum coke, and other forms of carbon. A carbon raiser is added to increase the carbon content of the steel to the specified level. A GAN consumption estimate based on USGS U.S. graphite consumption statistics indicates that 10,500 tonnes was used in this fashion in 2005.
## Expanded graphite
Expanded graphite is made by immersing natural flake graphite in a bath of chromic acid, then concentrated sulfuric acid, which forces the crystal lattice planes apart, thus expanding the graphite. The expanded graphite can be used to make graphite foil or used directly as "hot top" compound to insulate molten metal in a ladle or red-hot steel ingots and decrease heat loss, or as firestops fitted around a fire door or in sheet metal collars surrounding plastic pipe, (During a fire, the graphite expands and chars to resist fire penetration and spread.), or to make high-performance gasket material for high-temperature use. After being made into graphite foil, the foil is machined and assembled into the bipolar plates in fuel cells.
The foil is made into heat sinks for laptop computers which keeps them cool while saving weight, and is made into a foil laminate that can be used in valve packings or made into gaskets. Old-style packings are now a minor member of this grouping: fine flake graphite in oils or greases for uses requiring heat resistance. A GAN estimate of current U.S. natural graphite consumption in this end use is 7,500 tonnes.
## Brake linings
Natural amorphous and fine flake graphite are used in brake linings or brake shoes for heavier (nonautomotive) vehicles, and became important with the need to substitute for asbestos. This use has been important for quite some time, but nonasbestos organic (NAO) compositions are beginning to cost graphite market share. A brake-lining industry shake-out with some plant closings has not helped either, nor has an indifferent automotive market. According to the USGS, U.S. natural graphite consumption in brake linings was 6,510 tonnes in 2005.
## Foundry facings and lubricants
A foundry facing or mold wash is a water-based paint of amorphous or fine flake graphite. Painting the inside of a mold with it and letting it dry leaves a fine graphite coat that will ease separation of the object cast after the hot metal has cooled. Graphite lubricants are specialty items for use at very high or very low temperatures, as a wire die extrusion lubricant, an antiseize agent, a gear lubricant for mining machinery, and to lubricate locks. Having low-grit graphite, or even better no-grit graphite (ultra high purity), is highly desirable. It can be used as a dry powder, in water or oil, or as colloidal graphite (a permanent suspension in a liquid). An estimate based on USGS graphite consumption statistics indicates that 2,200 tonnes was used in this fashion in 2005.
## Other uses
Natural graphite has found uses as the marking material ("lead") in common pencils, in zinc-carbon batteries, in electric motor brushes, and various specialized applications.
# Uses of synthetic graphite
## Electrodes
These electrodes carry the electricity that heats electric arc furnaces, the vast majority steel furnaces. They are made from petroleum coke after it is mixed with petroleum pitch, extruded and shaped, then baked to sinter it, and then graphitized by heating it above the temperature that converts carbon to graphite. They can vary in size from 6 ft. long to 6 in. in diameter. The graphite electrode market is shrinking: plasma-arc furnaces (no electrodes) are often replacing electric arc furnaces, and the electric arc furnace itself is getting more efficient and making more steel per tonne of electrode. An estimate based on USGS data indicates that graphite electrode consumption was 197,000 tonnes in 2005.
## Powder and scrap
The powder is made by heating powdered petroleum coke above the temperature of graphitization, sometimes with minor modifications. The graphite scrap comes from pieces of unusable electrode material (in the manufacturing stage or after use) and lathe turnings, usually after crushing and sizing. Most synthetic graphite powder goes to carbon raising in steel (competing with natural graphite), with some used in batteries and brake linings. According to the USGS, U.S. synthetic graphite powder and scrap production was 95,000 tonnes in 2001 (latest data).
## Other uses
Graphite (carbon) fiber and carbon nanotubes are also used in carbon fiber reinforced plastics, and in heat-resistant composites such as reinforced carbon-carbon (RCC). Products made from carbon fiber graphite composites include fishing rods, golf clubs,bicycle frames,and pool sticks and have been successfully employed in reinforced concrete. The mechanical properties of carbon fiber graphite-reinforced plastic composites and grey cast iron are strongly influenced by the role of graphite in these materials. In this context, the term "(100%) graphite" is often loosely used to refer to a pure mixture of carbon reinforcement and resin, while the term "composite" is used for composite materials with additional ingredients.
Synthetic graphite also finds use as a matrix and neutron moderator within nuclear reactors. Its low neutron cross section also recommends it for use in proposed fusion reactors. Care must be taken that reactor-grade graphite is free of neutron absorbing materials such as boron, widely used as the seed electrode in commercial graphite deposition systems-- this caused the failure of the Germans' World War II graphite-based nuclear reactors. Since they could not isolate the difficulty they were forced to use far more expensive heavy water moderators. Graphite used for nuclear reactors is often referred to as nuclear graphite.
Graphite has been used in at least three radar absorbent materials. It was mixed with rubber in Sumpf and Schornsteinfeger, which were used on U-boat snorkels to reduce their radar cross section. It was also used in tiles on early F-117 Nighthawks. Modern gunpowder is coated in graphite to prevent the buildup of static charge.
# Graphite mining, beneficiation, and milling
Graphite is mined around the world by both open pit and underground methods. While flake graphite and amorphous graphite are both mined open pit and underground, lump (vein) graphite is only mined underground in Sri Lanka. The open pit mines usually employ equipment (i.e. bulldozers) to scoop up the ore, which is usually put in trucks and moved to the plant. Since the original rock is usually lateritized or weathered, this amounts to moving dirt with flecks or pieces of graphite in it from the pit (blasting is seldom required). The underground graphite mines employ drilling and blasting to break up the hard rock (ore), which is then moved by mine cars pulled by a locomotive, or moved by automotive vehicles, to the surface and then to the plant. In less-developed areas of the world, the ore can be mined by pick and shovel and transported by mine cars pushed by a laborer or by women carrying baskets of ore on their heads.
Graphite usually needs beneficiation, although thick-bedded amorphous graphite and vein graphite is almost always beneficiated, if beneficiated at all, by laborers hand-picking out the pieces of gangue (rock) and hand-screening the product. The great majority of world flake graphite production is crushed and ground if necessary and beneficiated by flotation. Treating graphite by flotation encounters one big difficulty: graphite is very soft and "marks" (coats) the particles of gangue. This makes the "marked" gangue particles float off with the graphite to yield a very impure concentrate. There are two ways of obtaining a saleable concentrate or product: regrinding and floating it again and again (up to seven times) to obtain a purer and purer concentrate, or by leaching (dissolving) the gangue with hydrofluoric acid (for a silicate gangue) or hydrochloric acid (for a carbonate gangue).
In the milling process, the incoming graphite products and concentrates can be ground before being classified (sized or screened), with the coarser flake size fractions (above 8 mesh, 8 mesh to 20 mesh, 20 mesh to 50 mesh) carefully preserved, and then the carbon contents are determined. Then some standard blends can be prepared from the different fractions, each with a certain flake size distribution and carbon content. Custom blends can also be made for individual customers who want a certain flake size distribution and carbon content. If flake size is unimportant, the concentrate can be ground more freely. Typical final products include a fine powder for use as a slurry in oil drilling; in zirconium silicate, sodium silicate and isopropyl alcohol coatings for foundry molds; and a carbon raiser in the steel industry ( Synthetic graphite powder and powdered petroleum coke can also be used as carbon raiser)(Earth Metrics, 1989). Rough graphite is typically classified, ground, and packaged at a graphite mill; often the more complex formulations are also mixed and packaged at the mill facility. Environmental impacts from graphite mills consist of air pollution including fine particulate exposure of workers and also soil contamination from powder spillages leading to heavy metals contaminations of soil. Dust masks are normally worn by workers during the production process to avoid worker exposure to the fine airborne graphite and zircon silicate.
# Graphite recycling
The most common way graphite is recycled occurs when synthetic graphite electrodes (or anodes or cathodes) are either manufactured and pieces are cut off or lathe turnings are discarded, or the electrode (or other) are used all the way down to the electrode holder. A new electrode replaces the old one , but a sizeable piece of the old electrode remains. This is crushed and sized, and the resulting graphite powder is mostly used to raise the carbon content of molten steel. Graphite-containing refractories are sometimes also recycled , but often not because of their graphite: the largest-volume items, such as carbon-magnesite bricks that contain only 15%-25% graphite, usually contain too little graphite. However, some recycled carbon-magnesite brick is used as the basis for furnace repair materials, and also crushed carbon-magnesite brick is used in slag conditioners. While crucibles have a high graphite content, the volume of crucibles used and then recycled is very small.
A high-quality flake graphite product that closely resembles natural flake graphite can be made from steelmaking kish. Kish is a large-volume near-molten waste skimmed from the molten iron feed to a basic oxygen furnace, and is a mix of graphite (precipitated out of the supersaturated iron), lime-rich slag, and some iron. The iron is recycled on site, so what is left is a mixture of graphite and slag. The best recovery process uses hydraulic classification (Which utilizes a flow of water to separate minerals by specific gravity: graphite is light and settles nearly last.) to get a 70% graphite rough concentrate. Leaching this concentrate with hydrochloric acid gives a 95% graphite product with a flake size ranging from 10 mesh down.
# Media | Graphite
Template:Seealso
Template:Infobox mineral
The mineral graphite, as with diamond and fullerene, is one of the allotropes of carbon. It was named by Abraham Gottlob Werner in 1789 from the Greek γραφειν (graphein): "to draw/write", for its use in pencils, where it is commonly called lead, as distinguished from the actual metallic element lead. Unlike diamond, graphite is an electrical conductor, and can be used, for instance, in the electrodes of an arc lamp. Graphite holds the distinction of being the most stable form of carbon under standard conditions. Therefore, it is used in thermochemistry as the standard state for defining the heat of formation of carbon compounds. Graphite may be considered the highest grade of coal, just above anthracite and alternatively called meta-anthracite, although it is not normally used as fuel because it is hard to ignite.
There are three principal types of natural graphite, each occurring in different types of ore deposit: (1) Crystalline flake graphite (or flake graphite for short) occurs as isolated, flat, plate-like particles with hexagonal edges if unbroken and when broken the edges can be irregular or angular; (2) Amorphous graphite occurs as fine particles and is the result of thermal metamorphism of coal, the last stage of coalification, and is sometimes called meta-anthracite. Very fine flake graphite is sometimes called amorphous in the trade; (3) Lump graphite (also called vein graphite) occurs in fissure veins or fractures and appears as massive platy intergrowths of fibrous or acicular crystalline aggregates, and is probably hydrothermal in origin.
The name "graphite fiber" is also sometimes used to refer to carbon fibre or carbon fibre reinforced plastic.
# Occurrence
Minerals associated with graphite include quartz, calcite, micas, iron meteorites, and tourmalines. China is usually the top producer of graphite, followed by India and Brazil.
Graphite has various other characteristics. Thin flakes are flexible but inelastic, the mineral can leave black marks on hands and paper, it conducts electricity, and displays superlubricity. Its best field indicators are softness, luster, density and streak.
According to the USGS, world production of natural graphite in 2006 was 1.03 million tonnes and in 2005 was 1.04 million tonnes (revised), of which the following major exporters produced: China produced 720,000 tonnes in both 2006 and 2005, Brazil 75,600 tonnes in 2006 and 75,515 tonnes in 2005 (revised), Canada 28,000 tonnes in both years, and Mexico (amorphous) 12,500 tonnes in 2006 and 12,357 tonnes in 2005 (revised). In addition, there are two specialist producers: Sri Lanka produced 3,200 tonnes in 2006 and 3,000 tonnes in 2005 of lump or vein graphite, and Madagascar produced 15,000 tonnes in both years, a large portion of it "crucible grade" or very large flake graphite. Some other producers produce very small amounts of "crucible grade".
According to the USGS, U.S. (synthetic) graphite electrode production in 2006 was 132,000 tonnes valued at $495 million and in 2005 was 146,000 tonnes valued at $391 million, and high-modulus graphite (carbon) fiber production in 2006 was 8,160 tonnes valued at $172 million and in 2005 was 7,020 tonnes valued at $134 million.
- graphite's unit cell
graphite's unit cell
- ball-and-stick model of a graphite layer
ball-and-stick model of a graphite layer
- side view of layer stacking
side view of layer stacking
- plane view of layer stacking
plane view of layer stacking
# Detailed properties
The two known forms of graphite, alpha (hexagonal) and beta (rhombohedral), have very similar physical properties (except that the graphene layers stack slightly differently).[1] The hexagonal graphite may be either flat or buckled.[2] Another form called cubic might have also been discovered.[3] Graphites that naturally occur have been found to contain up to 30% of the beta form, when synthetically-produced graphite only contains the alpha form.[citation needed] The alpha form can be converted to the beta form through mechanical treatment and the beta form reverts to the alpha form when it is heated above 1000 °C.[citation needed]
The acoustic and thermal properties of graphite are highly anisotropic, since phonons propagate very quickly along the tightly-bound planes, but are slower to travel from one plane to another.
Graphite can conduct electricity due to the vast electron delocalization within the carbon layers. These valence electrons are free to move, so are able to conduct electricity. However, the electricity is only conducted within the plane of the layers.
Graphite and graphite powder is valued in industrial applications for its self-lubricating and dry lubricating properties. There is a common belief that graphite's lubricating properties are solely due to the loose interlamellar coupling between sheets in the structure. However, it has been shown that in a vacuum environment (such as in technologies for use in space), graphite is a very poor lubricant. This observation led to the discovery that the lubrication is due to the presence of fluids between the layers, such as air and water, which are naturally adsorbed from the environment. This molecular property is unlike other layered, dry lubricants such as molybdenum disulfide. Recent studies suggest that an effect called superlubricity can also account for graphite's lubricating properties. The use of graphite is limited by its tendency to facilitate pitting corrosion in some stainless steels, and to promote galvanic corrosion between dissimilar metals (due to its electrical conductivity). It is also corrosive to aluminium in presence of moisture. For this reason, the US Air Force banned its use as a lubricant in aluminium aircraft [4], and discouraged its use in aluminium-containing automatic weapons [5]. Even graphite pencil marks on aluminium parts may facilitate corrosion [6]. Another high-temperature lubricant, hexagonal boron nitride, has the same molecular structure as graphite. It is sometimes called white graphite, due to its similar properties.
When a large number of crystallographic defects binds these planes together, graphite loses its lubrication properties and becomes what is known as pyrolytic carbon. This material is useful for blood-contacting implants such as prosthetic heart valves. It is also highly diamagnetic, thus it will float in mid-air above a strong magnet.
Graphite forms intercalation compounds with some metals and small molecules. In these compounds, the host molecule or atom gets "sandwiched" between the graphite layers, resulting in compounds with variable stoichiometry. A prominent example of an intercalation compound is potassium graphite, denoted by the formula KC8.
Natural and crystalline graphites are not often used in pure form as structural materials, due to their shear-planes, brittleness and inconsistent mechanical properties.
# History
Some time before 1565 (some sources say as early as 1500), an enormous deposit of graphite was discovered on the approach to Grey Knotts from the hamlet of Seathwaite near Borrowdale parish, Cumbria, England, which the locals found very useful for marking sheep.[7][8] This particular deposit of graphite was extremely pure and solid, and could easily be sawn into sticks. This remains the only deposit of graphite found in this solid form.[9]
# Uses of natural graphite
According to the USGS, U.S. consumption of natural graphite in 2005-06 averaged 41,850 tonnes in end uses such as refractories, steelmaking, expanded graphite, brake linings, and foundry facings-lubricants. GAN (Graphite Advocate News) import-export statistics for 2006 and 2007 indicate the consumption will continue at that level unless steelmaking carbon raiser takes a drastic drop.
## Refractories
This end-use begins before 1900 with the graphite crucible used to hold molten metal; this is now a minor part of refractories. In the mid 1980s, the carbon-magnesite brick became important, and a bit later the alumina-graphite shape. Currently the order of importance is alumina-graphite shapes, carbon-magnesite brick, monolithics (gunning and ramming mixes), and then crucibles. Crucibles began using very large flake graphite, and carbon-magnesite brick requiring not quite so large flake graphite; for these and others there is now much more flexibility in size of flake required, and amorphous graphite is no longer restricted to low-end refractories. Alumina-graphite shapes are used as continuous casting ware, such as nozzles and troughs, to convey the molten steel from ladle to mould, and carbon magnesite bricks line steel converters and electric arc furnaces to withstand extreme temperatures. High-purity monolithics are often used as a continuous furnace lining instead of the carbon-magnesite bricks. The U.S. and European refractories industry had a crisis in 2000-2003, with an indifferent market for steel and a declining refractory consumption per tonne of steel underlying firm buyouts and many plant closings. Many of the plant closings resulted from the RHI acquisition of Harbison-Walker Refractories; some plants had their equipment auctioned off. Since much of the lost capacity was for carbon-magnesite brick, graphite consumption within refractories area moved towards alumina-graphite shapes and monolithics, and away from the brick. The major source of carbon-magnesite brick is now imports from China. Almost all of the above refractories are used to make steel and account for 75% of refractory consumption; the rest is used by a variety of industries, such as cement. According to the USGS, 2006 U.S. natural graphite consumption in refractories was 11,000 tonnes and in 2005 11,800 tonnes.
## Steelmaking
Natural graphite in this end use mostly goes into carbon raising in molten steel, although it can be used to lubricate the dies used to extrude hot steel. Supplying carbon raiser is very competitive, therefore subject to cut-throat pricing from alternatives such as synthetic graphite powder, petroleum coke, and other forms of carbon. A carbon raiser is added to increase the carbon content of the steel to the specified level. A GAN consumption estimate based on USGS U.S. graphite consumption statistics indicates that 10,500 tonnes was used in this fashion in 2005.
## Expanded graphite
Expanded graphite is made by immersing natural flake graphite in a bath of chromic acid, then concentrated sulfuric acid, which forces the crystal lattice planes apart, thus expanding the graphite. The expanded graphite can be used to make graphite foil or used directly as "hot top" compound to insulate molten metal in a ladle or red-hot steel ingots and decrease heat loss, or as firestops fitted around a fire door or in sheet metal collars surrounding plastic pipe, (During a fire, the graphite expands and chars to resist fire penetration and spread.), or to make high-performance gasket material for high-temperature use. After being made into graphite foil, the foil is machined and assembled into the bipolar plates in fuel cells.
The foil is made into heat sinks for laptop computers which keeps them cool while saving weight, and is made into a foil laminate that can be used in valve packings or made into gaskets. Old-style packings are now a minor member of this grouping: fine flake graphite in oils or greases for uses requiring heat resistance. A GAN estimate of current U.S. natural graphite consumption in this end use is 7,500 tonnes.
## Brake linings
Natural amorphous and fine flake graphite are used in brake linings or brake shoes for heavier (nonautomotive) vehicles, and became important with the need to substitute for asbestos. This use has been important for quite some time, but nonasbestos organic (NAO) compositions are beginning to cost graphite market share. A brake-lining industry shake-out with some plant closings has not helped either, nor has an indifferent automotive market. According to the USGS, U.S. natural graphite consumption in brake linings was 6,510 tonnes in 2005.
## Foundry facings and lubricants
A foundry facing or mold wash is a water-based paint of amorphous or fine flake graphite. Painting the inside of a mold with it and letting it dry leaves a fine graphite coat that will ease separation of the object cast after the hot metal has cooled. Graphite lubricants are specialty items for use at very high or very low temperatures, as a wire die extrusion lubricant, an antiseize agent, a gear lubricant for mining machinery, and to lubricate locks. Having low-grit graphite, or even better no-grit graphite (ultra high purity), is highly desirable. It can be used as a dry powder, in water or oil, or as colloidal graphite (a permanent suspension in a liquid). An estimate based on USGS graphite consumption statistics indicates that 2,200 tonnes was used in this fashion in 2005.
## Other uses
Natural graphite has found uses as the marking material ("lead") in common pencils, in zinc-carbon batteries, in electric motor brushes, and various specialized applications.
# Uses of synthetic graphite
## Electrodes
These electrodes carry the electricity that heats electric arc furnaces, the vast majority steel furnaces. They are made from petroleum coke after it is mixed with petroleum pitch, extruded and shaped, then baked to sinter it, and then graphitized by heating it above the temperature that converts carbon to graphite. They can vary in size from 6 ft. long to 6 in. in diameter. The graphite electrode market is shrinking: plasma-arc furnaces (no electrodes) are often replacing electric arc furnaces, and the electric arc furnace itself is getting more efficient and making more steel per tonne of electrode. An estimate based on USGS data indicates that graphite electrode consumption was 197,000 tonnes in 2005.
## Powder and scrap
The powder is made by heating powdered petroleum coke above the temperature of graphitization, sometimes with minor modifications. The graphite scrap comes from pieces of unusable electrode material (in the manufacturing stage or after use) and lathe turnings, usually after crushing and sizing. Most synthetic graphite powder goes to carbon raising in steel (competing with natural graphite), with some used in batteries and brake linings. According to the USGS, U.S. synthetic graphite powder and scrap production was 95,000 tonnes in 2001 (latest data).
## Other uses
Graphite (carbon) fiber and carbon nanotubes are also used in carbon fiber reinforced plastics, and in heat-resistant composites such as reinforced carbon-carbon (RCC). Products made from carbon fiber graphite composites include fishing rods, golf clubs,bicycle frames,and pool sticks and have been successfully employed in reinforced concrete. The mechanical properties of carbon fiber graphite-reinforced plastic composites and grey cast iron are strongly influenced by the role of graphite in these materials. In this context, the term "(100%) graphite" is often loosely used to refer to a pure mixture of carbon reinforcement and resin, while the term "composite" is used for composite materials with additional ingredients.
Synthetic graphite also finds use as a matrix and neutron moderator within nuclear reactors. Its low neutron cross section also recommends it for use in proposed fusion reactors. Care must be taken that reactor-grade graphite is free of neutron absorbing materials such as boron, widely used as the seed electrode in commercial graphite deposition systems-- this caused the failure of the Germans' World War II graphite-based nuclear reactors. Since they could not isolate the difficulty they were forced to use far more expensive heavy water moderators. Graphite used for nuclear reactors is often referred to as nuclear graphite.
Graphite has been used in at least three radar absorbent materials. It was mixed with rubber in Sumpf and Schornsteinfeger, which were used on U-boat snorkels to reduce their radar cross section. It was also used in tiles on early F-117 Nighthawks. Modern gunpowder is coated in graphite to prevent the buildup of static charge.
# Graphite mining, beneficiation, and milling
Graphite is mined around the world by both open pit and underground methods. While flake graphite and amorphous graphite are both mined open pit and underground, lump (vein) graphite is only mined underground in Sri Lanka. The open pit mines usually employ equipment (i.e. bulldozers) to scoop up the ore, which is usually put in trucks and moved to the plant. Since the original rock is usually lateritized or weathered, this amounts to moving dirt with flecks or pieces of graphite in it from the pit (blasting is seldom required). The underground graphite mines employ drilling and blasting to break up the hard rock (ore), which is then moved by mine cars pulled by a locomotive, or moved by automotive vehicles, to the surface and then to the plant. In less-developed areas of the world, the ore can be mined by pick and shovel and transported by mine cars pushed by a laborer or by women carrying baskets of ore on their heads.
Graphite usually needs beneficiation, although thick-bedded amorphous graphite and vein graphite is almost always beneficiated, if beneficiated at all, by laborers hand-picking out the pieces of gangue (rock) and hand-screening the product. The great majority of world flake graphite production is crushed and ground if necessary and beneficiated by flotation. Treating graphite by flotation encounters one big difficulty: graphite is very soft and "marks" (coats) the particles of gangue. This makes the "marked" gangue particles float off with the graphite to yield a very impure concentrate. There are two ways of obtaining a saleable concentrate or product: regrinding and floating it again and again (up to seven times) to obtain a purer and purer concentrate, or by leaching (dissolving) the gangue with hydrofluoric acid (for a silicate gangue) or hydrochloric acid (for a carbonate gangue).
In the milling process, the incoming graphite products and concentrates can be ground before being classified (sized or screened), with the coarser flake size fractions (above 8 mesh, 8 mesh to 20 mesh, 20 mesh to 50 mesh) carefully preserved, and then the carbon contents are determined. Then some standard blends can be prepared from the different fractions, each with a certain flake size distribution and carbon content. Custom blends can also be made for individual customers who want a certain flake size distribution and carbon content. If flake size is unimportant, the concentrate can be ground more freely. Typical final products include a fine powder for use as a slurry in oil drilling; in zirconium silicate, sodium silicate and isopropyl alcohol coatings for foundry molds; and a carbon raiser in the steel industry ( Synthetic graphite powder and powdered petroleum coke can also be used as carbon raiser)(Earth Metrics, 1989). Rough graphite is typically classified, ground, and packaged at a graphite mill; often the more complex formulations are also mixed and packaged at the mill facility. Environmental impacts from graphite mills consist of air pollution including fine particulate exposure of workers and also soil contamination from powder spillages leading to heavy metals contaminations of soil. Dust masks are normally worn by workers during the production process to avoid worker exposure to the fine airborne graphite and zircon silicate.
# Graphite recycling
The most common way graphite is recycled occurs when synthetic graphite electrodes (or anodes or cathodes) are either manufactured and pieces are cut off or lathe turnings are discarded, or the electrode (or other) are used all the way down to the electrode holder. A new electrode replaces the old one , but a sizeable piece of the old electrode remains. This is crushed and sized, and the resulting graphite powder is mostly used to raise the carbon content of molten steel. Graphite-containing refractories are sometimes also recycled , but often not because of their graphite: the largest-volume items, such as carbon-magnesite bricks that contain only 15%-25% graphite, usually contain too little graphite. However, some recycled carbon-magnesite brick is used as the basis for furnace repair materials, and also crushed carbon-magnesite brick is used in slag conditioners. While crucibles have a high graphite content, the volume of crucibles used and then recycled is very small.
A high-quality flake graphite product that closely resembles natural flake graphite can be made from steelmaking kish. Kish is a large-volume near-molten waste skimmed from the molten iron feed to a basic oxygen furnace, and is a mix of graphite (precipitated out of the supersaturated iron), lime-rich slag, and some iron. The iron is recycled on site, so what is left is a mixture of graphite and slag. The best recovery process uses hydraulic classification (Which utilizes a flow of water to separate minerals by specific gravity: graphite is light and settles nearly last.) to get a 70% graphite rough concentrate. Leaching this concentrate with hydrochloric acid gives a 95% graphite product with a flake size ranging from 10 mesh down.
# Media
Template:Multi-video start
Template:Multi-video item
Template:Multi-video end | https://www.wikidoc.org/index.php/Graphite | |
e4be22fb12aebdb71ecab8659db217ffa0bb730e | wikidoc | Guar gum | Guar gum
Guar gum, also called guaran, is a galactomannan. It is primarily the ground endosperm of guar beans. The guar seeds are dehusked, milled and screened to obtain the guar gum . It is typically produced as a free flowing, pale, off-white colored, coarse to fine ground powder.
# Production
Guar gum is extracted from the guar bean, where it acts as a food and water store. The guar bean is principally grown in India and Pakistan, with smaller crops grown in the U.S.A., Australia and Africa. The drought-resistant guar bean can be eaten as a green bean, fed to cattle, or used in green manure. Moreover China also started growing the crop of Guar.
# Properties
## Solubility and Viscosity
Guar gum is more soluble than locust bean gum and is a better emulsifier as it has more galactose branch points. Unlike locust bean gum, it is not self-gelling. However, either borax or calcium can cross-link guar gum, causing it to gel. In water it is nonionic and hydrocolloidal. It is not affected by ionic strength or pH, but will degrade at pH extremes at temperature (e.g. pH 3 at 50°C). It remains stable in solution over pH range 5-7. Strong acids cause hydrolysis and loss of viscosity, and alkalies in strong concentration also tend to reduce viscosity. It is insoluble in most hydrocarbon solvents.
Guar gum shows high low-shear viscosity but is strongly shear-thinning. It is very thixotropic above concentration 1%, but below 0.3% the thixotropy is slight. It has much greater low-shear viscosity than that of locust bean gum, and also generally greater than that of other hydrocolloids. Guar Gum shows viscosity synergy with xanthan gum. Guar gum and micellar casein mixtures can be slightly thixotropic if a biphase system forms.
## Thickening
Guar gum is economical because it has almost 8 times the water-thickening potency of cornstarch - only a very small quantity is needed for producing sufficient viscosity. Thus it can be used in various multi-phase formulations; as an emulsifier because it helps to prevent oil droplets from coalescing, and/or as a stabilizer because it helps to prevent solid particles from settling.
## Ice-crystal growth
Guar gum retards ice crystal growth non-specifically by slowing mass transfer across the solid/liquid interface. It shows good stability during freeze-thaw cycles.
# Grading
Manufacturers define different grades and qualities of guar gum by the particle size, the viscosity that is generated with a given concentration, and the rate at which that viscosity develops. Coarse-mesh guar gums, will typically -- but not always -- develop viscosity more slowly. They may achieve a reasonably high viscosity, but will take longer to achieve. On the other hand, they will disperse better than fine-mesh, all conditions being equal. A finer mesh, like a 200 mesh, requires more effort to dissolve .
# Industrial applications
- Textile industry – sizing, finishing and printing
- Paper industry – improved sheet formation, folding and denser surface for printing
- Explosives industry – as waterproofing agent mixed with ammonium nitrate, nitroglycerin etc.
- Pharmaceutical industry – as binder or as disintegrator in tablets
- Cosmetics and toiletries industries – thickener in toothpastes, conditioner in shampoos (usually in a chemically modified version)
- Textiles
- Oil and gas drilling, Hydraulic fracturing
- Mining
- Hydroseeding – formation of seed bearing "guar tack"
# Food applications
The largest market for guar gum is in the food industry. It is generally recognized as safe (GRAS) in the US with differing percentages set for its allowable concentration in various food applications. In Europe, guar gum has EU food additive code E412.
Applications include:
- Baked goods - increases dough yield, gives greater resiliency, and improves texture and shelf life; in pastry fillings, it prevents "weeping" (syneresis) of the water in the filling, keeping the pastry crust crisp.
- Dairy - thickens milk, yogurt, kefir, and liquid cheese products; helps maintain homogeneity and texture of ice creams and sherbets
- Meat - functions as lubricant and binder.
- Dressing and sauces - improves the stability and appearance of salad dressings, barbecue sauces, relishes, ketchups and others
- Misc. - Dry soups, sweet desserts, canned fish in sauce, and frozen food items and animal feed.
# Nutritional and medicinal effects
Guar gum is a water-soluble fiber that acts as a bulk forming laxative, and as such, it is claimed to be effective in promoting regular bowel movements and relieve constipation and chronic related functional bowel ailments; such as diverticulosis, Crohn's disease, colitis and irritable bowel syndrome, among others. The increased mass in the intestines stimulates the movement of waste and toxins from the system, which is particularly helpful for good colon health, because it speeds the removal of waste and bacteria from the bowel and colon. In addition, because it is soluble, it is also able to absorb toxic substances (bacteria) that cause infective diarrhea.
Several studies have found significant decreases in human serum cholesterol levels following guar gum ingestion. These decreases are thought to be a function of its high soluble fiber content.
Guar gum is of interest with regards to both weight loss and diabetic diets. It is a thermogenic substance. Moreover, its low digestibility lends its use in recipes as a filler, which can help to provide satiety, or slow the digestion of a meal, thus lowering the glycemic index of that meal. In the late 1980s, guar gum was used and heavily promoted in several weight loss products. The USFDA eventually recalled these due to reports of esophageal blockage from insufficient fluid intake. For this reason, guar gum is no longer approved for use in over-the-counter weight loss aids in the United States. Moreover, a meta-analysis that combined the results of 11 randomized controlled trials found that guar gum supplements were not effective in reducing body weight.
Two Japanese studies using rats showed that guar gum supports increased absorption of calcium occurring in the colon instead of in the small intestine. This means that lesser amounts of calcium may be consumed in order to obtain its recommended minimum daily intake (RDI). This has obvious implications for reduced calorie diets, since calcium rich dairy products tend to be high in calories.
However, guar gum is also capable of reducing the absorbability of dietary minerals (other than calcium), when foods and/or nutritional supplements containing them are consumed concomitantly with it. However, this is less of a concern with guar gum than with various nonsoluble dietary fibers.
Some studies have found guar gum to improve dietary glucose tolerance. Research has revealed that the water soluble fiber in it may help people with diabetes by binding with glucose in the gastrointestinal tract, thus preventing its absorption.
It also functions as an adjuvant for diabetic drugs that are sometimes employed for the treatment of noninsulin dependent diabetes. The effect is to help lower blood glucose levels. Thus, diabetic patients who are taking drugs should consult their doctors before supplementing with guar gum. | Guar gum
Guar gum, also called guaran, is a galactomannan. It is primarily the ground endosperm of guar beans. The guar seeds are dehusked, milled and screened to obtain the guar gum [1]. It is typically produced as a free flowing, pale, off-white colored, coarse to fine ground powder.
# Production
Guar gum is extracted from the guar bean, where it acts as a food and water store. The guar bean is principally grown in India and Pakistan, with smaller crops grown in the U.S.A., Australia and Africa. The drought-resistant guar bean can be eaten as a green bean, fed to cattle, or used in green manure. Moreover China also started growing the crop of Guar.
# Properties
## Solubility and Viscosity
Guar gum is more soluble than locust bean gum and is a better emulsifier as it has more galactose branch points. Unlike locust bean gum, it is not self-gelling.[2] However, either borax or calcium can cross-link guar gum, causing it to gel. In water it is nonionic and hydrocolloidal. It is not affected by ionic strength or pH, but will degrade at pH extremes at temperature (e.g. pH 3 at 50°C).[2] It remains stable in solution over pH range 5-7. Strong acids cause hydrolysis and loss of viscosity, and alkalies in strong concentration also tend to reduce viscosity. It is insoluble in most hydrocarbon solvents.
Guar gum shows high low-shear viscosity but is strongly shear-thinning. It is very thixotropic above concentration 1%, but below 0.3% the thixotropy is slight. It has much greater low-shear viscosity than that of locust bean gum, and also generally greater than that of other hydrocolloids. Guar Gum shows viscosity synergy with xanthan gum. Guar gum and micellar casein mixtures can be slightly thixotropic if a biphase system forms.[3][2]
## Thickening
Guar gum is economical because it has almost 8 times the water-thickening potency of cornstarch - only a very small quantity is needed for producing sufficient viscosity. Thus it can be used in various multi-phase formulations; as an emulsifier because it helps to prevent oil droplets from coalescing, and/or as a stabilizer because it helps to prevent solid particles from settling.
## Ice-crystal growth
Guar gum retards ice crystal growth non-specifically by slowing mass transfer across the solid/liquid interface. It shows good stability during freeze-thaw cycles.[2]
# Grading
Manufacturers define different grades and qualities of guar gum by the particle size, the viscosity that is generated with a given concentration, and the rate at which that viscosity develops. Coarse-mesh guar gums, will typically -- but not always -- develop viscosity more slowly. They may achieve a reasonably high viscosity, but will take longer to achieve. On the other hand, they will disperse better than fine-mesh, all conditions being equal. A finer mesh, like a 200 mesh, requires more effort to dissolve [4].
# Industrial applications
- Textile industry – sizing, finishing and printing
- Paper industry – improved sheet formation, folding and denser surface for printing
- Explosives industry – as waterproofing agent mixed with ammonium nitrate, nitroglycerin etc.
- Pharmaceutical industry – as binder or as disintegrator in tablets
- Cosmetics and toiletries industries – thickener in toothpastes, conditioner in shampoos (usually in a chemically modified version)
- Textiles
- Oil and gas drilling, Hydraulic fracturing
- Mining
- Hydroseeding – formation of seed bearing "guar tack"[5]
# Food applications
The largest market for guar gum is in the food industry. It is generally recognized as safe (GRAS) in the US with differing percentages set for its allowable concentration in various food applications[6]. In Europe, guar gum has EU food additive code E412.
Applications include:
- Baked goods - increases dough yield, gives greater resiliency, and improves texture and shelf life; in pastry fillings, it prevents "weeping" (syneresis) of the water in the filling, keeping the pastry crust crisp.
- Dairy - thickens milk, yogurt, kefir, and liquid cheese products; helps maintain homogeneity and texture of ice creams and sherbets
- Meat - functions as lubricant and binder.
- Dressing and sauces - improves the stability and appearance of salad dressings, barbecue sauces, relishes, ketchups and others
- Misc. - Dry soups, sweet desserts, canned fish in sauce, and frozen food items and animal feed.
# Nutritional and medicinal effects
Guar gum is a water-soluble fiber that acts as a bulk forming laxative, and as such, it is claimed to be effective in promoting regular bowel movements and relieve constipation and chronic related functional bowel ailments; such as diverticulosis, Crohn's disease, colitis and irritable bowel syndrome, among others. The increased mass in the intestines stimulates the movement of waste and toxins from the system, which is particularly helpful for good colon health, because it speeds the removal of waste and bacteria from the bowel and colon. In addition, because it is soluble, it is also able to absorb toxic substances (bacteria) that cause infective diarrhea.
Several studies have found significant decreases in human serum cholesterol levels following guar gum ingestion. These decreases are thought to be a function of its high soluble fiber content.
Guar gum is of interest with regards to both weight loss and diabetic diets. It is a thermogenic substance.[7] Moreover, its low digestibility lends its use in recipes as a filler, which can help to provide satiety, or slow the digestion of a meal, thus lowering the glycemic index of that meal. In the late 1980s, guar gum was used and heavily promoted in several weight loss products. The USFDA eventually recalled these due to reports of esophageal blockage from insufficient fluid intake. For this reason, guar gum is no longer approved for use in over-the-counter weight loss aids in the United States. Moreover, a meta-analysis that combined the results of 11 randomized controlled trials found that guar gum supplements were not effective in reducing body weight.[8]
Two Japanese studies using rats showed that guar gum supports increased absorption of calcium occurring in the colon instead of in the small intestine. This means that lesser amounts of calcium may be consumed in order to obtain its recommended minimum daily intake (RDI). This has obvious implications for reduced calorie diets, since calcium rich dairy products tend to be high in calories.
However, guar gum is also capable of reducing the absorbability of dietary minerals (other than calcium), when foods and/or nutritional supplements containing them are consumed concomitantly with it. However, this is less of a concern with guar gum than with various nonsoluble dietary fibers.
Some studies have found guar gum to improve dietary glucose tolerance. Research has revealed that the water soluble fiber in it may help people with diabetes by binding with glucose in the gastrointestinal tract, thus preventing its absorption.
It also functions as an adjuvant for diabetic drugs that are sometimes employed for the treatment of noninsulin dependent diabetes. The effect is to help lower blood glucose levels. Thus, diabetic patients who are taking drugs should consult their doctors before supplementing with guar gum.
# External links
- GUAR GUM
- Guar Gum
- Swimming in a pool of guar gum slime is as easy as water
- DINESH ENTERPRISES -EXPORTER OF GUAR GUM POWDER | https://www.wikidoc.org/index.php/Guar_Gum | |
aa6b7051d09a1a2e35f0e2d8ce3506e49c441433 | wikidoc | H-reflex | H-reflex
The H-reflex is a reflectory reaction of muscles after electrical stimulation of sensory fibers (Ia afferents stemming from muscle spindles) in their innervating nerves (for example, those located behind the knee).
H-reflex is analogous to the mechanically induced spinal stretch reflex (for example, knee jerk reflex) because both cases muscle-spindle innervating fibers are activated.
H-reflex is used to assess fitness of astronauts. H-reflex was the first medical experiment completed on the International Space Station.
# History
It was first described by Paul Hoffmann (hence the name) in 1910. | H-reflex
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
The H-reflex is a reflectory reaction of muscles after electrical stimulation of sensory fibers (Ia afferents stemming from muscle spindles) in their innervating nerves (for example, those located behind the knee).
H-reflex is analogous to the mechanically induced spinal stretch reflex (for example, knee jerk reflex) because both cases muscle-spindle innervating fibers are activated.
H-reflex is used to assess fitness of astronauts. H-reflex was the first medical experiment completed on the International Space Station.
# History
It was first described by Paul Hoffmann (hence the name) in 1910. [1] | https://www.wikidoc.org/index.php/H-reflex | |
ae1c19f02fddc3babcaadbdff2d6dc8d027ee4f7 | wikidoc | Hepcidin | Hepcidin
Hepcidin is a protein that in humans is encoded by the HAMP gene. Hepcidin is a key regulator of the entry of iron into the circulation in mammals.
During conditions in which the hepcidin level is abnormally high, such as inflammation, serum iron falls due to iron trapping within macrophages and liver cells and decreased gut iron absorption. This typically leads to anemia due to an inadequate amount of serum iron being available for developing erythrocytes. When the hepcidin level is abnormally low such as in hemochromatosis, iron overload occurs due to increased ferroportin mediated iron efflux from storage and increased gut iron absorption.
# Structure
Hepcidin exists as a preprohormone (84 amino acids), prohormone (60 amino acids), and hormone (25 amino acids). Twenty- and 22-amino acid metabolites of hepcidin also exist in the urine. Deletion of 5 N-terminal amino acids results in loss of function. The conversion of prohepcidin to hepcidin is mediated by the prohormone convertase furin. This conversion may be regulated by alpha-1 antitrypsin.
Hepcidin is a tightly folded polypeptide with 32% beta sheet character and a hairpin structure stabilized by 4 disulfide bonds. The structure of hepcidin has been determined through solution NMR. NMR studies showed a new model for hepcidin: at ambient temperatures, the protein interconverts between two conformations, which could be individually resolved by temperature variation. The solution structure of hepcidin was determined at 325 K and 253 K in supercooled water. X-ray analysis of a co-crystal with Fab revealed a structure similar to the high-temperature NMR structure.
# Function
Hepcidin is a regulator of iron metabolism. Hepcidin inhibits iron transport by binding to the iron export channel ferroportin which is located on the basolateral surface of gut enterocytes and the plasma membrane of reticuloendothelial cells (macrophages). Hepcidin ultimately breaks down the transporter protein in the lysosome. Inhibiting ferroportin prevents iron from being exported and the iron is sequestered in the cells. By inhibiting ferroportin, hepcidin prevents enterocytes from allowing iron into the hepatic portal system, thereby reducing dietary iron absorption. The iron release from macrophages is also reduced by ferroportin inhibition. Increased hepcidin activity is partially responsible for reduced iron availability seen in anemia of chronic inflammation, such as renal failure.
Any one of several mutations in hepcidin result in juvenile hemochromatosis. The majority of juvenile hemochromatosis cases are due to mutations in hemojuvelin. Mutations in TMPRSS6 can cause anemia through dysregulation of Hepcidin.
Hepcidin has strong antimicrobial activity against E.coli ML35P N.cinerea and weaker antimicrobial activity against S.epidermidis, S.aureus and Group B streptococcus bacteria. Active against the fungus C.albicans. No activity against P.aeruginosa.
# Regulation
Hepcidin synthesis and secretion by the liver is controlled by iron stores within macrophages, inflammation, hypoxia, and erythropoiesis. Macrophages communicate with the hepatocyte to regulate hepcidin release into the circulation via eight different proteins: hemojuvelin, heriditrary hemochromatosis protein, transferrin receptor 2, bone morphogenic protein 6 (BMP6), matriptase-2, neogenin, BMP receptors, and transferrin.
Erythroferrone, produced in erythroblasts, has been identified as inhibiting hepcidin and so providing more iron for hemoglobin synthesis in situations such as stress erythropoiesis.
Vitamin D has been shown to decrease hepcidin, in cell models looking at transcription and when given in big doses to human volunteers. Optimal function of hepcidin may be predicated upon the adequate presence of vitamin D in the blood.
# History
The peptide was initially named LEAP-1, for Liver-Expressed Antimicrobial Protein, when it was first described in the year 2000. Later, a peptide associated with inflammation was discovered, and named "hepcidin" after it was observed that it was produced in the liver ("hep-") and appeared to have bactericidal properties ("-cide" for "killing"). Although it is primarily synthesized in the liver, smaller amounts are synthesised in other tissues such as fat cells.
Hepcidin was first discovered in human urine and serum in 2000.
Soon after this discovery, researchers discovered that hepcidin production in mice increases in conditions of iron overload as well as in inflammation. Genetically modified mice engineered to overexpress hepcidin died shortly after birth with severe iron deficiency, again suggesting a central and not redundant role in iron regulation. The first evidence that linked hepcidin to the clinical condition known as the anemia of inflammation came from the lab of Nancy Andrews in Boston when researchers looked at tissue from two patients with liver tumors with a severe microcytic anemia that did not respond to iron supplements. The tumor tissue appeared to be overproducing hepcidin, and contained large quantities of hepcidin mRNA. Removing the tumors surgically cured the anemia.
Taken together, these discoveries suggested that hepcidin regulates the absorption of iron into the body.
# Clinical significance
There are many diseases where failure to adequately absorb iron contributes to iron deficiency and iron deficiency anaemia. The treatment will depend on the hepcidin levels that are present, as oral treatment will be unlikely to be effective if hepcidin is blocking enteral absorption, in which cases parenteral iron treatment would be appropriate. Studies have found that measuring hepcidin would be of benefit to establish optimal treatment, although as this is not widely available, C-reactive protein (CRP) is used as a surrogate marker.
β-thalassemia, one of the most common congenital anemias, arises from partial or complete lack of β-globin synthesis. Excessive iron absorption is one of the main features of β-thalassemia and can lead to severe morbidity and mortality. The serial analyses of β-thalassemic mice indicate hemoglobin levels decreases over time, while the concentration of iron in the liver, spleen, and kidneys markedly increases. The overload of iron is associated with low levels of hepcidin. Patients with β-thalassemia also have low hepcidin levels. The observations led researchers to hypothesize that more iron is absorbed in β-thalassemia than is required for erythropoiesis. Increasing expression of hepcidin in β-thalassemic mice limits iron overload, and also decreases formation of insoluble membrane-bound globins and reactive oxygen species, and improves anemia. Mice with increased hepcidin expression also demonstrated an increase in the lifespan of their red cells, reversal of ineffective erythropoiesis and splenomegaly, and an increase in total hemoglobin levels. From these data, researchers suggested that therapeutics to increase hepcidin levels or act as hepcidin agonists could help treat the abnormal iron absorption in individuals with β-thalassemia and related disorders. In later studies in mice, erythroferrone has been suggested to be the factor that is responsible for the hepcidin suppression. Correcting hepcidin and iron levels in these mice did not improve their anemia. | Hepcidin
Hepcidin is a protein that in humans is encoded by the HAMP gene. Hepcidin is a key regulator of the entry of iron into the circulation in mammals.[2]
During conditions in which the hepcidin level is abnormally high, such as inflammation, serum iron falls due to iron trapping within macrophages and liver cells and decreased gut iron absorption. This typically leads to anemia due to an inadequate amount of serum iron being available for developing erythrocytes. When the hepcidin level is abnormally low such as in hemochromatosis, iron overload occurs due to increased ferroportin mediated iron efflux from storage and increased gut iron absorption.
# Structure
Hepcidin exists as a preprohormone (84 amino acids), prohormone (60 amino acids), and hormone (25 amino acids). Twenty- and 22-amino acid metabolites of hepcidin also exist in the urine. Deletion of 5 N-terminal amino acids results in loss of function. The conversion of prohepcidin to hepcidin is mediated by the prohormone convertase furin.[3] This conversion may be regulated by alpha-1 antitrypsin.[4]
Hepcidin is a tightly folded polypeptide with 32% beta sheet character and a hairpin structure stabilized by 4 disulfide bonds. The structure of hepcidin has been determined through solution NMR.[1] NMR studies showed a new model for hepcidin: at ambient temperatures, the protein interconverts between two conformations, which could be individually resolved by temperature variation. The solution structure of hepcidin was determined at 325 K and 253 K in supercooled water. X-ray analysis of a co-crystal with Fab revealed a structure similar to the high-temperature NMR structure.[5]
# Function
Hepcidin is a regulator of iron metabolism. Hepcidin inhibits iron transport by binding to the iron export channel ferroportin which is located on the basolateral surface of gut enterocytes and the plasma membrane of reticuloendothelial cells (macrophages). Hepcidin ultimately breaks down the transporter protein in the lysosome. Inhibiting ferroportin prevents iron from being exported and the iron is sequestered in the cells.[6][7] By inhibiting ferroportin, hepcidin prevents enterocytes from allowing iron into the hepatic portal system, thereby reducing dietary iron absorption. The iron release from macrophages is also reduced by ferroportin inhibition. Increased hepcidin activity is partially responsible for reduced iron availability seen in anemia of chronic inflammation, such as renal failure.[8]
Any one of several mutations in hepcidin result in juvenile hemochromatosis. The majority of juvenile hemochromatosis cases are due to mutations in hemojuvelin.[9] Mutations in TMPRSS6 can cause anemia through dysregulation of Hepcidin.[10]
Hepcidin has strong antimicrobial activity against E.coli ML35P N.cinerea and weaker antimicrobial activity against S.epidermidis, S.aureus and Group B streptococcus bacteria. Active against the fungus C.albicans. No activity against P.aeruginosa.[11]
# Regulation
Hepcidin synthesis and secretion by the liver is controlled by iron stores within macrophages, inflammation, hypoxia, and erythropoiesis. Macrophages communicate with the hepatocyte to regulate hepcidin release into the circulation via eight different proteins: hemojuvelin, heriditrary hemochromatosis protein, transferrin receptor 2, bone morphogenic protein 6 (BMP6), matriptase-2, neogenin, BMP receptors, and transferrin.[12]
Erythroferrone, produced in erythroblasts, has been identified as inhibiting hepcidin and so providing more iron for hemoglobin synthesis in situations such as stress erythropoiesis.[13][14]
Vitamin D has been shown to decrease hepcidin, in cell models looking at transcription and when given in big doses to human volunteers. Optimal function of hepcidin may be predicated upon the adequate presence of vitamin D in the blood.[15]
# History
The peptide was initially named LEAP-1, for Liver-Expressed Antimicrobial Protein, when it was first described in the year 2000.[16] Later, a peptide associated with inflammation was discovered, and named "hepcidin" after it was observed that it was produced in the liver ("hep-") and appeared to have bactericidal properties ("-cide" for "killing").[17] Although it is primarily synthesized in the liver, smaller amounts are synthesised in other tissues such as fat cells.[18]
Hepcidin was first discovered in human urine and serum in 2000.[19]
Soon after this discovery, researchers discovered that hepcidin production in mice increases in conditions of iron overload as well as in inflammation. Genetically modified mice engineered to overexpress hepcidin died shortly after birth with severe iron deficiency, again suggesting a central and not redundant role in iron regulation. The first evidence that linked hepcidin to the clinical condition known as the anemia of inflammation came from the lab of Nancy Andrews in Boston when researchers looked at tissue from two patients with liver tumors with a severe microcytic anemia that did not respond to iron supplements. The tumor tissue appeared to be overproducing hepcidin, and contained large quantities of hepcidin mRNA. Removing the tumors surgically cured the anemia.
Taken together, these discoveries suggested that hepcidin regulates the absorption of iron into the body.
# Clinical significance
There are many diseases where failure to adequately absorb iron contributes to iron deficiency and iron deficiency anaemia. The treatment will depend on the hepcidin levels that are present, as oral treatment will be unlikely to be effective if hepcidin is blocking enteral absorption, in which cases parenteral iron treatment would be appropriate. Studies have found that measuring hepcidin would be of benefit to establish optimal treatment,[20] although as this is not widely available, C-reactive protein (CRP) is used as a surrogate marker.
β-thalassemia, one of the most common congenital anemias, arises from partial or complete lack of β-globin synthesis. Excessive iron absorption is one of the main features of β-thalassemia and can lead to severe morbidity and mortality. The serial analyses of β-thalassemic mice indicate hemoglobin levels decreases over time, while the concentration of iron in the liver, spleen, and kidneys markedly increases. The overload of iron is associated with low levels of hepcidin. Patients with β-thalassemia also have low hepcidin levels. The observations led researchers to hypothesize that more iron is absorbed in β-thalassemia than is required for erythropoiesis. Increasing expression of hepcidin in β-thalassemic mice limits iron overload, and also decreases formation of insoluble membrane-bound globins and reactive oxygen species, and improves anemia.[21] Mice with increased hepcidin expression also demonstrated an increase in the lifespan of their red cells, reversal of ineffective erythropoiesis and splenomegaly, and an increase in total hemoglobin levels. From these data, researchers suggested that therapeutics to increase hepcidin levels or act as hepcidin agonists could help treat the abnormal iron absorption in individuals with β-thalassemia and related disorders.[22] In later studies in mice,[23] erythroferrone has been suggested to be the factor that is responsible for the hepcidin suppression. Correcting hepcidin and iron levels in these mice did not improve their anemia. | https://www.wikidoc.org/index.php/HAMP | |
6bf4533964250d6b22146f0dab062d49da6c7d0c | wikidoc | HIST1H1C | HIST1H1C
Histone H1.2 is a protein that in humans is encoded by the HIST1H1C gene.
Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6.
Apart from its roles in the nucleus, histone H1.2 also participates in apoptosis. In response to apoptotic stimuli, mainly DNA damage, it is translocated from the nucleus to the cytosol. There, it activates Bak, a pro-apoptotic protein bound to the mithochondria outer membrane (MOM). Activation of Bak causes the perforation of the mitochondria, a process known as MOMP (mitochondria outer membrane permeabilization) which promotes apoptosis. Histone H1.2 also forms a complex with the apoptosome, possibly regulating its formation. | HIST1H1C
Histone H1.2 is a protein that in humans is encoded by the HIST1H1C gene.[1][2][3]
Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6.[3]
Apart from its roles in the nucleus, histone H1.2 also participates in apoptosis. In response to apoptotic stimuli, mainly DNA damage, it is translocated from the nucleus to the cytosol. There, it activates Bak, a pro-apoptotic protein bound to the mithochondria outer membrane (MOM). Activation of Bak causes the perforation of the mitochondria, a process known as MOMP (mitochondria outer membrane permeabilization) which promotes apoptosis. Histone H1.2 also forms a complex with the apoptosome, possibly regulating its formation. | https://www.wikidoc.org/index.php/HIST1H1C | |
8cfe6b9363fa6e9e160b19963ba561fc1125527b | wikidoc | HIST1H3C | HIST1H3C
Histone H3.1 is a protein that in humans is encoded by the HIST1H3C gene.
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes, and functions in the compaction of chromatin into higher order structures.
This gene is intronless, and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails, instead containing a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. | HIST1H3C
Histone H3.1 is a protein that in humans is encoded by the HIST1H3C gene.[1][2][3][4]
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes, and functions in the compaction of chromatin into higher order structures.
This gene is intronless, and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails, instead containing a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6.[4] | https://www.wikidoc.org/index.php/HIST1H3C | |
5084bacce63abdcf91ec59144a4738a0e969e95a | wikidoc | HIV test | HIV test
HIV tests are used to detect the presence of the human immunodeficiency virus in serum, saliva, or urine. Such tests may detect HIV antibodies, antigens, or RNA.
# Terminology
The window period is the time from infection until a test can detect any change. The average window period with antibody tests is 22 days. Antigen testing cuts the window period to approximately 16 days and NAT (Nucleic Acid Testing) further reduces this period to 12 days.
Performance of medical tests is often described in terms of:
- sensitivity: The percentage of the results that will be positive when HIV is present
- specificity: The percentage of the results that will be negative when HIV is not present.
All diagnostic tests have limitations, and sometimes their use may produce erroneous or questionable results.
- False positive results are when the test concludes HIV is present when, in fact, the person is not infected.
- False negative results are when the test concludes HIV is not present, when in fact the person is infected.
Nonspecific reactions, hypergammaglobulinemia, or the presence of antibodies directed to other infectious agents that may be antigenically similar to HIV can produce false positive results. Autoimmune diseases, such as systemic lupus erythematosus, can also cause false positive results.
# Principles
## Screening donor blood and cellular products
Tests selected to screen donor blood and tissue must provide a high degree of confidence that HIV is not present (that is, a high sensitivity). A combination of antibody, antigen and nucleic acid tests are used by blood banks in Western countries. The World Health Organization estimated that, as of 2000, inadequate blood screening had resulted in 1 million new HIV infections worldwide.
In the USA, most blood donations are screened with an ELISA test for HIV-1 and HIV-2, as well as a nucleic acid test. These diagnostic tests are combined with careful donor selection. As of 2001, the risk of transfusion-acquired HIV in the U.S. was approximately one in 2.5 million for each transfusion.
## Diagnosis of HIV infection
Tests used for the diagnosis of HIV infection in a particular person require a high degree of both sensitivity and specificity. In the United States, this is achieved using an algorithm combining two tests for HIV antibodies. If antibodies are detected by an initial test based on the ELISA method, then a second test using the Western blot procedure determines the size of the antigens in the test kit binding to the antibodies. The combination of these two methods is highly accurate (see below).
## Human rights
The UNAIDS/WHO policy statement on HIV Testing states that conditions under which people undergo HIV testing must be anchored in a human rights approach that pays due respect to ethical principles. According to these principles, the conduct of HIV testing of individuals must be
- Confidential;
- Accompanied by counseling (for those who test positive);
- Conducted with the informed consent of the person being tested.
# Antibody tests
HIV antibody tests are specifically designed for routine diagnostic testing of adults; these tests are inexpensive and extremely accurate.
## Window period
Antibody tests may give false negative results during the window period, an interval of three weeks to six months between the time of HIV infection and the production of measurable antibodies to HIV (so-called seroconversion). Most people develop detectable antibodies approximately 30 days after infection, although some seroconvert later. The vast majority of people (99%) have detectable antibodies by three months after HIV infection; a six-month window is extremely rare with modern antibody testing. During the window period, an infected person can transmit HIV to others although their HIV infection may not be detectable with an antibody test. Antiretroviral therapy during the window period can delay the formation of antibodies and extend the window period beyond 12 months. Antibody tests may also yield false negative results in patients with X-linked agammaglobulinemia; other diagnostic tests should be used in such patients.
Three instances of delayed HIV seroconversion occurring in Health-care workers have been reported; in these instances, the Health-care workers tested negative for HIV antibodies greater than 6 months postexposure but were seropositive within 12 months after the exposure. DNA sequencing confirmed the source of infection in one instance. Two of the delayed seroconversions were associated with simultaneous exposure to hepatitis C virus (HCV). In one case, co-infection was associated with a rapidly fatal HCV disease course; however, it is not known whether HCV directly influences the risk for or course of HIV infection or is a marker for other exposure-related factors.
## ELISA
The ELISA test, or the enzyme immunoassay (EIA), was the first screening test commonly employed for HIV. It has a high sensitivity.
In an ELISA test, a person's serum is diluted 400-fold and applied to a plate to which HIV antigens have been attached. If antibodies to HIV are present in the serum, they may bind to these HIV antigens. The plate is then washed to remove all other components of the serum. A specially prepared "secondary antibody" — an antibody that binds to human antibodies — is then applied to the plate, followed by another wash. This secondary antibody is chemically linked in advance to an enzyme. Thus the plate will contain enzyme in proportion to the amount of secondary antibody bound to the plate. A substrate for the enzyme is applied, and catalysis by the enzyme leads to a change in color or fluorescence. ELISA results are reported as a number; the most controversial aspect of this test is determining the "cut-off" point between a positive and negative result.
## Western blot
In the Western blot procedure, cells that may be HIV-infected are opened and the proteins within are placed into a slab of gel, to which an electrical current is applied. Different proteins will move with different velocities in this field, depending on their size, while their electrical charge is leveled by a surfactant called sodium lauryl sulfate. Once the proteins are well-separated, they are transferred to a membrane and the procedure continues similar to an ELISA: the person's diluted serum is applied to the membrane and antibodies in the serum may attach to some of the HIV proteins. Antibodies which do not attach are washed away, and enzyme-linked antibodies with the capability to attach to the person's antibodies determine to which HIV proteins the person has antibodies.
There are no universal criteria for interpreting the Western blot test: the number of viral bands which must be present may vary. If no viral bands are detected, the result is negative. If at least one viral band for each of the GAG, POL, and ENV gene-product groups are present, the result is positive. The three-gene-product approach to Western blot interpretation has not been adopted for public health or clinical practice. Tests in which less than the required number of viral bands are detected are reported as indeterminate: a person who has an indeterminate result should be retested, as later tests may be more conclusive. Almost all HIV-infected persons with indeterminate Western-Blot results will develop a positive result when tested in one month; persistently indeterminate results over a period of six months suggests the results are not due to HIV infection. In a generally healthy low-risk population, indeterminate results on Western blot occur on the order of 1 in 5,000 patients.
## Rapid or point-of-care tests
Rapid Antibody Tests are qualitative immunoassays intended for use as a point-of-care test to aid in the diagnosis of HIV infection. These tests should be used in conjunction with the clinical status, history, and risk factors of the person being tested. The specificity of Rapid Antibody Tests in low-risk populations has not been evaluated. These tests should be used in appropriate multi-test algorithms designed for statistical validation of rapid HIV test results.
If no antibodies to HIV are detected, this does not mean the person has not been infected with HIV. It may take several months after HIV infection for the antibody response to reach detectable levels, during which time rapid testing for antibodies to HIV will not be indicative of true infection status. A comprehensive risk history and clinical judgement should be considered before concluding that an individual is not infected with HIV.
OraQuick is an antibody test that provides results in 20 minutes. The blood, plasma or oral fluid is mixed in a vial with developing solution, and the results are read from a sticklike testing device.
Orasure is an HIV test which uses mucosal transudate from the tissues of cheeks and gums. It is an antibody test which first employs ELISA, then Western Blot.
There is also a urine test; it employs both the ELISA and the Western Blot method.
Home Access Express HIV-1 Test is a FDA-approved home test: the patient collects a drop of blood and mails the sample to a laboratory; results and counseling are obtained over the phone.
There have been a number of cases of fraudulent tests being sold via mail order or the Internet to the general public. In 1997, a California man was indicted on mail fraud and wire charges for selling supposed home test kits. In 2004, the US Federal Trade Commission asked Federal Express and US Customs to confiscate shipments of the Discreet home HIV test kits, produced by Gregory Stephen Wong of Vancouver, BC. In February 2005, the US FDA issued a warning against using the rapid HIV test kits and other home use kits marketed by Globus Media of Montreal Canada.
## Interpreting antibody tests
ELISA testing alone cannot be used to diagnose HIV, even if the test suggests a high probability that antibody to HIV-1 is present. In the United States, such ELISA results are not reported as "positive" unless confirmed by a Western Blot.
The ELISA antibody tests were developed to provide a high level of confidence that donated blood was NOT infected with HIV. It is therefore not possible to conclude that blood rejected for transfusion because of a positive ELISA antibody test is in fact infected with HIV. Sometimes, retesting the donor in several months will produce a negative ELISA antibody test. This is why a confirmatory Western Blot is always used before reporting a "positive" HIV test result.
False positive results due to factors unrelated to exposure to HIV are found more often with the ELISA test than with the Western Blot. False positives can be caused by antibodies to viruses other than HIV, antibodies produced by pregnancy, and other medical conditions such as recent acute illnesses, influenza vaccinations and allergies. A false positive result does not indicate a condition of significant risk to health. When the ELISA test is combined with Western Blot, the rate of false positives is extremely low, and diagnostic accuracy is very high (see below).
## Accuracy of HIV testing
The evidence regarding the risks and benefits of HIV screening was reviewed in July 2005 by the U.S. Preventive Services Task Force. The authors concluded that:
...the use of repeatedly reactive enzyme immunoassay followed by confirmatory Western blot or immunofluorescent assay remains the standard method for diagnosing HIV-1 infection. A large study of HIV testing in 752 U.S. laboratories reported a sensitivity of 99.7% and specificity of 98.5% for enzyme immunoassay, and studies in U.S. blood donors reported specificities of 99.8% and greater than 99.99%. With confirmatory Western blot, the chance of a false-positive identification in a low-prevalence setting is about 1 in 250 000 (95% CI, 1 in 173 000 to 1 in 379 000).
Other studies have confirmed the accuracy of current methods of HIV testing in the United States, reporting false-positive rates of 0.0004% to 0.0007% and false-negative rates of 0.003% in the general population.
# Antigen tests
The p24 antigen test detects the presence of the p24 protein of HIV (also known as CA), a major core protein of the virus. Monoclonal antibodies specific to the p24 protein are mixed with the person's blood. Any p24 protein in the person's blood will stick to the monoclonal antibody and enzyme-linked antibody to the monoclonal antibodies to p24 causes a color change if p24 was present in the sample.
This test is no longer used routinely in the US or the EU to screen blood donations since the objective was to reduce the risk of false negatives in the window period. Nucleic acid testing (NAT) is more effective for this purpose, and p24 antigen testing is no longer indicated if a NAT test is performed. The p24 antigen test is not useful for general diagnostics, as it has very low sensitivity and only works during a certain time period after infection before the body produces antibodies to the p24 protein.
# Nucleic acid based tests (NAT)
Nucleic-acid-based tests amplify and detect a 142-base target sequence located in a highly conserved region of the HIV gag gene . Since 2001, donated blood in the United States has been screened with nucleic-acid-based tests, shortening the window period between infection and detectability of disease to about 12 days. Since these tests are relatively expensive, the blood is screened by first pooling some 10-20 samples and testing these together; if the pool tests positive, each sample is retested individually. A different version of this test is intended for use in conjunction with clinical presentation and other laboratory markers of disease progress for the management of HIV-1-infected patients.
In the RT-PCR test, viral RNA is extracted from the patient's plasma and is treated with reverse transcriptase so that the RNA of the virus is transcribed into DNA. The polymerase chain reaction (PCR) is then applied, using two primers thought to be unique to the virus's genome. After the PCR amplification process is complete, the resulting amplified segments bind to specific oligonucleotides bound to the vessel wall and are then made visible with a probe bound to an enzyme. The amount of virus in the sample can be quantified with sufficient accuracy to detect three-fold changes.
In the Quantiplex bDNA or branched DNA test, plasma is centrifugated to concentrate the virus, which is then opened to release its RNA. Special oligonucleotides are added which bind to viral RNA and to certain oligonucleotides bound to the wall of the vessel. In this way, viral RNA is fastened to the wall. Then new oligonucleotides are added which bind at several locations to this RNA; and other oligonucelotides which bind at several locations to those oligonucleotides. This is done to amplify the signal. Finally, oligonucleotides that bind to the last set of oligonucleotides and that are bound to an enzyme are added; the enzyme action causes a color reaction which allows quantification of the viral RNA in the original sample. Monitoring the effects of antiretroviral therapy by serial measurements of plasma HIV-1 RNA with this test has been validated for patients with viral loads greater than 25,000 copies per milliliter.
# Other tests used in HIV/AIDS treatment
The CD4 T-cell count is not an HIV test, but rather a procedure where the number of CD4 T-cells in the blood is determined.
A CD4 count does not check for the presence of HIV. It is used monitor immune system function in HIV-positive people. Declining CD4 T-cell counts are considered to be a marker of progression of HIV infection. In HIV-positive people, AIDS is officially diagnosed when the count drops below 200 cells/μL or when certain opportunistic infections occur. This use of a CD4 count as an AIDS criterion was introduced in 1992; the value of 200 was chosen because it corresponded with a greatly increased likelihood of opportunistic infection. Lower CD4 counts in people with AIDS are indicators that prophylaxis against certain types of opportunistic infections should be instituted.
Low CD4 T-cell counts are associated with a variety of conditions, including many viral infections, bacterial infections, parasitic infections, sepsis, tuberculosis, coccidioidomycosis, burns, trauma, intravenous injections of foreign proteins, malnutrition, over-exercising, pregnancy, normal daily variation, psychological stress, and social isolation.
This test is also used occasionally to estimate immune system function for people whose CD4 T cells are impaired for reasons other than HIV infection, which include several blood diseases, several genetic disorders, and the side effects of many chemotherapy drugs.
Generally speaking, the lower the number of T cells, the lower the immune system's function will be. Normal CD4 counts are between 500 and 1500 CD4+ T cells/microliter, and the counts may fluctuate in healthy people depending on recent infection status, nutrition, exercise and other factors. Women tend to have somewhat lower counts than men.
# Criticisms of HIV tests
HIV tests have been criticized by a number of AIDS dissidents (people who reject the scientific consensus that HIV causes AIDS), including the Perth Group of scientists (led by Eleni Papadopulos-Eleopulos) who question the very existence of HIV. Their arguments rest on issues of specificity, standardisation, reproducibility, and validation.
According to scientific consensus, the accuracy of serologic testing has been verified by isolation and culture of HIV and by detection of HIV RNA by PCR, which are widely accepted "gold standards" in microbiology. While the AIDS dissidents focus on individual components of HIV testing, it is generally believed that the combination of ELISA and Western Blot used for the diagnosis of HIV is remarkably accurate, with very low false-positive and -negative rates as described above. The vast majority of scientists believe that the views of AIDS dissidents are based on highly selective analysis of mostly outdated scientific papers; there is broad scientific consensus that HIV is the cause of AIDS. | HIV test
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [2]
HIV tests are used to detect the presence of the human immunodeficiency virus in serum, saliva, or urine. Such tests may detect HIV antibodies, antigens, or RNA.
# Terminology
The window period is the time from infection until a test can detect any change. The average window period with antibody tests is 22 days. Antigen testing cuts the window period to approximately 16 days and NAT (Nucleic Acid Testing) further reduces this period to 12 days.[3]
Performance of medical tests is often described in terms of:
- sensitivity: The percentage of the results that will be positive when HIV is present
- specificity: The percentage of the results that will be negative when HIV is not present.
All diagnostic tests have limitations, and sometimes their use may produce erroneous or questionable results.
- False positive results are when the test concludes HIV is present when, in fact, the person is not infected.
- False negative results are when the test concludes HIV is not present, when in fact the person is infected.
Nonspecific reactions, hypergammaglobulinemia, or the presence of antibodies directed to other infectious agents that may be antigenically similar to HIV can produce false positive results. Autoimmune diseases, such as systemic lupus erythematosus, can also cause false positive results.
# Principles
## Screening donor blood and cellular products
Tests selected to screen donor blood and tissue must provide a high degree of confidence that HIV is not present (that is, a high sensitivity). A combination of antibody, antigen and nucleic acid tests are used by blood banks in Western countries. The World Health Organization estimated that, as of 2000, inadequate blood screening had resulted in 1 million new HIV infections worldwide.
In the USA, most blood donations are screened with an ELISA test for HIV-1 and HIV-2, as well as a nucleic acid test. These diagnostic tests are combined with careful donor selection. As of 2001, the risk of transfusion-acquired HIV in the U.S. was approximately one in 2.5 million for each transfusion.[1]
## Diagnosis of HIV infection
Tests used for the diagnosis of HIV infection in a particular person require a high degree of both sensitivity and specificity. In the United States, this is achieved using an algorithm combining two tests for HIV antibodies. If antibodies are detected by an initial test based on the ELISA method, then a second test using the Western blot procedure determines the size of the antigens in the test kit binding to the antibodies. The combination of these two methods is highly accurate (see below).
## Human rights
The UNAIDS/WHO policy statement on HIV Testing states that conditions under which people undergo HIV testing must be anchored in a human rights approach that pays due respect to ethical principles.[2] According to these principles, the conduct of HIV testing of individuals must be
- Confidential;
- Accompanied by counseling (for those who test positive);
- Conducted with the informed consent of the person being tested.
# Antibody tests
HIV antibody tests are specifically designed for routine diagnostic testing of adults; these tests are inexpensive and extremely accurate.
## Window period
Antibody tests may give false negative results during the window period, an interval of three weeks to six months between the time of HIV infection and the production of measurable antibodies to HIV (so-called seroconversion). Most people develop detectable antibodies approximately 30 days after infection, although some seroconvert later. The vast majority of people (99%) have detectable antibodies by three months after HIV infection; a six-month window is extremely rare with modern antibody testing.[3] During the window period, an infected person can transmit HIV to others although their HIV infection may not be detectable with an antibody test. Antiretroviral therapy during the window period can delay the formation of antibodies and extend the window period beyond 12 months.[4] Antibody tests may also yield false negative results in patients with X-linked agammaglobulinemia; other diagnostic tests should be used in such patients.
Three instances of delayed HIV seroconversion occurring in Health-care workers have been reported;[5] in these instances, the Health-care workers[6] tested negative for HIV antibodies greater than 6 months postexposure but were seropositive within 12 months after the exposure.[7] DNA sequencing confirmed the source of infection in one instance. Two of the delayed seroconversions were associated with simultaneous exposure to hepatitis C virus (HCV). In one case, co-infection was associated with a rapidly fatal HCV disease course; however, it is not known whether HCV directly influences the risk for or course of HIV infection or is a marker for other exposure-related factors.
## ELISA
The ELISA test, or the enzyme immunoassay (EIA), was the first screening test commonly employed for HIV. It has a high sensitivity.
In an ELISA test, a person's serum is diluted 400-fold and applied to a plate to which HIV antigens have been attached. If antibodies to HIV are present in the serum, they may bind to these HIV antigens. The plate is then washed to remove all other components of the serum. A specially prepared "secondary antibody" — an antibody that binds to human antibodies — is then applied to the plate, followed by another wash. This secondary antibody is chemically linked in advance to an enzyme. Thus the plate will contain enzyme in proportion to the amount of secondary antibody bound to the plate. A substrate for the enzyme is applied, and catalysis by the enzyme leads to a change in color or fluorescence. ELISA results are reported as a number; the most controversial aspect of this test is determining the "cut-off" point between a positive and negative result.
## Western blot
In the Western blot procedure, cells that may be HIV-infected are opened and the proteins within are placed into a slab of gel, to which an electrical current is applied. Different proteins will move with different velocities in this field, depending on their size, while their electrical charge is leveled by a surfactant called sodium lauryl sulfate. Once the proteins are well-separated, they are transferred to a membrane and the procedure continues similar to an ELISA: the person's diluted serum is applied to the membrane and antibodies in the serum may attach to some of the HIV proteins. Antibodies which do not attach are washed away, and enzyme-linked antibodies with the capability to attach to the person's antibodies determine to which HIV proteins the person has antibodies.
There are no universal criteria for interpreting the Western blot test: the number of viral bands which must be present may vary. If no viral bands are detected, the result is negative. If at least one viral band for each of the GAG, POL, and ENV gene-product groups are present, the result is positive. The three-gene-product approach to Western blot interpretation has not been adopted for public health or clinical practice. Tests in which less than the required number of viral bands are detected are reported as indeterminate: a person who has an indeterminate result should be retested, as later tests may be more conclusive. Almost all HIV-infected persons with indeterminate Western-Blot results will develop a positive result when tested in one month; persistently indeterminate results over a period of six months suggests the results are not due to HIV infection. In a generally healthy low-risk population, indeterminate results on Western blot occur on the order of 1 in 5,000 patients.[8]
## Rapid or point-of-care tests
Rapid Antibody Tests are qualitative immunoassays intended for use as a point-of-care test to aid in the diagnosis of HIV infection. These tests should be used in conjunction with the clinical status, history, and risk factors of the person being tested. The specificity of Rapid Antibody Tests in low-risk populations has not been evaluated. These tests should be used in appropriate multi-test algorithms designed for statistical validation of rapid HIV test results.
If no antibodies to HIV are detected, this does not mean the person has not been infected with HIV. It may take several months after HIV infection for the antibody response to reach detectable levels, during which time rapid testing for antibodies to HIV will not be indicative of true infection status. A comprehensive risk history and clinical judgement should be considered before concluding that an individual is not infected with HIV.
OraQuick is an antibody test that provides results in 20 minutes. The blood, plasma or oral fluid is mixed in a vial with developing solution, and the results are read from a sticklike testing device.
Orasure is an HIV test which uses mucosal transudate from the tissues of cheeks and gums. It is an antibody test which first employs ELISA, then Western Blot.
There is also a urine test; it employs both the ELISA and the Western Blot method.
Home Access Express HIV-1 Test is a FDA-approved home test: the patient collects a drop of blood and mails the sample to a laboratory; results and counseling are obtained over the phone.
There have been a number of cases of fraudulent tests being sold via mail order or the Internet to the general public. In 1997, a California man was indicted on mail fraud and wire charges for selling supposed home test kits. In 2004, the US Federal Trade Commission asked Federal Express and US Customs to confiscate shipments of the Discreet home HIV test kits, produced by Gregory Stephen Wong of Vancouver, BC. In February 2005, the US FDA issued a warning against using the rapid HIV test kits and other home use kits marketed by Globus Media of Montreal Canada.
## Interpreting antibody tests
ELISA testing alone cannot be used to diagnose HIV, even if the test suggests a high probability that antibody to HIV-1 is present. In the United States, such ELISA results are not reported as "positive" unless confirmed by a Western Blot.
The ELISA antibody tests were developed to provide a high level of confidence that donated blood was NOT infected with HIV. It is therefore not possible to conclude that blood rejected for transfusion because of a positive ELISA antibody test is in fact infected with HIV. Sometimes, retesting the donor in several months will produce a negative ELISA antibody test. This is why a confirmatory Western Blot is always used before reporting a "positive" HIV test result.
False positive results due to factors unrelated to exposure to HIV are found more often with the ELISA test than with the Western Blot. False positives can be caused by antibodies to viruses other than HIV, antibodies produced by pregnancy, and other medical conditions such as recent acute illnesses, influenza vaccinations and allergies[9]. A false positive result does not indicate a condition of significant risk to health. When the ELISA test is combined with Western Blot, the rate of false positives is extremely low, and diagnostic accuracy is very high (see below).
## Accuracy of HIV testing
The evidence regarding the risks and benefits of HIV screening was reviewed in July 2005 by the U.S. Preventive Services Task Force.[10] The authors concluded that:
...the use of repeatedly reactive enzyme immunoassay followed by confirmatory Western blot or immunofluorescent assay remains the standard method for diagnosing HIV-1 infection. A large study of HIV testing in 752 U.S. laboratories reported a sensitivity of 99.7% and specificity of 98.5% for enzyme immunoassay, and studies in U.S. blood donors reported specificities of 99.8% and greater than 99.99%. With confirmatory Western blot, the chance of a false-positive identification in a low-prevalence setting is about 1 in 250 000 (95% CI, 1 in 173 000 to 1 in 379 000).
Other studies have confirmed the accuracy of current methods of HIV testing in the United States, reporting false-positive rates of 0.0004% to 0.0007% and false-negative rates of 0.003% in the general population.[11][12][13][14][15][16][17][18]
# Antigen tests
The p24 antigen test detects the presence of the p24 protein of HIV (also known as CA), a major core protein of the virus. Monoclonal antibodies specific to the p24 protein are mixed with the person's blood. Any p24 protein in the person's blood will stick to the monoclonal antibody and enzyme-linked antibody to the monoclonal antibodies to p24 causes a color change if p24 was present in the sample.
This test is no longer used routinely in the US[4] or the EU [5] to screen blood donations since the objective was to reduce the risk of false negatives in the window period. Nucleic acid testing (NAT) is more effective for this purpose, and p24 antigen testing is no longer indicated if a NAT test is performed. The p24 antigen test is not useful for general diagnostics, as it has very low sensitivity and only works during a certain time period after infection before the body produces antibodies to the p24 protein.
# Nucleic acid based tests (NAT)
Nucleic-acid-based tests amplify and detect a 142-base target sequence located in a highly conserved region of the HIV gag gene . Since 2001, donated blood in the United States has been screened with nucleic-acid-based tests, shortening the window period between infection and detectability of disease to about 12 days. Since these tests are relatively expensive, the blood is screened by first pooling some 10-20 samples and testing these together; if the pool tests positive, each sample is retested individually. A different version of this test is intended for use in conjunction with clinical presentation and other laboratory markers of disease progress for the management of HIV-1-infected patients.
In the RT-PCR test, viral RNA is extracted from the patient's plasma and is treated with reverse transcriptase so that the RNA of the virus is transcribed into DNA. The polymerase chain reaction (PCR) is then applied, using two primers thought to be unique to the virus's genome. After the PCR amplification process is complete, the resulting amplified segments bind to specific oligonucleotides bound to the vessel wall and are then made visible with a probe bound to an enzyme. The amount of virus in the sample can be quantified with sufficient accuracy to detect three-fold changes.
In the Quantiplex bDNA or branched DNA test, plasma is centrifugated to concentrate the virus, which is then opened to release its RNA. Special oligonucleotides are added which bind to viral RNA and to certain oligonucleotides bound to the wall of the vessel. In this way, viral RNA is fastened to the wall. Then new oligonucleotides are added which bind at several locations to this RNA; and other oligonucelotides which bind at several locations to those oligonucleotides. This is done to amplify the signal. Finally, oligonucleotides that bind to the last set of oligonucleotides and that are bound to an enzyme are added; the enzyme action causes a color reaction which allows quantification of the viral RNA in the original sample. Monitoring the effects of antiretroviral therapy by serial measurements of plasma HIV-1 RNA with this test has been validated for patients with viral loads greater than 25,000 copies per milliliter.[19]
# Other tests used in HIV/AIDS treatment
The CD4 T-cell count is not an HIV test, but rather a procedure where the number of CD4 T-cells in the blood is determined.
A CD4 count does not check for the presence of HIV. It is used monitor immune system function in HIV-positive people. Declining CD4 T-cell counts are considered to be a marker of progression of HIV infection. In HIV-positive people, AIDS is officially diagnosed when the count drops below 200 cells/μL or when certain opportunistic infections occur. This use of a CD4 count as an AIDS criterion was introduced in 1992; the value of 200 was chosen because it corresponded with a greatly increased likelihood of opportunistic infection. Lower CD4 counts in people with AIDS are indicators that prophylaxis against certain types of opportunistic infections should be instituted.
Low CD4 T-cell counts are associated with a variety of conditions, including many viral infections, bacterial infections, parasitic infections, sepsis, tuberculosis, coccidioidomycosis, burns, trauma, intravenous injections of foreign proteins, malnutrition, over-exercising, pregnancy, normal daily variation, psychological stress, and social isolation.
This test is also used occasionally to estimate immune system function for people whose CD4 T cells are impaired for reasons other than HIV infection, which include several blood diseases, several genetic disorders, and the side effects of many chemotherapy drugs.
Generally speaking, the lower the number of T cells, the lower the immune system's function will be. Normal CD4 counts are between 500 and 1500 CD4+ T cells/microliter, and the counts may fluctuate in healthy people depending on recent infection status, nutrition, exercise and other factors. Women tend to have somewhat lower counts than men.
# Criticisms of HIV tests
HIV tests have been criticized by a number of AIDS dissidents (people who reject the scientific consensus that HIV causes AIDS), including the Perth Group of scientists (led by Eleni Papadopulos-Eleopulos) who question the very existence of HIV. Their arguments rest on issues of specificity, standardisation, reproducibility, and validation.[20]
According to scientific consensus, the accuracy of serologic testing has been verified by isolation and culture of HIV and by detection of HIV RNA by PCR, which are widely accepted "gold standards" in microbiology.[21][22] While the AIDS dissidents focus on individual components of HIV testing, it is generally believed that the combination of ELISA and Western Blot used for the diagnosis of HIV is remarkably accurate, with very low false-positive and -negative rates as described above. The vast majority of scientists believe that the views of AIDS dissidents are based on highly selective analysis of mostly outdated scientific papers; there is broad scientific consensus that HIV is the cause of AIDS.[23][24][25] | https://www.wikidoc.org/index.php/HIV_test | |
7bed367efd2c2f627f91c46e825bbaeeedc91fcb | wikidoc | HLA-DQB1 | HLA-DQB1
Major histocompatibility complex, class II, DQ beta 1, also known as HLA-DQB1, is a human gene and also denotes the genetic locus that contains this gene. The protein encoded by this gene is one of two proteins that are required to form the DQ heterodimer, a cell surface receptor essential to the function of the immune system.
# Function
HLA-DQB1 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen-presenting cells (APC: B lymphocytes, dendritic cells, macrophages).
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa and it contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular protein domains, exon 4 encodes the transmembrane domain, and exon 5 encodes the cytoplasmic tail. Within the DQ molecule, both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation.
# Disease association
## Diabetes
Several alleles of HLA-DQB1 are associated with an increased risk of developing type 1 diabetes. The locus also has the genetic name IDDM1 as it is the highest genetic risk for type 1 diabetes. Again the DQB1*0201 and DQB1*0302 alleles, particularly the phenotype DQB1*0201/*0302 has a high risk of late onset type 1 diabetes. The risk is partially shared with the HLA-DR locus (DR3 and DR4 serotypes).
## Celiac disease
Celiac1 is a genetic name for DQB1, the HLA DQB1*0201, *0202, and *0302 encode genes that mediate the autoimmune coeliac disease. Homozygotes of DQB1*0201 have a higher risk of developing the celiac disease, relative to any other genetic locus.
## Multiple sclerosis
Certain HLA-DQB1 alleles are also linked to a modest increased risk of multiple sclerosis.
## Narcolepsy
Other HLA-DQB1 alleles are associated with a predisposition to narcolepsy, specifically HLA-DQB1*0602, which is carried by over 90% of patients with narcolepsy-cataplexy.
# Alleles | HLA-DQB1
Major histocompatibility complex, class II, DQ beta 1, also known as HLA-DQB1, is a human gene and also denotes the genetic locus that contains this gene.[1] The protein encoded by this gene is one of two proteins that are required to form the DQ heterodimer, a cell surface receptor essential to the function of the immune system.
# Function
HLA-DQB1 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen-presenting cells (APC: B lymphocytes, dendritic cells, macrophages).[1]
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa and it contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular protein domains, exon 4 encodes the transmembrane domain, and exon 5 encodes the cytoplasmic tail. Within the DQ molecule, both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation.[1][2]
# Disease association
## Diabetes
Several alleles of HLA-DQB1 are associated with an increased risk of developing type 1 diabetes.[3][4][5] The locus also has the genetic name IDDM1 as it is the highest genetic risk for type 1 diabetes. Again the DQB1*0201 and DQB1*0302 alleles, particularly the phenotype DQB1*0201/*0302 has a high risk of late onset type 1 diabetes. The risk is partially shared with the HLA-DR locus (DR3 and DR4 serotypes).
## Celiac disease
Celiac1 is a genetic name for DQB1, the HLA DQB1*0201, *0202, and *0302 encode genes that mediate the autoimmune coeliac disease. Homozygotes of DQB1*0201 have a higher risk of developing the celiac disease, relative to any other genetic locus.[6]
## Multiple sclerosis
Certain HLA-DQB1 alleles are also linked to a modest increased risk of multiple sclerosis.[7][8]
## Narcolepsy
Other HLA-DQB1 alleles are associated with a predisposition to narcolepsy,[9] specifically HLA-DQB1*0602, which is carried by over 90% of patients with narcolepsy-cataplexy.[10]
# Alleles | https://www.wikidoc.org/index.php/HLA-DQB1 | |
7386328db58e689cc257bc202fc8d7092c3811bd | wikidoc | HLA-DRB1 | HLA-DRB1
HLA class II histocompatibility antigen, DRB1 beta chain is a protein that in humans is encoded by the HLA-DRB1 gene. DRB1 encodes the most prevalent beta subunit of HLA-DR. Several alleles of DRB1 (shared epitope alleles) are associated with an increased incidence of rheumatoid arthritis.
# Function
The protein encoded by this gene belongs to the HLA class II beta chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins to T helper cells. Class II molecules are constitutively expressed in professional antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages), and could be induced in non-professional APCs.
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa. It is encoded by 6 exons, exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation.
# Gene expression
DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9.
Prevalence of the HLA-DRB1*10:01 allele was greatly increased in people with anti-IgLON5 disease. | HLA-DRB1
HLA class II histocompatibility antigen, DRB1 beta chain is a protein that in humans is encoded by the HLA-DRB1 gene.[1] DRB1 encodes the most prevalent beta subunit of HLA-DR. Several alleles of DRB1 (shared epitope alleles)[2] are associated with an increased incidence of rheumatoid arthritis.
# Function
The protein encoded by this gene belongs to the HLA class II beta chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins to T helper cells. Class II molecules are constitutively expressed in professional antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages),[1] and could be induced in non-professional APCs.
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa. It is encoded by 6 exons, exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation.[1]
# Gene expression
DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9.[1]
Prevalence of the HLA-DRB1*10:01 allele was greatly increased in people with anti-IgLON5 disease.[3] | https://www.wikidoc.org/index.php/HLA-DRB1 | |
39fd2b8ed4957ad9495b412f0a55d0838185be6d | wikidoc | HLA-DRB4 | HLA-DRB4
Major histocompatibility complex, class II, DR beta 4, also known as HLA-DRB4, is a human gene.
# Function
The protein encoded by this gene belongs to the HLA class II beta chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages).
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa. It is encoded by 6 exons, exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation.
# Gene expression
DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. | HLA-DRB4
Major histocompatibility complex, class II, DR beta 4, also known as HLA-DRB4, is a human gene.[1]
# Function
The protein encoded by this gene belongs to the HLA class II beta chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages).[1]
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa. It is encoded by 6 exons, exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation.[1]
# Gene expression
DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9.[1] | https://www.wikidoc.org/index.php/HLA-DRB4 | |
e7d76ed9ceb390022667ff782de1043aa256dd01 | wikidoc | HLA-DRB5 | HLA-DRB5
HLA class II histocompatibility antigen, DRB5 beta chain is a protein that in humans is encoded by the HLA-DRB5 gene.
# Function
The protein encoded by this gene belongs to the HLA class II beta chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages).
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa. It is encoded by 6 exons, exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation.
# Gene expression
DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. | HLA-DRB5
HLA class II histocompatibility antigen, DRB5 beta chain is a protein that in humans is encoded by the HLA-DRB5 gene.[1]
# Function
The protein encoded by this gene belongs to the HLA class II beta chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages).[1]
# Gene structure and polymorphisms
The beta chain is approximately 26-28 kDa. It is encoded by 6 exons, exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation.[1]
# Gene expression
DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9.[1] | https://www.wikidoc.org/index.php/HLA-DRB5 | |
7e286985bae9645cab257044e45cd967e1a5b7dc | wikidoc | Homeobox | Homeobox
# Overview
A homeobox is a DNA sequence found within genes that are involved in the regulation of development (morphogenesis) of animals, fungi and plants. Genes that have a homeobox are called homeobox genes and form the homeobox gene family.
Homeobox genes encode homeodomain protein products that are transcription factors sharing a characteristic protein fold structure that binds DNA to regulate expression of target genes.
Homeodomain proteins regulate gene expression and cell differentiation during early embryonic development, thus mutations in homeobox genes can cause developmental disorders.
# Discovery
They were discovered independently in 1983 by Walter Jakob Gehring and his colleagues at the University of Basel, Switzerland, and Matthew Scott and Amy Weiner, who were then working with Thomas Kaufman at Indiana University in Bloomington.
# Homeodomain
A homeobox is about 180 base pairs long; it encodes a protein domain (the homeodomain) which can bind DNA.
Homeobox genes encode transcription factors which typically switch on cascades of other genes, for instance all the ones needed to make a leg. The homeodomain binds DNA in a specific manner.
However, the specificity of a single homeodomain protein is usually not enough to recognize only its desired target genes. Most of the time, homeodomain proteins act in the promoter region of their target genes as complexes with other transcription factors, often also homeodomain proteins. Such complexes have a much higher target specificity than a single homeodomain protein.
# Hox genes
A particular subgroup of homeobox genes are the Hox genes, which are found in a special gene cluster, the Hox cluster (also called Hox complex).
Hox genes function in patterning the body axis. Thus, by providing the identity of particular body regions, Hox genes determine where limbs and other body segments will grow in a developing fetus or larva.
Mutations in any one of these genes can lead to the growth of extra, typically non-functional body parts in invertebrates, for example antennapedia complex in Drosophila, which results in a leg growing from the head in place of an antenna and is due to a defect in a single gene.
Mutation in vertebrate Hox genes usually results in miscarriage.
# Diversity
The homeobox genes were first found in the fruit fly Drosophila melanogaster and have subsequently been identified in many other species, from insects to reptiles and mammals.
Homeobox genes were previously only identified in bilaterians but recently, cnidarians have also been found to contain homeobox domains and the "missing link" in the evolution between the two have been identified.
## Non-human
Homeobox genes have even been found in fungi, for example the one-cellular yeasts, and plants. The well known homeotic genes in plants (MADS-box genes) are not homologous to Hox genes in animals. Plants and animals do not share the same homeotic genes, and this suggests that homeotic genes arose once in the early evolution of animals and once again in the early evolution of plants.
## Human genes
Humans generally contain homeobox genes in four clusters:
There is also a "distal-less homeobox" family: DLX1, DLX2, DLX3, DLX4, DLX, and DLX6.
"HESX homeobox 1" is also known as HESX1.
Short stature homeobox gene is also known as SHOX.
# Mutations
Mutations to homeobox genes can produce easily visible phenotypic changes.
Two examples of homeobox mutations in the above-mentioned fruit fly are legs where the antennae should be (Antennapedia), and a second pair of wings.
Duplication of homeobox genes can produce new body segments, and such duplications are likely to have been important in the evolution of segmented animals.
Interestingly, there is one insect family, the xyelid sawflies, in which both the antennae and mouthparts are remarkably leg-like in structure. This is not uncommon in arthropods as all arthropod appendages are homologous.
# Regulation
The regulation of Hox genes is highly complex and involves reciprocal interactions, mostly inhibitory. Drosophila is known to use the Polycomb and Trithorax Complexes to maintain the expression of Hox genes after the down-regulation of the pair-rule and gap genes that occurs during larval development. | Homeobox
# Overview
A homeobox is a DNA sequence found within genes that are involved in the regulation of development (morphogenesis) of animals, fungi and plants.[1] Genes that have a homeobox are called homeobox genes and form the homeobox gene family.[2]
Homeobox genes encode homeodomain protein products that are transcription factors sharing a characteristic protein fold structure that binds DNA to regulate expression of target genes.[3][4][1]
Homeodomain proteins regulate gene expression and cell differentiation during early embryonic development, thus mutations in homeobox genes can cause developmental disorders.[5]
# Discovery
They were discovered independently in 1983 by Walter Jakob Gehring and his colleagues at the University of Basel, Switzerland, and Matthew Scott and Amy Weiner, who were then working with Thomas Kaufman at Indiana University in Bloomington.[6][7]
# Homeodomain
A homeobox is about 180 base pairs long;[1] it encodes a protein domain (the homeodomain) which can bind DNA.
Homeobox genes encode transcription factors which typically switch on cascades of other genes, for instance all the ones needed to make a leg. The homeodomain binds DNA in a specific manner.
However, the specificity of a single homeodomain protein is usually not enough to recognize only its desired target genes. Most of the time, homeodomain proteins act in the promoter region of their target genes as complexes with other transcription factors, often also homeodomain proteins. Such complexes have a much higher target specificity than a single homeodomain protein.
# Hox genes
A particular subgroup of homeobox genes are the Hox genes, which are found in a special gene cluster, the Hox cluster (also called Hox complex).
Hox genes function in patterning the body axis. Thus, by providing the identity of particular body regions, Hox genes determine where limbs and other body segments will grow in a developing fetus or larva.
Mutations in any one of these genes can lead to the growth of extra, typically non-functional body parts in invertebrates, for example antennapedia complex in Drosophila, which results in a leg growing from the head in place of an antenna and is due to a defect in a single gene.
Mutation in vertebrate Hox genes usually results in miscarriage.
# Diversity
The homeobox genes were first found in the fruit fly Drosophila melanogaster and have subsequently been identified in many other species, from insects to reptiles and mammals.
Homeobox genes were previously only identified in bilaterians but recently, cnidarians have also been found to contain homeobox domains and the "missing link" in the evolution between the two have been identified.
## Non-human
Homeobox genes have even been found in fungi, for example the one-cellular yeasts, and plants. The well known homeotic genes in plants (MADS-box genes) are not homologous to Hox genes in animals. Plants and animals do not share the same homeotic genes, and this suggests that homeotic genes arose once in the early evolution of animals and once again in the early evolution of plants.
## Human genes
Humans generally contain homeobox genes in four clusters:
There is also a "distal-less homeobox" family: DLX1, DLX2, DLX3, DLX4, DLX, and DLX6.
"HESX homeobox 1" is also known as HESX1.
Short stature homeobox gene is also known as SHOX.
# Mutations
Mutations to homeobox genes can produce easily visible phenotypic changes.
Two examples of homeobox mutations in the above-mentioned fruit fly are legs where the antennae should be (Antennapedia), and a second pair of wings.
Duplication of homeobox genes can produce new body segments, and such duplications are likely to have been important in the evolution of segmented animals.
Interestingly, there is one insect family, the xyelid sawflies, in which both the antennae and mouthparts are remarkably leg-like in structure. This is not uncommon in arthropods as all arthropod appendages are homologous.
# Regulation
The regulation of Hox genes is highly complex and involves reciprocal interactions, mostly inhibitory. Drosophila is known to use the Polycomb and Trithorax Complexes to maintain the expression of Hox genes after the down-regulation of the pair-rule and gap genes that occurs during larval development. | https://www.wikidoc.org/index.php/HOX_genes | |
c6f4f07058e8c5d0e4b62d8032348feed6397fc0 | wikidoc | HSD17B10 | HSD17B10
17-β-Hydroxysteroid dehydrogenase X (HSD10) also known as 3-hydroxyacyl-CoA dehydrogenase type-2 is a mitochondrial enzyme that in humans is encoded by the HSD17B10 (hydroxysteroid (17β) dehydrogenase 10) gene. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. Human HSD10 cDNA was cloned from brain (NM_004493), and the resulting protein, a homotetramer, was first characterized as a short chain 3-hydroxyacyl-CoA dehydrogenase (SCHAD). Active sites of this enzyme can accommodate different substrates; 17β-HSD10 is involved in the oxidation of isoleucine, branched-chain fatty acids, and xenobiotics as well as the metabolism of sex hormones and neuroactive steroids.
# Function
17beta-hydroxysteroid dehydrogenase 10 is a member of the short-chain dehydrogenase/reductase superfamily. This homotetrameric mitochondrial multifunctional enzyme catalyzes the oxidation of neuroactive steroids and the degradation of isoleucine. This enzyme is capable of binding to other peptides, such as estrogen receptor α, amyloid-β, and tRNA methyltransferase 10C. Missense mutations of the HSD17B10 gene result in 17β-HSD10 deficiency, an infantile neurodegeneration characterized by progressive psychomotor regression and alteration of mitochondria morphology. 17β-HSD10 exhibits only a negligible alcohol dehydrogenase activity, and is not localized in the endoplasmic reticulum or plasma membrane. Its alternate name – Aβ binding alcohol dehydrogenase (ABAD) – is a misnomer predicated on the mistaken belief that this enzyme is an alcohol dehydrogenase.
# Structure
## Gene
Human HSD17B10 gene has 6 exons resides on the X chromosome at p11.22.
## Protein
The gene product is a mitochondrial protein that catalyzes the oxidation of a wide variety of fatty acids and steroids, and is a subunit of mitochondrial ribonuclease P, which is involved in tRNA maturation. The molecular weight of 17β-HSD10 that is composed of four identical subunits is 108 kDa; each subunit consists of 261 amino acid residues. Although the endoplasmic reticulum (ER)-associated amyloid-β peptide binding protein (ERAB) was reported to be associated with the ER and to consist of 262 residues with a molecular weight of 27 kDa, ERAB is actually identical to 17β-HSD10 that is localized in mitochondria but not ER.
# Clinical significance
Abnormal expression, as well as mutations of the HSD17B10 gene leads to impairment of the structure, function, and dynamics of mitochondria. This may underlie the pathogenesis of the synaptic and neuronal deficiency exhibited in 17β-HSD10 related diseases, including 17β-HSD10 deficiency and Alzheimer's disease (AD). Missense and silent mutations in the gene are the cause of hydroxysteroid (17β) dehydrogenase X (HSD10) deficiency, formerly MHBD deficiency, and X-linked mental retardation, choreoathetosis, and abnormal behavior (MRXS10), respectively. Restoration of steroid homeostasis could be achieved by the supplementation of neuroactive steroids with a proper dosing and treatment regimen or by the adjustment of 17β-HSD10 activity to protect neurons. The discovery of this enzyme's true function has opened a new therapeutic avenue for treating AD.
# Interactions
HSD17B10 has been shown to interact with Amyloid precursor protein. | HSD17B10
17-β-Hydroxysteroid dehydrogenase X (HSD10) also known as 3-hydroxyacyl-CoA dehydrogenase type-2 is a mitochondrial enzyme that in humans is encoded by the HSD17B10 (hydroxysteroid (17β) dehydrogenase 10) gene.[1][2][3][4][5] Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined.[6] Human HSD10 cDNA was cloned from brain (NM_004493), and the resulting protein, a homotetramer, was first characterized as a short chain 3-hydroxyacyl-CoA dehydrogenase (SCHAD).[7] Active sites of this enzyme can accommodate different substrates; 17β-HSD10 is involved in the oxidation of isoleucine, branched-chain fatty acids, and xenobiotics as well as the metabolism of sex hormones and neuroactive steroids.[8][9]
# Function
17beta-hydroxysteroid dehydrogenase 10 is a member of the short-chain dehydrogenase/reductase superfamily.[10] This homotetrameric mitochondrial multifunctional enzyme catalyzes the oxidation of neuroactive steroids and the degradation of isoleucine.[11] This enzyme is capable of binding to other peptides, such as estrogen receptor α, amyloid-β, and tRNA methyltransferase 10C. Missense mutations of the HSD17B10 gene result in 17β-HSD10 deficiency, an infantile neurodegeneration characterized by progressive psychomotor regression and alteration of mitochondria morphology. 17β-HSD10 exhibits only a negligible alcohol dehydrogenase activity, and is not localized in the endoplasmic reticulum or plasma membrane. Its alternate name – Aβ binding alcohol dehydrogenase (ABAD) – is a misnomer predicated on the mistaken belief that this enzyme is an alcohol dehydrogenase.[9]
# Structure
## Gene
Human HSD17B10 gene has 6 exons resides on the X chromosome at p11.22.[6]
## Protein
The gene product is a mitochondrial protein that catalyzes the oxidation of a wide variety of fatty acids and steroids, and is a subunit of mitochondrial ribonuclease P, which is involved in tRNA maturation.[6] The molecular weight of 17β-HSD10 that is composed of four identical subunits is 108 kDa; each subunit consists of 261 amino acid residues.[12] Although the endoplasmic reticulum (ER)-associated amyloid-β peptide binding protein (ERAB) was reported to be associated with the ER and to consist of 262 residues with a molecular weight of 27 kDa,[13] ERAB is actually identical to 17β-HSD10 that is localized in mitochondria but not ER.[3]
# Clinical significance
Abnormal expression, as well as mutations of the HSD17B10 gene leads to impairment of the structure, function, and dynamics of mitochondria. This may underlie the pathogenesis of the synaptic and neuronal deficiency exhibited in 17β-HSD10 related diseases, including 17β-HSD10 deficiency and Alzheimer's disease (AD).[6] Missense and silent mutations in the gene are the cause of hydroxysteroid (17β) dehydrogenase X (HSD10) deficiency, formerly MHBD deficiency, and X-linked mental retardation, choreoathetosis, and abnormal behavior (MRXS10), respectively.[11][14][15] Restoration of steroid homeostasis could be achieved by the supplementation of neuroactive steroids with a proper dosing and treatment regimen or by the adjustment of 17β-HSD10 activity to protect neurons.[9] The discovery of this enzyme's true function has opened a new therapeutic avenue for treating AD.
# Interactions
HSD17B10 has been shown to interact with Amyloid precursor protein.[8] | https://www.wikidoc.org/index.php/HSD17B10 | |
ae4950785026eb577431930dbeeb1f2d839ef964 | wikidoc | HSP90AB1 | HSP90AB1
Heat shock protein HSP 90-beta also called HSP90beta is a protein that in humans is encoded by the HSP90AB1 gene.
# Function
HSP90AB1 is a molecular chaperone. Chaperones are proteins that bind to other proteins, thereby stabilizing them in an ATP-dependent manner. Chaperones stabilize new proteins during translation, mature proteins which are partially unstable but also proteins that have become partially denatured due to various kinds of cellular stress. In case proper folding or refolding is impossible, HSPs mediate protein degradation. They also have specialized functions, such as intracellular transport into organelles.
# Classification
Human HSPs are classified into 5 major groups according to the HNGC (HUGO gene nomenclature committee):
- HSP70
- DnaJ (HSP40)
- HSPB (small heat shock proteins)
- HSPC (HSP90)
- chaperonins
Chaperonins are characterized by their barrel-shaped structure with binding sites for client proteins inside the barrels.
Human HSP90 proteins are classified into 5 major groups according to the HNGC:
- HSP90AA1 (heat shock protein 90 kDa alpha, class A, member 1)
- HSP90AB1 (heat shock protein 90 kDa alpha, class B, member 1) (this protein)
- HSP90B1 (heat shock protein 90 kDA beta, member 1)
- TRAP1 (TNF receptor associated protein 1)
Whereas HSP90AA1 and HSP90AB1 are located primarily in the cytoplasm of the cells, HSP90B1 can be found in the endoplasmic reticulum and Trap1 in mitochondria.
# Co-chaperones
Co-chaperones bind to HSPs and influence their activity, substrate (client) specificity and interaction with other HSPs. For example, the co-chaperone CDC37 (cell division cycle 37) stabilizes the cell cycle regulatory proteins CDK4 (cyclin dependent kinase 4) and Cdk6. Hop (HSP organizing protein) mediates the interaction between different HSPs, forming HSP70–HSP90 complexes. TOM70 (translocase of the outer mitochondrial membrane of ~70 kDa) mediates translocation of client proteins through the import pore into the mitochondrial matrix.
# Isoforms
Human HPS90AB1 shares 60% overall homology to its closest relative HSP90AA1. Murine HSP90AB1 was cloned in 1987 based on homology of the corresponding Drosophila melanogaster gene.
# Protein structure
HSP90AB1 is active as homodimer, forming a V-shaped structure.
It consists of three major domains:
- N-terminal domain (NTD) containing the ATP binding site
- middle domain, primarily responsible for substrate binding
- C-terminal domain (CTD) which is the dimerization domain (base of the V).
Between these domains, there are short charged domains. Co-chaperones primarily bind to the NTD and CTD. The latter Co-chaperones usually contain a tetratricopeptide repeat (TPR) domain which binds to a MEEVD motif at the C-terminus of the HSP. Inhibition of HSP90 activity by geldanamycin derivatives is based on their binding to the ATP binding site.
# Client proteins
Client proteins are steroid hormone receptors, kinases, ubiquitin ligases, transcription factors and proteins from many more families. Examples of HSP90AB1 client proteins are p38MAPK/MAPK14 (mitogen activated protein kinase 14), ERK5 (extracellular regulated kinase 5), or the checkpoint kinase Wee1.
# Clinical significance
Cystic fibrosis (CF, mucoviscidosis) is a genetic disease with increased viscosity of various secretions leading to organ failure of lung, pancreas and other organs. It is caused in nearly all cases by a deletion of phenylalanine 508 of CFTR (cystic fibrosis transmembrane conductance regulator). This mutation causes a maturation defect of this ion channel protein with increased degradation, mediated by HSPs. Deletion of the co-chaperone AHA1 (activator of heat shock 90kDa protein ATPase homolog 1) leads to stabilization of CFTR and opens up a perspective for a new therapy.
## Cancer
HSP90AB1 and its co-chaperones are frequently overexpressed in cancer cells. They are able to stabilize mutant proteins thereby allowing survival and increased proliferation of cancer cells. This renders HSPs potential targets for cancer treatment. In salivary gland tumors, expression of HSP90AA1 and HSP90AB1 correlates with malignancy, proliferation and metastasis. The same is basically true for lung cancers where a correlation with survival was found.
# Notes | HSP90AB1
Heat shock protein HSP 90-beta also called HSP90beta is a protein that in humans is encoded by the HSP90AB1 gene.[1][2][3]
# Function
HSP90AB1 is a molecular chaperone. Chaperones are proteins that bind to other proteins, thereby stabilizing them[4][5][6][7][8][9][10] in an ATP-dependent manner.[11] Chaperones stabilize new proteins during translation, mature proteins which are partially unstable but also proteins that have become partially denatured due to various kinds of cellular stress. In case proper folding or refolding is impossible, HSPs mediate protein degradation. They also have specialized functions, such as intracellular transport into organelles.
# Classification
Human HSPs are classified into 5 major groups according to the HNGC (HUGO gene nomenclature committee):[12][13]
- HSP70
- DnaJ (HSP40)
- HSPB (small heat shock proteins)
- HSPC (HSP90)
- chaperonins
Chaperonins are characterized by their barrel-shaped structure with binding sites for client proteins inside the barrels.
Human HSP90 proteins are classified into 5 major groups according to the HNGC:[13][14]
- HSP90AA1 (heat shock protein 90 kDa alpha, class A, member 1)
- HSP90AB1 (heat shock protein 90 kDa alpha, class B, member 1) (this protein)
- HSP90B1 (heat shock protein 90 kDA beta, member 1)
- TRAP1 (TNF receptor associated protein 1)
Whereas HSP90AA1 and HSP90AB1 are located primarily in the cytoplasm of the cells, HSP90B1 can be found in the endoplasmic reticulum and Trap1 in mitochondria.
# Co-chaperones
Co-chaperones bind to HSPs and influence their activity, substrate (client) specificity and interaction with other HSPs.[10] For example, the co-chaperone CDC37 (cell division cycle 37) stabilizes the cell cycle regulatory proteins CDK4 (cyclin dependent kinase 4) and Cdk6.[15] Hop (HSP organizing protein) mediates the interaction between different HSPs, forming HSP70–HSP90 complexes.[16][17] TOM70 (translocase of the outer mitochondrial membrane of ~70 kDa) mediates translocation of client proteins through the import pore into the mitochondrial matrix.[17][18]
# Isoforms
Human HPS90AB1 shares 60% overall homology to its closest relative HSP90AA1.[19] Murine HSP90AB1 was cloned in 1987 based on homology of the corresponding Drosophila melanogaster gene.[20][21]
# Protein structure
HSP90AB1 is active as homodimer, forming a V-shaped structure.[17][22][23][24][25][26]
It consists of three major domains:
- N-terminal domain (NTD) containing the ATP binding site
- middle domain, primarily responsible for substrate binding
- C-terminal domain (CTD) which is the dimerization domain (base of the V).
Between these domains, there are short charged domains. Co-chaperones primarily bind to the NTD and CTD. The latter Co-chaperones usually contain a tetratricopeptide repeat (TPR) domain which binds to a MEEVD motif at the C-terminus of the HSP.[17][27] Inhibition of HSP90 activity by geldanamycin derivatives is based on their binding to the ATP binding site.[11]
# Client proteins
Client proteins are steroid hormone receptors, kinases, ubiquitin ligases, transcription factors and proteins from many more families.[10][28][29] Examples of HSP90AB1 client proteins are p38MAPK/MAPK14 (mitogen activated protein kinase 14),[30] ERK5 (extracellular regulated kinase 5),[31] or the checkpoint kinase Wee1.[32]
# Clinical significance
Cystic fibrosis (CF, mucoviscidosis) is a genetic disease with increased viscosity of various secretions leading to organ failure of lung, pancreas and other organs. It is caused in nearly all cases by a deletion of phenylalanine 508 of CFTR (cystic fibrosis transmembrane conductance regulator). This mutation causes a maturation defect of this ion channel protein with increased degradation, mediated by HSPs. Deletion of the co-chaperone AHA1 (activator of heat shock 90kDa protein ATPase homolog 1) leads to stabilization of CFTR and opens up a perspective for a new therapy.[33]
## Cancer
HSP90AB1 and its co-chaperones are frequently overexpressed in cancer cells.[34] They are able to stabilize mutant proteins thereby allowing survival and increased proliferation of cancer cells. This renders HSPs potential targets for cancer treatment.[35][36][37] In salivary gland tumors, expression of HSP90AA1 and HSP90AB1 correlates with malignancy, proliferation and metastasis.[38] The same is basically true for lung cancers where a correlation with survival was found.[39]
# Notes | https://www.wikidoc.org/index.php/HSP90AB1 | |
a89e29261af859bb1ba641ecd59d128e81753578 | wikidoc | Hematoma | Hematoma
Synonyms and keywords: Haematoma
# Overview
A hematoma, or haematoma, is a collection of blood, generally the result of hemorrhage, or, more specifically, internal bleeding. Hematomas exist as bruises (ecchymoses), but can also develop in organs. Hematomas can also be under the nails, causing a brown-black discoloration. Some hematomas form into a welt- like formation that is hard to the touch, which is a sac of blood that the body creates to keep internal bleeding to a minimum. In most cases the sac of blood eventually dissolves, however in some cases they may continue to grow or show no change. If the sac of blood does not disappear it may need to be surgically removed.
It is not to be confused with hemangioma which is an abnormal build up of blood vessels in the skin or internal organs.
Hematomas can gradually migrate, as the effused cells and pigment move in the connective tissue. For example, a patient who injures the base of his thumb might cause a hematoma which will slowly move all through the finger within a week. Gravity is the main determinant of this process.
Hematomas on articulations can reduce mobility of a member and present roughly the same symptoms as a fracture.
# Classification
- Head/brain:
Subgaleal hematoma — between the galea aponeurosis and periosteum
Cephalhematoma — between the periosteum and skull
Epidural hematoma — between the skull and dura mater
Subdural hematoma — between the dura mater and arachnoid mater
Subarachnoid hematoma — between the arachnoid mater and pia mater (the subarachnoid space)
- Subgaleal hematoma — between the galea aponeurosis and periosteum
- Cephalhematoma — between the periosteum and skull
- Epidural hematoma — between the skull and dura mater
- Subdural hematoma — between the dura mater and arachnoid mater
- Subarachnoid hematoma — between the arachnoid mater and pia mater (the subarachnoid space)
- Perichondral hematoma (ear)
# Degrees of Hematoma
- Hematoma - bruise
- Petechiae - hematoma less than 12 mm in diameter
- Purpura - hematoma of 13 mm to 25 mm in diameter
- Ecchymoses or eccymosis - hematoma of greater than 25 mm in diameter | Hematoma
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Synonyms and keywords: Haematoma
# Overview
A hematoma, or haematoma, is a collection of blood, generally the result of hemorrhage, or, more specifically, internal bleeding. Hematomas exist as bruises (ecchymoses), but can also develop in organs. Hematomas can also be under the nails, causing a brown-black discoloration. Some hematomas form into a welt- like formation that is hard to the touch, which is a sac of blood that the body creates to keep internal bleeding to a minimum. In most cases the sac of blood eventually dissolves, however in some cases they may continue to grow or show no change. If the sac of blood does not disappear it may need to be surgically removed.
It is not to be confused with hemangioma which is an abnormal build up of blood vessels in the skin or internal organs.
Hematomas can gradually migrate, as the effused cells and pigment move in the connective tissue. For example, a patient who injures the base of his thumb might cause a hematoma which will slowly move all through the finger within a week. Gravity is the main determinant of this process.
Hematomas on articulations can reduce mobility of a member and present roughly the same symptoms as a fracture.
# Classification
- Head/brain:
Subgaleal hematoma — between the galea aponeurosis and periosteum
Cephalhematoma — between the periosteum and skull
Epidural hematoma — between the skull and dura mater
Subdural hematoma — between the dura mater and arachnoid mater
Subarachnoid hematoma — between the arachnoid mater and pia mater (the subarachnoid space)
- Subgaleal hematoma — between the galea aponeurosis and periosteum
- Cephalhematoma — between the periosteum and skull
- Epidural hematoma — between the skull and dura mater
- Subdural hematoma — between the dura mater and arachnoid mater
- Subarachnoid hematoma — between the arachnoid mater and pia mater (the subarachnoid space)
- Perichondral hematoma (ear)
# Degrees of Hematoma
- Hematoma - bruise
- Petechiae - hematoma less than 12 mm in diameter
- Purpura - hematoma of 13 mm to 25 mm in diameter
- Ecchymoses or eccymosis - hematoma of greater than 25 mm in diameter | https://www.wikidoc.org/index.php/Haematoma | |
0076ec8959f3f12cd9cf3569eaf9e94b31e485a8 | wikidoc | Hairball | Hairball
# Overview
A hairball is a small collection of hair or fur formed in the stomach of animals that is occasionally vomited up when it becomes too big. Hairballs are primarily a tight elongated cylinder of packed fur, but may include bits of other elements such as swallowed food. Hairballs are sometimes mistaken for other conditions of the stomach such as lymphosarcoma, tuberculosis, and tumour of the spleen. Cats are especially prone to hairball formation since they groom themselves by licking their fur, and thereby ingest it. Rabbits are also prone to hairballs because they groom themselves in the same fashion as cats, but hairballs are especially dangerous for rabbits because they cannot regurgitate them. Because the digestive system of a rabbit is very fragile, rabbit hairballs must be treated immediately or they may cause the animal to stop feeding and ultimately die due to dehydration. Cattle are also known to accumulate hairballs, but as they do not vomit, these are found usually after death and can be quite large.
# Clinical significance
A trichobezoar is a bezoar (a mass found trapped in the gastrointestinal system) formed from the ingestion of hair. Trichobezoars are often associated with trichotillomania (compulsive hair pulling), are rare, and can be fatal if undetected. Surgical intervention is often required.
# Diagnosis
## Physical Examination
### Hair
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.
# Society and culture
Although uncommon in humans, some hairballs have been reported. These hairballs occur when hair strands collect in the stomach and are unable to be ejected as a result of the friction on the surface of the gastric mucosa. Hairballs are often seen in young girls as a result of trichophagia, trichotillomania and pica. In 2003, a 3-year old girl in Red Deer, Alberta, Canada had a grapefruit-sized hairball surgically removed from her stomach; in 2004, an 18-year old woman from McAdam, New Brunswick, Canada, had a 2.3 kg hairball surgically removed from her lower intestine; and in 2014, a 9 pound hairball was removed from the stomach of an 18-year old in Kyrgyzstan. Hairballs can be quite hazardous in humans, since hair cannot be digested or passed by the human gastrointestinal system, and (assuming it is identified) even vomiting may be ineffective at removing the hair mass. This can result in the general impairment of the digestive system. | Hairball
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Kiran Singh, M.D. [2]
# Overview
A hairball is a small collection of hair or fur formed in the stomach of animals that is occasionally vomited up when it becomes too big. Hairballs are primarily a tight elongated cylinder of packed fur, but may include bits of other elements such as swallowed food. Hairballs are sometimes mistaken for other conditions of the stomach such as lymphosarcoma, tuberculosis, and tumour of the spleen.[1] Cats are especially prone to hairball formation since they groom themselves by licking their fur, and thereby ingest it. Rabbits are also prone to hairballs because they groom themselves in the same fashion as cats, but hairballs are especially dangerous for rabbits because they cannot regurgitate them. Because the digestive system of a rabbit is very fragile, rabbit hairballs must be treated immediately or they may cause the animal to stop feeding and ultimately die due to dehydration. Cattle are also known to accumulate hairballs, but as they do not vomit, these are found usually after death and can be quite large.
# Clinical significance
A trichobezoar is a bezoar (a mass found trapped in the gastrointestinal system) formed from the ingestion of hair. Trichobezoars are often associated with trichotillomania (compulsive hair pulling), are rare,[2] and can be fatal if undetected.[3][4][5][6] Surgical intervention is often required.[3][7]
# Diagnosis
## Physical Examination
### Hair
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.[8]
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.[8]
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.[8]
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.[8]
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.[8]
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.[8]
- Trichotillomania-trichobezoars. Adapted from Dermatology Atlas.[8]
# Society and culture
Although uncommon in humans, some hairballs have been reported. These hairballs occur when hair strands collect in the stomach and are unable to be ejected as a result of the friction on the surface of the gastric mucosa.[9] Hairballs are often seen in young girls as a result of trichophagia, trichotillomania and pica.[10] In 2003, a 3-year old girl in Red Deer, Alberta, Canada had a grapefruit-sized hairball surgically removed from her stomach; in 2004, an 18-year old woman from McAdam, New Brunswick, Canada, had a 2.3 kg hairball surgically removed from her lower intestine; and in 2014, a 9 pound hairball was removed from the stomach of an 18-year old in Kyrgyzstan.[11] Hairballs can be quite hazardous in humans,[12] since hair cannot be digested or passed by the human gastrointestinal system, and (assuming it is identified) even vomiting may be ineffective at removing the hair mass. This can result in the general impairment of the digestive system. | https://www.wikidoc.org/index.php/Hairball | |
c9fb5089eb8e2e49be66d090b54606e581add2b3 | wikidoc | Halfsies | Halfsies
Halfsies were a breakfast cereal manufactured by Quaker Oats from 1983 through 1984. They were the result of the so-called "sugar backlash" in which the amount of sugar in children's breakfast cereals became an issue. The premise was they contained half the sugar of regular breakfast cereals. The cereal nuggets were shaped as half a normal cereal ring, like the letter C.
They were corn based and, essentially, were Cap'n Crunch (another Quaker Oats product) with half the sugar and a slightly different texture.
The marketing campaign was headed by the King of The Land of Half who presided over The Land of Half. The box featured Half Land where houses, cars, food, etc. was all cut in half (i.e. only half of a house would be present with the walls open on one half and you could see into the house, etc.)
Halfsies were discontinued due to poor sales. | Halfsies
Halfsies were a breakfast cereal manufactured by Quaker Oats from 1983 through 1984. They were the result of the so-called "sugar backlash" in which the amount of sugar in children's breakfast cereals became an issue. The premise was they contained half the sugar of regular breakfast cereals. The cereal nuggets were shaped as half a normal cereal ring, like the letter C.
They were corn based and, essentially, were Cap'n Crunch (another Quaker Oats product) with half the sugar and a slightly different texture.
The marketing campaign was headed by the King of The Land of Half who presided over The Land of Half. The box featured Half Land where houses, cars, food, etc. was all cut in half (i.e. only half of a house would be present with the walls open on one half and you could see into the house, etc.)
Halfsies were discontinued due to poor sales. | https://www.wikidoc.org/index.php/Halfsies | |
45f2fda06b746a1f6089e3319fec9343649635b1 | wikidoc | Hallmark | Hallmark
A hallmark is a mark or series of marks struck on items made of precious metals - platinum, gold, silver and in some nations, palladium.
# General overview
## Hallmarks defined
A hallmark, is a mark or series of marks struck on items made of precious metals - platinum, gold, silver and in some nations, palladium. In a more general sense, the term hallmark can also be used refer to any distinguishing characteristic or trait.
Historically, hallmarks were applied by a trusted party: the 'guardians of the craft' or nowadays by an assay office. These marks guarantee a certain purity or fineness of the metal.
## Hallmarks distinguished from marks
These official hallmarks should not be confused with a markings, which often are just a number such as 750 or 925 (albeit intended to denote the fineness of the metal), which is done by the manufacturer, and unfortunately may not always reflect the true purity of the metal.
## Pre-requisites to hallmarking
Notwithstanding the hallmarking systems of many nations require, as a prerequisite to official hallmarking, that the maker or sponsor itself mark upon the item a responsibility mark and a claim of fineness. Responsibility marks are also required in the U.S. despite the fact that there is no official hallmarking scheme in that country. Nevertheless, in nations with an official hallmarking scheme, the hallmark is only applied after the item has been assayed to determine that its purity conforms not only to the standards set down by the law but also and with the maker’s claims as to metallurgical content.
## Systems differs from nation to nation
In some nations, such as the UK, the hallmark is made up of several elements including: a mark denoting the type of metal, the maker/sponsor's mark and the year of the marking. In other nations, such as Switzerland, the hallmark is a single mark regardless of metal or fineness, although that mark is augmented by a responsibility mark (known as a sponsor's mark in the UK) and the maker’s claim as to the fineness. Among a group of nations which are signatories to an international convention known as the Vienna Convention, additional, optional, yet official marks may also be struck by the assay office. These have the effect of easing import obligations among and between the member states.
# History of hallmarking
## Ancient Byzantine Hallmarks
The control or inspection of precious metals was an ancient concept of examination and marking, by means of inspection stamps (punch marks). The use of hallmarks, at first, on silver has a long history dating back to the fourth century AD and represents the oldest known form of consumer protection. A series or system of five marks has been found on Byzantine silver dating from this period though their interpretation is still not completely resolved.
## Hallmarking in the Late Middle Ages
However, from the Late Middle Ages, hallmarking was administered by local governments through authorized assayers. These assayers examined precious metal goods, under the auspices of the state, before the good could be offered for public sale. By the age of the Craft Guilds, the authorized examiner’s mark was the “master’s mark” which consisted frequently of his initials and/or the coat of arms of the goldsmith or silversmith. At one time, there was no distinction among silversmiths and goldsmiths who were all referred to as «orfèvres», the French word for goldsmith. The Master Craftsman was responsible for the quality of the work that left his atelier or workshop, regardless of who made the item. Hence the responsibility mark is still known today in French as le poinçon de maître literally "the maker's punch". In this period, fineness was more or less standardized in the major European nations (writ: France and England) at 20 karats for gold and 12 to 13 lots (75% to 81%) for silver, but the standards could only be partly enforced owing to the general nature of the time.
### France
Hallmarking is Europe's earliest form of consumer protection. Hallmarking in Europe appears first in France, with the Goldsmiths Statute of 1260promulgated under Etienne Boileau, Provost of Paris, for King Louis IX "St. Louis". A standard for silver was thus, established. In 1275, Philippe III "the Bold" prescribed by royal decree, the mark for use on silver works, along with specific punches for each community's smiths. In 1313, his successor, Philippe IV "the Fair" expanded the use of hallmarks to gold works.
### England
In 1300, King Edward I of England enacted a statute ordering that all silver articles must meet the Sterling silver standard (92.5% pure silver), and should be assayed by 'guardians of the craft', who would then mark the item with a leopard's head. In 1327, King Edward III of England granted a charter to the Worshipful Company of Goldsmiths (more commonly known as the Goldsmiths' Company), marking the beginning of the Company's formal existence. This entity was headquartered at London's "Goldsmiths' Hall of the Worshipful Company of Goldsmith" from whence the English term "hallmark" is derived.
In 1355, individual maker marks were introduced in France, which concept was later mirrored in England in 1363, adding accountability to the two systems.
### Switzerland
In 1424, the French Archbishop Jean de Brogny, after having consulted with a council of eight Masters Goldsmiths from Geneva, enacted a regulation on the purity and hallmarking of silver objects following the French standards for application in Geneva. Although gold was certainly used for articles, the regulation was silent on gold standards and its hallmarking. (Today in Switzerland, only precious metal watch cases must be hallmarked. Perhaps this attests to the significance of watches to the Swiss economy. The hallmarking of other items including silverware and jewelry is optional.)
### Augmentations in France and England
In 1427, the date letter system was established in France, allowing the accurate dating of any hallmarked piece.
In 1478, the Assay Office was established in Goldsmiths' Hall. At this time, the date letter system was introduced in England.
In 1697, a higher standard of silver, known as the Britannia standard (95.8% silver) was made compulsory in England to protect the new coinage which was being melted down by silversmiths for the silver. The Sterling standard was restored in 1720.
# Modern hallmarks
In the modern world, in an attempt at standardizing the legislation on the inspection of precious metals and to facilitate international trade, in 1973 a core group of European nations signed the Vienna Convention on the control of the fineness and the hallmarking of precious metal objects. Those articles, which are assayed and found to be in conformity by the qualifying office of a signatory country, receive a mark, known as the Common Control Mark (CCM), attesting to the material's fineness. The multi-tiered motif of the CCM is the balance scales, superimposed, for gold, on two intersecting circles; for platinum, a diamond shape and for silver a mark in the shape of the Latin letter "M".
This mark is recognized in all the other contracting States, including: Austria, Cyprus, the Czech Republic, Denmark, Finland, Great Britain, Hungary, Ireland, Israel, Latvia, Lithuania, the Netherlands, Norway, Poland, Portugal, Sweden, Switzerland and Ukraine (see links below). Other nations monitor the activities of the Convention and may apply for membership.
Complete international hallmarking has been plagued by difficulties, because even amongst countries which have implemented hallmarking, standards and enforcement vary considerably, making it difficult for one country to accept another's hallmarking as equivalent to its own. Many nations monitor the Vienna system and procedures are in place to allow additional nations to join the Vienna Convention. Similarly, with the consent all the current member states, the terms of the Convention may be amended.
The most significant item currently up for debate is the recognition of palladium as a precious metal. Some member nations recognize palladium as a precious metal while others do not.
## List of countries with statutory independent hallmarking as of 2007
Nations noted in bold are Vienna Convention members (as of 2007) and each recognizes the others hallmarks. (Click the external link for hallmark illustrations - text is French, scroll down for illustrations). For an overview in table form (in English) click here.
## In the UK
The Hallmarking Act 1973 made Britain a member of the Vienna Convention as well as introducing marking for platinum, a recognized metal under the Convention. All four remaining assay offices finally adopted the same date letter sequences. The latest changes in 1999 were made to the UK hallmarking system to bring the system closer into line with the European Union (EU).
As it now stands, the compulsory part of the UK hallmark consists of the sponsor or maker's mark, the assay office mark, and the standard of fineness (in this case silver, 925 parts in 1000).
These are shown in the top of the two example hallmarks. The bottom example shows the extra marks that can also be struck, the lion passant, indicating Sterling silver, the date mark (lowercase a for '2000'), and in this example, the 'Millennium mark', which was only available for the years 1999 and 2000. The bottom example bears the Yorkshire rose mark for the Sheffield Assay Office.
## In Switzerland
Although hallmarking in the Swiss territories dates back to Geneva in the 1400's there was no uniform system of hallmarking in Switzerland until 1881. Before that time, hallmarking was undertaken at the local level by the Swiss cantons. With the introduction of the Swiss system of hallmarking in 1881, there was uniformity throughout the nation. Under the current law, on all gold, silver, platinum or palladium watches cases made in Switzerland or imported into Switzerland, (Fr.) there shall be affixed, near the Maker's Responsibility Mark and his indication of purity, the official Hallmark, the head of a Saint-Bernard dog (illustrated below). Only precious metal watch cases must be hallmarked. Swiss hallmarking for other articles such as jewelry and cutlery is optional. In addition to the Swiss hallmark, all precious metal goods may be stamped with the Common Control Mark of the Vienna Convention.
## In the Netherlands
The Dutch, who are members of the International hallmarking Convention, have been striking hallmarks since at least 1814. Like many other nations, the Dutch require the registration and use of Responsibility Marks, however, perhaps somewhat unique, the Dutch publish a book entitled "Netherlands' Responsibility Marks since 1797" (in three volumes and in the English language) illustrating all the responsibility marks registered there since that time. This is significant since producers that exported precious metal good to the Netherlands would have been required to register their marks.
The Dutch government markets their assay services/office as the "Jewellery Gateway in and to Europe." The Netherlands' hallmarks are also recognized in other E.U. countries and thus can be sold in Austria, France, Ireland, Portugal, Spain and the United Kingdom without further testing. The Netherlands' hallmarks are also recognized in Belgium, Denmark, Finland and Sweden, which have voluntary hallmarking systems.
The Dutch assay office is located in Gouda between the Amsterdam and Rotterdam Airports. The Dutch recognize platinum, gold, silver and palladium as precious metals.
# Marking techniques
## Punching
Traditionally, the hallmarks are 'struck' using steel punches. Punches are made in different sizes, suitable for tiny pieces of jewelry to large silver platters. Punches are made in straight shank or ring shank, the former for normal punching with a hammer, and the later used with a press to mark rings. The problem with traditional punching is that the process of punching displaces metal, causing some distortion of the article being marked. This means that re-finishing of the article is required after hallmarking. For this reason, and that off-cuts from sprues are often used for assay, many articles are sent unfinished to the assay office for assay and hallmarking.
## Laser marking
A new method of marking using lasers is now available, which is especially valuable for delicate items and hollowware, which would be damaged or distorted by the punching process. Laser marking also means that finished articles do not need to be re-finished. Laser marking works by using high power lasers to evaporate material from the metal surface. Two methods exist, 2D and 3D laser marking. 2D laser marking burns the outline of the hallmarks into the object, while 3D laser marking better simulates the marks made by punching.
# Methods of assay
Precious metal items of art or jewelry are frequently hallmarked (depending upon the requirements of the laws of either the place of manufacture or the place of import). Where required to be hallmarked, semi-finished precious metal items of art or jewelry pass through the official testing channels where they are analyzed or assayed for precious metal content. While different nations permit a variety of legally acceptable finenesses, the assayer is actually testing to determine that the fineness of the product conforms with the statement or claim of fineness that the maker has claimed (usually by stamping a number such as 750 for 18k gold) on the item. In the past the assay was conducted by using the touchstone method but currently (most often) it is done using X-ray Fluorescence (XRF). XRF is used because this method is more exacting than the touchstone test. The most exact method of assay is known as fire assay or cupellation. This method is better suited for the assay of bullion and gold stocks rather than works or art or jewelry because it is a completely destructive method.
## The Touchstone
The age-old touchstone method is particularly suited to the testing of very valuable pieces, for which sampling by destructive means, such as scraping, cutting or drilling is unacceptable. A rubbing of the item is made on a special stone, treated with acids and the resulting color compared to references. Differences in precious metal content as small as 10 to 20 parts per thousand can often be established with confidence by the test. It is not indicated for use with white gold, for example, since the color variation among white gold alloys is almost imperceptible.
## X-Ray Fluorescence
The modern X-ray fluorescence is also a non-destructive technique that is suitable for normal assaying requirements. It typically has an accuracy of 2-5 parts per thousand and is well-suited to the relatively flat and large surfaces. It is a quick technique taking about three minutes, and the results can be automatically printed out by the computer. It also measures the content of the other alloying metals present. It is not indicated, however, for articles with chemical surface treatment or electroplating.
## The Fire Assay (Cupellation)
The most elaborate but totally destructive assay method is the fire-assay, also known as cupellation, with an accuracy of 1 part in 10,000. In this process the article is melted, the alloys separated and constituents weighed. Since this method is totally destructive, when this method is employed for the assay of jewelry, it is done under the guise random or selective sampling. For example if a single manufacturer deposits a lot of rings or watch cases, while most are assayed using the non-destructive methods a few pieces from the lot are randomly selected for fire assay.
## Other methods
There are methods of assay noted above which are more properly suited for finished goods while other methods are suitable for use on raw materials before artistic workmanship has begun. Raw precious metals (bullion or metal stock) are assayed by the following methods: silver is assayed by titration, gold is assayed by cupellation and platinum is assayed by ICP OES spectrometry. | Hallmark
A hallmark is a mark or series of marks struck on items made of precious metals - platinum, gold, silver and in some nations, palladium.
# General overview
## Hallmarks defined
A hallmark, is a mark or series of marks struck on items made of precious metals - platinum, gold, silver and in some nations, palladium. In a more general sense, the term hallmark can also be used refer to any distinguishing characteristic or trait.
Historically, hallmarks were applied by a trusted party: the 'guardians of the craft' or nowadays by an assay office. These marks guarantee a certain purity or fineness of the metal.
## Hallmarks distinguished from marks
These official hallmarks should not be confused with a markings, which often are just a number such as 750 or 925 (albeit intended to denote the fineness of the metal), which is done by the manufacturer, and unfortunately may not always reflect the true purity of the metal.
## Pre-requisites to hallmarking
Notwithstanding the hallmarking systems of many nations require, as a prerequisite to official hallmarking, that the maker or sponsor itself mark upon the item a responsibility mark and a claim of fineness. Responsibility marks are also required in the U.S. despite the fact that there is no official hallmarking scheme in that country. Nevertheless, in nations with an official hallmarking scheme, the hallmark is only applied after the item has been assayed to determine that its purity conforms not only to the standards set down by the law but also and with the maker’s claims as to metallurgical content.
## Systems differs from nation to nation
In some nations, such as the UK, the hallmark is made up of several elements including: a mark denoting the type of metal, the maker/sponsor's mark and the year of the marking. In other nations, such as Switzerland, the hallmark is a single mark regardless of metal or fineness, although that mark is augmented by a responsibility mark (known as a sponsor's mark in the UK) and the maker’s claim as to the fineness. Among a group of nations which are signatories to an international convention known as the Vienna Convention, additional, optional, yet official marks may also be struck by the assay office. These have the effect of easing import obligations among and between the member states.
# History of hallmarking
## Ancient Byzantine Hallmarks
The control or inspection of precious metals was an ancient concept of examination and marking, by means of inspection stamps (punch marks). The use of hallmarks, at first, on silver has a long history dating back to the fourth century AD and represents the oldest known form of consumer protection. A series or system of five marks has been found on Byzantine silver dating from this period though their interpretation is still not completely resolved.[1]
## Hallmarking in the Late Middle Ages
However, from the Late Middle Ages, hallmarking was administered by local governments through authorized assayers. These assayers examined precious metal goods, under the auspices of the state, before the good could be offered for public sale. By the age of the Craft Guilds, the authorized examiner’s mark was the “master’s mark” which consisted frequently of his initials and/or the coat of arms of the goldsmith or silversmith. At one time, there was no distinction among silversmiths and goldsmiths who were all referred to as «orfèvres», the French word for goldsmith. The Master Craftsman was responsible for the quality of the work that left his atelier or workshop, regardless of who made the item. Hence the responsibility mark is still known today in French as le poinçon de maître literally "the maker's punch". In this period, fineness was more or less standardized in the major European nations (writ: France and England) at 20 karats for gold and 12 to 13 lots (75% to 81%) for silver, but the standards could only be partly enforced owing to the general nature of the time.[clarification needed]
### France
Hallmarking is Europe's earliest form of consumer protection. Hallmarking in Europe appears first in France, with the Goldsmiths Statute of 1260promulgated under Etienne Boileau, Provost of Paris, for King Louis IX "St. Louis". A standard for silver was thus, established. In 1275, Philippe III "the Bold" prescribed by royal decree, the mark for use on silver works, along with specific punches for each community's smiths. In 1313, his successor, Philippe IV "the Fair" expanded the use of hallmarks to gold works.
### England
In 1300, King Edward I of England enacted a statute ordering that all silver articles must meet the Sterling silver standard (92.5% pure silver), and should be assayed by 'guardians of the craft', who would then mark the item with a leopard's head. In 1327, King Edward III of England granted a charter to the Worshipful Company of Goldsmiths (more commonly known as the Goldsmiths' Company), marking the beginning of the Company's formal existence. This entity was headquartered at London's "Goldsmiths' Hall of the Worshipful Company of Goldsmith" from whence the English term "hallmark" is derived.
In 1355, individual maker marks were introduced in France, which concept was later mirrored in England in 1363, adding accountability to the two systems.
### Switzerland
In 1424, the French Archbishop Jean de Brogny, after having consulted with a council of eight Masters Goldsmiths from Geneva, enacted a regulation on the purity and hallmarking of silver objects following the French standards for application in Geneva. Although gold was certainly used for articles, the regulation was silent on gold standards and its hallmarking.[2] (Today in Switzerland[3], only precious metal watch cases must be hallmarked.[4] Perhaps this attests to the significance of watches to the Swiss economy. The hallmarking of other items including silverware and jewelry is optional.)
### Augmentations in France and England
In 1427, the date letter system was established in France, allowing the accurate dating of any hallmarked piece.
In 1478, the Assay Office was established in Goldsmiths' Hall. At this time, the date letter system was introduced in England.
In 1697, a higher standard of silver, known as the Britannia standard (95.8% silver) was made compulsory in England to protect the new coinage which was being melted down by silversmiths for the silver. The Sterling standard was restored in 1720.
# Modern hallmarks
In the modern world, in an attempt at standardizing the legislation on the inspection of precious metals and to facilitate international trade, in 1973 a core group of European nations signed the Vienna Convention on the control of the fineness and the hallmarking of precious metal objects.[5] Those articles, which are assayed and found to be in conformity by the qualifying office of a signatory country, receive a mark, known as the Common Control Mark (CCM), attesting to the material's fineness. The multi-tiered motif of the CCM is the balance scales, superimposed, for gold, on two intersecting circles; for platinum, a diamond shape and for silver a mark in the shape of the Latin letter "M".
This mark is recognized in all the other contracting States, including: Austria, Cyprus, the Czech Republic, Denmark, Finland, Great Britain, Hungary, Ireland, Israel, Latvia, Lithuania, the Netherlands, Norway, Poland, Portugal, Sweden, Switzerland and Ukraine (see links below). Other nations monitor the activities of the Convention and may apply for membership.
Complete international hallmarking has been plagued by difficulties, because even amongst countries which have implemented hallmarking, standards and enforcement vary considerably, making it difficult for one country to accept another's hallmarking as equivalent to its own. Many nations monitor the Vienna system and procedures are in place to allow additional nations to join the Vienna Convention. Similarly, with the consent all the current member states, the terms of the Convention may be amended.
The most significant item currently up for debate is the recognition of palladium as a precious metal. Some member nations recognize palladium as a precious metal while others do not.[citation needed]
## List of countries with statutory independent hallmarking as of 2007
Nations noted in bold are Vienna Convention members (as of 2007) and each recognizes the others hallmarks. (Click the external link for hallmark illustrations - text is French, scroll down for illustrations). For an overview in table form (in English) click here.
## In the UK
The Hallmarking Act 1973 made Britain a member of the Vienna Convention as well as introducing marking for platinum, a recognized metal under the Convention. All four remaining assay offices finally adopted the same date letter sequences. The latest changes in 1999 were made to the UK hallmarking system to bring the system closer into line with the European Union (EU).
As it now stands, the compulsory part of the UK hallmark consists of the sponsor or maker's mark, the assay office mark, and the standard of fineness (in this case silver, 925 parts in 1000).
These are shown in the top of the two example hallmarks. The bottom example shows the extra marks that can also be struck, the lion passant, indicating Sterling silver, the date mark (lowercase a for '2000'), and in this example, the 'Millennium mark', which was only available for the years 1999 and 2000. The bottom example bears the Yorkshire rose mark for the Sheffield Assay Office.[6]
## In Switzerland
Although hallmarking in the Swiss territories dates back to Geneva in the 1400's there was no uniform system of hallmarking in Switzerland until 1881. Before that time, hallmarking was undertaken at the local level by the Swiss cantons. With the introduction of the Swiss system of hallmarking in 1881, there was uniformity throughout the nation. Under the current law, on all gold, silver, platinum or palladium watches cases made in Switzerland or imported into Switzerland, (Fr.) there shall be affixed, near the Maker's Responsibility Mark and his indication of purity, the official Hallmark, the head of a Saint-Bernard dog (illustrated below). Only precious metal watch cases must be hallmarked. Swiss hallmarking for other articles such as jewelry and cutlery is optional. In addition to the Swiss hallmark, all precious metal goods may be stamped with the Common Control Mark of the Vienna Convention.
## In the Netherlands
The Dutch, who are members of the International hallmarking Convention, have been striking hallmarks since at least 1814. Like many other nations, the Dutch require the registration and use of Responsibility Marks, however, perhaps somewhat unique, the Dutch publish a book entitled "Netherlands' Responsibility Marks since 1797" (in three volumes and in the English language) illustrating all the responsibility marks registered there since that time. This is significant since producers that exported precious metal good to the Netherlands would have been required to register their marks.
The Dutch government markets their assay services/office as the "Jewellery Gateway in and to Europe." The Netherlands' hallmarks are also recognized in other E.U. countries and thus can be sold in Austria, France, Ireland, Portugal, Spain and the United Kingdom without further testing. The Netherlands' hallmarks are also recognized in Belgium, Denmark, Finland and Sweden, which have voluntary hallmarking systems.
The Dutch assay office is located in Gouda between the Amsterdam and Rotterdam Airports. The Dutch recognize platinum, gold, silver and palladium as precious metals.
# Marking techniques
## Punching
Traditionally, the hallmarks are 'struck' using steel punches. Punches are made in different sizes, suitable for tiny pieces of jewelry to large silver platters. Punches are made in straight shank or ring shank, the former for normal punching with a hammer, and the later used with a press to mark rings. The problem with traditional punching is that the process of punching displaces metal, causing some distortion of the article being marked. This means that re-finishing of the article is required after hallmarking. For this reason, and that off-cuts from sprues are often used for assay, many articles are sent unfinished to the assay office for assay and hallmarking.
## Laser marking
A new method of marking using lasers is now available, which is especially valuable for delicate items and hollowware, which would be damaged or distorted by the punching process. Laser marking also means that finished articles do not need to be re-finished. Laser marking works by using high power lasers to evaporate material from the metal surface. Two methods exist, 2D and 3D laser marking. 2D laser marking burns the outline of the hallmarks into the object, while 3D laser marking better simulates the marks made by punching.
# Methods of assay
Precious metal items of art or jewelry are frequently hallmarked (depending upon the requirements of the laws of either the place of manufacture or the place of import). Where required to be hallmarked, semi-finished precious metal items of art or jewelry pass through the official testing channels where they are analyzed or assayed for precious metal content. While different nations permit a variety of legally acceptable finenesses, the assayer is actually testing to determine that the fineness of the product conforms with the statement or claim of fineness that the maker has claimed (usually by stamping a number such as 750 for 18k gold) on the item. In the past the assay was conducted by using the touchstone method but currently (most often) it is done using X-ray Fluorescence (XRF). XRF is used because this method is more exacting than the touchstone test. The most exact method of assay is known as fire assay or cupellation. This method is better suited for the assay of bullion and gold stocks rather than works or art or jewelry because it is a completely destructive method.
## The Touchstone
The age-old touchstone method is particularly suited to the testing of very valuable pieces, for which sampling by destructive means, such as scraping, cutting or drilling is unacceptable. A rubbing of the item is made on a special stone, treated with acids and the resulting color compared to references. Differences in precious metal content as small as 10 to 20 parts per thousand can often be established with confidence by the test. It is not indicated for use with white gold, for example, since the color variation among white gold alloys is almost imperceptible.
## X-Ray Fluorescence
The modern X-ray fluorescence is also a non-destructive technique that is suitable for normal assaying requirements. It typically has an accuracy of 2-5 parts per thousand and is well-suited to the relatively flat and large surfaces. It is a quick technique taking about three minutes, and the results can be automatically printed out by the computer. It also measures the content of the other alloying metals present. It is not indicated, however, for articles with chemical surface treatment or electroplating.
## The Fire Assay (Cupellation)
The most elaborate but totally destructive assay method is the fire-assay, also known as cupellation, with an accuracy of 1 part in 10,000. In this process the article is melted, the alloys separated and constituents weighed. Since this method is totally destructive, when this method is employed for the assay of jewelry, it is done under the guise random or selective sampling. For example if a single manufacturer deposits a lot of rings or watch cases, while most are assayed using the non-destructive methods a few pieces from the lot are randomly selected for fire assay.
## Other methods
There are methods of assay noted above which are more properly suited for finished goods while other methods are suitable for use on raw materials before artistic workmanship has begun. Raw precious metals (bullion or metal stock) are assayed by the following methods: silver is assayed by titration, gold is assayed by cupellation and platinum is assayed by ICP OES spectrometry. [1]
Template:CommonsCat | https://www.wikidoc.org/index.php/Hallmark | |
bf65640a7a2c22f84ac70985d8ff8339a00c4eec | wikidoc | Hangnail | Hangnail
A hangnail or agnail is a small, loose strip of torn skin near a fingernail or toenail. Hangnails are usually caused by dry skin or (in the case of fingernails) nail biting, and may be prevented with proper moisturization of the skin.
When attempting to remove a hangnail, additional skin may be painfully ripped off if its attachment is not broken properly. This may lead to a painful infection called paronychia. Therefore, hangnails should usually be cut using nail scissors or a nail clipper; biting them frequently makes it worse. People with a hangnail should be careful to cut it all off and rub hand lotion into the cuticles two to three times a day.
The term "hangnail" is misleading, as a hangnail is not an actual part of the nail. It's dead, dried skin, not nail, the latter being made up of mostly calcium and a fibrous protein, known as keratin.
# Etymology
Agnail is the Middle English term meaning "corn on the foot." It comes from the Old English term angnægl (from ang- tight/painful + nægl- nail). Agnail was adapted to hangnail by a process of folk etymology. | Hangnail
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
A hangnail or agnail is a small, loose strip of torn skin near a fingernail or toenail. Hangnails are usually caused by dry skin or (in the case of fingernails) nail biting, and may be prevented with proper moisturization of the skin.
When attempting to remove a hangnail, additional skin may be painfully ripped off if its attachment is not broken properly. This may lead to a painful infection called paronychia. Therefore, hangnails should usually be cut using nail scissors or a nail clipper; biting them frequently makes it worse. People with a hangnail should be careful to cut it all off and rub hand lotion into the cuticles two to three times a day. [1]
The term "hangnail" is misleading, as a hangnail is not an actual part of the nail. It's dead, dried skin, not nail, the latter being made up of mostly calcium and a fibrous protein, known as keratin.
# Etymology
Agnail is the Middle English term meaning "corn on the foot." It comes from the Old English term angnægl (from ang- tight/painful + nægl- nail). Agnail was adapted to hangnail by a process of folk etymology.[2] | https://www.wikidoc.org/index.php/Hangnail | |
94f0ad9ca7aab46730ec0f3a002155ec20275a82 | wikidoc | Hangover | Hangover
A hangover (veisalgia) describes the sum of unpleasant physiological effects following heavy consumption of drugs, particularly alcoholic beverages. The most commonly reported characteristics of a hangover include headache, nausea, sensitivity to light and noise, lethargy, dysphoria and thirst.
Hypoglycemia, dehydration, Acetaldehyde intoxication, and vitamin B12 deficiency are all theorized causes of hangover symptoms. Hangovers usually last 1 to 4 hours, but may last up to two or three days after alcohol was last consumed.
# Symptoms
An alcohol hangover is associated with a variety of symptoms that may include dehydration, fatigue, headache, nausea, vomiting, diarrhea, weakness, elevated body temperature, hypersalivation, difficulty concentrating, anxiety, irritability, sensitivity to light and noise, erratic motor functions, and trouble sleeping. Many people will also be repulsed by the thought or taste of alcohol during a hangover. The symptoms vary from person to person, and occasion to occasion, usually beginning several hours after drinking. It is not clear whether hangovers affect cognitive abilities.
# Causes
Hangovers are multi-causal. Ethanol has a dehydrating effect by causing increased urine production (such substances are known as diuretics), which causes headaches, dry mouth, and lethargy. Dehydration causes the brain to shrink away from the skull slightly. This can be mitigated by drinking water or an oral electrolyte solution after consumption of alcohol. Alcohol's effect on the stomach lining can account for nausea. Because of the increased NADH production during metabolism of ethanol by the enzymes alcohol dehydrogenase and aldehyde dehydrogenase, excess NADH can build up and slow down gluconeogenesis in the liver, thus causing hypoglycemia.
Another factor contributing to a hangover are the products from the breakdown of ethanol via liver enzymes. Ethanol is converted to acetaldehyde by the enzyme alcohol dehydrogenase, and then from acetaldehyde to acetic acid by the enzyme acetaldehyde dehydrogenase. Acetaldehyde (ethanal) is mildly toxic, contributing to hangover. These two reactions also require the conversion of NAD+ to NADH. With an excess of NADH, the lactate dehydrogenase reaction is driven to produce lactate from pyruvate (the end product of glycolysis) in order to regenerate NAD+ and sustain life. This diverts pyruvate from other pathways such as gluconeogenesis, thereby impairing the ability of the liver to supply glucose to tissues, especially the brain. Because glucose is the primary energy source of the brain, this lack of glucose contributes to hangover symptoms such as fatigue, weakness, mood disturbances, and decreased attention and concentration.
There are various nervous system effects: the removal of the depressive effects of alcohol in the brain probably account for the light and noise sensitivity.
In addition, it is thought that the presence of other alcohols (such as fusel oils), by-products of the alcoholic fermentation also called congeners, exaggerate many of the symptoms (cogeners may also be zinc or other metals added primarily to sweet liqueurs to enhance their flavor); this probably accounts for the mitigation of the effects when distilled alcohol, particularly vodka, is consumed instead.
The amount of congeners in the drink may also have an effect. Red wines have more congeners than white wines, and some people note less of a hangover with white wine. Some individuals have a strong negative reaction to red wine called red wine headache that can affect them within 15 minutes after drinking a single glass of red wine. The headache is usually accompanied by nausea and flushing.
In alcohol metabolism, one molecule of ethanol (the primary active ingredient in alcoholic beverages) produces 2 molecules of NADH, utilizing Vitamin B12 as a coenzyme. Over-consumption of ethanol may cause vitamin B12 deficiency as well.
# Possible remedies
There is debate about whether a hangover might be prevented or at least mitigated. There is currently no known proven mechanism for making oneself sober short of waiting for the body to metabolize ingested alcohol, which occurs via oxidation through the liver before alcohol leaves the body.
A four page literature review in British Medical Journal on hangover cures by Max Pittler of the Peninsula Medical School at Exeter University and colleagues concludes: "No compelling evidence exists to suggest that any conventional or complementary intervention is effective for preventing or treating alcohol hangover. The most effective way to avoid the symptoms of alcohol induced hangover is to practise moderation."
### Potentially beneficial remedies
- Rehydration: "Effective interventions include rehydration, prostaglandin inhibitors, and vitamin B6".
- Narcotics: Codeine, dihydrocodeine, tilidine and other such medication directly work against many of the effects of alcohol hangover. It is believed that analgesic preparations containing acetaminophen (paracetamol/Tylenol)may predispose people to the risk of potentially fatal hepatotoxicity. However, this is unproven and would potentially only occur if the maximal dose of acetaminophen was exceeded. Therefore, acetaminophen is a suitable agent at combating the symptomatic effects of a hangover. Consumption of narcotics along with alcohol or shortly after consumption thereof is potentially dangerous in itself because of added depressant effects on the central nervous system.
- Magnesium: It is well studied that excessive alcohol consumption can lead to a magnesium deficiency, or reduce levels of magnesium, as well as depleting zinc and other minerals. Individuals with lower magnesium levels may experience more severe hangovers. A healthy diet that contains an adequate intake of magnesium and other minerals may help in the long term to reduce the effects of hangovers. The hangover symptoms of headache, and light and sound sensitivity, are very similar to those of migraine. A common treatment for chronic migraine headaches is magnesium. Some scientists hypothesize that a hangover may be exhibiting at least some symptoms of an acute magnesium deficiency.
- Opuntia ficus indica: A 2004 clinical study suggests that taking an extract of a prickly pear cactus fruit (Opuntia ficus indica) five hours before drinking had a statistically significant effect on three hangover symptoms. "Three of the 9 symptoms – nausea, dry mouth, and anorexia – were significantly reduced by OFI." (Anorexia in this context simply means loss of appetite, not to be confused with anorexia nervosa.) The authors conclude, "The symptoms of the alcohol hangover are largely due to the activation of inflammation. An extract of the OFI plant has a moderate effect on reducing hangover symptoms, apparently by inhibiting the production of inflammatory mediators."
- Tolfenamic acid (TA): A study concludes, "TA was found significantly better than placebo in the subjective evaluation of drug efficacy (p<0.001) and in reducing the reported hangover symptoms in general (p < 0.01). In the TA group, significantly lower symptom scores were obtained for headache (p<0.01), and for nausea, vomiting, irritation, tremor, thirst, and dryness of mouth (all p < 0.05)."
- Vitamin B6 (pyritinol): Some studies have found that Vitamin B6 reduces hangovers.
- Chlormethiazole: "Chlormethiazole was found to lower blood pressure and adrenaline output and, furthermore, to relieve unpleasant physical symptoms, but did not affect fatigue and drowsiness. The cognitive test results were only slightly influenced by this agent, while psychomotor performance was significantly impaired. Subjects with severe subjective hangover seemed to benefit more from the chlormethiazole treatment than subjects with a mild hangover." "However, all 8 subjects had unpleasant nasal symptoms following chlormethiazole, and it is therefore not an ideal hypnotic for this age group."
- Rosiglitazone: "Rosiglitazone alleviated the symptoms of ethanol-induced hangover by inducing ALD2 expression…"
- Acetylcysteine: There are claims that N-acetylcysteine can relieve or prevent symptoms of hangover through scavenging of acetylaldehyde.
- "Artichoke and Sarsaparilla extract": A November 2004 issued U.S. Patent No. 6,824,798 states that the method described in the patent "results in complete elimination of veisalgia (hangover) in more than 80% of individuals". These plant extracts, when administered separately, do not seem to have a similar effect. The patent further states that the right combination of the extracts of both of these plants are required and that they then contain a complex of polyphenols, flavonoids, and phytosterols that are effective.
- Food and Water: Simple consumption of food and water may be enough to replenish lost moisture and at least rehydrate the body, making a hangover shorter.
### Possibly ineffective remedies
- Globe artichoke (Cynara scolymus) extract: "Our results suggest that artichoke extract is not effective in preventing the signs and symptoms of alcohol-induced hangover."
- Propranolol: "We conclude that propranolol does not prevent the symptoms of hangover."
- Fructose and glucose: "The results indicate that both fructose and glucose effectively inhibit the metabolic disturbances induced by ethanol but they do not affect the symptoms or signs of alcohol intoxication and hangover."
- Kudzu (Pueraria lobata): With respect to preventing hangovers, "The evidence regarding kudzu's effectiveness is mixed" and "There are no studies to demonstrate that kudzu can serve as a morning-after potion for eliminating hangovers as used in traditional Chinese practice."
# Etymology
The term hangover was originally a 19th century expression describing unfinished business – something left over from a meeting – or ‘survival.’ In 1904, the meaning "after-effect of drinking too much" first surfaced. | Hangover
Template:Inappropriate tone
A hangover (veisalgia) describes the sum of unpleasant physiological effects following heavy consumption of drugs, particularly alcoholic beverages. The most commonly reported characteristics of a hangover include headache, nausea, sensitivity to light and noise, lethargy, dysphoria and thirst.
Hypoglycemia, dehydration, Acetaldehyde intoxication, and vitamin B12 deficiency are all theorized causes of hangover symptoms. Hangovers usually last 1 to 4 hours,[1] but may last up to two or three days after alcohol was last consumed.[2]
# Symptoms
An alcohol hangover is associated with a variety of symptoms that may include dehydration, fatigue, headache, nausea, vomiting, diarrhea, weakness, elevated body temperature, hypersalivation, difficulty concentrating, anxiety, irritability, sensitivity to light and noise, erratic motor functions, and trouble sleeping. Many people will also be repulsed by the thought or taste of alcohol during a hangover. The symptoms vary from person to person, and occasion to occasion, usually beginning several hours after drinking. It is not clear whether hangovers affect cognitive abilities.
# Causes
Hangovers are multi-causal. Ethanol has a dehydrating effect by causing increased urine production (such substances are known as diuretics), which causes headaches, dry mouth, and lethargy. Dehydration causes the brain to shrink away from the skull slightly.[3] This can be mitigated by drinking water or an oral electrolyte solution after consumption of alcohol. Alcohol's effect on the stomach lining can account for nausea. Because of the increased NADH production during metabolism of ethanol by the enzymes alcohol dehydrogenase and aldehyde dehydrogenase, excess NADH can build up and slow down gluconeogenesis in the liver, thus causing hypoglycemia.
Another factor contributing to a hangover are the products from the breakdown of ethanol via liver enzymes. Ethanol is converted to acetaldehyde by the enzyme alcohol dehydrogenase, and then from acetaldehyde to acetic acid by the enzyme acetaldehyde dehydrogenase. Acetaldehyde (ethanal) is mildly toxic, contributing to hangover. These two reactions also require the conversion of NAD+ to NADH. With an excess of NADH, the lactate dehydrogenase reaction is driven to produce lactate from pyruvate (the end product of glycolysis) in order to regenerate NAD+ and sustain life. This diverts pyruvate from other pathways such as gluconeogenesis, thereby impairing the ability of the liver to supply glucose to tissues, especially the brain. Because glucose is the primary energy source of the brain, this lack of glucose contributes to hangover symptoms such as fatigue, weakness, mood disturbances, and decreased attention and concentration.
There are various nervous system effects: the removal of the depressive effects of alcohol in the brain probably account for the light and noise sensitivity.
In addition, it is thought that the presence of other alcohols (such as fusel oils), by-products of the alcoholic fermentation also called congeners, exaggerate many of the symptoms (cogeners may also be zinc or other metals added primarily to sweet liqueurs to enhance their flavor); this probably accounts for the mitigation of the effects when distilled alcohol, particularly vodka, is consumed instead.
The amount of congeners in the drink may also have an effect. Red wines have more congeners than white wines, and some people note less of a hangover with white wine. Some individuals have a strong negative reaction to red wine called red wine headache that can affect them within 15 minutes after drinking a single glass of red wine. The headache is usually accompanied by nausea and flushing.
In alcohol metabolism, one molecule of ethanol (the primary active ingredient in alcoholic beverages) produces 2 molecules of NADH, utilizing Vitamin B12 as a coenzyme. Over-consumption of ethanol may cause vitamin B12 deficiency as well.
# Possible remedies
There is debate about whether a hangover might be prevented or at least mitigated. There is currently no known proven mechanism for making oneself sober short of waiting for the body to metabolize ingested alcohol, which occurs via oxidation through the liver before alcohol leaves the body.
A four page literature review in British Medical Journal on hangover cures by Max Pittler of the Peninsula Medical School at Exeter University and colleagues concludes: "No compelling evidence exists to suggest that any conventional or complementary intervention is effective for preventing or treating alcohol hangover. The most effective way to avoid the symptoms of alcohol induced hangover is to practise moderation."[4]
### Potentially beneficial remedies
- Rehydration: "Effective interventions include rehydration, prostaglandin inhibitors, and vitamin B6".[5]
- Narcotics: Codeine, dihydrocodeine, tilidine and other such medication directly work against many of the effects of alcohol hangover. It is believed that analgesic preparations containing acetaminophen (paracetamol/Tylenol)may predispose people to the risk of potentially fatal hepatotoxicity. However, this is unproven and would potentially only occur if the maximal dose of acetaminophen was exceeded[6]. Therefore, acetaminophen is a suitable agent at combating the symptomatic effects of a hangover. Consumption of narcotics along with alcohol or shortly after consumption thereof is potentially dangerous in itself because of added depressant effects on the central nervous system.
- Magnesium: It is well studied that excessive alcohol consumption can lead to a magnesium deficiency, or reduce levels of magnesium, as well as depleting zinc and other minerals. Individuals with lower magnesium levels may experience more severe hangovers. A healthy diet that contains an adequate intake of magnesium and other minerals may help in the long term to reduce the effects of hangovers. The hangover symptoms of headache, and light and sound sensitivity, are very similar to those of migraine. A common treatment for chronic migraine headaches is magnesium. Some scientists hypothesize that a hangover may be exhibiting at least some symptoms of an acute magnesium deficiency.
- Opuntia ficus indica: A 2004 clinical study suggests that taking an extract of a prickly pear cactus fruit (Opuntia ficus indica) five hours before drinking had a statistically significant effect on three hangover symptoms. "Three of the 9 symptoms – nausea, dry mouth, and anorexia – were significantly reduced by OFI." (Anorexia in this context simply means loss of appetite, not to be confused with anorexia nervosa.)[7][8] The authors conclude, "The symptoms of the alcohol hangover are largely due to the activation of inflammation. An extract of the OFI plant has a moderate effect on reducing hangover symptoms, apparently by inhibiting the production of inflammatory mediators."
- Tolfenamic acid (TA): A study concludes, "TA was found significantly better than placebo in the subjective evaluation of drug efficacy (p<0.001) and in reducing the reported hangover symptoms in general (p < 0.01). In the TA group, significantly lower symptom scores were obtained for headache (p<0.01), and for nausea, vomiting, irritation, tremor, thirst, and dryness of mouth (all p < 0.05)."[9]
- Vitamin B6 (pyritinol): Some studies have found that Vitamin B6 reduces hangovers.[5][10]
- Chlormethiazole: "Chlormethiazole was found to lower blood pressure and adrenaline output and, furthermore, to relieve unpleasant physical symptoms, but did not affect fatigue and drowsiness. The cognitive test results were only slightly influenced by this agent, while psychomotor performance was significantly impaired. Subjects with severe subjective hangover seemed to benefit more from the chlormethiazole treatment than subjects with a mild hangover."[11] "However, all 8 subjects had unpleasant nasal symptoms following chlormethiazole, and it is therefore not an ideal hypnotic for this age group."[12]
- Rosiglitazone: [Study in rats] "Rosiglitazone alleviated the symptoms of ethanol-induced hangover by inducing ALD2 expression…"[13]
- Acetylcysteine: There are claims that N-acetylcysteine can relieve or prevent symptoms of hangover through scavenging of acetylaldehyde.
- "Artichoke and Sarsaparilla extract": A November 2004 issued U.S. Patent No. 6,824,798 states that the method described in the patent "results in complete elimination of veisalgia (hangover) in more than 80% of individuals". These plant extracts, when administered separately, do not seem to have a similar effect. The patent further states that the right combination of the extracts of both of these plants are required and that they then contain a complex of polyphenols, flavonoids, and phytosterols that are effective.
- Food and Water: Simple consumption of food and water may be enough to replenish lost moisture and at least rehydrate the body, making a hangover shorter.
### Possibly ineffective remedies
- Globe artichoke (Cynara scolymus) extract: "Our results suggest that artichoke extract is not effective in preventing the signs and symptoms of alcohol-induced hangover."[14]
- Propranolol: "We conclude that propranolol does not prevent the symptoms of hangover."[15][16]
- Fructose and glucose: "The results indicate that both fructose and glucose effectively inhibit the metabolic disturbances induced by ethanol but they do not affect the symptoms or signs of alcohol intoxication and hangover."[17]
- Kudzu (Pueraria lobata): With respect to preventing hangovers, "The evidence regarding kudzu's effectiveness is mixed" and "There are no studies to demonstrate that kudzu can serve as a morning-after potion for eliminating hangovers as used in traditional Chinese practice."[18]
# Etymology
Template:Wiktionarypar
Template:Wiktionarypar
The term hangover was originally a 19th century expression describing unfinished business – something left over from a meeting – or ‘survival.’ In 1904, the meaning "after-effect of drinking too much" first surfaced.[19][20] | https://www.wikidoc.org/index.php/Hangover | |
53e16416adbe4987a4fa173e84b7b1865fc3fde3 | wikidoc | Hardness | Hardness
Hardness refers to various properties of matter in the solid phase that give it high resistance to various kinds of shape change when force is applied. Hard matter is contrasted with soft matter.
Macroscopic hardness is generally characterized by strong intermolecular bonds. However, the behavior of solid materials under force is complex, resulting in several different scientific definitions of what might be called "hardness" in everyday usage.
In materials science, there are three principal operational definitions of hardness:
- Scratch hardness: Resistance to fracture or plastic (permanent) deformation due to friction from a sharp object
- Indentation hardness: Resistance to plastic (permanent) deformation due to impact from a sharp object
- Rebound hardness: Height of the bounce of an object dropped on the material, related to elasticity.
In physics, hardness encompasses:
- Elasticity, plasticity, viscosity, and viscoelasticity
- Strength and strain
- Brittleness/ductility and toughness
# Materials science
In materials science, hardness is the characteristic of a solid material expressing its resistance to permanent deformation. Hardness can be measured on the Mohs scale or various other scales. Some of the other scales used for indentation hardness in engineering—Rockwell, Vickers, and Brinell—can be compared using practical conversion tables.
## Scratch hardness
In mineralogy, hardness commonly refers to a material's ability to penetrate softer materials. An object made of a hard material will scratch an object made of a softer material. Scratch hardness is usually measured on the Mohs scale of mineral hardness. One tool to make this measurement is the sclerometer.
Pure diamond is the hardest known natural mineral substance and will scratch any other natural material. Diamond is therefore used to cut other diamonds; in particular, higher-grade diamonds are used to cut lower-grade diamonds.
The hardest substance known today is aggregated diamond nanorods, with a hardness 1.11 times diamond. Estimates from proposed molecular structure indicate the hardness of beta carbon nitride should also be greater than diamond (but less than ultrahard fullerite). This material has not yet been successfully synthesized.
## Indentation hardness
Primarily used in engineering and metallurgy, indentation hardness seeks to characterise a material's hardness; i.e. its resistance to permanent, and in particular plastic, deformation. It is usually measured by loading an indenter of specified geometry onto the material and measuring the dimensions of the resulting indentation.
There are several alternative definitions of indentation hardness, the most common of which are
- Brinell hardness test (HB);
- Janka Wood Hardness Rating;
- Knoop hardness test (HK) or microhardness test, for measurement over small areas;
- Meyer hardness test;
- Rockwell hardness test (HR), principally used in the USA;
- Shore durometer hardness, used for polymers;
- Vickers hardness test (HV), has one of the widest scales;
- Barcol hardness test, for composite materials, scale from 0 to 100.
There is, in general, no simple relationship between the results of different hardness tests. Though there are practical conversion tables for hard steels, for example, some materials show qualitatively different behaviours under the various measurement methods.
Hardness increases with decreasing particle size. This is known as the Hall-Petch effect. However, below a critical grain-size, hardness decreases with decreasing grain size. This is known as the inverse Hall-Petch effect.
For measuring hardness of nanograined materials, nanoindentation is used.
In the December 4, 2005 issue of The Jerusalem Post, Professors Eli Altus, Harold Basch and Shmaryahu Hoz, with doctoral student Lior Itzhaki reported the discovery of a polyyne that is 40 times harder than diamond. It is a "superhard" molecular rod, comprised of acetylene units.
It is important to note that hardness of a material to deformation is dependent to its microdurability or small-scale shear modulus in any direction, not to any rigidity or stiffness properties such as the bulk modulus or Young's modulus. Scientists and journalists often confuse stiffness for hardness, and spuriously report materials that are not actually harder than diamond because the anisotropy of their solid cells compromise hardness in other dimensions, resulting in a material prone to spalling and flaking in squamose or acicular habits in that dimension. e.g., Osmium is stiffer than diamond but is as hard as quartz. In other words, a claimed hard material should have similar hardness characteristics at any location on its surface.
## Rebound hardness
Also known as dynamic hardness, rebound hardness measures the height of the "bounce" of a diamond-tipped hammer dropped from a fixed height onto a material. The device used to take this measurement is known as a scleroscope.
One scale that measures rebound hardness is the Bennett Hardness Scale.
# Physics
In solid mechanics, solids generally have three responses to force, depending on the amount of force and the type of material:
- They exhibit elasticity—the ability to temporarily change shape, but return to the original shape when the pressure is removed. "Hardness" in the elastic range—a small temporary change in shape for a given force—is known as stiffness in the case of a given object, or a high elastic modulus in the case of a material.
- They exhibit plasticity—the ability to permanently change shape in response to the force, but remain in one piece. The yield strength is the point at which elastic deformation gives way to plastic deformation. Deformation in the plastic range is non-linear, and is described by the stress-strain curve. This response produces the observed properties of scratch and indentation hardness, as described and measured in materials science. Some materials exhibit both elasticity and viscosity when undergoing plastic deformation; this is called viscoelasticity.
- They fracture—split into two or more pieces. The "ultimate strength" or toughness of an object is the point at which fracture occurs.
Strength is a measure of the extent of a material's elastic range, or elastic and plastic ranges together. This is quantified as compressive strength, shear strength, tensile strength depending on the direction of the forces involved. Ultimate strength is measure of the maximum strain a material can withstand.
Brittleness, in technical usage, is the tendency of a material to fracture with very little or no detectable deformation beforehand. Thus in technical terms, a material can be both brittle and strong. In everyday usage "brittleness" usually refers to the tendency to fracture under a small amount of force, which exhibits both brittleness and a lack of strength (in the technical sense). For brittle materials, yield strength and ultimate strength are the same, because they do not experience detectable plastic deformation. The opposite of brittleness is ductility.
The toughness of a material is the maximum amount of energy it can absorb before fracturing, which is different than the amount of force that can be applied. Toughness tends to be small for brittle materials, because it is elastic and plastic deformations that allow materials to absorb large amounts of energy.
Materials whose properties are different in different directions (because of an asymmetrical crystal structure) are referred to as anisotropic.
# Examples of hard matter
- Ceramics
- Composites
- Metals
- Semiconductors | Hardness
Template:This
Hardness refers to various properties of matter in the solid phase that give it high resistance to various kinds of shape change when force is applied. Hard matter is contrasted with soft matter.
Macroscopic hardness is generally characterized by strong intermolecular bonds. However, the behavior of solid materials under force is complex, resulting in several different scientific definitions of what might be called "hardness" in everyday usage.
In materials science, there are three principal operational definitions of hardness:
- Scratch hardness: Resistance to fracture or plastic (permanent) deformation due to friction from a sharp object
- Indentation hardness: Resistance to plastic (permanent) deformation due to impact from a sharp object
- Rebound hardness: Height of the bounce of an object dropped on the material, related to elasticity.
In physics, hardness encompasses:
- Elasticity, plasticity, viscosity, and viscoelasticity
- Strength and strain
- Brittleness/ductility and toughness
# Materials science
In materials science, hardness is the characteristic of a solid material expressing its resistance to permanent deformation. Hardness can be measured on the Mohs scale or various other scales. Some of the other scales used for indentation hardness in engineering—Rockwell, Vickers, and Brinell—can be compared using practical conversion tables.
## Scratch hardness
In mineralogy, hardness commonly refers to a material's ability to penetrate softer materials. An object made of a hard material will scratch an object made of a softer material. Scratch hardness is usually measured on the Mohs scale of mineral hardness. One tool to make this measurement is the sclerometer.
Pure diamond is the hardest known natural mineral substance and will scratch any other natural material. Diamond is therefore used to cut other diamonds; in particular, higher-grade diamonds are used to cut lower-grade diamonds.
The hardest substance known today is aggregated diamond nanorods, with a hardness 1.11 times diamond. Estimates from proposed molecular structure indicate the hardness of beta carbon nitride should also be greater than diamond (but less than ultrahard fullerite). This material has not yet been successfully synthesized.
## Indentation hardness
Template:Sync
Primarily used in engineering and metallurgy, indentation hardness seeks to characterise a material's hardness; i.e. its resistance to permanent, and in particular plastic, deformation. It is usually measured by loading an indenter of specified geometry onto the material and measuring the dimensions of the resulting indentation.
There are several alternative definitions of indentation hardness, the most common of which are
- Brinell hardness test (HB);
- Janka Wood Hardness Rating;
- Knoop hardness test (HK) or microhardness test, for measurement over small areas;
- Meyer hardness test;
- Rockwell hardness test (HR), principally used in the USA;
- Shore durometer hardness, used for polymers;
- Vickers hardness test (HV), has one of the widest scales;
- Barcol hardness test, for composite materials, scale from 0 to 100.
There is, in general, no simple relationship between the results of different hardness tests. Though there are practical conversion tables for hard steels, for example, some materials show qualitatively different behaviours under the various measurement methods.
Hardness increases with decreasing particle size. This is known as the Hall-Petch effect. However, below a critical grain-size, hardness decreases with decreasing grain size. This is known as the inverse Hall-Petch effect.
For measuring hardness of nanograined materials, nanoindentation is used.
In the December 4, 2005 issue of The Jerusalem Post, Professors Eli Altus, Harold Basch and Shmaryahu Hoz, with doctoral student Lior Itzhaki reported the discovery of a polyyne that is 40 times harder than diamond. It is a "superhard" molecular rod, comprised of acetylene units.
It is important to note that hardness of a material to deformation is dependent to its microdurability or small-scale shear modulus in any direction, not to any rigidity or stiffness properties such as the bulk modulus or Young's modulus. Scientists and journalists often confuse stiffness for hardness[1][2], and spuriously report materials that are not actually harder than diamond because the anisotropy of their solid cells compromise hardness in other dimensions, resulting in a material prone to spalling and flaking in squamose or acicular habits in that dimension. e.g., Osmium is stiffer than diamond but is as hard as quartz. In other words, a claimed hard material should have similar hardness characteristics at any location on its surface.
## Rebound hardness
Also known as dynamic hardness, rebound hardness measures the height of the "bounce" of a diamond-tipped hammer dropped from a fixed height onto a material. The device used to take this measurement is known as a scleroscope.
[3]
One scale that measures rebound hardness is the Bennett Hardness Scale.
# Physics
In solid mechanics, solids generally have three responses to force, depending on the amount of force and the type of material:
- They exhibit elasticity—the ability to temporarily change shape, but return to the original shape when the pressure is removed. "Hardness" in the elastic range—a small temporary change in shape for a given force—is known as stiffness in the case of a given object, or a high elastic modulus in the case of a material.
- They exhibit plasticity—the ability to permanently change shape in response to the force, but remain in one piece. The yield strength is the point at which elastic deformation gives way to plastic deformation. Deformation in the plastic range is non-linear, and is described by the stress-strain curve. This response produces the observed properties of scratch and indentation hardness, as described and measured in materials science. Some materials exhibit both elasticity and viscosity when undergoing plastic deformation; this is called viscoelasticity.
- They fracture—split into two or more pieces. The "ultimate strength" or toughness of an object is the point at which fracture occurs.
Strength is a measure of the extent of a material's elastic range, or elastic and plastic ranges together. This is quantified as compressive strength, shear strength, tensile strength depending on the direction of the forces involved. Ultimate strength is measure of the maximum strain a material can withstand.
Brittleness, in technical usage, is the tendency of a material to fracture with very little or no detectable deformation beforehand. Thus in technical terms, a material can be both brittle and strong. In everyday usage "brittleness" usually refers to the tendency to fracture under a small amount of force, which exhibits both brittleness and a lack of strength (in the technical sense). For brittle materials, yield strength and ultimate strength are the same, because they do not experience detectable plastic deformation. The opposite of brittleness is ductility.
The toughness of a material is the maximum amount of energy it can absorb before fracturing, which is different than the amount of force that can be applied. Toughness tends to be small for brittle materials, because it is elastic and plastic deformations that allow materials to absorb large amounts of energy.
Materials whose properties are different in different directions (because of an asymmetrical crystal structure) are referred to as anisotropic.
# Examples of hard matter
- Ceramics
- Composites
- Metals
- Semiconductors | https://www.wikidoc.org/index.php/Hardness | |
66d7232171ee3ba0e1a49386b1f516fb0235d828 | wikidoc | Headgear | Headgear
# Headgear
Headgear is an appliance attached to dental braces that aid in correcting severe bite problems.
The most common treatment they are used for is correcting anteroposterior discrepancies - for instance the top teeth being too far forward relative to the lower teeth ("increased overjet".) The headgear is attached to the braces via metal hooks or a facebow and is anchored from the back of the head or neck with straps or a head-cap. Elastic bands are typically then used to apply pressure to the bow or hooks. Its purpose is to slow-down or stops the upper jaw from growing, hence preventing or correcting an overjet.
There is another type of headgear to treat reverse overjets (where the top jaw is not forward enough.) It is similar to a facemask, also attached to braces, and encourages forward growth of the upper jaw.
The headgear can also be used to make more space for teeth to come in. The headgear is then attached to the molars (via molar headgear bands & tubes), and helps to draw them backwards in the mouth, opening up space for the front teeth to be moved back using braces and bands.
Initially this can be embarrassing for children, however most doctors agree that children and adolescence adapt quickly to such changes and requirements. Parents should be aware that their child may be subject to mocking for wearing headgear although children and teenagers, friends and school peers normally get used to the new appliance after just a few weeks if full-time wear (i.e. 16 to 22 hours a day) is required. However, some orthodontists only require 12 hours per night.
They often must have multiple appliances and accessories to go along with their headgear, such as coil springs, plates or retainers and elastic bands.
The vast majority of patients receiving this type treatment are children and adolescence however adults sometimes are required to wear such appliances.
The need for headgear is a useful appliance for orthodontic specialists and it has increased somewhat as less and less orthodontists use temporary implants ("temporary anchorage devices") inside the patients mouth, to perform the same tooth movements.
# Facemask
Facemask or Reverse-pull Headgear is an orthodontic appliance typically used in growing patients to correct under bites (known as a Class III orthodontic problem) by pulling forward and assisting the growth of the upper jaw (the maxillary), allowing the upper jaw (mandibular bone) to catch up.
Facemasks or Reverse-pull Headgear needs to be worn approximately 12 to 22 hrs to be truly effective in correcting the under bite, usually anywhere from 6 to 18 months depending on the severity of the bite and how much a patient is growing.
The appliance normally consists of a frame or a centre bars that are strapped to the patients head during a fitting appointment. The frame has a section which is positioned in-front of the patients mouth, which allows for the attachment of elastic or rubber bands directly into the mouth area. These elastics are then hooked onto the child's braces (brackets and bands) or appliance fitted in his or her mouth. This creates a forward 'pulling' force to pull the upper jaw forward.
# Application
The orthodontic facemask will consist of three major components:
- Face frame: firstly the face-frame, is a metal and plastic structure which is adjusted to fit onto the patients face. The frame normally is stabilised on the child's face with the aid of a "chin cup" and a "forehead pad". These are padded to ensure patient comfort. The frame typically as a "mouth-yoke" which the orthodontist will adjust so it is positioned in-font of the patients mouth. The mouth yoke has a number of hooks (4 to 6 depending on type - see photo with 6 hooks) which allows the orthodontist to attach elastics or springs directly into the patients mouth. The frame allows the patient to move his or her head freely and to talk. All other oral activates are however restricted although drinking is recommended with a straw so as not to remove the whole appliance at night or in the day when thirsty.
- Head-cap: some facemasks and all reverse-pull headgear have a second part which consists of a head-cap, and is made up of a number of straps fitting around the patients head. In this case the head-cap is used to stabilise the face-frame described above and to ensure it is held correctly in position (see photo example of reverse-pull headgear with head-strap / cap).
- Attachment: the third and final component is the mouth attachment, typically using rubber bands, elastics or springs - joins the face-mask from the mouth-yoke, into the patients mouth. The elastics hook on the child's braces or other such suitable oral appliance. As the elastics are flexible up to six elastics may be used to provide various forward and sideways forces on the patients teeth and arch, while still allowing the patient to open and close his / her jaws.
In some cases it will be required to use surgery and a face-mask / reverse-pull headgear, although many parents and doctors recommend using early intervention (ages 7 to 13) using a facemask to avoid costly and painful surgical procedures later.
The appliance is very effective in correcting Class III orthodontic problems in younger or adolescent patients that are still growing however as parents, your orthodontist will provide you with all the information required for your child.
Initially it can be difficult for children to wear a mask or headgear, however most doctors and parents agree that children and adolescence adapt quickly to such changes and requirements. Parents should be aware that their child is often better-off wearing a facemask or headgear to avoid later surgery and the patient, friends and school peers normally get used to the new appliance after just a few weeks of full-time wear (i.e. 16 to 22 hours a day).
# Image Gallery
- Facemask or reverse-pull headgear with straps hooks for connection of elastic bands into the patients mouth, typically worn 12 to 22 hours a day depending on treatment plan. | Headgear
Editor in Chief: Berna Zorkun DMD [1]
# Headgear
Headgear is an appliance attached to dental braces that aid in correcting severe bite problems.
The most common treatment they are used for is correcting anteroposterior discrepancies - for instance the top teeth being too far forward relative to the lower teeth ("increased overjet".) The headgear is attached to the braces via metal hooks or a facebow and is anchored from the back of the head or neck with straps or a head-cap. Elastic bands are typically then used to apply pressure to the bow or hooks. Its purpose is to slow-down or stops the upper jaw from growing, hence preventing or correcting an overjet.
There is another type of headgear to treat reverse overjets (where the top jaw is not forward enough.) It is similar to a facemask, also attached to braces, and encourages forward growth of the upper jaw.
The headgear can also be used to make more space for teeth to come in. The headgear is then attached to the molars (via molar headgear bands & tubes), and helps to draw them backwards in the mouth, opening up space for the front teeth to be moved back using braces and bands.
Initially this can be embarrassing for children, however most doctors agree that children and adolescence adapt quickly to such changes and requirements. Parents should be aware that their child may be subject to mocking for wearing headgear although children and teenagers, friends and school peers normally get used to the new appliance after just a few weeks if full-time wear (i.e. 16 to 22 hours a day) is required. However, some orthodontists only require 12 hours per night.
They often must have multiple appliances and accessories to go along with their headgear, such as coil springs, plates or retainers and elastic bands.
The vast majority of patients receiving this type treatment are children and adolescence however adults sometimes are required to wear such appliances.
The need for headgear is a useful appliance for orthodontic specialists and it has increased somewhat as less and less orthodontists use temporary implants ("temporary anchorage devices") inside the patients mouth, to perform the same tooth movements.
# Facemask
Facemask or Reverse-pull Headgear is an orthodontic appliance typically used in growing patients to correct under bites (known as a Class III orthodontic problem) by pulling forward and assisting the growth of the upper jaw (the maxillary), allowing the upper jaw (mandibular bone) to catch up.
Facemasks or Reverse-pull Headgear needs to be worn approximately 12 to 22 hrs to be truly effective in correcting the under bite, usually anywhere from 6 to 18 months depending on the severity of the bite and how much a patient is growing.
The appliance normally consists of a frame or a centre bars that are strapped to the patients head during a fitting appointment. The frame has a section which is positioned in-front of the patients mouth, which allows for the attachment of elastic or rubber bands directly into the mouth area. These elastics are then hooked onto the child's braces (brackets and bands) or appliance fitted in his or her mouth. This creates a forward 'pulling' force to pull the upper jaw forward.
# Application
The orthodontic facemask will consist of three major components:
- Face frame: firstly the face-frame, is a metal and plastic structure which is adjusted to fit onto the patients face. The frame normally is stabilised on the child's face with the aid of a "chin cup" and a "forehead pad". These are padded to ensure patient comfort. The frame typically as a "mouth-yoke" which the orthodontist will adjust so it is positioned in-font of the patients mouth. The mouth yoke has a number of hooks (4 to 6 depending on type - see photo with 6 hooks) which allows the orthodontist to attach elastics or springs directly into the patients mouth. The frame allows the patient to move his or her head freely and to talk. All other oral activates are however restricted although drinking is recommended with a straw so as not to remove the whole appliance at night or in the day when thirsty.
- Head-cap: some facemasks and all reverse-pull headgear have a second part which consists of a head-cap, and is made up of a number of straps fitting around the patients head. In this case the head-cap is used to stabilise the face-frame described above and to ensure it is held correctly in position (see photo example of reverse-pull headgear with head-strap / cap).
- Attachment: the third and final component is the mouth attachment, typically using rubber bands, elastics or springs - joins the face-mask from the mouth-yoke, into the patients mouth. The elastics hook on the child's braces or other such suitable oral appliance. As the elastics are flexible up to six elastics may be used to provide various forward and sideways forces on the patients teeth and arch, while still allowing the patient to open and close his / her jaws.
In some cases it will be required to use surgery and a face-mask / reverse-pull headgear, although many parents and doctors recommend using early intervention (ages 7 to 13) using a facemask to avoid costly and painful surgical procedures later.
The appliance is very effective in correcting Class III orthodontic problems in younger or adolescent patients that are still growing however as parents, your orthodontist will provide you with all the information required for your child.
Initially it can be difficult for children to wear a mask or headgear, however most doctors and parents agree that children and adolescence adapt quickly to such changes and requirements. Parents should be aware that their child is often better-off wearing a facemask or headgear to avoid later surgery and the patient, friends and school peers normally get used to the new appliance after just a few weeks of full-time wear (i.e. 16 to 22 hours a day).
# Image Gallery
- Facemask or reverse-pull headgear with straps hooks for connection of elastic bands into the patients mouth, typically worn 12 to 22 hours a day depending on treatment plan.
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Headgear | |
17ec7f11e4c3e0a6b5b7e8a4a4f02d7f79355520 | wikidoc | Heat map | Heat map
A heat map is a graphical representation of data where the values taken by a variable in a two-dimensional map are represented as colours. A very similar presentation form is a Tree map.
Heat maps are typically used in Molecular Biology to represent the level of expression of many genes across a number of comparable samples (e.g. cells in different states, samples from different patients) as they are obtained from DNA microarrays.
Heat maps are also used in places where the data is volatile and representation of this data as a heat map improves usablity. For example, NASDAQ uses heat maps to show the NASDAQ 100 index volatility. There are also heat maps for showing the housing price in various regions. | Heat map
A heat map is a graphical representation of data where the values taken by a variable in a two-dimensional map are represented as colours. A very similar presentation form is a Tree map.
Heat maps are typically used in Molecular Biology to represent the level of expression of many genes across a number of comparable samples (e.g. cells in different states, samples from different patients) as they are obtained from DNA microarrays.
Heat maps are also used in places where the data is volatile and representation of this data as a heat map improves usablity. For example, NASDAQ uses heat maps to show the NASDAQ 100 index volatility. There are also heat maps for showing the housing price in various regions. | https://www.wikidoc.org/index.php/Heat_map | |
3484740a888d128e61695cda5299d820639f6f95 | wikidoc | Miliaria | Miliaria
Synonyms and keywords: Miliaria rubra, sweat gland, prickly heat.
# Overview
Miliaria (miliaria rubra, sweat rash or prickly heat) is a skin disease marked by small and itchy rashes. Miliaria is a common ailment in hot and humid conditions, such as in the tropics and during the summer season. Although it affects people of all ages, it is especially common in children and infants due to their underdeveloped sweat glands.
# Pathology
Miliaria (Prickly Heat) occurs when the sweat gland ducts get plugged due to dead skin cells or bacteria such as Staphylococcus epidermidis, a common bacterium that occurs on the skin which is also associated with acne. The trapped sweat leads to irritation (prickling), itching and to a rash of very small blisters, usually in a localized area of the skin. Drugs namely Diflorasone can increase the risk of Miliaria.
# Clinical features
Symptoms of miliaria include small red rashes, called papules, which may itch or more often cause an intense 'pins-and-needles' prickling sensation. These rashes may simultaneously occur at a number of areas on a sufferer's body, the most common including the face, neck, under the breasts and under the scrotum. Other areas include skin folds, areas of the body that may rub against clothing, such as the back, chest, and stomach, etc. A related and sometimes simultaneous condition is folliculitis, where hair follicles become plugged with foreign matter, resulting in inflammation.
The symptoms relating to miliaria should not be confused with shingles as they can be very similar. Shingles will restrict itself to one side of the body but also has a rash-like appearance. It is also accompanied by a prickling sensation and pain throughout the region. Those who suspect they have shingles and not miliaria should seek medical advice immediately as the sooner antivirals are taken, the better.
# Classification of miliaria
Miliaria can be classified according to the level at which obstruction occurs in the sweat glands. The most superficial obstruction (with the most mild clinical presentation), is known as miliaria crystallina; instead of a rash the patient presents with multiple tiny blister-like lesions that look like beads of perspiration and essentially cause no symptoms.
The most commonly encountered form of the illness is miliaria rubra, in which obstruction causes leakage of sweat into the deeper layers of the epidermis, provoking a local inflammatory reaction giving rise to the typical appearance of redness (hence rubra) and larger (but still only a few millimetres) blister-like lesions. This form of the illness is often accompanied by the typical symptoms - intense itching or "pins and needles" with a lack of sweating (anhidrosis) to affected areas. There is a small risk of heat exhaustion due to inability to sweat if the rash affects a large proportion of the body's surface area and/or the sufferer continues to engage in heat-producing activity.
The most severe form of miliaria, miliaria profunda, generally occurs as a complication of repeated episodes of miliaria rubra. The obstruction is located deep in the structure of the sweat gland, causing the gland's secretions to leak between the superficial and deep layers of the skin. The rash, and associated symptoms, tend to break out within hours of an activity provoking sweating but similarly fade within hours when the stimulus for the sweating is removed. The rash tends to be flesh-coloured as opposed to the prominent redness of miliaria rubra, and the risk of heat exhaustion is larger.
# Physical examination
## Gallery
### Skin
- url = >
- url = >
- url = >
- url = >
### Trunk
- url = >
- url = >
- url = >
- url = >
- url = >
- url = >
### Extremities
- url = >
- url = >
# Prevention
Prickly heat can be prevented by avoiding activities that induce sweating, using air conditioning to cool the environment, wearing light clothing and in general, avoiding hot and humid weather. If that is not possible, and especially if air conditioning is unavailable or unaffordable, then taking multiple showers throughout the day (and night as well if needed) to unplug and clean the sweat glands is the best defense against it.
# Treatment
Medical assistance should be sought for the first episode of a rash with the appearance of miliaria. The differential includes several conditions which an experienced practitioner should be able to recognise and may require treatment distinct from the usual measures taken for miliaria. In most cases the rash of miliaria will resolve without intervention. However, severe cases can last for a number of weeks and cause significant disability. General measures should be recommended for all patients, including moving to an air-conditioned environment if possible, avoiding sweat-provoking activities and occlusive clothing, and taking frequent cool showers.
It has been suggested that the use of topical antibacterials (including the use of antibacterial soaps) may shorten the duration of symptoms in miliaria rubra even in the absence of obvious superinfection. Other topical agents which may reduce the severity of symptoms include anti-itch preparations such as calamine or menthol and/or camphor based preparations, and topical steroid creams, however caution should be used with oil-based preparations (ointments and oily creams as opposed to water based or aqueous lotions) which may increase blockage to the sweat glands and prolong duration of illness. Other agents have been investigated including supplemental vitamin A and C and vitamin A based medications, but it is worth noting that there is little scientific evidence supporting any of the above treatments in terms of actually reducing the duration of symptoms or frequency of complications.
In cases where the rash has developed into open blisters or pustular lesions a doctor should be consulted as other (less benign) conditions should be excluded and/or more aggressive treatment may be required. | Miliaria
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Jesus Rosario Hernandez, M.D. [2].
Synonyms and keywords: Miliaria rubra, sweat gland, prickly heat.
# Overview
Miliaria (miliaria rubra, sweat rash or prickly heat) is a skin disease marked by small and itchy rashes. Miliaria is a common ailment in hot and humid conditions, such as in the tropics and during the summer season. Although it affects people of all ages, it is especially common in children and infants due to their underdeveloped sweat glands.
# Pathology
Miliaria (Prickly Heat) occurs when the sweat gland ducts get plugged due to dead skin cells or bacteria such as Staphylococcus epidermidis, a common bacterium that occurs on the skin which is also associated with acne. The trapped sweat leads to irritation (prickling), itching and to a rash of very small blisters, usually in a localized area of the skin. Drugs namely Diflorasone can increase the risk of Miliaria.
# Clinical features
Symptoms of miliaria include small red rashes, called papules, which may itch or more often cause an intense 'pins-and-needles' prickling sensation. These rashes may simultaneously occur at a number of areas on a sufferer's body, the most common including the face, neck, under the breasts and under the scrotum. Other areas include skin folds, areas of the body that may rub against clothing, such as the back, chest, and stomach, etc. A related and sometimes simultaneous condition is folliculitis, where hair follicles become plugged with foreign matter, resulting in inflammation.
The symptoms relating to miliaria should not be confused with shingles as they can be very similar. Shingles will restrict itself to one side of the body but also has a rash-like appearance. It is also accompanied by a prickling sensation and pain throughout the region. Those who suspect they have shingles and not miliaria should seek medical advice immediately as the sooner antivirals are taken, the better.
# Classification of miliaria
Miliaria can be classified according to the level at which obstruction occurs in the sweat glands. The most superficial obstruction (with the most mild clinical presentation), is known as miliaria crystallina; instead of a rash the patient presents with multiple tiny blister-like lesions that look like beads of perspiration and essentially cause no symptoms.[1]
The most commonly encountered form of the illness is miliaria rubra, in which obstruction causes leakage of sweat into the deeper layers of the epidermis, provoking a local inflammatory reaction giving rise to the typical appearance of redness (hence rubra) and larger (but still only a few millimetres) blister-like lesions. This form of the illness is often accompanied by the typical symptoms - intense itching or "pins and needles" with a lack of sweating (anhidrosis) to affected areas. There is a small risk of heat exhaustion due to inability to sweat if the rash affects a large proportion of the body's surface area and/or the sufferer continues to engage in heat-producing activity.
The most severe form of miliaria, miliaria profunda, generally occurs as a complication of repeated episodes of miliaria rubra. The obstruction is located deep in the structure of the sweat gland, causing the gland's secretions to leak between the superficial and deep layers of the skin. The rash, and associated symptoms, tend to break out within hours of an activity provoking sweating but similarly fade within hours when the stimulus for the sweating is removed. The rash tends to be flesh-coloured as opposed to the prominent redness of miliaria rubra, and the risk of heat exhaustion is larger.
# Physical examination
## Gallery
### Skin
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
### Trunk
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=292>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=292>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=292>
### Extremities
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
- url = http://www.atlasdermatologico.com.br/disease.jsf?diseaseId=291>
# Prevention
Prickly heat can be prevented by avoiding activities that induce sweating, using air conditioning to cool the environment, wearing light clothing and in general, avoiding hot and humid weather. If that is not possible, and especially if air conditioning is unavailable or unaffordable, then taking multiple showers throughout the day (and night as well if needed) to unplug and clean the sweat glands is the best defense against it.
# Treatment
Medical assistance should be sought for the first episode of a rash with the appearance of miliaria. The differential includes several conditions which an experienced practitioner should be able to recognise and may require treatment distinct from the usual measures taken for miliaria. In most cases the rash of miliaria will resolve without intervention. However, severe cases can last for a number of weeks and cause significant disability. General measures should be recommended for all patients, including moving to an air-conditioned environment if possible, avoiding sweat-provoking activities and occlusive clothing, and taking frequent cool showers.
It has been suggested that the use of topical antibacterials (including the use of antibacterial soaps) may shorten the duration of symptoms in miliaria rubra even in the absence of obvious superinfection. Other topical agents which may reduce the severity of symptoms include anti-itch preparations such as calamine or menthol and/or camphor based preparations, and topical steroid creams, however caution should be used with oil-based preparations (ointments and oily creams as opposed to water based or aqueous lotions) which may increase blockage to the sweat glands and prolong duration of illness. Other agents have been investigated including supplemental vitamin A and C and vitamin A based medications, but it is worth noting that there is little scientific evidence supporting any of the above treatments in terms of actually reducing the duration of symptoms or frequency of complications.
In cases where the rash has developed into open blisters or pustular lesions a doctor should be consulted as other (less benign) conditions should be excluded and/or more aggressive treatment may be required. | https://www.wikidoc.org/index.php/Heat_rash | |
934eeffa1c1c9ce4b9d8670ea0a5596bb1d51d18 | wikidoc | Hedonism | Hedonism
# Overview
Hedonism is the philosophy that pleasure is of ultimate importance, the most important pursuit. The name derives from the Greek word for "delight" (Template:Polytonic hēdonismos from Template:Polytonic hēdonē "pleasure" + suffix ισμός ismos "ism").
# Basic concepts
The basic idea behind hedonistic thought is that pleasure is the only thing that is good for a person. This is often used as a justification for evaluating actions in terms of how much pleasure and how little pain (i.e. suffering) they produce. In very simple terms, a hedonist strives to maximise this total pleasure (pleasure minus pain). The nineteenth-century British philosophers John Stuart Mill and Jeremy Bentham defended the ethical theory of Utilitarianism, according to which we should perform whichever action is best for everyone. Conjoining hedonism, as a view as to what is good for people, to utilitarianism has the result that all action should be directed toward achieving the greatest amount of happiness for the greatest number of people. Though consistent in their pursuit of happiness, Bentham and Mill’s versions of hedonism differ. There are two somewhat basic schools of thought on hedonism:
- One school, grouped around Jeremy Bentham, defends a quantitative approach. Bentham believed that the value of a pleasure could be quantitatively understood. Essentially, he believed the value of a pleasure to be its intensity multiplied by its duration - so it was not just the number of pleasures, but their intensity and how long they lasted that must be taken into account.
- Other proponents, like John Stuart Mill argue a qualitative approach. Mill believed that there can be different levels of pleasure - higher quality pleasure is better than lower quality pleasure. Mill also argues that simpler beings (he often references pigs) have an easier access to the simpler pleasures; since they do not see other aspects of life, they can simply indulge in their pleasures. The more elaborate beings tend to spend more thought on other matters and hence lessen the time for simple pleasure. It is therefore more difficult for them to indulge in such "simple pleasures" in the same manner.
Critics of the quantitative approachTemplate:Who assert that, generally, "pleasures" do not necessarily share common traits besides the fact that they can be seen as "pleasurable." Critics of the qualitative approachTemplate:Who argue that whether one pleasure is higher than another depends on factors other than how pleasurable it is. For example, the pleasure of sadism is a more base pleasure because it is morally unpalatable, and not because it is lacking in pleasure.
While some maintain that there is no standard for what constitutes pleasurable activities (for example, those with an interest in sadomasochism), most contemporary hedonists believe that pleasure and pain are easily distinguished and pursue the former.
In the medical sciences, the inability to derive pleasure from experiences that are typically considered pleasurable is referred to as anhedonia.
# Modern beliefs
Modern day hedonists strive firstly, as their predecessors, for pleasure. But also, hedonists feel that people should be equal, and that the way to achieve that is through allowing much more personal freedom. Hedonists, in the words of an organization known as Hedonist International, "want joyful togetherness, anarchy, epicurean ideas, multifaceted joy, sensuality, diversion, friendship, justice, tolerance, freedom, sexual freedom, sustainability, peace, free access to information, the arts, a cosmopolitan existence, and a world without borders or discrimination, and everything else that is wonderful but not a reality today. "(Hedonist Manifesto)
# Predecessors
Democritus seems to be the earliest philosopher on record to have categorically embraced a hedonistic philosophy; he called the supreme goal of life "contentment" or "cheerfulness", claiming that "joy and sorrow are the distinguishing mark of things beneficial and harmful" (DK 68 B 188).
Cyrenaicism (4th and 3rd centuries B.C.), founded by Aristippus of Cyrene, was one of the earliest Socratic schools, and emphasized one side only of the Socratic teaching. Taking Socrates' assertion that happiness is one of the ends of moral action, Aristippus maintained that pleasure was the supreme good. He found bodily gratifications, which he considered more intense, preferable to mental pleasures. They also denied that we should defer immediate gratification for the sake of long-term gain. In these respects they differ from the Epicureans.
Epicureanism is considered by some to be a form of ancient hedonism. Epicurus identified pleasure with tranquillity and emphasized the reduction of desire over the immediate acquisition of pleasure. In this way, Epicureanism escapes the preceding objection: while pleasure and the highest good are equated, Epicurus claimed that the highest pleasure consists of a simple, moderate life spent with friends and in philosophical discussion. He stressed that it was not good to do something that made one feel good if, by experiencing it, one would belittle later experiences and make them no longer feel good. For example, too much sex might later decrease interest in sex, which may cause one to be dissatisfied with one's sexual partner leading to unhappiness.
# Hedonism and egoism
Hedonism can be conjoined with psychological egoism - the theory that humans are motivated only by their self interest - to make psychological hedonism: a purely descriptive claim which states that agents naturally seek pleasure. Hedonism can also be combined with ethical egoism - the claim that individuals should seek their own good - to make ethical hedonism the claim that we should act so as to produce our own pleasure.
However, hedonism is not necessarily related to egoism. The Utilitarianism of John Stuart Mill is sometimes classified as a type of hedonism, as it judges the morality of actions by their consequent contributions to the greater good and happiness of all. Note that this is altruistic hedonism. Whereas some hedonistic doctrines propose doing whatever makes an individual happiest (over the long run), Mill promotes actions which make everyone happy. Compare individualism and collectivism.
It is true that Epicurus recommends for us to pursue our own pleasure, but he never suggests we should live a selfish life which impedes others from getting to that same objective.
Some of Sigmund Freud's theories of human motivation have been called psychological hedonism; his "life instinct" is essentially the observation that people will pursue pleasure. However, he introduces extra complexities with various other mechanisms, such as the "death instinct". The death instinct, Thanatos, can be equated to the desire for silence and peace, for calm and darkness, which causes them another form of happiness. It is also a death instinct, thus it can also be the desire for death. The fact that he leaves out the instinct to survive as a primary motivator, and that his hypotheses are notoriously invalidated by objective testing, casts doubt on this theory.
Ayn Rand, one of the biggest modern proponents of Egoism, rejected hedonism in a literal sense as a comprehensive ethical system:
To take "whatever makes one happy" as a guide to action means: to be guided by nothing but one's emotional whims. Emotions are not tools of cognition. . . . This is the fallacy inherent in hedonism--in any variant of ethical hedonism, personal or social, individual or collective. "Happiness" can properly be the purpose of ethics, but not the standard. The task of ethics is to define man's proper code of values and thus to give him the means of achieving happiness. To declare, as the ethical hedonists do, that "the proper value is whatever gives you pleasure" is to declare that "the proper value is whatever you happen to value"--which is an act of intellectual and philosophical abdication, an act which merely proclaims the futility of ethics and invites all men to play it deuces wild.
A modern proponent of hedonism with an ethical touch is the Swedish philosopher Torbjörn Tännsjö.
# The Christian view
Christian Hedonism is a term coined in 1986 for a theological movement originally conceived by Reformed Baptist pastor and theologian, John Piper, in his book, Desiring God: Meditations of a Christian Hedonist. The tenets of this philosophy are that humans were created by God with the priority purpose of lavishly enjoying God through knowing, worshiping, and serving Him. This philosophy recommends pursuing one's own happiness in God as the ultimate in human pleasure. Similar to the Epicurean view, the highest pleasure is regarded as something long-term and found not in indulgence but in a life devoted to God. Members of the Christian community have seriously questioned whether Christian Hedonism displaces "love God" with "enjoy God" as the greatest and foremost commandment.
A typical apologia for Christian Hedonism follows: Assuming one accepts that the primary definition of love is "an emotion of affection," then if one were to love something truly he must also truly enjoy it. In hedonism, obtaining pleasure is a higher goal than any other, including the pursuit of love. God, being a hedonist, loves Himself above all else and therefore enjoys His own presence above all other pleasurable pursuits. He calls men to also pursue all their pleasure only in God, as God also finds this experientially pleasant. Thus, Christian Hedonism is exemplified in relation to Jesus Christ, who justifies God in enjoying a rebellious creation by providing the sacrifice of Himself as the payment allowing God to be pleased with us, and for us to enjoy Him, forever. It could be summed up in this statement: "God is most glorified in us, when we are most satisfied in Him".
Quite a few people equate hedonism with sexuality and having a very loose or liberal view of the morality of sex. As noted above, many (perhaps most) forms of hedonism actually concentrate on spiritual, intellectual, or otherwise non-sexual forms of pleasure. The pursuit of sexual pleasure can certainly be a form of hedonism, but it is not the mainstream one. However, this has become the mainstream use of the word.
More recently, the term Christian Hedonism has been used by the French atheist philosopher Michel Onfray to qualify the various heretic movements from the Middle Ages to Montaigne.
# References and notes
- ↑ "Hedonism." Stanford Encyclopedia of Philosophy. 20 Apr. 2004. 4 Nov. 2007 .
- ↑ "Hedonist Manifesto." Hedonist International. Hedonist International. 4 Nov. 2007 .
- ↑ p. 125, C.C.W. Taylor, "Democritus", in C. Rowe & M. Schofield (eds.), Greek and Roman Political Thought, Cambridge 2005.
- ↑ "Cyrenaics." Internet Encyclopedia of Philosophy. The University of Tennessee At Martin. 4 Nov. 2007 .
- ↑ "The Cyrenaics and the Origin of Hedonism." Hedonism.org. BLTC. 4 Nov. 2007 .
- ↑ Ayn Rand, The Virtue of Selfishness, "The Objectivist Ethics".
- ↑ Torbjörn Tännsjö; Hedonistic Utilitarianism (Edinburgh: Edinburgh University Press (1998). | Hedonism
# Overview
Hedonism is the philosophy that pleasure is of ultimate importance, the most important pursuit. The name derives from the Greek word for "delight" (Template:Polytonic hēdonismos from Template:Polytonic hēdonē "pleasure" + suffix ισμός ismos "ism").
# Basic concepts
The basic idea behind hedonistic thought is that pleasure is the only thing that is good for a person. This is often used as a justification for evaluating actions in terms of how much pleasure and how little pain (i.e. suffering) they produce. In very simple terms, a hedonist strives to maximise this total pleasure (pleasure minus pain). The nineteenth-century British philosophers John Stuart Mill and Jeremy Bentham defended the ethical theory of Utilitarianism, according to which we should perform whichever action is best for everyone. Conjoining hedonism, as a view as to what is good for people, to utilitarianism has the result that all action should be directed toward achieving the greatest amount of happiness for the greatest number of people. Though consistent in their pursuit of happiness, Bentham and Mill’s versions of hedonism differ. There are two somewhat basic schools of thought on hedonism:[1]
- One school, grouped around Jeremy Bentham, defends a quantitative approach. Bentham believed that the value of a pleasure could be quantitatively understood. Essentially, he believed the value of a pleasure to be its intensity multiplied by its duration - so it was not just the number of pleasures, but their intensity and how long they lasted that must be taken into account.
- Other proponents, like John Stuart Mill argue a qualitative approach. Mill believed that there can be different levels of pleasure - higher quality pleasure is better than lower quality pleasure. Mill also argues that simpler beings (he often references pigs) have an easier access to the simpler pleasures; since they do not see other aspects of life, they can simply indulge in their pleasures. The more elaborate beings tend to spend more thought on other matters and hence lessen the time for simple pleasure. It is therefore more difficult for them to indulge in such "simple pleasures" in the same manner.
Critics of the quantitative approachTemplate:Who assert that, generally, "pleasures" do not necessarily share common traits besides the fact that they can be seen as "pleasurable." Critics of the qualitative approachTemplate:Who argue that whether one pleasure is higher than another depends on factors other than how pleasurable it is. For example, the pleasure of sadism is a more base pleasure because it is morally unpalatable, and not because it is lacking in pleasure.
While some maintain that there is no standard for what constitutes pleasurable activities (for example, those with an interest in sadomasochism), most contemporary hedonists believe that pleasure and pain are easily distinguished and pursue the former.
In the medical sciences, the inability to derive pleasure from experiences that are typically considered pleasurable is referred to as anhedonia.
# Modern beliefs
Modern day hedonists strive firstly, as their predecessors, for pleasure. But also, hedonists feel that people should be equal, and that the way to achieve that is through allowing much more personal freedom. Hedonists, in the words of an organization known as Hedonist International, "want joyful togetherness, anarchy, epicurean ideas, multifaceted joy, sensuality, diversion, friendship, justice, tolerance, freedom, sexual freedom, sustainability, peace, free access to information, the arts, a cosmopolitan existence, and a world without borders or discrimination, and everything else that is wonderful but not a reality today. "(Hedonist Manifesto)[2]
# Predecessors
Democritus seems to be the earliest philosopher on record to have categorically embraced a hedonistic philosophy; he called the supreme goal of life "contentment" or "cheerfulness", claiming that "joy and sorrow are the distinguishing mark of things beneficial and harmful" (DK 68 B 188).[3]
Cyrenaicism (4th and 3rd centuries B.C.), founded by Aristippus of Cyrene, was one of the earliest Socratic schools, and emphasized one side only of the Socratic teaching. Taking Socrates' assertion that happiness is one of the ends of moral action, Aristippus maintained that pleasure was the supreme good. He found bodily gratifications, which he considered more intense, preferable to mental pleasures. They also denied that we should defer immediate gratification for the sake of long-term gain. In these respects they differ from the Epicureans.[4][5]
Epicureanism is considered by some to be a form of ancient hedonism. Epicurus identified pleasure with tranquillity and emphasized the reduction of desire over the immediate acquisition of pleasure. In this way, Epicureanism escapes the preceding objection: while pleasure and the highest good are equated, Epicurus claimed that the highest pleasure consists of a simple, moderate life spent with friends and in philosophical discussion. He stressed that it was not good to do something that made one feel good if, by experiencing it, one would belittle later experiences and make them no longer feel good. For example, too much sex might later decrease interest in sex, which may cause one to be dissatisfied with one's sexual partner leading to unhappiness.
# Hedonism and egoism
Hedonism can be conjoined with psychological egoism - the theory that humans are motivated only by their self interest - to make psychological hedonism: a purely descriptive claim which states that agents naturally seek pleasure. Hedonism can also be combined with ethical egoism - the claim that individuals should seek their own good - to make ethical hedonism the claim that we should act so as to produce our own pleasure.
However, hedonism is not necessarily related to egoism. The Utilitarianism of John Stuart Mill is sometimes classified as a type of hedonism, as it judges the morality of actions by their consequent contributions to the greater good and happiness of all. Note that this is altruistic hedonism. Whereas some hedonistic doctrines propose doing whatever makes an individual happiest (over the long run), Mill promotes actions which make everyone happy. Compare individualism and collectivism.
It is true that Epicurus recommends for us to pursue our own pleasure, but he never suggests we should live a selfish life which impedes others from getting to that same objective.
Some of Sigmund Freud's theories of human motivation have been called psychological hedonism; his "life instinct" is essentially the observation that people will pursue pleasure. However, he introduces extra complexities with various other mechanisms, such as the "death instinct". The death instinct, Thanatos, can be equated to the desire for silence and peace, for calm and darkness, which causes them another form of happiness. It is also a death instinct, thus it can also be the desire for death. The fact that he leaves out the instinct to survive as a primary motivator, and that his hypotheses are notoriously invalidated by objective testing, casts doubt on this theory.
Ayn Rand, one of the biggest modern proponents of Egoism, rejected hedonism in a literal sense as a comprehensive ethical system:
To take "whatever makes one happy" as a guide to action means: to be guided by nothing but one's emotional whims. Emotions are not tools of cognition. . . . This is the fallacy inherent in hedonism--in any variant of ethical hedonism, personal or social, individual or collective. "Happiness" can properly be the purpose of ethics, but not the standard. The task of ethics is to define man's proper code of values and thus to give him the means of achieving happiness. To declare, as the ethical hedonists do, that "the proper value is whatever gives you pleasure" is to declare that "the proper value is whatever you happen to value"--which is an act of intellectual and philosophical abdication, an act which merely proclaims the futility of ethics and invites all men to play it deuces wild.[6]
A modern proponent of hedonism with an ethical touch is the Swedish philosopher Torbjörn Tännsjö[7].
# The Christian view
Christian Hedonism is a term coined in 1986 for a theological movement originally conceived by Reformed Baptist pastor and theologian, John Piper, in his book, Desiring God: Meditations of a Christian Hedonist. The tenets of this philosophy are that humans were created by God with the priority purpose of lavishly enjoying God through knowing, worshiping, and serving Him. This philosophy recommends pursuing one's own happiness in God as the ultimate in human pleasure. Similar to the Epicurean view, the highest pleasure is regarded as something long-term and found not in indulgence but in a life devoted to God. Members of the Christian community have seriously questioned whether Christian Hedonism displaces "love God" with "enjoy God" as the greatest and foremost commandment.
A typical apologia for Christian Hedonism follows: Assuming one accepts that the primary definition of love is "an emotion of affection," then if one were to love something truly he must also truly enjoy it. In hedonism, obtaining pleasure is a higher goal than any other, including the pursuit of love. God, being a hedonist, loves Himself above all else and therefore enjoys His own presence above all other pleasurable pursuits. He calls men to also pursue all their pleasure only in God, as God also finds this experientially pleasant. Thus, Christian Hedonism is exemplified in relation to Jesus Christ, who justifies God in enjoying a rebellious creation by providing the sacrifice of Himself as the payment allowing God to be pleased with us, and for us to enjoy Him, forever. It could be summed up in this statement: "God is most glorified in us, when we are most satisfied [pleased] in Him".
Quite a few people equate hedonism with sexuality and having a very loose or liberal view of the morality of sex. As noted above, many (perhaps most) forms of hedonism actually concentrate on spiritual, intellectual, or otherwise non-sexual forms of pleasure. The pursuit of sexual pleasure can certainly be a form of hedonism, but it is not the mainstream one.[citation needed] However, this has become the mainstream use of the word.
More recently, the term Christian Hedonism has been used by the French atheist philosopher Michel Onfray to qualify the various heretic movements from the Middle Ages to Montaigne.
# References and notes
- ↑ "Hedonism." Stanford Encyclopedia of Philosophy. 20 Apr. 2004. 4 Nov. 2007 <http://plato.stanford.edu/>.
- ↑ "Hedonist Manifesto." Hedonist International. Hedonist International. 4 Nov. 2007 http://www.hedonist-international.org .
- ↑ p. 125, C.C.W. Taylor, "Democritus", in C. Rowe & M. Schofield (eds.), Greek and Roman Political Thought, Cambridge 2005.
- ↑ "Cyrenaics." Internet Encyclopedia of Philosophy. The University of Tennessee At Martin. 4 Nov. 2007 <http://www.iep.utm.edu/>.
- ↑ "The Cyrenaics and the Origin of Hedonism." Hedonism.org. BLTC. 4 Nov. 2007 <http://www.hedonism.org>.
- ↑ Ayn Rand, The Virtue of Selfishness, "The Objectivist Ethics".
- ↑ Torbjörn Tännsjö; Hedonistic Utilitarianism (Edinburgh: Edinburgh University Press (1998). | https://www.wikidoc.org/index.php/Hedonism | |
e7eb13dbd70d57818a7e089e0d7f11f003a5a5e6 | wikidoc | Helium-3 | Helium-3
Helium-3 (He-3) is a light, non-radioactive isotope of helium with two protons and one neutron, rare on Earth, sought for use in nuclear fusion research. The abundance of helium-3 is thought to be greater on the Moon (embedded in the upper layer of regolith by the solar wind over billions of years) and the solar system's gas giants (left over from the original solar nebula), though still low in quantity (28 ppm of lunar regolith is helium-4 and 0.01 ppm is helium-3). It is proposed to be used as a second-generation fusion power source.
The helion, the nucleus of a helium-3 atom, consists of two protons but only one neutron, in contrast to two neutrons in ordinary helium. Its existence was first proposed in 1934 by the Australian nuclear physicist Mark Oliphant while based at Cambridge University's Cavendish Laboratory, in an experiment in which fast deuterons were reacted with other deuteron targets (the first demonstration of nuclear fusion). Helium-3, as an isotope, was postulated to be radioactive, until helions from it were accidentally identified as a trace "contaminant" in a sample of natural helium (which is mostly helium-4) from a gas well, by Luis W. Alvarez and Robert Cornog in a cyclotron experiment at the Lawrence Berkeley National Laboratory, in 1939.
# Physical properties
Helium-3's atomic mass of 3.0160293, being significantly lower than Helium-4's 4.0026, causes it to have significantly different properties. Helium-3 boils at 3.19 kelvins compared to helium-4's 4.23 K, and its critical point is also lower at 3.35 K, compared to helium-4's 5.19 K. It has less than half the density when liquid at its boiling point: 0.059 g/ml compared to helium-4's 0.12473 g/ml at one atmosphere. Its latent heat of vaporization is also considerably lower at 0.026 kJ/mol compared to helium-4's 0.0829 kJ/mol.
# Fusion reactions
Some fusion processes produce highly energetic neutrons which render reactor components radioactive with their bombardment, and power generation must occur through thermal means. However, the appeal of helium-3 fusion stems from the nature of its reaction products. Helium-3 itself is non-radioactive. The lone high-energy proton produced can be contained using electric and magnetic fields, which results in direct electricity generation.
However, since both reactants need to be mixed together to fuse, side reactions (21H + 21H and 32He+ 32He) will occur, the first of which is not aneutronic. Therefore in practice this reaction is unlikely to ever be completely 'clean', thus negating some of its attraction. Also, due to the higher Coulomb barrier, the temperatures required for 21H + 32He fusion are much higher than those of conventional 2H + 31H (deuterium + tritium) fusion.
The amounts of helium-3 needed as a replacement for conventional fuels should not be underestimated. The total amount of energy produced in the ³He + 21H+ reaction is 18.4 MeV, which corresponds to some 493 megawatt-hours (4.93x108 Wh) per three grams (one mole) of ³He. Even if that total amount of energy could be converted to electrical power with 100% efficiency (a physical impossibility), it would correspond to about 30 minutes of output of a thousand-megawatt electrical plant; a year's production by the same plant would require some 17.5 kilograms of helium-3.
The amount of fuel needed for large-scale applications can also be put in terms of total consumption: According to the US Energy Information Administration, "Electricity consumption by 107 million U.S. households in 2001 totaled 1,140 billion kWh" (1.114x1015 Wh). Again assuming 100% conversion efficiency, 6.7 tonnes of helium-3 would be required just for that segment of one country's energy demand, 15 to 20 tonnes given a more realistic end-to-end conversion efficiency.
# Neutron detection
Helium-3 is a most important isotope in instrumentation for neutron detection. It has a high absorption cross section for thermal neutron beams and is used as a converter gas in neutron detectors. The neutron is converted through the nuclear reaction
into charged particles tritium (T, 3H) and proton (p, 1H) which then are detected by creating a charge cloud in the stopping gas of a proportional counter or a Geiger-Müller tube.
Furthermore, the absorption process is strongly spin-dependent, which allows a spin-polarized helium-3 volume to transmit neutrons with one spin component while absorbing the other. This effect is employed in neutron polarization analysis, a technique which probes for magnetic properties of matter.
# Cryogenics
A helium-3 refrigerator uses helium-3 to achieve temperatures of 0.2 to 0.3 kelvin. A dilution refrigerator uses a mixture of helium-3 and helium-4 to reach cryogenic temperatures as low as a few thousandths of a kelvin.
An important property of helium-3, which distinguishes it from the more common helium-4, is that its nucleus is a fermion since it contains an odd number of spin 1/2 particles. Helium-4 nuclei are bosons, containing an even number of spin 1/2 particles. This is a direct result of the addition rules for quantized angular momentum. At low temperatures (about 2.17 K), helium-4 undergoes a phase transition: A fraction of it enters a superfluid phase that can be roughly understood as a type of Bose-Einstein condensate. Such a mechanism is not available for helium-3 atoms, which are fermions. However, it was widely speculated that helium-3 could also become a superfluid at much lower temperatures, if the atoms formed into pairs analogous to Cooper pairs in the BCS theory of superconductivity. Each Cooper pair, having integer spin, can be thought of as a boson. During the 1970s, David Morris Lee, Douglas Osheroff and Robert Coleman Richardson discovered two phase transitions along the melting curve, which was soon realized to be the two superfluid phases of helium-3. The transition to a superfluid occurs at 2.491 millikelvins on the melting curve. They were awarded the 1996 Nobel Prize in Physics for their discovery. Tony Leggett won the 2003 Nobel Prize in Physics for his work on refining understanding of the superfluid phase of helium-3.
In zero magnetic field, there are two distinct superfluid phases of 3He, the A-phase and the B-phase. The B-phase is the low-temperature, low-pressure phase which has an isotropic energy gap. The A-phase is the higher temperature, higher pressure phase that is further stabilized by a magnetic field and has two point nodes in its gap. The presence of two phases is a clear indication that 3He is an unconventional superfluid (superconductor), since the presence of two phases requires an additional symmetry, other than gauge symmetry, to be broken. In fact, it is a p-wave superfluid, with spin one, S=1, and angular momentum one, L=1. The ground state corresponds to total angular momentum zero, J=S+L=0 (vector addition). Excited states are possible with non-zero total angular momentum, J>0, which are excited pair collective modes. Because of the extreme purity of superfluid 3He (since all materials except 4He have solidified and sunk to the bottom of the liquid 3He and any 4He has phase separated entirely, this is the most pure condensed matter state), these collective modes have been studied with much greater precision than in any other unconventional pairing system.
# Manufacturing
Due to the rarity of helium-3 on Earth, it is typically manufactured instead of recovered from natural deposits. Helium-3 is a byproduct of tritium decay, and tritium can be produced through neutron bombardment of lithium, boron, or nitrogen targets. Current supplies of helium-3 come, in part, from the dismantling of nuclear weapons where it accumulates; approximately 150 kilograms of it have resulted from decay of US tritium production since 1955, most of which was for warheads. However, the production and storage of huge amounts of the gas tritium is probably uneconomical, as roughly eighteen tons of tritium stock are required for each ton of helium-3 produced annually by decay (production rate dN/dt from number of moles or other unit mass of tritium N is N γ = N - where the value of t½/(ln2) is about 18 years; see radioactive decay). If commercial fusion reactors were to use helium-3 as a fuel, they would require tens of tons of helium-3 each year to produce a fraction of the world's power. Breeding tritium with lithium-6 consumes the neutron, while breeding with lithium-7 produces a low energy neutron as a replacement for the consumed fast neutron. Note that any breeding of tritium on Earth requires the use of a high neutron flux, which proponents of helium-3 nuclear reactors hope to avoid.
# Medical lung imaging
Polarized helium-3 may be produced directly with lasers of the appropriate power, and with a thin layer of protective Cs metal on the inside of cylinders, the magnetized gas may be stored at pressures of 10 atm for up to 100 hours. When inhaled, mixtures containing the gas can be imaged with an MRI-like scanner which produces breath by breath images of lung ventilation, in real-time. Applications of this experimental technique are just beginning to be explored.
# Terrestrial occurrence
3He is a primordial substance in the Earth's mantle, considered to have become entrapped within the Earth during planetary formation. The ratio of 3He to 4He within the Earth's crust and mantle is less than that for assumptions of solar disk composition as obtained from meteorite and lunar samples, with terrestrial materials generally containing lower 3He/4He ratios due to ingrowth of 4He from radioactive decay.
3He is present within the mantle, in the ratio of 200-300 parts of 3He to a million parts of 4He. Ratios of 3He/4He in excess of atmospheric are indicative of a contribution of 3He from the mantle. Crustal sources are dominated by the 4He which is produced by the decay of radioactive elements in the crust and mantle.
3He is also present in the Earth's atmosphere. The natural abundance of 3He in naturally occurring helium gas is 1.38Template:E. The partial pressure of helium in the Earth's atmosphere is about 4 millitorr, and thus 5.2 parts per million of helium. It has been proven that the Earth's atmosphere contains approximately 4000 tons of 3He.
3He is produced on Earth from three sources: lithium spallation, cosmic rays, and decay of tritium (3H). The contribution from cosmic rays is negligible within all except the oldest regolith materials, and lithium spallation reactions are a lesser contributor than the production of 4He by alpha particle emissions.
The total amount of helium-3 in the mantle may be in the range of 100 thousand to a million tonnes. However, this mantle helium is not directly accessible. Some of it leaks up through deep-sourced hotspot volcanoes such as those of the Hawaiian islands, but only 300 grams per year is emitted to the atmosphere. Mid-ocean ridges emit another 3 kilogram per year. Around subduction zones, various sources produce helium-3 in natural gas deposits which possibly contain a thousand tonnes of helium-3 (although there may be 25 thousand tonnes if all ancient subduction zones have such deposits). Crustal natural gas sources may have only half a tonne total. There may be another four thousand tonnes in interplanetary dust particles on the ocean floors. Extracting helium-3 from these sources consumes more energy than fusion would release. Extraction from the most efficient source, natural gas, consumes ten times the energy available from fusion reactions.
# Extraterrestrial supplies
The Moon's surface contains helium-3 at concentrations on the order of 0.01 ppm. A number of people, starting with Gerald Kulcinski in 1986, have proposed to explore the moon, mine lunar regolith and using the helium-3 for fusion. Because of the low concentrations of helium-3, any mining equipment would need to process large amounts of regolith, and some proposals have suggested that helium-3 extraction be piggybacked onto a larger mining and development operation.
Cosmochemist and geochemist Ouyang Ziyuan from the Chinese Academy of Sciences who is now in charge of the Chinese Lunar Exploration Program has already stated on many occasions that one of the main goals of the program would be the mining of helium-3, from where "each year three space shuttle missions could bring enough fuel for all human beings across the world."
In January 2006 the Russian space company RKK Energiya announced that it considers lunar helium-3 a potential economic resource to be mined by 2020, if funding can be found.
Mining gas giants for helium-3 has also been proposed. The British Interplanetary Society's hypothetical Project Daedalus interstellar probe design was fueled by helium-3 mines on the planet Jupiter, for example. Jupiter's high gravity makes this a less energetically favorable operation than extracting helium-3 from the other gas giants of the solar system, however.
# Power generation
A second-generation approach to controlled fusion power involves combining helium-3 (32He) and deuterium (21H). This reaction produces an helium-4 ion (42He) (like an alpha particle, but of different origin) and a high-energy proton (positively charged hydrogen ion) (11p). The most important potential advantage of this fusion reaction for power production as well as other applications lies in its compatibility with the use of electrostatic fields to control fuel ions and the fusion protons. Protons, as positively charged particles, can be converted directly into electricity, through use of solid-state conversion materials as well as other techniques. Potential conversion efficiencies of 70 percent may be possible, as there is no need to convert proton energy to heat in order to drive turbine-powered generators.
There have been many claims about the capabilities of Helium-3 power plants. According to proponents, fusion power plants operating on deuterium and helium-3 would offer lower capital and operating costs than their competitors due to less technical complexity, higher conversion efficiency, smaller size, the absence of radioactive fuel, no air or water pollution, and only low-level radioactive waste disposal requirements. Recent estimates suggest that about $6 billion in investment capital will be required to develop and construct the first helium-3 fusion power plant. Financial breakeven at today's wholesale electricity prices (5 cents per kilowatt-hour) would occur after five 1000-megawatt plants were on line, replacing old conventional plants or meeting new demand.
The reality is not so clean-cut. The most advanced fusion programs in the world are inertial confinement fusion (such as National Ignition Facility) and magnetic confinement fusion (such as ITER and other tokamaks). In the case of the former, there is no solid roadmap to power generation. In the case of the latter, commercial power generation is not expected until around 2050. In both cases, the type of fusion discussed is the simplest: D-T fusion. The reason for this is the very low Coulomb barrier for this reaction; for D+He3, the barrier is much higher, and He3-He3 higher still. The immense cost of reactors like ITER and National Ignition Facility are largely due to their immense size, yet to scale up to higher plasma temperatures would require reactors far larger still. The 14.7 MeV proton and 3.6 MeV alpha particle from D-He3 fusion, plus the higher conversion efficiency, means that more electricity is obtained per kilogram than with D-T fusion (17.6 MeV), but not that much more. As a further downside, the rates of reaction for He3 fusion reactions are not particularly high, requiring a reactor that is larger still or more reactors to produce the same amount of electricity.
To attempt to work around this problem of massively large power plants that may not even be economical with D-T fusion, let alone the far more challenging D-He3 fusion, a number of other reactors have been proposed -- the Fusor, Polywell, Focus fusion, and many more. These generally attempt to achieve fusion in thermal disequilibrium, something that could potentially prove impossible, and consequently, these long-shot programs tend to have trouble garnering funding despite their low budgets. Unlike the "big", "hot" fusion systems, however, if such systems were to work, they could scale to the higher barrier "aneutronic" fuels. However, these systems would scale well enough that their proponents tend to promote p-B fusion, which requires no exotic fuels like He-3. | Helium-3
Template:Infobox isotope
Helium-3 (He-3) is a light, non-radioactive isotope of helium with two protons and one neutron, rare on Earth, sought for use in nuclear fusion research. The abundance of helium-3 is thought to be greater on the Moon (embedded in the upper layer of regolith by the solar wind over billions of years) and the solar system's gas giants (left over from the original solar nebula), though still low in quantity (28 ppm of lunar regolith is helium-4 and 0.01 ppm is helium-3).[1] It is proposed to be used as a second-generation fusion power source.
The helion, the nucleus of a helium-3 atom, consists of two protons but only one neutron, in contrast to two neutrons in ordinary helium. Its existence was first proposed in 1934 by the Australian nuclear physicist Mark Oliphant while based at Cambridge University's Cavendish Laboratory, in an experiment in which fast deuterons were reacted with other deuteron targets (the first demonstration of nuclear fusion). Helium-3, as an isotope, was postulated to be radioactive, until helions from it were accidentally identified as a trace "contaminant" in a sample of natural helium (which is mostly helium-4) from a gas well, by Luis W. Alvarez and Robert Cornog in a cyclotron experiment at the Lawrence Berkeley National Laboratory, in 1939. [2]
# Physical properties
Helium-3's atomic mass of 3.0160293, being significantly lower than Helium-4's 4.0026, causes it to have significantly different properties. Helium-3 boils at 3.19 kelvins compared to helium-4's 4.23 K, and its critical point is also lower at 3.35 K, compared to helium-4's 5.19 K. It has less than half the density when liquid at its boiling point: 0.059 g/ml compared to helium-4's 0.12473 g/ml at one atmosphere. Its latent heat of vaporization is also considerably lower at 0.026 kJ/mol compared to helium-4's 0.0829 kJ/mol.[3]
# Fusion reactions
Some fusion processes produce highly energetic neutrons which render reactor components radioactive with their bombardment, and power generation must occur through thermal means. However, the appeal of helium-3 fusion stems from the nature of its reaction products. Helium-3 itself is non-radioactive. The lone high-energy proton produced can be contained using electric and magnetic fields, which results in direct electricity generation.[9]
However, since both reactants need to be mixed together to fuse, side reactions (21H + 21H and 32He+ 32He) will occur, the first of which is not aneutronic. Therefore in practice this reaction is unlikely to ever be completely 'clean', thus negating some of its attraction. Also, due to the higher Coulomb barrier, the temperatures required for 21H + 32He fusion are much higher than those of conventional 2H + 31H (deuterium + tritium) fusion.
The amounts of helium-3 needed as a replacement for conventional fuels should not be underestimated. The total amount of energy produced in the ³He + 21H+ reaction is 18.4 MeV, which corresponds to some 493 megawatt-hours (4.93x108 Wh) per three grams (one mole) of ³He. Even if that total amount of energy could be converted to electrical power with 100% efficiency (a physical impossibility), it would correspond to about 30 minutes of output of a thousand-megawatt electrical plant; a year's production by the same plant would require some 17.5 kilograms of helium-3.
The amount of fuel needed for large-scale applications can also be put in terms of total consumption: According to the US Energy Information Administration, "Electricity consumption by 107 million U.S. households in 2001 totaled 1,140 billion kWh" (1.114x1015 Wh). Again assuming 100% conversion efficiency, 6.7 tonnes of helium-3 would be required just for that segment of one country's energy demand, 15 to 20 tonnes given a more realistic end-to-end conversion efficiency.[citation needed]
# Neutron detection
Helium-3 is a most important isotope in instrumentation for neutron detection. It has a high absorption cross section for thermal neutron beams and is used as a converter gas in neutron detectors. The neutron is converted through the nuclear reaction
into charged particles tritium (T, 3H) and proton (p, 1H) which then are detected by creating a charge cloud in the stopping gas of a proportional counter or a Geiger-Müller tube. [10]
Furthermore, the absorption process is strongly spin-dependent, which allows a spin-polarized helium-3 volume to transmit neutrons with one spin component while absorbing the other. This effect is employed in neutron polarization analysis, a technique which probes for magnetic properties of matter.[11] [12]
# Cryogenics
A helium-3 refrigerator uses helium-3 to achieve temperatures of 0.2 to 0.3 kelvin. A dilution refrigerator uses a mixture of helium-3 and helium-4 to reach cryogenic temperatures as low as a few thousandths of a kelvin. [13]
An important property of helium-3, which distinguishes it from the more common helium-4, is that its nucleus is a fermion since it contains an odd number of spin 1/2 particles. Helium-4 nuclei are bosons, containing an even number of spin 1/2 particles. This is a direct result of the addition rules for quantized angular momentum. At low temperatures (about 2.17 K), helium-4 undergoes a phase transition: A fraction of it enters a superfluid phase that can be roughly understood as a type of Bose-Einstein condensate. Such a mechanism is not available for helium-3 atoms, which are fermions. However, it was widely speculated that helium-3 could also become a superfluid at much lower temperatures, if the atoms formed into pairs analogous to Cooper pairs in the BCS theory of superconductivity. Each Cooper pair, having integer spin, can be thought of as a boson. During the 1970s, David Morris Lee, Douglas Osheroff and Robert Coleman Richardson discovered two phase transitions along the melting curve, which was soon realized to be the two superfluid phases of helium-3.[14][15] The transition to a superfluid occurs at 2.491 millikelvins on the melting curve. They were awarded the 1996 Nobel Prize in Physics for their discovery. Tony Leggett won the 2003 Nobel Prize in Physics for his work on refining understanding of the superfluid phase of helium-3.[16]
In zero magnetic field, there are two distinct superfluid phases of 3He, the A-phase and the B-phase. The B-phase is the low-temperature, low-pressure phase which has an isotropic energy gap. The A-phase is the higher temperature, higher pressure phase that is further stabilized by a magnetic field and has two point nodes in its gap. The presence of two phases is a clear indication that 3He is an unconventional superfluid (superconductor), since the presence of two phases requires an additional symmetry, other than gauge symmetry, to be broken. In fact, it is a p-wave superfluid, with spin one, S=1, and angular momentum one, L=1. The ground state corresponds to total angular momentum zero, J=S+L=0 (vector addition). Excited states are possible with non-zero total angular momentum, J>0, which are excited pair collective modes. Because of the extreme purity of superfluid 3He (since all materials except 4He have solidified and sunk to the bottom of the liquid 3He and any 4He has phase separated entirely, this is the most pure condensed matter state), these collective modes have been studied with much greater precision than in any other unconventional pairing system.
# Manufacturing
Due to the rarity of helium-3 on Earth, it is typically manufactured instead of recovered from natural deposits. Helium-3 is a byproduct of tritium decay, and tritium can be produced through neutron bombardment of lithium, boron, or nitrogen targets. Current supplies of helium-3 come, in part, from the dismantling of nuclear weapons where it accumulates[17]; approximately 150 kilograms of it have resulted from decay of US tritium production since 1955, most of which was for warheads[18]. However, the production and storage of huge amounts of the gas tritium is probably uneconomical, as roughly eighteen tons of tritium stock are required for each ton of helium-3 produced annually by decay (production rate dN/dt from number of moles or other unit mass of tritium N is N γ = N * [ln2/t½] where the value of t½/(ln2) is about 18 years; see radioactive decay). If commercial fusion reactors were to use helium-3 as a fuel, they would require tens of tons of helium-3 each year to produce a fraction of the world's power.[19] Breeding tritium with lithium-6 consumes the neutron, while breeding with lithium-7 produces a low energy neutron as a replacement for the consumed fast neutron. Note that any breeding of tritium on Earth requires the use of a high neutron flux, which proponents of helium-3 nuclear reactors hope to avoid.[citation needed]
# Medical lung imaging
Polarized helium-3 may be produced directly with lasers of the appropriate power, and with a thin layer of protective Cs metal on the inside of cylinders, the magnetized gas may be stored at pressures of 10 atm for up to 100 hours. When inhaled, mixtures containing the gas can be imaged with an MRI-like scanner which produces breath by breath images of lung ventilation, in real-time. Applications of this experimental technique are just beginning to be explored[20].
# Terrestrial occurrence
3He is a primordial substance in the Earth's mantle, considered to have become entrapped within the Earth during planetary formation. The ratio of 3He to 4He within the Earth's crust and mantle is less than that for assumptions of solar disk composition as obtained from meteorite and lunar samples, with terrestrial materials generally containing lower 3He/4He ratios due to ingrowth of 4He from radioactive decay.
3He is present within the mantle, in the ratio of 200-300 parts of 3He to a million parts of 4He. Ratios of 3He/4He in excess of atmospheric are indicative of a contribution of 3He from the mantle. Crustal sources are dominated by the 4He which is produced by the decay of radioactive elements in the crust and mantle.
3He is also present in the Earth's atmosphere. The natural abundance of 3He in naturally occurring helium gas is 1.38Template:E. The partial pressure of helium in the Earth's atmosphere is about 4 millitorr, and thus 5.2 parts per million of helium. It has been proven that the Earth's atmosphere contains approximately 4000 tons of 3He.
3He is produced on Earth from three sources: lithium spallation, cosmic rays, and decay of tritium (3H). The contribution from cosmic rays is negligible within all except the oldest regolith materials, and lithium spallation reactions are a lesser contributor than the production of 4He by alpha particle emissions.
The total amount of helium-3 in the mantle may be in the range of 100 thousand to a million tonnes. However, this mantle helium is not directly accessible. Some of it leaks up through deep-sourced hotspot volcanoes such as those of the Hawaiian islands, but only 300 grams per year is emitted to the atmosphere. Mid-ocean ridges emit another 3 kilogram per year. Around subduction zones, various sources produce helium-3 in natural gas deposits which possibly contain a thousand tonnes of helium-3 (although there may be 25 thousand tonnes if all ancient subduction zones have such deposits). Crustal natural gas sources may have only half a tonne total. There may be another four thousand tonnes in interplanetary dust particles on the ocean floors. Extracting helium-3 from these sources consumes more energy than fusion would release. Extraction from the most efficient source, natural gas, consumes ten times the energy available from fusion reactions. [19]
# Extraterrestrial supplies
The Moon's surface contains helium-3 at concentrations on the order of 0.01 ppm.[21][22] A number of people, starting with Gerald Kulcinski in 1986,[23] have proposed to explore the moon, mine lunar regolith and using the helium-3 for fusion. Because of the low concentrations of helium-3, any mining equipment would need to process large amounts of regolith,[24] and some proposals have suggested that helium-3 extraction be piggybacked onto a larger mining and development operation.[citation needed]
Cosmochemist and geochemist Ouyang Ziyuan from the Chinese Academy of Sciences who is now in charge of the Chinese Lunar Exploration Program has already stated on many occasions that one of the main goals of the program would be the mining of helium-3, from where "each year three space shuttle missions could bring enough fuel for all human beings across the world."[25]
In January 2006 the Russian space company RKK Energiya announced that it considers lunar helium-3 a potential economic resource to be mined by 2020,[26] if funding can be found.[27][28]
Mining gas giants for helium-3 has also been proposed.[29] The British Interplanetary Society's hypothetical Project Daedalus interstellar probe design was fueled by helium-3 mines on the planet Jupiter, for example. Jupiter's high gravity makes this a less energetically favorable operation than extracting helium-3 from the other gas giants of the solar system, however.
# Power generation
A second-generation approach to controlled fusion power involves combining helium-3 (32He) and deuterium (21H). This reaction produces an helium-4 ion (42He) (like an alpha particle, but of different origin) and a high-energy proton (positively charged hydrogen ion) (11p). The most important potential advantage of this fusion reaction for power production as well as other applications lies in its compatibility with the use of electrostatic fields to control fuel ions and the fusion protons. Protons, as positively charged particles, can be converted directly into electricity, through use of solid-state conversion materials as well as other techniques. Potential conversion efficiencies of 70 percent may be possible, as there is no need to convert proton energy to heat in order to drive turbine-powered generators.
There have been many claims about the capabilities of Helium-3 power plants. According to proponents, fusion power plants operating on deuterium and helium-3 would offer lower capital and operating costs than their competitors due to less technical complexity, higher conversion efficiency, smaller size, the absence of radioactive fuel, no air or water pollution, and only low-level radioactive waste disposal requirements. Recent estimates suggest that about $6 billion in investment capital will be required to develop and construct the first helium-3 fusion power plant. Financial breakeven at today's wholesale electricity prices (5 cents per kilowatt-hour) would occur after five 1000-megawatt plants were on line, replacing old conventional plants or meeting new demand.[30]
The reality is not so clean-cut. The most advanced fusion programs in the world are inertial confinement fusion (such as National Ignition Facility) and magnetic confinement fusion (such as ITER and other tokamaks). In the case of the former, there is no solid roadmap to power generation. In the case of the latter, commercial power generation is not expected until around 2050[31]. In both cases, the type of fusion discussed is the simplest: D-T fusion. The reason for this is the very low Coulomb barrier for this reaction; for D+He3, the barrier is much higher, and He3-He3 higher still. The immense cost of reactors like ITER and National Ignition Facility are largely due to their immense size, yet to scale up to higher plasma temperatures would require reactors far larger still. The 14.7 MeV proton and 3.6 MeV alpha particle from D-He3 fusion, plus the higher conversion efficiency, means that more electricity is obtained per kilogram than with D-T fusion (17.6 MeV), but not that much more. As a further downside, the rates of reaction for He3 fusion reactions are not particularly high, requiring a reactor that is larger still or more reactors to produce the same amount of electricity.
To attempt to work around this problem of massively large power plants that may not even be economical with D-T fusion, let alone the far more challenging D-He3 fusion, a number of other reactors have been proposed -- the Fusor, Polywell, Focus fusion, and many more. These generally attempt to achieve fusion in thermal disequilibrium, something that could potentially prove impossible[32], and consequently, these long-shot programs tend to have trouble garnering funding despite their low budgets. Unlike the "big", "hot" fusion systems, however, if such systems were to work, they could scale to the higher barrier "aneutronic" fuels. However, these systems would scale well enough that their proponents tend to promote p-B fusion, which requires no exotic fuels like He-3. | https://www.wikidoc.org/index.php/Helium-3 | |
5e6c906c3f5642a96d14ffed70cbebaa8f23a026 | wikidoc | Hemozoin | Hemozoin
Hemozoin is a disposal product formed from the digestion of blood by some blood-feeding parasites. Haematophagous organisms such as Malaria parasites (Plasmodium spp.), Rhodnius and Schistosoma digest hemoglobin and release high quantities of free heme, which is the non-protein component of hemoglobin. A heme or haem is a prosthetic group that consists of an iron atom contained in the center of a large heterocyclic organic ring called a porphyrin. This process is much-studied in Plasmodium since it is an attractive target for developing drugs to treat malaria.
# Formation
The monomeric and potentially toxic α-hematin (ferriprotoporphyrin IX) is detoxified by biocrystallization into insoluble, chemically inert ß-hematin crystals (hemozoin). Several mechanisms have been proposed for this reaction and the area is controversial, with membrane lipids, histidine-rich proteins, or even a combination of the two, being proposed to catalyse the formation of hemozoin.
# Structure
In ß-hematin a unique iron oxygen coordinate bond links the central iron of one heme to the oxygen of the carboxylate side chain of the adjacent heme. β-hematin can either be a cyclic dimer or a linear polymer , a polymeric form has never been found in hemozoin. Hemozoin crystals have a distinct triclinic structure and are weakly magnetic. They also exhibit optical dichroism, which means that they absorb light more strongly along their length than across their width, and this allows the automated detection of malaria. Hemozoin is produced in a form that under the action of an applied magnetic field gives rise to an induced optical dichroism characteristic of the hemozoin concentration and precise measurement of this induced dichroism may be used to determine the level of malarial infection. | Hemozoin
Hemozoin is a disposal product formed from the digestion of blood by some blood-feeding parasites. Haematophagous organisms such as Malaria parasites (Plasmodium spp.), Rhodnius and Schistosoma digest hemoglobin and release high quantities of free heme, which is the non-protein component of hemoglobin.[1] A heme or haem is a prosthetic group that consists of an iron atom contained in the center of a large heterocyclic organic ring called a porphyrin. This process is much-studied in Plasmodium since it is an attractive target for developing drugs to treat malaria.
# Formation
The monomeric and potentially toxic α-hematin (ferriprotoporphyrin IX) is detoxified by biocrystallization into insoluble, chemically inert ß-hematin crystals (hemozoin).[2] [3] Several mechanisms have been proposed for this reaction and the area is controversial, with membrane lipids,[4][5] histidine-rich proteins,[6] or even a combination of the two,[7] being proposed to catalyse the formation of hemozoin.
# Structure
In ß-hematin a unique iron oxygen coordinate bond links the central iron of one heme to the oxygen of the carboxylate side chain of the adjacent heme. β-hematin can either be a cyclic dimer or a linear polymer [8], a polymeric form has never been found in hemozoin.[9] Hemozoin crystals have a distinct triclinic structure and are weakly magnetic. They also exhibit optical dichroism, which means that they absorb light more strongly along their length than across their width, and this allows the automated detection of malaria. Hemozoin is produced in a form that under the action of an applied magnetic field gives rise to an induced optical dichroism characteristic of the hemozoin concentration and precise measurement of this induced dichroism may be used to determine the level of malarial infection. [10] | https://www.wikidoc.org/index.php/Hemozoin | |
f5232ef34e90f1f3ae894cdf53bd4263d169b740 | wikidoc | Hemp oil | Hemp oil
Hemp oil can be extracted from the seed of the hemp plant, which contains between 30-35% oil by weight, which is high in essential fatty acids. The plant can also be pressed for oil. Cold-pressed, unrefined hemp oil is light green, with a nutty, grassy flavour.
Refined hemp oil is clear with little flavour. It is widely used in body care products, lubricants, paints and industrial uses.
Antimicrobial properties make it a useful ingredient for soaps, shampoos and detergents. The oil is of high nutritional value because its 3:1 ratio of omega-6 to omega-3 essential fatty acids matches the balance required by the human body. It has also received attention in recent years as a possible source of biodiesel. There are a number of organisations that promote the production and use of hemp oil.
Hemp oil is deliberately manufactured to contain no significant amounts of THC and is not considered as a psychoactive drug.
# Nutrition
30–35% of the weight of hempseed is oil containing 80% essential fatty acids (EFAs), linoleic acid (LA, 50-70%), alpha-linolenic acid (ALA, 15–25%) and Gamma-Linolenic acid (GLA, 1–6%). The proportions of linoleic acid and alpha-linolenic acid in hempseed oil meet human requirements for EFAs. Unfortunately the unsaturated fat makes the oil rancid quickly, unless it is stored in dark coloured bottles or mixed with chemical preservatives. This makes hemp oil difficult to transport or store. The high unsaturated fat content also makes the oil unsuitable for frying. This severely limits hemp oil's potential on the food market, although some marketing potential exists as a nutritional supplement. Cooking of any oil reduces its nutritional value, and may convert beneficial fatty acids to less benign substances. | Hemp oil
Hemp oil can be extracted from the seed of the hemp plant, which contains between 30-35% oil by weight, which is high in essential fatty acids. The plant can also be pressed for oil. Cold-pressed, unrefined hemp oil is light green, with a nutty, grassy flavour.
Refined hemp oil is clear with little flavour. It is widely used in body care products, lubricants, paints and industrial uses.
Antimicrobial properties make it a useful ingredient for soaps, shampoos and detergents. The oil is of high nutritional value because its 3:1 ratio of omega-6 to omega-3 essential fatty acids matches the balance required by the human body.[1] It has also received attention in recent years as a possible source of biodiesel.[2] There are a number of organisations that promote the production and use of hemp oil.[3]
Hemp oil is deliberately manufactured to contain no significant amounts of THC and is not considered as a psychoactive drug.
## Nutrition
30–35% of the weight of hempseed is oil containing 80% essential fatty acids (EFAs), linoleic acid (LA, 50-70%), alpha-linolenic acid (ALA, 15–25%) and Gamma-Linolenic acid (GLA, 1–6%).[4][5] The proportions of linoleic acid and alpha-linolenic acid in hempseed oil meet human requirements for EFAs. Unfortunately the unsaturated fat makes the oil rancid quickly, unless it is stored in dark coloured bottles or mixed with chemical preservatives. This makes hemp oil difficult to transport or store. The high unsaturated fat content also makes the oil unsuitable for frying. This severely limits hemp oil's potential on the food market, although some marketing potential exists as a nutritional supplement.[6] Cooking of any oil reduces its nutritional value, and may convert beneficial fatty acids to less benign substances. | https://www.wikidoc.org/index.php/Hemp_oil | |
c1d39034b98522ec3a9f7502dfce3e6042039864 | wikidoc | Hepatica | Hepatica
Hepatica is a genus of herbaceous perennial plants belonging to the buttercup family, Ranunculaceae. A native of central and northern Europe, Asia and northeastern North America, Hepatica is sometimes called liverleaf or "liverwort". It should not be confused with liverworts, which may also be called "Hepaticae". A few botanists include Hepatica within a wider interpretation of Anemone, as Anemone hepatica.
Between two and ten species of Hepatica are recognised, with some of the taxa more often treated as varieties:
- Hepatica nobilis - Common Hepatica
H. nobilis var. pyrenaica (H. pyrenaica) - Pyrenees
H. nobilis var. japonica (H. japonica) - Japan
H. nobilis var. nobilis - European Hepatica - Alps north to Scandinavia
H. nobilis var. pubescens (H. pubescens) - Japan
H. nobilis var. acuta (H. acutiloba) - Sharp-lobed Hepatica - North America
H. nobilis var. obtusa (H. americana) - Round-lobed Hepatica - North America
- H. nobilis var. pyrenaica (H. pyrenaica) - Pyrenees
- H. nobilis var. japonica (H. japonica) - Japan
- H. nobilis var. nobilis - European Hepatica - Alps north to Scandinavia
- H. nobilis var. pubescens (H. pubescens) - Japan
- H. nobilis var. acuta (H. acutiloba) - Sharp-lobed Hepatica - North America
- H. nobilis var. obtusa (H. americana) - Round-lobed Hepatica - North America
- Hepatica transsilvanica - Carpathian Mountains and Transylvania
Hepatica cultivation has been popular in Japan since the 18th Century (mid-Edo period), where flowers with doubled petals and a range of colour patterns have been developed .
Noted for their tolerance of alkaline limestone-derived soils, Hepatica may grow in a wide range of conditions; it can be found either in deeply shaded deciduous (especially beech) woodland and scrub or grassland in full sun. Hepatica will also grow in both sandy and clay-rich substrates, being associated with limestone. Moist soil and winter snowfall is a requirement; Hepatica is tolerant of winter snow cover, but less so of dry frost.
Hepatica reaches a height of 10 cm and produces hermaphroditic flowers from February to May. The leaves are basal and dark leathery green, each with three lobes. The flowers may be white, bluish purple or pink; they are supported singly on hairy, largely leafless stems. Butterflies, moths, bees, flies and beetles are known to act as pollinators for Hepatica.
Hepatica is named from its leaves, which, like the human liver (Greek hepar), have three lobes. It was once used as a medicinal herb. Owing to the doctrine of signatures, the plant was thought an effective treatment for liver disorders. Although poisonous in large doses, the leaves and flowers may be used as an astringent, demulcent for slow-healing injuries and as a diuretic .
# Gallery
- Hepatica nobilis
Hepatica nobilis
- Hepatica nobilis
Hepatica nobilis
- Hepatica nobilis
Hepatica nobilis | Hepatica
Hepatica is a genus of herbaceous perennial plants belonging to the buttercup family, Ranunculaceae. A native of central and northern Europe, Asia and northeastern North America, Hepatica is sometimes called liverleaf or "liverwort". It should not be confused with liverworts, which may also be called "Hepaticae". A few botanists include Hepatica within a wider interpretation of Anemone, as Anemone hepatica.[1][2]
Between two and ten species of Hepatica are recognised, with some of the taxa more often treated as varieties:
- Hepatica nobilis - Common Hepatica
H. nobilis var. pyrenaica (H. pyrenaica) - Pyrenees
H. nobilis var. japonica (H. japonica) - Japan
H. nobilis var. nobilis - European Hepatica - Alps north to Scandinavia
H. nobilis var. pubescens (H. pubescens) - Japan
H. nobilis var. acuta (H. acutiloba) - Sharp-lobed Hepatica - North America[3][4]
H. nobilis var. obtusa (H. americana) - Round-lobed Hepatica - North America[5][6]
- H. nobilis var. pyrenaica (H. pyrenaica) - Pyrenees
- H. nobilis var. japonica (H. japonica) - Japan
- H. nobilis var. nobilis - European Hepatica - Alps north to Scandinavia
- H. nobilis var. pubescens (H. pubescens) - Japan
- H. nobilis var. acuta (H. acutiloba) - Sharp-lobed Hepatica - North America[3][4]
- H. nobilis var. obtusa (H. americana) - Round-lobed Hepatica - North America[5][6]
- Hepatica transsilvanica - Carpathian Mountains and Transylvania
Hepatica cultivation has been popular in Japan since the 18th Century (mid-Edo period), where flowers with doubled petals and a range of colour patterns have been developed [7].
Noted for their tolerance of alkaline limestone-derived soils, Hepatica may grow in a wide range of conditions; it can be found either in deeply shaded deciduous (especially beech) woodland and scrub or grassland in full sun. Hepatica will also grow in both sandy and clay-rich substrates, being associated with limestone. Moist soil and winter snowfall is a requirement; Hepatica is tolerant of winter snow cover, but less so of dry frost.
Hepatica reaches a height of 10 cm and produces hermaphroditic flowers from February to May. The leaves are basal and dark leathery green, each with three lobes. The flowers may be white, bluish purple or pink; they are supported singly on hairy, largely leafless stems. Butterflies, moths, bees, flies and beetles are known to act as pollinators for Hepatica.
Hepatica is named from its leaves, which, like the human liver (Greek hepar), have three lobes. It was once used as a medicinal herb. Owing to the doctrine of signatures, the plant was thought an effective treatment for liver disorders. Although poisonous in large doses, the leaves and flowers may be used as an astringent, demulcent for slow-healing injuries and as a diuretic [1].
# Gallery
- Hepatica nobilis
Hepatica nobilis
- Hepatica nobilis
Hepatica nobilis
- Hepatica nobilis
Hepatica nobilis | https://www.wikidoc.org/index.php/Hepatica | |
1000c010a2d9006767424d51491755e581d8fbfa | wikidoc | Lymphoma | Lymphoma
# Overview
Lymphoma is a type of cancer that originates in lymphocytes (a type of white blood cell in the vertebrate immune system). There are many types of lymphoma. Lymphomas are part of the broad group of diseases called hematological neoplasms. It was discovered by Thomas Hodgkin in 1832 and was called Hodgkin's Disease throughout the 19th and 20th centuries. Colloquially, lymphoma is broadly categorized as Hodgkin's lymphoma or non-Hodgkin lymphoma (all other types of lymphoma). Scientific classification of the types of lymphoma is more detailed. Although older classifications referred to histiocytic lymphomas, these are recognized in newer classifications as of B, T or NK cell lineage. Histiocytic malignancies are rare and are classified as sarcomas.
# Classification
# Differentiating Lymphoma From Other Diseases
CNS lymphoma must be differentiated from other causes of seizures, headache, and fever in immunocompromised patients such as disseminated tuberculosis and disseminated aspergillosis.
# Epidemiology and Demographics
- According to the U.S. National Institutes of Health, lymphomas account for about five percent of all cases of cancer in the United States.
- Hodgkin's lymphoma in particular accounts for less than one percent of all cases of cancer in the United States | Lymphoma
For patient information click here
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Ross Bonander, Aditya Ganti M.B.B.S. [2]
# Overview
Lymphoma is a type of cancer that originates in lymphocytes (a type of white blood cell in the vertebrate immune system). There are many types of lymphoma. Lymphomas are part of the broad group of diseases called hematological neoplasms. It was discovered by Thomas Hodgkin in 1832 and was called Hodgkin's Disease throughout the 19th and 20th centuries. Colloquially, lymphoma is broadly categorized as Hodgkin's lymphoma or non-Hodgkin lymphoma (all other types of lymphoma). Scientific classification of the types of lymphoma is more detailed. Although older classifications referred to histiocytic lymphomas, these are recognized in newer classifications as of B, T or NK cell lineage. Histiocytic malignancies are rare and are classified as sarcomas.[1]
# Classification
# Differentiating Lymphoma From Other Diseases
CNS lymphoma must be differentiated from other causes of seizures, headache, and fever in immunocompromised patients such as disseminated tuberculosis and disseminated aspergillosis.
# Epidemiology and Demographics
- According to the U.S. National Institutes of Health, lymphomas account for about five percent of all cases of cancer in the United States.
- Hodgkin's lymphoma in particular accounts for less than one percent of all cases of cancer in the United States | https://www.wikidoc.org/index.php/Heptaosplenic_T-cell_Lymphoma | |
8332424781171e8842c9c00d0eaccbd30b862af6 | wikidoc | Oligomer | Oligomer
# Overview
In chemistry, an oligomer consists of a finite number of monomer units (ολιγος, or oligos, is Greek for "a few"), in contrast to a polymer which, at least in principle, consists of an unbounded number of monomers.
In biochemistry, the term oligomer is used for short, single stranded DNA fragments, generally used in hybridization experiments (bound to glass slides or nylon membranes). It can also refer to a protein complex made of two or more subunits. In this case, a complex made of several different protein subunits is called a hetero-oligomer. When only one type of protein subunit is used in the complex, it is called homo-oligomer.
In oligomerization a chemical process only converts monomers to a finite degree of polymerization. The actual figure is a matter of debate, often a value between 10 and 100. | Oligomer
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
In chemistry, an oligomer consists of a finite number of monomer units (ολιγος, or oligos, is Greek for "a few"), in contrast to a polymer which, at least in principle, consists of an unbounded number of monomers.
In biochemistry, the term oligomer is used for short, single stranded DNA fragments, generally used in hybridization experiments (bound to glass slides or nylon membranes). It can also refer to a protein complex made of two or more subunits. In this case, a complex made of several different protein subunits is called a hetero-oligomer. When only one type of protein subunit is used in the complex, it is called homo-oligomer.
In oligomerization a chemical process only converts monomers to a finite degree of polymerization. The actual figure is a matter of debate, often a value between 10 and 100. | https://www.wikidoc.org/index.php/Hetero-oligomer | |
45087f32d043debd966407a0d037876124b55e34 | wikidoc | Zygosity | Zygosity
Zygosity refers to the genetic condition of a zygote. In genetics, zygosity describes the similarity or dissimilarity of DNA between homologous chromosomes at a specific allelic position or gene.
Every gene in a diploid organism has two alleles at the gene's locus. These alleles are defined as dominant or recessive, depending on the phenotype resulting from the two alleles. If a gene's two alleles are both dominant or both recessive, that specific gene is homozygous. If one allele is dominant and the other is recessive, the gene is heterozygous.
The terms homozygous, heterozygous and hemizygous are used to simplify the description of the genotype of a diploid organism at a single genetic locus. At a given gene or position along a chromosome (a locus), the DNA sequence can vary among individuals in the population. The variable DNA segments are referred to as alleles, and diploid organisms generally have two alleles at each locus, one allele for each of the two homologous chromosomes. Simply stated, homozygous describes two identical alleles or DNA sequences at one locus, heterozygous describes two different alleles at one locus, and hemizygous describes the presence of only a single copy of the gene in an otherwise diploid organism.
Zygosity is also used to describe the genetic condition of the zygote(s) from which twins emerge, where it refers to the similarity or dissimilarity of the twins' DNA. Identical twins are monozygotic - they develop from one zygote (one fertilized egg that develops into two embryos). Fraternal twins are dizygotic - they developed separately from two zygotes (two fertilized eggs). For a description of these terms, see twins.
# Homozygous
An organism is referred to as being homozygous (Basically meaning of the same alleles) at a specific locus when it carries two identical copies of the gene affecting a given trait on the two corresponding homologous chromosomes (e.g., the genotype is PP or pp when P and p refer to different possible alleles of the same gene). Such a cell or such an organism is called a homozygote.
A homozygous dominant genotype occurs when a particular locus has two copies of the dominant allele (e.g. PP). A homozygous recessive genotype occurs when a particular locus has two copies of the recessive allele (e.g. pp).
Pure-bred or true breeding organisms are homozygous.
For example a homozygous individual could have the allele combinations PP or pp.
All homozygous alleles are either allozygous or autozygous.
## Allozygous
Allozygosity is when two alleles are alike, but unrelated. The two alleles had different ancestral alleles that through convergent evolution became similar.
## Autozygous
Autozygosity is when two alleles are alike by relation, that is to say since they had a common ancestor, and they are similar.
# Heterozygous
An organism is a heterozygote or is heterozygous at a locus or gene when it has different alleles occupying the gene's position in each of the homologous chromosomes. In other words, it describes an individual that has 2 different alleles for a trait. In diploid organisms, the two different alleles were inherited from the organism's two parents. For example a heterozygous individual would have the allele combination Pp.
# Hemizygous
Hemizygous describes a diploid individual who has only one allele of a gene or chromosome segment rather than the usual two. A hemizygote refers to a cell or organism whose genome includes only one allele at a given locus. For organisms where the male is heterogametic, such as humans, it refers in particular to X-linked genes, since males normally possess only one X-chromosome. They are hemizygous for (nearly) all genes that are located on the X-chromosome.
In a more extreme example, male honeybees (Drones) are hemizygous organisms since they develop from unfertilized eggs and their entire genome is haploid.
# Inheritance of traits
The relationship between different alleles and the phenotypes that they affect is described in Dominance relationship. Some alleles are neither dominant nor recessive to another allele. In such cases, both alleles affect the phenotype of the heterozygote. Sometimes the result is an intermediate phenotype, such as when a snapdragon plant producing red flowers is crossed to one producing white flowers: the result is a heterozygous plant producing pink flowers. This is called incomplete dominance.
To symbolize how a gene is inherited, the dominant allele is indicated with an upper case character and the recessive with a lower case character. The colour of flowers in Mendel's inheritance experiments are often indicated as PP for the dominant homozygote, which produces a red flower, and pp for the recessive homozygote, which produces a white flower. When these two are crossed, the F1 or first filial generation receives one chromosome with the P allele from the red-flowered parent and a corresponding chromosome with the p allele from the white-flowered parent. All of the F1 generation are heterozygous, and this genotype is indicated with Pp. All of the F1 plants produce red flowers, as this is the dominant allele.
# Heterozygosity
Heterozygosity refers to the state of being a heterozygote. Heterozygosity can also refer to the fraction of loci within an individual that are heterozygous. In population genetics, it is commonly extended to refer to the population as a whole, i.e. the fraction of individuals in a population that are heterozygous for a particular locus.
Typically, the observed(H_o) and expected(H_e) heterozygosities are compared, defined as follows for diploid individuals in a population:
where n is the number of individuals in the population, and a_{i1},a_{i2} are the alleles of individual i at the target locus.
H_e = 1 - \sum_{i=1}^{m}{(f_i)^2}
where m is the number of alleles at the target locus, and f_i is the frequency of the i^{th} allele at the target locus. | Zygosity
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Template:Editor help
Zygosity refers to the genetic condition of a zygote. In genetics, zygosity describes the similarity or dissimilarity of DNA between homologous chromosomes at a specific allelic position or gene.
Every gene in a diploid organism has two alleles at the gene's locus. These alleles are defined as dominant or recessive, depending on the phenotype resulting from the two alleles. If a gene's two alleles are both dominant or both recessive, that specific gene is homozygous. If one allele is dominant and the other is recessive, the gene is heterozygous.
The terms homozygous, heterozygous and hemizygous are used to simplify the description of the genotype of a diploid organism at a single genetic locus. At a given gene or position along a chromosome (a locus), the DNA sequence can vary among individuals in the population. The variable DNA segments are referred to as alleles, and diploid organisms generally have two alleles at each locus, one allele for each of the two homologous chromosomes. Simply stated, homozygous describes two identical alleles or DNA sequences at one locus, heterozygous describes two different alleles at one locus, and hemizygous describes the presence of only a single copy of the gene in an otherwise diploid organism.
Zygosity is also used to describe the genetic condition of the zygote(s) from which twins emerge, where it refers to the similarity or dissimilarity of the twins' DNA. Identical twins are monozygotic - they develop from one zygote (one fertilized egg that develops into two embryos). Fraternal twins are dizygotic - they developed separately from two zygotes (two fertilized eggs). For a description of these terms, see twins.
# Homozygous
An organism is referred to as being homozygous (Basically meaning of the same alleles) at a specific locus when it carries two identical copies of the gene affecting a given trait on the two corresponding homologous chromosomes (e.g., the genotype is PP or pp when P and p refer to different possible alleles of the same gene). Such a cell or such an organism is called a homozygote.
A homozygous dominant genotype occurs when a particular locus has two copies of the dominant allele (e.g. PP). A homozygous recessive genotype occurs when a particular locus has two copies of the recessive allele (e.g. pp).
Pure-bred or true breeding organisms are homozygous.
For example a homozygous individual could have the allele combinations PP or pp.
All homozygous alleles are either allozygous or autozygous.
## Allozygous
Allozygosity is when two alleles are alike, but unrelated. The two alleles had different ancestral alleles that through convergent evolution became similar.
## Autozygous
Autozygosity is when two alleles are alike by relation, that is to say since they had a common ancestor, and they are similar.
# Heterozygous
An organism is a heterozygote or is heterozygous at a locus or gene when it has different alleles occupying the gene's position in each of the homologous chromosomes. In other words, it describes an individual that has 2 different alleles for a trait. In diploid organisms, the two different alleles were inherited from the organism's two parents. For example a heterozygous individual would have the allele combination Pp.
# Hemizygous
Hemizygous describes a diploid individual who has only one allele of a gene or chromosome segment rather than the usual two. A hemizygote refers to a cell or organism whose genome includes only one allele at a given locus. For organisms where the male is heterogametic, such as humans, it refers in particular to X-linked genes, since males normally possess only one X-chromosome. They are hemizygous for (nearly) all genes that are located on the X-chromosome.
In a more extreme example, male honeybees (Drones) are hemizygous organisms since they develop from unfertilized eggs and their entire genome is haploid.
# Inheritance of traits
The relationship between different alleles and the phenotypes that they affect is described in Dominance relationship. Some alleles are neither dominant nor recessive to another allele. In such cases, both alleles affect the phenotype of the heterozygote. Sometimes the result is an intermediate phenotype, such as when a snapdragon plant producing red flowers is crossed to one producing white flowers: the result is a heterozygous plant producing pink flowers. This is called incomplete dominance.
To symbolize how a gene is inherited, the dominant allele is indicated with an upper case character and the recessive with a lower case character. The colour of flowers in Mendel's inheritance experiments are often indicated as PP for the dominant homozygote, which produces a red flower, and pp for the recessive homozygote, which produces a white flower. When these two are crossed, the F1 or first filial generation receives one chromosome with the P allele from the red-flowered parent and a corresponding chromosome with the p allele from the white-flowered parent. All of the F1 generation are heterozygous, and this genotype is indicated with Pp. All of the F1 plants produce red flowers, as this is the dominant allele.
# Heterozygosity
Heterozygosity refers to the state of being a heterozygote. Heterozygosity can also refer to the fraction of loci within an individual that are heterozygous. In population genetics, it is commonly extended to refer to the population as a whole, i.e. the fraction of individuals in a population that are heterozygous for a particular locus.
Typically, the observed(<math>H_o</math>) and expected(<math>H_e</math>) heterozygosities are compared, defined as follows for diploid individuals in a population:
where <math>n</math> is the number of individuals in the population, and <math>a_{i1},a_{i2}</math> are the alleles of individual <math>i</math> at the target locus.
H_e = 1 - \sum_{i=1}^{m}{(f_i)^2}
</math>
where <math>m</math> is the number of alleles at the target locus, and <math>f_i</math> is the frequency of the <math>i^{th}</math> allele at the target locus. | https://www.wikidoc.org/index.php/Heterozygosity | |
03caf6d7dc05b11fcae23d13ef77c1e9cfa997bb | wikidoc | Hexacene | Hexacene
Hexacene is an aromatic molecule consisting of six linearly-fused benzene rings. Hexacene and its derivatives are investigated for potential applications as organic semiconductor.
Hexacene is one of a series of linear acenes, the previous one being pentacene (five fused benzene rings) and the next one being heptacene (seven fused benzene rings) .
Hexacene is very unstable, being highly reactive in the 6, 15 positions due to pi electron localization. Its spectra must be collected on freshly purified samples handled in an inert atmosphere such as nitrogen or argon. Only with very large substituents it is possible to isolate an hexacene for instance the compound 6,15-bis(tri-t-butylsilylethynyl)hexacene which melts with decomposition at 96°C.
The first reported synthesis of hexacene itself dates back to 1942 In 1955 the compound is synthesized by dehydrogenation of hexacosadehydrohexacene by palladium on carbon . In 1982 hexacene is reported as a bluish green compound with decomposition at 380 degrees . In 2007, a research group claimed the first reproducible unsubstituted hexacene synthesis (invalidating the previous claims) based on photochemical decarbonylation of a dione precursor :
The compound cannot be isolated: it dimerizes even at concentration as low as 10-4 M and reacts in solution with oxygen to the organic peroxide. In a PMMA polymer matrix on the other hand these side-reactions are limited and the compound can survive up to 12 hours. The next homologue heptacene also studied by this group, is even more unstable (decomposes within 4 hours). | Hexacene
Hexacene is an aromatic molecule consisting of six linearly-fused benzene rings. Hexacene and its derivatives are investigated for potential applications as organic semiconductor.
Hexacene is one of a series of linear acenes, the previous one being pentacene (five fused benzene rings) and the next one being heptacene (seven fused benzene rings) [1].
Hexacene is very unstable, being highly reactive in the 6, 15 positions due to pi electron localization. Its spectra must be collected on freshly purified samples handled in an inert atmosphere such as nitrogen or argon. Only with very large substituents it is possible to isolate an hexacene for instance the compound 6,15-bis(tri-t-butylsilylethynyl)hexacene which melts with decomposition at 96°C. [2]
The first reported synthesis of hexacene itself dates back to 1942 [3] In 1955 the compound is synthesized by dehydrogenation of hexacosadehydrohexacene by palladium on carbon [4]. In 1982 hexacene is reported as a bluish green compound with decomposition at 380 degrees [5]. In 2007, a research group claimed the first reproducible unsubstituted hexacene synthesis (invalidating the previous claims) based on photochemical decarbonylation of a dione precursor [6]:
The compound cannot be isolated: it dimerizes even at concentration as low as 10-4 M and reacts in solution with oxygen to the organic peroxide. In a PMMA polymer matrix on the other hand these side-reactions are limited and the compound can survive up to 12 hours. The next homologue heptacene also studied by this group, is even more unstable (decomposes within 4 hours). | https://www.wikidoc.org/index.php/Hexacene | |
2c697d9866b2ae1e6eaac642b7dad83fced0c50e | wikidoc | Hexamine | Hexamine
# Overview
Hexamine, also called hexamethylenetetramine or methenamine (INN), is a heterocyclic organic compound that can be prepared by the reaction of formaldehyde and ammonia. It is crystalline and white in appearance. Particle size ranges from 80-800 micrometres. It is moderately soluble in water and very soluble in most organic solvents. It has a cage-like structure similar to adamantane.
It has two very different types of uses: as an antibiotic (commonly the hippurate salt, methenamine hippurate), and as a solid fuel tablet used for cooking while camping or hiking. The name methenamine is more common in its medicinal uses and hexamine is more common in commercial uses.
# Medicinal and food uses
Methenamine hippurate is mainly used for the prophylaxis (prevention) of urinary tract infections, where it is hydrolysed in the acidic pH of the urine to form formaldehyde. Formaldehyde is an effective antiseptic against bacteria and fungi in vitro, but may not be effective in vivo - it has not been shown to be effective for the treatment of urinary tract infections. Furthermore, certain bacteria (including Proteus spp. and Pseudomonas spp.) increase urinary pH, rendering methenamine ineffective. (Rossi, 2004) Methenamine can also be used to treat hyperhidrosis when applied topically. (Beers & Berkow, 1999) In China, a 10% solution is used as a deodorant.
As a food additive, hexamine is used as a preservative in cheeses. It has E number E239. In some countries it is banned for this use.
Hexamine can be absorbed through the skin, and some people are allergic to it. This usually only manifests as a rash.
# Industrial and commercial uses
Hexamine is used as a component with 1,3,5-trioxane in hexamine fuel tablets (often called Esbit). This solid fuel in tablet form is used by campers, hobbyists, the military and relief organizations for heating camping food or military rations. It burns smokelessly, has a high energy density, does not liquify while burning and leaves no ashes.
Another important area for use of hexamine is in the production of powdery or liquid preparations of phenolic resins and phenolic resin moulding compounds, where hexamine is added as a hardening component. These products are used as binders, e.g. in brake and clutch linings, abrasive products, non-woven textiles, formed parts produced by moulding processes, and fireproof materials.
It is used in rubber and textile adhesives, in paints and lacquers, in the photographic industry, in the production of explosives such as RDX, as a corrosion inhibitor, as a protein modifier, as a reagent in chemical analysis, and in the production of deodorants and hair fixers, among many other uses. (Roempp, 1997; Ullmann, 1995)
# Reagent in organic chemistry
Hexamine is a reagent in organic chemistry. it is used in the Duff reaction (formylation of arenes) and in the Delepine reaction (synthesis of amines from alkyl halides)
# Producers
Vesta Pharmaceuticals, Inc offers Methenamine tablet for Timed Burning which is used for the US Government Safety Measure.
Since 1990 the number of European producers has been significantly declining. The French SNPE closed the factory 1990, in 1993 the production of Hexamine in Leuna / Germany was ceased. 1996 the Italian facility of Agrolinz was closed down and 2001 the UK producer Borden closed down the site. In 2006 the production unit of Chemko, Slovakian Republic, was closed down. The remaining producers are INEOS in Germany, Caldic in the Netherlands and Hexion in Italy. Further closures are to be expected. | Hexamine
Template:Chembox new
# Overview
Hexamine, also called hexamethylenetetramine or methenamine (INN), is a heterocyclic organic compound that can be prepared by the reaction of formaldehyde and ammonia. It is crystalline and white in appearance. Particle size ranges from 80-800 micrometres. It is moderately soluble in water and very soluble in most organic solvents. It has a cage-like structure similar to adamantane.
It has two very different types of uses: as an antibiotic (commonly the hippurate salt, methenamine hippurate), and as a solid fuel tablet used for cooking while camping or hiking. The name methenamine is more common in its medicinal uses and hexamine is more common in commercial uses.
# Medicinal and food uses
Methenamine hippurate is mainly used for the prophylaxis (prevention) of urinary tract infections, where it is hydrolysed in the acidic pH of the urine to form formaldehyde. Formaldehyde is an effective antiseptic against bacteria and fungi in vitro, but may not be effective in vivo - it has not been shown to be effective for the treatment of urinary tract infections. Furthermore, certain bacteria (including Proteus spp. and Pseudomonas spp.) increase urinary pH, rendering methenamine ineffective. (Rossi, 2004) Methenamine can also be used to treat hyperhidrosis when applied topically. (Beers & Berkow, 1999) In China, a 10% solution is used as a deodorant.
As a food additive, hexamine is used as a preservative in cheeses. It has E number E239. In some countries it is banned for this use.
Hexamine can be absorbed through the skin, and some people are allergic to it. This usually only manifests as a rash.
# Industrial and commercial uses
Hexamine is used as a component with 1,3,5-trioxane in hexamine fuel tablets (often called Esbit). This solid fuel in tablet form is used by campers, hobbyists, the military and relief organizations for heating camping food or military rations. It burns smokelessly, has a high energy density, does not liquify while burning and leaves no ashes.
Another important area for use of hexamine is in the production of powdery or liquid preparations of phenolic resins and phenolic resin moulding compounds, where hexamine is added as a hardening component. These products are used as binders, e.g. in brake and clutch linings, abrasive products, non-woven textiles, formed parts produced by moulding processes, and fireproof materials.
It is used in rubber and textile adhesives, in paints and lacquers, in the photographic industry, in the production of explosives such as RDX, as a corrosion inhibitor, as a protein modifier, as a reagent in chemical analysis, and in the production of deodorants and hair fixers, among many other uses. (Roempp, 1997; Ullmann, 1995)
# Reagent in organic chemistry
Hexamine is a reagent in organic chemistry. it is used in the Duff reaction (formylation of arenes) and in the Delepine reaction (synthesis of amines from alkyl halides)
# Producers
Vesta Pharmaceuticals, Inc offers Methenamine tablet for Timed Burning which is used for the US Government Safety Measure.
Since 1990 the number of European producers has been significantly declining. The French SNPE closed the factory 1990, in 1993 the production of Hexamine in Leuna / Germany was ceased. 1996 the Italian facility of Agrolinz was closed down and 2001 the UK producer Borden closed down the site. In 2006 the production unit of Chemko, Slovakian Republic, was closed down. The remaining producers are INEOS in Germany, Caldic in the Netherlands and Hexion in Italy. Further closures are to be expected. | https://www.wikidoc.org/index.php/Hexamethylenetetramine | |
bb7ca53d8219d7b1c680191bf5e9c47bcc3b74a1 | wikidoc | Hfr cell | Hfr cell
An hfr cell (also called hfr strain) is a bacterium with a conjugative plasmid (often F) integrated into its genomic DNA. Hfr is the abbreviation for high frequency recombination, which was first characterized by Luca Cavalli-Sforza. Unlike a normal F+ cell, hfr strains will, upon conjugation with a F− cell, attempt to transfer their entire DNA through the mating bridges (called pili) to the F− cell. This occurs because the F factor has integrated itself via an insertion point in the bacterial chromosome. Due to the F factor's inherent nature to transfer itself over the pilus during bacteria conjugation, the rest of the bacterial genome is dragged along with it, thus making such cells very useful and interesting in terms of studying gene linkage and recombination. Because the genome's rate of transfer through the pilus is constant, molecular biologists and geneticists can use Hfr strain of bacteria (often E. coli) to study genetic linkage and map the chromosome. The procedure commonly used for this is called interrupted mating.
A bacterium may undergo conjugation. During this process, genetic material is transferred to another bacterium through the sex pili. To form sex pili and donate DNA during conjugation, an F plasmid is required. The F plasmid consists of around 25 genes which are mostly required for the production of the sex pili. F+ denotes cells that contain the F plasmid, while F− cells do not. The F plasmid is considered to be an episome which may become integrated into the main chromosome. When the F genes become integrated into the chromosome, the cell is said to be Hfr (high frequency of recombination). An Hfr cell may transfer F genes to an F− cell. During this transfer of genetic material, the F episome may take chromosomal DNA with it. The donor cell does not lose any genetic material as anything transferred is also replicated concurrently. It is extremely rare that an Hfr cell's chromosome is transferred in its entirety. Homologous recombination occurs when the newly acquired DNA crosses over with the homologous region of its own chromosome.
A structure as fragile as a mating bridge will, however, likely break, and so the transfer is rarely complete. Thus, the F− cell uses only part of the genomic DNA of the Hfr cell for recombination. Though there is some debate on the issue, the pili themselves do not seem to be the structures through which the actual exchange of DNA takes place; rather, some proteins seem to open a channel between the bacteria.
de:Hfr-Stamm | Hfr cell
An hfr cell (also called hfr strain) is a bacterium with a conjugative plasmid (often F) integrated into its genomic DNA. Hfr is the abbreviation for high frequency recombination, which was first characterized by Luca Cavalli-Sforza. Unlike a normal F+ cell, hfr strains will, upon conjugation with a F− cell, attempt to transfer their entire DNA through the mating bridges (called pili) to the F− cell. This occurs because the F factor has integrated itself via an insertion point in the bacterial chromosome. Due to the F factor's inherent nature to transfer itself over the pilus during bacteria conjugation, the rest of the bacterial genome is dragged along with it, thus making such cells very useful and interesting in terms of studying gene linkage and recombination. Because the genome's rate of transfer through the pilus is constant, molecular biologists and geneticists can use Hfr strain of bacteria (often E. coli) to study genetic linkage and map the chromosome. The procedure commonly used for this is called interrupted mating.
A bacterium may undergo conjugation. During this process, genetic material is transferred to another bacterium through the sex pili. To form sex pili and donate DNA during conjugation, an F plasmid is required. The F plasmid consists of around 25 genes which are mostly required for the production of the sex pili. F+ denotes cells that contain the F plasmid, while F− cells do not. The F plasmid is considered to be an episome which may become integrated into the main chromosome. When the F genes become integrated into the chromosome, the cell is said to be Hfr (high frequency of recombination). An Hfr cell may transfer F genes to an F− cell. During this transfer of genetic material, the F episome may take chromosomal DNA with it. The donor cell does not lose any genetic material as anything transferred is also replicated concurrently. It is extremely rare that an Hfr cell's chromosome is transferred in its entirety. Homologous recombination occurs when the newly acquired DNA crosses over with the homologous region of its own chromosome.
A structure as fragile as a mating bridge will, however, likely break, and so the transfer is rarely complete. Thus, the F− cell uses only part of the genomic DNA of the Hfr cell for recombination. Though there is some debate on the issue, the pili themselves do not seem to be the structures through which the actual exchange of DNA takes place; rather, some proteins seem to open a channel between the bacteria.
de:Hfr-Stamm
Template:WH
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Hfr_cell | |
6fddf13aa492e4c0fdb684fa5a1b1511d33dd1f9 | wikidoc | Horchata | Horchata
Horchata or orxata is the name for several kinds of vegetable beverages, made of ground almonds, rice, barley or tigernuts (chufas).
# Etymology
The name comes from Valencian orxata, probably from ordiata, made from ordi (barley) (Latin *hordeata < hordeum). The French and English 'orgeat', the Italian 'orzata', and the Surinamese Dutch orgeade have the same origin, though the beverages themselves have diverged, and none of them is typically made from barley anymore.
According to a folk etymology, James I of Aragon was offered a glass of the beverage by an Arab girl after his conquest of Valencia, and exclaimed, Això és or, xata! (This is gold, girl!).
# Spain
In Spain, it usually refers to orxata de xufes (horchata de chufas), made from tigernuts, water and sugar. Originally from Valencia, it is served ice cold as a refreshment. It has a regulating council to ensure the quality of the product and the villages where it can come from, with the Denomination of Origin. Classics get an A. The village of Alboraia is well known for the quality of their horchatas. The idea of making horchata from tigernuts comes from the period of Muslim presence in Valencia (from the 8th to 13th century).
# Latin America
While in some countries the drink is usually tan and "milky", some recipes call for milk, and others do not. Other ingredients often include sugar, cinnamon, and vanilla. Though horchata was once typically homemade, it is now available in both ready-to-drink (shelf-stable or refrigerated) and powdered form in grocery stores.
In the US, rice-based or morro horchata is served in many Mexican restaurants, and the horchata de chufas is virtually unknown. Rice-based horchata is also sometimes available in US grocery and convenience stores, especially in Latino neighborhoods.
Horchata, together with tamarindo and jamaica, are the three typical drink flavors of Mexican aguas frescas.
The horchata found in El Salvador is often made of a mixture of herbs, not rice. In El Salvador, horchata is typically flavored with Morro (Calabash tree) seed, ground cocoa and cinnamon as well as sesame seeds, and in some cases is strained.
In Nicaragua and Honduras horchata refers to the drink known as semilla de jicaro, made from the Jicaro seeds ground up with rice and spices. The drink is made with cold milk and sugar and is very popular nationally. Recently Nicaragua has began exporting this product primarily to the United States.
# As an alcoholic mixer
Some Latin-American bars in Southern California use horchata as a mixer in a cocktail known as a Rice Rocket. The drink is made of 2 parts horchata, 1 part coconut-flavored rum and a dash of Goldschläger over ice. | Horchata
Horchata or orxata is the name for several kinds of vegetable beverages, made of ground almonds, rice, barley or tigernuts (chufas).
# Etymology
The name comes from Valencian orxata, probably from ordiata, made from ordi (barley) (Latin *hordeata < hordeum). The French and English 'orgeat', the Italian 'orzata', and the Surinamese Dutch orgeade have the same origin, though the beverages themselves have diverged, and none of them is typically made from barley anymore. [1]
According to a folk etymology, James I of Aragon was offered a glass of the beverage by an Arab girl after his conquest of Valencia, and exclaimed, Això és or, xata! (This is gold, girl!).
# Spain
In Spain, it usually refers to orxata de xufes (horchata de chufas), made from tigernuts, water and sugar. Originally from Valencia, it is served ice cold as a refreshment. It has a regulating council[1] to ensure the quality of the product and the villages where it can come from, with the Denomination of Origin. Classics get an A. The village of Alboraia is well known for the quality of their horchatas. The idea of making horchata from tigernuts comes from the period of Muslim presence in Valencia (from the 8th to 13th century).
# Latin America
While in some countries the drink is usually tan and "milky", some recipes call for milk, and others do not. Other ingredients often include sugar, cinnamon, and vanilla. Though horchata was once typically homemade, it is now available in both ready-to-drink (shelf-stable or refrigerated) and powdered form in grocery stores.
In the US, rice-based or morro horchata is served in many Mexican restaurants, and the horchata de chufas is virtually unknown. Rice-based horchata is also sometimes available in US grocery and convenience stores, especially in Latino neighborhoods.
Horchata, together with tamarindo and jamaica, are the three typical drink flavors of Mexican aguas frescas.
The horchata found in El Salvador is often made of a mixture of herbs, not rice. In El Salvador, horchata is typically flavored with Morro (Calabash tree) seed, ground cocoa and cinnamon as well as sesame seeds, and in some cases is strained.
In Nicaragua and Honduras horchata refers to the drink known as semilla de jicaro, made from the Jicaro seeds ground up with rice and spices. The drink is made with cold milk and sugar and is very popular nationally. Recently Nicaragua has began exporting this product primarily to the United States.
# As an alcoholic mixer
Some Latin-American bars in Southern California use horchata as a mixer in a cocktail known as a Rice Rocket. The drink is made of 2 parts horchata, 1 part coconut-flavored rum and a dash of Goldschläger over ice. | https://www.wikidoc.org/index.php/Horchata | |
a984da1c2ca0c504409d43afc4416e1cca2b318f | wikidoc | Horimono | Horimono
Horimono (彫り物, 彫物, literally carving, engraving) is a word used to describe Japanese Irezumi (Japanese Tattooing) or to describe the carving of images into a sword blade.
# Japanese Irezumi
The Japanese word irezumi (入れ墨, 入墨, 文身, 剳青, 黥 or 刺青) refers to the insertion of ink under the skin to leave a permanent, usually decorative mark, in other words, tattooing. While both terms are often used interchangeably, horimono is generally considered the more polite term.
Tattooing for spiritual and decorative purposes in Japan is thought to extend back to at least the Jōmon or paleolithic period (approximately 10000 BCE). Some scholars have suggested that the distinctive cord-marked patterns observed on the faces and bodies of figures dated to that period represent tattoos, but this claim is by no means unanimous. There are similarities, however, between such markings and the tattoo traditions observed in other contemporaneous cultures.
At the beginning of the Meiji period the Japanese government, wanting to protect its image and make a good impression on the West, outlawed tattoos, and irezumi took on connotations of criminality. Nevertheless, fascinated foreigners went to Japan seeking the skills of tattoo artists, and traditional tattooing continued underground.
Tattooing was legalized by the occupation forces in 1945, but unfortunately has retained its image of criminality. For many years, traditional Japanese tattoos were associated with the yakuza, Japan's notorious mafia, and many businesses in Japan (such as public baths, fitness centers and hot springs) still ban customers with tattoos.
# Japanese Swords
Horimono is also called Chokoku (彫刻) when describing carving pictures into Japanese swords including Katana and Tanto. The carving is used mostly for ceremonial blades due to the inherent weakness in a carved blade. The engravings are created by a Chokokushi (彫刻師), also called a Horimonoshi (彫物師) engraver. They come in a huge variety of designs: Kozumi (claws), Kusa kurikara (草倶利伽羅) (Arabesque style), Munenagabori (Created in Munenaga), Rendai (Lotus pedastal), Tokko (a type of indian sword), fruit, dragons, and many others. | Horimono
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Horimono (彫り物, 彫物, literally carving, engraving) is a word used to describe Japanese Irezumi (Japanese Tattooing) or to describe the carving of images into a sword blade.
# Japanese Irezumi
The Japanese word irezumi (入れ墨, 入墨, 文身, 剳青, 黥 or 刺青) refers to the insertion of ink under the skin to leave a permanent, usually decorative mark, in other words, tattooing. While both terms are often used interchangeably, horimono is generally considered the more polite term.
Tattooing for spiritual and decorative purposes in Japan is thought to extend back to at least the Jōmon or paleolithic period (approximately 10000 BCE). Some scholars have suggested that the distinctive cord-marked patterns observed on the faces and bodies of figures dated to that period represent tattoos, but this claim is by no means unanimous. There are similarities, however, between such markings and the tattoo traditions observed in other contemporaneous cultures.
At the beginning of the Meiji period the Japanese government, wanting to protect its image and make a good impression on the West, outlawed tattoos, and irezumi took on connotations of criminality. Nevertheless, fascinated foreigners went to Japan seeking the skills of tattoo artists, and traditional tattooing continued underground.
Tattooing was legalized by the occupation forces in 1945, but unfortunately has retained its image of criminality. For many years, traditional Japanese tattoos were associated with the yakuza, Japan's notorious mafia, and many businesses in Japan (such as public baths, fitness centers and hot springs) still ban customers with tattoos.
# Japanese Swords
Horimono is also called Chokoku[1] (彫刻) when describing carving pictures into Japanese swords including Katana and Tanto. The carving is used mostly for ceremonial blades due to the inherent weakness in a carved blade[2]. The engravings are created by a Chokokushi (彫刻師), also called a Horimonoshi (彫物師) engraver. They come in a huge variety of designs: Kozumi (claws), Kusa kurikara (草倶利伽羅) (Arabesque style), Munenagabori (Created in Munenaga), Rendai (Lotus pedastal), Tokko (a type of indian sword), fruit, dragons, and many others. | https://www.wikidoc.org/index.php/Horimono | |
8243a7c8248b5af3bee2e4722717a75b3be5cb51 | wikidoc | Hy's law | Hy's law
Synonyms and keywords: Hy's rule
# Overview
Hy's law is a prognostic indicator based on observations by Hyman J. Zimmerman that drug-induced hepatocellular injury with jaundice is a grave illness, with an estimated mortality rate of 10 to 50 percent.
Hy’s Law is essentially a translation of Hy Zimmerman’s observation that pure hepatocellular injury sufficient to cause hyperbilirubinemia is an ominous indicator of the potential for a drug to cause serious liver injury. Thus, a finding of ALT elevation, usually substantial, seen concurrently with bilirubin >2xULN, identifies a drug likely to cause severe DILI (fatal or requiring transplant) at a rate roughly 1/10 the rate of Hy’s Law cases.
# Historical Perspective
Recognition of the importance of altered liver function, in addition to liver injury, began with Zimmerman’s observation that drug-induced hepatocellular injury (i.e., aminotransferase elevation) accompanied by jaundice had a poor prognosis, with a 10 to 50 percent mortality from acute liver failure in pretransplantation days. The reason for this now seems clear. Because the liver has a large excess of bilirubin-excreting capacity, injury to hepatocytes sufficient to cause jaundice or even mild hyperbilirubinemia (i.e., a bilirubin >2xULN) represents an extent of liver injury so great that recovery may not be possible in some patients. Zimmerman’s observation that hepatocellular injury sufficient to impair bilirubin excretion was ominous has been used at the Food and Drug Administration (FDA) over the years to identify drugs likely to be capable of causing severe liver injury. The observation of the critical importance of altered liver function has been referred to informally as Hy’s Law.
# Classification
# Pathophysiology
# Causes
# Differentiating Hy's law from Other Diseases
# Epidemiology and Demographics
# Risk Factors
# Screening
# Natural History, Complications, and Prognosis
## Natural History
## Complications
## Prognosis
Without a hepatic transplant, patients meeting criteria for Hy's Law face a case fatality rate of 10% to 50%.
# Diagnosis
## Diagnostic Criteria
## History and Symptoms
## Physical Examination
## Laboratory Findings
## Imaging Findings
## Other Diagnostic Studies
# Treatment
## Medical Therapy
## Surgery
## Prevention | Hy's law
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief:
Synonyms and keywords: Hy's rule
# Overview
Hy's law is a prognostic indicator based on observations by Hyman J. Zimmerman that drug-induced hepatocellular injury with jaundice is a grave illness, with an estimated mortality rate of 10 to 50 percent.
Hy’s Law is essentially a translation of Hy Zimmerman’s observation that pure hepatocellular injury sufficient to cause hyperbilirubinemia is an ominous indicator of the potential for a drug to cause serious liver injury. Thus, a finding of ALT elevation, usually substantial, seen concurrently with bilirubin >2xULN, identifies a drug likely to cause severe DILI (fatal or requiring transplant) at a rate roughly 1/10 the rate of Hy’s Law cases.[1][2]
# Historical Perspective
Recognition of the importance of altered liver function, in addition to liver injury, began with Zimmerman’s observation that drug-induced hepatocellular injury (i.e., aminotransferase elevation) accompanied by jaundice had a poor prognosis, with a 10 to 50 percent mortality from acute liver failure in pretransplantation days.[3] The reason for this now seems clear. Because the liver has a large excess of bilirubin-excreting capacity, injury to hepatocytes sufficient to cause jaundice or even mild hyperbilirubinemia (i.e., a bilirubin >2xULN) represents an extent of liver injury so great that recovery may not be possible in some patients. Zimmerman’s observation that hepatocellular injury sufficient to impair bilirubin excretion was ominous has been used at the Food and Drug Administration (FDA) over the years to identify drugs likely to be capable of causing severe liver injury. The observation of the critical importance of altered liver function has been referred to informally as Hy’s Law.[4][5]
# Classification
# Pathophysiology
# Causes
# Differentiating Hy's law from Other Diseases
# Epidemiology and Demographics
# Risk Factors
# Screening
# Natural History, Complications, and Prognosis
## Natural History
## Complications
## Prognosis
Without a hepatic transplant, patients meeting criteria for Hy's Law face a case fatality rate of 10% to 50%.[6]
# Diagnosis
## Diagnostic Criteria
## History and Symptoms
## Physical Examination
## Laboratory Findings
## Imaging Findings
## Other Diagnostic Studies
# Treatment
## Medical Therapy
## Surgery
## Prevention | https://www.wikidoc.org/index.php/Hy%27s_Law | |
2d1af77889538250927e7246456f4730c94eaf43 | wikidoc | Hydrogen | Hydrogen
Hydrogen (Template:PronEng), is the chemical element represented by the symbol H and an atomic number of 1. At standard temperature and pressure it is a colourless, odorless, nonmetallic, tasteless, highly flammable diatomic gas (H2). With an atomic mass of 1.00794 amu, hydrogen is the lightest element.
Hydrogen is the most abundant of the chemical elements, constituting roughly 75% of the universe's elemental mass. Stars in the main sequence are mainly composed of hydrogen in its plasma state. Elemental hydrogen is relatively rare on Earth, and is industrially produced from hydrocarbons such as methane, after which most elemental hydrogen is used "captively" (meaning locally at the production site), with the largest markets about equally divided between fossil fuel upgrading (e.g., hydrocracking) and ammonia production (mostly for the fertilizer market). Hydrogen may be produced from water using the process of electrolysis, but this process is presently significantly more expensive commercially than hydrogen production from natural gas.
The most common naturally occurring isotope of hydrogen, known as protium, has a single proton and no neutrons. In ionic compounds it can take on either a positive charge (becoming a cation composed of a bare proton) or a negative charge (becoming an anion known as a hydride). Hydrogen can form compounds with most elements and is present in water and most organic compounds. It plays a particularly important role in acid-base chemistry, in which many reactions involve the exchange of protons between soluble molecules. As the only neutral atom for which the Schrödinger equation can be solved analytically, study of the energetics and bonding of the hydrogen atom has played a key role in the development of quantum mechanics.
# Chemistry
The solubility and characteristics of hydrogen with various metals are very important in metallurgy (as many metals can suffer hydrogen embrittlement) and in developing safe ways to store it for use as a fuel. Hydrogen is highly soluble in many compounds composed of rare earth metals and transition metals and can be dissolved in both crystalline and amorphous metals. Hydrogen solubility in metals is influenced by local distortions or impurities in the metal crystal lattice.
## Combustion
Hydrogen gas is highly flammable and will burn at concentrations as low as 4% H2 in air. The enthalpy of combustion for hydrogen is – 286 kJ/mol; it burns according to the following balanced equation.
When mixed with oxygen across a wide range of proportions, hydrogen explodes upon ignition. Hydrogen burns violently in air. It ignites automatically at a temperature of 560 C
Pure hydrogen-oxygen flames burn in the ultraviolet color range and are nearly invisible to the naked eye, as illustrated by the faintness of flame from the main space shuttle engines (as opposed to the easily visible flames from the shuttle boosters). Thus it is difficult to visually detect if a hydrogen leak is burning. The explosion of the Hindenburg airship was an infamous case of hydrogen combustion (pictured), although the tragedy was due mainly to combustible materials in the skin, which were also responsible for the coloring of the flames. Another characteristic of hydrogen fires is that the flames tend to ascend rapidly with the gas in air, as illustrated by the Hindenberg flames, causing less damage than hydrocarbon fires. Two-thirds of the Hindenburg passengers survived the fire, and many of the deaths which occurred were from falling or from diesel fuel burns.
## Electron energy levels
The ground state energy level of the electron in a hydrogen atom is -13.6 eV, which is equivalent to an ultraviolet photon of roughly 92 nm.
The energy levels of hydrogen can be calculated fairly accurately using the Bohr model of the atom, which conceptualizes the electron as "orbiting" the proton in analogy to the Earth's orbit of the sun. However, the electromagnetic force attracts electrons and protons to one another, while planets and celestial objects are attracted to each other by gravity. Because of the discretization of angular momentum postulated in early quantum mechanics by Bohr, the electron in the Bohr model can only occupy certain allowed distances from the proton, and therefore only certain allowed energies. A more accurate description of the hydrogen atom comes from a purely quantum mechanical treatment that uses the Schrödinger equation or the equivalent Feynman path integral formulation to calculate the probability density of the electron around the proton. Treating the electron as a matter wave reproduces chemical results such as shape of the hydrogen atom more naturally than the particle-based Bohr model, although the energy and spectral results are the same. Modeling the system fully using the reduced mass of nucleus and electron (as one would do in the two-body problem in celestial mechanics) yields an even better formula for the hydrogen spectra, and also the correct spectral shifts for the isotopes deuterium and tritium. Very small adjustments in energy levels in the hydrogen atom, which correspond to actual spectral effects, may be determined by using a full quantum mechanical theory which corrects for the effects of special relativity (see Dirac equation), and by accounting for quantum effects arising from production of virtual particles in the vacuum and as a result of electric fields (see quantum electrodynamics).
In hydrogen liquid, the electronic ground state energy level is split into hyperfine structure levels because of magnetic effects of the quantum mechanical spin of the electron and proton. The energy of the atom when the proton and electron spins are aligned is higher than when they are not aligned. The transition between these two states can occur through emission of a photon through a magnetic dipole transition. Radio telescopes can detect the radiation produced in this process, which is used to map the distribution of hydrogen in the galaxy.
H2 reacts directly with other oxidizing elements. A violent and spontaneous reaction can occur at room temperature with chlorine and fluorine, forming the corresponding hydrogen halides: hydrogen chloride and hydrogen fluoride.
## Elemental molecular forms
There are two different types of diatomic hydrogen molecules that differ by the relative spin of their nuclei. In the orthohydrogen form, the spins of the two protons are parallel and form a triplet state; in the parahydrogen form the spins are antiparallel and form a singlet. At standard temperature and pressure, hydrogen gas contains about 25% of the para form and 75% of the ortho form, also known as the "normal form". The equilibrium ratio of orthohydrogen to parahydrogen depends on temperature, but since the ortho form is an excited state and has a higher energy than the para form, it is unstable and cannot be purified. At very low temperatures, the equilibrium state is composed almost exclusively of the para form. The physical properties of pure parahydrogen differ slightly from those of the normal form. The ortho/para distinction also occurs in other hydrogen-containing molecules or functional groups, such as water and methylene.
The uncatalyzed interconversion between para and ortho H2 increases with increasing temperature; thus rapidly condensed H2 contains large quantities of the high-energy ortho form that convert to the para form very slowly. The ortho/para ratio in condensed H2 is an important consideration in the preparation and storage of liquid hydrogen: the conversion from ortho to para is exothermic and produces enough heat to evaporate the hydrogen liquid, leading to loss of the liquefied material. Catalysts for the ortho-para interconversion, such as iron compounds, are used during hydrogen cooling.
A molecular form called protonated molecular hydrogen, or H3+, is found in the interstellar medium (ISM), where it is generated by ionization of molecular hydrogen from cosmic rays. It has also been observed in the upper atmosphere of the planet Jupiter. This molecule is relatively stable in the environment of outer space due to the low temperature and density. H3+ is one of the most abundant ions in the Universe, and it plays a notable role in the chemistry of the interstellar medium.
## Compounds
### Covalent and organic compounds
While H2 is not very reactive under standard conditions, it does form compounds with most elements. Millions of hydrocarbons are known, but they are not formed by the direct reaction of elementary hydrogen and carbon (although synthesis gas production followed by the Fischer-Tropsch process to make hydrocarbons comes close to being an exception, as this begins with coal and the elemental hydrogen is generated in situ). Hydrogen can form compounds with elements that are more electronegative, such as halogens (e.g., F, Cl, Br, I) and chalcogens (O, S, Se); in these compounds hydrogen takes on a partial positive charge. When bonded to fluorine, oxygen, or nitrogen, hydrogen can participate in a form of strong noncovalent bonding called hydrogen bonding, which is critical to the stability of many biological molecules. Hydrogen also forms compounds with less electronegative elements, such as the metals and metalloids, in which it takes on a partial negative charge. These compounds are often known as hydrides.
Hydrogen forms a vast array of compounds with carbon. Because of their general association with living things, these compounds came to be called organic compounds; the study of their properties is known as organic chemistry and their study in the context of living organisms is known as biochemistry. By some definitions, "organic" compounds are only required to contain carbon (as a classic historical example, urea). However, most of them also contain hydrogen, and since it is the carbon-hydrogen bond which gives this class of compounds most of its particular chemical characteristics, carbon-hydrogen bonds are required in some definitions of the word "organic" in chemistry. (This latter definition is not perfect, however, as in this definition urea would not be included as an organic compound).
In inorganic chemistry, hydrides can also serve as bridging ligands that link two metal centers in a coordination complex. This function is particularly common in group 13 elements, especially in boranes (boron hydrides) and aluminum complexes, as well as in clustered carboranes.
### Hydrides
Compounds of hydrogen are often called hydrides, a term that is used fairly loosely. To chemists, the term "hydride" usually implies that the H atom has acquired a negative or anionic character, denoted H−. The existence of the hydride anion, suggested by G.N. Lewis in 1916 for group I and II salt-like hydrides, was demonstrated by Moers in 1920 with the electrolysis of molten lithium hydride (LiH), that produced a stoichiometric quantity of hydrogen at the anode. For hydrides other than group I and II metals, the term is quite misleading, considering the low electronegativity of hydrogen. An exception in group II hydrides is BeH2, which is polymeric. In lithium aluminum hydride, the AlH4− anion carries hydridic centers firmly attached to the Al(III). Although hydrides can be formed with almost all main-group elements, the number and combination of possible compounds varies widely; for example, there are over 100 binary borane hydrides known, but only one binary aluminum hydride. Binary indium hydride has not yet been identified, although larger complexes exist.
### "Protons" and acids
Oxidation of H2 formally gives the proton, H+. This species is central to discussion of acids, though the term proton is used loosely to refer to positively charged or cationic hydrogen, denoted H+. A bare proton H+ cannot exist in solution because of its strong tendency to attach itself to atoms or molecules with electrons. To avoid the convenient fiction of the naked "solvated proton" in solution, acidic aqueous solutions are sometimes considered to contain the hydronium ion (H3O+) organized into clusters to form H9O4+. Other oxonium ions are found when water is in solution with other solvents.
Although exotic on earth, one of the most common ions in the universe is the H3+ ion, known as protonated molecular hydrogen or the triatomic hydrogen cation.
# Isotopes
Hydrogen has three naturally occurring isotopes, denoted 1H, ²H, and ³H. Other, highly unstable nuclei (4H to 7H) have been synthesized in the laboratory but not observed in nature.
- 1H is the most common hydrogen isotope with an abundance of more than 99.98%. Because the nucleus of this isotope consists of only a single proton, it is given the descriptive but rarely used formal name protium.
- ²H, the other stable hydrogen isotope, is known as deuterium and contains one proton and one neutron in its nucleus. Deuterium comprises 0.0026 – 0.0184% (by mole-fraction or atom-fraction) of hydrogen samples on Earth, with the lower number tending to be found in samples of hydrogen gas and the higher enrichments (0.015% or 150 ppm) typical of ocean water. Deuterium is not radioactive, and does not represent a significant toxicity hazard. Water enriched in molecules that include deuterium instead of normal hydrogen is called heavy water. Deuterium and its compounds are used as a non-radioactive label in chemical experiments and in solvents for 1H-NMR spectroscopy. Heavy water is used as a neutron moderator and coolant for nuclear reactors. Deuterium is also a potential fuel for commercial nuclear fusion.
- ³H is known as tritium and contains one proton and two neutrons in its nucleus. It is radioactive, decaying into Helium-3 through beta decay with a half-life of 12.32 years. Small amounts of tritium occur naturally because of the interaction of cosmic rays with atmospheric gases; tritium has also been released during nuclear weapons tests. It is used in nuclear fusion reactions, as a tracer in isotope geochemistry, and specialized in self-powered lighting devices. Tritium was once routinely used in chemical and biological labeling experiments as a radiolabel (this has become less common).
Hydrogen is the only element that has different names for its isotopes in common use today. (During the early study of radioactivity, various heavy radioactive isotopes were given names, but such names are no longer used). The symbols D and T (instead of ²H and ³H) are sometimes used for deuterium and tritium, but the corresponding symbol P is already in use for phosphorus and thus is not available for protium. IUPAC states that while this use is common it is not preferred.
# Natural occurrence
Hydrogen is the most abundant element in the universe, making up 75% of normal matter by mass and over 90% by number of atoms. This element is found in great abundance in stars and gas giant planets. Molecular clouds of H2 are associated with star formation. Hydrogen plays a vital role in powering stars through proton-proton reaction nuclear fusion.
Throughout the universe, hydrogen is mostly found in the atomic and plasma states whose properties are quite different from molecular hydrogen. As a plasma, hydrogen's electron and proton are not bound together, resulting in very high electrical conductivity and high emissivity (producing the light from the sun and other stars). The charged particles are highly influenced by magnetic and electric fields. For example, in the solar wind they interact with the Earth's magnetosphere giving rise to Birkeland currents and the aurora. Hydrogen is found in the neutral atomic state in the Interstellar medium. The large amount of neutral hydrogen found in the damped Lyman-alpha systems is thought to dominate the cosmological baryonic density of the Universe up to redshift z=4.
Under ordinary conditions on Earth, elemental hydrogen exists as the diatomic gas, H2 (for data see table). However, hydrogen gas is very rare in the Earth's atmosphere (1 ppm by volume) because of its light weight, which enables it to escape from Earth's gravity more easily than heavier gases. Although H atoms and H2 molecules are abundant in interstellar space, they are difficult to generate, concentrate, and purify on Earth. Still, hydrogen is the third most abundant element on the Earth's surface. Most of the Earth's hydrogen is in the form of chemical compounds such as hydrocarbons and water. Hydrogen gas is produced by some bacteria and algae and is a natural component of flatus. Methane is a hydrogen source of increasing importance.
# History
## Discovery of H2
Hydrogen gas, H2, was first artificially produced and formally described by T. Von Hohenheim (also known as Paracelsus, 1493 – 1541) via the mixing of metals with strong acids. He was unaware that the flammable gas produced by this chemical reaction was a new chemical element. In 1671, Robert Boyle rediscovered and described the reaction between iron filings and dilute acids, which results in the production of hydrogen gas. In 1766, Henry Cavendish was the first to recognize hydrogen gas as a discrete substance, by identifying the gas from a metal-acid reaction as "inflammable air" and further finding that the gas produces water when burned. Cavendish had stumbled on hydrogen when experimenting with acids and mercury. Although he wrongly assumed that hydrogen was a liberated component of the mercury rather than the acid, he was still able to accurately describe several key properties of hydrogen. He is usually given credit for its discovery as an element. In 1783, Antoine Lavoisier gave the element the name of hydrogen when he (with Laplace) reproduced Cavendish's finding that water is produced when hydrogen is burned. Lavoisier's name for the gas won out.
One of the first uses of H2 was for balloons, and later airships. The H2 was obtained by reacting sulfuric acid and metallic iron. Infamously, H2 was used in the Hindenburg airship that was destroyed in a midair fire. The highly flammable hydrogen (H2) was later replaced for airships and most balloons by the unreactive helium (He).
## Role in history of quantum theory
Because of its relatively simple atomic structure, consisting only of a proton and an electron, the hydrogen atom, together with the spectrum of light produced from it or absorbed by it, has been central to the development of the theory of atomic structure. Furthermore, the corresponding simplicity of the hydrogen molecule and the corresponding cation H2+ allowed fuller understanding of the nature of the chemical bond, which followed shortly after the quantum mechanical treatment of the hydrogen atom had been developed in the mid-1920s.
One of the first quantum effects to be explicitly noticed (but not understood at the time) was a Maxwell observation involving hydrogen, half a century before full quantum mechanical theory arrived. Maxwell observed that the specific heat capacity of H2 unaccountably departs from that of a diatomic gas below room temperature and begins to increasingly resemble that of a monatomic gas at cryogenic temperatures. According to quantum theory, this behavior arises from the spacing of the (quantized) rotational energy levels, which are particularly wide-spaced in H2 because of its low mass. These widely spaced levels inhibit equal partition of heat energy into rotational motion in hydrogen at low temperatures. Diatomic gases composed of heavier atoms do not have such widely spaced levels and do not exhibit the same effect.
# Applications
Large quantities of H2 are needed in the petroleum and chemical industries. The largest application of H2 is for the processing ("upgrading") of fossil fuels, and in the production of ammonia. The key consumers of H2 in the petrochemical plant include hydrodealkylation, hydrodesulfurization, and hydrocracking. H2 has several other important uses. H2 is used as a hydrogenating agent, particularly in increasing the level of saturation of unsaturated fats and oils (found in items such as margarine), and in the production of methanol. It is similarly the source of hydrogen in the manufacture of hydrochloric acid. H2 is also used as a reducing agent of metallic ores.
Apart from its use as a reactant, H2 has wide applications in physics and engineering. It is used as a shielding gas in welding methods such as atomic hydrogen welding. H2 is used as the rotor coolant in electrical generators at power stations, because it has the highest thermal conductivity of any gas. Liquid H2 is used in cryogenic research, including superconductivity studies. Since H2 is lighter than air, having a little more than 1/15th of the density of air, it was once widely used as a lifting agent in balloons and airships. However, this use was curtailed after the Hindenburg disaster erroneously convinced the public that the gas was too dangerous for this purpose. Hydrogen is still regularly used for the inflation of weather balloons.
In more recent application Hydrogen is used pure or mixed with Nitrogen (sometime called Forming Gas) as a tracer gas for minute leak detection. Applications can be found in automotive, aircraft, consumer goods, medical device and chemical industry. Hydrogen is an authorized food additive (E 949) that allows food package leak testing among other anti-oxidizing properties.
Hydrogen's rarer isotopes also each have specific applications. Deuterium (hydrogen-2) is used in nuclear fission applications as a moderator to slow neutrons, and in nuclear fusion reactions. Deuterium compounds have applications in chemistry and biology in studies of reaction isotope effects. Tritium (hydrogen-3), produced in nuclear reactors, is used in the production of hydrogen bombs, as an isotopic label in the biosciences, and as a radiation source in luminous paints.
The triple point temperature of equilibrium hydrogen is a defining fixed point on the ITS-90 temperature scale at 13.8033 Kelvin.
## Energy carrier
Hydrogen is not an energy source, except in the hypothetical context of commercial nuclear fusion power plants using deuterium or tritium, a technology presently far from development. The sun's energy comes from nuclear fusion of hydrogen but this process is difficult to achieve on earth. Elemental hydrogen from solar, biological, or electrical sources costs more in energy to make than is obtained by burning it. Hydrogen may be obtained from fossil sources (such as methane) for less energy than required to make it, but these sources are unsustainable, and are also themselves direct energy sources (and are rightly regarded as the basic source of the energy in the hydrogen obtained from them).
Molecular hydrogen has been widely discussed in the context of energy, as a possible carrier of energy on an economy-wide scale. A theoretical advantage of using H2 as an energy carrier is the localization and concentration of environmentally unwelcome aspects of hydrogen manufacture from fossil fuel energy sources. For example, CO2 sequestration followed by carbon capture and storage could be conducted at the point of H2 production from methane. Hydrogen used in transportation would burn cleanly, without carbon emissions. However, the infrastructure costs associated with full conversion to a hydrogen economy would be substantial. In addition, the energy density per unit volume of both liquid hydrogen and hydrogen gas at any practicable pressure is significantly less than that of traditional fuel sources. (Although the energy density per unit mass is higher)
# Production
H2 is produced in chemistry and biology laboratories, often as a by-product of other reactions; in industry for the hydrogenation of unsaturated substrates; and in nature as a means of expelling reducing equivalents in biochemical reactions.
## Laboratory syntheses
In the laboratory, H2 is usually prepared by the reaction of acids on metals such as zinc.
Aluminum produces H2 upon treatment with acids but also with base:
The electrolysis of water is a simple method of producing hydrogen, although the resulting hydrogen necessarily has less energy content than was required to produce it. A low voltage current is run through the water, and gaseous oxygen forms at the anode while gaseous hydrogen forms at the cathode. Typically the cathode is made from platinum or another inert metal when producing hydrogen for storage. If, however, the gas is to be burnt on site, oxygen is desirable to assist the combustion, and so both electrodes would be made from inert metals. (Iron, for instance, would oxidize, and thus decrease the amount of oxygen given off.) The theoretical maximum efficiency (electricity used vs. energetic value of hydrogen produced) is between 80 – 94%. Bellona Report on Hydrogen
In 2007, it was discovered that an alloy of aluminium and gallium in pellet form added to water could be used to generate hydrogen. The process creates also creates alumina, but the expensive gallium, which prevents to formation of an oxide skin on the pellets, can be re-used. This potentially has important implications for a hydrogen economy, since hydrogen can be produced on-site and does not need to be transported.
## Industrial syntheses
Hydrogen can be prepared in several different ways but the economically most important processes involve removal of hydrogen from hydrocarbons. Commercial bulk hydrogen is usually produced by the steam reforming of natural gas. At high temperatures (700 – 1100 °C; 1,300 – 2,000 °F), steam (water vapor) reacts with methane to yield carbon monoxide and H2.
This reaction is favored at low pressures but is nonetheless conducted at high pressures (20 atm; 600 inHg) since high pressure H2 is the most marketable product. The product mixture is known as "synthesis gas" because it is often used directly for the production of methanol and related compounds. Hydrocarbons other than methane can be used to produce synthesis gas with varying product ratios. One of the many complications to this highly optimized technology is the formation of coke or carbon:
Consequently, steam reforming typically employs an excess of H2O.
Additional hydrogen from steam reforming can be recovered from the carbon monoxide through the water gas shift reaction, especially with an iron oxide catalyst. This reaction is also a common industrial source of carbon dioxide: :CO + H2O → CO2 + H2
Other important methods for H2 production include partial oxidation of hydrocarbons:
and the coal reaction, which can serve as a prelude to the shift reaction above: :C + H2O → CO + H2
Hydrogen is sometimes produced and consumed in the same industrial process, without being separated. In the Haber process for the production of ammonia (the world's fifth most produced industrial compound), hydrogen is generated from natural gas.
Hydrogen is also produced in usable quantities as a co-product of the major petrochemical processes of steam cracking and reforming. Electrolysis of brine to yield chlorine also produces hydrogen as a co-product.
## Biological syntheses
H2 is a product of some types of anaerobic metabolism and is produced by several microorganisms, usually via reactions catalyzed by iron- or nickel-containing enzymes called hydrogenases. These enzymes catalyze the reversible redox reaction between H2 and its component two protons and two electrons. Creation of hydrogen gas occurs in the transfer of reducing equivalents produced during pyruvate fermentation to water.
Water splitting, in which water is decomposed into its component protons, electrons, and oxygen, occurs in the light reactions in all photosynthetic organisms. Some such organisms — including the alga Chlamydomonas reinhardtii and cyanobacteria — have evolved a second step in the dark reactions in which protons and electrons are reduced to form H2 gas by specialized hydrogenases in the chloroplast. Efforts have been undertaken to genetically modify cyanobacterial hydrogenases to efficiently synthesize H2 gas even in the presence of oxygen.
Other rarer but mechanistically interesting routes to H2 production also exist in nature. Nitrogenase produces approximately one equivalent of H2 for each equivalent of N2 reduced to ammonia. Some phosphatases reduce phosphite to H2.
# Etymology
Hydrogen, Template:Lang-la, is from Ancient Greek ὕδωρ (hydor): "water" and (genes): "forming". Ancient Greek γείνομαι (geinomai): "to beget or sire")
The word "hydrogen" has several different meanings;
- the name of an element.
- an atom, sometimes called "H dot", that is abundant in space but essentially absent on Earth, because it dimerizes.
- a diatomic molecule that occurs naturally in trace amounts in the Earth's atmosphere; chemists increasingly refer to H2 as dihydrogen, or hydrogen molecule, to distinguish this molecule from atomic hydrogen and hydrogen found in other compounds.
- the atomic constituent within all organic compounds, water, and many other chemical compounds.
The elemental forms of hydrogen should not be confused with hydrogen as it appears in chemical compounds. | Hydrogen
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [3]
Template:Infobox hydrogen
Hydrogen (Template:PronEng), is the chemical element represented by the symbol H and an atomic number of 1. At standard temperature and pressure it is a colourless, odorless, nonmetallic, tasteless, highly flammable diatomic gas (H2). With an atomic mass of 1.00794 amu, hydrogen is the lightest element.
Hydrogen is the most abundant of the chemical elements, constituting roughly 75% of the universe's elemental mass.[1] Stars in the main sequence are mainly composed of hydrogen in its plasma state. Elemental hydrogen is relatively rare on Earth, and is industrially produced from hydrocarbons such as methane, after which most elemental hydrogen is used "captively" (meaning locally at the production site), with the largest markets about equally divided between fossil fuel upgrading (e.g., hydrocracking) and ammonia production (mostly for the fertilizer market). Hydrogen may be produced from water using the process of electrolysis, but this process is presently significantly more expensive commercially than hydrogen production from natural gas[2].
The most common naturally occurring isotope of hydrogen, known as protium, has a single proton and no neutrons. In ionic compounds it can take on either a positive charge (becoming a cation composed of a bare proton) or a negative charge (becoming an anion known as a hydride). Hydrogen can form compounds with most elements and is present in water and most organic compounds. It plays a particularly important role in acid-base chemistry, in which many reactions involve the exchange of protons between soluble molecules. As the only neutral atom for which the Schrödinger equation can be solved analytically, study of the energetics and bonding of the hydrogen atom has played a key role in the development of quantum mechanics.
# Chemistry
The solubility and characteristics of hydrogen with various metals are very important in metallurgy (as many metals can suffer hydrogen embrittlement) and in developing safe ways to store it for use as a fuel. Hydrogen is highly soluble in many compounds composed of rare earth metals and transition metals[3] and can be dissolved in both crystalline and amorphous metals.[4] Hydrogen solubility in metals is influenced by local distortions or impurities in the metal crystal lattice.[5]
## Combustion
Hydrogen gas is highly flammable and will burn at concentrations as low as 4% H2 in air. The enthalpy of combustion for hydrogen is – 286 kJ/mol; it burns according to the following balanced equation.
When mixed with oxygen across a wide range of proportions, hydrogen explodes upon ignition. Hydrogen burns violently in air. It ignites automatically at a temperature of 560 C [4]
Pure hydrogen-oxygen flames burn in the ultraviolet color range and are nearly invisible to the naked eye, as illustrated by the faintness of flame from the main space shuttle engines (as opposed to the easily visible flames from the shuttle boosters). Thus it is difficult to visually detect if a hydrogen leak is burning. The explosion of the Hindenburg airship was an infamous case of hydrogen combustion (pictured), although the tragedy was due mainly to combustible materials in the skin, which were also responsible for the coloring of the flames.[6] Another characteristic of hydrogen fires is that the flames tend to ascend rapidly with the gas in air, as illustrated by the Hindenberg flames, causing less damage than hydrocarbon fires. Two-thirds of the Hindenburg passengers survived the fire, and many of the deaths which occurred were from falling or from diesel fuel burns.[7]
## Electron energy levels
The ground state energy level of the electron in a hydrogen atom is -13.6 eV, which is equivalent to an ultraviolet photon of roughly 92 nm.
The energy levels of hydrogen can be calculated fairly accurately using the Bohr model of the atom, which conceptualizes the electron as "orbiting" the proton in analogy to the Earth's orbit of the sun. However, the electromagnetic force attracts electrons and protons to one another, while planets and celestial objects are attracted to each other by gravity. Because of the discretization of angular momentum postulated in early quantum mechanics by Bohr, the electron in the Bohr model can only occupy certain allowed distances from the proton, and therefore only certain allowed energies. A more accurate description of the hydrogen atom comes from a purely quantum mechanical treatment that uses the Schrödinger equation or the equivalent Feynman path integral formulation to calculate the probability density of the electron around the proton. Treating the electron as a matter wave reproduces chemical results such as shape of the hydrogen atom more naturally than the particle-based Bohr model, although the energy and spectral results are the same. Modeling the system fully using the reduced mass of nucleus and electron (as one would do in the two-body problem in celestial mechanics) yields an even better formula for the hydrogen spectra, and also the correct spectral shifts for the isotopes deuterium and tritium. Very small adjustments in energy levels in the hydrogen atom, which correspond to actual spectral effects, may be determined by using a full quantum mechanical theory which corrects for the effects of special relativity (see Dirac equation), and by accounting for quantum effects arising from production of virtual particles in the vacuum and as a result of electric fields (see quantum electrodynamics).
In hydrogen liquid, the electronic ground state energy level is split into hyperfine structure levels because of magnetic effects of the quantum mechanical spin of the electron and proton. The energy of the atom when the proton and electron spins are aligned is higher than when they are not aligned. The transition between these two states can occur through emission of a photon through a magnetic dipole transition. Radio telescopes can detect the radiation produced in this process, which is used to map the distribution of hydrogen in the galaxy.
H2 reacts directly with other oxidizing elements. A violent and spontaneous reaction can occur at room temperature with chlorine and fluorine, forming the corresponding hydrogen halides: hydrogen chloride and hydrogen fluoride.
## Elemental molecular forms
There are two different types of diatomic hydrogen molecules that differ by the relative spin of their nuclei.[8] In the orthohydrogen form, the spins of the two protons are parallel and form a triplet state; in the parahydrogen form the spins are antiparallel and form a singlet. At standard temperature and pressure, hydrogen gas contains about 25% of the para form and 75% of the ortho form, also known as the "normal form".[9] The equilibrium ratio of orthohydrogen to parahydrogen depends on temperature, but since the ortho form is an excited state and has a higher energy than the para form, it is unstable and cannot be purified. At very low temperatures, the equilibrium state is composed almost exclusively of the para form. The physical properties of pure parahydrogen differ slightly from those of the normal form.[10] The ortho/para distinction also occurs in other hydrogen-containing molecules or functional groups, such as water and methylene.
The uncatalyzed interconversion between para and ortho H2 increases with increasing temperature; thus rapidly condensed H2 contains large quantities of the high-energy ortho form that convert to the para form very slowly.[11] The ortho/para ratio in condensed H2 is an important consideration in the preparation and storage of liquid hydrogen: the conversion from ortho to para is exothermic and produces enough heat to evaporate the hydrogen liquid, leading to loss of the liquefied material. Catalysts for the ortho-para interconversion, such as iron compounds, are used during hydrogen cooling.[12]
A molecular form called protonated molecular hydrogen, or H3+, is found in the interstellar medium (ISM), where it is generated by ionization of molecular hydrogen from cosmic rays. It has also been observed in the upper atmosphere of the planet Jupiter. This molecule is relatively stable in the environment of outer space due to the low temperature and density. H3+ is one of the most abundant ions in the Universe, and it plays a notable role in the chemistry of the interstellar medium.[13]
## Compounds
### Covalent and organic compounds
While H2 is not very reactive under standard conditions, it does form compounds with most elements. Millions of hydrocarbons are known, but they are not formed by the direct reaction of elementary hydrogen and carbon (although synthesis gas production followed by the Fischer-Tropsch process to make hydrocarbons comes close to being an exception, as this begins with coal and the elemental hydrogen is generated in situ). Hydrogen can form compounds with elements that are more electronegative, such as halogens (e.g., F, Cl, Br, I) and chalcogens (O, S, Se); in these compounds hydrogen takes on a partial positive charge. When bonded to fluorine, oxygen, or nitrogen, hydrogen can participate in a form of strong noncovalent bonding called hydrogen bonding, which is critical to the stability of many biological molecules. Hydrogen also forms compounds with less electronegative elements, such as the metals and metalloids, in which it takes on a partial negative charge. These compounds are often known as hydrides.
Hydrogen forms a vast array of compounds with carbon. Because of their general association with living things, these compounds came to be called organic compounds; the study of their properties is known as organic chemistry and their study in the context of living organisms is known as biochemistry. By some definitions, "organic" compounds are only required to contain carbon (as a classic historical example, urea). However, most of them also contain hydrogen, and since it is the carbon-hydrogen bond which gives this class of compounds most of its particular chemical characteristics, carbon-hydrogen bonds are required in some definitions of the word "organic" in chemistry. (This latter definition is not perfect, however, as in this definition urea would not be included as an organic compound).
In inorganic chemistry, hydrides can also serve as bridging ligands that link two metal centers in a coordination complex. This function is particularly common in group 13 elements, especially in boranes (boron hydrides) and aluminum complexes, as well as in clustered carboranes.[14]
### Hydrides
Compounds of hydrogen are often called hydrides, a term that is used fairly loosely. To chemists, the term "hydride" usually implies that the H atom has acquired a negative or anionic character, denoted H−. The existence of the hydride anion, suggested by G.N. Lewis in 1916 for group I and II salt-like hydrides, was demonstrated by Moers in 1920 with the electrolysis of molten lithium hydride (LiH), that produced a stoichiometric quantity of hydrogen at the anode.[15] For hydrides other than group I and II metals, the term is quite misleading, considering the low electronegativity of hydrogen. An exception in group II hydrides is BeH2, which is polymeric. In lithium aluminum hydride, the AlH4− anion carries hydridic centers firmly attached to the Al(III). Although hydrides can be formed with almost all main-group elements, the number and combination of possible compounds varies widely; for example, there are over 100 binary borane hydrides known, but only one binary aluminum hydride.[16] Binary indium hydride has not yet been identified, although larger complexes exist.[17]
### "Protons" and acids
Oxidation of H2 formally gives the proton, H+. This species is central to discussion of acids, though the term proton is used loosely to refer to positively charged or cationic hydrogen, denoted H+. A bare proton H+ cannot exist in solution because of its strong tendency to attach itself to atoms or molecules with electrons. To avoid the convenient fiction of the naked "solvated proton" in solution, acidic aqueous solutions are sometimes considered to contain the hydronium ion (H3O+) organized into clusters to form H9O4+.[18] Other oxonium ions are found when water is in solution with other solvents.[19]
Although exotic on earth, one of the most common ions in the universe is the H3+ ion, known as protonated molecular hydrogen or the triatomic hydrogen cation.[20]
# Isotopes
Hydrogen has three naturally occurring isotopes, denoted 1H, ²H, and ³H. Other, highly unstable nuclei (4H to 7H) have been synthesized in the laboratory but not observed in nature.[21][22]
- 1H is the most common hydrogen isotope with an abundance of more than 99.98%. Because the nucleus of this isotope consists of only a single proton, it is given the descriptive but rarely used formal name protium.
- ²H, the other stable hydrogen isotope, is known as deuterium and contains one proton and one neutron in its nucleus. Deuterium comprises 0.0026 – 0.0184% (by mole-fraction or atom-fraction) of hydrogen samples on Earth, with the lower number tending to be found in samples of hydrogen gas and the higher enrichments (0.015% or 150 ppm) typical of ocean water. Deuterium is not radioactive, and does not represent a significant toxicity hazard. Water enriched in molecules that include deuterium instead of normal hydrogen is called heavy water. Deuterium and its compounds are used as a non-radioactive label in chemical experiments and in solvents for 1H-NMR spectroscopy. Heavy water is used as a neutron moderator and coolant for nuclear reactors. Deuterium is also a potential fuel for commercial nuclear fusion.
- ³H is known as tritium and contains one proton and two neutrons in its nucleus. It is radioactive, decaying into Helium-3 through beta decay with a half-life of 12.32 years.[14] Small amounts of tritium occur naturally because of the interaction of cosmic rays with atmospheric gases; tritium has also been released during nuclear weapons tests. It is used in nuclear fusion reactions, as a tracer in isotope geochemistry, and specialized in self-powered lighting devices. Tritium was once routinely used in chemical and biological labeling experiments as a radiolabel (this has become less common).
Hydrogen is the only element that has different names for its isotopes in common use today. (During the early study of radioactivity, various heavy radioactive isotopes were given names, but such names are no longer used). The symbols D and T (instead of ²H and ³H) are sometimes used for deuterium and tritium, but the corresponding symbol P is already in use for phosphorus and thus is not available for protium. IUPAC states that while this use is common it is not preferred.
# Natural occurrence
Hydrogen is the most abundant element in the universe, making up 75% of normal matter by mass and over 90% by number of atoms.[23] This element is found in great abundance in stars and gas giant planets. Molecular clouds of H2 are associated with star formation. Hydrogen plays a vital role in powering stars through proton-proton reaction nuclear fusion.
Throughout the universe, hydrogen is mostly found in the atomic and plasma states whose properties are quite different from molecular hydrogen. As a plasma, hydrogen's electron and proton are not bound together, resulting in very high electrical conductivity and high emissivity (producing the light from the sun and other stars). The charged particles are highly influenced by magnetic and electric fields. For example, in the solar wind they interact with the Earth's magnetosphere giving rise to Birkeland currents and the aurora. Hydrogen is found in the neutral atomic state in the Interstellar medium. The large amount of neutral hydrogen found in the damped Lyman-alpha systems is thought to dominate the cosmological baryonic density of the Universe up to redshift z=4.[24]
Under ordinary conditions on Earth, elemental hydrogen exists as the diatomic gas, H2 (for data see table). However, hydrogen gas is very rare in the Earth's atmosphere (1 ppm by volume) because of its light weight, which enables it to escape from Earth's gravity more easily than heavier gases. Although H atoms and H2 molecules are abundant in interstellar space, they are difficult to generate, concentrate, and purify on Earth. Still, hydrogen is the third most abundant element on the Earth's surface.[25] Most of the Earth's hydrogen is in the form of chemical compounds such as hydrocarbons and water.[14] Hydrogen gas is produced by some bacteria and algae and is a natural component of flatus. Methane is a hydrogen source of increasing importance.
# History
## Discovery of H2
Hydrogen gas, H2, was first artificially produced and formally described by T. Von Hohenheim (also known as Paracelsus, 1493 – 1541) via the mixing of metals with strong acids. He was unaware that the flammable gas produced by this chemical reaction was a new chemical element. In 1671, Robert Boyle rediscovered and described the reaction between iron filings and dilute acids, which results in the production of hydrogen gas.[26] In 1766, Henry Cavendish was the first to recognize hydrogen gas as a discrete substance, by identifying the gas from a metal-acid reaction as "inflammable air" and further finding that the gas produces water when burned. Cavendish had stumbled on hydrogen when experimenting with acids and mercury. Although he wrongly assumed that hydrogen was a liberated component of the mercury rather than the acid, he was still able to accurately describe several key properties of hydrogen. He is usually given credit for its discovery as an element. In 1783, Antoine Lavoisier gave the element the name of hydrogen when he (with Laplace) reproduced Cavendish's finding that water is produced when hydrogen is burned. Lavoisier's name for the gas won out.
One of the first uses of H2 was for balloons, and later airships. The H2 was obtained by reacting sulfuric acid and metallic iron. Infamously, H2 was used in the Hindenburg airship that was destroyed in a midair fire. The highly flammable hydrogen (H2) was later replaced for airships and most balloons by the unreactive helium (He).
## Role in history of quantum theory
Because of its relatively simple atomic structure, consisting only of a proton and an electron, the hydrogen atom, together with the spectrum of light produced from it or absorbed by it, has been central to the development of the theory of atomic structure. Furthermore, the corresponding simplicity of the hydrogen molecule and the corresponding cation H2+ allowed fuller understanding of the nature of the chemical bond, which followed shortly after the quantum mechanical treatment of the hydrogen atom had been developed in the mid-1920s.
One of the first quantum effects to be explicitly noticed (but not understood at the time) was a Maxwell observation involving hydrogen, half a century before full quantum mechanical theory arrived. Maxwell observed that the specific heat capacity of H2 unaccountably departs from that of a diatomic gas below room temperature and begins to increasingly resemble that of a monatomic gas at cryogenic temperatures. According to quantum theory, this behavior arises from the spacing of the (quantized) rotational energy levels, which are particularly wide-spaced in H2 because of its low mass. These widely spaced levels inhibit equal partition of heat energy into rotational motion in hydrogen at low temperatures. Diatomic gases composed of heavier atoms do not have such widely spaced levels and do not exhibit the same effect.[27]
# Applications
Large quantities of H2 are needed in the petroleum and chemical industries. The largest application of H2 is for the processing ("upgrading") of fossil fuels, and in the production of ammonia. The key consumers of H2 in the petrochemical plant include hydrodealkylation, hydrodesulfurization, and hydrocracking.[28] H2 has several other important uses. H2 is used as a hydrogenating agent, particularly in increasing the level of saturation of unsaturated fats and oils (found in items such as margarine), and in the production of methanol. It is similarly the source of hydrogen in the manufacture of hydrochloric acid. H2 is also used as a reducing agent of metallic ores.
Apart from its use as a reactant, H2 has wide applications in physics and engineering. It is used as a shielding gas in welding methods such as atomic hydrogen welding. H2 is used as the rotor coolant in electrical generators at power stations, because it has the highest thermal conductivity of any gas. Liquid H2 is used in cryogenic research, including superconductivity studies. Since H2 is lighter than air, having a little more than 1/15th of the density of air, it was once widely used as a lifting agent in balloons and airships. However, this use was curtailed after the Hindenburg disaster erroneously convinced the public that the gas was too dangerous for this purpose. Hydrogen is still regularly used for the inflation of weather balloons.
In more recent application Hydrogen is used pure or mixed with Nitrogen (sometime called Forming Gas) as a tracer gas for minute leak detection. Applications can be found in automotive, aircraft, consumer goods, medical device and chemical industry. Hydrogen is an authorized food additive (E 949) that allows food package leak testing among other anti-oxidizing properties.[29]
Hydrogen's rarer isotopes also each have specific applications. Deuterium (hydrogen-2) is used in nuclear fission applications as a moderator to slow neutrons, and in nuclear fusion reactions. Deuterium compounds have applications in chemistry and biology in studies of reaction isotope effects. Tritium (hydrogen-3), produced in nuclear reactors, is used in the production of hydrogen bombs, as an isotopic label in the biosciences, and as a radiation source in luminous paints.
The triple point temperature of equilibrium hydrogen is a defining fixed point on the ITS-90 temperature scale at 13.8033 Kelvin.
## Energy carrier
Hydrogen is not an energy source, except in the hypothetical context of commercial nuclear fusion power plants using deuterium or tritium, a technology presently far from development. The sun's energy comes from nuclear fusion of hydrogen but this process is difficult to achieve on earth. Elemental hydrogen from solar, biological, or electrical sources costs more in energy to make than is obtained by burning it. Hydrogen may be obtained from fossil sources (such as methane) for less energy than required to make it, but these sources are unsustainable, and are also themselves direct energy sources (and are rightly regarded as the basic source of the energy in the hydrogen obtained from them).
Molecular hydrogen has been widely discussed in the context of energy, as a possible carrier of energy on an economy-wide scale. A theoretical advantage of using H2 as an energy carrier is the localization and concentration of environmentally unwelcome aspects of hydrogen manufacture from fossil fuel energy sources. For example, CO2 sequestration followed by carbon capture and storage could be conducted at the point of H2 production from methane. Hydrogen used in transportation would burn cleanly, without carbon emissions. However, the infrastructure costs associated with full conversion to a hydrogen economy would be substantial.[30] In addition, the energy density per unit volume of both liquid hydrogen and hydrogen gas at any practicable pressure is significantly less than that of traditional fuel sources. (Although the energy density per unit mass is higher)
# Production
H2 is produced in chemistry and biology laboratories, often as a by-product of other reactions; in industry for the hydrogenation of unsaturated substrates; and in nature as a means of expelling reducing equivalents in biochemical reactions.
## Laboratory syntheses
In the laboratory, H2 is usually prepared by the reaction of acids on metals such as zinc.
Aluminum produces H2 upon treatment with acids but also with base:
The electrolysis of water is a simple method of producing hydrogen, although the resulting hydrogen necessarily has less energy content than was required to produce it. A low voltage current is run through the water, and gaseous oxygen forms at the anode while gaseous hydrogen forms at the cathode. Typically the cathode is made from platinum or another inert metal when producing hydrogen for storage. If, however, the gas is to be burnt on site, oxygen is desirable to assist the combustion, and so both electrodes would be made from inert metals. (Iron, for instance, would oxidize, and thus decrease the amount of oxygen given off.) The theoretical maximum efficiency (electricity used vs. energetic value of hydrogen produced) is between 80 – 94%. Bellona Report on Hydrogen
In 2007, it was discovered that an alloy of aluminium and gallium in pellet form added to water could be used to generate hydrogen.[31] The process creates also creates alumina, but the expensive gallium, which prevents to formation of an oxide skin on the pellets, can be re-used. This potentially has important implications for a hydrogen economy, since hydrogen can be produced on-site and does not need to be transported.
## Industrial syntheses
Hydrogen can be prepared in several different ways but the economically most important processes involve removal of hydrogen from hydrocarbons. Commercial bulk hydrogen is usually produced by the steam reforming of natural gas.[32] At high temperatures (700 – 1100 °C; 1,300 – 2,000 °F), steam (water vapor) reacts with methane to yield carbon monoxide and H2.
This reaction is favored at low pressures but is nonetheless conducted at high pressures (20 atm; 600 inHg) since high pressure H2 is the most marketable product. The product mixture is known as "synthesis gas" because it is often used directly for the production of methanol and related compounds. Hydrocarbons other than methane can be used to produce synthesis gas with varying product ratios. One of the many complications to this highly optimized technology is the formation of coke or carbon:
Consequently, steam reforming typically employs an excess of H2O.
Additional hydrogen from steam reforming can be recovered from the carbon monoxide through the water gas shift reaction, especially with an iron oxide catalyst. This reaction is also a common industrial source of carbon dioxide:[32] :CO + H2O → CO2 + H2
Other important methods for H2 production include partial oxidation of hydrocarbons:
and the coal reaction, which can serve as a prelude to the shift reaction above:[32] :C + H2O → CO + H2
Hydrogen is sometimes produced and consumed in the same industrial process, without being separated. In the Haber process for the production of ammonia (the world's fifth most produced industrial compound), hydrogen is generated from natural gas.
Hydrogen is also produced in usable quantities as a co-product of the major petrochemical processes of steam cracking and reforming. Electrolysis of brine to yield chlorine also produces hydrogen as a co-product.
## Biological syntheses
H2 is a product of some types of anaerobic metabolism and is produced by several microorganisms, usually via reactions catalyzed by iron- or nickel-containing enzymes called hydrogenases. These enzymes catalyze the reversible redox reaction between H2 and its component two protons and two electrons. Creation of hydrogen gas occurs in the transfer of reducing equivalents produced during pyruvate fermentation to water.[33]
Water splitting, in which water is decomposed into its component protons, electrons, and oxygen, occurs in the light reactions in all photosynthetic organisms. Some such organisms — including the alga Chlamydomonas reinhardtii and cyanobacteria — have evolved a second step in the dark reactions in which protons and electrons are reduced to form H2 gas by specialized hydrogenases in the chloroplast.[34] Efforts have been undertaken to genetically modify cyanobacterial hydrogenases to efficiently synthesize H2 gas even in the presence of oxygen.[35]
Other rarer but mechanistically interesting routes to H2 production also exist in nature. Nitrogenase produces approximately one equivalent of H2 for each equivalent of N2 reduced to ammonia. Some phosphatases reduce phosphite to H2.
# Etymology
Hydrogen, Template:Lang-la, is from Ancient Greek ὕδωρ (hydor): "water" and (genes): "forming". Ancient Greek γείνομαι (geinomai): "to beget or sire")[36]
The word "hydrogen" has several different meanings;
- the name of an element.
- an atom, sometimes called "H dot", that is abundant in space but essentially absent on Earth, because it dimerizes.
- a diatomic molecule that occurs naturally in trace amounts in the Earth's atmosphere; chemists increasingly refer to H2 as dihydrogen,[37] or hydrogen molecule, to distinguish this molecule from atomic hydrogen and hydrogen found in other compounds.
- the atomic constituent within all organic compounds, water, and many other chemical compounds.
The elemental forms of hydrogen should not be confused with hydrogen as it appears in chemical compounds. | https://www.wikidoc.org/index.php/Hydrogen | |
a375e7e9f9f3f8fc4aa921b8a1c9f8d00a7eb3bd | wikidoc | Tonicity | Tonicity
Tonicity is a measure of effective osmolarity or effective osmolality in cell biology. Osmolality and osmolarity are properties of a particular solution, independent of any membrane. Tonicity is a property of a solution in reference to a particular membrane, and is equal to the sum of the concentrations of the solutes which have the capacity to exert an osmotic force across that membrane. Tonicity, also, depends on solute permeability (permeant solutes do not affect tonicity; impermeant solutes do affect tonicity). Tonicity is generally classified in three ranges; hypertonicity, hypotonicity and isotonicity.
# Hypertonicity
A cell in a hypertonic environment is surrounded by a higher concentration of impermeable solute than exists in the inside of the cell. Osmotic pressure directs a net amount of water out of the cell, causing it to shrink.
Hypertonic, isotonic and hypotonic solutions are defined in reference to a cell membrane by comparing the tonicity of the solution with the tonicity within the cell.
In animal cells, being in a hypertonic environment results in crenation, where the shape of the cell becomes distorted and wrinkled as water leaves the cell. Some organisms have evolved methods of circumventing hypertonicity; for example, saltwater is hypertonic to the fish that live in it. Since they cannot isolate themselves from osmotic water loss, because they need a large surface area in their gills for gas exchange, they respond by drinking large amounts of water, and excreting the salt. This process is called osmoregulation.
In plant cells, the effect is more dramatic. The cell membrane pulls away from the cell wall, but the cell remains joined to the adjacent cells at points called plasmodesmata. Thus, the cell takes on the appearance of a pincushion, with the plasmodesmata almost ceasing to function because they have become so constricted. This condition is known as plasmolysis.
# Isotonicity
A cell in an isotonic environment is in a state of equilibrium with its surroundings. When the amount of impermeable solute is the same on the inside and outside of the cell, osmotic pressure becomes equal; the force of water trying to exit and enter the cell balances out. This pressure is what drives hypertonic or hypotonic cells to become isotonic.
# Hypotonicity
The opposite of a hypertonic environment is a hypotonic one, where the net movement of water is into the cell. If the cell contains more impermeable solute than its surroundings, water will enter it. In the case of animal cells, they will swell until they burst; plant cells do not burst, due to the reinforcement their cell wall provides. | Tonicity
Tonicity is a measure of effective osmolarity or effective osmolality in cell biology. Osmolality and osmolarity are properties of a particular solution, independent of any membrane. Tonicity is a property of a solution in reference to a particular membrane, and is equal to the sum of the concentrations of the solutes which have the capacity to exert an osmotic force across that membrane. Tonicity, also, depends on solute permeability (permeant solutes do not affect tonicity; impermeant solutes do affect tonicity). Tonicity is generally classified in three ranges; hypertonicity, hypotonicity and isotonicity.
# Hypertonicity
A cell in a hypertonic environment is surrounded by a higher concentration of impermeable solute than exists in the inside of the cell. Osmotic pressure directs a net amount of water out of the cell, causing it to shrink.
Hypertonic, isotonic and hypotonic solutions are defined in reference to a cell membrane by comparing the tonicity of the solution with the tonicity within the cell.
In animal cells, being in a hypertonic environment results in crenation, where the shape of the cell becomes distorted and wrinkled as water leaves the cell. Some organisms have evolved methods of circumventing hypertonicity; for example, saltwater is hypertonic to the fish that live in it. Since they cannot isolate themselves from osmotic water loss, because they need a large surface area in their gills for gas exchange, they respond by drinking large amounts of water, and excreting the salt. This process is called osmoregulation.
In plant cells, the effect is more dramatic. The cell membrane pulls away from the cell wall, but the cell remains joined to the adjacent cells at points called plasmodesmata. Thus, the cell takes on the appearance of a pincushion, with the plasmodesmata almost ceasing to function because they have become so constricted. This condition is known as plasmolysis.
# Isotonicity
A cell in an isotonic environment is in a state of equilibrium with its surroundings. When the amount of impermeable solute is the same on the inside and outside of the cell, osmotic pressure becomes equal; the force of water trying to exit and enter the cell balances out. This pressure is what drives hypertonic or hypotonic cells to become isotonic.
# Hypotonicity
The opposite of a hypertonic environment is a hypotonic one, where the net movement of water is into the cell. If the cell contains more impermeable solute than its surroundings, water will enter it. In the case of animal cells, they will swell until they burst; plant cells do not burst, due to the reinforcement their cell wall provides. | https://www.wikidoc.org/index.php/Hyperosmotic | |
8c90770f1a73215e86ec513443cdb94938ff0e97 | wikidoc | Hypnocil | Hypnocil
Hypnocil is a fictitious, experimental drug used in the A Nightmare On Elm Street series of movies, specifically in Dream Warriors and Freddy vs. Jason. As explained in the movies, it is used for the suppression of dreams, but has not yet been approved by the Food and Drug Administration (FDA). This is true even after the more than 15 years that take place between the two movies it is featured in. Its mechanism is similar to that of anti-epileptic drugs except that it works during sleep time only preventing the REM phase of sleep. It is useful against Freddy Krueger in that he can only affect (and therefore kill) a person who is asleep and dreaming. When a person is on this drug, he is essentially powerless to hurt them.
In the first script for the third Nightmare on Elm Street film written by Wes Craven and Bruce Wagner, it was spelled "Hypnocyl." In this script it was also supposed to be effective in treating manifestations of psychotic disorders and night terrors.
# Side effects
As revealed in deleted scenes from Freddy vs. Jason and in the film's novelization Hypnocil can cause nervousness and even prolonged coma if taken in heavier than recommended doses.
bg:Хипноцил | Hypnocil
Hypnocil is a fictitious, experimental drug used in the A Nightmare On Elm Street series of movies, specifically in Dream Warriors and Freddy vs. Jason. As explained in the movies, it is used for the suppression of dreams, but has not yet been approved by the Food and Drug Administration (FDA). This is true even after the more than 15 years that take place between the two movies it is featured in. Its mechanism is similar to that of anti-epileptic drugs except that it works during sleep time only preventing the REM phase of sleep. It is useful against Freddy Krueger in that he can only affect (and therefore kill) a person who is asleep and dreaming. When a person is on this drug, he is essentially powerless to hurt them.
In the first script for the third Nightmare on Elm Street film written by Wes Craven and Bruce Wagner, it was spelled "Hypnocyl." In this script it was also supposed to be effective in treating manifestations of psychotic disorders and night terrors.
# Side effects
As revealed in deleted scenes from Freddy vs. Jason and in the film's novelization Hypnocil can cause nervousness and even prolonged coma if taken in heavier than recommended doses.
Template:Nightmareseries
bg:Хипноцил
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Hypnocil | |
944b5a72a4970a65ab89c582c123747514d0782f | wikidoc | Hypnosis | Hypnosis
Hypnosis (from the Greek hypnos, "sleep") is "a trance-like state that resembles sleep but is induced by a person whose suggestions are readily accepted by the subject."
# History
A part of healing from ancient times, hypnosis is the induction of trance states and the use of therapeutic suggestion, which was a central feature of the ancient Egyptian and Indian sleep temples as well as Greek healing temples, and variations of these techniques were practiced throughout the world. During the Middle Ages and early modern period, hypnosis began to be better understood by physicians such as Avicenna and Paracelsus.
Modern hypnosis began in the eighteenth century with Franz Anton Mesmer, who used what he called "magnetic healing" to treat a variety of psychological and psychophysiological disorders. Sigmund Freud, at first, found it extremely effective in treating hysteria and then, troubled by the sudden emergence of powerful emotions in his patients and its unreliable nature (as some patients could simply not be hypnotized) abandoned it. The therapeutic use of hypnosis in medicine was accepted in 1955 by the British Medical Association, which was closely followed in 1958 by the American Medical Association.
# Methods and effects
## General methods
Hypnotic susceptibility is the measurable responsiveness that a person has to hypnosis. Not all people can be hypnotized, but about 10% of people respond exceptionally well.There is little evidence linking susceptibility to intelligence or personality traits, but some research has linked hypnosis to the amount of imagination in subjects. Recent research suggests that highly hypnotizable people have high sensory and perceptual gating abilities that allow them to block some stimuli from awareness (Barnier, McConkey, and Wright, 2004).
There is a common claim that no one can be hypnotized against their will.
New research, developed by board-certified hypnotist Gerald Kein, claims that everybody is equally hypnotizable and that "people accept hypnosis in direct relationship to the amount of fear they have". Successful hypnosis is attained by the removal of inhibitory fear. With fear removed, most individuals can be deeply hypnotized in 5-10 seconds. Licensed mental health professionals are generally not trained in these techniques and use the old PR hypnotic induction developed in the 1940s (Kein, 1985).
## General effects
### Focused attention
Some schools of thought hold that hypnosis as a state is very similar to other states of extreme concentration, where a person becomes oblivious to his or her surroundings while lost in thought. Often suggested as an example is highway hypnosis, when a driver suddenly finds his or herself much further down the road without any memory of driving the intervening distance.
According to state theorists, the act of hypnotizing, is, in effect, the act of deliberately and mechanically inducing a similar state.
### Suggestibility
Some psychologists have developed studies that show a correlation between the effects people display when acting as "hypnotized" and their level of suggestibility. Some of these studies involve the Harvard scale, and Stanford scale.
Hypnosis has been described as "suspension of the critical factor" which expands on the idea of "increased suggestibility". A person who claims to be hypnotized may accept statements as true that he or she would normally reject.
However, this still does not demonstrate the validity of hypnosis as a real state, as subjects carrying out role playing might react similarly.
It often appears as if the "hypnotized" participant accepts the authority of the "hypnotist" over his or her own experience. When asked after the conclusion of such a session, some participants claim to be genuinely unable to recall the incident, while others say that they had known the hypnotist was wrong but at the time it had seemed easier just to go along with his instructions. (Richard Feynman describes this, in his memoir Surely You're Joking, Mr. Feynman!, as his own hypnotic experience.) The mechanism of this effect, however, is disputed. Some hypnotists claim that this shows the difference between a deep and a shallow hypnotic trance, while skeptics cite that such effects can be duplicated in other circumstances where an agent holds authority, such as in the Milgram experiment. Because of the ability to achieve these effects through normal varieties of communication and circumstance, there is no scientific theory that supports the existence of hypnosis
## Depth of hypnosis
### Pupillary reflex
An objective sign of hypnosis can be observed by a pupillary reflex test, which demonstrates a response that is opposed to the normal physiological response. When subjects are in a profound hypnotic state, they are asked to remain in hypnosis and open their eyes. The subjects' pupils are usually dilated and remain dilated, or react poorly, when a penlight is shone into them (the normal non-hypnotic response is a contraction of the pupil).
The esoteric publication Hypnotism, by Danish hypnotist Carl Septus, is an early reference work that notes the absence of the pupillary reflex sign. Septus states specifically that after subjects have been asked to open their eyes during a deep trance, light shone into the eyes does not cause pupil contraction. The hypnotist may use suggestion to keep the subject in hypnosis, but must avoid suggestions relating to eyes, visual focus, light, or the dilation or contraction of the pupils.
# Applications
### Hypnotherapy
Hypnotherapy is a term to describe the use of hypnosis in a therapeutic context. Many hypnotherapists refer to their practice as "clinical work". Hypnotherapy can either be used as an addition to the work of licensed physicians or psychologists, or it can be used in a stand-alone environment where the hypnotherapist in question usually owns his or her own business. The majority of these stand-alone certified hypnotherapists (C.Hts in the U.S., Diploma. Hyp in the UK) today earn a large portion of their income through the cessation of smoking (often in a single session) and the aid of weight loss (body sculpting). Psychologists and psychiatrists use hypnosis predominantly for the treatment of dissociative disorders, phobias, habit change, depression and post-traumatic syndromes. There is no evidence that 'incurable' diseases (such as cancer, diabetes, and arthritis) are curable with hypnosis, but pain and other bodily symptoms related to the diseases are controllable. Some of the treatments practiced by hypnotherapists, in particular so-called regression, have been viewed with skepticism.
The American Medical Association and the American Psychological Association have both cautioned against the use of repressed memory therapy in dealing with cases of alleged childhood trauma, stating that "it is impossible, without other corroborative evidence, to distinguish a true memory from a false one", and so the procedure is "fraught with problems of potential misapplication". (See also false memory). This is why forensic hypnosis is not widely used in many countries' legal systems. However, hypnosis therapy is frequently used by the public, and there is no shortage of testimonial evidence of its helpfulness.
### Organizations
The American Society of Clinical Hypnosis and British Society of Clinical Hypnosis are organizations that seek to promote the use of hypnosis in treating a wide variety of physical and psychological ailments. The American society was founded by Milton Erickson, who was opposed to unlicensed professionals performing therapeutic hypnosis. In the United States, the largest organization promoting its use for both therapeutic and non-therapeutic use is the National Guild of Hypnotists, or NGH.
### Medicine and dentistry
One of the major initial applications of hypnosis was the suppression of pain during medical procedures. This was supplanted (in the late 19th century) by the development of more reliable chemical anesthetics.
Hypnodontia – the use of hypnosis in dentistry – has a long history. Besides smoothing out dental procedures by way of its generalized anti-anxiety effects, use of hypnodontia can increase overall patient comfort, make the dental experience acceptable and bearable, decrease resistance to future intervention and, through posthypnotic suggestions, encourage more rapid recovery.
### Education
In a lecture to the American Society of Clinical Hypnosis (ASCH) during their annual conference at the State University Of New York, Dr. Milton Erickson taught the process of indirect hypnosis while Dr. Robert W. Habbick spoke of his research on the use of hypnosis in enhancing learning and reducing anxiety. Dr. Habbick explained the use of a triad of suggestions: "(a) enhancing confidence, while (b) strengthening focused interest in the work and (c) improving energy to do the studying necessary." The results of his controlled research pointed the way toward the need to apply hypnosis especially with students who have difficulty studying. In a more recent lecture, Dr. Habbick spoke in Boston to ASCH of the positive effects of using his suggested hypnosis triad with students at the Bureau of Study Council at Harvard University
### Hypnodermatology
Hypnodermatology is the practice of treating skin diseases with hypnosis.
### Surgery
A study done at the Mt. Sinai School of Medicine looked at two groups of patients facing surgery for breast cancer. The group that received hypnosis prior to surgery reported less pain, nausea, and anxiety after surgery than did the control group. There was a cost benefit as well, as the average hypnosis patient reduced the cost of treatment by an average of $772.00.
### Other uses
Michael R. Nash writes, in a 2001 article for Scientific American titled "The Truth and the Hype of Hypnosis", "using hypnosis, scientists have temporarily created hallucinations, compulsions, certain types of memory loss, false memories, and delusions in the laboratory so that these phenomena can be studied in a controlled environment."
In his book The Hidden Persuaders (1957) Vance Packard describes research involving the behavior of housewives in supermarkets in the 1950's. Cameras were hidden to measure a shopper's eye-blink rate as she compared items. It was assumed that her eye-blink rate would increase as she performed mental calculations to determine which product was the best value. In fact, the cameras recorded an eye-blink rate which indicated that the housewife was, according to Packard, usually in a hypnotic state while shopping. This led manufacturers to produce new brands of laundry detergent in competition with their own, existing brands, where the primary differences were in the product names, colors and shapes of designs on the packages, which were designed to appeal to women at different times of their menstrual cycles. The effects of this research can be noted today by visiting the laundry detergent section of any American supermarket.
Hypnotism has also received publicity about its use in Forensics, Sports, Education, and physical therapy and rehabilitation.
Although not widespread, hypnotism can be used to induce lucid dreams.
# Theories
Though various conjectures are made about hypnosis, the field has received significant support from the science-oriented psychology community due to research into hypnotic phenomena conducted by practitioners and theorists (Sala 1999). Both Heap and Dryden (1991) and Ambrose and Newbold (1980) consider that the theoretical debates on hypnotherapy have been productive, and that hypnosis has benefited from the attentions of those involved in the controversies. However, it has also been stated that the practice of hypnosis has been characterized by gullibility and fraudulence from the 18th century to its adoption by New Age practitioners.
### Social constructionism
Social constructionism and role-playing theory of hypnosis, discovered by Jun Zhou in the early 18th centuryTemplate:Page number, suggests that individuals are playing a role and that really there is no such thing as hypnosis. A relationship is built depending on how much rapport has been established between the "hypnotist" and the subject (see Hawthorne effect, Pygmalion effect, and placebo effect).
Some psychologists, such as Robert Baker, claim that what we call hypnosis is actually a form of learned social behavior, a complex hybrid of social compliance, relaxation, and suggestibility that can account for many esoteric behavioral manifestations.Template:Page number
Nicholas Spanos states, "hypnotic procedures influence behavior indirectly by altering subjects' motivations, expectations and interpretations."Template:Page number
### Dissociation
Pierre Janet originally developed the idea of dissociation of consciousness as a result of his work with hysterical patients. He believed that hypnosis was an example of dissociation whereby areas of an individual's behavioral control are split off from ordinary awareness. Hypnosis would remove some control from the conscious mind and the individual would respond with autonomic, reflexive behavior. Weitzenhoffer describes hypnosis via this theory as "dissociation of awareness from the majority of sensory and even strictly neural events taking place."Template:Page number
### Neuropsychology
Anna Gosline says in a NewScientist.com article:
"Gruzelier and his colleagues studied brain activity using an fMRI while subjects completed a standard cognitive exercise, called the Stroop task.
The team screened subjects before the study and chose 12 that were highly susceptible to hypnosis and 12 with low susceptibility. They all completed the task in the fMRI under normal conditions and then again under hypnosis.
Throughout the study, both groups were consistent in their task results, achieving similar scores regardless of their mental state. During their first task session, before hypnosis, there were no significant differences in brain activity between the groups.
But under hypnosis, Gruzelier found that the highly susceptible subjects showed significantly more brain activity in the anterior cingulate gyrus than the weakly susceptible subjects. This area of the brain has been shown to respond to errors and evaluate emotional outcomes.
The highly susceptible group also showed much greater brain activity on the left side of the prefrontal cortex than the weakly susceptible group. This is an area involved with higher level cognitive processing and behaviour."
### Conditioned process
Ivan Pavlov believed that hypnosis was a "partial sleep". He observed that the various degrees of hypnosis did not significantly differ physiologically from the waking state and hypnosis depended on insignificant changes of environmental stimuli. Pavlov also suggested that lower-brain-stem mechanisms were involved in hypnotic conditioning.Template:Page number
### Hyper-suggestibility
Currently a more popular "hyper-suggestibility theory" states that the subject focuses attention by responding to the hypnotist's suggestion. As attention is focused and magnified, the hypnotist's words are gradually accepted without the subject conducting any conscious censorship of what is being said. This is not unlike the athlete listening to the coach's last pieces of advice minutes before an important sport event; concentration filters out all that is unimportant and magnifies what is said about what really matters to the subject.Template:Page number
### Information
Information theory uses a brain-as-computer model. In electronic systems, a system adjusts its feedback networks to increase the signal-to-noise ratio for optimum functioning, called the "steady state". Increasing the receptability of a receptor enables messages to be more clearly received from a transmitter, primarily by reducing the interference (noise). Thus the hypnotist's object is to use techniques to reduce the interference and increase the receptability of specific messages (suggestions).Template:Page number
### Systems
Systems theory, in this context, may be regarded as an extension of James Braid's original conceptualization of hypnosisTemplate:Page number as involving a process of enhancing or depressing the activity of the nervous system. Systems theory considers the nervous system's organization into interacting subsystems. Hypnotic phenomena thus involve not only increased or decreased activity of particular subsystems, but also their interaction. A central phenomenon in this regard is that of feedback loops, familiar to systems theory, which suggest a mechanism for creating the more extreme hypnotic phenomena.
# Research
A peer-reviewed article on the University of Maryland Medical Center's web site says:
"Although studies on hypnosis as a treatment for obesity are not conclusive, most research suggests that hypnotherapy (when used in combination with cognitive behavioral therapy, exercise, and a low-fat diet) may help overweight or obese individuals lose weight."
### Clinical studies
In 1996, the National Institutes of Health technology assessment panel judged hypnosis to be an effective intervention for alleviating pain from cancer and other chronic conditions. A large number of clinical studies also indicate that hypnosis can reduce the acute pain experienced by patients undergoing burn-wound debridement, enduring bone marrow aspirations, and childbirth. An analysis published in a recent issue of the International Journal of Clinical and Experimental Hypnosis, for example, found that hypnotic suggestions relieved the pain of 75% of 933 subjects participating in 27 different experiments.
### Brain imaging
One controlled scientific experiment postulates that hypnosis may alter our perception of conscious experience in a way not possible when people are not "hypnotized", at least in "highly hypnotizable" people. In this experiment, color perception was changed by hypnosis in "highly hypnotizable" people as determined by (PET) scans (Kosslyn et al., 2000).
Another research example, employing event-related functional MRI (fMRI) and EEG coherence measures, compared certain specific neural activity "...during Stroop task performance between participants of low and high hypnotic susceptibility, at baseline and after hypnotic induction". According to its authors, "the fMRI data revealed that conflict-related ACC activity interacted with hypnosis and hypnotic susceptibility, in that highly susceptible participants displayed increased conflict-related neural activity in the hypnosis condition compared to baseline, as well as with respect to subjects with low susceptibility." (Egner et al., 2005)
Michael Nash said in a Scientific American article: "In 1998 Henry Szechtman of McMaster University in Ontario and his co-workers used PET to image the brain activity of hypnotized subjects who were invited to imagine a scenario and who then experienced a hallucination ... By monitoring regional blood flow in areas activated during both hearing and auditory hallucination but not during simple imagining, the investigators sought to determine where in the brain a hallucinated sound is mistakenly "tagged" as authentic and originating in the outside world.
Szechtman and his colleagues imaged the brain activity of eight very hypnotizable subjects who had been prescreened for their ability to hallucinate under hypnosis ... The tests showed that a region of the brain called the right anterior cingulate cortex was just as active while the volunteers were hallucinating as it was while they were actually hearing the stimulus. In contrast, that brain area was not active while the subjects were imagining that they heard the stimulus."
# Variations
### Self-hypnosis
Self-hypnosis (or auto suggestion) — hypnosis in which a person hypnotizes himself or herself without the assistance of another person to serve as the hypnotist — is a staple of hypnotherapy-related self-help programs. It is most often used to help the self-hypnotist stay on a diet, overcome smoking or some other addiction, or to generally boost the hypnotized person's self-esteem. It is rarely used for the more complex or controversial uses of hypnosis, which require the hypnotist to monitor the hypnotized person's reactions and responses and respond accordingly. Most people who practice self-hypnosis require a focus in order to become fully hypnotized; there are many computer programs on the market that can ostensibly help in this area, though few, if any, have been scientifically proven to aid self-hypnosis.
Some people use devices known as mind machines to help them go into self-hypnosis more readily. A mind machine consists of glasses with different colored flashing LEDs on the inside, and headphones. The LEDs stimulate the visual channel, while the headphones stimulate the audio channel with similar or slightly different frequencies designed to produce a certain mental state. The use of binaural beats in the audio is common; it is said to produce hypnosis more readily.
Self-hypnosis is a skill that can be improved as time goes by. People use techniques such as imagining walking down 10 steps, feeling deeper relaxed as they imagine slowly walking down each step, one at a time. It is a good idea to initially seek the skills of a practicing hypnotherapist in order to understand what it feels like to be in a hypnotic trance. This greatly helps, as the individual can aim to replicate this state. Alternatively, a person may wish to use hypnosis recordings instead.
### Walking hypnosis
Also known as environmental hypnosis, this, as defined by Hypnosis Online, is a naturally occurring trance that one can enter while performing a monotonous repetitive task, such as walking or gardening, or in sedentary pursuits such as listening to a lecture or reading, in which one's attention drifts from the task into a trance-like state, often known as "zoning out". This natural reaction to boredom is often harnessed by athletes to render them oblivious to distractions, especially physical symptoms of pain and fatigue, and the state is known in this context as being "in the zone."
### Waking hypnosis
This phenomenon, as expounded by Melvin Powers in 1955, involves altering the behaviour of a subject by suggestion without inducing a trance. Related to the placebo effect, a subject becomes subconsciously convinced that what they are being told is inevitable reality, for example that the air in the room will cause them to swallow. They can be convinced that a completely benign substance is actually a drug that will induce whatever effect is suggested. In order to work, the subject must completely trust the source of the suggestion or be subconsciously convinced by a calm authoritative tone.
### Mass application
Influencing crowds through common longings and yearnings by a demagogue is called mass hypnosis. Generally, mass hypnosis is applied to religious sessions. Many forms of music and dance can be used to create religious trance.
### Indirect application
In addition to direct application of hypnosis (that is, treatment of conditions by means of hypnosis), there is also indirect application, wherein hypnosis is used to facilitate another procedure. Some people seem more able to display "enhanced functioning", such as the suppression of pain, while utilizing hypnosis.
## Post-hypnotic suggestion
Robin Waterfield writes, in his 2002 book Hidden Depths: The Story of Hypnosis, "a person can act, some time later, on a suggestion seeded during the hypnotic session. Post-hypnotic suggestions can last for a long time. A hypnotherapist told one of his patients, who was also a friend: 'When I touch you on the finger you will immediately be hypnotized.' Fourteen years later, at a dinner party, he touched him deliberately on the finger and his head fell back against the chair."
# Potential dangers
Pratt et al., write, in their 1988 book A Clinical Hypnosis Primer, "A hypnotized patient will respond to a suggestion literally. A suggestion that requires conscious interpretation can have undesirable effects." They give the following report taken from Hartland, 1971, p.37: "A patient who was terrified to go into the street because of the traffic was once told by a hypnotist that when she left his room, she would no longer bother about the traffic and would be able to cross the road without the slightest fear. She obeyed his instructions so literally that she ended up in a hospital."
They also mention:
From Kleinhauz and Beran, 1984:
"In one case, a woman had experienced 10 years of fatigue, irritability, and periods of childish behavior during which her perceptions were distorted. The source of the problem was traced back to a stage performance 10 years earlier, when she was regressed to a traumatic period of her life."
From Kleinhauz and Eli, 1987:
"In one case, a dentist using hypnorelaxation with a patient complied with her request to provide direction suggestions to stop smoking. The patient's underlying psychological conflicts, which the dentist was not qualified to assess, led to the development of an anxiety/depressive reaction."
From Machovec, 1987:
"A woman undergoing psychotherapy facilitated by hypnosis attempted to use the procedures she had learned to relieve her husband's dental pain. During the deepening technique of arm levitation, her husband's fingertips 'stuck' to his head, and a therapist had to intervene to end the trance state."
### Extreme reactions
Licensed hypnotherapistsTemplate:Who have expressed concerns that practitioners of hypnosis who are unlicensed can evoke intense emotions in clients that they are not trained to treat. These abreactions can occur recalling traumatic events.
### False memory
False memory obtained via hypnosis has figured prominently in many investigations and court cases, including cases of alleged sexual abuse. There is no scientific way to prove that any of these recollections are completely accurate.
Individuals have been led by an errant hypnotist to believe in things that they later were able to show did not happen.
The American Medical Association and the American Psychological Association have both cautioned against the use of repressed memory therapy in dealing with cases of alleged childhood trauma, stating that "it is impossible, without other corroborative evidence, to distinguish a true memory from a false one", and so the procedure is "fraught with problems of potential misapplication". (See also false memory).
# Misconceptions
The notion of hypnosis has elicited many presentations in popular culture. Intrinsically, the notion that people are susceptible to commands outside their conscious control can be an effective way of representing the notion of the fallible narrator. Due to the nature of belief in hypnosis, it's possible that popular beliefs regarding hypnosis actually influence the experience, reinforcing the beliefs.
### Control
Some believe that hypnosis is a form of mind control and/or brainwashing that can control a person's behavior and judgment and therefore could potentially cause them harm. These beliefs are not generally based on scientific evidence, as there is no scientific consensus on whether mind control even exists. But there are people interested in research and funding to help work on controlling others and perfecting mind control techniques. These techniques can be researched with the scientific method and reasoning skills.
English entertainer Derren Brown appeared in a series on Channel 4 (in the UK) and the SCI FI Channel (in the US), as the central figure in "Mind Control With Derren Brown," which kicked off on July 26, 2007, with the first of six one-hour episodes. This series has also been shown on other cable channels. In the pilot, Brown appears to use a simple verbal suggestion to manipulate a store clerk into accepting a plain piece of white paper as a twenty dollar bill. He also asks subway passengers where they are getting off and then appears to cause them to forget the name of the stop. Additionally, he gets people to hand him their wallets and walk away from him. In other episodes, he convinces people that he is reading their minds when, in fact, he claims he is simply giving them verbal suggestions which influence their subsequent thinking. He emphasizes that he has no special personal powers and there is no proof that any of his magical "effects" actually employ hypnosis techniques at all.
### Unconscious state
While the word hypnosis is derived from the Greek words for sleep and state, and many hypnotists still use the language of sleep and awake, most times they use this language symbolically at most, but hypnosis is not sleep. In fact, many modern hypnotists are in the school of thought that the conscious mind is still active, just very much subdued, not off.
From the mental standpoint, a hypnotic subject is relaxed yet alert and always aware at some level. Some choose to think of this as a state of mind called "trance".
### Weak-mindedness
Due to the popular but incorrect notion of hypnosis as mind control, some people believe that the ability to experience hypnosis is related to strength and soundness of mind. However, scientists note that personality traits such as gullibility or submissiveness or factors such as low intelligence are not related to hypnotize-ability. Research studies suggest that none of intelligence, gender, or personality traits affect responsiveness to hypnosis and that hypnotize-ability may in fact be hereditary or genetic in nature.
While it is still not completely certain why some are more suggestible than others, many hypnotists would agree that someone who is more intelligent is in fact better at following suggestions, which throws out the school of thought about "weak-mindedness." While in a hypnotic state, the more intelligent interpret a wider array of suggestions and can understand such suggestion's effects were they to be followed. This is noted where if a person is given suggestions that they definitely won't understand, either something completely unexpected would happen, or more likely, the suggestion will be completely ignored. However, it does not appear that a "stronger" or "weaker" mind plays any difference in bringing a person into a hypnotic state in general, just in the ability to follow suggestions after entering such a state.
### Overactive imagination
Another misconception in popular culture is that hypnosis is often the product of vivid imaginations and that hypnotic phenomena is merely imagined in the mind. However, research indicates many imaginative people do not fare well as good hypnotic subjects. Furthermore, studies using PET scans have shown that hypnotized subjects suggested to have auditory hallucinations demonstrated regional blood flow in the same areas of the brain as real hearing, whereas subjects merely imagining hearing noise did not.
### Instant Induction
It is a misconception that induction into hypnosis is time-consuming and requires complete relaxation. Hypnosis through lengthy relaxation or visual experiences is the most common form of induction, but speed-trance instant inductions (2-10 seconds) is a method for induction or re-induction among stage hypnotists, as well as clinical hypnotists seeking to manage trauma or overcome anxiety and resistance. It is possible to hypnotize a subject in just a few seconds by causing confusion, loss of equilibrium, misdirection, shock, or eye fixation. "Speed-trance" is a term used by John Cerbone and Richard Nongard (2007) to describe this virtually instantaneous phenomenon. Variations of rapid inductions based on the Milton Erickson Handshake Interrupt and its use by Richard Bandler and practitioners of NLP have been widely taught.
# Entertainment
## Stage hypnosis
### The Hypnotist
Due to the stage hypnotist's showmanship and their perpetuating the illusion of possessing mysterious abilities, hypnosis is often seen as caused by the hypnotist's power. The real power of hypnosis comes from the trust the hypnotist can instill in his subjects. They have to willingly grant him the ability to take over their critical thinking and direct their bodies. Some people are very trusting, or even looking for an excuse to abdicate their responsibilities and are able to be hypnotised within seconds, while others take more time to counter their fears.
### The subject
In a stage hypnosis situation the hypnotist chooses his participants carefully. First he gives the entire audience a few exercises to perform and plants ideas in their minds, such as, only intelligent people can be hypnotized and only those wanting to have fun will play along. These suggestions are designed to overcome the natural fear of trusting a stranger with the greater fear of being seen as unintelligent, unsociable, and joyless by the rest of the audience. Out of the crowd he will spot people who appear trusting, extroverted and willing to put on a show. Often these people are looking for an excuse to do something they otherwise would not do sober. The hypnotist starts them off by having them imagine ordinary situations that they have likely encountered, like being cold or hot, hungry or thirsty then gradually builds to giving them a suggestion that is totally out of character, such as sing like Elvis. The desire to be the center of attention, having an excuse to violate their own inner fear suppressors and the pressure to please, plus the expectation of the audience wanting them to provide some entertainment is usually enough to persuade an extrovert to do almost anything. In other words the participants are persuaded to 'play along'. This gives the impression that the hypnotist has total control over them.
## Hypnosis in popular media
- Thomas Mann's story Mario and the Magician relates the effect of a hypnotist on a mass audience. It is said to be symbolic of the power of Fascism.
- Popular magician/mentalist "The Amazing Kreskin" disputes the validity of hypnosis and once offered $100,000 to anyone who could prove to his satisfaction that such a thing as "hypnotic trance" exists.
- The Showtime Network television show Penn & Teller: Bullshit!, which features comedy duo Penn & Teller, took a skeptical look at hypnosis in one of their episodes. They took the view that the so-called hypnotic trance does not exist at all, and that all hypnosis sessions are merely voluntary shared fantasies. Penn and Teller also state that the unusual behaviors people exhibit during a hypnosis session have always been well within their reach.
- Paramount syndicated television show The Montel Williams Show, featured a presentation by Hypnotist The Incredible Boris Cherniak where hypnotized subjects reacted to a variety of comical situations, while at the same time showcasing the therapeutic effects of hypnosis such as quitting smoking.
- The British car show Top Gear featured one of the presenters, Richard Hammond, getting hypnotized. Once hypnotized, he manifested a number of personality and mental changes, including not remembering how to drive a car, and thinking that a miniature child's version of a Porsche 911 was his own car, and attempting to drive it around in the studio.
- An episode of MythBusters dealt with hypnosis, attempting to ascertain if post-hypnotic suggestion could influence the actions of a subject against their will and/or be used to improve memory. The conclusion was that hypnosis did not alter their behaviour, but was based on unnamed author published 'self-hypnosis' CD's of indiscernable quality or expertise.
- In the 2001 movie Zoolander Derek Zoolander is hypnotized to the song 'Relax' by Mugatu to kill the Prime Minister of Malaysia.
- The internet website YouTube has become a popular forum for learning techniques associated with both clinical hypnosis and stage hypnosis. Don Spencer, Derren Brown, Richard Nongard, Richard Bandler, Peter Powers and others have popular entertainment or instructional videos that have been seen on YouTube.com and this has increased the ease or popularity of learning hypnosis or viewing hypnosis as entertainment. It has also brought about the phenomena of "street" hypnosis.
- Several songs are named after hypnosis. These include "Hypnotized" by Fleetwood Mac, "Hypnotize" by System of a Down, The Notorious B.I.G, and The White Stripes, "Mass Hypnosis" by Sepultura, "Hypnotized" by Heathen, Hypnotic Suggestion EP by The Apples in Stereo and also "Are You A Hypnotist??" by The Flaming Lips.
- In the popular animated show Futurama, a recurring character is the Hypnotoad. He is first seen having hypnotized the judges of a dog show, enabling him to win. In a later episode, he is shown to have his own popular television show, "Everybody Loves Hypnotoad".
- In an episode of Doug, Dr. Klotzenstein hypnotizes children into eating junk food, in which, Quailman must save the day.
- In the long running BBC science-fiction series Doctor Who, the recurring Time Lord villain the Master will sometimes use hypnosis to bring subjects under his control. This is usually achieved by him staring the victim in the eyes and saying, "I am the Master and you will obey me!". In the 1985 story The Mark of the Rani, the Master uses a pendulum to hypnotize a victim.
- in Woody Allen's The Curse of the Jade Scorpion, two detectives are stage-hypnotized only to become "word-triggered" thieves.
- Derren Brown claims to use hypnotism as part of his performances in Mind Control with Derren Brown.
- In the 1948 MGM musical, The Pirate, starring Gene Kelly and Judy Garland, Kelly's character uses mesmerism/hypnosis that puts Garland's character in a trance, freeing her spirit and evoking her to reveal her fantasies and desires to him and the audience.
- The title character in the film Donnie Darko undergoes hypnosis in an attempt to locate the root of his mental difficulties.
# Standards
### UK
In 2002 UK Department for Education and Skills developed The National Occupational Standards for hypnotherapy based on National Qualifications Framework of The Qualifications and Curriculum Authority and started conferring optional certificates and diplomas in international level through National Awarding Bodies by assessing learning outcomes of training /accrediting prior experiential learning.
### U.S.A.
The United States Department of Labor, Directory of Occupational Titles (D.O.T. 079.157.010) supplies the following definition:
Hypnotherapist -- Induces hypnotic state in client to increase motivation or alter behavior pattern through hypnosis. Consults with client to determine the nature of problem. Prepares client to enter hypnotic states by explaining how hypnosis works and what client will experience. Tests subject to determine degrees of physical and emotional suggestibility. Induces hypnotic state in client using individualized methods and techniques of hypnosis based on interpretation of test results and analysis of client's problem. May train client in self-hypnosis conditioning.
### India
The Indian Ministry of Health & Family Welfare stated that hypnotherapy is a recognized mode of therapy to be practiced by only appropriately trained individuals.
### Australia
Professional hypnotherapy and use of the occupational titles hypnotherapist or clinical hypnotherapist is not government-regulated in Australia.
In 1996, as a result of a three-year research project led by Lindsay B. Yeates, the Australian Hypnotherapists' Association (founded in 1949), the oldest hypnotism-oriented professional organization in Australia, instituted a peer-group accreditation system for full-time Australian professional hypnotherapists, the first of its kind in the world. The system was further revised in 1999. The Australian Hypnotherapists Association is a member of the Psychotherapy and Counselling Federation of Australia (PACFA) which represents many counselling and psychotherapy associations in Australia as well as many other professions.
However, many clinical hypnotherapists and Hypnotherapy Associations do not wish to be represented by PACFA simply because the are not representing hypnotherapy itself.
Australian hypnotism/hypnotherapy organizations (including the Australian Hypnotherapists Association) are seeking government regulation similar to other mental health professions. However, the various tiers of Australian government have shown consistently over they last two decades that they are opposed to government legislation and in favour of self regulation by industry groups.
With this in mind in 2007 a majority of professional hypnosis groups — including professional organizations, private teaching organizations, and other hypntotism-associated professional bodies — have agreed to work toward creating a new national body to be known as Hypnotherapy Council of Australia. The Council of Clinical Hypnotherapists (CCH) will represent the Hypnosis Associations from the Southern Region of Australia, i.e. the States of Victoria, Tasmania and Western Australia. | Hypnosis
Template:Tooshort
Template:TOCleft
Hypnosis (from the Greek hypnos, "sleep") is "a trance-like state that resembles sleep but is induced by a person whose suggestions are readily accepted by the subject."[1]
# History
A part of healing from ancient times, hypnosis is the induction of trance states and the use of therapeutic suggestion, which was a central feature of the ancient Egyptian and Indian sleep temples as well as Greek healing temples, and variations of these techniques were practiced throughout the world. During the Middle Ages and early modern period, hypnosis began to be better understood by physicians such as Avicenna[2] and Paracelsus.
Modern hypnosis began in the eighteenth century with Franz Anton Mesmer, who used what he called "magnetic healing" to treat a variety of psychological and psychophysiological disorders. Sigmund Freud, at first, found it extremely effective in treating hysteria and then, troubled by the sudden emergence of powerful emotions in his patients and its unreliable nature (as some patients could simply not be hypnotized) abandoned it. The therapeutic use of hypnosis in medicine was accepted in 1955 by the British Medical Association, which was closely followed in 1958 by the American Medical Association.
# Methods and effects
## General methods
Hypnotic susceptibility is the measurable responsiveness that a person has to hypnosis. Not all people can be hypnotized, but about 10% of people respond exceptionally well.[3]There is little evidence linking susceptibility to intelligence or personality traits, but some research has linked hypnosis to the amount of imagination in subjects. Recent research suggests that highly hypnotizable people have high sensory and perceptual gating abilities that allow them to block some stimuli from awareness (Barnier, McConkey, and Wright, 2004).
There is a common claim that no one can be hypnotized against their will.[4]
New research, developed by board-certified hypnotist Gerald Kein, claims that everybody is equally hypnotizable and that "people accept hypnosis in direct relationship to the amount of fear they have". Successful hypnosis is attained by the removal of inhibitory fear. With fear removed, most individuals can be deeply hypnotized in 5-10 seconds. Licensed mental health professionals are generally not trained in these techniques and use the old PR hypnotic induction developed in the 1940s (Kein, 1985).
## General effects
### Focused attention
Some schools of thought hold that hypnosis as a state is very similar to other states of extreme concentration, where a person becomes oblivious to his or her surroundings while lost in thought. Often suggested as an example is highway hypnosis, when a driver suddenly finds his or herself much further down the road without any memory of driving the intervening distance.
According to state theorists, the act of hypnotizing, is, in effect, the act of deliberately and mechanically inducing a similar state.[5]
### Suggestibility
Some psychologists have developed studies that show a correlation between the effects people display when acting as "hypnotized" and their level of suggestibility. Some of these studies involve the Harvard scale, and Stanford scale.
Hypnosis has been described as "suspension of the critical factor" which expands on the idea of "increased suggestibility". A person who claims to be hypnotized may accept statements as true that he or she would normally reject.
However, this still does not demonstrate the validity of hypnosis as a real state, as subjects carrying out role playing might react similarly.
It often appears as if the "hypnotized" participant accepts the authority of the "hypnotist" over his or her own experience. When asked after the conclusion of such a session, some participants claim to be genuinely unable to recall the incident, while others say that they had known the hypnotist was wrong but at the time it had seemed easier just to go along with his instructions. (Richard Feynman describes this, in his memoir Surely You're Joking, Mr. Feynman!, as his own hypnotic experience.) The mechanism of this effect, however, is disputed. Some hypnotists claim that this shows the difference between a deep and a shallow hypnotic trance, while skeptics cite that such effects can be duplicated in other circumstances where an agent holds authority, such as in the Milgram experiment. Because of the ability to achieve these effects through normal varieties of communication and circumstance, there is no scientific theory that supports the existence of hypnosis
## Depth of hypnosis
### Pupillary reflex
An objective sign of hypnosis can be observed by a pupillary reflex test, which demonstrates a response that is opposed to the normal physiological response. When subjects are in a profound hypnotic state, they are asked to remain in hypnosis and open their eyes. The subjects' pupils are usually dilated and remain dilated, or react poorly, when a penlight is shone into them (the normal non-hypnotic response is a contraction of the pupil).
The esoteric publication Hypnotism, by Danish hypnotist Carl Septus, is an early reference work that notes the absence of the pupillary reflex sign. Septus states specifically that after subjects have been asked to open their eyes during a deep trance, light shone into the eyes does not cause pupil contraction. The hypnotist may use suggestion to keep the subject in hypnosis, but must avoid suggestions relating to eyes, visual focus, light, or the dilation or contraction of the pupils. [6]
# Applications
### Hypnotherapy
Hypnotherapy is a term to describe the use of hypnosis in a therapeutic context. Many hypnotherapists refer to their practice as "clinical work". Hypnotherapy can either be used as an addition to the work of licensed physicians or psychologists, or it can be used in a stand-alone environment where the hypnotherapist in question usually owns his or her own business. The majority of these stand-alone certified hypnotherapists (C.Hts in the U.S., Diploma. Hyp in the UK) today earn a large portion of their income through the cessation of smoking (often in a single session) and the aid of weight loss (body sculpting). Psychologists and psychiatrists use hypnosis predominantly for the treatment of dissociative disorders, phobias, habit change, depression and post-traumatic syndromes.[7] There is no evidence that 'incurable' diseases (such as cancer, diabetes, and arthritis) are curable with hypnosis, but pain and other bodily symptoms related to the diseases are controllable.[8][9][10][11] Some of the treatments practiced by hypnotherapists, in particular so-called regression, have been viewed with skepticism.[12]
The American Medical Association and the American Psychological Association have both cautioned against the use of repressed memory therapy in dealing with cases of alleged childhood trauma, stating that "it is impossible, without other corroborative evidence, to distinguish a true memory from a false one",[13] and so the procedure is "fraught with problems of potential misapplication".[14] (See also false memory). This is why forensic hypnosis is not widely used in many countries' legal systems. However, hypnosis therapy is frequently used by the public, and there is no shortage of testimonial evidence of its helpfulness.
### Organizations
The American Society of Clinical Hypnosis and British Society of Clinical Hypnosis are organizations that seek to promote the use of hypnosis in treating a wide variety of physical and psychological ailments. The American society was founded by Milton Erickson, who was opposed to unlicensed professionals performing therapeutic hypnosis. In the United States, the largest organization promoting its use for both therapeutic and non-therapeutic use is the National Guild of Hypnotists, or NGH.
### Medicine and dentistry
One of the major initial applications of hypnosis was the suppression of pain during medical procedures. This was supplanted (in the late 19th century) by the development of more reliable chemical anesthetics.
Hypnodontia – the use of hypnosis in dentistry – has a long history. Besides smoothing out dental procedures by way of its generalized anti-anxiety effects, use of hypnodontia can increase overall patient comfort, make the dental experience acceptable and bearable, decrease resistance to future intervention and, through posthypnotic suggestions, encourage more rapid recovery.
### Education
In a lecture to the American Society of Clinical Hypnosis (ASCH) during their annual conference at the State University Of New York, Dr. Milton Erickson taught the process of indirect hypnosis while Dr. Robert W. Habbick spoke of his research on the use of hypnosis in enhancing learning and reducing anxiety. Dr. Habbick explained the use of a triad of suggestions: "(a) enhancing confidence, while (b) strengthening focused interest in the work and (c) improving energy to do the studying necessary." The results of his controlled research pointed the way toward the need to apply hypnosis especially with students who have difficulty studying. In a more recent lecture, Dr. Habbick spoke in Boston to ASCH of the positive effects of using his suggested hypnosis triad with students at the Bureau of Study Council at Harvard University
### Hypnodermatology
Hypnodermatology is the practice of treating skin diseases with hypnosis.
### Surgery
A study done at the Mt. Sinai School of Medicine looked at two groups of patients facing surgery for breast cancer. The group that received hypnosis prior to surgery reported less pain, nausea, and anxiety after surgery than did the control group. There was a cost benefit as well, as the average hypnosis patient reduced the cost of treatment by an average of $772.00.[15]
### Other uses
Michael R. Nash writes, in a 2001 article for Scientific American titled "The Truth and the Hype of Hypnosis", "using hypnosis, scientists have temporarily created hallucinations, compulsions, certain types of memory loss, false memories, and delusions in the laboratory so that these phenomena can be studied in a controlled environment."[16]
In his book The Hidden Persuaders (1957) Vance Packard describes research involving the behavior of housewives in supermarkets in the 1950's. Cameras were hidden to measure a shopper's eye-blink rate as she compared items. It was assumed that her eye-blink rate would increase as she performed mental calculations to determine which product was the best value. In fact, the cameras recorded an eye-blink rate which indicated that the housewife was, according to Packard, usually in a hypnotic state while shopping. This led manufacturers to produce new brands of laundry detergent in competition with their own, existing brands, where the primary differences were in the product names, colors and shapes of designs on the packages, which were designed to appeal to women at different times of their menstrual cycles. The effects of this research can be noted today by visiting the laundry detergent section of any American supermarket.
Hypnotism has also received publicity about its use in Forensics, Sports, Education, and physical therapy and rehabilitation.[17]
Although not widespread, hypnotism can be used to induce lucid dreams.
# Theories
Though various conjectures are made about hypnosis, the field has received significant support from the science-oriented psychology community due to research into hypnotic phenomena conducted by practitioners and theorists (Sala 1999). Both Heap and Dryden (1991) and Ambrose and Newbold (1980) consider that the theoretical debates on hypnotherapy have been productive, and that hypnosis has benefited from the attentions of those involved in the controversies. However, it has also been stated that the practice of hypnosis has been characterized by gullibility and fraudulence from the 18th century to its adoption by New Age practitioners.
### Social constructionism
Social constructionism and role-playing theory of hypnosis, discovered by Jun Zhou in the early 18th century[18]Template:Page number, suggests that individuals are playing a role and that really there is no such thing as hypnosis. A relationship is built depending on how much rapport has been established between the "hypnotist" and the subject (see Hawthorne effect, Pygmalion effect, and placebo effect).
Some psychologists, such as Robert Baker, claim that what we call hypnosis is actually a form of learned social behavior, a complex hybrid of social compliance, relaxation, and suggestibility that can account for many esoteric behavioral manifestations.[19]Template:Page number
Nicholas Spanos states, "hypnotic procedures influence behavior indirectly by altering subjects' motivations, expectations and interpretations."[20]Template:Page number
### Dissociation
Pierre Janet originally developed the idea of dissociation of consciousness as a result of his work with hysterical patients. He believed that hypnosis was an example of dissociation whereby areas of an individual's behavioral control are split off from ordinary awareness. Hypnosis would remove some control from the conscious mind and the individual would respond with autonomic, reflexive behavior. Weitzenhoffer describes hypnosis via this theory as "dissociation of awareness from the majority of sensory and even strictly neural events taking place."[21]Template:Page number
### Neuropsychology
Anna Gosline says in a NewScientist.com article:
"Gruzelier and his colleagues studied brain activity using an fMRI while subjects completed a standard cognitive exercise, called the Stroop task.
The team screened subjects before the study and chose 12 that were highly susceptible to hypnosis and 12 with low susceptibility. They all completed the task in the fMRI under normal conditions and then again under hypnosis.
Throughout the study, both groups were consistent in their task results, achieving similar scores regardless of their mental state. During their first task session, before hypnosis, there were no significant differences in brain activity between the groups.
But under hypnosis, Gruzelier found that the highly susceptible subjects showed significantly more brain activity in the anterior cingulate gyrus than the weakly susceptible subjects. This area of the brain has been shown to respond to errors and evaluate emotional outcomes.
The highly susceptible group also showed much greater brain activity on the left side of the prefrontal cortex than the weakly susceptible group. This is an area involved with higher level cognitive processing and behaviour."[22]
### Conditioned process
Ivan Pavlov believed that hypnosis was a "partial sleep". He observed that the various degrees of hypnosis did not significantly differ physiologically from the waking state and hypnosis depended on insignificant changes of environmental stimuli. Pavlov also suggested that lower-brain-stem mechanisms were involved in hypnotic conditioning.[23]Template:Page number[24]
### Hyper-suggestibility
Currently a more popular "hyper-suggestibility theory" states that the subject focuses attention by responding to the hypnotist's suggestion. As attention is focused and magnified, the hypnotist's words are gradually accepted without the subject conducting any conscious censorship of what is being said. This is not unlike the athlete listening to the coach's last pieces of advice minutes before an important sport event; concentration filters out all that is unimportant and magnifies what is said about what really matters to the subject.[18]Template:Page number
### Information
Information theory uses a brain-as-computer model. In electronic systems, a system adjusts its feedback networks to increase the signal-to-noise ratio for optimum functioning, called the "steady state". Increasing the receptability of a receptor enables messages to be more clearly received from a transmitter, primarily by reducing the interference (noise). Thus the hypnotist's object is to use techniques to reduce the interference and increase the receptability of specific messages (suggestions).[18]Template:Page number
### Systems
Systems theory, in this context, may be regarded as an extension of James Braid's original conceptualization of hypnosis[25]Template:Page number as involving a process of enhancing or depressing the activity of the nervous system. Systems theory considers the nervous system's organization into interacting subsystems. Hypnotic phenomena thus involve not only increased or decreased activity of particular subsystems, but also their interaction. A central phenomenon in this regard is that of feedback loops, familiar to systems theory, which suggest a mechanism for creating the more extreme hypnotic phenomena.[26][27]
# Research
A peer-reviewed article on the University of Maryland Medical Center's web site says:
"Although studies on hypnosis as a treatment for obesity are not conclusive, most research suggests that hypnotherapy (when used in combination with cognitive behavioral therapy, exercise, and a low-fat diet) may help overweight or obese individuals lose weight."[28]
### Clinical studies
In 1996, the National Institutes of Health technology assessment panel judged hypnosis to be an effective intervention for alleviating pain from cancer and other chronic conditions. A large number of clinical studies also indicate that hypnosis can reduce the acute pain experienced by patients undergoing burn-wound debridement, enduring bone marrow aspirations, and childbirth. An analysis published in a recent issue of the International Journal of Clinical and Experimental Hypnosis, for example, found that hypnotic suggestions relieved the pain of 75% of 933 subjects participating in 27 different experiments.[16]
### Brain imaging
One controlled scientific experiment postulates that hypnosis may alter our perception of conscious experience in a way not possible when people are not "hypnotized", at least in "highly hypnotizable" people. In this experiment, color perception was changed by hypnosis in "highly hypnotizable" people as determined by (PET) scans (Kosslyn et al., 2000).
Another research example, employing event-related functional MRI (fMRI) and EEG coherence measures, compared certain specific neural activity "...during Stroop task performance between participants of low and high hypnotic susceptibility, at baseline and after hypnotic induction". According to its authors, "the fMRI data revealed that conflict-related ACC activity interacted with hypnosis and hypnotic susceptibility, in that highly susceptible participants displayed increased conflict-related neural activity in the hypnosis condition compared to baseline, as well as with respect to subjects with low susceptibility." (Egner et al., 2005)
Michael Nash said in a Scientific American article: "In 1998 Henry Szechtman of McMaster University in Ontario and his co-workers used PET to image the brain activity of hypnotized subjects who were invited to imagine a scenario and who then experienced a hallucination ... By monitoring regional blood flow in areas activated during both hearing and auditory hallucination but not during simple imagining, the investigators sought to determine where in the brain a hallucinated sound is mistakenly "tagged" as authentic and originating in the outside world.
Szechtman and his colleagues imaged the brain activity of eight very hypnotizable subjects who had been prescreened for their ability to hallucinate under hypnosis ... The tests showed that a region of the brain called the right anterior cingulate cortex was just as active while the volunteers were hallucinating as it was while they were actually hearing the stimulus. In contrast, that brain area was not active while the subjects were imagining that they heard the stimulus."[16]
# Variations
### Self-hypnosis
Self-hypnosis (or auto suggestion) — hypnosis in which a person hypnotizes himself or herself without the assistance of another person to serve as the hypnotist — is a staple of hypnotherapy-related self-help programs. It is most often used to help the self-hypnotist stay on a diet, overcome smoking or some other addiction, or to generally boost the hypnotized person's self-esteem. It is rarely used for the more complex or controversial uses of hypnosis, which require the hypnotist to monitor the hypnotized person's reactions and responses and respond accordingly. Most people who practice self-hypnosis require a focus in order to become fully hypnotized; there are many computer programs on the market that can ostensibly help in this area, though few, if any, have been scientifically proven to aid self-hypnosis.
Some people use devices known as mind machines to help them go into self-hypnosis more readily. A mind machine consists of glasses with different colored flashing LEDs on the inside, and headphones. The LEDs stimulate the visual channel, while the headphones stimulate the audio channel with similar or slightly different frequencies designed to produce a certain mental state. The use of binaural beats in the audio is common; it is said to produce hypnosis more readily.
Self-hypnosis is a skill that can be improved as time goes by. People use techniques such as imagining walking down 10 steps, feeling deeper relaxed as they imagine slowly walking down each step, one at a time. It is a good idea to initially seek the skills of a practicing hypnotherapist in order to understand what it feels like to be in a hypnotic trance. This greatly helps, as the individual can aim to replicate this state. Alternatively, a person may wish to use hypnosis recordings instead.
### Walking hypnosis
Also known as environmental hypnosis, this, as defined by Hypnosis Online, is a naturally occurring trance that one can enter while performing a monotonous repetitive task, such as walking or gardening, or in sedentary pursuits such as listening to a lecture or reading, in which one's attention drifts from the task into a trance-like state, often known as "zoning out". This natural reaction to boredom is often harnessed by athletes to render them oblivious to distractions, especially physical symptoms of pain and fatigue, and the state is known in this context as being "in the zone."
### Waking hypnosis
This phenomenon, as expounded by Melvin Powers in 1955, involves altering the behaviour of a subject by suggestion without inducing a trance. Related to the placebo effect, a subject becomes subconsciously convinced that what they are being told is inevitable reality, for example that the air in the room will cause them to swallow. They can be convinced that a completely benign substance is actually a drug that will induce whatever effect is suggested. In order to work, the subject must completely trust the source of the suggestion or be subconsciously convinced by a calm authoritative tone.
### Mass application
Influencing crowds through common longings and yearnings by a demagogue is called mass hypnosis. Generally, mass hypnosis is applied to religious sessions. Many forms of music and dance can be used to create religious trance.[29]
### Indirect application
In addition to direct application of hypnosis (that is, treatment of conditions by means of hypnosis), there is also indirect application, wherein hypnosis is used to facilitate another procedure. Some people seem more able to display "enhanced functioning", such as the suppression of pain, while utilizing hypnosis.
## Post-hypnotic suggestion
Robin Waterfield writes, in his 2002 book Hidden Depths: The Story of Hypnosis, "a person can act, some time later, on a suggestion seeded during the hypnotic session. Post-hypnotic suggestions can last for a long time. A hypnotherapist told one of his patients, who was also a friend: 'When I touch you on the finger you will immediately be hypnotized.' Fourteen years later, at a dinner party, he touched him deliberately on the finger and his head fell back against the chair."[30]
# Potential dangers
Pratt et al., write, in their 1988 book A Clinical Hypnosis Primer, "A hypnotized patient will respond to a suggestion literally. A suggestion that requires conscious interpretation can have undesirable effects." They give the following report taken from Hartland, 1971, p.37: "A patient who was terrified to go into the street because of the traffic was once told by a hypnotist that when she left his room, she would no longer bother about the traffic and would be able to cross the road without the slightest fear. She obeyed his instructions so literally that she ended up in a hospital."[31]
They also mention:
From Kleinhauz and Beran, 1984:
"In one case, a woman had experienced 10 years of fatigue, irritability, and periods of childish behavior during which her perceptions were distorted. The source of the problem was traced back to a stage performance 10 years earlier, when she was regressed to a traumatic period of her life."
From Kleinhauz and Eli, 1987:
"In one case, a dentist using hypnorelaxation with a patient complied with her request to provide direction suggestions to stop smoking. The patient's underlying psychological conflicts, which the dentist was not qualified to assess, led to the development of an anxiety/depressive reaction."
From Machovec, 1987:
"A woman undergoing psychotherapy facilitated by hypnosis attempted to use the procedures she had learned to relieve her husband's dental pain. During the deepening technique of arm levitation, her husband's fingertips 'stuck' to his head, and a therapist had to intervene to end the trance state."[32]
### Extreme reactions
Licensed hypnotherapistsTemplate:Who have expressed concerns that practitioners of hypnosis who are unlicensed can evoke intense emotions in clients that they are not trained to treat. These abreactions can occur recalling traumatic events.
### False memory
False memory obtained via hypnosis has figured prominently in many investigations and court cases, including cases of alleged sexual abuse. There is no scientific way to prove that any of these recollections are completely accurate.
Individuals have been led by an errant hypnotist to believe in things that they later were able to show did not happen[1].
The American Medical Association and the American Psychological Association have both cautioned against the use of repressed memory therapy in dealing with cases of alleged childhood trauma, stating that "it is impossible, without other corroborative evidence, to distinguish a true memory from a false one",[13] and so the procedure is "fraught with problems of potential misapplication".[14] (See also false memory).
# Misconceptions
The notion of hypnosis has elicited many presentations in popular culture. Intrinsically, the notion that people are susceptible to commands outside their conscious control can be an effective way of representing the notion of the fallible narrator. Due to the nature of belief in hypnosis, it's possible that popular beliefs regarding hypnosis actually influence the experience, reinforcing the beliefs.
### Control
Some believe that hypnosis is a form of mind control and/or brainwashing that can control a person's behavior and judgment and therefore could potentially cause them harm. These beliefs are not generally based on scientific evidence, as there is no scientific consensus on whether mind control even exists. But there are people interested in research and funding to help work on controlling others and perfecting mind control techniques. These techniques can be researched with the scientific method and reasoning skills.[33][34]
English entertainer Derren Brown appeared in a series on Channel 4 (in the UK) and the SCI FI Channel (in the US), as the central figure in "Mind Control With Derren Brown,"[35] which kicked off on July 26, 2007, with the first of six one-hour episodes. This series has also been shown on other cable channels. In the pilot, Brown appears to use a simple verbal suggestion to manipulate a store clerk into accepting a plain piece of white paper as a twenty dollar bill. He also asks subway passengers where they are getting off and then appears to cause them to forget the name of the stop. Additionally, he gets people to hand him their wallets and walk away from him. In other episodes, he convinces people that he is reading their minds when, in fact, he claims he is simply giving them verbal suggestions which influence their subsequent thinking. He emphasizes that he has no special personal powers and there is no proof that any of his magical "effects" actually employ hypnosis techniques at all.
### Unconscious state
While the word hypnosis is derived from the Greek words for sleep and state, and many hypnotists still use the language of sleep and awake, most times they use this language symbolically at most, but hypnosis is not sleep. In fact, many modern hypnotists are in the school of thought that the conscious mind is still active, just very much subdued, not off.
From the mental standpoint, a hypnotic subject is relaxed yet alert and always aware at some level. Some choose to think of this as a state of mind called "trance".[36]
### Weak-mindedness
Due to the popular but incorrect notion of hypnosis as mind control, some people believe that the ability to experience hypnosis is related to strength and soundness of mind. However, scientists note that personality traits such as gullibility or submissiveness or factors such as low intelligence are not related to hypnotize-ability. Research studies suggest that none of intelligence, gender, or personality traits affect responsiveness to hypnosis and that hypnotize-ability may in fact be hereditary or genetic in nature.[16]
While it is still not completely certain why some are more suggestible than others, many hypnotists would agree that someone who is more intelligent is in fact better at following suggestions, which throws out the school of thought about "weak-mindedness." While in a hypnotic state, the more intelligent interpret a wider array of suggestions and can understand such suggestion's effects were they to be followed. This is noted where if a person is given suggestions that they definitely won't understand, either something completely unexpected would happen, or more likely, the suggestion will be completely ignored. However, it does not appear that a "stronger" or "weaker" mind plays any difference in bringing a person into a hypnotic state in general, just in the ability to follow suggestions after entering such a state.
### Overactive imagination
Another misconception in popular culture is that hypnosis is often the product of vivid imaginations and that hypnotic phenomena is merely imagined in the mind. However, research indicates many imaginative people do not fare well as good hypnotic subjects. Furthermore, studies using PET scans have shown that hypnotized subjects suggested to have auditory hallucinations demonstrated regional blood flow in the same areas of the brain as real hearing, whereas subjects merely imagining hearing noise did not.[16]
### Instant Induction
It is a misconception that induction into hypnosis is time-consuming and requires complete relaxation. Hypnosis through lengthy relaxation or visual experiences is the most common form of induction, but speed-trance instant inductions (2-10 seconds) is a method for induction or re-induction among stage hypnotists, as well as clinical hypnotists seeking to manage trauma or overcome anxiety and resistance. It is possible to hypnotize a subject in just a few seconds by causing confusion, loss of equilibrium, misdirection, shock, or eye fixation. "Speed-trance" is a term used by John Cerbone and Richard Nongard (2007) to describe this virtually instantaneous phenomenon. Variations of rapid inductions based on the Milton Erickson Handshake Interrupt and its use by Richard Bandler and practitioners of NLP have been widely taught.[citation needed]
# Entertainment
## Stage hypnosis
### The Hypnotist
Due to the stage hypnotist's showmanship and their perpetuating the illusion of possessing mysterious abilities, hypnosis is often seen as caused by the hypnotist's power. The real power of hypnosis comes from the trust the hypnotist can instill in his subjects. They have to willingly grant him the ability to take over their critical thinking and direct their bodies. Some people are very trusting, or even looking for an excuse to abdicate their responsibilities and are able to be hypnotised within seconds, while others take more time to counter their fears.[37]
### The subject
In a stage hypnosis situation the hypnotist chooses his participants carefully. First he gives the entire audience a few exercises to perform and plants ideas in their minds, such as, only intelligent people can be hypnotized and only those wanting to have fun will play along. These suggestions are designed to overcome the natural fear of trusting a stranger with the greater fear of being seen as unintelligent, unsociable, and joyless by the rest of the audience. Out of the crowd he will spot people who appear trusting, extroverted and willing to put on a show. Often these people are looking for an excuse to do something they otherwise would not do sober. The hypnotist starts them off by having them imagine ordinary situations that they have likely encountered, like being cold or hot, hungry or thirsty then gradually builds to giving them a suggestion that is totally out of character, such as sing like Elvis. The desire to be the center of attention, having an excuse to violate their own inner fear suppressors and the pressure to please, plus the expectation of the audience wanting them to provide some entertainment is usually enough to persuade an extrovert to do almost anything. In other words the participants are persuaded to 'play along'. This gives the impression that the hypnotist has total control over them.[38]
## Hypnosis in popular media
- Thomas Mann's story Mario and the Magician relates the effect of a hypnotist on a mass audience. It is said to be symbolic of the power of Fascism.
- Popular magician/mentalist "The Amazing Kreskin" disputes the validity of hypnosis and once offered $100,000 to anyone who could prove to his satisfaction that such a thing as "hypnotic trance" exists.[39]
- The Showtime Network television show Penn & Teller: Bullshit!, which features comedy duo Penn & Teller, took a skeptical look at hypnosis in one of their episodes. They took the view that the so-called hypnotic trance does not exist at all, and that all hypnosis sessions are merely voluntary shared fantasies. Penn and Teller also state that the unusual behaviors people exhibit during a hypnosis session have always been well within their reach.
- Paramount syndicated television show The Montel Williams Show, featured a presentation by Hypnotist The Incredible Boris Cherniak where hypnotized subjects reacted to a variety of comical situations, while at the same time showcasing the therapeutic effects of hypnosis such as quitting smoking.[40]
- The British car show Top Gear featured one of the presenters, Richard Hammond, getting hypnotized. Once hypnotized, he manifested a number of personality and mental changes, including not remembering how to drive a car, and thinking that a miniature child's version of a Porsche 911 was his own car, and attempting to drive it around in the studio.
- An episode of MythBusters dealt with hypnosis, attempting to ascertain if post-hypnotic suggestion could influence the actions of a subject against their will and/or be used to improve memory. The conclusion was that hypnosis did not alter their behaviour, but was based on unnamed author published 'self-hypnosis' CD's of indiscernable quality or expertise.
- In the 2001 movie Zoolander Derek Zoolander is hypnotized to the song 'Relax' by Mugatu to kill the Prime Minister of Malaysia.
- The internet website YouTube has become a popular forum for learning techniques associated with both clinical hypnosis and stage hypnosis. Don Spencer, Derren Brown, Richard Nongard, Richard Bandler, Peter Powers and others have popular entertainment or instructional videos that have been seen on YouTube.com and this has increased the ease or popularity of learning hypnosis or viewing hypnosis as entertainment. It has also brought about the phenomena of "street" hypnosis.
- Several songs are named after hypnosis. These include "Hypnotized" by Fleetwood Mac, "Hypnotize" by System of a Down, The Notorious B.I.G, and The White Stripes, "Mass Hypnosis" by Sepultura, "Hypnotized" by Heathen, Hypnotic Suggestion EP by The Apples in Stereo and also "Are You A Hypnotist??" by The Flaming Lips.
- In the popular animated show Futurama, a recurring character is the Hypnotoad. He is first seen having hypnotized the judges of a dog show, enabling him to win. In a later episode, he is shown to have his own popular television show, "Everybody Loves Hypnotoad".
- In an episode of Doug, Dr. Klotzenstein hypnotizes children into eating junk food, in which, Quailman must save the day.
- In the long running BBC science-fiction series Doctor Who, the recurring Time Lord villain the Master will sometimes use hypnosis to bring subjects under his control. This is usually achieved by him staring the victim in the eyes and saying, "I am the Master and you will obey me!". In the 1985 story The Mark of the Rani, the Master uses a pendulum to hypnotize a victim.
- in Woody Allen's The Curse of the Jade Scorpion, two detectives are stage-hypnotized only to become "word-triggered" thieves.
- Derren Brown claims to use hypnotism as part of his performances in Mind Control with Derren Brown.
- In the 1948 MGM musical, The Pirate, starring Gene Kelly and Judy Garland, Kelly's character uses mesmerism/hypnosis that puts Garland's character in a trance, freeing her spirit and evoking her to reveal her fantasies and desires to him and the audience.
- The title character in the film Donnie Darko undergoes hypnosis in an attempt to locate the root of his mental difficulties.
# Standards
### UK
In 2002 UK Department for Education and Skills developed The National Occupational Standards for hypnotherapy based on National Qualifications Framework of The Qualifications and Curriculum Authority and started conferring optional certificates and diplomas in international level through National Awarding Bodies by assessing learning outcomes of training /accrediting prior experiential learning.
### U.S.A.
The United States Department of Labor, Directory of Occupational Titles (D.O.T. 079.157.010) supplies the following definition:
Hypnotherapist -- Induces hypnotic state in client to increase motivation or alter behavior pattern through hypnosis. Consults with client to determine the nature of problem. Prepares client to enter hypnotic states by explaining how hypnosis works and what client will experience. Tests subject to determine degrees of physical and emotional suggestibility. Induces hypnotic state in client using individualized methods and techniques of hypnosis based on interpretation of test results and analysis of client's problem. May train client in self-hypnosis conditioning.
### India
The Indian Ministry of Health & Family Welfare stated that hypnotherapy is a recognized mode of therapy to be practiced by only appropriately trained individuals.
### Australia
Professional hypnotherapy and use of the occupational titles hypnotherapist or clinical hypnotherapist is not government-regulated in Australia.
In 1996, as a result of a three-year research project led by Lindsay B. Yeates, the Australian Hypnotherapists' Association[2] (founded in 1949), the oldest hypnotism-oriented professional organization in Australia, instituted a peer-group accreditation system for full-time Australian professional hypnotherapists, the first of its kind in the world.[41] The system was further revised in 1999.[42] The Australian Hypnotherapists Association is a member of the Psychotherapy and Counselling Federation of Australia (PACFA) which represents many counselling and psychotherapy associations in Australia as well as many other professions.
However, many clinical hypnotherapists and Hypnotherapy Associations do not wish to be represented by PACFA simply because the are not representing hypnotherapy itself.
Australian hypnotism/hypnotherapy organizations (including the Australian Hypnotherapists Association) are seeking government regulation similar to other mental health professions. However, the various tiers of Australian government have shown consistently over they last two decades that they are opposed to government legislation and in favour of self regulation by industry groups.
With this in mind in 2007 a majority of professional hypnosis groups — including professional organizations, private teaching organizations, and other hypntotism-associated professional bodies — have agreed to work toward creating a new national body to be known as Hypnotherapy Council of Australia. The Council of Clinical Hypnotherapists (CCH) will represent the Hypnosis Associations from the Southern Region of Australia, i.e. the States of Victoria, Tasmania and Western Australia. | https://www.wikidoc.org/index.php/Hypnosis | |
12efac22211d72168129aa1674ddaf06922595a8 | wikidoc | Hypnotic | Hypnotic
# Overview
Hypnotic drugs are a class of drugs that induce sleep (which differentiates them from the sedative category), used in the treatment of insomnia and in surgical anesthesia. Often the treatment of insomnia will not begin with drugs at all. Because many hypnotic drugs are habit-forming, a physician will usually recommend alternative sleeping patterns and exercise before prescribing medication for sleep. This is due to a large number of factors known to disturb the human sleep pattern.
These drugs include barbiturates, opioids, benzodiazepines (not all, hypnotic benzodiazepines are usually more powerful than the others in their group), zolpidem, zaleplon, zopiclone, eszopiclone, chloral hydrate, chlormethiazole or the antihistamines doxylamine, promethazine, and diphenhydramine. Alcohol is also used as a hypnotic drug.
# Hypnotic Withdrawal
## Differential Diagnosis
- Alcohol withdrawal
- Anxiety disorders
- Essential tremor
- Hypoglycemia
- Diabetic ketoacidosis
- Seizure due to infections, head injury, poisonings
## DSM-V Diagnostic Criteria for Sedative, Hypnotic, or Anxiolytic Withdrawal
# Hypnotic Intoxication
## Differential Diagnosis
- Alcohol use disorders
- Alcohol intoxication
- Delirium
- Traumatic brain injury
## DSM-V Diagnostic Criteria for Sedative, Hypnotic, or Anxiolytic Intoxication
# Hypnotic Use Disorder
## Differential Diagnosis
- Alcohol use disorder
- Clinically appropriate use of the medication
- Generalized anxiety disorder
- Multiple sclerosis
- Subdural hematoma
## Epidemiology and Demographics of Sedative, Hypnotic, or Anxiolytic Use Disorder
### Prevalence
The 12 month prevalence of hypnotic or anxiolytic use disorder is:
- 300 per 100,000 (0.3%) among adults 12-17 years old
- 200 per 100,000 among adults 18 years and older
## Risk Factors
- Availability of the substances
- Alcohol use disorder
- Environmental factors
- Early onset of use
- Genetic predisposition
- Peer use of the substance
## DSM-V Diagnostic Criteria for Sedative, Hypnotic, or Anxiolytic Use Disorder | Hypnotic
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Kiran Singh, M.D. [2]
# Overview
Hypnotic drugs are a class of drugs that induce sleep (which differentiates them from the sedative category), used in the treatment of insomnia and in surgical anesthesia. Often the treatment of insomnia will not begin with drugs at all. Because many hypnotic drugs are habit-forming, a physician will usually recommend alternative sleeping patterns and exercise before prescribing medication for sleep. This is due to a large number of factors known to disturb the human sleep pattern.
These drugs include barbiturates, opioids, benzodiazepines (not all, hypnotic benzodiazepines are usually more powerful than the others in their group), zolpidem, zaleplon, zopiclone, eszopiclone, chloral hydrate, chlormethiazole or the antihistamines doxylamine, promethazine, and diphenhydramine. Alcohol is also used as a hypnotic drug.
# Hypnotic Withdrawal
## Differential Diagnosis
- Alcohol withdrawal
- Anxiety disorders
- Essential tremor
- Hypoglycemia
- Diabetic ketoacidosis
- Seizure due to infections, head injury, poisonings[1]
## DSM-V Diagnostic Criteria for Sedative, Hypnotic, or Anxiolytic Withdrawal[1]
# Hypnotic Intoxication
## Differential Diagnosis
- Alcohol use disorders
- Alcohol intoxication
- Delirium
- Traumatic brain injury[1]
## DSM-V Diagnostic Criteria for Sedative, Hypnotic, or Anxiolytic Intoxication[1]
# Hypnotic Use Disorder
## Differential Diagnosis
- Alcohol use disorder
- Clinically appropriate use of the medication
- Generalized anxiety disorder
- Multiple sclerosis
- Subdural hematoma[1]
## Epidemiology and Demographics of Sedative, Hypnotic, or Anxiolytic Use Disorder
### Prevalence
The 12 month prevalence of hypnotic or anxiolytic use disorder is:
- 300 per 100,000 (0.3%) among adults 12-17 years old
- 200 per 100,000 among adults 18 years and older[1]
## Risk Factors
- Availability of the substances
- Alcohol use disorder
- Environmental factors
- Early onset of use
- Genetic predisposition
- Peer use of the substance[1]
## DSM-V Diagnostic Criteria for Sedative, Hypnotic, or Anxiolytic Use Disorder[1] | https://www.wikidoc.org/index.php/Hypnotic | |
cd9fc9c7c5682099e4648428a36414212c600d85 | wikidoc | Hypolith | Hypolith
In Arctic and Antarctic ecology, a hypolith is a photosynthetic organism that lives
underneath rocks in climatically extreme deserts such as Cornwallis Island and Devon Island in the Canadian high Arctic. The community itself is the hypolithon.
Hypolithons are protected from harsh ultraviolet radiation and wind scouring by their rock, which can also trap moisture. The rocks are generally translucent to allow for the penetration of light. Writing in Nature, ecologist Charles S. Cockell of the British Antarctic Survey and Dale Stokes describe how hypoliths reported to date (until 2004) had been found under quartz, which is one of the most common translucent rocks .
However, Cockell reported that on Cornwallis Island and Devon Island, 94-95% of a random sample of 850 opaque dolomitic rocks were colonized by hypoliths, and found that the communities were dominated by cyanobacteria. The rocks chosen were visually indistinguishable from those nearby, and were about 10cm across; the hypolithon was visible as a greenish coloured band. Cockell proposed that rock sorting by periglacial action, including that during freeze–thaw cycles, improves light penetration around the edges of rocks (see granular material and Brazil nut effect).
Cockell and Stokes went on to estimate the productivity of the Arctic communities by monitoring the uptake of sodium bicarbonate labelled with Carbon-14 and found that (for Devon Island) productivity of the hypolithon was comparable to that of plants, lichens, and bryophytes combined (0.8 ± 0.3 g m-2 y-1 and 1 ± 0.4 g m-2 y-1 respectively) and concluded that the polar hypolithon may double previous estimates of the productivity of that region of the rocky polar desert. | Hypolith
In Arctic and Antarctic ecology, a hypolith is a photosynthetic organism that lives
underneath rocks in climatically extreme deserts such as Cornwallis Island and Devon Island in the Canadian high Arctic. The community itself is the hypolithon.
Hypolithons are protected from harsh ultraviolet radiation and wind scouring by their rock, which can also trap moisture. The rocks are generally translucent to allow for the penetration of light. Writing in Nature, ecologist Charles S. Cockell of the British Antarctic Survey and Dale Stokes describe how hypoliths reported to date (until 2004) had been found under quartz, which is one of the most common translucent rocks [1].
However, Cockell reported that on Cornwallis Island and Devon Island, 94-95% of a random sample of 850 opaque dolomitic rocks were colonized by hypoliths, and found that the communities were dominated by cyanobacteria. The rocks chosen were visually indistinguishable from those nearby, and were about 10cm across; the hypolithon was visible as a greenish coloured band. Cockell proposed that rock sorting by periglacial action, including that during freeze–thaw cycles, improves light penetration around the edges of rocks (see granular material and Brazil nut effect).
Cockell and Stokes went on to estimate the productivity of the Arctic communities by monitoring the uptake of sodium bicarbonate labelled with Carbon-14 and found that (for Devon Island) productivity of the hypolithon was comparable to that of plants, lichens, and bryophytes combined (0.8 ± 0.3 g m-2 y-1 and 1 ± 0.4 g m-2 y-1 respectively) and concluded that the polar hypolithon may double previous estimates of the productivity of that region of the rocky polar desert.[2] | https://www.wikidoc.org/index.php/Hypolith | |
50b45720dca292525971660fcc3d908bc05a2464 | wikidoc | Hypusine | Hypusine
Hypusine is an unusual amino acid found in all eukaryotes and in some archaebacteria, but not in eubacteria. The only known protein containing hypusine is eukaryotic translation initiation factor 5A (eIF-5A) and a similar protein found in archaebacteria. In human, two isoforms of eIF-5A have been described: eIF-5A-1 and eIF-5A-2. They are coded by two different genes. This protein is involved in protein biosynthesis and promotes the formation of the first peptide bond. The region surrounding the hypusine residue is highly conserved among the eukaryotes and is essential to the function of eIF-5A. Thus, hypusine and eIF-5A appear to be vital for the viability and proliferation of eukaryotic cells.
Hypusine is formed in eIF-5A by post-translational modification of one of the lysyl residues. There are two reactions and two enzymes involved:
- 1. Deoxyhypusine synthase catalyzes the cleavage of the polyamine spermidine and transfer of its 4-aminobutyl moiety to the ε-amino group of one specific lysine residue of the eIF-5A precursor to form deoxyhypusine and 1,3-diaminopropane.
- 2. Deoxyhypusine hydroxylase mediates the formation of hypusine by addition of a hydroxyl group to the deoxyhypusine residue.
An excess of hypusine was found in the urine of children and patients with familial hyperlysinemia.
Hypusine was first isolated from bovine brain by Japanese scientists Shiba et all. in 1971. The name hypusine indicates that the molecule comprises moieties of hydroxyputrescine and lysine.
# Note
- ↑ Shiba T, Mizote H, Kaneko T, Nakajima T, Kakimoto Y., Hypusine, a new amino acid occurring in bovine brain. Isolation and structural determination. Biochim Biophys Acta. 1971 Sep 21;244(3):523-31. | Hypusine
Template:Chembox new
Hypusine is an unusual amino acid found in all eukaryotes and in some archaebacteria, but not in eubacteria. The only known protein containing hypusine is eukaryotic translation initiation factor 5A (eIF-5A) and a similar protein found in archaebacteria. In human, two isoforms of eIF-5A have been described: eIF-5A-1 and eIF-5A-2. They are coded by two different genes. This protein is involved in protein biosynthesis and promotes the formation of the first peptide bond. The region surrounding the hypusine residue is highly conserved among the eukaryotes and is essential to the function of eIF-5A. Thus, hypusine and eIF-5A appear to be vital for the viability and proliferation of eukaryotic cells.
Hypusine is formed in eIF-5A by post-translational modification of one of the lysyl residues. There are two reactions and two enzymes involved:
- 1. Deoxyhypusine synthase catalyzes the cleavage of the polyamine spermidine and transfer of its 4-aminobutyl moiety to the ε-amino group of one specific lysine residue of the eIF-5A precursor to form deoxyhypusine and 1,3-diaminopropane.
- 2. Deoxyhypusine hydroxylase mediates the formation of hypusine by addition of a hydroxyl group to the deoxyhypusine residue.
An excess of hypusine was found in the urine of children and patients with familial hyperlysinemia.
Hypusine was first isolated from bovine brain by Japanese scientists Shiba et all. in 1971.[1] The name hypusine indicates that the molecule comprises moieties of hydroxyputrescine and lysine.
# Note
- ↑ Shiba T, Mizote H, Kaneko T, Nakajima T, Kakimoto Y., Hypusine, a new amino acid occurring in bovine brain. Isolation and structural determination. Biochim Biophys Acta. 1971 Sep 21;244(3):523-31.
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Hypusine | |
5c358aa7b7884d09f5625f7a3f6f956fb5d397f4 | wikidoc | Hysteria | Hysteria
# Overview
Hysteria, or somatization disorder, is a diagnostic label applied to a state of mind, one of unmanageable fear or emotional excesses. The fear is often centered on a body part, most often on an imagined problem with that body part (disease is a common complaint). People who are "hysterical" often lose self-control due to the overwhelming fear.
Because of its association with female hysteria the term hysteria fell out of favor in the latter half of the 20th century. The word "hysterical" was replaced with synonyms such as functional, nonorganic, psychogenic and medically unexplained. In 1980 the American Psychiatric Association officially changed the diagnosis of “hysterical neurosis, conversion type” to “conversion disorder.” In that diagnostic manual the word "neurosis" was removed entirely for any conditions. Currently, the formal term for what is popularly called "hysteria" by the layman in the professional diagnostic manuals, DSM-IV, and ICO is the Histrionic personality disorder. The word "hysteria" is used in the popular press and in informal conversations.
# History
The term originates with the Greek medical term, hysterikos. This referred to a medical condition, thought to be particular to women, caused by disturbances of the uterus, hystera in Greek. The term hysteria was coined by Hippocrates, who thought that the cause of hysteria was due to the uterus wandering around the body in search of children.
The same general definition, or under the name female hysteria, came into widespread use in the middle and late 19th century to describe what is today generally considered to be sexual dissatisfaction. Typical "treatment" was massage of the patient's genitalia by the physician and later vibrators or water sprays to cause orgasm. By the early 1900s, the practice and usage of the term had fallen from use until it was again popularized when the writings of Sigmund Freud became known and influential in Britain and the USA in the 1920s. The Freudian psychoanalytic school of psychology uses its own, somewhat controversial, ways to treat hysteria.
The knowledge of hysterical processes was advanced by the work of Jean-Martin Charcot, a French neurologist. However, many now consider hysteria to be a legacy diagnosis (i.e., a catch-all junk diagnosis), particularly due to its long list of possible manifestations: one Victorian physician cataloged 75 pages of possible symptoms of hysteria and called the list incomplete..
# Mass hysteria
The term also occurs in the phrase mass hysteria to describe mass public near-panic reactions. It is commonly applied to the waves of popular medical problems that "everyone gets" in response to news articles.
A similar usage refers to any sort of "public wave" phenomenon, and has been used to describe the periodic widespread reappearance and public interest in UFO reports, crop circles, and similar examples. Also, when information, real or fake, becomes misinterpreted but believed, e.g. penis panic.
Hysteria is often associated with movements like the Salem Witch Trials, McCarthyism, the First Red Scare, the Second Red Scare, Terrorism, and Satanic ritual abuse where it is better understood through the related sociological term of moral panic. | Hysteria
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Hysteria, or somatization disorder, is a diagnostic label applied to a state of mind, one of unmanageable fear or emotional excesses. The fear is often centered on a body part, most often on an imagined problem with that body part (disease is a common complaint). People who are "hysterical" often lose self-control due to the overwhelming fear.
Because of its association with female hysteria the term hysteria fell out of favor in the latter half of the 20th century. The word "hysterical" was replaced with synonyms such as functional, nonorganic, psychogenic and medically unexplained. In 1980 the American Psychiatric Association officially changed the diagnosis of “hysterical neurosis, conversion type” to “conversion disorder.” In that diagnostic manual the word "neurosis" was removed entirely for any conditions. Currently, the formal term for what is popularly called "hysteria" by the layman in the professional diagnostic manuals, DSM-IV, and ICO is the Histrionic personality disorder. The word "hysteria" is used in the popular press and in informal conversations.
# History
The term originates with the Greek medical term, hysterikos. This referred to a medical condition, thought to be particular to women, caused by disturbances of the uterus, hystera in Greek. The term hysteria was coined by Hippocrates, who thought that the cause of hysteria was due to the uterus wandering around the body in search of children.
The same general definition, or under the name female hysteria, came into widespread use in the middle and late 19th century to describe what is today generally considered to be sexual dissatisfaction.[1] Typical "treatment" was massage of the patient's genitalia by the physician and later vibrators or water sprays to cause orgasm.[1] By the early 1900s, the practice and usage of the term had fallen from use until it was again popularized when the writings of Sigmund Freud became known and influential in Britain and the USA in the 1920s. The Freudian psychoanalytic school of psychology uses its own, somewhat controversial, ways to treat hysteria.
The knowledge of hysterical processes was advanced by the work of Jean-Martin Charcot, a French neurologist. However, many now consider hysteria to be a legacy diagnosis (i.e., a catch-all junk diagnosis),[2] particularly due to its long list of possible manifestations: one Victorian physician cataloged 75 pages of possible symptoms of hysteria and called the list incomplete.[3].
# Mass hysteria
The term also occurs in the phrase mass hysteria to describe mass public near-panic reactions. It is commonly applied to the waves of popular medical problems that "everyone gets" in response to news articles.
A similar usage refers to any sort of "public wave" phenomenon, and has been used to describe the periodic widespread reappearance and public interest in UFO reports, crop circles, and similar examples. Also, when information, real or fake, becomes misinterpreted but believed, e.g. penis panic.
Hysteria is often associated with movements like the Salem Witch Trials, McCarthyism, the First Red Scare, the Second Red Scare, Terrorism, and Satanic ritual abuse where it is better understood through the related sociological term of moral panic. | https://www.wikidoc.org/index.php/Hysteria | |
58b4c2d511b1f7a466eac4e96b7ddeb7d9def052 | wikidoc | Losartan | Losartan
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Losartan is an Angiotensin 2 Receptor Blocker that is FDA approved for the treatment of hypertension, hypertensive patients with left ventricular hypertrophy, nephropathy in type 2 diabetic patients. There is a Black Box Warning for this drug as shown here. Common adverse reactions include chest pain, hypotension, endocrine metabolic, hyperkalemia, hypoglycemia, diarrhea, anemia, asthenia, dizziness, cough, fatigue.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Hypertension
- Dosing information
- Losartan potassium may be administered with other antihypertensive agents, and with or without food.
- Dosing must be individualized.
- Usual starting dosage: 50 mg PO qd‘’‘,
- With 25 mg used in patients with possible depletion of intravascular volume (e.g., patients treated with diuretics) and patients with a history of hepatic impairment.
- Dosage range: 25 mg-100 mg PO qd or bid
- If the antihypertensive effect measured at trough using once-a-day dosing is inadequate, a twice-a-day regimen at the same total daily dose or an increase in dose may give a more satisfactory response. The effect of losartan is substantially present within one week but in some studies the maximal effect occurred in 3 to 6 weeks.
- If blood pressure is not controlled by losartan potassium alone, a low dose of a diuretic may be added. Hydrochlorothiazide has been shown to have an additive effect.
- No initial dosage adjustment is necessary for elderly patients or for patients with renal impairment, including patients on dialysis.
Pediatric Hypertensive Patients ≥ 6 years of age
- The usual recommended starting dose is 0.7 mg/kg once daily (up to 50 mg total) administered as a tablet or a suspension. Dosage should be adjusted according to blood pressure response. Doses above 1.4 mg/kg (or in excess of 100 mg) daily have not been studied in pediatric patients.
- Losartan potassium is not recommended in pediatric patients <6 years of age or in pediatric patients with glomerular filtration rate <30 mL/min/1.73 m2.
### Hypertensive Patients with Left Ventricular Hypertrophy
- Dosing information
- Usual starting dosage: 50 mg PO qd.
- Hydrochlorothiazide 12.5 mg PO qd’‘’ should be added and/or the dose of losartan potassium should be increased to ‘’‘100 mg once daily’‘’ followed by an increase in hydrochlorothiazide to 25 mg once daily based on blood pressure response.
### Nephropathy in Type 2 Diabetic Patients
- Dosing information
- Usual starting dosage: 50 mg PO qd.
- The dose should be increased to 100 mg PO qd based on blood pressure response.
- Losartan potassium may be administered with insulin and other commonly used hypoglycemic agents (e.g., sulfonylureas, glitazones and glucosidase inhibitors).
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
### Stage B Heart Failure
- Developed by: American College of Cardiology Foundation (ACCF) and American Heart Association (AHA)
- Class of Recommendation: Class I
- Level of Evidence: Level A
- Dosing Information
- Not applicable
### Non–Guideline-Supported Use
### Prophylaxis of Diabetes mellitus
- Dosing information
- 50 mg PO qd
### Diabetic nephropathy, In Type 1 Diabetes
- Dosing information
- 100 mg PO qd
### Erectile dysfunction
- Dosing information
- initiated at 50 mg/day; the dose was titrated to 100 mg/day after 4 weeks
### Erythrocytosis
- Dosing information
- 25 mg/day 9017632
- 50 mg daily for 12 weeks
- 100 mg/day
### Gout
- Dosing information
- Not applicable
### Hyperuricemia
- Dosing information
- 50 mg/day
### IgA nephropathy
- Dosing information
- 200 mg/day
- 50 mg/day
### Impaired cognition
- Dosing information
- 50 mg/day
### Nondiabetic Kidney disease
- Dosing information
- 50 mg/day ,
### Prophylaxis of Paroxysmal atrial fibrillation
- Dosing information
- 50 mg/day
### Raised intraocular pressure
- Dosing information
- 50 mg/day
### Isolated Systolic hypertension
- Dosing information
- 50 mg PO qd
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
### Hypertension (Patients ≥ 6 years of age)
- Dosing information
- Usual recommended starting dosage: 0.7 mg/kg PO qd (up to 50 mg total) administered as a tablet or a suspension (see Preparation of Suspension).
- Dosage should be adjusted according to blood pressure response.
- Doses above 1.4 mg/kg (or in excess of 100 mg) daily have not been studied in pediatric patients.
- Losartan potassium is not recommended in pediatric patients <6 years of age or in pediatric patients with glomerular filtration rate <30 mL/min/1.73 m2.
### Preparation of Suspension (for 200 mL of a 2.5 mg/mL suspension)
- Add 10 mL of Purified Water USP to an 8 ounce (240 mL) amber polyethylene terephthalate (PET) bottle containing ten 50 mg losartan potassium tablets. Immediately shake for at least 2 minutes. Let the concentrate stand for 1 hour and then shake for 1 minute to disperse the tablet contents. Separately prepare a 50/50 volumetric mixture of Ora-Plus™ and Ora-Sweet SF™. Add 190 mL of the 50/50 Ora-Plus™/Ora-Sweet SF™ mixture to the tablet and water slurry in the PET bottle and shake for 1 minute to disperse the ingredients. The suspension should be refrigerated at 2 to 8°C (36 to 46°F) and can be stored for up to 4 weeks. Shake the suspension prior to each use and return promptly to the refrigerator.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Losartan in pediatric patients.
### Non–Guideline-Supported Use
### Alport syndrome
- Dosing information
- Maximum dosage: 50 mg/day if weight under 50 kg;
- Maximum dosage: 100 mg/day if weight 50 kg or more
### Nondiabetic Kidney disease
- Dosing information
- 0.8 mg/kg daily
# Contraindications
Losartan is contraindicated in patients who are hypersensitive to any component of this product.
Do not co-administer aliskiren with Losartan in patients with diabetes.
# Warnings
### Fetal Toxicity
### Pregnancy Category D
- Use of drugs that act on the renin-angiotensin system during the second and third trimesters of pregnancy reduces renal function and increases fetal and neonatal morbidity and death. Resulting oligohydramnios can be associated with fetal lung hypoplasia and skeletal deformations. Potential neonatal adverse effects include skull hypoplasia, anuria, hypotension, renal failure, and death. When pregnancy is detected,discontinue Losartan as soon as possible. These adverse outcomes are usually associated with the use of these drugs in the second and third trimester of pregnancy. Most epidemiologic studies examining fetal abnormalities after exposure to antihypertensive use in the first trimester have not distinguished drugs affecting the renin-angiotensin system from other antihypertensive agents. Appropriate management of maternal hypertension during pregnancy is important to optimize outcomes for both mother and fetus.
- In the unusual case that there is no appropriate alternative to therapy with drugs affecting the renin-angiotensin system for a particular patient, apprise the mother of the potential risk to the fetus. Perform serial ultrasound examinations to assess the intra-amniotic environment.
- If oligohydramnios is observed, discontinue Losartan, unless it is considered life-saving for the mother. Fetal testing may be appropriate, based on the week of pregnancy. Patients and physicians should be aware, however, that oligohydramnios may not appear until after the fetus has sustained irreversible injury.
- Closely observe infants with histories of in utero exposure to Losartan for hypotension, oliguria, and hyperkalemia.
- Losartan potassium has been shown to produce adverse effects in rat fetuses and neonates, including decreased body weight, delayed physical and behavioral development, mortality and renal toxicity. With the exception of neonatal weight gain (which was affected at doses as low as 10 mg/kg/day), doses associated with these effects exceeded 25 mg/kg/day (approximately three times the maximum recommended human dose of 100 mg on a mg/m2 basis). These findings are attributed to drug exposure in late gestation and during lactation. Significant levels of losartan and its active metabolite were shown to be present in rat fetal plasma during late gestation and in rat milk.
### Hypotension — Volume-Depleted Patients
- In patients who are intravascularly volume-depleted (e.g., those treated with diuretics), symptomatic hypotension may occur after initiation of therapy with Losartan. These conditions should be corrected prior to administration of Losartan, or a lower starting dose should be used.
## PRECAUTIONS
### General
Hypersensitivity: Angioedema. See ADVERSE REACTIONS, Postmarketing Experience.
### Impaired Hepatic Function
- Based on pharmacokinetic data which demonstrate significantly increased plasma concentrations of losartan in cirrhotic patients, a lower dose should be considered for patients with impaired liver function (see DOSAGE AND ADMINISTRATION and CLINICAL PHARMACOLOGY, Pharmacokinetics).
### Impaired Renal Function
- As a consequence of inhibiting the renin-angiotensin-aldosterone system, changes in renal function have been reported in susceptible individuals treated with Losartan; in some patients, these changes in renal function were reversible upon discontinuation of therapy.
- In patients whose renal function may depend on the activity of the renin-angiotensin-aldosterone system (e.g., patients with severe congestive heart failure), treatment with angiotensin converting enzyme inhibitors has been associated with oliguria and/or progressive azotemia and (rarely) with acute renal failure and/or death. Similar outcomes have been reported with Losartan.
- In studies of ACE inhibitors in patients with unilateral or bilateral renal artery stenosis, increases in serum creatinine or blood urea nitrogen (BUN) have been reported. Similar effects have been reported with Losartan; in some patients, these effects were reversible upon discontinuation of therapy.
### Electrolyte Imbalance
- Electrolyte imbalances are common in patients with renal impairment, with or without diabetes, and should be addressed. In a clinical study conducted in type 2 diabetic patients with proteinuria, the incidence of hyperkalemia was higher in the group treated with Losartan as compared to the placebo group; however, few patients discontinued therapy due to hyperkalemia
# Adverse Reactions
## Clinical Trials Experience
## Hypertension
- Losartan has been evaluated for safety in more than 3300 adult patients treated for essential hypertension and 4058 patients/subjects overall. Over 1200 patients were treated for over 6 months and more than 800 for over one year. In general, treatment with Losartan was well-tolerated. The overall incidence of adverse experiences reported with Losartan was similar to placebo.
- In controlled clinical trials, discontinuation of therapy due to clinical adverse experiences was required in 2.3 percent of patients treated with Losartan and 3.7 percent of patients given placebo.
- The following table of adverse events is based on four 6- to 12-week, placebo-controlled trials involving over 1000 patients on various doses (10-150 mg) of losartan and over 300 patients given placebo. All doses of losartan are grouped because none of the adverse events appeared to have a dose-related frequency. The adverse experiences reported in ≥1% of patients treated with Losartan and more commonly than placebo are shown in the table below.
- The following adverse events were also reported at a rate of 1% or greater in patients treated with losartan, but were as, or more frequent, in the placebo group: asthenia/fatigue, edema/swelling, abdominal pain, chest pain, nausea, headache, pharyngitis, diarrhea, dyspepsia, myalgia, insomnia, cough, sinus disorder.
- Adverse events occurred at about the same rates in men and women, older and younger patients, and Black and non-Black patients.
- A patient with known hypersensitivity to aspirin and penicillin, when treated with Losartan, was withdrawn from study due to swelling of the lips and eyelids and facial rash, reported as angioedema, which returned to normal 5 days after therapy was discontinued.
- Superficial peeling of palms and hemolysis were reported in one subject.
- In addition to the adverse events above, potentially important events that occurred in at least two patients/subjects exposed to losartan or other adverse events that occurred in <1% of patients in clinical studies are listed below. It cannot be determined whether these events were causally related to losartan: Body as a Whole: facial edema, fever, orthostatic effects, syncope; Cardiovascular: angina pectoris, second degree AV block, CVA, hypotension, myocardial infarction, arrhythmias including atrial fibrillation, palpitation, sinus bradycardia, tachycardia, ventricular tachycardia, ventricular fibrillation; Digestive: anorexia, constipation, dental pain, dry mouth, flatulence, gastritis, vomiting; Hematologic: anemia; Metabolic: gout; Musculoskeletal: arm pain, hip pain, joint swelling, knee pain, musculoskeletal pain, shoulder pain, stiffness, arthralgia, arthritis, fibromyalgia, muscle weakness; NervousSystem/Psychiatric: anxiety, anxiety disorder, ataxia, confusion, depression, dream abnormality, hypesthesia, decreased libido, memory impairment, migraine, nervousness, paresthesia, peripheral neuropathy, panic disorder, sleep disorder, somnolence, tremor, vertigo; Respiratory: dyspnea, bronchitis, pharyngeal discomfort, epistaxis, rhinitis, respiratory congestion; Skin: alopecia, dermatitis, dry skin, ecchymosis, erythema, flushing, photosensitivity, pruritus, rash, sweating, urticaria; Special Senses: blurred vision, burning/stinging in the eye, conjunctivitis, taste perversion, tinnitus, decrease in visual acuity; Urogenital: impotence, nocturia, urinary frequency, urinary tract infection.
- Persistent dry cough (with an incidence of a few percent) has been associated with ACE-inhibitor use and in practice can be a cause of discontinuation of ACE-inhibitor therapy. Two prospective, parallel-group, double-blind, randomized, controlled trials were conducted to assess the effects of losartan on the incidence of cough in hypertensive patients who had experienced cough while receiving ACE-inhibitor therapy. Patients who had typical ACE-inhibitor cough when challenged with lisinopril, whose cough disappeared on placebo, were randomized to losartan 50 mg, lisinopril 20 mg, or either placebo (one study, n=97) or 25 mg hydrochlorothiazide (n=135). The double-blind treatment period lasted up to 8 weeks. The incidence of cough is shown below.
- These studies demonstrate that the incidence of cough associated with losartan therapy, in a population that all had cough associated with ACE-inhibitor therapy, is similar to that associated with hydrochlorothiazide or placebo therapy.
- Cases of cough, including positive re-challenges, have been reported with the use of losartan in postmarketing experience.
- Pediatric Patients: No relevant differences between the adverse experience profile for pediatric patients and that previously reported for adult patients were identified.
- In the LIFE study, adverse events with Losartan were similar to those reported previously for patients with hypertension.
### Nephropathy in Type 2 Diabetic Patients
- In the RENAAL study involving 1513 patients treated with Losartan or placebo, the overall incidences of reported adverse experiences were similar for the two groups. Losartan was generally well tolerated as evidenced by a similar incidence of discontinuations due to side effects compared to placebo (19% for Losartan, 24% for placebo). The adverse experiences, regardless of drug relationship, reported with an incidence of ≥4% of patients treated with Losartan and occurring more commonly than placebo, on a background of conventional antihypertensive therapy, are shown in the table below.
## Postmarketing Experience
The following additional adverse reactions have been reported in postmarketing experience:
Digestive: Hepatitis (reported rarely).
General Disorders and Administration Site Conditions: Malaise.
Hemic:Thrombocytopenia (reported rarely).
Hypersensitivity: Angioedema, including swelling of the larynx and glottis, causing airway obstruction and/or swelling of the face, lips, pharynx, and/or tongue has been reported rarely in patients treated with losartan; some of these patients previously experienced angioedema with other drugs including ACE inhibitors. Vasculitis, including Henoch-Schönlein purpura, has been reported. Anaphylactic reactions have been reported.
Metabolic and Nutrition: Hyperkalemia, hyponatremia have been reported with losartan.
Musculoskeletal: Rare cases of rhabdomyolysis have been reported in patients receiving angiotensin II receptor blockers.
Nervous system disorders: Dysgeusia.
Respiratory: Dry cough.
Skin: Erythroderma.
### Laboratory Test Findings
- In controlled clinical trials, clinically important changes in standard laboratory parameters were rarely associated with administration of Losartan.
Creatinine, Blood Urea Nitrogen: Minor increases in blood urea nitrogen (BUN) or serum creatinine were observed in less than 0.1 percent of patients with essential hypertensiontreated with Losartan alone.
Hemoglobin and Hematocrit: Small decreases in hemoglobin and hematocrit (mean decreases of approximately 0.11 grams percent and 0.09 volume percent, respectively) occurred frequently in patients treated with Losartan alone, but were rarely of clinical importance. No patients were discontinued due to anemia.
Liver Function Tests: Occasional elevations of liver enzymes and/or serum bilirubin have occurred. In patients with essential hypertension treated with Losartan alone, one patient (<0.1%) was discontinued due to these laboratory adverse experiences.
# Drug Interactions
- Losartan, administered for 12 days, did not affect the pharmacokinetics or pharmacodynamics of a single dose of warfarin. Losartan did not affect the pharmacokinetics of oral or intravenous digoxin. There is no pharmacokinetic interaction between losartan and hydrochlorothiazide. Coadministration of losartan and cimetidine led to an increase of about 18% in AUC of losartan but did not affect the pharmacokinetics of its active metabolite. Coadministration of losartan and phenobarbital led to a reduction of about 20% in the AUC of losartan and that of its active metabolite. A somewhat greater interaction (approximately 40% reduction in the AUC of active metabolite and approximately 30% reduction in the AUC of losartan) has been reported with rifampin. Fluconazole, an inhibitor of cytochrome P450 2C9, decreased the AUC of the active metabolite by approximately 40%, but increased the AUC of losartan by approximately 70% following multiple doses. Conversion of losartan to its active metabolite after intravenous administration is not affected by ketoconazole, an inhibitor of P450 3A4. The AUC of active metabolite following oral losartan was not affected by erythromycin, another inhibitor of P450 3A4, but the AUC of losartan was increased by 30%.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): D
- Use of drugs that act on the renin-angiotensin system during the second and third trimesters of pregnancy reduces renal function and increases fetal and neonatal morbidity and death. Resulting oligohydramnios can be associated with fetal lung hypoplasia and skeletal deformations. Potential neonatal adverse effects include skull hypoplasia, anuria, hypotension, renal failure, and death. When pregnancy is detected, discontinue losartan potassium tablets as soon as possible. These adverse outcomes are usually associated with the use of these drugs in the second and third trimester of pregnancy. Most epidemiologic studies examining fetal abnormalities after exposure to antihypertensive use in the first trimester have not distinguished drugs affecting the renin-angiotensin system from other antihypertensive agents. Appropriate management of maternal hypertension during pregnancy is important to optimize outcomes for both mother and fetus.
- In the unusual case that there is no appropriate alternative to therapy with drugs affecting the renin-angiotensin system for a particular patient, apprise the mother of the potential risk to the fetus. Perform serial ultrasound examinations to assess the intra-amniotic environment.
- If oligohydramnios is observed, discontinue losartan potassium tablets, unless it is considered life-saving for the mother. Fetal testing may be appropriate, based on the week of pregnancy. Patients and physicians should be aware, however, that oligohydramnios may not appear until after the fetus has sustained irreversible injury.
- Closely observe infants with histories of in utero exposure to losartan potassium for hypotension, oliguria, and hyperkalemia.
- Losartan potassium has been shown to produce adverse effects in rat fetuses and neonates, including decreased body weight, delayed physical and behavioral development, mortality and renal toxicity. With the exception of neonatal weight gain (which was affected at doses as low as 10 mg/kg/day), doses associated with these effects exceeded 25 mg/kg/day (approximately three times the maximum recommended human dose of 100 mg on a mg/m2 basis). These findings are attributed to drug exposure in late gestation and during lactation. Significant levels of losartan and its active metabolite were shown to be present in rat fetal plasma during late gestation and in rat milk.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Losartan in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Losartan during labor and delivery.
### Nursing Mothers
- It is not known whether losartan is excreted in human milk, but significant levels of losartan and its active metabolite were shown to be present in rat milk. Because of the potential for adverse effects on the nursing infant, a decision should be made whether to discontinue nursing or discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
- Neonates with a history of in utero exposure to Losartan
- If oliguria or hypotension occurs, direct attention toward support of blood pressure and renal perfusion. Exchange transfusions or dialysis may be required as a means of reversing hypotension and/or substituting for disordered renal function.
- Antihypertensive effects of Losartan have been established in hypertensive pediatric patients aged 6 to 16 years. There are no data on the effect of Losartan on blood pressure in pediatric patients under the age of 6 or in pediatric patients with glomerular filtration rate <30 mL/min/1.73 m2.
### Geriatic Use
- Of the total number of patients receiving Losartan in controlled clinical studies for hypertension, 391 patients (19%) were 65 years and over, while 37 patients (2%) were 75 years and over. In a controlled clinical study for renal protection in type 2 diabetic patients with proteinuria, 248 patients (33%) were 65 years and over. In a controlled clinical study for the reduction in the combined risk of cardiovascular death, stroke and myocardial infarction in hypertensive patients with left ventricular hypertrophy, 2857 patients (62%) were 65 years and over, while 808 patients (18%) were 75 years and over. No overall differences in effectiveness or safety were observed between these patients and younger patients, but greater sensitivity of some older individuals cannot be ruled out.
### Gender
There is no FDA guidance on the use of Losartan with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Losartan with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Losartan in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Losartan in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Losartan in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Losartan in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
FDA Package Insert for Losartan contains no information regarding drug monitoring.
# IV Compatibility
There is limited information about the IV Compatibility.
# Overdosage
- Significant lethality was observed in mice and rats after oral administration of 1000 mg/kg and 2000 mg/kg, respectively, about 44 and 170 times the maximum recommended human dose on a mg/m2 basis.
- Limited data are available in regard to overdosage in humans. The most likely manifestation of overdosage would be hypotension and tachycardia; bradycardia could occur from parasympathetic (vagal) stimulation. If symptomatic hypotension should occur, supportive treatment should be instituted.
- Neither losartan nor its active metabolite can be removed by hemodialysis.
# Pharmacology
## Mechanism of Action
- Angiotensin II , is a potent vasoconstrictor, the primary vasoactive hormone of the renin-angiotensin system and an important component in the pathophysiology of hypertension. It also stimulates aldosterone secretion by the adrenal cortex. Losartan and its principal active metabolite block the vasoconstrictor and aldosterone-secreting effects of Angiotensin II by selectively blocking the binding of Angiotensin II to the AT1 receptor found in many tissues, (e.g., vascular smooth muscle, adrenal gland). There is also an AT2 receptor found in many tissues but it is not known to be associated with cardiovascular homeostasis. Both losartan and its principal active metabolite do not exhibit any partial agonist activity at the AT1 receptor and have much greater affinity (about 1000 fold) for the AT1 receptor than for the AT2 receptor. In vitro binding studies indicate that losartan is a reversible, competitive inhibitor of the AT1 receptor. The active metabolite is 10 to 40 times more potent by weight than losartan and appears to be a reversible, non-competitive inhibitor of the AT1 receptor.
Neither losartan nor its active metabolite inhibits ACE (kininase II, the enzyme that converts angiotensin I to Angiotensin II and degrades bradykinin); nor do they bind to or block other hormone receptors or ion channels known to be important in cardiovascular regulation.
## Structure
- Losartan (losartan potassium) is an angiotensin II receptor (type AT1) antagonist. Losartan potassium, a non-peptide molecule, is chemically described as 2-butyl-4-chloro-1-imidazole-5-methanol monopotassium salt.
- Its empirical formula is C22H22ClKN6O, and its structural formula is:
- Losartan potassium is a white to off-white free-flowing crystalline powder with a molecular weight of 461.01. It is freely soluble in water, soluble in alcohols, and slightly soluble in common organic solvents, such as acetonitrile and methyl ethyl ketone. Oxidation of the 5-hydroxymethyl group on the imidazole ring results in the active metabolite of losartan.
## Pharmacodynamics
## Adult Hypertension
- Losartan inhibits the pressor effect of angiotensin II (as well as angiotensin I) infusions. A dose of 100 mg inhibits the pressor effect by about 85% at peak with 25-40% inhibition persisting for 24 hours. Removal of the negative feedback of angiotensin II causes a 2- to 3-fold rise in plasma renin activity and consequent rise in angiotensin II plasma concentration in hypertensive patients. Losartan does not affect the response to bradykinin, whereas ACE inhibitors increase the response to bradykinin. Aldosterone plasma concentrations fall following losartan administration. In spite of the effect of losartan on aldosterone secretion, very little effect on serum potassium was observed.
- In a single-dose study in normal volunteers, losartan had no effects on glomerular filtration rate, renal plasma flow or filtration fraction. In multiple-dose studies in hypertensive patients, there were no notable effects on systemic or renal prostaglandin concentrations, fasting triglycerides, total cholesterol or HDL-cholesterol or fasting glucose concentrations. There was a small uricosuric effect leading to a minimal decrease in serum uric acid (mean decrease <0.4 mg/dL) during chronic oral administration.
- The antihypertensive effects of Losartan were demonstrated principally in 4 placebo-controlled, 6- to 12-week trials of dosages from 10 to 150 mg per day in patients with baseline diastolic blood pressures of 95-115. The studies allowed comparisons of two doses (50-100 mg/day) as once-daily or twice-daily regimens, comparisons of peak and trough effects, and comparisons of response by gender, age, and race. Three additional studies examined the antihypertensive effects of losartan and hydrochlorothiazide in combination.
- The 4 studies of losartan monotherapy included a total of 1075 patients randomized to several doses of losartan and 334 to placebo. The 10- and 25-mg doses produced some effect at peak (6 hours after dosing) but small and inconsistent trough (24 hour) responses. Doses of 50, 100 and 150 mg once daily gave statistically significant systolic/diastolic mean decreases in blood pressure, compared to placebo in the range of 5.5-10.5/3.5-7.5 mmHg, with the 150-mg dose giving no greater effect than 50-100 mg. Twice-daily dosing at 50-100 mg/day gave consistently larger trough responses than once-daily dosing at the same total dose. Peak (6 hour) effects were uniformly, but moderately, larger than trough effects, with the trough-to-peak ratio for systolic and diastolic responses 50-95% and 60-90%, respectively.
- Addition of a low dose of hydrochlorothiazide (12.5 mg) to losartan 50 mg once daily resulted in placebo-adjusted blood pressure reductions of 15.5/9.2 mmHg.
- Analysis of age, gender, and race subgroups of patients showed that men and women, and patients over and under 65, had generally similar responses. Losartan was effective in reducing blood pressure regardless of race, although the effect was somewhat less in Black patients (usually a low-renin population).
- The effect of losartan is substantially present within one week but in some studies the maximal effect occurred in 3-6 weeks. In long-term follow-up studies (without placebo control) the effect of losartan appeared to be maintained for up to a year. There is no apparent rebound effect after abrupt withdrawal of losartan. There was essentially no change in average heart rate in losartan-treated patients in controlled trials.
## Pediatric Hypertension
- The antihypertensive effect of losartan was studied in one trial enrolling 177 hypertensive pediatric patients aged 6 to 16 years old. Children who weighed <50 kg received 2.5, 25 or 50 mg of losartan daily and patients who weighed ≥50 kg received 5, 50 or 100 mg of losartan daily. Children in the lowest dose group were given losartan in a suspension formulation. The majority of the children had hypertension associated with renal and urogenital disease. The sitting diastolic blood pressure (SiDBP) on entry into the study was higher than the 95th percentile level for the patient's age, gender, and height. At the end of three weeks, losartan reduced systolic and diastolic blood pressure, measured at trough, in a dose-dependent manner. Overall, the two higher doses (25 to 50 mg in patients <50 kg; 50 to 100 mg in patients ≥50 kg) reduced diastolic blood pressure by 5 to 6 mmHg more than the lowest dose used (2.5 mg in patients <50 kg; 5 mg in patients ≥50 kg). The lowest dose, corresponding to an average daily dose of 0.07 mg/kg, did not appear to offer consistent antihypertensive efficacy. When patients were randomized to continue losartan at the two higher doses or to placebo after 3 weeks of therapy, trough diastolic blood pressure rose in patients on placebo between 5 and 7 mmHg more than patients randomized to continuing losartan. When the low dose of losartan was randomly withdrawn, the rise in trough diastolic blood pressure was the same in patients receiving placebo and in those continuing losartan, again suggesting that the lowest dose did not have significant antihypertensive efficacy. Overall, no significant differences in the overall antihypertensive effect of losartan were detected when the patients were analyzed according to age (<, ≥12 years old) or gender. While blood pressure was reduced in all racial subgroups examined, too few non-White patients were enrolled to compare the dose-response of losartan in the non-White subgroup.
## Reduction in the Risk of Stroke
- The Losartan Intervention For Endpoint reduction in hypertension (LIFE) study was a multinational, double-blind study comparing Losartan and atenolol in 9193 hypertensive patients with ECG-documented left ventricular hypertrophy. Patients with myocardial infarction or stroke within six months prior to randomization were excluded. Patients were randomized to receive once daily Losartan 50 mg or atenolol 50 mg. If goal blood pressure (<140/90 mmHg) was not reached, hydrochlorothiazide (12.5 mg) was added first and, if needed, the dose of Losartan or atenolol was then increased to 100 mg once daily. If necessary, other antihypertensive treatments (e.g., increase in dose of hydrochlorothiazide therapy to 25 mg or addition of other diuretic therapy, calcium-channel blockers, alpha-blockers, or centrally acting agents, but not ACE inhibitors, angiotensin II antagonists, or beta-blockers) were added to the treatment regimen to reach the goal blood pressure.
- Of the randomized patients, 4963 (54%) were female and 533 (6%) were Black. The mean age was 67 with 5704 (62%) age ≥65. At baseline, 1195 (13%) had diabetes, 1326 (14%) had isolated systolic hypertension, 1469 (16%) had coronary heart disease, and 728 (8%) had cerebrovascular disease. Baseline mean blood pressure was 174/98 mmHg in both treatment groups. The mean length of follow-up was 4.8 years. At the end of study or at the last visit before a primary endpoint, 77% of the group treated with Losartan and 73% of the group treated with atenolol were still taking study medication. Of the patients still taking study medication, the mean doses of Losartan and atenolol were both about 80 mg/day, and 15% were taking atenolol or losartan as monotherapy, while 77% were also receiving hydrochlorothiazide (at a mean dose of 20 mg/day in each group). Blood pressure reduction measured at trough was similar for both treatment groups but blood pressure was not measured at any other time of the day. At the end of study or at the last visit before a primary endpoint, the mean blood pressures were 144.1/81.3 mmHg for the group treated with Losartan and 145.4/80.9 mmHg for the group treated with atenolol .
- The primary endpoint was the first occurrence of cardiovascular death, nonfatal stroke, or nonfatal myocardial infarction. Patients with nonfatal events remained in the trial, so that there was also an examination of the first event of each type even if it was not the first event (e.g., a stroke following an initial myocardial infarction would be counted in the analysis of stroke). Treatment with Losartan resulted in a 13% reduction (p=0.021) in risk of the primary endpoint compared to the atenolol group (see Figure 1 and Table 2); this difference was primarily the result of an effect on fatal and nonfatal stroke. Treatment with Losartan reduced the risk of stroke by 25% relative to atenolol (p=0.001) (see Figure 2 and Table 2).
Figure 1. Kaplan-Meier estimates of the primary endpoint of time to cardiovascular death, nonfatal stroke, or nonfatal myocardial infarction in the groups treated with Losartan and atenolol. The Risk Reduction is adjusted for baseline Framingham risk score and level of electrocardiographic left ventricular hypertrophy.
Figure 2. Kaplan-Meier estimates of the time to fatal/nonfatal stroke in the groups treated with Losartan and atenolol. The Risk Reduction is adjusted for baseline Framingham risk score and level of electrocardiographic left ventricular hypertrophy.
- Table 2 shows the results for the primary composite endpoint and the individual endpoints. The primary endpoint was the first occurrence of stroke, myocardial infarction or cardiovascular death, analyzed using an intention-to-treat (ITT) approach. The table shows the number of events for each component in two different ways. The Components of Primary Endpoint (as a first event) counts only the events that define the primary endpoint, while the Secondary Endpoints count all first events of a particular type, whether or not they were preceded by a different type of event.
- Although the LIFE study favored Losartan over atenolol with respect to the primary endpoint (p=0.021), this result is from a single study and, therefore, is less compelling than the difference between Losartan and placebo. Although not measured directly, the difference between Losartan and placebo is compelling because there is evidence that atenolol is itself effective (vs. placebo) in reducing cardiovascular events, including stroke, in hypertensive patients.
- Other clinical endpoints of the LIFE study were: total mortality, hospitalization for heart failure or angina pectoris, coronary or peripheral revascularization procedures, and resuscitated cardiac arrest. There were no significant differences in the rates of these endpoints between the Losartan and atenolol groups.
- For the primary endpoint and stroke, the effects of Losartan in patient subgroups defined by age, gender, race and presence or absence of isolated systolic hypertension (ISH), diabetes, and history of cardiovascular disease (CVD) are shown in Figure 3 below. Subgroup analyses can be difficult to interpret and it is not known whether these represent true differences or chance effects.
## Race
- In the LIFE study, Black patients treated with atenolol were at lower risk of experiencing the primary composite endpoint compared with Black patients treated with Losartan. In the subgroup of Black patients (n=533; 6% of the LIFE study patients), there were 29 primary endpoints among 263 patients on atenolol (11%, 26 per 1000 patient-years) and 46 primary endpoints among 270 patients (17%, 42 per 1000 patient-years) on Losartan. This finding could not be explained on the basis of differences in the populations other than race or on any imbalances between treatment groups. In addition, blood pressure reductions in both treatment groups were consistent between Black and non-Black patients. Given the difficulty in interpreting subset differences in large trials, it cannot be known whether the observed difference is the result of chance. However, the LIFE study provides no evidence that the benefits of Losartan on reducing the risk of cardiovascular events in hypertensive patients with left ventricular hypertrophy apply to Black patients.
## Nephropathy in Type 2 Diabetic Patients
- The Reduction of Endpoints in NIDDM with the Angiotensin II Receptor Antagonist Losartan (RENAAL) study was a randomized, placebo-controlled, double-blind, multicenter study conducted worldwide in 1513 patients with type 2 diabetes with nephropathy (defined as serum creatinine 1.3 to 3.0 mg/dl in females or males ≤60 kg and 1.5 to 3.0 mg/dl in males >60 kg and proteinuria ).
- Patients were randomized to receive Losartan 50 mg once daily or placebo on a background of conventional antihypertensive therapy excluding ACE inhibitors and angiotensin II antagonists. After one month, investigators were instructed to titrate study drug to 100 mg once daily if the trough blood pressure goal (140/90 mmHg) was not achieved. Overall, 72% of patients received the 100-mg daily dose more than 50% of the time they were on study drug. Because the study was designed to achieve equal blood pressure control in both groups, other antihypertensive agents (diuretics, calcium-channel blockers, alpha- or beta-blockers, and centrally acting agents) could be added as needed in both groups. Patients were followed for a mean duration of 3.4 years.
- The study population was diverse with regard to race (Asian 16.7%, Black 15.2%, Hispanic 18.3%, White 48.6%). Overall, 63.2% of the patients were men, and 66.4% were under the age of 65 years. Almost all of the patients (96.6%) had a history of hypertension, and the patients entered the trial with a mean serum creatinine of 1.9 mg/dl and mean proteinuria (urinary albumin/creatinine) of 1808 mg/g at baseline.
- The primary endpoint of the study was the time to first occurrence of any one of the following events: doubling of serum creatinine, end-stage renal disease (ESRD) (need for dialysis or transplantation), or death. Treatment with Losartan resulted in a 16% risk reduction in this endpoint (see Figure 4 and Table 3). Treatment with Losartan also reduced the occurrence of sustained doubling of serum creatinine by 25% and ESRD by 29% as separate endpoints, but had no effect on overall mortality (see Table 3).
- The mean baseline blood pressures were 152/82 mmHg for Losartan plus conventional antihypertensive therapy and 153/82 mmHg for placebo plus conventional antihypertensive therapy. At the end of the study, the mean blood pressures were 143/76 mmHg for the group treated with Losartan and 146/77 mmHg for the group treated with placebo.
Figure 4. Kaplan-Meier curve for the primary composite endpoint of doubling of serum creatinine, end stage renal disease (need for dialysis or transplantation) or death.
- The secondary endpoints of the study were change in proteinuria, change in the rate of progression of renal disease, and the composite of morbidity and mortality from cardiovascular causes (hospitalization for heart failure, myocardial infarction, revascularization, stroke, hospitalization for unstable angina, or cardiovascular death). Compared with placebo, Losartan significantly reduced proteinuria by an average of 34%, an effect that was evident within 3 months of starting therapy, and significantly reduced the rate of decline in glomerular filtration rate during the study by 13%, as measured by the reciprocal of the serum creatinine concentration. There was no significant difference in the incidence of the composite endpoint of cardiovascular morbidity and mortality.
- The favorable effects of Losartan were seen in patients also taking other anti-hypertensive medications (angiotensin II receptor antagonists and angiotensin converting enzyme inhibitors were not allowed), oral hypoglycemic agents and lipid-lowering agents.
- For the primary endpoint and ESRD, the effects of Losartan in patient subgroups defined by age, gender and race are shown in Table 4 below. Subgroup analyses can be difficult to interpret and it is not known whether these represent true differences or chance effects.
## Pharmacokinetics
### General
- Losartan is an orally active agent that undergoes substantial first-pass metabolism by cytochrome P450 enzymes. It is converted, in part, to an active carboxylic acid metabolite that is responsible for most of the angiotensin II receptor antagonism that follows losartan treatment. Losartan metabolites have been identified in human plasma and urine. In addition to the active carboxylic acid metabolite, several inactive metabolites are formed. Following oral and intravenous administration of 14C-labeled losartan potassium, circulating plasma radioactivity is primarily attributed to losartan and its active metabolite. In vitro studies indicate that cytochrome P450 2C9 and 3A4 are involved in the biotransformation of losartan to its metabolites. Minimal conversion of losartan to the active metabolite (less than 1% of the dose compared to 14% of the dose in normal subjects) was seen in about one percent of individuals studied.
- The terminal half-life of losartan is about 2 hours and of the metabolite is about 6-9 hours.
- The pharmacokinetics of losartan and its active metabolite are linear with oral losartan doses up to 200 mg and do not change over time. Neither losartan nor its metabolite accumulate in plasma upon repeated once-daily dosing.
- Following oral administration, losartan is well absorbed (based on absorption of radiolabeled losartan) and undergoes substantial first-pass metabolism; the systemic bioavailability of losartan is approximately 33%. About 14% of an orally-administered dose of losartan is converted to the active metabolite. Mean peak concentrations of losartan and its active metabolite are reached in 1 hour and in 3-4 hours, respectively. While maximum plasma concentrations of losartan and its active metabolite are approximately equal, the AUC of the metabolite is about 4 times as great as that of losartan. A meal slows absorption of losartan and decreases its Cmax but has only minor effects on losartan AUC or on the AUC of the metabolite (about 10% decreased).
- The pharmacokinetics of losartan and its active metabolite were also determined after IV doses of each component separately in healthy volunteers. The volume of distribution of losartan and the active metabolite is about 34 liters and 12 liters, respectively. Total plasma clearance of losartan and the active metabolite is about 600 mL/min and 50 mL/min, respectively, with renal clearance of about 75 mL/min and 25 mL/min, respectively. After single doses of losartan administered orally, about 4% of the dose is excreted unchanged in the urine and about 6% is excreted in urine as active metabolite. Biliary excretion contributes to the elimination of losartan and its metabolites. Following oral 14C-labeled losartan, about 35% of radioactivity is recovered in the urine and about 60% in the feces. Following an intravenous dose of 14C-labeled losartan, about 45% of radioactivity is recovered in the urine and 50% in the feces.
- Both losartan and its active metabolite are highly bound to plasma proteins, primarily albumin, with plasma free fractions of 1.3% and 0.2%, respectively. Plasma protein binding is constant over the concentration range achieved with recommended doses. Studies in rats indicate that losartan crosses the blood-brain barrier poorly, if at all.
### Special Populations
Pediatric: Pharmacokinetic parameters after multiple doses of losartan (average dose 0.7 mg/kg, range 0.36 to 0.97 mg/kg) as a tablet to 25 hypertensive patients aged 6 to 16 years are shown in Table 1 below. Pharmacokinetics of losartan and its active metabolite were generally similar across the studied age groups and similar to historical pharmacokinetic data in adults. The principal pharmacokinetic parameters in adults and children are shown in the table below.
- The bioavailability of the suspension formulation was compared with losartan tablets in healthy adults. The suspension and tablet are similar in their bioavailability with respect to both losartan and the active metabolite.
Geriatric and Gender: Losartan pharmacokinetics have been investigated in the elderly (65-75 years) and in both genders. Plasma concentrations of losartan and its active metabolite are similar in elderly and young hypertensives. Plasma concentrations of losartan were about twice as high in female hypertensives as male hypertensives, but concentrations of the active metabolite were similar in males and females. No dosage adjustment is necessary.
Race: Pharmacokinetic differences due to race have not been studied (see also PRECAUTIONS, Race and CLINICAL PHARMACOLOGY, Pharmacodynamics and Clinical Effects, Reduction in the Risk of Stroke, Race).
Renal Insufficiency: Following oral administration, plasma concentrations and AUCs of losartan and its active metabolite are increased by 50-90% in patients with mild (creatinine clearance of 50 to 74 mL/min) or moderate (creatinine clearance 30 to 49 mL/min) renal insufficiency. In this study, renal clearance was reduced by 55-85% for both losartan and its active metabolite in patients with mild or moderate renal insufficiency. Neither losartan nor its active metabolite can be removed by hemodialysis. No dosage adjustment is necessary for patients with renal impairment unless they are volume-depletion.
Hepatic Insufficiency: Following oral administration in patients with mild to moderate alcoholic cirrhosis of the liver, plasma concentrations of losartan and its active metabolite were, respectively, 5-times and about 1.7-times those in young male volunteers. Compared to normal subjects the total plasma clearance of losartan in patients with hepatic insufficiency was about 50% lower and the oral bioavailability was about 2-times higher. A lower starting dose is recommended for patients with a history of hepatic impairment.
## Nonclinical Toxicology
## Carcinogenesis, Mutagenesis, Impairment of Fertility
- Losartan potassium was not carcinogenic when administered at maximally tolerated dosages to rats and mice for 105 and 92 weeks, respectively. Female rats given the highest dose (270 mg/kg/day) had a slightly higher incidence of pancreatic acinar adenoma. The maximally tolerated dosages (270 mg/kg/day in rats, 200 mg/kg/day in mice) provided systemic exposures for losartan and its pharmacologically active metabolite that were approximately 160- and 90-times (rats) and 30- and 15-times (mice) the exposure of a 50 kg human given 100 mg per day.
- Losartan potassium was negative in the microbial mutagenesis and V-79 mammalian cell mutagenesis assays and in the in vitro alkaline elution and in vitro and in vivochromosomal aberration assays. In addition, the active metabolite showed no evidence of genotoxicity in the microbial mutagenesis, in vitro alkaline elution, and in vitrochromosomal aberration assays.
- Fertility and reproductive performance were not affected in studies with male rats given oral doses of losartan potassium up to approximately 150 mg/kg/day. The administration of toxic dosage levels in females (300/200 mg/kg/day) was associated with a significant (p<0.05) decrease in the number of corpora lutea/female, implants/female, and live fetuses/female at C-section. At 100 mg/kg/day only a decrease in the number of corpora lutea/female was observed. The relationship of these findings to drug-treatment is uncertain since there was no effect at these dosage levels on implants/pregnant female, percent post-implantation loss, or live animals/litter at parturition. In nonpregnant rats dosed at 135 mg/kg/day for 7 days, systemic exposure (AUCs) for losartan and its active metabolite were approximately 66 and 26 times the exposure achieved in man at the maximum recommended human daily dosage (100 mg).
# Clinical Studies
FDA Package Insert for Losartan contains no information regarding Clinical Studies.
# How Supplied
25 mg – Each white, round, biconvex film coated tablets debossed with “11” on one side and plain on other side contains 25 mg of losartan potassium, USP. Tablets are supplied in bottles of 30 (NDC 76439-140-30), 90 (NDC 76439-140-90), 1000 (NDC 76439-140-11), and 10 x 10 (unit-dose tablets) (NDC 76439-140-10).
50 mg – Each white, round, biconvex, film coated tablets debossed with “12” on scoreline side and plain on other side contains 50 mg of losartan potassium, USP. Tablets are supplied in bottles of 30 (NDC 76439-141-30), 90 (NDC 76439-141-90), 1000 (NDC 76439-141-11), and 10 x 10 (unit-dose tablets) (NDC 76439-141-10).
100 mg – Each white, oval, biconvex film coated tablets debossed with “13” on one side and plain on other side contains 100 mg of losartan potassium, USP. Tablets are supplied in bottles of 30 (NDC 76439-142-30), 90 (NDC 76439-142-90), 1000 (NDC 76439-142-11), and 10 x 10 (unit-dose tablets) (NDC 76439-142-10).
## Storage
- Store at 25°C (77°F); excursions permitted to 15-30°C (59-86°F). . Keep container tightly closed. Protect from light.
Dispense in a tight, light-resistant container as defined in USP.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
FDA Package Insert for Losartan contains no information regarding Patient Counseling Information.
# Precautions with Alcohol
Alcohol-Losartan interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
Cozaar
# Look-Alike Drug Names
Losartan - Solace
Losartan - Zocor
# Drug Shortage Status
# Price | Losartan
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Sheng Shi, M.D. [2], Rabin Bista, M.B.B.S. [3]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Losartan is an Angiotensin 2 Receptor Blocker that is FDA approved for the treatment of hypertension, hypertensive patients with left ventricular hypertrophy, nephropathy in type 2 diabetic patients. There is a Black Box Warning for this drug as shown here. Common adverse reactions include chest pain, hypotension, endocrine metabolic, hyperkalemia, hypoglycemia, diarrhea, anemia, asthenia, dizziness, cough, fatigue.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Hypertension
- Dosing information
- Losartan potassium may be administered with other antihypertensive agents, and with or without food.
- Dosing must be individualized.
- Usual starting dosage: 50 mg PO qd‘’‘,
- With 25 mg used in patients with possible depletion of intravascular volume (e.g., patients treated with diuretics) and patients with a history of hepatic impairment.
- Dosage range: 25 mg-100 mg PO qd or bid
- If the antihypertensive effect measured at trough using once-a-day dosing is inadequate, a twice-a-day regimen at the same total daily dose or an increase in dose may give a more satisfactory response. The effect of losartan is substantially present within one week but in some studies the maximal effect occurred in 3 to 6 weeks.
- If blood pressure is not controlled by losartan potassium alone, a low dose of a diuretic may be added. Hydrochlorothiazide has been shown to have an additive effect.
- No initial dosage adjustment is necessary for elderly patients or for patients with renal impairment, including patients on dialysis.
Pediatric Hypertensive Patients ≥ 6 years of age
- The usual recommended starting dose is 0.7 mg/kg once daily (up to 50 mg total) administered as a tablet or a suspension. Dosage should be adjusted according to blood pressure response. Doses above 1.4 mg/kg (or in excess of 100 mg) daily have not been studied in pediatric patients.
- Losartan potassium is not recommended in pediatric patients <6 years of age or in pediatric patients with glomerular filtration rate <30 mL/min/1.73 m2.
### Hypertensive Patients with Left Ventricular Hypertrophy
- Dosing information
- Usual starting dosage: 50 mg PO qd.
- Hydrochlorothiazide 12.5 mg PO qd’‘’ should be added and/or the dose of losartan potassium should be increased to ‘’‘100 mg once daily’‘’ followed by an increase in hydrochlorothiazide to 25 mg once daily based on blood pressure response.
### Nephropathy in Type 2 Diabetic Patients
- Dosing information
- Usual starting dosage: 50 mg PO qd.
- The dose should be increased to 100 mg PO qd based on blood pressure response.
- Losartan potassium may be administered with insulin and other commonly used hypoglycemic agents (e.g., sulfonylureas, glitazones and glucosidase inhibitors).
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
### Stage B Heart Failure
- Developed by: American College of Cardiology Foundation (ACCF) and American Heart Association (AHA)
- Class of Recommendation: Class I
- Level of Evidence: Level A
- Dosing Information
- Not applicable
### Non–Guideline-Supported Use
### Prophylaxis of Diabetes mellitus
- Dosing information
- 50 mg PO qd[1]
### Diabetic nephropathy, In Type 1 Diabetes
- Dosing information
- 100 mg PO qd[2]
### Erectile dysfunction
- Dosing information
- initiated at 50 mg/day; the dose was titrated to 100 mg/day after 4 weeks[3]
### Erythrocytosis
- Dosing information
- 25 mg/day 9017632
- 50 mg daily for 12 weeks[4]
- 100 mg/day[5]
### Gout
- Dosing information
- Not applicable [6]
### Hyperuricemia
- Dosing information
- 50 mg/day[7]
### IgA nephropathy
- Dosing information
- 200 mg/day [8]
- 50 mg/day [9]
### Impaired cognition
- Dosing information
- 50 mg/day[10]
### Nondiabetic Kidney disease
- Dosing information
- 50 mg/day [11],[12]
### Prophylaxis of Paroxysmal atrial fibrillation
- Dosing information
- 50 mg/day[13]
### Raised intraocular pressure
- Dosing information
- 50 mg/day[14]
### Isolated Systolic hypertension
- Dosing information
- 50 mg PO qd[15]
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
### Hypertension (Patients ≥ 6 years of age)
- Dosing information
- Usual recommended starting dosage: 0.7 mg/kg PO qd (up to 50 mg total) administered as a tablet or a suspension (see Preparation of Suspension).
- Dosage should be adjusted according to blood pressure response.
- Doses above 1.4 mg/kg (or in excess of 100 mg) daily have not been studied in pediatric patients.
- Losartan potassium is not recommended in pediatric patients <6 years of age or in pediatric patients with glomerular filtration rate <30 mL/min/1.73 m2.
### Preparation of Suspension (for 200 mL of a 2.5 mg/mL suspension)
- Add 10 mL of Purified Water USP to an 8 ounce (240 mL) amber polyethylene terephthalate (PET) bottle containing ten 50 mg losartan potassium tablets. Immediately shake for at least 2 minutes. Let the concentrate stand for 1 hour and then shake for 1 minute to disperse the tablet contents. Separately prepare a 50/50 volumetric mixture of Ora-Plus™ and Ora-Sweet SF™. Add 190 mL of the 50/50 Ora-Plus™/Ora-Sweet SF™ mixture to the tablet and water slurry in the PET bottle and shake for 1 minute to disperse the ingredients. The suspension should be refrigerated at 2 to 8°C (36 to 46°F) and can be stored for up to 4 weeks. Shake the suspension prior to each use and return promptly to the refrigerator.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Losartan in pediatric patients.
### Non–Guideline-Supported Use
### Alport syndrome
- Dosing information
- Maximum dosage: 50 mg/day if weight under 50 kg;
- Maximum dosage: 100 mg/day if weight 50 kg or more [16]
### Nondiabetic Kidney disease
- Dosing information
- 0.8 mg/kg daily[17]
# Contraindications
Losartan is contraindicated in patients who are hypersensitive to any component of this product.
Do not co-administer aliskiren with Losartan in patients with diabetes.
# Warnings
### Fetal Toxicity
### Pregnancy Category D
- Use of drugs that act on the renin-angiotensin system during the second and third trimesters of pregnancy reduces renal function and increases fetal and neonatal morbidity and death. Resulting oligohydramnios can be associated with fetal lung hypoplasia and skeletal deformations. Potential neonatal adverse effects include skull hypoplasia, anuria, hypotension, renal failure, and death. When pregnancy is detected,discontinue Losartan as soon as possible. These adverse outcomes are usually associated with the use of these drugs in the second and third trimester of pregnancy. Most epidemiologic studies examining fetal abnormalities after exposure to antihypertensive use in the first trimester have not distinguished drugs affecting the renin-angiotensin system from other antihypertensive agents. Appropriate management of maternal hypertension during pregnancy is important to optimize outcomes for both mother and fetus.
- In the unusual case that there is no appropriate alternative to therapy with drugs affecting the renin-angiotensin system for a particular patient, apprise the mother of the potential risk to the fetus. Perform serial ultrasound examinations to assess the intra-amniotic environment.
- If oligohydramnios is observed, discontinue Losartan, unless it is considered life-saving for the mother. Fetal testing may be appropriate, based on the week of pregnancy. Patients and physicians should be aware, however, that oligohydramnios may not appear until after the fetus has sustained irreversible injury.
- Closely observe infants with histories of in utero exposure to Losartan for hypotension, oliguria, and hyperkalemia.
- Losartan potassium has been shown to produce adverse effects in rat fetuses and neonates, including decreased body weight, delayed physical and behavioral development, mortality and renal toxicity. With the exception of neonatal weight gain (which was affected at doses as low as 10 mg/kg/day), doses associated with these effects exceeded 25 mg/kg/day (approximately three times the maximum recommended human dose of 100 mg on a mg/m2 basis). These findings are attributed to drug exposure in late gestation and during lactation. Significant levels of losartan and its active metabolite were shown to be present in rat fetal plasma during late gestation and in rat milk.
### Hypotension — Volume-Depleted Patients
- In patients who are intravascularly volume-depleted (e.g., those treated with diuretics), symptomatic hypotension may occur after initiation of therapy with Losartan. These conditions should be corrected prior to administration of Losartan, or a lower starting dose should be used.
## PRECAUTIONS
### General
Hypersensitivity: Angioedema. See ADVERSE REACTIONS, Postmarketing Experience.
### Impaired Hepatic Function
- Based on pharmacokinetic data which demonstrate significantly increased plasma concentrations of losartan in cirrhotic patients, a lower dose should be considered for patients with impaired liver function (see DOSAGE AND ADMINISTRATION and CLINICAL PHARMACOLOGY, Pharmacokinetics).
### Impaired Renal Function
- As a consequence of inhibiting the renin-angiotensin-aldosterone system, changes in renal function have been reported in susceptible individuals treated with Losartan; in some patients, these changes in renal function were reversible upon discontinuation of therapy.
- In patients whose renal function may depend on the activity of the renin-angiotensin-aldosterone system (e.g., patients with severe congestive heart failure), treatment with angiotensin converting enzyme inhibitors has been associated with oliguria and/or progressive azotemia and (rarely) with acute renal failure and/or death. Similar outcomes have been reported with Losartan.
- In studies of ACE inhibitors in patients with unilateral or bilateral renal artery stenosis, increases in serum creatinine or blood urea nitrogen (BUN) have been reported. Similar effects have been reported with Losartan; in some patients, these effects were reversible upon discontinuation of therapy.
### Electrolyte Imbalance
- Electrolyte imbalances are common in patients with renal impairment, with or without diabetes, and should be addressed. In a clinical study conducted in type 2 diabetic patients with proteinuria, the incidence of hyperkalemia was higher in the group treated with Losartan as compared to the placebo group; however, few patients discontinued therapy due to hyperkalemia
# Adverse Reactions
## Clinical Trials Experience
## Hypertension
- Losartan has been evaluated for safety in more than 3300 adult patients treated for essential hypertension and 4058 patients/subjects overall. Over 1200 patients were treated for over 6 months and more than 800 for over one year. In general, treatment with Losartan was well-tolerated. The overall incidence of adverse experiences reported with Losartan was similar to placebo.
- In controlled clinical trials, discontinuation of therapy due to clinical adverse experiences was required in 2.3 percent of patients treated with Losartan and 3.7 percent of patients given placebo.
- The following table of adverse events is based on four 6- to 12-week, placebo-controlled trials involving over 1000 patients on various doses (10-150 mg) of losartan and over 300 patients given placebo. All doses of losartan are grouped because none of the adverse events appeared to have a dose-related frequency. The adverse experiences reported in ≥1% of patients treated with Losartan and more commonly than placebo are shown in the table below.
- The following adverse events were also reported at a rate of 1% or greater in patients treated with losartan, but were as, or more frequent, in the placebo group: asthenia/fatigue, edema/swelling, abdominal pain, chest pain, nausea, headache, pharyngitis, diarrhea, dyspepsia, myalgia, insomnia, cough, sinus disorder.
- Adverse events occurred at about the same rates in men and women, older and younger patients, and Black and non-Black patients.
- A patient with known hypersensitivity to aspirin and penicillin, when treated with Losartan, was withdrawn from study due to swelling of the lips and eyelids and facial rash, reported as angioedema, which returned to normal 5 days after therapy was discontinued.
- Superficial peeling of palms and hemolysis were reported in one subject.
- In addition to the adverse events above, potentially important events that occurred in at least two patients/subjects exposed to losartan or other adverse events that occurred in <1% of patients in clinical studies are listed below. It cannot be determined whether these events were causally related to losartan: Body as a Whole: facial edema, fever, orthostatic effects, syncope; Cardiovascular: angina pectoris, second degree AV block, CVA, hypotension, myocardial infarction, arrhythmias including atrial fibrillation, palpitation, sinus bradycardia, tachycardia, ventricular tachycardia, ventricular fibrillation; Digestive: anorexia, constipation, dental pain, dry mouth, flatulence, gastritis, vomiting; Hematologic: anemia; Metabolic: gout; Musculoskeletal: arm pain, hip pain, joint swelling, knee pain, musculoskeletal pain, shoulder pain, stiffness, arthralgia, arthritis, fibromyalgia, muscle weakness; NervousSystem/Psychiatric: anxiety, anxiety disorder, ataxia, confusion, depression, dream abnormality, hypesthesia, decreased libido, memory impairment, migraine, nervousness, paresthesia, peripheral neuropathy, panic disorder, sleep disorder, somnolence, tremor, vertigo; Respiratory: dyspnea, bronchitis, pharyngeal discomfort, epistaxis, rhinitis, respiratory congestion; Skin: alopecia, dermatitis, dry skin, ecchymosis, erythema, flushing, photosensitivity, pruritus, rash, sweating, urticaria; Special Senses: blurred vision, burning/stinging in the eye, conjunctivitis, taste perversion, tinnitus, decrease in visual acuity; Urogenital: impotence, nocturia, urinary frequency, urinary tract infection.
- Persistent dry cough (with an incidence of a few percent) has been associated with ACE-inhibitor use and in practice can be a cause of discontinuation of ACE-inhibitor therapy. Two prospective, parallel-group, double-blind, randomized, controlled trials were conducted to assess the effects of losartan on the incidence of cough in hypertensive patients who had experienced cough while receiving ACE-inhibitor therapy. Patients who had typical ACE-inhibitor cough when challenged with lisinopril, whose cough disappeared on placebo, were randomized to losartan 50 mg, lisinopril 20 mg, or either placebo (one study, n=97) or 25 mg hydrochlorothiazide (n=135). The double-blind treatment period lasted up to 8 weeks. The incidence of cough is shown below.
- These studies demonstrate that the incidence of cough associated with losartan therapy, in a population that all had cough associated with ACE-inhibitor therapy, is similar to that associated with hydrochlorothiazide or placebo therapy.
- Cases of cough, including positive re-challenges, have been reported with the use of losartan in postmarketing experience.
- Pediatric Patients: No relevant differences between the adverse experience profile for pediatric patients and that previously reported for adult patients were identified.
- In the LIFE study, adverse events with Losartan were similar to those reported previously for patients with hypertension.
### Nephropathy in Type 2 Diabetic Patients
- In the RENAAL study involving 1513 patients treated with Losartan or placebo, the overall incidences of reported adverse experiences were similar for the two groups. Losartan was generally well tolerated as evidenced by a similar incidence of discontinuations due to side effects compared to placebo (19% for Losartan, 24% for placebo). The adverse experiences, regardless of drug relationship, reported with an incidence of ≥4% of patients treated with Losartan and occurring more commonly than placebo, on a background of conventional antihypertensive therapy, are shown in the table below.
## Postmarketing Experience
The following additional adverse reactions have been reported in postmarketing experience:
Digestive: Hepatitis (reported rarely).
General Disorders and Administration Site Conditions: Malaise.
Hemic:Thrombocytopenia (reported rarely).
Hypersensitivity: Angioedema, including swelling of the larynx and glottis, causing airway obstruction and/or swelling of the face, lips, pharynx, and/or tongue has been reported rarely in patients treated with losartan; some of these patients previously experienced angioedema with other drugs including ACE inhibitors. Vasculitis, including Henoch-Schönlein purpura, has been reported. Anaphylactic reactions have been reported.
Metabolic and Nutrition: Hyperkalemia, hyponatremia have been reported with losartan.
Musculoskeletal: Rare cases of rhabdomyolysis have been reported in patients receiving angiotensin II receptor blockers.
Nervous system disorders: Dysgeusia.
Respiratory: Dry cough.
Skin: Erythroderma.
### Laboratory Test Findings
- In controlled clinical trials, clinically important changes in standard laboratory parameters were rarely associated with administration of Losartan.
Creatinine, Blood Urea Nitrogen: Minor increases in blood urea nitrogen (BUN) or serum creatinine were observed in less than 0.1 percent of patients with essential hypertensiontreated with Losartan alone.
Hemoglobin and Hematocrit: Small decreases in hemoglobin and hematocrit (mean decreases of approximately 0.11 grams percent and 0.09 volume percent, respectively) occurred frequently in patients treated with Losartan alone, but were rarely of clinical importance. No patients were discontinued due to anemia.
Liver Function Tests: Occasional elevations of liver enzymes and/or serum bilirubin have occurred. In patients with essential hypertension treated with Losartan alone, one patient (<0.1%) was discontinued due to these laboratory adverse experiences.
# Drug Interactions
- Losartan, administered for 12 days, did not affect the pharmacokinetics or pharmacodynamics of a single dose of warfarin. Losartan did not affect the pharmacokinetics of oral or intravenous digoxin. There is no pharmacokinetic interaction between losartan and hydrochlorothiazide. Coadministration of losartan and cimetidine led to an increase of about 18% in AUC of losartan but did not affect the pharmacokinetics of its active metabolite. Coadministration of losartan and phenobarbital led to a reduction of about 20% in the AUC of losartan and that of its active metabolite. A somewhat greater interaction (approximately 40% reduction in the AUC of active metabolite and approximately 30% reduction in the AUC of losartan) has been reported with rifampin. Fluconazole, an inhibitor of cytochrome P450 2C9, decreased the AUC of the active metabolite by approximately 40%, but increased the AUC of losartan by approximately 70% following multiple doses. Conversion of losartan to its active metabolite after intravenous administration is not affected by ketoconazole, an inhibitor of P450 3A4. The AUC of active metabolite following oral losartan was not affected by erythromycin, another inhibitor of P450 3A4, but the AUC of losartan was increased by 30%.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): D
- Use of drugs that act on the renin-angiotensin system during the second and third trimesters of pregnancy reduces renal function and increases fetal and neonatal morbidity and death. Resulting oligohydramnios can be associated with fetal lung hypoplasia and skeletal deformations. Potential neonatal adverse effects include skull hypoplasia, anuria, hypotension, renal failure, and death. When pregnancy is detected, discontinue losartan potassium tablets as soon as possible. These adverse outcomes are usually associated with the use of these drugs in the second and third trimester of pregnancy. Most epidemiologic studies examining fetal abnormalities after exposure to antihypertensive use in the first trimester have not distinguished drugs affecting the renin-angiotensin system from other antihypertensive agents. Appropriate management of maternal hypertension during pregnancy is important to optimize outcomes for both mother and fetus.
- In the unusual case that there is no appropriate alternative to therapy with drugs affecting the renin-angiotensin system for a particular patient, apprise the mother of the potential risk to the fetus. Perform serial ultrasound examinations to assess the intra-amniotic environment.
- If oligohydramnios is observed, discontinue losartan potassium tablets, unless it is considered life-saving for the mother. Fetal testing may be appropriate, based on the week of pregnancy. Patients and physicians should be aware, however, that oligohydramnios may not appear until after the fetus has sustained irreversible injury.
- Closely observe infants with histories of in utero exposure to losartan potassium for hypotension, oliguria, and hyperkalemia.
- Losartan potassium has been shown to produce adverse effects in rat fetuses and neonates, including decreased body weight, delayed physical and behavioral development, mortality and renal toxicity. With the exception of neonatal weight gain (which was affected at doses as low as 10 mg/kg/day), doses associated with these effects exceeded 25 mg/kg/day (approximately three times the maximum recommended human dose of 100 mg on a mg/m2 basis). These findings are attributed to drug exposure in late gestation and during lactation. Significant levels of losartan and its active metabolite were shown to be present in rat fetal plasma during late gestation and in rat milk.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Losartan in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Losartan during labor and delivery.
### Nursing Mothers
- It is not known whether losartan is excreted in human milk, but significant levels of losartan and its active metabolite were shown to be present in rat milk. Because of the potential for adverse effects on the nursing infant, a decision should be made whether to discontinue nursing or discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
- Neonates with a history of in utero exposure to Losartan
- If oliguria or hypotension occurs, direct attention toward support of blood pressure and renal perfusion. Exchange transfusions or dialysis may be required as a means of reversing hypotension and/or substituting for disordered renal function.
- Antihypertensive effects of Losartan have been established in hypertensive pediatric patients aged 6 to 16 years. There are no data on the effect of Losartan on blood pressure in pediatric patients under the age of 6 or in pediatric patients with glomerular filtration rate <30 mL/min/1.73 m2.
### Geriatic Use
- Of the total number of patients receiving Losartan in controlled clinical studies for hypertension, 391 patients (19%) were 65 years and over, while 37 patients (2%) were 75 years and over. In a controlled clinical study for renal protection in type 2 diabetic patients with proteinuria, 248 patients (33%) were 65 years and over. In a controlled clinical study for the reduction in the combined risk of cardiovascular death, stroke and myocardial infarction in hypertensive patients with left ventricular hypertrophy, 2857 patients (62%) were 65 years and over, while 808 patients (18%) were 75 years and over. No overall differences in effectiveness or safety were observed between these patients and younger patients, but greater sensitivity of some older individuals cannot be ruled out.
### Gender
There is no FDA guidance on the use of Losartan with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Losartan with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Losartan in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Losartan in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Losartan in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Losartan in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
FDA Package Insert for Losartan contains no information regarding drug monitoring.
# IV Compatibility
There is limited information about the IV Compatibility.
# Overdosage
- Significant lethality was observed in mice and rats after oral administration of 1000 mg/kg and 2000 mg/kg, respectively, about 44 and 170 times the maximum recommended human dose on a mg/m2 basis.
- Limited data are available in regard to overdosage in humans. The most likely manifestation of overdosage would be hypotension and tachycardia; bradycardia could occur from parasympathetic (vagal) stimulation. If symptomatic hypotension should occur, supportive treatment should be instituted.
- Neither losartan nor its active metabolite can be removed by hemodialysis.
# Pharmacology
## Mechanism of Action
- Angiotensin II [formed from angiotensin I in a reaction catalyzed by angiotensin converting enzyme (ACE, kininase II)], is a potent vasoconstrictor, the primary vasoactive hormone of the renin-angiotensin system and an important component in the pathophysiology of hypertension. It also stimulates aldosterone secretion by the adrenal cortex. Losartan and its principal active metabolite block the vasoconstrictor and aldosterone-secreting effects of Angiotensin II by selectively blocking the binding of Angiotensin II to the AT1 receptor found in many tissues, (e.g., vascular smooth muscle, adrenal gland). There is also an AT2 receptor found in many tissues but it is not known to be associated with cardiovascular homeostasis. Both losartan and its principal active metabolite do not exhibit any partial agonist activity at the AT1 receptor and have much greater affinity (about 1000 fold) for the AT1 receptor than for the AT2 receptor. In vitro binding studies indicate that losartan is a reversible, competitive inhibitor of the AT1 receptor. The active metabolite is 10 to 40 times more potent by weight than losartan and appears to be a reversible, non-competitive inhibitor of the AT1 receptor.
Neither losartan nor its active metabolite inhibits ACE (kininase II, the enzyme that converts angiotensin I to Angiotensin II and degrades bradykinin); nor do they bind to or block other hormone receptors or ion channels known to be important in cardiovascular regulation.
## Structure
- Losartan (losartan potassium) is an angiotensin II receptor (type AT1) antagonist. Losartan potassium, a non-peptide molecule, is chemically described as 2-butyl-4-chloro-1-[p-(o-1H-tetrazol-5-ylphenyl)benzyl]imidazole-5-methanol monopotassium salt.
- Its empirical formula is C22H22ClKN6O, and its structural formula is:
- Losartan potassium is a white to off-white free-flowing crystalline powder with a molecular weight of 461.01. It is freely soluble in water, soluble in alcohols, and slightly soluble in common organic solvents, such as acetonitrile and methyl ethyl ketone. Oxidation of the 5-hydroxymethyl group on the imidazole ring results in the active metabolite of losartan.
## Pharmacodynamics
## Adult Hypertension
- Losartan inhibits the pressor effect of angiotensin II (as well as angiotensin I) infusions. A dose of 100 mg inhibits the pressor effect by about 85% at peak with 25-40% inhibition persisting for 24 hours. Removal of the negative feedback of angiotensin II causes a 2- to 3-fold rise in plasma renin activity and consequent rise in angiotensin II plasma concentration in hypertensive patients. Losartan does not affect the response to bradykinin, whereas ACE inhibitors increase the response to bradykinin. Aldosterone plasma concentrations fall following losartan administration. In spite of the effect of losartan on aldosterone secretion, very little effect on serum potassium was observed.
- In a single-dose study in normal volunteers, losartan had no effects on glomerular filtration rate, renal plasma flow or filtration fraction. In multiple-dose studies in hypertensive patients, there were no notable effects on systemic or renal prostaglandin concentrations, fasting triglycerides, total cholesterol or HDL-cholesterol or fasting glucose concentrations. There was a small uricosuric effect leading to a minimal decrease in serum uric acid (mean decrease <0.4 mg/dL) during chronic oral administration.
- The antihypertensive effects of Losartan were demonstrated principally in 4 placebo-controlled, 6- to 12-week trials of dosages from 10 to 150 mg per day in patients with baseline diastolic blood pressures of 95-115. The studies allowed comparisons of two doses (50-100 mg/day) as once-daily or twice-daily regimens, comparisons of peak and trough effects, and comparisons of response by gender, age, and race. Three additional studies examined the antihypertensive effects of losartan and hydrochlorothiazide in combination.
- The 4 studies of losartan monotherapy included a total of 1075 patients randomized to several doses of losartan and 334 to placebo. The 10- and 25-mg doses produced some effect at peak (6 hours after dosing) but small and inconsistent trough (24 hour) responses. Doses of 50, 100 and 150 mg once daily gave statistically significant systolic/diastolic mean decreases in blood pressure, compared to placebo in the range of 5.5-10.5/3.5-7.5 mmHg, with the 150-mg dose giving no greater effect than 50-100 mg. Twice-daily dosing at 50-100 mg/day gave consistently larger trough responses than once-daily dosing at the same total dose. Peak (6 hour) effects were uniformly, but moderately, larger than trough effects, with the trough-to-peak ratio for systolic and diastolic responses 50-95% and 60-90%, respectively.
- Addition of a low dose of hydrochlorothiazide (12.5 mg) to losartan 50 mg once daily resulted in placebo-adjusted blood pressure reductions of 15.5/9.2 mmHg.
- Analysis of age, gender, and race subgroups of patients showed that men and women, and patients over and under 65, had generally similar responses. Losartan was effective in reducing blood pressure regardless of race, although the effect was somewhat less in Black patients (usually a low-renin population).
- The effect of losartan is substantially present within one week but in some studies the maximal effect occurred in 3-6 weeks. In long-term follow-up studies (without placebo control) the effect of losartan appeared to be maintained for up to a year. There is no apparent rebound effect after abrupt withdrawal of losartan. There was essentially no change in average heart rate in losartan-treated patients in controlled trials.
## Pediatric Hypertension
- The antihypertensive effect of losartan was studied in one trial enrolling 177 hypertensive pediatric patients aged 6 to 16 years old. Children who weighed <50 kg received 2.5, 25 or 50 mg of losartan daily and patients who weighed ≥50 kg received 5, 50 or 100 mg of losartan daily. Children in the lowest dose group were given losartan in a suspension formulation. The majority of the children had hypertension associated with renal and urogenital disease. The sitting diastolic blood pressure (SiDBP) on entry into the study was higher than the 95th percentile level for the patient's age, gender, and height. At the end of three weeks, losartan reduced systolic and diastolic blood pressure, measured at trough, in a dose-dependent manner. Overall, the two higher doses (25 to 50 mg in patients <50 kg; 50 to 100 mg in patients ≥50 kg) reduced diastolic blood pressure by 5 to 6 mmHg more than the lowest dose used (2.5 mg in patients <50 kg; 5 mg in patients ≥50 kg). The lowest dose, corresponding to an average daily dose of 0.07 mg/kg, did not appear to offer consistent antihypertensive efficacy. When patients were randomized to continue losartan at the two higher doses or to placebo after 3 weeks of therapy, trough diastolic blood pressure rose in patients on placebo between 5 and 7 mmHg more than patients randomized to continuing losartan. When the low dose of losartan was randomly withdrawn, the rise in trough diastolic blood pressure was the same in patients receiving placebo and in those continuing losartan, again suggesting that the lowest dose did not have significant antihypertensive efficacy. Overall, no significant differences in the overall antihypertensive effect of losartan were detected when the patients were analyzed according to age (<, ≥12 years old) or gender. While blood pressure was reduced in all racial subgroups examined, too few non-White patients were enrolled to compare the dose-response of losartan in the non-White subgroup.
## Reduction in the Risk of Stroke
- The Losartan Intervention For Endpoint reduction in hypertension (LIFE) study was a multinational, double-blind study comparing Losartan and atenolol in 9193 hypertensive patients with ECG-documented left ventricular hypertrophy. Patients with myocardial infarction or stroke within six months prior to randomization were excluded. Patients were randomized to receive once daily Losartan 50 mg or atenolol 50 mg. If goal blood pressure (<140/90 mmHg) was not reached, hydrochlorothiazide (12.5 mg) was added first and, if needed, the dose of Losartan or atenolol was then increased to 100 mg once daily. If necessary, other antihypertensive treatments (e.g., increase in dose of hydrochlorothiazide therapy to 25 mg or addition of other diuretic therapy, calcium-channel blockers, alpha-blockers, or centrally acting agents, but not ACE inhibitors, angiotensin II antagonists, or beta-blockers) were added to the treatment regimen to reach the goal blood pressure.
- Of the randomized patients, 4963 (54%) were female and 533 (6%) were Black. The mean age was 67 with 5704 (62%) age ≥65. At baseline, 1195 (13%) had diabetes, 1326 (14%) had isolated systolic hypertension, 1469 (16%) had coronary heart disease, and 728 (8%) had cerebrovascular disease. Baseline mean blood pressure was 174/98 mmHg in both treatment groups. The mean length of follow-up was 4.8 years. At the end of study or at the last visit before a primary endpoint, 77% of the group treated with Losartan and 73% of the group treated with atenolol were still taking study medication. Of the patients still taking study medication, the mean doses of Losartan and atenolol were both about 80 mg/day, and 15% were taking atenolol or losartan as monotherapy, while 77% were also receiving hydrochlorothiazide (at a mean dose of 20 mg/day in each group). Blood pressure reduction measured at trough was similar for both treatment groups but blood pressure was not measured at any other time of the day. At the end of study or at the last visit before a primary endpoint, the mean blood pressures were 144.1/81.3 mmHg for the group treated with Losartan and 145.4/80.9 mmHg for the group treated with atenolol [the difference in systolic blood pressure (SBP) of 1.3 mmHg was significant (p<0.001), while the difference of 0.4 mmHg in diastolic blood pressure (DBP) was not significant (p=0.098)].
- The primary endpoint was the first occurrence of cardiovascular death, nonfatal stroke, or nonfatal myocardial infarction. Patients with nonfatal events remained in the trial, so that there was also an examination of the first event of each type even if it was not the first event (e.g., a stroke following an initial myocardial infarction would be counted in the analysis of stroke). Treatment with Losartan resulted in a 13% reduction (p=0.021) in risk of the primary endpoint compared to the atenolol group (see Figure 1 and Table 2); this difference was primarily the result of an effect on fatal and nonfatal stroke. Treatment with Losartan reduced the risk of stroke by 25% relative to atenolol (p=0.001) (see Figure 2 and Table 2).
Figure 1. Kaplan-Meier estimates of the primary endpoint of time to cardiovascular death, nonfatal stroke, or nonfatal myocardial infarction in the groups treated with Losartan and atenolol. The Risk Reduction is adjusted for baseline Framingham risk score and level of electrocardiographic left ventricular hypertrophy.
Figure 2. Kaplan-Meier estimates of the time to fatal/nonfatal stroke in the groups treated with Losartan and atenolol. The Risk Reduction is adjusted for baseline Framingham risk score and level of electrocardiographic left ventricular hypertrophy.
- Table 2 shows the results for the primary composite endpoint and the individual endpoints. The primary endpoint was the first occurrence of stroke, myocardial infarction or cardiovascular death, analyzed using an intention-to-treat (ITT) approach. The table shows the number of events for each component in two different ways. The Components of Primary Endpoint (as a first event) counts only the events that define the primary endpoint, while the Secondary Endpoints count all first events of a particular type, whether or not they were preceded by a different type of event.
- Although the LIFE study favored Losartan over atenolol with respect to the primary endpoint (p=0.021), this result is from a single study and, therefore, is less compelling than the difference between Losartan and placebo. Although not measured directly, the difference between Losartan and placebo is compelling because there is evidence that atenolol is itself effective (vs. placebo) in reducing cardiovascular events, including stroke, in hypertensive patients.
- Other clinical endpoints of the LIFE study were: total mortality, hospitalization for heart failure or angina pectoris, coronary or peripheral revascularization procedures, and resuscitated cardiac arrest. There were no significant differences in the rates of these endpoints between the Losartan and atenolol groups.
- For the primary endpoint and stroke, the effects of Losartan in patient subgroups defined by age, gender, race and presence or absence of isolated systolic hypertension (ISH), diabetes, and history of cardiovascular disease (CVD) are shown in Figure 3 below. Subgroup analyses can be difficult to interpret and it is not known whether these represent true differences or chance effects.
## Race
- In the LIFE study, Black patients treated with atenolol were at lower risk of experiencing the primary composite endpoint compared with Black patients treated with Losartan. In the subgroup of Black patients (n=533; 6% of the LIFE study patients), there were 29 primary endpoints among 263 patients on atenolol (11%, 26 per 1000 patient-years) and 46 primary endpoints among 270 patients (17%, 42 per 1000 patient-years) on Losartan. This finding could not be explained on the basis of differences in the populations other than race or on any imbalances between treatment groups. In addition, blood pressure reductions in both treatment groups were consistent between Black and non-Black patients. Given the difficulty in interpreting subset differences in large trials, it cannot be known whether the observed difference is the result of chance. However, the LIFE study provides no evidence that the benefits of Losartan on reducing the risk of cardiovascular events in hypertensive patients with left ventricular hypertrophy apply to Black patients.
## Nephropathy in Type 2 Diabetic Patients
- The Reduction of Endpoints in NIDDM with the Angiotensin II Receptor Antagonist Losartan (RENAAL) study was a randomized, placebo-controlled, double-blind, multicenter study conducted worldwide in 1513 patients with type 2 diabetes with nephropathy (defined as serum creatinine 1.3 to 3.0 mg/dl in females or males ≤60 kg and 1.5 to 3.0 mg/dl in males >60 kg and proteinuria [urinary albumin to creatinine ratio ≥300 mg/g]).
- Patients were randomized to receive Losartan 50 mg once daily or placebo on a background of conventional antihypertensive therapy excluding ACE inhibitors and angiotensin II antagonists. After one month, investigators were instructed to titrate study drug to 100 mg once daily if the trough blood pressure goal (140/90 mmHg) was not achieved. Overall, 72% of patients received the 100-mg daily dose more than 50% of the time they were on study drug. Because the study was designed to achieve equal blood pressure control in both groups, other antihypertensive agents (diuretics, calcium-channel blockers, alpha- or beta-blockers, and centrally acting agents) could be added as needed in both groups. Patients were followed for a mean duration of 3.4 years.
- The study population was diverse with regard to race (Asian 16.7%, Black 15.2%, Hispanic 18.3%, White 48.6%). Overall, 63.2% of the patients were men, and 66.4% were under the age of 65 years. Almost all of the patients (96.6%) had a history of hypertension, and the patients entered the trial with a mean serum creatinine of 1.9 mg/dl and mean proteinuria (urinary albumin/creatinine) of 1808 mg/g at baseline.
- The primary endpoint of the study was the time to first occurrence of any one of the following events: doubling of serum creatinine, end-stage renal disease (ESRD) (need for dialysis or transplantation), or death. Treatment with Losartan resulted in a 16% risk reduction in this endpoint (see Figure 4 and Table 3). Treatment with Losartan also reduced the occurrence of sustained doubling of serum creatinine by 25% and ESRD by 29% as separate endpoints, but had no effect on overall mortality (see Table 3).
- The mean baseline blood pressures were 152/82 mmHg for Losartan plus conventional antihypertensive therapy and 153/82 mmHg for placebo plus conventional antihypertensive therapy. At the end of the study, the mean blood pressures were 143/76 mmHg for the group treated with Losartan and 146/77 mmHg for the group treated with placebo.
Figure 4. Kaplan-Meier curve for the primary composite endpoint of doubling of serum creatinine, end stage renal disease (need for dialysis or transplantation) or death.
- The secondary endpoints of the study were change in proteinuria, change in the rate of progression of renal disease, and the composite of morbidity and mortality from cardiovascular causes (hospitalization for heart failure, myocardial infarction, revascularization, stroke, hospitalization for unstable angina, or cardiovascular death). Compared with placebo, Losartan significantly reduced proteinuria by an average of 34%, an effect that was evident within 3 months of starting therapy, and significantly reduced the rate of decline in glomerular filtration rate during the study by 13%, as measured by the reciprocal of the serum creatinine concentration. There was no significant difference in the incidence of the composite endpoint of cardiovascular morbidity and mortality.
- The favorable effects of Losartan were seen in patients also taking other anti-hypertensive medications (angiotensin II receptor antagonists and angiotensin converting enzyme inhibitors were not allowed), oral hypoglycemic agents and lipid-lowering agents.
- For the primary endpoint and ESRD, the effects of Losartan in patient subgroups defined by age, gender and race are shown in Table 4 below. Subgroup analyses can be difficult to interpret and it is not known whether these represent true differences or chance effects.
## Pharmacokinetics
### General
- Losartan is an orally active agent that undergoes substantial first-pass metabolism by cytochrome P450 enzymes. It is converted, in part, to an active carboxylic acid metabolite that is responsible for most of the angiotensin II receptor antagonism that follows losartan treatment. Losartan metabolites have been identified in human plasma and urine. In addition to the active carboxylic acid metabolite, several inactive metabolites are formed. Following oral and intravenous administration of 14C-labeled losartan potassium, circulating plasma radioactivity is primarily attributed to losartan and its active metabolite. In vitro studies indicate that cytochrome P450 2C9 and 3A4 are involved in the biotransformation of losartan to its metabolites. Minimal conversion of losartan to the active metabolite (less than 1% of the dose compared to 14% of the dose in normal subjects) was seen in about one percent of individuals studied.
- The terminal half-life of losartan is about 2 hours and of the metabolite is about 6-9 hours.
- The pharmacokinetics of losartan and its active metabolite are linear with oral losartan doses up to 200 mg and do not change over time. Neither losartan nor its metabolite accumulate in plasma upon repeated once-daily dosing.
- Following oral administration, losartan is well absorbed (based on absorption of radiolabeled losartan) and undergoes substantial first-pass metabolism; the systemic bioavailability of losartan is approximately 33%. About 14% of an orally-administered dose of losartan is converted to the active metabolite. Mean peak concentrations of losartan and its active metabolite are reached in 1 hour and in 3-4 hours, respectively. While maximum plasma concentrations of losartan and its active metabolite are approximately equal, the AUC of the metabolite is about 4 times as great as that of losartan. A meal slows absorption of losartan and decreases its Cmax but has only minor effects on losartan AUC or on the AUC of the metabolite (about 10% decreased).
- The pharmacokinetics of losartan and its active metabolite were also determined after IV doses of each component separately in healthy volunteers. The volume of distribution of losartan and the active metabolite is about 34 liters and 12 liters, respectively. Total plasma clearance of losartan and the active metabolite is about 600 mL/min and 50 mL/min, respectively, with renal clearance of about 75 mL/min and 25 mL/min, respectively. After single doses of losartan administered orally, about 4% of the dose is excreted unchanged in the urine and about 6% is excreted in urine as active metabolite. Biliary excretion contributes to the elimination of losartan and its metabolites. Following oral 14C-labeled losartan, about 35% of radioactivity is recovered in the urine and about 60% in the feces. Following an intravenous dose of 14C-labeled losartan, about 45% of radioactivity is recovered in the urine and 50% in the feces.
- Both losartan and its active metabolite are highly bound to plasma proteins, primarily albumin, with plasma free fractions of 1.3% and 0.2%, respectively. Plasma protein binding is constant over the concentration range achieved with recommended doses. Studies in rats indicate that losartan crosses the blood-brain barrier poorly, if at all.
### Special Populations
Pediatric: Pharmacokinetic parameters after multiple doses of losartan (average dose 0.7 mg/kg, range 0.36 to 0.97 mg/kg) as a tablet to 25 hypertensive patients aged 6 to 16 years are shown in Table 1 below. Pharmacokinetics of losartan and its active metabolite were generally similar across the studied age groups and similar to historical pharmacokinetic data in adults. The principal pharmacokinetic parameters in adults and children are shown in the table below.
- The bioavailability of the suspension formulation was compared with losartan tablets in healthy adults. The suspension and tablet are similar in their bioavailability with respect to both losartan and the active metabolite.
Geriatric and Gender: Losartan pharmacokinetics have been investigated in the elderly (65-75 years) and in both genders. Plasma concentrations of losartan and its active metabolite are similar in elderly and young hypertensives. Plasma concentrations of losartan were about twice as high in female hypertensives as male hypertensives, but concentrations of the active metabolite were similar in males and females. No dosage adjustment is necessary.
Race: Pharmacokinetic differences due to race have not been studied (see also PRECAUTIONS, Race and CLINICAL PHARMACOLOGY, Pharmacodynamics and Clinical Effects, Reduction in the Risk of Stroke, Race).
Renal Insufficiency: Following oral administration, plasma concentrations and AUCs of losartan and its active metabolite are increased by 50-90% in patients with mild (creatinine clearance of 50 to 74 mL/min) or moderate (creatinine clearance 30 to 49 mL/min) renal insufficiency. In this study, renal clearance was reduced by 55-85% for both losartan and its active metabolite in patients with mild or moderate renal insufficiency. Neither losartan nor its active metabolite can be removed by hemodialysis. No dosage adjustment is necessary for patients with renal impairment unless they are volume-depletion.
Hepatic Insufficiency: Following oral administration in patients with mild to moderate alcoholic cirrhosis of the liver, plasma concentrations of losartan and its active metabolite were, respectively, 5-times and about 1.7-times those in young male volunteers. Compared to normal subjects the total plasma clearance of losartan in patients with hepatic insufficiency was about 50% lower and the oral bioavailability was about 2-times higher. A lower starting dose is recommended for patients with a history of hepatic impairment.
## Nonclinical Toxicology
## Carcinogenesis, Mutagenesis, Impairment of Fertility
- Losartan potassium was not carcinogenic when administered at maximally tolerated dosages to rats and mice for 105 and 92 weeks, respectively. Female rats given the highest dose (270 mg/kg/day) had a slightly higher incidence of pancreatic acinar adenoma. The maximally tolerated dosages (270 mg/kg/day in rats, 200 mg/kg/day in mice) provided systemic exposures for losartan and its pharmacologically active metabolite that were approximately 160- and 90-times (rats) and 30- and 15-times (mice) the exposure of a 50 kg human given 100 mg per day.
- Losartan potassium was negative in the microbial mutagenesis and V-79 mammalian cell mutagenesis assays and in the in vitro alkaline elution and in vitro and in vivochromosomal aberration assays. In addition, the active metabolite showed no evidence of genotoxicity in the microbial mutagenesis, in vitro alkaline elution, and in vitrochromosomal aberration assays.
- Fertility and reproductive performance were not affected in studies with male rats given oral doses of losartan potassium up to approximately 150 mg/kg/day. The administration of toxic dosage levels in females (300/200 mg/kg/day) was associated with a significant (p<0.05) decrease in the number of corpora lutea/female, implants/female, and live fetuses/female at C-section. At 100 mg/kg/day only a decrease in the number of corpora lutea/female was observed. The relationship of these findings to drug-treatment is uncertain since there was no effect at these dosage levels on implants/pregnant female, percent post-implantation loss, or live animals/litter at parturition. In nonpregnant rats dosed at 135 mg/kg/day for 7 days, systemic exposure (AUCs) for losartan and its active metabolite were approximately 66 and 26 times the exposure achieved in man at the maximum recommended human daily dosage (100 mg).
# Clinical Studies
FDA Package Insert for Losartan contains no information regarding Clinical Studies.
# How Supplied
25 mg – Each white, round, biconvex film coated tablets debossed with “11” on one side and plain on other side contains 25 mg of losartan potassium, USP. Tablets are supplied in bottles of 30 (NDC 76439-140-30), 90 (NDC 76439-140-90), 1000 (NDC 76439-140-11), and 10 x 10 (unit-dose tablets) (NDC 76439-140-10).
50 mg – Each white, round, biconvex, film coated tablets debossed with “12” on scoreline side and plain on other side contains 50 mg of losartan potassium, USP. Tablets are supplied in bottles of 30 (NDC 76439-141-30), 90 (NDC 76439-141-90), 1000 (NDC 76439-141-11), and 10 x 10 (unit-dose tablets) (NDC 76439-141-10).
100 mg – Each white, oval, biconvex film coated tablets debossed with “13” on one side and plain on other side contains 100 mg of losartan potassium, USP. Tablets are supplied in bottles of 30 (NDC 76439-142-30), 90 (NDC 76439-142-90), 1000 (NDC 76439-142-11), and 10 x 10 (unit-dose tablets) (NDC 76439-142-10).
## Storage
- Store at 25°C (77°F); excursions permitted to 15-30°C (59-86°F). [see USP Controlled Room Temperature]. Keep container tightly closed. Protect from light.
Dispense in a tight, light-resistant container as defined in USP.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
FDA Package Insert for Losartan contains no information regarding Patient Counseling Information.
# Precautions with Alcohol
Alcohol-Losartan interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
Cozaar
# Look-Alike Drug Names
Losartan - Solace
Losartan - Zocor [18]
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Hyzaar | |
82173d5b074392329669edb20d1580c02a4309a8 | wikidoc | IFA Kits | IFA Kits
# Reading an IFA HIV Test Results
An IFA or immunofluorescent assay HIV test is done to examine a tissue sample for the presence or absence of the HIV-1 virus. This is a test that includes blood drawing or plasma samples from the patients and allows them to undergo laboratory analysis to check detectable levels of the antibodies created by the immune system to fight the HIV virus.
1. The IFA HIV test is basically employed used after the more standard western-blot test or ELISA test has returned a positive or inconclusive result. Physician doesn’t regularly execute this type of test for the first-step screening procedure for the HIV virus, though the methods tend to depend from doctor to doctor and clinic to clinic.
2. When reading a result, make sure to ask assistance from your doctor or the qualified, sexual-health professional who proctored the test. If you don’t like to reveal your identity, you can look for an anonymous in-person HIV testing services, particularly in larger cities.
3. As needed by the IFA testing, you are asked to give out a blood or plasma sample.
4. Don’t hesitate to ask your physician concerning the techniques utilized when conducting an IFA HIV test. During the IFA testing, there is a particular antibody to the antigens which is produced to combat the HIV-1 virus. They normally employ one of four processes and these are competitive, noncompetitive, heterogeneous or homogeneous-immunoassay testing. This test is not functional to detect the antibodies formed against the HIV-2 virus, for it is only limited on reading the presence of HIV-1.
5. Ask your physician to explain the protocol specific to the lab to finally complete the testing on your sample. Laboratories necessitate a précised amount of HIV-1 antigen which is the exact amount varying from lab to lab. It must be presented before concluding a test reactive or positive.
6. Undergo a follow-up test if your IFA test gives positive results. | IFA Kits
# Reading an IFA HIV Test Results
An IFA or immunofluorescent assay HIV test is done to examine a tissue sample for the presence or absence of the HIV-1 virus. This is a test that includes blood drawing or plasma samples from the patients and allows them to undergo laboratory analysis to check detectable levels of the antibodies created by the immune system to fight the HIV virus.
1. The IFA HIV test is basically employed used after the more standard western-blot test or ELISA test has returned a positive or inconclusive result. Physician doesn’t regularly execute this type of test for the first-step screening procedure for the HIV virus, though the methods tend to depend from doctor to doctor and clinic to clinic.
2. When reading a result, make sure to ask assistance from your doctor or the qualified, sexual-health professional who proctored the test. If you don’t like to reveal your identity, you can look for an anonymous in-person HIV testing services, particularly in larger cities.
3. As needed by the IFA testing, you are asked to give out a blood or plasma sample.
4. Don’t hesitate to ask your physician concerning the techniques utilized when conducting an IFA HIV test. During the IFA testing, there is a particular antibody to the antigens which is produced to combat the HIV-1 virus. They normally employ one of four processes and these are competitive, noncompetitive, heterogeneous or homogeneous-immunoassay testing. This test is not functional to detect the antibodies formed against the HIV-2 virus, for it is only limited on reading the presence of HIV-1.
5. Ask your physician to explain the protocol specific to the lab to finally complete the testing on your sample. Laboratories necessitate a précised amount of HIV-1 antigen which is the exact amount varying from lab to lab. It must be presented before concluding a test reactive or positive.
6. Undergo a follow-up test if your IFA test gives positive results. | https://www.wikidoc.org/index.php/IFA_Kits | |
05b7a6496d3b4b1140d14e3602d9f7ed90a03e72 | wikidoc | IL1RAPL1 | IL1RAPL1
X-linked interleukin-1 receptor accessory protein-like 1 is a protein that in humans is encoded by the IL1RAPL1 gene.
# Function
The protein encoded by this gene is a member of the interleukin-1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 (IL1RAPL2).
# Clinical significance
This gene and IL1RAPL2 are located at a region on chromosome X that is associated with X-linked non-syndromic mental retardation. Deletions and mutations in this gene were found in patients with mental retardation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities. | IL1RAPL1
X-linked interleukin-1 receptor accessory protein-like 1 is a protein that in humans is encoded by the IL1RAPL1 gene.[1][2][3]
# Function
The protein encoded by this gene is a member of the interleukin-1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 (IL1RAPL2).[3]
# Clinical significance
This gene and IL1RAPL2 are located at a region on chromosome X that is associated with X-linked non-syndromic mental retardation. Deletions and mutations in this gene were found in patients with mental retardation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities.[3] | https://www.wikidoc.org/index.php/IL1RAPL1 | |
ccff2517cd1852f07a4ea5c1c453a9b42b542f16 | wikidoc | ISBT 128 | ISBT 128
# Overview
ISBT 128 is a system for identification, labeling and processing of human blood, tissue, and cellular therapy products using an internationally standardized system. The acronym ISBT stands for the International Society of Blood Transfusion. The number 128 reflects the choice of barcode symbology known as Code 128.
# History
The current version of the ISBT 128 Standard Technical Specification is version 3.0.0; version 1 was first published in 1994, and was intended to replace the ABC Codabar and other similar CODABAR-based standards in use in transfusion medicine at that time with a more secure barcode symbology which contains more information.
The ISBT working group on automation and data processing was joined by the American Association of Blood Banks (AABB), the American Red Cross (ARC), the Department of Defense, and the Health Industry Manufacturers Association in the development of the symbology which was adopted as an international standard.
The International Council for Commonality in Blood Banking Automation (ICCBBA) was established and given the responsibility for implementation and management of the new standard. Guidance from the AABB states that all AABB accredited blood banks must implement ISBT 128 by May 1, 2008.
# How ISBT 128 works
The ISBT 128 system increases the level of standardization in transfusion medicine. Each blood product is given a unique donation identification number which includes an assigned collection facility code. This allows every product to be specifically identified and tracked anywhere in the world. Specific products and blood treatment processes are labeled the same way every time using this system.
The ISBT 128 barcode allows for more information to be coded into a small space and includes an internal check digit to prevent barcode misreads. Each barcode contains two data identifier characters embedded in the barcode that identifies the type of information coded in the barcode (e.g. ABO/Rh, Product Code) followed by the specific unit information which is reproduced in an eye readable format just below the barcode.
The label information is divided into quadrants. Donor ID (unit number) prints in the upper left quadrant. ABO/Rh prints in the upper right quadrant. Product code prints in the lower left quadrant. Expiration date/time (down to the hour and minute) print in the lower right quadrant along with any special testing (antigens, CMV, etc.) | ISBT 128
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
ISBT 128 is a system for identification, labeling and processing of human blood, tissue, and cellular therapy products using an internationally standardized system. The acronym ISBT stands for the International Society of Blood Transfusion. The number 128 reflects the choice of barcode symbology known as Code 128.
# History
The current version of the ISBT 128 Standard Technical Specification is version 3.0.0; version 1 was first published in 1994, and was intended to replace the ABC Codabar and other similar CODABAR-based standards in use in transfusion medicine at that time with a more secure barcode symbology which contains more information.
The ISBT working group on automation and data processing was joined by the American Association of Blood Banks (AABB), the American Red Cross (ARC), the Department of Defense, and the Health Industry Manufacturers Association in the development of the symbology which was adopted as an international standard.
The International Council for Commonality in Blood Banking Automation (ICCBBA) was established and given the responsibility for implementation and management of the new standard. Guidance from the AABB states that all AABB accredited blood banks must implement ISBT 128 by May 1, 2008.
# How ISBT 128 works
The ISBT 128 system increases the level of standardization in transfusion medicine. Each blood product is given a unique donation identification number which includes an assigned collection facility code. This allows every product to be specifically identified and tracked anywhere in the world. Specific products and blood treatment processes are labeled the same way every time using this system.
The ISBT 128 barcode allows for more information to be coded into a small space and includes an internal check digit to prevent barcode misreads. Each barcode contains two data identifier characters embedded in the barcode that identifies the type of information coded in the barcode (e.g. ABO/Rh, Product Code) followed by the specific unit information which is reproduced in an eye readable format just below the barcode.
The label information is divided into quadrants. Donor ID (unit number) prints in the upper left quadrant. ABO/Rh prints in the upper right quadrant. Product code prints in the lower left quadrant. Expiration date/time (down to the hour and minute) print in the lower right quadrant along with any special testing (antigens, CMV, etc.) | https://www.wikidoc.org/index.php/ISBT_128 | |
29caba7fd236afc141e5b809b543a5de01e83518 | wikidoc | ITGB1BP1 | ITGB1BP1
Integrin beta-1-binding protein 1 is a protein that in humans is encoded by the ITGB1BP1 gene.
The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion.
# Interactions
ITGB1BP1 has been shown to interact with KRIT1, LRP2, CD29 and LRP1. | ITGB1BP1
Integrin beta-1-binding protein 1 is a protein that in humans is encoded by the ITGB1BP1 gene.[1][2][3]
The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion.[3]
# Interactions
ITGB1BP1 has been shown to interact with KRIT1,[1][4] LRP2,[5] CD29[2][6] and LRP1.[5] | https://www.wikidoc.org/index.php/ITGB1BP1 | |
ca781afead7e82ee3f0362ce5c8212e02e9ca57f | wikidoc | Ibogaine | Ibogaine
Ibogaine is an indole alkaloid, a long-acting hallucinogen which has gained attention due to its application in the treatment of opioid addiction and similar addiction syndromes. It occurs naturally in a number of dogbane plants, among them above all in Tabernanthe iboga, otherwise known as iboga.
# Formulations
Pure crystalline ibogaine hydrochloride is the most standardized formulation dosing and typically must be produced by the semi-synthesis from voacangine in commercial laboratories. In Africa, Tabernanthe iboga is consumed as a stimulant by chewing the rootbark. In Bwiti religious ceremonies, the rootbark is pulverized and swallowed with water to produce intense psychoactive effects. Ibogaine is also available in a total alkaloid extract of the Tabernanthe iboga plant, which also contains all the other iboga alkaloids and thus has only about 1/5th the potency by weight as standardized ibogaine hydrochloride.
Total alkaloid extracts of T. iboga are often loosely called "Indra extract". However, that name actually refers to a particular stock of about 44kg of an iboga extract manufactured by an unnamed European industrial manufacturer in 1981. This stock was later purchased by Carl Waltenburg, who distributed it under the name "Indra extract". Waltenburg used this extract to treat heroin addicts in Christiana, Denmark, a squatter village where heroin addiction was widespread in 1982. Indra extract was offered for sale over the internet until 2006, when the Indra web presence disappeared. It is unclear whether the extracts sold as "Indra extract" are actually from Waltenburg's original stock, or whether any of that stock is even viable or in existence. Ibogaine and related indole compounds are susceptible to oxidation when exposed to oxygen as opposed to their salt form which is stable. The exact methods and quality of the original Indra extraction was never documented, so the real composition of the product remains uncertain.
# History
Ibogaine was first isolated from Tabernanthe iboga in 1901 by Dybowski and Landrin and independently by Haller and Heckel in the same year. Samples of the plant were obtained from Gabon, Africa in the mid 1800s where it has been used in initiation rites of the Bwiti religion. The challenging total synthesis was accomplished by G. Büchi in 1966. Since then, several further totally synthetic routes have been developed. The use of ibogaine in treating substance use disorders in human subjects was first proposed by Howard Lotsof in U.S. Patent 4,499,096 which was awarded in 1985. Ibogaine's ability to attenuate opioid withdrawal confirmed in the rat was first published by Dzoljic et al. (1988). Ibogaine's use in diminishing morphine self-administration in preclinical studies was shown by Glick et al. (1991) and ibogaine's capacity to reduce cocaine self-administration in the rat was shown by Cappendijk et al. (1993). Animal model support for ibogaine claims to treat alcohol dependence were established by Rezvani (1995).
Data demonstrating ibogaine's efficacy in attenuating opioid withdrawal in drug dependent human subjects was published by Alper et al. (1999) and Mash et al. (2000). However, there have been as yet no peer-reviewed studies demonstrating any statistically significant long term improvement following ibogaine administration to humans with drug problems.
# Effects
At low doses, ibogaine has a mild stimulant effect. At higher doses, temporary effects include hallucination and ataxia (uncoordinated, stumbling-like movement). The most studied long-term therapeutic effect is that ibogaine seems to catalyze partial or complete interruption of addiction to opioids. An integral effect is the alleviation of symptoms of opioid withdrawal. Research also suggests that ibogaine may be useful in treating dependence to other substances such as alcohol, methamphetamine, and nicotine, and may affect compulsive behavioral patterns not involving substance abuse or chemical dependence. Ibogaine has been used as an adjunct to psychotherapy by Claudio Naranjo, documented in his book The Healing Journey.
# Pharmacology
The pharmacology of ibogaine is quite complex, affecting many different neurotransmitter systems simultaneously.
Because of its fairly low potency at any of its target sites, ibogaine is used in doses anywhere from 5 milligrams per kilogram of body weight for minor effect to 30 mg/kg in the cases of strong polysubstance addiction. It is unknown whether doses greater than 30mg/kg in humans produce effects that are therapeutically beneficial, medically risky, or simply prolonged in duration.
## Mechanism and Pharmacodynamics
Among recent proposals for ibogaine mechanisms of action is activation of the glial cell line-derived neurotrophic factor (GDNF) pathway in the ventral tegmental area (VTA) of the brain. The work has principally been accomplished in preclinical ethanol research where 40 mg/kg of ibogaine caused increases of RNA expression of GDNF in keeping with reduction of ethanol intake in the rat,
absent neurotoxicity or cell death.
Ibogaine is a noncompetitive antagonist at α3β4 nicotinic receptors, binding with moderate affinity. Several other α3β4 antagonists are known, and some of these such as bupropion (Wellbutrin or Zyban), and mecamylamine have been used for treating nicotine addiction. This α3β4-antagonism correlates quite well with the observed effect of interrupting addiction. Co-administration of ibogaine with other α3β4-antagonists such as 18-MC, dextromethorphan or mecamylamine had a stronger anti-addictive effect than when it was administered alone. Since α3β4 channels and NMDA channels are related to each other and their binding sites within the lumen bind a range of same ligands (e.g. DXM, PCP), some "older" sources suggested that ibogaine's anti-addictive properties may be (partly) due to it being an NMDA receptor antagonist. However, ligands, like 18-MC, selective for α3β4- vs. NMDA-channels showed no drop-off in activity.
It is suspected that ibogaine's actions on the opioid and glutamatergic systems are also involved in its anti-addictive effects. Persons treated with ibogaine report a cessation of opioid withdrawal signs generally within an hour of administration.
Ibogaine is a weak 5HT2A receptor agonist and although it is unclear how significant this action is for the anti-addictive effects of ibogaine, it is likely to be important for the hallucinogenic effects. Ibogaine is also a sigma2 receptor agonist.
## Metabolites
Ibogaine is metabolized in the human body by cytochrome P450 2D6, and the major metabolite is noribogaine (12-hydroxyibogamine). Noribogaine is most potent as a serotonin reuptake inhibitor and acts as moderate κ- and weak µ-opioid receptor full agonist and has therefore also an aspect of an opiate replacement similar to compounds like methadone. Both ibogaine and noribogaine have a plasma half-life of around thirty minutes, although the half-life or noribogaine is slightly longer than the parent compound. It is proposed that ibogaine is deposited in fat and metabolized into noribogaine as it is released. Noribogaine shows higher plasma levels than ibogaine and may therefore be detected for longer periods of time than ibogaine. Noribogaine is also more potent than ibogaine in rat drug discrimination assays when tested for the subjective effects of ibogaine. Noribogaine differs from ibogaine in that it contains a hydroxy instead of a methoxy group at the 12 position.
## Analogs
A synthetic derivative of ibogaine, 18-methoxycoronaridine (18-MC) is a selective α3β4 antagonist that was developed collaboratively by the neurologist Stanley D. Glick (Albany) and the chemist Martin E. Kuehne (Vermont).
Voacangine, a close natural analog of ibogaine found in the tree bark of the Voacanga africana tree, is a common ingredient in the semi-synthesis of ibogaine because it is more abundant and easily accessible than iboga rootbark. Based on their structural similarity to ibogaine and 18-MC and their binding properties in vitro, it is likely that other alkaloidal components of T. iboga and V. africana such as voacangine, ibogamine and coronaridine also contribute to the anti-addictive properties of the extracts from these plants.
File:Ibogaine analogues.png
# Usage
## Addiction Interruption
Proponents of ibogaine treatment for drug addiction have established formal and informal clinics or self-help groups in Canada, Mexico, the Caribbean, Costa Rica, the Czech Republic, France, Slovenia, the Netherlands, Brazil, South Africa, the United Kingdom and New Zealand where ibogaine is administered as an experimental drug. Although the full nature of Ibogaine is still emerging, it appears that the most effective treatment paradigm involves visionary doses of ibogaine of 10 to 20 mg/kg, producing an interruption of opiate withdrawal and craving. Many users of ibogaine report experiencing visual phenomena during a waking dream state, such as instructive replays of life events that led to their addiction, while others report therapeutic shamanic visions that help them conquer the fears and negative emotions that might drive their addiction. It is proposed that intensive counseling and therapy during the interruption period following treatment is of significant value. Some patients require a second or third treatment session with ibogaine over the course of the next 12 to 18 months as it will provide a greater efficacy in extinguishing the opiate addiction or other drug dependence syndrome. A minority of patients relapse completely into opiate addiction within days or weeks. A comprehensive article (Lotsof 1995) on the subject of ibogaine therapy, detailing the procedure, effects and aftereffects is found in, "Ibogaine in the Treatment of Chemical Dependence Disorders: Clinical Perspectives".
## Chronic pain management
In 1957, Jurg Schneider, a pharmacologist at CIBA, found that ibogaine potentiates morphine analgesia. Further research was abandoned and no additional data was ever published by Ciba researchers on ibogaine/opioid interactions. Almost 50 years later Patrick Kroupa and Hattie Wells released the first treatment protocol for concomitant administration of ibogaine with opioids in human subjects indicating ibogaine reduced tolerance to opioid drugs. Kroupa, et al., published their research in the Multidisciplinary Association for Psychedelic Studies (MAPS) Journal demonstrating that administration of low "maintenance" doses of ibogaine HCl with opioids decreases tolerance.
# Side effects
At therapeutic doses, ibogaine has an active window of 24 to 48 hours, is often physically and mentally exhausting and produces ataxia for as long as twelve hours, in some cases even longer. Nausea that may lead to vomiting is not uncommon throughout the experience. Such unpleasant symptoms tend to reduce the attractiveness of ibogaine as a recreational drug at therapeutic doses, however, at lower doses ibogaine is known to have stimulant effects. Some users administer ibogaine by enema in order to avoid nausea.
In one study using dogs as the subject, ibogaine has been observed to increase sinus arrhythmia (the normal change in heart rate during respiration). Ventricular ectopy has been observed in a minority of patients during ibogaine therapy. It has been proposed that there is a theoretical risk of QT-interval prolongation following ibogaine administration, but no actual occurrence of this phenomenon has been published to date.
There are 8 documented fatalities that have been loosely associated with ibogaine ingestion. . Autopsies have failed to implicate ibogaine as the sole cause of death due to some patients having significant pre-existing medical problems, and some patients surreptitiously consuming other drugs such as heroin against medical indications during or after ibogaine treatment.
# Research
An ibogaine research project was funded by the US National Institute on Drug Abuse in the early 1990s. The National Institute on Drug Abuse (NIDA) abandoned efforts to continue this project into clinical studies in 1995, citing other reports that suggested a risk of brain damage with extremely high doses and fatal heart arrhythmia in patients having a history of health problems, as well as inadequate funding for ibogaine development within their budget. However, NIDA funding for ibogaine research continues in indirect grants often cited in peer reviewed ibogaine publications.
In addition, after years of work and a number of significant changes to the original protocol, on August 17, 2006, a MAPS-sponsored research team received "unconditional approval" from a Canadian Institutional Review Board (IRB) to proceed with a long-term observational case study that will examine changes in substance use in 20 consecutive people seeking ibogaine-based addiction treatment for opiate dependence at the Iboga Therapy House in Vancouver.
# Legal status
Ibogaine and its salts were regulated by the U.S. Food and Drug Administration in 1967 pursuant to its enhanced authority to regulate stimulants, depressants, and hallucinogens granted by the 1965 Drug Abuse Control Amendments (DACA) to the Federal Food, Drug, and Cosmetic Act. In 1970, with the passage of the Controlled Substances Act, it was classified as a Schedule I controlled substance in the United States, along with other psychedelics such as LSD and mescaline. Since that time, several other countries, including Sweden, Denmark, Belgium, and Switzerland, have also banned the sale and possession of ibogaine.
In early 2006, a non-profit foundation addressing the issue of providing ibogaine for the purpose of addiction interruption within establishment drug treatment care was formed in Sweden.
# Media references
## Documentary and autobiographical
- Ibogaine: Rite Of Passage is a documentary film about the use of ibogaine in Bwiti tradition and addiction medicine.
- Daniel Pinchbeck writes of his own experience with ibogaine (among other psychoactives) in Breaking Open The Head
- Ibogaine was the topic of a segment the American public radio series This American Life, Week of December 1, 2006. The show called "Sink or Swim" documented the story of a former addict who opened an underground addiction treatment service using ibogaine.
## References in popular media
- Hunter S. Thompson alleged in his book Fear and Loathing: On the Campaign Trail '72 that United States Democratic Party presidential hopeful Edmund Muskie used ibogaine during his 1972 campaign. This is also voiced in 1972 articles in Rolling Stone magazine. Thompson also claimed to have used ibogaine himself.
- In the movie Good Will Hunting, the character Skylar (a chemistry student) cites the complex and time-consuming task of assigning the proton spectrum for ibogaine as an excuse for declining a social invitation.
- The X-Files, Season 8, Episode 7, "Via Negativa". Originally aired: 12/17/2000. A serial killer and cult leader uses ibogaine to leave his body and kill his victims.
- CSI, Season 4, Episode 16, "Getting Off". Originally aired: 1/1/2004. Summary: An underground ibogaine treatment provider is murdered by dealers of morphine and cocaine who perceive ibogaine's anti-addictive properties as a threat to their business.
- Journalist and author Daniel Pinchbeck has discussed ibogaine and firsthand experience with ibogaine in his books Breaking Open the Head and its follow-up 2012: The Return of Queztcoatl
- The Policy (1999) by Patrick Lynch incorporates ibogaine into the plot. One of the characters is sent to drug rehabilitation for a cocaine problem to keep him out of the way for some period of time while an insurance scam is accomplished but he opts for ibogaine therapy and returns home far earlier than anticipated only be to murdered. | Ibogaine
Ibogaine is an indole alkaloid, a long-acting hallucinogen which has gained attention due to its application in the treatment of opioid addiction and similar addiction syndromes. It occurs naturally in a number of dogbane plants, among them above all in Tabernanthe iboga, otherwise known as iboga.
# Formulations
Pure crystalline ibogaine hydrochloride is the most standardized formulation dosing and typically must be produced by the semi-synthesis from voacangine in commercial laboratories. In Africa, Tabernanthe iboga is consumed as a stimulant by chewing the rootbark. In Bwiti religious ceremonies, the rootbark is pulverized and swallowed with water to produce intense psychoactive effects. Ibogaine is also available in a total alkaloid extract of the Tabernanthe iboga plant, which also contains all the other iboga alkaloids and thus has only about 1/5th the potency by weight as standardized ibogaine hydrochloride.[1]
Total alkaloid extracts of T. iboga are often loosely called "Indra extract". However, that name actually refers to a particular stock of about 44kg of an iboga extract manufactured by an unnamed European industrial manufacturer in 1981. This stock was later purchased by Carl Waltenburg, who distributed it under the name "Indra extract". Waltenburg used this extract to treat heroin addicts in Christiana, Denmark, a squatter village where heroin addiction was widespread in 1982.[2] Indra extract was offered for sale over the internet until 2006, when the Indra web presence disappeared. It is unclear whether the extracts sold as "Indra extract" are actually from Waltenburg's original stock, or whether any of that stock is even viable or in existence. Ibogaine and related indole compounds are susceptible to oxidation when exposed to oxygen[3] as opposed to their salt form which is stable. The exact methods and quality of the original Indra extraction was never documented, so the real composition of the product remains uncertain.
# History
Ibogaine was first isolated from Tabernanthe iboga in 1901 by Dybowski and Landrin[4] and independently by Haller and Heckel in the same year. Samples of the plant were obtained from Gabon, Africa in the mid 1800s where it has been used in initiation rites of the Bwiti religion. The challenging total synthesis was accomplished by G. Büchi in 1966.[5] Since then, several further totally synthetic routes have been developed.[6] The use of ibogaine in treating substance use disorders in human subjects was first proposed by Howard Lotsof in U.S. Patent 4,499,096 which was awarded in 1985. Ibogaine's ability to attenuate opioid withdrawal confirmed in the rat was first published by Dzoljic et al. (1988).[7] Ibogaine's use in diminishing morphine self-administration in preclinical studies was shown by Glick et al. (1991)[8] and ibogaine's capacity to reduce cocaine self-administration in the rat was shown by Cappendijk et al. (1993).[9] Animal model support for ibogaine claims to treat alcohol dependence were established by Rezvani (1995).[10]
Data demonstrating ibogaine's efficacy in attenuating opioid withdrawal in drug dependent human subjects was published by Alper et al. (1999)[11] and Mash et al. (2000).[12] However, there have been as yet no peer-reviewed studies demonstrating any statistically significant long term improvement following ibogaine administration to humans with drug problems.
# Effects
At low doses, ibogaine has a mild stimulant effect. At higher doses, temporary effects include hallucination and ataxia (uncoordinated, stumbling-like movement). The most studied long-term therapeutic effect is that ibogaine seems to catalyze partial or complete interruption of addiction to opioids. An integral effect is the alleviation of symptoms of opioid withdrawal. Research also suggests that ibogaine may be useful in treating dependence to other substances such as alcohol, methamphetamine, and nicotine, and may affect compulsive behavioral patterns not involving substance abuse or chemical dependence. Ibogaine has been used as an adjunct to psychotherapy by Claudio Naranjo, documented in his book The Healing Journey.[13]
# Pharmacology
The pharmacology of ibogaine is quite complex, affecting many different neurotransmitter systems simultaneously.[14][15]
Because of its fairly low potency at any of its target sites, ibogaine is used in doses anywhere from 5 milligrams per kilogram of body weight for minor effect to 30 mg/kg in the cases of strong polysubstance addiction. It is unknown whether doses greater than 30mg/kg in humans produce effects that are therapeutically beneficial, medically risky, or simply prolonged in duration.
## Mechanism and Pharmacodynamics
Among recent proposals for ibogaine mechanisms of action is activation of the glial cell line-derived neurotrophic factor (GDNF) pathway in the ventral tegmental area (VTA) of the brain. The work has principally been accomplished in preclinical ethanol research where 40 mg/kg of ibogaine caused increases of RNA expression of GDNF in keeping with reduction of ethanol intake in the rat,
absent neurotoxicity or cell death.[16]
Ibogaine is a noncompetitive antagonist at α3β4 nicotinic receptors, binding with moderate affinity.[17] Several other α3β4 antagonists are known, and some of these such as bupropion (Wellbutrin or Zyban), and mecamylamine have been used for treating nicotine addiction. This α3β4-antagonism correlates quite well with the observed effect of interrupting addiction. Co-administration of ibogaine with other α3β4-antagonists such as 18-MC, dextromethorphan or mecamylamine had a stronger anti-addictive effect than when it was administered alone.[18] Since α3β4 channels and NMDA channels are related to each other and their binding sites within the lumen bind a range of same ligands (e.g. DXM, PCP),[19] some "older" sources suggested that ibogaine's anti-addictive properties may be (partly) due to it being an NMDA receptor antagonist.[20] However, ligands, like 18-MC, selective for α3β4- vs. NMDA-channels showed no drop-off in activity.
It is suspected that ibogaine's actions on the opioid and glutamatergic systems are also involved in its anti-addictive effects. Persons treated with ibogaine report a cessation of opioid withdrawal signs generally within an hour of administration.
Ibogaine is a weak 5HT2A receptor agonist[21] and although it is unclear how significant this action is for the anti-addictive effects of ibogaine, it is likely to be important for the hallucinogenic effects.[22] Ibogaine is also a sigma2 receptor agonist.[23]
## Metabolites
Ibogaine is metabolized in the human body by cytochrome P450 2D6, and the major metabolite is noribogaine (12-hydroxyibogamine). Noribogaine is most potent as a serotonin reuptake inhibitor and acts as moderate κ- and weak µ-opioid receptor full agonist and has therefore also an aspect of an opiate replacement similar to compounds like methadone. Both ibogaine and noribogaine have a plasma half-life of around thirty minutes, although the half-life or noribogaine is slightly longer than the parent compound. It is proposed that ibogaine is deposited in fat and metabolized into noribogaine as it is released.[24] Noribogaine shows higher plasma levels than ibogaine and may therefore be detected for longer periods of time than ibogaine. Noribogaine is also more potent than ibogaine in rat drug discrimination assays when tested for the subjective effects of ibogaine.[25] Noribogaine differs from ibogaine in that it contains a hydroxy instead of a methoxy group at the 12 position.
## Analogs
A synthetic derivative of ibogaine, 18-methoxycoronaridine (18-MC) is a selective α3β4 antagonist that was developed collaboratively by the neurologist Stanley D. Glick (Albany) and the chemist Martin E. Kuehne (Vermont).[26]
Voacangine, a close natural analog of ibogaine found in the tree bark of the Voacanga africana tree, is a common ingredient in the semi-synthesis of ibogaine because it is more abundant and easily accessible than iboga rootbark.[27] Based on their structural similarity to ibogaine and 18-MC and their binding properties in vitro, it is likely that other alkaloidal components of T. iboga and V. africana such as voacangine, ibogamine and coronaridine also contribute to the anti-addictive properties of the extracts from these plants.
File:Ibogaine analogues.png
# Usage
## Addiction Interruption
Proponents of ibogaine treatment for drug addiction have established formal and informal clinics or self-help groups in Canada, Mexico, the Caribbean, Costa Rica, the Czech Republic, France, Slovenia, the Netherlands, Brazil, South Africa, the United Kingdom and New Zealand where ibogaine is administered as an experimental drug. Although the full nature of Ibogaine is still emerging, it appears that the most effective treatment paradigm involves visionary doses of ibogaine of 10 to 20 mg/kg, producing an interruption of opiate withdrawal and craving. Many users of ibogaine report experiencing visual phenomena during a waking dream state, such as instructive replays of life events that led to their addiction, while others report therapeutic shamanic visions that help them conquer the fears and negative emotions that might drive their addiction. It is proposed that intensive counseling and therapy during the interruption period following treatment is of significant value. Some patients require a second or third treatment session with ibogaine over the course of the next 12 to 18 months as it will provide a greater efficacy in extinguishing the opiate addiction or other drug dependence syndrome. A minority of patients relapse completely into opiate addiction within days or weeks. A comprehensive article (Lotsof 1995) on the subject of ibogaine therapy, detailing the procedure, effects and aftereffects is found in, "Ibogaine in the Treatment of Chemical Dependence Disorders: Clinical Perspectives".[28]
## Chronic pain management
In 1957, Jurg Schneider, a pharmacologist at CIBA, found that ibogaine potentiates morphine analgesia.[29] Further research was abandoned and no additional data was ever published by Ciba researchers on ibogaine/opioid interactions. Almost 50 years later Patrick Kroupa and Hattie Wells released the first treatment protocol for concomitant administration of ibogaine with opioids in human subjects indicating ibogaine reduced tolerance to opioid drugs.[30] Kroupa, et al., published their research in the Multidisciplinary Association for Psychedelic Studies (MAPS) Journal demonstrating that administration of low "maintenance" doses of ibogaine HCl with opioids decreases tolerance.
# Side effects
At therapeutic doses, ibogaine has an active window of 24 to 48 hours, is often physically and mentally exhausting and produces ataxia for as long as twelve hours, in some cases even longer. Nausea that may lead to vomiting is not uncommon throughout the experience. Such unpleasant symptoms tend to reduce the attractiveness of ibogaine as a recreational drug at therapeutic doses, however, at lower doses ibogaine is known to have stimulant effects. Some users administer ibogaine by enema in order to avoid nausea.
In one study using dogs as the subject, ibogaine has been observed to increase sinus arrhythmia (the normal change in heart rate during respiration).[4] Ventricular ectopy has been observed in a minority of patients during ibogaine therapy. [5] It has been proposed that there is a theoretical risk of QT-interval prolongation following ibogaine administration, but no actual occurrence of this phenomenon has been published to date. [6]
There are 8 documented fatalities that have been loosely associated with ibogaine ingestion. [7]. Autopsies have failed to implicate ibogaine as the sole cause of death due to some patients having significant pre-existing medical problems, and some patients surreptitiously consuming other drugs such as heroin against medical indications during or after ibogaine treatment.
# Research
An ibogaine research project was funded by the US National Institute on Drug Abuse in the early 1990s. The National Institute on Drug Abuse (NIDA) abandoned efforts to continue this project into clinical studies in 1995, citing other reports that suggested a risk of brain damage with extremely high doses and fatal heart arrhythmia in patients having a history of health problems, as well as inadequate funding for ibogaine development within their budget. However, NIDA funding for ibogaine research continues in indirect grants often cited in peer reviewed ibogaine publications.
In addition, after years of work and a number of significant changes to the original protocol, on August 17, 2006, a MAPS-sponsored research team received "unconditional approval" from a Canadian Institutional Review Board (IRB) to proceed with a long-term observational case study that will examine changes in substance use in 20 consecutive people seeking ibogaine-based addiction treatment for opiate dependence at the Iboga Therapy House in Vancouver.
# Legal status
Ibogaine and its salts were regulated by the U.S. Food and Drug Administration in 1967 pursuant to its enhanced authority to regulate stimulants, depressants, and hallucinogens granted by the 1965 Drug Abuse Control Amendments (DACA) to the Federal Food, Drug, and Cosmetic Act. In 1970, with the passage of the Controlled Substances Act, it was classified as a Schedule I controlled substance in the United States, along with other psychedelics such as LSD and mescaline. Since that time, several other countries, including Sweden, Denmark, Belgium, and Switzerland, have also banned the sale and possession of ibogaine.
In early 2006, a non-profit foundation addressing the issue of providing ibogaine for the purpose of addiction interruption within establishment drug treatment care was formed in Sweden.[31]
# Media references
## Documentary and autobiographical
- Ibogaine: Rite Of Passage is a documentary film about the use of ibogaine in Bwiti tradition and addiction medicine. [8]
- Daniel Pinchbeck writes of his own experience with ibogaine (among other psychoactives) in Breaking Open The Head [9]
- Ibogaine was the topic of a segment the American public radio series This American Life, Week of December 1, 2006. The show called "Sink or Swim" documented the story of a former addict who opened an underground addiction treatment service using ibogaine.
## References in popular media
- Hunter S. Thompson alleged in his book Fear and Loathing: On the Campaign Trail '72 [32] that United States Democratic Party presidential hopeful Edmund Muskie used ibogaine during his 1972 campaign. This is also voiced in 1972 articles in Rolling Stone magazine. Thompson also claimed to have used ibogaine himself.
- In the movie Good Will Hunting, the character Skylar (a chemistry student) cites the complex and time-consuming task of assigning the proton spectrum for ibogaine as an excuse for declining a social invitation.
- The X-Files, Season 8, Episode 7, "Via Negativa". Originally aired: 12/17/2000. A serial killer and cult leader uses ibogaine to leave his body and kill his victims.
- CSI, Season 4, Episode 16, "Getting Off". Originally aired: 1/1/2004. Summary: An underground ibogaine treatment provider is murdered by dealers of morphine and cocaine who perceive ibogaine's anti-addictive properties as a threat to their business.
- Journalist and author Daniel Pinchbeck has discussed ibogaine and firsthand experience with ibogaine in his books Breaking Open the Head and its follow-up 2012: The Return of Queztcoatl [10]
- The Policy (1999) by Patrick Lynch incorporates ibogaine into the plot. One of the characters is sent to drug rehabilitation for a cocaine problem to keep him out of the way for some period of time while an insurance scam is accomplished but he opts for ibogaine therapy and returns home far earlier than anticipated only be to murdered. | https://www.wikidoc.org/index.php/Ibogaine | |
c11c334c1713451cc594bca78152c82b1bcfdc43 | wikidoc | Icaridin | Icaridin
Icaridin, also known as picaridine, KBR 3023, Bayrepel, and hydroxyethyl butyl piperidine carboxylate is an insect repellent owned and manufactured by Lanxess AG. It has a broad efficacy against different insects and is almost colorless and odorless.
The name picaridin was proposed as an International Nonproprietary Name (INN) to the World Health Organization (WHO), but the official name that has been approved by the WHO is icaridin. Bayrepel is a registered trademark of Bayer AG, Leverkusen, Germany. The product is marketed in the US in Cutter products as picaridin.
# Empirical findings
Icaridin has been reported to be as effective as DEET without the irritation associated with DEET. According to the WHO, icaridin “demonstrates excellent repellent properties comparable to, and often superior to, those of the standard DEET.” In the United States, the Centers for Disease Control and Prevention recommends using repellants based on icaridin, DEET, or oil of lemon eucalyptus (which may require more applications), for effective protection against mosquitoes that carry the West Nile virus, Eastern Equine Encephalitis and other illnesses.
Unlike DEET, icaridin does not dissolve plastics. | Icaridin
Icaridin, also known as picaridine, KBR 3023, Bayrepel, and hydroxyethyl butyl piperidine carboxylate is an insect repellent owned and manufactured by Lanxess AG. It has a broad efficacy against different insects and is almost colorless and odorless.
The name picaridin was proposed as an International Nonproprietary Name (INN) to the World Health Organization (WHO), but the official name that has been approved by the WHO is icaridin. Bayrepel is a registered trademark of Bayer AG, Leverkusen, Germany. The product is marketed in the US in Cutter products as picaridin.
# Empirical findings
Icaridin has been reported to be as effective as DEET without the irritation associated with DEET.[1] According to the WHO, icaridin “demonstrates excellent repellent properties comparable to, and often superior to, those of the standard DEET.” In the United States, the Centers for Disease Control and Prevention recommends using repellants based on icaridin, DEET, or oil of lemon eucalyptus (which may require more applications[2]), for effective protection against mosquitoes that carry the West Nile virus, Eastern Equine Encephalitis and other illnesses.
Unlike DEET, icaridin does not dissolve plastics.[3] | https://www.wikidoc.org/index.php/Icaridin | |
f9bb5bd41f096a4ab74ab28289257a11194be380 | wikidoc | Iclaprim | Iclaprim
# Overview
Iclaprim (INN), codenamed AR-100 and RO-48-2622, is a diaminopyrimidine dihydrofolate reductase (DHFR)-inhibiting extended-spectrum antibiotic active against gram positive organisms being developed for the treatment of complicated skin and soft tissue infections caused by antibiotic-resistant bacteria. It is structurally related to trimethoprim. In Phase III clinical trials, intravenously-administered iclaprim was found to be as effective as and better tolerated than linezolid in people with skin and soft tissue infections, many caused by methicillin-resistant Staphylococcus aureus (MRSA). In vitro, iclaprim is highly active against MRSA, vancomycin-resistant Staphylococcus aureus (VRSA), strains of Streptococcus pneumoniae resistant to several common antibiotics, and some Gram-negative bacteria.
A new drug application for iclaprim was filed with the U.S. Food and Drug Administration in March 2008, and a marketing authorisation application (MAA) was accepted by the European Medicines Agency on August 21, 2008. Phase II clinical trials are being conducted to assess whether iclaprim can be taken by mouth as well as intravenously and whether it is effective for the treatment of hospital-acquired pneumonia.
Iclaprim was granted fast track status by the FDA, but approval of the drug was eventually declined in 2009 and no further development has taken place since then. | Iclaprim
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Iclaprim (INN), codenamed AR-100 and RO-48-2622, is a diaminopyrimidine dihydrofolate reductase (DHFR)-inhibiting extended-spectrum antibiotic active against gram positive organisms being developed for the treatment of complicated skin and soft tissue infections caused by antibiotic-resistant bacteria.[2] It is structurally related to trimethoprim. In Phase III clinical trials, intravenously-administered iclaprim was found to be as effective as and better tolerated than linezolid in people with skin and soft tissue infections, many caused by methicillin-resistant Staphylococcus aureus (MRSA).[3][4] In vitro, iclaprim is highly active against MRSA, vancomycin-resistant Staphylococcus aureus (VRSA), strains of Streptococcus pneumoniae resistant to several common antibiotics, and some Gram-negative bacteria.[1]
A new drug application for iclaprim was filed with the U.S. Food and Drug Administration in March 2008,[3] and a marketing authorisation application (MAA) was accepted by the European Medicines Agency on August 21, 2008. Phase II clinical trials are being conducted to assess whether iclaprim can be taken by mouth as well as intravenously and whether it is effective for the treatment of hospital-acquired pneumonia.[4][5]
Iclaprim was granted fast track status by the FDA,[6] but approval of the drug was eventually declined in 2009[7] and no further development has taken place since then. | https://www.wikidoc.org/index.php/Iclaprim | |
da6f1421537915b0d07a0337d5aa6dec8b29d9f0 | wikidoc | Illicium | Illicium
Illicium (Anise-tree, Anise tree) is a genus of flowering plants containing 42 species of evergreen shrubs and small trees, and is the sole genus in family Illiciaceae. The species are native to the tropical and subtropical regions of eastern and southeastern Asia, southeastern North America, and the West Indies.
- Illicium anisatum (Japanese Star Anise). Southern Japan, Taiwan.
- Illicium arborescens. Taiwan.
- Illicium floridanum (Purple Anise or Florida Anise). Southeastern United States.
- Illicium henryi (Henry's Anise). Southwestern China.
- Illicium lanceolatum. Southern China.
- Illicium mexicanum (Mexican Anise). Mexico.
- Illicium parviflorum (Yellow Anise). Southeastern United States.
- Illicium ternstroemioides. Southern China.
- Illicium verum (Star Anise). Southern China, Vietnam.
# Uses
The fruits of Illicium verum are known as star anise, and are used as a seasoning in Chinese and southeast-Asian cooking. Japanese star anise (Illicium anisatum) is used in Japan to produce incense, but its fruits are toxic if ingested.
da:Stjerneanis-slægten
de:Sternanisgewächse
fi:Tähtianikset | Illicium
Illicium (Anise-tree, Anise tree) is a genus of flowering plants containing 42 species of evergreen shrubs and small trees, and is the sole genus in family Illiciaceae. The species are native to the tropical and subtropical regions of eastern and southeastern Asia, southeastern North America, and the West Indies.
- Illicium anisatum (Japanese Star Anise). Southern Japan, Taiwan.
- Illicium arborescens. Taiwan.
- Illicium floridanum (Purple Anise or Florida Anise). Southeastern United States.
- Illicium henryi (Henry's Anise). Southwestern China.
- Illicium lanceolatum. Southern China.
- Illicium mexicanum (Mexican Anise). Mexico.
- Illicium parviflorum (Yellow Anise). Southeastern United States.
- Illicium ternstroemioides. Southern China.
- Illicium verum (Star Anise). Southern China, Vietnam.
## Uses
The fruits of Illicium verum are known as star anise, and are used as a seasoning in Chinese and southeast-Asian cooking. Japanese star anise (Illicium anisatum) is used in Japan to produce incense, but its fruits are toxic if ingested.
Template:Fruit-tree-stub
da:Stjerneanis-slægten
de:Sternanisgewächse
fi:Tähtianikset
Template:WS | https://www.wikidoc.org/index.php/Illicium | |
838a0e49e5aea39cd213fcc92972778df2a1946a | wikidoc | Iloprost | Iloprost
## Pulmonary arterial hypertension
- Indication
- Iloprost® is indicated for the treatment of pulmonary arterial hypertension (PAH) (WHO Group 1) to improve a composite endpoint consisting of exercise tolerance, symptoms (NYHA Class), and lack of deterioration. Studies establishing effectiveness included predominately patients with NYHA Functional Class III-IV symptoms and etiologies of idiopathic or heritable PAH (65%) or PAH associated with connective tissue diseases (23%)
- Dosing information
- Iloprost is intended to be inhaled using the I-neb® AAD® System. The first inhaled dose should be 2.5 mcg (as delivered at the mouthpiece).
- If this dose is well tolerated, dosing should be increased to 5.0 mcg and maintained at that dose;
- otherwise maintain the dose at 2.5 mcg.
- Frequency: 6 to 9 times per day (no more than once every 2 hours) during waking hours, according to individual need and tolerability.
- The maximum daily dose evaluated in clinical studies was 45 mcg (5 mcg 9 times per day).
- Direct mixing of Iloprost with other medications in the I-neb® AAD® System has not been evaluated; do not mix with other medications.
- To avoid potential interruptions in drug delivery due to equipment malfunctions, the patient should have easy access to a back-up I-neb®AAD® System.
- Iloprost is supplied in 1 mL ampules in two concentrations: 10 mcg/mL and 20 mcg/mL.
Use in Patients with Pre-existing Hepatic Impairment
- Dosing information
- Because iloprost elimination is reduced in patients with impaired liver function , consider increasing the dosing interval (e.g., 3-4 hours between doses depending on the patient's response at the end of the dose interval) in patients with Child-Pugh Class B or C hepatic impairment.
## Use in Patients with Pre-existing Renal Impairment
- Dosing information
- Dose adjustment is not required in patients who are not on dialysis. The effect of dialysis on iloprost is unknown
## Radiographic contrast agent nephropathy
- Dosing information
- 0.5 nanograms/kg/min (ng/kg/min) 30 to 90 minutes prior to contrast administration
## Transient osteoporosis
- Dosing information
- 50 mcg (reduced to 25 mcg and then 20 mcg due to adverse effects) in 500 mL of sodium chloride solution administered IV over 6 hours on 5 consecutive days.
- 50 mcg 3 times daily for 3 days
## Risk of Syncope
Monitor vital signs while initiating Iloprost. Do not initiate Iloprost in patients with systolic blood pressure below 85 mmHg. Syncope can also occur in association with pulmonary arterial hypertension, particularly in association with physical exertion. The occurrence of exertional syncope may reflect a therapeutic gap or insufficient efficacy, and the need to adjust dose or change therapy should be considered.
## Pulmonary Venous Hypertension
Should signs of pulmonary edema occur when inhaled Iloprost is administered in patients with pulmonary hypertension, stop treatment immediately, as this may be a sign of pulmonary venous hypertension.
## Bronchospasm
Iloprost inhalation can induce bronchospasm. Bronchospasm may be more severe or frequent in patients with a history of hyperreactive airways. Iloprost has not been evaluated in patients with chronic obstructive pulmonary disease (COPD), severe asthma, or with acute pulmonary infections.
Pre-marketing safety data on Iloprost were obtained from 215 patients with pulmonary arterial hypertension receiving iloprost in two 12-week clinical trials and two long-term extensions. Patients received inhaled Iloprost for periods of from 1 day to more than 3 years. The median number of weeks of exposure was 15. Forty patients completed 12 months of open-label treatment with iloprost.
The following table shows adverse events reported by at least 4 Iloprost patients and reported at least 3% more frequently for Iloprost patients than placebo patients in the 12-week placebo-controlled study.
Pre-marketing serious adverse events reported with the use of inhaled Iloprost and not shown in Table 1 include congestive heart failure, chest pain, supraventricular tachycardia, dyspnea, peripheral edema, and kidney failure.
In a small clinical trial (the STEP trial) , safety trends in patients receiving concomitant bosentan and Iloprost were consistent with those observed in the larger experience of the Phase 3 study in patients receiving only Iloprost or bosentan.
## Adverse events with higher doses
In a study in healthy subjects (n=160), inhaled doses of iloprost solution were given every 2 hours, beginning with 5 mcg and increasing up to 20 mcg for a total of 6 dose inhalations (total cumulative dose of 70 mcg) or up to the highest dose tolerated in a subgroup of 40 subjects. There were 13 subjects (32%) who failed to reach the highest scheduled dose (20 mcg). Five were unable to increase the dose because of (mild to moderate) transient chest pain/discomfort/tightness, usually accompanied by headache, nausea, and dizziness. The remaining 8 subjects discontinued for other reasons.
Cases of bronchospasm and wheezing have been reported, particularly in patients with a history of hyperreactive airways . Bleeding events most commonly reported as epistaxis and hemoptysis were observed on Iloprost treatment . Cases of thrombocytopenia, dizziness, diarrhea, mouth and tongue irritation, nasal congestion, dysgeusia, hypersensitivity, and rash have also been reported with the use of Iloprost.
# Cytochrome P450
Although clinical studies have not been conducted with Iloprost (inhaled iloprost), in vitro studies of iloprost indicate that no relevant inhibition of cytochrome P450 drug metabolism would be expected.
# Antihypertensives and Vasodilators
In studies in normal subjects, there was no pharmacodynamic interaction between intravenous iloprost and either nifedipine, diltiazem, or captopril. However, Iloprost has the potential to increase the hypotensive effect of vasodilators and antihypertensive agents.
# Anticoagulants and Platelet Inhibitors
Since Iloprost inhibits platelet function, there is a potential for increased risk of bleeding, particularly in patients maintained on anticoagulants or platelet inhibitors.
In developmental toxicity studies in pregnant Han-Wistar rats, continuous intravenous administration of iloprost at a dosage of 0.01 mg/kg daily (serum levels not available) led to shortened digits of the thoracic extremity in fetuses and pups. In comparable studies in pregnant Sprague-Dawley rats which received iloprost clathrate (13% iloprost by weight) orally at dosages of up to 50 mg/kg/day (Cmax of 90 ng/mL), in pregnant rabbits at intravenous dosages of up to 0.5 mg/kg/day (Cmax of 86 ng/mL), and in pregnant monkeys at dosages of up to 0.04 mg/kg/day (serum levels of 1 ng/mL), no such digital anomalies or other gross-structural abnormalities were observed in the fetuses/pups. However, in gravid Sprague-Dawley rats, iloprost clathrate (13% iloprost) significantly increased the number of non-viable fetuses at a maternally toxic oral dosage of 250 mg/kg/day and in Han-Wistar rats was found to be embryolethal in 15 of 44 litters at an intravenous dosage of 1 mg/kg/day.
For the 10 mcg/mL solution, one mL of the solution contains 0.01 mg iloprost, 0.81 mg ethanol, 0.121 mg tromethamine, 9.0 mg sodium chloride, and approximately 0.51 mg hydrochloric acid (for pH adjustment to 8.1) in water for injection.
For the 20 mcg/mL solution, one mL of the solution contains 0.02 mg iloprost, 1.62 mg ethanol, 0.242 mg tromethamine, 9.0 mg sodium chloride, and approximately 0.76 mg hydrochloric acid (for pH adjustment to 8.4) in water for injection.
The solution contains no preservatives.
The chemical name for iloprost is (E)-(3aS, 4R, 5R, 6aS)-hexahydro-5-hydroxy-4--Δ2(1H),Δ-pentalenevaleric acid. Iloprost consists of a mixture of the 4R and 4S diastereoisomers at a ratio of approximately 53:47. Iloprost is an oily substance, which is soluble in methanol, ethanol, ethyl acetate, acetone, and pH 7 buffer, sparingly soluble in buffer pH 9, and very slightly soluble in distilled water, buffer pH 3, and buffer pH 5. The molecular formula of iloprost is C22H32O4. Its relative molecular weight is 360.49. The structural formula is shown below:
Iloprost administered intravenously has linear pharmacokinetics over the dose range of 1 to 3 ng/kg/min. The half-life of iloprost is 20 to 30 minutes. Following inhalation of iloprost (5 mcg) patients with pulmonary hypertension have iloprost peak plasma levels of approximately 150 pg/mL. Iloprost was generally not detectable in plasma 30 minutes to 1 hour after inhalation.
Absorption and Distribution: The absolute bioavailability of inhaled iloprost has not been determined. Following intravenous infusion, the apparent steady-state volume of distribution was 0.7 to 0.8 L/kg in healthy subjects. Iloprost is approximately 60% protein-bound, mainly to albumin, and this ratio is concentration-independent in the range of 30 to 3000 pg/mL.
Metabolism and Excretion: In vitro studies reveal that cytochrome P450-dependent metabolism plays only a minor role in the biotransformation of iloprost. Iloprost is metabolized principally via β-oxidation of the carboxyl side chain. The main metabolite is tetranor-iloprost, which is found in the urine in free and conjugated form. In animal experiments, tetranor-iloprost was pharmacologically inactive.
Clearance in normal subjects was approximately 20 mL/min/kg.
A mass-balance study using intravenously and orally administered -iloprost in healthy subjects (n=8) showed recovery of 81% of total radioactivity over 14 hours post-dose, with 68% and 12% recoveries in urine and feces, respectively.
Iloprost was not mutagenic in bacterial and mammalian cells in the presence or absence of extrinsic metabolic activation. Iloprost did not cause chromosomal aberrations in vitro in human lymphocytes and was not clastogenic in vivo in NMRI/SPF mice. There was no evidence of a tumorigenic effect of iloprost clathrate (13% iloprost by weight) in Sprague-Dawley rats dosed orally for up to 8 months at doses of up to 125 mg/kg/day (Cmax of 45 ng/mL serum), followed by 16 months at 100 mg/kg/day, or in Crl:CD-1®(ICR)BR albino mice dosed orally for up to 24 months at doses of up to 125 mg/kg/day (Cmax of 156 ng/mL serum). The recommended clinical dosage regimen for iloprost (5 mcg) affords a serum Cmax of 0.16 ng/mL. Fertility of males or females was not impaired in Han-Wistar rats at intravenous doses up to 1 mg/kg/day.
The primary efficacy endpoint was clinical response at 12 weeks, a composite endpoint defined by: a) improvement in exercise ability (6-minute walk test) by at least 10% versus baseline evaluated 30 minutes after dosing, b) improvement by at least one NYHA class versus baseline, and c) no death or deterioration of pulmonary hypertension. Deterioration required two or more of the following criteria: 1) refractory systolic blood pressure 100 U/L, or total bilirubin ≥ 5 mg/dL), 4) rapidly progressive cardiogenic renal failure (e.g., decrease of estimated creatinine clearance to ≤ 50% of baseline), 5) decrease in 6-minute walking distance by ≥ 30% of baseline value, 6) new long-term need for i.v. catecholamines or diuretics, 7) cardiac index ≤ 1.3 L/min/m2, 8) CVP ≥ 22 mmHg despite adequate diuretic therapy, and 9) SVO2 ≤ 45% despite nasal O2 therapy.
Although effectiveness was seen in the full population (response rates for the primary composite endpoint of 17% and 5%; p=0.007), there was inadequate evidence of benefit in patients with pulmonary hypertension associated with chronic thromboembolic disease (WHO Group 4); the results presented are therefore those related to patients with PAH (WHO Group 1). The response rate for the primary efficacy endpoint among PAH patients was 19% for the iloprost group, compared with 4% for the placebo group (p=0.0033). All three components of the composite endpoint favored iloprost (Figure 1).
The absolute change in 6-minute walk distance (Figure 2) measured (using all available data and no imputation) 30 minutes after inhalation among patients with PAH was greater in the iloprost group compared to the placebo group at all time points. At Week 12, the placebo-corrected difference was 40 meters (p<0.01). When walk distance was measured immediately prior to inhalation, the improvement compared to placebo was approximately 60% of the effect seen at 30 minutes after inhalation.
The effect of Iloprost in various subgroups is shown in Table 2.
Hemodynamic assessments obtained at week 12 before inhalation in both groups (at least 2 hours after a previous dose, trough) and after inhalation in the iloprost group (approximately 15 minutes after a dose, peak), are shown in Table 3. The relationship between hemodynamic changes and clinical effects is unknown.
In a small, randomized, double-blind, placebo-controlled study (the STEP trial), 34 patients treated with bosentan 125 mg bid for at least 16 weeks tolerated the addition of inhaled iloprost (up to 5 mcg 6 to 9 times per day during waking hours). The mean daily inhaled dose was 27 mcg and the mean number of inhalations per day was 5.6.
1 mL ampule containing iloprost 10 mcg per mL, carton of 30 (NDC 66215-302-30)
1 mL ampule containing iloprost 20 mcg per mL, carton of 30 (NDC 66215-303-30)
Excursions permitted to 15 – 30°C (59 – 86°F)
Advise patients that they may have a fall in blood pressure with Iloprost, so they may become dizzy or even faint. They should stand up slowly when they get out of a chair or bed. If fainting gets worse, patients should consult their physicians about dose adjustment.
Advise patients that Iloprost should be inhaled at intervals of not less than 2 hours and that the acute benefits of Iloprost may not last 2 hours. Thus patients may want to adjust times of administration to cover planned activities.
- ↑ Spargias K, Adreanides E, Demerouti E, Gkouziouta A, Manginas A, Pavlides G; et al. (2009). "] in patients with ] undergoing ] or ]". Circulation. 120 (18): 1793–9. doi:10.1161/CIRCULATIONAHA.109.863159. PMID 19841299. URL–wikilink conflict (help)CS1 maint: Explicit use of et al. (link) CS1 maint: Multiple names: authors list (link) .mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}
- ↑ Meizer R, Radda C, Stolz G, Kotsaris S, Petje G, Krasny C; et al. (2005). "MRI-controlled analysis of 104 patients with painful bone marrow edema in different joint localizations treated with the prostacyclin analogue iloprost". Wien Klin Wochenschr. 117 (7–8): 278–86. PMID 15926619.CS1 maint: Explicit use of et al. (link) CS1 maint: Multiple names: authors list (link)
- ↑ Mayerhoefer ME, Kramer J, Breitenseher MJ, Norden C, Vakil-Adli A, Hofmann S; et al. (2007). "Short-term outcome of painful bone marrow oedema of the knee following oral treatment with iloprost or tramadol: results of an exploratory phase II study of 41 patients". Rheumatology (Oxford). 46 (9): 1460–5. doi:10.1093/rheumatology/kem172. PMID 17636179.CS1 maint: Explicit use of et al. (link) CS1 maint: Multiple names: authors list (link) | Iloprost
### Pulmonary arterial hypertension
- Indication
- Iloprost® is indicated for the treatment of pulmonary arterial hypertension (PAH) (WHO Group 1) to improve a composite endpoint consisting of exercise tolerance, symptoms (NYHA Class), and lack of deterioration. Studies establishing effectiveness included predominately patients with NYHA Functional Class III-IV symptoms and etiologies of idiopathic or heritable PAH (65%) or PAH associated with connective tissue diseases (23%)
- Dosing information
- Iloprost is intended to be inhaled using the I-neb® AAD® System. The first inhaled dose should be 2.5 mcg (as delivered at the mouthpiece).
- If this dose is well tolerated, dosing should be increased to 5.0 mcg and maintained at that dose;
- otherwise maintain the dose at 2.5 mcg.
- Frequency: 6 to 9 times per day (no more than once every 2 hours) during waking hours, according to individual need and tolerability.
- The maximum daily dose evaluated in clinical studies was 45 mcg (5 mcg 9 times per day).
- Direct mixing of Iloprost with other medications in the I-neb® AAD® System has not been evaluated; do not mix with other medications.
- To avoid potential interruptions in drug delivery due to equipment malfunctions, the patient should have easy access to a back-up I-neb®AAD® System.
- Iloprost is supplied in 1 mL ampules in two concentrations: 10 mcg/mL and 20 mcg/mL.
Use in Patients with Pre-existing Hepatic Impairment
- Dosing information
- Because iloprost elimination is reduced in patients with impaired liver function , consider increasing the dosing interval (e.g., 3-4 hours between doses depending on the patient's response at the end of the dose interval) in patients with Child-Pugh Class B or C hepatic impairment.
### Use in Patients with Pre-existing Renal Impairment
- Dosing information
- Dose adjustment is not required in patients who are not on dialysis. The effect of dialysis on iloprost is unknown
### Radiographic contrast agent nephropathy
- Dosing information
- 0.5 nanograms/kg/min (ng/kg/min) 30 to 90 minutes prior to contrast administration [1]
### Transient osteoporosis
- Dosing information
- 50 mcg (reduced to 25 mcg and then 20 mcg due to adverse effects) in 500 mL of sodium chloride solution administered IV over 6 hours on 5 consecutive days. [2]
- 50 mcg 3 times daily for 3 days [3]
### Risk of Syncope
Monitor vital signs while initiating Iloprost. Do not initiate Iloprost in patients with systolic blood pressure below 85 mmHg. Syncope can also occur in association with pulmonary arterial hypertension, particularly in association with physical exertion. The occurrence of exertional syncope may reflect a therapeutic gap or insufficient efficacy, and the need to adjust dose or change therapy should be considered.
### Pulmonary Venous Hypertension
Should signs of pulmonary edema occur when inhaled Iloprost is administered in patients with pulmonary hypertension, stop treatment immediately, as this may be a sign of pulmonary venous hypertension.
### Bronchospasm
Iloprost inhalation can induce bronchospasm. Bronchospasm may be more severe or frequent in patients with a history of hyperreactive airways. Iloprost has not been evaluated in patients with chronic obstructive pulmonary disease (COPD), severe asthma, or with acute pulmonary infections.
Pre-marketing safety data on Iloprost were obtained from 215 patients with pulmonary arterial hypertension receiving iloprost in two 12-week clinical trials and two long-term extensions. Patients received inhaled Iloprost for periods of from 1 day to more than 3 years. The median number of weeks of exposure was 15. Forty patients completed 12 months of open-label treatment with iloprost.
The following table shows adverse events reported by at least 4 Iloprost patients and reported at least 3% more frequently for Iloprost patients than placebo patients in the 12-week placebo-controlled study.
Pre-marketing serious adverse events reported with the use of inhaled Iloprost and not shown in Table 1 include congestive heart failure, chest pain, supraventricular tachycardia, dyspnea, peripheral edema, and kidney failure.
In a small clinical trial (the STEP trial) , safety trends in patients receiving concomitant bosentan and Iloprost were consistent with those observed in the larger experience of the Phase 3 study in patients receiving only Iloprost or bosentan.
### Adverse events with higher doses
In a study in healthy subjects (n=160), inhaled doses of iloprost solution were given every 2 hours, beginning with 5 mcg and increasing up to 20 mcg for a total of 6 dose inhalations (total cumulative dose of 70 mcg) or up to the highest dose tolerated in a subgroup of 40 subjects. There were 13 subjects (32%) who failed to reach the highest scheduled dose (20 mcg). Five were unable to increase the dose because of (mild to moderate) transient chest pain/discomfort/tightness, usually accompanied by headache, nausea, and dizziness. The remaining 8 subjects discontinued for other reasons.
Cases of bronchospasm and wheezing have been reported, particularly in patients with a history of hyperreactive airways . Bleeding events most commonly reported as epistaxis and hemoptysis were observed on Iloprost treatment . Cases of thrombocytopenia, dizziness, diarrhea, mouth and tongue irritation, nasal congestion, dysgeusia, hypersensitivity, and rash have also been reported with the use of Iloprost.
## Cytochrome P450
Although clinical studies have not been conducted with Iloprost (inhaled iloprost), in vitro studies of iloprost indicate that no relevant inhibition of cytochrome P450 drug metabolism would be expected.
## Antihypertensives and Vasodilators
In studies in normal subjects, there was no pharmacodynamic interaction between intravenous iloprost and either nifedipine, diltiazem, or captopril. However, Iloprost has the potential to increase the hypotensive effect of vasodilators and antihypertensive agents.
## Anticoagulants and Platelet Inhibitors
Since Iloprost inhibits platelet function, there is a potential for increased risk of bleeding, particularly in patients maintained on anticoagulants or platelet inhibitors.
In developmental toxicity studies in pregnant Han-Wistar rats, continuous intravenous administration of iloprost at a dosage of 0.01 mg/kg daily (serum levels not available) led to shortened digits of the thoracic extremity in fetuses and pups. In comparable studies in pregnant Sprague-Dawley rats which received iloprost clathrate (13% iloprost by weight) orally at dosages of up to 50 mg/kg/day (Cmax of 90 ng/mL), in pregnant rabbits at intravenous dosages of up to 0.5 mg/kg/day (Cmax of 86 ng/mL), and in pregnant monkeys at dosages of up to 0.04 mg/kg/day (serum levels of 1 ng/mL), no such digital anomalies or other gross-structural abnormalities were observed in the fetuses/pups. However, in gravid Sprague-Dawley rats, iloprost clathrate (13% iloprost) significantly increased the number of non-viable fetuses at a maternally toxic oral dosage of 250 mg/kg/day and in Han-Wistar rats was found to be embryolethal in 15 of 44 litters at an intravenous dosage of 1 mg/kg/day.
For the 10 mcg/mL solution, one mL of the solution contains 0.01 mg iloprost, 0.81 mg ethanol, 0.121 mg tromethamine, 9.0 mg sodium chloride, and approximately 0.51 mg hydrochloric acid (for pH adjustment to 8.1) in water for injection.
For the 20 mcg/mL solution, one mL of the solution contains 0.02 mg iloprost, 1.62 mg ethanol, 0.242 mg tromethamine, 9.0 mg sodium chloride, and approximately 0.76 mg hydrochloric acid (for pH adjustment to 8.4) in water for injection.
The solution contains no preservatives.
The chemical name for iloprost is (E)-(3aS, 4R, 5R, 6aS)-hexahydro-5-hydroxy-4-[(E)-(3S,4RS)-3-hydroxy-4-methyl-1-octen-6-ynyl]-Δ2(1H),Δ-pentalenevaleric acid. Iloprost consists of a mixture of the 4R and 4S diastereoisomers at a ratio of approximately 53:47. Iloprost is an oily substance, which is soluble in methanol, ethanol, ethyl acetate, acetone, and pH 7 buffer, sparingly soluble in buffer pH 9, and very slightly soluble in distilled water, buffer pH 3, and buffer pH 5. The molecular formula of iloprost is C22H32O4. Its relative molecular weight is 360.49. The structural formula is shown below:
Iloprost administered intravenously has linear pharmacokinetics over the dose range of 1 to 3 ng/kg/min. The half-life of iloprost is 20 to 30 minutes. Following inhalation of iloprost (5 mcg) patients with pulmonary hypertension have iloprost peak plasma levels of approximately 150 pg/mL. Iloprost was generally not detectable in plasma 30 minutes to 1 hour after inhalation.
Absorption and Distribution: The absolute bioavailability of inhaled iloprost has not been determined. Following intravenous infusion, the apparent steady-state volume of distribution was 0.7 to 0.8 L/kg in healthy subjects. Iloprost is approximately 60% protein-bound, mainly to albumin, and this ratio is concentration-independent in the range of 30 to 3000 pg/mL.
Metabolism and Excretion: In vitro studies reveal that cytochrome P450-dependent metabolism plays only a minor role in the biotransformation of iloprost. Iloprost is metabolized principally via β-oxidation of the carboxyl side chain. The main metabolite is tetranor-iloprost, which is found in the urine in free and conjugated form. In animal experiments, tetranor-iloprost was pharmacologically inactive.
Clearance in normal subjects was approximately 20 mL/min/kg.
A mass-balance study using intravenously and orally administered [3H]-iloprost in healthy subjects (n=8) showed recovery of 81% of total radioactivity over 14 hours post-dose, with 68% and 12% recoveries in urine and feces, respectively.
Iloprost was not mutagenic in bacterial and mammalian cells in the presence or absence of extrinsic metabolic activation. Iloprost did not cause chromosomal aberrations in vitro in human lymphocytes and was not clastogenic in vivo in NMRI/SPF mice. There was no evidence of a tumorigenic effect of iloprost clathrate (13% iloprost by weight) in Sprague-Dawley rats dosed orally for up to 8 months at doses of up to 125 mg/kg/day (Cmax of 45 ng/mL serum), followed by 16 months at 100 mg/kg/day, or in Crl:CD-1®(ICR)BR albino mice dosed orally for up to 24 months at doses of up to 125 mg/kg/day (Cmax of 156 ng/mL serum). The recommended clinical dosage regimen for iloprost (5 mcg) affords a serum Cmax of 0.16 ng/mL. Fertility of males or females was not impaired in Han-Wistar rats at intravenous doses up to 1 mg/kg/day.
The primary efficacy endpoint was clinical response at 12 weeks, a composite endpoint defined by: a) improvement in exercise ability (6-minute walk test) by at least 10% versus baseline evaluated 30 minutes after dosing, b) improvement by at least one NYHA class versus baseline, and c) no death or deterioration of pulmonary hypertension. Deterioration required two or more of the following criteria: 1) refractory systolic blood pressure < 85 mmHg, 2) worsening of right heart failure with cardiac edema, ascites, or pleural effusion despite adequate background therapy, 3) rapidly progressive cardiogenic hepatic failure (e.g., leading to an increase of GOT or GPT to > 100 U/L, or total bilirubin ≥ 5 mg/dL), 4) rapidly progressive cardiogenic renal failure (e.g., decrease of estimated creatinine clearance to ≤ 50% of baseline), 5) decrease in 6-minute walking distance by ≥ 30% of baseline value, 6) new long-term need for i.v. catecholamines or diuretics, 7) cardiac index ≤ 1.3 L/min/m2, 8) CVP ≥ 22 mmHg despite adequate diuretic therapy, and 9) SVO2 ≤ 45% despite nasal O2 therapy.
Although effectiveness was seen in the full population (response rates for the primary composite endpoint of 17% and 5%; p=0.007), there was inadequate evidence of benefit in patients with pulmonary hypertension associated with chronic thromboembolic disease (WHO Group 4); the results presented are therefore those related to patients with PAH (WHO Group 1). The response rate for the primary efficacy endpoint among PAH patients was 19% for the iloprost group, compared with 4% for the placebo group (p=0.0033). All three components of the composite endpoint favored iloprost (Figure 1).
The absolute change in 6-minute walk distance (Figure 2) measured (using all available data and no imputation) 30 minutes after inhalation among patients with PAH was greater in the iloprost group compared to the placebo group at all time points. At Week 12, the placebo-corrected difference was 40 meters (p<0.01). When walk distance was measured immediately prior to inhalation, the improvement compared to placebo was approximately 60% of the effect seen at 30 minutes after inhalation.
The effect of Iloprost in various subgroups is shown in Table 2.
Hemodynamic assessments obtained at week 12 before inhalation in both groups (at least 2 hours after a previous dose, trough) and after inhalation in the iloprost group (approximately 15 minutes after a dose, peak), are shown in Table 3. The relationship between hemodynamic changes and clinical effects is unknown.
In a small, randomized, double-blind, placebo-controlled study (the STEP trial), 34 patients treated with bosentan 125 mg bid for at least 16 weeks tolerated the addition of inhaled iloprost (up to 5 mcg 6 to 9 times per day during waking hours). The mean daily inhaled dose was 27 mcg and the mean number of inhalations per day was 5.6.
1 mL ampule containing iloprost 10 mcg per mL, carton of 30 (NDC 66215-302-30)
1 mL ampule containing iloprost 20 mcg per mL, carton of 30 (NDC 66215-303-30)
Excursions permitted to 15 – 30°C (59 – 86°F)
[See USP Controlled Room Temperature]
Advise patients that they may have a fall in blood pressure with Iloprost, so they may become dizzy or even faint. They should stand up slowly when they get out of a chair or bed. If fainting gets worse, patients should consult their physicians about dose adjustment.
Advise patients that Iloprost should be inhaled at intervals of not less than 2 hours and that the acute benefits of Iloprost may not last 2 hours. Thus patients may want to adjust times of administration to cover planned activities.
- ↑ Spargias K, Adreanides E, Demerouti E, Gkouziouta A, Manginas A, Pavlides G; et al. (2009). "[[contrast-induced nephropathy]] in patients with [[renal dysfunction]] undergoing [[coronary angiography]] or [[coronary intervention|intervention]]". Circulation. 120 (18): 1793–9. doi:10.1161/CIRCULATIONAHA.109.863159. PMID 19841299. URL–wikilink conflict (help)CS1 maint: Explicit use of et al. (link) CS1 maint: Multiple names: authors list (link) .mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/d/d6/Lock-gray-alt-2.svg/9px-Lock-gray-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/a/aa/Lock-red-alt-2.svg/9px-Lock-red-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}
- ↑ Meizer R, Radda C, Stolz G, Kotsaris S, Petje G, Krasny C; et al. (2005). "MRI-controlled analysis of 104 patients with painful bone marrow edema in different joint localizations treated with the prostacyclin analogue iloprost". Wien Klin Wochenschr. 117 (7–8): 278–86. PMID 15926619.CS1 maint: Explicit use of et al. (link) CS1 maint: Multiple names: authors list (link)
- ↑ Mayerhoefer ME, Kramer J, Breitenseher MJ, Norden C, Vakil-Adli A, Hofmann S; et al. (2007). "Short-term outcome of painful bone marrow oedema of the knee following oral treatment with iloprost or tramadol: results of an exploratory phase II study of 41 patients". Rheumatology (Oxford). 46 (9): 1460–5. doi:10.1093/rheumatology/kem172. PMID 17636179.CS1 maint: Explicit use of et al. (link) CS1 maint: Multiple names: authors list (link) | https://www.wikidoc.org/index.php/Iloprost | |
34ac6f28cf0b59de9cbf39294171555a10ea8c76 | wikidoc | Imipenem | Imipenem
Imipenem is an intravenous beta-lactam antibiotic developed in 1985.
Imipenem belongs to the subgroup of carbapenems. It is derived from a compound called thienamycin, which is produced by the bacteria Streptomyces cattleya. Imipenem has a broad spectrum of activity against aerobic and anaerobic Gram positive as well as Gram negative bacteria. It is particularly important for its activity against Pseudomonas aeruginosa and the Enterococcus species. It is not active against methicillin-resistant Staphylococcus aureus, however. Imipenem and other drugs in the carbapenem class are commonly referred to as "magic bullets." Their use is typically restricted in order to avoid widespread bacterial resistance.
# Method of action
Imipenem acts as an antimicrobial through inhibiting cell wall synthesis of various gram-positive and gram-negative bacteria. It remains very stable in the presence of beta-lactamase (both penicillinase and cephalosporinase) produced by some bacteria, and is a strong inhibitor of beta-lactamases from some gram-negative bacteria that are resistant to most beta-lactam antibiotics.
# Co-administration with cilastatin
Imipenem is rapidly degraded by the renal enzyme dehydropeptidase when administered alone, and is always co-administered with cilastatin to prevent this inactivation.
# Adverse effects
Common adverse drug reactions are nausea and vomiting. People who are allergic to penicillin and other beta-lactam antibiotics should not take imipenem. Imipenem can also cause seizures. | Imipenem
Imipenem is an intravenous beta-lactam antibiotic developed in 1985.
Imipenem belongs to the subgroup of carbapenems. It is derived from a compound called thienamycin, which is produced by the bacteria Streptomyces cattleya. Imipenem has a broad spectrum of activity against aerobic and anaerobic Gram positive as well as Gram negative bacteria. It is particularly important for its activity against Pseudomonas aeruginosa and the Enterococcus species. It is not active against methicillin-resistant Staphylococcus aureus, however. Imipenem and other drugs in the carbapenem class are commonly referred to as "magic bullets." Their use is typically restricted in order to avoid widespread bacterial resistance.
# Method of action
Imipenem acts as an antimicrobial through inhibiting cell wall synthesis of various gram-positive and gram-negative bacteria. It remains very stable in the presence of beta-lactamase (both penicillinase and cephalosporinase) produced by some bacteria, and is a strong inhibitor of beta-lactamases from some gram-negative bacteria that are resistant to most beta-lactam antibiotics.
# Co-administration with cilastatin
Imipenem is rapidly degraded by the renal enzyme dehydropeptidase when administered alone, and is always co-administered with cilastatin to prevent this inactivation.
# Adverse effects
Common adverse drug reactions are nausea and vomiting. People who are allergic to penicillin and other beta-lactam antibiotics should not take imipenem. Imipenem can also cause seizures. | https://www.wikidoc.org/index.php/Imipenem | |
55502e9c9ee1da89c2f958511283dbcf97022eb3 | wikidoc | Importin | Importin
Importin is a type of karyopherin that transports protein molecules into the nucleus by binding to specific recognition sequences, called nuclear localization sequences (NLS).
Importin has two subunits, importin α and importin β. Members of the importin-β family can bind and transport cargo by themselves, or can form heterodimers with importin-α. As part of a heterodimer, importin-β mediates interactions with the pore complex, while importin-α acts as an adaptor protein to bind the nuclear localisation signal (NLS) on the cargo. The NLS-Importin α-Importin β trimer dissociates after binding to Ran GTP inside the nucleus, with the two importin proteins being recycled to the cytoplasm for further use.
# Discovery
Importin can exist as either a heterodimer of importin-α/β or as a monomer of Importin-β. Importin-α was first isolated in 1994 by a group including Enno Hartmann, based at the Max Delbrück Center for Molecular Medicine. The process of nuclear protein import had already been characterised in previous reviews, but the key proteins involved had not been elucidated up until that point. A 60kDa cytosolic protein, essential for protein import into the nucleus, and with a 44% sequence identity to SRP1p, was purified from Xenopus eggs. It was cloned, sequenced and expressed in E.coli and in order to completely reconstitute signal dependent transport, had to be combined with Ran(TC4). Other key stimulatory factors were also found in the study.
Importin-β, unlike importin-α, has no direct homologues in yeast, but was purified as a 90-95kDa protein and found to form a heterodimer with importin-α in a number of different cases. These included a study led by Michael Rexach
and further studies by Dirk Görlich. These groups found that importin-α requires another protein, importin-β to function, and that together they form a receptor for nuclear localization signals (NLS), thus allowing transport into the nucleus. Since these initial discoveries in 1994 and 1995, a host of Importin genes, such as IPO4 and IPO7, have been found that facilitate the import of slightly different cargo proteins, due to their differing structure and locality.
# Structure
## Importin-α
A large proportion of the importin-α adaptor protein is made up of several armadillo repeats (ARM) arranged in tandem. These repeats can stack together to form a curved shaped structure, which facilitates binding to the NLS of specific cargo proteins. The major NLS binding site is found towards the N-terminus, with a minor site being found at the C-terminus. As well as the ARM structures, Importin-α also contains a 90 amino acid N-terminal region, responsible for binding to Importin-β, known as IBB (Importin-β binding domain). This is also a site of autoinhibition, and is implicated in the release of cargo once importin-α reaches the nucleus.
## Importin-β
Importin-β is the typical structure of a larger superfamily of karyopherins. The basis of their structure is 18-20 tandem repeats of the HEAT motif. Each one of these repeats contains two antiparallel alpha helices linked by a turn, which stack together to form the overall structure of the protein.
In order to transport cargo into the nucleus, importin-β must associate with the nuclear pore complexes. It does this by forming weak, transient bonds with nucleoporins at their various FG (Phe-Gly) motifs. Crystallographic analysis has shown that these motifs bind to importin-β at shallow hydrophobic pockets found on its surface.
# Nuclear protein import cycle
The primary function of importin is to mediate the translocation of proteins with nuclear localization signals into the nucleus, through nuclear pore complexes (NPC), in a process known as the nuclear protein import cycle.
## Cargo binding
The first step of this cycle is the binding of cargo. Importin can perform this function as a monomeric importin-β protein, but usually requires the presence of importin-α, which acts as an adaptor to cargo proteins (via interactions with the NLS). The NLS is a sequence of basic amino acids that tags the protein as cargo destined for the nucleus. A cargo protein can contain either one or two of these motifs, which will bind to the major and/or minor binding sites on importin-α.
## Cargo transport
Once the cargo protein is bound, importin-β interacts with the NPC, and the complex diffuses into the nucleus from the cytoplasm. The rate of diffusion depends on both the concentration of importin-α present in the cytoplasm and also the binding affinity of importin-α to the cargo. Once inside the nucleus, the complex interacts with the Ras-family GTPase, Ran-GTP. This leads to the dissociation of the complex by altering the conformation of Importin-β. Importin-β is left bound to Ran-GTP, ready to be recycled.
## Cargo release
Now that the importin-α/cargo complex is free of importin-β, the cargo protein can be released into the nucleus. The N-terminal importin-β-binding (IBB) domain of importin-α contains an auto-regulatory region that mimics the NLS motif. The release of importin-β frees this region and allows it to loop back and compete for binding with the cargo protein at the major NLS-binding site. This competition leads to the release of the protein. In some cases, specific release factors such as Nup2 and Nup50 can be employed to help release the cargo as well.
## Recycling
Finally, in order to return to the cytoplasm, importin-α must associate with a Ran-GTP/CAS (nuclear export factor) complex which facilitates its exit from the nucleus. CAS (cellular apoptosis susceptibility protein) is part of the importin-β superfamily of karyopherins and is defined as a nuclear export factor. Importin-β returns to the cytoplasm, still bound to Ran-GTP. Once in the cytoplasm, Ran-GTP is hydrolysed by RanGAP, forming Ran-GDP, and releasing the two importins for further activity. It is this hydrolysis of GTP that provides the energy for the cycle as a whole. In the nucleus, a GEF will charge Ran with a GTP molecule, which is then hydrolysed by a GAP in the cytoplasm, as stated above. It is this activity of Ran that allows for the unidirectional transport of proteins.
# Disease
There are several disease states and pathologies that are associated with mutations or changes in expression of importin-α and importin-β.
Importins are vital regulatory proteins during the processes of gametogenesis and embryogenesis. As a result, a disruption in the expression patterns of importin-α has been shown to cause fertility defects in Drosophila melanogaster.
There have also been studies that link altered importin-α to some cases of cancer. Breast cancer studies have implicated a truncated form of importin-α in which the NLS binding domain is missing. In addition, importin-α has been shown to transport the tumour suppressor gene, BRCA1 (breast cancer type 1 susceptibility protein), into the nucleus. The overexpression of importin-α has also been linked with poor survival rates seen in certain melanoma patients.
Importin activity is also associated with some viral pathologies. For instance, in the infection pathway of the Ebola virus, a key step is the inhibition of the nuclear import of PY-STAT1. This is achieved by the virus sequestering importin-α in the cytoplasm, meaning it can no longer bind its cargo at the NLS. As a result, importin cannot function and the cargo protein stays in the cytoplasm.
# Types of cargo
Many different cargo proteins can be transported into the nucleus by importin. Often, different proteins will require different combinations of α and β in order to translocate. Some examples of different cargo are listed below.
# Human importin genes
Although importin-α and importin-β are used to describe importin as a whole, they actually represent larger families of proteins that share a similar structure and function. Various different genes have been identified for both α and β, with some of them listed below. Note that often karyopherin and importin are used interchangeably.
- Importin: IPO4, IPO5, IPO7, IPO8, IPO9, IPO11, IPO13
- Karyopherin-α: KPNA1, KPNA2, KPNA3, KPNA4, KPNA5, KPNA6
- Karyopherin-β: KPNB1 | Importin
Importin is a type of karyopherin[1] that transports protein molecules into the nucleus by binding to specific recognition sequences, called nuclear localization sequences (NLS).
Importin has two subunits, importin α and importin β. Members of the importin-β family can bind and transport cargo by themselves, or can form heterodimers with importin-α. As part of a heterodimer, importin-β mediates interactions with the pore complex, while importin-α acts as an adaptor protein to bind the nuclear localisation signal (NLS) on the cargo. The NLS-Importin α-Importin β trimer dissociates after binding to Ran GTP inside the nucleus,[2] with the two importin proteins being recycled to the cytoplasm for further use.
# Discovery
Importin can exist as either a heterodimer of importin-α/β or as a monomer of Importin-β. Importin-α was first isolated in 1994 by a group including Enno Hartmann, based at the Max Delbrück Center for Molecular Medicine.[1] The process of nuclear protein import had already been characterised in previous reviews,[3] but the key proteins involved had not been elucidated up until that point. A 60kDa cytosolic protein, essential for protein import into the nucleus, and with a 44% sequence identity to SRP1p, was purified from Xenopus eggs. It was cloned, sequenced and expressed in E.coli and in order to completely reconstitute signal dependent transport, had to be combined with Ran(TC4). Other key stimulatory factors were also found in the study.[1]
Importin-β, unlike importin-α, has no direct homologues in yeast, but was purified as a 90-95kDa protein and found to form a heterodimer with importin-α in a number of different cases. These included a study led by Michael Rexach[4]
</ref> and further studies by Dirk Görlich.[5] These groups found that importin-α requires another protein, importin-β to function, and that together they form a receptor for nuclear localization signals (NLS), thus allowing transport into the nucleus. Since these initial discoveries in 1994 and 1995, a host of Importin genes, such as IPO4 and IPO7, have been found that facilitate the import of slightly different cargo proteins, due to their differing structure and locality.
# Structure
## Importin-α
A large proportion of the importin-α adaptor protein is made up of several armadillo repeats (ARM) arranged in tandem. These repeats can stack together to form a curved shaped structure, which facilitates binding to the NLS of specific cargo proteins. The major NLS binding site is found towards the N-terminus, with a minor site being found at the C-terminus. As well as the ARM structures, Importin-α also contains a 90 amino acid N-terminal region, responsible for binding to Importin-β, known as IBB (Importin-β binding domain). This is also a site of autoinhibition, and is implicated in the release of cargo once importin-α reaches the nucleus.[6]
## Importin-β
Importin-β is the typical structure of a larger superfamily of karyopherins. The basis of their structure is 18-20 tandem repeats of the HEAT motif. Each one of these repeats contains two antiparallel alpha helices linked by a turn, which stack together to form the overall structure of the protein.[7]
In order to transport cargo into the nucleus, importin-β must associate with the nuclear pore complexes. It does this by forming weak, transient bonds with nucleoporins at their various FG (Phe-Gly) motifs. Crystallographic analysis has shown that these motifs bind to importin-β at shallow hydrophobic pockets found on its surface.[8]
# Nuclear protein import cycle
The primary function of importin is to mediate the translocation of proteins with nuclear localization signals into the nucleus, through nuclear pore complexes (NPC), in a process known as the nuclear protein import cycle.
## Cargo binding
The first step of this cycle is the binding of cargo. Importin can perform this function as a monomeric importin-β protein, but usually requires the presence of importin-α, which acts as an adaptor to cargo proteins (via interactions with the NLS). The NLS is a sequence of basic amino acids that tags the protein as cargo destined for the nucleus. A cargo protein can contain either one or two of these motifs, which will bind to the major and/or minor binding sites on importin-α.[9]
## Cargo transport
Once the cargo protein is bound, importin-β interacts with the NPC, and the complex diffuses into the nucleus from the cytoplasm. The rate of diffusion depends on both the concentration of importin-α present in the cytoplasm and also the binding affinity of importin-α to the cargo. Once inside the nucleus, the complex interacts with the Ras-family GTPase, Ran-GTP. This leads to the dissociation of the complex by altering the conformation of Importin-β. Importin-β is left bound to Ran-GTP, ready to be recycled.[9]
## Cargo release
Now that the importin-α/cargo complex is free of importin-β, the cargo protein can be released into the nucleus. The N-terminal importin-β-binding (IBB) domain of importin-α contains an auto-regulatory region that mimics the NLS motif. The release of importin-β frees this region and allows it to loop back and compete for binding with the cargo protein at the major NLS-binding site. This competition leads to the release of the protein. In some cases, specific release factors such as Nup2 and Nup50 can be employed to help release the cargo as well.[9]
## Recycling
Finally, in order to return to the cytoplasm, importin-α must associate with a Ran-GTP/CAS (nuclear export factor) complex which facilitates its exit from the nucleus. CAS (cellular apoptosis susceptibility protein) is part of the importin-β superfamily of karyopherins and is defined as a nuclear export factor. Importin-β returns to the cytoplasm, still bound to Ran-GTP. Once in the cytoplasm, Ran-GTP is hydrolysed by RanGAP, forming Ran-GDP, and releasing the two importins for further activity. It is this hydrolysis of GTP that provides the energy for the cycle as a whole. In the nucleus, a GEF will charge Ran with a GTP molecule, which is then hydrolysed by a GAP in the cytoplasm, as stated above. It is this activity of Ran that allows for the unidirectional transport of proteins.[9]
# Disease
There are several disease states and pathologies that are associated with mutations or changes in expression of importin-α and importin-β.
Importins are vital regulatory proteins during the processes of gametogenesis and embryogenesis. As a result, a disruption in the expression patterns of importin-α has been shown to cause fertility defects in Drosophila melanogaster.[10]
There have also been studies that link altered importin-α to some cases of cancer. Breast cancer studies have implicated a truncated form of importin-α in which the NLS binding domain is missing.[11] In addition, importin-α has been shown to transport the tumour suppressor gene, BRCA1 (breast cancer type 1 susceptibility protein), into the nucleus. The overexpression of importin-α has also been linked with poor survival rates seen in certain melanoma patients.[12]
Importin activity is also associated with some viral pathologies. For instance, in the infection pathway of the Ebola virus, a key step is the inhibition of the nuclear import of PY-STAT1. This is achieved by the virus sequestering importin-α in the cytoplasm, meaning it can no longer bind its cargo at the NLS.[13] As a result, importin cannot function and the cargo protein stays in the cytoplasm.
# Types of cargo
Many different cargo proteins can be transported into the nucleus by importin. Often, different proteins will require different combinations of α and β in order to translocate. Some examples of different cargo are listed below.
# Human importin genes
Although importin-α and importin-β are used to describe importin as a whole, they actually represent larger families of proteins that share a similar structure and function. Various different genes have been identified for both α and β, with some of them listed below. Note that often karyopherin and importin are used interchangeably.
- Importin: IPO4, IPO5, IPO7, IPO8, IPO9, IPO11, IPO13
- Karyopherin-α: KPNA1, KPNA2, KPNA3, KPNA4, KPNA5, KPNA6
- Karyopherin-β: KPNB1 | https://www.wikidoc.org/index.php/Importin | |
196f79fff241a5ef2a54aefec245f4334ee4ccdf | wikidoc | Impurity | Impurity
Impurities are substances inside a confined amount of liquid, gas, or solid, which differ from the chemical composition of the material or compound.
Impurities are either naturally occurring or added during synthesis of a chemical or commercial product. During production, impurities may be purposely, accidentally, inevitably, or incidentally added into the substance.
The level of impurities in a material are generally defined in relative terms. Standards have been established by various organizations that attempt to define the permitted levels of various impurities in a manufactured product. Strictly speaking, then, a material's level of purity can only be stated as being more or less pure than some other material.
# Destructive impurities
Impurities can be destructive when they obstruct the working nature of the material. Examples include ash and debris in metals and leaf pieces in blank white papers. The removal of impurities is usually done chemically. For example, in the manufacturing of iron, calcium carbonate is added to the blast furnace to remove silicon dioxide from the iron ore. Zone refining is an economically important method for the purification of semiconductors.
However, some kinds of impurities can be removed by physical means. A mixture of water and salt can be separated by distillation, with water as the distillate and salt as the solid residue. Impurities are usually physically removed from liquids and gases. Removal of sand particles from metal ore is one example with solids.
No matter what method is used, it is usually impossible to separate an impurity completely from a material. What technicians can do is to increase the purity of a material to as near 100% as possible or economically feasible.
# Constructive impurities
Impurities can, though, add constructive properties to a material. Alloys are metals with impurities. The resulting combination has desirable properties not found in the constituent materials. Steel, for example, is made by introducing a controlled amount (less than 2%) of carbon into pure iron. In the manufacturing of solar cells, pure silicon is mixed with a very small portion of impurities (0.001% to 0.01%) in the form of phosphorus and boron atoms in order to generate electricity. This is known as doping of silicon and is constructive, although the phosphorus and boron could be called impurities.
Research on magnetic impurities has shown that considerable alteration of certain properties such as specific heat may be affected by small concentrations of an impurity, as for example impurities in semiconducting ferromagnetic alloys may lead to different properties as first predicted by White, Hogan, Suhl and Nakamura.
# Impurities and nucleation
When an impure liquid is cooled to its melting point the liquid, undergoing a phase transition, crystallizes around the impurities and becomes a crystalline solid. If there are no impurities then the liquid is said to be pure and can be supercooled below its melting point without becoming a solid. This occurs because the liquid has nothing to condense around so the solid cannot form a natural crystalline solid. The solid is eventually formed when dynamic arrest or glass transition occurs, but it forms into an amorphous solid — a glass, instead, as there is no long-range order in the structure.
Impurities play an important role in the nucleation of other phase transitions. For example, the presence of foreign elements may have important effects on the mechanical and magnetic properties of metal alloys. Iron atoms in copper cause the renowned Kondo effect where the conduction electron spins form a magnetic bound state with the impurity atom. Magnetic impurities in superconductors can serve as generation sites for vortex defects. Point defects can nucleate reversed domains in ferromagnets and dramatically affect their coercivity. In general impurities are able to serve as initiation points for phase transitions because the energetic cost of creating a finite-size domain of a new phase is lower at a point defect. In order for the nucleus of a new phase to be stable, it must reach a critical size. This threshold size is often lower at an impurity site. | Impurity
Impurities are substances inside a confined amount of liquid, gas, or solid, which differ from the chemical composition of the material or compound.
Impurities are either naturally occurring or added during synthesis of a chemical or commercial product. During production, impurities may be purposely, accidentally, inevitably, or incidentally added into the substance.
The level of impurities in a material are generally defined in relative terms. Standards have been established by various organizations that attempt to define the permitted levels of various impurities in a manufactured product. Strictly speaking, then, a material's level of purity can only be stated as being more or less pure than some other material.
# Destructive impurities
Impurities can be destructive when they obstruct the working nature of the material. Examples include ash and debris in metals and leaf pieces in blank white papers. The removal of impurities is usually done chemically. For example, in the manufacturing of iron, calcium carbonate is added to the blast furnace to remove silicon dioxide from the iron ore. Zone refining is an economically important method for the purification of semiconductors.
However, some kinds of impurities can be removed by physical means. A mixture of water and salt can be separated by distillation, with water as the distillate and salt as the solid residue. Impurities are usually physically removed from liquids and gases. Removal of sand particles from metal ore is one example with solids.
No matter what method is used, it is usually impossible to separate an impurity completely from a material. What technicians can do is to increase the purity of a material to as near 100% as possible or economically feasible.
# Constructive impurities
Impurities can, though, add constructive properties to a material. Alloys are metals with impurities. The resulting combination has desirable properties not found in the constituent materials. Steel, for example, is made by introducing a controlled amount (less than 2%) of carbon into pure iron. In the manufacturing of solar cells, pure silicon is mixed with a very small portion of impurities (0.001% to 0.01%) in the form of phosphorus and boron atoms in order to generate electricity. This is known as doping of silicon and is constructive, although the phosphorus and boron could be called impurities.
Research on magnetic impurities has shown that considerable alteration of certain properties such as specific heat may be affected by small concentrations of an impurity, as for example impurities in semiconducting ferromagnetic alloys may lead to different properties as first predicted by White, Hogan, Suhl and Nakamura.[1][2]
# Impurities and nucleation
When an impure liquid is cooled to its melting point the liquid, undergoing a phase transition, crystallizes around the impurities and becomes a crystalline solid. If there are no impurities then the liquid is said to be pure and can be supercooled below its melting point without becoming a solid. This occurs because the liquid has nothing to condense around so the solid cannot form a natural crystalline solid. The solid is eventually formed when dynamic arrest or glass transition occurs, but it forms into an amorphous solid — a glass, instead, as there is no long-range order in the structure.
Impurities play an important role in the nucleation of other phase transitions. For example, the presence of foreign elements may have important effects on the mechanical and magnetic properties of metal alloys. Iron atoms in copper cause the renowned Kondo effect where the conduction electron spins form a magnetic bound state with the impurity atom. Magnetic impurities in superconductors can serve as generation sites for vortex defects. Point defects can nucleate reversed domains in ferromagnets and dramatically affect their coercivity. In general impurities are able to serve as initiation points for phase transitions because the energetic cost of creating a finite-size domain of a new phase is lower at a point defect. In order for the nucleus of a new phase to be stable, it must reach a critical size. This threshold size is often lower at an impurity site. | https://www.wikidoc.org/index.php/Impurities | |
4bcfc6d348e1f81b032aeaf62a80db244f1edd0b | wikidoc | In vitro | In vitro
# Overview
In vitro (Latin: (with) in the glass) refers to the technique of performing a given experiment in a test tube, or, generally, in a controlled environment outside a living organism. In vitro fertilization is a well-known example of this. Many experiments in cellular biology are conducted outside of organisms or cells; because the test conditions may not correspond to the conditions inside of the organism, this may result in inaccurate results. Consequently, such experimental results are often annotated with in vitro, in contradistinction with in vivo .
# In vitro research
This type of research aims at describing the effects of an experimental variable on a subset of an organism's constituent parts. It tends to focus on organs, tissues, cells, cellular components, proteins, and/or biomolecules. Overall, it is better suited for deducing the mechanisms of action (See in vivo for its description and respective merits). With fewer variables and perceptually amplified reactions to subtle causes, results are, generally, more discernible.
The massive adoption of low-cost in vitro molecular biology techniques has caused a shift away from in vivo research which is more idiosyncratic and expensive in comparison to its molecular counterpart. Currently, in vitro research is both vital and highly productive. | In vitro
# Overview
In vitro (Latin: (with) in the glass) refers to the technique of performing a given experiment in a test tube, or, generally, in a controlled environment outside a living organism. In vitro fertilization is a well-known example of this. Many experiments in cellular biology are conducted outside of organisms or cells; because the test conditions may not correspond to the conditions inside of the organism, this may result in inaccurate results. Consequently, such experimental results are often annotated with in vitro, in contradistinction with in vivo .
# In vitro research
This type of research aims at describing the effects of an experimental variable on a subset of an organism's constituent parts. It tends to focus on organs, tissues, cells, cellular components, proteins, and/or biomolecules. Overall, it is better suited for deducing the mechanisms of action (See in vivo for its description and respective merits). With fewer variables and perceptually amplified reactions to subtle causes, results are, generally, more discernible.
The massive adoption of low-cost in vitro molecular biology techniques has caused a shift away from in vivo research which is more idiosyncratic and expensive in comparison to its molecular counterpart. Currently, in vitro research is both vital and highly productive. | https://www.wikidoc.org/index.php/In-vitro | |
237aee80f48725130ca89ff8cb08547d73921171 | wikidoc | Indiplon | Indiplon
Indiplon (INN and USAN) is a nonbenzodiazepine, hypnotic sedative being developed in 2 formulations - an immediate release product for sleep onset and a modified-release version for sleep maintenance.
# Mode of action
Indiplon is said to work by enhancing the action of the inhibitory neurotransmitter GABA, like most other nonbenzodiazepine sedatives. Its primary function is to bind to BZ1 and Alpha1 subunits of the GABA-A receptors in the brain.
# Availability
Indiplon was originally scheduled for release to doctors and pharmacies sometime in 2007, most likely in the springtime of that year, which is when Sanofi-Aventis' popular sleep aid, zolpidem, lost its patent rights in the United States and thus became available to patients as a much less expensive generic. Neurocrine Biosciences had planned to comarket indiplon in the US with Pfizer. However, following the issuing of a nonapprovable letter for the modified-release formulation and an approvable letter for the immediate-release version by the FDA (May 2006), Pfizer decided to end its relationship with Neurocrine.
The planned brand name has not yet been revealed to the public. Various setbacks have given cause for industry pundits to say that Indiplon will not become available until sometime in 2008 at the earliest. The delay has caused Neurocrine's stock value to drop significantly. The new drug application (NDA) was approved by the FDA in 1998, and since then, Neurocrine has been conducting clinical trials, with purportedly satisfactory results.
The impending availability of Indiplon is, as of mid-2007, unknown. Repeated problems getting the drug approved by the FDA has sent Neurocrine back to the drawing board numerous times since it first started development of the drug in the 1990s.
According to the FDA, capsules containing 5 mg and 10 mg are approvable pending additional submission of information to the FDA, but tablets containing 15 mg received a letter of disapproval indicating significant data are needed to refile with the FDA for further consideration.
It should also be noted that the domains indiplon.com and indiplon.net are both owned by domain squatters. Normally, when a company is developing a new product, they'll register, if possible, several domain names to promote the product. Neurocrine/Pfizer has curiously not done this, contrary to Pfizer's regular practice of doing so. | Indiplon
Indiplon (INN and USAN) is a nonbenzodiazepine, hypnotic sedative being developed in 2 formulations - an immediate release product for sleep onset and a modified-release version for sleep maintenance.
# Mode of action
Indiplon is said to work by enhancing the action of the inhibitory neurotransmitter GABA, like most other nonbenzodiazepine sedatives. Its primary function is to bind to BZ1 and Alpha1 subunits of the GABA-A receptors in the brain.
# Availability
Indiplon was originally scheduled for release to doctors and pharmacies sometime in 2007, most likely in the springtime of that year, which is when Sanofi-Aventis' popular sleep aid, zolpidem, lost its patent rights in the United States and thus became available to patients as a much less expensive generic. Neurocrine Biosciences had planned to comarket indiplon in the US with Pfizer. However, following the issuing of a nonapprovable letter for the modified-release formulation and an approvable letter for the immediate-release version by the FDA (May 2006), Pfizer decided to end its relationship with Neurocrine.
The planned brand name has not yet been revealed to the public. Various setbacks have given cause for industry pundits to say that Indiplon will not become available until sometime in 2008 at the earliest[1]. The delay has caused Neurocrine's stock value to drop significantly. The new drug application (NDA) was approved by the FDA in 1998, and since then, Neurocrine has been conducting clinical trials, with purportedly satisfactory results.
The impending availability of Indiplon is, as of mid-2007, unknown. Repeated problems getting the drug approved by the FDA has sent Neurocrine back to the drawing board numerous times since it first started development of the drug in the 1990s.
According to the FDA, capsules containing 5 mg and 10 mg are approvable pending additional submission of information to the FDA, but tablets containing 15 mg received a letter of disapproval indicating significant data are needed to refile with the FDA for further consideration.[2]
It should also be noted that the domains indiplon.com and indiplon.net are both owned by domain squatters. Normally, when a company is developing a new product, they'll register, if possible, several domain names to promote the product. Neurocrine/Pfizer has curiously not done this, contrary to Pfizer's regular practice of doing so.
# External links
- Neurocrine's Indiplon page
- 2004 press release announcing Neurocrine's new product, Indiplon
- Pfizer
- GenomeNet Entry: D02640
Template:Pharma-stub
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Indiplon | |
f5bf83652bb94bcdf3793e527170046476cf7885 | wikidoc | Inotrope | Inotrope
# Overview
An inotrope (IPA: Template:IPA) is an agent which increases or decreases the force or energy of muscular contractions. Negatively inotropic agents weaken the force of muscular contractions. Positively inotropic agents increase the strength of muscular contraction.
Most commonly, the inotropic state is used in reference to various drugs that affect the strength of contraction of heart muscle (myocardial contractility). However, it can also refer to pathological conditions. For example, ventricular hypertrophy can increase inotropic state, while myocardial infarction can decrease it.
# Cardiac inotropes
Both positive and negative inotropes are used in the management of various cardiovascular conditions.
The choice of agent largely depends on specific pharmacological effects of individual agents with respect to the condition.
One of the most important factors affecting inotropic state is the level of calcium in the cytoplasm. Positive inotropes usually increase the level, while negative inotropes decrease it. However, not all drugs involve calcium release, and among those which do, the mechanism for manipulating the calcium level can vary from drug to drug.
# Positive inotropic agents
Positive inotropic agents increase myocardial contractility, and are used to support cardiac function in conditions such as decompensated congestive heart failure, cardiogenic shock, septic shock, myocardial infarction, cardiomyopathy, etc.
Examples of positive inotropic agents include:
- Calcium
- Calcium sensitisers
Levosimendan
- Levosimendan
- Cardiac glycosides
Digoxin
- Digoxin
- Catecholamines
Dopamine
Dobutamine
Dopexamine
Epinephrine (adrenaline)
Isoprenaline (isoproterenol)
Norepinephrine (noradrenaline)
- Dopamine
- Dobutamine
- Dopexamine
- Epinephrine (adrenaline)
- Isoprenaline (isoproterenol)
- Norepinephrine (noradrenaline)
- Phosphodiesterase inhibitors
Enoximone
Milrinone
Theophylline
- Enoximone
- Milrinone
- Theophylline
# Negative inotropic agents
Negative inotropic agents decrease myocardial contractility, and are used to decrease cardiac workload in conditions such as angina. While negative inotropism may precipitate or exacerbate heart failure, certain beta blockers (e.g. carvedilol) have been shown to reduce morbidity and mortality in congestive heart failure.
- Beta blockers
- Diltiazem
- Verapamil | Inotrope
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
An inotrope (IPA: Template:IPA) is an agent which increases or decreases the force or energy of muscular contractions. Negatively inotropic agents weaken the force of muscular contractions. Positively inotropic agents increase the strength of muscular contraction.
Most commonly, the inotropic state is used in reference to various drugs that affect the strength of contraction of heart muscle (myocardial contractility). However, it can also refer to pathological conditions. For example, ventricular hypertrophy can increase inotropic state, while myocardial infarction can decrease it.
# Cardiac inotropes
Both positive and negative inotropes are used in the management of various cardiovascular conditions.
The choice of agent largely depends on specific pharmacological effects of individual agents with respect to the condition.
One of the most important factors affecting inotropic state is the level of calcium in the cytoplasm. Positive inotropes usually increase the level, while negative inotropes decrease it. However, not all drugs involve calcium release, and among those which do, the mechanism for manipulating the calcium level can vary from drug to drug.
# Positive inotropic agents
Positive inotropic agents increase myocardial contractility, and are used to support cardiac function in conditions such as decompensated congestive heart failure, cardiogenic shock, septic shock, myocardial infarction, cardiomyopathy, etc.
Examples of positive inotropic agents include:
- Calcium
- Calcium sensitisers
Levosimendan
- Levosimendan
- Cardiac glycosides
Digoxin
- Digoxin
- Catecholamines
Dopamine
Dobutamine
Dopexamine
Epinephrine (adrenaline)
Isoprenaline (isoproterenol)
Norepinephrine (noradrenaline)
- Dopamine
- Dobutamine
- Dopexamine
- Epinephrine (adrenaline)
- Isoprenaline (isoproterenol)
- Norepinephrine (noradrenaline)
- Phosphodiesterase inhibitors
Enoximone
Milrinone
Theophylline
- Enoximone
- Milrinone
- Theophylline
# Negative inotropic agents
Negative inotropic agents decrease myocardial contractility, and are used to decrease cardiac workload in conditions such as angina. While negative inotropism may precipitate or exacerbate heart failure, certain beta blockers (e.g. carvedilol) have been shown to reduce morbidity and mortality in congestive heart failure.
- Beta blockers
- Diltiazem
- Verapamil | https://www.wikidoc.org/index.php/Inotrope | |
4bcee0c1545f367a30ffc7bd4aa16c1acbeda6c6 | wikidoc | Insanity | Insanity
Insanity, or madness, is a general popular and legal term defining behavior influenced by mental instability. It is defined by the Merriam-Webster dictionary as a deranged state of the mind or lack of understanding. Today it is most commonly encountered as an informal term or in the narrow legal context of the insanity defense, and in the medical profession, the term is now avoided in favor of specific diagnoses of mental illness as schizophrenia and other psychotic disorders.
# Linguistic roots
In English, the word "sane" derives from the Latin adjective sanus meaning healthy. The phrase "mens sana in corpore sano" means a "healthy mind in a healthy body". From this perspective, insanity can be considered as poor health of the mind, not necessarily of the brain as an organ (although that can affect mental health), but rather refers to defective function of mental processes such as reasoning. A Latin phrase for "sane" is "compos mentis" (lit. "of composed mind"), and a euphemistic term for insanity is "non compos mentis".
# In Medicine
Insanity as a diagnosis is now considered to be outdated. The disorders formerly encompassed by the term are schizophrenic and other psychotic disorders. These are characterized by social withdrawal, deterioration of personal care, inability to perceive oneself as a separate entity, rapid shifting of thought and topic, autistic absorption, hallucinatory symptoms, delusions and often depersonalization. Symptoms can be singular or combined with a wide variation among sufferers. Motor activity is generally reduced and appearance become bizarre while perceptual and conversational distortions are evident.
Medical disorders as thyroid dysfunction, adrenal or pituitary disorders may contribute to the above symptoms and must be ruled out before a psychiatric diagnosis is made. Medical treatment includes hospitalization and antipsychotic medication. Prognosis is usually excellent in alleviation of symptoms but the disorder may be recurrent when medication is halted.
# Historical treatment
During the 18th century, the French and English introduced humane treatment of the clinically insane, though the criteria for diagnosis and placement in an asylum were considerably looser than today, often including such conditions as speech impediments and epilepsy.
The world's oldest asylum is The Bethlem Royal Hospital of London, also known as Bedlam, which began admitting the mentally ill in 1403. The first American asylum was built in Williamsburg, Virginia, circa 1773. Before the 19th century these hospitals were used to isolate the mentally ill or the socially ostracized from society rather than cure them or maintain their health. Pictures from this era portrayed patients bound with rope or chains, often to beds or walls, or restrained in straitjackets.
# Legal use of the term
While in criminal law, insanity may serve as a defense to criminal acts, in most U.S. states, jurisdictions differ in their definition of insanity. All jurisdictions require a sanity evaluation to address the question first of whether or not the defendant has a mental illness. Most courts accept a major mental illness such as psychosis but will not accept the diagnosis of a personality disorder for the purposes of an insanity defense. The second question is whether the mental illness interfered with the defendant's ability to distinguish right from wrong. That is, did the defendant know that the alleged behavior was against the law at the time the offense was committed. Additionally, some jurisdictions add the question of whether or not the defendant was in control of his behavior at the time of the offense. For example, if the defendant compelled by some aspect of his mental illness to commit the illegal act, the defendant could be evaluated as not in control of his behavior at the time of the offense. The forensic mental health specialists submit their evaluations to the court. Since the question of sanity or insanity is a legal question and not a medical one, the judge and or jury will make the final decision regarding the defendant's status regarding an insanity defense.
In most jurisdictions within the United States, if the insanity plea is accepted, the defendant is committed to a psychiatric institution for at least 60 days for further evaluation, and then reevaluated at least yearly after that.
## Mitigating factor
The United States Supreme Court in Penry v. Lynaugh and the United States Court of Appeals for the Fifth Circuit in Bigby v. Dretke have been clear in their decisions that jury instructions in death penalty cases that do not ask about mitigating factors regarding the defendant's mental health violate the defendant's Eighth Amendment rights, saying that the jury is to be instructed to consider mitigating factors when answering unrelated questions. This ruling suggests specific explanations to jury is necessary to weigh mitigating factors.
# Slang usage
In popular culture, "insane" could also refer to something extremely foolish, while persons may be deemed "insane" if their behavior strongly deviates from accepted social norms; in the past, insanity has been used to refer to individuals who have exhibited apathetic, cruel, hypersexual and homosexual behavior. The term is typically negative, but departure from established norms may also be seen as a positive quality; in this case, being "insane" is being daringly unconventional or individualistic. This use of insane is illustrated by the following quote from Henry David Thoreau's A Plea for Captain John Brown, an essay supporting the well-known militant abolitionist:
Many, no doubt, are well disposed, but sluggish by constitution and by habit, and they cannot conceive of a man who is actuated by higher motives than they are, accordingly they pronounce this man insane, for they know that they could never act as he does, as long as they are themselves.
In this sense, "insanity" is not implied to be an actual disorder, let alone severe. | Insanity
Insanity, or madness, is a general popular and legal term defining behavior influenced by mental instability. It is defined by the Merriam-Webster dictionary as a deranged state of the mind or lack of understanding. Today it is most commonly encountered as an informal term or in the narrow legal context of the insanity defense, and in the medical profession, the term is now avoided in favor of specific diagnoses of mental illness as schizophrenia and other psychotic disorders.[1]
# Linguistic roots
In English, the word "sane" derives from the Latin adjective sanus meaning healthy. The phrase "mens sana in corpore sano" means a "healthy mind in a healthy body". From this perspective, insanity can be considered as poor health of the mind, not necessarily of the brain as an organ (although that can affect mental health), but rather refers to defective function of mental processes such as reasoning. A Latin phrase for "sane" is "compos mentis" (lit. "of composed mind"), and a euphemistic term for insanity is "non compos mentis".
# In Medicine
Insanity as a diagnosis is now considered to be outdated. The disorders formerly encompassed by the term are schizophrenic and other psychotic disorders. These are characterized by social withdrawal, deterioration of personal care, inability to perceive oneself as a separate entity, rapid shifting of thought and topic, autistic absorption, hallucinatory symptoms, delusions and often depersonalization. Symptoms can be singular or combined with a wide variation among sufferers. Motor activity is generally reduced and appearance become bizarre while perceptual and conversational distortions are evident.
Medical disorders as thyroid dysfunction, adrenal or pituitary disorders may contribute to the above symptoms and must be ruled out before a psychiatric diagnosis is made. Medical treatment includes hospitalization and antipsychotic medication. Prognosis is usually excellent in alleviation of symptoms but the disorder may be recurrent when medication is halted.[1]
# Historical treatment
During the 18th century, the French and English introduced humane treatment of the clinically insane, though the criteria for diagnosis and placement in an asylum were considerably looser than today, often including such conditions as speech impediments and epilepsy.
The world's oldest asylum is The Bethlem Royal Hospital of London, also known as Bedlam, which began admitting the mentally ill in 1403. The first American asylum was built in Williamsburg, Virginia, circa 1773. Before the 19th century these hospitals were used to isolate the mentally ill or the socially ostracized from society rather than cure them or maintain their health. Pictures from this era portrayed patients bound with rope or chains, often to beds or walls, or restrained in straitjackets.
# Legal use of the term
While in criminal law, insanity may serve as a defense to criminal acts, in most U.S. states, jurisdictions differ in their definition of insanity. All jurisdictions require a sanity evaluation to address the question first of whether or not the defendant has a mental illness. Most courts accept a major mental illness such as psychosis but will not accept the diagnosis of a personality disorder for the purposes of an insanity defense. The second question is whether the mental illness interfered with the defendant's ability to distinguish right from wrong. That is, did the defendant know that the alleged behavior was against the law at the time the offense was committed. Additionally, some jurisdictions add the question of whether or not the defendant was in control of his behavior at the time of the offense. For example, if the defendant compelled by some aspect of his mental illness to commit the illegal act, the defendant could be evaluated as not in control of his behavior at the time of the offense. The forensic mental health specialists submit their evaluations to the court. Since the question of sanity or insanity is a legal question and not a medical one, the judge and or jury will make the final decision regarding the defendant's status regarding an insanity defense.[2][3]
In most jurisdictions within the United States, if the insanity plea is accepted, the defendant is committed to a psychiatric institution for at least 60 days for further evaluation, and then reevaluated at least yearly after that.
## Mitigating factor
The United States Supreme Court in Penry v. Lynaugh and the United States Court of Appeals for the Fifth Circuit in Bigby v. Dretke have been clear in their decisions that jury instructions in death penalty cases that do not ask about mitigating factors regarding the defendant's mental health violate the defendant's Eighth Amendment rights, saying that the jury is to be instructed to consider mitigating factors when answering unrelated questions. This ruling suggests specific explanations to jury is necessary to weigh mitigating factors.
# Slang usage
In popular culture, "insane" could also refer to something extremely foolish, while persons may be deemed "insane" if their behavior strongly deviates from accepted social norms; in the past, insanity has been used to refer to individuals who have exhibited apathetic, cruel, hypersexual and homosexual behavior. The term is typically negative, but departure from established norms may also be seen as a positive quality; in this case, being "insane" is being daringly unconventional or individualistic. This use of insane is illustrated by the following quote from Henry David Thoreau's A Plea for Captain John Brown, an essay supporting the well-known militant abolitionist:
Many, no doubt, are well disposed, but sluggish by constitution and by habit, and they cannot conceive of a man who is actuated by higher motives than they are, accordingly they pronounce this man insane, for they know that they could never act as he does, as long as they are themselves.
In this sense, "insanity" is not implied to be an actual disorder, let alone severe. | https://www.wikidoc.org/index.php/Insanity | |
eac03cd0af1436b1e14467dcb4a76fbd7e63c709 | wikidoc | Integrin | Integrin
# Overview
Integrins are transmembrane receptors that mediate the attachment between a cell and its surroundings, such as other cells or the extracellular matrix (ECM). In signal transduction, integrins pass information about the chemical composition and mechanical status of the ECM into the cell. Therefore, in addition to transmitting mechanical forces across otherwise vulnerable membranes, they are involved in cell signaling and the regulation of cell cycle, shape, and motility.
Typically, receptors inform a cell of the molecules in its environment and the cell responds. Not only do integrins perform this outside-in signaling, but they also operate an inside-out mode. Thus, they transduce information from the ECM to the cell as well as reveal the status of the cell to the outside, allowing rapid and flexible responses to changes in the environment, for example to allow blood coagulation by platelets.
There are many types of integrin, and many cells have multiple types on their surface. Integrins are of vital importance to all animals and have been found in all animals investigated, from sponges to mammals. Integrins have been extensively studied in humans.
Integrins work alongside other proteins such as cadherins, immunoglobulin superfamily cell adhesion molecules, selectins and syndecans to mediate cell–cell and cell–matrix interaction and communication. Integrins bind cell surface and ECM components such as fibronectin, vitronectin, collagen, and laminin.
# Structure
Integrins are obligate heterodimers containing two distinct chains, called the α (alpha) and β (beta) subunits. In mammals, eighteen α and eight β subunits have been characterized, whereas the Drosophila genome encodes only five α and two β subunits, and Caenorhabditis nematodes possess genes for two α subunits and one β. The α and β subunits each penetrate the plasma membrane and possess small cytoplasmic domains. | Integrin
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Integrins are transmembrane receptors that mediate the attachment between a cell and its surroundings, such as other cells or the extracellular matrix (ECM). In signal transduction, integrins pass information about the chemical composition and mechanical status of the ECM into the cell. Therefore, in addition to transmitting mechanical forces across otherwise vulnerable membranes, they are involved in cell signaling and the regulation of cell cycle, shape, and motility.
Typically, receptors inform a cell of the molecules in its environment and the cell responds. Not only do integrins perform this outside-in signaling, but they also operate an inside-out mode. Thus, they transduce information from the ECM to the cell as well as reveal the status of the cell to the outside, allowing rapid and flexible responses to changes in the environment, for example to allow blood coagulation by platelets.
There are many types of integrin, and many cells have multiple types on their surface. Integrins are of vital importance to all animals and have been found in all animals investigated, from sponges to mammals. Integrins have been extensively studied in humans.
Integrins work alongside other proteins such as cadherins, immunoglobulin superfamily cell adhesion molecules, selectins and syndecans to mediate cell–cell and cell–matrix interaction and communication. Integrins bind cell surface and ECM components such as fibronectin, vitronectin, collagen, and laminin.
# Structure
Integrins are obligate heterodimers containing two distinct chains, called the α (alpha) and β (beta) subunits. In mammals, eighteen α and eight β subunits have been characterized, whereas the Drosophila genome encodes only five α and two β subunits, and Caenorhabditis nematodes possess genes for two α subunits and one β.[1] The α and β subunits each penetrate the plasma membrane and possess small cytoplasmic domains.[2] | https://www.wikidoc.org/index.php/Integrin | |
6fb012d50199ee80a7a6d036608d538042ae9aab | wikidoc | Iodoform | Iodoform
# Overview
The compound iodoform is CHI3. A pale yellow, crystalline, volatile substance, it has a penetrating odor (in older chemistry texts, the smell is sometimes referred to as the smell of hospitals) and, analogous to chloroform, sweetish taste. It is slightly soluble in glycerol, petroleum ether or alcohol (78 g/l at 25 °C), averagely soluble in chloroform, acetic acid and ether (136 g/l at 25 °C) and easily soluble in benzene and acetone (120 g/l at 25 °C).
# Physical properties
Its entalphy of sublimation is 69.9 kJ.mol-1 at range of temperatures 35 - 92 °C.
Iodoform molecule parameters are: d(C-I) = 2.12 ± 0.04 Å, d(I-I) = 3.535 ± 0.01 Å and I-C-I = 113°. Dipole moment is 1 D. Its space group is P63 and lattice constants are a = 6.83 Å, c = 7.52 Å.
It has critical point at 584.85 °C, 5.63 MPa. Refractive index is 1.786 (D, 20 °C).
# Synthesis
It was first prepared by Georges Serrulas in 1822 and its molecular formula was identified by Jean-Baptiste Dumas in 1834.
Iodoform can be synthesized in the haloform reaction by the reaction of iodine and sodium hydroxide with any one of these four kinds of organic compounds:
- a methyl ketone: CH3COR, where R is an organic side chain.
- acetaldehyde: CH3CHO
- ethanol: CH3CH2OH
- secondary alcohols: CH3CHROH, where R is an alkyl or aryl group.
These reactions are so reliable that it is called the iodoform test, signalled by the precipitation of pale yellow crystals.
# Reactions
Some reagents (e.g. hydroiodic acid) can convert iodoform to diiodomethane.
Also conversion to carbon dioxide is possible. Iodoform reacts with silver nitrate producing carbon monoxide, which is oxidized by mixture of sulfuric acid and iodine pentaoxide.
# Uses
It was used in medicine as a healing and antiseptic dressing for wounds and sores around the beginning of the 20th century, though this use is now superseded by better antiseptics. | Iodoform
Template:Chembox new
# Overview
The compound iodoform is CHI3. A pale yellow, crystalline, volatile substance, it has a penetrating odor (in older chemistry texts, the smell is sometimes referred to as the smell of hospitals) and, analogous to chloroform, sweetish taste. It is slightly soluble in glycerol, petroleum ether or alcohol (78 g/l at 25 °C), averagely soluble in chloroform, acetic acid and ether (136 g/l at 25 °C) and easily soluble in benzene and acetone (120 g/l at 25 °C).
# Physical properties
Its entalphy of sublimation is 69.9 kJ.mol-1 at range of temperatures 35 - 92 °C.
Iodoform molecule parameters are: d(C-I) = 2.12 ± 0.04 Å, d(I-I) = 3.535 ± 0.01 Å and I-C-I = 113°. Dipole moment is 1 D. Its space group is P63 and lattice constants are a = 6.83 Å, c = 7.52 Å.
It has critical point at 584.85 °C, 5.63 MPa. Refractive index is 1.786 (D, 20 °C).
# Synthesis
It was first prepared by Georges Serrulas in 1822 and its molecular formula was identified by Jean-Baptiste Dumas in 1834.
Iodoform can be synthesized in the haloform reaction by the reaction of iodine and sodium hydroxide with any one of these four kinds of organic compounds:
- a methyl ketone: CH3COR, where R is an organic side chain.
- acetaldehyde: CH3CHO
- ethanol: CH3CH2OH
- secondary alcohols: CH3CHROH, where R is an alkyl or aryl group.
These reactions are so reliable that it is called the iodoform test, signalled by the precipitation of pale yellow crystals.
# Reactions
Some reagents (e.g. hydroiodic acid) can convert iodoform to diiodomethane.
Also conversion to carbon dioxide is possible. Iodoform reacts with silver nitrate producing carbon monoxide, which is oxidized by mixture of sulfuric acid and iodine pentaoxide.
# Uses
It was used in medicine as a healing and antiseptic dressing for wounds and sores around the beginning of the 20th century, though this use is now superseded by better antiseptics. | https://www.wikidoc.org/index.php/Iodoform | |
befa700c1fcb97496c3680963e0e231e345f459d | wikidoc | Iodophor | Iodophor
An Iodophor is a preparation containing iodine complexed with a solubilizing agent, such as a surfactant or povidone (forming povidone-iodine). The result is a water-soluble material that releases free iodine when in solution. Iodophors are prepared by mixing iodine with the solubilizing agent; heat can be used to speed up the reaction.
# Medical Use
Free iodine kills the eukaryotic or prokaryotic cells by iodination of lipids and oxidation of compounds in the cytoplasm and cell membrane. Unlike with some antibiotics, microbes do not develop resistant strains against iodine. However, iodine is an irritant to mucous membranes and corrodes medical instruments. Iodine also kills live cells of mammals. Therefore, a slow release in smaller concentrations is desirable for patient use.
In iodophor formulations free iodine is released slowly from the carrier molecules, and thus are more gentle to the skin and have increased shelf-life. Effectiveness of any iodophore depends on active free iodine percentage. Percentages greater than 3.5% have no additional advantage.
Despite of all these advantages, iodophores must be used under technical supervision. Many cases of toxicity and adverse reaction have been reported.
# Home Use
Diluted iodophor is often used by homebrewers and home wine makers to sanitize equipment and bottles. Its major advantage over other sanitizers is that when used in proper proportions it sublimates directly from solution to gas, and hence leaves no residues. It is also non-toxic to humans and therefore especially suited to food processing applications. It is cheap and effective, but it can leave unattractive orange-brown stains on plastic parts and equipment that it is left in contact with.
It is often supplied in different concentrations and is further diluted with water before use. The label will advise the appropriate dilution rate, commonly 1:1000 or 1:100. Equipment to be sanitized should be thoroughly clean and left in contact with the solution for at least 2 minutes. | Iodophor
An Iodophor is a preparation containing iodine complexed with a solubilizing agent, such as a surfactant or povidone (forming povidone-iodine). The result is a water-soluble material that releases free iodine when in solution. Iodophors are prepared by mixing iodine with the solubilizing agent; heat can be used to speed up the reaction.
# Medical Use
Free iodine kills the eukaryotic or prokaryotic cells by iodination of lipids and oxidation of compounds in the cytoplasm and cell membrane. Unlike with some antibiotics, microbes do not develop resistant strains against iodine. However, iodine is an irritant to mucous membranes and corrodes medical instruments. Iodine also kills live cells of mammals. Therefore, a slow release in smaller concentrations is desirable for patient use.
In iodophor formulations free iodine is released slowly from the carrier molecules, and thus are more gentle to the skin and have increased shelf-life. Effectiveness of any iodophore depends on active free iodine percentage. Percentages greater than 3.5% have no additional advantage.
Despite of all these advantages, iodophores must be used under technical supervision. Many cases of toxicity and adverse reaction have been reported.
# Home Use
Diluted iodophor is often used by homebrewers and home wine makers to sanitize equipment and bottles. Its major advantage over other sanitizers is that when used in proper proportions it sublimates directly from solution to gas, and hence leaves no residues. It is also non-toxic to humans and therefore especially suited to food processing applications. It is cheap and effective, but it can leave unattractive orange-brown stains on plastic parts and equipment that it is left in contact with.
It is often supplied in different concentrations and is further diluted with water before use. The label will advise the appropriate dilution rate, commonly 1:1000 or 1:100. Equipment to be sanitized should be thoroughly clean and left in contact with the solution for at least 2 minutes.
# External links and references
Can iodophor be used as a no-rinse sanitizer?
Streaming mp3 from BasicBrewing.com with interview of Murl Landman of National Chemicals (BTF Iodophr)
Template:Treatment-stub
de:Iodophore
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Iodophor | |
cc879c89ecb8c56488d5fca64a32b48da120c063 | wikidoc | Loversol | Loversol
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Loversol is a diagnostic agent and radiological contrast media that is FDA approved for the procedure of peripheral and coronary arteriography, left ventriculography, contrast enhanced computed tomographic imaging of the head and body, intravenous excretory urography, intravenous digital subtraction angiography and venography. Ioversol 350 is indicated in children for angiocardiography. There is a Black Box Warning for this drug as shown here. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### General
- As with all radiopaque contrast agents, only the lowest dose necessary to obtain adequate visualization should be used. A lower dose may reduce the possibility of an adverse reaction. Most procedures do not require use of either the maximum volume or the highest concentration of Ioversol. The combination of volume and concentration of Ioversol to be used should be carefully individualized accounting for factors such as age, body weight, size of the vessel and the rate of blood flow within the vessel. Other factors such as anticipated pathology, degree and extent of opacification required, structure(s) or area to be examined, disease processes affecting the patient, and equipment and technique to be employed should be considered.
- It is desirable that intravascularly administered iodinated contrast agents be at or close to body temperature when injected.
- If during administration a reaction occurs, the injection should be stopped until the reaction has subsided.
- Patients should be well hydrated prior to and following Ioversol (ioversol injection) administration.
- As with all contrast media, other drugs should not be mixed with ioversol solutions because of the potential for chemical incompatibility.
- Sterile technique must be used in all vascular injections involving contrast media.
- If nondisposable equipment is used, scrupulous care should be taken to prevent residual contamination with traces of cleansing agents.
- Withdrawal of contrast agents from their containers should be accomplished under strict aseptic conditions using only sterile syringes and transfer devices. Contrast agents which have been transferred into other delivery systems should be used immediately.
- Parenteral drug products should be inspected visually for particulate matter and discoloration prior to administration and should not be used if particulates are observed or marked discoloration has occurred.
- The Ioversol formulations are supplied in single dose containers. Discard unused portion.
## General Angiography
- Visualization of the cardiovascular system may be accomplished by any accepted radiological technique.
### Cerebral Arteriography
- Extreme caution is advised in patients with advanced arteriosclerosis, severe hypertension, cardiac decompensation, senility, recent cerebral thrombosis or embolism, and migraine. Cardiovascular reactions that may occur with some frequency are bradycardia and either an increase or decrease in systemic blood pressure. Neurological reactions that may occur are: seizures, drowsiness, transient paresis, and mild disturbances in vision.
- Central nervous system reactions with Ioversol in controlled clinical studies in cerebral arteriography that were considered drug-related and occurred with frequencies greater than 1% were: headache, bradycardia, blood pressure fluctuation, disorientation, nausea and vertigo.
- Ioversol 240, Ioversol 300 or Ioversol 320 is recommended for this procedure. The usual individual injection for visualization of the carotid or vertebral arteries is 2 to 12 mL, repeated as necessary. Aortic arch injection for a simultaneous four vessel study requires 20 to 50 mL. Total procedural doses should not usually exceed 200 mL.
### Peripheral Arteriography
- Pulsation should be present in the artery to be injected. In thromboangiitis obliterans, or ascending infection associated with severe ischemia, angiography should be performed with extreme caution, if at all.
- Ioversol 300, Ioversol 320 or Ioversol 350 is recommended for this procedure. The usual individual injection volumes for visualization of various peripheral arteries are as follows:
- These doses may be repeated as necessary. Total procedural doses should not usually exceed 250 mL.
### Visceral and Renal Arteriography and Aortography
- In aortography, depending on the technique employed, the risks of this procedure also include the following: injury to the aorta and neighboring organs, pleural puncture, renal damage including infarction and acute tubular necrosis with oliguria and anuria, retroperitoneal hemorrhage from the translumbar approach and spinal cord injury and pathology associated with the syndrome of transverse myelitis.
Under conditions of slowed aortic circulation there is an increased likelihood for aortography to cause muscle spasm. Occasional serious neurologic complications, including paraplegia, have also been reported in patients with aortoiliac obstruction, femoral artery obstruction, abdominal compression, hypotension, hypertension, spinal anesthesia, and injection of vasopressors to increase contrast. In these patients the concentration, volume, and number of repeat injections of the medium should be maintained at a minimum with appropriate intervals between injections. The position of the patient and catheter tip should be carefully monitored.
- Entry of a large aortic dose into the renal artery may cause, even in the absence of symptoms, albuminuria, hematuria, and an elevated creatinine and urea nitrogen. Rapid and complete return of function usually follows.
- Ioversol 320 is recommended for visceral arteriography, renal arteriography, and aortography procedures. The usual individual injection volumes for visualization for the aorta and various visceral arteries are as follows:
- These doses may be repeated as necessary. Total procedural doses should not usually exceed 250 mL.
### Coronary Arteriography and Left Ventriculography
- Mandatory prerequisites to the procedure are specialized personnel, ECG monitoring apparatus and adequate facilities for immediate resuscitation and cardioversion. Electrocardiograms and vital signs should be routinely monitored throughout the procedure.
- There were no cardiovascular system reactions with Ioversol in controlled clinical studies in coronary arteriography with left ventriculography that were considered drug-related and occurred with a frequency greater than 1%.
- Ioversol 320 or Ioversol 350 is recommended for this procedure. The usual individual injection volumes for visualization of the coronary arteries and left ventricle are:
- These doses may be repeated as necessary. Total procedural dose for the combined procedures should not usually exceed 250 mL. When large individual volumes are administered, as in ventriculography and aortography, it has been suggested that several minutes be permitted to elapse between each injection to allow for subsidence of possible hemodynamic disturbances.
### Pediatric Angiocardiography
- Mandatory prerequisites to the procedure are specialized personnel, ECG monitoring apparatus and adequate facilities for immediate resuscitation and cardioversion. Electrocardiograms and vital signs should be routinely monitored throughout the procedure. Pediatric patients at higher risk of experiencing adverse events during contrast medium administration may include those having asthma, a sensitivity to medication and/or allergens, congestive heart failure, a serum creatinine greater than 1.5 mg/dL, or those less than 12 months of age.
- Ioversol 350 or Ioversol 320 is recommended for this procedure. The usual single ventricular injection of Ioversol 350 or Ioversol 320 is 1.25 mL/kg of body weight with a range of 1 mL/kg to 1.5 mL/kg. When multiple injections are given, the total administered dose should not exceed 5 mL/kg up to a total volume of 250 mL.
### Venography
- Special care is required when venography is performed in patients with suspected thrombosis, phlebitis, severe ischemic disease, local infection or a totally obstructed venous system. In order to minimize extravasation during injection, fluoroscopy is recommended.
- Ioversol 240, Ioversol 300, Ioversol 320 or Ioversol 350 is recommended for this procedure. The usual dose is 50 to 100 mL per extremity with smaller or larger volumes indicated in some cases. Dosage should not usually exceed 250 mL.
- Following the procedure, the venous system should be flushed with Sodium Chloride Injection USP or 5% Dextrose in Water (D5W). Massage and elevation are also helpful for clearing the contrast medium from the extremity.
### Computed Tomography
- Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 is recommended for head imaging.
- Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 is recommended for body imaging.
- Tumors: Ioversol may be useful to investigate the presence and extent of certain malignancies such as: gliomas including malignant gliomas, glioblastomas, astrocytomas, oligodendrogliomas and gangliomas, ependymomas, medulloblastomas, meningiomas, neuromas, pinealomas, pituitary adenomas, craniopharyngiomas, germinomas, and metastatic lesions. The usefulness of contrast enhancement for the investigation of the retrobulbar space and in cases of low grade or infiltrative glioma has not been demonstrated. In calcified lesions, there is less likelihood of enhancement. Following therapy, tumors may show decreased or no enhancement. The opacification of the inferior vermis following contrast media administration has resulted in false-positive diagnosis in a number of otherwise normal studies.
- Non-neoplastic Conditions: Ioversol may be beneficial in the image enhancement of non-neoplastic lesions. Cerebral infarctions of recent onset may be better visualized with contrast enhancement, while some infarctions are obscured if contrast medium is used. The use of iodinated contrast media results in enhancement in about 60% of cerebral infarctions studied from one to four weeks from the onset of symptoms.
- Sites of active infection may also be enhanced following contrast medium administration.
- Arteriovenous malformations and aneurysms will show contrast enhancement. For these vascular lesions the enhancement is probably dependent on the iodine content of the circulating blood pool. Hematomas and intraparenchymal bleeders seldom demonstrate contrast enhancement. However, in cases of intraparenchymal clot, for which there is no obvious clinical explanation, contrast media administration may be helpful in ruling out the possibility of associated arteriovenous malformation.
- Adults
For adults, the usual dosage is 50 to 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 100 to 250 mL of Ioversol 240. Scanning may be performed immediately after completion of the intravenous administration. Dosage should not usually exceed 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 250 mL of Ioversol 240.
- For adults, the usual dosage is 50 to 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 100 to 250 mL of Ioversol 240. Scanning may be performed immediately after completion of the intravenous administration. Dosage should not usually exceed 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 250 mL of Ioversol 240.
- Children
The dosage recommended for use in children is 1 mL/kg to 3 mL/kg of Ioversol 320.
- The dosage recommended for use in children is 1 mL/kg to 3 mL/kg of Ioversol 320.
### Body Imaging
- Ioversol may be useful for enhancement of computed tomographic images for detection and evaluation of lesions in the liver, pancreas, kidneys, aorta, mediastinum, pelvis, abdominal cavity, and retroperitoneal space.
- Enhancement of computed tomography with Ioversol may be of benefit in establishing diagnoses of certain lesions in these sites with greater assurance than is possible with CT alone. In other cases, the contrast agent may allow visualization of lesions not seen with CT alone (i.e., tumor extension) or may help to define suspicious lesions seen with unenhanced CT (i.e., pancreatic cyst).
- Adults: Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 may be administered by bolus injection, by rapid infusion, or by a combination of both. The usual doses are summarized below:
- Dosage should not usually exceed 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 250 mL of Ioversol 240.
- Children: The dosage recommended for use in children is 1 mL/kg to 3 mL/kg of Ioversol 320, with a usual dose of 2 mL/kg.
### Intravenous Digital Subtraction Angiography
- Intravenous digital subtraction angiography (IV DSA) is a radiographic modality which allows dynamic imaging of the arterial system following intravenous injection of iodinated x-ray contrast media through the use of image intensification, enhancement of the iodine signal and digital processing of the image data. Temporal subtraction of the images obtained prior to and during the “first arterial pass” of the injected contrast medium yields images which are devoid of bone and soft tissue.
- IV DSA is most frequently used to examine the heart, including coronary by-pass grafts; the pulmonary arteries; arteries of the brachiocephalic circulation; the aortic arch; the abdominal aorta and its major branches; the iliac arteries; and the arteries of the extremities.
- No special patient preparation is required for IV DSA. However, it is advisable to ensure that patients are well hydrated prior to examination.
- In addition to the general precautions previously described, the risks associated with IV DSA include those usually attendant with catheter procedures and include intramural injections, vessel dissection and tissue extravasation. The potential risk is reduced when small test injections of contrast medium are made under fluoroscopic observation to ensure that the catheter tip is properly positioned and, in the case of peripheral placement, that the vein is of adequate size.
- Patient motion, including respiration and swallowing, can result in misregistration leading to image degradation and non-diagnostic studies.
### Usual Dosage
- Ioversol 350 may be injected centrally, in either the superior or inferior vena cava or right atrium; or peripherally into an appropriate arm vein. For central injections, catheters may be introduced at the antecubital fossa into either the basilic or cephalic vein or at the leg into the femoral vein and advanced to the distal segment of the corresponding vena cava. For peripheral injections, the catheter is introduced at the antecubital fossa into an appropriate size arm vein. In order to reduce the potential for extravasation during peripheral injection, a catheter of approximately 20 cm in length should be employed.
- Depending on the area to be imaged, the usual dose range per injection is 30 to 50 mL. Injections may be repeated as necessary. The total procedural dose should not exceed 250 mL.
- Injection rates will vary depending on the site of catheter placement and vessel size. Central catheter injections are usually made at a rate of between 10 and 30 mL/second. Peripheral injections are usually made at a rate of between 12 and 20 mL/second. Since the injected medium can sometimes remain in the arm vein for an extended period, it is advisable to flush the vein immediately following injection with an appropriate volume (20 to 25 mL) of Sodium Chloride Injection USP or 5% Dextrose in Water (D5W).
### Intravenous Urography
Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 is recommended for routine and high dose excretory urography. Preparatory dehydration is dangerous and may contribute to acute renal failure.
- Adults: The usual dose for routine excretory urography in adults is 50 to 75 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 75 to 100 mL of Ioversol 240. Higher dosages may be indicated to achieve optimum results where poor visualization is anticipated (e.g., elderly patients or patients with impaired renal function). In these patients, high dose urography may be preferred, using Ioversol 350 at a dose of 1.4 mL/kg (maximum 140 mL), Ioversol 320 at a dose of 1.5 to 2 mL/kg (maximum 150 mL), Ioversol 300 at a dose of 1.6 mL/kg (maximum 150 mL) or Ioversol 240 at a dose of 2 mL/kg (maximum 200 mL).
- Children: Ioversol 320 at doses of 0.5 mL/kg to 3 mL/kg of body weight has produced diagnostic opacification of the excretory tract. The usual dose for children is 1 mL/kg to 1.5 mL/kg. Dosage for infants and children should be administered in proportion to age and body weight. The total administered dose should not exceed 3 mL/kg.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ioversol (Patient information) in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ioversol (Patient information) in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Loversol FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ioversol (Patient information) in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ioversol (Patient information) in pediatric patients.
# Contraindications
- None
# Warnings
### General
- Diagnostic procedures which involve the use of iodinated intravascular contrast agents should be carried out under the direction of personnel skilled and experienced in the particular procedure to be performed. A fully equipped emergency cart, or equivalent supplies and equipment, and personnel competent in recognizing and treating adverse reactions of all types should always be available. Since severe delayed reactions have been known to occur, emergency facilities and competent personnel should be available for at least 30 to 60 minutes after administration.
- Preparatory dehydration is dangerous and may contribute to acute renal failure in patients with advanced vascular disease, diabetic patients, and in susceptible nondiabetic patients (often elderly with pre-existing renal disease). Patients should be well hydrated prior to and following the administration of Ioversol.
- The possibility of a reaction, including serious, life-threatening, fatal, anaphylactoid or cardiovascular reactions, should always be considered. Increased risk is associated with a history of previous reaction to a contrast medium, a known sensitivity to iodine and known allergies (i.e., bronchial asthma, hay fever and food allergies) or hypersensitivities.
- The occurrence of severe idiosyncratic reactions has prompted the use of several pretesting methods. However, pretesting cannot be relied upon to predict severe reactions and may itself be hazardous to the patient. It is suggested that a thorough medical history with emphasis on allergy and hypersensitivity, prior to the injection of any contrast medium, may be more accurate than pretesting in predicting potential adverse reactions. A positive history of allergies or hypersensitivity does not arbitrarily contraindicate the use of a contrast agent when a diagnostic procedure is thought essential, but caution should be exercised. Premedication with antihistamines or corticosteroids to avoid or minimize possible allergic reactions in such patients should be considered. Reports indicate that such pretreatment does not prevent serious life-threatening reactions, but may reduce both their incidence and severity.
- General anesthesia may be indicated in the performance of some procedures in selected patients; however, a higher incidence of adverse reactions has been reported in these patients, and may be attributable to the inability of the patient to identify untoward symptoms or to the hypotensive effect of anesthesia which can prolong the circulation time and increase the duration of exposure to the contrast agent.
- In angiographic procedures, the possibility of dislodging plaques or damaging or perforating the vessel wall should be considered during catheter manipulations and contrast medium injection. Test injections to ensure proper catheter placement are suggested.
- Angiography should be avoided whenever possible in patients with homocystinuria because of the risk of inducing thrombosis and embolism.
- Patients with congestive heart failure should be observed for several hours following the procedure to detect delayed hemodynamic disturbances which may be associated with a transitory increase in the circulating osmotic load.
- Selective coronary arteriography should be performed only in selected patients and those in whom the expected benefits outweigh the procedural risk. The inherent risks of angiocardiography in patients with chronic pulmonary emphysema must be weighed against the necessity for performing this procedure.
- Extreme caution during injection of a contrast medium is necessary to avoid extravasation. This is especially important in patients with severe arterial or venous disease.
### Information for Patients
- Patients receiving iodinated intravascular contrast agents should be instructed to:
Inform your physician if you are pregnant.
Inform your physician if you are diabetic or if you have multiple myeloma, pheochromocytoma, homozygous sickle cell disease or known thyroid disorder.
Inform your physician if you are allergic to any drugs or food, or if you had any reactions to previous injections of dyes used for x-ray procedures.
Inform your physician about any other medications you are currently taking including non-prescription drugs.
- Inform your physician if you are pregnant.
- Inform your physician if you are diabetic or if you have multiple myeloma, pheochromocytoma, homozygous sickle cell disease or known thyroid disorder.
- Inform your physician if you are allergic to any drugs or food, or if you had any reactions to previous injections of dyes used for x-ray procedures.
- Inform your physician about any other medications you are currently taking including non-prescription drugs.
# Adverse Reactions
## Clinical Trials Experience
- Adverse reactions following the use of Ioversol formulations are usually mild to moderate, of short duration and resolve spontaneously (without treatment). However, serious, life-threatening and fatal reactions, mostly of cardiovascular origin, have been associated with the administration of iodine-containing contrast media.
- Injections of contrast media are often associated with sensations of warmth and pain. In controlled double-blind clinical studies, significantly less warmth and pain were associated with the injection of Ioversol than with iothalamate meglumine, diatrizoate meglumine, and diatrizoate meglumine and diatrizoate sodium.
- When Ioversol was used for coronary arteriography and ventriculography in double-blind clinical trials, electrocardiographic and hemodynamic changes occurred with less frequency and severity with ioversol injection than with diatrizoate meglumine and diatrizoate sodium.
- Following coronary artery and left ventricular injection, electro-cardiographic parameters were affected less with Ioversol (ioversol injection) than with diatrizoate meglumine and diatrizoate sodium injection. These parameters included the following: bradycardia, tachycardia, T-wave amplitude, ST depression and ST elevation.
- Ioversol has also been shown to cause fewer changes in cardiac function and systemic blood pressure than conventional ionic media. These include cardiac output, left ventricular systolic pressure and end-diastolic pressure, right ventricular systolic pressure and pulmonary artery systolic pressures and decreases in systolic pressure and diastolic blood pressures.
The following table of incidence of reactions is based upon clinical trials with Ioversol formulations in 2,098 patients. This listing includes all adverse reactions which were coincidental to the administration of ioversol regardless of their direct attributability to the drug or the procedure. Adverse reactions are listed by organ system and in decreasing order of occurrence. Significantly more severe reactions are listed before others in a system regardless of frequency.
Regardless of the contrast medium employed, the overall incidence of serious adverse reaction is higher with coronary arteriography than with other procedures. Cardiac decompensation, serious arrhythmias, myocardial ischemia or myocardial infarction may occur during coronary arteriography and left ventriculography.
### Pediatrics
- In controlled clinical trials involving 159 patients for pediatric angiocardiography, contrast enhanced computed tomographic imaging of the head and body, and intravenous excretory urography, adverse reactions reported were as follows: fever (1.3%), nausea (0.6%), muscle spasm (0.6%), LV pressure changes (0.6%).
### General Adverse Reactions to Contrast Media
- The following adverse reactions are possible with any parenterally administered iodinated contrast medium. Severe life-threatening reactions and fatalities, mostly of cardiovascular origin, have occurred. Most deaths occur during injection or 5 to 10 minutes later; the main feature being cardiac arrest with cardiovascular disease as the main aggravating factor. Isolated reports of hypotensive collapse and shock are found in the literature. Based upon clinical literature, reported deaths from the administration of conventional iodinated contrast agents range from 6.6 per 1 million (0.00066 percent) to 1 in 10,000 patients (0.01 percent).
- The reported incidence of adverse reactions to contrast media in patients with a history of allergy is twice that of the general population. Patients with a history of previous reactions to a contrast medium are three times more susceptible than other patients. However, sensitivity to contrast media does not appear to increase with repeated examinations.
Adverse reactions to injectable contrast media fall into two categories: chemotoxic reactions and idiosyncratic reactions.
- Chemotoxic reactions result from the physiochemical properties of the contrast medium, the dose and the speed of injection. All hemodynamic disturbances and injuries to organs or vessels perfused by the contrast medium are included in this category.
- Idiosyncratic reactions include all other reactions. They occur more frequently in patients 20 to 40 years old. Idiosyncratic reactions may or may not be dependent on the dose injected, the speed of injection, the mode of injection and the radiographic procedure. Idiosyncratic reactions are subdivided into minor, intermediate and severe. The minor reactions are self-limited and of short duration; the severe reactions are life-threatening and treatment is urgent and mandatory.
In addition to the adverse reactions reported for ioversol, the following additional adverse reactions have been reported with the use of other contrast agents and are possible with any water soluble, iodinated contrast agent.
- Nervous: convulsions, aphasia, paralysis, visual field losses which are usually transient but may be permanent, coma and death.
- Cardiovascular: angioneurotic edema, peripheral edema, vasodilation, thrombosis and rarely thrombophlebitis, disseminated intravascular coagulation and shock.
- Skin: maculopapular rash, erythema, conjunctival symptoms, ecchymosis and tissue necrosis.
- Respiratory: choking, dyspnea, wheezing which may be an initial manifestation of more severe and infrequent reactions including asthmatic attack, laryngospasm and bronchospasm, apnea and cyanosis. Rarely these allergic-type reactions can progress into anaphylaxis with loss of consciousness, coma, severe cardiovascular disturbances and death.
- Miscellaneous: hyperthermia, temporary anuria or other nephropathy.
- Other reactions may also occur with the use of any contrast agent as a consequence of the procedural hazard; these include hemorrhage or pseudoaneurysms at the puncture site, brachial plexus palsy following axillary artery injections, chest pain, myocardial infarction, and transient changes in hepatorenal chemistry tests. Arterial thrombosis, displacement of arterial plaques, venous thrombosis, dissection of the coronary vessels and transient sinus arrest are rare complications.
## Postmarketing Experience
There is limited information regarding Loversol Postmarketing Experience in the drug label.
# Drug Interactions
### Drug Interactions
- Renal toxicity has been reported in a few patients with liver dysfunction who were given oral cholecystographic agents followed by intravascular contrast agents. Administration of any intravascular contrast agent should therefore be postponed in patients who have recently received a cholecystographic contrast agent.
- Other drugs should not be mixed with ioversol injection.
### Drug/Laboratory Test Interactions
- The results of PBI and radioactive iodine uptake studies, which depend on iodine estimation, will not accurately reflect thyroid function for up to 16 days following administration of iodinated contrast media. However, thyroid function tests not depending on iodine estimations, e.g., T3 resin uptake and total or free thyroxine (T4) assays are not affected.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): B
- No teratogenic effects attributable to ioversol have been observed in teratology studies performed in animals. There are, however, no adequate and well controlled studies in pregnant women. It is not known whether ioversol crosses the placental barrier or reaches fetal tissues. However, many injectable contrast agents cross the placental barrier in humans and appear to enter fetal tissue passively. Because animal teratology studies are not always predictive of human response, this drug should be used during pregnancy only if clearly needed. X-ray procedures involve a certain risk related to the exposure of the fetus.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Loversol in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Loversol during labor and delivery.
### Nursing Mothers
- It is not known whether ioversol is excreted in human milk. However, many injectable contrast agents are excreted unchanged in human milk. Although it has not been established that serious adverse reactions occur in nursing infants, caution should be exercised when intravascular contrast media are administered to nursing women because of potential adverse reactions, and consideration should be given to temporarily discontinuing nursing.
### Pediatric Use
- Safety and effectiveness in children have been established for the use of Ioversol 350 and Ioversol 320 in angiocardiography, and for Ioversol 320 in contrast enhanced computed tomographic imaging of the head and body, and intravenous excretory urography.
- Safety and effectiveness in newborns have not been established.
### Geriatic Use
There is no FDA guidance on the use of Loversol in geriatric settings.
### Gender
There is no FDA guidance on the use of Loversol with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Loversol with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Loversol in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Loversol in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Loversol in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Loversol in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Loversol Administration in the drug label.
### Monitoring
There is limited information regarding Loversol Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Loversol and IV administrations.
# Overdosage
- The adverse effects of overdosage are life-threatening and affect mainly the pulmonary and cardiovascular system. Treatment of an overdosage is directed toward the support of all vital functions and prompt institution of symptomatic therapy.
- Ioversol does not bind to plasma or serum protein and is, therefore, dialyzable.
- The intravenous LD50 values (gI/kg) for ioversol in animals were: 17 (mice), and 15 (rats).
# Pharmacology
## Mechanism of Action
There is limited information regarding Loversol Mechanism of Action in the drug label.
## Structure
There is limited information regarding Loversol Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Loversol Pharmacodynamics in the drug label.
## Pharmacokinetics
- The pharmacokinetics of ioversol intravascularly administered in normal subjects conform to an open two compartment model with first order elimination (a rapid alpha phase for drug distribution and a slower beta phase for drug elimination). Based on the blood clearance curves for 12 healthy volunteers (6 receiving 50 mL and 6 receiving 150 mL of Ioversol 320), the biological half-life was 1.5 hours for both dose levels and there was no evidence of any dose related difference in the rate of elimination.
- Ioversol is excreted mainly through the kidneys following intravascular administration. In patients with impaired renal function, the elimination half-life is prolonged. In the absence of renal dysfunction, the mean half-life for urinary excretion following a 50 mL dose was 118 minutes (105 to 156) and following a 150 mL dose was 105 minutes (74 to 141). Greater than 95% of the administered dose was excreted within the first 24 hours, with the peak urine concentration occurring in the first 2 hours after administration. Fecal elimination was negligible.
- Ioversol does not bind to serum or plasma proteins to any extent and no significant metabolism, deiodination or biotransformation occurs.
- Ioversol probably crosses the placental barrier in humans by simple diffusion. It is not known to what extent ioversol is excreted in human milk.
- Intravascular injection of ioversol opacifies those vessels in the path of the flow of the contrast medium, permitting radiographic visualization of the internal structures until significant hemodilution occurs.
- Ioversol may be visualized in the renal parenchyma within 30 to 60 seconds following rapid intravenous injection. Opacification of the calyces and pelves in patients with normal renal function becomes apparent within 1 to 3 minutes, with optimum contrast occurring within 5 to 15 minutes.
- Animal studies indicate that ioversol does not cross the blood-brain barrier or cause endothelial damage to any significant extent.
- Ioversol enhances computed tomographic imaging through augmentation of radiographic efficiency. The degree of density enhancement is directly related to the iodine content in an administered dose; peak iodine blood levels occur immediately following rapid intravenous injection. Blood levels fall rapidly within 5 to 10 minutes and the vascular compartment half-life is approximately 20 minutes. This can be accounted for by the dilution in the vascular and extravascular fluid compartments which causes an initial sharp fall in plasma concentration. Equilibration with the extracellular compartments is reached in about 10 minutes; thereafter, the fall becomes exponential.
- The pharmacokinetics of ioversol in both normal and abnormal tissue have been shown to be variable. Contrast enhancement appears to be greatest immediately after bolus administration (15 seconds to 120 seconds). Thus, greatest enhancement may be detected by a series of consecutive two-to-three second scans performed within 30 to 90 seconds after injection (i.e., dynamic computed tomographic imaging). Utilization of a continuous scanning technique (i.e., dynamic CT scanning) may improve enhancement and diagnostic assessment of tumor and other lesions such as abscess, occasionally revealing unsuspected or more extensive disease. For example, a cyst may be distinguished from a vascularized solid lesion when precontrast and enhanced scans are compared; the nonperfused mass shows unchanged x-ray absorption (CT number). A vascularized lesion is characterized by an increase in CT number in the few minutes after a bolus of intravascular contrast agent; it may be malignant, benign, or normal tissue, but would probably not be a cyst, hematoma, or other nonvascular lesion.
- Because unenhanced scanning may provide adequate diagnostic information in the individual patient, the decision to employ contrast enhancement, which may be associated with risk and increased radiation exposure, should be based upon a careful evaluation of clinical, other radiological, and unenhanced CT findings.
### CT Scanning Of The Head
- In contrast enhanced computed tomographic head imaging, Ioversol does not accumulate in normal brain tissue due to the presence of the normal blood-brain barrier. The increase in x-ray absorption in the normal brain is due to the presence of contrast agent within the blood pool. A break in the blood-brain barrier such as occurs in malignant tumors of the brain allows for the accumulation of contrast medium within the interstitial tissue of the tumor. Adjacent normal brain tissue does not contain the contrast medium.
- Maximum contrast enhancement in tissue frequently occurs after peak blood iodine levels are reached. A delay in maximum contrast enhancement can occur. Diagnostic contrast enhanced images of the brain have been obtained up to 1 hour after intravenous bolus administration. This delay suggests that radiographic contrast enhancement is at least in part dependent on the accumulation of iodine containing medium within the lesion and outside the blood pool, although the mechanism by which this occurs is not clear. The radiographic enhancement of nontumoral lesions, such as arteriovenous malformations and aneurysms, is probably dependent on the iodine content of the circulating blood pool.
- In patients where the blood-brain barrier is known or suspected to be disrupted, the use of any radiographic contrast medium must be assessed on an individual risk to benefit basis. However, compared to ionic media, nonionic media are less toxic to the central nervous system.
### CT Scanning Of The Body
- In contrast enhanced computed tomographic body imaging (nonneural tissue), Ioversol diffuses rapidly from the vascular into the extravascular space. Increase in x-ray absorption is related to blood flow, concentration of the contrast medium, and extraction of the contrast medium by interstitial tissue of tumors since no barrier exists. Contrast enhancement is thus due to the relative differences in extravascular diffusion between normal and abnormal tissue, quite different from that in the brain.
## Nonclinical Toxicology
There is limited information regarding Loversol Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Loversol Clinical Studies in the drug label.
# How Supplied
## Storage
- Store Ioversol and Ioversol RFID-tagged syringes at 25°C (77°F); excursions permitted to 15° to 30°C (59° to 86°F) . Ioversol is sensitive to light and must be protected from strong daylight or direct exposure to the sun. If Ioversol syringes are frozen or if crystallization occurs, the syringe and contents should be discarded. If Ioversol in glass bottles is frozen or if crystallization occurs, the bottle and contents should be discarded. Ioversol may be stored up to 40°C for up to one month in a contrast media warmer utilizing circulating warm air. When storing Ioversol for periods longer than one month, store at 25°C (77°F); excursions permitted to 15° to 30°C (59° to 86°F) . Do not reautoclave plastic container because of possible damage to syringe.
- As with all contrast media, glass and plastic containers should be inspected prior to use to ensure that breakage or other damage has not occurred during shipping and handling. All containers should be inspected for closure integrity. Damaged containers should not be used.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Loversol Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Ioversol (Patient information) interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- Optiray
# Look-Alike Drug Names
There is limited information regarding Loversol Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Loversol
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Alberto Plate [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Loversol is a diagnostic agent and radiological contrast media that is FDA approved for the procedure of peripheral and coronary arteriography, left ventriculography, contrast enhanced computed tomographic imaging of the head and body, intravenous excretory urography, intravenous digital subtraction angiography and venography. Ioversol 350 is indicated in children for angiocardiography. There is a Black Box Warning for this drug as shown here. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### General
- As with all radiopaque contrast agents, only the lowest dose necessary to obtain adequate visualization should be used. A lower dose may reduce the possibility of an adverse reaction. Most procedures do not require use of either the maximum volume or the highest concentration of Ioversol. The combination of volume and concentration of Ioversol to be used should be carefully individualized accounting for factors such as age, body weight, size of the vessel and the rate of blood flow within the vessel. Other factors such as anticipated pathology, degree and extent of opacification required, structure(s) or area to be examined, disease processes affecting the patient, and equipment and technique to be employed should be considered.
- It is desirable that intravascularly administered iodinated contrast agents be at or close to body temperature when injected.
- If during administration a reaction occurs, the injection should be stopped until the reaction has subsided.
- Patients should be well hydrated prior to and following Ioversol (ioversol injection) administration.
- As with all contrast media, other drugs should not be mixed with ioversol solutions because of the potential for chemical incompatibility.
- Sterile technique must be used in all vascular injections involving contrast media.
- If nondisposable equipment is used, scrupulous care should be taken to prevent residual contamination with traces of cleansing agents.
- Withdrawal of contrast agents from their containers should be accomplished under strict aseptic conditions using only sterile syringes and transfer devices. Contrast agents which have been transferred into other delivery systems should be used immediately.
- Parenteral drug products should be inspected visually for particulate matter and discoloration prior to administration and should not be used if particulates are observed or marked discoloration has occurred.
- The Ioversol formulations are supplied in single dose containers. Discard unused portion.
## General Angiography
- Visualization of the cardiovascular system may be accomplished by any accepted radiological technique.
### Cerebral Arteriography
- Extreme caution is advised in patients with advanced arteriosclerosis, severe hypertension, cardiac decompensation, senility, recent cerebral thrombosis or embolism, and migraine. Cardiovascular reactions that may occur with some frequency are bradycardia and either an increase or decrease in systemic blood pressure. Neurological reactions that may occur are: seizures, drowsiness, transient paresis, and mild disturbances in vision.
- Central nervous system reactions with Ioversol in controlled clinical studies in cerebral arteriography that were considered drug-related and occurred with frequencies greater than 1% were: headache, bradycardia, blood pressure fluctuation, disorientation, nausea and vertigo.
- Ioversol 240, Ioversol 300 or Ioversol 320 is recommended for this procedure. The usual individual injection for visualization of the carotid or vertebral arteries is 2 to 12 mL, repeated as necessary. Aortic arch injection for a simultaneous four vessel study requires 20 to 50 mL. Total procedural doses should not usually exceed 200 mL.
### Peripheral Arteriography
- Pulsation should be present in the artery to be injected. In thromboangiitis obliterans, or ascending infection associated with severe ischemia, angiography should be performed with extreme caution, if at all.
- Ioversol 300, Ioversol 320 or Ioversol 350 is recommended for this procedure. The usual individual injection volumes for visualization of various peripheral arteries are as follows:
- These doses may be repeated as necessary. Total procedural doses should not usually exceed 250 mL.
### Visceral and Renal Arteriography and Aortography
- In aortography, depending on the technique employed, the risks of this procedure also include the following: injury to the aorta and neighboring organs, pleural puncture, renal damage including infarction and acute tubular necrosis with oliguria and anuria, retroperitoneal hemorrhage from the translumbar approach and spinal cord injury and pathology associated with the syndrome of transverse myelitis.
Under conditions of slowed aortic circulation there is an increased likelihood for aortography to cause muscle spasm. Occasional serious neurologic complications, including paraplegia, have also been reported in patients with aortoiliac obstruction, femoral artery obstruction, abdominal compression, hypotension, hypertension, spinal anesthesia, and injection of vasopressors to increase contrast. In these patients the concentration, volume, and number of repeat injections of the medium should be maintained at a minimum with appropriate intervals between injections. The position of the patient and catheter tip should be carefully monitored.
- Entry of a large aortic dose into the renal artery may cause, even in the absence of symptoms, albuminuria, hematuria, and an elevated creatinine and urea nitrogen. Rapid and complete return of function usually follows.
- Ioversol 320 is recommended for visceral arteriography, renal arteriography, and aortography procedures. The usual individual injection volumes for visualization for the aorta and various visceral arteries are as follows:
- These doses may be repeated as necessary. Total procedural doses should not usually exceed 250 mL.
### Coronary Arteriography and Left Ventriculography
- Mandatory prerequisites to the procedure are specialized personnel, ECG monitoring apparatus and adequate facilities for immediate resuscitation and cardioversion. Electrocardiograms and vital signs should be routinely monitored throughout the procedure.
- There were no cardiovascular system reactions with Ioversol in controlled clinical studies in coronary arteriography with left ventriculography that were considered drug-related and occurred with a frequency greater than 1%.
- Ioversol 320 or Ioversol 350 is recommended for this procedure. The usual individual injection volumes for visualization of the coronary arteries and left ventricle are:
- These doses may be repeated as necessary. Total procedural dose for the combined procedures should not usually exceed 250 mL. When large individual volumes are administered, as in ventriculography and aortography, it has been suggested that several minutes be permitted to elapse between each injection to allow for subsidence of possible hemodynamic disturbances.
### Pediatric Angiocardiography
- Mandatory prerequisites to the procedure are specialized personnel, ECG monitoring apparatus and adequate facilities for immediate resuscitation and cardioversion. Electrocardiograms and vital signs should be routinely monitored throughout the procedure. Pediatric patients at higher risk of experiencing adverse events during contrast medium administration may include those having asthma, a sensitivity to medication and/or allergens, congestive heart failure, a serum creatinine greater than 1.5 mg/dL, or those less than 12 months of age.
- Ioversol 350 or Ioversol 320 is recommended for this procedure. The usual single ventricular injection of Ioversol 350 or Ioversol 320 is 1.25 mL/kg of body weight with a range of 1 mL/kg to 1.5 mL/kg. When multiple injections are given, the total administered dose should not exceed 5 mL/kg up to a total volume of 250 mL.
### Venography
- Special care is required when venography is performed in patients with suspected thrombosis, phlebitis, severe ischemic disease, local infection or a totally obstructed venous system. In order to minimize extravasation during injection, fluoroscopy is recommended.
- Ioversol 240, Ioversol 300, Ioversol 320 or Ioversol 350 is recommended for this procedure. The usual dose is 50 to 100 mL per extremity with smaller or larger volumes indicated in some cases. Dosage should not usually exceed 250 mL.
- Following the procedure, the venous system should be flushed with Sodium Chloride Injection USP or 5% Dextrose in Water (D5W). Massage and elevation are also helpful for clearing the contrast medium from the extremity.
### Computed Tomography
- Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 is recommended for head imaging.
- Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 is recommended for body imaging.
- Tumors: Ioversol may be useful to investigate the presence and extent of certain malignancies such as: gliomas including malignant gliomas, glioblastomas, astrocytomas, oligodendrogliomas and gangliomas, ependymomas, medulloblastomas, meningiomas, neuromas, pinealomas, pituitary adenomas, craniopharyngiomas, germinomas, and metastatic lesions. The usefulness of contrast enhancement for the investigation of the retrobulbar space and in cases of low grade or infiltrative glioma has not been demonstrated. In calcified lesions, there is less likelihood of enhancement. Following therapy, tumors may show decreased or no enhancement. The opacification of the inferior vermis following contrast media administration has resulted in false-positive diagnosis in a number of otherwise normal studies.
- Non-neoplastic Conditions: Ioversol may be beneficial in the image enhancement of non-neoplastic lesions. Cerebral infarctions of recent onset may be better visualized with contrast enhancement, while some infarctions are obscured if contrast medium is used. The use of iodinated contrast media results in enhancement in about 60% of cerebral infarctions studied from one to four weeks from the onset of symptoms.
- Sites of active infection may also be enhanced following contrast medium administration.
- Arteriovenous malformations and aneurysms will show contrast enhancement. For these vascular lesions the enhancement is probably dependent on the iodine content of the circulating blood pool. Hematomas and intraparenchymal bleeders seldom demonstrate contrast enhancement. However, in cases of intraparenchymal clot, for which there is no obvious clinical explanation, contrast media administration may be helpful in ruling out the possibility of associated arteriovenous malformation.
- Adults
For adults, the usual dosage is 50 to 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 100 to 250 mL of Ioversol 240. Scanning may be performed immediately after completion of the intravenous administration. Dosage should not usually exceed 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 250 mL of Ioversol 240.
- For adults, the usual dosage is 50 to 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 100 to 250 mL of Ioversol 240. Scanning may be performed immediately after completion of the intravenous administration. Dosage should not usually exceed 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 250 mL of Ioversol 240.
- Children
The dosage recommended for use in children is 1 mL/kg to 3 mL/kg of Ioversol 320.
- The dosage recommended for use in children is 1 mL/kg to 3 mL/kg of Ioversol 320.
### Body Imaging
- Ioversol may be useful for enhancement of computed tomographic images for detection and evaluation of lesions in the liver, pancreas, kidneys, aorta, mediastinum, pelvis, abdominal cavity, and retroperitoneal space.
- Enhancement of computed tomography with Ioversol may be of benefit in establishing diagnoses of certain lesions in these sites with greater assurance than is possible with CT alone. In other cases, the contrast agent may allow visualization of lesions not seen with CT alone (i.e., tumor extension) or may help to define suspicious lesions seen with unenhanced CT (i.e., pancreatic cyst).
- Adults: Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 may be administered by bolus injection, by rapid infusion, or by a combination of both. The usual doses are summarized below:
- Dosage should not usually exceed 150 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 250 mL of Ioversol 240.
- Children: The dosage recommended for use in children is 1 mL/kg to 3 mL/kg of Ioversol 320, with a usual dose of 2 mL/kg.
### Intravenous Digital Subtraction Angiography
- Intravenous digital subtraction angiography (IV DSA) is a radiographic modality which allows dynamic imaging of the arterial system following intravenous injection of iodinated x-ray contrast media through the use of image intensification, enhancement of the iodine signal and digital processing of the image data. Temporal subtraction of the images obtained prior to and during the “first arterial pass” of the injected contrast medium yields images which are devoid of bone and soft tissue.
- IV DSA is most frequently used to examine the heart, including coronary by-pass grafts; the pulmonary arteries; arteries of the brachiocephalic circulation; the aortic arch; the abdominal aorta and its major branches; the iliac arteries; and the arteries of the extremities.
- No special patient preparation is required for IV DSA. However, it is advisable to ensure that patients are well hydrated prior to examination.
- In addition to the general precautions previously described, the risks associated with IV DSA include those usually attendant with catheter procedures and include intramural injections, vessel dissection and tissue extravasation. The potential risk is reduced when small test injections of contrast medium are made under fluoroscopic observation to ensure that the catheter tip is properly positioned and, in the case of peripheral placement, that the vein is of adequate size.
- Patient motion, including respiration and swallowing, can result in misregistration leading to image degradation and non-diagnostic studies.
### Usual Dosage
- Ioversol 350 may be injected centrally, in either the superior or inferior vena cava or right atrium; or peripherally into an appropriate arm vein. For central injections, catheters may be introduced at the antecubital fossa into either the basilic or cephalic vein or at the leg into the femoral vein and advanced to the distal segment of the corresponding vena cava. For peripheral injections, the catheter is introduced at the antecubital fossa into an appropriate size arm vein. In order to reduce the potential for extravasation during peripheral injection, a catheter of approximately 20 cm in length should be employed.
- Depending on the area to be imaged, the usual dose range per injection is 30 to 50 mL. Injections may be repeated as necessary. The total procedural dose should not exceed 250 mL.
- Injection rates will vary depending on the site of catheter placement and vessel size. Central catheter injections are usually made at a rate of between 10 and 30 mL/second. Peripheral injections are usually made at a rate of between 12 and 20 mL/second. Since the injected medium can sometimes remain in the arm vein for an extended period, it is advisable to flush the vein immediately following injection with an appropriate volume (20 to 25 mL) of Sodium Chloride Injection USP or 5% Dextrose in Water (D5W).
### Intravenous Urography
Ioversol 350, Ioversol 320, Ioversol 300 or Ioversol 240 is recommended for routine and high dose excretory urography. Preparatory dehydration is dangerous and may contribute to acute renal failure.
- Adults: The usual dose for routine excretory urography in adults is 50 to 75 mL of Ioversol 350, Ioversol 320 or Ioversol 300 or 75 to 100 mL of Ioversol 240. Higher dosages may be indicated to achieve optimum results where poor visualization is anticipated (e.g., elderly patients or patients with impaired renal function). In these patients, high dose urography may be preferred, using Ioversol 350 at a dose of 1.4 mL/kg (maximum 140 mL), Ioversol 320 at a dose of 1.5 to 2 mL/kg (maximum 150 mL), Ioversol 300 at a dose of 1.6 mL/kg (maximum 150 mL) or Ioversol 240 at a dose of 2 mL/kg (maximum 200 mL).
- Children: Ioversol 320 at doses of 0.5 mL/kg to 3 mL/kg of body weight has produced diagnostic opacification of the excretory tract. The usual dose for children is 1 mL/kg to 1.5 mL/kg. Dosage for infants and children should be administered in proportion to age and body weight. The total administered dose should not exceed 3 mL/kg.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ioversol (Patient information) in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ioversol (Patient information) in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Loversol FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ioversol (Patient information) in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ioversol (Patient information) in pediatric patients.
# Contraindications
- None
# Warnings
### General
- Diagnostic procedures which involve the use of iodinated intravascular contrast agents should be carried out under the direction of personnel skilled and experienced in the particular procedure to be performed. A fully equipped emergency cart, or equivalent supplies and equipment, and personnel competent in recognizing and treating adverse reactions of all types should always be available. Since severe delayed reactions have been known to occur, emergency facilities and competent personnel should be available for at least 30 to 60 minutes after administration.
- Preparatory dehydration is dangerous and may contribute to acute renal failure in patients with advanced vascular disease, diabetic patients, and in susceptible nondiabetic patients (often elderly with pre-existing renal disease). Patients should be well hydrated prior to and following the administration of Ioversol.
- The possibility of a reaction, including serious, life-threatening, fatal, anaphylactoid or cardiovascular reactions, should always be considered. Increased risk is associated with a history of previous reaction to a contrast medium, a known sensitivity to iodine and known allergies (i.e., bronchial asthma, hay fever and food allergies) or hypersensitivities.
- The occurrence of severe idiosyncratic reactions has prompted the use of several pretesting methods. However, pretesting cannot be relied upon to predict severe reactions and may itself be hazardous to the patient. It is suggested that a thorough medical history with emphasis on allergy and hypersensitivity, prior to the injection of any contrast medium, may be more accurate than pretesting in predicting potential adverse reactions. A positive history of allergies or hypersensitivity does not arbitrarily contraindicate the use of a contrast agent when a diagnostic procedure is thought essential, but caution should be exercised. Premedication with antihistamines or corticosteroids to avoid or minimize possible allergic reactions in such patients should be considered. Reports indicate that such pretreatment does not prevent serious life-threatening reactions, but may reduce both their incidence and severity.
- General anesthesia may be indicated in the performance of some procedures in selected patients; however, a higher incidence of adverse reactions has been reported in these patients, and may be attributable to the inability of the patient to identify untoward symptoms or to the hypotensive effect of anesthesia which can prolong the circulation time and increase the duration of exposure to the contrast agent.
- In angiographic procedures, the possibility of dislodging plaques or damaging or perforating the vessel wall should be considered during catheter manipulations and contrast medium injection. Test injections to ensure proper catheter placement are suggested.
- Angiography should be avoided whenever possible in patients with homocystinuria because of the risk of inducing thrombosis and embolism.
- Patients with congestive heart failure should be observed for several hours following the procedure to detect delayed hemodynamic disturbances which may be associated with a transitory increase in the circulating osmotic load.
- Selective coronary arteriography should be performed only in selected patients and those in whom the expected benefits outweigh the procedural risk. The inherent risks of angiocardiography in patients with chronic pulmonary emphysema must be weighed against the necessity for performing this procedure.
- Extreme caution during injection of a contrast medium is necessary to avoid extravasation. This is especially important in patients with severe arterial or venous disease.
### Information for Patients
- Patients receiving iodinated intravascular contrast agents should be instructed to:
Inform your physician if you are pregnant.
Inform your physician if you are diabetic or if you have multiple myeloma, pheochromocytoma, homozygous sickle cell disease or known thyroid disorder.
Inform your physician if you are allergic to any drugs or food, or if you had any reactions to previous injections of dyes used for x-ray procedures.
Inform your physician about any other medications you are currently taking including non-prescription drugs.
- Inform your physician if you are pregnant.
- Inform your physician if you are diabetic or if you have multiple myeloma, pheochromocytoma, homozygous sickle cell disease or known thyroid disorder.
- Inform your physician if you are allergic to any drugs or food, or if you had any reactions to previous injections of dyes used for x-ray procedures.
- Inform your physician about any other medications you are currently taking including non-prescription drugs.
# Adverse Reactions
## Clinical Trials Experience
- Adverse reactions following the use of Ioversol formulations are usually mild to moderate, of short duration and resolve spontaneously (without treatment). However, serious, life-threatening and fatal reactions, mostly of cardiovascular origin, have been associated with the administration of iodine-containing contrast media.
- Injections of contrast media are often associated with sensations of warmth and pain. In controlled double-blind clinical studies, significantly less warmth and pain were associated with the injection of Ioversol than with iothalamate meglumine, diatrizoate meglumine, and diatrizoate meglumine and diatrizoate sodium.
- When Ioversol was used for coronary arteriography and ventriculography in double-blind clinical trials, electrocardiographic and hemodynamic changes occurred with less frequency and severity with ioversol injection than with diatrizoate meglumine and diatrizoate sodium.
- Following coronary artery and left ventricular injection, electro-cardiographic parameters were affected less with Ioversol (ioversol injection) than with diatrizoate meglumine and diatrizoate sodium injection. These parameters included the following: bradycardia, tachycardia, T-wave amplitude, ST depression and ST elevation.
- Ioversol has also been shown to cause fewer changes in cardiac function and systemic blood pressure than conventional ionic media. These include cardiac output, left ventricular systolic pressure and end-diastolic pressure, right ventricular systolic pressure and pulmonary artery systolic pressures and decreases in systolic pressure and diastolic blood pressures.
The following table of incidence of reactions is based upon clinical trials with Ioversol formulations in 2,098 patients. This listing includes all adverse reactions which were coincidental to the administration of ioversol regardless of their direct attributability to the drug or the procedure. Adverse reactions are listed by organ system and in decreasing order of occurrence. Significantly more severe reactions are listed before others in a system regardless of frequency.
Regardless of the contrast medium employed, the overall incidence of serious adverse reaction is higher with coronary arteriography than with other procedures. Cardiac decompensation, serious arrhythmias, myocardial ischemia or myocardial infarction may occur during coronary arteriography and left ventriculography.
### Pediatrics
- In controlled clinical trials involving 159 patients for pediatric angiocardiography, contrast enhanced computed tomographic imaging of the head and body, and intravenous excretory urography, adverse reactions reported were as follows: fever (1.3%), nausea (0.6%), muscle spasm (0.6%), LV pressure changes (0.6%).
### General Adverse Reactions to Contrast Media
- The following adverse reactions are possible with any parenterally administered iodinated contrast medium. Severe life-threatening reactions and fatalities, mostly of cardiovascular origin, have occurred. Most deaths occur during injection or 5 to 10 minutes later; the main feature being cardiac arrest with cardiovascular disease as the main aggravating factor. Isolated reports of hypotensive collapse and shock are found in the literature. Based upon clinical literature, reported deaths from the administration of conventional iodinated contrast agents range from 6.6 per 1 million (0.00066 percent) to 1 in 10,000 patients (0.01 percent).
- The reported incidence of adverse reactions to contrast media in patients with a history of allergy is twice that of the general population. Patients with a history of previous reactions to a contrast medium are three times more susceptible than other patients. However, sensitivity to contrast media does not appear to increase with repeated examinations.
Adverse reactions to injectable contrast media fall into two categories: chemotoxic reactions and idiosyncratic reactions.
- Chemotoxic reactions result from the physiochemical properties of the contrast medium, the dose and the speed of injection. All hemodynamic disturbances and injuries to organs or vessels perfused by the contrast medium are included in this category.
- Idiosyncratic reactions include all other reactions. They occur more frequently in patients 20 to 40 years old. Idiosyncratic reactions may or may not be dependent on the dose injected, the speed of injection, the mode of injection and the radiographic procedure. Idiosyncratic reactions are subdivided into minor, intermediate and severe. The minor reactions are self-limited and of short duration; the severe reactions are life-threatening and treatment is urgent and mandatory.
In addition to the adverse reactions reported for ioversol, the following additional adverse reactions have been reported with the use of other contrast agents and are possible with any water soluble, iodinated contrast agent.
- Nervous: convulsions, aphasia, paralysis, visual field losses which are usually transient but may be permanent, coma and death.
- Cardiovascular: angioneurotic edema, peripheral edema, vasodilation, thrombosis and rarely thrombophlebitis, disseminated intravascular coagulation and shock.
- Skin: maculopapular rash, erythema, conjunctival symptoms, ecchymosis and tissue necrosis.
- Respiratory: choking, dyspnea, wheezing which may be an initial manifestation of more severe and infrequent reactions including asthmatic attack, laryngospasm and bronchospasm, apnea and cyanosis. Rarely these allergic-type reactions can progress into anaphylaxis with loss of consciousness, coma, severe cardiovascular disturbances and death.
- Miscellaneous: hyperthermia, temporary anuria or other nephropathy.
- Other reactions may also occur with the use of any contrast agent as a consequence of the procedural hazard; these include hemorrhage or pseudoaneurysms at the puncture site, brachial plexus palsy following axillary artery injections, chest pain, myocardial infarction, and transient changes in hepatorenal chemistry tests. Arterial thrombosis, displacement of arterial plaques, venous thrombosis, dissection of the coronary vessels and transient sinus arrest are rare complications.
## Postmarketing Experience
There is limited information regarding Loversol Postmarketing Experience in the drug label.
# Drug Interactions
### Drug Interactions
- Renal toxicity has been reported in a few patients with liver dysfunction who were given oral cholecystographic agents followed by intravascular contrast agents. Administration of any intravascular contrast agent should therefore be postponed in patients who have recently received a cholecystographic contrast agent.
- Other drugs should not be mixed with ioversol injection.
### Drug/Laboratory Test Interactions
- The results of PBI and radioactive iodine uptake studies, which depend on iodine estimation, will not accurately reflect thyroid function for up to 16 days following administration of iodinated contrast media. However, thyroid function tests not depending on iodine estimations, e.g., T3 resin uptake and total or free thyroxine (T4) assays are not affected.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): B
- No teratogenic effects attributable to ioversol have been observed in teratology studies performed in animals. There are, however, no adequate and well controlled studies in pregnant women. It is not known whether ioversol crosses the placental barrier or reaches fetal tissues. However, many injectable contrast agents cross the placental barrier in humans and appear to enter fetal tissue passively. Because animal teratology studies are not always predictive of human response, this drug should be used during pregnancy only if clearly needed. X-ray procedures involve a certain risk related to the exposure of the fetus.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Loversol in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Loversol during labor and delivery.
### Nursing Mothers
- It is not known whether ioversol is excreted in human milk. However, many injectable contrast agents are excreted unchanged in human milk. Although it has not been established that serious adverse reactions occur in nursing infants, caution should be exercised when intravascular contrast media are administered to nursing women because of potential adverse reactions, and consideration should be given to temporarily discontinuing nursing.
### Pediatric Use
- Safety and effectiveness in children have been established for the use of Ioversol 350 and Ioversol 320 in angiocardiography, and for Ioversol 320 in contrast enhanced computed tomographic imaging of the head and body, and intravenous excretory urography.
- Safety and effectiveness in newborns have not been established.
### Geriatic Use
There is no FDA guidance on the use of Loversol in geriatric settings.
### Gender
There is no FDA guidance on the use of Loversol with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Loversol with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Loversol in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Loversol in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Loversol in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Loversol in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Loversol Administration in the drug label.
### Monitoring
There is limited information regarding Loversol Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Loversol and IV administrations.
# Overdosage
- The adverse effects of overdosage are life-threatening and affect mainly the pulmonary and cardiovascular system. Treatment of an overdosage is directed toward the support of all vital functions and prompt institution of symptomatic therapy.
- Ioversol does not bind to plasma or serum protein and is, therefore, dialyzable.
- The intravenous LD50 values (gI/kg) for ioversol in animals were: 17 (mice), and 15 (rats).
# Pharmacology
## Mechanism of Action
There is limited information regarding Loversol Mechanism of Action in the drug label.
## Structure
There is limited information regarding Loversol Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Loversol Pharmacodynamics in the drug label.
## Pharmacokinetics
- The pharmacokinetics of ioversol intravascularly administered in normal subjects conform to an open two compartment model with first order elimination (a rapid alpha phase for drug distribution and a slower beta phase for drug elimination). Based on the blood clearance curves for 12 healthy volunteers (6 receiving 50 mL and 6 receiving 150 mL of Ioversol 320), the biological half-life was 1.5 hours for both dose levels and there was no evidence of any dose related difference in the rate of elimination.
- Ioversol is excreted mainly through the kidneys following intravascular administration. In patients with impaired renal function, the elimination half-life is prolonged. In the absence of renal dysfunction, the mean half-life for urinary excretion following a 50 mL dose was 118 minutes (105 to 156) and following a 150 mL dose was 105 minutes (74 to 141). Greater than 95% of the administered dose was excreted within the first 24 hours, with the peak urine concentration occurring in the first 2 hours after administration. Fecal elimination was negligible.
- Ioversol does not bind to serum or plasma proteins to any extent and no significant metabolism, deiodination or biotransformation occurs.
- Ioversol probably crosses the placental barrier in humans by simple diffusion. It is not known to what extent ioversol is excreted in human milk.
- Intravascular injection of ioversol opacifies those vessels in the path of the flow of the contrast medium, permitting radiographic visualization of the internal structures until significant hemodilution occurs.
- Ioversol may be visualized in the renal parenchyma within 30 to 60 seconds following rapid intravenous injection. Opacification of the calyces and pelves in patients with normal renal function becomes apparent within 1 to 3 minutes, with optimum contrast occurring within 5 to 15 minutes.
- Animal studies indicate that ioversol does not cross the blood-brain barrier or cause endothelial damage to any significant extent.
- Ioversol enhances computed tomographic imaging through augmentation of radiographic efficiency. The degree of density enhancement is directly related to the iodine content in an administered dose; peak iodine blood levels occur immediately following rapid intravenous injection. Blood levels fall rapidly within 5 to 10 minutes and the vascular compartment half-life is approximately 20 minutes. This can be accounted for by the dilution in the vascular and extravascular fluid compartments which causes an initial sharp fall in plasma concentration. Equilibration with the extracellular compartments is reached in about 10 minutes; thereafter, the fall becomes exponential.
- The pharmacokinetics of ioversol in both normal and abnormal tissue have been shown to be variable. Contrast enhancement appears to be greatest immediately after bolus administration (15 seconds to 120 seconds). Thus, greatest enhancement may be detected by a series of consecutive two-to-three second scans performed within 30 to 90 seconds after injection (i.e., dynamic computed tomographic imaging). Utilization of a continuous scanning technique (i.e., dynamic CT scanning) may improve enhancement and diagnostic assessment of tumor and other lesions such as abscess, occasionally revealing unsuspected or more extensive disease. For example, a cyst may be distinguished from a vascularized solid lesion when precontrast and enhanced scans are compared; the nonperfused mass shows unchanged x-ray absorption (CT number). A vascularized lesion is characterized by an increase in CT number in the few minutes after a bolus of intravascular contrast agent; it may be malignant, benign, or normal tissue, but would probably not be a cyst, hematoma, or other nonvascular lesion.
- Because unenhanced scanning may provide adequate diagnostic information in the individual patient, the decision to employ contrast enhancement, which may be associated with risk and increased radiation exposure, should be based upon a careful evaluation of clinical, other radiological, and unenhanced CT findings.
### CT Scanning Of The Head
- In contrast enhanced computed tomographic head imaging, Ioversol does not accumulate in normal brain tissue due to the presence of the normal blood-brain barrier. The increase in x-ray absorption in the normal brain is due to the presence of contrast agent within the blood pool. A break in the blood-brain barrier such as occurs in malignant tumors of the brain allows for the accumulation of contrast medium within the interstitial tissue of the tumor. Adjacent normal brain tissue does not contain the contrast medium.
- Maximum contrast enhancement in tissue frequently occurs after peak blood iodine levels are reached. A delay in maximum contrast enhancement can occur. Diagnostic contrast enhanced images of the brain have been obtained up to 1 hour after intravenous bolus administration. This delay suggests that radiographic contrast enhancement is at least in part dependent on the accumulation of iodine containing medium within the lesion and outside the blood pool, although the mechanism by which this occurs is not clear. The radiographic enhancement of nontumoral lesions, such as arteriovenous malformations and aneurysms, is probably dependent on the iodine content of the circulating blood pool.
- In patients where the blood-brain barrier is known or suspected to be disrupted, the use of any radiographic contrast medium must be assessed on an individual risk to benefit basis. However, compared to ionic media, nonionic media are less toxic to the central nervous system.
### CT Scanning Of The Body
- In contrast enhanced computed tomographic body imaging (nonneural tissue), Ioversol diffuses rapidly from the vascular into the extravascular space. Increase in x-ray absorption is related to blood flow, concentration of the contrast medium, and extraction of the contrast medium by interstitial tissue of tumors since no barrier exists. Contrast enhancement is thus due to the relative differences in extravascular diffusion between normal and abnormal tissue, quite different from that in the brain.
## Nonclinical Toxicology
There is limited information regarding Loversol Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Loversol Clinical Studies in the drug label.
# How Supplied
## Storage
- Store Ioversol and Ioversol RFID-tagged syringes at 25°C (77°F); excursions permitted to 15° to 30°C (59° to 86°F) [see USP Controlled Room Temperature]. Ioversol is sensitive to light and must be protected from strong daylight or direct exposure to the sun. If Ioversol syringes are frozen or if crystallization occurs, the syringe and contents should be discarded. If Ioversol in glass bottles is frozen or if crystallization occurs, the bottle and contents should be discarded. Ioversol may be stored up to 40°C for up to one month in a contrast media warmer utilizing circulating warm air. When storing Ioversol for periods longer than one month, store at 25°C (77°F); excursions permitted to 15° to 30°C (59° to 86°F) [see USP Controlled Room Temperature]. Do not reautoclave plastic container because of possible damage to syringe.
- As with all contrast media, glass and plastic containers should be inspected prior to use to ensure that breakage or other damage has not occurred during shipping and handling. All containers should be inspected for closure integrity. Damaged containers should not be used.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Loversol Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Ioversol (Patient information) interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- Optiray
# Look-Alike Drug Names
There is limited information regarding Loversol Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Ioversol | |
392255fd7436e06d4e9013ba05d5a32df93ffe6b | wikidoc | Psyllium | Psyllium
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Psyllium is a laxative that is FDA approved for the treatment of constipation. Common adverse reactions include borborygmi and flatulence.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
# Indications
- For relief of occasional constipation and to induce regularity. This product generally produces bowel movement within 12 to 72 hours
# Dosage
- 5 capsules one to three times daily
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Psyllium in adult patients.
### Non–Guideline-Supported Use
# Indications
- Constipation
- Gastrointestinal symptom, Orlistat-induced
- Hypercholesterolemia
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
# Indications
- For relief of occasional constipation and to induce regularity. This product generally produces bowel movement within 12 to 72 hours
# Dosage
Children 12 years and over
- 5 capsules one to three times daily
Children under 12 years
- Consult a doctor
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Psyllium in pediatric patients.
### Non–Guideline-Supported Use
- There is limited information regarding Off-Label Non–Guideline-Supported Use of Psyllium in pediatric patients.
# Contraindications
There is limited information regarding Psyllium Contraindications in the drug label.
# Warnings
- Choking Taking this product without adequate fluid may cause it to swell and block your throat or esophagus and may cause choking. Do not take this product if you have difficulty in swallowing. If you experience chest pain, vomiting or difficulty in swallowing or breathing after taking this product, seek immediate medical attention.
DO NOT USE
- When abdominal pain, nausea or vomiting are present unless directed by a doctor
- If constipation lasts more than seven days
- If you have difficulty swallowing
ASK A DOCTOR BEFORE USE IF YOU HAVE
- Noticed a sudden change in bowel habits that persists over a period of 2 weeks.
Stop use and ask a doctor if
- You experience rectal bleeding or fail to have a bowel movement, as these may be signs of a serious condition
# Adverse Reactions
## Clinical Trials Experience
- There is limited information regarding Clinical Trial Experience of Psyllium in the drug label.
## Postmarketing Experience
- There is limited information regarding Postmarketing Experience of Psyllium in the drug label.
# Drug Interactions
There is limited information regarding Psyllium Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Psyllium in women who are pregnant.
Pregnancy Category (AUS):
- There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Psyllium in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Psyllium during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Psyllium with respect to nursing mothers.
### Pediatric Use
There is no FDA guidance on the use of Psyllium with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Psyllium with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Psyllium with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Psyllium with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Psyllium in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Psyllium in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Psyllium in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Psyllium in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
- Take this product (child or adult dose) with at least 8 ounces (a full glass0 of water or other fluid. Taking this product without enough liquid may cause choking. See choking warning.
### Monitoring
- There is limited information regarding Monitoring of Psyllium in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Psyllium in the drug label.
# Overdosage
- There is limited information regarding Chronic Overdose of Psyllium in the drug label.
# Pharmacology
There is limited information regarding Psyllium Pharmacology in the drug label.
## Mechanism of Action
## Structure
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Psyllium in the drug label.
## Pharmacokinetics
There is limited information regarding Pharmacokinetics of Psyllium in the drug label.
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Psyllium in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Psyllium in the drug label.
# How Supplied
## Storage
There is limited information regarding Psyllium Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Patient Counseling Information of Psyllium in the drug label.
# Precautions with Alcohol
- Alcohol-Psyllium interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- KONSYL 100 PERCENT NATURAL PSYLLIUM FIBER ®
# Look-Alike Drug Names
- A® — B®
# Drug Shortage Status
# Price | Psyllium
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Kiran Singh, M.D. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Psyllium is a laxative that is FDA approved for the treatment of constipation. Common adverse reactions include borborygmi and flatulence.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
# Indications
- For relief of occasional constipation and to induce regularity. This product generally produces bowel movement within 12 to 72 hours
# Dosage
- 5 capsules one to three times daily
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Psyllium in adult patients.
### Non–Guideline-Supported Use
# Indications
- Constipation
- Gastrointestinal symptom, Orlistat-induced
- Hypercholesterolemia
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
# Indications
- For relief of occasional constipation and to induce regularity. This product generally produces bowel movement within 12 to 72 hours
# Dosage
Children 12 years and over
- 5 capsules one to three times daily
Children under 12 years
- Consult a doctor
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Psyllium in pediatric patients.
### Non–Guideline-Supported Use
- There is limited information regarding Off-Label Non–Guideline-Supported Use of Psyllium in pediatric patients.
# Contraindications
There is limited information regarding Psyllium Contraindications in the drug label.
# Warnings
- Choking Taking this product without adequate fluid may cause it to swell and block your throat or esophagus and may cause choking. Do not take this product if you have difficulty in swallowing. If you experience chest pain, vomiting or difficulty in swallowing or breathing after taking this product, seek immediate medical attention.
DO NOT USE
- When abdominal pain, nausea or vomiting are present unless directed by a doctor
- If constipation lasts more than seven days
- If you have difficulty swallowing
ASK A DOCTOR BEFORE USE IF YOU HAVE
- Noticed a sudden change in bowel habits that persists over a period of 2 weeks.
Stop use and ask a doctor if
- You experience rectal bleeding or fail to have a bowel movement, as these may be signs of a serious condition
# Adverse Reactions
## Clinical Trials Experience
- There is limited information regarding Clinical Trial Experience of Psyllium in the drug label.
## Postmarketing Experience
- There is limited information regarding Postmarketing Experience of Psyllium in the drug label.
# Drug Interactions
There is limited information regarding Psyllium Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Psyllium in women who are pregnant.
Pregnancy Category (AUS):
- There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Psyllium in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Psyllium during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Psyllium with respect to nursing mothers.
### Pediatric Use
There is no FDA guidance on the use of Psyllium with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Psyllium with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Psyllium with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Psyllium with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Psyllium in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Psyllium in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Psyllium in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Psyllium in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
- Take this product (child or adult dose) with at least 8 ounces (a full glass0 of water or other fluid. Taking this product without enough liquid may cause choking. See choking warning.
### Monitoring
- There is limited information regarding Monitoring of Psyllium in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Psyllium in the drug label.
# Overdosage
- There is limited information regarding Chronic Overdose of Psyllium in the drug label.
# Pharmacology
There is limited information regarding Psyllium Pharmacology in the drug label.
## Mechanism of Action
-
## Structure
-
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Psyllium in the drug label.
## Pharmacokinetics
There is limited information regarding Pharmacokinetics of Psyllium in the drug label.
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Psyllium in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Psyllium in the drug label.
# How Supplied
-
## Storage
There is limited information regarding Psyllium Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Patient Counseling Information of Psyllium in the drug label.
# Precautions with Alcohol
- Alcohol-Psyllium interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- KONSYL 100 PERCENT NATURAL PSYLLIUM FIBER ®[1]
# Look-Alike Drug Names
- A® — B®[2]
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Ispaghula | |
135c862090543cde97254978e43992a485f44e6c | wikidoc | Ixazomib | Ixazomib
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Ixazomib is a antineoplastic agent that is FDA approved for the treatment of treatment of multiple myeloma in combination with lenalidomide and dexamethasonein patients who have received at least one prior therapy. Common adverse reactions include thrombocytopenia, gastrointestinal toxicities, peripheral neuropathy, peripheral edema, cutaneous reactions, and hepatotoxicity.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
## Multiple Myeloma
Ixazomib is indicated in combination with lenalidomide and dexamethasone for the treatment of patients with multiple myeloma who have received at least one prior therapy.
Dosing and Administration Guidelines
- Ixazomib is indicated in combination with lenalidomide and dexamethasone for the treatment of patients with multiple myeloma who have received at least one prior therapy.
- The recommended starting dose of Ixazomib is 4 mg administered orally once a week on Days 1, 8, and 15 of a 28-day treatment cycle.
- The recommended starting dose of lenalidomide is 25 mg administered daily on Days 1 through 21 of a 28-day treatment cycle.
- The recommended starting dose of dexamethasone is 40 mg administered on Days 1, 8, 15, and 22 of a 28-day treatment cycle.
For additional information regarding lenalidomide and dexamethasone, refer to their prescribing information.
- Ixazomib should be taken once a week on the same day and at approximately the same time for the first three weeks of a four week cycle. Ixazomib should be taken at least one hour before or at least two hours after food. The whole capsule should be swallowed with water. The capsule should not be crushed, chewed or opened.
- If a Ixazomib dose is delayed or missed, the dose should be taken only if the next scheduled dose is ≥ 72 hours away. A missed dose should not be taken within 72 hours of the next scheduled dose. A double dose should not be taken to make up for the missed dose.
- If vomiting occurs after taking a dose, the patient should not repeat the dose. The patient should resume dosing at the time of the next scheduled dose.
Prior to initiating a new cycle of therapy:
Absolute neutrophil count should be at least 1,000/mm3
Platelet count should be at least 75,000/mm3
Non-hematologic toxicities should, at the physician's discretion, generally be recovered to patient's baseline condition or Grade 1 or lower
Treatment should be continued until disease progression or unacceptable toxicity.
Dose Modification Guidelines
- The Ixazomib dose reduction steps are presented in Table 2 and the dose modification guidelines are provided in Table 3.
An alternating dose modification approach is recommended for Ixazomib and lenalidomide for thrombocytopenia, neutropenia, and rash as described in Table 3. Refer to the lenalidomide prescribing information if dose reduction is needed for lenalidomide.
Dosage in Patients with Hepatic Impairment
- Reduce the starting dose of Ixazomib to 3 mg in patients with moderate (total bilirubin greater than 1.5-3 × ULN) or severe (total bilirubin greater than 3 × ULN) hepatic impairment.
Dosage in Patients with Renal Impairment
- Reduce the starting dose of Ixazomib to 3 mg in patients with severe renal impairment (creatinine clearance less than 30 mL/min) or end-stage renal disease (ESRD) requiring dialysis. Ixazomib is not dialyzable and therefore can be administered without regard to the timing of dialysis.
- Refer to the lenalidomide prescribing information for dosing recommendations in patients with renal impairment.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ixazomib in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ixazomib in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Ixazomib FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ixazomib in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ixazomib in pediatric patients.
# Contraindications
None.
# Warnings
Thrombocytopenia
- Thrombocytopenia has been reported with Ixazomib with platelet nadirs typically occurring between Days 14-21 of each 28-day cycle and recovery to baseline by the start of the next cycle. Three percent of patients in the Ixazomib regimen and 1% of patients in the placebo regimen had a platelet count ≤ 10,000/mm3 during treatment. Less than 1% of patients in both regimens had a platelet count ≤ 5000/mm3 during treatment. Discontinuations due to thrombocytopenia were similar in both regimens (< 1% of patients in the Ixazomib regimen and 2% of patients in the placebo regimen discontinued one or more of the three drugs).The rate of platelet transfusions was 6% in the Ixazomib regimen and 5% in the placebo regimen.
- Monitor platelet counts at least monthly during treatment with Ixazomib. Consider more frequent monitoring during the first three cycles. Manage thrombocytopenia with dose modifications and platelet transfusions as per standard medical guidelines.
Gastrointestinal Toxicities
- Diarrhea, constipation, nausea, and vomiting, have been reported with Ixazomib, occasionally requiring use of antidiarrheal and antiemetic medications, and supportive care. Diarrhea was reported in 42% of patients in the Ixazomib regimen and 36% in the placebo regimen, constipation in 34% and 25%, respectively, nausea in 26% and 21%, respectively, and vomiting in 22% and 11%, respectively. Diarrhea resulted in discontinuation of one or more of the three drugs in 1% of patients in the Ixazomib regimen and < 1% of patients in the placebo regimen. Adjust dosing for Grade 3 or 4 symptoms.
Peripheral Neuropathy
- The majority of peripheral neuropathy adverse reactions were Grade 1 (18% in the Ixazomib regimen and 14% in the placebo regimen) and Grade 2 (8% in the Ixazomib regimen and 5% in the placebo regimen). Grade 3 adverse reactions of peripheral neuropathy were reported at 2% in both regimens; there were no Grade 4 or serious adverse reactions.
- The most commonly reported reaction was peripheral sensory neuropathy (19% and 14% in the Ixazomib and placebo regimen, respectively). Peripheral motor neuropathy was not commonly reported in either regimen (< 1%). Peripheral neuropathy resulted in discontinuation of one or more of the three drugs in 1% of patients in both regimens. Patients should be monitored for symptoms of neuropathy. Patients experiencing new or worsening peripheral neuropathy may require dose modification.
Peripheral Edema
- Peripheral edema was reported in 25% and 18% of patients in the Ixazomib and placebo regimens, respectively. The majority of peripheral edema adverse reactions were Grade 1 (16% in the Ixazomib regimen and 13% in the placebo regimen) and Grade 2 (7% in the Ixazomib regimen and 4% in the placebo regimen).
- Grade 3 peripheral edema was reported in 2% and 1% of patients in the Ixazomib and placebo regimens, respectively. There was no Grade 4 peripheral edema reported. There were no discontinuations reported due to peripheral edema. Evaluate for underlying causes and provide supportive care, as necessary. Adjust dosing of dexamethasone per its prescribing information or Ixazomib for Grade 3 or 4 symptoms.
Cutaneous Reactions
- Rash was reported in 19% of patients in the Ixazomib regimen and 11% of patients in the placebo regimen. The majority of the rash adverse reactions were Grade 1 (10% in the Ixazomib regimen and 7% in the placebo regimen) or Grade 2 (6% in the Ixazomib regimen and 3% in the placebo regimen). Grade 3 rash was reported in 3% of patients in the Ixazomib regimen and 1% of patients in the placebo regimen. There were no Grade 4 or serious adverse reactions of rash reported. The most common type of rash reported in both regimens included maculo-papular and macular rash. Rash resulted in discontinuation of one or more of the three drugs in < 1% of patients in both regimens. Manage rash with supportive care or with dose modification if Grade 2 or higher.
Hepatotoxicity
- Drug-induced liver injury, hepatocellular injury, hepatic steatosis, hepatitis cholestatic and hepatotoxicity have each been reported in < 1% of patients treated with Ixazomib. Events of liver impairment have been reported (6% in the Ixazomib regimen and 5% in the placebo regimen). Monitor hepatic enzymes regularly and adjust dosing for Grade 3 or 4 symptoms.
Embryo-Fetal Toxicity
- Ixazomib can cause fetal harm when administered to a pregnant woman based on the mechanism of action and findings in animals. There are no adequate and well-controlled studies in pregnant women using Ixazomib. Ixazomib caused embryo-fetal toxicity in pregnant rats and rabbits at doses resulting in exposures that were slightly higher than those observed in patients receiving the recommended dose.
- Females of reproductive potential should be advised to avoid becoming pregnant while being treated with Ixazomib. If Ixazomib is used during pregnancy or if the patient becomes pregnant while taking Ixazomib, the patient should be apprised of the potential hazard to the fetus. Advise females of reproductive potential that they must use effective contraception during treatment with Ixazomib and for 90 days following the final dose.
# Adverse Reactions
## Clinical Trials Experience
- Thrombocytopenia
- Gastrointestinal Toxicities
- Peripheral Neuropathy
- Peripheral Edema
- Cutaneous Reactions
- Hepatotoxicity
Clinical Trials Experience
- Because clinical trials are conducted under widely varying conditions, adverse reaction rates observed in the clinical trials of a drug cannot be directly compared to rates in the clinical trials of another drug and may not reflect the rates observed in practice.
- The safety population from the randomized, double-blind, placebo-controlled clinical study included 720 patients with relapsed and/or refractory multiple myeloma, who received Ixazomib in combination with lenalidomide and dexamethasone ( Ixazomib regimen; N=360) or placebo in combination with lenalidomide and dexamethasone (placebo regimen; N=360).
- The most frequently reported adverse reactions (≥ 20%) in the Ixazomib regimen and greater than the placebo regimen were diarrhea, constipation, thrombocytopenia, peripheral neuropathy, nausea, peripheral edema, vomiting, and back pain. Serious adverse reactions reported in ≥ 2% of patients included thrombocytopenia (2%) and diarrhea (2%). For each adverse reaction, one or more of the three drugs was discontinued in ≤ 1% of patients in the Ixazomib regimen.
- Table 4 summarizes the adverse reactions occurring in at least 5% of patients with at least a 5% difference between the Ixazomib regimen and the placebo regimen.
Eye Disorders
- Eye disorders were reported with many different preferred terms but in aggregate, the frequency was 26% in patients in the Ixazomib regimen and 16% of patients in the placebo regimen. The most common adverse reactions were blurred vision (6% in the Ixazomib regimen and 3% in the placebo regimen), dry eye (5% in the Ixazomib regimen and 1% in the placebo regimen), and conjunctivitis (6% in the Ixazomib regimen and 1% in the placebo regimen). Grade 3 adverse reactions were reported in 2% of patients in the Ixazomib regimen and 1% in the placebo regimen.
Adverse Reactions Reported Outside of the Randomized Controlled Trial
- The following serious adverse reactions have each been reported at a frequency of < 1%: acute febrile neutrophilic dermatosis (Sweet's syndrome), Stevens-Johnson syndrome, transverse myelitis, posterior reversible encephalopathy syndrome, tumor lysis syndrome, and thrombotic thrombocytopenic purpura.
## Postmarketing Experience
There is limited information regarding Ixazomib Postmarketing Experience in the drug label.
# Drug Interactions
Strong CYP3A Inducers
Avoid concomitant administration of Ixazomib with strong CYP3A inducers (such as rifampin, phenytoin, carbamazepine, and St. John's Wort)
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
Women should avoid becoming pregnant while being treated with Ixazomib.
Risk Summary
Ixazomib can cause fetal harm when administered to a pregnant woman. There are no human data available regarding the potential effect of Ixazomib on pregnancy or development of the embryo or fetus. Ixazomib caused embryo-fetal toxicity in pregnant rats and rabbits at doses resulting in exposures that were slightly higher then those observed in patients receiving the recommended dose . Advise women of the potential risk to a fetus and to avoid becoming pregnant while being treated with Ixazomib.
In the U.S. general population, the estimated background risk of major birth defects and miscarriage in clinically recognized pregnancies is 2-4% and 15-20%, respectively.
Animal Data
- In an embryo-fetal development study in pregnant rabbits there were increases in fetal skeletal variations/abnormalities (fused caudal vertebrae, number of lumbar vertebrae, and full supernumerary ribs) at doses that were also maternally toxic (≥ 0.3 mg/kg). Exposures in the rabbit at 0.3 mg/kg were 1.9 times the clinical time averaged exposures at the recommended dose of 4 mg. In a rat dose range-finding embryo-fetal development study, at doses that were maternally toxic, there were decreases in fetal weights, a trend towards decreased fetal viability, and increased post-implantation losses at 0.6 mg/kg. Exposures in rats at the dose of 0.6 mg/kg was 2.5 times the clinical time averaged exposures at the recommended dose of 4 mg.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Ixazomib in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Ixazomib during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Ixazomib in women who are nursing.
### Pediatric Use
Safety and effectiveness have not been established in pediatric patients.
### Geriatic Use
- Of the total number of subjects in clinical studies of Ixazomib, 55% were 65 and over, while 17% were 75 and over. No overall differences in safety or effectiveness were observed between these subjects and younger subjects, and other reported clinical experience has not identified differences in responses between the elderly and younger patients, but greater sensitivity of some older individuals cannot be ruled out.
### Gender
There is no FDA guidance on the use of Ixazomib with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Ixazomib with respect to specific racial populations.
### Renal Impairment
- In patients with severe renal impairment or ESRD requiring dialysis, the mean AUC increased by 39% when compared to patients with normal renal function. Reduce the starting dose of Ixazomib in patients with severe renal impairment or ESRD requiring dialysis. Ixazomib is not dialyzable and therefore can be administered without regard to the timing of dialysis.
### Hepatic Impairment
In patients with moderate or severe hepatic impairment, the mean AUC increased by 20% when compared to patients with normal hepatic function. Reduce the starting dose of Ixazomib in patients with moderate or severe hepatic impairment.
### Females of Reproductive Potential and Males
Contraception
- Male and female patients of childbearing potential must use effective contraceptive measures during and for 90 days following treatment.
Infertility
- Fertility studies were not conducted with Ixazomib; however there were no effects on reproductive organs in either males or females in nonclinical studies in rats and dogs
### Immunocompromised Patients
There is no FDA guidance one the use of Ixazomib in patients who are immunocompromised.
### Lactation
Risk Summary
- It is not known whether Ixazomib or its metabolites are present in human milk. Many drugs are present in human milk and as a result, there could be a potential for adverse events in nursing infants. Advise women to discontinue nursing.
# Administration and Monitoring
### Administration
Please see adult indications and dosing
### Monitoring
There is limited information regarding Ixazomib Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Ixazomib and IV administrations.
# Overdosage
- There is no known specific antidote for Ixazomib overdose. In the event of an overdose, monitor the patient for adverse reactions and provide appropriate supportive care.
# Pharmacology
## Mechanism of Action
Ixazomib is a reversible proteasome inhibitor. Ixazomib preferentially binds and inhibits the chymotrypsin-like activity of the beta 5 subunit of the 20S proteasome.
Ixazomib induced apoptosis of multiple myeloma cell lines in vitro. Ixazomib demonstrated in vitro cytotoxicity against myeloma cells from patients who had relapsed after multiple prior therapies, including bortezomib, lenalidomide, and dexamethasone. The combination of ixazomib and lenalidomide demonstrated synergistic cytotoxic effects in multiple myeloma cell lines. In vivo, ixazomib demonstrated antitumor activity in a mouse multiple myeloma tumor xenograft model.
## Structure
The molecular formula for ixazomib citrate is C20H23BCl2N2O9 and its molecular weight is 517.12. Ixazomib citrate has one chiral center and is the R-stereoisomer. The solubility of ixazomib citrate in 0.1N HCl (pH 1.2) at 37°C is 0.61 mg/mL (reported as ixazomib). The solubility increases as the pH increases.
- Ixazomib capsules for oral use contain 4, 3 or 2.3 mg of ixazomib equivalent to 5.7, 4.3 or 3.3 mg of ixazomib citrate, respectively. Inactive ingredients include microcrystalline cellulose, magnesium stearate, and talc. Capsule shells contain gelatin and titanium dioxide. The 4 mg capsule shell contains red and yellow iron oxide, the 3 mg capsule shell contains black iron oxide and the 2.3 mg capsule shell contains red iron oxide. The printing ink contains shellac, propylene glycol, potassium hydroxide, and black iron oxide.
## Pharmacodynamics
Cardiac Electrophysiology
- Ixazomib did not prolong the QTc interval at clinically relevant exposures based on pharmacokinetic-pharmacodynamic analysis of data from 245 patients.
## Pharmacokinetics
Absorption
- After oral administration, the median time to achieve peak ixazomib plasma concentrations was one hour. The mean absolute oral bioavailability was 58%, based on population PK analysis. Ixazomib AUC increases in a dose proportional manner over a dose range of 0.2 to 10.6 mg.
- A food effect study conducted in patients with a single 4 mg dose of ixazomib showed that a high-fat meal decreased ixazomib AUC by 28% and Cmax by 69%.
Distribution
- Ixazomib is 99% bound to plasma proteins and distributes into red blood cells with a blood-to-plasma ratio of 10. The steady-state volume of distribution is 543 L.
Elimination
- Based on a population PK analysis, systemic clearance was approximately 1.9 L/hr with inter-individual variability of 44%. The terminal half-life (t1/2) of ixazomib was 9.5 days. Following weekly oral dosing, the accumulation ratio was determined to be 2-fold.
Metabolism
- After oral administration of a radiolabeled dose, ixazomib represented 70% of total drug-related material in plasma. Metabolism by multiple CYP enzymes and non-CYP proteins is expected to be the major clearance mechanism for ixazomib. At clinically relevant ixazomib concentrations, in vitro studies using human cDNA-expressed cytochrome P450 isozymes showed that no specific CYP isozyme predominantly contributes to ixazomib metabolism. At higher than clinical concentrations, ixazomib was metabolized by multiple CYP isoforms with estimated relative contributions of 3A4 (42%), 1A2 (26%), 2B6 (16%), 2C8 (6%), 2D6 (5%), 2C19 (5%) and 2C9 (< 1%).
Excretion
- After administration of a single oral dose of 14C-ixazomib to 5 patients with advanced cancer, 62% of the administered radioactivity was excreted in urine and 22% in the feces. Unchanged ixazomib accounted for < 3.5% of the administered dose recovered in urine.
Specific Populations
Age, Sex, Race
There was no clinically meaningful effect of age (range 23-91 years), sex, body surface area(range 1.2-2.7 m2), or race on the clearance of ixazomib based on population PK analysis.
Hepatic Impairment
- The PK of ixazomib was similar in patients with normal hepatic function and in patients with mild hepatic impairment (total bilirubin ≤ ULN and AST > ULN or total bilirubin > 1-1.5 × ULN and any AST) based on population PK analysis.
The PK of ixazomib was characterized in patients with normal hepatic function at 4 mg (N=12), moderate hepatic impairment at 2.3 mg (total bilirubin > 1.5-3 × ULN, N=13) or severe hepatic impairment at 1.5 mg (total bilirubin > 3 × ULN, N=18). Dose-normalized mean AUC was 20% higher in patients with moderate or severe hepatic impairment as compared to patients with normal hepatic function.
Renal Impairment
- The PK of ixazomib was similar in patients with normal renal function and in patients with mild or moderate renal impairment (creatinine clearance ≥ 30 mL/min) based on population PK analysis.
- The PK of ixazomib was characterized at a dose of 3 mg in patients with normal renal function (creatinine clearance ≥ 90 mL/min, N=18), severe renal impairment (creatinine clearance < 30 mL/min, N=14), or ESRD requiring dialysis (N=6). Mean AUC was 39% higher in patients with severe renal impairment or ESRD requiring dialysis as compared to patients with normal renal function. Pre- and post-dialyzer concentrations of ixazomib measured during the hemodialysis session were similar, suggesting that ixazomib is not dialyzable.
Drug Interactions
Effect of Other Drugs on Ixazomib
Strong CYP3A Inducers
Co-administration of Ixazomib with rifampin decreased ixazomib Cmax by 54% and AUC by 74%.
Strong CYP3A Inhibitors
- Co-administration of Ixazomib with clarithromycin did not result in a clinically meaningful change in the systemic exposure of ixazomib.
Strong CYP1A2 Inhibitors
- Co-administration of Ixazomib with strong CYP1A2 inhibitors did not result in a clinically meaningful change in the systemic exposure of ixazomib based on a population PK analysis.
Effect of Ixazomib on Other Drugs
- Ixazomib is neither a reversible nor a time-dependent inhibitor of CYPs 1A2, 2B6, 2C8, 2C9, 2C19, 2D6, or 3A4/5. Ixazomib did not induce CYP1A2, CYP2B6, and CYP3A4/5 activity or corresponding immunoreactive protein levels. Ixazomib is not expected to produce drug-drug interactions via CYP inhibition or induction.
Transporter-Based Interactions
- Ixazomib is a low affinity substrate of P-gp. Ixazomib is not a substrate of BCRP, MRP2 or hepatic OATPs. Ixazomib is not an inhibitor of P-gp, BCRP, MRP2, OATP1B1, OATP1B3, OCT2, OAT1, OAT3, MATE1, or MATE2-K. Ixazomib is not expected to cause transporter-mediated drug-drug interactions.
## Nonclinical Toxicology
Carcinogenesis, Mutagenesis, Impairment of Fertility
- Ixazomib was not mutagenic in a bacterial reverse mutation assay (Ames assay). Ixazomib was considered positive in an in vitro clastogenicity test in human peripheral blood lymphocytes. However, in vivo, ixazomib was not clastogenic in a bone marrow micronucleus assay in mice and was negative in an in vivo comet assay in mice, as assessed in the stomach and liver. No carcinogenicity studies have been performed with ixazomib.
- Developmental toxicity studies in rats and rabbits did not show direct embryo-fetal toxicity below maternally toxic doses of ixazomib. Studies of fertility and early embryonic development and pre- and postnatal toxicology were not conducted with ixazomib, but evaluation of reproductive tissues was conducted in the general toxicity studies. There were no effects due to ixazomib treatment on male or female reproductive organs in studies up to 6-months duration in rats and up to 9-months duration in dogs.
# Clinical Studies
- The efficacy and safety of Ixazomib in combination with lenalidomide and dexamethasone was evaluated in a randomized, double-blind, placebo-controlled, multicenter study in patients with relapsed and/or refractory multiple myeloma who had received at least one prior line of therapy. Patients who were refractory to lenalidomide or proteasome inhibitors were excluded from the study.
- A total of 722 patients were randomized in a 1:1 ratio to receive either the combination of Ixazomib, lenalidomide and dexamethasone (N=360; Ixazomib regimen) or the combination of placebo, lenalidomide and dexamethasone (N=362; placebo regimen) until disease progression or unacceptable toxicity. Randomization was stratified according to number of prior lines of therapy (1 versus 2 or 3), myeloma International Staging System (ISS) (stage I or II versus III), and previous therapy with a proteasome inhibitor (exposed or naïve). Twenty three percent (N=166) of the patients had light chain disease and 12% (N=87) of patients had free light chain-measurable only disease.
- Thromboprophylaxis was recommended for all patients in both treatment groups according to the lenalidomide prescribing information. Antiemetics were used in 19% of patients in the Ixazomib regimen and 12% of patients in the placebo regimen; antivirals in 64% and 60%, respectively, and antihistamines in 27% and 19%, respectively. These medications were given to patients at the physician's discretion as prophylaxis and/or management of symptoms.
- Patients received Ixazomib 4 mg or placebo on Days 1, 8, and 15 plus lenalidomide (25 mg) on Days 1 through 21 and dexamethasone (40 mg) on Days 1, 8, 15, and 22 of a 28-day cycle. Patients with renal impairment received a starting dose of lenalidomide according to its prescribing information. Treatment continued until disease progression or unacceptable toxicities.
- Table 6 summarizes the baseline patient and disease characteristics in the study. The baseline demographics and disease characteristics were balanced and comparable between the study regimens.
The efficacy of Ixazomib was evaluated by progression-free survival (PFS) according to the 2011 International Myeloma Working Group (IMWG) Consensus Uniform Response Criteria as assessed by a blinded independent review committee (IRC) based on central lab results. Response was assessed every four weeks until disease progression.
- The approval of Ixazomib was based upon a statistically significant improvement in PFS of the Ixazomib regimen compared to the placebo regimen. PFS results are summarized in Table 7 and shown in Figure 1.
A non-inferential PFS analysis was conducted at a median follow up of 23 months with 372 PFS events. Hazard ratio of PFS was 0.82 (95% confidence interval ) for Ixazomib regimen versus placebo regimen, and estimated median PFS was 20 months in the Ixazomib regimen and 15.9 months in the placebo regimen. At the same time, a planned interim OS analysis was conducted with 35% of the required number of deaths for final OS analysis; there were 81 deaths in the Ixazomib regimen and 90 deaths in the placebo regimen. An OS benefit was not demonstrated.
# How Supplied
Ixazomib is supplied as:
4 mg gelatin capsule: Light orange, size 3, imprinted with "Takeda" on the cap and "4.0 mg" on the body in black ink. Ixazomib 4 mg capsules contain 4 mg of ixazomib equivalent to 5.7 mg of ixazomib citrate.
One 4 mg capsule in a single blister pack (NDC 63020-080-01)
Three 4 mg single packs in a carton (NDC 63020-080-02)
3.0 mg gelatin capsule: Light grey, size 4, imprinted with "Takeda" on the cap and "3.0 mg" on the body in black ink. Ixazomib 3 mg capsules contain 3 mg of ixazomib equivalent to 4.3 mg of ixazomib citrate.
One 3 mg capsule in a single blister pack (NDC 63020-079-01)
Three 3 mg single packs in a carton (NDC 63020-079-02)
2.3 mg gelatin capsule: Light pink, size 4, imprinted with "Takeda" on the cap and "2.3 mg" on the body in black ink. Ixazomib 2.3 mg capsules contain 2.3 mg of ixazomib equivalent to 3.3 mg of ixazomib citrate.
- One 2.3 mg capsule in a single blister pack (NDC 63020-078-01)
- Three 2.3 mg single packs in a carton (NDC 63020-078-02)
- Capsules are individually packaged in a PVC-Aluminum/Aluminum blister.
## Storage
Storage
- Ixazomib may be stored at room temperature. Do not store above 30°C (86°F). Do not freeze.
- Store capsules in original packaging until immediately prior to use.
Handling and Disposal
- Ixazomib is cytotoxic. Capsules should not be opened or crushed. Direct contact with the capsule contents should be avoided. In case of capsule breakage, avoid direct contact of capsule contents with the skin or eyes. If contact occurs with the skin, wash thoroughly with soap and water. If contact occurs with the eyes, flush thoroughly with water.
- Any unused medicinal product or waste material should be disposed in accordance with local requirements.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
Advise the patient to read the FDA-approved patient labeling (Patient Information).
Dosing Instructions
- Instruct patients to take Ixazomib exactly as prescribed.
- Advise patients to take Ixazomib once a week on the same day and at approximately the same time for the first three weeks of a four week cycle.
- Advise patients to take Ixazomib at least one hour before or at least two hours after food.
- Advise patients that Ixazomib and dexamethasone should not be taken at the same time, because dexamethasone should be taken with food and Ixazomib should not be taken with food.
- Advise patients to swallow the capsule whole with water. The capsule should not be crushed, chewed or opened.
- Advise patients that direct contact with the capsule contents should be avoided. *In case of capsule breakage, avoid direct contact of capsule contents with the skin or eyes. If contact occurs with the skin, wash thoroughly with soap and water. If contact occurs with the eyes, flush thoroughly with water.
- If a patient misses a dose, advise them to take the missed dose as long as the next scheduled dose is ≥ 72 hours away. Advise patients not to take a missed dose if it is within 72 hours of their next scheduled dose.
- If a patient vomits after taking a dose, advise them not to repeat the dose but resume dosing at the time of the next scheduled dose.
- Advise patients to store capsules in original packaging, and not to remove the capsule from the packaging until just prior to taking Ixazomib.
Thrombocytopenia
- Advise patients that they may experience low platelet counts (thrombocytopenia). Signs of thrombocytopenia may include bleeding and easy bruising.
Gastrointestinal Toxicities
Advise patients they may experience diarrhea, constipation, nausea and vomiting and to contact their physician if these adverse reactions persist.
Peripheral Neuropathy
- Advise patients to contact their physicians if they experience new or worsening symptoms of peripheral neuropathy such as tingling, numbness, pain, a burning feeling in the feet or hands, or weakness in the arms or legs.
Peripheral Edema
- Advise patients to contact their physicians if they experience unusual swelling of their extremities or weight gain due to swelling.
Cutaneous Reactions
- Advise patients to contact their physicians if they experience new or worsening rash.
Hepatotoxicity
- Advise patients to contact their physicians if they experience jaundice or right upper quadrant abdominal pain.
Pregnancy
- Advise women of the potential risk to a fetus and to avoid becoming pregnant while being treated with Ixazomib and for 90 days following the final dose. Advise patients to contact their physicians immediately if they or their female partner become pregnant during treatment or within 90 days of the final dose.
Concomitant Medications
- Advise patients to speak with their physicians about any other medication they are currently taking and before starting any new medications.
# Precautions with Alcohol
Alcohol-Ixazomib interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
NINLARO
# Look-Alike Drug Names
There is limited information regarding Ixazomib Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Ixazomib
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Vishal Devarkonda, M.B.B.S[2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Ixazomib is a antineoplastic agent that is FDA approved for the treatment of treatment of multiple myeloma in combination with lenalidomide and dexamethasonein patients who have received at least one prior therapy. Common adverse reactions include thrombocytopenia, gastrointestinal toxicities, peripheral neuropathy, peripheral edema, cutaneous reactions, and hepatotoxicity.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
## Multiple Myeloma
Ixazomib is indicated in combination with lenalidomide and dexamethasone for the treatment of patients with multiple myeloma who have received at least one prior therapy.
Dosing and Administration Guidelines
- Ixazomib is indicated in combination with lenalidomide and dexamethasone for the treatment of patients with multiple myeloma who have received at least one prior therapy.
- The recommended starting dose of Ixazomib is 4 mg administered orally once a week on Days 1, 8, and 15 of a 28-day treatment cycle.
- The recommended starting dose of lenalidomide is 25 mg administered daily on Days 1 through 21 of a 28-day treatment cycle.
- The recommended starting dose of dexamethasone is 40 mg administered on Days 1, 8, 15, and 22 of a 28-day treatment cycle.
For additional information regarding lenalidomide and dexamethasone, refer to their prescribing information.
- Ixazomib should be taken once a week on the same day and at approximately the same time for the first three weeks of a four week cycle. Ixazomib should be taken at least one hour before or at least two hours after food. The whole capsule should be swallowed with water. The capsule should not be crushed, chewed or opened.
- If a Ixazomib dose is delayed or missed, the dose should be taken only if the next scheduled dose is ≥ 72 hours away. A missed dose should not be taken within 72 hours of the next scheduled dose. A double dose should not be taken to make up for the missed dose.
- If vomiting occurs after taking a dose, the patient should not repeat the dose. The patient should resume dosing at the time of the next scheduled dose.
Prior to initiating a new cycle of therapy:
Absolute neutrophil count should be at least 1,000/mm3
Platelet count should be at least 75,000/mm3
Non-hematologic toxicities should, at the physician's discretion, generally be recovered to patient's baseline condition or Grade 1 or lower
Treatment should be continued until disease progression or unacceptable toxicity.
Dose Modification Guidelines
- The Ixazomib dose reduction steps are presented in Table 2 and the dose modification guidelines are provided in Table 3.
An alternating dose modification approach is recommended for Ixazomib and lenalidomide for thrombocytopenia, neutropenia, and rash as described in Table 3. Refer to the lenalidomide prescribing information if dose reduction is needed for lenalidomide.
Dosage in Patients with Hepatic Impairment
- Reduce the starting dose of Ixazomib to 3 mg in patients with moderate (total bilirubin greater than 1.5-3 × ULN) or severe (total bilirubin greater than 3 × ULN) hepatic impairment.
Dosage in Patients with Renal Impairment
- Reduce the starting dose of Ixazomib to 3 mg in patients with severe renal impairment (creatinine clearance less than 30 mL/min) or end-stage renal disease (ESRD) requiring dialysis. Ixazomib is not dialyzable and therefore can be administered without regard to the timing of dialysis.
- Refer to the lenalidomide prescribing information for dosing recommendations in patients with renal impairment.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ixazomib in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ixazomib in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Ixazomib FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Ixazomib in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Ixazomib in pediatric patients.
# Contraindications
None.
# Warnings
Thrombocytopenia
- Thrombocytopenia has been reported with Ixazomib with platelet nadirs typically occurring between Days 14-21 of each 28-day cycle and recovery to baseline by the start of the next cycle. Three percent of patients in the Ixazomib regimen and 1% of patients in the placebo regimen had a platelet count ≤ 10,000/mm3 during treatment. Less than 1% of patients in both regimens had a platelet count ≤ 5000/mm3 during treatment. Discontinuations due to thrombocytopenia were similar in both regimens (< 1% of patients in the Ixazomib regimen and 2% of patients in the placebo regimen discontinued one or more of the three drugs).The rate of platelet transfusions was 6% in the Ixazomib regimen and 5% in the placebo regimen.
- Monitor platelet counts at least monthly during treatment with Ixazomib. Consider more frequent monitoring during the first three cycles. Manage thrombocytopenia with dose modifications and platelet transfusions as per standard medical guidelines.
Gastrointestinal Toxicities
- Diarrhea, constipation, nausea, and vomiting, have been reported with Ixazomib, occasionally requiring use of antidiarrheal and antiemetic medications, and supportive care. Diarrhea was reported in 42% of patients in the Ixazomib regimen and 36% in the placebo regimen, constipation in 34% and 25%, respectively, nausea in 26% and 21%, respectively, and vomiting in 22% and 11%, respectively. Diarrhea resulted in discontinuation of one or more of the three drugs in 1% of patients in the Ixazomib regimen and < 1% of patients in the placebo regimen. Adjust dosing for Grade 3 or 4 symptoms.
Peripheral Neuropathy
- The majority of peripheral neuropathy adverse reactions were Grade 1 (18% in the Ixazomib regimen and 14% in the placebo regimen) and Grade 2 (8% in the Ixazomib regimen and 5% in the placebo regimen). Grade 3 adverse reactions of peripheral neuropathy were reported at 2% in both regimens; there were no Grade 4 or serious adverse reactions.
- The most commonly reported reaction was peripheral sensory neuropathy (19% and 14% in the Ixazomib and placebo regimen, respectively). Peripheral motor neuropathy was not commonly reported in either regimen (< 1%). Peripheral neuropathy resulted in discontinuation of one or more of the three drugs in 1% of patients in both regimens. Patients should be monitored for symptoms of neuropathy. Patients experiencing new or worsening peripheral neuropathy may require dose modification.
Peripheral Edema
- Peripheral edema was reported in 25% and 18% of patients in the Ixazomib and placebo regimens, respectively. The majority of peripheral edema adverse reactions were Grade 1 (16% in the Ixazomib regimen and 13% in the placebo regimen) and Grade 2 (7% in the Ixazomib regimen and 4% in the placebo regimen).
- Grade 3 peripheral edema was reported in 2% and 1% of patients in the Ixazomib and placebo regimens, respectively. There was no Grade 4 peripheral edema reported. There were no discontinuations reported due to peripheral edema. Evaluate for underlying causes and provide supportive care, as necessary. Adjust dosing of dexamethasone per its prescribing information or Ixazomib for Grade 3 or 4 symptoms.
Cutaneous Reactions
- Rash was reported in 19% of patients in the Ixazomib regimen and 11% of patients in the placebo regimen. The majority of the rash adverse reactions were Grade 1 (10% in the Ixazomib regimen and 7% in the placebo regimen) or Grade 2 (6% in the Ixazomib regimen and 3% in the placebo regimen). Grade 3 rash was reported in 3% of patients in the Ixazomib regimen and 1% of patients in the placebo regimen. There were no Grade 4 or serious adverse reactions of rash reported. The most common type of rash reported in both regimens included maculo-papular and macular rash. Rash resulted in discontinuation of one or more of the three drugs in < 1% of patients in both regimens. Manage rash with supportive care or with dose modification if Grade 2 or higher.
Hepatotoxicity
- Drug-induced liver injury, hepatocellular injury, hepatic steatosis, hepatitis cholestatic and hepatotoxicity have each been reported in < 1% of patients treated with Ixazomib. Events of liver impairment have been reported (6% in the Ixazomib regimen and 5% in the placebo regimen). Monitor hepatic enzymes regularly and adjust dosing for Grade 3 or 4 symptoms.
Embryo-Fetal Toxicity
- Ixazomib can cause fetal harm when administered to a pregnant woman based on the mechanism of action and findings in animals. There are no adequate and well-controlled studies in pregnant women using Ixazomib. Ixazomib caused embryo-fetal toxicity in pregnant rats and rabbits at doses resulting in exposures that were slightly higher than those observed in patients receiving the recommended dose.
- Females of reproductive potential should be advised to avoid becoming pregnant while being treated with Ixazomib. If Ixazomib is used during pregnancy or if the patient becomes pregnant while taking Ixazomib, the patient should be apprised of the potential hazard to the fetus. Advise females of reproductive potential that they must use effective contraception during treatment with Ixazomib and for 90 days following the final dose.
# Adverse Reactions
## Clinical Trials Experience
- Thrombocytopenia
- Gastrointestinal Toxicities
- Peripheral Neuropathy
- Peripheral Edema
- Cutaneous Reactions
- Hepatotoxicity
Clinical Trials Experience
- Because clinical trials are conducted under widely varying conditions, adverse reaction rates observed in the clinical trials of a drug cannot be directly compared to rates in the clinical trials of another drug and may not reflect the rates observed in practice.
- The safety population from the randomized, double-blind, placebo-controlled clinical study included 720 patients with relapsed and/or refractory multiple myeloma, who received Ixazomib in combination with lenalidomide and dexamethasone ( Ixazomib regimen; N=360) or placebo in combination with lenalidomide and dexamethasone (placebo regimen; N=360).
- The most frequently reported adverse reactions (≥ 20%) in the Ixazomib regimen and greater than the placebo regimen were diarrhea, constipation, thrombocytopenia, peripheral neuropathy, nausea, peripheral edema, vomiting, and back pain. Serious adverse reactions reported in ≥ 2% of patients included thrombocytopenia (2%) and diarrhea (2%). For each adverse reaction, one or more of the three drugs was discontinued in ≤ 1% of patients in the Ixazomib regimen.
- Table 4 summarizes the adverse reactions occurring in at least 5% of patients with at least a 5% difference between the Ixazomib regimen and the placebo regimen.
.
Eye Disorders
- Eye disorders were reported with many different preferred terms but in aggregate, the frequency was 26% in patients in the Ixazomib regimen and 16% of patients in the placebo regimen. The most common adverse reactions were blurred vision (6% in the Ixazomib regimen and 3% in the placebo regimen), dry eye (5% in the Ixazomib regimen and 1% in the placebo regimen), and conjunctivitis (6% in the Ixazomib regimen and 1% in the placebo regimen). Grade 3 adverse reactions were reported in 2% of patients in the Ixazomib regimen and 1% in the placebo regimen.
Adverse Reactions Reported Outside of the Randomized Controlled Trial
- The following serious adverse reactions have each been reported at a frequency of < 1%: acute febrile neutrophilic dermatosis (Sweet's syndrome), Stevens-Johnson syndrome, transverse myelitis, posterior reversible encephalopathy syndrome, tumor lysis syndrome, and thrombotic thrombocytopenic purpura.
## Postmarketing Experience
There is limited information regarding Ixazomib Postmarketing Experience in the drug label.
# Drug Interactions
Strong CYP3A Inducers
Avoid concomitant administration of Ixazomib with strong CYP3A inducers (such as rifampin, phenytoin, carbamazepine, and St. John's Wort)
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
Women should avoid becoming pregnant while being treated with Ixazomib.
Risk Summary
Ixazomib can cause fetal harm when administered to a pregnant woman. There are no human data available regarding the potential effect of Ixazomib on pregnancy or development of the embryo or fetus. Ixazomib caused embryo-fetal toxicity in pregnant rats and rabbits at doses resulting in exposures that were slightly higher then those observed in patients receiving the recommended dose [see DATA]. Advise women of the potential risk to a fetus and to avoid becoming pregnant while being treated with Ixazomib.
In the U.S. general population, the estimated background risk of major birth defects and miscarriage in clinically recognized pregnancies is 2-4% and 15-20%, respectively.
Animal Data
- In an embryo-fetal development study in pregnant rabbits there were increases in fetal skeletal variations/abnormalities (fused caudal vertebrae, number of lumbar vertebrae, and full supernumerary ribs) at doses that were also maternally toxic (≥ 0.3 mg/kg). Exposures in the rabbit at 0.3 mg/kg were 1.9 times the clinical time averaged exposures at the recommended dose of 4 mg. In a rat dose range-finding embryo-fetal development study, at doses that were maternally toxic, there were decreases in fetal weights, a trend towards decreased fetal viability, and increased post-implantation losses at 0.6 mg/kg. Exposures in rats at the dose of 0.6 mg/kg was 2.5 times the clinical time averaged exposures at the recommended dose of 4 mg.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Ixazomib in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Ixazomib during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Ixazomib in women who are nursing.
### Pediatric Use
Safety and effectiveness have not been established in pediatric patients.
### Geriatic Use
- Of the total number of subjects in clinical studies of Ixazomib, 55% were 65 and over, while 17% were 75 and over. No overall differences in safety or effectiveness were observed between these subjects and younger subjects, and other reported clinical experience has not identified differences in responses between the elderly and younger patients, but greater sensitivity of some older individuals cannot be ruled out.
### Gender
There is no FDA guidance on the use of Ixazomib with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Ixazomib with respect to specific racial populations.
### Renal Impairment
- In patients with severe renal impairment or ESRD requiring dialysis, the mean AUC increased by 39% when compared to patients with normal renal function. Reduce the starting dose of Ixazomib in patients with severe renal impairment or ESRD requiring dialysis. Ixazomib is not dialyzable and therefore can be administered without regard to the timing of dialysis.
### Hepatic Impairment
In patients with moderate or severe hepatic impairment, the mean AUC increased by 20% when compared to patients with normal hepatic function. Reduce the starting dose of Ixazomib in patients with moderate or severe hepatic impairment.
### Females of Reproductive Potential and Males
Contraception
- Male and female patients of childbearing potential must use effective contraceptive measures during and for 90 days following treatment.
Infertility
- Fertility studies were not conducted with Ixazomib; however there were no effects on reproductive organs in either males or females in nonclinical studies in rats and dogs
### Immunocompromised Patients
There is no FDA guidance one the use of Ixazomib in patients who are immunocompromised.
### Lactation
Risk Summary
- It is not known whether Ixazomib or its metabolites are present in human milk. Many drugs are present in human milk and as a result, there could be a potential for adverse events in nursing infants. Advise women to discontinue nursing.
# Administration and Monitoring
### Administration
Please see adult indications and dosing
### Monitoring
There is limited information regarding Ixazomib Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Ixazomib and IV administrations.
# Overdosage
- There is no known specific antidote for Ixazomib overdose. In the event of an overdose, monitor the patient for adverse reactions and provide appropriate supportive care.
# Pharmacology
## Mechanism of Action
Ixazomib is a reversible proteasome inhibitor. Ixazomib preferentially binds and inhibits the chymotrypsin-like activity of the beta 5 subunit of the 20S proteasome.
Ixazomib induced apoptosis of multiple myeloma cell lines in vitro. Ixazomib demonstrated in vitro cytotoxicity against myeloma cells from patients who had relapsed after multiple prior therapies, including bortezomib, lenalidomide, and dexamethasone. The combination of ixazomib and lenalidomide demonstrated synergistic cytotoxic effects in multiple myeloma cell lines. In vivo, ixazomib demonstrated antitumor activity in a mouse multiple myeloma tumor xenograft model.
## Structure
The molecular formula for ixazomib citrate is C20H23BCl2N2O9 and its molecular weight is 517.12. Ixazomib citrate has one chiral center and is the R-stereoisomer. The solubility of ixazomib citrate in 0.1N HCl (pH 1.2) at 37°C is 0.61 mg/mL (reported as ixazomib). The solubility increases as the pH increases.
- Ixazomib capsules for oral use contain 4, 3 or 2.3 mg of ixazomib equivalent to 5.7, 4.3 or 3.3 mg of ixazomib citrate, respectively. Inactive ingredients include microcrystalline cellulose, magnesium stearate, and talc. Capsule shells contain gelatin and titanium dioxide. The 4 mg capsule shell contains red and yellow iron oxide, the 3 mg capsule shell contains black iron oxide and the 2.3 mg capsule shell contains red iron oxide. The printing ink contains shellac, propylene glycol, potassium hydroxide, and black iron oxide.
## Pharmacodynamics
Cardiac Electrophysiology
- Ixazomib did not prolong the QTc interval at clinically relevant exposures based on pharmacokinetic-pharmacodynamic analysis of data from 245 patients.
## Pharmacokinetics
Absorption
- After oral administration, the median time to achieve peak ixazomib plasma concentrations was one hour. The mean absolute oral bioavailability was 58%, based on population PK analysis. Ixazomib AUC increases in a dose proportional manner over a dose range of 0.2 to 10.6 mg.
- A food effect study conducted in patients with a single 4 mg dose of ixazomib showed that a high-fat meal decreased ixazomib AUC by 28% and Cmax by 69%.
Distribution
- Ixazomib is 99% bound to plasma proteins and distributes into red blood cells with a blood-to-plasma ratio of 10. The steady-state volume of distribution is 543 L.
Elimination
- Based on a population PK analysis, systemic clearance was approximately 1.9 L/hr with inter-individual variability of 44%. The terminal half-life (t1/2) of ixazomib was 9.5 days. Following weekly oral dosing, the accumulation ratio was determined to be 2-fold.
Metabolism
- After oral administration of a radiolabeled dose, ixazomib represented 70% of total drug-related material in plasma. Metabolism by multiple CYP enzymes and non-CYP proteins is expected to be the major clearance mechanism for ixazomib. At clinically relevant ixazomib concentrations, in vitro studies using human cDNA-expressed cytochrome P450 isozymes showed that no specific CYP isozyme predominantly contributes to ixazomib metabolism. At higher than clinical concentrations, ixazomib was metabolized by multiple CYP isoforms with estimated relative contributions of 3A4 (42%), 1A2 (26%), 2B6 (16%), 2C8 (6%), 2D6 (5%), 2C19 (5%) and 2C9 (< 1%).
Excretion
- After administration of a single oral dose of 14C-ixazomib to 5 patients with advanced cancer, 62% of the administered radioactivity was excreted in urine and 22% in the feces. Unchanged ixazomib accounted for < 3.5% of the administered dose recovered in urine.
Specific Populations
Age, Sex, Race
There was no clinically meaningful effect of age (range 23-91 years), sex, body surface area(range 1.2-2.7 m2), or race on the clearance of ixazomib based on population PK analysis.
Hepatic Impairment
- The PK of ixazomib was similar in patients with normal hepatic function and in patients with mild hepatic impairment (total bilirubin ≤ ULN and AST > ULN or total bilirubin > 1-1.5 × ULN and any AST) based on population PK analysis.
The PK of ixazomib was characterized in patients with normal hepatic function at 4 mg (N=12), moderate hepatic impairment at 2.3 mg (total bilirubin > 1.5-3 × ULN, N=13) or severe hepatic impairment at 1.5 mg (total bilirubin > 3 × ULN, N=18). Dose-normalized mean AUC was 20% higher in patients with moderate or severe hepatic impairment as compared to patients with normal hepatic function.
Renal Impairment
- The PK of ixazomib was similar in patients with normal renal function and in patients with mild or moderate renal impairment (creatinine clearance ≥ 30 mL/min) based on population PK analysis.
- The PK of ixazomib was characterized at a dose of 3 mg in patients with normal renal function (creatinine clearance ≥ 90 mL/min, N=18), severe renal impairment (creatinine clearance < 30 mL/min, N=14), or ESRD requiring dialysis (N=6). Mean AUC was 39% higher in patients with severe renal impairment or ESRD requiring dialysis as compared to patients with normal renal function. Pre- and post-dialyzer concentrations of ixazomib measured during the hemodialysis session were similar, suggesting that ixazomib is not dialyzable.
Drug Interactions
Effect of Other Drugs on Ixazomib
Strong CYP3A Inducers
Co-administration of Ixazomib with rifampin decreased ixazomib Cmax by 54% and AUC by 74%.
Strong CYP3A Inhibitors
- Co-administration of Ixazomib with clarithromycin did not result in a clinically meaningful change in the systemic exposure of ixazomib.
Strong CYP1A2 Inhibitors
- Co-administration of Ixazomib with strong CYP1A2 inhibitors did not result in a clinically meaningful change in the systemic exposure of ixazomib based on a population PK analysis.
Effect of Ixazomib on Other Drugs
- Ixazomib is neither a reversible nor a time-dependent inhibitor of CYPs 1A2, 2B6, 2C8, 2C9, 2C19, 2D6, or 3A4/5. Ixazomib did not induce CYP1A2, CYP2B6, and CYP3A4/5 activity or corresponding immunoreactive protein levels. Ixazomib is not expected to produce drug-drug interactions via CYP inhibition or induction.
Transporter-Based Interactions
- Ixazomib is a low affinity substrate of P-gp. Ixazomib is not a substrate of BCRP, MRP2 or hepatic OATPs. Ixazomib is not an inhibitor of P-gp, BCRP, MRP2, OATP1B1, OATP1B3, OCT2, OAT1, OAT3, MATE1, or MATE2-K. Ixazomib is not expected to cause transporter-mediated drug-drug interactions.
## Nonclinical Toxicology
Carcinogenesis, Mutagenesis, Impairment of Fertility
- Ixazomib was not mutagenic in a bacterial reverse mutation assay (Ames assay). Ixazomib was considered positive in an in vitro clastogenicity test in human peripheral blood lymphocytes. However, in vivo, ixazomib was not clastogenic in a bone marrow micronucleus assay in mice and was negative in an in vivo comet assay in mice, as assessed in the stomach and liver. No carcinogenicity studies have been performed with ixazomib.
- Developmental toxicity studies in rats and rabbits did not show direct embryo-fetal toxicity below maternally toxic doses of ixazomib. Studies of fertility and early embryonic development and pre- and postnatal toxicology were not conducted with ixazomib, but evaluation of reproductive tissues was conducted in the general toxicity studies. There were no effects due to ixazomib treatment on male or female reproductive organs in studies up to 6-months duration in rats and up to 9-months duration in dogs.
# Clinical Studies
- The efficacy and safety of Ixazomib in combination with lenalidomide and dexamethasone was evaluated in a randomized, double-blind, placebo-controlled, multicenter study in patients with relapsed and/or refractory multiple myeloma who had received at least one prior line of therapy. Patients who were refractory to lenalidomide or proteasome inhibitors were excluded from the study.
- A total of 722 patients were randomized in a 1:1 ratio to receive either the combination of Ixazomib, lenalidomide and dexamethasone (N=360; Ixazomib regimen) or the combination of placebo, lenalidomide and dexamethasone (N=362; placebo regimen) until disease progression or unacceptable toxicity. Randomization was stratified according to number of prior lines of therapy (1 versus 2 or 3), myeloma International Staging System (ISS) (stage I or II versus III), and previous therapy with a proteasome inhibitor (exposed or naïve). Twenty three percent (N=166) of the patients had light chain disease and 12% (N=87) of patients had free light chain-measurable only disease.
- Thromboprophylaxis was recommended for all patients in both treatment groups according to the lenalidomide prescribing information. Antiemetics were used in 19% of patients in the Ixazomib regimen and 12% of patients in the placebo regimen; antivirals in 64% and 60%, respectively, and antihistamines in 27% and 19%, respectively. These medications were given to patients at the physician's discretion as prophylaxis and/or management of symptoms.
- Patients received Ixazomib 4 mg or placebo on Days 1, 8, and 15 plus lenalidomide (25 mg) on Days 1 through 21 and dexamethasone (40 mg) on Days 1, 8, 15, and 22 of a 28-day cycle. Patients with renal impairment received a starting dose of lenalidomide according to its prescribing information. Treatment continued until disease progression or unacceptable toxicities.
- Table 6 summarizes the baseline patient and disease characteristics in the study. The baseline demographics and disease characteristics were balanced and comparable between the study regimens.
The efficacy of Ixazomib was evaluated by progression-free survival (PFS) according to the 2011 International Myeloma Working Group (IMWG) Consensus Uniform Response Criteria as assessed by a blinded independent review committee (IRC) based on central lab results. Response was assessed every four weeks until disease progression.
- The approval of Ixazomib was based upon a statistically significant improvement in PFS of the Ixazomib regimen compared to the placebo regimen. PFS results are summarized in Table 7 and shown in Figure 1.
A non-inferential PFS analysis was conducted at a median follow up of 23 months with 372 PFS events. Hazard ratio of PFS was 0.82 (95% confidence interval [0.67, 1.0]) for Ixazomib regimen versus placebo regimen, and estimated median PFS was 20 months in the Ixazomib regimen and 15.9 months in the placebo regimen. At the same time, a planned interim OS analysis was conducted with 35% of the required number of deaths for final OS analysis; there were 81 deaths in the Ixazomib regimen and 90 deaths in the placebo regimen. An OS benefit was not demonstrated.
# How Supplied
Ixazomib is supplied as:
4 mg gelatin capsule: Light orange, size 3, imprinted with "Takeda" on the cap and "4.0 mg" on the body in black ink. Ixazomib 4 mg capsules contain 4 mg of ixazomib equivalent to 5.7 mg of ixazomib citrate.
One 4 mg capsule in a single blister pack (NDC 63020-080-01)
Three 4 mg single packs in a carton (NDC 63020-080-02)
3.0 mg gelatin capsule: Light grey, size 4, imprinted with "Takeda" on the cap and "3.0 mg" on the body in black ink. Ixazomib 3 mg capsules contain 3 mg of ixazomib equivalent to 4.3 mg of ixazomib citrate.
One 3 mg capsule in a single blister pack (NDC 63020-079-01)
Three 3 mg single packs in a carton (NDC 63020-079-02)
2.3 mg gelatin capsule: Light pink, size 4, imprinted with "Takeda" on the cap and "2.3 mg" on the body in black ink. Ixazomib 2.3 mg capsules contain 2.3 mg of ixazomib equivalent to 3.3 mg of ixazomib citrate.
- One 2.3 mg capsule in a single blister pack (NDC 63020-078-01)
- Three 2.3 mg single packs in a carton (NDC 63020-078-02)
- Capsules are individually packaged in a PVC-Aluminum/Aluminum blister.
## Storage
Storage
- Ixazomib may be stored at room temperature. Do not store above 30°C (86°F). Do not freeze.
- Store capsules in original packaging until immediately prior to use.
Handling and Disposal
- Ixazomib is cytotoxic. Capsules should not be opened or crushed. Direct contact with the capsule contents should be avoided. In case of capsule breakage, avoid direct contact of capsule contents with the skin or eyes. If contact occurs with the skin, wash thoroughly with soap and water. If contact occurs with the eyes, flush thoroughly with water.
- Any unused medicinal product or waste material should be disposed in accordance with local requirements.
# Images
## Drug Images
## Package and Label Display Panel
.
.
.
# Patient Counseling Information
Advise the patient to read the FDA-approved patient labeling (Patient Information).
Dosing Instructions
- Instruct patients to take Ixazomib exactly as prescribed.
- Advise patients to take Ixazomib once a week on the same day and at approximately the same time for the first three weeks of a four week cycle.
- Advise patients to take Ixazomib at least one hour before or at least two hours after food.
- Advise patients that Ixazomib and dexamethasone should not be taken at the same time, because dexamethasone should be taken with food and Ixazomib should not be taken with food.
- Advise patients to swallow the capsule whole with water. The capsule should not be crushed, chewed or opened.
- Advise patients that direct contact with the capsule contents should be avoided. *In case of capsule breakage, avoid direct contact of capsule contents with the skin or eyes. If contact occurs with the skin, wash thoroughly with soap and water. If contact occurs with the eyes, flush thoroughly with water.
- If a patient misses a dose, advise them to take the missed dose as long as the next scheduled dose is ≥ 72 hours away. Advise patients not to take a missed dose if it is within 72 hours of their next scheduled dose.
- If a patient vomits after taking a dose, advise them not to repeat the dose but resume dosing at the time of the next scheduled dose.
- Advise patients to store capsules in original packaging, and not to remove the capsule from the packaging until just prior to taking Ixazomib.
Thrombocytopenia
- Advise patients that they may experience low platelet counts (thrombocytopenia). Signs of thrombocytopenia may include bleeding and easy bruising.
Gastrointestinal Toxicities
Advise patients they may experience diarrhea, constipation, nausea and vomiting and to contact their physician if these adverse reactions persist.
Peripheral Neuropathy
- Advise patients to contact their physicians if they experience new or worsening symptoms of peripheral neuropathy such as tingling, numbness, pain, a burning feeling in the feet or hands, or weakness in the arms or legs.
Peripheral Edema
- Advise patients to contact their physicians if they experience unusual swelling of their extremities or weight gain due to swelling.
Cutaneous Reactions
- Advise patients to contact their physicians if they experience new or worsening rash.
Hepatotoxicity
- Advise patients to contact their physicians if they experience jaundice or right upper quadrant abdominal pain.
Pregnancy
- Advise women of the potential risk to a fetus and to avoid becoming pregnant while being treated with Ixazomib and for 90 days following the final dose. Advise patients to contact their physicians immediately if they or their female partner become pregnant during treatment or within 90 days of the final dose.
Concomitant Medications
- Advise patients to speak with their physicians about any other medication they are currently taking and before starting any new medications.
# Precautions with Alcohol
Alcohol-Ixazomib interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
NINLARO
# Look-Alike Drug Names
There is limited information regarding Ixazomib Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Ixazomib | |
f070bb88b7afa0d8587ce4633760a8526af5a4e9 | wikidoc | JC virus | JC virus
# Overview
The JC virus (JCV) is a type of human polyomavirus (formerly known as papovavirus) and is genetically similar to BK virus and SV40. It was discovered in 1971 and named after the two initials of a patient with progressive multifocal leukoencephalopathy (PML). The virus is widespread, with 86% of the general population presenting antibodies, but it usually remains latent, causing disease only when the immune system has been severely weakened. The virus causes PML and other diseases only in cases of immunodeficiency, as in AIDS, or immunosuppression, as in organ transplant patients.
# Epidemiology
The virus is very common in the general population, infecting 70 to 90 percent of humans; most people acquire JCV in childhood or adolescence . It is found in high concentrations in urban sewage worldwide, leading some researchers to suspect contaminated water as a typical route of infection .
Minor genetic variations are found consistently in different geographic areas; thus, genetic analysis of JC virus samples has been useful in tracing the history of human migration .
# Infection and pathogenesis
The initial site of infection may be the tonsils , or possibly the gastrointestinal tract . The virus then remains latent in the gastrointestinal tract and can also infect epithelial cells in the kidneys, where it continues to reproduce, shedding virus particles in the urine.
JCV can cross the blood-brain barrier into the central nervous system, where it infects oligodendrocytes and astrocytes, possibly through the 5-HT2A serotonin receptor . It is found within the brain even in people with no symptoms .
When immunodeficiency or immunosuppression allows JCV to reactivate, it attacks the previously infected tissues. In the kidneys, this results in hemorrhagic cystitis and ureteral stenosis; in the brain, it causes the usually fatal progressive multifocal leukoencephalopathy or PML by destroying oligodendrocytes. Several studies since 2000 have suggested that the virus is also linked to colorectal cancer, as JCV has been found in malignant colon tumors, but these findings are still controversial . | JC virus
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
The JC virus (JCV) is a type of human polyomavirus (formerly known as papovavirus) and is genetically similar to BK virus and SV40. It was discovered in 1971 and named after the two initials of a patient with progressive multifocal leukoencephalopathy (PML). The virus is widespread, with 86% of the general population presenting antibodies, but it usually remains latent, causing disease only when the immune system has been severely weakened. The virus causes PML and other diseases only in cases of immunodeficiency, as in AIDS, or immunosuppression, as in organ transplant patients.
# Epidemiology
The virus is very common in the general population, infecting 70 to 90 percent of humans; most people acquire JCV in childhood or adolescence [1]. It is found in high concentrations in urban sewage worldwide, leading some researchers to suspect contaminated water as a typical route of infection [2].
Minor genetic variations are found consistently in different geographic areas; thus, genetic analysis of JC virus samples has been useful in tracing the history of human migration [3].
# Infection and pathogenesis
The initial site of infection may be the tonsils [4], or possibly the gastrointestinal tract [2]. The virus then remains latent in the gastrointestinal tract [5] and can also infect epithelial cells in the kidneys, where it continues to reproduce, shedding virus particles in the urine.
JCV can cross the blood-brain barrier into the central nervous system, where it infects oligodendrocytes and astrocytes, possibly through the 5-HT2A serotonin receptor [6]. It is found within the brain even in people with no symptoms [7].
When immunodeficiency or immunosuppression allows JCV to reactivate, it attacks the previously infected tissues. In the kidneys, this results in hemorrhagic cystitis and ureteral stenosis; in the brain, it causes the usually fatal progressive multifocal leukoencephalopathy or PML by destroying oligodendrocytes. Several studies since 2000 have suggested that the virus is also linked to colorectal cancer, as JCV has been found in malignant colon tumors, but these findings are still controversial [8]. | https://www.wikidoc.org/index.php/JC_polyomavirus | |
fa3491037cc44900e56fc26dbf97533c38e888b7 | wikidoc | Norplant | Norplant
# Overview
Norplant is a form of birth control developed by the Population Council that was first approved in 1983 in Finland, where it was manufactured by Leiras Oy Pharmaceuticals. The original Norplant consisted of a set of six small (2.4 mm x 34 mm) silicone capsules, each filled with 36 mg of levonorgestrel (a progestin used in many birth control pills) implanted subdermally in the upper arm and effective for five years. The original (6 capsule) Norplant's production has been phased out; USAID's contract ran until December 2006.
The original (6 capsule) Norplant was approved by the FDA in 1990 and marketed in the United States in 1991 by Wyeth Pharmaceuticals. Norplant distribution in the United States ended in 2002; limited supplies still remained in the U.S. until 2004. Norplant was withdrawn from the UK market in 1999.
Norplant II (Norplant-2, Jadelle), also developed by the Population Council and manufactured by Schering Oy, consists of two small (2.5 mm x 43 mm) silicone rods each containing 75 mg of levonorgestrel in a polymer matrix, instead of six capsules. It was approved May 31, 1996 by the FDA as being effective for 3 years; it was subsequently approved November 22, 2002 by the FDA as being effective for 5 years. Jadelle has not been marketed in the United States; Jadelle is the successor to the original Norplant in USAID's contract beginning January 2007.
# Insertion
Norplant is implanted under the skin in the upper arm of a woman, by creating a small incision and inserting the capsules in a fanlike shape. Insertion of Norplant usually takes 15 minutes and the capsules can sometimes be seen under the skin, although usually they look like small veins. They can also be felt under the skin. Once inserted, the contraceptive works within 24 hours and lasts up to five years.
# Function and effectiveness
Norplant works by preventing ovulation, which means that no eggs are released for fertilization (although it does not succeed in this 100% of the time); by thickening the mucus of the cervix, which prevents sperm from entering; and by thinning the lining of the uterus, which makes implantation of an egg less likely. Because Norplant has the potential to prevent a successful pregnancy after fertilization occurs, some consider it (and other hormonal contraception, which works in the same way) to be abortive.
The way in which Norplant causes these effects is by use of hormones. A small amount of the hormone, progestin, is released through the capsules continuously, more during the first year and a half, but then at a level similar to most contraceptive pills afterward. According to studies completed, Norplant has been shown to be 99% – 99.95% effective at preventing pregnancy, and is one of the most reliable, though not the most available, forms of birth control around. It is important that people understand Norplant, however, does not protect against sexually transmitted diseases.
# Contraindications
Norplant should not be used in women with liver disease, breast cancer, or blood clots. Women who believe they may already be pregnant or those with vaginal bleeding should first see a physician. However, since Norplant does not contain estrogen like some birth control pills, older women, women who smoke, and women with high blood pressure are not restricted from using the system.
# Side effects
After three months of using Norplant, women will need to schedule a follow-up appointment to monitor blood pressure and discuss any concerns. Side effects may include irregular menstrual periods for the first approximately three months, including periods lasting longer than normal, bleeding or spotting between periods, heavy bleeding, or going with no period for the mentioned period of time. Common side effects include weight gain,
nervousness, anxiety, nausea, vomiting, mastalgia, dizziness, dermatitis/rash, hirsutism, scalp-hair loss, headache, depression, and acne. Sometimes, pain, itching or infection at the site of the implant will occur. Ovarian cysts may also occur, but usually do not require treatment, although they can cause pain even if benign.
# Removal
Norplant can be removed at any time by creating a second incision and withdrawing the capsules. Norplant is normally removed when the five year period is over and reinsertion of a new set is preferred, or if:
- Pregnancy is desired
- Different birth control is preferred
- Complications arise
Removal can be uncomplicated, but removal difficulties have been reported with a frequency of 6.2%, based on 849 removals. Removal difficulties include: multiple incisions, capsule fragments remaining, pain, multiple visits, deep placement, lengthy removal procedure, or other.
# Norplant discontinued in the United States
By 1996, more than 50,000 women had filed lawsuits, including 70 class actions, against Wyeth and/or its subsidiaries, or doctors who prescribed Norplant. Wyeth never lost a Norplant lawsuit.
On August 26, 1999, after winning 3 jury verdicts, 20 pretrial summary judgments and the dismissal of 14,000 claims, Wyeth offered out-of-court cash settlements of $1,500 each to about 36,000 women who contended that they had not been adequately warned about possible side effects of Norplant such as irregular menstrual bleeding, headaches, nausea and depression. Wyeth said that most of the plaintiffs experienced routine side effects described in Norplant's labeling information. Wyeth did not admit to any wrongdoing, saying the settlement offer "was purely a business decision," noting "our legal success has come at a steep price because lawsuits are time-consuming, expensive, and have a chilling effect on research," and that it would continue to offer Norplant and would defend "any and all new lawsuits aggressively."
About 32,000 women accepted the out-of-court $1,500 settlements. On August 14, 2002, Wyeth won partial summary judgment and dismissal of the claims of the 2,960 remaining plaintiffs who had not accepted Wyeth's out-of-court settlement offer.
In August 2000, Wyeth suspended shipments of Norplant in the United States because during regular quality assurance monitoring, representative samples of seven lots distributed beginning October 20, 1999 tested within product specifications, but at the lower end of the release rate specification for shelf life stability, raising concerns about those lots' contraceptive effectiveness. Wyeth recommended that women who had Norplant capsules from those lots implanted use backup contraception until they determined the clinical relevance of the atypically low levels of levonorgestrel release.
On July 26, 2002, Wyeth announced that data from investigations conducted in women with Norplant capsules from the suspect lots did not suggest less contraceptive effectiveness than that reported in clinical trials, and that therefore backup contraception could be safely discontinued. Wyeth also announced that due to limitations in product component supplies, they did not plan to resume marketing the six-capsule Norplant system in the United States.
# Footnotes
- ↑ Erica Johnson (April 1,2003). "Medical device lawsuits". CBC news. Check date values in: |date= (help).mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}
- ↑ "Contraceptive Maker Wins Woman's Suit Over Side Effects". The New York Times: p. A.7. 1998. Unknown parameter |month= ignored (help)CS1 maint: Extra text (link)
- ↑ Morrow, David J. (1999). "Maker of Norplant Offers a Settlement in Suit Over Effects". The New York Times: p. A.1. Unknown parameter |month= ignored (help)CS1 maint: Extra text (link)
- ↑ Manson, Pamela (2002). "Federal Judge Dismisses Norplant Damage Claims". Texas Lawyer. Retrieved 2007-01-15. Unknown parameter |month= ignored (help) | Norplant
Template:BirthControl infobox
# Overview
Norplant is a form of birth control developed by the Population Council that was first approved in 1983 in Finland, where it was manufactured by Leiras Oy Pharmaceuticals. The original Norplant consisted of a set of six small (2.4 mm x 34 mm) silicone capsules, each filled with 36 mg of levonorgestrel (a progestin used in many birth control pills) implanted subdermally in the upper arm and effective for five years.[1] The original (6 capsule) Norplant's production has been phased out; USAID's contract ran until December 2006.[2]
The original (6 capsule) Norplant was approved by the FDA in 1990 and marketed in the United States in 1991 by Wyeth Pharmaceuticals. Norplant distribution in the United States ended in 2002; limited supplies still remained in the U.S. until 2004. Norplant was withdrawn from the UK market in 1999.[3]
Norplant II (Norplant-2, Jadelle), also developed by the Population Council and manufactured by Schering Oy, consists of two small (2.5 mm x 43 mm) silicone rods each containing 75 mg of levonorgestrel in a polymer matrix, instead of six capsules. It was approved May 31, 1996 by the FDA as being effective for 3 years; it was subsequently approved November 22, 2002 by the FDA as being effective for 5 years. Jadelle has not been marketed in the United States;[4] Jadelle is the successor to the original Norplant in USAID's contract beginning January 2007.[5]
# Insertion
Norplant is implanted under the skin in the upper arm of a woman, by creating a small incision and inserting the capsules in a fanlike shape. Insertion of Norplant usually takes 15 minutes and the capsules can sometimes be seen under the skin, although usually they look like small veins. They can also be felt under the skin. Once inserted, the contraceptive works within 24 hours and lasts up to five years.
# Function and effectiveness
Norplant works by preventing ovulation, which means that no eggs are released for fertilization (although it does not succeed in this 100% of the time); by thickening the mucus of the cervix, which prevents sperm from entering; and by thinning the lining of the uterus, which makes implantation of an egg less likely. Because Norplant has the potential to prevent a successful pregnancy after fertilization occurs, some consider it (and other hormonal contraception, which works in the same way) to be abortive.
The way in which Norplant causes these effects is by use of hormones. A small amount of the hormone, progestin, is released through the capsules continuously, more during the first year and a half, but then at a level similar to most contraceptive pills afterward. According to studies completed, Norplant has been shown to be 99% – 99.95% effective at preventing pregnancy, and is one of the most reliable, though not the most available, forms of birth control around. It is important that people understand Norplant, however, does not protect against sexually transmitted diseases.
# Contraindications
Norplant should not be used in women with liver disease, breast cancer, or blood clots. Women who believe they may already be pregnant or those with vaginal bleeding should first see a physician. However, since Norplant does not contain estrogen like some birth control pills, older women, women who smoke, and women with high blood pressure are not restricted from using the system.
# Side effects
After three months of using Norplant, women will need to schedule a follow-up appointment to monitor blood pressure and discuss any concerns. Side effects may include irregular menstrual periods for the first approximately three months, including periods lasting longer than normal, bleeding or spotting between periods, heavy bleeding, or going with no period for the mentioned period of time. Common side effects include weight gain,
nervousness, anxiety, nausea, vomiting, mastalgia, dizziness, dermatitis/rash, hirsutism, scalp-hair loss, headache, depression, and acne. Sometimes, pain, itching or infection at the site of the implant will occur. Ovarian cysts may also occur, but usually do not require treatment, although they can cause pain even if benign.
# Removal
Norplant can be removed at any time by creating a second incision and withdrawing the capsules. Norplant is normally removed when the five year period is over and reinsertion of a new set is preferred, or if:
- Pregnancy is desired
- Different birth control is preferred
- Complications arise
Removal can be uncomplicated, but removal difficulties have been reported with a frequency of 6.2%, based on 849 removals. Removal difficulties include: multiple incisions, capsule fragments remaining, pain, multiple visits, deep placement, lengthy removal procedure, or other.[6]
# Norplant discontinued in the United States
By 1996, more than 50,000 women had filed lawsuits, including 70 class actions, against Wyeth and/or its subsidiaries, or doctors who prescribed Norplant.[1] Wyeth never lost a Norplant lawsuit.
[7]
On August 26, 1999, after winning 3 jury verdicts, 20 pretrial summary judgments and the dismissal of 14,000 claims, Wyeth offered out-of-court cash settlements of $1,500 each to about 36,000 women who contended that they had not been adequately warned about possible side effects of Norplant such as irregular menstrual bleeding, headaches, nausea and depression. Wyeth said that most of the plaintiffs experienced routine side effects described in Norplant's labeling information. Wyeth did not admit to any wrongdoing, saying the settlement offer "was purely a business decision," noting "our legal success has come at a steep price because lawsuits are time-consuming, expensive, and have a chilling effect on research," and that it would continue to offer Norplant and would defend "any and all new lawsuits aggressively."[2][3]
About 32,000 women accepted the out-of-court $1,500 settlements. On August 14, 2002, Wyeth won partial summary judgment and dismissal of the claims of the 2,960 remaining plaintiffs who had not accepted Wyeth's out-of-court settlement offer.[4]
In August 2000, Wyeth suspended shipments of Norplant in the United States because during regular quality assurance monitoring, representative samples of seven lots distributed beginning October 20, 1999 tested within product specifications, but at the lower end of the release rate specification for shelf life stability, raising concerns about those lots' contraceptive effectiveness. Wyeth recommended that women who had Norplant capsules from those lots implanted use backup contraception until they determined the clinical relevance of the atypically low levels of levonorgestrel release.[8]
On July 26, 2002, Wyeth announced that data from investigations conducted in women with Norplant capsules from the suspect lots did not suggest less contraceptive effectiveness than that reported in clinical trials, and that therefore backup contraception could be safely discontinued. Wyeth also announced that due to limitations in product component supplies, they did not plan to resume marketing the six-capsule Norplant system in the United States.[9]
# Footnotes
- ↑ Erica Johnson (April 1,2003). "Medical device lawsuits". CBC news. Check date values in: |date= (help).mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/d/d6/Lock-gray-alt-2.svg/9px-Lock-gray-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/a/aa/Lock-red-alt-2.svg/9px-Lock-red-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}
- ↑ "Contraceptive Maker Wins Woman's Suit Over Side Effects". The New York Times: p. A.7. 1998. Unknown parameter |month= ignored (help)CS1 maint: Extra text (link)
- ↑ Morrow, David J. (1999). "Maker of Norplant Offers a Settlement in Suit Over Effects". The New York Times: p. A.1. Unknown parameter |month= ignored (help)CS1 maint: Extra text (link)
- ↑ Manson, Pamela (2002). "Federal Judge Dismisses Norplant Damage Claims". Texas Lawyer. Retrieved 2007-01-15. Unknown parameter |month= ignored (help)
Template:WH
Template:WS | https://www.wikidoc.org/index.php/Jadelle | |
4e9f784b882b501cd872f76e11743316e00d8749 | wikidoc | Java Man | Java Man
Java Man is the name given to fossils discovered in 1891 at Trinil on the banks of the Bengawan Solo River in East Java, Indonesia, one of the first known specimens of Homo erectus. Its discoverer, Eugène Dubois, gave it the scientific name Pithecanthropus erectus, a name derived from Greek and Latin roots meaning upright ape-man.
# History and significance
Dubois' find was not a complete specimen, but consisted of a skullcap, a femur, and a few teeth. There is some dissent as to whether all these bones represent the same species. A second, more complete specimen was later discovered in the village of Sangiran, Central Java, 18km to the north of Solo. This find, a skullcap of similar size to that found by Dubois, was discovered by Berlin-born paleontologist GHR von Koenigswald in 1936. Many more finds have subsequently been made at the Sangiran site , although official reports remain critical of the site's "poor" presentation and interpretation .
Until older human remains were discovered in the Great Rift Valley in Kenya, Dubois' and Koenigswald's discoveries were the oldest hominid remains ever found. Some scientists of the day suggested Dubois' Java Man as a potential intermediate form between modern humans and the common ancestor we share with the other great apes. The current consensus of anthropologists is that the direct ancestors of modern humans were African populations of Homo erectus (possibly Homo ergaster), rather than the Asian populations exemplified by Java Man and Peking Man.
As with many notable hominid fossil finds, some creationists have attempted to downplay the evolutionary significance of Java Man by arguing the specimen should be considered either fully human or fully ape. An example of the former argument is the claim that Java Man is "a true member of the Human family"; an example of the latter is the erroneous claim that Dubois himself later decided that Java Man was really a large Gibbon. | Java Man
Java Man is the name given to fossils discovered in 1891 at Trinil on the banks of the Bengawan Solo River in East Java, Indonesia, one of the first known specimens of Homo erectus. Its discoverer, Eugène Dubois, gave it the scientific name Pithecanthropus erectus, a name derived from Greek and Latin roots meaning upright ape-man.
# History and significance
Dubois' find was not a complete specimen, but consisted of a skullcap, a femur, and a few teeth. There is some dissent as to whether all these bones represent the same species[1]. A second, more complete specimen was later discovered in the village of Sangiran, Central Java, 18km to the north of Solo. This find, a skullcap of similar size to that found by Dubois, was discovered by Berlin-born paleontologist GHR von Koenigswald in 1936. Many more finds have subsequently been made at the Sangiran site [2] [needs better citation], although official reports remain critical of the site's "poor" presentation and interpretation [3].
Until older human remains were discovered in the Great Rift Valley in Kenya, Dubois' and Koenigswald's discoveries were the oldest hominid remains ever found. Some scientists of the day suggested[citation needed] Dubois' Java Man as a potential intermediate form between modern humans and the common ancestor we share with the other great apes. The current consensus of anthropologists is that the direct ancestors of modern humans were African populations of Homo erectus (possibly Homo ergaster), rather than the Asian populations exemplified by Java Man and Peking Man.
As with many notable hominid fossil finds, some creationists have attempted to downplay the evolutionary significance of Java Man by arguing the specimen should be considered either fully human or fully ape. An example of the former argument is the claim that Java Man is "a true member of the Human family"[4]; an example of the latter is the erroneous claim that Dubois himself later decided that Java Man was really a large Gibbon[5]. | https://www.wikidoc.org/index.php/Java_Man | |
983cae3358d32663b685a9b3cff0fe2481e7b969 | wikidoc | Jealousy | Jealousy
# Overview
Jealousy typically refers to the thoughts, feelings, and behaviors that occur when a person believes a valued relationship is being threatened by a rival. This rival may or may not know that he or she is perceived as a threat.
According to many authors, jealousy is a complex emotion, meaning that it is not possible to provide a simple and immediate description of it, as it would be for “basic” emotions like joy or anger. A definition that expresses this character of complexity is “a cognitive elaboration of basic emotions” (Prinz, 2004, p. 93). This means that the experience of jealousy as felt by humans appears to be not merely sensory, showing some characters of rational elaboration and instinct. In addition, it is a common fact that the experience of jealousy can last much longer than the one of a basic emotion like anger, without losing its original intensity.
# Etymology
The word stems from the French jalousie, formed from jaloux (jealous), and further from Low Latin zelosus (full of zeal), in turn from the Greek word ζήλος (zelos), sometimes "jealousy", but more often in a good sense "emulation, ardour, zeal" (with a root connoting "to boil, ferment"; or "yeast").
# Occurrence of Jealousy
Jealousy is a familiar experience in human relationships. It has been reported in every culture and in many forms where researchers have looked.
It has been observed in infants as young as 5-6 months old and in adults over 65 years old.
It has been an enduring topic of interest for scientists, artists, and theologians. Psychologists have proposed several models of the processes underlying jealousy and have identified individual differences that influence the expression of jealousy. Sociologists have demonstrated that cultural beliefs and values play an important role in determining what triggers jealousy and what constitutes socially acceptable expressions of jealousy. Biologists have identified factors that may unconsciously influence the expression of jealousy. Artists have explored the theme of jealousy in photographs, paintings, movies, songs, plays, poems, and books. Theologians have offered religious views of jealousy based on the scriptures of their respective faiths. Despite its familiarity, however, people define jealousy in different ways.
The word "jealousy" is frequently used to describe what is more properly envy, fixation on what someone else has.
# Basics of Jealousy
## A picture of jealousy
Authors usually concentrate their studies on interpersonal jealousy or even on the narrower scope of sexual jealousy. Defining jealousy is tough. This is due to the difficulty of finding the necessary and sufficient conditions for jealousy to happen. So, when authors talk about jealousy, they try to provide the most general picture of it gathering the traits through which jealousy manifests itself. I will use the concept of “definition” to refer to this kind of description. Parrott makes use of the cause of jealousy to define it. He says “jealousy is an emotion experienced when a person is threatened by the loss of an important relation with another person” (Parrot, 2001, p. 313). After, he defines it also as “a type of anxious insecurity following from the perception of threat to a relation” which sustains the jealous’ self (Parrot, 2001, p. 314). Differently, Prinz (2004, p. 93) says that jealousy is a “non basic emotion”, meaning that “it is combination of basic emotions with other mental states that are not emotions”. His statement has a foundation on the concept of basic and non basic emotions, which he takes from Plutchik. Prinz (2004, p. 93) suggests that jealousy “contains anger, sadness, disgust” (basic emotions), “all brought together by the belief that one’s lover has been unfaithful” (mental state). Further, Goldie says jealousy is a passion, focusing his definition on the effects of jealousy, which “frequently get out of control” (2000, p. 229). These difference of approach manifest the fact that the experience of jealousy has an impact on our feeling and acting so broad that it is suitable for a multidisciplinary approach.
Describing jealousy, illustrating the circumstance in which it happens is indeed easier and more profitable than trying to define it. Many authors agree on the fact that jealousy is a three-party relation: the jealous person, the lover and the rival. With three characters, there are three different relation to describe: the jealous-lover's, the lover-rival's, the rival-jealous'. Going through all of them separately, the basic traits of jealousy will come out.
The relation between the jealous person and the lover is love. Love comes always with a touch of possessiveness. If possessiveness predominates among all other traits of love, jealousy becomes “ethically unjustifiable” because it “involves treating the other person as a possession” (Goldie, 2000, p. 232). It could be interesting to assess whether loving implies being jealous of the object of love. If possessiveness alone can generate jealousy, then this emotion can exist even if the lover is not a person. Such a kind of jealousy is showed in the following example. You are a child and your little brother finds an old toy somewhere in the room you share, and start to play with it. As soon as you realize that it is yours, you want it immediately back, even if you didn’t want to use it at that moment, he is not damaging or consuming it and, most of all, you forgot you had that toy until the moment you saw it in his hands. You don’t want anybody to play with your things; absurdly you prefer it to remain buried under dust than being used by someone else. You are jealous of your toys and your jealousy arises from a powerful feeling of possession.
The relation between lover and the rival is the element responsible for the “fear of loss” (Parrot, 2001, p. 313). present in jealousy. It can be a relation of the same kind with respect to the one existing between the jealous and the lover. In this case, we face sexual jealousy. This kind of jealousy is the most explored. In this case, jealousy consists in what of worse ??? can be felt and thought when the lover undertakes a new tie which implies the shift of the time and resources he or she used to dedicate to the jealous in favour of the rival. This is, for example, being jealous of the lover because of one of his/her colleague (meaning that the colleague is the rival). But, there’s also the possibility of being jealous of the lover’s job. In this case, even if there’s no possibility for a sexual betrayal, still the threat of loss stands, in the time the lover will spend in the office instead that with the jealous. The most important characteristics of the relation between lover and rival is that it can be entirely or partially imaginary. This is a key aspect to consider and will be discussed further.
The relation between the rival and the jealous person is difficult to assess. To do this, it is necessary to imagine a situation of jealousy in different scenarios that differ only for the relation existing between jealous and rival. Let’s say, the jealous’ wife has betrayed him: 1) with his best friend, 2) with the president of his company, 3) with another woman, 4) with a perfect stranger. Situation 2 and 4 only differ with respect to the social position of the rival, who in situation 2 has a strong position and some influence on the jealous. The emotion felt would be probably the same, but the reaction would be very different. In situation 2, in fact, a sense of impotency and sheepishness would prevail and block any reaction of the jealous toward the rival. Of course, there would be cases when the jealous would decide to do anyway something, engaging a fight with the rival. This indeed depends on his personality. Anyway, this action would be the result of a rationally pondered decision about the effect of such a reaction (lose his job, ban from the community…). In situation 4 everything would be “easier” and there would be less inhibition to the anger toward the rival. Situation 1 would be harder to face. In fact, it represents a double betrayal and the emotional shock would be much harder to bear. Here the jealous is losing the special and exclusive relation with the lover and with his friend, he can feel isolated with a sense of disgust for what happened behind him. Situation 3 would be probably the easiest to digest. In this case, the attention of the partner is lost but it doesn’t go anywhere else. The new relation is different. Here it is not possible to talk of jealousy, similarly to the case in which the partner would die; in those two cases, in facts, the lover does not engage a new relation of the same kind of the one he had with the jealous person.
These examples aim to show how people react to jealousy depending on their character and their emotional strength, meaning the way one copes with the difficulties of life preserving his equilibrium and serenity. The character of the jealous person is the factor that distinguishes situation 2 and 4. It is a common fact that the true social role of jealous and rival is a second order cause of this difference, being of prime importance the way the jealous elaborate the social “hierarchy” through his personal character. Situation 1 and 3 imply a strong impact on the emotional equilibrium of the jealous person, so the critical factor is the emotional strength with which he faces the situation.
It is possible to conclude that two traits were found, possessiveness and fear of loss, that identify jealousy. Possessiveness is necessary for jealousy, for as it is always present either as a degenerate aspect of love or as an independent trait. But, without a menace threatening the proximity with the lover, jealousy cannot occur. So the couple possessiveness – fear of loss seems to include the essence of jealousy. Once jealousy starts off, it evolves further, being the origin of thoughts and actions which are still part of the experience of jealousy. So the two character of jealousy found till now are not sufficient to define jealousy completely. The discussion about the relation between the jealous person and rival tries to investigate what happens after jealousy is generated. In this second phase, the jealous person has an active role and factors like his character and his emotional strength become important. This is the point where a comparison with envy is necessary, to understand the role of aspects like self esteem in jealousy, not to confuse the emotion under study with envy and to achieve the purpose of define some borders between the two.
## A comparison of jealousy and envy
Envy and jealousy are distinct in their object (Goldie, 2000, p. 221). Jealousy concerns something one has and is afraid of losing, while envy concerns something one does not have and either he wants to acquire (nonmalicious envy) or he wants the other(s) not to have (malicious envy) (Parrot, 2001, p. 309). A comparison between jealousy and envy can be carried out in order to understand their differences and similarities. Possible objects of love can be possible objects of jealousy; possible object of self esteem can be possible object of envy. Love and self esteem, which appear to be the main reasons for the two emotions, are extremely positive values, so that there could be some good in envy and jealousy. In fact, nonmalicious envy can “motivate people to improve themselves” (Parrot, 2001, p. 309). Moreover, jealousy can be the proof of passionate love, as an emotion that is appreciated by the partner thus strengthening the love relation. There are degenerate aspects of both emotions: possessiveness for love and self-indulgence for self esteem. Those can yield to destructive behaviours and feelings like the lover’s segregation in jealousy and the schadenfreude (joy for another’s misfortune) in envy.
While the origin of jealousy is still under discussion, the origin of envy has been well established. Parrott (2001, p. 308) says it originates from “a social comparison”, Goldie, from “a comparison of ourselves with the other person” (2000, p. 222). Envy can be considered a vice, meaning something that is always bad to be condemned anyway. This consideration comes up from the fact that very seldom (if not ever) the observation of another person’s success or achievement is free from any sort of hostility. Because of this, one could foster the inhibition of envy, control or disapprove it completely. But, as said before, envy can also be a drive for improvement, exactly as said for jealousy when it was considered as a passion.
It has been proved that envy has an important role in society, a so strong influence on human facts that “there are crimes of envy, politics based on envy, institutions designed to regulate envy and powerful motives for avoiding being envied by others” (Parrot, 2001, p. 308). Nothing of that kind has been said of jealousy. Envy share with jealousy its characteristics of nonbasic emotion (Prinz, 2004, p. 93). Parrott finds in it, among others, frustrate desire, inferiority, resentment of fate. With respect of this last emotional experience, the author says that there is a component of “love of justice” in it, explained with the fact that “we are more angry at undeserved than at deserved good fortune” (2001, p. 310).
After all these consideration, envy and jealousy appear to be pretty different. So why they are often confused? Goldie says they are “closely related” (200, p. 221). There is indeed a common characteristic in them, they are complex and can come in many forms. They originate from the fact that humans are capable of having emotions but also thought, feelings, emotions about emotions (Goldie, 2000, p. 239). This is the essence of the complex nature of jealousy and envy. Further, their qualitative character is similar. In fact, jealousy and envy share some of the basic emotions they are made of: anger, fear, sadness, anxiety. Those are very powerful and have a monopolizing effect on the perception faculties of a person. One could easily notice that, when real anger is experienced, it doesn’t really matter the emotional or rational process that yielded to that state of anger. People involved in envy or jealousy don’t distinguish between them because at some point of the emotional experience they are indistinguishable.
Given that, even for an external observer it could be difficult to distinguish envy and jealousy. This is related in part to the way these two emotions can be generated. Imagine a relation between a man and a woman who are very old friends. He has a secret feeling of love for her, fed by the good times they spent together and by the many occasion of complicity and exclusive intimacy. The way the man perceive their relation is in part related to his imagination; in addition, suppose that there had never been episodes of sex intimacy. Now the woman is about to marry another person. The man is very upset. He’s angry, he feels betrayed. He wanted to be the person sharing the same bed with the woman. He feels frustrated. He thinks it’s unfair that another enjoys the maximum expression of an exclusive relation he thinks he has a right to. We find the three protaginists forming the lover-rival-jealous triangle. There is a claim for love from the jealous person that is not shared by the counterpart, this claim of love being strongly affected by possessiveness. In addition, the man feels resentment because the other person will have something he hasn’t, he desired and he thought he had the right to have. This example shows clearly that sometimes it is hard to separate envy and jealousy, either because the circumstances in which those emotions are generated can stimulate both of them either because their qualitative character is similar.
To summarize, it is possible to distinguish envy and jealousy from a conceptual point of view, because they show different constitutive traits. Jealousy is the fear of loss for something one has and is very important for one, envy is the will to overcome a lack arising from the comparison with someone else. These two statements do not provide an exhaustive characterization of the two emotions, but specify two different necessary condition for jealousy and envy. The confusion arise from the fact that these two conditions can happen at the same time, as shown in the last example. Secondly, it could be hard for the person experiencing jealousy or envy to distinguish them because of the phenomenological elements they share: anger, anxiety, fear and so on. Regarding the role of self esteem in jealousy, we can conclude that it is much more prominent in envy so that we can neglect it when we talk about jealousy in this analysis.
At this point, the picture is sufficiently clear to go into the debate about the nature of jealousy.
## The nature of jealousy, innate and cultural elements
As said formerly, jealousy is more than a mere, sudden emotion. It consist in an entire “emotional episode” including the circumstances that lead up to jealousy, jealousy itself as emotion, any attempt at self regulation, subsequent actions and events and the resolution of the episode (Parrott, 2001, p. 306). There’s a complex “narrative” behind jealousy (Parrott, ibidem), as it is perceived and thought by the jealous. The origin of this narrative is extremely relevant to understand the nature of jealousy. The narrative can originate from experienced facts, thoughts, perceptions, memories, but also imagination, guess and assumptions. The more society and culture matter in the formation of these factors, the more jealousy can have a social and cultural origin. By contrast, Goldie (2000, p. 228) shows how jealousy can be a “cognitively impenetrable state”, where education and rational belief matter very little.
What a cognitively impenetrable state is can be effectively explained by this example. Imagine being a climber, dangling from a rock face over a precipice. The rope you are tied to is very thin so you are almost paralyzed by the fear of falling down. Besides being a climber, you are also a material scientist and you know that the rope is made of a material so strong that it cannot break for any reason. Nevertheless, you still are terrorized by the possibility of a break. Rational evidence cannot help you to feel safer because the state of fear in this example is cognitively impenetrable.
This was to introduce a consideration about the origin of jealousy. An argument in favour of the innate origin of jealousy is found in evolutionary psychology. They say, jealousy evolved in order to maximize the success of our genes. In brief, jealousy is a biological based emotion (Prinz after Buss and Larsen, 2004, p. 120) selected to foster the certainty about the paternity of one’s own offspring. A jealous behaviour, in men, is directed into avoiding sexual betrayal and a consequent waste of resources and effort in taking care of some else’s offspring.
Upon this consideration, there would be a difference between men’s and women’s jealousy, the former being directed against sexual infidelity, the latter against emotional infidelity . Goldie (2000, p. 233) asserts, after Hume, that since today we have the DNA paternity test, no more reasons stand??? for jealousy, for as one “experience emotions because of the way one is educated”. Education today can give us the conviction of the possibility to give a rational evidence of paternity. But it is not clear how education can have an influence on such an innate, “biological” origin of jealousy.
For this reason, jealousy appears to be somehow a cognitive impenetrable state. It seems that education cannot penetrate so deeply inside us so to counteract an instinctive feeling. Is this the proof of the instinctive nature of jealousy, because an innate attitude takes over education and rational control? There are other aspects to consider before answering, for as some other factors participate to the formation of the emotional experience of jealousy.People who have been jealous have said its an un pleasant emotion.
There are two issues in favour of a cultural or social origin of jealousy. The first is that the narrative from which jealousy arises can be in great part made by the imagination. Imagination is strongly affected by the culture a person is inserted in. The reasoning method, the way one is inclined to infer thought or conclusions on facts, the way one perceive some situations depends strongly on cultural context. Let’s just think of the difference concerning jealousy in a monogamy and polygamy culture. Women accept or not such a relation depending on the way it is coded into their society. One could imagine that women in a polygamist culture probably are not forced to repress jealousy, they simply are not jealous. Moreover, consider the influence that stereotypes can have in the way we evaluate other people. Think of a new colleague of you wife; you can be jealous just because he is, for example, Italian and “You know what they say about Italians…”.
You expressed a judgement on a person based on no facts or experience, just on a general prejudice. This judgement is sufficient to cause jealousy. The second issue is a consideration about how to suppress jealousy. The characteristics that can put off jealousy are “chastity and modesty, that are artificial virtues, arising from education and the voluntary conventions of men, and the interests of society” (Goldie after Hume, 2000, p. 230). Besides, it is hard to find any natural characteristics that would put off jealousy. If it is possible to assume that the remedy for jealousy must have the same nature of jealousy, then it is possible to conclude that jealousy has a social origin. For the reason exposed before, this does not exclude the coexistence of different causes for jealousy.
Finally, it is possible to conclude that there is an innate character in jealousy, as seen in the discussion about the certitude of paternity. Education and social context cannot act on the instinctive drive to some jealous feeling. But it has been shown that jealousy is not merely the feeling of a simple emotion. A rational elaboration, influenced by social conventions, imagination and personal character comes along with the instinctive push. Its role is of the same importance. There is not a temporal sequence where one of these two traits of jealousy comes first and the other follows. On the contrary, we could imagine that the instinct of jealousy is “surrounded” by some cultural reasons that could lead to jealousy and some social ways to react to it. In turn, those reactions can be partly instinctive, because they depend on what has been defined as the emotional strength of a person. The two nature of jealousy communicate and influence each other.
## Coping with jealousy
People who experience pathological jealousy, and people for whom jealousy triggers violence, may benefit from professional counseling. People who experience normal jealousy have at least nine strategies for coping with jealousy. The problem-solving strategies include: improving the primary relationship, interfering with the rival relationship, demanding commitment, and self-assessment. The emotion-focused strategies include: derogation of partner or rival, developing alternatives, denial/avoidance, support/catharsis, and appraisal challenge. These strategies are related to emotion regulation, conflict management, cognitive change, and ground rules for managing jealous competition. The most important thing to do about any feelings of jealousy is to first admit them, and then attempt to overcome them. Polyamory groups encourage the replacement of jealousy with compersion, or empathizing with a lover's joy with another lover.
# Jealousy in the sciences
## Psychology of jealousy
While mainstream psychology considers sexual arousal through jealousy a paraphilia (categorized as zelophilia), some authors on sexuality (Serge Kreutz, Instrumental Jealousy) have argued that jealousy in manageable dimensions can have a definite positive effect on sexual function and sexual satisfaction. Studies have also shown that jealousy sometimes heightens passion towards partners and increases the intensity of passionate sex.
## Sociology of jealousy
Anthropologists have claimed that jealousy varies across cultures. Cultural learning can influence the situations that trigger jealousy and the manner in which jealousy is expressed. Attitudes toward jealousy can also change within a culture over time. For example, attitudes toward jealousy changed substantially during the 1960s and 1970s in the United States. People in the United States adopted much more negative views about jealousy.
# Jealousy in art
Jealousy is the powerful complex of emotions experienced at the loss, real or imagined, of something or someone you believe is yours, whereas envy concerns what you don’t have and would like to possess. Othello is filled with jealousy at the thought of losing Desdemona: Iago is consumed with envy of Othello’s prestige. Because jealous lovers tell multiple stories about those who arouse their jealousy, and because the emotion is so corrosive, jealousy is a common theme in literature, art, theatre, and film.
# Jealousy in religion
Jealousy in religion examines how the scriptures and teachings of various religions deal with the topic of jealousy. Religions may be compared and contrasted on how they deal with two issues: concepts of divine jealousy, and rules about the provocation and expression of human jealousy. | Jealousy
Template:Close Relationships
Template:Emotion
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Jealousy typically refers to the thoughts, feelings, and behaviors that occur when a person believes a valued relationship is being threatened by a rival. This rival may or may not know that he or she is perceived as a threat.
According to many authors, jealousy is a complex emotion, meaning that it is not possible to provide a simple and immediate description of it, as it would be for “basic” emotions like joy or anger. A definition that expresses this character of complexity is “a cognitive elaboration of basic emotions” (Prinz, 2004, p. 93). This means that the experience of jealousy as felt by humans appears to be not merely sensory, showing some characters of rational elaboration and instinct. In addition, it is a common fact that the experience of jealousy can last much longer than the one of a basic emotion like anger, without losing its original intensity.
# Etymology
The word stems from the French jalousie, formed from jaloux (jealous), and further from Low Latin zelosus (full of zeal), in turn from the Greek word ζήλος (zelos), sometimes "jealousy", but more often in a good sense "emulation, ardour, zeal"[1][2] (with a root connoting "to boil, ferment"; or "yeast").
# Occurrence of Jealousy
Jealousy is a familiar experience in human relationships. It has been reported in every culture and in many forms where researchers have looked.
[3]
[4]
[5]
It has been observed in infants as young as 5-6 months old and in adults over 65 years old.
[6]
[7]
[8]
[9]
It has been an enduring topic of interest for scientists, artists, and theologians. Psychologists have proposed several models of the processes underlying jealousy and have identified individual differences that influence the expression of jealousy. Sociologists have demonstrated that cultural beliefs and values play an important role in determining what triggers jealousy and what constitutes socially acceptable expressions of jealousy. Biologists have identified factors that may unconsciously influence the expression of jealousy. Artists have explored the theme of jealousy in photographs, paintings, movies, songs, plays, poems, and books. Theologians have offered religious views of jealousy based on the scriptures of their respective faiths. Despite its familiarity, however, people define jealousy in different ways.
The word "jealousy" is frequently used to describe what is more properly envy, fixation on what someone else has.
# Basics of Jealousy
## A picture of jealousy
Authors usually concentrate their studies on interpersonal jealousy or even on the narrower scope of sexual jealousy. Defining jealousy is tough. This is due to the difficulty of finding the necessary and sufficient conditions for jealousy to happen. So, when authors talk about jealousy, they try to provide the most general picture of it gathering the traits through which jealousy manifests itself. I will use the concept of “definition” to refer to this kind of description. Parrott makes use of the cause of jealousy to define it. He says “jealousy is an emotion experienced when a person is threatened by the loss of an important relation with another person” (Parrot, 2001, p. 313). After, he defines it also as “a type of anxious insecurity following from the perception of threat to a relation” which sustains the jealous’ self (Parrot, 2001, p. 314). Differently, Prinz (2004, p. 93) says that jealousy is a “non basic emotion”, meaning that “it is combination of basic emotions with other mental states that are not emotions”. His statement has a foundation on the concept of basic and non basic emotions, which he takes from Plutchik. Prinz (2004, p. 93) suggests that jealousy “contains anger, sadness, disgust” (basic emotions), “all brought together by the belief that one’s lover has been unfaithful” (mental state). Further, Goldie says jealousy is a passion, focusing his definition on the effects of jealousy, which “frequently get out of control” (2000, p. 229). These difference of approach manifest the fact that the experience of jealousy has an impact on our feeling and acting so broad that it is suitable for a multidisciplinary approach.
Describing jealousy, illustrating the circumstance in which it happens is indeed easier and more profitable than trying to define it. Many authors agree on the fact that jealousy is a three-party relation: the jealous person, the lover and the rival. With three characters, there are three different relation to describe: the jealous-lover's, the lover-rival's, the rival-jealous'. Going through all of them separately, the basic traits of jealousy will come out.
The relation between the jealous person and the lover is love. Love comes always with a touch of possessiveness. If possessiveness predominates among all other traits of love, jealousy becomes “ethically unjustifiable” because it “involves treating the other person as a possession” (Goldie, 2000, p. 232). It could be interesting to assess whether loving implies being jealous of the object of love. If possessiveness alone can generate jealousy, then this emotion can exist even if the lover is not a person. Such a kind of jealousy is showed in the following example. You are a child and your little brother finds an old toy somewhere in the room you share, and start to play with it. As soon as you realize that it is yours, you want it immediately back, even if you didn’t want to use it at that moment, he is not damaging or consuming it and, most of all, you forgot you had that toy until the moment you saw it in his hands. You don’t want anybody to play with your things; absurdly you prefer it to remain buried under dust than being used by someone else. You are jealous of your toys and your jealousy arises from a powerful feeling of possession.
The relation between lover and the rival is the element responsible for the “fear of loss” (Parrot, 2001, p. 313). present in jealousy. It can be a relation of the same kind with respect to the one existing between the jealous and the lover. In this case, we face sexual jealousy. This kind of jealousy is the most explored. In this case, jealousy consists in what of worse ??? can be felt and thought when the lover undertakes a new tie which implies the shift of the time and resources he or she used to dedicate to the jealous in favour of the rival. This is, for example, being jealous of the lover because of one of his/her colleague (meaning that the colleague is the rival). But, there’s also the possibility of being jealous of the lover’s job. In this case, even if there’s no possibility for a sexual betrayal, still the threat of loss stands, in the time the lover will spend in the office instead that with the jealous. The most important characteristics of the relation between lover and rival is that it can be entirely or partially imaginary. This is a key aspect to consider and will be discussed further.
The relation between the rival and the jealous person is difficult to assess. To do this, it is necessary to imagine a situation of jealousy in different scenarios that differ only for the relation existing between jealous and rival. Let’s say, the jealous’ wife has betrayed him: 1) with his best friend, 2) with the president of his company, 3) with another woman, 4) with a perfect stranger. Situation 2 and 4 only differ with respect to the social position of the rival, who in situation 2 has a strong position and some influence on the jealous. The emotion felt would be probably the same, but the reaction would be very different. In situation 2, in fact, a sense of impotency and sheepishness would prevail and block any reaction of the jealous toward the rival. Of course, there would be cases when the jealous would decide to do anyway something, engaging a fight with the rival. This indeed depends on his personality. Anyway, this action would be the result of a rationally pondered decision about the effect of such a reaction (lose his job, ban from the community…). In situation 4 everything would be “easier” and there would be less inhibition to the anger toward the rival. Situation 1 would be harder to face. In fact, it represents a double betrayal and the emotional shock would be much harder to bear. Here the jealous is losing the special and exclusive relation with the lover and with his friend, he can feel isolated with a sense of disgust for what happened behind him. Situation 3 would be probably the easiest to digest. In this case, the attention of the partner is lost but it doesn’t go anywhere else. The new relation is different. Here it is not possible to talk of jealousy, similarly to the case in which the partner would die; in those two cases, in facts, the lover does not engage a new relation of the same kind of the one he had with the jealous person.
These examples aim to show how people react to jealousy depending on their character and their emotional strength, meaning the way one copes with the difficulties of life preserving his equilibrium and serenity. The character of the jealous person is the factor that distinguishes situation 2 and 4. It is a common fact that the true social role of jealous and rival is a second order cause of this difference, being of prime importance the way the jealous elaborate the social “hierarchy” through his personal character. Situation 1 and 3 imply a strong impact on the emotional equilibrium of the jealous person, so the critical factor is the emotional strength with which he faces the situation.
It is possible to conclude that two traits were found, possessiveness and fear of loss, that identify jealousy. Possessiveness is necessary for jealousy, for as it is always present either as a degenerate aspect of love or as an independent trait. But, without a menace threatening the proximity with the lover, jealousy cannot occur. So the couple possessiveness – fear of loss seems to include the essence of jealousy. Once jealousy starts off, it evolves further, being the origin of thoughts and actions which are still part of the experience of jealousy. So the two character of jealousy found till now are not sufficient to define jealousy completely. The discussion about the relation between the jealous person and rival tries to investigate what happens after jealousy is generated. In this second phase, the jealous person has an active role and factors like his character and his emotional strength become important. This is the point where a comparison with envy is necessary, to understand the role of aspects like self esteem in jealousy, not to confuse the emotion under study with envy and to achieve the purpose of define some borders between the two.
## A comparison of jealousy and envy
Envy and jealousy are distinct in their object (Goldie, 2000, p. 221). Jealousy concerns something one has and is afraid of losing, while envy concerns something one does not have and either he wants to acquire (nonmalicious envy) or he wants the other(s) not to have (malicious envy) (Parrot, 2001, p. 309). A comparison between jealousy and envy can be carried out in order to understand their differences and similarities. Possible objects of love can be possible objects of jealousy; possible object of self esteem can be possible object of envy. Love and self esteem, which appear to be the main reasons for the two emotions, are extremely positive values, so that there could be some good in envy and jealousy. In fact, nonmalicious envy can “motivate people to improve themselves” (Parrot, 2001, p. 309). Moreover, jealousy can be the proof of passionate love, as an emotion that is appreciated by the partner thus strengthening the love relation. There are degenerate aspects of both emotions: possessiveness for love and self-indulgence for self esteem. Those can yield to destructive behaviours and feelings like the lover’s segregation in jealousy and the schadenfreude (joy for another’s misfortune) in envy.
While the origin of jealousy is still under discussion, the origin of envy has been well established. Parrott (2001, p. 308) says it originates from “a social comparison”, Goldie, from “a comparison of ourselves with the other person” (2000, p. 222). Envy can be considered a vice, meaning something that is always bad to be condemned anyway. This consideration comes up from the fact that very seldom (if not ever) the observation of another person’s success or achievement is free from any sort of hostility. Because of this, one could foster the inhibition of envy, control or disapprove it completely. But, as said before, envy can also be a drive for improvement, exactly as said for jealousy when it was considered as a passion.
It has been proved that envy has an important role in society, a so strong influence on human facts that “there are crimes of envy, politics based on envy, institutions designed to regulate envy and powerful motives for avoiding being envied by others” (Parrot, 2001, p. 308). Nothing of that kind has been said of jealousy. Envy share with jealousy its characteristics of nonbasic emotion (Prinz, 2004, p. 93). Parrott finds in it, among others, frustrate desire, inferiority, resentment of fate. With respect of this last emotional experience, the author says that there is a component of “love of justice” in it, explained with the fact that “we are more angry at undeserved than at deserved good fortune” (2001, p. 310).
After all these consideration, envy and jealousy appear to be pretty different. So why they are often confused? Goldie says they are “closely related” (200, p. 221). There is indeed a common characteristic in them, they are complex and can come in many forms. They originate from the fact that humans are capable of having emotions but also thought, feelings, emotions about emotions (Goldie, 2000, p. 239). This is the essence of the complex nature of jealousy and envy. Further, their qualitative character is similar. In fact, jealousy and envy share some of the basic emotions they are made of: anger, fear, sadness, anxiety. Those are very powerful and have a monopolizing effect on the perception faculties of a person. One could easily notice that, when real anger is experienced, it doesn’t really matter the emotional or rational process that yielded to that state of anger. People involved in envy or jealousy don’t distinguish between them because at some point of the emotional experience they are indistinguishable.
Given that, even for an external observer it could be difficult to distinguish envy and jealousy. This is related in part to the way these two emotions can be generated. Imagine a relation between a man and a woman who are very old friends. He has a secret feeling of love for her, fed by the good times they spent together and by the many occasion of complicity and exclusive intimacy. The way the man perceive their relation is in part related to his imagination; in addition, suppose that there had never been episodes of sex intimacy. Now the woman is about to marry another person. The man is very upset. He’s angry, he feels betrayed. He wanted to be the person sharing the same bed with the woman. He feels frustrated. He thinks it’s unfair that another enjoys the maximum expression of an exclusive relation he thinks he has a right to. We find the three protaginists forming the lover-rival-jealous triangle. There is a claim for love from the jealous person that is not shared by the counterpart, this claim of love being strongly affected by possessiveness. In addition, the man feels resentment because the other person will have something he hasn’t, he desired and he thought he had the right to have. This example shows clearly that sometimes it is hard to separate envy and jealousy, either because the circumstances in which those emotions are generated can stimulate both of them either because their qualitative character is similar.
To summarize, it is possible to distinguish envy and jealousy from a conceptual point of view, because they show different constitutive traits. Jealousy is the fear of loss for something one has and is very important for one, envy is the will to overcome a lack arising from the comparison with someone else. These two statements do not provide an exhaustive characterization of the two emotions, but specify two different necessary condition for jealousy and envy. The confusion arise from the fact that these two conditions can happen at the same time, as shown in the last example. Secondly, it could be hard for the person experiencing jealousy or envy to distinguish them because of the phenomenological elements they share: anger, anxiety, fear and so on. Regarding the role of self esteem in jealousy, we can conclude that it is much more prominent in envy so that we can neglect it when we talk about jealousy in this analysis.
At this point, the picture is sufficiently clear to go into the debate about the nature of jealousy.
## The nature of jealousy, innate and cultural elements
As said formerly, jealousy is more than a mere, sudden emotion. It consist in an entire “emotional episode” including the circumstances that lead up to jealousy, jealousy itself as emotion, any attempt at self regulation, subsequent actions and events and the resolution of the episode (Parrott, 2001, p. 306). There’s a complex “narrative” behind jealousy (Parrott, ibidem), as it is perceived and thought by the jealous. The origin of this narrative is extremely relevant to understand the nature of jealousy. The narrative can originate from experienced facts, thoughts, perceptions, memories, but also imagination, guess and assumptions. The more society and culture matter in the formation of these factors, the more jealousy can have a social and cultural origin. By contrast, Goldie (2000, p. 228) shows how jealousy can be a “cognitively impenetrable state”, where education and rational belief matter very little.
What a cognitively impenetrable state is can be effectively explained by this example. Imagine being a climber, dangling from a rock face over a precipice. The rope you are tied to is very thin so you are almost paralyzed by the fear of falling down. Besides being a climber, you are also a material scientist and you know that the rope is made of a material so strong that it cannot break for any reason. Nevertheless, you still are terrorized by the possibility of a break. Rational evidence cannot help you to feel safer because the state of fear in this example is cognitively impenetrable.
This was to introduce a consideration about the origin of jealousy. An argument in favour of the innate origin of jealousy is found in evolutionary psychology. They say, jealousy evolved in order to maximize the success of our genes. In brief, jealousy is a biological based emotion (Prinz after Buss and Larsen, 2004, p. 120) selected to foster the certainty about the paternity of one’s own offspring. A jealous behaviour, in men, is directed into avoiding sexual betrayal and a consequent waste of resources and effort in taking care of some else’s offspring.
Upon this consideration, there would be a difference between men’s and women’s jealousy, the former being directed against sexual infidelity, the latter against emotional infidelity . Goldie (2000, p. 233) asserts, after Hume, that since today we have the DNA paternity test, no more reasons stand??? for jealousy, for as one “experience emotions because of the way one is educated”. Education today can give us the conviction of the possibility to give a rational evidence of paternity. But it is not clear how education can have an influence on such an innate, “biological” origin of jealousy.
For this reason, jealousy appears to be somehow a cognitive impenetrable state. It seems that education cannot penetrate so deeply inside us so to counteract an instinctive feeling. Is this the proof of the instinctive nature of jealousy, because an innate attitude takes over education and rational control? There are other aspects to consider before answering, for as some other factors participate to the formation of the emotional experience of jealousy.People who have been jealous have said its an un pleasant emotion.
There are two issues in favour of a cultural or social origin of jealousy. The first is that the narrative from which jealousy arises can be in great part made by the imagination. Imagination is strongly affected by the culture a person is inserted in. The reasoning method, the way one is inclined to infer thought or conclusions on facts, the way one perceive some situations depends strongly on cultural context. Let’s just think of the difference concerning jealousy in a monogamy and polygamy culture. Women accept or not such a relation depending on the way it is coded into their society. One could imagine that women in a polygamist culture probably are not forced to repress jealousy, they simply are not jealous. Moreover, consider the influence that stereotypes can have in the way we evaluate other people. Think of a new colleague of you wife; you can be jealous just because he is, for example, Italian and “You know what they say about Italians…”.
You expressed a judgement on a person based on no facts or experience, just on a general prejudice. This judgement is sufficient to cause jealousy. The second issue is a consideration about how to suppress jealousy. The characteristics that can put off jealousy are “chastity and modesty, that are artificial virtues, arising from education and the voluntary conventions of men, and the interests of society” (Goldie after Hume, 2000, p. 230). Besides, it is hard to find any natural characteristics that would put off jealousy. If it is possible to assume that the remedy for jealousy must have the same nature of jealousy, then it is possible to conclude that jealousy has a social origin. For the reason exposed before, this does not exclude the coexistence of different causes for jealousy.
Finally, it is possible to conclude that there is an innate character in jealousy, as seen in the discussion about the certitude of paternity. Education and social context cannot act on the instinctive drive to some jealous feeling. But it has been shown that jealousy is not merely the feeling of a simple emotion. A rational elaboration, influenced by social conventions, imagination and personal character comes along with the instinctive push. Its role is of the same importance. There is not a temporal sequence where one of these two traits of jealousy comes first and the other follows. On the contrary, we could imagine that the instinct of jealousy is “surrounded” by some cultural reasons that could lead to jealousy and some social ways to react to it. In turn, those reactions can be partly instinctive, because they depend on what has been defined as the emotional strength of a person. The two nature of jealousy communicate and influence each other.
## Coping with jealousy
People who experience pathological jealousy, and people for whom jealousy triggers violence, may benefit from professional counseling. People who experience normal jealousy have at least nine strategies for coping with jealousy. The problem-solving strategies include: improving the primary relationship, interfering with the rival relationship, demanding commitment, and self-assessment. The emotion-focused strategies include: derogation of partner or rival, developing alternatives, denial/avoidance, support/catharsis, and appraisal challenge. These strategies are related to emotion regulation, conflict management, cognitive change, and ground rules for managing jealous competition. The most important thing to do about any feelings of jealousy is to first admit them, and then attempt to overcome them. Polyamory groups encourage the replacement of jealousy with compersion, or empathizing with a lover's joy with another lover.
# Jealousy in the sciences
## Psychology of jealousy
While mainstream psychology considers sexual arousal through jealousy a paraphilia (categorized as zelophilia), some authors on sexuality (Serge Kreutz, Instrumental Jealousy) have argued that jealousy in manageable dimensions can have a definite positive effect on sexual function and sexual satisfaction. Studies have also shown that jealousy sometimes heightens passion towards partners and increases the intensity of passionate sex. [10]
[11]
## Sociology of jealousy
Anthropologists have claimed that jealousy varies across cultures. Cultural learning can influence the situations that trigger jealousy and the manner in which jealousy is expressed. Attitudes toward jealousy can also change within a culture over time. For example, attitudes toward jealousy changed substantially during the 1960s and 1970s in the United States. People in the United States adopted much more negative views about jealousy.
# Jealousy in art
Jealousy is the powerful complex of emotions experienced at the loss, real or imagined, of something or someone you believe is yours, whereas envy concerns what you don’t have and would like to possess. Othello is filled with jealousy at the thought of losing Desdemona: Iago is consumed with envy of Othello’s prestige. Because jealous lovers tell multiple stories about those who arouse their jealousy, and because the emotion is so corrosive, jealousy is a common theme in literature, art, theatre, and film.
# Jealousy in religion
Jealousy in religion examines how the scriptures and teachings of various religions deal with the topic of jealousy. Religions may be compared and contrasted on how they deal with two issues: concepts of divine jealousy, and rules about the provocation and expression of human jealousy. | https://www.wikidoc.org/index.php/Jealousy | |
a17d429097af4961ab9fa45eb255b148020b830b | wikidoc | Jet fuel | Jet fuel
Jet fuel is a type of aviation fuel designed for use in jet-engined aircraft.
# Description
Jet fuel is clear to straw colored. The most common fuel is an unleaded/paraffin (kerosene) oil-based fuel classified as Jet A-1 (otherwise known as AVTUR), which is produced to an internationally standardized set of specifications. (see below).
The only other jet fuel that is commonly used in civilian turbine engine-powered aviation is called Jet B, a fuel in the naphtha-kerosene region that is used for its enhanced cold-weather performance. However, Jet B's lighter composition makes it more dangerous to handle, and it is thus restricted only to areas where its cold-weather characteristics are absolutely necessary.
Jet fuel is a mixture of a large number of different hydrocarbons, possibly as many as a thousand or more. The range of their sizes (molecular weights or carbon numbers) is restricted by the requirements for the product, for example, freezing point or smoke point. Kerosene-type jet fuel (including Jet A and Jet A-1) has a carbon number distribution between about 8 and 16 carbon numbers; wide-cut or naphtha-type jet fuel (including Jet B), between about 5 and 15 carbon numbers.
Both standard jet fuels (Jet A and Jet B) may contain a number of additives:
- Antioxidants to prevent gumming, usually based on alkylated phenols, eg. AO-30, AO-31, or AO-37;
- Antistatic agents, to dissipate static electricity and prevent sparking; Stadis 450, with dinonylnaphthylsulfonic acid (DINNSA) as the active ingredient, is an example
- Corrosion inhibitors, e.g. DCI-4A used for civilian and military fuels, and DCI-6A used for military fuels;
- Fuel System Icing Inhibitor (FSII) agents, e.g. Di-EGME; FSII is often mixed at the point-of-sale so that users with heated fuel lines do not have to pay the extra expense.
- Biocide can be added if evidence of bacterial colonies inside the fuel system exists.
Militaries around the world use a different classification system of JP numbers. Some are almost identical to their civilian counterparts and differ only by the amounts of a few additives; Jet A-1 is similar to JP-8, Jet B is similar to JP-4. Other military fuels are highly specialized products and are developed for very specific applications. JP-5 fuel is fairly common, and was introduced to reduce the risk of fire on aircraft carriers (has a higher flash point - a minimum of 60 °C). Other fuels were specific to one type of aircraft. JP-6 was developed specifically for the XB-70 Valkyrie and JP-7 for the SR-71 Blackbird. Both these fuels were engineered to have a high flash point to better cope with the heat and stresses of high speed supersonic flight. One aircraft-specific jet fuel still in use by the United States Air Force is JPTS, which was developed in 1956 for the Lockheed U-2 spy plane.
Jet fuels are sometimes classified as kerosene or naphtha-type. Kerosene-type fuels include Jet A, Jet A1, JP-5 and JP-8. Naphtha-type jet fuels, sometimes referred to as "wide-cut" jet fuel, include Jet B and JP-4.
## Jet A
Jet A is the standard jet fuel type in the U.S. since the 1950s and is only available there. Jet A is similar to Jet-A1, except for its higher freezing point of −40 °C (vs −47 ° Jet A-1). Like Jet A-1, Jet A has a fairly high flash point of 38 °C, with an autoignition temperature of 410 °F (210 °C). Jet A can be identified in trucks and storage facilities by the UN number 1863 Hazardous Material placards. Jet A trucks, storage tanks, and pipes that carry Jet A will be marked with a black sticker with a white "Jet A" written over it, next to another black stripe. Jet A will have a clear to straw color if it is clean and free of contamination. Water is denser than Jet A, and will collect on the bottom of a tank. Jet A storage tanks must be sumped on a regular basis to check for water contamination. It is possible for water particles to become suspended in Jet A, which can be found by performing a "Clear and Bright" test. A hazy appearance can indicate water contamination beyond the acceptable limit of 30ppm (parts per million).
The U.S. commercial fuels are not required by law to contain antistatic additives, and generally do not.
The annual U.S. usage of jet fuel was 21 billion gallons (80 billion liters) in 2006.
A consortium consisting of Boeing, NASA Glenn Research Center, MTU Aero Engines (Germany), and the US Air Force Research Laboratory is investigating development of jet fuel blends containing a substantial percentage of bio-fuel.
# History of jet fuel
Fuel for a piston-engine powered aircraft (usually a high-octane gasoline known as Avgas) has a low flash point to improve its ignition characteristics. Turbine engines can operate with a wide range of fuels, and jet-aircraft engines typically use fuels with higher flash points, which are less flammable and therefore safer to transport and handle. The first jet fuels were based on kerosene or a gasoline-kerosene mix, and most jet fuels are still kerosene-based.
# Piston engine use
Jet fuel is very similar to diesel fuel, and a few aircraft engine manufacturers, most notably Thielert, have begun offering piston engines which run on jet fuel. The technology promises to be a way to provide light, powerful, and environmentally-friendly engines for the general aviation market while simplifying airport logistics and phasing out leaded avgas.
Jet fuel is often used in ground support vehicles at airports, instead of diesel. The United States military makes heavy use of JP-8, for instance. However, jet fuel tends to have poor lubricating ability in comparison to diesel, thereby increasing wear on fuel pumps and other related engine parts. Civilian vehicles tend to disallow its use, or require that an additive be mixed with the jet fuel in order to restore its lubricity.
# Jet biofuels
The airline industry is responsible for about 11 percent of greenhouse gases emitted by the U.S. transportation sector. Boeing estimates that biofuels could reduce flight-related greenhouse-gas emissions by 60 to 80 percent. The solution would be blending algae fuels with existing jet fuel:
Green Flight International flew the World's first jet aircraft on 100% biodiesel. The flight was in a single engine L-29 Jet piloted by Douglas Rodante and Carol Sugars.
- Boeing and Air New Zealand are collaborating with leading Brazilian biofuels maker Tecbio and Aquaflow Bionomic of New Zealand and other jet biofuel developers around the world.
- Virgin Atlantic successfully tested a biofuel made from babassu nuts and coconut on a single engine on a 747 flight from London to Amsterdam.
Oil prices increased about fivefold from 2003-2008, raising fears that world petroleum production is becoming unable to keep up with demand. The near-total dependency on petroleum for aviation fuel adds extra urgency to the search for alternatives. | Jet fuel
Jet fuel is a type of aviation fuel designed for use in jet-engined aircraft.
# Description
Jet fuel is clear to straw colored. The most common fuel is an unleaded/paraffin (kerosene) oil-based fuel classified as Jet A-1 (otherwise known as AVTUR), which is produced to an internationally standardized set of specifications. (see below).
The only other jet fuel that is commonly used in civilian turbine engine-powered aviation is called Jet B, a fuel in the naphtha-kerosene region that is used for its enhanced cold-weather performance. However, Jet B's lighter composition makes it more dangerous to handle, and it is thus restricted only to areas where its cold-weather characteristics are absolutely necessary.
Jet fuel is a mixture of a large number of different hydrocarbons, possibly as many as a thousand or more. The range of their sizes (molecular weights or carbon numbers) is restricted by the requirements for the product, for example, freezing point or smoke point. Kerosene-type jet fuel (including Jet A and Jet A-1) has a carbon number distribution between about 8 and 16 carbon numbers; wide-cut or naphtha-type jet fuel (including Jet B), between about 5 and 15 carbon numbers. [1]
Both standard jet fuels (Jet A and Jet B) may contain a number of additives:
- Antioxidants to prevent gumming, usually based on alkylated phenols, eg. AO-30, AO-31, or AO-37;
- Antistatic agents, to dissipate static electricity and prevent sparking; Stadis 450, with dinonylnaphthylsulfonic acid (DINNSA) as the active ingredient, is an example
- Corrosion inhibitors, e.g. DCI-4A used for civilian and military fuels, and DCI-6A used for military fuels;
- Fuel System Icing Inhibitor (FSII) agents, e.g. Di-EGME; FSII is often mixed at the point-of-sale so that users with heated fuel lines do not have to pay the extra expense.
- Biocide can be added if evidence of bacterial colonies inside the fuel system exists.
Militaries around the world use a different classification system of JP numbers. Some are almost identical to their civilian counterparts and differ only by the amounts of a few additives; Jet A-1 is similar to JP-8, Jet B is similar to JP-4. Other military fuels are highly specialized products and are developed for very specific applications. JP-5 fuel is fairly common, and was introduced to reduce the risk of fire on aircraft carriers (has a higher flash point - a minimum of 60 °C). Other fuels were specific to one type of aircraft. JP-6 was developed specifically for the XB-70 Valkyrie and JP-7 for the SR-71 Blackbird. Both these fuels were engineered to have a high flash point to better cope with the heat and stresses of high speed supersonic flight. One aircraft-specific jet fuel still in use by the United States Air Force is JPTS, which was developed in 1956 for the Lockheed U-2 spy plane.
Jet fuels are sometimes classified as kerosene or naphtha-type. Kerosene-type fuels include Jet A, Jet A1, JP-5 and JP-8. Naphtha-type jet fuels, sometimes referred to as "wide-cut" jet fuel, include Jet B and JP-4.
## Jet A
Jet A is the standard jet fuel type in the U.S. since the 1950s and is only available there. Jet A is similar to Jet-A1, except for its higher freezing point of −40 °C (vs −47 ° Jet A-1). Like Jet A-1, Jet A has a fairly high flash point of 38 °C, with an autoignition temperature of 410 °F (210 °C). Jet A can be identified in trucks and storage facilities by the UN number 1863 Hazardous Material placards. Jet A trucks, storage tanks, and pipes that carry Jet A will be marked with a black sticker with a white "Jet A" written over it, next to another black stripe. Jet A will have a clear to straw color if it is clean and free of contamination. Water is denser than Jet A, and will collect on the bottom of a tank. Jet A storage tanks must be sumped on a regular basis to check for water contamination. It is possible for water particles to become suspended in Jet A, which can be found by performing a "Clear and Bright" test. A hazy appearance can indicate water contamination beyond the acceptable limit of 30ppm (parts per million).
The U.S. commercial fuels are not required by law to contain antistatic additives, and generally do not[citation needed].
The annual U.S. usage of jet fuel was 21 billion gallons (80 billion liters) in 2006. [2]
A consortium consisting of Boeing, NASA Glenn Research Center, MTU Aero Engines (Germany), and the US Air Force Research Laboratory is investigating development of jet fuel blends containing a substantial percentage of bio-fuel. [1]
# History of jet fuel
Fuel for a piston-engine powered aircraft (usually a high-octane gasoline known as Avgas) has a low flash point to improve its ignition characteristics. Turbine engines can operate with a wide range of fuels, and jet-aircraft engines typically use fuels with higher flash points, which are less flammable and therefore safer to transport and handle. The first jet fuels were based on kerosene or a gasoline-kerosene mix, and most jet fuels are still kerosene-based.
# Piston engine use
Jet fuel is very similar to diesel fuel, and a few aircraft engine manufacturers, most notably Thielert, have begun offering piston engines which run on jet fuel. The technology promises to be a way to provide light, powerful, and environmentally-friendly engines for the general aviation market while simplifying airport logistics and phasing out leaded avgas.[citation needed]
Jet fuel is often used in ground support vehicles at airports, instead of diesel. The United States military makes heavy use of JP-8, for instance. However, jet fuel tends to have poor lubricating ability in comparison to diesel, thereby increasing wear on fuel pumps and other related engine parts. Civilian vehicles tend to disallow its use, or require that an additive be mixed with the jet fuel in order to restore its lubricity.
# Jet biofuels
The airline industry is responsible for about 11 percent of greenhouse gases emitted by the U.S. transportation sector. Boeing estimates that biofuels could reduce flight-related greenhouse-gas emissions by 60 to 80 percent. The solution would be blending algae fuels with existing jet fuel: [3]
Green Flight International flew the World's first jet aircraft on 100% biodiesel. The flight was in a single engine L-29 Jet piloted by Douglas Rodante and Carol Sugars.[citation needed]
- Boeing and Air New Zealand are collaborating with leading Brazilian biofuels maker Tecbio [4] and Aquaflow Bionomic of New Zealand and other jet biofuel developers around the world.
- Virgin Atlantic successfully tested a biofuel made from babassu nuts and coconut on a single engine on a 747 flight from London to Amsterdam. [5]
Oil prices increased about fivefold from 2003-2008, raising fears that world petroleum production is becoming unable to keep up with demand. The near-total dependency on petroleum for aviation fuel adds extra urgency to the search for alternatives.[citation needed] | https://www.wikidoc.org/index.php/Jet_Fuel-4 | |
d681c9419c7c05b926690a4b783d023a2b9ee384 | wikidoc | KCNQ1OT1 | KCNQ1OT1
KCNQ1 overlapping transcript 1, also known as KCNQ1OT1, is a long non-coding RNA gene found in the KCNQ1 locus. This locus consists of 8-10 protein-coding genes, specifically expressed from the maternal allele (including the KCNQ1 gene), and the paternally expressed non-coding RNA gene KCNQ1OT1. KCNQ1OT1 and KCNQ1 are imprinted genes and are part of an imprinting control region (ICR). Mitsuya identified that KCNQ1OT1 is an antisense transcript of KCNQ1. KCNQ1OT1 is a paternally expressed allele and KCNQ1 is a maternally expressed allele. KCNQ1OT1 is a nuclear, 91 kb transcript, found in close proximity to the nucleolus in certain cell types.
It interacts with chromatin, the histone methyltransferase G9a (responsible for the mono- and dimethylation of histone 3 lysine 9, H3K9), and the Polycomb Repressive Complex 2, PRC2, (responsible for the trimethylation of H3K27). It plays an important role in the transcriptional silencing of the KCNQ1 locus by regulating histone methylation. An 890 bp region at the 5' end of KCNQ1OT1 acts as a silencing domain. This region regulates CpG methylation levels of somatically acquired differentially methylated regions (DMRs), mediates the interaction of KCNQ1OT1 with chromatin and with DNA (cytosine-5)-methyltransferase 1 (DNMT1), but does not affect the interactions of histone methyltransferases with KCNQ1OT1.
The misregulation of the imprinted gene KCNQ1OT1 can lead to a variety of abnormalities. The loss of the maternal methylation of the KCNQ1OT1 allele is most commonly associated with Beckwith-Wiedemann syndrome. The deletion of KCNQ1OT1 in males can result in a removal of the repressor in six cis genes. Offspring from the males that had KCNQ1OT1 knocked out weighed 20-25% less than the control. If the deletion occurred in females, their offspring had no growth restrictions. Furthermore, uniparental paternal disomy (UPD) of KCNQ1OT1 is strongly associated with Wilms’ tumor. In fact, three out of four patients with Beckwith-Wiedemann Syndrome and Wilms’ tumor had UPD. When KCNQ1OT1 transcript is truncated, normally repressed alleles on the paternal chromosome are instead expressed. As the evidence shows, the misregulation of KCNQ1OT1 can lead to disastrous physical and genetic effects. | KCNQ1OT1
KCNQ1 overlapping transcript 1, also known as KCNQ1OT1, is a long non-coding RNA gene found in the KCNQ1 locus. This locus consists of 8-10 protein-coding genes, specifically expressed from the maternal allele (including the KCNQ1 gene), and the paternally expressed non-coding RNA gene KCNQ1OT1.[1] KCNQ1OT1 and KCNQ1 are imprinted genes and are part of an imprinting control region (ICR). Mitsuya identified that KCNQ1OT1 is an antisense transcript of KCNQ1. KCNQ1OT1 is a paternally expressed allele and KCNQ1 is a maternally expressed allele.[2] KCNQ1OT1 is a nuclear, 91 kb transcript, found in close proximity to the nucleolus in certain cell types.[3][4]
It interacts with chromatin, the histone methyltransferase G9a (responsible for the mono- and dimethylation of histone 3 lysine 9, H3K9), and the Polycomb Repressive Complex 2, PRC2, (responsible for the trimethylation of H3K27).[3] It plays an important role in the transcriptional silencing of the KCNQ1 locus by regulating histone methylation.[1] An 890 bp region at the 5' end of KCNQ1OT1 acts as a silencing domain.[5][6] This region regulates CpG methylation levels of somatically acquired differentially methylated regions (DMRs), mediates the interaction of KCNQ1OT1 with chromatin and with DNA (cytosine-5)-methyltransferase 1 (DNMT1), but does not affect the interactions of histone methyltransferases with KCNQ1OT1.[6]
The misregulation of the imprinted gene KCNQ1OT1 can lead to a variety of abnormalities. The loss of the maternal methylation of the KCNQ1OT1 allele is most commonly associated with Beckwith-Wiedemann syndrome.[7] The deletion of KCNQ1OT1 in males can result in a removal of the repressor in six cis genes.[8] Offspring from the males that had KCNQ1OT1 knocked out weighed 20-25% less than the control.[8] If the deletion occurred in females, their offspring had no growth restrictions. Furthermore, uniparental paternal disomy (UPD) of KCNQ1OT1 is strongly associated with Wilms’ tumor. In fact, three out of four patients with Beckwith-Wiedemann Syndrome and Wilms’ tumor had UPD.[9] When KCNQ1OT1 transcript is truncated, normally repressed alleles on the paternal chromosome are instead expressed.[10] As the evidence shows, the misregulation of KCNQ1OT1 can lead to disastrous physical and genetic effects. | https://www.wikidoc.org/index.php/KCNQ1OT1 | |
7858546343a51878ca85194070eabc5927cc72a3 | wikidoc | KIAA0090 | KIAA0090
KIAA0090 is a human gene coding for a protein of unknown function. KIAA0090 has two aliases OTTHUMP00000002581 and RP1-43E13.1. The gene codes for multiple transcript variants which can localize to different subcellular compartments. KIAA0090 interacts with multiple effector proteins. KIAA0090 contains a conserved COG1520 WD40 like repeat domain thought to be the method of such interaction.
# Characterization of the KIAA0090 gene and its transcript products
KIAA0090 is located on chromosome one in the p arm at location 1p36.132. It covers 36.74 kb, from base pairs 19451486 to 19414744. The gene is composed of 37 gt-at introns/alternative introns with 57 exons expressed in 1 unspliced form of 4253 bp and 20 alternatively spliced forms of varying lengths. The gene has 8 probable promoters. The gene is flanked by UBR4 on its right and MRTO4 on its left. This Information is graphically displayed in Figure 1.
Expressed Sequence Tags and isolated cDNA clones indicate KIAA0090 is expressed ubiquitously in low to moderate levels throughout the body. This includes but is not limited to testis, tongue, lung, cerebellum, brain, mammary gland, trachea, placenta, esophageal, salivary gland, brain, hippocampus, amygdale, bone marrow, thalamus, spleen, uterus, thymus, kidney, eye, heart, gall bladder, prostate, liver, parathyroid gland, ovary, stomach, skeletal muscle, colon, pancreas, and skin. Expression of KIAA0090 changes throughout development (embryogenesis, fetal, adult, etc.)and during carcinogenesis. Evidence indicates a correlation between conditions and expression level but no data exists to suggest KIAA0090 is responsible for any disease or stage of development.
The mRNA for this gene codes for 18 protein isoforms6. The remaining 3 splice variants have no evidence supporting their ability to be translated.
# Characterization of the KIAA0090 Protein Product
Analysis indicates the KIAA0090 unspliced protein product to be 993 amino acids long with an isoelectric point of 7.418 and a molecular weight of 111765.73 Daltons. The primary structure of this protein contains 4 conserved domains. This includes a signal peptide from position 1 to 22, a COG1520 WD40 like domain, a leucine zipper domain, a DUF1620 domain (domain of unknown function), and a transmembrane domain. These can be viewed in Figure 2. Several conserved cysteine residues are present at positions 226,235, 335, 364,449, 581, 675, 925, and 985. Several internal localization signals are also present. Dependent on splice outcome and posttranslational modification, these additional signals indicate the protein could localize to the peroxisome, the plasma membrane, outside the cell, the cytosol, the nucleus, or mitochondria.
Post translational modification of KIAA0090 can occur. 54 possible sites of phosphorylation exist; 33 serines, 10 threonines, and 11 tyrosines. 3 sites of N-linked glycosylation are present at residues 370, 818, and 913 The signal peptide can be cleaved between residues 21 and 22.
This information is graphically displayed in Figure 3. Structure beyond the primary remains predicative. Bioinformatic analysis yields consensus data that is also displayed in Figure 3. The protein is highly conserved throughout Eukaryotes both in multi and single cellular organisms. This includes but is not limited to animals, plants, fungi, and protists.
The WD40 like domain COG1520 is KIAA0090s only identified functional effector domain. WD40 containing proteins are signal transducers involved in transduction of signals to binding factors, the centromeres, and other effectors. Coimmunoprecipitation experiments have proven KIAA0090 interaction with these types of proteins; specifically the centromeric protein CENPH, the BAX Inhibitor TMBI4, the ADP ribosylation factor ARF6, the kinase TNIK, and the transcriptional repressor T22D1. The number of splice variants indicates this list is probably not definitive. As further characterization is completed additional interactions would be expected. | KIAA0090
KIAA0090 is a human gene coding for a protein of unknown function.[1] KIAA0090 has two aliases OTTHUMP00000002581 and RP1-43E13.1. The gene codes for multiple transcript variants which can localize to different subcellular compartments. KIAA0090 interacts with multiple effector proteins. KIAA0090 contains a conserved COG1520 WD40 like repeat domain thought to be the method of such interaction.
# Characterization of the KIAA0090 gene and its transcript products
KIAA0090 is located on chromosome one in the p arm at location 1p36.132.[2] It covers 36.74 kb, from base pairs 19451486 to 19414744. The gene is composed of 37 gt-at introns/alternative introns with 57 exons expressed in 1 unspliced form of 4253 bp and 20 alternatively spliced forms of varying lengths.[3] The gene has 8 probable promoters.[4] The gene is flanked by UBR4 on its right and MRTO4 on its left.[1] This Information is graphically displayed in Figure 1.
Expressed Sequence Tags and isolated cDNA clones indicate KIAA0090 is expressed ubiquitously in low to moderate levels throughout the body.[5] This includes but is not limited to testis, tongue, lung, cerebellum, brain, mammary gland, trachea, placenta, esophageal, salivary gland, brain, hippocampus, amygdale, bone marrow, thalamus, spleen, uterus, thymus, kidney, eye, heart, gall bladder, prostate, liver, parathyroid gland, ovary, stomach, skeletal muscle, colon, pancreas, and skin. Expression of KIAA0090 changes throughout development (embryogenesis, fetal, adult, etc.)and during carcinogenesis. Evidence indicates a correlation between conditions and expression level but no data exists to suggest KIAA0090 is responsible for any disease or stage of development.
The mRNA for this gene codes for 18 protein isoforms6. The remaining 3 splice variants have no evidence supporting their ability to be translated.
# Characterization of the KIAA0090 Protein Product
Analysis indicates the KIAA0090 unspliced protein product to be 993 amino acids long with an isoelectric point of 7.418 and a molecular weight of 111765.73 Daltons.[6][7] The primary structure of this protein contains 4 conserved domains.[8] This includes a signal peptide from position 1 to 22, a COG1520 WD40 like domain, a leucine zipper domain, a DUF1620 domain (domain of unknown function), and a transmembrane domain. These can be viewed in Figure 2. Several conserved cysteine residues are present at positions 226,235, 335, 364,449, 581, 675, 925, and 985.[9] Several internal localization signals are also present.[10][11][12][13][14] Dependent on splice outcome and posttranslational modification, these additional signals indicate the protein could localize to the peroxisome, the plasma membrane, outside the cell, the cytosol, the nucleus, or mitochondria.
Post translational modification of KIAA0090 can occur. 54 possible sites of phosphorylation exist; 33 serines, 10 threonines, and 11 tyrosines.[15] 3 sites of N-linked glycosylation are present at residues 370, 818, and 913[16] The signal peptide can be cleaved between residues 21 and 22.[13]
This information is graphically displayed in Figure 3. Structure beyond the primary remains predicative. Bioinformatic analysis yields consensus data that is also displayed in Figure 3.[17][18] The protein is highly conserved throughout Eukaryotes both in multi and single cellular organisms. This includes but is not limited to animals, plants, fungi, and protists.
The WD40 like domain COG1520 is KIAA0090s only identified functional effector domain. WD40 containing proteins are signal transducers involved in transduction of signals to binding factors, the centromeres, and other effectors.[19] Coimmunoprecipitation experiments have proven KIAA0090 interaction with these types of proteins; specifically the centromeric protein CENPH, the BAX Inhibitor TMBI4, the ADP ribosylation factor ARF6, the kinase TNIK, and the transcriptional repressor T22D1.[20] The number of splice variants indicates this list is probably not definitive. As further characterization is completed additional interactions would be expected. | https://www.wikidoc.org/index.php/KIAA0090 | |
6c99a0764319c01e66d5bcbbf6ffd212f968d316 | wikidoc | KIAA0319 | KIAA0319
KIAA0319 is a protein which in humans is encoded by the KIAA0319 gene.
# Clinical significance
Variants of the KIAA0319 gene have been associated with developmental dyslexia.
Reading disability, or dyslexia, is a major social, educational, and mental health problem. In spite of average intelligence and adequate educational opportunities, 5 to 10% of school children have substantial reading deficits. Twin and family studies have shown a substantial genetic component to this disorder, with heritable variation estimated at 50 to 70%.
An NIDCD-supported investigator recently has identified a mutation in a gene on chromosome 6, called the KIAA0319 gene, that appears to play a key role in Specific Language Impairment.
# Function
The KIAA0319 protein is expressed on the cell membrane and may be involved in neuronal migration. Furthermore, KIAA0319 follows a clathrin-mediated endocytic pathway | KIAA0319
KIAA0319 is a protein which in humans is encoded by the KIAA0319 gene.[1][2]
# Clinical significance
Variants of the KIAA0319 gene have been associated with developmental dyslexia.[3]
Reading disability, or dyslexia, is a major social, educational, and mental health problem. In spite of average intelligence and adequate educational opportunities, 5 to 10% of school children have substantial reading deficits. Twin and family studies have shown a substantial genetic component to this disorder, with heritable variation estimated at 50 to 70%.[1]
An NIDCD-supported investigator recently has identified a mutation in a gene on chromosome 6, called the KIAA0319 gene, that appears to play a key role in Specific Language Impairment.[4]
# Function
The KIAA0319 protein is expressed on the cell membrane and may be involved in neuronal migration. Furthermore, KIAA0319 follows a clathrin-mediated endocytic pathway[5] | https://www.wikidoc.org/index.php/KIAA0319 | |
3916dbb20f1f5d1bba4b68df79f0b3054d3ffe52 | wikidoc | KIAA0825 | KIAA0825
KIAA0825 is a protein that in humans is encoded by the gene of the same name, located on chromosome 5, 5q15. It is a possible risk factor in Type II Diabetes, and associated with high levels of glucose in the blood. It is a relatively fast mutating gene, compared to other coding genes. There is however one region which is highly conserved across the species that have the gene, known as DUF4495. It is predicted to travel between the nucleus and the cytoplasm.
# General information
KIAA0825 is gene that appears to be a genetic factor that increases the risk of Type II Diabetes, possibly by increasing the level of blood glucose levels. It has also been identified as a possible oncogene. C5orf36 has one common alias KIAA0825. The gene is about 478 kb long and contains 22 exons. It produces 10 different variants: 9 alternatively spliced, and one un-spliced version. The longest experimentally confirmed mRNA is 7240 bp long and produces a protein 1275 amino acids long. The protein is predicted to weigh about 147.8kDal. It has orthologs in most animals including Aplysia californica, but is not found outside animals with the possible exception of Plasmodiophora brassicae.
# Protein information
The protein has a predicted weight of 147.8 kDal. It does not contain a known nuclear localization signal but does contain a nuclear export signal. The subcellular localization for the protein is predicted to be the nucleus and the cytoplasm. This suggests that the protein might shuttle back and forth across the nuclear membrane.
## Secondary structure
Several programs suggest that the secondary structure of the protein is mainly helices with only a few beta sheets. Analysis of protein composition also suggests that the protein has relatively low levels of glycine. This could suggest a fairly rigid structure relative to other proteins.
The tertiary structure is harder to predict due to the size of the protein, partially due to its size. The 3-D structure shown shows a prediction made by I-TASSER. This is a possible strture with a C-score of -1.06 on a scale from -5 to 1 (in which the higher the number the greater the confidence). This predicted structure indicates there are two main parts, and it is possible they interact depending on the state of the protein (e.g. whether or not it's phosphorylated).
# Expression
The mRNA for KIAA0825 is expressed at relatively low rates in comparison to other mRNAs. The protein however is expressed at relatively high rates, especially in parts of the brain as well as adrenal glands and the thyroid. This would suggest that the protein is not readily degraded and remains in the cell for long periods of time, such that continuous transcription of the DNA into mRNA is unnecessary. No current finding suggest that there is alternative expression of different isoforms in different tissues.
# Regulation
Analysis of the promoter offers some insight into the expression of KIAA0825. One possible regulator found is the NeuroD1 transcription factor. This factor is an important regulator for the insulin gene, and a mutation in this gene can lead to Type II diabetes. This could explain why KIAA0825 is expressed at lower levels in patients with Type II diabetes. Another possible transcription factor is the Myeloid zinc finger 1 factor, which is tied to myeloid leukemia, because it delays apoptosis of cells in the presence of retinoic acid. There are also several places where Vertebrate SMAD family transcription factors can bind. These transcription factors are thought to be responsible for nucleocytoplasmic dynamics. This means that these SMAD transcription factors could affect KIAA0825, because subcellular localization suggests it shuttles across the nuclear envelope.
# Function
There are two proteins found to interact with KIAA0825. One is One is Interleukin enhancer-binding factor 3. ILF3 is a factor that complexes with other proteins and regulates gene expression and stabilizes mRNAs. The other is the Amyloid-beta precursor protein. This protein is an integral membrane protein found most commonly in the synapses of neurons. Neither of these proteins is well enough understood to indicate for certain the role of C5orf36 in human cells. They however suggest that KIAA0825 could serve a variety of roles in different parts of the cell.
# Orthology
KIAA0825 orthologs can be found in virtually all animals, but cannot be found in plants, bacteria, or protozoa. It is mostly highly conserved in vertebrates especially mammals, but genes that contain region similar to DUF4495 region can be found in California sea hare, generally one of the most simple animal. The size especially in mammals is well conserved sticking very close to between 1250 and 1300 amino acids long. This suggests that the protein wraps around on itself forming important structures for its function.
There were no paralogs found of the gene KIAA0825 in humans or in any other species. | KIAA0825
KIAA0825 is a protein that in humans is encoded by the gene of the same name, located on chromosome 5, 5q15. It is a possible risk factor in Type II Diabetes, and associated with high levels of glucose in the blood. It is a relatively fast mutating gene, compared to other coding genes. There is however one region which is highly conserved across the species that have the gene, known as DUF4495. It is predicted to travel between the nucleus and the cytoplasm.
# General information
KIAA0825 is gene that appears to be a genetic factor that increases the risk of Type II Diabetes, possibly by increasing the level of blood glucose levels.[1] It has also been identified as a possible oncogene.[2] C5orf36 has one common alias KIAA0825. The gene is about 478 kb long and contains 22 exons. It produces 10 different variants: 9 alternatively spliced, and one un-spliced version. The longest experimentally confirmed mRNA is 7240 bp long and produces a protein 1275 amino acids long.[3] The protein is predicted to weigh about 147.8kDal. It has orthologs in most animals including Aplysia californica, but is not found outside animals with the possible exception of Plasmodiophora brassicae.
# Protein information
The protein has a predicted weight of 147.8 kDal.[4][5] It does not contain a known nuclear localization signal but does contain a nuclear export signal.[6] The subcellular localization for the protein is predicted to be the nucleus and the cytoplasm.[7] This suggests that the protein might shuttle back and forth across the nuclear membrane.
## Secondary structure
Several programs suggest that the secondary structure of the protein is mainly helices with only a few beta sheets.[8][9][10][11] Analysis of protein composition also suggests that the protein has relatively low levels of glycine.[12] This could suggest a fairly rigid structure relative to other proteins.
The tertiary structure is harder to predict due to the size of the protein, partially due to its size. The 3-D structure shown shows a prediction made by I-TASSER. This is a possible strture with a C-score of -1.06 on a scale from -5 to 1 (in which the higher the number the greater the confidence).[13][14][15] This predicted structure indicates there are two main parts, and it is possible they interact depending on the state of the protein (e.g. whether or not it's phosphorylated).
# Expression
The mRNA for KIAA0825 is expressed at relatively low rates in comparison to other mRNAs.[16] The protein however is expressed at relatively high rates, especially in parts of the brain as well as adrenal glands and the thyroid.[17] This would suggest that the protein is not readily degraded and remains in the cell for long periods of time, such that continuous transcription of the DNA into mRNA is unnecessary. No current finding suggest that there is alternative expression of different isoforms in different tissues.
# Regulation
Analysis of the promoter offers some insight into the expression of KIAA0825.[18] One possible regulator found is the NeuroD1 transcription factor. This factor is an important regulator for the insulin gene, and a mutation in this gene can lead to Type II diabetes.[19] This could explain why KIAA0825 is expressed at lower levels in patients with Type II diabetes. Another possible transcription factor is the Myeloid zinc finger 1 factor, which is tied to myeloid leukemia, because it delays apoptosis of cells in the presence of retinoic acid.[20] There are also several places where Vertebrate SMAD family transcription factors can bind. These transcription factors are thought to be responsible for nucleocytoplasmic dynamics.[21] This means that these SMAD transcription factors could affect KIAA0825, because subcellular localization suggests it shuttles across the nuclear envelope.
# Function
There are two proteins found to interact with KIAA0825. One is One is Interleukin enhancer-binding factor 3.[22] ILF3 is a factor that complexes with other proteins and regulates gene expression and stabilizes mRNAs.[23] The other is the Amyloid-beta precursor protein.[24] This protein is an integral membrane protein found most commonly in the synapses of neurons. Neither of these proteins is well enough understood to indicate for certain the role of C5orf36 in human cells. They however suggest that KIAA0825 could serve a variety of roles in different parts of the cell.
# Orthology
KIAA0825 orthologs can be found in virtually all animals, but cannot be found in plants, bacteria, or protozoa. It is mostly highly conserved in vertebrates especially mammals, but genes that contain region similar to DUF4495 region can be found in California sea hare, generally one of the most simple animal. The size especially in mammals is well conserved sticking very close to between 1250 and 1300 amino acids long. This suggests that the protein wraps around on itself forming important structures for its function.
There were no paralogs found of the gene KIAA0825 in humans or in any other species. | https://www.wikidoc.org/index.php/KIAA0825 | |
ae37404c5bc6e385ba22b2de66f76fd250faff72 | wikidoc | KIAA0895 | KIAA0895
KIAA0895 is a human gene that encodes a protein known as KIAA0895 protein or hypothetical protein LOC23366. Other known aliases are OTTHUMP00000206979 and OTTHUMP00000206980.
# Gene
The KIAA0895 gene is located at p14.2 on chromosome 7.
It can be transcribed into 15 transcript variants, which in turn can produce 13 different isoforms of the protein.
The genomic DNA is 65,976 s long, while the longest mRNA that it produces is 4463 bases long.
## Gene Neighborhood
KIAA0895 is surrounded by the following genes on chromosome 7:
- ELMO1
- AOAH
- HERPUD2
- TBX20
# Protein
The longest protein isoform that is produced by the KIAA0895 gene is termed LOC23366 isoform 1 and is 520 amino acids long.
## Regions
LOC23366 contains a protein domain of unknown function called DUF1704.
It also contains a region of low complexity from position 120 to position 150 in the protein, and an arginine-rich area from position 12 to position 51.
## Post-translational Modification
The KIAA0895 protein is predicted to undergo phosphorylation at several serines, threonines, and tyrosines throughout its structure, particularly in the first half of the protein The predicted phosphorylation sites are shown on the accompanying graph. There are also predicted to be three N-linked glycosylation sites.
# Expression
KIAA0895 is shown to be expressed at low levels in various tissues throughout the body. It is expressed most highly in the adrenal gland, the bone marrow, and the testis. It is also found in cancerous tissues, most highly in cervical tumors and bladder carcinoma.
# Conservation
KIAA0895 has one paralog in humans known as KIAA0895L. Orthologs have been found in all mammals, and eukaryotes through T. thermophila. The full list of organisms in which orthologs have been found is given below.
- Pan troglodytes
- Pongo abelii
- Macaca mulatta
- Callithrix jacchus
- Sus scrofa
- Canis familiaris
- Ailuropoda melanoleuca
- Equus caballus
- Oryctolagus cuniculus
- Mus musculus
- Rattus norvegicus
- Monodelphis domestica
- Ornithorhynchus anatinus
- Taeniopygia guttata
- Meleagris gallopavo
- Gallus gallus
- Xenopus (Silurana) tropicalis
- Danio rerio
- Ciona intestinalis
- Strongylocentrotus purpuratus
- Branchiostoma floridae
- Tetrahymena thermophila | KIAA0895
KIAA0895 is a human gene that encodes a protein known as KIAA0895 protein or hypothetical protein LOC23366.[1][2] Other known aliases are OTTHUMP00000206979 and OTTHUMP00000206980.[3]
# Gene
The KIAA0895 gene is located at p14.2 on chromosome 7.
It can be transcribed into 15 transcript variants, which in turn can produce 13 different isoforms of the protein.[4]
The genomic DNA is 65,976 [base pair]s long,[1] while the longest mRNA that it produces is 4463 bases long.
## Gene Neighborhood
KIAA0895 is surrounded by the following genes on chromosome 7:[1]
- ELMO1
- AOAH
- HERPUD2
- TBX20
# Protein
The longest protein isoform that is produced by the KIAA0895 gene is termed LOC23366 isoform 1 and is 520 amino acids long.[5]
## Regions
LOC23366 contains a protein domain of unknown function called DUF1704.[6]
It also contains a region of low complexity from position 120 to position 150 in the protein,[7] and an arginine-rich area from position 12 to position 51.[8]
## Post-translational Modification
The KIAA0895 protein is predicted to undergo phosphorylation at several serines, threonines, and tyrosines throughout its structure, particularly in the first half of the protein[9] The predicted phosphorylation sites are shown on the accompanying graph. There are also predicted to be three N-linked glycosylation sites.[10]
# Expression
KIAA0895 is shown to be expressed at low levels in various tissues throughout the body. It is expressed most highly in the adrenal gland, the bone marrow, and the testis.[11] It is also found in cancerous tissues, most highly in cervical tumors and bladder carcinoma.
# Conservation
KIAA0895 has one paralog in humans known as KIAA0895L.[12] Orthologs have been found in all mammals, and eukaryotes through T. thermophila.[13] The full list of organisms in which orthologs have been found is given below.
- Pan troglodytes
- Pongo abelii
- Macaca mulatta
- Callithrix jacchus
- Sus scrofa
- Canis familiaris
- Ailuropoda melanoleuca
- Equus caballus
- Oryctolagus cuniculus
- Mus musculus
- Rattus norvegicus
- Monodelphis domestica
- Ornithorhynchus anatinus
- Taeniopygia guttata
- Meleagris gallopavo
- Gallus gallus
- Xenopus (Silurana) tropicalis
- Danio rerio
- Ciona intestinalis
- Strongylocentrotus purpuratus
- Branchiostoma floridae
- Tetrahymena thermophila | https://www.wikidoc.org/index.php/KIAA0895 | |
4a3b9a561aa6935bcab60874f483d136198d4e19 | wikidoc | KIAA0922 | KIAA0922
Transmembrane protein 131-like(TMEM131L protein), alternatively named uncharacterized protein KIAA0922 (KIAA0922 protein), is an integral transmembrane protein encoded by the human gene KIAA0922 that is significantly conserved in eukaryotes, at least through protists. Although the function of this gene is not yet fully elucidated, initial microarray evidence suggests that it may be involved in immune responses. Furthermore, its paralog, prolyl endopeptidase (PREP) whose function is known, provides clues as to the function of TMEM131L.
# Gene
The KIAA0922 gene is found in the human genome at chromosomal location 4q31.3 on the plus strand and is 170,364 base pairs (bp) in length, spanning from 154,387,498 to 154,557,863 along chromosome 4 (NC_000004.11). The gene has the aliases TMEM131L, FLJ10592, DKFZp586H1322, and LOC23240 The gene includes 44 distinct introns (with an additional 6 probable non-overlapping alternative last exons). The function of this gene is not yet fully understood.
The gene includes the Domain of unknown function 3651 (DUF3651) which is part of the transmembrane associated family pfam12371 and of the superfamily cl13764. The mature mRNA of certain transcript variants have a confirmed signal peptide region. although protein localization remains unknown.
# mRNA
KIAA0922 mRNA is around 5 kilo-base pairs(kbp) in length. Thirteen splice variants are supported by ACEVIEW analysis but only two have been experimentally identified. Mostly, different variants seem to vary based on differing truncation of the 3' and 5' ends (especially due to the presence of an upstream stop codon in the exonic region).
# Protein
Protein TMEM131L is an integral membrane protein and is also known as OTTHUMP00000205136. The protein TMEM131L Isoform I is 1,610 amino acids in length and its primary structure weighs 179.209 kilo-Dalton (unit) (kDa). Twelve different isoforms of this protein have been predicted (one partial, six COOH complete, and five complete) however there have been only 5 experimentally observed.
## Expression
The protein TMEM131L shows highest levels of expression in immune related cells and tissues such as lymphocytes and bone marrow. Levels of TMEM131L protein have been shown to significantly increase under certain immune responses, such as increasing over time after introduction of measles virus to the immune cells dendritic cells and in peripheral blood lymphocytes from kidney transplants displaying acute rejection.
## Transmembrane region
There is only one confirmed transmembrane domain region in protein TMEM131L. This domain exists near the center of the protein, at 871-891 amino acid of the 1610 amino acid long protein sequence (for isoform I).
There is a dramatic switch from hydrophobic to hydrophilic amino acid density at this confirmed transmembrane region. There is also a switch to a higher density of predicted N-linked glycosylation sites across this confirmed transmembrane region (0.0136 to 0.0069 predicted N-glycosylation sites/amino acid) at this region. Furthermore, the only confirmed phosphorylation site is on the latter half of the protein (1,123 aa in isoform I) and predicted phosphorylation sites increase in density across the confirmed transmembrane region (from 0.0386 to 0.0905 predicted phosphorylation sites/amino acid). These results together indicate that the first half of the protein (1-871 aa of isoform I) is outside of the membrane while the second half (891-1610 aa of isoform I) is inside of the membrane, although experimentation is necessary to confirm this deduction.
# Paralogs
## Prolyl endopeptidase
The enzyme prolyl endopeptidase (PREP) is 13.4% identical to transmembrane protein 131L. PREP acts in the cytosol by cleaving peptide bonds on the C-terminus of short prolyl residues (approx. 30 amino acids long). PREP has been found to be involved with the maturation and degradation of neuropeptides and peptide hormones. PREP and its general functions are conserved through flavobateria.
Of particular interest, the highest areas of amino acid conservation between PREP and KIAA0922 are the areas most conserved in KIAA0922 (KIAA0922#Conservation) are the esterase lipase region (483...706) and peptidase S9 N region (7...423)
This connection may help direct the efforts to elucidate the function of transmembrane protein 131L.
## Transmembrane protein 131
Transmembrane protein 131L is 36% identical and 54% similar to transmembrane protein 131. The gene for transmembrane protein 131 is found on chromosomal location 2q11.2 and the protein is 1883 amino acids long and is also an integral membrane protein. However, research indicates that the TMEM131L protein is more highly methylated than the TMEM protein.
# Conservation
Following Biology Workbench multialign CLUSTAL W analyses, certain regions of TMEM131L protein are highly conserved through Eukaryotes as distantly as single-celled protists (24% identity with Dictyostelium fasciculatum). These exact same regions also appear to be conserved in the KIAA0922 paralog Prolyl endopeptidase (PREP), a gene for a cytostolic enzyme that cleaves the C-terminus of short polyl proteins. | KIAA0922
Transmembrane protein 131-like(TMEM131L protein), alternatively named uncharacterized protein KIAA0922 (KIAA0922 protein), is an integral transmembrane protein[1] encoded by the human gene KIAA0922 that is significantly conserved in eukaryotes, at least through protists.[2][3][4] Although the function of this gene is not yet fully elucidated, initial microarray evidence suggests that it may be involved in immune responses. Furthermore, its paralog, prolyl endopeptidase (PREP) whose function is known, provides clues as to the function of TMEM131L.
# Gene
The KIAA0922 gene is found in the human genome at chromosomal location 4q31.3 on the plus strand and is 170,364 base pairs (bp) in length, spanning from 154,387,498 to 154,557,863[5] along chromosome 4 (NC_000004.11).[6] The gene has the aliases TMEM131L, FLJ10592, DKFZp586H1322, and LOC23240 [7] The gene includes 44 distinct introns (with an additional 6 probable non-overlapping alternative last exons).[7] The function of this gene is not yet fully understood.
The gene includes the Domain of unknown function 3651 (DUF3651) which is part of the transmembrane associated family pfam12371 and of the superfamily cl13764.[8] The mature mRNA of certain transcript variants have a confirmed signal peptide region.[9] although protein localization remains unknown.
# mRNA
KIAA0922 mRNA is around 5 kilo-base pairs(kbp) in length.[5] Thirteen splice variants are supported by ACEVIEW analysis but only two have been experimentally identified.[7] Mostly, different variants seem to vary based on differing truncation of the 3' and 5' ends (especially due to the presence of an upstream stop codon in the exonic region).[7]
# Protein
Protein TMEM131L is an integral membrane protein[1] and is also known as OTTHUMP00000205136.[7] The protein TMEM131L Isoform I is 1,610 amino acids in length[10] and its primary structure weighs 179.209 kilo-Dalton (unit) (kDa).[6] Twelve different isoforms of this protein have been predicted (one partial, six COOH complete, and five complete) however there have been only 5 experimentally observed.[7]
## Expression
The protein TMEM131L shows highest levels of expression in immune related cells and tissues such as lymphocytes and bone marrow.[3] Levels of TMEM131L protein have been shown to significantly increase under certain immune responses, such as increasing over time after introduction of measles virus to the immune cells dendritic cells[11] and in peripheral blood lymphocytes from kidney transplants displaying acute rejection.[12]
## Transmembrane region
There is only one confirmed transmembrane domain region in protein TMEM131L.[9] This domain exists near the center of the protein, at 871-891 amino acid of the 1610 amino acid long protein sequence (for isoform I).[9]
There is a dramatic switch from hydrophobic to hydrophilic amino acid density at this confirmed transmembrane region.[13] There is also a switch to a higher density of predicted N-linked glycosylation sites across this confirmed transmembrane region (0.0136 to 0.0069 predicted N-glycosylation sites/amino acid) at this region.[14] Furthermore, the only confirmed phosphorylation site is on the latter half of the protein (1,123 aa in isoform I)[9] and predicted phosphorylation sites increase in density across the confirmed transmembrane region (from 0.0386 to 0.0905 predicted phosphorylation sites/amino acid).[15] These results together indicate that the first half of the protein (1-871 aa of isoform I) is outside of the membrane while the second half (891-1610 aa of isoform I) is inside of the membrane, although experimentation is necessary to confirm this deduction.
# Paralogs
## Prolyl endopeptidase
The enzyme prolyl endopeptidase (PREP) is 13.4% identical to transmembrane protein 131L.[16][17][18][19] PREP acts in the cytosol by cleaving peptide bonds on the C-terminus of short prolyl residues (approx. 30 amino acids long).[20][21] PREP has been found to be involved with the maturation and degradation of neuropeptides and peptide hormones.[22] PREP and its general functions are conserved through flavobateria.[23]
Of particular interest, the highest areas of amino acid conservation between PREP and KIAA0922 are the areas most conserved in KIAA0922 (KIAA0922#Conservation) are the esterase lipase region (483...706)[24] and peptidase S9 N region (7...423)[24]
This connection may help direct the efforts to elucidate the function of transmembrane protein 131L.
## Transmembrane protein 131
Transmembrane protein 131L is 36% identical and 54% similar to transmembrane protein 131. The gene for transmembrane protein 131 is found on chromosomal location 2q11.2 and the protein is 1883 amino acids long and is also an integral membrane protein.[25][26] However, research indicates that the TMEM131L protein is more highly methylated than the TMEM protein.[9]
# Conservation
Following Biology Workbench[16] multialign CLUSTAL W[4] analyses, certain regions of TMEM131L protein are highly conserved through Eukaryotes as distantly as single-celled protists (24% identity with Dictyostelium fasciculatum).[27] These exact same regions also appear to be conserved in the KIAA0922 paralog Prolyl endopeptidase (PREP), a gene for a cytostolic enzyme that cleaves the C-terminus of short polyl proteins.[9] | https://www.wikidoc.org/index.php/KIAA0922 | |
8c4bb95134c7512c06977dcc0f60940df7439850 | wikidoc | KIAA1109 | KIAA1109
Uncharacterized protein KIAA1109 is a protein that in humans is encoded by the KIAA1109 gene.
This protein has a function that is not yet understood. KIAA1109 has 3 aliases, FSA (fragile site-associated) protein, MGC110967 and DKFZp781P0474.
# Gene
## Location
KIAA1109 is found on the long arm of chromosome 4 (4q27), with the genomic sequence starting at 118,818,167 bp and ending at 119,010,362 bp
## Gene Neighborhood
The gene neighborhood of KIAA1109 involves 4 other genes.
KIAA1109 is a part of the KIAA1109/Tenr/IL2/IL21 gene region. This region consists of the three genes to the right of KIAA1109; ADAD1, IL2 and IL21.
Another gene located in the neighborhood of KIAA1109 is TRPC3. This gene is to the left of KIAA1109 on the opposite side of the genes described above.
## Expression
According to data on NCBI’s EST Abundance Profile page for KIAA1109, the gene is expressed in many different tissues in humans. Human expression is seen most predominately in parathyroid, muscle, ear, eye, mammary gland, lymph node, thymus in addition to 27 other tissues. KIAA1109 is also expressed in various disease states including 12 different tumors as well as bladder carcinoma, chondrosarcoma, glioma, leukemia, lymphoma, non-neoplasia, retinoblastoma tissues. KIAA1109 is expressed in all stages of development from embryoid body to adult, except in infants. No expression of my gene is seen during the infant stage of development.
## Promoter
According to Genomatix’s ElDorado program the promoter region of KIAA1109 is predicted to be 601 base pairs in length. The promoter region starts 500 base pairs upstream of the 5’ UTR of KIAA1109 mRNA transcript and contains part of this 5’ UTR.
## Homology
KIAA1109 is conserved throughout many species. Orthologs have been found in many mammals and other vertebrates. More distant homologs have been identified in animals such as insects. See the mRNA and protein conservation sections below for more details. No human paralogs for KIAA1109 have been identified.
# mRNA
## Splice Variants
KIAA1109 has 13 mRNA splice variants and 6 unspliced variants. Variant A is the longest and most commonly occurring variant of the gene and is the subject of this article. KIAA1109 variant A is made up of 84 exons and is 15,592 base pairs in length. The accession number for this nucleotide is NM_015312.3.
## Conservation
The mRNA sequence of KIAA1109 is highly conserved throughout mammals. The mRNA sequence identity to mammals is no less than 81.9% (in platypus) and ranging up to 99.5% (in chimpanzees). Birds also show fairly high conservation with mRNA sequence identities around 78% in zebra finches.
The table blow shows information on the mRNA orthologs.
# Protein
## General Properties
KIAA1109 protein is 5005 amino acids in length, and has a predicted molecular weight of 555519.38 daltons. The isoelectirc point of KIAA1109 protein is predicted to be 6.12.
## Composition
The amino acid composition of KIAA1109 protein showed amino acid frequencies within 1.5% of that of normal human proteins for all but Alanine, Serine and Threonine. Alanine has a lower frequency in KIAA1109 than in that of a normal human protein while Serine and Threonine both have a higher frequency in KIAA1109 than in the average human protein.
## Conservation
The amino acid sequence of KIAA1109 is highly conserved throughout mammals. The protein identity ranges from 93.2% in Opossum to 99.8% in Chimpanzees and protein similarity is no less than 97% in all mammals included. Birds continue to show fairly high conservation with protein identities around 90% and proteins similarities at a high 96%. While conservation is still high the lower numbers may be due to small truncations on either, the 5’ and 3’ ends of these sequences.
As we move to the more distant species of zebra fish and then the red four beetle and carpenter ant the conservations drops. In the insects the protein identities are down to around 34%.
## Conserved Domains
NCBI conserved domains search identified two domains in KIAA1109. The first is the fragile site associated C-terminus, which is said to be linked to celiac disease susceptibility according to genome-wide-association studies and may also be associated with polycystic kidney disease. The second conserved region identified by NCBI in KIAA1109 is an uncharacterized conserved protein (DUF2246), whose function is unknown and is conserved in various species from humans to worms.
## Post Translation Modifications
KIAA1109 is predicted to undergo various types of post translational modifications including glycate, N-glycosylation, O-GlcNAc, O Glycosylation, Sulfonation and Phosphorylation.
## Subcellular Localization
KIAA1109 contains one transmembrane domain from amino acids 26-46.
No signal peptides, mitochondrial targeting sequences or chloroplast peptides were predicted for my protein and it is therefore not predicted to localize to secretory pathway, mitochondria or chloroplast.
## Interacting Proteins
MADH2 and Beta-catenin were both found to have a physical interaction with my protein as deteched by display technonloy by Miyamoto-Sato et al. 2010. | KIAA1109
Uncharacterized protein KIAA1109 is a protein that in humans is encoded by the KIAA1109 gene.[1][2][3]
This protein has a function that is not yet understood. KIAA1109 has 3 aliases, FSA (fragile site-associated) protein, MGC110967 and DKFZp781P0474.[4]
# Gene
## Location
KIAA1109 is found on the long arm of chromosome 4 (4q27), with the genomic sequence starting at 118,818,167 bp and ending at 119,010,362 bp[5]
## Gene Neighborhood
The gene neighborhood of KIAA1109 involves 4 other genes.
KIAA1109 is a part of the KIAA1109/Tenr/IL2/IL21 gene region. This region consists of the three genes to the right of KIAA1109; ADAD1, IL2 and IL21.[6]
Another gene located in the neighborhood of KIAA1109 is TRPC3. This gene is to the left of KIAA1109 on the opposite side of the genes described above.[4]
## Expression
According to data on NCBI’s EST Abundance Profile page for KIAA1109, the gene is expressed in many different tissues in humans. Human expression is seen most predominately in parathyroid, muscle, ear, eye, mammary gland, lymph node, thymus in addition to 27 other tissues. KIAA1109 is also expressed in various disease states including 12 different tumors as well as bladder carcinoma, chondrosarcoma, glioma, leukemia, lymphoma, non-neoplasia, retinoblastoma tissues.[7] KIAA1109 is expressed in all stages of development from embryoid body to adult, except in infants. No expression of my gene is seen during the infant stage of development.[7]
## Promoter
According to Genomatix’s ElDorado program the promoter region of KIAA1109 is predicted to be 601 base pairs in length. The promoter region starts 500 base pairs upstream of the 5’ UTR of KIAA1109 mRNA transcript and contains part of this 5’ UTR.[8]
## Homology
KIAA1109 is conserved throughout many species. Orthologs have been found in many mammals and other vertebrates. More distant homologs have been identified in animals such as insects. See the mRNA and protein conservation sections below for more details. No human paralogs for KIAA1109 have been identified.[9]
# mRNA
## Splice Variants
KIAA1109 has 13 mRNA splice variants and 6 unspliced variants. Variant A is the longest and most commonly occurring variant of the gene[10] and is the subject of this article. KIAA1109 variant A is made up of 84 exons and is 15,592 base pairs in length.[6] The accession number for this nucleotide is NM_015312.3.
## Conservation
The mRNA sequence of KIAA1109 is highly conserved throughout mammals. The mRNA sequence identity to mammals is no less than 81.9% (in platypus) and ranging up to 99.5% (in chimpanzees).[11] Birds also show fairly high conservation with mRNA sequence identities around 78% in zebra finches.
The table blow shows information on the mRNA orthologs.
# Protein
## General Properties
KIAA1109 protein is 5005 amino acids in length,[13] and has a predicted molecular weight of 555519.38 daltons.[14] The isoelectirc point of KIAA1109 protein is predicted to be 6.12.[15]
## Composition
The amino acid composition of KIAA1109 protein showed amino acid frequencies within 1.5% of that of normal human proteins for all but Alanine, Serine and Threonine. Alanine has a lower frequency in KIAA1109 than in that of a normal human protein while Serine and Threonine both have a higher frequency in KIAA1109 than in the average human protein.[16]
## Conservation
The amino acid sequence of KIAA1109 is highly conserved throughout mammals. The protein identity ranges from 93.2% in Opossum to 99.8% in Chimpanzees and protein similarity is no less than 97% in all mammals included. Birds continue to show fairly high conservation with protein identities around 90% and proteins similarities at a high 96%. While conservation is still high the lower numbers may be due to small truncations on either, the 5’ and 3’ ends of these sequences.[9]
As we move to the more distant species of zebra fish and then the red four beetle and carpenter ant the conservations drops. In the insects the protein identities are down to around 34%.[9]
## Conserved Domains
NCBI conserved domains search identified two domains in KIAA1109. The first is the fragile site associated C-terminus, which is said to be linked to celiac disease susceptibility according to genome-wide-association studies and may also be associated with polycystic kidney disease.[17] The second conserved region identified by NCBI in KIAA1109 is an uncharacterized conserved protein (DUF2246), whose function is unknown and is conserved in various species from humans to worms.[18]
## Post Translation Modifications
KIAA1109 is predicted to undergo various types of post translational modifications including glycate, N-glycosylation, O-GlcNAc, O Glycosylation, Sulfonation and Phosphorylation.[19]
## Subcellular Localization
KIAA1109 contains one transmembrane domain from amino acids 26-46.[13]
No signal peptides, mitochondrial targeting sequences or chloroplast peptides were predicted for my protein and it is therefore not predicted to localize to secretory pathway, mitochondria or chloroplast.[20]
## Interacting Proteins
MADH2 and Beta-catenin were both found to have a physical interaction with my protein as deteched by display technonloy by Miyamoto-Sato et al. 2010.[21][22] | https://www.wikidoc.org/index.php/KIAA1109 | |
bfadc502ee621f29525be1757205f743671242e8 | wikidoc | KIAA1257 | KIAA1257
KIAA1257 is a protein that in humans is encoded by the KIAA1257 gene. KIAA1257 has been shown to be involve with activation of genes involved in sex determination
# Gene
In humans the gene KIAA1257 is located on chromosome 3q21.3. It spans 122 kilobasepairs (kBp) and contains 22 exons. It is flanked by Ras-related protein Rab-43 and several pseudogenes and on the opposite strand Acyl CoA dehydrogenase family member 9 (ACAD9) and EF-hand and coiled-coil domain containing 1 (EFCC1).
# Transcripts
The exons of KIAA1257 are alternatively spliced into 17 different isoforms (Table 1). Isoform X1 encodes the longest protein product and isoform X4 is the most common variant translated. Both the 5' and 3' UTR's are capable of forming stem loop structures that could serve as binding site for RNA-binding proteins.
Table 1
# Protein
The protein KIAA1257 exists most commonly as a translation of the mRNA isoform X4, which is only half the length of isoform X1's product even though they have similar mRNA lengths. Protein isoform X1 is 1179 amino acids long, has a molecular weight of 136.4 kilodaltons (kDa) and an isoelectric point (pI) of 8.1. KIAA1257 contains a domain of unknown function (DUF) 4550 in the first third of the protein sequence that has a high lysine content (15%). Most of the protein exists in a random coil structure but the final thirds contains 6 predicted alpha helices. KIAA1257 is predicted to be localized to the nucleus and contains several nuclear localization signals. A summary of KIAA1257 orthologs is shown below.
Table 2
# Expression and Regulation
KIAA1257 is mainly expressed in the testes and ovaries of adult humans, however expression is low in these tissues. KIAA1257 is most highly expressed during the earliest stages of development. Expression is the highest in the 2 through 8 cell stages of embryonic development and begins to decline steadily after morula and then blastocyst formation.
KIAA1257 has a promoter region upstream of the 5' UTR with several transcription factor binding sites including a Sox11 binding site. Sox11 is involved in the regulation of many developmental genes.
# Clinical Significance
KIAA1257 has been shown to activate expression of Nuclear receptor subfamily 5 group A member 1 (NR5A1). NR5A1 is involved in sex determination and defects in the gene are related to XY sex reversal.
# Homology
KIAA1257 is found in all vertebrates except for cartilaginous and jawless fishes. KIAA1257 orthologs in birds, fish, and reptiles have 30-40% identity with humans while mammals such as goats, cats, and dogs have 60-70% identity and primates have 85-99% identity.
Table 3 | KIAA1257
KIAA1257 is a protein that in humans is encoded by the KIAA1257 gene. KIAA1257 has been shown to be involve with activation of genes involved in sex determination[1]
.[2]
# Gene
In humans the gene KIAA1257 is located on chromosome 3q21.3. It spans 122 kilobasepairs (kBp) and contains 22 exons. It is flanked by Ras-related protein Rab-43 and several pseudogenes and on the opposite strand Acyl CoA dehydrogenase family member 9 (ACAD9) and EF-hand and coiled-coil domain containing 1 (EFCC1).
# Transcripts
The exons of KIAA1257 are alternatively spliced into 17 different isoforms (Table 1). Isoform X1 encodes the longest protein product and isoform X4 is the most common variant translated. Both the 5' and 3' UTR's are capable of forming stem loop structures that could serve as binding site for RNA-binding proteins.[3]
Table 1
# Protein
The protein KIAA1257 exists most commonly as a translation of the mRNA isoform X4, which is only half the length of isoform X1's product even though they have similar mRNA lengths. Protein isoform X1 is 1179 amino acids long, has a molecular weight of 136.4 kilodaltons (kDa) and an isoelectric point (pI) of 8.1.[4][5] KIAA1257 contains a domain of unknown function (DUF) 4550 in the first third of the protein sequence that has a high lysine content (15%).[4] Most of the protein exists in a random coil structure but the final thirds contains 6 predicted alpha helices.[6] KIAA1257 is predicted to be localized to the nucleus and contains several nuclear localization signals.[7] A summary of KIAA1257 orthologs is shown below.
Table 2
# Expression and Regulation
KIAA1257 is mainly expressed in the testes and ovaries of adult humans, however expression is low in these tissues. KIAA1257 is most highly expressed during the earliest stages of development. Expression is the highest in the 2 through 8 cell stages of embryonic development and begins to decline steadily after morula and then blastocyst formation.[9]
KIAA1257 has a promoter region upstream of the 5' UTR with several transcription factor binding sites including a Sox11 binding site.[10] Sox11 is involved in the regulation of many developmental genes.
# Clinical Significance
KIAA1257 has been shown to activate expression of Nuclear receptor subfamily 5 group A member 1 (NR5A1).[1] NR5A1 is involved in sex determination and defects in the gene are related to XY sex reversal.
# Homology
KIAA1257 is found in all vertebrates except for cartilaginous and jawless fishes. KIAA1257 orthologs in birds, fish, and reptiles have 30-40% identity with humans while mammals such as goats, cats, and dogs have 60-70% identity and primates have 85-99% identity.[11]
Table 3 | https://www.wikidoc.org/index.php/KIAA1257 | |
c17db6ab59597aece2841893cc2c3e6a58e4bbfb | wikidoc | KIAA1377 | KIAA1377
Uncharacterized protein KIAA1377 is a protein that in humans is encoded by the KIAA1377 gene.
Also known as Cep126, the protein has been shown to localize to the centrosome. Furthermore, it is found at pericentriolar satellites and the base of the primary cilium. Depleting Cep126 leads to dispersion of pericentriolar satellites, in turn disrupting microtubule organization at the mitotic spindle.
# Clinical relevance
Mutations in this gene have been found to cause monomelic amyotrophy. | KIAA1377
Uncharacterized protein KIAA1377 is a protein that in humans is encoded by the KIAA1377 gene.[1][2]
Also known as Cep126, the protein has been shown to localize to the centrosome. Furthermore, it is found at pericentriolar satellites and the base of the primary cilium. Depleting Cep126 leads to dispersion of pericentriolar satellites, in turn disrupting microtubule organization at the mitotic spindle.[3]
# Clinical relevance
Mutations in this gene have been found to cause monomelic amyotrophy.[4] | https://www.wikidoc.org/index.php/KIAA1377 | |
478ef0f778f41f43692335b2b13147660d2e34d0 | wikidoc | KIAA1524 | KIAA1524
Protein CIP2A also known as cancerous inhibitor of PP2A (CIP2A) is a protein that in humans is encoded by the KIAA1524 gene.
# Function
Protein phosphatase 2A (PP2A) is a trimeric serine-threonine phosphatase consisting of a catalytic C-subunit (PP2Ac), a scaffolding A-subunit and various regulatory B-subunits. Importantly, it has been estimated that collectively PP2A complexes can dephosphorylate a vast majority of all cellular serine/threonine phosphorylated proteins including large number of phosphoproteins involved in cancer maintenance and progression. The functional role of PP2A as a human tumor suppressor was validated by studies initiated by the Weinberg laboratory, which demonstrated that normal human cells immortalized by overexpression of TERT and inhibition of p53 and Rb, could not be transformed by oncogenic forms of H-Ras without simultaneous inhibition of PP2A activity. These studies established the paradigm that increased activity of oncogenic kinases is not sufficient to drive human cell transformation if PP2A activity is not simultaneously inhibited. In striking contrast to the tumor suppressor p53, which in human tumors is mainly inactivated by mutations, PP2A complex proteins are mutated at low frequency () and rather seem to be inhibited by overexpression of PP2A inhibitor proteins such as CIP2A, PME-1 and SET.
CIP2A inhibits PP2A tumor suppressor activity in human malignancies. More specifically, CIP2A was demonstrated to inhibit PP2A activity towards oncogenic transcription factor c-Myc, and thereby prevent c-Myc proteolytic degradation. Moreover, CIP2A is required for the malignant cellular growth and for in vivo tumor formation. In accordance with the oncogenic role of CIP2A, overexpression of CIP2A promotes Ras-elicited cell growth and transforms immortalized human cells (HEK-TERVs). More recently CIP2A has been shown to regulate phosphorylation and activity of many other oncoproteins and to drive malignant cell growth and tumorigenesis in various human cancer types. Importantly, CIP2A deficient mice are viable, suggesting that targeting of oncogenic function of CIP2A would not results in serious side-effects.
# Clinical significance
CIP2A is over-expressed in several common human malignancies including, human head and neck squamous cell carcinoma (HNSCC), colon cancer, gastric cancer, breast cancer, prostate cancer and lung cancer. Notably, in these cancer types CIP2A over-expression is observed with very high frequency; in breast cancer around 40% of cancer patients are over-expressing CIP2A whereas in all other studied cancer types the frequency is between 65-87 percent. In breast cancer CIP2A expression correlates with disease aggressivity whereas in gastric and lung cancer CIP2A expression predicts for poor patient survival. To date high CIP2A expression has been observed to predict poor patient prognosis in more than dozen human cancer types, which makes it one of the most frequently altered human oncoprotein with clinical relevance.
CIP2A is also over expressed in prostate cancer, lung cancer, oral squamous cell carcinoma, and gastric cancer. Furthermore, the expression of CIP2A correlates with breast cancer aggressivity. It is also implicated in some Chronic Myeloid Leukemia (CML) resistance to imatinib (Gleevec). | KIAA1524
Protein CIP2A also known as cancerous inhibitor of PP2A (CIP2A) is a protein that in humans is encoded by the KIAA1524 gene.[1][2]
# Function
Protein phosphatase 2A (PP2A) is a trimeric serine-threonine phosphatase consisting of a catalytic C-subunit (PP2Ac), a scaffolding A-subunit and various regulatory B-subunits. Importantly, it has been estimated that collectively PP2A complexes can dephosphorylate a vast majority of all cellular serine/threonine phosphorylated proteins including large number of phosphoproteins involved in cancer maintenance and progression. The functional role of PP2A as a human tumor suppressor was validated by studies initiated by the Weinberg laboratory, which demonstrated that normal human cells immortalized by overexpression of TERT and inhibition of p53 and Rb, could not be transformed by oncogenic forms of H-Ras without simultaneous inhibition of PP2A activity. These studies established the paradigm that increased activity of oncogenic kinases is not sufficient to drive human cell transformation if PP2A activity is not simultaneously inhibited. In striking contrast to the tumor suppressor p53, which in human tumors is mainly inactivated by mutations, PP2A complex proteins are mutated at low frequency (http://www.cbioportal.org) and rather seem to be inhibited by overexpression of PP2A inhibitor proteins such as CIP2A, PME-1 and SET.
CIP2A inhibits PP2A tumor suppressor activity in human malignancies.[3] More specifically, CIP2A was demonstrated to inhibit PP2A activity towards oncogenic transcription factor c-Myc, and thereby prevent c-Myc proteolytic degradation. Moreover, CIP2A is required for the malignant cellular growth and for in vivo tumor formation. In accordance with the oncogenic role of CIP2A, overexpression of CIP2A promotes Ras-elicited cell growth and transforms immortalized human cells (HEK-TERVs). More recently CIP2A has been shown to regulate phosphorylation and activity of many other oncoproteins and to drive malignant cell growth and tumorigenesis in various human cancer types. Importantly, CIP2A deficient mice are viable, suggesting that targeting of oncogenic function of CIP2A would not results in serious side-effects.
# Clinical significance
CIP2A is over-expressed in several common human malignancies including, human head and neck squamous cell carcinoma (HNSCC), colon cancer, gastric cancer, breast cancer, prostate cancer and lung cancer. Notably, in these cancer types CIP2A over-expression is observed with very high frequency; in breast cancer around 40% of cancer patients are over-expressing CIP2A whereas in all other studied cancer types the frequency is between 65-87 percent. In breast cancer CIP2A expression correlates with disease aggressivity whereas in gastric and lung cancer CIP2A expression predicts for poor patient survival.[4][5] To date high CIP2A expression has been observed to predict poor patient prognosis in more than dozen human cancer types, which makes it one of the most frequently altered human oncoprotein with clinical relevance.
CIP2A is also over expressed in prostate cancer,[6] lung cancer,[7] oral squamous cell carcinoma,[8] and gastric cancer.[4] Furthermore, the expression of CIP2A correlates with breast cancer aggressivity.[9] It is also implicated in some Chronic Myeloid Leukemia (CML) resistance to imatinib (Gleevec). | https://www.wikidoc.org/index.php/KIAA1524 | |
33c1327e65698cc86c24f5f60f0a091db79ac045 | wikidoc | KIAA1551 | KIAA1551
KIAA1551 in Homo sapiens is a novel protein with a function not yet well understood in the scientific community. It is encoded by the KIAA1551 gene. KIAA1551 is broadly expressed in the lymph nodes, ovaries, appendix and spleen. KIAA1551 shows characteristics of being a minor histocompatibility antigen, as well as tumor suppressor capabilities. The high epression in the lymph nodes and spleen indicate function in the immune system.
# Gene
KIAA1551 is a protein coding gene found on Chromosome 12 and maps to 12p11.21. Alternative names for this gene include Gonad Expressed Transcript (GET), UTA2-1 and C12orf35. KIAA1551 has 7 exons, 3 of which occur before the start codon.
## Expression
### Normal Tissue Expression
A study of normal human tissue expression profiling shows that KIAA1551 is highly expressed in the thymus, spleen, bone marrow and liver. This is interesting as it relates to common organs associated with the Immune system.
Gene tissue expression patterns found through the National Center for Biotechnology Information UniGene EST Profile showed that there was also high expression of KIAA1551 in the lymph nodes, uterus, mouth, thyroid, larynx and blood.
### Expression by Health State
An evaluation of KIAA1551 expression in health states was performed using NCBI Unigene’s EST Profile. Although KIAA1551 is highly expressed in uterine tumors, it is also highly expressed in the uterus, suggesting that it is unlikely the gene is associated closely with uterine cancer. However, KIAA1551 may be related to adrenal tumors, as there was lower expression of this gene within normal kidney tissue.
## Transcript
### Predicted Transcription Factor Binding Sites
Transcription factor binding sites within the promoter of KIAA1551 included mainly transcription factors that were associated with bone marrow cells, antibody- producing cells, and blood cells. This supports the association of KIAA1551 with the functioning immune system.
# Protein
KIAA1551 is 1747 amino acids in length and has one domain of unknown function, DUF4617. The Molecular Weight of KIAA1551 is 194.9 kdal. The basal isoelectric point is 8.95. A localization prediction suggests that KIAA1551 is likely a nuclear protein.
## Protein Structure
The secondary structure of KIAA1551 consists of mainly random coil structures (approximately 59.2%), few alpha helices (24% of residues) and fewer extended strands (15.8% of residues).
A predicted 3-D structure was created using Swiss model work space, shown above.
## Protein Interactions
KIAA1551 interacts with NANOG, MDM2, EXOC1 and CALML3. These interactions further suggest KIAA1551 is a nuclear protein, and that it may be associated with tumor-suppressor proteins and immune system proteins.
EXOC1 was involved in a schizophrenia study, relating a schizophrenia risk gene (DISC1) to a network of protein-protein interactions. This study used a two-hybrid assay as evidence to the protein interaction between KIAA1551 and EXOC1. EXOC1 functions as a response to microbial infections, which reduces viral RNA synthesis and protein translation.
NANOG was predicted to interact with KIAA1551 based on an affinity capture-MS, which linked NANOG to proteins involved with the cell cycle. This study used affinity purification combined with high accuracy mass spectrometry to find specific protein interactions. NANOG was also found to be an essential transcription factor in embryonic stem cells, specifically involved in gene expression to affect cell fate.
MDM2 is a gene that interacts with others to affect the cell cycle and apoptosis, and is located in tissues common to KIAA1551, such as the uterus and lymph node. MDM2 was found to interact with KIAA1551 through the use of a phage display library. This interaction further suggests that KIAA1551 is a nuclear protein, as MDM2 and its splice variants contain nuclear localization signals for nucleoplasmic distribution.
CALML3 was found to interact with KIAA1551 based on affinity capture-MS assay, similar to how NANOG was found to interact with KIAA1551. A study on CALML3 expression in epidermal development showed that CALML3 was useful marker for development, and loss of CALML3 expression correlated with malignant phenotypes.
# Evolutionary Relationships
## Orthologs
The closest orthologs to KIAA1551 are primates, however, conserved sequences can be found in whales, bears, snakes, birds, turtles, and frogs. Orthologs of KIAA1551 diverged as long ago as 353 million years ago (Xenopus laevis), while the closest evolutionary ortholog is Papio anubis, which diverged approximately 28.1 million years ago.
## Phylogenetic Tree
An unrooted phylogenetic tree of KIAA1551 was created of 20 orthologs and the human KIAA1551 gene.
## Molecular Phylogeny
A graph shown below of the molecular evolution of KIAA1551 shows that it evolved relatively quickly compared to both cytochrome C, a slowly evolving protein, and fibrinogen alpha, which evolved more quickly than cytochrome C. The comparison shows that KIAA1551 is fairly quickly diverging, which suggests that it could be a gene that changes quickly in response to its environment, such as the introduction of a pathogen. | KIAA1551
KIAA1551 in Homo sapiens is a novel protein with a function not yet well understood in the scientific community. It is encoded by the KIAA1551 gene. KIAA1551 is broadly expressed in the lymph nodes, ovaries, appendix and spleen.[1] KIAA1551 shows characteristics of being a minor histocompatibility antigen, as well as tumor suppressor capabilities.[2][3] The high epression in the lymph nodes and spleen indicate function in the immune system.
# Gene
KIAA1551 is a protein coding gene found on Chromosome 12 and maps to 12p11.21.[4] Alternative names for this gene include Gonad Expressed Transcript (GET), UTA2-1 and C12orf35.[1] KIAA1551 has 7 exons, 3 of which occur before the start codon.[1]
## Expression
### Normal Tissue Expression
A study of normal human tissue expression profiling shows that KIAA1551 is highly expressed in the thymus, spleen, bone marrow and liver.[5] This is interesting as it relates to common organs associated with the Immune system.
Gene tissue expression patterns found through the National Center for Biotechnology Information UniGene EST Profile showed that there was also high expression of KIAA1551 in the lymph nodes, uterus, mouth, thyroid, larynx and blood.[6]
### Expression by Health State
An evaluation of KIAA1551 expression in health states was performed using NCBI Unigene’s EST Profile.[7] Although KIAA1551 is highly expressed in uterine tumors, it is also highly expressed in the uterus, suggesting that it is unlikely the gene is associated closely with uterine cancer. However, KIAA1551 may be related to adrenal tumors, as there was lower expression of this gene within normal kidney tissue.
## Transcript
### Predicted Transcription Factor Binding Sites
Transcription factor binding sites within the promoter of KIAA1551 included mainly transcription factors that were associated with bone marrow cells, antibody- producing cells, and blood cells.[8] This supports the association of KIAA1551 with the functioning immune system.
# Protein
KIAA1551 is 1747 amino acids in length and has one domain of unknown function, DUF4617.[9] The Molecular Weight of KIAA1551 is 194.9 kdal.[10] The basal isoelectric point is 8.95.[11] A localization prediction suggests that KIAA1551 is likely a nuclear protein.[11]
## Protein Structure
The secondary structure of KIAA1551 consists of mainly random coil structures (approximately 59.2%), few alpha helices (24% of residues) and fewer extended strands (15.8% of residues).[12]
A predicted 3-D structure was created using Swiss model work space, shown above.[13]
## Protein Interactions
KIAA1551 interacts with NANOG, MDM2, EXOC1 and CALML3. These interactions further suggest KIAA1551 is a nuclear protein, and that it may be associated with tumor-suppressor proteins and immune system proteins.[14]
EXOC1 was involved in a schizophrenia study, relating a schizophrenia risk gene (DISC1) to a network of protein-protein interactions.[15] This study used a two-hybrid assay as evidence to the protein interaction between KIAA1551 and EXOC1. EXOC1 functions as a response to microbial infections, which reduces viral RNA synthesis and protein translation.[16]
NANOG was predicted to interact with KIAA1551 based on an affinity capture-MS, which linked NANOG to proteins involved with the cell cycle. This study used affinity purification combined with high accuracy mass spectrometry to find specific protein interactions.[17] NANOG was also found to be an essential transcription factor in embryonic stem cells, specifically involved in gene expression to affect cell fate.[18]
MDM2 is a gene that interacts with others to affect the cell cycle and apoptosis, and is located in tissues common to KIAA1551, such as the uterus and lymph node.[19] MDM2 was found to interact with KIAA1551 through the use of a phage display library. This interaction further suggests that KIAA1551 is a nuclear protein, as MDM2 and its splice variants contain nuclear localization signals for nucleoplasmic distribution.[20]
CALML3 was found to interact with KIAA1551 based on affinity capture-MS assay, similar to how NANOG was found to interact with KIAA1551.[21] A study on CALML3 expression in epidermal development showed that CALML3 was useful marker for development, and loss of CALML3 expression correlated with malignant phenotypes.[22]
# Evolutionary Relationships
## Orthologs
The closest orthologs to KIAA1551 are primates, however, conserved sequences can be found in whales, bears, snakes, birds, turtles, and frogs. Orthologs of KIAA1551 diverged as long ago as 353 million years ago (Xenopus laevis), while the closest evolutionary ortholog is Papio anubis, which diverged approximately 28.1 million years ago.
## Phylogenetic Tree
An unrooted phylogenetic tree of KIAA1551 was created of 20 orthologs and the human KIAA1551 gene.
## Molecular Phylogeny
A graph shown below of the molecular evolution of KIAA1551 shows that it evolved relatively quickly compared to both cytochrome C, a slowly evolving protein, and fibrinogen alpha, which evolved more quickly than cytochrome C. The comparison shows that KIAA1551 is fairly quickly diverging, which suggests that it could be a gene that changes quickly in response to its environment, such as the introduction of a pathogen. | https://www.wikidoc.org/index.php/KIAA1551 | |
993a3aa93cad317ddfe6bf8801bf2882b748b693 | wikidoc | KIAA1704 | KIAA1704
KIAA1704, also known as LSR7 (lipopolysaccharide-specific response protein 7), is a protein that in humans is encoded by the GPALPP1 (GPALPP motifs containing 1) gene. The function of KIAA1704 is not yet well understood. KIAA1704 contains one domain of unknown function, DUF3752. The protein contains a conserved, uncharged, repeated motif GPALPP(GF) near the N terminus and an unusual, conserved, mixed charge throughout (alternating readily between positive and negative charges). It is predicted to be localized to the nucleus.
# Clinical significance
KIAA1704 has at least a 5 fold expression loss associated with mantle cell lymphoma.
In a second study, researchers used a linkage disequilibrium mapping study of locus 13q13-14 to investigate potential susceptibility for autism over a 1.5 Mb linkage peak, including KIAA1704. A single marker PDTPhase analysis was performed for four SNPs for KIAA1704; however, none of the SNPs were statistically significant in associating the marker with the loci.
An expression study found that KIAA1704 is significantly up-regulated in U937 cells (macrophage-like human cell line) when treated with nicotine.
# Properties
# Gene
## Location
KIAA1704 is found on the chromosome 13, at locus q14.12, with the genomic sequence starting at 45,563,687 bp and ending at 45,602,405 bp.
## Gene Neighborhood
KIAA1704 is located on the positive strand surrounded by 5 nearby genes.
Positive Orientation
- General Transcription Factor IIF (GTF2F2) is further downstream directed in the same orientation. Functionally, it binds to RNA Polymerase II.
Negative Orientation
- Nuclear Fragile X Mental Retardation Protein Interacting Protein 1 (NUFIp1) shows RNA-binding activity with specific nuclear role for FMRP. This is an RNA-binding protein associated with Fragile X. Start sites are antisense to start of KIAA1704.
- Potassium Channel Tetramerisation Domain Containing 4 (KCTD4) proposed to participate in potassium ion transport.
- Tumor protein translationally controlled 1 (TPT1) is involved in calcium binding and microtubule stabilization.
- Small nucleolar RNA, H/ACA box 31 (SNORA31) does not have a known function at this time.
## Expression
KIAA1704 has ubiquitous low to moderate expression patterns across body tissues (below 50%)
## Promoter
Using GenoMatix ElDorado analysis tools, the promoter was predicted to be 727 base pairs in length projecting into exon 1. There are two predicted transcriptional start sites for this promoter, shown on the adjacent image.
KIAA1704 promoter showed significant histone 3 lysine 4 trimethylation peaks in K562 cells (erythroid cell line). It also showed increased relative expression in erythroid progenitors along with gene neighbors, NUFIP1 and TPT1.
An additional study found that the proximal promoter is one of many thousand direct targets of transcription factor, Myc, in vivo.
# mRNA
## Splice Variants
According to Ensembl, there are four coding splice variants. None of the alternative splice forms have experimental evidence associated. One splice variant undergoes non-sense mediated decay while another is predicted to splice the gene directly in half and retain amino acids 171-340.
## Conservation
NCBI BLAST searches reveal that known mRNA orthologs exist in mammals, reptiles, birds, frogs, and fish with at least 65% sequence identity.
# Protein
## General Properties
## Composition
Shown in the table below, KIAA1704 has significantly higher percentages of charged amino acids (D, K, KR, KRED) than the normal human protein and is mostly conserved within its orthologous proteins.
## Conservation
KIAA1704 has protein orthologs extending through plants, shown in descending order of identity in the table below. Mammals have the highest level of conservation with 89 percent identity followed by birds, frogs, fish, invertebrates, insects, and plants.
## Conserved domains
Concerning conserved domains, thus far, there does not appear to be much information about conserved motif, GPALPP(GF). This motif represents the neutral segments in this highly charged protein.
DUF3752 is generally found in Eukaryotes and is between 140-163 amino acids in length. It belongs to pfam12572, member of superfamily cl13947
Information provided by Statistical Analysis of Proteins (SAPS) tool.
## Post Translation Modifications
KIAA1704 is predicted by ExPASy tools to undergo several conserved post translational modifications including glycation, o-linked glycosylation, serine phosphorylation, threonine phosphorylation, and several kinase specific phosphorylation (PKC, PKA, and CKII).
## Secondary Structure
There are four conserved predicted alpha helices located towards the C terminus of the protein. The N terminus is predicted to be dominated by coiled regions.
## Subcellular Localization
ExPASy PSORT predicts 74% chance of being localized to the nucleus. | KIAA1704
KIAA1704, also known as LSR7 (lipopolysaccharide-specific response protein 7), is a protein that in humans is encoded by the GPALPP1 (GPALPP motifs containing 1) gene. The function of KIAA1704 is not yet well understood. KIAA1704 contains one domain of unknown function, DUF3752. The protein contains a conserved, uncharged, repeated motif GPALPP(GF) near the N terminus and an unusual, conserved, mixed charge throughout (alternating readily between positive and negative charges).[1] It is predicted to be localized to the nucleus.[2]
# Clinical significance
KIAA1704 has at least a 5 fold expression loss associated with mantle cell lymphoma.[3]
In a second study, researchers used a linkage disequilibrium mapping study of locus 13q13-14 to investigate potential susceptibility for autism over a 1.5 Mb linkage peak, including KIAA1704. A single marker PDTPhase analysis was performed for four SNPs for KIAA1704; however, none of the SNPs were statistically significant in associating the marker with the loci.[4]
An expression study found that KIAA1704 is significantly up-regulated in U937 cells (macrophage-like human cell line) when treated with nicotine.[5]
# Properties
# Gene
## Location
KIAA1704 is found on the chromosome 13, at locus q14.12, with the genomic sequence starting at 45,563,687 bp and ending at 45,602,405 bp.[6]
## Gene Neighborhood
KIAA1704 is located on the positive strand surrounded by 5 nearby genes.
Positive Orientation
- General Transcription Factor IIF (GTF2F2) is further downstream directed in the same orientation. Functionally, it binds to RNA Polymerase II.[7]
Negative Orientation
- Nuclear Fragile X Mental Retardation Protein Interacting Protein 1 (NUFIp1) shows RNA-binding activity with specific nuclear role for FMRP. This is an RNA-binding protein associated with Fragile X. Start sites are antisense to start of KIAA1704.[7]
- Potassium Channel Tetramerisation Domain Containing 4 (KCTD4) proposed to participate in potassium ion transport.[7]
- Tumor protein translationally controlled 1 (TPT1) is involved in calcium binding and microtubule stabilization.[7]
- Small nucleolar RNA, H/ACA box 31 (SNORA31) does not have a known function at this time.[7]
## Expression
KIAA1704 has ubiquitous low to moderate expression patterns across body tissues (below 50%)[8]
## Promoter
Using GenoMatix ElDorado analysis tools, the promoter was predicted to be 727 base pairs in length projecting into exon 1. There are two predicted transcriptional start sites for this promoter, shown on the adjacent image.[9]
KIAA1704 promoter showed significant histone 3 lysine 4 trimethylation peaks in K562 cells (erythroid cell line). It also showed increased relative expression in erythroid progenitors along with gene neighbors, NUFIP1 and TPT1.[10]
An additional study found that the proximal promoter is one of many thousand direct targets of transcription factor, Myc, in vivo.[11]
# mRNA
## Splice Variants
According to Ensembl, there are four coding splice variants. None of the alternative splice forms have experimental evidence associated. One splice variant undergoes non-sense mediated decay while another is predicted to splice the gene directly in half and retain amino acids 171-340.[12]
## Conservation
NCBI BLAST searches reveal that known mRNA orthologs exist in mammals, reptiles, birds, frogs, and fish with at least 65% sequence identity.[13]
# Protein
## General Properties
## Composition
Shown in the table below, KIAA1704 has significantly higher percentages of charged amino acids (D, K, KR, KRED) than the normal human protein and is mostly conserved within its orthologous proteins.[1]
## Conservation
KIAA1704 has protein orthologs extending through plants, shown in descending order of identity in the table below. Mammals have the highest level of conservation with 89 percent identity followed by birds, frogs, fish, invertebrates, insects, and plants.[13]
## Conserved domains
Concerning conserved domains, thus far, there does not appear to be much information about conserved motif, GPALPP(GF). This motif represents the neutral segments in this highly charged protein.
DUF3752 is generally found in Eukaryotes and is between 140-163 amino acids in length. It belongs to pfam12572, member of superfamily cl13947[14]
Information provided by Statistical Analysis of Proteins (SAPS) tool.[1]
## Post Translation Modifications
KIAA1704 is predicted by ExPASy tools to undergo several conserved post translational modifications including glycation, o-linked glycosylation, serine phosphorylation, threonine phosphorylation, and several kinase specific phosphorylation (PKC, PKA, and CKII).[2]
## Secondary Structure
There are four conserved predicted alpha helices located towards the C terminus of the protein. The N terminus is predicted to be dominated by coiled regions.[15]
## Subcellular Localization
ExPASy PSORT predicts 74% chance of being localized to the nucleus.[2] | https://www.wikidoc.org/index.php/KIAA1704 | |
83ea93dfbff75f92432428d5945439df4f629f4e | wikidoc | KIAA1797 | KIAA1797
KIAA1797 is a protein that in humans is encoded by the KIAA1797 gene.
A specific single-nucleotide polymorphism rs7875153 in KIAA1797 is associated with heart rate.
# Gene
KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914. Located on chromosome 9 at area q21.3, the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields a mRNA of 6117 base pairs.
## Expression
KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression have been observed in tissues ranging from reproductive to secretory.
Kiaa1797 expression pic
# mRNA
Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are “ugagaugaacucgguaucuca” and “uccuaagagaggag” respectively. Other possible secondary structures are shown in the table below.
# Protein sequence
The main isoform of the human protein is 1801 amino acid long, a total of 200,072 Da.
Two distinct Domain of unknown function(DUF) are found in the sequence.DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was provided regarding this DUF.
Kiaa1797 DUF pic
# Homology
KIAA1797 is well conserved in mammals. However, it is also found in non-mammalians with lower sequence identities.
# Gene Neighborhood
KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.
Kiaa1797 Gene hood
# Function
The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane proteins. | KIAA1797
KIAA1797 is a protein that in humans is encoded by the KIAA1797 gene.[1]
A specific single-nucleotide polymorphism rs7875153 in KIAA1797 is associated with heart rate.[2]
# Gene
KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.[1] Located on chromosome 9 at area q21.3,[3] the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields a mRNA of 6117 base pairs.
## Expression
KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression have been observed in tissues ranging from reproductive to secretory.[4]
Kiaa1797 expression pic
# mRNA
Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are “ugagaugaacucgguaucuca” and “uccuaagagaggag” respectively. Other possible secondary structures are shown in the table below.
# Protein sequence
The main isoform of the human protein is 1801 amino acid long, a total of 200,072 Da.[3]
Two distinct Domain of unknown function(DUF) are found in the sequence.DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was provided regarding this DUF.
Kiaa1797 DUF pic
# Homology
KIAA1797 is well conserved in mammals. However, it is also found in non-mammalians with lower sequence identities.
# Gene Neighborhood
KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.
Kiaa1797 Gene hood
# Function
The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane proteins. | https://www.wikidoc.org/index.php/KIAA1797 | |
3d831141138c60f671b7fbda4ba7fe98ddf08aa5 | wikidoc | KIAA1841 | KIAA1841
KIAA1841 is a gene in humans that encodes a protein known as KIAA1841 (uncharacterized protein KIAA1841). KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription.
# Gene
## Location
KIAA1841 is located on the long arm of chromosome 2 (2q14), starting at 61297486 and ending at 61349294. The KIAA1841 gene spans 52809 base pairs and is orientated on the ++ strand. The coding region is made up of 4292 base pairs and the protein sequence of 718 amino acids.
## Gene neighborhood
Genes PEX13 and C2orf74 neighbor KIAA1841 on chromosome 2.
## Expression
KIAA1841 is highly expressed in reproductive structures and nervous tissue. These include the brain, prostate, cervix, ear and nervous tissue. It is intermediately expressed in the lungs and spinal cord. KIAA1841 is expressed at low levels in a wide range of tissues throughout the human body.
## Transcript variants
In humans, the KIAA1841 gene produces 18 alternatively spliced transcript variants as well as 3 unspliced. From the 18 spliced variants 4 form a protein product. The main transcript in humans is transcript ID ENST00000402291, or OTTHUMT00000325477.
# Homology
## Paralogs
There are no paralogs of KIAA1841
## Orthologs
Below is a table of a variety of orthologs of the human KIAA1841. The table include closely, intermediately and distantly related orthologs.
Orthologs of the human protein KIAA1841 are listed above in descending order or date of divergence and then ascending order of percent identity. KIAA1841 is highly conserved throughout all orthologs, this is demonstrated with a 40% identity in the least similar ortholog. KAA1841 has evolved slowly and evenly over time.
## Homologous domains
The domain of unknown function 3342 is conserved in all orthologs. It is the highest conserved region of the protein.
Conservation of this domain was traced all the way back to a fungus called Batrachochytrium dendrobatidis, which
diverged 1216 millions of years ago from humans.
# Protein
## General properties
The molecular weight of KIAA1841 is 82 kiloDaltons. The isoelectric point is 6.5. The protein sequence is not rich or low in any amino acids. There are two stretches of non-polar regions, which are capable of being transmembrane regions. There is a stretch of 21 0’s from 254-275 and a stretch of 24 0’s from 420-444.1 The DUF3342 domain stretches from 147-449.
## Composition
There is an even distribution of amino acids comprising KIAA1841. The percent composition of each amino acid is fairly consistent throughout the orthologs of the protein. The most distant ortholog displays the most variance in amino acid composition. There is a higher percent composition of alanine, histidine and leucine and a lower composition of lysine.
The protein sequence of KIAA1841 is not rich or low in any amino acids. The same is true in Mus musculus, Danio rerio, Drosophila melanogaster but not true for the most distantly related. Batrachochytrium dendrobatidis is rich is histidine. Humans and closely related orthologs are composed of 2.2% to 3.8% histidine compared to 5% in Batrachochytrium dendrobatidis.
## Domains
The DUF3342 domain stretches from 147-449 on KIAA1841 and has a molecular weight of 35.7 kdal. The DUF domain is low in G (2%) and rich is C (6.3%). Both of the non-polar stretches in the protein are located within the DUF domain. One at the beginning and one at the end.
The domain (DUF3342) of unknown function is a part of the pfam11822 family. This family of proteins has yet to be functionally characterized and it is found in bacteria. This domain is usually between 170 amino acids and 303 amino acids in length. The N terminal half of this protein family is a BTB-like domain. BTB domains multifunctional protein-protein interaction motif that is involved in a number of different cellular functions, including roles in regulating transcription, cytoskeleton dynamics, gating and assembly of ion channels and is involved with ubiquitination of proteins. BTB domain structures are highly conversed and are found on proteins that only have one or two other types of domains.
## Post-translational modifications
KIAA1841 is highly phosphorylated post modification. There are 37 predicted phosphorylated sites. There is one leucine-rich nuclear export signal toward the end of the protein. There is one sulfated tyrosine, which strengthens protein-protein interactions. Two motifs with high probability of post translational modification sumoylation sites were found. Sumoylation sites are involved in a number of cellular processes, including nuclear-cytosolic transport, transcriptional regulation and protein stability.
## Secondary structure
KIAA1841 is primarily composed of alpha helices and beta sheets. Alpha helices comprise the majority of the protein, this is true for the DUF domain and both terminuses. The DUF domain has slightly less beta sheets compared to the protein as a whole and the C terminus has an even smaller amount of beta sheets comprising its secondary structure.
## Subcellular localization
Protein KIAA1841 is targeted to the nucleus.
## Interacting proteins
KIAA1841 was found to interact with SRPK1 (Serine/arginine- rich protein-specific kinase 1) The interaction was detected via a protein kinase assay. SRPK1 localizes to the nucleus and the cytoplasm. By regulating intracellular localization of splicing factors it is thought to play a role in regulating both constitutive and alternative splicing. KIAA1841 is also found in the nucleus and is thought to play a role in regulating transcription.
# Clinical significance
## Disease association
Diseases associated with this gene are Crohn’s disease, celiac disease and inflammatory bowel disease. | KIAA1841
KIAA1841 is a gene in humans that encodes a protein known as KIAA1841 (uncharacterized protein KIAA1841). KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription.
# Gene
## Location
KIAA1841 is located on the long arm of chromosome 2 (2q14), starting at 61297486 and ending at 61349294. The KIAA1841 gene spans 52809 base pairs and is orientated on the ++ strand. The coding region is made up of 4292 base pairs and the protein sequence of 718 amino acids.[1]
## Gene neighborhood
Genes PEX13 and C2orf74 neighbor KIAA1841 on chromosome 2.[2]
## Expression
KIAA1841 is highly expressed in reproductive structures and nervous tissue. These include the brain, prostate, cervix, ear and nervous tissue. It is intermediately expressed in the lungs and spinal cord.[3][4] KIAA1841 is expressed at low levels in a wide range of tissues throughout the human body.
## Transcript variants
In humans, the KIAA1841 gene produces 18 alternatively spliced transcript variants as well as 3 unspliced. From the 18 spliced variants 4 form a protein product. The main transcript in humans is transcript ID ENST00000402291, or OTTHUMT00000325477.[5][6][7]
# Homology
## Paralogs
There are no paralogs of KIAA1841[8]
## Orthologs
Below is a table of a variety of orthologs of the human KIAA1841. The table include closely, intermediately and distantly related orthologs.
Orthologs of the human protein KIAA1841 are listed above in descending order or date of divergence and then ascending order of percent identity. KIAA1841 is highly conserved throughout all orthologs, this is demonstrated with a 40% identity in the least similar ortholog. KAA1841 has evolved slowly and evenly over time.[9][10]
## Homologous domains
The domain of unknown function 3342 is conserved in all orthologs. It is the highest conserved region of the protein.
Conservation of this domain was traced all the way back to a fungus called Batrachochytrium dendrobatidis, which
diverged 1216 millions of years ago from humans.[11]
# Protein
## General properties
The molecular weight of KIAA1841 is 82 kiloDaltons. The isoelectric point is 6.5. The protein sequence is not rich or low in any amino acids. There are two stretches of non-polar regions, which are capable of being transmembrane regions. There is a stretch of 21 0’s from 254-275 and a stretch of 24 0’s from 420-444.1 The DUF3342 domain stretches from 147-449.[12]
## Composition
There is an even distribution of amino acids comprising KIAA1841. The percent composition of each amino acid is fairly consistent throughout the orthologs of the protein. The most distant ortholog displays the most variance in amino acid composition. There is a higher percent composition of alanine, histidine and leucine and a lower composition of lysine.
The protein sequence of KIAA1841 is not rich or low in any amino acids. The same is true in Mus musculus, Danio rerio, Drosophila melanogaster but not true for the most distantly related. Batrachochytrium dendrobatidis is rich is histidine. Humans and closely related orthologs are composed of 2.2% to 3.8% histidine compared to 5% in Batrachochytrium dendrobatidis.
## Domains
The DUF3342 domain stretches from 147-449 on KIAA1841 and has a molecular weight of 35.7 kdal. The DUF domain is low in G (2%) and rich is C (6.3%). Both of the non-polar stretches in the protein are located within the DUF domain. One at the beginning and one at the end.
The domain (DUF3342) of unknown function is a part of the pfam11822 family. This family of proteins has yet to be functionally characterized and it is found in bacteria. This domain is usually between 170 amino acids and 303 amino acids in length. The N terminal half of this protein family is a BTB-like domain. BTB domains multifunctional protein-protein interaction motif that is involved in a number of different cellular functions, including roles in regulating transcription, cytoskeleton dynamics, gating and assembly of ion channels and is involved with ubiquitination of proteins. BTB domain structures are highly conversed and are found on proteins that only have one or two other types of domains.
## Post-translational modifications
KIAA1841 is highly phosphorylated post modification. There are 37 predicted phosphorylated sites. There is one leucine-rich nuclear export signal toward the end of the protein. There is one sulfated tyrosine, which strengthens protein-protein interactions. Two motifs with high probability of post translational modification sumoylation sites were found. Sumoylation sites are involved in a number of cellular processes, including nuclear-cytosolic transport, transcriptional regulation and protein stability.
## Secondary structure
KIAA1841 is primarily composed of alpha helices and beta sheets. Alpha helices comprise the majority of the protein, this is true for the DUF domain and both terminuses. The DUF domain has slightly less beta sheets compared to the protein as a whole and the C terminus has an even smaller amount of beta sheets comprising its secondary structure.[13][14]
## Subcellular localization
Protein KIAA1841 is targeted to the nucleus.[15]
## Interacting proteins
KIAA1841 was found to interact with SRPK1 (Serine/arginine- rich protein-specific kinase 1)[16] The interaction was detected via a protein kinase assay. SRPK1 localizes to the nucleus and the cytoplasm. By regulating intracellular localization of splicing factors it is thought to play a role in regulating both constitutive and alternative splicing. KIAA1841 is also found in the nucleus and is thought to play a role in regulating transcription.
# Clinical significance
## Disease association
Diseases associated with this gene are Crohn’s disease, celiac disease and inflammatory bowel disease.[17][18] | https://www.wikidoc.org/index.php/KIAA1841 | |
708754147d85c7ccfb3a8c41f973f408d9619927 | wikidoc | KIAA1958 | KIAA1958
Protein KIAA1958 is a protein that in humans is encoded by the KIAA1958 gene. Orthologs of KIAA1958 go as far back in evolution to chordates, although, it is closer in homology to primates than any other orthologs. KIAA1958 has no known paralogs.
# Gene
KIAA1958 is located on the long arm of chromosome 9 (9.q32) in humans on the plus strand from 115249248 to 115427597. Its mRNA has 2683 bp. The gene has these neighbors on chromosome 9:
HSDL2: Hydroxysteroid dehydrogenase-like protein 2 plays a role in nucleotide binding, oxidoreductase activity, and sterol binding.
C9orf147: Chromosome 9 open reading frame 147 has an unknown function.
C9orf80: Chromosome 9 open reading frame 80 is a component of the SOSS complex, a multiprotein complex that functions downstream of the MRN complex to promote DNA repair and G2/M checkpoint. The SOSS complex associates with single-stranded DNA at DNA lesions and influences diverse endpoints in the cellular DNA damage response including cell cycle checkpoint activation, recombinational repair and maintenance of genomic stability.
SNX30: Sorting nexin-30 may be linked to phosphatidylinositol binding.
# Expression
KIAA1958 is expressed in the highest quantities in the larynx as proposed by EST. The highest expression in developmental stage is the blastocyst and for health state, it is most found in uterine tumors.
Data from NCBI GEO Profile shows that KIAA1958 expression includes many of the tissue types in the human body. Using EMBL-EBI, KIAA1958 was found to be overexpressed in pseudopod RNA during the migration of the metastatic cancer cells. KIAA1958 was also overexpressed in Stat5/ab and stat 3 which are transcription factors reported to be critical for the growth and viability of prostate cancer cells and both the embryonic stem cell and the pluripotent stem cell.
# Protein
KIAA1958 is composed of 716 amino acids and weighs 79212 Da with an iso-electric point of 6.375. Although not much is known about the KIAA1958 protein, scientific predictions have been made using supercomputers for predictions of KIAA1958's structure and function. KIAA1958 undergoes post-translational modifications. The most interesting modification is phosphorylation. In comparison to other proteins, KIAA1958 has a substantially significant amount of serines phosphorylated during post-translational modification. 36 serines are predicted to be phosphorylated.
## Structure
PELE on SDSC Biology WorkBench is supercomputer that is able to predict secondary structure of the KIAA1958 protein. According to this tool, the protein's secondary structure is a combination of alpha helices and beta sheets, in almost equal amount and spread out almost evenly throughout the protein.
## Interactions
There is no known proof that KIAA1958 interacts with any other proteins at this time.
# Homology | KIAA1958
Protein KIAA1958 is a protein that in humans is encoded by the KIAA1958 gene.[1] Orthologs of KIAA1958 go as far back in evolution to chordates, although, it is closer in homology to primates than any other orthologs. KIAA1958 has no known paralogs.
# Gene
KIAA1958 is located on the long arm of chromosome 9 (9.q32) in humans on the plus strand from 115249248 to 115427597.[2] Its mRNA has 2683 bp.[1] The gene has these neighbors on chromosome 9:
HSDL2: Hydroxysteroid dehydrogenase-like protein 2 plays a role in nucleotide binding, oxidoreductase activity, and sterol binding.[3]
C9orf147: Chromosome 9 open reading frame 147 has an unknown function.[4]
C9orf80: Chromosome 9 open reading frame 80 is a component of the SOSS complex, a multiprotein complex that functions downstream of the MRN complex to promote DNA repair and G2/M checkpoint. The SOSS complex associates with single-stranded DNA at DNA lesions and influences diverse endpoints in the cellular DNA damage response including cell cycle checkpoint activation, recombinational repair and maintenance of genomic stability.[5]
SNX30: Sorting nexin-30 may be linked to phosphatidylinositol binding.[6]
# Expression
KIAA1958 is expressed in the highest quantities in the larynx as proposed by EST.[7] The highest expression in developmental stage is the blastocyst and for health state, it is most found in uterine tumors.[7]
Data from NCBI GEO Profile[8] shows that KIAA1958 expression includes many of the tissue types in the human body. Using EMBL-EBI, KIAA1958 was found to be overexpressed in pseudopod RNA during the migration of the metastatic cancer cells.[9] KIAA1958 was also overexpressed in Stat5/ab and stat 3 which are transcription factors reported to be critical for the growth and viability of prostate cancer cells[9] and both the embryonic stem cell and the pluripotent stem cell.[9]
# Protein
KIAA1958 is composed of 716 amino acids and weighs 79212 Da with an iso-electric point of 6.375.[10] Although not much is known about the KIAA1958 protein, scientific predictions have been made using supercomputers for predictions of KIAA1958's structure and function. KIAA1958 undergoes post-translational modifications. The most interesting modification is phosphorylation. In comparison to other proteins, KIAA1958 has a substantially significant amount of serines phosphorylated during post-translational modification. 36 serines are predicted to be phosphorylated.
## Structure
PELE on SDSC Biology WorkBench is supercomputer that is able to predict secondary structure of the KIAA1958 protein.[11] According to this tool, the protein's secondary structure is a combination of alpha helices and beta sheets, in almost equal amount and spread out almost evenly throughout the protein.
## Interactions
There is no known proof that KIAA1958 interacts with any other proteins at this time.[12]
# Homology | https://www.wikidoc.org/index.php/KIAA1958 | |
ac462fc404406d25741ded4b4e003fd3c2c5e046 | wikidoc | Ken Evoy | Ken Evoy
Ken Evoy (born September 25 1953) is currently the founder and CEO of SiteSell Inc. and was one of Canada's most productive toy makers well into the 1990s. This game design company (named Isovoy Inc. - a mix of his and his wife's surnames) went on to create and license more than 20 toy creations between 1985 and 1998.
This history in business, along with the education that resulted from his graduating McGill University with an M.D. in 1979, helped Evoy create SiteSell Inc. This company designs and develops a hosted "Web business-building system" called Site Build It! (SBI!).
With more than 20,000 subscribers , Evoy uses his knowledge of the Internet marketing industry to help "small small businesses" succeed on the Internet.
Evoy's evolution in the online marketing industry has led to the popularity of several now well-known terms online such as "monetization," "keyword" and "preselling."
"Pre-selling is not about hard-selling your product, it's about becoming an expert in the eyes of your visitor by delivering this great information. And once you've accomplished that the...final step, obviously, is about monetizing. "How do I monetize this targeted traffic that's coming in, that's believing in me and turning that into income?The Peter Anthony Holder Show. November 7, 2005. Check date values in: |= (help).mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}"
# Biography
## Early years
Ken Evoy was born on September 25, 1953 in Montreal to Grant Evoy and Simone (née Rioux). Raised in the Montreal area, he attended Loyola_High_School_(Montreal) in Montreal. He went on to study anatomy at McGill University, where he graduated with First Class Honors. He entered Medicine at McGill University in 1975, completing his internship in 1980.
Dr. Evoy practiced as an emergency physician from 1980 to 1990. He was one of three physicians, along with Dr. Marc Afilalo and Dr. Ivan Steiner, responsible for hiring and training two hundred physicians in pre-hospital emergency care at Montreal's newly founded EMS system, Corporation des Urgences Sante du Montreal Metropolitain ("Urgences Santé"). He later practiced as a full-time emergency physician at Hôpital du Sacré-Coeur de Montréal and the Jewish General Hospital. | Ken Evoy
Template:COI
Template:Infobox person
Ken Evoy (born September 25 1953) is currently the founder and CEO of SiteSell Inc. and was one of Canada's most productive toy makers well into the 1990s.[1] This game design company (named Isovoy Inc. - a mix of his and his wife's surnames) went on to create and license more than 20 toy creations between 1985 and 1998.
This history in business, along with the education that resulted from his graduating McGill University with an M.D. in 1979, helped Evoy create SiteSell Inc. This company designs and develops a hosted "Web business-building system" [2] called Site Build It! (SBI!).
With more than 20,000 subscribers [3], Evoy uses his knowledge of the Internet marketing industry to help "small small businesses" succeed on the Internet.
Evoy's evolution in the online marketing industry has led to the popularity of several now well-known terms online such as "monetization," "keyword" and "preselling."[citation needed]
"Pre-selling is not about hard-selling your product, it's about becoming an expert in the eyes of your visitor by delivering this great information. And once you've accomplished that the...final step, obviously, is about monetizing. "How do I monetize this targeted traffic that's coming in, that's believing in me and turning that into income?The Peter Anthony Holder Show. November 7, 2005. Check date values in: |= (help).mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/d/d6/Lock-gray-alt-2.svg/9px-Lock-gray-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/a/aa/Lock-red-alt-2.svg/9px-Lock-red-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}"
# Biography
## Early years
Ken Evoy was born on September 25, 1953 in Montreal to Grant Evoy and Simone (née Rioux). Raised in the Montreal area, he attended Loyola_High_School_(Montreal) in Montreal. He went on to study anatomy at McGill University, where he graduated with First Class Honors. He entered Medicine at McGill University in 1975, completing his internship in 1980.
Dr. Evoy practiced as an emergency physician from 1980 to 1990. He was one of three physicians, along with Dr. Marc Afilalo and Dr. Ivan Steiner, responsible for hiring and training two hundred physicians in pre-hospital emergency care at Montreal's newly founded EMS system, Corporation des Urgences Sante du Montreal Metropolitain ("Urgences Santé"). He later practiced as a full-time emergency physician at Hôpital du Sacré-Coeur de Montréal and the Jewish General Hospital. | https://www.wikidoc.org/index.php/Ken_Evoy | |
87b3c78bd709fb1e704e25bc97b6d949a52dfb5c | wikidoc | Kerosene | Kerosene
# Overview
Kerosene, sometimes spelled kerosine in scientific and industrial usage, is a flammable hydrocarbon liquid. The name is derived from Greek "keros" (κηρός wax).
It is commonly called paraffin oil or paraffin in the UK and South Africa (not to be confused with the waxy solid also called paraffin wax or just paraffin); the term kerosene is usual in much of the U.S., Australia, and New Zealand.
Its heating value, or heat of combustion, is around 18,500 Btu/lb, or 43.1 MJ/kg, making it similar to that of diesel. It is widely used to power jet-engined aircraft, but is also commonly used as a heating fuel.
The Chemical Formula is C14H30.
# Distillation
Kerosene is a thin, clear liquid formed from hydrocarbons. Kerosene is obtained from the fractional distillation of petroleum between 150 °C and 275 °C, resulting in a mixture of carbon chains containing 12 to 15 carbon atoms.
Kerosene was first described by al-Razi (Rhazes) as a distillation of petroleum in 9th century Baghdad. In his Kitab al-Asrar (Book of Secrets), he described two methods for the production of kerosene. One method involved using clay as an absorbent, while the other method involved using ammonium chloride (sal ammoniac). In 1807, Kerosene was refined from a naturally-occurring asphaltum called Albertite by Canadian geologist Abraham Gesner, founding the modern petroleum industry in the process. Gesner went on to establish his Kerosene Gaslight Company to market kerosene around the world in 1850. Scottish chemist James Young built the first truly commercial oil-works in the world at Bathgate in 1851, using oil extracted from locally mined Torbanite, shale and bituminous coal.
Polish chemist Ignacy Łukasiewicz discovered the means of refining kerosene from the less expensive seep oil in 1856.
The widespread availability of cheaper kerosene was the principal factor in the precipitous decline in the whaling industry in the mid- to late 19th century, as the leading product of whaling was oil for lamps.
# Uses
## Heating and lighting
At one time the fuel was widely used in kerosene lamps and lanterns. These were superseded by the electric light bulb and flashlights powered by dry cell batteries.
Its use as a cooking fuel is mostly restricted to some portable stoves for backpackers and to less developed countries, where it is usually less refined and contains impurities and even debris.
As a heating fuel, it is often used in portable stoves, and is sold in some filling stations. It is sometimes used as a heat source during power failures. The use of portable kerosene heaters is not recommended for closed indoor areas without a chimney due to the danger of buildup of carbon monoxide gas.
Kerosene is widely used in Japan as a home heating fuel for portable and installed kerosene heaters. In Japan, kerosene can be readily bought at any filling station or be delivered to homes.
In the United Kingdom and Ireland kerosene is often used as both a cooking and heating fuel in areas where there is a limited gas supply.
The Amish, who limit use of electric appliances for religious reasons, rely on kerosene for lighting and often purchase kerosene-powered versions of appliances such as refrigerators.
More ubiquitous in the late 19th and early 20th centuries, kerosene space heaters were often built into kitchen ranges and kept many farm and fishing families warm and dry through the winter. At one time citrus growers used smudge pots fueled by kerosene to create a pall of thick smoke over a grove in an effort to prevent freezing temperatures from damaging crops. "Salamanders" were kerosene space heaters used on construction sites to dry out building materials and to warm workers. Before the days of blinking electrically lighted road barriers, highway construction zones were marked at night by kerosene fired pot-bellied torches. Most of these uses of kerosene created thick black smoke because of the low temperature of combustion.
A notable exception, discovered in the early 19th century, is the use of a mantle above the wick on a kerosene lamp. Looking like a delicate woven bag above the woven cotton wick, the mantle was a residue of mineral material (thorium dioxide) which glowed white hot as it burned the volatile gases emanating from the blue flame at the base of the wick. These types of lamps are still in use today in areas of the world without electricity.
Kerosene is also used for fire performances such as poi and staff because of its low flash point, making the fire low risk, should the performer come in contact with the flame.
## Transportation
Today, kerosene is mainly used in fuel for jet engines (more technically Avtur, Jet-A, Jet-A1, Jet-B, JP-4, JP-5, JP-7 or JP-8). One form of the fuel known as RP-1 is burned with liquid oxygen as rocket fuel. These fuel grade kerosenes meet specifications as to smoke points and freeze points.
In the early 20th century, kerosene was used as a cheap fuel for tractors. The engine would start on gasoline, then switch over to kerosene once the engine warmed up. A "heat valve" on the manifold would route the exhaust gases around the intake pipe, heating the kerosene to the point where it can be ignited by an electrical spark.
Kerosene is sometimes used as an additive in diesel fuel to prevent gelling or waxing in cold temperatures.
## Cooking
In countries like India, kerosene is the main fuel used for cooking, especially by the poor. Kerosene stoves have replaced the traditional wood-based cooking appliances that are unhealthy and inefficient. The price of kerosene can be a major political issue; the Indian government subsidises the fuel to keep the price very low (around 15cents/litre as of Feb.2007).
## Other
Kerosene has been used to treat pools of standing water to prevent mosquitoes from breeding, notably in the yellow fever outbreak of 1905 in New Orleans. It can also be used to remove lice from hair, but this practice is painful and potentially very dangerous. Also, this would wash out all natural oil & fats from the hair and scalp.
Since kerosene is chemically stable, it is used to store substances with redox tendencies within to prevent unwanted reactions, such as alkali metals.
Kerosene is also used in the packaging and storage of White Phosphorus to prevent immediate combustion on contact with oxygen.
Besides, kerosene can be used to store crystals. When a water-soluble crystal is left in air, dehydration may occur slowly. This makes the colour of the crystal become dull. Kerosene can therefore prevent the crystal contacting with air.
It is used as a solvent and in conjunction with cutting oil as a thread cutting and reaming lubricant.
Kerosene is often used in the entertainment industry, as a fuel for fire dancing. Kerosene is not usually used as a fuel for indoor fire-dancing as it produces an unpleasant odour which becomes, in sufficient concentration, poisonous. In general such use of fire indoors is not common. Methanol is often used instead, but it can be a more dangerous fuel because of its lower flash point, and it also produces less "impressive" flames.
In Sri Lanka, it is also used to help ignite firewood stoves, power electric generators, wash tar and grease from vehicles or hands, remove stains from clothes, and as a rust-loosener and creeping oil. | Kerosene
# Overview
Kerosene, sometimes spelled kerosine in scientific and industrial usage,[1] is a flammable hydrocarbon liquid. The name is derived from Greek "keros" (κηρός wax).
It is commonly called paraffin oil or paraffin in the UK and South Africa (not to be confused with the waxy solid also called paraffin wax or just paraffin); the term kerosene is usual in much of the U.S., Australia, and New Zealand.[2]
Its heating value, or heat of combustion, is around 18,500 Btu/lb, or 43.1 MJ/kg, making it similar to that of diesel. It is widely used to power jet-engined aircraft, but is also commonly used as a heating fuel.
The Chemical Formula is C14H30.
# Distillation
Kerosene is a thin, clear liquid formed from hydrocarbons. Kerosene is obtained from the fractional distillation of petroleum between 150 °C and 275 °C, resulting in a mixture of carbon chains containing 12 to 15 carbon atoms.
Kerosene was first described by al-Razi (Rhazes) as a distillation of petroleum in 9th century Baghdad. In his Kitab al-Asrar (Book of Secrets), he described two methods for the production of kerosene. One method involved using clay as an absorbent, while the other method involved using ammonium chloride (sal ammoniac).[3] In 1807, Kerosene was refined from a naturally-occurring asphaltum called Albertite by Canadian geologist Abraham Gesner, founding the modern petroleum industry in the process. Gesner went on to establish his Kerosene Gaslight Company to market kerosene around the world in 1850. Scottish chemist James Young built the first truly commercial oil-works in the world at Bathgate in 1851, using oil extracted from locally mined Torbanite, shale and bituminous coal.
Polish chemist Ignacy Łukasiewicz discovered the means of refining kerosene from the less expensive seep oil in 1856.
The widespread availability of cheaper kerosene was the principal factor in the precipitous decline in the whaling industry in the mid- to late 19th century, as the leading product of whaling was oil for lamps.
# Uses
## Heating and lighting
At one time the fuel was widely used in kerosene lamps and lanterns. These were superseded by the electric light bulb and flashlights powered by dry cell batteries.
Its use as a cooking fuel is mostly restricted to some portable stoves for backpackers and to less developed countries, where it is usually less refined and contains impurities and even debris.
As a heating fuel, it is often used in portable stoves, and is sold in some filling stations. It is sometimes used as a heat source during power failures. The use of portable kerosene heaters is not recommended for closed indoor areas without a chimney due to the danger of buildup of carbon monoxide gas.
Kerosene is widely used in Japan as a home heating fuel for portable and installed kerosene heaters. In Japan, kerosene can be readily bought at any filling station or be delivered to homes.
In the United Kingdom and Ireland kerosene is often used as both a cooking and heating fuel in areas where there is a limited gas supply.[4]
The Amish, who limit use of electric appliances for religious reasons, rely on kerosene for lighting and often purchase kerosene-powered versions of appliances such as refrigerators.
More ubiquitous in the late 19th and early 20th centuries, kerosene space heaters were often built into kitchen ranges and kept many farm and fishing families warm and dry through the winter. At one time citrus growers used smudge pots fueled by kerosene to create a pall of thick smoke over a grove in an effort to prevent freezing temperatures from damaging crops. "Salamanders" were kerosene space heaters used on construction sites to dry out building materials and to warm workers. Before the days of blinking electrically lighted road barriers, highway construction zones were marked at night by kerosene fired pot-bellied torches. Most of these uses of kerosene created thick black smoke because of the low temperature of combustion.
A notable exception, discovered in the early 19th century, is the use of a mantle above the wick on a kerosene lamp. Looking like a delicate woven bag above the woven cotton wick, the mantle was a residue of mineral material (thorium dioxide) which glowed white hot as it burned the volatile gases emanating from the blue flame at the base of the wick. These types of lamps are still in use today in areas of the world without electricity.
Kerosene is also used for fire performances such as poi and staff because of its low flash point, making the fire low risk, should the performer come in contact with the flame.
## Transportation
Today, kerosene is mainly used in fuel for jet engines (more technically Avtur, Jet-A, Jet-A1, Jet-B, JP-4, JP-5, JP-7 or JP-8). One form of the fuel known as RP-1 is burned with liquid oxygen as rocket fuel. These fuel grade kerosenes meet specifications as to smoke points and freeze points.
In the early 20th century, kerosene was used as a cheap fuel for tractors. The engine would start on gasoline, then switch over to kerosene once the engine warmed up. A "heat valve" on the manifold would route the exhaust gases around the intake pipe, heating the kerosene to the point where it can be ignited by an electrical spark.
Kerosene is sometimes used as an additive in diesel fuel to prevent gelling or waxing in cold temperatures.
## Cooking
In countries like India, kerosene is the main fuel used for cooking, especially by the poor. Kerosene stoves have replaced the traditional wood-based cooking appliances that are unhealthy and inefficient. The price of kerosene can be a major political issue; the Indian government subsidises the fuel to keep the price very low (around 15cents/litre as of Feb.2007).
## Other
Kerosene has been used to treat pools of standing water to prevent mosquitoes from breeding, notably in the yellow fever outbreak of 1905 in New Orleans. It can also be used to remove lice from hair, but this practice is painful and potentially very dangerous. Also, this would wash out all natural oil & fats from the hair and scalp.
Since kerosene is chemically stable, it is used to store substances with redox tendencies within to prevent unwanted reactions, such as alkali metals.
Kerosene is also used in the packaging and storage of White Phosphorus to prevent immediate combustion on contact with oxygen.
Besides, kerosene can be used to store crystals. When a water-soluble crystal is left in air, dehydration may occur slowly. This makes the colour of the crystal become dull. Kerosene can therefore prevent the crystal contacting with air.
It is used as a solvent and in conjunction with cutting oil as a thread cutting and reaming lubricant.
Kerosene is often used in the entertainment industry, as a fuel for fire dancing. Kerosene is not usually used as a fuel for indoor fire-dancing as it produces an unpleasant odour which becomes, in sufficient concentration, poisonous. In general such use of fire indoors is not common. Methanol is often used instead, but it can be a more dangerous fuel because of its lower flash point, and it also produces less "impressive" flames.
In Sri Lanka, it is also used to help ignite firewood stoves, power electric generators, wash tar and grease from vehicles or hands, remove stains from clothes, and as a rust-loosener and creeping oil.[citation needed] | https://www.wikidoc.org/index.php/Kerosene | |
94a342bb4e59df259db1c635025ba45561514297 | wikidoc | Ketamine | Ketamine
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Ketamine is a general anesthetic that is FDA approved for the {{{indicationType}}} of general anesthesia; adjunct, procedural sedation. Common adverse reactions include cardiovascular: hypertension, tachycardia, neurologic: emergence from anesthesia, psychiatric sign or symptom (12% to 50% )..
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
- General anesthesia; adjunct: induction, 1 to 4.5 mg (base)/kg IV single dose
- General anesthesia; adjunct: induction, 1 to 2 mg/kg IV infusion at 0.5 mg/kg/min; in addition to diazepam 2 to 5 mg IV over 1 min
- General anesthesia; adjunct: induction, 6.5 to 13 mg (base)/kg IM
- General anesthesia; adjunct: maintenance, 0.1 to 0.5 mg (base)/min IV infusion, repeat as needed; augmented with diazepam 2 to 5 mg IV
- General anesthesia; adjunct: maintenance, 0.01 to 0.03 mg/kg/min continuous IV infusion
- General anesthesia; adjunct: maintenance, increments of one-half to the full induction dose may be repeated as needed
- Procedural sedation: 1 to 2 mg/kg IV over 1 to 2 min, may be followed by 0.25 to 0.5 mg/kg IV every 5 to 10 min as needed.
- Rapid sequence intubation, Induction: 2 mg/kg IV.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
- General anesthesia; Adjunct.
- Procedural sedation.
### Non–Guideline-Supported Use
- Administration of analgesic - sedation.
- Bronchospasm.
- Rapid sequence intubation, induction
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
- Safety and efficacy have not been established in children younger than 16 years.
- General anesthesia; adjunct: induction, 5 to 10 mg (base)/kg IM; range, 4 to 13 mg/kg.
- General anesthesia; adjunct: induction, 1 to 2 mg/kg IV; range, 0.5 to 4.5 mg/kg.
- General anesthesia; adjunct: maintenance, 0.01 to 0.03 mg/kg/min continuous IV infusion.
- General anesthesia; adjunct: maintenance, increments of one-half to the full induction dose may be repeated as needed.
- Procedural sedation: 0.5 to 2 mg/kg IV over 1 to 2 min, may repeat 0.25 to 1 mg/kg IV (one-half initial dose) every 10 to 15 min as needed.
- Procedural sedation: 2 to 5 mg/kg IM, may repeat 2 to 4 mg/kg after 10 min.
- Rapid sequence intubation, Induction: 1 to 3 mg/kg IV.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information about Off-Label Guideline-Supported Use of Ketamine in pediatric patients.
### Non–Guideline-Supported Use
There is limited information about Off-Label Non–Guideline-Supported Use of Ketamine in pediatric patients.
# Contraindications
- Ketamine hydrochloride is contraindicated in those in whom a significant elevation of blood pressure would constitute a serious hazard and in those who have shown hypersensitivity to the drug.
# Warnings
- Cardiac function should be continually monitored during the procedure in patients found to have hypertension or cardiac decompensation.
- Postoperative confusional states may occur during the recovery period. (See Special Note.)
- Respiratory depression may occur with overdosage or too rapid a rate of administration of Ketamine, in which case supportive ventilation should be employed. Mechanical support of respiration is preferred to administration of analeptics.
# Adverse Reactions
## Clinical Trials Experience
- Blood pressure and pulse rate are frequently elevated following administration of Ketamine alone. However, hypotension and bradycardia have been observed. Arrhythmia has also occurred.
- Although respiration is frequently stimulated, severe depression of respiration or apnea may occur following rapid intravenous administration of high doses of Ketamine. Laryngospasms and other forms of airway obstruction have occurred during Ketamine anesthesia.
- Diplopia and nystagmus have been noted following Ketamine administration. It also may cause a slight elevation in intraocular pressure measurement.
- Severe irritative and inflammatory urinary tract and bladder symptoms including cystitis have been reported in individuals with history of chronic ketamine use or abuse.
- (See Special Note.)
- In some patients, enhanced skeletal muscle tone may be manifested by tonic and clonic movements sometimes resembling seizures (see Dosage And Administration Section).
- Anorexia, nausea and vomiting have been observed; however, this is not usually severe and allows the great majority of patients to take liquids by mouth shortly after regaining consciousness (see Dosage And Administration Section).
- Anaphylaxis. Local pain and exanthema at the injection site have infrequently been reported. Transient erythema and/or morbilliform rash have also been reported.
- For medical advice about adverse reactions contact your medical professional. To report suspected adverse reactions, contact JHP at 1-866-923-2547 or MEDWATCH at 1-800-FDA-1088 (1-800-332-1088) or /.
## Postmarketing Experience
There is limited information regarding Ketamine Postmarketing Experience in the drug label.
# Drug Interactions
- Prolonged recovery time may occur if barbiturates and/or narcotics are used concurrently with Ketamine.
- Ketamine is clinically compatible with the commonly used general and local anesthetic agents when an adequate respiratory exchange is maintained.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- Since the safe use in pregnancy, including obstetrics (either vaginal or abdominal delivery), has not been established, such use is not recommended.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Ketamine in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Ketamine during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Ketamine in women who are nursing.
### Pediatric Use
- Safety and effectiveness in pediatric patients below the age of 16 have not been established.
### Geriatic Use
- Clinical studies of ketamine hydrochloride did not include sufficient numbers of subjects aged 65 and over to determine whether they respond differently from younger subjects. Other reported clinical experience has not identified differences in responses between the elderly and younger patients. In general, dose selection for an elderly patient should be cautious, usually starting at the low end of the dosing range, reflecting the greater frequency of decreased hepatic, renal, or cardiac function, and of concomitant disease or other drug therapy.
### Gender
There is no FDA guidance on the use of Ketamine with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Ketamine with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Ketamine in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Ketamine in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Ketamine in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Ketamine in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Ketamine Administration in the drug label.
### Monitoring
There is limited information regarding Ketamine Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Ketamine and IV administrations.
# Overdosage
- Respiratory depression may occur with overdosage or too rapid a rate of administration of Ketamine, in which case supportive ventilation should be employed. Mechanical support of respiration is preferred to administration of analeptics.
# Pharmacology
## Mechanism of Action
There is limited information regarding Ketamine Mechanism of Action in the drug label.
## Structure
- Ketalar is a nonbarbiturate anesthetic chemically designated dl 2-(0-chlorophenyl)-2-(methylamino) cyclohexanone hydrochloride. It is formulated as a slightly acid (pH 3.5-5.5) sterile solution for intravenous or intramuscular injection in concentrations containing the equivalent of either 10, 50 or 100 mg ketamine base per milliliter and contains not more than 0.1 mg/mL Phemerol® (benzethonium chloride) added as a preservative. The 10 mg/mL solution has been made isotonic with sodium chloride.
## Pharmacodynamics
- Ketamine is a rapid-acting general anesthetic producing an anesthetic state characterized by profound analgesia, normal pharyngeal-laryngeal reflexes, normal or slightly enhanced skeletal muscle tone, cardiovascular and respiratory stimulation, and occasionally a transient and minimal respiratory depression.
- A patent airway is maintained partly by virtue of unimpaired pharyngeal and laryngeal reflexes. (See Warnings And Precautions Sections.)
- The biotransformation of Ketamine includes N-dealkylation (metabolite I), hydroxylation of the cyclohexone ring (metabolites III and IV), conjugation with glucuronic acid and dehydration of the hydroxylated metabolites to form the cyclohexene derivative (metabolite II).
- The anesthetic state produced by Ketamine has been termed "dissociative anesthesia" in that it appears to selectively interrupt association pathways of the brain before producing somatesthetic sensory blockade. It may selectively depress the thalamoneocortical system before significantly obtunding the more ancient cerebral centers and pathways (reticular-activating and limbic systems).
- Elevation of blood pressure begins shortly after injection, reaches a maximum within a few minutes and usually returns to preanesthetic values within 15 minutes after injection. In the majority of cases, the systolic and diastolic blood pressure peaks from 10% to 50% above preanesthetic levels shortly after induction of anesthesia, but the elevation can be higher or longer in individual cases (see Contraindications Section).
- Ketamine has a wide margin of safety; several instances of unintentional administration of overdoses of Ketamine (up to ten times that usually required) have been followed by prolonged but complete recovery.
- Ketamine has been studied in over 12,000 operative and diagnostic procedures, involving over 10,000 patients from 105 separate studies. During the course of these studies Ketamine was administered as the sole agent, as induction for other general agents, or to supplement low-potency agents.
- Specific areas of application have included the following:
- Debridement, painful dressings, and skin grafting in burn patients, as well as other superficial surgical procedures.
- Neurodiagnostic procedures such as pneumonencephalograms, ventriculograms, myelograms, and lumbar punctures. See also Precaution concerning increased intracranial pressure.
- Diagnostic and operative procedures of the eye, ear, nose, and mouth, including dental extractions.
- Diagnostic and operative procedures of the pharynx, larynx, or bronchial tree. NOTE: Muscle relaxants, with proper attention to respiration, may be required (see Precautions Section).
- Sigmoidoscopy and minor surgery of the anus and rectum, and circumcision.
- Extraperitoneal procedures used in gynecology such as dilatation and curettage.
- Orthopedic procedures such as closed reductions, manipulations, femoral pinning, amputations, and biopsies.
- As an anesthetic in poor-risk patients with depression of vital functions.
- In procedures where the intramuscular route of administration is preferred.
- In cardiac catheterization procedures.
- In these studies, the anesthesia was rated either "excellent" or "good" by the anesthesiologist and the surgeon at 90% and 93%, respectively; rated "fair" at 6% and 4%, respectively; and rated "poor" at 4% and 3%, respectively. In a second method of evaluation, the anesthesia was rated "adequate" in at least 90%, and "inadequate" in 10% or less of the procedures.
## Pharmacokinetics
- The biotransformation of Ketamine includes N-dealkylation (metabolite I), hydroxylation of the cyclohexone ring (metabolites III and IV), conjugation with glucuronic acid and dehydration of the hydroxylated metabolites to form the cyclohexene derivative (metabolite II).
- Following intravenous administration, the ketamine concentration has an initial slope (alpha phase) lasting about 45 minutes with a half-life of 10 to 15 minutes. This first phase corresponds clinically to the anesthetic effect of the drug. The anesthetic action is terminated by a combination of redistribution from the CNS to slower equilibrating peripheral tissues and by hepatic biotransformation to metabolite I. This metabolite is about 1/3 as active as ketamine in reducing halothane requirements (MAC) of the rat. The later half-life of ketamine (beta phase) is 2.5 hours.
## Nonclinical Toxicology
There is limited information regarding Ketamine Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Ketamine Clinical Studies in the drug label.
# How Supplied
- Ketamine is supplied as the hydrochloride in concentrations equivalent to ketamine base.
## Storage
- Store between 20° to 25°C (68° to 77°F). (See USP controlled room temperature.)
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
- As appropriate, especially in cases where early discharge is possible, the duration of Ketamine and other drugs employed during the conduct of anesthesia should be considered. The patients should be cautioned that driving an automobile, operating hazardous machinery or engaging in hazardous activities should not be undertaken for 24 hours or more (depending upon the dosage of Ketamine and consideration of other drugs employed) after anesthesia.
# Precautions with Alcohol
Alcohol-Ketamine interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Ketamine Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Ketamine Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Ketamine
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Chetan Lokhande, M.B.B.S [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Ketamine is a general anesthetic that is FDA approved for the {{{indicationType}}} of general anesthesia; adjunct, procedural sedation. Common adverse reactions include cardiovascular: hypertension, tachycardia, neurologic: emergence from anesthesia, psychiatric sign or symptom (12% to 50% )..
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
- General anesthesia; adjunct: induction, 1 to 4.5 mg (base)/kg IV single dose
- General anesthesia; adjunct: induction, 1 to 2 mg/kg IV infusion at 0.5 mg/kg/min; in addition to diazepam 2 to 5 mg IV over 1 min
- General anesthesia; adjunct: induction, 6.5 to 13 mg (base)/kg IM
- General anesthesia; adjunct: maintenance, 0.1 to 0.5 mg (base)/min IV infusion, repeat as needed; augmented with diazepam 2 to 5 mg IV
- General anesthesia; adjunct: maintenance, 0.01 to 0.03 mg/kg/min continuous IV infusion
- General anesthesia; adjunct: maintenance, increments of one-half to the full induction dose may be repeated as needed
- Procedural sedation: 1 to 2 mg/kg IV over 1 to 2 min, may be followed by 0.25 to 0.5 mg/kg IV every 5 to 10 min as needed.
- Rapid sequence intubation, Induction: 2 mg/kg IV.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
- General anesthesia; Adjunct.
- Procedural sedation.
### Non–Guideline-Supported Use
- Administration of analgesic - sedation.
- Bronchospasm.
- Rapid sequence intubation, induction
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
- Safety and efficacy have not been established in children younger than 16 years.
- General anesthesia; adjunct: induction, 5 to 10 mg (base)/kg IM; range, 4 to 13 mg/kg.
- General anesthesia; adjunct: induction, 1 to 2 mg/kg IV; range, 0.5 to 4.5 mg/kg.
- General anesthesia; adjunct: maintenance, 0.01 to 0.03 mg/kg/min continuous IV infusion.
- General anesthesia; adjunct: maintenance, increments of one-half to the full induction dose may be repeated as needed.
- Procedural sedation: 0.5 to 2 mg/kg IV over 1 to 2 min, may repeat 0.25 to 1 mg/kg IV (one-half initial dose) every 10 to 15 min as needed.
- Procedural sedation: 2 to 5 mg/kg IM, may repeat 2 to 4 mg/kg after 10 min.
- Rapid sequence intubation, Induction: 1 to 3 mg/kg IV.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information about Off-Label Guideline-Supported Use of Ketamine in pediatric patients.
### Non–Guideline-Supported Use
There is limited information about Off-Label Non–Guideline-Supported Use of Ketamine in pediatric patients.
# Contraindications
- Ketamine hydrochloride is contraindicated in those in whom a significant elevation of blood pressure would constitute a serious hazard and in those who have shown hypersensitivity to the drug.
# Warnings
- Cardiac function should be continually monitored during the procedure in patients found to have hypertension or cardiac decompensation.
- Postoperative confusional states may occur during the recovery period. (See Special Note.)
- Respiratory depression may occur with overdosage or too rapid a rate of administration of Ketamine, in which case supportive ventilation should be employed. Mechanical support of respiration is preferred to administration of analeptics.
# Adverse Reactions
## Clinical Trials Experience
- Blood pressure and pulse rate are frequently elevated following administration of Ketamine alone. However, hypotension and bradycardia have been observed. Arrhythmia has also occurred.
- Although respiration is frequently stimulated, severe depression of respiration or apnea may occur following rapid intravenous administration of high doses of Ketamine. Laryngospasms and other forms of airway obstruction have occurred during Ketamine anesthesia.
- Diplopia and nystagmus have been noted following Ketamine administration. It also may cause a slight elevation in intraocular pressure measurement.
- Severe irritative and inflammatory urinary tract and bladder symptoms including cystitis have been reported in individuals with history of chronic ketamine use or abuse.[1]
- (See Special Note.)
- In some patients, enhanced skeletal muscle tone may be manifested by tonic and clonic movements sometimes resembling seizures (see Dosage And Administration Section).
- Anorexia, nausea and vomiting have been observed; however, this is not usually severe and allows the great majority of patients to take liquids by mouth shortly after regaining consciousness (see Dosage And Administration Section).
- Anaphylaxis. Local pain and exanthema at the injection site have infrequently been reported. Transient erythema and/or morbilliform rash have also been reported.
- For medical advice about adverse reactions contact your medical professional. To report suspected adverse reactions, contact JHP at 1-866-923-2547 or MEDWATCH at 1-800-FDA-1088 (1-800-332-1088) or http://www.fda.gov/medwatch/.
## Postmarketing Experience
There is limited information regarding Ketamine Postmarketing Experience in the drug label.
# Drug Interactions
- Prolonged recovery time may occur if barbiturates and/or narcotics are used concurrently with Ketamine.
- Ketamine is clinically compatible with the commonly used general and local anesthetic agents when an adequate respiratory exchange is maintained.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- Since the safe use in pregnancy, including obstetrics (either vaginal or abdominal delivery), has not been established, such use is not recommended.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Ketamine in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Ketamine during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Ketamine in women who are nursing.
### Pediatric Use
- Safety and effectiveness in pediatric patients below the age of 16 have not been established.
### Geriatic Use
- Clinical studies of ketamine hydrochloride did not include sufficient numbers of subjects aged 65 and over to determine whether they respond differently from younger subjects. Other reported clinical experience has not identified differences in responses between the elderly and younger patients. In general, dose selection for an elderly patient should be cautious, usually starting at the low end of the dosing range, reflecting the greater frequency of decreased hepatic, renal, or cardiac function, and of concomitant disease or other drug therapy.
### Gender
There is no FDA guidance on the use of Ketamine with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Ketamine with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Ketamine in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Ketamine in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Ketamine in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Ketamine in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Ketamine Administration in the drug label.
### Monitoring
There is limited information regarding Ketamine Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Ketamine and IV administrations.
# Overdosage
- Respiratory depression may occur with overdosage or too rapid a rate of administration of Ketamine, in which case supportive ventilation should be employed. Mechanical support of respiration is preferred to administration of analeptics.
# Pharmacology
## Mechanism of Action
There is limited information regarding Ketamine Mechanism of Action in the drug label.
## Structure
- Ketalar is a nonbarbiturate anesthetic chemically designated dl 2-(0-chlorophenyl)-2-(methylamino) cyclohexanone hydrochloride. It is formulated as a slightly acid (pH 3.5-5.5) sterile solution for intravenous or intramuscular injection in concentrations containing the equivalent of either 10, 50 or 100 mg ketamine base per milliliter and contains not more than 0.1 mg/mL Phemerol® (benzethonium chloride) added as a preservative. The 10 mg/mL solution has been made isotonic with sodium chloride.
## Pharmacodynamics
- Ketamine is a rapid-acting general anesthetic producing an anesthetic state characterized by profound analgesia, normal pharyngeal-laryngeal reflexes, normal or slightly enhanced skeletal muscle tone, cardiovascular and respiratory stimulation, and occasionally a transient and minimal respiratory depression.
- A patent airway is maintained partly by virtue of unimpaired pharyngeal and laryngeal reflexes. (See Warnings And Precautions Sections.)
- The biotransformation of Ketamine includes N-dealkylation (metabolite I), hydroxylation of the cyclohexone ring (metabolites III and IV), conjugation with glucuronic acid and dehydration of the hydroxylated metabolites to form the cyclohexene derivative (metabolite II).
- The anesthetic state produced by Ketamine has been termed "dissociative anesthesia" in that it appears to selectively interrupt association pathways of the brain before producing somatesthetic sensory blockade. It may selectively depress the thalamoneocortical system before significantly obtunding the more ancient cerebral centers and pathways (reticular-activating and limbic systems).
- Elevation of blood pressure begins shortly after injection, reaches a maximum within a few minutes and usually returns to preanesthetic values within 15 minutes after injection. In the majority of cases, the systolic and diastolic blood pressure peaks from 10% to 50% above preanesthetic levels shortly after induction of anesthesia, but the elevation can be higher or longer in individual cases (see Contraindications Section).
- Ketamine has a wide margin of safety; several instances of unintentional administration of overdoses of Ketamine (up to ten times that usually required) have been followed by prolonged but complete recovery.
- Ketamine has been studied in over 12,000 operative and diagnostic procedures, involving over 10,000 patients from 105 separate studies. During the course of these studies Ketamine was administered as the sole agent, as induction for other general agents, or to supplement low-potency agents.
- Specific areas of application have included the following:
- Debridement, painful dressings, and skin grafting in burn patients, as well as other superficial surgical procedures.
- Neurodiagnostic procedures such as pneumonencephalograms, ventriculograms, myelograms, and lumbar punctures. See also Precaution concerning increased intracranial pressure.
- Diagnostic and operative procedures of the eye, ear, nose, and mouth, including dental extractions.
- Diagnostic and operative procedures of the pharynx, larynx, or bronchial tree. NOTE: Muscle relaxants, with proper attention to respiration, may be required (see Precautions Section).
- Sigmoidoscopy and minor surgery of the anus and rectum, and circumcision.
- Extraperitoneal procedures used in gynecology such as dilatation and curettage.
- Orthopedic procedures such as closed reductions, manipulations, femoral pinning, amputations, and biopsies.
- As an anesthetic in poor-risk patients with depression of vital functions.
- In procedures where the intramuscular route of administration is preferred.
- In cardiac catheterization procedures.
- In these studies, the anesthesia was rated either "excellent" or "good" by the anesthesiologist and the surgeon at 90% and 93%, respectively; rated "fair" at 6% and 4%, respectively; and rated "poor" at 4% and 3%, respectively. In a second method of evaluation, the anesthesia was rated "adequate" in at least 90%, and "inadequate" in 10% or less of the procedures.
## Pharmacokinetics
- The biotransformation of Ketamine includes N-dealkylation (metabolite I), hydroxylation of the cyclohexone ring (metabolites III and IV), conjugation with glucuronic acid and dehydration of the hydroxylated metabolites to form the cyclohexene derivative (metabolite II).
- Following intravenous administration, the ketamine concentration has an initial slope (alpha phase) lasting about 45 minutes with a half-life of 10 to 15 minutes. This first phase corresponds clinically to the anesthetic effect of the drug. The anesthetic action is terminated by a combination of redistribution from the CNS to slower equilibrating peripheral tissues and by hepatic biotransformation to metabolite I. This metabolite is about 1/3 as active as ketamine in reducing halothane requirements (MAC) of the rat. The later half-life of ketamine (beta phase) is 2.5 hours.
## Nonclinical Toxicology
There is limited information regarding Ketamine Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Ketamine Clinical Studies in the drug label.
# How Supplied
- Ketamine is supplied as the hydrochloride in concentrations equivalent to ketamine base.
## Storage
- Store between 20° to 25°C (68° to 77°F). (See USP controlled room temperature.)
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
- As appropriate, especially in cases where early discharge is possible, the duration of Ketamine and other drugs employed during the conduct of anesthesia should be considered. The patients should be cautioned that driving an automobile, operating hazardous machinery or engaging in hazardous activities should not be undertaken for 24 hours or more (depending upon the dosage of Ketamine and consideration of other drugs employed) after anesthesia.
# Precautions with Alcohol
Alcohol-Ketamine interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Ketamine Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Ketamine Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Ketalar | |
39b16586285e74fd5477666605b92fb4955627fc | wikidoc | Kilogram | Kilogram
# Overview
The kilogram or kilogramme (symbol: kg) is the base unit of mass in the International System of Units (known also by its French-language initials “SI”). The kilogram is defined as being equal to the mass of the International Prototype Kilogram (IPK; known also by its French-language name Le Grand K), which is almost exactly equal to the mass of one liter of water. It is the only SI base unit with an SI prefix as part of its name. It is also the only SI unit that is still defined in relation to an artifact rather than to a fundamental physical property that can be reproduced in different laboratories.
In everyday usage, the mass of an object in kilograms is often referred to as its weight, although strictly speaking the weight of an object is the gravitational force on it, measured in newtons (see also Kilogram-force). Similarly, the avoirdupois pound, used in both the Imperial system and U.S. customary units, is a unit of mass and its related unit of force is the pound-force. The avoirdupois pound is defined as exactly 0.45359237 kg, making one kilogram approximately equal to 2.205 avoirdupois pounds.
Many units in the SI system are defined relative to the kilogram so its stability is important. After the International Prototype Kilogram had been found to vary in mass over time, the International Committee for Weights and Measures (known also by its French-language initials CIPM) recommended in 2005 that the kilogram be redefined in terms of fundamental constants of nature.
# The nature of mass
The kilogram is a unit of mass, the measurement of which corresponds to the general, everyday notion of how “heavy” something is. However, mass is actually an inertial property; that is, the tendency of an object to remain at constant velocity unless acted upon by an outside force. An object with a mass of one kilogram will accelerate at one meter per second squared (about one-tenth the acceleration due to Earth’s gravity) when acted upon by a force of one newton (symbol: N).
While the weight of matter is entirely dependent upon the strength of local gravity, the mass of matter is constant (assuming it is not traveling at a relativistic speed with respect to an observer). Accordingly, for astronauts in microgravity, no effort is required to hold objects off the cabin floor; they are “weightless.” However, since objects in microgravity still retain their mass, an astronaut must exert ten times as much force to accelerate a 10-kilogram object at the same rate as a 1-kilogram object.
# History
### Early definitions
On 7 April 1795, the gram was decreed in France to be equal to “the absolute weight of a volume of water equal to the cube of the hundredth part of the meter, at the temperature of melting ice.” Since trade and commerce typically involve items significantly more massive than one gram, and since a mass standard made of water would be inconvenient and unstable, the regulation of commerce necessitated the manufacture of a practical realization of the water-based definition of mass. Accordingly, a provisional mass standard was made as a single-piece, metallic artifact one thousand times more massive than the gram—the kilogram.
At the same time, work was commissioned to precisely determine the mass of a cubic decimeter (one liter) of water. Although the decreed definition of the kilogram specified water at 0 °C—its highly stable temperature point—the scientists in 1799 chose to redefine the standard to water’s most stable density point: the temperature at which water reaches maximum density, which was measured at the time as 4 °C. They concluded that one cubic decimeter of water at its maximum density was equal to 99.92072% of the mass of the provisional kilogram made four years earlier. That same year, 1799, an all-platinum kilogram prototype was fabricated with the objective that it would equal, as close as was scientifically feasible for the day, the mass of a cubic decimeter of water at 4 °C. The prototype was presented to the Archives of the Republic in June and on 10 December 1799, the prototype was formally ratified as the Kilogramme des Archive (Kilogram of the Archives) and the kilogram was defined as being equal to its mass. This standard stood for the next ninety years.
### International Prototype Kilogram
Since 1889, the SI system defines the magnitude of the kilogram to be equal to the mass of the International Prototype Kilogram, often referred to in the professional metrology world as the “IPK”. The IPK is made of an alloy of 90% platinum and 10% iridium (by weight) and is machined into a right-circular cylinder (height = diameter) of 39.17 mm to minimize its surface area. The addition of 10% iridium improved upon the all-platinum Kilogram of the Archives by greatly increasing hardness while still retaining platinum’s many virtues: extreme resistance to oxidation, extremely high density, satisfactory electrical and thermal conductivities, and low magnetic susceptibility. The IPK and its six sister copies are stored in an environmentally monitored safe in the lower vault located in the basement of the BIPM’s House of Breteuil in Sèvres on the outskirts of Paris (see Links to photographs, below for images). Three independently controlled keys are required to open the vault. Official copies of the IPK were made available to other nations to serve as their national standards. These are compared to the IPK roughly every 50 years.
The IPK is one of three cylinders made in 1879. In 1883, it was found to be indistinguishable from the mass of the Kilogram of the Archives made eighty-four years prior, and was formally ratified as the kilogram by the 1st CGPM in 1889. Modern measurements of the density of Vienna Standard Mean Ocean Water—purified water that has a carefully controlled isotopic composition—show that a cubic decimeter of water at its point of maximum density, 3.984 °C, has a mass that is 25.05 parts per million less than the kilogram. This small, 25 ppm difference, and the fact that the mass of the IPK was indistinguishable from the mass of the Kilogram of the Archives, speak volumes of the scientists’ skills over Template:Age years ago when making their measurements of water’s properties and in manufacturing the Kilogram of the Archives.
# Stability of the International Prototype Kilogram
By definition, the error in the measured value of the IPK’s mass is exactly zero; the IPK is the kilogram. However, any changes in the IPK’s mass over time can be deduced by comparing its mass to that of its official copies stored throughout the world, a process called “periodic verification.” For instance, the U.S. owns four platinum-iridium (“Pt-10Ir”) kilogram standards, two of which, K4 and K20, are from the original batch of 40 replicas delivered in 1884. The K20 prototype was designated as the primary national standard of mass for the U.S. Both of these, as well as those from other nations, are periodically returned to the BIPM for verification.
Note that the masses of the replicas are not precisely equal to that of the IPK; their masses are calibrated and documented as offset values. For instance, K20, the U.S.’s primary standard, originally had an official mass of 1 kg–39 µg in 1889; that is to say, K20 was 39 µg less than the IPK. A verification performed in 1948 showed a mass of 1 kg–19 µg. The latest verification performed in 1999 shows a mass identical to its original 1889 value. The mass of K4, the U.S.’s check standard, as of 1999 was officially calibrated as 1 kg–116 µg. However, it was 41 µg more massive (in comparison to the IPK) in 1889.
Since the IPK and its replicas are stored in air (albeit under two or more nested bell jars), they adsorb atmospheric contamination onto their surfaces and gain mass. Accordingly, they are cleaned in a process the BIPM developed between 1939 and 1946 known as “the BIPM cleaning method” that comprises lightly rubbing with a chamois soaked in equal parts ether and ethanol, steam-cleaning with bi-distilled water, and allowing the prototypes to settle for 7–10 days before period verification. Cleaning the prototypes removes between 5 and 60 µg of contamination depending largely on the time elapsed since the last cleaning. Further, a second cleaning can remove up to 10 µg more. After cleaning—even when they are stored under their bell jars—the IPK and its replicas immediately begin gaining mass again. The BIPM even developed a model of this gain and concluded that it averaged 1.11 µg per month for the first 3 months after cleaning and then decreased to an average of about 1 µg per year thereafter. Since check standards like K4 are not cleaned for routine calibrations of other mass standards—a precaution to minimize the potential for wear and handling damage—the BIPM’s model has been used as an “after cleaning” correction factor.
Because the first forty official copies are made of the same alloy as the IPK and are stored under similar conditions, periodic verifications using a large number of replicas—especially the national primary standards, which are rarely used—can convincingly demonstrate the stability of the IPK. What has become clear after the third periodic verification performed between 1988 and 1992 is that masses of the entire worldwide ensemble of prototypes have been slowly but inexorably diverging from each other. It is also clear that the mass of the IPK lost perhaps 50 µg over the last century, and possibly significantly more, in comparison to its official copies. The answer as to why this might be the case has proved elusive for physicists who have dedicated their careers to the SI unit of mass. No plausible mechanism has been proposed to explain either a steady decrease in the mass of the IPK, or an increase in that of its replicas dispersed throughout the world. This relative nature of the changes amongst the world’s kilogram prototypes is often misreported in the popular press, and even some notable scientific magazines, which often state that the IPK simply “lost 50 µg” and omit the very important caveat of “in comparison to its official copies.” Further, there is no technical means available to determine whether or not the entire worldwide ensemble of prototypes suffer from even greater long-term trends upwards or downwards because their mass “relative to an invariant of nature is unknown at a level below 1000 µg over a period of 100 or even 50 years.” Given the lack of data identifying which of the world’s kilogram prototypes has been most stable in absolute terms, it is equally as valid to state that the first batch of replicas has, as a group, gained an average of about 25 µg over one hundred years in comparison to the IPK.
What is known specifically about the IPK is that it exhibits a short-term instability of about 30 µg over a period of about a month in its after-cleaned mass. The precise reason for this short-term instability is not understood but is thought to entail surface effects: microscopic differences between the prototypes’ polished surfaces, possibly aggravated by hydrogen absorption due to catalysis of the volatile organic compounds that slowly deposit onto the prototypes as well as the hydrocarbon-based solvents used to clean them.
Scientists are seeing far greater variability in the prototypes than previously believed. The increasing divergence in the masses of the world’s prototypes and the short-term instability in the IPK has prompted research into improved methods to obtain a smooth surface finish using diamond-turning on newly manufactured replicas and has intensified the search for a new definition of the kilogram. See Proposed future definitions, below.
# Importance of the kilogram
The stability of the IPK is crucial because the kilogram underpins much of the SI system of measurement as it is currently defined and structured. For instance, the newton is defined as the force necessary to accelerate the kilogram by one meter per second squared. If the mass of the IPK were to change slightly, so too must the newton by a proportional degree. In turn, the pascal, the SI unit of pressure, is defined in terms of the newton. This chain of dependency follows to many other SI units of measure. For instance, the joule, the SI unit of energy, is defined as that expended when a force of one newton acts through one meter. Next to be affected is the SI unit of power, the watt, which is one joule per second. The ampere too is defined relative to the newton, and ultimately, the kilogram. With the magnitude of the primary units of electricity thus determined by the kilogram, so too follow many others; namely, the coulomb, volt, tesla, and weber. Even units used in the measure of light would be affected. The candela—following the change in the watt—would in turn affect the lumen and lux.
Because the magnitude of many of the units comprising the SI system of measurement is ultimately defined by the mass of a Template:Age-year-old, golf ball-size piece of metal, the quality of the IPK must be diligently protected in order to preserve the integrity of the SI system. Yet, in spite of the best stewardship, the IPK has likely already lost 4.4 µg relative to the average mass of the worldwide ensemble of prototypes since the third periodic verification Template:Age years ago. Further, the world’s national metrology labs must wait for the fourth periodic verification to confirm whether the historical trends persisted.
Fortunately, definitions of the SI units are quite different from their practical realizations. For instance, the meter is defined as the distance light travels in a vacuum during a time interval of 1⁄299,792,458 of a second. However, the meter’s practical realization typically takes the form of a helium-neon laser, and the meter’s length is delineated—not defined—as 1,579,800.298728 wavelengths of light from this laser. Now suppose that the official measurement of the second was found to have drifted by a few parts per billion (it is actually exquisitely stable). There would be no automatic effect on the meter because the second—and thus the meter’s length—is abstracted via the laser comprising the meter’s practical realization. Scientists performing meter calibrations would simply continue to measure out the same number of laser wavelengths until an agreement was reached to do otherwise. The same is true with regard to the real-world dependency on the kilogram: if the mass of the IPK was found to have changed slightly, there would be no automatic effect upon the other units of measure because their practical realizations provide an insulating layer of abstraction. Any discrepancy would eventually have to be reconciled though because the virtue of the SI system is its precise mathematical and logical harmony amongst its units. If the IPK’s value were definitively proven to have changed, one solution would be to simply redefine the kilogram as being equal to the mass of the IPK plus an offset value, similarly to what is currently done with its replicas; e.g., “the kilogram is equal to the mass of the IPK + 42 ppb.”
The long-term solution to this problem, however, is to liberate the SI system’s dependency on the IPK by developing a practical realization of the kilogram that can be reproduced in different laboratories by following a written specification. The units of measure in such a practical realization would have their magnitudes precisely defined and expressed in terms of fundamental physical constants. While major portions of the SI system would still be based on the kilogram, the kilogram would in turn be based on invariant, universal constants of nature. While this is a worthwhile objective and much work towards that end is ongoing, no alternative has achieved the uncertainty of a couple parts in 108 (~20 µg) required to improve upon the IPK. However, as of April 2007, the NIST’s implementation of the watt balance was approaching this goal, with a demonstrated uncertainty of 36 µg. See Watt balance, below.
# Proposed future definitions
The kilogram is the only SI unit that is still defined in relation to an artifact. Note that the meter was also once defined as an artifact (a single platinum-iridium bar with two marks on it). However, it was eventually redefined in terms of invariant, fundamental constants of nature that are delineated via practical realizations (apparatus) that can be reproduced in different laboratories by following a written specification. Today, physicists are investigating various approaches to do the same with the kilogram. Some of the approaches are fundamentally very different from each other. Some are based on equipment and procedures that enable the reproducible production of new, kilogram-mass prototypes on demand (albeit with extraordinary effort) using measurement techniques and material properties that are ultimately based on, or traceable to, fundamental constants. Others are devices that measure either the acceleration or weight of hand-tuned, kilogram test masses and which express their magnitudes in electrical terms via special components that permit traceability to fundamental constants. Measuring the weight of test masses requires the precise measurement of the strength of gravity in laboratories. All approaches would precisely fix one or more constants of nature at a defined value. These different approaches are as follows:
### Atom-counting approaches
Though not offering a practical realization, this definition would precisely define the magnitude of the kilogram in terms of a certain number of carbon-12 atoms. Carbon-12 is a certain isotope of carbon. The mole is currently defined as “the quantity of entities (elementary particles like atoms or molecules) equal to the number of atoms in 12 grams of carbon-12.” Thus, the current definition of the mole requires that 1000/12 (83⅓) moles of C-12 has a mass of precisely one kilogram. The number of atoms in a mole, a quantity known as the Avogadro constant, is an experimentally determined value that is currently measured as being 6.02214179(30)×1023 atoms (2006 CODATA value). This new definition of the kilogram proposes to fix the Avogadro constant at precisely 6.02214179×1023 and the kilogram would be defined as “the mass equal to that of 83⅓ · 6.02214179×1023 atoms of carbon-12.”
Currently, the uncertainty in the Avogadro constant is determined by the uncertainty in the measured mass of carbon-12 atoms (a relative standard uncertainty of 50 parts per billion at this time). By fixing the Avogadro constant, the practical effect of this proposal would be that the precise magnitude of the kilogram would be subject to future refinement as improved measurements of the mass of carbon-12 atoms become available; electronic realizations of the kilogram would be recalibrated as required. In an electronic definition of the kilogram, 83⅓ moles of carbon-12 would—by definition—continue to have a mass of precisely one kilogram and the Avogadro constant would continue to have uncertainty in its precise value.
A variation on a carbon-12-based definition proposes to define the Avogadro constant as being precisely 84,446,8863
(≈6.02214098×1023 atoms. An imaginary realization of a 12-gram mass prototype would be a cube of carbon-12 atoms measuring precisely 84,446,886 atoms across on a side. With this proposal, the kilogram would be defined as “the mass equal to 84,446,8863 × 83⅓ atoms of carbon-12.” The value 84,446,886 was chosen because it has a special property; its cube (the proposed new value for the Avogadro constant) is evenly divisible by twelve. Thus with this definition of the kilogram, there would be an integer number of atoms in one gram of carbon-12: 50,184,508,190,229,061,679,538 atoms.
Another Avogadro constant-based approach, known as the Avogadro project, would define and delineate the kilogram as a softball-size sphere of silicon atoms. Silicon was chosen because a commercial infrastructure with mature processes for creating defect-free, ultra-pure monocrystalline silicon already exists to service the semiconductor industry. To make a practical realization of the kilogram, a silicon boule (a rod-like, single-crystal ingot) would be produced. Its isotopic composition would be measured with a mass spectrometer to determine its average atomic mass. The rod would be cut, ground, and polished into spheres. The size of a select sphere would be measured using optical interferometry to an uncertainty of about 0.3 nm on the radius—roughly a single atomic layer. The precise lattice spacing between the atoms in its crystal structure (≈192 pm) would be measured using a scanning X-ray interferometer. This permits its atomic spacing to be determined with an uncertainty of only three parts per billion. With the size of the sphere, its average atomic mass, and its atomic spacing known, the required sphere diameter can be calculated with sufficient precision and uncertainty to enable it to be finish-polished to a target mass of one kilogram.
Experiments are being performed on the Avogadro Project’s silicon spheres to determine whether their masses are most stable when stored in a vacuum, a partial vacuum, or ambient pressure. However, no technical means currently exist to prove a long-term stability any better than that of the IPK’s because the most sensitive and accurate measurements of mass are made with dual-pan balances like the BIPM’s FB-2 flexure-strip balance (see Links to photographs, below). Balances can only compare the mass of a silicon sphere to that of a reference mass. Given the latest understanding of the lack of long-term mass stability with the IPK and its replicas, there is no known, perfectly stable mass artifact to compare against. Single-pan scales capable of measuring weight relative to an invariant of nature with a long-term uncertainty of only 10–20 parts per billion do not yet exist. Another issue to be overcome is that silicon oxidizes and forms a thin layer (equivalent to 5–20 silicon atoms) of silicon dioxide (common glass) and silicon monoxide. This layer slightly increases the mass of the sphere, an effect which must be accounted for when polishing the sphere to its finish dimension. Oxidation is not an issue with platinum and iridium, both of which are noble metals that are roughly as cathodic as oxygen and therefore don’t oxidize unless coaxed to do so in the laboratory. The presence of the thin oxide layer on a silicon-sphere mass prototype places additional restrictions on the procedures that might be suitable to clean it to avoid changing the layer’s thickness or oxide stoichiometry.
All silicon-based approaches would fix the Avogadro constant but vary in the details of the definition of the kilogram. One approach would use silicon with all three of its natural isotopes present. About 7.77% of silicon comprises the two heavier isotopes: silicon-29 and silicon-30. As described in Carbon–12 above, this method would define the magnitude of the kilogram in terms of a certain number of carbon-12 atoms by fixing the Avogadro constant; the silicon sphere would be the practical realization. This approach could accurately delineate the magnitude of the kilogram because the mass of the three silicon isotopes relative to carbon-12 are known with great precision. An alternative method for creating a silicon sphere-based kilogram proposes to use isotopic separation techniques to enrich the silicon until it is nearly pure silicon-28, which has an atomic mass of 27.9769271(7)u=g/mol. With this approach, the Avogadro constant would not only be fixed, but so too would the atomic mass of silicon-28. As such, the definition of the kilogram would be decoupled from carbon-12 and the kilogram would instead be defined as 1000/27.9769271 · 6.022141793×1023 atoms of silicon-28 (≈35.7437397 fixed moles of silicon-28 atoms). Physicists could elect to define the kilogram in terms of silicon-28 even when kilogram prototypes are made of natural silicon (all three isotopes present). Even with a kilogram definition based on silicon-28, a silicon-sphere prototype made of nearly pure silicon-28 would necessarily deviate slightly from the defined number of moles of silicon in order to compensate for various chemical and isotopic impurities as well as the effect of surface oxides.
Another Avogadro-based approach, ion accumulation, would define and delineate the kilogram by precisely creating new metal prototypes on demand. It would do so by accumulating gold or bismuth ions (atoms stripped of an electron) and counting them by measuring the electrical current required to neutralize the ions. Gold and bismuth were chosen because they can be safely handled and have the two highest atomic masses among the mononuclidic elements that can be treated as if they are non-radioactive (bismuth) or perfectly stable (gold). See also Table of nuclides.
With a gold-based definition of the kilogram for instance, the atomic mass of gold would be fixed as precisely 196.966569g/mol, from the current value of 196.966569(4)g/mol. As with a definition based upon carbon-12, the Avogadro constant would also be fixed. The kilogram would then be defined as “the mass equal to that of precisely 1000/196.966569 · 6.02214179×1023 atoms of gold” (3,057,443,616,231,138,188,734,962 atoms of gold ≈5.0770037021 fixed moles).
Ion-accumulation techniques, while a relatively new field of study, have advanced rapidly. In 2003, experiments with gold at a current of only 10 µA demonstrated a relative uncertainty of 1.5%. Yet, follow-on experiments using bismuth ions and a current of 30 mA were expected to accumulate a mass of 30 g in six days and to have a relative uncertainty of better than 1 part in 106.
Among the many technical challenges of the ion-deposition apparatus is in obtaining sufficiently high ion currents while simultaneously decelerating the ions so they can all deposit onto the target electrode imbedded in a balance pan. Experiments with gold showed that the ions must be decelerated to very low energies to avoid sputtering effects, which essentially gold-plates the inside of the deposition chamber and diminishes the mass retained on the electrode. The deposited mass fraction approaches very close to 100% at ion energies of less than around 1 eV (<1 km/s).
If the kilogram is one day defined as a precise quantity of gold or bismuth atoms deposited with an electric current, not only would the Avogadro constant and the atomic mass of gold or bismuth be precisely fixed, but so too would the value of the ampere. This would be brought about by precisely fixing the value of the elementary charge (e), likely to 1.602176487×10-19 coulomb (from the present 2006 CODATA value of 1.602176487(40)×10-19 . Doing so would effectively define the ampere as a flow of 1/1.602176487×10-19 (6,241,509,647,120,417,390) electrons per second past a fixed point in an electric circuit. The SI unit of mass would thus be fully defined by having precisely fixed the values of the Avogadro constant and elementary charge, and by exploiting the fact that the atomic masses of bismuth and gold atoms are invariant, universal constants of nature.
One challenge in maturing an ion-accumulation-based kilogram into a practical realization is the development of a deposition chamber/balance system that enables the convenient calibration of a reasonable quantity of transfer standards relative to any single internal ion-deposited prototype. The mass prototypes produced by ion deposition techniques are nothing like the freestanding platinum-iridium prototypes currently in use; they are deposited onto—and become part of—an electrode imbedded into one pan of a special balance that is part of the device. Further, the ion-deposited material doesn’t have a hard, highly polished surface that can be vigorously cleaned like those of current prototypes. Gold, while dense and a noble metal (resistant to oxidation and the formation of other compounds), is extremely soft so an internal gold prototype would have to be kept well isolated and scrupulously clean to avoid contamination and the potential of wear from having to remove the contamination. Bismuth, which is an inexpensive metal used in low-temperature solders, slowly oxidizes when exposed to room-temperature air and forms other chemical compounds and so, would not produce a stable reference mass unless it was continually maintained in a vacuum or inert atmosphere.
### Electronic approaches
The watt balance is essentially a single-pan weighing scale that measures the electric power necessary to oppose the weight of a kilogram test mass as it is accelerated by gravity. It is a variation of an ampere balance in that it employs an extra calibration step that nulls the effect of geometry. The electric potential in the watt balance is delineated by a Josephson voltage standard, which allows voltage to be linked to an invariant constant of nature with extremely high precision and stability. Its circuit resistance is calibrated against a quantum Hall resistance standard. The watt balance requires exquisitely precise measurement of gravity in a laboratory (see “FG-5 absolute gravimeter” in Links to photographs, below). For instance, the gravity gradient of 3.1 µGal/cm (≈3 ppb/cm) is accounted for when the elevation of the center of the gravimeter differs from that of the nearby test mass. As of April 2007, the NIST’s implementation of the watt balance was demonstrating a combined relative standard uncertainty (CRSU) at 68% probability of 36 µg and a short-term resolution of 10–15 µg. The UK’s National Physical Laboratory’s watt balance as of 2007, was demonstrating a CRSU of 70.3 µg.
Ultimately, the watt balance would define the kilogram in terms of the Planck constant, which is a measure that relates the energy of photons to their frequency. The Planck constant would be fixed, where h = 6.62606896×10-34J·s (from the 2006 CODATA value of 6.62606896(33)×10-34J·s) and the kilogram would be defined as “the mass of a body at rest whose equivalent energy equals the energy of photons whose frequencies sum to 1.356392733×1050 Hz.”
The virtue of electronic realizations like the watt balance is that the definition and dissemination of the kilogram would no longer be dependent upon the stability of kilogram prototypes, which must be very carefully handled and stored. It would free physicists from the need to rely on assumptions about the stability of those prototypes, including those that would be manufactured under atom-counting schemes. Instead, hand-tuned, close-approximation mass standards would simply be weighed and documented as being equal to one kilogram plus an offset value. With scales, the kilogram would not only be defined in electrical terms, it would also be delineated in electrical terms. Mass artifacts calibrated in a watt balance would effectively become transfer standards. Further, one additional term in all scale-based realizations—acceleration due to gravity—is currently measured using dropping-mass absolute gravimeters that contain an iodine-stabilized HeNe laser interferometer. The fringe-signal, frequency-sweep output from the interferometer is measured with a rubidium atomic clock. Thus, the ‘gravity’ term in the delineation of an all-electronic kilogram would also be measured relative to invariants of nature.
Scales like the watt balance also permit more flexibility in choosing materials with especially desirable properties for mass standards. For instance, Pt-10Ir could continue to be used so that the specific gravity of newly produced mass standards would be the same as existing national primary and check standards (≈21.55 g/ml). This would reduce the relative uncertainty when making mass comparisons in air. Alternately, entirely different materials and constructions could be explored with the objective of producing mass standards with greater stability. For instance, osmium-iridium alloys could be investigated if platinum’s propensity to absorb hydrogen (due to catalysis of VOCs and hydrocarbon-based cleaning solvents) and atmospheric mercury proved to be sources of instability. Also, vapor-deposited, protective ceramic coatings like nitrides could be investigated for their suitability to isolate these new alloys.
The challenge with watt balances is not only in reducing their uncertainty, but also in making them truly practical realizations of the kilogram. Nearly every aspect of watt balances and their support equipment requires such extraordinarily precise and accurate, state-of-the-art technology that—unlike a device like an atomic clock—few countries would currently choose to fund their operation. For instance, the NIST’s watt balance uses four resistance standards, each of which is rotated through the watt balance every two to six weeks after being calibrated in a different part of the facility. Simply moving the resistance standards down the hall to the watt balance alters their values 10 ppb (equivalent to 10 µg) or more. The plan is to eventually collocate the watt balance and the calibration equipment so the resistance standards can be calibrated in place. Still, present-day technology is insufficient to permit stable operation of watt balances between even biannual calibrations. If the kilogram is defined in terms of the Planck constant, it is likely there may only be a few—at most—watt balances initially operating in the world.
This approach would define the kilogram as “the mass which would be accelerated at precisely 2 × 10–7 m/s² when subjected to the per-meter force between two straight parallel conductors of infinite length, of negligible circular cross section, placed 1 meter apart in vacuum, through which flow a constant current of 1/1.602176487×10−19 (6,241,509,647,120,417,390) elementary charges per second”.
Effectively, this would define the kilogram as a derivative of the ampere, rather than present relationship, which defines the ampere as a derivative of the kilogram. This redefinition of the kilogram would result from fixing the elementary charge (e) to be precisely 1.602176487×10−19 coulomb (from the current 2006 CODATA value of 1.602176487(40)×10−19), which effectively defines the coulomb as being the sum of 6,241,509,647,120,417,390 elementary charges. It would necessarily follow that the ampere then becomes an electrical current of this same quantity of elementary charges per second.
The virtue of a practical realization based upon this definition is that unlike the watt balance and other scale-based methods, all of which require the careful characterization of gravity in the laboratory, this method delineates the magnitude of the kilogram directly in the very terms that define the nature of mass: acceleration due to an applied force. Unfortunately, it is extremely difficult to develop a practical realization based upon accelerating masses. Experiments over a period of years in Japan with a superconducting, 30-gram mass supported by diamagnetic levitation never achieved an uncertainty better than ten parts per million. Magnetic hysteresis was one of the limiting issues. Other groups are continuing this line of research using different techniques to levitate the mass.
# SI multiples
Because SI prefixes may not be concatenated (serially linked) within the name or symbol for a unit of measure, SI prefixes are used with the gram, not the kilogram, which already has a prefix as part of its name. For instance, one-millionth of a kilogram is 1 mg (one milligram), not 1 µkg (one microkilogram).
- When the Greek lowercase “µ” (mu) in the symbol of microgram is typographically unavailable, it is occasionally—although not properly—replaced by Latin lowercase “u”.
- The microgram is often abbreviated “mcg”, particularly in pharmaceutical and nutritional supplement labeling, to avoid confusion since the “µ” prefix is not well recognized outside of technical disciplines. Note however, that the abbreviation “mcg”, is also the symbol for an obsolete CGS unit of measure known as the “millicentigram”, which is equal to 10 µg.
- The unit name “megagram” is rarely used, and even then, typically only in technical fields in contexts where especially rigorous consistency with the units of measure is desired. For most purposes, the unit “tonne” is instead used. The tonne and its symbol, t, were adopted by the CIPM in 1879. It is a non-SI unit accepted by the BIPM for use with the SI. In English speaking countries it is usually called “metric ton”. Note also that the unit name “megatonne” or “megaton” (Mt) is often used in current literature on global climate change and its equivalent value in scientific literature on the subject is the “teragram” (Tg).
# Glossary
- Abstracted: Isolated and its effect changed in form, often simplified or made more accessible in the process.
- Artifact: A human-made object used as a comparative standard in the measurement of a physical quantity.
- Check standard:
- A standard body’s backup replica of the International Prototype Kilogram (IPK).
- A secondary kilogram mass standard used as a stand-in for the primary standard during routine calibrations.
- Definition: A formal, specific, and exact specification.
- Delineation: The physical means used to mark a boundary or express the magnitude of an entity.
- Disseminate: To widely distribute the magnitude of a unit of measure, typically via replicas and transfer standards.
- IPK: Abbreviation of “International Prototype Kilogram” (CG image), the artifact which has a mass defined as precisely one kilogram.
- Magnitude: The extent or numeric value of a property
- National prototype: A replica of the IPK possessed by a nation.
- Practical realization: An artifact or readily reproducible apparatus to conveniently delineate the magnitude of a unit of measure.
- Primary national standard:
- A replica of the IPK possessed by a nation
- The least used replica of the IPK when a nation possesses more than one.
- Prototype:
- A human-made object that serves as the defining comparative standard in the measurement of a physical quantity.
- A human-made object that serves as the comparative standard in the measurement of a physical quantity.
- The IPK and any of its replicas
- Replica: An official copy of the IPK.
- Sister copy: One of six official copies of the IPK that are stored in the same safe as the IPK and are used as check standards by the BIPM.
- Transfer standard: An artifact or apparatus that reproduces the magnitude of a unit of measure in a different, usually more practical, form. | Kilogram
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
The kilogram or kilogramme (symbol: kg) is the base unit of mass in the International System of Units (known also by its French-language initials “SI”). The kilogram is defined as being equal to the mass of the International Prototype Kilogram (IPK; known also by its French-language name Le Grand K), which is almost exactly equal to the mass of one liter of water.[1] It is the only SI base unit with an SI prefix as part of its name. It is also the only SI unit that is still defined in relation to an artifact rather than to a fundamental physical property that can be reproduced in different laboratories.
In everyday usage, the mass of an object in kilograms is often referred to as its weight, although strictly speaking the weight of an object is the gravitational force on it, measured in newtons (see also Kilogram-force). Similarly, the avoirdupois pound, used in both the Imperial system and U.S. customary units, is a unit of mass and its related unit of force is the pound-force. The avoirdupois pound is defined as exactly 0.45359237 kg, making one kilogram approximately equal to 2.205 avoirdupois pounds.
Many units in the SI system are defined relative to the kilogram so its stability is important. After the International Prototype Kilogram had been found to vary in mass over time, the International Committee for Weights and Measures (known also by its French-language initials CIPM) recommended in 2005 that the kilogram be redefined in terms of fundamental constants of nature.[2]
# The nature of mass
The kilogram is a unit of mass, the measurement of which corresponds to the general, everyday notion of how “heavy” something is. However, mass is actually an inertial property; that is, the tendency of an object to remain at constant velocity unless acted upon by an outside force. An object with a mass of one kilogram will accelerate at one meter per second squared (about one-tenth the acceleration due to Earth’s gravity) when acted upon by a force of one newton (symbol: N).
While the weight of matter is entirely dependent upon the strength of local gravity, the mass of matter is constant (assuming it is not traveling at a relativistic speed with respect to an observer). Accordingly, for astronauts in microgravity, no effort is required to hold objects off the cabin floor; they are “weightless.” However, since objects in microgravity still retain their mass, an astronaut must exert ten times as much force to accelerate a 10-kilogram object at the same rate as a 1-kilogram object.
# History
### Early definitions
On 7 April 1795, the gram was decreed in France to be equal to “the absolute weight of a volume of water equal to the cube of the hundredth part of the meter, at the temperature of melting ice.”[3] Since trade and commerce typically involve items significantly more massive than one gram, and since a mass standard made of water would be inconvenient and unstable, the regulation of commerce necessitated the manufacture of a practical realization of the water-based definition of mass. Accordingly, a provisional mass standard was made as a single-piece, metallic artifact one thousand times more massive than the gram—the kilogram.
At the same time, work was commissioned to precisely determine the mass of a cubic decimeter (one liter[4]) of water. Although the decreed definition of the kilogram specified water at 0 °C—its highly stable temperature point—the scientists in 1799 chose to redefine the standard to water’s most stable density point: the temperature at which water reaches maximum density, which was measured at the time as 4 °C.[5] They concluded that one cubic decimeter of water at its maximum density was equal to 99.92072% of the mass of the provisional kilogram made four years earlier.[6] That same year, 1799, an all-platinum kilogram prototype was fabricated with the objective that it would equal, as close as was scientifically feasible for the day, the mass of a cubic decimeter of water at 4 °C. The prototype was presented to the Archives of the Republic in June and on 10 December 1799, the prototype was formally ratified as the Kilogramme des Archive (Kilogram of the Archives) and the kilogram was defined as being equal to its mass. This standard stood for the next ninety years.
### International Prototype Kilogram
Since 1889, the SI system defines the magnitude of the kilogram to be equal to the mass of the International Prototype Kilogram, often referred to in the professional metrology world as the “IPK”. The IPK is made of an alloy of 90% platinum and 10% iridium (by weight) and is machined into a right-circular cylinder (height = diameter) of 39.17 mm to minimize its surface area.[7] The addition of 10% iridium improved upon the all-platinum Kilogram of the Archives by greatly increasing hardness while still retaining platinum’s many virtues: extreme resistance to oxidation, extremely high density, satisfactory electrical and thermal conductivities, and low magnetic susceptibility. The IPK and its six sister copies are stored in an environmentally monitored safe in the lower vault located in the basement of the BIPM’s House of Breteuil in Sèvres on the outskirts of Paris (see Links to photographs, below for images). Three independently controlled keys are required to open the vault. Official copies of the IPK were made available to other nations to serve as their national standards. These are compared to the IPK roughly every 50 years.
The IPK is one of three cylinders made in 1879. In 1883, it was found to be indistinguishable from the mass of the Kilogram of the Archives made eighty-four years prior, and was formally ratified as the kilogram by the 1st CGPM in 1889.[7] Modern measurements of the density of Vienna Standard Mean Ocean Water—purified water that has a carefully controlled isotopic composition—show that a cubic decimeter of water at its point of maximum density, 3.984 °C, has a mass that is 25.05 parts per million less than the kilogram.[8] This small, 25 ppm difference, and the fact that the mass of the IPK was indistinguishable from the mass of the Kilogram of the Archives, speak volumes of the scientists’ skills over Template:Age years ago when making their measurements of water’s properties and in manufacturing the Kilogram of the Archives.
# Stability of the International Prototype Kilogram
By definition, the error in the measured value of the IPK’s mass is exactly zero; the IPK is the kilogram. However, any changes in the IPK’s mass over time can be deduced by comparing its mass to that of its official copies stored throughout the world, a process called “periodic verification.” For instance, the U.S. owns four platinum-iridium (“Pt-10Ir”) kilogram standards, two of which, K4 and K20, are from the original batch of 40 replicas delivered in 1884.[10] The K20 prototype was designated as the primary national standard of mass for the U.S. Both of these, as well as those from other nations, are periodically returned to the BIPM for verification.[11]
Note that the masses of the replicas are not precisely equal to that of the IPK; their masses are calibrated and documented as offset values. For instance, K20, the U.S.’s primary standard, originally had an official mass of 1 kg–39 µg in 1889; that is to say, K20 was 39 µg less than the IPK. A verification performed in 1948 showed a mass of 1 kg–19 µg. The latest verification performed in 1999 shows a mass identical to its original 1889 value. The mass of K4, the U.S.’s check standard, as of 1999 was officially calibrated as 1 kg–116 µg. However, it was 41 µg more massive (in comparison to the IPK) in 1889.
Since the IPK and its replicas are stored in air (albeit under two or more nested bell jars), they adsorb atmospheric contamination onto their surfaces and gain mass. Accordingly, they are cleaned in a process the BIPM developed between 1939 and 1946 known as “the BIPM cleaning method” that comprises lightly rubbing with a chamois soaked in equal parts ether and ethanol, steam-cleaning with bi-distilled water, and allowing the prototypes to settle for 7–10 days before period verification.[12] Cleaning the prototypes removes between 5 and 60 µg of contamination depending largely on the time elapsed since the last cleaning. Further, a second cleaning can remove up to 10 µg more. After cleaning—even when they are stored under their bell jars—the IPK and its replicas immediately begin gaining mass again. The BIPM even developed a model of this gain and concluded that it averaged 1.11 µg per month for the first 3 months after cleaning and then decreased to an average of about 1 µg per year thereafter. Since check standards like K4 are not cleaned for routine calibrations of other mass standards—a precaution to minimize the potential for wear and handling damage—the BIPM’s model has been used as an “after cleaning” correction factor.
Because the first forty official copies are made of the same alloy as the IPK and are stored under similar conditions, periodic verifications using a large number of replicas—especially the national primary standards, which are rarely used—can convincingly demonstrate the stability of the IPK. What has become clear after the third periodic verification performed between 1988 and 1992 is that masses of the entire worldwide ensemble of prototypes have been slowly but inexorably diverging from each other. It is also clear that the mass of the IPK lost perhaps 50 µg over the last century, and possibly significantly more, in comparison to its official copies.[9][13] The answer as to why this might be the case has proved elusive for physicists who have dedicated their careers to the SI unit of mass. No plausible mechanism has been proposed to explain either a steady decrease in the mass of the IPK, or an increase in that of its replicas dispersed throughout the world.[14] This relative nature of the changes amongst the world’s kilogram prototypes is often misreported in the popular press, and even some notable scientific magazines, which often state that the IPK simply “lost 50 µg” and omit the very important caveat of “in comparison to its official copies.”[15] Further, there is no technical means available to determine whether or not the entire worldwide ensemble of prototypes suffer from even greater long-term trends upwards or downwards because their mass “relative to an invariant of nature is unknown at a level below 1000 µg over a period of 100 or even 50 years.”[13] Given the lack of data identifying which of the world’s kilogram prototypes has been most stable in absolute terms, it is equally as valid to state that the first batch of replicas has, as a group, gained an average of about 25 µg over one hundred years in comparison to the IPK.[16]
What is known specifically about the IPK is that it exhibits a short-term instability of about 30 µg over a period of about a month in its after-cleaned mass.[17] The precise reason for this short-term instability is not understood but is thought to entail surface effects: microscopic differences between the prototypes’ polished surfaces, possibly aggravated by hydrogen absorption due to catalysis of the volatile organic compounds that slowly deposit onto the prototypes as well as the hydrocarbon-based solvents used to clean them.[18]
Scientists are seeing far greater variability in the prototypes than previously believed. The increasing divergence in the masses of the world’s prototypes and the short-term instability in the IPK has prompted research into improved methods to obtain a smooth surface finish using diamond-turning on newly manufactured replicas and has intensified the search for a new definition of the kilogram. See Proposed future definitions, below.[19]
# Importance of the kilogram
The stability of the IPK is crucial because the kilogram underpins much of the SI system of measurement as it is currently defined and structured. For instance, the newton is defined as the force necessary to accelerate the kilogram by one meter per second squared. If the mass of the IPK were to change slightly, so too must the newton by a proportional degree. In turn, the pascal, the SI unit of pressure, is defined in terms of the newton. This chain of dependency follows to many other SI units of measure. For instance, the joule, the SI unit of energy, is defined as that expended when a force of one newton acts through one meter. Next to be affected is the SI unit of power, the watt, which is one joule per second. The ampere too is defined relative to the newton, and ultimately, the kilogram. With the magnitude of the primary units of electricity thus determined by the kilogram, so too follow many others; namely, the coulomb, volt, tesla, and weber. Even units used in the measure of light would be affected. The candela—following the change in the watt—would in turn affect the lumen and lux.
Because the magnitude of many of the units comprising the SI system of measurement is ultimately defined by the mass of a Template:Age-year-old, golf ball-size piece of metal, the quality of the IPK must be diligently protected in order to preserve the integrity of the SI system. Yet, in spite of the best stewardship, the IPK has likely already lost 4.4 µg relative to the average mass of the worldwide ensemble of prototypes since the third periodic verification Template:Age years ago.[20] Further, the world’s national metrology labs must wait for the fourth periodic verification to confirm whether the historical trends persisted.
Fortunately, definitions of the SI units are quite different from their practical realizations. For instance, the meter is defined as the distance light travels in a vacuum during a time interval of 1⁄299,792,458 of a second. However, the meter’s practical realization typically takes the form of a helium-neon laser, and the meter’s length is delineated—not defined—as 1,579,800.298728 wavelengths of light from this laser. Now suppose that the official measurement of the second was found to have drifted by a few parts per billion (it is actually exquisitely stable). There would be no automatic effect on the meter because the second—and thus the meter’s length—is abstracted via the laser comprising the meter’s practical realization. Scientists performing meter calibrations would simply continue to measure out the same number of laser wavelengths until an agreement was reached to do otherwise. The same is true with regard to the real-world dependency on the kilogram: if the mass of the IPK was found to have changed slightly, there would be no automatic effect upon the other units of measure because their practical realizations provide an insulating layer of abstraction. Any discrepancy would eventually have to be reconciled though because the virtue of the SI system is its precise mathematical and logical harmony amongst its units. If the IPK’s value were definitively proven to have changed, one solution would be to simply redefine the kilogram as being equal to the mass of the IPK plus an offset value, similarly to what is currently done with its replicas; e.g., “the kilogram is equal to the mass of the IPK + 42 ppb.”
The long-term solution to this problem, however, is to liberate the SI system’s dependency on the IPK by developing a practical realization of the kilogram that can be reproduced in different laboratories by following a written specification. The units of measure in such a practical realization would have their magnitudes precisely defined and expressed in terms of fundamental physical constants. While major portions of the SI system would still be based on the kilogram, the kilogram would in turn be based on invariant, universal constants of nature. While this is a worthwhile objective and much work towards that end is ongoing, no alternative has achieved the uncertainty of a couple parts in 108 (~20 µg) required to improve upon the IPK. However, as of April 2007, the NIST’s implementation of the watt balance was approaching this goal, with a demonstrated uncertainty of 36 µg.[21] See Watt balance, below.
# Proposed future definitions
The kilogram is the only SI unit that is still defined in relation to an artifact. Note that the meter was also once defined as an artifact (a single platinum-iridium bar with two marks on it). However, it was eventually redefined in terms of invariant, fundamental constants of nature that are delineated via practical realizations (apparatus) that can be reproduced in different laboratories by following a written specification. Today, physicists are investigating various approaches to do the same with the kilogram. Some of the approaches are fundamentally very different from each other. Some are based on equipment and procedures that enable the reproducible production of new, kilogram-mass prototypes on demand (albeit with extraordinary effort) using measurement techniques and material properties that are ultimately based on, or traceable to, fundamental constants. Others are devices that measure either the acceleration or weight of hand-tuned, kilogram test masses and which express their magnitudes in electrical terms via special components that permit traceability to fundamental constants. Measuring the weight of test masses requires the precise measurement of the strength of gravity in laboratories. All approaches would precisely fix one or more constants of nature at a defined value. These different approaches are as follows:
### Atom-counting approaches
Though not offering a practical realization, this definition would precisely define the magnitude of the kilogram in terms of a certain number of carbon-12 atoms. Carbon-12 is a certain isotope of carbon. The mole is currently defined as “the quantity of entities (elementary particles like atoms or molecules) equal to the number of atoms in 12 grams of carbon-12.” Thus, the current definition of the mole requires that 1000/12 (83⅓) moles of C-12 has a mass of precisely one kilogram. The number of atoms in a mole, a quantity known as the Avogadro constant, is an experimentally determined value that is currently measured as being 6.02214179(30)×1023 atoms (2006 CODATA value). This new definition of the kilogram proposes to fix the Avogadro constant at precisely 6.02214179×1023 and the kilogram would be defined as “the mass equal to that of 83⅓ · 6.02214179×1023 atoms of carbon-12.”
Currently, the uncertainty in the Avogadro constant is determined by the uncertainty in the measured mass of carbon-12 atoms (a relative standard uncertainty of 50 parts per billion at this time). By fixing the Avogadro constant, the practical effect of this proposal would be that the precise magnitude of the kilogram would be subject to future refinement as improved measurements of the mass of carbon-12 atoms become available; electronic realizations of the kilogram would be recalibrated as required. In an electronic definition of the kilogram, 83⅓ moles of carbon-12 would—by definition—continue to have a mass of precisely one kilogram and the Avogadro constant would continue to have uncertainty in its precise value.
A variation on a carbon-12-based definition proposes to define the Avogadro constant as being precisely 84,446,8863
(≈6.02214098×1023 atoms. An imaginary realization of a 12-gram mass prototype would be a cube of carbon-12 atoms measuring precisely 84,446,886 atoms across on a side. With this proposal, the kilogram would be defined as “the mass equal to 84,446,8863 × 83⅓ atoms of carbon-12.” The value 84,446,886 was chosen because it has a special property; its cube (the proposed new value for the Avogadro constant) is evenly divisible by twelve. Thus with this definition of the kilogram, there would be an integer number of atoms in one gram of carbon-12: 50,184,508,190,229,061,679,538 atoms.[22]
Another Avogadro constant-based approach, known as the Avogadro project, would define and delineate the kilogram as a softball-size sphere of silicon atoms. Silicon was chosen because a commercial infrastructure with mature processes for creating defect-free, ultra-pure monocrystalline silicon already exists to service the semiconductor industry. To make a practical realization of the kilogram, a silicon boule (a rod-like, single-crystal ingot) would be produced. Its isotopic composition would be measured with a mass spectrometer to determine its average atomic mass. The rod would be cut, ground, and polished into spheres. The size of a select sphere would be measured using optical interferometry to an uncertainty of about 0.3 nm on the radius—roughly a single atomic layer. The precise lattice spacing between the atoms in its crystal structure (≈192 pm) would be measured using a scanning X-ray interferometer. This permits its atomic spacing to be determined with an uncertainty of only three parts per billion. With the size of the sphere, its average atomic mass, and its atomic spacing known, the required sphere diameter can be calculated with sufficient precision and uncertainty to enable it to be finish-polished to a target mass of one kilogram.
Experiments are being performed on the Avogadro Project’s silicon spheres to determine whether their masses are most stable when stored in a vacuum, a partial vacuum, or ambient pressure. However, no technical means currently exist to prove a long-term stability any better than that of the IPK’s because the most sensitive and accurate measurements of mass are made with dual-pan balances like the BIPM’s FB-2 flexure-strip balance (see Links to photographs, below). Balances can only compare the mass of a silicon sphere to that of a reference mass. Given the latest understanding of the lack of long-term mass stability with the IPK and its replicas, there is no known, perfectly stable mass artifact to compare against. Single-pan scales capable of measuring weight relative to an invariant of nature with a long-term uncertainty of only 10–20 parts per billion do not yet exist. Another issue to be overcome is that silicon oxidizes and forms a thin layer (equivalent to 5–20 silicon atoms) of silicon dioxide (common glass) and silicon monoxide. This layer slightly increases the mass of the sphere, an effect which must be accounted for when polishing the sphere to its finish dimension. Oxidation is not an issue with platinum and iridium, both of which are noble metals that are roughly as cathodic as oxygen and therefore don’t oxidize unless coaxed to do so in the laboratory. The presence of the thin oxide layer on a silicon-sphere mass prototype places additional restrictions on the procedures that might be suitable to clean it to avoid changing the layer’s thickness or oxide stoichiometry.
All silicon-based approaches would fix the Avogadro constant but vary in the details of the definition of the kilogram. One approach would use silicon with all three of its natural isotopes present. About 7.77% of silicon comprises the two heavier isotopes: silicon-29 and silicon-30. As described in Carbon–12 above, this method would define the magnitude of the kilogram in terms of a certain number of carbon-12 atoms by fixing the Avogadro constant; the silicon sphere would be the practical realization. This approach could accurately delineate the magnitude of the kilogram because the mass of the three silicon isotopes relative to carbon-12 are known with great precision. An alternative method for creating a silicon sphere-based kilogram proposes to use isotopic separation techniques to enrich the silicon until it is nearly pure silicon-28, which has an atomic mass of 27.9769271(7)u=g/mol. With this approach, the Avogadro constant would not only be fixed, but so too would the atomic mass of silicon-28. As such, the definition of the kilogram would be decoupled from carbon-12 and the kilogram would instead be defined as 1000/27.9769271 · 6.022141793×1023 atoms of silicon-28 (≈35.7437397 fixed moles of silicon-28 atoms). Physicists could elect to define the kilogram in terms of silicon-28 even when kilogram prototypes are made of natural silicon (all three isotopes present). Even with a kilogram definition based on silicon-28, a silicon-sphere prototype made of nearly pure silicon-28 would necessarily deviate slightly from the defined number of moles of silicon in order to compensate for various chemical and isotopic impurities as well as the effect of surface oxides.[24]
Another Avogadro-based approach, ion accumulation, would define and delineate the kilogram by precisely creating new metal prototypes on demand. It would do so by accumulating gold or bismuth ions (atoms stripped of an electron) and counting them by measuring the electrical current required to neutralize the ions. Gold and bismuth were chosen because they can be safely handled and have the two highest atomic masses among the mononuclidic elements that can be treated as if they are non-radioactive (bismuth) or perfectly stable (gold). See also Table of nuclides.[25]
With a gold-based definition of the kilogram for instance, the atomic mass of gold would be fixed as precisely 196.966569g/mol, from the current value of 196.966569(4)g/mol. As with a definition based upon carbon-12, the Avogadro constant would also be fixed. The kilogram would then be defined as “the mass equal to that of precisely 1000/196.966569 · 6.02214179×1023 atoms of gold” (3,057,443,616,231,138,188,734,962 atoms of gold ≈5.0770037021 fixed moles).
Ion-accumulation techniques, while a relatively new field of study, have advanced rapidly. In 2003, experiments with gold at a current of only 10 µA demonstrated a relative uncertainty of 1.5%. Yet, follow-on experiments using bismuth ions and a current of 30 mA were expected to accumulate a mass of 30 g in six days and to have a relative uncertainty of better than 1 part in 106.[26]
Among the many technical challenges of the ion-deposition apparatus is in obtaining sufficiently high ion currents while simultaneously decelerating the ions so they can all deposit onto the target electrode imbedded in a balance pan. Experiments with gold showed that the ions must be decelerated to very low energies to avoid sputtering effects, which essentially gold-plates the inside of the deposition chamber and diminishes the mass retained on the electrode. The deposited mass fraction approaches very close to 100% at ion energies of less than around 1 eV (<1 km/s).[27]
If the kilogram is one day defined as a precise quantity of gold or bismuth atoms deposited with an electric current, not only would the Avogadro constant and the atomic mass of gold or bismuth be precisely fixed, but so too would the value of the ampere. This would be brought about by precisely fixing the value of the elementary charge (e), likely to 1.602176487×10-19 coulomb (from the present 2006 CODATA value of 1.602176487(40)×10-19 . Doing so would effectively define the ampere as a flow of 1/1.602176487×10-19 (6,241,509,647,120,417,390) electrons per second past a fixed point in an electric circuit. The SI unit of mass would thus be fully defined by having precisely fixed the values of the Avogadro constant and elementary charge, and by exploiting the fact that the atomic masses of bismuth and gold atoms are invariant, universal constants of nature.
One challenge in maturing an ion-accumulation-based kilogram into a practical realization is the development of a deposition chamber/balance system that enables the convenient calibration of a reasonable quantity of transfer standards relative to any single internal ion-deposited prototype. The mass prototypes produced by ion deposition techniques are nothing like the freestanding platinum-iridium prototypes currently in use; they are deposited onto—and become part of—an electrode imbedded into one pan of a special balance that is part of the device. Further, the ion-deposited material doesn’t have a hard, highly polished surface that can be vigorously cleaned like those of current prototypes. Gold, while dense and a noble metal (resistant to oxidation and the formation of other compounds), is extremely soft so an internal gold prototype would have to be kept well isolated and scrupulously clean to avoid contamination and the potential of wear from having to remove the contamination. Bismuth, which is an inexpensive metal used in low-temperature solders, slowly oxidizes when exposed to room-temperature air and forms other chemical compounds and so, would not produce a stable reference mass unless it was continually maintained in a vacuum or inert atmosphere.
### Electronic approaches
The watt balance is essentially a single-pan weighing scale that measures the electric power necessary to oppose the weight of a kilogram test mass as it is accelerated by gravity. It is a variation of an ampere balance in that it employs an extra calibration step that nulls the effect of geometry. The electric potential in the watt balance is delineated by a Josephson voltage standard, which allows voltage to be linked to an invariant constant of nature with extremely high precision and stability. Its circuit resistance is calibrated against a quantum Hall resistance standard. The watt balance requires exquisitely precise measurement of gravity in a laboratory (see “FG-5 absolute gravimeter” in Links to photographs, below). For instance, the gravity gradient of 3.1 µGal/cm (≈3 ppb/cm) is accounted for when the elevation of the center of the gravimeter differs from that of the nearby test mass. As of April 2007, the NIST’s implementation of the watt balance was demonstrating a combined relative standard uncertainty (CRSU) at 68% probability of 36 µg and a short-term resolution of 10–15 µg.[21] The UK’s National Physical Laboratory’s watt balance as of 2007, was demonstrating a CRSU of 70.3 µg.[28]
Ultimately, the watt balance would define the kilogram in terms of the Planck constant, which is a measure that relates the energy of photons to their frequency. The Planck constant would be fixed, where h = 6.62606896×10-34J·s (from the 2006 CODATA value of 6.62606896(33)×10-34J·s) and the kilogram would be defined as “the mass of a body at rest whose equivalent energy equals the energy of photons whose frequencies sum to 1.356392733×1050 Hz.”[29]
The virtue of electronic realizations like the watt balance is that the definition and dissemination of the kilogram would no longer be dependent upon the stability of kilogram prototypes, which must be very carefully handled and stored. It would free physicists from the need to rely on assumptions about the stability of those prototypes, including those that would be manufactured under atom-counting schemes. Instead, hand-tuned, close-approximation mass standards would simply be weighed and documented as being equal to one kilogram plus an offset value. With scales, the kilogram would not only be defined in electrical terms, it would also be delineated in electrical terms. Mass artifacts calibrated in a watt balance would effectively become transfer standards. Further, one additional term in all scale-based realizations—acceleration due to gravity—is currently measured using dropping-mass absolute gravimeters that contain an iodine-stabilized HeNe laser interferometer. The fringe-signal, frequency-sweep output from the interferometer is measured with a rubidium atomic clock. Thus, the ‘gravity’ term in the delineation of an all-electronic kilogram would also be measured relative to invariants of nature.
Scales like the watt balance also permit more flexibility in choosing materials with especially desirable properties for mass standards. For instance, Pt-10Ir could continue to be used so that the specific gravity of newly produced mass standards would be the same as existing national primary and check standards (≈21.55 g/ml). This would reduce the relative uncertainty when making mass comparisons in air. Alternately, entirely different materials and constructions could be explored with the objective of producing mass standards with greater stability. For instance, osmium-iridium alloys could be investigated if platinum’s propensity to absorb hydrogen (due to catalysis of VOCs and hydrocarbon-based cleaning solvents) and atmospheric mercury proved to be sources of instability. Also, vapor-deposited, protective ceramic coatings like nitrides could be investigated for their suitability to isolate these new alloys.
The challenge with watt balances is not only in reducing their uncertainty, but also in making them truly practical realizations of the kilogram. Nearly every aspect of watt balances and their support equipment requires such extraordinarily precise and accurate, state-of-the-art technology that—unlike a device like an atomic clock—few countries would currently choose to fund their operation. For instance, the NIST’s watt balance uses four resistance standards, each of which is rotated through the watt balance every two to six weeks after being calibrated in a different part of the facility. Simply moving the resistance standards down the hall to the watt balance alters their values 10 ppb (equivalent to 10 µg) or more. The plan is to eventually collocate the watt balance and the calibration equipment so the resistance standards can be calibrated in place. Still, present-day technology is insufficient to permit stable operation of watt balances between even biannual calibrations. If the kilogram is defined in terms of the Planck constant, it is likely there may only be a few—at most—watt balances initially operating in the world.
This approach would define the kilogram as “the mass which would be accelerated at precisely 2 × 10–7 m/s² when subjected to the per-meter force between two straight parallel conductors of infinite length, of negligible circular cross section, placed 1 meter apart in vacuum, through which flow a constant current of 1/1.602176487×10−19 (6,241,509,647,120,417,390) elementary charges per second”.
Effectively, this would define the kilogram as a derivative of the ampere, rather than present relationship, which defines the ampere as a derivative of the kilogram. This redefinition of the kilogram would result from fixing the elementary charge (e) to be precisely 1.602176487×10−19 coulomb (from the current 2006 CODATA value of 1.602176487(40)×10−19), which effectively defines the coulomb as being the sum of 6,241,509,647,120,417,390 elementary charges. It would necessarily follow that the ampere then becomes an electrical current of this same quantity of elementary charges per second.
The virtue of a practical realization based upon this definition is that unlike the watt balance and other scale-based methods, all of which require the careful characterization of gravity in the laboratory, this method delineates the magnitude of the kilogram directly in the very terms that define the nature of mass: acceleration due to an applied force. Unfortunately, it is extremely difficult to develop a practical realization based upon accelerating masses. Experiments over a period of years in Japan with a superconducting, 30-gram mass supported by diamagnetic levitation never achieved an uncertainty better than ten parts per million. Magnetic hysteresis was one of the limiting issues. Other groups are continuing this line of research using different techniques to levitate the mass.[30]
# SI multiples
Because SI prefixes may not be concatenated (serially linked) within the name or symbol for a unit of measure, SI prefixes are used with the gram, not the kilogram, which already has a prefix as part of its name.[31] For instance, one-millionth of a kilogram is 1 mg (one milligram), not 1 µkg (one microkilogram).
Template:SI multiples
- When the Greek lowercase “µ” (mu) in the symbol of microgram is typographically unavailable, it is occasionally—although not properly—replaced by Latin lowercase “u”.
- The microgram is often abbreviated “mcg”, particularly in pharmaceutical and nutritional supplement labeling, to avoid confusion since the “µ” prefix is not well recognized outside of technical disciplines.[32] Note however, that the abbreviation “mcg”, is also the symbol for an obsolete CGS unit of measure known as the “millicentigram”, which is equal to 10 µg.
- The unit name “megagram” is rarely used, and even then, typically only in technical fields in contexts where especially rigorous consistency with the units of measure is desired. For most purposes, the unit “tonne” is instead used. The tonne and its symbol, t, were adopted by the CIPM in 1879. It is a non-SI unit accepted by the BIPM for use with the SI. In English speaking countries it is usually called “metric ton”.[33] Note also that the unit name “megatonne” or “megaton” (Mt) is often used in current literature on global climate change and its equivalent value in scientific literature on the subject is the “teragram” (Tg).
# Glossary
- Abstracted: Isolated and its effect changed in form, often simplified or made more accessible in the process.
- Artifact: A human-made object used as a comparative standard in the measurement of a physical quantity.
- Check standard:
- A standard body’s backup replica of the International Prototype Kilogram (IPK).
- A secondary kilogram mass standard used as a stand-in for the primary standard during routine calibrations.
- Definition: A formal, specific, and exact specification.
- Delineation: The physical means used to mark a boundary or express the magnitude of an entity.
- Disseminate: To widely distribute the magnitude of a unit of measure, typically via replicas and transfer standards.
- IPK: Abbreviation of “International Prototype Kilogram” (CG image), the artifact which has a mass defined as precisely one kilogram.
- Magnitude: The extent or numeric value of a property
- National prototype: A replica of the IPK possessed by a nation.
- Practical realization: An artifact or readily reproducible apparatus to conveniently delineate the magnitude of a unit of measure.
- Primary national standard:
- A replica of the IPK possessed by a nation
- The least used replica of the IPK when a nation possesses more than one.
- Prototype:
- A human-made object that serves as the defining comparative standard in the measurement of a physical quantity.
- A human-made object that serves as the comparative standard in the measurement of a physical quantity.
- The IPK and any of its replicas
- Replica: An official copy of the IPK.
- Sister copy: One of six official copies of the IPK that are stored in the same safe as the IPK and are used as check standards by the BIPM.
- Transfer standard: An artifact or apparatus that reproduces the magnitude of a unit of measure in a different, usually more practical, form. | https://www.wikidoc.org/index.php/Kg |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.