id
stringlengths 40
40
| source
stringclasses 9
values | title
stringlengths 2
345
| clean_text
stringlengths 35
1.63M
| raw_text
stringlengths 4
1.63M
| url
stringlengths 4
498
| overview
stringlengths 0
10k
|
|---|---|---|---|---|---|---|
94d06a92bb687857c6ea1a5838cd97610710780e | wikidoc | TMEM106A | TMEM106A
TMEM106A is a gene that encodes the transmembrane protein 106A (TMEM106A) in Homo sapiens. It is located at 17q21.31 on the plus strand next to cancer-related genes NBR1 and BRCA1. The TMEM106A gene contains a domain of unknown function, DUF1356.
# Protein structure
The TMEM106A protein has a molecular weight of 28.9 kdal. It has 262 amino acids, 240 of which are in the domain of function. The protein has a transmembrane region. There is evidence for a secondary transmembrane region in humans but this region is not conserved in related orthologs. The protein does not contain a peptide signal protein. The protein structure contains a similar proportion of alpha-helix and beta-strand secondary structures (this does not include transmembrane structures).
There are several areas for post-translational modification for TMEM106A including:
- Phosphorylation,
- N-glycosylation
- Lysine glycosylation
# Homology
## Paralogs
The TMEM106A gene has two paralogs: TMEM106B and TMEM106C. These paralogs belong to the gene family pfam07092, which belongs to the DUF1356 superfamily. This family consists of several mammalian proteins that are around 250 amino acids in length. TMEM106B and TMEM106C are conserved in invertebrates to mammals.
## Orthologs
The TMEM106A gene has been found in only the Chordate phylum. Of the three subphyla, TMEM106A is most commonly found in Vertebrata and has also been found in select members of Tunicata, which are invertebrate marine filter feeders. This phylum split occurred 722.5 million years ago. TMEM106A has not been seen in bacteria, plants, or fungi.
# Expression
TMEM106A is expressed in several human tissues. The tissues with highest expression are uterus, kidneys, small intestine, and stomach. EST profiles for orthologs show expression is conserved with greatest expression in kidneys and lesser expression in several other areas. Some tissues never show expression including: muscle, adipose tissue, and bone.
# Gene neighborhood
In Homo sapiens, TMEM106A is located next to NBR1, a gene identified as an ovarian tumor antigen monitored in ovarian cancer. It is also located near BRCA1, a breast cancer tumor suppressor gene. The first 140 amino acids of the TMEM106A protein, including portions of DUF1356 and a transmembrane region, are deleted along with BRCA1 during early-onset breast cancer. | TMEM106A
TMEM106A is a gene that encodes the transmembrane protein 106A (TMEM106A) in Homo sapiens.[1] It is located at 17q21.31 on the plus strand next to cancer-related genes NBR1 and BRCA1.[1][2] The TMEM106A gene contains a domain of unknown function, DUF1356.[1]
# Protein structure
The TMEM106A protein has a molecular weight of 28.9 kdal. It has 262 amino acids, 240 of which are in the domain of function.[1] The protein has a transmembrane region.[3] There is evidence for a secondary transmembrane region in humans but this region is not conserved in related orthologs.[4] The protein does not contain a peptide signal protein.[5] The protein structure contains a similar proportion of alpha-helix and beta-strand secondary structures (this does not include transmembrane structures).[6][7]
There are several areas for post-translational modification for TMEM106A including:
- Phosphorylation,[8]
- N-glycosylation [9]
- Lysine glycosylation [10]
# Homology
## Paralogs
The TMEM106A gene has two paralogs: TMEM106B and TMEM106C. These paralogs belong to the gene family pfam07092, which belongs to the DUF1356 superfamily. This family consists of several mammalian proteins that are around 250 amino acids in length.[11] TMEM106B and TMEM106C are conserved in invertebrates to mammals.
## Orthologs
The TMEM106A gene has been found in only the Chordate phylum.[16] Of the three subphyla, TMEM106A is most commonly found in Vertebrata and has also been found in select members of Tunicata, which are invertebrate marine filter feeders. This phylum split occurred 722.5 million years ago.[17] TMEM106A has not been seen in bacteria, plants, or fungi.
# Expression
TMEM106A is expressed in several human tissues. The tissues with highest expression are uterus, kidneys, small intestine, and stomach.[12][18] EST profiles for orthologs show expression is conserved with greatest expression in kidneys and lesser expression in several other areas.[19] Some tissues never show expression including: muscle, adipose tissue, and bone.
# Gene neighborhood
In Homo sapiens, TMEM106A is located next to NBR1, a gene identified as an ovarian tumor antigen monitored in ovarian cancer.[20] It is also located near BRCA1, a breast cancer tumor suppressor gene.[21] The first 140 amino acids of the TMEM106A protein, including portions of DUF1356 and a transmembrane region, are deleted along with BRCA1 during early-onset breast cancer.[22] | https://www.wikidoc.org/index.php/TMEM106A | |
bdfe38aa75738ce5b2d5c31edba9afce0b13d714 | wikidoc | TMEM106C | TMEM106C
TMEM106C is a gene that encodes the transmembrane protein 106C (TMEM106C) in Homo sapiens It has been found to be overexpressed in cancer cells and also is related to distal arthrogryposis, a condition of stiff joints and irregular muscle development. The TMEM106C gene contains a domain of unknown function, DUF1356, that spans most of the protein. Transmembrane protein 106C also goes by the aliases MGC5576 or MGC111210, LOC79022.
# Location and gene neighborhood
The TMEM106C gene is located on the long arm of the 12th chromosome. It is found at position 12q13.1. This gene spans from 48357225 to 48362667 on chromosome 12. This gene is in between COL2A1, the human type II collagen gene, and VDR, the human Vitamin D Receptor gene.
This protein is found to be an integral part of the endoplasm reticulum membrane.
# Protein structure
The TMEM106A protein has a molecular weight of 27.9 kdal with a PI of 6.325. It has 250 amino acids, 230 of which are in the domain of unknown function. No signal peptide has been found for this protein but TMEM106C has transmembrane regions which gives evidence for an internal signal peptide. This protein spans the ER membrane 2 times. There is evidence that these transmembrane regions take on helical structures. The predicted structure of the protein is shown to the left:
TMEM106C is valine-rich with no tryptophan.
There are several areas for post-translational modification for TMEM106A including:
- Phosphorylation
- Kinase-Specific Phosphoylation
- N-glycosylation
# Expression
This gene is highly expressed. TMEM106C is expressed 4.9 times the average gene. TMEM106C has ubiquitous expression. It can be found expressed in many tissues types. Tissue types with high expression included the adrenal gland, eye, reproductive organs, cervix and blood. High expression was found using EST and GEO data.
This gene is also found overexpressed in cancer cells. This gene has found to be expressed three times more in adrenal tumor and twice more in bladder carcinoma and retinoblastoma than normal expression.
It is also found to be highly expressed in breast (mammary gland) tumor, cervical tumor, esophageal tumor, leukemia, liver tumor; lung tumor, pancreatic tumor, prostate cancer, and soft tissue/muscle tissue tumor.
TMEM106C is found in all stages of development from embryoid body, blastocyst, fetus, infant, juvenile and adult.
# Homology
## Paralogs
There are two paralogs for TMEM106C. These paralogs are TMEM106A and TMEM106B. Both genes are found highly conserved in Mammalia. TMEM106A is also found to be conserved in invertebrates as well. The protein was found in tapeworms and other invertebrate worms.
## Orthologs
TMEM106C is highly conserved in Mammalia. Links to sequences can be found in the table below: | TMEM106C
TMEM106C is a gene that encodes the transmembrane protein 106C (TMEM106C) in Homo sapiens It has been found to be overexpressed in cancer cells and also is related to distal arthrogryposis,[1][2] a condition of stiff joints and irregular muscle development. The TMEM106C gene contains a domain of unknown function, DUF1356, that spans most of the protein. Transmembrane protein 106C also goes by the aliases MGC5576 or MGC111210, LOC79022.[3]
# Location and gene neighborhood
The TMEM106C gene is located on the long arm of the 12th chromosome. It is found at position 12q13.1. This gene spans from 48357225 to 48362667 on chromosome 12.[3] This gene is in between COL2A1, the human type II collagen gene, and VDR, the human Vitamin D Receptor gene.[4]
This protein is found to be an integral part of the endoplasm reticulum membrane.[5]
# Protein structure
The TMEM106A protein has a molecular weight of 27.9 kdal with a PI of 6.325.[7] It has 250 amino acids, 230 of which are in the domain of unknown function. No signal peptide has been found for this protein but TMEM106C has transmembrane regions which gives evidence for an internal signal peptide.[8] This protein spans the ER membrane 2 times.[6] There is evidence that these transmembrane regions take on helical structures.[9] The predicted structure of the protein is shown to the left:
TMEM106C is valine-rich with no tryptophan.[7]
There are several areas for post-translational modification for TMEM106A including:[10]
- Phosphorylation[11]
- Kinase-Specific Phosphoylation[12]
- N-glycosylation[13]
# Expression
This gene is highly expressed. TMEM106C is expressed 4.9 times the average gene.[3] TMEM106C has ubiquitous expression. It can be found expressed in many tissues types. Tissue types with high expression included the adrenal gland, eye, reproductive organs, cervix and blood. High expression was found using EST and GEO data.
This gene is also found overexpressed in cancer cells. This gene has found to be expressed three times more in adrenal tumor and twice more in bladder carcinoma and retinoblastoma than normal expression.
It is also found to be highly expressed in breast (mammary gland) tumor, cervical tumor, esophageal tumor, leukemia, liver tumor; lung tumor, pancreatic tumor, prostate cancer, and soft tissue/muscle tissue tumor.[16]
TMEM106C is found in all stages of development from embryoid body, blastocyst, fetus, infant, juvenile and adult.[17]
# Homology
## Paralogs
There are two paralogs for TMEM106C. These paralogs are TMEM106A and TMEM106B.[2] Both genes are found highly conserved in Mammalia. TMEM106A is also found to be conserved in invertebrates as well. The protein was found in tapeworms and other invertebrate worms.[18]
## Orthologs
TMEM106C is highly conserved in Mammalia. Links to sequences can be found in the table below:[18] | https://www.wikidoc.org/index.php/TMEM106C | |
b871492c088615fb6254ec18ebc36270754c3ec0 | wikidoc | TMEM126A | TMEM126A
Transmembrane protein 126A is a mitochondrial transmembrane protein of unknown function coded for by the TMEM126A gene.
A nonsense mutation in the TMEM126A gene has been shown to be related to optic atrophy. TMEM126A shows higher levels of expression in the parathyroid gland as well as in the peripheral blood cells of Huntington's disease patients, indicating that expression of this protein has some relation to blood regulation.
TMEM126A has two isoforms and is found on the long arm of Chromosome 11 in region 1, band 4, sub-band 1. It is produced by the TMEM126 gene, which codes for a mRNA 726 base pairs long. which translates into a protein 195 amino acids long. In addition, this gene is expressed 1.8 times the average of a normal gene and has expression with the prostate, uterus, kidney, placenta, heart, brain, and a large number of other tissues.
# Gene
## Locus
TMEM126 is located on the long arm of chromosome 11 in humans. It is found on the first sub-band of the fourth band within the first region. This can be written as 11q14.1.
## Aliases
TMEM126A is also known as OPA7 and DKFZp586c1924.
# Homology/evolutionary history
TMEM126A has been highly conserved among mammals, never dropping below 60% sequence identity when aligned with the same protein sequence from other species. It has been less well conserved outside of mammals, although it is evident in both fish, birds, and some invertebrates.
## Orthologs
## Paralogs
TMEM126A has a single paralog: TMEM126B. It is also found at 11q14.1 and is also known as HT007. TMEM126B shares 36% sequence identity and 49% sequence similarity with TMEM126A. The central domain is conserved between TMEM126A and TMEM126B.
# mRNA
## Promoter Analysis
Promoter sequence:
TTCACCCAACACTGCTTCCAAATAAGCAGTACTCTGGAGAACACGAGAAATCCTCAGAAAAATAAGCTGCAGCTCTGAGG
TGCTGATTATGGTAGGGCAATCAATACAGATCAAAACATGGCACAGGGAGCTTAAGTTCCTAGGGAGAGTAGAAAATCGA
TAGAGCCAAGAAATAGCTCACCTTTGACTTATTTTTAACCTGAGTAGCTATCATATGCCAAGAGCTGTGCAGTTTTCATT
TACCCCATGCCAAGAACGTAAGTAGGCTCTACTGACCAGGAAGTTAAGTAATATGCCCGAGGTACGTTTTCAATGGAAGA
GGCTGACTGAGGGTCACCCAACTTATATCTCGAAATTTCACAATTTCTACAAGTTCTGTCCTGGGAGGCAAGAGTAGGTG
AAACGAGCACACTCTACGCCAGGCAAACAAACCTCAACGCTTAGCCTCCCGGCACCTCCTAGGGCCGGAAGCTTCTCAGC
CCAAAGCCGCTGCTGGCTGCAACCTCCGTCCCGCAGTCCAATTAGCAGCCGCGACCCGGCGCCCGCCCACGCCGCGTCAC
GAGTCAGCCAAAGATGGCTGCGCCCAGGTAATTTGAGCAAAGGCCACAGTGAACTCCGGCGTGGCTGAGGAAGGAGGAGG
CACCCACAGGCTGCTGGGAGGAGAGCATAAGGTACTGGTATTCCGGGGGAGGGGGTGAAGTAAATGTCCCGGTGTCAGGA
GAAGCACGACGCGG
There was only one promoter sequence found by using ElDorado on Genomatix. It is 734 base pairs long and found far upstream of the coding region of TMEM126A. The promoter sequence experiences extremely high levels of expression among primates but could not be found in any other species.
## mRNA Folding
The minimum free energy formation has a number of hairpin loops and bulges. Another formation exists with a much larger bulge but which maintains the same hairpin loops.
TMEM126A has a number of likely locations for the formation of hairpin loops, four of which are extremely likely.
## Alternative Splicing
In some circumstances, the second exon of the TMEM126A mRNA can be spliced out. This exon contains the main starting codon for the gene. The loss of this region would delay the start of translation until the next methionine, which occurs later in exon 3. Ultimately, this causes a loss of a great deal of genetic information from exons 2 and three.
# Protein
## Isoforms
The protein has three isoforms (a,b and c). The first isoform is the main version and the longest while the other two are both shorter.
## Secondary structure
TMEM126A has a mixture of alpha helices, beta strands and coils that make up its secondary structure. There are two regions of high alpha-helix density which correspond to the transmembrane regions of the protein.
## Domains and motifs
TMEM126A contains four exons, two transmembrane regions, and three stem-loop capable regions.
## Post-translational modifications
A peptide interaction can be found at amino acid 82 and continues to amino acid 90. This regions has good solubility, thanks to the presence of both cysteine and valine, is not conserved in rabbits, which allows for antibody production, and demonstrates high hydrophobicity.
In addition, there are two glycosylation sites at amino acids 13 and 60. as well as one phosphorylation site at amino acid 40
# Expression
TMEM126A is expressed ubiquitously throughout the human body at 1.8 times the normal expression level for human genes. It experiences especially high expression in the parathyroid gland. In addition, TMEM126A experiences higher levels of expression in peripheral blood cells in patients diagnosed with Huntington's disease as well as individuals who experience ocular dominance.
# Interacting proteins
TMEM126A interacts with a number of proteins. MYC and MAX form a complex and promote transcription. There is interaction with ATP synthase and the optic atrophy protein. These interactions relate to the proteins function in the mitochondria as well as its medical applications.
# Clinical significance
A nonsense mutation in the TMEM126A gene has been shown to be related to optic atrophy. This mutation occurs on the second exon of the protein. The mutation results in decreased expression of TMEM126A. It has been demonstrated that a mutated TMEM126A gene can be distinguished from a normal gene through the use of antibodies which recognize the differences between the two. Experiments have shown that it associates with CD137L in myeloid cells.
# Model organisms
Model organisms have been used in the study of TMEM126A function. A conditional knockout mouse line called Tmem126atm1a(EUCOMM)Wtsi was generated at the Wellcome Trust Sanger Institute. Male and female animals underwent a standardized phenotypic screen to determine the effects of deletion. Additional screens performed: - In-depth immunological phenotyping | TMEM126A
Transmembrane protein 126A is a mitochondrial transmembrane protein of unknown function coded for by the TMEM126A gene.[1][2]
A nonsense mutation in the TMEM126A gene has been shown to be related to optic atrophy. TMEM126A shows higher levels of expression in the parathyroid gland[3] as well as in the peripheral blood cells of Huntington's disease patients, indicating that expression of this protein has some relation to blood regulation.
TMEM126A has two isoforms and is found on the long arm of Chromosome 11 in region 1, band 4, sub-band 1.[4] It is produced by the TMEM126 gene, which codes for a mRNA 726 base pairs long.[5] which translates into a protein 195 amino acids long.[6] In addition, this gene is expressed 1.8 times the average of a normal gene and has expression with the prostate, uterus, kidney, placenta, heart, brain, and a large number of other tissues.[7]
# Gene
## Locus
TMEM126 is located on the long arm of chromosome 11 in humans. It is found on the first sub-band of the fourth band within the first region.[5] This can be written as 11q14.1.
## Aliases
TMEM126A is also known as OPA7 and DKFZp586c1924.
# Homology/evolutionary history
TMEM126A has been highly conserved among mammals, never dropping below 60% sequence identity when aligned with the same protein sequence from other species. It has been less well conserved outside of mammals, although it is evident in both fish, birds, and some invertebrates.[8]
## Orthologs
[8]
## Paralogs
TMEM126A has a single paralog: TMEM126B. It is also found at 11q14.1 and is also known as HT007.[9] TMEM126B shares 36% sequence identity and 49% sequence similarity with TMEM126A.[8] The central domain is conserved between TMEM126A and TMEM126B.[10]
# mRNA
## Promoter Analysis
Promoter sequence:
TTCACCCAACACTGCTTCCAAATAAGCAGTACTCTGGAGAACACGAGAAATCCTCAGAAAAATAAGCTGCAGCTCTGAGG
TGCTGATTATGGTAGGGCAATCAATACAGATCAAAACATGGCACAGGGAGCTTAAGTTCCTAGGGAGAGTAGAAAATCGA
TAGAGCCAAGAAATAGCTCACCTTTGACTTATTTTTAACCTGAGTAGCTATCATATGCCAAGAGCTGTGCAGTTTTCATT
TACCCCATGCCAAGAACGTAAGTAGGCTCTACTGACCAGGAAGTTAAGTAATATGCCCGAGGTACGTTTTCAATGGAAGA
GGCTGACTGAGGGTCACCCAACTTATATCTCGAAATTTCACAATTTCTACAAGTTCTGTCCTGGGAGGCAAGAGTAGGTG
AAACGAGCACACTCTACGCCAGGCAAACAAACCTCAACGCTTAGCCTCCCGGCACCTCCTAGGGCCGGAAGCTTCTCAGC
CCAAAGCCGCTGCTGGCTGCAACCTCCGTCCCGCAGTCCAATTAGCAGCCGCGACCCGGCGCCCGCCCACGCCGCGTCAC
GAGTCAGCCAAAGATGGCTGCGCCCAGGTAATTTGAGCAAAGGCCACAGTGAACTCCGGCGTGGCTGAGGAAGGAGGAGG
CACCCACAGGCTGCTGGGAGGAGAGCATAAGGTACTGGTATTCCGGGGGAGGGGGTGAAGTAAATGTCCCGGTGTCAGGA
GAAGCACGACGCGG[11]
[8]
There was only one promoter sequence found by using ElDorado on Genomatix. It is 734 base pairs long and found far upstream of the coding region of TMEM126A. The promoter sequence experiences extremely high levels of expression among primates but could not be found in any other species.
## mRNA Folding
The minimum free energy formation has a number of hairpin loops and bulges. Another formation exists with a much larger bulge but which maintains the same hairpin loops.
TMEM126A has a number of likely locations for the formation of hairpin loops, four of which are extremely likely.
## Alternative Splicing
In some circumstances, the second exon of the TMEM126A mRNA can be spliced out. This exon contains the main starting codon for the gene. The loss of this region would delay the start of translation until the next methionine, which occurs later in exon 3. Ultimately, this causes a loss of a great deal of genetic information from exons 2 and three.
# Protein
## Isoforms
The protein has three isoforms (a,b and c). The first isoform is the main version and the longest while the other two are both shorter.
## Secondary structure
TMEM126A has a mixture of alpha helices, beta strands and coils that make up its secondary structure. There are two regions of high alpha-helix density which correspond to the transmembrane regions of the protein.
## Domains and motifs
TMEM126A contains four exons, two transmembrane regions, and three stem-loop capable regions.[12][13]
## Post-translational modifications
A peptide interaction can be found at amino acid 82 and continues to amino acid 90. This regions has good solubility, thanks to the presence of both cysteine and valine, is not conserved in rabbits, which allows for antibody production, and demonstrates high hydrophobicity.
In addition, there are two glycosylation sites at amino acids 13 and 60.[14] as well as one phosphorylation site at amino acid 40[15]
# Expression
TMEM126A is expressed ubiquitously throughout the human body at 1.8 times the normal expression level for human genes. It experiences especially high expression in the parathyroid gland.[3] In addition, TMEM126A experiences higher levels of expression in peripheral blood cells in patients diagnosed with Huntington's disease as well as individuals who experience ocular dominance.
# Interacting proteins
TMEM126A interacts with a number of proteins. MYC and MAX form a complex and promote transcription.[16] There is interaction with ATP synthase and the optic atrophy protein.[17] These interactions relate to the proteins function in the mitochondria as well as its medical applications.
# Clinical significance
A nonsense mutation in the TMEM126A gene has been shown to be related to optic atrophy.[18] This mutation occurs on the second exon of the protein. The mutation results in decreased expression of TMEM126A. It has been demonstrated that a mutated TMEM126A gene can be distinguished from a normal gene through the use of antibodies which recognize the differences between the two. Experiments have shown that it associates with CD137L in myeloid cells.[19]
# Model organisms
Model organisms have been used in the study of TMEM126A function. A conditional knockout mouse line called Tmem126atm1a(EUCOMM)Wtsi was generated at the Wellcome Trust Sanger Institute.[20] Male and female animals underwent a standardized phenotypic screen[21] to determine the effects of deletion.[22][23][24][25] Additional screens performed: - In-depth immunological phenotyping[26] | https://www.wikidoc.org/index.php/TMEM126A | |
05a96c3842385ab6380c28e23c4cb141aa8d76f2 | wikidoc | TMEM229B | TMEM229B
Transmembrane protein 229b is a protein that in humans is encoded by the TMEM229b gene.
# Nomenclature
The TMEM229B gene is also known as C14orf83, FLJ33387, Q8NBD8, Hs.509707, Hs.712258, IPR010540, and CN083_HUMAN.
# Gene
The TMEM229B gene is located on the sense strand (-) of chromosome 14 at location 14q24.1 and spans the chromosomal locus 67,936,983—67,982,021. Covering a total of 45,038 base pairs (bp) along the chromosome, the TMEM229B gene has a total of 3 exons in its primary unspliced transcript mRNA of 4,068 bp. There are a total of 7 transcript variants for TMEM229B ranging in mRNA size from 519 bp to 5008 bp. The TMEM229B gene is flanked by phosphatidylinotisol glycan anchor class H (PIGH), a protein associated with the endoplasmic reticulum specifically GPI-anchor biosynthesis, and PLEK2 on its left. See Figure 1.0. The gene is highly conserved in vertebrates, including portions of the approximately 3,000 base pairs of 3'UTR.
# Tissue distribution
Expressed sequence tag mapping of TMEM229B gene expression indicates that it is ubiquitously expressed throughout the body. TMEM229B is more heavily expressed in the parathyroid, skin, and thyroid tissues, and moderately expressed in bone marrow, trachea, spleen, eye, brain, pancreas, mammary gland, intestine, liver, thymus, lymph node, ovarian, muscle, lung, blood, and kidney tissues.
# Protein
The translated TMEM229B protein is a total of 167 amino acids long, with a predicted molecular weight of 19,531 Daltons. The TMEM229B protein contains a domain of unknown function, part of the domain family DUF1113, spanning from amino acids 87 to 135.
Based on predicted structure TMEM229b is highly resemblant of a connexin subunit. A highly conserved phosphorylation site exists at the Threonine-139 position. See multiple sequence alignment below.
- Annotated diagram of the TMEM229b gene (with its 3 exons), mature mRNA and protein domains. Functional peptide is predicted to take the form of a connexin 4-pass transmembrane subunit (seen below).
Annotated diagram of the TMEM229b gene (with its 3 exons), mature mRNA and protein domains. Functional peptide is predicted to take the form of a connexin 4-pass transmembrane subunit (seen below).
# Clinical relevance
Expression of the TMEM229B gene increases in several disease states including amelanotic skin melanoma, B-cell neoplasm, breast carcinoma, Burkitt's lymphoma, colorectal adenocarcinoma, carcinoma, cutaneous T cell lymphoma, esophageal carcinoma, gastric carcinoma, glioblastoma, liver carcinoma, lymphoma, melanoma, small cell lung carcinoma, T-cell acute lymphoblastic leukemia, thyroid carcinoma and Wilms' tumor as found in several microarray experiments. Over-expression of the TMEM229B gene has not been linked as a causal factor in any of these disease states. | TMEM229B
Transmembrane protein 229b is a protein that in humans is encoded by the TMEM229b gene.[1]
# Nomenclature
The TMEM229B gene is also known as C14orf83, FLJ33387, Q8NBD8, Hs.509707, Hs.712258, IPR010540, and CN083_HUMAN.[2][3][4]
# Gene
The TMEM229B gene is located on the sense strand (-) of chromosome 14 at location 14q24.1 and spans the chromosomal locus 67,936,983—67,982,021.[5] Covering a total of 45,038 base pairs (bp) along the chromosome, the TMEM229B gene has a total of 3 exons in its primary unspliced transcript mRNA of 4,068 bp. There are a total of 7 transcript variants for TMEM229B ranging in mRNA size from 519 bp to 5008 bp.[6] The TMEM229B gene is flanked by phosphatidylinotisol glycan anchor class H (PIGH), a protein associated with the endoplasmic reticulum specifically GPI-anchor biosynthesis, and PLEK2 on its left.[7][8] See Figure 1.0. The gene is highly conserved in vertebrates, including portions of the approximately 3,000 base pairs of 3'UTR.[9]
# Tissue distribution
Expressed sequence tag mapping of TMEM229B gene expression indicates that it is ubiquitously expressed throughout the body. TMEM229B is more heavily expressed in the parathyroid, skin, and thyroid tissues, and moderately expressed in bone marrow, trachea, spleen, eye, brain, pancreas, mammary gland, intestine, liver, thymus, lymph node, ovarian, muscle, lung, blood, and kidney tissues.[10]
# Protein
The translated TMEM229B protein is a total of 167 amino acids long, with a predicted molecular weight of 19,531 Daltons.[11] The TMEM229B protein contains a domain of unknown function, part of the domain family DUF1113, spanning from amino acids 87 to 135.[12]
Based on predicted structure TMEM229b is highly resemblant of a connexin subunit.[13] A highly conserved phosphorylation site exists at the Threonine-139 position.[14] See multiple sequence alignment below.
- Annotated diagram of the TMEM229b gene (with its 3 exons), mature mRNA and protein domains. Functional peptide is predicted to take the form of a connexin 4-pass transmembrane subunit (seen below).
Annotated diagram of the TMEM229b gene (with its 3 exons), mature mRNA and protein domains. Functional peptide is predicted to take the form of a connexin 4-pass transmembrane subunit (seen below).
# Clinical relevance
Expression of the TMEM229B gene increases in several disease states including amelanotic skin melanoma, B-cell neoplasm, breast carcinoma, Burkitt's lymphoma, colorectal adenocarcinoma, carcinoma, cutaneous T cell lymphoma, esophageal carcinoma, gastric carcinoma, glioblastoma, liver carcinoma, lymphoma, melanoma, small cell lung carcinoma, T-cell acute lymphoblastic leukemia, thyroid carcinoma and Wilms' tumor as found in several microarray experiments.[13] Over-expression of the TMEM229B gene has not been linked as a causal factor in any of these disease states. | https://www.wikidoc.org/index.php/TMEM229B | |
d9515bbadfba1ee9d8470406f0dc09d9928b969c | wikidoc | TNFRSF18 | TNFRSF18
Tumor necrosis factor receptor superfamily member 18 (TNFRSF18) also known as activation-inducible TNFR family receptor (AITR) or glucocorticoid-induced TNFR-related protein (GITR) is a protein that in humans is encoded by the TNFRSF18 gene. GITR is currently of interest to immunologists as a co-stimulatory immune checkpoint molecule.
# Function
TNFRSF18 is a member of the tumor necrosis factor receptor (TNF-R) superfamily. This receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25+/CD4+ regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported.
## AITR
Human activation-inducible tumor necrosis factor receptor (AITR) and its ligand, AITRL, are important costimulatory molecules in the pathogenesis of autoimmune diseases. Despite the importance of these costimulatory molecules in autoimmune disease, their role in the autoimmune reaction to herniated disc fragments has yet to be explored.
## GITR
GITR was identified as a new member of the TNF receptor superfamily, by comparing gene expression in untreated and DEX-treated murine T-cell lines. GITR can also be induced when T cells are activated. Although mouse GITR is induced by either GC engagement or T-cell activation, its human homologue (hGITR/AITR) is upregulated only by activation. Therefore, the requirements for GR signaling in inducing GITR expression by T cells remain moot .
GITR (glucocorticoid-induced tumor necrosis factor receptor) is a surface receptor molecule that has been shown to be involved in inhibiting the suppressive activity of T-regulatory cells and extending the survival of T-effector cells. In mouse models, GITR was initially noted to be selectively enriched on the surface of regulatory T cells, making this an attractive potential surface marker for these rare cells. However, subsequent studies revealed GITR to also be up-regulated on any activated T cells in humans, thus undermining its utility as a regulatory T cell marker. | TNFRSF18
Tumor necrosis factor receptor superfamily member 18 (TNFRSF18) also known as activation-inducible TNFR family receptor (AITR)[1] or glucocorticoid-induced TNFR-related protein (GITR) is a protein that in humans is encoded by the TNFRSF18 gene.[2][3][4] GITR is currently of interest to immunologists as a co-stimulatory immune checkpoint molecule.
# Function
TNFRSF18 is a member of the tumor necrosis factor receptor (TNF-R) superfamily. This receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25+/CD4+ regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported.[4]
## AITR
Human activation-inducible tumor necrosis factor receptor (AITR) and its ligand, AITRL, are important costimulatory molecules in the pathogenesis of autoimmune diseases. Despite the importance of these costimulatory molecules in autoimmune disease, their role in the autoimmune reaction to herniated disc fragments has yet to be explored.[5]
## GITR
GITR was identified as a new member of the TNF receptor superfamily, by comparing gene expression in untreated and DEX-treated murine T-cell lines. GITR can also be induced when T cells are activated. Although mouse GITR is induced by either GC engagement or T-cell activation, its human homologue (hGITR/AITR) is upregulated only by activation. Therefore, the requirements for GR signaling in inducing GITR expression by T cells remain moot .[6]
GITR (glucocorticoid-induced tumor necrosis factor receptor) is a surface receptor molecule that has been shown to be involved in inhibiting the suppressive activity of T-regulatory cells and extending the survival of T-effector cells. In mouse models, GITR was initially noted to be selectively enriched on the surface of regulatory T cells, making this an attractive potential surface marker for these rare cells. However, subsequent studies revealed GITR to also be up-regulated on any activated T cells in humans, thus undermining its utility as a regulatory T cell marker.[7] | https://www.wikidoc.org/index.php/TNFRSF18 | |
523ecdca259e8c61599f71cee2f4f5283333a6ea | wikidoc | TRAF3IP3 | TRAF3IP3
TRAF3-interacting JNK-activating modulator is a protein that in humans is encoded by the TRAF3IP3 gene.
# Model organisms
Model organisms have been used in the study of TRAF3IP3 function. A conditional knockout mouse line, called Traf3ip3tm1a(KOMP)Wtsi was generated as part of the International Knockout Mouse Consortium program—a high-throughput mutagenesis project to generate and distribute animal models of disease to interested scientists.
Male and female animals underwent a standardized phenotypic screen to determine the effects of deletion. Twenty three tests were carried out on homozygous mutant mice and two significant abnormalities were observed. Males had a decrease in white blood cell count and females had an increased susceptibility to bacterial infection.
# Interactions
TRAF3IP3 has been shown to interact with STRN, MOBKL3, STK24 and FAM40A. | TRAF3IP3
TRAF3-interacting JNK-activating modulator is a protein that in humans is encoded by the TRAF3IP3 gene.[1][2]
# Model organisms
Model organisms have been used in the study of TRAF3IP3 function. A conditional knockout mouse line, called Traf3ip3tm1a(KOMP)Wtsi[8][9] was generated as part of the International Knockout Mouse Consortium program—a high-throughput mutagenesis project to generate and distribute animal models of disease to interested scientists.[10][11][12]
Male and female animals underwent a standardized phenotypic screen to determine the effects of deletion.[6][13] Twenty three tests were carried out on homozygous mutant mice and two significant abnormalities were observed.[6] Males had a decrease in white blood cell count and females had an increased susceptibility to bacterial infection.[6]
# Interactions
TRAF3IP3 has been shown to interact with STRN,[14] MOBKL3,[14] STK24[14] and FAM40A.[14] | https://www.wikidoc.org/index.php/TRAF3IP3 | |
9496c7402b714b4f6eabf3515d6da0ddde703012 | wikidoc | Tabebuia | Tabebuia
Tabebuia is a neotropical genus of about 100 species in the tribe Tecomeae of the family Bignoniaceae. The species range from northern Mexico and the Antilles south to northern Argentina, including those on the islands of Hispaniola (Dominican Republic and Haiti) and Cuba.
# Description
They are large shrubs and trees growing to 5 to 50 m (16 to 160 ft) tall depending on the species; many species are dry-season deciduous but some are evergreen. The leaves are opposite pairs, simple or palmately compound with 3-7 leaflets. Tabebuia is a notable flowering tree.
Tabebuia flowers are 3 to 11 cm (1 to 4 in) wide and are produced in dense clusters. They present a cupular calyx campanulate to tubular, truncate, bilabiate or 5-lobed. Corolla colors vary between species ranging from white, light pink, yellow, lavender, magenta, or red. The outside texture of the flower tube is either glabrous or pubescent.
The fruit is a dehiscent pod, 10 to 50 cm (4 to 20 in)long, containing numerous (sometimes winged) seeds. These pods often remain on the tree through dry season until the beginning of the rainy season.
# Usage
Species in this genus are important as timber trees. The wood is used for furniture, decking, and other outdoor uses. It has a fire rating of A1 (the highest possible, the same as concrete) , and is denser than water (it sinks). It is increasingly popular as a decking material due to its insect resistance and durability. FSC-certified ipê wood is now (as of 2007) readily available on the market.
It has been broadly used as ornamental tree in landscaping gardens, public squares and boulevards due to its impressive and colorful flowering. Many flowers appear on still leafless stems at the end of the dry season, making the floral display more conspicuous.
The bark of several species is used medicinally (particularly the Inner Bark of Tabebuia impetiginosa also known as Lapacho or Taheebo). Its main active principles are lapachol, quercetin and other flavonoids. The inner bark is dried, shredded and then boiled making a bitter or sour-tasting brownish-colored tea. It is also available in pill form. The herbal remedy is typically used during flu and cold season and for "curing" smoker's cough. It apparently works as expectorant: by promoting the lungs to "cough up" and free deeply embedded mucus and contaminates.
Tabebuia species are used as an additive to some versions of the psychedelic drink Ayahuasca.
# Species
Of nearly 100 species, a few notable are:
- Tabebuia alba (Cham.) Sandw. (syn.: Tecoma alba Cham, Handroanthus albus (Cham.) Mattos) - Brazil
- Tabebuia caraiba (Mart.) Bur. (syn.: Tecoma argentea Bur. et K. Sch., Tecoma caraiba Mart., Tecoma caraiba var. squamellulosa (DC.) Bur. et K. Sch., Tecoma squamellulosa DC., and Handroanthus caraiba (Mart.) Mattos)
- Tabebuia cassinoides
- Tabebuia chrysantha (Jacq.) Nichols. (Araguaney) from northern South America, is the national tree of Venezuela. The flowers are yellow. In northern Colombia is known as cañaguate.
- Tabebuia chrysotricha (Mart. ex DC.) Standl. (Golden trumpet tree; syn T. flavescens, T. pedicellata), from Brazil; golden-yellow to red flowers.
- Tabebuia donnell-smithii Rose (Prima vera or Gold tree), a native of Mexico and Central Americas, is considered one of the most colorful of all Central america trees. The leaves are deciduous. Masses of golden-yellow flowers cover the crown after the leaves are shed. Other Regionals Common Names are San Juan (Honduras), Palo blanco (Guatemala), Cortez blanco (El Salvador), Duranga (Mexico)
- Tabebuia guayacan (Seem.) Hemsl., Biol. Cent.-Amer.
- Tabebuia heptaphylla (tajy)
- Tabebuia impetiginosa Lor. ex Griseb. Main syn.: Tabebuia avellanedae (Pink Ipê, Ipê-roxo, Paud'arco-roxo, Ipê-roxo-damata, Ipê-reto, Ipê-rosa, Ipê-comum, Ipê-cavatã, Lapacho, Peúva, and Piúva ; syn. Tecoma ipe Mart. ex K. Schm., Tecoma avellandedae (Lor. ex Griseb.) Spreg., Handroanthus avellanedae (Lor. ex Griseb.) Mattos, Tabebuia ipe (Mart.) Standl.) from South America, is native of Brazil; bark is used medicinally.
- Tabebuia orinocensis A.H. Gentry, Mem.
- Tabebuia ochracea Standl., Field Mus. Nat. Hist., Bot.
- Tabebuia rosea (A.P. de Candolle) Britton (Pink Poui, Pink tecoma or Apama or Apamate; syn. T. pentaphylla (L.) Hemsley, widely but incorrectly applied to this species) is a popular street tree in tropical cities because of its multi-annular masses of light pink flowers and modest size. The roots are not especially aggressive towards roads and sidewalks. It is native of Brazil
- Tabebuia roseo-alba
- Tabebuia serratifolia (Yellow Poui, Ipê, Pau d'arco, Ipê roxo, or Lapacho) is a commercially farmed hardwood notable for its extreme hardness and resistance to fire and pests. Its inner bark is used as a treatment for fungal infections.
- Tabebuia subtilis Sprague & Sandwith, Bull.
- Tabebuia umbellata
- Tabebuia vellosoi
# Exploitation
The demand for ipê has risen dramatically in recent years, especially in the United States. By the 1990s, numerous environmental organizations working on preservation of the Amazon Rainforest reported that about 80% of logging in the Brazilian Amazon was illegal. The Brazilian government has confirmed this figure, most notably in a ‘leaked’ report from the Brazilian Intelligence Agency, the Secretaria de Assuntos Estratégicos (SAE) or Strategic Affairs Secretariat, in which it was confirmed that five times the amount of wood sanctioned to be cut from legal Amazon concessions was being exported and that numerous staff of the environment agency, IBAMA, were taking bribes. In one Greenpeace report, The Santarém Five and Illegal Logging — A Case Study, five companies were reported to be logging illegally in the region around Santarém, Pará. At that time exports from that region were most notably going to the Netherlands and France. Ipê was among the illegal exports.
Much of the ipê imported into the US is used for decking. Starting in the late 1960s, importing companies targeted large boardwalk projects to sell ipê, beginning with New York City Parks and Recreation (“Parks”) which maintains the city’s boardwalk, including along the beach of Coney Island. The city began using ipê around that time and has since converted the entire boardwalk — over 10 miles (16 km) long — to ipê. The ipê lasted about 25 years, at which time (1994), Parks has been replacing it with new ipê. Given that ipê trees typically grow in densities of only one or two trees per acre, large areas of forest must be logged to fill orders for boardwalks and, to a lesser extent, homeowner decks.
A Rainforest Relief report, Deep Impact, stated that average yields are 76 board feet per acre (44 m³/km²) of FEQ (first export quality — FAS four-side-clear) grade ipê over seven feet (2.1 m) in length. Typically, wooden boardwalks are composed of 30,000 to 40,000 board feet (70 to 90 m³) per city block. For New York City’s 10 miles (16 km) of boardwalk, this would yield an estimate of 83,360 acres (337 km²) of Amazon rainforest logged. | Tabebuia
Tabebuia is a neotropical genus of about 100 species [1] in the tribe Tecomeae of the family Bignoniaceae. The species range from northern Mexico and the Antilles south to northern Argentina, including those on the islands of Hispaniola (Dominican Republic and Haiti) and Cuba.
# Description
They are large shrubs and trees growing to 5 to 50 m (16 to 160 ft) tall depending on the species; many species are dry-season deciduous but some are evergreen. The leaves are opposite pairs, simple or palmately compound with 3-7 leaflets. Tabebuia is a notable flowering tree.
Tabebuia flowers are 3 to 11 cm (1 to 4 in) wide and are produced in dense clusters. They present a cupular calyx campanulate to tubular, truncate, bilabiate or 5-lobed. Corolla colors vary between species ranging from white, light pink, yellow, lavender, magenta, or red. The outside texture of the flower tube is either glabrous or pubescent.
The fruit is a dehiscent pod, 10 to 50 cm (4 to 20 in)long, containing numerous (sometimes winged) seeds. These pods often remain on the tree through dry season until the beginning of the rainy season.
# Usage
Species in this genus are important as timber trees. The wood is used for furniture, decking, and other outdoor uses. It has a fire rating of A1 (the highest possible, the same as concrete) [2], and is denser than water (it sinks). It is increasingly popular as a decking material due to its insect resistance and durability. FSC-certified ipê wood is now (as of 2007) readily available on the market.
It has been broadly used as ornamental tree in landscaping gardens, public squares and boulevards due to its impressive and colorful flowering. Many flowers appear on still leafless stems at the end of the dry season, making the floral display more conspicuous.
The bark of several species is used medicinally (particularly the Inner Bark of Tabebuia impetiginosa also known as Lapacho or Taheebo). Its main active principles are lapachol, quercetin and other flavonoids. The inner bark is dried, shredded and then boiled making a bitter or sour-tasting brownish-colored tea. It is also available in pill form. The herbal remedy is typically used during flu and cold season and for "curing" smoker's cough. It apparently works as expectorant: by promoting the lungs to "cough up" and free deeply embedded mucus and contaminates.
Tabebuia species are used as an additive to some versions of the psychedelic drink Ayahuasca.[3]
# Species
Of nearly 100 species, a few notable are:
- Tabebuia alba (Cham.) Sandw. (syn.: Tecoma alba Cham, Handroanthus albus (Cham.) Mattos) - Brazil
- Tabebuia caraiba (Mart.) Bur. (syn.: Tecoma argentea Bur. et K. Sch., Tecoma caraiba Mart., Tecoma caraiba var. squamellulosa (DC.) Bur. et K. Sch., Tecoma squamellulosa DC., and Handroanthus caraiba (Mart.) Mattos)
- Tabebuia cassinoides
- Tabebuia chrysantha (Jacq.) Nichols. (Araguaney) from northern South America, is the national tree of Venezuela. The flowers are yellow. In northern Colombia is known as cañaguate.[2]
- Tabebuia chrysotricha (Mart. ex DC.) Standl. (Golden trumpet tree; syn T. flavescens, T. pedicellata), from Brazil; golden-yellow to red flowers.
- Tabebuia donnell-smithii Rose (Prima vera or Gold tree), a native of Mexico and Central Americas, is considered one of the most colorful of all Central america trees. The leaves are deciduous. Masses of golden-yellow flowers cover the crown after the leaves are shed. Other Regionals Common Names are San Juan (Honduras), Palo blanco (Guatemala), Cortez blanco (El Salvador), Duranga (Mexico)
- Tabebuia guayacan (Seem.) Hemsl., Biol. Cent.-Amer.
- Tabebuia heptaphylla (tajy)
- Tabebuia impetiginosa Lor. ex Griseb. Main syn.: Tabebuia avellanedae (Pink Ipê, Ipê-roxo, Paud'arco-roxo, Ipê-roxo-damata, Ipê-reto, Ipê-rosa, Ipê-comum, Ipê-cavatã, Lapacho, Peúva, and Piúva ; syn. Tecoma ipe Mart. ex K. Schm., Tecoma avellandedae (Lor. ex Griseb.) Spreg., Handroanthus avellanedae (Lor. ex Griseb.) Mattos, Tabebuia ipe (Mart.) Standl.) from South America, is native of Brazil; bark is used medicinally.
- Tabebuia orinocensis A.H. Gentry, Mem.
- Tabebuia ochracea Standl., Field Mus. Nat. Hist., Bot.
- Tabebuia rosea (A.P. de Candolle) Britton (Pink Poui, Pink tecoma or Apama or Apamate; syn. T. pentaphylla (L.) Hemsley, widely but incorrectly applied to this species) is a popular street tree in tropical cities because of its multi-annular masses of light pink flowers and modest size. The roots are not especially aggressive towards roads and sidewalks. It is native of Brazil
- Tabebuia roseo-alba
- Tabebuia serratifolia (Yellow Poui, Ipê, Pau d'arco, Ipê roxo, or Lapacho) is a commercially farmed hardwood notable for its extreme hardness and resistance to fire and pests. Its inner bark is used as a treatment for fungal infections.
- Tabebuia subtilis Sprague & Sandwith, Bull.
- Tabebuia umbellata
- Tabebuia vellosoi
# Exploitation
The demand for ipê has risen dramatically in recent years, especially in the United States. By the 1990s, numerous environmental organizations working on preservation of the Amazon Rainforest reported that about 80% of logging in the Brazilian Amazon was illegal. The Brazilian government has confirmed this figure, most notably in a ‘leaked’ report from the Brazilian Intelligence Agency, the Secretaria de Assuntos Estratégicos (SAE) or Strategic Affairs Secretariat, in which it was confirmed that five times the amount of wood sanctioned to be cut from legal Amazon concessions was being exported and that numerous staff of the environment agency, IBAMA, were taking bribes. In one Greenpeace report, The Santarém Five and Illegal Logging — A Case Study, five companies were reported to be logging illegally in the region around Santarém, Pará. At that time exports from that region were most notably going to the Netherlands and France. Ipê was among the illegal exports.
Much of the ipê imported into the US is used for decking. Starting in the late 1960s, importing companies targeted large boardwalk projects to sell ipê, beginning with New York City Parks and Recreation (“Parks”) which maintains the city’s boardwalk, including along the beach of Coney Island. The city began using ipê around that time and has since converted the entire boardwalk — over 10 miles (16 km) long — to ipê. The ipê lasted about 25 years, at which time (1994), Parks has been replacing it with new ipê. Given that ipê trees typically grow in densities of only one or two trees per acre, large areas of forest must be logged to fill orders for boardwalks and, to a lesser extent, homeowner decks.
A Rainforest Relief report, Deep Impact, stated that average yields are 76 board feet per acre (44 m³/km²) of FEQ (first export quality — FAS four-side-clear) grade ipê over seven feet (2.1 m) in length. Typically, wooden boardwalks are composed of 30,000 to 40,000 board feet (70 to 90 m³) per city block. For New York City’s 10 miles (16 km) of boardwalk, this would yield an estimate of 83,360 acres (337 km²) of Amazon rainforest logged. | https://www.wikidoc.org/index.php/Tabebuia | |
31d386861094c5396535a5204cecbdd6d509fa98 | wikidoc | Talbutal | Talbutal
# Overview
Talbutal (Lotusate) is a barbiturate with a short to intermediate duration of action. It is a structural isomer of butalbital. Talbutal is a schedule III drug in the U.S.
# Pharmacology
Talbutal is a short to intermediate-acting barbiturate. Barbiturates act as nonselective depressants of the central nervous system (CNS), capable of producing all levels of CNS mood alteration from excitation to mild sedation, hypnosis, and deep coma. In sufficiently high therapeutic doses, barbiturates induce anesthesia.
# Mechanism of action
Talbutal binds at a distinct binding site associated with a Cl− ionopore at the GABAA receptor, increasing the duration of time for which the Cl− ionopore is open. The post-synaptic inhibitory effect of GABA in the thalamus is, therefore, prolonged.
# Toxicity
Symptoms of acute barbiturate poisoning include drowsiness, confusion, coma, respiratory depression, hypotension, and shock. | Talbutal
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Talbutal (Lotusate) is a barbiturate with a short to intermediate duration of action. It is a structural isomer of butalbital. Talbutal is a schedule III drug in the U.S.
# Pharmacology
Talbutal is a short to intermediate-acting barbiturate. Barbiturates act as nonselective depressants of the central nervous system (CNS), capable of producing all levels of CNS mood alteration from excitation to mild sedation, hypnosis, and deep coma. In sufficiently high therapeutic doses, barbiturates induce anesthesia.[1]
# Mechanism of action
Talbutal binds at a distinct binding site associated with a Cl− ionopore at the GABAA receptor, increasing the duration of time for which the Cl− ionopore is open. The post-synaptic inhibitory effect of GABA in the thalamus is, therefore, prolonged.
# Toxicity
Symptoms of acute barbiturate poisoning include drowsiness, confusion, coma, respiratory depression, hypotension,[1] and shock. | https://www.wikidoc.org/index.php/Talbutal | |
afcffdaa2b0a50910b4e1be9cd731dfdc9712955 | wikidoc | Tamarind | Tamarind
The Tamarind (Tamarindus indica) (from the Arabic: تمر هندي tamar hindi = Indian date) is in the family Fabaceae. The genus Tamarindus is monotypic (having only a single species). It is a tropical tree, native to tropical Africa, including Sudan and parts of the Madagascar dry deciduous forests. It was introduced into India so long ago that it has often been reported as indigenous there, and it was apparently from India that it reached the Persians and the Arabs who called it "tamar hindi" (Indian date, from the date-like appearance of the dried pulp), giving rise to both its common and generic names. Unfortunately, the specific name, "indica", also perpetuates the illusion of Indian origin. The fruit was well known to the ancient Egyptians and to the Greeks in the 4th Century B.C.
The tree has long been naturalized in the East Indies and the islands of the Pacific. One of the first tamarind trees in Hawaii was planted in 1797. The tamarind was certainly introduced into tropical America, Bermuda, the Bahamas, and the West Indies much earlier. In all tropical and near-tropical areas, including South Florida, it is grown as a shade and fruit tree, along roadsides and in dooryards and parks. There are commercial plantings in Mexico, Belize and other Central American countries and in northern Brazil. In India there are extensive tamarind orchards producing 275,500 tons (250,000 MT) annually. The pulp is marketed in northern Malaya and to some extent wherever the tree is found even if there are no plantations.
The tree can grow up to 20 m in height, and stays evergreen in regions without a dry season. Tamarind timber consists of hard, dark red heartwood and softer, yellowish sapwood. The leaves consist of 10–40 leaflets. The flowers are produced in racemes. The fruit is a brown pod-like legume, which contains a soft acidic pulp and many hard-coated seeds. The seeds can be scarified to enhance germination.
Alternative names include Indian date, translation of Arabic تمر هندي tamr hindī. In Malaysia it is called asam in Malay and swee boey in Hokkien (Min Nan). In Indonesia it is called asem (or asam) Jawa (means Javanese asam) in Indonesian. In the Philippines it is called sampaloc in Tagalog and sambag in Cebuano. In Oriya it is called tentuli. In Hindi it is called imli. In Marathi it is called chinch. In Bangla, the term is tẽtul. In Sinhala the name is siyambala, in Telugu it is called chintachettu (tree) and chintapandu (fruit extract) and in Tamil and Malayalam it is puli (புளி). In Kannada it is called hunase. In Malagasy it is called voamadilo. The Vietnamese term is me. In Puerto Rico it is called "tamarindo". The tamarind is the provincial tree of the Phetchabun province of Thailand (in Thailand it is called ma-kham). In Taiwan it is called loan-tz.
Tamarind (Tamarindus indica) should not be confused with the Manila tamarind (Pithecellobium dulce), which is an entirely different plant, though also in Fabaceae.
# Uses
The fruit pulp is edible and popular. It is used as a spice in both Asian and Latin American cuisines, and is also an important ingredient in Worcestershire sauce, HP sauce and the Jamaican-produced Pickapeppa sauce . The hard green pulp of a young fruit is very tart and acidic and is most often used as a component of savory dishes. The ripened fruit is sweeter, yet still distinctively sour, and can be used in desserts and sweetened drinks, or as a snack. In Thailand, there is a carefully cultivated sweet variety with little to no tartness grown specifically to be eaten as a fresh fruit.
The leaves are also distinctly tart in flavor, and are used in many soups in the North Eastern part of Thailand.
In temples, especially in Asian countries, the pulp is used to clean brass shrine furniture, removing dulling and the greenish patina that forms.
The wood is a bold red color. Due to its density and durability, tamarind heartwood can be used in making furniture and wood flooring. A tamarind switch is sometimes used as an implement for corporal punishment.
Tamarind trees are very common in South India, particularly in Tamil Nadu and Andhra Pradesh. They are used as ornamental trees and to provide shade on the country roads and highways. Tamarind is extensively used in the cuisine of both these states.
Tamarind is a staple in the Tamil Nadu diet, where it is used to prepare Rasam, Sambhar, Puliyogare, and various types of chutneys.
The pulp, leaves, and bark also have medical applications. For example, in the Philippines, the leaves have been traditionally used in herbal tea for reducing malaria fever. Due to its medicinal value, tamarind is used as an Ayurvedic Medicine for gastric and/or digestion problems.
In Egypt, there is an acidic chilled drink made from tamarind which is popular in summertime. It is called "tamr hindi".
In Madagascar, the tree is known as the kily tree. Its fruits and leaves are a well-known favorite of ring-tailed lemurs, providing as much as 50% of their food resources during the year if available.
Tamarind is available in specialty food stores worldwide in pod form or as a paste or concentrate. It is also sold in various snack forms in Southeast Asia and in Mexico where it is dried and salted, candied (see for example pulparindo), and served as a cold drink. Pad Thai, a Thai dish popular with Europeans and Americans, sometimes includes tamarind for its tart taste (though lime juice and/or white vinegar are more commonly used). A tamarind-based sweet-and-sour sauce served over deep-fried fish is also a common dish in Central Thailand. In Singapore and Malaysia it is used to add a sweet-sour taste to gravy for fish in a dish called asam fish. In the Philippines it is used to add a sour taste in Sinigang soup.
In Latin America, especially Mexico, and Latin American immigrant communities in the US, the fruit is wildly popular and is fashioned into a drink, "Agua de Tamarindo", and many kinds of treats. Many popular Tamarindo concoctions are hard candies and suckers and one of the most popular aguas frescas is flavored with tamarind.
In the state of Andhra Pradesh in India, a tangy pickle is made from Tamarind flowers.
The tamarind tree is the official plant of Santa Clara, Cuba. Consequently it appears in the coat of arms of the city.
Other uses: tamarind has recently become popular in bonsai culture, frequently used in Asian countries like Indonesia, Taiwan and the Philippines. In the last Japan Airlines World Bonsai competition, Mr. Budi Sulistyo of Indonesia won the second prize with an ancient tamarind bonsai.
# References and external links
- Dassanayake, M. D. & Fosberg, F. R. (Eds.). (1991). A Revised Handbook to the Flora of Ceylon. Washington, D. C.: Smithsonian Institution.
- Hooker, Joseph Dalton. (1879). The Flora of British India, Vol II. London: L. Reeve & Co.
- Fruits of Warm Climates: Tamarind
- Plant Cultures: History and botany of tamarind
- California Rare Fruit Growers: Tamarind Fruit Facts
- Official Pickapeppa sauce web site | Tamarind
The Tamarind (Tamarindus indica) (from the Arabic: تمر هندي tamar hindi = Indian date) is in the family Fabaceae. The genus Tamarindus is monotypic (having only a single species). It is a tropical tree, native to tropical Africa, including Sudan and parts of the Madagascar dry deciduous forests. It was introduced into India so long ago that it has often been reported as indigenous there, and it was apparently from India that it reached the Persians and the Arabs who called it "tamar hindi" (Indian date, from the date-like appearance of the dried pulp), giving rise to both its common and generic names.[citation needed] Unfortunately, the specific name, "indica", also perpetuates the illusion of Indian origin. The fruit was well known to the ancient Egyptians and to the Greeks in the 4th Century B.C.[citation needed]
The tree has long been naturalized in the East Indies and the islands of the Pacific. One of the first tamarind trees in Hawaii was planted in 1797. The tamarind was certainly introduced into tropical America, Bermuda, the Bahamas, and the West Indies much earlier. In all tropical and near-tropical areas, including South Florida, it is grown as a shade and fruit tree, along roadsides and in dooryards and parks. There are commercial plantings in Mexico, Belize and other Central American countries and in northern Brazil. In India there are extensive tamarind orchards producing 275,500 tons (250,000 MT) annually. The pulp is marketed in northern Malaya and to some extent wherever the tree is found even if there are no plantations.
The tree can grow up to 20 m in height, and stays evergreen in regions without a dry season. Tamarind timber consists of hard, dark red heartwood and softer, yellowish sapwood. The leaves consist of 10–40 leaflets. The flowers are produced in racemes. The fruit is a brown pod-like legume, which contains a soft acidic pulp and many hard-coated seeds. The seeds can be scarified to enhance germination.
Alternative names include Indian date, translation of Arabic تمر هندي tamr hindī. In Malaysia it is called asam in Malay and swee boey in Hokkien (Min Nan). In Indonesia it is called asem (or asam) Jawa (means Javanese asam) in Indonesian. In the Philippines it is called sampaloc in Tagalog and sambag in Cebuano. In Oriya it is called tentuli. In Hindi it is called imli. In Marathi it is called chinch. In Bangla, the term is tẽtul. In Sinhala the name is siyambala, in Telugu it is called chintachettu (tree) and chintapandu (fruit extract) and in Tamil and Malayalam it is puli (புளி). In Kannada it is called hunase. In Malagasy it is called voamadilo. The Vietnamese term is me. In Puerto Rico it is called "tamarindo". The tamarind is the provincial tree of the Phetchabun province of Thailand (in Thailand it is called ma-kham). In Taiwan it is called loan-tz.
Tamarind (Tamarindus indica) should not be confused with the Manila tamarind (Pithecellobium dulce), which is an entirely different plant, though also in Fabaceae.
# Uses
The fruit pulp is edible and popular. It is used as a spice in both Asian and Latin American cuisines, and is also an important ingredient in Worcestershire sauce, HP sauce and the Jamaican-produced Pickapeppa sauce [1]. The hard green pulp of a young fruit is very tart and acidic and is most often used as a component of savory dishes. The ripened fruit is sweeter, yet still distinctively sour, and can be used in desserts and sweetened drinks, or as a snack. In Thailand, there is a carefully cultivated sweet variety with little to no tartness grown specifically to be eaten as a fresh fruit.
The leaves are also distinctly tart in flavor, and are used in many soups in the North Eastern part of Thailand.
In temples, especially in Asian countries, the pulp is used to clean brass shrine furniture, removing dulling and the greenish patina that forms.[2]
The wood is a bold red color. Due to its density and durability, tamarind heartwood can be used in making furniture and wood flooring. A tamarind switch is sometimes used as an implement for corporal punishment.
Tamarind trees are very common in South India, particularly in Tamil Nadu and Andhra Pradesh. They are used as ornamental trees and to provide shade on the country roads and highways. Tamarind is extensively used in the cuisine of both these states.
Tamarind is a staple in the Tamil Nadu diet, where it is used to prepare Rasam, Sambhar, Puliyogare, and various types of chutneys.
The pulp, leaves, and bark also have medical applications. For example, in the Philippines, the leaves have been traditionally used in herbal tea for reducing malaria fever. Due to its medicinal value, tamarind is used as an Ayurvedic Medicine for gastric and/or digestion problems.
In Egypt, there is an acidic chilled drink made from tamarind which is popular in summertime. It is called "tamr hindi".
In Madagascar, the tree is known as the kily tree. Its fruits and leaves are a well-known favorite of ring-tailed lemurs, providing as much as 50% of their food resources during the year if available.
Tamarind is available in specialty food stores worldwide in pod form or as a paste or concentrate. It is also sold in various snack forms in Southeast Asia and in Mexico where it is dried and salted, candied (see for example pulparindo), and served as a cold drink. Pad Thai, a Thai dish popular with Europeans and Americans, sometimes includes tamarind for its tart taste (though lime juice and/or white vinegar are more commonly used). A tamarind-based sweet-and-sour sauce served over deep-fried fish is also a common dish in Central Thailand. In Singapore and Malaysia it is used to add a sweet-sour taste to gravy for fish in a dish called asam fish. In the Philippines it is used to add a sour taste in Sinigang soup.
In Latin America, especially Mexico, and Latin American immigrant communities in the US, the fruit is wildly popular and is fashioned into a drink, "Agua de Tamarindo", and many kinds of treats. Many popular Tamarindo concoctions are hard candies and suckers and one of the most popular aguas frescas is flavored with tamarind.
In the state of Andhra Pradesh in India, a tangy pickle is made from Tamarind flowers.
The tamarind tree is the official plant of Santa Clara, Cuba. Consequently it appears in the coat of arms of the city.
Other uses: tamarind has recently become popular in bonsai culture, frequently used in Asian countries like Indonesia, Taiwan and the Philippines. In the last Japan Airlines World Bonsai competition, Mr. Budi Sulistyo of Indonesia won the second prize with an ancient tamarind bonsai.
# References and external links
- Dassanayake, M. D. & Fosberg, F. R. (Eds.). (1991). A Revised Handbook to the Flora of Ceylon. Washington, D. C.: Smithsonian Institution.
- Hooker, Joseph Dalton. (1879). The Flora of British India, Vol II. London: L. Reeve & Co.
- Fruits of Warm Climates: Tamarind
- Plant Cultures: History and botany of tamarind
- California Rare Fruit Growers: Tamarind Fruit Facts
- Official Pickapeppa sauce web site
Template:Herbs & spices | https://www.wikidoc.org/index.php/Tamarind | |
3e7326692f475b4daf2b2931f4e3791fde5c8741 | wikidoc | Tarragon | Tarragon
Tarragon or dragon's-wort (Artemisia dracunculus L.) is a perennial herb in the family Asteraceae related to wormwood. Corresponding to its species name, a common term for the plant is "dragon herb." It is native to a wide area of the Northern Hemisphere from easternmost Europe across central and eastern Asia to western North America, and south to northern India and Mexico. The North American populations may however be naturalised from early human introduction.
Tarragon grows to 120-150 cm tall, with slender, branched stems. The leaves are lanceolate, 2-8 cm long and 2-10 mm broad, glossy green, with an entire margin. The flowers are produced in small capitulae 2-4 mm diameter, each capitulum containing up to 40 yellow or greenish-yellow florets.
# Cultivation and uses
Tarragon has an aromatic property reminiscent of anise, due to the presence of estragole. French tarragon is the variety generally considered best for the kitchen, but cannot be grown from seed. Russian tarragon (A. dracunculoides L.) can be grown from seed but is much weaker in flavour.
However, Russian tarragon is a far more hardy and vigorous plant, spreading at the roots and growing over a meter tall. This tarragon actually prefers poor soils and happily tolerates drought and neglect. It is not as strongly aromatic and flavoursome as its French cousin, but it produces many more leaves from early spring onwards that are mild and good in salads and cooked food. The young stems in early spring can be cooked as an asparagus substitute. Grow indoors from seed and plant out in the summer. Spreading plant can be divided easily.
Tarragon is one of the four fines herbes of French cooking, and particularly suitable for chicken, fish and egg dishes. Tarragon is one of the main components of Bearnaise sauce.
Tarragon is used to flavor a popular carbonated soft drink in the countries of Armenia, Georgia and, by extension, Russia. The drink—named Tarkhun (Template:IPA2, թարխուն, Тархун), which is the Armenian, Persian and Russian word for tarragon—is made out of sugary tarragon concentrate and colored bright green.
"I believe that if ever I had to practice cannibalism, I might manage if there were enough tarragon around." --James Beard
Cis-Pellitorin, an isobutylamide eliciting a pungent taste, has been isolated from Tarragon plant. | Tarragon
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Tarragon or dragon's-wort (Artemisia dracunculus L.) is a perennial herb in the family Asteraceae related to wormwood. Corresponding to its species name, a common term for the plant is "dragon herb." It is native to a wide area of the Northern Hemisphere from easternmost Europe across central and eastern Asia to western North America, and south to northern India and Mexico. The North American populations may however be naturalised from early human introduction.
Tarragon grows to 120-150 cm tall, with slender, branched stems. The leaves are lanceolate, 2-8 cm long and 2-10 mm broad, glossy green, with an entire margin. The flowers are produced in small capitulae 2-4 mm diameter, each capitulum containing up to 40 yellow or greenish-yellow florets.
# Cultivation and uses
Tarragon has an aromatic property reminiscent of anise, due to the presence of estragole. French tarragon is the variety generally considered best for the kitchen, but cannot be grown from seed. Russian tarragon (A. dracunculoides L.) can be grown from seed but is much weaker in flavour.
However, Russian tarragon is a far more hardy and vigorous plant, spreading at the roots and growing over a meter tall. This tarragon actually prefers poor soils and happily tolerates drought and neglect. It is not as strongly aromatic and flavoursome as its French cousin, but it produces many more leaves from early spring onwards that are mild and good in salads and cooked food. The young stems in early spring can be cooked as an asparagus substitute. Grow indoors from seed and plant out in the summer. Spreading plant can be divided easily.
Tarragon is one of the four fines herbes of French cooking, and particularly suitable for chicken, fish and egg dishes. Tarragon is one of the main components of Bearnaise sauce.
Tarragon is used to flavor a popular carbonated soft drink in the countries of Armenia, Georgia and, by extension, Russia. The drink—named Tarkhun (Template:IPA2, թարխուն, Тархун), which is the Armenian, Persian and Russian word for tarragon—is made out of sugary tarragon concentrate and colored bright green.
"I believe that if ever I had to practice cannibalism, I might manage if there were enough tarragon around." --James Beard
Cis-Pellitorin, an isobutylamide eliciting a pungent taste, has been isolated from Tarragon plant.[1] | https://www.wikidoc.org/index.php/Tarragon | |
c481fb1edb8a84e0df36eea76bb515eee0721cd2 | wikidoc | Tautomer | Tautomer
Tautomers are organic compounds that are interconvertible by a chemical reaction called tautomerization. As most commonly encountered, this reaction results in the formal migration of a hydrogen atom or proton, accompanied by a switch of a single bond and adjacent double bond. In solutions where tautomerization is possible, a chemical equilibrium of the tautomers will be reached. The exact ratio of the tautomers depends on several factors, including temperature, solvent, and pH. The concept of tautomers that are interconvertible by tautomerizations is called tautomerism. Tautomerism is a special case of structural isomerism and can play an important role in non-canonical base pairing in DNA and especially RNA molecules.
Tautomerizations are catalyzed by:
- base (1. deprotonation; 2. formation of a delocalized anion (e.g. an enolate); 3. protonation at a different position of the anion).
- acids (1. protonation; 2. formation of a delocalized cation; 3. deprotonation at a different position adjacent to the cation).
Common tautomeric pairs are:
- ketone - enol, e.g. for acetone (see: keto-enol tautomerism).
- amide - imidic acid, e.g. during nitrile hydrolysis reactions.
- lactam - lactim, an amide - imidic acid tautomerism in heterocyclic rings, e.g. in the nucleobases guanine, thymine, and cytosine.
- enamine - imine
- enamine - enamine, e.g. during pyridoxalphosphate catalyzed enzymatic reactions.
Prototropic tautomerism refers to the relocation of a proton, as in the above examples, and may be considered a subset of acid-base behavior. Prototropic tautomers are sets of isomeric protonation states with the same empirical formula and total charge.
Annular tautomerism is a type of prototropic tautomerism where a proton can occupy two or more positions of a heterocyclic system. for example, 1H- and 3H-imidazole; 1H-, 2H- and 4H- 1,2,4-triazole; 1H- and 2H- isoindole.
Ring-chain tautomerism occurs when the movement of the proton is accompanied by a change from an open structure to a ring, such as the aldehyde and pyran forms of glucose.
Valence tautomerism is distinct from prototropic tautomerism, and involves processes with rapid reorganisation of bonding electrons. An example of this type of tautomerism can be found in bullvalene. Another example is open and closed forms of certain heterocycles, such as azide - tetrazole. Valence tautomerism requires a change in molecular geometry and should not be confused with canonical resonance structures or mesomers. | Tautomer
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Tautomers are organic compounds that are interconvertible by a chemical reaction called tautomerization. As most commonly encountered, this reaction results in the formal migration of a hydrogen atom or proton, accompanied by a switch of a single bond and adjacent double bond. In solutions where tautomerization is possible, a chemical equilibrium of the tautomers will be reached. The exact ratio of the tautomers depends on several factors, including temperature, solvent, and pH. The concept of tautomers that are interconvertible by tautomerizations is called tautomerism. Tautomerism is a special case of structural isomerism and can play an important role in non-canonical base pairing in DNA and especially RNA molecules.
Tautomerizations are catalyzed by:
- base (1. deprotonation; 2. formation of a delocalized anion (e.g. an enolate); 3. protonation at a different position of the anion).
- acids (1. protonation; 2. formation of a delocalized cation; 3. deprotonation at a different position adjacent to the cation).
Common tautomeric pairs are:
- ketone - enol, e.g. for acetone (see: keto-enol tautomerism).
- amide - imidic acid, e.g. during nitrile hydrolysis reactions.
- lactam - lactim, an amide - imidic acid tautomerism in heterocyclic rings, e.g. in the nucleobases guanine, thymine, and cytosine.
- enamine - imine
- enamine - enamine, e.g. during pyridoxalphosphate catalyzed enzymatic reactions.
Prototropic tautomerism refers to the relocation of a proton, as in the above examples, and may be considered a subset of acid-base behavior. Prototropic tautomers are sets of isomeric protonation states with the same empirical formula and total charge.
Annular tautomerism is a type of prototropic tautomerism where a proton can occupy two or more positions of a heterocyclic system. for example, 1H- and 3H-imidazole; 1H-, 2H- and 4H- 1,2,4-triazole; 1H- and 2H- isoindole.
Ring-chain tautomerism occurs when the movement of the proton is accompanied by a change from an open structure to a ring, such as the aldehyde and pyran forms of glucose.
Valence tautomerism is distinct from prototropic tautomerism, and involves processes with rapid reorganisation of bonding electrons. An example of this type of tautomerism can be found in bullvalene. Another example is open and closed forms of certain heterocycles, such as azide - tetrazole. Valence tautomerism requires a change in molecular geometry and should not be confused with canonical resonance structures or mesomers. | https://www.wikidoc.org/index.php/Tautomer | |
737bd33d2378f203ddd205afaa10ec284156193f | wikidoc | Teaching | Teaching
Robert G. Badgett, M.D.
In medical education, Teaching is a "formal and organized process of transmitting knowledge to a person or group"
# Methods of faculty physicians
Methods of teaching faculty include role modeling and teaching tactics.
Some aspects overlap as well as some aspects may conflict.
- Knowledgeable and efficiency as attributes for role modeling is also an important tactic for teaching.
- Most attributes for role modeling may require time to occur which may conflict with efficiency of teaching as a tactic.
## Teaching tactics
Teaching tactics used by individual faculty during clinical care have been validated:
- Learning climate
- Control of session. Efficiency, attention to time, complete, agenda setting, avoided digressions
- Communication of goals
- Promoting and understanding retention
- Evaluation
- Feedback
- Promoting self-directed learning
- Teacher's knowledge. Includes directing learners to use literature; discussed viewpoints other than is/her own.
## Role modeling
Role-modeling behavior of quality physicians includes several attributes that have been recommended or studied:
- Curiosity:
- Caring, humanism, and kindness
- Competence in clinical skills, including knowledgeable
- Critical thinking
- Humility
- Promotes self-directed learning
Learners' perspectives on important attributes may differ from attributes that faculty value. | Teaching
Template:Tocright
Robert G. Badgett, M.D.[1]
In medical education, Teaching is a "formal and organized process of transmitting knowledge to a person or group"[1]
# Methods of faculty physicians
Methods of teaching faculty include role modeling and teaching tactics.
Some aspects overlap as well as some aspects may conflict.
- Knowledgeable and efficiency as attributes for role modeling is also an important tactic for teaching.
- Most attributes for role modeling may require time to occur which may conflict with efficiency of teaching as a tactic.
## Teaching tactics
Teaching tactics used by individual faculty during clinical care have been validated:[2]
- Learning climate
- Control of session. Efficiency, attention to time, complete, agenda setting, avoided digressions
- Communication of goals
- Promoting and understanding retention
- Evaluation
- Feedback
- Promoting self-directed learning
- Teacher's knowledge. Includes directing learners to use literature; discussed viewpoints other than is/her own.
## Role modeling
Role-modeling behavior of quality physicians includes several attributes that have been recommended or studied[3][4][5]:
- Curiosity[5][6]:
- Caring, humanism[3], and kindness[5]
- Competence in clinical skills[3], including knowledgeable[5]
- Critical thinking[5]
- Humility[5]
- Promotes self-directed learning[5]
Learners' perspectives on important attributes may differ from attributes that faculty value[7]. | https://www.wikidoc.org/index.php/Teaching | |
fe6494c8e30c46cb8cef80a981b766fbb66e9470 | wikidoc | Teaspoon | Teaspoon
A teaspoon is a small spoon commonly used to stir the contents of a cup of tea or coffee. Teaspoons with longer handles are commonly used for ice cream. Other spoon sizes include the tablespoon and the dessert spoon. Much less common is the coffee spoon, which is a smaller version of the teaspoon.
# Measure of volume
In some countries, the teaspoon is also used as a unit of volume, especially in cooking recipes and pharmaceutic prescriptions. It is abbreviated in English as t. or tsp. (German and Dutch: TL, from Teelöffel or Theelepel). It is often taken to mean 5 mL; in some countries this value is even defined in law, for example in the USA in 21CFR101.9(b)(5)(viii). The same definition is used in some other English-speaking countries (e.g., Australia, Canada, New Zealand, United Kingdom). Older definitions included
1/6 U.S. fl. oz (4.93 mL) in the USA and 1/8 Imperial fl. oz (3.55 mL) in Britain.
A related unit is
Common teaspoons for stirring drinks are not always designed to contain any standard volume. In practice, they may hold between 2.5 mL and 6 mL of liquid, so caution must be exerted when using a teaspoon to measure a certain prescribed dose of a medicine. For this reason and in order to avoid dispensing errors, special measuring spoons are available that hold exactly 5 mL.
If a recipe calls for a teaspoon of a powder ingredient (salt, flour, etc.), this normally refers to an approximately levelled filling of the spoon, just like with liquids. For example, a teaspoon of salt for cooking purposes, is 5 mL or about 4.75 grams.
Some recipes also call for heaping (or heaped in British English) spoon measures. Such a heaping/heaped teaspoon, refers to an inexact volume of the required ingredient, obtained by scooping it up with a teaspoon and not levelling it off. The amount obtained by heaping a spoon can easily vary by more than a factor of two. | Teaspoon
A teaspoon is a small spoon commonly used to stir the contents of a cup of tea or coffee. Teaspoons with longer handles are commonly used for ice cream. Other spoon sizes include the tablespoon and the dessert spoon. Much less common is the coffee spoon, which is a smaller version of the teaspoon.
# Measure of volume
In some countries, the teaspoon is also used as a unit of volume, especially in cooking recipes and pharmaceutic prescriptions. It is abbreviated in English as t. or tsp. (German and Dutch: TL, from Teelöffel or Theelepel). It is often taken to mean 5 mL; in some countries this value is even defined in law, for example in the USA in 21CFR101.9(b)(5)(viii). The same definition is used in some other English-speaking countries (e.g., Australia, Canada, New Zealand, United Kingdom). Older definitions included
1/6 U.S. fl. oz (4.93 mL) in the USA and 1/8 Imperial fl. oz (3.55 mL) in Britain.
A related unit is
Common teaspoons for stirring drinks are not always designed to contain any standard volume. In practice, they may hold between 2.5 mL and 6 mL of liquid, so caution must be exerted when using a teaspoon to measure a certain prescribed dose of a medicine. For this reason and in order to avoid dispensing errors, special measuring spoons are available that hold exactly 5 mL.
If a recipe calls for a teaspoon of a powder ingredient (salt, flour, etc.), this normally refers to an approximately levelled filling of the spoon, just like with liquids. For example, a teaspoon of salt for cooking purposes, is 5 mL or about 4.75 grams.
Some recipes also call for heaping (or heaped in British English) spoon measures. Such a heaping/heaped teaspoon, refers to an inexact volume of the required ingredient, obtained by scooping it up with a teaspoon and not levelling it off. The amount obtained by heaping a spoon can easily vary by more than a factor of two. | https://www.wikidoc.org/index.php/Teaspoon | |
be7d9f38d6047b3cf8e1fa46fe6270de7f7ab0a6 | wikidoc | Teething | Teething
# Overview
Teething is the process during which an infant's teeth start to sequentially grow in. Teething can start as early as three months or as late, in some cases, as twelve months. Occasionally a baby may even present with one or more teeth at birth. The typical time frame for new teeth to appear is somewhere between six and nine months. It can take up to several years for all 20 deciduous (aka "baby" or "milk") teeth to emerge. The process of teething is sometimes referred to as "cutting teeth".
The infant teeth tend to emerge in pairs - first one upper incisor emerges then the other upper incisor emerges before the next set begin to emerge. The general pattern of emergence is:
- Lower central incisors (2)
- Upper central incisors (2)
- Upper lateral incisors (2),
- Lower lateral incisors (2)
- First molars (4)
- Canines (4)
- Second molars (4)
Milk teeth tend to emerge sooner in females than in males. The exact pattern and initial starting times of teething appear to be hereditary. When and how teeth appear in an infant has no bearing on the health of the child.
During teething, the new teeth break through the surface of the gums. Signs of teething may include
- Poor mood
- Loss of appetite
- Chewing of objects
- Bruises/swelling in gums
- Excess salivation
- Runny nose
Teething has not been shown to cause fever. A slight rise of temperature may occur when the teeth come through the gum, but this does not make a baby ill.
Infants chew on objects to aid in the teething process. This can be dangerous if the baby is allowed to chew on objects which are small enough to be swallowed or which could break while being chewed and cause choking. Teething rings and other toys are often designed with textures that will appeal to an infant during teething.
In cases where the infant is in obvious pain, some doctors recommend the use of anti-inflammatories or child-safe pain-relief treatments containing benzocaine. Some infants gain relief from chewing on cold objects.
Dentists recommend brushing infants' teeth as soon as they appear. It is not advisable to wait for the teething process to be complete. Dentists may recommend against the use of fluoride toothpaste during teething. | Teething
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Teething is the process during which an infant's teeth start to sequentially grow in. Teething can start as early as three months or as late, in some cases, as twelve months. Occasionally a baby may even present with one or more teeth at birth. The typical time frame for new teeth to appear is somewhere between six and nine months. It can take up to several years for all 20 deciduous (aka "baby" or "milk") teeth to emerge. The process of teething is sometimes referred to as "cutting teeth".
The infant teeth tend to emerge in pairs - first one upper incisor emerges then the other upper incisor emerges before the next set begin to emerge. The general pattern of emergence is:
- Lower central incisors (2)
- Upper central incisors (2)
- Upper lateral incisors (2),
- Lower lateral incisors (2)
- First molars (4)
- Canines (4)
- Second molars (4)
Milk teeth tend to emerge sooner in females than in males. The exact pattern and initial starting times of teething appear to be hereditary. When and how teeth appear in an infant has no bearing on the health of the child.
During teething, the new teeth break through the surface of the gums. Signs of teething may include
- Poor mood
- Loss of appetite
- Chewing of objects
- Bruises/swelling in gums
- Excess salivation
- Runny nose
Teething has not been shown to cause fever. A slight rise of temperature may occur when the teeth come through the gum, but this does not make a baby ill.
Infants chew on objects to aid in the teething process. This can be dangerous if the baby is allowed to chew on objects which are small enough to be swallowed or which could break while being chewed and cause choking. Teething rings and other toys are often designed with textures that will appeal to an infant during teething.
In cases where the infant is in obvious pain, some doctors recommend the use of anti-inflammatories or child-safe pain-relief treatments containing benzocaine. Some infants gain relief from chewing on cold objects.
Dentists recommend brushing infants' teeth as soon as they appear. It is not advisable to wait for the teething process to be complete. Dentists may recommend against the use of fluoride toothpaste during teething. | https://www.wikidoc.org/index.php/Teething | |
9960433ca0c064714605f7571630bdb2ed7fdc10 | wikidoc | Telomere | Telomere
# Overview
A telomere is a region of highly repetitive DNA at the end of a linear chromosome that functions as a disposable buffer. Every time linear chromosomes are replicated during late S phase, the DNA polymerase complex is incapable of replicating all the way to the end of the chromosome; if it were not for telomeres, this would quickly result in the loss of vital genetic information, which is needed to sustain a cell's activities. Every time a cell with linear chromosomes divides, it will lose a small piece of one of its strands of DNA. This process has been referred to by James Watson and Alexei Olovnikov as the "end replication problem" (1971). It is believed that telomeres have a function in the ageing process.
# Nature and function of telomeres
Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. This is because during replication, DNA polymerase can only synthesize DNA in a 5' to 3' direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. At the terminal of the DNA strand, the RNA primer is laid but DNA polymerase cannot extend beyond it. This RNA primer will not later be replaced by DNA, and therefore cannot be translated into gene products or replicated later. Without telomeres at the end of DNA, this genetic sequence would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained.
In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich. These GC-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes.
In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.
In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.
If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.
At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex.
A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.
# Telomere shortening
"Telomeres" shorten because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.
On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.
Eventually, the last RNA primer attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of both the leading and lagging strands.
# Lengthening telomeres
The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco.
Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans.
However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, in that lengthening telomeres might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).
A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms. A side effect of the mutation was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng et al., 2004).
Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.
However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Although this is indeed probably so because changing telomere lengths are usually associated with changing speed of senescence, the relationship may well be the other way around, with telomere shortening a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds:
In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. In 2006, Juola et al. reported that in another, unrelated long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.
The telomere length varies in cloned animals. Sometimes the clones end up with shorter telomeres since the D.N.A. has already divided countless times. Occasionally, the telomeres in a clone's D.N.A. are longer because they get "reprogrammed". The clone's new telomeres combine with the old ones, giving it abnormally long telomeres.
# Telomere Length Assay
Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method involves fluorescent in situ hybridization (FISH). These methods however, require significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length. This assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demonstrated to be proportional to the average telomere length in a cell. The Real-Time PCR assay has been since scaled up to high-throughput 384-well format use; making the assay feasible for use in large cohort studies.
# Telomere sequences
# Telomeres and cancer
Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.
# Related papers
- Bret Weinstein and Deborah Ciszek; The Reserve Capacity Hypothesis: A paper detailing the evolutionary origins and medical implications of the vertebrate telomere system, including the pervasive trade-off between cancer prevention and damage repair. Also addresses the probable danger posed by the elongation of telomeres in lab mice.
- Yu-Sheng Cong, Woodring E. Wright, and Jerry W. Shay; Human Telomerase and Its Regulation
- Susan Bassham, Aaron Beam, and Janis Shampay; Telomere Variation in Xenopus laevis
- Guenther Witzany (2007). Telomeres in Evolution and Development from Biosemiotic Perspective. Nature Precedings: doi:10.1038/npre.2007.932.2 | Telomere
# Overview
A telomere is a region of highly repetitive DNA at the end of a linear chromosome that functions as a disposable buffer. Every time linear chromosomes are replicated during late S phase, the DNA polymerase complex is incapable of replicating all the way to the end of the chromosome; if it were not for telomeres, this would quickly result in the loss of vital genetic information, which is needed to sustain a cell's activities. Every time a cell with linear chromosomes divides, it will lose a small piece of one of its strands of DNA. This process has been referred to by James Watson and Alexei Olovnikov as the "end replication problem" (1971). It is believed that telomeres have a function in the ageing process.
# Nature and function of telomeres
Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. This is because during replication, DNA polymerase can only synthesize DNA in a 5' to 3' direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. At the terminal of the DNA strand, the RNA primer is laid but DNA polymerase cannot extend beyond it. This RNA primer will not later be replaced by DNA, and therefore cannot be translated into gene products or replicated later. Without telomeres at the end of DNA, this genetic sequence would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained.
In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich. These GC-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes.
In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.
In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.
If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.
At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex.
A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.
# Telomere shortening
"Telomeres" shorten because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.
On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.
Eventually, the last RNA primer attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of both the leading and lagging strands.
# Lengthening telomeres
The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco.
Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans.
However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, in that lengthening telomeres might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).
A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms. A side effect of the mutation was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng et al., 2004).
Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.
However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Although this is indeed probably so because changing telomere lengths are usually associated with changing speed of senescence, the relationship may well be the other way around, with telomere shortening a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds:
In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres[1]. In 2006, Juola et al. reported that in another, unrelated long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.
The telomere length varies in cloned animals. Sometimes the clones end up with shorter telomeres since the D.N.A. has already divided countless times. Occasionally, the telomeres in a clone's D.N.A. are longer because they get "reprogrammed". The clone's new telomeres combine with the old ones, giving it abnormally long telomeres.
# Telomere Length Assay
Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method involves fluorescent in situ hybridization (FISH). These methods however, require significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length. This assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demonstrated to be proportional to the average telomere length in a cell. The Real-Time PCR assay has been since scaled up to high-throughput 384-well format use; making the assay feasible for use in large cohort studies.
# Telomere sequences
# Telomeres and cancer
Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.
# Related papers
- Bret Weinstein and Deborah Ciszek; The Reserve Capacity Hypothesis: A paper detailing the evolutionary origins and medical implications of the vertebrate telomere system, including the pervasive trade-off between cancer prevention and damage repair. Also addresses the probable danger posed by the elongation of telomeres in lab mice.[2]
- Yu-Sheng Cong, Woodring E. Wright, and Jerry W. Shay; Human Telomerase and Its Regulation [3]
- Susan Bassham, Aaron Beam, and Janis Shampay; Telomere Variation in Xenopus laevis [4]
- Guenther Witzany (2007). Telomeres in Evolution and Development from Biosemiotic Perspective. Nature Precedings: doi:10.1038/npre.2007.932.2
# External links
- Telomeres and Telomerase - A summary
- Telomerase.org - free research abstracts list in PDF format. | https://www.wikidoc.org/index.php/Telomere | |
ec93493c4755abdb7ad9d36845d24c5bb6a648eb | wikidoc | Tenascin | Tenascin
Tenascins are extracellular matrix glycoproteins. They are abundant in the extracellular matrix of developing vertebrate embryos and they reappear around healing wounds and in the stroma of some tumors.
There are four members of the tenascin gene family: tenascin-C, tenascin-R, tenascin-X and tenascin-W.
- Tenascin-C is the founding member of the gene family. In the embryo it is made by migrating cells like the neural crest; it is also abundant in developing tendons, bone and cartilage.
- Tenascin-R is found in the developing and adult nervous system.
- Tenascin-X is found primarily in loose connective tissue; mutations in the human tenascin-X gene can lead to a form of Ehlers-Danlos syndrome.
- Tenascin-W is found in the kidney and in developing bone.
The basic structure is 14 EFG-like repeats towards the N-terminal end, and 8 or more FnIII domains which vary upon species and variant.
Tenascin-C isoform is the best understood. It has anti-adhesive properties, causing cells in tissue culture to become rounded after it is added to the medium. One mechanism to explain this may come from its ability to bind to the extracellular matrix glycoprotein fibronectin and block fibronectin's interactions with specific syndecans. The expression of tenascin-C in the stroma of certain tumors is associated with a poor prognosis. | Tenascin
Tenascins are extracellular matrix glycoproteins. They are abundant in the extracellular matrix of developing vertebrate embryos and they reappear around healing wounds and in the stroma of some tumors.
There are four members of the tenascin gene family: tenascin-C, tenascin-R, tenascin-X and tenascin-W.
- Tenascin-C is the founding member of the gene family. In the embryo it is made by migrating cells like the neural crest; it is also abundant in developing tendons, bone and cartilage.
- Tenascin-R is found in the developing and adult nervous system.
- Tenascin-X is found primarily in loose connective tissue; mutations in the human tenascin-X gene can lead to a form of Ehlers-Danlos syndrome. [1]
- Tenascin-W is found in the kidney and in developing bone.
The basic structure is 14 EFG-like repeats towards the N-terminal end, and 8 or more FnIII domains which vary upon species and variant.
Tenascin-C isoform is the best understood. It has anti-adhesive properties, causing cells in tissue culture to become rounded after it is added to the medium. One mechanism to explain this may come from its ability to bind to the extracellular matrix glycoprotein fibronectin and block fibronectin's interactions with specific syndecans. The expression of tenascin-C in the stroma of certain tumors is associated with a poor prognosis. | https://www.wikidoc.org/index.php/Tenascin | |
273bec6d15645977292df757a8f6616215295fe2 | wikidoc | Teneurin | Teneurin
Teneurins are transmembrane proteins. The name refers to "ten-a" (from "tenascin-like protein, accessory") and "neurons", the primary site of teneurin expression. Ten-m refers to tenascin-like protein major are type II transmembrane glycoproteins.
Teneurins are highly conserved between Drosophila, C. elegans and vertebrates. In each species they are expressed by a subset of neurons as well as at sites of pattern formation and morphogenesis. In Drosophila, a teneurin known as ten-m or Odz is a pair-rule gene, and its expression is required for normal development. The knockdown of teneurin (ten-1) expression in C. elegans with RNAi leads to abnormal neuronal pathfinding and abnormal development of the gonads.
The intracellular domain of some, if not all, teneurins can be cleaved and transported to the cell nucleus, where it proposed to act as a transcription factor. A peptide derived from the terminus of the extracellular domain shares structural homology with certain neuropeptides.
There are four teneurin genes in vertebrates named teneurin-1 through -4. Other names found in the literature include Odz-1 through -4 and Tenm-1 through -4.
# Homology
Teneurins are a family of phylogenetically conserved transmembrane glycoproteins expressed during pattern formation and morphogenesis.
# History
Originally discovered as ten-m and ten-a in Drosophila melanogaster, the teneurin family is conserved from Caenorhabditis elegans (ten-1) to vertebrates, in which four paralogs exist (teneurin-1 to -4 or odz-1 to -4). Their distinct protein domain architecture is highly conserved between invertebrate and vertebrate teneurins, particularly in the extracellular part. The intracellular domains of Ten-a, Ten-m/Odz and C. elegans Ten-1 are significantly different, both in size and structure, from the comparable domains of vertebrate teneurins, but the extracellular domains of all of these proteins are remarkably similar.
# Function
Teneurins translocate to the nucleus where they regulate transcriptional activity. Teneurins promote neurite outgrowth and cell adhesion. The intracellular domain interacts with the DNA-binding transcriptional repressors and also regulate the activity of transcription factors.
Additionally, they have been known to interact with the cytoskeleton adaptor protein, CAP/ponsin, suggesting cell signalling roles and regulation of actin organisation.
Teneurin-3 regulates the structural and functional wiring of retinal ganglion cells in the vertebrate visual system.
# Structure
Ten-m1–4, exist as homodimers and undergo homophilic interactions in vertebrates.
## C terminal domain
The large C-terminal extracellular domain consists of eight EGF-like repeats (see PROSITEDOC), a region of conserved cysteines and unique YD-repeats.
## N terminal domain
The teneurin intracellular (IC) domain (∼300–400 aa) is located at the N-terminus and contains a number of conserved putative tyrosine phosphorylation sites, two EF-hand-like calcium-binding
motifs, and two polyproline domains. These proline-rich stretches are characteristic of SH3-binding sites.
There is considerable divergence between intracellular domains of invertebrate and vertebrate teneurins as well as between different invertebrate proteins.
This domain is found in the intracellular N-terminal region of the teneurin family.
# Human genes
Human genes encoded teneurin domain proteins (TENM1-4) are list in the infoboxes. | Teneurin
Teneurins are transmembrane proteins. The name refers to "ten-a" (from "tenascin-like protein, accessory") and "neurons", the primary site of teneurin expression. Ten-m refers to tenascin-like protein major are type II transmembrane glycoproteins.
Teneurins are highly conserved between Drosophila, C. elegans and vertebrates. In each species they are expressed by a subset of neurons as well as at sites of pattern formation and morphogenesis. In Drosophila, a teneurin known as ten-m or Odz is a pair-rule gene, and its expression is required for normal development. The knockdown of teneurin (ten-1) expression in C. elegans with RNAi leads to abnormal neuronal pathfinding and abnormal development of the gonads.
The intracellular domain of some, if not all, teneurins can be cleaved and transported to the cell nucleus, where it proposed to act as a transcription factor. A peptide derived from the terminus of the extracellular domain shares structural homology with certain neuropeptides.
There are four teneurin genes in vertebrates named teneurin-1 through -4. Other names found in the literature include Odz-1 through -4 and Tenm-1 through -4.
# Homology
Teneurins are a family of phylogenetically conserved transmembrane glycoproteins expressed during pattern formation and morphogenesis.[1]
# History
Originally discovered as ten-m and ten-a in Drosophila melanogaster, the teneurin family is conserved from Caenorhabditis elegans (ten-1) to vertebrates, in which four paralogs exist (teneurin-1 to -4 or odz-1 to -4). Their distinct protein domain architecture is highly conserved between invertebrate and vertebrate teneurins, particularly in the extracellular part. The intracellular domains of Ten-a, Ten-m/Odz and C. elegans Ten-1 are significantly different, both in size and structure, from the comparable domains of vertebrate teneurins, but the extracellular domains of all of these proteins are remarkably similar.
# Function
Teneurins translocate to the nucleus where they regulate transcriptional activity. Teneurins promote neurite outgrowth and cell adhesion. The intracellular domain interacts with the DNA-binding transcriptional repressors and also regulate the activity of transcription factors.
Additionally, they have been known to interact with the cytoskeleton adaptor protein, CAP/ponsin, suggesting cell signalling roles and regulation of actin organisation.[2]
Teneurin-3 regulates the structural and functional wiring of retinal ganglion cells in the vertebrate visual system.[3]
# Structure
Ten-m1–4, exist as homodimers and undergo homophilic interactions in vertebrates.
## C terminal domain
The large C-terminal extracellular domain consists of eight EGF-like repeats (see PROSITEDOC), a region of conserved cysteines and unique YD-repeats.
## N terminal domain
The teneurin intracellular (IC) domain (∼300–400 aa) is located at the N-terminus and contains a number of conserved putative tyrosine phosphorylation sites, two EF-hand-like calcium-binding
motifs, and two polyproline domains. These proline-rich stretches are characteristic of SH3-binding sites.
There is considerable divergence between intracellular domains of invertebrate and vertebrate teneurins as well as between different invertebrate proteins.[4][5][6][7][8]
This domain is found in the intracellular N-terminal region of the teneurin family.
# Human genes
Human genes encoded teneurin domain proteins (TENM1-4) are list in the infoboxes. | https://www.wikidoc.org/index.php/Teneurin | |
4a44c7cc18554fd6677e038c76ea91a2a3c92885 | wikidoc | Tentacle | Tentacle
Tentacles can refer to the elongated flexible organs that are present in some animals, especially invertebrates, and sometimes to the hairs of the leaves of some insectivorous plants. Usually, they are used for feeding, feeling and grasping. Anatomically, they work like other muscular hydrostats.
# Tentacles in marine animals
The phylum mollusca includes many species with muscular hydrostats in the form of tentacles and arms (octopuses do not have tentacles: they have arms). Tentacles are longer than arms and usually have suckers at their tips only. Squid and cuttlefish have eight arms like octopuses, and also two tentacles, which is one good way to distinguish squid from octopuses.
The tentacles of the Giant Squid and Colossal Squid are particularly formidable, having powerful suckers and deadly teeth at the ends of the tentacle. The teeth of the Giant Squid are small, "bottle-cap" shaped circular saws, while the tentacles of the Colossal Squid wield two long rows of thick, sharp, finger-length screws of protruding bone.
Cnidarians, which include among others the jellyfishes, are another phylum with many tentaculated specimens. Cnidarians often have huge numbers of cnidocytes on their tentacles. Cnidocytes are cells containing a coiled thread-like structure called nematocyst, which can be fired at potential prey.
Many species of the jellyfishlike ctenophores have two tentacles, while some have none. Their tentacles have adhesive structures called colloblasts or lasso cells. These cells burst open when prey comes in contact with the tentacle; sticky threads released from each of the colloblasts will then capture the food.
Bryozoa (Moss animals) are tiny creatures with a ring of tentacles surrounding the mouth.
# Tentacles in amphibians
Some wormlike amphibians have tentacles. The caecilians have two tentacles at their heads, which are probably used for the olfactory sense.
# Tentacles in mammals
The star-nosed mole, Condylura cristata, possesses nasal tentacles which are mobile and extremely sensitive, helping the animal to find its way about the burrow and detect prey.
# Tentacles in plants
In carnivorous plants, tentacles refer to the stalked glands of the upper surface of the leaves. On a sundew plant, they are hairlike projections with a drop of nectar-like glue which attract insects. When an insect is captured, the tentacles bend inward and the leaf rolls together as shown in the picture. The tentacles then secrete digestive enzymes to dissolve and engulf the insect.
# Tentacles in cultural context
The great differences between humans and the tentacle-bearing mollusca have led to tentacles being associated with inhumanity and disgust in legend and fiction. For examples, see:
- Tentacle rape
- Purple Tentacle (see Day of the Tentacle)
- Cthulhu
- The Kraken
- Cecaelia
## In games
- Half-Life
- Die by the Sword
- Ing | Tentacle
Tentacles can refer to the elongated flexible organs that are present in some animals, especially invertebrates, and sometimes to the hairs of the leaves of some insectivorous plants. Usually, they are used for feeding, feeling and grasping. Anatomically, they work like other muscular hydrostats.
# Tentacles in marine animals
The phylum mollusca includes many species with muscular hydrostats in the form of tentacles and arms (octopuses do not have tentacles: they have arms). Tentacles are longer than arms and usually have suckers at their tips only. Squid and cuttlefish have eight arms like octopuses, and also two tentacles, which is one good way to distinguish squid from octopuses.
The tentacles of the Giant Squid and Colossal Squid are particularly formidable, having powerful suckers and deadly teeth at the ends of the tentacle. The teeth of the Giant Squid are small, "bottle-cap" shaped circular saws, while the tentacles of the Colossal Squid wield two long rows of thick, sharp, finger-length screws of protruding bone.
Cnidarians, which include among others the jellyfishes, are another phylum with many tentaculated specimens. Cnidarians often have huge numbers of cnidocytes on their tentacles. Cnidocytes are cells containing a coiled thread-like structure called nematocyst, which can be fired at potential prey.
Many species of the jellyfishlike ctenophores have two tentacles, while some have none. Their tentacles have adhesive structures called colloblasts or lasso cells. These cells burst open when prey comes in contact with the tentacle; sticky threads released from each of the colloblasts will then capture the food.
Bryozoa (Moss animals) are tiny creatures with a ring of tentacles surrounding the mouth.
# Tentacles in amphibians
Some wormlike amphibians have tentacles. The caecilians have two tentacles at their heads, which are probably used for the olfactory sense.
# Tentacles in mammals
The star-nosed mole, Condylura cristata, possesses nasal tentacles which are mobile and extremely sensitive, helping the animal to find its way about the burrow and detect prey.
# Tentacles in plants
In carnivorous plants, tentacles refer to the stalked glands of the upper surface of the leaves. On a sundew plant, they are hairlike projections with a drop of nectar-like glue which attract insects. When an insect is captured, the tentacles bend inward and the leaf rolls together as shown in the picture. The tentacles then secrete digestive enzymes to dissolve and engulf the insect.
# Tentacles in cultural context
The great differences between humans and the tentacle-bearing mollusca have led to tentacles being associated with inhumanity and disgust in legend and fiction. For examples, see:
- Tentacle rape
- Purple Tentacle (see Day of the Tentacle)
- Cthulhu
- The Kraken
- Cecaelia
## In games
- Half-Life
- Die by the Sword
- Ing
# External links
- Difference between arms and tentacles
cs:Chapadlo
da:Fangarm
de:Tentakel
eo:Tentaklo
ko:촉수
id:Tentakel
it:Tentacolo
lt:Čiuptuvai
nl:Tentakel
no:Tentakel
nn:Tentakel
simple:Tentacle
fi:Lonkero
Template:WS | https://www.wikidoc.org/index.php/Tentacle | |
fa6368c4802418d2910fc80fa4431e7340c74599 | wikidoc | Tentoxin | Tentoxin
Tentoxin is a natural cyclic tetrapeptide produced by phytopathogenic fungi from genus Alternaria (A. tenuis and A. alternata). It selectively induces chlorosis in several germinating seedling plants. Therefore, tentoxin may be used as a potential natural herbicide.
Tentoxin was first isolated and characterized by George Templeton et al. in 1967 from Alternaria tenuis.
# Notes
- ↑ Templeton, G. E., C. 1. Grable, N. D. Fulton, W. L. Meyer. 1967. Tentoxin from Alternaria tenuis: its isolation and characterization. Proceedings of the Mycotoxin Research Seminar, Washington, D. C., June 8-9, 1967. United States Department of Agriculture. pp. 27-29. | Tentoxin
Tentoxin is a natural cyclic tetrapeptide produced by phytopathogenic fungi from genus Alternaria (A. tenuis and A. alternata). It selectively induces chlorosis in several germinating seedling plants. Therefore, tentoxin may be used as a potential natural herbicide.
Tentoxin was first isolated and characterized by George Templeton et al. in 1967 from Alternaria tenuis[1].
## Notes
- ↑ Templeton, G. E., C. 1. Grable, N. D. Fulton, W. L. Meyer. 1967. Tentoxin from Alternaria tenuis: its isolation and characterization. Proceedings of the Mycotoxin Research Seminar, Washington, D. C., June 8-9, 1967. United States Department of Agriculture. pp. 27-29.
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Tentoxin | |
3bfbe079395196bfebf2cd85907e1fb8de6ce2b5 | wikidoc | Test0421 | Test0421
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0421 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Condition 1
- Dosing Information
## Off-Label Use and Dosage (Adult)
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0421 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
# Contraindications
There is limited information regarding Test0421 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0421 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0421 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0421 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0421 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0421 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0421 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0421 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0421 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0421 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0421 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0421 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0421 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0421 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0421 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0421 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0421 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0421 Administration in the drug label.
### Monitoring
There is limited information regarding Test0421 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0421 and IV administrations.
# Overdosage
There is limited information regarding Test0421 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0421 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0421 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0421 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0421 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0421 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0421 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0421 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0421 How Supplied in the drug label.
## Storage
There is limited information regarding Test0421 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0421 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0421 interaction has not been established. Talk to your doctor regarding the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0421 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0421 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Test0421
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1];
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0421 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Condition 1
- Dosing Information
## Off-Label Use and Dosage (Adult)
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0421 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
# Contraindications
There is limited information regarding Test0421 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0421 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0421 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0421 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0421 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0421 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0421 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0421 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0421 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0421 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0421 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0421 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0421 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0421 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0421 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0421 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0421 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0421 Administration in the drug label.
### Monitoring
There is limited information regarding Test0421 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0421 and IV administrations.
# Overdosage
There is limited information regarding Test0421 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0421 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0421 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0421 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0421 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0421 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0421 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0421 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0421 How Supplied in the drug label.
## Storage
There is limited information regarding Test0421 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0421 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0421 interaction has not been established. Talk to your doctor regarding the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0421 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0421 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Test0421 | |
bb4855af54dec9c5f42923844cab959c14a5bb22 | wikidoc | Test0424 | Test0424
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0424 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
Condition 1
- Dosing Information
## Off-Label Use and Dosage (Adult)
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0424 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
# Contraindications
There is limited information regarding Test0424 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0424 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0424 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0424 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0424 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0424 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0424 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0424 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0424 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0424 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0424 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0424 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0424 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0424 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0424 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0424 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0424 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0424 Administration in the drug label.
### Monitoring
There is limited information regarding Test0424 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0424 and IV administrations.
# Overdosage
There is limited information regarding Test0424 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0424 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0424 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0424 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0424 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0424 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0424 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0424 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0424 How Supplied in the drug label.
## Storage
There is limited information regarding Test0424 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0424 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0424 interaction has not been established. Talk to your doctor regarding the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0424 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0424 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Test0424
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1];
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0424 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
<h4>Condition 1</h4>
- Dosing Information
## Off-Label Use and Dosage (Adult)
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0424 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
# Contraindications
There is limited information regarding Test0424 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0424 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0424 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0424 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0424 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0424 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0424 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0424 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0424 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0424 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0424 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0424 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0424 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0424 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0424 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0424 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0424 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0424 Administration in the drug label.
### Monitoring
There is limited information regarding Test0424 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0424 and IV administrations.
# Overdosage
There is limited information regarding Test0424 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0424 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0424 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0424 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0424 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0424 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0424 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0424 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0424 How Supplied in the drug label.
## Storage
There is limited information regarding Test0424 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0424 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0424 interaction has not been established. Talk to your doctor regarding the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0424 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0424 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Test0424 | |
69f9f0e050fb59ba7a3e34d8ebf43fb39e388e05 | wikidoc | Test0712 | Test0712
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0712 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
There is limited information regarding Test0712 FDA-Labeled Indications and Dosage (Adult) in the drug label.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0712 in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0712 in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0712 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0712 in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0712 in pediatric patients.
# Contraindications
There is limited information regarding Test0712 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0712 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0712 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0712 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0712 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0712 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0712 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0712 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0712 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0712 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0712 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0712 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0712 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0712 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0712 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0712 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0712 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0712 Administration in the drug label.
### Monitoring
There is limited information regarding Test0712 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0712 and IV administrations.
# Overdosage
There is limited information regarding Test0712 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0712 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0712 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0712 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0712 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0712 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0712 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0712 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0712 How Supplied in the drug label.
## Storage
There is limited information regarding Test0712 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0712 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0712 interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0712 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0712 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Test0712
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1];
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0712 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
There is limited information regarding Test0712 FDA-Labeled Indications and Dosage (Adult) in the drug label.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0712 in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0712 in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0712 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0712 in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0712 in pediatric patients.
# Contraindications
There is limited information regarding Test0712 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0712 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0712 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0712 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0712 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0712 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0712 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0712 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0712 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0712 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0712 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0712 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0712 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0712 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0712 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0712 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0712 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0712 Administration in the drug label.
### Monitoring
There is limited information regarding Test0712 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0712 and IV administrations.
# Overdosage
There is limited information regarding Test0712 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0712 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0712 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0712 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0712 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0712 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0712 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0712 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0712 How Supplied in the drug label.
## Storage
There is limited information regarding Test0712 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0712 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0712 interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0712 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0712 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Test0712 | |
e1bdc66e586d0c0914af92bf6daeeb225ef05d80 | wikidoc | Test0730 | Test0730
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0730 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
There is limited information regarding Test0730 FDA-Labeled Indications and Dosage (Adult) in the drug label.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0730 in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0730 in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0730 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0730 in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0730 in pediatric patients.
# Contraindications
There is limited information regarding Test0730 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0730 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0730 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0730 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0730 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0730 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0730 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0730 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0730 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0730 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0730 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0730 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0730 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0730 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0730 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0730 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0730 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0730 Administration in the drug label.
### Monitoring
There is limited information regarding Test0730 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0730 and IV administrations.
# Overdosage
There is limited information regarding Test0730 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0730 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0730 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0730 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0730 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0730 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0730 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0730 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0730 How Supplied in the drug label.
## Storage
There is limited information regarding Test0730 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0730 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0730 interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0730 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0730 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Test0730
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1];
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Test0730 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
There is limited information regarding Test0730 FDA-Labeled Indications and Dosage (Adult) in the drug label.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0730 in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0730 in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test0730 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Test0730 in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Test0730 in pediatric patients.
# Contraindications
There is limited information regarding Test0730 Contraindications in the drug label.
# Warnings
There is limited information regarding Test0730 Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Test0730 Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Test0730 Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Test0730 Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Test0730 in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test0730 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test0730 during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Test0730 in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Test0730 in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Test0730 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test0730 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test0730 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test0730 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test0730 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test0730 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test0730 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
There is limited information regarding Test0730 Administration in the drug label.
### Monitoring
There is limited information regarding Test0730 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test0730 and IV administrations.
# Overdosage
There is limited information regarding Test0730 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Test0730 Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Test0730 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test0730 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test0730 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test0730 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test0730 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test0730 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test0730 How Supplied in the drug label.
## Storage
There is limited information regarding Test0730 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test0730 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test0730 interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
There is limited information regarding Test0730 Brand Names in the drug label.
# Look-Alike Drug Names
There is limited information regarding Test0730 Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Test0730 | |
79d8cb0b5e57649d0c32d1f8838062d4c72a8374 | wikidoc | Test1235 | Test1235
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Test1235 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. There is a Black Box Warning for this drug as shown here. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Acute Coronary Syndrome
- Dosing Information
- For patients with non-ST-elevation ACS (UA/NSTEMI), initiate clopidogrel bisulfate with a single 300 mg oral loading dose and then continue at 75 mg once daily. Initiate aspirin (75 to 325 mg once daily) and continue in combination with clopidogrel bisulfate.
- For patients with STEMI, the recommended dose of clopidogrel bisulfate is 75 mg once daily orally, administered in combination with aspirin (75 to 325 mg once daily), with or without thrombolytics. Clopidogrel bisulfate may be initiated with or without a loading dose.
### Recent MI, Recent Stroke, or Established Peripheral Arterial Disease
- Dosing Information
- 75 mg PO qd, with or without food
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
### Acute ST segment elevation myocardial infarction - Percutaneous coronary intervention - Thrombosis; Prophylaxis
- Dosing Information
- 100 mg
### Arterial thrombosis; Prophylaxis
- Dosing Information
- 200 mg
### Atrial fibrillation - Thrombosis; Prophylaxis
### Heart failure, chronic - Thrombosis; Prophylaxis
### Percutaneous coronary intervention, Elective - Thrombosis; Prophylaxis
### Non–Guideline-Supported Use
### Thrombosis, In patients with stable cardiovascular disease or multiple cardiovascular risk factors; Prophylaxis
- Dosing Information
- 75 mg PO qd
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test1235 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information about Off-Label Guideline-Supported Use of Test1235 in pediatric patients.
### Non–Guideline-Supported Use
There is limited information about Off-Label Non–Guideline-Supported Use of Test1235 in pediatric patients.
# Contraindications
- Active Bleeding
- Clopidogrel tablets USP are contraindicated in patients with active pathological bleeding such as peptic ulcer or intracranial hemorrhage.
- Hypersensitivity
- Clopidogrel tablets USP are contraindicated in patients with hypersensitivity (e.g., anaphylaxis) to clopidogrel or any component of the product.
# Warnings
### Diminished Antiplatelet Activity Due to Impaired CYP2C19 Function
Clopidogrel is a prodrug. Inhibition of platelet aggregation by clopidogrel is achieved through an active metabolite. The metabolism of clopidogrel to its active metabolite can be impaired by genetic variations in CYP2C19 and by concomitant medications that interfere with CYP2C19.
### Proton Pump Inhibitors
Avoid concomitant use of clopidogrel bisulfate with omeprazole or esomeprazole because both significantly reduce the antiplatelet activity of clopidogrel bisulfate.
### General Risk of Bleeding
Thienopyridines, including clopidogrel bisulfate, increase the risk of bleeding. If a patient is to undergo surgery and an antiplatelet effect is not desired, discontinue clopidogrel bisulfate five days prior to surgery. In patients who stopped therapy more than five days prior to CABG the rates of major bleeding were similar (event rate 4.4% clopidogrel bisulfate + aspirin; 5.3% placebo + aspirin). In patients who remained on therapy within five days of CABG, the major bleeding rate was 9.6% for clopidogrel bisulfate + aspirin, and 6.3% for placebo + aspirin.
Thienopyridines inhibit platelet aggregation for the lifetime of the platelet (7 to 10 days), so withholding a dose will not be useful in managing a bleeding event or the risk of bleeding associated with an invasive procedure. Because the half-life of clopidogrel's active metabolite is short, it may be possible to restore hemostasis by administering exogenous platelets; however, platelet transfusions within 4 hours of the loading dose or 2 hours of the maintenance dose may be less effective.
### Discontinuation of clopidogrel bisulfate
Avoid lapses in therapy, and if clopidogrel bisulfate must be temporarily discontinued, restart as soon as possible. Premature discontinuation of clopidogrel bisulfate may increase the risk of cardiovascular events.
### Patients with Recent Transient Ischemic Attack (TIA) or Stroke
In patients with recent TIA or stroke who are at high risk for recurrent ischemic events, the combination of aspirin and clopidogrel bisulfate has not been shown to be more effective than clopidogrel bisulfate alone, but the combination has been shown to increase major bleeding.
### Thrombotic Thrombocytopenic Purpura (TTP)
TTP, sometimes fatal, has been reported following use of clopidogrel bisulfate, sometimes after a short exposure (<2 weeks). TTP is a serious condition that requires urgent treatment including plasmapheresis (plasma exchange). It is characterized by thrombocytopenia, microangiopathic hemolytic anemia (schistocytes seen on peripheral smear), neurological findings, renal dysfunction, and fever.
### Cross-Reactivity among Thienopyridines
Hypersensitivity including rash, angioedema or hematologic reaction have been reported in patients receiving clopidogrel bisulfate, including patients with a history of hypersensitivity or hematologic reaction to other thienopyridines.
# Adverse Reactions
## Clinical Trials Experience
The following serious adverse reactions are discussed below and elsewhere in the labeling:
Bleeding
Thrombotic thrombocytopenic purpura
6.1 Clinical Studies Experience
Because clinical trials are conducted under widely varying conditions and durations of follow up, adverse reaction rates observed in the clinical trials of a drug cannot be directly compared to rates in the clinical trials of another drug and may not reflect the rates observed in practice.
Clopidogrel bisulfate has been evaluated for safety in more than 54,000 patients, including over 21,000 patients treated for 1 year or more. The clinically important adverse reactions observed in trials comparing clopidogrel bisulfate plus aspirin to placebo plus aspirin and trials comparing clopidogrel bisulfate alone to aspirin alone are discussed below.
Bleeding
CURE
In CURE, clopidogrel bisulfate use with aspirin was associated with an increase in major bleeding (primarily gastrointestinal and at puncture sites) compared to placebo with aspirin (see Table 1). The incidence of intracranial hemorrhage (0.1%) and fatal bleeding (0.2%) were the same in both groups. Other bleeding events that were reported more frequently in the clopidogrel group were epistaxis, hematuria, and bruise.
The overall incidence of bleeding is described in the table below.
## Postmarketing Experience
There is limited information regarding Test1235 Postmarketing Experience in the drug label.
# Drug Interactions
## = SSRIs and SNRIs
Since selective serotonin reuptake inhibitors (SSRIs) and serotonin norepinephrine reuptake inhibitors (SNRIs) affect platelet activation, the concomitant administration of SSRIs and SNRIs with clopidogrel may increase the risk of bleeding.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): B
Reproduction studies performed in rats and rabbits at doses up to 500 and 300 mg/kg/day, respectively (65 and 78 times the recommended daily human dose, respectively, on a mg/m2 basis), revealed no evidence of impaired fertility or fetotoxicity due to clopidogrel. There are, however, no adequate and well-controlled studies in pregnant women. Because animal reproduction studies are not always predictive of a human response, clopidogrel bisulfate should be used during pregnancy only if clearly needed.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test1235 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test1235 during labor and delivery.
### Nursing Mothers
Studies in rats have shown that clopidogrel and/or its metabolites are excreted in the milk. It is not known whether this drug is excreted in human milk. Because many drugs are excreted in human milk and because of the potential for serious adverse reactions in nursing infants from clopidogrel, a decision should be made whether to discontinue nursing or to discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
Safety and effectiveness in pediatric populations have not been established.
Additional information describing a clinical study in which efficacy was not demonstrated in neonates and infants is approved in the package insert for Bristol-Myers Squibb’s clopidogrel tablets. However, due to Bristol-Myers Squibb’s marketing exclusivity rights, this drug product is not labeled with that pediatric information.
### Geriatic Use
There is no FDA guidance on the use of Test1235 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test1235 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test1235 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test1235 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test1235 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test1235 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test1235 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Test1235 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test1235 and IV administrations.
# Overdosage
There is limited information regarding Test1235 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
## Mechanism of Action
There is limited information regarding Test1235 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test1235 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test1235 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test1235 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test1235 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test1235 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test1235 How Supplied in the drug label.
## Storage
There is limited information regarding Test1235 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test1235 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test1235 interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
# Look-Alike Drug Names
Plavix - Paxil
# Drug Shortage Status
# Price | Test1235
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1];
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Test1235 is {{{aOrAn}}} {{{drugClass}}} that is FDA approved for the {{{indicationType}}} of {{{indication}}}. There is a Black Box Warning for this drug as shown here. Common adverse reactions include {{{adverseReactions}}}.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Acute Coronary Syndrome
- Dosing Information
- For patients with non-ST-elevation ACS (UA/NSTEMI), initiate clopidogrel bisulfate with a single 300 mg oral loading dose and then continue at 75 mg once daily. Initiate aspirin (75 to 325 mg once daily) and continue in combination with clopidogrel bisulfate.
- For patients with STEMI, the recommended dose of clopidogrel bisulfate is 75 mg once daily orally, administered in combination with aspirin (75 to 325 mg once daily), with or without thrombolytics. Clopidogrel bisulfate may be initiated with or without a loading dose.
### Recent MI, Recent Stroke, or Established Peripheral Arterial Disease
- Dosing Information
- 75 mg PO qd, with or without food
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
### Acute ST segment elevation myocardial infarction - Percutaneous coronary intervention - Thrombosis; Prophylaxis
- Dosing Information
- 100 mg
### Arterial thrombosis; Prophylaxis
- Dosing Information
- 200 mg
### Atrial fibrillation - Thrombosis; Prophylaxis
### Heart failure, chronic - Thrombosis; Prophylaxis
### Percutaneous coronary intervention, Elective - Thrombosis; Prophylaxis
### Non–Guideline-Supported Use
### Thrombosis, In patients with stable cardiovascular disease or multiple cardiovascular risk factors; Prophylaxis
- Dosing Information
- 75 mg PO qd
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Test1235 FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information about Off-Label Guideline-Supported Use of Test1235 in pediatric patients.
### Non–Guideline-Supported Use
There is limited information about Off-Label Non–Guideline-Supported Use of Test1235 in pediatric patients.
# Contraindications
- Active Bleeding
- Clopidogrel tablets USP are contraindicated in patients with active pathological bleeding such as peptic ulcer or intracranial hemorrhage.
- Hypersensitivity
- Clopidogrel tablets USP are contraindicated in patients with hypersensitivity (e.g., anaphylaxis) to clopidogrel or any component of the product.
# Warnings
### Diminished Antiplatelet Activity Due to Impaired CYP2C19 Function
Clopidogrel is a prodrug. Inhibition of platelet aggregation by clopidogrel is achieved through an active metabolite. The metabolism of clopidogrel to its active metabolite can be impaired by genetic variations in CYP2C19 and by concomitant medications that interfere with CYP2C19.
### Proton Pump Inhibitors
Avoid concomitant use of clopidogrel bisulfate with omeprazole or esomeprazole because both significantly reduce the antiplatelet activity of clopidogrel bisulfate.
### General Risk of Bleeding
Thienopyridines, including clopidogrel bisulfate, increase the risk of bleeding. If a patient is to undergo surgery and an antiplatelet effect is not desired, discontinue clopidogrel bisulfate five days prior to surgery. In patients who stopped therapy more than five days prior to CABG the rates of major bleeding were similar (event rate 4.4% clopidogrel bisulfate + aspirin; 5.3% placebo + aspirin). In patients who remained on therapy within five days of CABG, the major bleeding rate was 9.6% for clopidogrel bisulfate + aspirin, and 6.3% for placebo + aspirin.
Thienopyridines inhibit platelet aggregation for the lifetime of the platelet (7 to 10 days), so withholding a dose will not be useful in managing a bleeding event or the risk of bleeding associated with an invasive procedure. Because the half-life of clopidogrel's active metabolite is short, it may be possible to restore hemostasis by administering exogenous platelets; however, platelet transfusions within 4 hours of the loading dose or 2 hours of the maintenance dose may be less effective.
### Discontinuation of clopidogrel bisulfate
Avoid lapses in therapy, and if clopidogrel bisulfate must be temporarily discontinued, restart as soon as possible. Premature discontinuation of clopidogrel bisulfate may increase the risk of cardiovascular events.
### Patients with Recent Transient Ischemic Attack (TIA) or Stroke
In patients with recent TIA or stroke who are at high risk for recurrent ischemic events, the combination of aspirin and clopidogrel bisulfate has not been shown to be more effective than clopidogrel bisulfate alone, but the combination has been shown to increase major bleeding.
### Thrombotic Thrombocytopenic Purpura (TTP)
TTP, sometimes fatal, has been reported following use of clopidogrel bisulfate, sometimes after a short exposure (<2 weeks). TTP is a serious condition that requires urgent treatment including plasmapheresis (plasma exchange). It is characterized by thrombocytopenia, microangiopathic hemolytic anemia (schistocytes [fragmented RBCs] seen on peripheral smear), neurological findings, renal dysfunction, and fever.
### Cross-Reactivity among Thienopyridines
Hypersensitivity including rash, angioedema or hematologic reaction have been reported in patients receiving clopidogrel bisulfate, including patients with a history of hypersensitivity or hematologic reaction to other thienopyridines.
# Adverse Reactions
## Clinical Trials Experience
The following serious adverse reactions are discussed below and elsewhere in the labeling:
Bleeding [see Warnings and Precautions (5.2)]
Thrombotic thrombocytopenic purpura [see Warnings and Precautions (5.5)]
6.1 Clinical Studies Experience
Because clinical trials are conducted under widely varying conditions and durations of follow up, adverse reaction rates observed in the clinical trials of a drug cannot be directly compared to rates in the clinical trials of another drug and may not reflect the rates observed in practice.
Clopidogrel bisulfate has been evaluated for safety in more than 54,000 patients, including over 21,000 patients treated for 1 year or more. The clinically important adverse reactions observed in trials comparing clopidogrel bisulfate plus aspirin to placebo plus aspirin and trials comparing clopidogrel bisulfate alone to aspirin alone are discussed below.
Bleeding
CURE
In CURE, clopidogrel bisulfate use with aspirin was associated with an increase in major bleeding (primarily gastrointestinal and at puncture sites) compared to placebo with aspirin (see Table 1). The incidence of intracranial hemorrhage (0.1%) and fatal bleeding (0.2%) were the same in both groups. Other bleeding events that were reported more frequently in the clopidogrel group were epistaxis, hematuria, and bruise.
The overall incidence of bleeding is described in the table below.
## Postmarketing Experience
There is limited information regarding Test1235 Postmarketing Experience in the drug label.
# Drug Interactions
## = SSRIs and SNRIs
Since selective serotonin reuptake inhibitors (SSRIs) and serotonin norepinephrine reuptake inhibitors (SNRIs) affect platelet activation, the concomitant administration of SSRIs and SNRIs with clopidogrel may increase the risk of bleeding.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): B
Reproduction studies performed in rats and rabbits at doses up to 500 and 300 mg/kg/day, respectively (65 and 78 times the recommended daily human dose, respectively, on a mg/m2 basis), revealed no evidence of impaired fertility or fetotoxicity due to clopidogrel. There are, however, no adequate and well-controlled studies in pregnant women. Because animal reproduction studies are not always predictive of a human response, clopidogrel bisulfate should be used during pregnancy only if clearly needed.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Test1235 in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Test1235 during labor and delivery.
### Nursing Mothers
Studies in rats have shown that clopidogrel and/or its metabolites are excreted in the milk. It is not known whether this drug is excreted in human milk. Because many drugs are excreted in human milk and because of the potential for serious adverse reactions in nursing infants from clopidogrel, a decision should be made whether to discontinue nursing or to discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
Safety and effectiveness in pediatric populations have not been established.
Additional information describing a clinical study in which efficacy was not demonstrated in neonates and infants is approved in the package insert for Bristol-Myers Squibb’s clopidogrel tablets. However, due to Bristol-Myers Squibb’s marketing exclusivity rights, this drug product is not labeled with that pediatric information.
### Geriatic Use
There is no FDA guidance on the use of Test1235 in geriatric settings.
### Gender
There is no FDA guidance on the use of Test1235 with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Test1235 with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Test1235 in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Test1235 in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Test1235 in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Test1235 in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Test1235 Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Test1235 and IV administrations.
# Overdosage
There is limited information regarding Test1235 overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
## Mechanism of Action
There is limited information regarding Test1235 Mechanism of Action in the drug label.
## Structure
There is limited information regarding Test1235 Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Test1235 Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Test1235 Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Test1235 Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Test1235 Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Test1235 How Supplied in the drug label.
## Storage
There is limited information regarding Test1235 Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Test1235 Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Test1235 interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- 1
- 2
- 3
# Look-Alike Drug Names
Plavix - Paxil
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Test1235 | |
15ab867c33ed84091a4a3ea76dc20d45fd714d0e | wikidoc | Testicle | Testicle
The testicle (from Latin testis, meaning "witness", plural testes) is the male generative gland in animals. This article will concentrate on mammalian testicles unless otherwise noted.
# Anatomy and physiology
## Function
Like the ovaries (to which they are homologous), testicles are components of both the reproductive system (being gonads) and the endocrine system (being endocrine glands). The respective functions of the testicles are:
- producing sperm (spermatozoa)
- producing male sex hormones, of which testosterone is the best-known
Both functions of the testicle, sperm-forming and endocrine, are under control of gonadotropic hormones produced by the anterior pituitary:
- luteinizing hormone (LH)
- follicle-stimulating hormone (FSH)
## External appearance
Male mammals have two testicles, which are often contained within an extension of the abdomen called the scrotum. In mammals with external testicles it is most common for one testis to hang lower than the other. It is estimated that in about 85% of men the lower hanging testicle is the left one. This is due to differences in the vascular anatomical structure on the right and left sides.
In normal adult human males, testicular size ranges from the lower end of around 14 cm³ to the upper end larger than 35 cm³. Measurement in the living adult is done in two basic ways:
- comparing the testicle with ellipsoids of known sizes (orchidometer).
- measuring the length, depth and width with a ruler, a pair of calipers or ultrasound imaging.
The volume is then calculated using the formula for the volume of an ellipsoid: 4/3 π × (length/2) × (width/2) × (depth/2).
To some extent, it is possible to change testicular size. Short of direct injury or subjecting them to adverse conditions, e.g., higher temperature than they are normally accustomed to, they can be shrunk by competing against their intrinsic hormonal function through the use of externally administered steroidal hormones. Steroids taken for muscle enhancement often have the undesired side effect of testicular shrinkage. Similarly, stimulation of testicular functions via gonadotropic-like hormones may enlarge their size. Testicles may shrink or atrophy during hormone replacement therapy.
## Internal structure
### Duct system
Under a tough membraneous shell, the tunica albuginea, the testis contains very fine coiled tubes called the seminiferous tubules. The tubes are lined with a layer of cells that, from puberty into old-age, produce sperm cells.
The sperm travel from the seminiferous tubules to the rete testis located in the mediastinum testis, to the efferent ducts, and then to the epididymis where newly-created sperm cells mature (see spermatogenesis). The sperm move into the vas deferens, and are eventually expelled through the urethra and out of the urethral orifice through muscular contractions.
Between the seminiferous tubules are special cells called Leydig cells (or "interstitial cells") where testosterone and other androgens are formed.
### Blood supply and lymphatic drainage
Blood supply and lymphatic drainage of the testes and scrotum are distinct:
- The paired testicular arteries arise directly from the abdominal aorta and descend through the inguinal canal, while the scrotum and the rest of the external genitalia is supplied by the internal pudendal artery (itself a branch of the internal iliac artery).
- Lymphatic drainage of the testes follows the testicular arteries back to the paraaortic lymph nodes, while lymph from the scrotum drains to the inguinal lymph nodes.
### Layers
Many anatomical features of the adult testis reflect its developmental origin in the abdomen.
The layers of tissue enclosing each testicle are derived from the layers of the anterior abdominal wall. Notably, the cremasteric muscle arises from the internal oblique muscle.
### The blood-testis barrier
Large molecules cannot pass from the blood into the lumen of a seminiferous tubule due to the presence of tight junctions between adjacent Sertoli cells. The spermatogonia are in the basal compartment (deep to the level of the tight junctions) and the more mature forms such as primary and secondary spermatocytes and spermatids are in the adluminal compartment.
The function of the blood-testis barrier (red highlight in diagram above) may be to prevent an auto-immune reaction. Mature sperm (and their antigens) arise long after immune tolerance is established in infancy. Therefore, since sperm are antigenically different from self tissue, a male animal can react immunologically to his own sperm. In fact, he is capable of making antibodies against them.
Injection of sperm antigens causes inflammation of the testis (autoimmune orchitis) and reduced fertility. Thus, the blood-testis barrier may reduce the likelihood that sperm proteins will induce an immune response, reducing fertility and so progeny.
## Temperature regulation
The testes work best at temperatures slightly less than core body temperature (37 °C or 98.6 °F for humans). The spermatogenesis is less efficient at lower and higher temperatures. There are a number of mechanisms to maintain the testes at the optimum temperature.
The cremasteric muscle is part of the spermatic cord. When this muscle contracts, the cord is shortened and the testicle is moved closer up toward the body, which provides slightly more warmth to maintain optimal testicular temperature. When cooling is required, the cremasteric muscle relaxes and the testicle is lowered away from the warm body and is able to cool. This phenomenon is known as the cremasteric reflex. It also occurs in response to stress (the testicles rise up toward the body in an effort to protect them in a fight), and there are persistent reports that relaxation indicates approach of orgasm. There is a noticeable tendency to also retract during orgasm.
The testicles can also be lifted voluntarily using the pubococcygeus muscle, which partially activates related muscles. This can sometimes be triggered by tightening or sucking in the stomach or abdomen.
# Development
There are two phases in which the testicles grow substantially, namely in embryonic and pubertal age.
## Embryonic
During mammalian development, the gonads are at first capable of becoming either ovaries or testes. In humans, starting at about week 4 the gonadal rudiments are present within the intermediate mesoderm adjacent to the developing kidneys. At about week 6, sex cords develop within the forming testes. These are comprised of early Sertoli cells that surround and nurture the germ cells that migrate into the gonads shortly before sex determination begins. In males, the sex-specific gene SRY that is found on the Y-chromosome initiates sex determination by downstream regulation of sex-determining factors, (such as GATA4, SOX9 and AMH), which leads to development of the male phenotype, including directing development of the early bipotential gonad down the male path of development.
## Pubertal
The testicles grow in response to the start of spermatogenesis. Size depends on lytic function, sperm production (amount of spermatogenisis present in testis), interstitial fluid, and Sertoli cell fluid production. After puberty, the volume of the testicles can be increased by over 500% as compared to the pre-pubertal size. In humans the average testicle size after puberty measures up to be 2 inches long, 0.8 inch in breadth, and 1.2 inches in diameter (5 x 2 x 3 cm).
# Evolution
## External testicles
The basal condition for mammals is to have internal testicles. Only the Boreoeutherian land mammals, the large group of mammals that includes humans, have externalized testicles. Indeed their testicles function best at temperatures lower than their core body temperature. Their testes are located outside of the body, suspended by the spermatic cord within the scrotum. The testes of the non-boreotherian mammals such as the monotremes, armadillos, sloths, elephants remain within the abdomen. There are also some Boreoeutherian mammals with internal testes, such as the rhinoceros.
Marine boreotherian mammals such as whales and dolphins, also have internal testes, but it has recently been shown (e.g., for dolphins) that they use elaborate vascular networks to provide the necessary temperature lowering for optimum function. As external testes would increase drag, many boreotherian aquatic mammals have internal testes which are kept cool by special circulatory systems that cool the arterial blood going to the testes by placing the arteries near veins bringing cooled venous blood from the skin.
There are several hypotheses why most boreotherian mammals have external testes which operate best at a temperature that is slightly less than the core body temperature, e.g. that it is stuck with enzymes evolved in a colder temperature due to external testes evolving for different reasons, that the lower temperature of the testes simply is more efficient for sperm production.
1) More efficient. The classic hypothesis is that cooler temperature of the testes allows for more efficient fertile spermatogenesis. In other words, there are no possible enzymes operating at normal core body temperature that are as efficient as the ones evolved, at least none appearing in our evolution so far.
The early mammals had lower body temperatures and thus their testes worked efficiently within their body. However it is argued that boreotherian mammals have higher body temperatures than the other mammals and had to develop external testicles to keep them cool. It is argued that those mammals with internal testicles, such as the monotremes, armadillos, sloths, elephants, and rhinoceroses, have a lower core body temperatures than those mammals with external testicles.
However, the question remains why birds despite having very high core body temperatures have internal testes and did not evolve external testes. It was once theorized that birds used their air sacs to cool the testes internally, but later studies revealed that birds' testes are able to function at core body temperature.
2) Irreversible adaptation to sperm competition. It has been suggested that the ancestor of the boreoeutherian mammals was a small mammal that required very large testes (perhaps rather like those of a hamster) for sperm competition and thus had to place its testes outside the body. This led to enzymes involved in spermatogenesis, spermatogenic DNA polymerase beta and recombinase activities evolving a unique temperature optimum, slightly less than core body temperature. When the boreoeutherian mammals then diversified into forms that were larger and/or did not require intense sperm competition they were stuck with enzymes that operated best at cooler temperatures and had to keep their testicles outside the body.
3) Protection from abdominal cavity pressure changes. One argument for the evolution of external testes is that it protects the testes from abdominal cavity pressure changes caused by jumping and galloping.
## Testicular size
Testicular size as a proportion of body weight varies widely. In the mammalian kingdom, there is a tendency for testicular size to correspond with multiple mates (e.g., harems,polygamy). Production of testicular output sperm and spermatic fluid is also larger in polygamous animals, possibly a spermatogenic competition for survival. The testicles of the right whale are likely to be the largest of any animal, each weighing around 500 kg (1,100 lb).
# Health issues
The testicles are well-known to be very sensitive to impact and injury. Blue balls is a slang term for a temporary fluid congestion in the testicles and prostate region caused by prolonged sexual arousal.
The most prominent diseases of testicles are:
- testicular cancer and other neoplasms
- swelling of a testicle, caused by hydrocele testis
- inflammation of the testicles, called orchitis
- inflammation of the epididymis, called epididymitis
- spermatic cord torsion also called testicular torsion
- varicocele — swollen vein from the testes, usually affecting the left testicle
- anorchidism is the absence of one or both testicles.
The removal of one or both testicles is termed:
- orchidectomy, in medicine (where orchiectomy and orchectomy are synonymous), and
- castration in general use, especially when done as punishment or torture, or as a catch-all term for orchidectomy in a veterinary context.
- Gelding in the specifically equine sense.
Testicular prostheses are available to mimic the appearance and feel of one or both testicles, when absent as from injury or as treatment for gender identity disorder. There have also been some instances of their implanting in dogs.
# Additional images
- Testicle of a cat: 1 Extremitas capitata, 2 Extremitas caudata, 3 Margo epididymalis, 4 Margo liber, 5 Mesorchium, 6 Epididymis, 7 testicular artery and vene, 8 Ductus deferens
- Testis surface
- Testis cross section
- The right testis, exposed by laying open the tunica vaginalis. | Testicle
Template:Infobox Anatomy
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [5]
The testicle (from Latin testis, meaning "witness",[1] plural testes) is the male generative gland in animals. This article will concentrate on mammalian testicles unless otherwise noted.
# Anatomy and physiology
## Function
Like the ovaries (to which they are homologous), testicles are components of both the reproductive system (being gonads) and the endocrine system (being endocrine glands). The respective functions of the testicles are:
- producing sperm (spermatozoa)
- producing male sex hormones, of which testosterone is the best-known
Both functions of the testicle, sperm-forming and endocrine, are under control of gonadotropic hormones produced by the anterior pituitary:
- luteinizing hormone (LH)
- follicle-stimulating hormone (FSH)
## External appearance
Male mammals have two testicles, which are often contained within an extension of the abdomen called the scrotum. In mammals with external testicles it is most common for one testis to hang lower than the other. It is estimated that in about 85% of men the lower hanging testicle is the left one. This is due to differences in the vascular anatomical structure on the right and left sides.
In normal adult human males, testicular size ranges from the lower end of around 14 cm³ to the upper end larger than 35 cm³. Measurement in the living adult is done in two basic ways:
- comparing the testicle with ellipsoids of known sizes (orchidometer).
- measuring the length, depth and width with a ruler, a pair of calipers or ultrasound imaging.
The volume is then calculated using the formula for the volume of an ellipsoid: 4/3 π × (length/2) × (width/2) × (depth/2).
To some extent, it is possible to change testicular size. Short of direct injury or subjecting them to adverse conditions, e.g., higher temperature than they are normally accustomed to, they can be shrunk by competing against their intrinsic hormonal function through the use of externally administered steroidal hormones. Steroids taken for muscle enhancement often have the undesired side effect of testicular shrinkage. Similarly, stimulation of testicular functions via gonadotropic-like hormones may enlarge their size. Testicles may shrink or atrophy during hormone replacement therapy.
## Internal structure
### Duct system
Under a tough membraneous shell, the tunica albuginea, the testis contains very fine coiled tubes called the seminiferous tubules. The tubes are lined with a layer of cells that, from puberty into old-age, produce sperm cells.
The sperm travel from the seminiferous tubules to the rete testis located in the mediastinum testis, to the efferent ducts, and then to the epididymis where newly-created sperm cells mature (see spermatogenesis). The sperm move into the vas deferens, and are eventually expelled through the urethra and out of the urethral orifice through muscular contractions.
Between the seminiferous tubules are special cells called Leydig cells (or "interstitial cells") where testosterone and other androgens are formed.
### Blood supply and lymphatic drainage
Blood supply and lymphatic drainage of the testes and scrotum are distinct:
- The paired testicular arteries arise directly from the abdominal aorta and descend through the inguinal canal, while the scrotum and the rest of the external genitalia is supplied by the internal pudendal artery (itself a branch of the internal iliac artery).
- Lymphatic drainage of the testes follows the testicular arteries back to the paraaortic lymph nodes, while lymph from the scrotum drains to the inguinal lymph nodes.
### Layers
Many anatomical features of the adult testis reflect its developmental origin in the abdomen.
The layers of tissue enclosing each testicle are derived from the layers of the anterior abdominal wall. Notably, the cremasteric muscle arises from the internal oblique muscle.
### The blood-testis barrier
Large molecules cannot pass from the blood into the lumen of a seminiferous tubule due to the presence of tight junctions between adjacent Sertoli cells. The spermatogonia are in the basal compartment (deep to the level of the tight junctions) and the more mature forms such as primary and secondary spermatocytes and spermatids are in the adluminal compartment.
The function of the blood-testis barrier (red highlight in diagram above) may be to prevent an auto-immune reaction. Mature sperm (and their antigens) arise long after immune tolerance is established in infancy. Therefore, since sperm are antigenically different from self tissue, a male animal can react immunologically to his own sperm. In fact, he is capable of making antibodies against them.
Injection of sperm antigens causes inflammation of the testis (autoimmune orchitis) and reduced fertility. Thus, the blood-testis barrier may reduce the likelihood that sperm proteins will induce an immune response, reducing fertility and so progeny.
## Temperature regulation
The testes work best at temperatures slightly less than core body temperature (37 °C or 98.6 °F for humans). The spermatogenesis is less efficient at lower and higher temperatures. There are a number of mechanisms to maintain the testes at the optimum temperature.
The cremasteric muscle is part of the spermatic cord. When this muscle contracts, the cord is shortened and the testicle is moved closer up toward the body, which provides slightly more warmth to maintain optimal testicular temperature. When cooling is required, the cremasteric muscle relaxes and the testicle is lowered away from the warm body and is able to cool. This phenomenon is known as the cremasteric reflex. It also occurs in response to stress (the testicles rise up toward the body in an effort to protect them in a fight), and there are persistent reports that relaxation indicates approach of orgasm. There is a noticeable tendency to also retract during orgasm.
The testicles can also be lifted voluntarily using the pubococcygeus muscle, which partially activates related muscles. This can sometimes be triggered by tightening or sucking in the stomach or abdomen.
# Development
There are two phases in which the testicles grow substantially, namely in embryonic and pubertal age.
## Embryonic
During mammalian development, the gonads are at first capable of becoming either ovaries or testes.[2] In humans, starting at about week 4 the gonadal rudiments are present within the intermediate mesoderm adjacent to the developing kidneys. At about week 6, sex cords develop within the forming testes. These are comprised of early Sertoli cells that surround and nurture the germ cells that migrate into the gonads shortly before sex determination begins. In males, the sex-specific gene SRY that is found on the Y-chromosome initiates sex determination by downstream regulation of sex-determining factors, (such as GATA4, SOX9 and AMH), which leads to development of the male phenotype, including directing development of the early bipotential gonad down the male path of development.
## Pubertal
The testicles grow in response to the start of spermatogenesis. Size depends on lytic function, sperm production (amount of spermatogenisis present in testis), interstitial fluid, and Sertoli cell fluid production. After puberty, the volume of the testicles can be increased by over 500% as compared to the pre-pubertal size. In humans the average testicle size after puberty measures up to be 2 inches long, 0.8 inch in breadth, and 1.2 inches in diameter (5 x 2 x 3 cm).
# Evolution
## External testicles
The basal condition for mammals is to have internal testicles. Only the Boreoeutherian land mammals, the large group of mammals that includes humans, have externalized testicles. Indeed their testicles function best at temperatures lower than their core body temperature. Their testes are located outside of the body, suspended by the spermatic cord within the scrotum. The testes of the non-boreotherian mammals such as the monotremes, armadillos, sloths, elephants remain within the abdomen.[3] There are also some Boreoeutherian mammals with internal testes, such as the rhinoceros.
Marine boreotherian mammals such as whales and dolphins, also have internal testes, but it has recently been shown (e.g., for dolphins) that they use elaborate vascular networks to provide the necessary temperature lowering for optimum function. As external testes would increase drag, many boreotherian aquatic mammals have internal testes which are kept cool by special circulatory systems that cool the arterial blood going to the testes by placing the arteries near veins bringing cooled venous blood from the skin.
There are several hypotheses why most boreotherian mammals have external testes which operate best at a temperature that is slightly less than the core body temperature, e.g. that it is stuck with enzymes evolved in a colder temperature due to external testes evolving for different reasons, that the lower temperature of the testes simply is more efficient for sperm production.
1) More efficient. The classic hypothesis is that cooler temperature of the testes allows for more efficient fertile spermatogenesis. In other words, there are no possible enzymes operating at normal core body temperature that are as efficient as the ones evolved, at least none appearing in our evolution so far.
The early mammals had lower body temperatures and thus their testes worked efficiently within their body. However it is argued that boreotherian mammals have higher body temperatures than the other mammals and had to develop external testicles to keep them cool. It is argued that those mammals with internal testicles, such as the monotremes, armadillos, sloths, elephants, and rhinoceroses, have a lower core body temperatures than those mammals with external testicles.
However, the question remains why birds despite having very high core body temperatures have internal testes and did not evolve external testes.[4] It was once theorized that birds used their air sacs to cool the testes internally, but later studies revealed that birds' testes are able to function at core body temperature.[4]
2) Irreversible adaptation to sperm competition. It has been suggested that the ancestor of the boreoeutherian mammals was a small mammal that required very large testes (perhaps rather like those of a hamster) for sperm competition and thus had to place its testes outside the body.[5] This led to enzymes involved in spermatogenesis, spermatogenic DNA polymerase beta and recombinase activities evolving a unique temperature optimum, slightly less than core body temperature. When the boreoeutherian mammals then diversified into forms that were larger and/or did not require intense sperm competition they were stuck with enzymes that operated best at cooler temperatures and had to keep their testicles outside the body.
3) Protection from abdominal cavity pressure changes. One argument for the evolution of external testes is that it protects the testes from abdominal cavity pressure changes caused by jumping and galloping.[6]
## Testicular size
Testicular size as a proportion of body weight varies widely. In the mammalian kingdom, there is a tendency for testicular size to correspond with multiple mates (e.g., harems,polygamy). Production of testicular output sperm and spermatic fluid is also larger in polygamous animals, possibly a spermatogenic competition for survival. The testicles of the right whale are likely to be the largest of any animal, each weighing around 500 kg (1,100 lb).
# Health issues
The testicles are well-known to be very sensitive to impact and injury. Blue balls is a slang term for a temporary fluid congestion in the testicles and prostate region caused by prolonged sexual arousal.
The most prominent diseases of testicles are:
- testicular cancer and other neoplasms
- swelling of a testicle, caused by hydrocele testis
- inflammation of the testicles, called orchitis
- inflammation of the epididymis, called epididymitis
- spermatic cord torsion also called testicular torsion
- varicocele — swollen vein from the testes, usually affecting the left testicle[7]
- anorchidism is the absence of one or both testicles.
The removal of one or both testicles is termed:
- orchidectomy, in medicine (where orchiectomy and orchectomy are synonymous), and
- castration in general use, especially when done as punishment or torture, or as a catch-all term for orchidectomy in a veterinary context.
- Gelding in the specifically equine sense.
Testicular prostheses are available to mimic the appearance and feel of one or both testicles, when absent as from injury or as treatment for gender identity disorder. There have also been some instances of their implanting in dogs.
# Additional images
- Testicle of a cat: 1 Extremitas capitata, 2 Extremitas caudata, 3 Margo epididymalis, 4 Margo liber, 5 Mesorchium, 6 Epididymis, 7 testicular artery and vene, 8 Ductus deferens
- Testis surface
- Testis cross section
- The right testis, exposed by laying open the tunica vaginalis. | https://www.wikidoc.org/index.php/Teste | |
f9db8a86a2c708b285adcf627600125dca115a3d | wikidoc | Tetherin | Tetherin
Tetherin, also known as bone marrow stromal antigen 2, is a lipid raft associated protein that in humans is encoded by the BST2 gene. In addition, tetherin has been designated as CD317 (cluster of differentiation 317). This protein is constitutively expressed in mature B cells, plasma cells and plasmacytoid dendritic cells, and in many other cells, it is only expressed as a response to stimuli from IFN pathway.
# Gene activation
Tetherin is part of IFN-dependent antiviral response pathway. When the presence of virus and viral components is detected by recognition molecules such as (RIG-I), a cascades of interactions happen between signaling molecules, eventually the signal reaches the nucleus to upregulate the expression of interferon-stimulated genes (ISGs), this in turn activates IFN-a pathway to send the signal to neighboring cells, which causes upregulation in the expression of other ISGs and many viral restriction factors, such as tetherin.
# Function
Tetherin is a human cellular protein which inhibits retrovirus infection by preventing the diffusion of virus particles after budding from infected cells. Initially discovered as an inhibitor to HIV-1 infection in the absence of Vpu, tetherin has also been shown to inhibit the release of other RNA viruses such as the Lassa and Marburg virions suggesting a common mechanism that inhibits enveloped virus release without interaction with viral proteins. In addition, tetherin also restricts neuroinvasion of the DNA virus HSV-1.
# Structure
Tetherin is a type 2 integral membrane protein, with the N-terminus in the cytoplasm, one membrane spanning domain, and a C-terminus modified by the addition of a glycosyl-phosphatidylinositol (gpi) anchor. The transmembrane of tetherin is predicted to be a single alpha helix. The ectodomain consists of alpha helical coiled-coil region where the coils are slightly spread apart. Although Tetherin is localized to the lipid rafts on the surface of the cells, they are endocytosed to be sorted through TGN by clathrin-dependent pathway. This is mediated by AP2 binding to the dual-tyrosine motif located in the cytosolic domain of tetherin. When the virion buds from the surface of the cell, one of the tetherin membrane domains is in the new viral membrane, the other remains in the plasma membrane, tethering the virion to the cell. It is antagonized by the viral protein Vpu which is thought to work by targeting tetherin for degradation via the β-TrCP2 dependent pathway.
Tetherin exists as a dimer on the surface of cells, and prevention of dimerisation by mutating the cystine residues, prevents tetherin from inhibiting virus release, although it is still detectable in the cell. The stabilization of the protein through disulfide bond within the coiled coil region seems to be important in its function
# Interaction with different viruses
Tetherin is known to block many different types of enveloped viruses by tethering the budding virus like particles (VLPs) and inhibiting them from leaving the cell surface. Studies have shown that it is not the amino acid sequence, but the topology of tetherin is required for the tethering of virions on the cell surface. Their unique topology allows them to be in the cell through their N-terminus while using the GPI anchor to attach to budding virions. HIV-1 overcomes this restriction through vpu. Vpu interacts with tethrin by interacting with the protein at its transmembrane domain and recruiting β-TrCP2, which causes ubiquitination and degradation of tetherin. It has been recently shown that tetherin gene variants are associated with HIV disease progression underscoring the role of BST-2 in HIV type 1 infection. Another primate lentivirus, SIV, also, counteracts tetherin by their removal from the plasma membrane. KSHV protein K5 also targets tetherin for degradation through ubiquitination. Ebola counteracts tethrin through two mechanism. VP35 of Ebola, inhibits multiple steps of IFN-signaling pathway, which blocks the induction of tetherin as a downstream effect. Also, it has been noted that the full-length Ebola GP may either translocate tetherin or disrupt the structure of tetherin. Sendai virus proteins HN and F direct tethrin to endosomes or proteasome for degradation. CHIKV protein nsP1 interacts with tetherin by disrupting the tetherin-virion complex formation.
Cell-to-cell transmission through virological synapse in human retroviruses is also inhibited by tetherin. Tetherin aggregates virions and downmodulates the infectivity of the virions. It has also been suggested that tetherin may be involved in the structural integrity of the virological synapse.
# Other functions
Tetherin has also been predicted to be involved in cell adhesion and cell migration. Recently it has, also, been identified as the protein that help stabilize lipid rafts by joining nearby lipid rafts to form a cluster. For some viruses, such as Dengue virus, tetherin inhibits the budding of virions as well as cell-to-cell transmission of the virus. For human cytomegalovirus (HCMV), tetherin promotes entry of the virus, especially during cell differentiation. It has also been shown that tetherin is incorporated into newly formed virions. | Tetherin
Tetherin, also known as bone marrow stromal antigen 2, is a lipid raft associated protein that in humans is encoded by the BST2 gene.[1][2][3] In addition, tetherin has been designated as CD317 (cluster of differentiation 317). This protein is constitutively expressed in mature B cells, plasma cells and plasmacytoid dendritic cells, and in many other cells, it is only expressed as a response to stimuli from IFN pathway.[4]
# Gene activation
Tetherin is part of IFN-dependent antiviral response pathway. When the presence of virus and viral components is detected by recognition molecules such as (RIG-I), a cascades of interactions happen between signaling molecules, eventually the signal reaches the nucleus to upregulate the expression of interferon-stimulated genes (ISGs), this in turn activates IFN-a pathway to send the signal to neighboring cells, which causes upregulation in the expression of other ISGs and many viral restriction factors, such as tetherin.[5][6]
# Function
Tetherin is a human cellular protein which inhibits retrovirus infection by preventing the diffusion of virus particles after budding from infected cells. Initially discovered as an inhibitor to HIV-1 infection in the absence of Vpu, tetherin has also been shown to inhibit the release of other RNA viruses such as the Lassa and Marburg virions[7][8] suggesting a common mechanism that inhibits enveloped virus release without interaction with viral proteins. In addition, tetherin also restricts neuroinvasion of the DNA virus HSV-1.[9]
# Structure
Tetherin is a type 2 integral membrane protein, with the N-terminus in the cytoplasm, one membrane spanning domain, and a C-terminus modified by the addition of a glycosyl-phosphatidylinositol (gpi) anchor.[10] The transmembrane of tetherin is predicted to be a single alpha helix. The ectodomain consists of alpha helical coiled-coil region where the coils are slightly spread apart.[11] Although Tetherin is localized to the lipid rafts on the surface of the cells, they are endocytosed to be sorted through TGN by clathrin-dependent pathway. This is mediated by AP2 binding to the dual-tyrosine motif located in the cytosolic domain of tetherin.[3] When the virion buds from the surface of the cell, one of the tetherin membrane domains is in the new viral membrane, the other remains in the plasma membrane, tethering the virion to the cell. It is antagonized by the viral protein Vpu[12] which is thought to work by targeting tetherin for degradation via the β-TrCP2 dependent pathway.[13][14]
Tetherin exists as a dimer on the surface of cells, and prevention of dimerisation by mutating the cystine residues, prevents tetherin from inhibiting virus release, although it is still detectable in the cell. The stabilization of the protein through disulfide bond within the coiled coil region seems to be important in its function[4]
# Interaction with different viruses
Tetherin is known to block many different types of enveloped viruses by tethering the budding virus like particles (VLPs) and inhibiting them from leaving the cell surface. Studies have shown that it is not the amino acid sequence, but the topology of tetherin is required for the tethering of virions on the cell surface.[4] Their unique topology allows them to be in the cell through their N-terminus while using the GPI anchor to attach to budding virions.[11] HIV-1 overcomes this restriction through vpu. Vpu interacts with tethrin by interacting with the protein at its transmembrane domain and recruiting β-TrCP2, which causes ubiquitination and degradation of tetherin. It has been recently shown that tetherin gene variants are associated with HIV disease progression underscoring the role of BST-2 in HIV type 1 infection.[15] Another primate lentivirus, SIV, also, counteracts tetherin by their removal from the plasma membrane.[16][17] KSHV protein K5 also targets tetherin for degradation through ubiquitination.[18] Ebola counteracts tethrin through two mechanism. VP35 of Ebola, inhibits multiple steps of IFN-signaling pathway, which blocks the induction of tetherin as a downstream effect. Also, it has been noted that the full-length Ebola GP may either translocate tetherin or disrupt the structure of tetherin.[5] Sendai virus proteins HN and F direct tethrin to endosomes or proteasome for degradation.[19] CHIKV protein nsP1 interacts with tetherin by disrupting the tetherin-virion complex formation.[20]
Cell-to-cell transmission through virological synapse in human retroviruses is also inhibited by tetherin. Tetherin aggregates virions and downmodulates the infectivity of the virions. It has also been suggested that tetherin may be involved in the structural integrity of the virological synapse.[4]
# Other functions
Tetherin has also been predicted to be involved in cell adhesion and cell migration. Recently it has, also, been identified as the protein that help stabilize lipid rafts by joining nearby lipid rafts to form a cluster.[21] For some viruses, such as Dengue virus, tetherin inhibits the budding of virions as well as cell-to-cell transmission of the virus.[22] For human cytomegalovirus (HCMV), tetherin promotes entry of the virus, especially during cell differentiation. It has also been shown that tetherin is incorporated into newly formed virions.[23] | https://www.wikidoc.org/index.php/Tetherin | |
69a4d459ca168c6acee655d9484e4abcce494644 | wikidoc | Tetramer | Tetramer
# Overview
A tetramer is a protein with four subunits (tetrameric). There are homo-tetramers (all subunits are identical) such as glutathione S-transferase or single-strand binding protein, dimers of hetero-dimers such as haemoglobin (a dimer of an alpha/beta dimer), and hetero-tetramers, where each subunit is different.
In Immunology, MHC tetramers can be used to quantitate numbers of antigen-specific T cells (especially CD8+ T cells). MHC tetramers are based on recombinant class I molecules that, through the action of bacterial BirA, have been biotinylated. These molecules are folded with the peptide of interest and β2M and tetramerized by a fluorescently labeled streptavidin. (Streptavidin binds to four biotins per molecule.) This tetramer reagent will specifically label T cells that express T cell receptors that are specific for a given peptide-MHC complex. For example, a Kb/FAPGNYPAL tetramer will specifically bind to Sendai virus specific CTL in a C57BL/6 mouse. Antigen specific responses can be measured as CD8+, tetramer+ T cells as a fraction of all CD8+ lymphocytes.
The reason for using a tetramer, as opposed to a single labeled MHC class I molecule is that the tetrahedral tetramers can bind to three TCRs at once, allowing specific binding in spite of the low (10-6 molar) affinity of the typical class I-peptide-TCR interaction.
MHC Class II tetramers can also be made although these are more difficult to work with practically. | Tetramer
# Overview
A tetramer is a protein with four subunits (tetrameric). There are homo-tetramers (all subunits are identical) such as glutathione S-transferase or single-strand binding protein, dimers of hetero-dimers such as haemoglobin (a dimer of an alpha/beta dimer), and hetero-tetramers, where each subunit is different.
In Immunology, MHC tetramers can be used to quantitate numbers of antigen-specific T cells (especially CD8+ T cells). MHC tetramers are based on recombinant class I molecules that, through the action of bacterial BirA, have been biotinylated. These molecules are folded with the peptide of interest and β2M and tetramerized by a fluorescently labeled streptavidin. (Streptavidin binds to four biotins per molecule.) This tetramer reagent will specifically label T cells that express T cell receptors that are specific for a given peptide-MHC complex. For example, a Kb/FAPGNYPAL tetramer will specifically bind to Sendai virus specific CTL in a C57BL/6 mouse. Antigen specific responses can be measured as CD8+, tetramer+ T cells as a fraction of all CD8+ lymphocytes.
The reason for using a tetramer, as opposed to a single labeled MHC class I molecule is that the tetrahedral tetramers can bind to three TCRs at once, allowing specific binding in spite of the low (10-6 molar) affinity of the typical class I-peptide-TCR interaction.
MHC Class II tetramers can also be made although these are more difficult to work with practically.
Template:WH
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Tetramer | |
868a69cd9de239c83945c99beeaa1594c1adca7d | wikidoc | Theanine | Theanine
Theanine is an amino acid commonly found in tea (infusions of Camellia sinensis). Theanine is related to glutamine, and can cross the blood-brain barrier. Because it can enter the brain, theanine has psychoactive properties. Theanine has been shown to reduce mental and physical stress and may produce feelings of relaxation.
Theanine is speculated to produce these effects by increasing the level of gamma-aminobutyric acid (GABA) production. Theanine increases brain serotonin, dopamine, GABA levels and has micromolar affinities for AMPA, Kainate and NMDA receptors. It has also been found that injecting spontaneously hypertensive mice with theanine significantly lowered levels of 5-hydroxyindole in the brain. Researchers also speculate that it may inhibit glutamic acid excitotoxicity. Theanine also promotes alpha wave production in the brain.
Studies on test rats have shown that even repeated, extremely high doses of theanine cause little to no harmful psychological or physical effects.
L-theanine may help the body's immune system response when fighting infection by boosting the disease-fighting capacity of gamma delta T cells. The study, published in 2003 by the Brigham and Women's Hospital, included a four-week trial with 11 coffee drinkers and 10 tea drinkers, who consumed 600 milliliters of coffee or black tea daily. Blood sample analysis found that the production of anti-bacterial proteins was up to five times higher in the tea-drinkers, an indicator of a stronger immune response.
Recently, marketing campaigns from tea companies have been emphasizing the natural presence of L-theanine in their tea and that L-theanine boosts the production of alpha brainwaves. | Theanine
Template:Portalpar
Theanine is an amino acid commonly found in tea (infusions of Camellia sinensis). Theanine is related to glutamine, and can cross the blood-brain barrier.[1] Because it can enter the brain, theanine has psychoactive properties.[2] Theanine has been shown to reduce mental and physical stress[3] and may produce feelings of relaxation.[4]
Theanine is speculated to produce these effects by increasing the level of gamma-aminobutyric acid (GABA) production. Theanine increases brain serotonin, dopamine, GABA levels and has micromolar affinities for AMPA, Kainate and NMDA receptors.[5] It has also been found that injecting spontaneously hypertensive mice with theanine significantly lowered levels of 5-hydroxyindole in the brain.[6] Researchers also speculate that it may inhibit glutamic acid excitotoxicity.[5] Theanine also promotes alpha wave production in the brain.[2]
Studies on test rats have shown that even repeated, extremely high doses of theanine cause little to no harmful psychological or physical effects.[7]
L-theanine may help the body's immune system response when fighting infection by boosting the disease-fighting capacity of gamma delta T cells. The study, published in 2003 by the Brigham and Women's Hospital, included a four-week trial with 11 coffee drinkers and 10 tea drinkers, who consumed 600 milliliters of coffee or black tea daily. Blood sample analysis found that the production of anti-bacterial proteins was up to five times higher in the tea-drinkers, an indicator of a stronger immune response.[8]
Recently, marketing campaigns from tea companies have been emphasizing the natural presence of L-theanine in their tea and that L-theanine boosts the production of alpha brainwaves. [9] | https://www.wikidoc.org/index.php/Theanine | |
4a762b7d5afaa2393d9e467b05418275c4ff349d | wikidoc | Thermite | Thermite
Thermite is a pyrotechnic composition of aluminium powder and a metal oxide which produces an aluminothermic reaction known as a thermite reaction. It is not explosive, but can create short bursts of extremely high temperatures focused on a very small target for a short period of time.
The aluminium reduces the oxide of another metal, most commonly iron oxide, because aluminium is highly combustible. The products are aluminium oxide, free elemental iron, and a large amount of heat. The reactants are commonly powdered and mixed with a binder to keep the material solid and prevent separation.
The reaction is used for thermite welding, often used to join rail tracks. Other metal oxides can be used, such as chromium oxide, to generate elementary metal. Copper thermite, using copper oxide, is used for creating electric joints in a process called cadwelding. Some thermite-like mixtures are used as pyrotechnic initiators such as fireworks.
# History
Thermite (Thermit) was invented in 1893 and patented in 1895 by German chemist Hans Goldschmidt. Consequently, the reaction is sometimes called the "Goldschmidt reaction" or "Goldschmidt process". Dr. Goldschmidt was originally interested in producing very pure metals by avoiding the use of carbon in smelting, but he soon realized the value in welding.
The first commercial application was the welding of tram tracks in Essen, in 1899. Degussa, a corporate descendant of Goldschmidt's firm, is still today one of the world's largest producers of welding thermite.
# Types
Black or blue iron oxide (Fe3O4), produced by oxidizing iron in an oxygen-rich environment under high heat, is the most commonly used thermite oxidizing agent because it is inexpensive and easily produced. Red iron(III) oxide (Fe2O3, commonly known as rust) can also be used. Other oxides are occasionally used, such as MnO2 in manganese thermite, Cr2O3 in chromium thermite, or copper(II) oxide in copper thermite, but only for highly specialised purposes. All examples use aluminium as the reactive metal. Fluoropolymers can be used in special formulations, Teflon with magnesium or aluminium being a relatively common example. Magnesium/teflon/viton is another pyrolant of this type.
In principle, any reactive metal could be used instead of aluminium. This is rarely done, however, because the properties of aluminium are ideal for this reaction. It is by far the cheapest of the highly reactive metals; it also forms a passivation layer making it safer to handle than many other reactive metals. The melting and boiling points of aluminium also make it ideal for thermite reactions. Its relatively low melting point (660 °C, 1221 °F) means that it is easy to melt the metal, so that the reaction can occur mainly in the liquid phase and thus proceeds fairly quickly. At the same time, its high boiling point (2519 °C, 4566 °F) enables the reaction to reach very high temperatures, since several processes tend to limit the maximum temperature to just below the boiling point. Such a high boiling point is common among transition metals (e.g. iron and copper boil at 2887 °C and 2582 °C respectively), but is especially unusual among the highly reactive metals (cf. magnesium and sodium which boil at 1090 °C and 883 °C respectively). Further, the low density of the aluminium oxide formed as a result of the reaction tends to cause it to float on the iron, reducing contamination of the weld.
Although the reactants are stable at room temperature, they burn with an extremely intense exothermic reaction when they are heated to ignition temperature. The products emerge as liquids due to the high temperatures reached (up to 2500 °C (4500 °F) with iron(III) oxide)—although the actual temperature reached depends on how quickly heat can escape to the surrounding environment. Thermite contains its own supply of oxygen and does not require any external source of air. Consequently, it cannot be smothered and may ignite in any environment, given sufficient initial heat. It will burn well while wet and cannot be extinguished with water. Small amounts of water will boil before reaching the reaction. If thermite is ignited underwater, the molten iron produced will extract oxygen from water and generate hydrogen gas in a single-replacement reaction. This gas may, in turn, burn by combining with oxygen in the air.
# Ignition
Metals are capable of burning under the right conditions, similarly to the combustion process of wood or gasoline. In fact, rust is the result of oxidation of steel or iron at very slow rates. A thermite reaction is a process in which the correct mixture of metallic fuels are combined and ignited. Ignition itself requires extremely high temperatures.
Ignition of a thermite reaction normally requires supervision by a trained technician, and may require persistent efforts, as ignition can be unreliable and unpredictable. Thermite reactions require very high temperatures for initiation. These temperatures cannot be reached with conventional black powder fuses, nitrocellulose rods, detonators, a suitable pyrotechnic initiator, or other common igniting substances. Even when the thermite is hot enough to glow bright red, it will not ignite as it must be at or near white-hot to initiate the reaction. It is possible to start the reaction using a propane torch if done correctly. The torch can preheat the entire pile of thermite which will make it explode instead of burning slowly when it finally reaches ignition temperature.
Often, strips of magnesium metal are used as fuses. Because metals burn without releasing cooling gases, they can potentially burn at extremely high temperatures. Reactive metals such as magnesium can easily reach temperatures sufficiently high for thermite ignition. However, this method is notoriously unreliable: magnesium itself is difficult to ignite, and in windy or wet conditions the strip may be extinguished. Also, magnesium strips do not contain their own source of oxygen so combustion cannot occur unless the magnesium strips are exposed to air. A significant danger of magnesium ignition is the fact that the metal is an excellent conductor of heat; heating one end of the ribbon may cause the other end to transfer enough heat to the thermite to cause premature ignition. Despite these issues, magnesium ignition remains popular amongst amateur thermite users, mainly because it can be easily obtained.
The reaction between potassium permanganate and glycerine or ethylene glycol is used as an alternative to the magnesium method. When these two substances mix, a spontaneous reaction will begin, slowly increasing the temperature of the mixture until flames are produced. The heat released by the oxidation of glycerine is sufficient to initiate a thermite reaction. However, this method can also be unreliable and the delay between mixing and ignition can vary greatly due to factors such as particle size and ambient temperature.
Apart from magnesium ignition, some amateurs also choose to use sparklers to ignite the thermite mixture. These reach the necessary temperatures and provide enough time before the burning point reaches the sample. However, this can be a dangerous method, as the iron sparks, like the magnesium strips, burn at thousands of degrees and can ignite the thermite even though the sparkler itself is not in contact with it. This is especially dangerous with finely powdered thermite.
Similarly, finely-powdered thermite can be ignited by a regular flint spark lighter, as the sparks are burning metal (in this case, the highly-reactive rare-earth metals lanthanum and cerium). Therefore it is unsafe to strike a lighter close to thermite.
A stoichiometric mixture of finely powdered iron(III) oxide and aluminium may be ignited using ordinary red-tipped book matches by partially embedding one match head in the mixture, and igniting that match head with another match, preferably held with tongs in gloves to prevent flash burns.
# Civilian uses
Thermite reactions have many uses. Thermite is not an explosive but instead operates by increasing a very small area of metal to extremely high temperatures. Intense heat focused on a small spot can be used to cut through metal or weld metal components together by melting a very thin film where the components meet.
Thermite may be used for repair by the welding in-place of thick steel sections such as locomotive axle-frames where the repair can take place without removing the part from its installed location. It can also be used for quickly cutting or welding steel such as rail tracks, without requiring complex or heavy equipment. However, defects such as slag inclusions and holes are often present in such welded junctions and great care is needed to operate the process successfully.
A thermite reaction, when used to purify the ores of some metals, is called the Thermite process, or aluminothermic reaction. An adaptation of the reaction, used to obtain pure uranium, was developed as part of the Manhattan Project at Ames Laboratory under the direction of Frank Spedding. It is sometimes called the Ames process.
Copper thermite is used for welding together thick copper wires for the purpose of electrical connections. It is used extensively by the electrical utilities and telecommunications industries (Exothermic Welded Connections).
Thermite's main ingredients were also utilized for their individual qualities, specifically reflectivity and heat insulation, in a paint coating or dope for the Hindenburg, possibly contributing to its fiery destruction. This was a theory put forward by former NASA scientist Addison Bain, and later tested in small scale by the Mythbusters with semi-inconclusive results (it wasn't proven to be the thermite reactions fault but instead was conjectured to be a mix between that and the Hydrogen filling the Hindenburg).
# Military uses
Thermite hand grenades are used as incendiary devices to destroy enemy equipment quickly. Additionally, thermite grenades are used by friendly forces to destroy their own items and equipment when there is imminent danger of capture. Because standard iron-thermite is difficult to ignite, burns with practically no flame and has a small radius of action, standard thermite is rarely used on its own as an incendiary composition. It is more usually employed with other ingredients added to enhance its incendiary effects. Thermate-TH3 is a mixture of thermite and pyrotechnic additives which have been found to be superior to standard thermite for incendiary purposes. Its composition by weight is generally 68.7% thermite, 29.0% barium nitrate, 2.0% sulfur and 0.3% binder (such as PBAN). Addition of barium nitrate to thermite increases its thermal effect, creates flame in burning and significantly reduces the ignition temperature. Although the primary purpose of Thermate-TH3 is as an incendiary, it will also weld metal surfaces together.
A classic military use for thermite is disabling artillery pieces and it has been used for this purpose since the Second World War. Thermite can permanently disable artillery pieces without the use of explosive charges and therefore can be used with a reasonable amount of stealth. There are several ways to do this. By far the most destructive method is to weld the weapon shut by inserting one or more armed thermite grenades into the breech and then quickly closing it. This makes the weapon impossible to load. An alternative method is to insert an armed thermite grenade down the muzzle of the artillery piece, fouling the barrel. This makes the piece very dangerous to fire. Yet another method is to use thermite to weld the traversing and elevation mechanism of the weapon, making it impossible to aim properly.
Thermite was also used in both German and Allied incendiary bombs during WWII. Incendiary bombs usually consisted of dozens of thin thermite-filled canisters (bomblets) ignited by a magnesium fuse. Incendiary bombs destroyed entire cities due to the raging fires that resulted from their use. Cities that primarily consisted of wooden buildings were especially susceptible. These incendiary bombs were utilized primarily during night time air raids. Bomb sights could not be used at night, creating the need to use munitions that could destroy targets without the need for precision placement.
# Hazards
Thermite usage is hazardous due to the extremely high temperatures produced and the extreme difficulty in smothering a reaction once initiated. The thermite reaction releases dangerous ultra-violet (UV) light requiring that the reaction not be viewed directly, or that special eye protection (for example, a welder's mask) be worn. Small streams of molten iron released in the reaction can travel considerable distances and may melt through metal containers, igniting their contents. Additionally, flammable metals with relatively low boiling points such as zinc, whose boiling point of 907 °C (1665 °F) is about 1370 °C (2500 °F) below the temperature at which thermite burns, could potentially boil superheated metal violently into the air if near a thermite reaction, where it could then burst into flame as it is exposed to oxygen.
Preheating of thermite before ignition can easily be done accidentally, for example by pouring a new pile of thermite over a hot, recently-ignited pile of thermite slag. When ignited, preheated thermite can burn almost instantaneously, releasing a much greater amount of light and heat energy than normal and causing burns and eye damage at what would normally be a reasonably safe distance.
The thermite reaction can take place accidentally in industrial locations where abrasive grinding and cutting wheels are used with ferrous metals. Using aluminium in this situation produces an admixture of oxides which is capable of a violent explosive reaction.
Mixing water with thermite or pouring water onto burning thermite can cause a phreatomagmatic explosion, spraying hot fragments in all directions.
# Notes
- ↑ or rather, where the solid oxide particles meet the liquid metal
- ↑ i.e. loss of fuel and heat due to vaporization
- ↑ Fireball from Aluminium Grinding Dust | Thermite
Thermite is a pyrotechnic composition of aluminium powder and a metal oxide which produces an aluminothermic reaction known as a thermite reaction. It is not explosive, but can create short bursts of extremely high temperatures focused on a very small target for a short period of time.
The aluminium reduces the oxide of another metal, most commonly iron oxide, because aluminium is highly combustible. The products are aluminium oxide, free elemental iron, and a large amount of heat. The reactants are commonly powdered and mixed with a binder to keep the material solid and prevent separation.
The reaction is used for thermite welding, often used to join rail tracks. Other metal oxides can be used, such as chromium oxide, to generate elementary metal. Copper thermite, using copper oxide, is used for creating electric joints in a process called cadwelding. Some thermite-like mixtures are used as pyrotechnic initiators such as fireworks.
# History
Thermite (Thermit) was invented in 1893 and patented in 1895 by German chemist Hans Goldschmidt. Consequently, the reaction is sometimes called the "Goldschmidt reaction" or "Goldschmidt process". Dr. Goldschmidt was originally interested in producing very pure metals by avoiding the use of carbon in smelting, but he soon realized the value in welding.
The first commercial application was the welding of tram tracks in Essen, in 1899. Degussa, a corporate descendant of Goldschmidt's firm, is still today one of the world's largest producers of welding thermite.
# Types
Black or blue iron oxide (Fe3O4), produced by oxidizing iron in an oxygen-rich environment under high heat, is the most commonly used thermite oxidizing agent because it is inexpensive and easily produced. Red iron(III) oxide (Fe2O3, commonly known as rust) can also be used. Other oxides are occasionally used, such as MnO2 in manganese thermite, Cr2O3 in chromium thermite, or copper(II) oxide in copper thermite, but only for highly specialised purposes. All examples use aluminium as the reactive metal. Fluoropolymers can be used in special formulations, Teflon with magnesium or aluminium being a relatively common example. Magnesium/teflon/viton is another pyrolant of this type.
In principle, any reactive metal could be used instead of aluminium. This is rarely done, however, because the properties of aluminium are ideal for this reaction. It is by far the cheapest of the highly reactive metals; it also forms a passivation layer making it safer to handle than many other reactive metals. The melting and boiling points of aluminium also make it ideal for thermite reactions. Its relatively low melting point (660 °C, 1221 °F) means that it is easy to melt the metal, so that the reaction can occur mainly in the liquid phase[1] and thus proceeds fairly quickly. At the same time, its high boiling point (2519 °C, 4566 °F) enables the reaction to reach very high temperatures, since several processes tend to limit the maximum temperature to just below the boiling point.[2] Such a high boiling point is common among transition metals (e.g. iron and copper boil at 2887 °C and 2582 °C respectively), but is especially unusual among the highly reactive metals (cf. magnesium and sodium which boil at 1090 °C and 883 °C respectively). Further, the low density of the aluminium oxide formed as a result of the reaction tends to cause it to float on the iron, reducing contamination of the weld.
Although the reactants are stable at room temperature, they burn with an extremely intense exothermic reaction when they are heated to ignition temperature. The products emerge as liquids due to the high temperatures reached (up to 2500 °C (4500 °F) with iron(III) oxide)—although the actual temperature reached depends on how quickly heat can escape to the surrounding environment. Thermite contains its own supply of oxygen and does not require any external source of air. Consequently, it cannot be smothered and may ignite in any environment, given sufficient initial heat. It will burn well while wet and cannot be extinguished with water. Small amounts of water will boil before reaching the reaction. If thermite is ignited underwater, the molten iron produced will extract oxygen from water and generate hydrogen gas in a single-replacement reaction. This gas may, in turn, burn by combining with oxygen in the air.
# Ignition
Metals are capable of burning under the right conditions, similarly to the combustion process of wood or gasoline. In fact, rust is the result of oxidation of steel or iron at very slow rates. A thermite reaction is a process in which the correct mixture of metallic fuels are combined and ignited. Ignition itself requires extremely high temperatures.
Ignition of a thermite reaction normally requires supervision by a trained technician, and may require persistent efforts, as ignition can be unreliable and unpredictable. Thermite reactions require very high temperatures for initiation. These temperatures cannot be reached with conventional black powder fuses, nitrocellulose rods, detonators, a suitable pyrotechnic initiator, or other common igniting substances. Even when the thermite is hot enough to glow bright red, it will not ignite as it must be at or near white-hot to initiate the reaction. It is possible to start the reaction using a propane torch if done correctly. The torch can preheat the entire pile of thermite which will make it explode instead of burning slowly when it finally reaches ignition temperature.
Often, strips of magnesium metal are used as fuses. Because metals burn without releasing cooling gases, they can potentially burn at extremely high temperatures. Reactive metals such as magnesium can easily reach temperatures sufficiently high for thermite ignition. However, this method is notoriously unreliable: magnesium itself is difficult to ignite, and in windy or wet conditions the strip may be extinguished. Also, magnesium strips do not contain their own source of oxygen so combustion cannot occur unless the magnesium strips are exposed to air. A significant danger of magnesium ignition is the fact that the metal is an excellent conductor of heat; heating one end of the ribbon may cause the other end to transfer enough heat to the thermite to cause premature ignition. Despite these issues, magnesium ignition remains popular amongst amateur thermite users, mainly because it can be easily obtained.
The reaction between potassium permanganate and glycerine or ethylene glycol is used as an alternative to the magnesium method. When these two substances mix, a spontaneous reaction will begin, slowly increasing the temperature of the mixture until flames are produced. The heat released by the oxidation of glycerine is sufficient to initiate a thermite reaction. However, this method can also be unreliable and the delay between mixing and ignition can vary greatly due to factors such as particle size and ambient temperature.
Apart from magnesium ignition, some amateurs also choose to use sparklers to ignite the thermite mixture. These reach the necessary temperatures and provide enough time before the burning point reaches the sample. However, this can be a dangerous method, as the iron sparks, like the magnesium strips, burn at thousands of degrees and can ignite the thermite even though the sparkler itself is not in contact with it. This is especially dangerous with finely powdered thermite.
Similarly, finely-powdered thermite can be ignited by a regular flint spark lighter, as the sparks are burning metal (in this case, the highly-reactive rare-earth metals lanthanum and cerium). Therefore it is unsafe to strike a lighter close to thermite.
A stoichiometric mixture of finely powdered iron(III) oxide and aluminium may be ignited using ordinary red-tipped book matches by partially embedding one match head in the mixture, and igniting that match head with another match, preferably held with tongs in gloves to prevent flash burns.
# Civilian uses
Thermite reactions have many uses. Thermite is not an explosive but instead operates by increasing a very small area of metal to extremely high temperatures. Intense heat focused on a small spot can be used to cut through metal or weld metal components together by melting a very thin film where the components meet.
Thermite may be used for repair by the welding in-place of thick steel sections such as locomotive axle-frames where the repair can take place without removing the part from its installed location. It can also be used for quickly cutting or welding steel such as rail tracks, without requiring complex or heavy equipment. However, defects such as slag inclusions and holes are often present in such welded junctions and great care is needed to operate the process successfully.
A thermite reaction, when used to purify the ores of some metals, is called the Thermite process, or aluminothermic reaction. An adaptation of the reaction, used to obtain pure uranium, was developed as part of the Manhattan Project at Ames Laboratory under the direction of Frank Spedding. It is sometimes called the Ames process.
Copper thermite is used for welding together thick copper wires for the purpose of electrical connections. It is used extensively by the electrical utilities and telecommunications industries (Exothermic Welded Connections).
Thermite's main ingredients were also utilized for their individual qualities, specifically reflectivity and heat insulation, in a paint coating or dope for the Hindenburg, possibly contributing to its fiery destruction. This was a theory put forward by former NASA scientist Addison Bain, and later tested in small scale by the Mythbusters with semi-inconclusive results (it wasn't proven to be the thermite reactions fault but instead was conjectured to be a mix between that and the Hydrogen filling the Hindenburg).
# Military uses
Thermite hand grenades are used as incendiary devices to destroy enemy equipment quickly. Additionally, thermite grenades are used by friendly forces to destroy their own items and equipment when there is imminent danger of capture. Because standard iron-thermite is difficult to ignite, burns with practically no flame and has a small radius of action, standard thermite is rarely used on its own as an incendiary composition. It is more usually employed with other ingredients added to enhance its incendiary effects. Thermate-TH3 is a mixture of thermite and pyrotechnic additives which have been found to be superior to standard thermite for incendiary purposes. Its composition by weight is generally 68.7% thermite, 29.0% barium nitrate, 2.0% sulfur and 0.3% binder (such as PBAN). Addition of barium nitrate to thermite increases its thermal effect, creates flame in burning and significantly reduces the ignition temperature. Although the primary purpose of Thermate-TH3 is as an incendiary, it will also weld metal surfaces together.
A classic military use for thermite is disabling artillery pieces and it has been used for this purpose since the Second World War. Thermite can permanently disable artillery pieces without the use of explosive charges and therefore can be used with a reasonable amount of stealth. There are several ways to do this. By far the most destructive method is to weld the weapon shut by inserting one or more armed thermite grenades into the breech and then quickly closing it. This makes the weapon impossible to load. An alternative method is to insert an armed thermite grenade down the muzzle of the artillery piece, fouling the barrel. This makes the piece very dangerous to fire. Yet another method is to use thermite to weld the traversing and elevation mechanism of the weapon, making it impossible to aim properly.
Thermite was also used in both German and Allied incendiary bombs during WWII. Incendiary bombs usually consisted of dozens of thin thermite-filled canisters (bomblets) ignited by a magnesium fuse. Incendiary bombs destroyed entire cities due to the raging fires that resulted from their use. Cities that primarily consisted of wooden buildings were especially susceptible. These incendiary bombs were utilized primarily during night time air raids. Bomb sights could not be used at night, creating the need to use munitions that could destroy targets without the need for precision placement.
# Hazards
Thermite usage is hazardous due to the extremely high temperatures produced and the extreme difficulty in smothering a reaction once initiated. The thermite reaction releases dangerous ultra-violet (UV) light requiring that the reaction not be viewed directly, or that special eye protection (for example, a welder's mask) be worn. Small streams of molten iron released in the reaction can travel considerable distances and may melt through metal containers, igniting their contents. Additionally, flammable metals with relatively low boiling points such as zinc, whose boiling point of 907 °C (1665 °F) is about 1370 °C (2500 °F) below the temperature at which thermite burns, could potentially boil superheated metal violently into the air if near a thermite reaction, where it could then burst into flame as it is exposed to oxygen.
Preheating of thermite before ignition can easily be done accidentally, for example by pouring a new pile of thermite over a hot, recently-ignited pile of thermite slag. When ignited, preheated thermite can burn almost instantaneously, releasing a much greater amount of light and heat energy than normal and causing burns and eye damage at what would normally be a reasonably safe distance.
The thermite reaction can take place accidentally in industrial locations where abrasive grinding and cutting wheels are used with ferrous metals. Using aluminium in this situation produces an admixture of oxides which is capable of a violent explosive reaction.[3]
Mixing water with thermite or pouring water onto burning thermite can cause a phreatomagmatic explosion, spraying hot fragments in all directions.
# Notes
- ↑ or rather, where the solid oxide particles meet the liquid metal
- ↑ i.e. loss of fuel and heat due to vaporization
- ↑ Fireball from Aluminium Grinding Dust | https://www.wikidoc.org/index.php/Thermite | |
abafe9a3c7c7ddc2d9f97bb34927a402645fc838 | wikidoc | Thiourea | Thiourea
# Overview
Thiourea is an organic compound of carbon, nitrogen, sulfur and hydrogen, with the formula CSN2H4 or (NH2)2CS. It is similar to urea, except that the oxygen atom is replaced by a sulfur atom. The properties of urea and thiourea differ significantly because of the relative electronegativities of sulfur and oxygen. Thiourea is a versatile reagent in organic synthesis. "Thioureas" refers to a broad class of compounds with the general structure (R1R²N)(R³R4N)C=S. Thioureas are related to thioamides, e.g. RC(S)NR2, where R is methyl, ethyl, etc.
# Structure and bonding
Thiourea is a planar molecule. The C=S bond distance is 1.60±0.1 Å for a wide range of derivatives. This narrow range indicates that the C=S bond is insensitive to the nature of the substitutent. Thus, the thioamide, which is similar to an amide group, is difficult to perturb.
Thiourea occurs in two tautomeric forms:
# Synthesis of thiourea
The global annual production of thiourea is around 10,000 tons. About 40% is produced in Germany, another 40% in China, and 20% in Japan.
Thiourea can be prepared from ammonium thiocyanate but more commonly is synthesized by the reaction of hydrogen sulfide with calcium cyanamide in the presence of carbon dioxide.
Many thiourea derivatives are useful. N,N-unsubstituted thioureas are generally prepared by allowing the corresponding cyanamide to react with LiAlHSH in the presence of 1 N HCl in anhydrous diethyl ether. LiAlHSH can be prepared by reacting sulfur with lithium aluminium hydride.
# Applications of thiourea
Thiourea reduces peroxides to the corresponding diols. The intermediate of the reaction is an unstable epidioxide which can only be identified at -100 ℃. Epidioxide is similar to epoxide except with two oxygen atoms. This intermediate reduces to diol by thiourea.
Thiourea is also used in the reductive workup of ozonolysis to give carbonyl compounds. Dimethylsulfide is also an effective reagent for this reaction, but it is highly volatile (b.p. 37 ℃) and has an obnoxious odor whereas thiourea is odorless and conveniently non-volatile (reflecting its polarity).
Thiourea is commonly employed to convert alkyl halides to thiols. Such reactions proceed via the intermediacy of isothiuronium salts.. The reaction capitalizes on the high nuceophilicity of the sulfur center and the hydrolytic instability of the isothiuronium salt:
In principle, alkali metal sulfides could also be used to convert alkyl halides to thiols, but thiourea avoids formation of dialkyl sulfides, a side product that plagues the use of Na2S and related reagents.
Thioureas are used a building blocks to pyrimidine derivatives. Thus thioureas condense with β-dicarbonyl compounds. The amino group on the thiourea initially condenses with a carbonyl, followed by cyclization and tautomerization. Desulfurization delivers the pyrimidine.
Similarly, aminothiazoles can be synthesized by the reaction of alpha-halo ketones and thiourea.
Another common application for use of thiourea is a common sulfur source for making semiconductor cadmium sulfide nanoparticle. A slurry of 1 g cadmium sulfate (1.3 mmol), 0.5 g thiourea (6.6 mmol), and 0.1 g SiO2 (1.7 mmol) were sonicated for 3 hours under ambient air at room temperature. The colorless slurry solution changes to yellow indicating the generation of CdS.
Other industrial uses of thiourea include production of flame retardant resins, and vulcanization accelerators. Thiourea is used as an auxiliary agent in diazo paper (light-sensitive photocopy paper) and almost all other types of copy paper. The liquid silver cleaning product TarnX is essentially a solution of thiourea. A leaching agent for gold leaching and silver leaching can be created by selectively oxidizing thiourea, bypassing the steps of cyanide use and smelting.
# Safety
A goitrogenic effect (enlargement of the thyroid gland) has been reported, and hepatic tumors have resulted from chronic administration in rat. Bone marrow depression also has been reported. | Thiourea
Template:Chembox new
# Overview
Thiourea is an organic compound of carbon, nitrogen, sulfur and hydrogen, with the formula CSN2H4 or (NH2)2CS. It is similar to urea, except that the oxygen atom is replaced by a sulfur atom. The properties of urea and thiourea differ significantly because of the relative electronegativities of sulfur and oxygen. Thiourea is a versatile reagent in organic synthesis. "Thioureas" refers to a broad class of compounds with the general structure (R1R²N)(R³R4N)C=S. Thioureas are related to thioamides, e.g. RC(S)NR2, where R is methyl, ethyl, etc.
# Structure and bonding
Thiourea is a planar molecule. The C=S bond distance is 1.60±0.1 Å for a wide range of derivatives. This narrow range indicates that the C=S bond is insensitive to the nature of the substitutent. Thus, the thioamide, which is similar to an amide group, is difficult to perturb.
Thiourea occurs in two tautomeric forms:
# Synthesis of thiourea
The global annual production of thiourea is around 10,000 tons. About 40% is produced in Germany, another 40% in China, and 20% in Japan.
Thiourea can be prepared from ammonium thiocyanate but more commonly is synthesized by the reaction of hydrogen sulfide with calcium cyanamide in the presence of carbon dioxide.
Many thiourea derivatives are useful. N,N-unsubstituted thioureas are generally prepared by allowing the corresponding cyanamide to react with LiAlHSH in the presence of 1 N HCl in anhydrous diethyl ether. LiAlHSH can be prepared by reacting sulfur with lithium aluminium hydride.
# Applications of thiourea
Thiourea reduces peroxides to the corresponding diols.[1] The intermediate of the reaction is an unstable epidioxide which can only be identified at -100 ℃. Epidioxide is similar to epoxide except with two oxygen atoms. This intermediate reduces to diol by thiourea.
Thiourea is also used in the reductive workup of ozonolysis to give carbonyl compounds.[2] Dimethylsulfide is also an effective reagent for this reaction, but it is highly volatile (b.p. 37 ℃) and has an obnoxious odor whereas thiourea is odorless and conveniently non-volatile (reflecting its polarity).
Thiourea is commonly employed to convert alkyl halides to thiols. Such reactions proceed via the intermediacy of isothiuronium salts.[3]. The reaction capitalizes on the high nuceophilicity of the sulfur center and the hydrolytic instability of the isothiuronium salt:
In principle, alkali metal sulfides could also be used to convert alkyl halides to thiols, but thiourea avoids formation of dialkyl sulfides, a side product that plagues the use of Na2S and related reagents.
Thioureas are used a building blocks to pyrimidine derivatives. Thus thioureas condense with β-dicarbonyl compounds.[4] The amino group on the thiourea initially condenses with a carbonyl, followed by cyclization and tautomerization. Desulfurization delivers the pyrimidine.
Similarly, aminothiazoles can be synthesized by the reaction of alpha-halo ketones and thiourea.[5]
Another common application for use of thiourea is a common sulfur source for making semiconductor cadmium sulfide nanoparticle. A slurry of 1 g cadmium sulfate (1.3 mmol), 0.5 g thiourea (6.6 mmol), and 0.1 g SiO2 (1.7 mmol) were sonicated for 3 hours under ambient air at room temperature. The colorless slurry solution changes to yellow indicating the generation of CdS.
Other industrial uses of thiourea include production of flame retardant resins, and vulcanization accelerators. Thiourea is used as an auxiliary agent in diazo paper (light-sensitive photocopy paper) and almost all other types of copy paper. The liquid silver cleaning product TarnX is essentially a solution of thiourea. A leaching agent for gold leaching and silver leaching can be created by selectively oxidizing thiourea, bypassing the steps of cyanide use and smelting.[1]
# Safety
A goitrogenic effect (enlargement of the thyroid gland) has been reported, and hepatic tumors have resulted from chronic administration in rat. Bone marrow depression also has been reported. | https://www.wikidoc.org/index.php/Thiocarbamide | |
b6b821d5b369713df9af567016246db81d2235c7 | wikidoc | Thionins | Thionins
Thionins are small, basic plant proteins, 45 to 50 amino acids in length, which include three or four conserved disulfide linkages. The proteins are toxic to animal cells, presumably attacking the cell membrane and rendering it permeable:
this results in the inhibition of sugar uptake and allows potassium and phosphate ions, proteins, and nucleotides to leak from cells. Thionins are mainly found in seeds where they may act as a defence against consumption by animals. A barley (Hordeum vulgare) leaf thionin that is highly toxic to plant pathogens and is involved in the mechanism of plant defence against microbial infections has also been identified. The hydrophobic protein crambin from the Abyssinian kale (Crambe abyssinica) is also a member of the thionin family.
# Databases
A database for antimicrobial peptides, including thionins is available: PhytAMP (). | Thionins
Thionins are small, basic plant proteins, 45 to 50 amino acids in length, which include three or four conserved disulfide linkages. The proteins are toxic to animal cells, presumably attacking the cell membrane and rendering it permeable:
this results in the inhibition of sugar uptake and allows potassium and phosphate ions, proteins, and nucleotides to leak from cells[1]. Thionins are mainly found in seeds where they may act as a defence against consumption by animals. A barley (Hordeum vulgare) leaf thionin that is highly toxic to plant pathogens and is involved in the mechanism of plant defence against microbial infections has also been identified[2]. The hydrophobic protein crambin from the Abyssinian kale (Crambe abyssinica) is also a member of the thionin family[1].
# Databases
A database for antimicrobial peptides, including thionins is available: PhytAMP (http://phytamp.pfba-lab.org)[3]. | https://www.wikidoc.org/index.php/Thionins | |
1540c1a891c25b699203ca49a838c9b57a29a4a8 | wikidoc | Thiotepa | Thiotepa
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Thiotepa is an antineoplastic agent that is FDA approved for the treatment of cns lymphoma, multiple myeloma, breast cancer, ovarian cancer, germ cell tumor, thalassemia, leukemia. Common adverse reactions include alopecia, injection site pain, rash, loss of appetite, nausea, vomiting, asthenia, fatigue.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
- The recommended dose in haematological diseases ranges from 125 mg/m2/day (3.38 mg/kg/day) to 300 mg/m2/day (8.10 mg/kg/day) as a single daily infusion, administered from 2 up to 4 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 900 mg/m2 (24.32 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 125 mg/m2/day (3.38 mg/kg/day) to 300 mg/m2/day (8.10 mg/ kg/day) as a single daily infusion, administered from 2 up to 4 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 900 mg/m2 (24.32 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 185 mg/m2/day (5 mg/kg/day) as a single daily infusion, administered for 2 consecutive days before autologous HPCT, without exceeding the total maximum cumulative dose of 370 mg/m2 (10 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 150 mg/m2/day (4.05 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) as a single daily infusion, administered for 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 750 mg/m2 (20.27 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in solid tumours ranges from 120 mg/m2/day (3.24 mg/kg/day) to 250 mg/ m2/day (6.76 mg/kg/day) divided in one or two daily infusions, administered from 2 up to 5 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 800 mg/m2 (21.62 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 120 mg/m2/day (3.24 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) as a single daily infusion, administered from 3 up to 5 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 800 mg/m2 (21.62 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 125 mg/m2/day (3.38 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) divided in one or two daily infusions, administered from 3 up to 4 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 750 mg/m2 (20.27 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 250 mg/m2/day (6.76 mg/kg/day) as a single daily infusion, administered in 2 consecutive days before autologous HPCT, without exceeding the total maximum cumulative dose of 500 mg/m2 (13.51 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 150 mg/m2/day (4.05 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) as a single daily infusion, administered for 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 750 mg/m2 (20.27 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in haematological diseases ranges from 185 mg/m2/day (5 mg/kg/day) to 481 mg/m2/day (13 mg/kg/day) divided in one or two daily infusions, administered from 1 up to 3 consecutive days before allogeneic HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 555 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in lymphoma is 370 mg/m2/day (10 mg/kg/day) divided in two daily infusions before allogeneic HPCT, without exceeding the total maximum cumulative dose of 370 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
- The recommended dose is 185 mg/m2/day (5 mg/kg/day) as a single daily infusion before allogeneic HPCT, without exceeding the total maximum cumulative dose of 185 mg/m2 (5 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 185 mg/m2/day (5 mg/kg/day) to 481 mg/m2/day (13 mg/kg/day) divided in one or two daily infusions, administered from 1 up to 2 consecutive days before allogeneic HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 555 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 370 mg/m2/day (10 mg/kg/day) divided in two daily infusions, administered before allogeneic HPCT, without exceeding the total maximum cumulative dose of 370 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Thiotepa in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Thiotepa in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
- The recommended dose in solid tumours ranges from 150 mg/m2/day (6 mg/kg/day) to 350 mg/ m2/day (14 mg/kg/day) as a single daily infusion, administered from 2 up to 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 1050 mg/m2 (42 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 250 mg/m2/day (10 mg/kg/day) to 350 mg/m2/day (14 mg/kg/ day) as a single daily infusion, administered for 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 1050 mg/m2 (42 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in haematological diseases ranges from 125 mg/m2/day (5 mg/kg/day) to 250 mg/ m2/day (10 mg/kg/day) divided in one or two daily infusions, administered from 1 up to 3 consecutive days before allogeneic HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 375 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 250 mg/m2/day (10 mg/kg/day) divided in two daily infusions, administered before allogeneic HPCT, without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 200 mg/m2/day (8 mg/kg/day) to 250 mg/m2/day (10 mg/kg/ day) divided in two daily infusions, administered before allogeneic HPCT without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 125 mg/m2/day (5 mg/kg/day) as a single daily infusion, administered for 3 consecutive days before allogeneic HPCT, without exceeding the total maximum cumulative dose of 375 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 125 mg/m2/day (5 mg/kg/day) as a single daily infusion, administered for 2 consecutive days before allogeneic HPCT, without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 250 mg/m2/day (10 mg/kg/day) divided in two daily infusions, administered before allogeneic HPCT, without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
- TEPADINA® must be reconstituted with 1.5 ml of sterile water for injections.
- Using a syringe fitted with a needle, aseptically withdraw 1.5 ml of sterile water for injections.
- Inject the content of the syringe into the vial through the rubber stopper.
- Remove the syringe and the needle and mix manually by repeated inversions.
- Only clear colourless solutions, without any particulate matter, must be used.
- The reconstituted solution is hypotonic and must be further diluted prior to administration with 500 ml sodium chloride 9 mg/ml (0.9 %) solution for injection (1000 ml if the dose is higher than 500 mg) or with an appropriate volume of sodium chloride 9 mg/ml (0.9 %) in order to obtain a final TEPADINA®concentration between 0.5 and 1 mg/ml.
- TEPADINA® infusion solution should be inspected visually for particulate matter and opalescence prior to administration. Solutions containing a precipitate should be discarded.
- It is recommended that the infusion solution be administered to patients using an infusion set equipped with a 0.2 µm in-line filter.
- TEPADINA® should be aseptically administered as a 2 - 4 hours infusion under room temperature and normal light conditions.
- Prior to and following each infusion, the indwelling catheter line should be flushed with approximately 5 ml sodium chloride 9 mg/ml (0.9 %) solution for injection.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Thiotepa in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Thiotepa in pediatric patients.
# Contraindications
- Existing hepatic, renal or bone marrow damage (may use low dosage and frequent monitoring if need outweighs risk)
- Hypersensitivity to thiotepa
# Warnings
There is limited information regarding Thiotepa Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Thiotepa Clinical Trials Experience in the drug label.
## Postmarketing Experience
- Decrease in circulating blood cell counts (intended effect of the medicine to prepare you for your transplant infusion)
- Infection
- Liver disorders including blocking of a liver vein
- The graft attacks your body (graft versus host disease)
- Respiratory complications.
- Increased susceptibility to infection
- Whole-body inflammatory state (sepsis)
- Decreased counts of white blood cells, platelets and red blood cells (anaemia)
- The transplanted cells attack your body (graft versus host disease)
- Dizziness, headache, blurred vision
- Uncontrolled shaking of the body (convulsion)
- Sensation of tingling, pricking or numbness (paraesthesia)
- Partial loss of movement
- Cardiac arrest
- Nausea, vomiting, diarrhea
- Inflammation of the mucosa of the mouth (mucositis)
- Irritated stomach, gullet, intestine
- Inflammation of the liver
- High glucose in the blood
- Skin rash, itching, shedding
- Skin color disorder
- Redness of the skin (erythema)
- Hair loss
- Back and abdominal pain, pain
- Muscle and joint pain
- Abnormal electrical activity in the heart (arrhythmia)
- Inflammation of lung tissue
- Enlarged liver
- Altered organ function
- Blocking of a liver vein (VOD)
- Yellowing of the skin and eyes (jaundice)
- Hearing impaired
- Lymphatic obstruction
- High blood pressure
- Increased liver, renal and digestive enzymes
- Abnormal blood electrolytes
- Weight gain
- Fever, general weakness, chills
- Bleeding (haemorrhage)
- Nasal bleeding
- General swelling due to fluid retention (edema)
- Pain or inflammation at the injection site
- Eye infection (conjunctivitis)
- Decreased sperm cell count
- Vaginal bleeding
- Absence of menstrual periods (amenorrhea)
- Memory loss
- Delaying in weight and height increase
- Bladder disfunction
- Underproduction of testosterone
- Insufficient production of thyroid hormone
- Deficient activity of the pituitary gland
- Confusional state.
# Drug Interactions
There is limited information regarding Thiotepa Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): D
- You must tell your doctor if you are or think you may be pregnant before you receive TEPADINA® . You must not use TEPADINA® during pregnancy.
- Both women and men using TEPADINA® must use effective contraceptive methods during treatment.
- It is not known whether this medicinal product is excreted in breast milk. - As a precautionary measure, women must not breast-feed during treatment with TEPADINA® .
- TEPADINA® can impair male and female fertility. Male patients should seek for sperm preservation before therapy is started and should not father while treated and during the year after cessation of treatment.
Pregnancy Category (AUS): D
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Thiotepa in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Thiotepa during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Thiotepa with respect to nursing mothers.
### Pediatric Use
There is no FDA guidance on the use of Thiotepa with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Thiotepa with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Thiotepa with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Thiotepa with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Thiotepa in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Thiotepa in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Thiotepa in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Thiotepa in patients who are immunocompromised.
### Others
(Description)
# Administration and Monitoring
### Administration
- Oral
### Monitoring
- Blood counts and liver enzymes
# IV Compatibility
There is limited information regarding the compatibility of Thiotepa and IV administrations.
# Overdosage
There is limited information regarding Thiotepa overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
## Mechanism of Action
- Thiotepa is a cytotoxic, ethylenimine-type agent related to nitrogen mustard, which acts by releasing ethylenimine radicals that disrupts DNA bonds and causes the breakage of links between the purine base and sugar, liberating alkylated guanines, resulting in the misreading of the DNA code and the inhibition of DNA, RNA, and protein synthesis in rapidly proliferating tumor cells.
## Structure
(Description with picture)
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Thiotepa in the drug label.
## Pharmacokinetics
- Bioavailability, Oral: incomplete
- Distribution
- Vd: 0.3 to 1.6 L/kg
- Liver
- Metabolite, tepa: active
- Potent inhibitor of CYP2B6
- Renal: less than 2% unchanged; 4.2% as active metabolite
- Total body clearance: 419 to 446 mL/min
- Dialyzable: Yes
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Thiotepa in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Thiotepa in the drug label.
# How Supplied
There is limited information regarding Thiotepa How Supplied in the drug label.
## Storage
- Keep out of the reach and sight of children.
- Do not use TEPADINA® after the expiry date which is stated on the carton and vial label, after EXP. The expiry date refers to the last day of that month.
- Store and transport refrigerated (2 °C - 8 °C).
- Do not freeze.
- After reconstitution the product is stable for 8 hours when stored at 2 °C - 8 °C.
- After dilution the product is stable for 24 hours when stored at 2 °C - 8 °C and for 4 hours when stored at 25 °C. From a microbiological point of view, the product should be used immediately.
- Any unused product or waste material should be disposed of in accordance with local requirements.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
- WHAT TEPADINA® IS AND WHAT IT IS USED FOR
- TEPADINA® contains the active substance thiotepa, which belongs to a group of medicines called alkylating agents.
- TEPADINA® is used to prepare patients for bone marrow transplantation. It works by destroying bone marrow cells. This enables the transplantation of new bone marrow cells (haematopoietic progenitor cells), which in turn enable the body to produce healthy blood cells. TEPADINA® can be used in adults and children.
- BEFORE YOU USE TEPADINA®
- Do not use TEPADINA®
- If you are allergic (hypersensitive) to thiotepa,
- If you are pregnant or think you may be pregnant (see below),
- If you are breast-feeding,
- If you are receiving yellow fever vaccination, live virus and bacterial vaccines.
- Take special care with TEPADINA®
- You should tell your doctor if you have:
- Liver or kidney problems,
- Heart or lung problems,
- Seizures/fits (epilepsy) or have had them in the past (if treated with phenytoin or fosphenytoin).
- You will have to take regular blood tests during treatment to check your blood cell counts.
- You will have to use anti-infectives to prevent and manage infections.
- TEPADINA® may cause another type of cancer in the future. Your doctor will discuss this risk with you.
- You must tell your doctor if you are or think you may be pregnant before you receive TEPADINA® . You must not use TEPADINA® during pregnancy.
- Both women and men using TEPADINA® must use effective contraceptive methods during treatment.
- It is not known whether this medicinal product is excreted in breast milk. - As a precautionary measure, women must not breast-feed during treatment with TEPADINA® .
- TEPADINA® can impair male and female fertility. Male patients should seek for sperm preservation before therapy is started and should not father while treated and during the year after cessation of treatment.
- Please tell your doctor if you are taking or have recently taken any other medicines, including medicines obtained without a prescription.
- HOW TO USE TEPADINA®
- Your doctor will calculate the dose according to your body surface or weight and your disease.
- How TEPADINA® is given
- TEPADINA® is administered by a qualified healthcare professional as an intravenous infusion (drip in a vein) after dilution of the individual vial. - Each infusion will last 2 - 4 hours.
- You will receive your infusions every 12 or 24 hours. The duration of treatment can last up to 3 days. Frequency of administration and duration of treatment depend on your disease.
- POSSIBLE SIDE EFFECTS
- Like all medicines, TEPADINA® can cause side effects, although not everybody gets them.
- The most serious side effects of TEPADINA® therapy or the transplant procedure may include
- Decrease in circulating blood cell counts (intended effect of the medicine to prepare you for your transplant infusion)
- Infection
- Liver disorders including blocking of a liver vein
- The graft attacks your body (graft versus host disease)
- Respiratory complications
- Your doctor will monitor your blood counts and liver enzymes regularly to detect and manage these events.
- Side effects of TEPADINA® may occur with certain frequencies, which are defined as follows:
- Very common
- Affects more than 1 user in 10
- Common
- Affects 1 to 10 users in 100
- Uncommon
- Affects 1 to 10 users in 1,000
- Rare
- Affects 1 to 10 users in 10,000
- Very rare
- Affects less than 1 user in 10,000
- Not known
- Frequency cannot be estimated from the available data.
- Increased susceptibility to infection
- Whole-body inflammatory state (sepsis)
- Decreased counts of white blood cells, platelets and red blood cells (anaemia)
- The transplanted cells attack your body (graft versus host disease)
- Dizziness, headache, blurred vision
- Uncontrolled shaking of the body (convulsion)
- Sensation of tingling, pricking or numbness (paraesthesia)
- Partial loss of movement
- Cardiac arrest
- Nausea, vomiting, diarrhoea
- Inflammation of the mucosa of the mouth (mucositis)
- Irritated stomach, gullet, intestine
- Inflammation of the colon
- Anorexia, decreased appetite
- High glucose in the blood
- Skin rash, itching, shedding
- Skin colour disorder (do not confuse with jaundice - see below)
- Redness of the skin (erythema)
- Hair loss
- Back and abdominal pain, pain
- Muscle and joint pain
- Abnormal electrical activity in the heart (arrhythmia)
- Inflammation of lung tissue
- Enlarged liver
- Altered organ function
- Blocking of a liver vein (VOD)
- Yellowing of the skin and eyes (jaundice)
- Hearing impaired
- Lymphatic obstruction
- High blood pressure
- Increased liver, renal and digestive enzymes
- Abnormal blood electrolytes
- Weight gain
- Fever, general weakness, chills
- Bleeding (haemorrhage)
- Nasal bleeding
- General swelling due to fluid retention (oedema)
- Pain or inflammation at the injection site
- Eye infection (conjunctivitis)
- Decreased sperm cell count
- Vaginal bleeding
- Absence of menstrual periods (amenorrhea)
- Memory loss
- Delaying in weight and height increase
- Bladder disfunction
- Underproduction of testosterone
- Insufficient production of thyroid hormone
- Deficient activity of the pituitary gland
- Confusional state
- Anxiety, confusion
- Abnormal bulging outward of one of the arteries in the brain (intracranial aneurysm)
- Creatinine elevated
- Allergic reactions
- Occlusion of a blood vessel (embolism)
- Heart rhythm disorder
- Heart inability
- Cardiovascular inability
- Oxygen deficiency
- Fluid accumulation in the lungs (pulmonary oedema)
- Pulmonary bleeding
- Respiratory arrest
- Blood in the urine (haematuria) and moderate renal insufficiency
- Inflammation of the urinary bladder
- Discomfort in urination and decrease in urine output (disuria and oliguria)
- Increase in the amount of nitrogen components in the blood stream (BUN increase)
- Cataract
- Inability of the liver
- Cerebral haemorrhage
- Cough
- Constipation and upset stomach
- Obstruction of the bowel
- Perforation of stomach
- Changes in muscle tone
- Gross lack of coordination of muscle movements
- Bruises due to a low platelet count
- Menopausal symptoms
- Cancer (second primary malignancies)
- Abnormal brain function
- Inflammation and exfoliation of the skin (erythrodermic psoriasis), delirium, nervousness, hallucination, agitation, gastrointestinal ulcer
- Inflammation of the muscular tissue of the heart (myocarditis), abnormal heart condition (cardiomyopathy)
- Male and female infertility
- If any of the side effects gets serious, or if you notice any side effects not mentioned in this leaflet, please tell your doctor or nurse.
- What TEPADINA® contains
- The active substance is thiotepa. One vial contains 15 mg thiotepa. After reconstitution, each ml contains 10 mg thiotepa (10 mg/ml).
- TEPADINA ® does not contain any other ingredients.
- What TEPADINA® looks like and contents of the pack
- TEPADINA® is a white crystalline powder supplied in a glass vial containing 15 mg thiotepa.
- Each carton contains 1 vial.
# Precautions with Alcohol
Alcohol-Thiotepa interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- TEPADINA ®
# Look-Alike Drug Names
There is limited information regarding Thiotepa Look-Alike Drug Names in the drug label.
# Drug Shortage Status
Drug Shortage
# Price | Thiotepa
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Ammu Susheela, M.D. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Thiotepa is an antineoplastic agent that is FDA approved for the treatment of cns lymphoma, multiple myeloma, breast cancer, ovarian cancer, germ cell tumor, thalassemia, leukemia. Common adverse reactions include alopecia, injection site pain, rash, loss of appetite, nausea, vomiting, asthenia, fatigue.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
- The recommended dose in haematological diseases ranges from 125 mg/m2/day (3.38 mg/kg/day) to 300 mg/m2/day (8.10 mg/kg/day) as a single daily infusion, administered from 2 up to 4 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 900 mg/m2 (24.32 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 125 mg/m2/day (3.38 mg/kg/day) to 300 mg/m2/day (8.10 mg/ kg/day) as a single daily infusion, administered from 2 up to 4 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 900 mg/m2 (24.32 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 185 mg/m2/day (5 mg/kg/day) as a single daily infusion, administered for 2 consecutive days before autologous HPCT, without exceeding the total maximum cumulative dose of 370 mg/m2 (10 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 150 mg/m2/day (4.05 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) as a single daily infusion, administered for 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 750 mg/m2 (20.27 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in solid tumours ranges from 120 mg/m2/day (3.24 mg/kg/day) to 250 mg/ m2/day (6.76 mg/kg/day) divided in one or two daily infusions, administered from 2 up to 5 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 800 mg/m2 (21.62 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 120 mg/m2/day (3.24 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) as a single daily infusion, administered from 3 up to 5 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 800 mg/m2 (21.62 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 125 mg/m2/day (3.38 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) divided in one or two daily infusions, administered from 3 up to 4 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 750 mg/m2 (20.27 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 250 mg/m2/day (6.76 mg/kg/day) as a single daily infusion, administered in 2 consecutive days before autologous HPCT, without exceeding the total maximum cumulative dose of 500 mg/m2 (13.51 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 150 mg/m2/day (4.05 mg/kg/day) to 250 mg/m2/day (6.76 mg/ kg/day) as a single daily infusion, administered for 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 750 mg/m2 (20.27 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in haematological diseases ranges from 185 mg/m2/day (5 mg/kg/day) to 481 mg/m2/day (13 mg/kg/day) divided in one or two daily infusions, administered from 1 up to 3 consecutive days before allogeneic HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 555 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in lymphoma is 370 mg/m2/day (10 mg/kg/day) divided in two daily infusions before allogeneic HPCT, without exceeding the total maximum cumulative dose of 370 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
- The recommended dose is 185 mg/m2/day (5 mg/kg/day) as a single daily infusion before allogeneic HPCT, without exceeding the total maximum cumulative dose of 185 mg/m2 (5 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 185 mg/m2/day (5 mg/kg/day) to 481 mg/m2/day (13 mg/kg/day) divided in one or two daily infusions, administered from 1 up to 2 consecutive days before allogeneic HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 555 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 370 mg/m2/day (10 mg/kg/day) divided in two daily infusions, administered before allogeneic HPCT, without exceeding the total maximum cumulative dose of 370 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Thiotepa in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Thiotepa in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
- The recommended dose in solid tumours ranges from 150 mg/m2/day (6 mg/kg/day) to 350 mg/ m2/day (14 mg/kg/day) as a single daily infusion, administered from 2 up to 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 1050 mg/m2 (42 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 250 mg/m2/day (10 mg/kg/day) to 350 mg/m2/day (14 mg/kg/ day) as a single daily infusion, administered for 3 consecutive days before autologous HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 1050 mg/m2 (42 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose in haematological diseases ranges from 125 mg/m2/day (5 mg/kg/day) to 250 mg/ m2/day (10 mg/kg/day) divided in one or two daily infusions, administered from 1 up to 3 consecutive days before allogeneic HPCT depending on the combination with other chemotherapeutic medicinal products, without exceeding the total maximum cumulative dose of 375 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 250 mg/m2/day (10 mg/kg/day) divided in two daily infusions, administered before allogeneic HPCT, without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
- The recommended dose ranges from 200 mg/m2/day (8 mg/kg/day) to 250 mg/m2/day (10 mg/kg/ day) divided in two daily infusions, administered before allogeneic HPCT without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 125 mg/m2/day (5 mg/kg/day) as a single daily infusion, administered for 3 consecutive days before allogeneic HPCT, without exceeding the total maximum cumulative dose of 375 mg/m2 (15 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 125 mg/m2/day (5 mg/kg/day) as a single daily infusion, administered for 2 consecutive days before allogeneic HPCT, without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/kg), during the time of the entire conditioning treatment.
- The recommended dose is 250 mg/m2/day (10 mg/kg/day) divided in two daily infusions, administered before allogeneic HPCT, without exceeding the total maximum cumulative dose of 250 mg/m2 (10 mg/ kg), during the time of the entire conditioning treatment.
- TEPADINA® must be reconstituted with 1.5 ml of sterile water for injections.
- Using a syringe fitted with a needle, aseptically withdraw 1.5 ml of sterile water for injections.
- Inject the content of the syringe into the vial through the rubber stopper.
- Remove the syringe and the needle and mix manually by repeated inversions.
- Only clear colourless solutions, without any particulate matter, must be used.
- The reconstituted solution is hypotonic and must be further diluted prior to administration with 500 ml sodium chloride 9 mg/ml (0.9 %) solution for injection (1000 ml if the dose is higher than 500 mg) or with an appropriate volume of sodium chloride 9 mg/ml (0.9 %) in order to obtain a final TEPADINA®concentration between 0.5 and 1 mg/ml.
- TEPADINA® infusion solution should be inspected visually for particulate matter and opalescence prior to administration. Solutions containing a precipitate should be discarded.
- It is recommended that the infusion solution be administered to patients using an infusion set equipped with a 0.2 µm in-line filter.
- TEPADINA® should be aseptically administered as a 2 - 4 hours infusion under room temperature and normal light conditions.
- Prior to and following each infusion, the indwelling catheter line should be flushed with approximately 5 ml sodium chloride 9 mg/ml (0.9 %) solution for injection.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Thiotepa in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Thiotepa in pediatric patients.
# Contraindications
- Existing hepatic, renal or bone marrow damage (may use low dosage and frequent monitoring if need outweighs risk)
- Hypersensitivity to thiotepa
# Warnings
There is limited information regarding Thiotepa Warnings' in the drug label.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Thiotepa Clinical Trials Experience in the drug label.
## Postmarketing Experience
- Decrease in circulating blood cell counts (intended effect of the medicine to prepare you for your transplant infusion)
- Infection
- Liver disorders including blocking of a liver vein
- The graft attacks your body (graft versus host disease)
- Respiratory complications.
- Increased susceptibility to infection
- Whole-body inflammatory state (sepsis)
- Decreased counts of white blood cells, platelets and red blood cells (anaemia)
- The transplanted cells attack your body (graft versus host disease)
- Dizziness, headache, blurred vision
- Uncontrolled shaking of the body (convulsion)
- Sensation of tingling, pricking or numbness (paraesthesia)
- Partial loss of movement
- Cardiac arrest
- Nausea, vomiting, diarrhea
- Inflammation of the mucosa of the mouth (mucositis)
- Irritated stomach, gullet, intestine
- Inflammation of the liver
- High glucose in the blood
- Skin rash, itching, shedding
- Skin color disorder
- Redness of the skin (erythema)
- Hair loss
- Back and abdominal pain, pain
- Muscle and joint pain
- Abnormal electrical activity in the heart (arrhythmia)
- Inflammation of lung tissue
- Enlarged liver
- Altered organ function
- Blocking of a liver vein (VOD)
- Yellowing of the skin and eyes (jaundice)
- Hearing impaired
- Lymphatic obstruction
- High blood pressure
- Increased liver, renal and digestive enzymes
- Abnormal blood electrolytes
- Weight gain
- Fever, general weakness, chills
- Bleeding (haemorrhage)
- Nasal bleeding
- General swelling due to fluid retention (edema)
- Pain or inflammation at the injection site
- Eye infection (conjunctivitis)
- Decreased sperm cell count
- Vaginal bleeding
- Absence of menstrual periods (amenorrhea)
- Memory loss
- Delaying in weight and height increase
- Bladder disfunction
- Underproduction of testosterone
- Insufficient production of thyroid hormone
- Deficient activity of the pituitary gland
- Confusional state.
# Drug Interactions
There is limited information regarding Thiotepa Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): D
- You must tell your doctor if you are or think you may be pregnant before you receive TEPADINA® . You must not use TEPADINA® during pregnancy.
- Both women and men using TEPADINA® must use effective contraceptive methods during treatment.
- It is not known whether this medicinal product is excreted in breast milk. * As a precautionary measure, women must not breast-feed during treatment with TEPADINA® .
- TEPADINA® can impair male and female fertility. Male patients should seek for sperm preservation before therapy is started and should not father while treated and during the year after cessation of treatment.
Pregnancy Category (AUS): D
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Thiotepa in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Thiotepa during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Thiotepa with respect to nursing mothers.
### Pediatric Use
There is no FDA guidance on the use of Thiotepa with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Thiotepa with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Thiotepa with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Thiotepa with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Thiotepa in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Thiotepa in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Thiotepa in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Thiotepa in patients who are immunocompromised.
### Others
(Description)
# Administration and Monitoring
### Administration
- Oral
### Monitoring
- Blood counts and liver enzymes
# IV Compatibility
There is limited information regarding the compatibility of Thiotepa and IV administrations.
# Overdosage
There is limited information regarding Thiotepa overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
## Mechanism of Action
- Thiotepa is a cytotoxic, ethylenimine-type agent related to nitrogen mustard, which acts by releasing ethylenimine radicals that disrupts DNA bonds and causes the breakage of links between the purine base and sugar, liberating alkylated guanines, resulting in the misreading of the DNA code and the inhibition of DNA, RNA, and protein synthesis in rapidly proliferating tumor cells.
## Structure
(Description with picture)
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Thiotepa in the drug label.
## Pharmacokinetics
- Bioavailability, Oral: incomplete
- Distribution
- Vd: 0.3 to 1.6 L/kg
- Liver
- Metabolite, tepa: active
- Potent inhibitor of CYP2B6
- Renal: less than 2% unchanged; 4.2% as active metabolite
- Total body clearance: 419 to 446 mL/min
- Dialyzable: Yes
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Thiotepa in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Thiotepa in the drug label.
# How Supplied
There is limited information regarding Thiotepa How Supplied in the drug label.
## Storage
- Keep out of the reach and sight of children.
- Do not use TEPADINA® after the expiry date which is stated on the carton and vial label, after EXP. The expiry date refers to the last day of that month.
- Store and transport refrigerated (2 °C - 8 °C).
- Do not freeze.
- After reconstitution the product is stable for 8 hours when stored at 2 °C - 8 °C.
- After dilution the product is stable for 24 hours when stored at 2 °C - 8 °C and for 4 hours when stored at 25 °C. From a microbiological point of view, the product should be used immediately.
- Any unused product or waste material should be disposed of in accordance with local requirements.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
- WHAT TEPADINA® IS AND WHAT IT IS USED FOR
- TEPADINA® contains the active substance thiotepa, which belongs to a group of medicines called alkylating agents.
- TEPADINA® is used to prepare patients for bone marrow transplantation. It works by destroying bone marrow cells. This enables the transplantation of new bone marrow cells (haematopoietic progenitor cells), which in turn enable the body to produce healthy blood cells. TEPADINA® can be used in adults and children.
- BEFORE YOU USE TEPADINA®
- Do not use TEPADINA®
- If you are allergic (hypersensitive) to thiotepa,
- If you are pregnant or think you may be pregnant (see below),
- If you are breast-feeding,
- If you are receiving yellow fever vaccination, live virus and bacterial vaccines.
- Take special care with TEPADINA®
- You should tell your doctor if you have:
- Liver or kidney problems,
- Heart or lung problems,
- Seizures/fits (epilepsy) or have had them in the past (if treated with phenytoin or fosphenytoin).
- You will have to take regular blood tests during treatment to check your blood cell counts.
- You will have to use anti-infectives to prevent and manage infections.
- TEPADINA® may cause another type of cancer in the future. Your doctor will discuss this risk with you.
- You must tell your doctor if you are or think you may be pregnant before you receive TEPADINA® . You must not use TEPADINA® during pregnancy.
- Both women and men using TEPADINA® must use effective contraceptive methods during treatment.
- It is not known whether this medicinal product is excreted in breast milk. * As a precautionary measure, women must not breast-feed during treatment with TEPADINA® .
- TEPADINA® can impair male and female fertility. Male patients should seek for sperm preservation before therapy is started and should not father while treated and during the year after cessation of treatment.
- Please tell your doctor if you are taking or have recently taken any other medicines, including medicines obtained without a prescription.
- HOW TO USE TEPADINA®
- Your doctor will calculate the dose according to your body surface or weight and your disease.
- How TEPADINA® is given
- TEPADINA® is administered by a qualified healthcare professional as an intravenous infusion (drip in a vein) after dilution of the individual vial. * Each infusion will last 2 - 4 hours.
- You will receive your infusions every 12 or 24 hours. The duration of treatment can last up to 3 days. Frequency of administration and duration of treatment depend on your disease.
- POSSIBLE SIDE EFFECTS
- Like all medicines, TEPADINA® can cause side effects, although not everybody gets them.
- The most serious side effects of TEPADINA® therapy or the transplant procedure may include
- Decrease in circulating blood cell counts (intended effect of the medicine to prepare you for your transplant infusion)
- Infection
- Liver disorders including blocking of a liver vein
- The graft attacks your body (graft versus host disease)
- Respiratory complications
- Your doctor will monitor your blood counts and liver enzymes regularly to detect and manage these events.
- Side effects of TEPADINA® may occur with certain frequencies, which are defined as follows:
- Very common
- Affects more than 1 user in 10
- Common
- Affects 1 to 10 users in 100
- Uncommon
- Affects 1 to 10 users in 1,000
- Rare
- Affects 1 to 10 users in 10,000
- Very rare
- Affects less than 1 user in 10,000
- Not known
- Frequency cannot be estimated from the available data.
- Increased susceptibility to infection
- Whole-body inflammatory state (sepsis)
- Decreased counts of white blood cells, platelets and red blood cells (anaemia)
- The transplanted cells attack your body (graft versus host disease)
- Dizziness, headache, blurred vision
- Uncontrolled shaking of the body (convulsion)
- Sensation of tingling, pricking or numbness (paraesthesia)
- Partial loss of movement
- Cardiac arrest
- Nausea, vomiting, diarrhoea
- Inflammation of the mucosa of the mouth (mucositis)
- Irritated stomach, gullet, intestine
- Inflammation of the colon
- Anorexia, decreased appetite
- High glucose in the blood
- Skin rash, itching, shedding
- Skin colour disorder (do not confuse with jaundice - see below)
- Redness of the skin (erythema)
- Hair loss
- Back and abdominal pain, pain
- Muscle and joint pain
- Abnormal electrical activity in the heart (arrhythmia)
- Inflammation of lung tissue
- Enlarged liver
- Altered organ function
- Blocking of a liver vein (VOD)
- Yellowing of the skin and eyes (jaundice)
- Hearing impaired
- Lymphatic obstruction
- High blood pressure
- Increased liver, renal and digestive enzymes
- Abnormal blood electrolytes
- Weight gain
- Fever, general weakness, chills
- Bleeding (haemorrhage)
- Nasal bleeding
- General swelling due to fluid retention (oedema)
- Pain or inflammation at the injection site
- Eye infection (conjunctivitis)
- Decreased sperm cell count
- Vaginal bleeding
- Absence of menstrual periods (amenorrhea)
- Memory loss
- Delaying in weight and height increase
- Bladder disfunction
- Underproduction of testosterone
- Insufficient production of thyroid hormone
- Deficient activity of the pituitary gland
- Confusional state
- Anxiety, confusion
- Abnormal bulging outward of one of the arteries in the brain (intracranial aneurysm)
- Creatinine elevated
- Allergic reactions
- Occlusion of a blood vessel (embolism)
- Heart rhythm disorder
- Heart inability
- Cardiovascular inability
- Oxygen deficiency
- Fluid accumulation in the lungs (pulmonary oedema)
- Pulmonary bleeding
- Respiratory arrest
- Blood in the urine (haematuria) and moderate renal insufficiency
- Inflammation of the urinary bladder
- Discomfort in urination and decrease in urine output (disuria and oliguria)
- Increase in the amount of nitrogen components in the blood stream (BUN increase)
- Cataract
- Inability of the liver
- Cerebral haemorrhage
- Cough
- Constipation and upset stomach
- Obstruction of the bowel
- Perforation of stomach
- Changes in muscle tone
- Gross lack of coordination of muscle movements
- Bruises due to a low platelet count
- Menopausal symptoms
- Cancer (second primary malignancies)
- Abnormal brain function
- Inflammation and exfoliation of the skin (erythrodermic psoriasis), delirium, nervousness, hallucination, agitation, gastrointestinal ulcer
- Inflammation of the muscular tissue of the heart (myocarditis), abnormal heart condition (cardiomyopathy)
- Male and female infertility
- If any of the side effects gets serious, or if you notice any side effects not mentioned in this leaflet, please tell your doctor or nurse.
- What TEPADINA® contains
- The active substance is thiotepa. One vial contains 15 mg thiotepa. After reconstitution, each ml contains 10 mg thiotepa (10 mg/ml).
- TEPADINA ® does not contain any other ingredients.
- What TEPADINA® looks like and contents of the pack
- TEPADINA® is a white crystalline powder supplied in a glass vial containing 15 mg thiotepa.
- Each carton contains 1 vial.
# Precautions with Alcohol
Alcohol-Thiotepa interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- TEPADINA ®[1]
# Look-Alike Drug Names
There is limited information regarding Thiotepa Look-Alike Drug Names in the drug label.
# Drug Shortage Status
Drug Shortage
# Price | https://www.wikidoc.org/index.php/Thiotepa | |
2b1bbfc34108b7cccc0484f3236f95c52c7d7b99 | wikidoc | Thymosin | Thymosin
Thymosin is an actin-binding protein in cells.
The predominant form of thymosin, thymosin β4, is a member of a highly conserved family of actin monomer-sequestering proteins. β-thymosins are the primary regulators of unpolymerized actin, and are essential for maintaining the small cytoplasmic pool of free G-actin monomers required for rapid filament elongation and allowing for the flux of monomers between the thymosin-bound pool and F-actin (Dedova et.al., 2006).
Thymosin β4 sequesters actin, holding it in a form that is unable to polymerize. Due to its profusion in the cytosol and its ability to bind ATP G-actin but not F-actin, thymosin β4 is regarded as the principal actin-sequestering protein. Tβ4 binds ATP G- monomeric actin in a 1:1 complex where G-actin cannot polymerize. Thymosin β4 (Tβ4) functions like a buffer for monomeric actin as represented in the following reaction (Lodish et al., 2000):
F-actin G-actin + Tβ4 G-actin/Tβ4
Increase in cytosolic concentrations of thymosin β4 increases the concentration of sequestered actin subunits and correspondingly decreases F-actin due to actin filaments being in equilibrium with actin monomers (Lodish et al., 2000).
Furthermore, the inhibitory thymosin which sequesters the actin competes for monomers with profilin.
Actin monomers preferentially bind to either ATP or ADP and both forms of G-actin are capable of polymerization. The affinities of ATP-G-actin and ADP-G-actin monomers for thymosin and profilin vary significantly. Both profilin and thymosin β4 bind ATP monomers with higher affinity than ADP monomers; however, binding by thymosin is preferred over profilin-binding. This affinity for ATP monomers ensures that the pool of unpolymerized actin consists almost entirely of ATP-G-actin with no significant amount of ADP-G-actin in the thymosin-sequestered pool (Atkinson et al., 2004).
Release of ATP-actin monomers from thymosin β4 occurs as part of the mechanism that drives rapid actin polymerization in the normal function of the cytoskeleton in cell morphology and cell motility. Thymosin maintains the bulk of the monomer pool due to its abundance and high affinity for ATP monomers. Maintenance of a high concentration of available monomers at nuclei or filament barbed ends is necessary for rapid actin polymerization. The low affinity of the interaction between ADP monomers and thymosin is necessary to allow monomers to be handed on so that catalysis of nucleotide exchange by profilin regenerates ATP monomers for rapid addition onto filament barbed ends (Atkinson et al., 2004).
Figure 1: Thymosin and profilin regulation of polymerization
In Figure 1, thymosin β4 and profilin serve complementary roles in regulating the polymerization of G-actin. (a) Profilin is bound to PIP2, a membrane lipid, at the cell membrane while the majority of G-actin is bound in a complex with thymosin β4 and thus unable to polymerize. (b) In response to an extracellular signal, such as chemotactic molecules that stimulate actin assembly, profilin is released from the membrane by the hydrolysis of PIP2. The released profilin displaces thymosin β4, forming profilin G-actin complexes that can assemble into filaments. (c) The profilin-actin complexes interact with proline-rich proteins in the membrane, where profilin adds actin monomers to the (+) end of actin filaments. (d) Eventually, the incorporation of monomers into filaments depletes the pools of profilin-actin and thymosin β4 actin complexes. ADP G-actin subunits that have dissociated from a filament are converted into ATP G-actin by profilin, thus helping to replenish the cytoplasmic pool of ATP G-actin (Lodish et al., 2000).
Figure 2: Thymosin and profilin competition
In Figure 2, the effect of thymosin and profilin on actin polymerization is shown. When thymosin binds to an actin monomer it sterically prevents further binding to and elongation of the plus end of the actin filament. In contrast, when profilin binds to an actin monomer the filament is still capable of elongating. As thymosin and profilin cannot both bind to a single actin monomer at the same time, there is competition between the inhibitory thymosin and the profilin. Generally a majority of actin monomer is thymosin-bound, thus the activation of a small amount of profilin produces rapid filament assembly. Profilin binds to actin monomers that are temporarily released from the thymosin-bound monomer pool, shuttles them onto the plus ends of actin filaments, and is then released and recycled for further rounds of filament elongation (Alberts et al., 2002).
Therefore, the polymerization of actin is controlled by the give and take between thymosin and profilin. Thymosin basically acts in an inhibitory fashion and interacts with the G-actin monomer and interferes with conformations (ATP and ADP bound forms) to control the assembly of microfilaments.
The promise of repairing sun parched aging skin is alluring, especially if damage control may be attained by applying a substance that is abundant in our body. Thymosin beta 4 (Tb4), a molecule that accelerates wound healing in animals and cultured cells, "may be valuable in repairing skin damage caused by sun or even by the wear and tear of aging?" This hopeful message of Tb4's potential to restore damaged human skin was voiced at the 5th International Symposium on Aging Skin, in California (May 2001), by Dr. Allan Goldstein, Chairman of the Biochemistry Department at George Washington University and founder of RegeneRX Biopharmaceuticals. RegeneRX is carrying out preclinical research on Tb4 as a wound healer, in collaboration with scientists at the National Institutes of Health.
Skin is the largest organ of the body, which makes up 16% of total body weight. It is also the largest organ that provides immune protection and plays a role in inflammation. Composed of specialized epithelial and connective tissue cells, skin is our major interface with the environment, a shield from the outside world and a means of interacting with it. As such, the skin is subjected to insults and injuries: burns from the sun’s ultraviolet radiation that elicit inflammatory reactions, damage from environmental pollutants and wear and tear that comes with aging.
Thymosin beta 4 accelerated skin wound healing in a rat model of a full thickness wound where the epithelial layer was destroyed. When Tb4 was applied topically to the wound or injected into the animal, epithelial layer restoration in the wound was increased 42% by day four and 61% by day seven, after treatment, compared to untreated. Furthermore, Tb4 stimulated collagen deposition in the wound and angiogenesis. Tb4 accelerated keratinocyte migration, resulting in the wound contracting by more than 11%, compared to untreated wounds, to close the skin gap in the wound. An analysis of skin sections (histological observations) showed that the Tb4 treated wounds healed faster than the untreated. Proof of accelerated cell migration was also seen in vitro, where Tb4 increased keratinocyte migration two to threefold, within four to five hours after treatment, compared to untreated keratinocytes.
A critical step in wound healing is angiogenesis. New vessels are needed to supply nutrients and oxygen to the cells involved in repair, to remove toxic materials and debris of dead cells and generate optimal conditions for new tissue formation. Another important step is the directional migration of cells into the injured area, joining up to repair the wound. This requires an attractant that will direct the cells to the wound and propel them to the site. These critical steps in wound healing are regulated by beta 4, as seen in the following experiments. | Thymosin
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Thymosin is an actin-binding protein in cells.
The predominant form of thymosin, thymosin β4, is a member of a highly conserved family of actin monomer-sequestering proteins. β-thymosins are the primary regulators of unpolymerized actin, and are essential for maintaining the small cytoplasmic pool of free G-actin monomers required for rapid filament elongation and allowing for the flux of monomers between the thymosin-bound pool and F-actin (Dedova et.al., 2006).
Thymosin β4 sequesters actin, holding it in a form that is unable to polymerize. Due to its profusion in the cytosol and its ability to bind ATP G-actin but not F-actin, thymosin β4 is regarded as the principal actin-sequestering protein. Tβ4 binds ATP G- monomeric actin in a 1:1 complex where G-actin cannot polymerize. Thymosin β4 (Tβ4) functions like a buffer for monomeric actin as represented in the following reaction (Lodish et al., 2000):
F-actin <-> G-actin + Tβ4 <-> G-actin/Tβ4
Increase in cytosolic concentrations of thymosin β4 increases the concentration of sequestered actin subunits and correspondingly decreases F-actin due to actin filaments being in equilibrium with actin monomers (Lodish et al., 2000).
Furthermore, the inhibitory thymosin which sequesters the actin competes for monomers with profilin.
Actin monomers preferentially bind to either ATP or ADP and both forms of G-actin are capable of polymerization. The affinities of ATP-G-actin and ADP-G-actin monomers for thymosin and profilin vary significantly. Both profilin and thymosin β4 bind ATP monomers with higher affinity than ADP monomers; however, binding by thymosin is preferred over profilin-binding. This affinity for ATP monomers ensures that the pool of unpolymerized actin consists almost entirely of ATP-G-actin with no significant amount of ADP-G-actin in the thymosin-sequestered pool (Atkinson et al., 2004).
Release of ATP-actin monomers from thymosin β4 occurs as part of the mechanism that drives rapid actin polymerization in the normal function of the cytoskeleton in cell morphology and cell motility. Thymosin maintains the bulk of the monomer pool due to its abundance and high affinity for ATP monomers. Maintenance of a high concentration of available monomers at nuclei or filament barbed ends is necessary for rapid actin polymerization. The low affinity of the interaction between ADP monomers and thymosin is necessary to allow monomers to be handed on so that catalysis of nucleotide exchange by profilin regenerates ATP monomers for rapid addition onto filament barbed ends (Atkinson et al., 2004).
Figure 1: Thymosin and profilin regulation of polymerization
In Figure 1, thymosin β4 and profilin serve complementary roles in regulating the polymerization of G-actin. (a) Profilin is bound to PIP2, a membrane lipid, at the cell membrane while the majority of G-actin is bound in a complex with thymosin β4 and thus unable to polymerize. (b) In response to an extracellular signal, such as chemotactic molecules that stimulate actin assembly, profilin is released from the membrane by the hydrolysis of PIP2. The released profilin displaces thymosin β4, forming profilin G-actin complexes that can assemble into filaments. (c) The profilin-actin complexes interact with proline-rich proteins in the membrane, where profilin adds actin monomers to the (+) end of actin filaments. (d) Eventually, the incorporation of monomers into filaments depletes the pools of profilin-actin and thymosin β4 actin complexes. ADP G-actin subunits that have dissociated from a filament are converted into ATP G-actin by profilin, thus helping to replenish the cytoplasmic pool of ATP G-actin (Lodish et al., 2000).
Figure 2: Thymosin and profilin competition
In Figure 2, the effect of thymosin and profilin on actin polymerization is shown. When thymosin binds to an actin monomer it sterically prevents further binding to and elongation of the plus end of the actin filament. In contrast, when profilin binds to an actin monomer the filament is still capable of elongating. As thymosin and profilin cannot both bind to a single actin monomer at the same time, there is competition between the inhibitory thymosin and the profilin. Generally a majority of actin monomer is thymosin-bound, thus the activation of a small amount of profilin produces rapid filament assembly. Profilin binds to actin monomers that are temporarily released from the thymosin-bound monomer pool, shuttles them onto the plus ends of actin filaments, and is then released and recycled for further rounds of filament elongation (Alberts et al., 2002).
Therefore, the polymerization of actin is controlled by the give and take between thymosin and profilin. Thymosin basically acts in an inhibitory fashion and interacts with the G-actin monomer and interferes with conformations (ATP and ADP bound forms) to control the assembly of microfilaments.
The promise of repairing sun parched aging skin is alluring, especially if damage control may be attained by applying a substance that is abundant in our body. Thymosin beta 4 (Tb4), a molecule that accelerates wound healing in animals and cultured cells, "may be valuable in repairing skin damage caused by sun or even by the wear and tear of aging?" This hopeful message of Tb4's potential to restore damaged human skin was voiced at the 5th International Symposium on Aging Skin, in California (May 2001), by Dr. Allan Goldstein, Chairman of the Biochemistry Department at George Washington University and founder of RegeneRX Biopharmaceuticals. RegeneRX is carrying out preclinical research on Tb4 as a wound healer, in collaboration with scientists at the National Institutes of Health.
Skin is the largest organ of the body, which makes up 16% of total body weight. It is also the largest organ that provides immune protection and plays a role in inflammation. Composed of specialized epithelial and connective tissue cells, skin is our major interface with the environment, a shield from the outside world and a means of interacting with it. As such, the skin is subjected to insults and injuries: burns from the sun’s ultraviolet radiation that elicit inflammatory reactions, damage from environmental pollutants and wear and tear that comes with aging.
Thymosin beta 4 accelerated skin wound healing in a rat model of a full thickness wound where the epithelial layer was destroyed. When Tb4 was applied topically to the wound or injected into the animal, epithelial layer restoration in the wound was increased 42% by day four and 61% by day seven, after treatment, compared to untreated. Furthermore, Tb4 stimulated collagen deposition in the wound and angiogenesis. Tb4 accelerated keratinocyte migration, resulting in the wound contracting by more than 11%, compared to untreated wounds, to close the skin gap in the wound. An analysis of skin sections (histological observations) showed that the Tb4 treated wounds healed faster than the untreated. Proof of accelerated cell migration was also seen in vitro, where Tb4 increased keratinocyte migration two to threefold, within four to five hours after treatment, compared to untreated keratinocytes.
A critical step in wound healing is angiogenesis. New vessels are needed to supply nutrients and oxygen to the cells involved in repair, to remove toxic materials and debris of dead cells and generate optimal conditions for new tissue formation. Another important step is the directional migration of cells into the injured area, joining up to repair the wound. This requires an attractant that will direct the cells to the wound and propel them to the site. These critical steps in wound healing are regulated by beta 4, as seen in the following experiments. | https://www.wikidoc.org/index.php/Thymosin | |
6587d1a1118ff996e5c48e2d0872a9f7b787cdbf | wikidoc | Thymulin | Thymulin
Thymulin (also known as Thymic Factor or under its old name Facteur Thymique Serique) is a nonapeptide produced by two distinct epithelial populations in the thymus first described by Bach in 1977. It requires zinc for biological activity.
The hormon is believed to be involved in T-cell differentiation and enhancement of T and NK cell actions. Besides this rather paracrine or auto-organic effects on the thymus dependent immune system, Thymulin seems to have neuroendocrine effects as well. There exist bidirectional interactions between thymic epithelium and the hypothalamus-pituitary axis (for example, thymulin follows a circadian rhythm and physiologically elevated ACTH levels correlate positively with thymulin plasma levels and vice versa).
A recent focus has been on the role of thymulin as an effector on proinflammatory mediators/cytokines. A peptide analogue of thymulin (PAT) has been found to have analgesic effects in higher concentrations and particularly neuroprotective anti-inflammatory effects in the CNS.
Astrocytes seem to be the target for thymulin for this effect. Researchers hopes to develop drugs thwarting inflammatory processes associated with neurodegenerative diseases and even rheumatism with the help of thymulin analoga.
Moreover, thymulin has been associated with anorexia nervosa. | Thymulin
Template:Chembox new
Thymulin (also known as Thymic Factor or under its old name Facteur Thymique Serique) is a nonapeptide produced by two distinct epithelial populations in the thymus first described by Bach in 1977.[1] It requires zinc for biological activity.
The hormon is believed to be involved in T-cell differentiation and enhancement of T and NK cell actions.[1] Besides this rather paracrine or auto-organic effects on the thymus dependent immune system, Thymulin seems to have neuroendocrine effects as well. There exist bidirectional interactions between thymic epithelium and the hypothalamus-pituitary axis (for example, thymulin follows a circadian rhythm and physiologically elevated ACTH levels correlate positively with thymulin plasma levels and vice versa[2]).
A recent focus has been on the role of thymulin as an effector on proinflammatory mediators/cytokines. A peptide analogue of thymulin (PAT) has been found to have analgesic effects in higher concentrations and particularly neuroprotective anti-inflammatory effects in the CNS.[3]
Astrocytes seem to be the target for thymulin for this effect. Researchers hopes to develop drugs thwarting inflammatory processes associated with neurodegenerative diseases and even rheumatism with the help of thymulin analoga.
Moreover, thymulin has been associated with anorexia nervosa.[4] | https://www.wikidoc.org/index.php/Thymulin | |
829716f93b09dab7c40b69da8992be87d6edf84e | wikidoc | Tiapride | Tiapride
# Overview
Tiapride is a drug that selectively blocks D2 and D3 dopamine receptors in the brain. It is used to treat a variety of neurological and psychiatric disorders including dyskinesia, alcohol withdrawal syndrome, negative symptoms of psychosis, and agitation and aggression in the elderly. A derivative of benzamide, tiapride is chemically and functionally similar to other benzamide antipsychotics such as sulpiride and amisulpride known for their dopamine antagonist effects.
# Medical uses
## Alcoholism
Research in animal models and clinical studies in alcoholic patients have found that tiapride has anxiolytic effects. Dopamine hyperactivity has been linked with alcohol withdrawal syndrome (AWS), suggesting that tiapride's antidopaminergic effects are the most likely mechanism for its clinical efficacy, although others believe some other mechanism might be involved. Alcoholic patients treated with tiapride at a dosage of 300 mg/day reported reduced psychological distress and improved abstinence from alcohol. In another study in which alcoholic patients were given titrated doses up to 800 mg/day, subjects showed significant improvements in ratigns of withdrawal, craving, psychiatric symptoms and quality of life.
While tiapride does not affect positive symptoms of psychosis such as hallucinosis or delirium sometimes manifested in alcohol withdrawal syndrome, if combined with a drug such as carbamazepine that addresses those symptoms, it is ideal for treating alcohol dependency because its metabolism does not depend on liver function and it has low potential for abuse. This sets it apart from the benzodiazepines, which are contraindicated with alcohol and can be addictive. Moreover, tiapride's rapid onset makes intravenous or intramuscular injection prior to or during withdrawal episodes particularly effective.
## Agitation and aggression
Agitation and aggression are also associated with hyperdopaminergic activity. Antipsychotic drugs are the most common treatment for these symptoms, but often come with a host of side-effects including orthostatic hypotension and deficits in vigilance and attention. One clinical study in agitated elderly patients compared the effects of tiapride, haloperidol and placebo and found that while the two drugs had comparable efficacy superior to the placebo effect, tiapride had fewer and less severe side effects than haloperidol.
Tiapride's selectivity for the limbic system, which is associated with emotion, could underlie its particular efficacy in treating these affective disorders. Moreover, its selectivity for the dopaminergic system is thought to account for its avoidance of the side effects typically associated with other neuroleptic drugs, such as chlorpromazine, which act on a number of neurotransmitter systems.
## Movement disorders
While tiapride preferentially targets the limbic system over the striatum, its moderate antagonistic effect on striatal dopamine receptors makes it effective in treating motor deficits that involve this area, such as tardive dyskinesia and chorea. Tiapride's moderate efficacy at D2 receptors may explain why it is able to treat motor symptoms without the extrapyramidal symptoms caused by excess dopamine blockage, which are sometimes seen in haloperidol or chlorpromazine. One clinical study of patients with tardive dyskinesia associated with Parkinson's disease found that tiapride significantly improved motor abilities without affecting other parkinsonian symptoms.
# Side effects
Although it is considered a "safe" medicine, it is, like sulpiride, strictly contraindicated for patients under the age of 18 due to its effects during the process of puberty. This is likely related to its side effects on levels of the hormone prolactin, which is involved in sexual development. There are also insufficient clinical data on the other side effects in adolescents.
Tiapride has been found to cause excess prolactin levels in plasma, which can cause decreased libido, infertility and increased risk of breast cancer. This is because dopamine plays a primary role in regulating prolactin release by binding to D2 receptors on prolactin-secreting cells in the anterior pituitary. Thus, when tiapride blocks these receptors these cells are disinhibited and release more prolactin.
The side-effect reported most commonly to the U.S. Food and Drug Administration (FDA) is rhabdomyolysis, a condition characterized by muscle tissue breakdown. Cardiac abnormalities such as prolongation of the QT interval and torsades de pointes have also been observed.
Dosages above approximately 300 mg/day risk inducing tardive dyskinesia. However, given the drug's fairly wide window of tolerable doses, dosages can often be titrated to obtain the desired effect without bringing about motor deficits. In general, tiapride is considered an atypical antipsychotic because of its low risk for extrapyramidal symptoms, such as akinesia and akathesia. These effects are thought to be reduced in tiapride relative to typical antipsychotics because of its selectivity for the limbic system over extrapyramidal areas that control movement.
# Pharmacodynamics
Tiapride is a dopamine D2 and D3 receptor antagonist. It is more selective than other neuroleptic drugs such as haloperidol and risperidone, which not only target four of the five known dopamine receptor subtypes (D1-4), but also block serotonin (5-HT2A, 2C), α1- and α2-adrenergic, and histamine H1 receptors. Compared to these drugs, tiapride has a relatively moderate affinity for its target receptors, displacing 50 percent of 3H-raclopride binding at a concentration of 320 nM at D2 receptors and a concentration of 180 nM at D3 receptors.
Tiapride displays a relatively high regional selectivity for limbic areas. One study found that, in contrast with haloperidol, which displays equal affinity for receptors in the rat limbic system and striatum, tiapride shows over three times as much affinity for limbic areas than striatal areas. Another study in rats found tiapride's affinity for the septum, a limbic region, to be over thirty times as high as for the striatum.
Efficacy at the D2 receptor is moderate, with 80 percent of receptors occupied even in the presence of excess tiapride concentrations.
# Pharmacokinetics
Tiapride is primarily taken orally in the form of a tablet, but can also be administered via intravenous or intramuscular injection. A liquid oral formulation is also available for elderly patients with difficulty chewing solids. For all three methods of administration, the bioavailability of tiapride is approximately 75 percent. Peak plasma concentrations are attained between 0.4 and 1.5 hours following administration, and steady-state concentrations achieved 24 to 48 hours after beginning administration 3 times a day. It distributes rapidly and exhibits virtually no binding to plasma proteins, giving it a relatively high volume of distribution. Benzamide and its derivatives are highly water soluble, and because of their polarity are believed to cross the blood-brain barrier via carrier-mediated transport. Elimination of tiapride, mostly in its original form, occurs through renal excretion with a half-life of 3 to 4 hours.
Recommended dosages of tiapride vary with clinical symptoms. In alcoholic patients, delirium or pre-delirium associated with alcohol withdrawal can be alleviated by administration of 400–1200 mg/day or up to 1800 mg/day if necessary. Tremors and other dyskinsias can be treated with 300–800 mg/day. For reducing agitation and aggression in elderly patients, 200–300 mg/day is recommended.
# Availability
Tiapride is marketed under various trade names and is widely available outside of the United States. The most common trade name for tiapride is Tiapridal, which is used throughout Europe as well as parts of South America, the Middle East, and North Africa. It is also sold under different names in Italy (Italprid, Sereprile), Japan (Tialaread, Tiaryl, Tiaprim, Tiaprizal), Chile (Sereprid), Germany (Tiaprid, Tiapridex), and China (Tiapride). | Tiapride
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Tiapride is a drug that selectively blocks D2 and D3 dopamine receptors in the brain. It is used to treat a variety of neurological and psychiatric disorders including dyskinesia, alcohol withdrawal syndrome, negative symptoms of psychosis, and agitation and aggression in the elderly.[1] A derivative of benzamide, tiapride is chemically and functionally similar to other benzamide antipsychotics such as sulpiride and amisulpride known for their dopamine antagonist effects.
# Medical uses
## Alcoholism
Research in animal models and clinical studies in alcoholic patients have found that tiapride has anxiolytic effects. Dopamine hyperactivity has been linked with alcohol withdrawal syndrome (AWS), suggesting that tiapride's antidopaminergic effects are the most likely mechanism for its clinical efficacy,[2] although others believe some other mechanism might be involved.[3] Alcoholic patients treated with tiapride at a dosage of 300 mg/day reported reduced psychological distress and improved abstinence from alcohol.[3] In another study in which alcoholic patients were given titrated doses up to 800 mg/day, subjects showed significant improvements in ratigns of withdrawal, craving, psychiatric symptoms and quality of life.[2]
While tiapride does not affect positive symptoms of psychosis such as hallucinosis or delirium sometimes manifested in alcohol withdrawal syndrome, if combined with a drug such as carbamazepine that addresses those symptoms, it is ideal for treating alcohol dependency because its metabolism does not depend on liver function and it has low potential for abuse.[2] This sets it apart from the benzodiazepines, which are contraindicated with alcohol and can be addictive.[3] Moreover, tiapride's rapid onset makes intravenous or intramuscular injection prior to or during withdrawal episodes particularly effective.[2]
## Agitation and aggression
Agitation and aggression are also associated with hyperdopaminergic activity. Antipsychotic drugs are the most common treatment for these symptoms, but often come with a host of side-effects including orthostatic hypotension and deficits in vigilance and attention. One clinical study in agitated elderly patients compared the effects of tiapride, haloperidol and placebo and found that while the two drugs had comparable efficacy superior to the placebo effect, tiapride had fewer and less severe side effects than haloperidol.[4]
Tiapride's selectivity for the limbic system, which is associated with emotion, could underlie its particular efficacy in treating these affective disorders. Moreover, its selectivity for the dopaminergic system is thought to account for its avoidance of the side effects typically associated with other neuroleptic drugs, such as chlorpromazine, which act on a number of neurotransmitter systems.[1]
## Movement disorders
While tiapride preferentially targets the limbic system over the striatum, its moderate antagonistic effect on striatal dopamine receptors makes it effective in treating motor deficits that involve this area, such as tardive dyskinesia and chorea. Tiapride's moderate efficacy at D2 receptors[5] may explain why it is able to treat motor symptoms without the extrapyramidal symptoms caused by excess dopamine blockage, which are sometimes seen in haloperidol or chlorpromazine. One clinical study of patients with tardive dyskinesia associated with Parkinson's disease found that tiapride significantly improved motor abilities without affecting other parkinsonian symptoms.[6]
# Side effects
Although it is considered a "safe" medicine, it is, like sulpiride, strictly contraindicated for patients under the age of 18 due to its effects during the process of puberty. This is likely related to its side effects on levels of the hormone prolactin, which is involved in sexual development.[7] There are also insufficient clinical data on the other side effects in adolescents.
Tiapride has been found to cause excess prolactin levels in plasma,[6] which can cause decreased libido, infertility and increased risk of breast cancer.[8] This is because dopamine plays a primary role in regulating prolactin release by binding to D2 receptors on prolactin-secreting cells in the anterior pituitary.[9] Thus, when tiapride blocks these receptors these cells are disinhibited and release more prolactin.
The side-effect reported most commonly to the U.S. Food and Drug Administration (FDA) is rhabdomyolysis, a condition characterized by muscle tissue breakdown.[10] Cardiac abnormalities such as prolongation of the QT interval and torsades de pointes have also been observed.[8]
Dosages above approximately 300 mg/day risk inducing tardive dyskinesia.[3] However, given the drug's fairly wide window of tolerable doses,[1] dosages can often be titrated to obtain the desired effect without bringing about motor deficits. In general, tiapride is considered an atypical antipsychotic because of its low risk for extrapyramidal symptoms, such as akinesia and akathesia. These effects are thought to be reduced in tiapride relative to typical antipsychotics because of its selectivity for the limbic system over extrapyramidal areas that control movement.[1]
# Pharmacodynamics
Tiapride is a dopamine D2 and D3 receptor antagonist. It is more selective than other neuroleptic drugs such as haloperidol and risperidone, which not only target four of the five known dopamine receptor subtypes (D1-4), but also block serotonin (5-HT2A, 2C), α1- and α2-adrenergic, and histamine H1 receptors.[1] Compared to these drugs, tiapride has a relatively moderate affinity for its target receptors, displacing 50 percent of 3H-raclopride binding at a concentration of 320 nM at D2 receptors and a concentration of 180 nM at D3 receptors.
Tiapride displays a relatively high regional selectivity for limbic areas. One study found that, in contrast with haloperidol, which displays equal affinity for receptors in the rat limbic system and striatum, tiapride shows over three times as much affinity for limbic areas than striatal areas.[1] Another study in rats found tiapride's affinity for the septum, a limbic region, to be over thirty times as high as for the striatum.[11]
Efficacy at the D2 receptor is moderate, with 80 percent of receptors occupied even in the presence of excess tiapride concentrations.[5]
# Pharmacokinetics
Tiapride is primarily taken orally in the form of a tablet, but can also be administered via intravenous or intramuscular injection.[3] A liquid oral formulation is also available for elderly patients with difficulty chewing solids.[12] For all three methods of administration, the bioavailability of tiapride is approximately 75 percent. Peak plasma concentrations are attained between 0.4 and 1.5 hours following administration, and steady-state concentrations achieved 24 to 48 hours after beginning administration 3 times a day. It distributes rapidly and exhibits virtually no binding to plasma proteins, giving it a relatively high volume of distribution. Benzamide and its derivatives are highly water soluble, and because of their polarity are believed to cross the blood-brain barrier via carrier-mediated transport.[13] Elimination of tiapride, mostly in its original form, occurs through renal excretion with a half-life of 3 to 4 hours.[3]
Recommended dosages of tiapride vary with clinical symptoms. In alcoholic patients, delirium or pre-delirium associated with alcohol withdrawal can be alleviated by administration of 400–1200 mg/day or up to 1800 mg/day if necessary. Tremors and other dyskinsias can be treated with 300–800 mg/day. For reducing agitation and aggression in elderly patients, 200–300 mg/day is recommended.[3]
# Availability
Tiapride is marketed under various trade names and is widely available outside of the United States. The most common trade name for tiapride is Tiapridal, which is used throughout Europe as well as parts of South America, the Middle East, and North Africa. It is also sold under different names in Italy (Italprid, Sereprile), Japan (Tialaread, Tiaryl, Tiaprim, Tiaprizal), Chile (Sereprid), Germany (Tiaprid, Tiapridex), and China (Tiapride).[14] | https://www.wikidoc.org/index.php/Tiapride | |
5fda6b3f0ef415551241d6c29657b0cf36fb2930 | wikidoc | Tilidine | Tilidine
# Overview
Tilidine (INN, USAN), or tilidate (BAN) (brand names: Tilidin, Valoron and Valtran) is a synthetic opioid painkiller, used mainly in Germany, Switzerland, South Africa and Belgium for treatment of moderate to severe pain, both acute and chronic. Its onset of pain relief after oral administration is about 10–15 minutes and peak relief from pain occurs about 25–50 minutes after oral administration.
Never having been in medical use there, Tilidine is a Schedule I Narcotic controlled substance in the United States, having an ACSCN of 9750 and an annual aggregate manufacturing quota of 10 grammes in 2013.
# Medical uses
Tilidine is used in the form of hydrochloride or phosphate salt. In Germany, tilidine is available in a fixed combination with naloxone for oral administration (Valoron N and generics); the mixture of naloxone is claimed to lower the abuse liability of the opioid analgesic. This is so that if people take the medication orally (which is the way they are meant to) the opioid blocker, naloxone, has minimal effects on them but if they inject it the naloxone becomes bioavailable and hence antagonises the effects of the tilidine producing withdrawal effects. In Switzerland the original Valoron brand with only tilidine and no naloxone is also available.
As well as its use as an analgesic, tilidine is also commonly used in Germany for treatment of restless legs syndrome.
# Adverse effects
Its most common adverse effects are transient nausea and vomiting, dizziness, drowsiness, fatigue, headache and nervousness; less commonly, nausea and vomiting (after repeated dosing), hallucinations, confusion, euphoria, tremor, hyperreflexia, clonus and increased sweating. Uncommonly, somnolence; rarely, diarrhoea and abdominal pain.
# Physicochemistry
It usually comes in its hydrochloride hemihydrate salt form; in this form it is highly soluble in water, ethanol and dichloromethane and appears as a white/almost white crystalline powder. Its storage is restricted by its insensitivity to light and sensitivity to degradation by oxygen, hence necessitating its storage in amber bottles and at temperatures below 30 degrees Celsius, respectively.
# Pharmacology
Considered a low- to medium-potency opioid, tilidine has the oral potency of about 0.2, that is, a dose of 100 mg p.o. is equianalgesic to approximately 20 mg morphine sulfate orally. It is administered orally (by mouth), rectally (by a suppository), or by injection (SC, IM or slowly IV) with single doses of 50 to 100 mg, the maximal daily dose being up to 600 mg.
Tilidine itself is only a weak opioid, but is rapidly metabolised in the liver and gut to its active metabolite nortilidine and then to bisnortilidine. It is the (1S,2R)-isomer that is responsible for its analgesic activity.
# Synthesis
It is manufactured by a Diels-Alder reaction of 1-N,N-dimethylaminobuta-1,3-diene with ethyl atropate, yielding a mixture of isomers, of which only the (E)-(trans)-isomers are active and are separated subsequently from the mixture by precipitation of the inactive (Z)-(cis)-isomers as zinc complex. The inactive (Z)-(cis)-isomers may be epimerized to the more thermodynamically favoured (E)-(trans)-isomers via reflux in diluted phosphoric acid. | Tilidine
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Tilidine (INN, USAN), or tilidate (BAN) (brand names: Tilidin, Valoron and Valtran) is a synthetic opioid painkiller, used mainly in Germany, Switzerland, South Africa and Belgium for treatment of moderate to severe pain, both acute and chronic.[3] Its onset of pain relief after oral administration is about 10–15 minutes and peak relief from pain occurs about 25–50 minutes after oral administration.[1]
Never having been in medical use there, Tilidine is a Schedule I Narcotic controlled substance in the United States, having an ACSCN of 9750 and an annual aggregate manufacturing quota of 10 grammes in 2013.
# Medical uses
Tilidine is used in the form of hydrochloride or phosphate salt. In Germany, tilidine is available in a fixed combination with naloxone for oral administration (Valoron N and generics); the mixture of naloxone is claimed to lower the abuse liability of the opioid analgesic.[1] This is so that if people take the medication orally (which is the way they are meant to) the opioid blocker, naloxone, has minimal effects on them but if they inject it the naloxone becomes bioavailable and hence antagonises the effects of the tilidine producing withdrawal effects.[1][4] In Switzerland the original Valoron brand with only tilidine and no naloxone is also available.[3]
As well as its use as an analgesic, tilidine is also commonly used in Germany for treatment of restless legs syndrome.[5]
# Adverse effects
Its most common adverse effects are transient nausea and vomiting, dizziness, drowsiness, fatigue, headache and nervousness; less commonly, nausea and vomiting (after repeated dosing), hallucinations, confusion, euphoria, tremor, hyperreflexia, clonus and increased sweating.[1] Uncommonly, somnolence; rarely, diarrhoea and abdominal pain.[1]
# Physicochemistry
It usually comes in its hydrochloride hemihydrate salt form; in this form it is highly soluble in water, ethanol and dichloromethane and appears as a white/almost white crystalline powder.[3] Its storage is restricted by its insensitivity to light and sensitivity to degradation by oxygen, hence necessitating its storage in amber bottles and at temperatures below 30 degrees Celsius, respectively.[1][3]
# Pharmacology
Considered a low- to medium-potency opioid, tilidine has the oral potency of about 0.2, that is, a dose of 100 mg p.o. is equianalgesic to approximately 20 mg morphine sulfate orally. It is administered orally (by mouth), rectally (by a suppository), or by injection (SC, IM or slowly IV) with single doses of 50 to 100 mg, the maximal daily dose being up to 600 mg.[6]
Tilidine itself is only a weak opioid, but is rapidly metabolised in the liver and gut to its active metabolite nortilidine and then to bisnortilidine.[7][8] It is the (1S,2R)-isomer that is responsible for its analgesic activity.[9]
# Synthesis
It is manufactured by a Diels-Alder reaction of 1-N,N-dimethylaminobuta-1,3-diene with ethyl atropate, yielding a mixture of isomers,[10] of which only the (E)-(trans)-isomers are active and are separated subsequently from the mixture by precipitation of the inactive (Z)-(cis)-isomers as zinc complex.[7] The inactive (Z)-(cis)-isomers may be epimerized to the more thermodynamically favoured (E)-(trans)-isomers via reflux in diluted phosphoric acid. | https://www.wikidoc.org/index.php/Tilidine | |
e00d701353c5b353b04ca22681ce8e697ab1cb8d | wikidoc | Tin pest | Tin pest
Tin pest is an autocatalytic, allotropic transformation of the element tin, which causes deterioration of tin objects at low temperatures. Tin pest has also been called tin disease, or tin leprosy (Lèpre d'étain).
It was observed in medieval Europe that the pipes of church pipe organs were affected in cool climates. As soon as the tin began decomposing, the process sped up, and seemed to feed on itself.
# The allotropic transformation
At 13.2 degrees Celsius (about 56 degrees Fahrenheit) and below, pure tin transforms from the (silvery, ductile) allotrope of β-modification white tin to brittle, α-modification grey tin. Eventually it decomposes into powder, hence the name tin pest.
The decomposition will catalyze itself, which is why the reaction seems to speed up once it starts; the mere presence of tin pest leads to more tin pest. Tin objects at low temperatures will simply disintegrate.
# Possible historical examples
## Scott expedition to Antarctica
In 1910 British polar explorer Robert Scott hoped to be the first to reach the South Pole, but was beaten by Norwegian explorer Roald Amundsen. On foot, the expedition trudged through the frozen deserts of the Antarctic, making for caches of food and kerosene deposited on the way in. In early 1912, at the first cache, there was no kerosene; the cans — soldered with tin — were empty. Members of the expedition later died in the cold and blizzards, only eleven miles from a massive depot of supplies.
The cause of the empty tins is unknown. Some observers blame poor quality soldering, although tin cans over eighty years old have been discovered in Antarctic buildings with the soldering in good condition. In any case, the lack of kerosene was just one factor in the deaths. One source observes,
The likely cause of death for Scott's polar party was some combination of scurvy, gangrene, starvation, dehydration, and hypothermia.
## Napoleon's buttons
The story is often told of Napoleon's men freezing in the bitter Russian winter, their clothes falling apart as tin pest ate the buttons. Whether failing buttons were indeed a contributing factor in the failure of the invasion remains disputed; critics of the theory point out that the tin used would have been quite impure and thus more tolerant of cold temperatures. Laboratory tests provide evidence that the time required for unalloyed tin to develop significant tin pest damage at lowered temperatures is about 18 months, which is more than twice the length of Napoleon's Russian campaign.
# Modern tin
Today tin casting and plating avoids tin pest. The tin is alloyed with small amounts of antimony or bismuth, which prevent the decomposition. Silver, indium, and lead have also been used. | Tin pest
Tin pest is an autocatalytic, allotropic transformation of the element tin, which causes deterioration of tin objects at low temperatures. Tin pest has also been called tin disease, or tin leprosy (Lèpre d'étain).
It was observed in medieval Europe that the pipes of church pipe organs were affected in cool climates. As soon as the tin began decomposing, the process sped up, and seemed to feed on itself.
# The allotropic transformation
At 13.2 degrees Celsius (about 56 degrees Fahrenheit) and below, pure tin transforms from the (silvery, ductile) allotrope of β-modification white tin to brittle, α-modification grey tin. Eventually it decomposes into powder, hence the name tin pest.
The decomposition will catalyze itself, which is why the reaction seems to speed up once it starts; the mere presence of tin pest leads to more tin pest. Tin objects at low temperatures will simply disintegrate.
# Possible historical examples
## Scott expedition to Antarctica
In 1910 British polar explorer Robert Scott hoped to be the first to reach the South Pole, but was beaten by Norwegian explorer Roald Amundsen. On foot, the expedition trudged through the frozen deserts of the Antarctic, making for caches of food and kerosene deposited on the way in. In early 1912, at the first cache, there was no kerosene; the cans — soldered with tin — were empty. Members of the expedition later died in the cold and blizzards, only eleven miles from a massive depot of supplies.
The cause of the empty tins is unknown. Some observers blame poor quality soldering, although tin cans over eighty years old have been discovered in Antarctic buildings with the soldering in good condition. In any case, the lack of kerosene was just one factor in the deaths. One source observes,
The likely cause of death for Scott's polar party was some combination of scurvy, gangrene, starvation, dehydration, and hypothermia.[1]
## Napoleon's buttons
The story is often told of Napoleon's men freezing in the bitter Russian winter, their clothes falling apart as tin pest ate the buttons. Whether failing buttons were indeed a contributing factor in the failure of the invasion remains disputed; critics of the theory point out that the tin used would have been quite impure and thus more tolerant of cold temperatures. Laboratory tests provide evidence that the time required for unalloyed tin to develop significant tin pest damage at lowered temperatures is about 18 months, which is more than twice the length of Napoleon's Russian campaign.[1]
# Modern tin
Today tin casting and plating avoids tin pest. The tin is alloyed with small amounts of antimony or bismuth, which prevent the decomposition. Silver, indium, and lead have also been used. | https://www.wikidoc.org/index.php/Tin_pest | |
edf8547962289a24a7b97cc3d76e8bc718cbd917 | wikidoc | TobraDex | TobraDex
Synonyms / Brand Names:
# Dosing and Administration
One or two drops instilled into the conjunctival sac(s) every four to six hours. During the initial 24 to 48 hours, the dosage may be increased to one or two drops every two (2) hours. Frequency should be decreased gradually as warranted by improvement in clinical signs. Care should be taken not to discontinue therapy prematurely.
Not more than 20 mL should be prescribed initially and the prescription should not be refilled without further evaluation.
FDA Package Insert Resources
Indications, Contraindications, Side Effects, Drug Interactions, etc.
Calculate Creatine Clearance
On line calculator of your patients Cr Cl by a variety of formulas.
Convert pounds to Kilograms
On line calculator of your patients weight in pounds to Kg for dosing estimates.
Publication Resources
Recent articles, WikiDoc State of the Art Review, Textbook Information
Trial Resources
Ongoing Trials, Trial Results
Guidelines & Evidence Based Medicine Resources
US National Guidelines, Cochrane Collaboration, etc.
Media Resources
Slides, Video, Images, MP3, Podcasts, etc.
Patient Resources
Discussion Groups, Handouts, Blogs, News, etc.
International Resources
en Español
# FDA Package Insert Resources
Indications
Contraindications
Side Effects
Precautions
Overdose
Instructions for Administration
How Supplied
Pharmacokinetics and Molecular Data
FDA label
FDA on TobraDex
Return to top
# Publication Resources
Most Recent Articles on TobraDex
Review Articles on TobraDex
Articles on TobraDex in N Eng J Med, Lancet, BMJ
WikiDoc State of the Art Review
Textbook Information on TobraDex
Return to top
# Trial Resources
Ongoing Trials with TobraDex at Clinical Trials.gov
Trial Results with TobraDex
Return to top
# Guidelines & Evidence Based Medicine Resources
US National Guidelines Clearinghouse on TobraDex
Cochrane Collaboration on TobraDex
Cost Effectiveness of TobraDex
Return to top
# Media Resources
Powerpoint Slides on TobraDex
Images of TobraDex
Podcasts & MP3s on TobraDex
Videos on TobraDex
Return to top
# Patient Resources
Patient Information from National Library of Medicine
Patient Resources on TobraDex
Discussion Groups on TobraDex
Patient Handouts on TobraDex
Blogs on TobraDex
TobraDex in the News
TobraDex in the Marketplace
Return to top
# International Resources
TobraDex en Español
Return to top
Adapted from the FDA Package Insert. | TobraDex
Synonyms / Brand Names:
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Dosing and Administration
One or two drops instilled into the conjunctival sac(s) every four to six hours. During the initial 24 to 48 hours, the dosage may be increased to one or two drops every two (2) hours. Frequency should be decreased gradually as warranted by improvement in clinical signs. Care should be taken not to discontinue therapy prematurely.
Not more than 20 mL should be prescribed initially and the prescription should not be refilled without further evaluation.
FDA Package Insert Resources
Indications, Contraindications, Side Effects, Drug Interactions, etc.
Calculate Creatine Clearance
On line calculator of your patients Cr Cl by a variety of formulas.
Convert pounds to Kilograms
On line calculator of your patients weight in pounds to Kg for dosing estimates.
Publication Resources
Recent articles, WikiDoc State of the Art Review, Textbook Information
Trial Resources
Ongoing Trials, Trial Results
Guidelines & Evidence Based Medicine Resources
US National Guidelines, Cochrane Collaboration, etc.
Media Resources
Slides, Video, Images, MP3, Podcasts, etc.
Patient Resources
Discussion Groups, Handouts, Blogs, News, etc.
International Resources
en Español
# FDA Package Insert Resources
Indications
Contraindications
Side Effects
Precautions
Overdose
Instructions for Administration
How Supplied
Pharmacokinetics and Molecular Data
FDA label
FDA on TobraDex
Return to top
# Publication Resources
Most Recent Articles on TobraDex
Review Articles on TobraDex
Articles on TobraDex in N Eng J Med, Lancet, BMJ
WikiDoc State of the Art Review
Textbook Information on TobraDex
Return to top
# Trial Resources
Ongoing Trials with TobraDex at Clinical Trials.gov
Trial Results with TobraDex
Return to top
# Guidelines & Evidence Based Medicine Resources
US National Guidelines Clearinghouse on TobraDex
Cochrane Collaboration on TobraDex
Cost Effectiveness of TobraDex
Return to top
# Media Resources
Powerpoint Slides on TobraDex
Images of TobraDex
Podcasts & MP3s on TobraDex
Videos on TobraDex
Return to top
# Patient Resources
Patient Information from National Library of Medicine
Patient Resources on TobraDex
Discussion Groups on TobraDex
Patient Handouts on TobraDex
Blogs on TobraDex
TobraDex in the News
TobraDex in the Marketplace
Return to top
# International Resources
TobraDex en Español
Return to top
Adapted from the FDA Package Insert. | https://www.wikidoc.org/index.php/TobraDex | |
24b6265ce7b8c73f3739830354ec6c49fb2ef028 | wikidoc | Tolmetin | Tolmetin
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Tolmetin is a Antirheumatic that is FDA approved for the treatment of rheumatoid arthritis, osteoarthritis and juvenile rheumatoid arthritis. There is a Black Box Warning for this drug as shown here. Common adverse reactions include Nausea, dyspepsia, gastrointestinal distress, abdominal pain, diarrhea, flatulence, vomiting.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Indications
- Carefully consider the potential benefits and risks of tolmetin sodium and other treatment options before deciding to use tolmetin sodium. Use the lowest effective dose for the shortest duration consistent with individual patient treatment goals.
- Tolmetin sodium is indicated for the relief of signs and symptoms of rheumatoid arthritis and osteoarthritis. Tolmetin sodium is indicated in the treatment of acute flares and the long-term management of the chronic disease.
- Tolmetin sodium is also indicated for treatment of juvenile rheumatoid arthritis. The safety and effectiveness of tolmetin sodium have not been established in pediatric patients under 2 years of age
### Dosage
- Carefully consider the potential benefits and risks of tolmetin sodium and other treatment options before deciding to use tolmetin sodium. Use the lowest effective dose for the shortest duration consistent with individual patient treatment goals.
- After observing the response to initial therapy with tolmetin sodium, the dose and frequency should be adjusted to suit an individual patient's needs.
- For the relief of rheumatoid arthritis or osteoarthritis, the recommended starting dose for adults is 400 mg three times daily (1200 mg daily), preferably including a dose on arising and a dose at bedtime. To achieve optimal therapeutic effect the dose should be adjusted according to the patient's response after one or two weeks. Control is usually achieved at doses of 600–1800 mg daily in divided doses (generally t.i.d.). Doses larger than 1800 mg/day have not been studied and are not recommended.
- For the relief of juvenile rheumatoid arthritis, the recommended starting dose for pediatric patients (2 years and older) is 20 mg/kg/day in divided doses (t.i.d. or q.i.d.). When control has been achieved, the usual dose ranges from 15 to 30 mg/kg/day. Doses higher than 30 mg/kg/day have not been studied, and, therefore, are not recommended.
- A therapeutic response to tolmetin sodium can be expected in a few days to a week. Progressive improvement can be anticipated during succeeding weeks of therapy. If gastrointestinal symptoms occur, tolmetin sodium can be administered with antacids other than sodium bicarbonate. Tolmetin sodium bioavailability and pharmacokinetics are not significantly affected by acute or chronic administration of magnesium and aluminum hydroxides; however, bioavailability is affected by food or milk
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Tolmetin in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Tolmetin in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
### Indications
- Tolmetin sodium is also indicated for treatment of juvenile rheumatoid arthritis. The safety and effectiveness of tolmetin sodium have not been established in pediatric patients under 2 years of age
### Dosage
- For the relief of juvenile rheumatoid arthritis, the recommended starting dose for pediatric patients (2 years and older) is 20 mg/kg/day in divided doses (t.i.d. or q.i.d.). When control has been achieved, the usual dose ranges from 15 to 30 mg/kg/day. Doses higher than 30 mg/kg/day have not been studied, and, therefore, are not recommended.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Tolmetin in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Tolmetin in pediatric patients.
# Contraindications
- Tolmetin sodium is contraindicated in patients with known hypersensitivity to tolmetin sodium.
- Tolmetin sodium should not be given to patients who have experienced asthma, urticaria or allergic-type reactions after taking aspirin or other NSAIDs. Severe, rarely fatal, anaphylactic-like reactions to NSAIDs have been reported in such patients.
- Tolmetin sodium is contraindicated for the treatment of peri-operative pain in the setting of coronary artery bypass graft (CABG) surgery
# Warnings
- Clinical trials of several COX-2 selective and nonselective NSAIDs of up to three years duration have shown an increased risk of serious cardiovascular (CV) thrombotic events, myocardial infarction, and stroke, which can be fatal. All NSAIDs, both COX-2 selective and nonselective, may have a similar risk. Patients with known CV disease or risk factors for CV disease may be at greater risk. To minimize the potential risk for an adverse CV event in patients treated with an NSAID, the lowest effective dose should be used for the shortest duration possible. Physicians and patients should remain alert for the development of such events, even in the absence of previous CV symptoms. Patients should be informed about the signs and/or symptoms of serious CV events and the steps to take if they occur.
- There is no consistent evidence that concurrent use of aspirin mitigates the increased risk of serious CV thrombotic events associated with NSAID use. The concurrent use of aspirin and an NSAID does increase the risk of serious GI events.
- Two large, controlled, clinical trials of a COX-2 selective NSAID for the treatment of pain in the first 10 to 14 days following CABG surgery found an increased incidence of myocardial infarction and stroke.
- NSAIDs, including tolmetin sodium, can lead to onset of new hypertension or worsening of preexisting hypertension, either of which may contribute to the increased incidence of CV events. Patients taking thiazides or loop diuretics may have impaired response to these therapies when taking NSAIDs. NSAIDs, including tolmetin sodium, should be used with caution in patients with hypertension. Blood pressure (BP) should be monitored closely during the initiation of NSAID treatment and throughout the course of therapy.
- Fluid retention and edema have been observed in some patients taking NSAIDs. Tolmetin sodium should be used with caution in patients with fluid retention or heart failure.
- NSAIDs, including tolmetin sodium, can cause serious gastrointestinal adverse events including inflammation, bleeding, ulceration, and perforation of the stomach, small intestine or large intestine, which can be fatal. These serious adverse events can occur at any time, with or without warning symptoms in patients treated with NSAIDs. Only one in five patients who develop a serious upper GI adverse event on NSAID therapy is symptomatic. Upper GI ulcers, gross bleeding, or perforation caused by NSAIDs occur in approximately 1% of patients treated for 3 to 6 months, and in about 2 to 4% of patients treated for one year. These trends continue with longer duration of use, increasing the likelihood of developing a serious GI event at some time during the course of therapy. However, even short-term therapy is not without risk.
- NSAIDs should be prescribed with extreme caution in those with a prior history of ulcer disease or gastrointestinal bleeding. Patients with a prior history of peptic ulcer disease and/or gastrointestinal bleeding who use NSAIDs have a greater than 10-fold increased risk for developing a GI bleed compared to patients with neither of these risk factors. Other factors that increase the risk for GI bleeding in patients treated with NSAIDs include concomitant use of oral corticosteroids or anticoagulants, longer duration of NSAID therapy, smoking, use of alcohol, older age, and poor general health status. Most spontaneous reports of fatal GI events are in elderly or debilitated patients and, therefore, special care should be taken in treating this population.
- To minimize the potential risk for an adverse GI event in patients treated with an NSAID, the lowest effective dose should be used for the shortest possible duration. Patients and physicians should remain alert for signs and symptoms of GI ulceration and bleeding during NSAID therapy and promptly initiate additional evaluation and treatment if a serious GI adverse event is suspected. This should include discontinuation of the NSAID until a serious GI adverse event is ruled out. For high-risk patients, alternate therapies that do not involve NSAIDs should be considered.
- Long-term administration of NSAIDs has resulted in renal papillary necrosis and other renal injury. Acute interstitial nephritis with hematuria, proteinuria, and occasionally nephritic syndrome have been reported in patients treated with tolmetin sodium. Renal toxicity has also been seen in patients in whom renal prostaglandins have a compensatory role in the maintenance of renal perfusion. In these patients, administration of an NSAID may cause a dose-dependent reduction in prostaglandin formation and, secondarily, in renal blood flow, which may precipitate overt renal decompensation. Patients at greatest risk of this reaction are those with impaired renal function, heart failure, liver dysfunction, those taking diuretics and ACE inhibitors, and the elderly. Discontinuation of NSAID therapy is usually followed by recovery to the pretreatment state.
- No information is available from controlled clinical studies regarding the use of tolmetin sodium in patients with advanced renal disease. Therefore, treatment with tolmetin sodium is not recommended in these patients with advanced renal disease. If tolmetin sodium therapy must be initiated, close monitoring of the patient's renal function is advisable.
- As with other NSAIDs, anaphylactoid reactions may occur in patients with known prior exposure to tolmetin sodium. Tolmetin sodium should not be given to patients with the aspirin triad. This symptom complex typically occurs in asthmatic patients who experience rhinitis with or without nasal polyps, or who exhibit severe, potentially fatal bronchospasm after taking aspirin or other NSAIDs. Emergency help should be sought in cases where an anaphylactoid reaction occurs.
- NSAIDs, including tolmetin sodium, can cause serious skin adverse events such as exfoliative dermatitis, Stevens-Johnson Syndrome (SJS), and toxic epidermal necrolysis (TEN), which can be fatal. These serious events may occur without warning. Patients should be informed about the signs and symptoms of serious skin manifestations and use of the drug should be discontinued at the first appearance of skin rash or any other sign of hypersensitivity.
- In late pregnancy, as with other NSAIDs, tolmetin sodium should be avoided because it may cause premature closure of the ductus arteriosus
### Precautions
- Tolmetin sodium cannot be expected to substitute for corticosteroids or to treat corticosteroid insufficiency. Abrupt discontinuation of corticosteroids may lead to disease exacerbation. Patients on prolonged corticosteroid therapy should have their therapy tapered slowly if a decision is made to discontinue corticosteroids.
- The pharmacological activity of tolmetin sodium in reducing fever and inflammation may diminish the utility of these diagnostic signs in detecting complications of presumed noninfectious, painful conditions.
- Because of ocular changes observed in animals and of reports of adverse eye findings with NSAIDs, it is recommended that patients who develop visual disturbances during treatment with tolmetin sodium have ophthalmologic evaluations.
- Borderline elevations of one or more liver tests may occur in up to 15% of patients taking NSAIDs, including tolmetin sodium. These laboratory abnormalities may progress, may remain unchanged, or may be transient with continuing therapy. Notable elevations of ALT or AST (approximately three or more times the upper limit of normal) have been reported in approximately 1% of patients in clinical trials with NSAIDs. In addition, rare cases of severe hepatic reactions, including jaundice and fatal fulminant hepatitis, liver necrosis, and hepatic failure, some of them with fatal outcomes have been reported.
- A patient with symptoms and/or signs suggesting liver dysfunction, or in whom an abnormal liver test has occurred should be evaluated for evidence of the development of a more severe hepatic reaction while on therapy with tolmetin sodium. If clinical signs and symptoms consistent with liver disease develop, or if systemic manifestations occur (e.g., eosinophilia, rash, etc.), tolmetin sodium should be discontinued.
- Anemia is sometimes seen in patients receiving NSAIDs, including tolmetin sodium. This may be due to fluid retention, occult or gross GI blood loss, or an incompletely described effect upon erythropoiesis. Patients on long-term treatment with NSAIDs, including tolmetin sodium, should have their hemoglobin or hematocrit checked if they exhibit any signs or symptoms of anemia. NSAIDs inhibit platelet aggregation and have been shown to prolong bleeding time in some patients. Unlike aspirin, their effect on platelet function is quantitatively less, of shorter duration, and reversible. Patients receiving tolmetin sodium who may be adversely affected by alterations in platelet function, such as those with coagulation disorders or patients receiving anticoagulants, should be carefully monitored.
- Patients with asthma may have aspirin-sensitive asthma. The use of aspirin in patients with aspirin-sensitive asthma has been associated with severe bronchospasm which can be fatal. Since cross reactivity, including bronchospasm, between aspirin and other NSAIDs has been reported in such aspirin-sensitive patients, tolmetin sodium should not be administered to patients with this form of aspirin sensitivity and should be used with caution in patients with preexisting asthma.
- Because serious GI tract ulcerations and bleeding can occur without warning symptoms, physicians should monitor for signs or symptoms of GI bleeding. Patients on long-term treatment with NSAIDs should have their CBC and a chemistry profile checked periodically. If clinical signs and symptoms consistent with liver or renal disease develop, systemic manifestations occur (e.g., eosinophilia, rash, etc.) or if abnormal liver tests persist or worsen, tolmetin sodium should be discontinued.
# Adverse Reactions
## Clinical Trials Experience
- The adverse reactions which have been observed in clinical trials encompass observations in about 4370 patients treated with tolmetin sodium, over 800 of whom have undergone at least one year of therapy. These adverse reactions, reported below by body system, are among those typical of nonsteroidal anti-inflammatory drugs and, as expected, gastrointestinal complaints were most frequent. In clinical trials with tolmetin sodium, about 10% of patients dropped out because of adverse reactions, mostly gastrointestinal in nature.
- The following adverse reactions which occurred more frequently than 1 in 100 were reported in controlled clinical trials.
- Nausea (11%), dyspepsia, gastrointestinal distress, abdominal pain, diarrhea, flatulence, vomiting, constipation, gastritis, and peptic ulcer. Forty percent of the ulcer patients had a prior history of peptic ulcer disease and/or were receiving concomitant anti-inflammatory drugs including corticosteroids, which are known to produce peptic ulceration.
- Headache, asthenia, chest pain
- Elevated blood pressure, edema
- Dizziness, drowsiness, depression
- Weight gain, weight loss
- Skin irritation
- Tinnitus, visual disturbance
- Small and transient decreases in hemoglobin and hematocrit not associated with gastrointestinal bleeding have occurred. These are similar to changes reported with other nonsteroidal anti-inflammatory drugs.
- Elevated BUN, urinary tract infection
- 1 Reactions occurring in 3% to 9% of patients treated with tolmetin sodium. Reactions occurring in fewer than 3% of the patients are unmarked.
(Causal Relationship Probable)
- The following adverse reactions were reported less frequently than 1 in 100 controlled clinical trials or were reported since marketing. The probability exists that there is a causal relationship between tolmetin sodium and these adverse reactions.
- Gastrointestinal bleeding with or without evidence of peptic ulcer, perforation, glossitis, stomatitis, hepatitis, liver function abnormalities
- Anaphylactoid reactions, fever, lymphadenopathy, serum sickness
- Hemolytic anemia, thrombocytopenia, granulocytopenia, agranulocytosis
- Congestive heart failure in patients with marginal cardiac function
- Urticaria, purpura, erythema multiforme, toxic epidermal necrolysis
- Hematuria, proteinuria, dysuria, renal failure
(Causal Relationship Unknown)
- Other adverse reactions were reported less frequently than 1 in 100 controlled clinical trials or were reported since marketing, but a causal relationship between tolmetin sodium and the reaction could not be determined. These rarely reported reactions are being listed as alerting information for the physician since the possibility of a causal relationship cannot be excluded.
- Epistaxis
- Optic neuropathy, retinal and macular changes
## Postmarketing Experience
There is limited information regarding Postmarketing Experience of Tolmetin in the drug label.
# Drug Interactions
- Reports suggest that NSAIDs may diminish the antihypertensive effect of ACE-inhibitors. This interaction should be given consideration in patients taking NSAIDs concomitantly with ACE-inhibitors.
- As with other NSAIDs, concomitant administration of tolmetin sodium and aspirin is not generally recommended because of the potential of increased adverse effects.
- Clinical studies, as well as post-marketing observations, have shown that NSAIDs can reduce the natriuretic effect of furosemide and thiazides in some patients. This response has been attributed to inhibition of renal prostaglandin synthesis. During concomitant therapy with NSAIDs, the patient should be observed closely for signs of renal failure, as well as to assure diuretic efficacy.
- NSAIDs have produced an elevation of plasma lithium levels and a reduction in renal lithium clearance. The mean minimum lithium concentration increased 15% and the renal clearance was decreased by approximately 20%. These effects have been attributed to inhibition of renal prostaglandin synthesis by the NSAID. Thus, when NSAIDs and lithium are administered concurrently, subjects should be observed carefully for signs of lithium toxicity.
- NSAIDs have been reported to competitively inhibit methotrexate accumulation in rabbit kidney slices. This may indicate that they could enhance the toxicity of methotrexate. Caution should be used when NSAIDs are administered concomitantly with methotrexate.
- The effects of warfarin and NSAIDs on GI bleeding are synergistic, such that users of both drugs together have a risk of serious GI bleeding higher than users of either drug alone.
- The in vitro binding of warfarin to human plasma proteins is unaffected by tolmetin, and tolmetin does not alter the prothrombin time of normal volunteers. However, increased prothrombin time and bleeding have been reported in patients on concomitant tolmetin sodium and warfarin therapy. Therefore, caution should be exercised when administering tolmetin sodium to patients on anticoagulants.
- In adult diabetic patients under treatment with either sulfonylureas or insulin there is no change in the clinical effects of either tolmetin sodium or the hypoglycemic agents.
### Drug/Laboratory Test Interactions
- The metabolites of tolmetin sodium in urine have been found to give positive tests for proteinuria using tests which rely on acid precipitation as their endpoint (e.g., sulfosalicylic acid). No interference is seen in the tests for proteinuria using dye-impregnated commercially available reagent strips (e.g., Albustix®, Uristix®, etc.).
### Drug-Food Interactions
- In a controlled single-dose study, administration of tolmetin sodium with milk had no effect on peak plasma tolmetin concentrations, but decreased total tolmetin bioavailability by 16%. When tolmetin sodium was taken immediately after a meal, peak plasma tolmetin concentrations were reduced by 50% while total bioavailability was again decreased by 16%.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): C
- Reproduction studies in rats and rabbits at doses up to 50 mg/kg (1.5 times the maximum clinical dose based on a body weight of 60 kg) revealed no evidence of teratogenesis or impaired fertility due to tolmetin sodium. However, animal reproduction studies are not always predictive of human response. There are no adequate and well-controlled studies in pregnant women. Tolmetin sodium should be used in pregnancy only if the potential benefit justifies the potential risk to the fetus.
- Because of the known effects of NSAIDs on the fetal cardiovascular system (closure of ductus arteriosus), use during pregnancy (particularly late pregnancy) should be avoided.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Tolmetin in women who are pregnant.
### Labor and Delivery
- In rat studies with NSAIDs, as with other drugs known to inhibit prostaglandin synthesis, an increased incidence of dystocia, delayed parturition, and decreased pup survival occurred. The effects of tolmetin sodium on labor and delivery in pregnant women are unknown.
### Nursing Mothers
- Tolmetin sodium has been shown to be secreted in human milk. Because of the potential for serious adverse reactions in nursing infants from tolmetin sodium, a decision should be made whether to discontinue nursing or to discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
- Safety and effectiveness in pediatric patients below the age of 2 have not been established.
### Geriatic Use
- As with any NSAIDs, caution should be exercised in treating the elderly (65 years and older).
### Gender
There is no FDA guidance on the use of Tolmetin with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Tolmetin with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Tolmetin in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Tolmetin in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Tolmetin in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Tolmetin in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
- Blood pressure (BP) should be monitored closely during the initiation of NSAID treatment and throughout the course of therapy.
- If tolmetin sodium therapy must be initiated, close monitoring of the patient's renal function is advisable.
- Patients receiving tolmetin sodium who may be adversely affected by alterations in platelet function, such as those with coagulation disorders or patients receiving anticoagulants, should be carefully monitored
- Because serious GI tract ulcerations and bleeding can occur without warning symptoms, physicians should monitor for signs or symptoms of GI bleeding.
- Patients on long-term treatment with NSAIDs should have their CBC and a chemistry profile checked periodically.
# IV Compatibility
There is limited information regarding IV Compatibility of Tolmetin in the drug label.
# Overdosage
- In the event of overdosage, the stomach should be emptied by inducing vomiting or by gastric lavage followed by the administration of activated charcoal.
# Pharmacology
## Mechanism of Action
- The mode of action for tolmetin sodium is not known. However, studies in laboratory animals and man have demonstrated that the anti-inflammatory action of tolmetin sodium is not due to pituitary-adrenal stimulation. Tolmetin sodium inhibits prostaglandin synthetase in vitro and lowers the plasma level of prostaglandin E in man. This reduction in prostaglandin synthesis may be responsible for the anti-inflammatory action. Tolmetin sodium does not appear to alter the course of the underlying disease in man.
- Studies in animals have shown tolmetin sodium to possess anti-inflammatory, analgesic, and antipyretic activity. In the rat, tolmetin sodium prevents the development of experimentally induced polyarthritis and also decreases established inflammation.
## Structure
- Each tolmetin sodium capsule, for oral administration, contains 492 mg of tolmetin sodium (as the dihydrate), equivalent to 400 mg of tolmetin. Each capsule contains 36 mg (1.568 mEq) of sodium and the following inactive ingredients: FD&C Red No. 3, FD&C Yellow No. 6, gelatin, magnesium stearate, pregelatinized starch, talc and titanium dioxide.
- Each tolmetin sodium tablet, for oral administration, contains 246 mg of tolmetin sodium (as the dihydrate), equivalent to 200 mg of tolmetin (scored for 100 mg). Each tablet contains 18 mg (0.784 mEq) of sodium and the following inactive ingredients: magnesium stearate, microcrystalline cellulose, pregelatinized starch, sodium starch glycolate and talc.
- The pKa of tolmetin is 3.5 and tolmetin sodium is freely soluble in water.
- Tolmetin sodium is a nonselective nonsteroidal anti-inflammatory agent.
- The structural formula is:
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Tolmetin in the drug label.
## Pharmacokinetics
- In patients with rheumatoid arthritis and in normal volunteers, tolmetin sodium is rapidly and almost completely absorbed with peak plasma levels being reached within 30–60 minutes after an oral therapeutic dose. In controlled studies, the time to reach peak tolmetin plasma concentration is approximately 20 minutes longer following administration of a 600 mg tablet, compared to an equivalent dose given as 200 mg tablets. The clinical meaningfulness of this finding, if any, is unknown. Tolmetin displays a biphasic elimination from the plasma consisting of a rapid phase with a half-life of 1 to 2 hours followed by a slower phase with a half-life of about 5 hours. Peak plasma levels of approximately 40 µg/mL are obtained with a 400 mg oral dose. Essentially all of the administered dose is recovered in the urine in 24 hours either as an inactive oxidative metabolite or as conjugates of tolmetin. An 18-day multiple dose study demonstrated no accumulation of tolmetin when compared with a single dose.
- In two fecal blood loss studies of 4 to 6 days duration involving 15 subjects each, tolmetin sodium did not induce an increase in blood loss over that observed during a 4-day drug-free control period. In the same studies, aspirin produced a greater blood loss than occurred during the drug-free control period, and a greater blood loss than occurred during the tolmetin sodium treatment period. In one of the two studies, indomethacin produced a greater fecal blood loss than occurred during the drug-free control period; in the second study, indomethacin did not induce a significant increase in blood loss.
- Tolmetin sodium is effective in treating both the acute flares and in the long-term management of the symptoms of rheumatoid arthritis, osteoarthritis and juvenile rheumatoid arthritis.
- In patients with either rheumatoid arthritis or osteoarthritis, tolmetin sodium is as effective as aspirin and indomethacin in controlling disease activity, but the frequency of the milder gastrointestinal adverse effects and tinnitus was less than in aspirin-treated patients, and the incidence of central nervous system adverse effects was less than in indomethacin-treated patients.
- In patients with juvenile rheumatoid arthritis, tolmetin sodium is as effective as aspirin in controlling disease activity, with a similar incidence of adverse reactions. Mean SGOT values, initially elevated in patients on previous aspirin therapy, remained elevated in the aspirin group and decreased in the tolmetin sodium group.
- Tolmetin sodium has produced additional therapeutic benefit when added to a regimen of gold salts and, to a lesser extent, with corticosteroids. Tolmetin sodium should not be used in conjunction with salicylates since greater benefit from the combination is not likely, but the potential for adverse reactions is increased.
## Nonclinical Toxicology
- Tolmetin sodium did not possess any carcinogenic liability in the following long-term studies: a 24-month study in rats at doses as high as 75 mg/kg/day, and an 18-month study in mice at doses as high as 50 mg/kg/day.
- No mutagenic potential of tolmetin sodium was found in the Ames Salmonella-Microsomal Activation Test.
- Reproductive studies revealed no impairment of fertility in animals. Effects on parturition have been shown, however, as with other prostaglandin inhibitors. This information is detailed in the PREGNANCY section.
# Clinical Studies
There is limited information regarding Clinical Studies of Tolmetin in the drug label.
# How Supplied
- Tolmetin sodium capsules and tablets are supplied as follows:
- Tolmetin sodium capsules equivalent to 400 mg tolmetin, orange/orange imprinted:
- Mutual
- Tolmetin sodium tablets equivalent to 200 mg tolmetin, off white, round scored, debossed: MP 50
## Storage
- Store at 20° to 25°C (68° to 77°F).
- DISPENSE IN TIGHT, LIGHT-RESISTANT CONTAINER.
# Images
## Drug Images
## Package and Label Display Panel
### PRINCIPAL DISPLAY PANEL - 200 MG - 100 TABLET BOTTLE
MP
NDC 53489-506-01
TOLMETIN SODIUM
TABLETS USP
200 mg*
PHARMACIST:
PLEASE DISPENSE WITH MEDICATION GUIDE
100 TABLETS
Rx only
MUTUAL PHARMACEUTICAL CO., INC.
PHILADELPHIA, PA 19124 USA
### Ingredients and Appearance
# Patient Counseling Information
- Patients should be informed of the following information before initiating therapy with an NSAID and periodically during the course of ongoing therapy. Patients should also be encouraged to read the NSAID Medication Guide that accompanies each prescription dispensed.
- Tolmetin sodium, like other NSAIDs, may cause serious CV side effects, such as MI or stroke, which may result in hospitalization and even death. Although serious CV events can occur without warning symptoms, patients should be alert for the signs and symptoms of chest pain, shortness of breath, weakness, slurring of speech, and should ask for medical advice when observing any indicative signs or symptoms. Patients should be apprised of the importance of this follow-up.
- Tolmetin sodium, like other NSAIDs, can cause GI discomfort and, rarely, serious GI side effects, such as ulcers and bleeding, which may result in hospitalization and even death. Although serious GI tract ulcerations and bleeding can occur without warning symptoms, patients should be alert for the signs and symptoms of ulcerations and bleeding, and should ask for medical advice when observing any indicative signs or symptoms including epigastric pain, dyspepsia, melena, and hematemesis. Patients should be apprised of the importance of this follow-up.
- Tolmetin sodium, like other NSAIDs, can cause serious skin side effects such as exfoliative dermatitis, SJS, and TEN, which may result in hospitalizations and even death. Although serious skin reactions may occur without warning, patients should be alert for the signs and symptoms of skin rash and blisters, fever, or other signs of hypersensitivity, such as itching, and should ask for medical advice when observing any indicative signs or symptoms. Patients should be advised to stop the drug immediately if they develop any type of rash and contact their physicians as soon as possible.
Patients should promptly report signs or symptoms of unexplained weight gain or edema to their physicians.
Patients should be informed of the warning signs and symptoms of hepatotoxicity (e.g., nausea, fatigue, lethargy, pruritus, jaundice, right upper quadrant tenderness, and "flu-like" symptoms). If these occur, patients should be instructed to stop therapy and seek immediate medical therapy.
Patients should be informed of the signs of an anaphylactoid reaction (e.g., difficulty breathing, swelling of the face or throat). If these occur, patients should be instructed to seek immediate emergency help .
- In late pregnancy, as with other NSAIDs, tolmetin sodium should be avoided because it will cause premature closure of the ductus arteriosus.
### MEDICATION GUIDE FOR NON-STEROIDAL ANTI-INFLAMMATORY DRUGS (NSAIDS)
(See the end of this Medication Guide for a list of prescription NSAID medicines.)
- NSAID medicines may increase the chance of a heart attack or stroke that can lead to death.
- This chance increases:
- with longer use of NSAID medicines
- in people who have heart disease
- NSAID medicines should never be used right before or after a heart surgery called a "coronary artery bypass graft (CABG)."
- NSAID medicines can cause ulcers and bleeding in the stomach and intestines at any time during treatment. Ulcers and bleeding:
- can happen without warning symptoms
- may cause death
- The chance of a person getting an ulcer or bleeding increases with:
- taking medicines called "corticosteroids" and "anticoagulants"
- longer use
- smoking
- drinking alcohol
- older age
- having poor health
- NSAID medicines should only be used:
- exactly as prescribed
- at the lowest dose possible for your treatment
- for the shortest time needed
- NSAID medicines are used to treat pain and redness, swelling, and heat (inflammation) from medical conditions such as:
- different types of arthritis
- menstrual cramps and other types of short-term pain
- Do not take an NSAID medicine:
- if you had an asthma attack, hives, or other allergic reaction with aspirin or any other NSAID medicine
- for pain right before or after heart bypass surgery
- Tell your healthcare provider:
- about all of your medical conditions.
- about all of the medicines you take. NSAIDs and some other medicines can interact with each other and cause serious side effects. Keep a list of your medicines :- to show to your healthcare provider and pharmacist.
- if you are pregnant. NSAID medicines should not be used by pregnant women late in their pregnancy.
- if you are breastfeeding. Talk to your doctor.
- Get emergency help right away if you have any of the following symptoms:
- shortness of breath or trouble breathing
- chest pain
- weakness in one part or side of your body
- slurred speech
- swelling of the face or throat
- Stop your NSAID medicine and call your healthcare provider right away if you have any of the following symptoms:
- nausea
- more tired or weaker than usual
- itching
- your skin or eyes look yellow
- stomach pain
- flu-like symptoms
- vomit blood
- there is blood in your bowel movement or it is black and sticky like tar
- skin rash or blisters with fever
- unusual weight gain
- swelling of the arms and legs, hands and feet
- These are not all the side effects with NSAID medicines. Talk to your healthcare provider or pharmacist for more information about NSAID medicines.
- Call your doctor for medical advice about side effects. You may report side effects to FDA at 1-800-FDA-1088.
- Other information about Non-Steroidal Anti-Inflammatory Drugs (NSAIDs)
- Aspirin is an NSAID medicine but it does not increase the chance of a heart attack. Aspirin can cause bleeding in the brain, stomach, and intestines. Aspirin can also cause ulcers in the stomach and intestines.
- Some of these NSAID medicines are sold in lower doses without a prescription (over-the-counter). Talk to your health care provider before using over-the-counter NSAIDs for more than 10 days.
- NSAID medicines that need a prescription
- This Medication Guide has been approved by the U.S. Food and Drug Administration.
# Precautions with Alcohol
- Alcohol-Tolmetin interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- TOLMETIN SODIUM®
# Look-Alike Drug Names
There is limited information regarding Tolmetin Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Tolmetin
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Rabin Bista, M.B.B.S. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Black Box Warning
# Overview
Tolmetin is a Antirheumatic that is FDA approved for the treatment of rheumatoid arthritis, osteoarthritis and juvenile rheumatoid arthritis. There is a Black Box Warning for this drug as shown here. Common adverse reactions include Nausea, dyspepsia, gastrointestinal distress, abdominal pain, diarrhea, flatulence, vomiting.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Indications
- Carefully consider the potential benefits and risks of tolmetin sodium and other treatment options before deciding to use tolmetin sodium. Use the lowest effective dose for the shortest duration consistent with individual patient treatment goals.
- Tolmetin sodium is indicated for the relief of signs and symptoms of rheumatoid arthritis and osteoarthritis. Tolmetin sodium is indicated in the treatment of acute flares and the long-term management of the chronic disease.
- Tolmetin sodium is also indicated for treatment of juvenile rheumatoid arthritis. The safety and effectiveness of tolmetin sodium have not been established in pediatric patients under 2 years of age
### Dosage
- Carefully consider the potential benefits and risks of tolmetin sodium and other treatment options before deciding to use tolmetin sodium. Use the lowest effective dose for the shortest duration consistent with individual patient treatment goals.
- After observing the response to initial therapy with tolmetin sodium, the dose and frequency should be adjusted to suit an individual patient's needs.
- For the relief of rheumatoid arthritis or osteoarthritis, the recommended starting dose for adults is 400 mg three times daily (1200 mg daily), preferably including a dose on arising and a dose at bedtime. To achieve optimal therapeutic effect the dose should be adjusted according to the patient's response after one or two weeks. Control is usually achieved at doses of 600–1800 mg daily in divided doses (generally t.i.d.). Doses larger than 1800 mg/day have not been studied and are not recommended.
- For the relief of juvenile rheumatoid arthritis, the recommended starting dose for pediatric patients (2 years and older) is 20 mg/kg/day in divided doses (t.i.d. or q.i.d.). When control has been achieved, the usual dose ranges from 15 to 30 mg/kg/day. Doses higher than 30 mg/kg/day have not been studied, and, therefore, are not recommended.
- A therapeutic response to tolmetin sodium can be expected in a few days to a week. Progressive improvement can be anticipated during succeeding weeks of therapy. If gastrointestinal symptoms occur, tolmetin sodium can be administered with antacids other than sodium bicarbonate. Tolmetin sodium bioavailability and pharmacokinetics are not significantly affected by acute or chronic administration of magnesium and aluminum hydroxides; however, bioavailability is affected by food or milk
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Tolmetin in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Tolmetin in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
### Indications
- Tolmetin sodium is also indicated for treatment of juvenile rheumatoid arthritis. The safety and effectiveness of tolmetin sodium have not been established in pediatric patients under 2 years of age
### Dosage
- For the relief of juvenile rheumatoid arthritis, the recommended starting dose for pediatric patients (2 years and older) is 20 mg/kg/day in divided doses (t.i.d. or q.i.d.). When control has been achieved, the usual dose ranges from 15 to 30 mg/kg/day. Doses higher than 30 mg/kg/day have not been studied, and, therefore, are not recommended.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Tolmetin in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Tolmetin in pediatric patients.
# Contraindications
- Tolmetin sodium is contraindicated in patients with known hypersensitivity to tolmetin sodium.
- Tolmetin sodium should not be given to patients who have experienced asthma, urticaria or allergic-type reactions after taking aspirin or other NSAIDs. Severe, rarely fatal, anaphylactic-like reactions to NSAIDs have been reported in such patients.
- Tolmetin sodium is contraindicated for the treatment of peri-operative pain in the setting of coronary artery bypass graft (CABG) surgery
# Warnings
- Clinical trials of several COX-2 selective and nonselective NSAIDs of up to three years duration have shown an increased risk of serious cardiovascular (CV) thrombotic events, myocardial infarction, and stroke, which can be fatal. All NSAIDs, both COX-2 selective and nonselective, may have a similar risk. Patients with known CV disease or risk factors for CV disease may be at greater risk. To minimize the potential risk for an adverse CV event in patients treated with an NSAID, the lowest effective dose should be used for the shortest duration possible. Physicians and patients should remain alert for the development of such events, even in the absence of previous CV symptoms. Patients should be informed about the signs and/or symptoms of serious CV events and the steps to take if they occur.
- There is no consistent evidence that concurrent use of aspirin mitigates the increased risk of serious CV thrombotic events associated with NSAID use. The concurrent use of aspirin and an NSAID does increase the risk of serious GI events.
- Two large, controlled, clinical trials of a COX-2 selective NSAID for the treatment of pain in the first 10 to 14 days following CABG surgery found an increased incidence of myocardial infarction and stroke.
- NSAIDs, including tolmetin sodium, can lead to onset of new hypertension or worsening of preexisting hypertension, either of which may contribute to the increased incidence of CV events. Patients taking thiazides or loop diuretics may have impaired response to these therapies when taking NSAIDs. NSAIDs, including tolmetin sodium, should be used with caution in patients with hypertension. Blood pressure (BP) should be monitored closely during the initiation of NSAID treatment and throughout the course of therapy.
- Fluid retention and edema have been observed in some patients taking NSAIDs. Tolmetin sodium should be used with caution in patients with fluid retention or heart failure.
- NSAIDs, including tolmetin sodium, can cause serious gastrointestinal adverse events including inflammation, bleeding, ulceration, and perforation of the stomach, small intestine or large intestine, which can be fatal. These serious adverse events can occur at any time, with or without warning symptoms in patients treated with NSAIDs. Only one in five patients who develop a serious upper GI adverse event on NSAID therapy is symptomatic. Upper GI ulcers, gross bleeding, or perforation caused by NSAIDs occur in approximately 1% of patients treated for 3 to 6 months, and in about 2 to 4% of patients treated for one year. These trends continue with longer duration of use, increasing the likelihood of developing a serious GI event at some time during the course of therapy. However, even short-term therapy is not without risk.
- NSAIDs should be prescribed with extreme caution in those with a prior history of ulcer disease or gastrointestinal bleeding. Patients with a prior history of peptic ulcer disease and/or gastrointestinal bleeding who use NSAIDs have a greater than 10-fold increased risk for developing a GI bleed compared to patients with neither of these risk factors. Other factors that increase the risk for GI bleeding in patients treated with NSAIDs include concomitant use of oral corticosteroids or anticoagulants, longer duration of NSAID therapy, smoking, use of alcohol, older age, and poor general health status. Most spontaneous reports of fatal GI events are in elderly or debilitated patients and, therefore, special care should be taken in treating this population.
- To minimize the potential risk for an adverse GI event in patients treated with an NSAID, the lowest effective dose should be used for the shortest possible duration. Patients and physicians should remain alert for signs and symptoms of GI ulceration and bleeding during NSAID therapy and promptly initiate additional evaluation and treatment if a serious GI adverse event is suspected. This should include discontinuation of the NSAID until a serious GI adverse event is ruled out. For high-risk patients, alternate therapies that do not involve NSAIDs should be considered.
- Long-term administration of NSAIDs has resulted in renal papillary necrosis and other renal injury. Acute interstitial nephritis with hematuria, proteinuria, and occasionally nephritic syndrome have been reported in patients treated with tolmetin sodium. Renal toxicity has also been seen in patients in whom renal prostaglandins have a compensatory role in the maintenance of renal perfusion. In these patients, administration of an NSAID may cause a dose-dependent reduction in prostaglandin formation and, secondarily, in renal blood flow, which may precipitate overt renal decompensation. Patients at greatest risk of this reaction are those with impaired renal function, heart failure, liver dysfunction, those taking diuretics and ACE inhibitors, and the elderly. Discontinuation of NSAID therapy is usually followed by recovery to the pretreatment state.
- No information is available from controlled clinical studies regarding the use of tolmetin sodium in patients with advanced renal disease. Therefore, treatment with tolmetin sodium is not recommended in these patients with advanced renal disease. If tolmetin sodium therapy must be initiated, close monitoring of the patient's renal function is advisable.
- As with other NSAIDs, anaphylactoid reactions may occur in patients with known prior exposure to tolmetin sodium. Tolmetin sodium should not be given to patients with the aspirin triad. This symptom complex typically occurs in asthmatic patients who experience rhinitis with or without nasal polyps, or who exhibit severe, potentially fatal bronchospasm after taking aspirin or other NSAIDs. Emergency help should be sought in cases where an anaphylactoid reaction occurs.
- NSAIDs, including tolmetin sodium, can cause serious skin adverse events such as exfoliative dermatitis, Stevens-Johnson Syndrome (SJS), and toxic epidermal necrolysis (TEN), which can be fatal. These serious events may occur without warning. Patients should be informed about the signs and symptoms of serious skin manifestations and use of the drug should be discontinued at the first appearance of skin rash or any other sign of hypersensitivity.
- In late pregnancy, as with other NSAIDs, tolmetin sodium should be avoided because it may cause premature closure of the ductus arteriosus
### Precautions
- Tolmetin sodium cannot be expected to substitute for corticosteroids or to treat corticosteroid insufficiency. Abrupt discontinuation of corticosteroids may lead to disease exacerbation. Patients on prolonged corticosteroid therapy should have their therapy tapered slowly if a decision is made to discontinue corticosteroids.
- The pharmacological activity of tolmetin sodium in reducing fever and inflammation may diminish the utility of these diagnostic signs in detecting complications of presumed noninfectious, painful conditions.
- Because of ocular changes observed in animals and of reports of adverse eye findings with NSAIDs, it is recommended that patients who develop visual disturbances during treatment with tolmetin sodium have ophthalmologic evaluations.
- Borderline elevations of one or more liver tests may occur in up to 15% of patients taking NSAIDs, including tolmetin sodium. These laboratory abnormalities may progress, may remain unchanged, or may be transient with continuing therapy. Notable elevations of ALT or AST (approximately three or more times the upper limit of normal) have been reported in approximately 1% of patients in clinical trials with NSAIDs. In addition, rare cases of severe hepatic reactions, including jaundice and fatal fulminant hepatitis, liver necrosis, and hepatic failure, some of them with fatal outcomes have been reported.
- A patient with symptoms and/or signs suggesting liver dysfunction, or in whom an abnormal liver test has occurred should be evaluated for evidence of the development of a more severe hepatic reaction while on therapy with tolmetin sodium. If clinical signs and symptoms consistent with liver disease develop, or if systemic manifestations occur (e.g., eosinophilia, rash, etc.), tolmetin sodium should be discontinued.
- Anemia is sometimes seen in patients receiving NSAIDs, including tolmetin sodium. This may be due to fluid retention, occult or gross GI blood loss, or an incompletely described effect upon erythropoiesis. Patients on long-term treatment with NSAIDs, including tolmetin sodium, should have their hemoglobin or hematocrit checked if they exhibit any signs or symptoms of anemia. NSAIDs inhibit platelet aggregation and have been shown to prolong bleeding time in some patients. Unlike aspirin, their effect on platelet function is quantitatively less, of shorter duration, and reversible. Patients receiving tolmetin sodium who may be adversely affected by alterations in platelet function, such as those with coagulation disorders or patients receiving anticoagulants, should be carefully monitored.
- Patients with asthma may have aspirin-sensitive asthma. The use of aspirin in patients with aspirin-sensitive asthma has been associated with severe bronchospasm which can be fatal. Since cross reactivity, including bronchospasm, between aspirin and other NSAIDs has been reported in such aspirin-sensitive patients, tolmetin sodium should not be administered to patients with this form of aspirin sensitivity and should be used with caution in patients with preexisting asthma.
- Because serious GI tract ulcerations and bleeding can occur without warning symptoms, physicians should monitor for signs or symptoms of GI bleeding. Patients on long-term treatment with NSAIDs should have their CBC and a chemistry profile checked periodically. If clinical signs and symptoms consistent with liver or renal disease develop, systemic manifestations occur (e.g., eosinophilia, rash, etc.) or if abnormal liver tests persist or worsen, tolmetin sodium should be discontinued.
# Adverse Reactions
## Clinical Trials Experience
- The adverse reactions which have been observed in clinical trials encompass observations in about 4370 patients treated with tolmetin sodium, over 800 of whom have undergone at least one year of therapy. These adverse reactions, reported below by body system, are among those typical of nonsteroidal anti-inflammatory drugs and, as expected, gastrointestinal complaints were most frequent. In clinical trials with tolmetin sodium, about 10% of patients dropped out because of adverse reactions, mostly gastrointestinal in nature.
- The following adverse reactions which occurred more frequently than 1 in 100 were reported in controlled clinical trials.
- Nausea (11%), dyspepsia, gastrointestinal distress, abdominal pain, diarrhea, flatulence, vomiting, constipation, gastritis, and peptic ulcer. Forty percent of the ulcer patients had a prior history of peptic ulcer disease and/or were receiving concomitant anti-inflammatory drugs including corticosteroids, which are known to produce peptic ulceration.
- Headache, asthenia, chest pain
- Elevated blood pressure, edema
- Dizziness, drowsiness, depression
- Weight gain, weight loss
- Skin irritation
- Tinnitus, visual disturbance
- Small and transient decreases in hemoglobin and hematocrit not associated with gastrointestinal bleeding have occurred. These are similar to changes reported with other nonsteroidal anti-inflammatory drugs.
- Elevated BUN, urinary tract infection
- 1 Reactions occurring in 3% to 9% of patients treated with tolmetin sodium. Reactions occurring in fewer than 3% of the patients are unmarked.
(Causal Relationship Probable)
- The following adverse reactions were reported less frequently than 1 in 100 controlled clinical trials or were reported since marketing. The probability exists that there is a causal relationship between tolmetin sodium and these adverse reactions.
- Gastrointestinal bleeding with or without evidence of peptic ulcer, perforation, glossitis, stomatitis, hepatitis, liver function abnormalities
- Anaphylactoid reactions, fever, lymphadenopathy, serum sickness
- Hemolytic anemia, thrombocytopenia, granulocytopenia, agranulocytosis
- Congestive heart failure in patients with marginal cardiac function
- Urticaria, purpura, erythema multiforme, toxic epidermal necrolysis
- Hematuria, proteinuria, dysuria, renal failure
(Causal Relationship Unknown)
- Other adverse reactions were reported less frequently than 1 in 100 controlled clinical trials or were reported since marketing, but a causal relationship between tolmetin sodium and the reaction could not be determined. These rarely reported reactions are being listed as alerting information for the physician since the possibility of a causal relationship cannot be excluded.
- Epistaxis
- Optic neuropathy, retinal and macular changes
## Postmarketing Experience
There is limited information regarding Postmarketing Experience of Tolmetin in the drug label.
# Drug Interactions
- Reports suggest that NSAIDs may diminish the antihypertensive effect of ACE-inhibitors. This interaction should be given consideration in patients taking NSAIDs concomitantly with ACE-inhibitors.
- As with other NSAIDs, concomitant administration of tolmetin sodium and aspirin is not generally recommended because of the potential of increased adverse effects.
- Clinical studies, as well as post-marketing observations, have shown that NSAIDs can reduce the natriuretic effect of furosemide and thiazides in some patients. This response has been attributed to inhibition of renal prostaglandin synthesis. During concomitant therapy with NSAIDs, the patient should be observed closely for signs of renal failure, as well as to assure diuretic efficacy.
- NSAIDs have produced an elevation of plasma lithium levels and a reduction in renal lithium clearance. The mean minimum lithium concentration increased 15% and the renal clearance was decreased by approximately 20%. These effects have been attributed to inhibition of renal prostaglandin synthesis by the NSAID. Thus, when NSAIDs and lithium are administered concurrently, subjects should be observed carefully for signs of lithium toxicity.
- NSAIDs have been reported to competitively inhibit methotrexate accumulation in rabbit kidney slices. This may indicate that they could enhance the toxicity of methotrexate. Caution should be used when NSAIDs are administered concomitantly with methotrexate.
- The effects of warfarin and NSAIDs on GI bleeding are synergistic, such that users of both drugs together have a risk of serious GI bleeding higher than users of either drug alone.
- The in vitro binding of warfarin to human plasma proteins is unaffected by tolmetin, and tolmetin does not alter the prothrombin time of normal volunteers. However, increased prothrombin time and bleeding have been reported in patients on concomitant tolmetin sodium and warfarin therapy. Therefore, caution should be exercised when administering tolmetin sodium to patients on anticoagulants.
- In adult diabetic patients under treatment with either sulfonylureas or insulin there is no change in the clinical effects of either tolmetin sodium or the hypoglycemic agents.
### Drug/Laboratory Test Interactions
- The metabolites of tolmetin sodium in urine have been found to give positive tests for proteinuria using tests which rely on acid precipitation as their endpoint (e.g., sulfosalicylic acid). No interference is seen in the tests for proteinuria using dye-impregnated commercially available reagent strips (e.g., Albustix®, Uristix®, etc.).
### Drug-Food Interactions
- In a controlled single-dose study, administration of tolmetin sodium with milk had no effect on peak plasma tolmetin concentrations, but decreased total tolmetin bioavailability by 16%. When tolmetin sodium was taken immediately after a meal, peak plasma tolmetin concentrations were reduced by 50% while total bioavailability was again decreased by 16%.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): C
- Reproduction studies in rats and rabbits at doses up to 50 mg/kg (1.5 times the maximum clinical dose based on a body weight of 60 kg) revealed no evidence of teratogenesis or impaired fertility due to tolmetin sodium. However, animal reproduction studies are not always predictive of human response. There are no adequate and well-controlled studies in pregnant women. Tolmetin sodium should be used in pregnancy only if the potential benefit justifies the potential risk to the fetus.
- Because of the known effects of NSAIDs on the fetal cardiovascular system (closure of ductus arteriosus), use during pregnancy (particularly late pregnancy) should be avoided.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Tolmetin in women who are pregnant.
### Labor and Delivery
- In rat studies with NSAIDs, as with other drugs known to inhibit prostaglandin synthesis, an increased incidence of dystocia, delayed parturition, and decreased pup survival occurred. The effects of tolmetin sodium on labor and delivery in pregnant women are unknown.
### Nursing Mothers
- Tolmetin sodium has been shown to be secreted in human milk. Because of the potential for serious adverse reactions in nursing infants from tolmetin sodium, a decision should be made whether to discontinue nursing or to discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
- Safety and effectiveness in pediatric patients below the age of 2 have not been established.
### Geriatic Use
- As with any NSAIDs, caution should be exercised in treating the elderly (65 years and older).
### Gender
There is no FDA guidance on the use of Tolmetin with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Tolmetin with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Tolmetin in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Tolmetin in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Tolmetin in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Tolmetin in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
- Blood pressure (BP) should be monitored closely during the initiation of NSAID treatment and throughout the course of therapy.
- If tolmetin sodium therapy must be initiated, close monitoring of the patient's renal function is advisable.
- Patients receiving tolmetin sodium who may be adversely affected by alterations in platelet function, such as those with coagulation disorders or patients receiving anticoagulants, should be carefully monitored
- Because serious GI tract ulcerations and bleeding can occur without warning symptoms, physicians should monitor for signs or symptoms of GI bleeding.
- Patients on long-term treatment with NSAIDs should have their CBC and a chemistry profile checked periodically.
# IV Compatibility
There is limited information regarding IV Compatibility of Tolmetin in the drug label.
# Overdosage
- In the event of overdosage, the stomach should be emptied by inducing vomiting or by gastric lavage followed by the administration of activated charcoal.
# Pharmacology
## Mechanism of Action
- The mode of action for tolmetin sodium is not known. However, studies in laboratory animals and man have demonstrated that the anti-inflammatory action of tolmetin sodium is not due to pituitary-adrenal stimulation. Tolmetin sodium inhibits prostaglandin synthetase in vitro and lowers the plasma level of prostaglandin E in man. This reduction in prostaglandin synthesis may be responsible for the anti-inflammatory action. Tolmetin sodium does not appear to alter the course of the underlying disease in man.
- Studies in animals have shown tolmetin sodium to possess anti-inflammatory, analgesic, and antipyretic activity. In the rat, tolmetin sodium prevents the development of experimentally induced polyarthritis and also decreases established inflammation.
## Structure
- Each tolmetin sodium capsule, for oral administration, contains 492 mg of tolmetin sodium (as the dihydrate), equivalent to 400 mg of tolmetin. Each capsule contains 36 mg (1.568 mEq) of sodium and the following inactive ingredients: FD&C Red No. 3, FD&C Yellow No. 6, gelatin, magnesium stearate, pregelatinized starch, talc and titanium dioxide.
- Each tolmetin sodium tablet, for oral administration, contains 246 mg of tolmetin sodium (as the dihydrate), equivalent to 200 mg of tolmetin (scored for 100 mg). Each tablet contains 18 mg (0.784 mEq) of sodium and the following inactive ingredients: magnesium stearate, microcrystalline cellulose, pregelatinized starch, sodium starch glycolate and talc.
- The pKa of tolmetin is 3.5 and tolmetin sodium is freely soluble in water.
- Tolmetin sodium is a nonselective nonsteroidal anti-inflammatory agent.
- The structural formula is:
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Tolmetin in the drug label.
## Pharmacokinetics
- In patients with rheumatoid arthritis and in normal volunteers, tolmetin sodium is rapidly and almost completely absorbed with peak plasma levels being reached within 30–60 minutes after an oral therapeutic dose. In controlled studies, the time to reach peak tolmetin plasma concentration is approximately 20 minutes longer following administration of a 600 mg tablet, compared to an equivalent dose given as 200 mg tablets. The clinical meaningfulness of this finding, if any, is unknown. Tolmetin displays a biphasic elimination from the plasma consisting of a rapid phase with a half-life of 1 to 2 hours followed by a slower phase with a half-life of about 5 hours. Peak plasma levels of approximately 40 µg/mL are obtained with a 400 mg oral dose. Essentially all of the administered dose is recovered in the urine in 24 hours either as an inactive oxidative metabolite or as conjugates of tolmetin. An 18-day multiple dose study demonstrated no accumulation of tolmetin when compared with a single dose.
- In two fecal blood loss studies of 4 to 6 days duration involving 15 subjects each, tolmetin sodium did not induce an increase in blood loss over that observed during a 4-day drug-free control period. In the same studies, aspirin produced a greater blood loss than occurred during the drug-free control period, and a greater blood loss than occurred during the tolmetin sodium treatment period. In one of the two studies, indomethacin produced a greater fecal blood loss than occurred during the drug-free control period; in the second study, indomethacin did not induce a significant increase in blood loss.
- Tolmetin sodium is effective in treating both the acute flares and in the long-term management of the symptoms of rheumatoid arthritis, osteoarthritis and juvenile rheumatoid arthritis.
- In patients with either rheumatoid arthritis or osteoarthritis, tolmetin sodium is as effective as aspirin and indomethacin in controlling disease activity, but the frequency of the milder gastrointestinal adverse effects and tinnitus was less than in aspirin-treated patients, and the incidence of central nervous system adverse effects was less than in indomethacin-treated patients.
- In patients with juvenile rheumatoid arthritis, tolmetin sodium is as effective as aspirin in controlling disease activity, with a similar incidence of adverse reactions. Mean SGOT values, initially elevated in patients on previous aspirin therapy, remained elevated in the aspirin group and decreased in the tolmetin sodium group.
- Tolmetin sodium has produced additional therapeutic benefit when added to a regimen of gold salts and, to a lesser extent, with corticosteroids. Tolmetin sodium should not be used in conjunction with salicylates since greater benefit from the combination is not likely, but the potential for adverse reactions is increased.
## Nonclinical Toxicology
- Tolmetin sodium did not possess any carcinogenic liability in the following long-term studies: a 24-month study in rats at doses as high as 75 mg/kg/day, and an 18-month study in mice at doses as high as 50 mg/kg/day.
- No mutagenic potential of tolmetin sodium was found in the Ames Salmonella-Microsomal Activation Test.
- Reproductive studies revealed no impairment of fertility in animals. Effects on parturition have been shown, however, as with other prostaglandin inhibitors. This information is detailed in the PREGNANCY section.
# Clinical Studies
There is limited information regarding Clinical Studies of Tolmetin in the drug label.
# How Supplied
- Tolmetin sodium capsules and tablets are supplied as follows:
- Tolmetin sodium capsules equivalent to 400 mg tolmetin, orange/orange imprinted:
- Mutual
- Tolmetin sodium tablets equivalent to 200 mg tolmetin, off white, round scored, debossed: MP 50
## Storage
- Store at 20° to 25°C (68° to 77°F).
- DISPENSE IN TIGHT, LIGHT-RESISTANT CONTAINER.
# Images
## Drug Images
## Package and Label Display Panel
### PRINCIPAL DISPLAY PANEL - 200 MG - 100 TABLET BOTTLE
MP
NDC 53489-506-01
TOLMETIN SODIUM
TABLETS USP
200 mg*
PHARMACIST:
PLEASE DISPENSE WITH MEDICATION GUIDE
100 TABLETS
Rx only
MUTUAL PHARMACEUTICAL CO., INC.
PHILADELPHIA, PA 19124 USA
### Ingredients and Appearance
# Patient Counseling Information
- Patients should be informed of the following information before initiating therapy with an NSAID and periodically during the course of ongoing therapy. Patients should also be encouraged to read the NSAID Medication Guide that accompanies each prescription dispensed.
- Tolmetin sodium, like other NSAIDs, may cause serious CV side effects, such as MI or stroke, which may result in hospitalization and even death. Although serious CV events can occur without warning symptoms, patients should be alert for the signs and symptoms of chest pain, shortness of breath, weakness, slurring of speech, and should ask for medical advice when observing any indicative signs or symptoms. Patients should be apprised of the importance of this follow-up.
- Tolmetin sodium, like other NSAIDs, can cause GI discomfort and, rarely, serious GI side effects, such as ulcers and bleeding, which may result in hospitalization and even death. Although serious GI tract ulcerations and bleeding can occur without warning symptoms, patients should be alert for the signs and symptoms of ulcerations and bleeding, and should ask for medical advice when observing any indicative signs or symptoms including epigastric pain, dyspepsia, melena, and hematemesis. Patients should be apprised of the importance of this follow-up.
- Tolmetin sodium, like other NSAIDs, can cause serious skin side effects such as exfoliative dermatitis, SJS, and TEN, which may result in hospitalizations and even death. Although serious skin reactions may occur without warning, patients should be alert for the signs and symptoms of skin rash and blisters, fever, or other signs of hypersensitivity, such as itching, and should ask for medical advice when observing any indicative signs or symptoms. Patients should be advised to stop the drug immediately if they develop any type of rash and contact their physicians as soon as possible.
Patients should promptly report signs or symptoms of unexplained weight gain or edema to their physicians.
Patients should be informed of the warning signs and symptoms of hepatotoxicity (e.g., nausea, fatigue, lethargy, pruritus, jaundice, right upper quadrant tenderness, and "flu-like" symptoms). If these occur, patients should be instructed to stop therapy and seek immediate medical therapy.
Patients should be informed of the signs of an anaphylactoid reaction (e.g., difficulty breathing, swelling of the face or throat). If these occur, patients should be instructed to seek immediate emergency help .
- In late pregnancy, as with other NSAIDs, tolmetin sodium should be avoided because it will cause premature closure of the ductus arteriosus.
### MEDICATION GUIDE FOR NON-STEROIDAL ANTI-INFLAMMATORY DRUGS (NSAIDS)
(See the end of this Medication Guide for a list of prescription NSAID medicines.)
- NSAID medicines may increase the chance of a heart attack or stroke that can lead to death.
- This chance increases:
- with longer use of NSAID medicines
- in people who have heart disease
- NSAID medicines should never be used right before or after a heart surgery called a "coronary artery bypass graft (CABG)."
- NSAID medicines can cause ulcers and bleeding in the stomach and intestines at any time during treatment. Ulcers and bleeding:
- can happen without warning symptoms
- may cause death
- The chance of a person getting an ulcer or bleeding increases with:
- taking medicines called "corticosteroids" and "anticoagulants"
- longer use
- smoking
- drinking alcohol
- older age
- having poor health
- NSAID medicines should only be used:
- exactly as prescribed
- at the lowest dose possible for your treatment
- for the shortest time needed
- NSAID medicines are used to treat pain and redness, swelling, and heat (inflammation) from medical conditions such as:
- different types of arthritis
- menstrual cramps and other types of short-term pain
- Do not take an NSAID medicine:
- if you had an asthma attack, hives, or other allergic reaction with aspirin or any other NSAID medicine
- for pain right before or after heart bypass surgery
- Tell your healthcare provider:
- about all of your medical conditions.
- about all of the medicines you take. NSAIDs and some other medicines can interact with each other and cause serious side effects. Keep a list of your medicines :* to show to your healthcare provider and pharmacist.
- if you are pregnant. NSAID medicines should not be used by pregnant women late in their pregnancy.
- if you are breastfeeding. Talk to your doctor.
- Get emergency help right away if you have any of the following symptoms:
- shortness of breath or trouble breathing
- chest pain
- weakness in one part or side of your body
- slurred speech
- swelling of the face or throat
- Stop your NSAID medicine and call your healthcare provider right away if you have any of the following symptoms:
- nausea
- more tired or weaker than usual
- itching
- your skin or eyes look yellow
- stomach pain
- flu-like symptoms
- vomit blood
- there is blood in your bowel movement or it is black and sticky like tar
- skin rash or blisters with fever
- unusual weight gain
- swelling of the arms and legs, hands and feet
- These are not all the side effects with NSAID medicines. Talk to your healthcare provider or pharmacist for more information about NSAID medicines.
- Call your doctor for medical advice about side effects. You may report side effects to FDA at 1-800-FDA-1088.
- Other information about Non-Steroidal Anti-Inflammatory Drugs (NSAIDs)
- Aspirin is an NSAID medicine but it does not increase the chance of a heart attack. Aspirin can cause bleeding in the brain, stomach, and intestines. Aspirin can also cause ulcers in the stomach and intestines.
- Some of these NSAID medicines are sold in lower doses without a prescription (over-the-counter). Talk to your health care provider before using over-the-counter NSAIDs for more than 10 days.
- NSAID medicines that need a prescription
- This Medication Guide has been approved by the U.S. Food and Drug Administration.
# Precautions with Alcohol
- Alcohol-Tolmetin interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- TOLMETIN SODIUM®[1]
# Look-Alike Drug Names
There is limited information regarding Tolmetin Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Tolectin | |
f3dbdb9cfd7969a9192d89f4f021e0940da01c9f | wikidoc | Tom Hyde | Tom Hyde
Thomas E. Hyde, BA, DC, DABCSP, FICC, was born in 1945 to Ida and Earle Hyde in Thomasville, GA. He practiced in Miami, Florida from 1977-1997 after receiving his Doctor of Chiropractic degree from Logan College of Chiropractic in 1977 and his Bachelor of Arts degree in biology from Florida State University in 1973. He is married to Susan Hyde and has one daughter, Jennifer.
Hyde is notable for having been Secretary-general of the International Federation of Sports Chiropractic, and team Doctor for the United States Olympic Committee at the Pan American Games in Indianapolis, IN, in 1987, as well as having summited Mounts Kilimanjaro and Aconcagua in addition to his numerous other awards and accomplishments spanning a long career.
# Career
He served as president and executive director of the American Chiropractic Association (ACA) Sports Council for eight years and served as the secretary general for the International Federation of Sports Chiropractic (FICS).
He has served as the liaison between FICS and the World Olympians Association.
1987 - Hyde became the first DC to be selected to go to the United States Olympic Training Center, in Colorado Springs, CO, when the volunteer Chiropractor program was implemented, and was subsequently selected to represent the United States as team doctor at the Pan American Games that year in Indianapolis, IN.
1990 - He was the State of Florida's coordinator for medical services for the Sunshine Games
1990-1997 - He served as the chiropractic consultant for the Miami Dolphins .
1997 - He was appointed to serve a four-year term on the Pan American Games and Olympic Task Force for the state of Florida.
Hyde served on the Governor's Council on Physical Fitness and Sports .
2001 - Hyde became a member of the ACA Sports Council Hall of Fame.
2004 - He was a member of the commission, called "The Mercy Guidelines" which created the seminal, national professional guidelines for the practice of Chiropractic.
2006 - Hyde became a member of the Miami-Dade Sports Commission, Board of Directors.
2009 - He was named "Person of the Year" by Dynamic Chiropractic.
Hyde has lectured all over the United States, Canada, Hong Kong, Japan, Mexico, Argentina, Denmark , England, France, Switzerland, Australia, Chile, Brazil, Wales and South Africa. | Tom Hyde
Thomas E. Hyde, BA, DC, DABCSP, FICC, was born in 1945 to Ida and Earle Hyde in Thomasville, GA. He practiced in Miami, Florida from 1977-1997 after receiving his Doctor of Chiropractic degree from Logan College of Chiropractic in 1977 and his Bachelor of Arts degree in biology from Florida State University in 1973. He is married to Susan Hyde and has one daughter, Jennifer.
Hyde is notable for having been Secretary-general of the International Federation of Sports Chiropractic[1], and team Doctor for the United States Olympic Committee at the Pan American Games in Indianapolis, IN, in 1987,[2] as well as having summited Mounts Kilimanjaro[3] and Aconcagua[4] in addition to his numerous other awards and accomplishments spanning a long career.
# Career
He served as president [5] and executive director [6] of the American Chiropractic Association (ACA) Sports Council for eight years [1] and served as the secretary general for the International Federation of Sports Chiropractic (FICS). [1]
He has served as the liaison between FICS and the World Olympians Association[7][8].
1987 - Hyde became the first [2] DC to be selected to go to the United States Olympic Training Center, in Colorado Springs, CO, when the volunteer Chiropractor program was implemented, and was subsequently selected to represent the United States as team doctor at the Pan American Games that year in Indianapolis, IN.
1990 - He was the State of Florida's coordinator for medical services for the Sunshine Games [9]
1990-1997 - He served as the chiropractic consultant for the Miami Dolphins [10].
1997 - He was appointed to serve a four-year term on the Pan American Games and Olympic Task Force for the state of Florida[11].
Hyde served on the Governor's Council on Physical Fitness and Sports [12].
2001 - Hyde became a member of the ACA Sports Council Hall of Fame. [13]
2004 - He was a member of the commission, called "The Mercy Guidelines" which created the seminal, national professional guidelines for the practice of Chiropractic.[5]
2006 - Hyde became a member of the Miami-Dade Sports Commission, Board of Directors.[14]
2009 - He was named "Person of the Year" by Dynamic Chiropractic[15].
Hyde has lectured all over the United States, Canada, Hong Kong, Japan, Mexico, Argentina, Denmark [16], England, France, Switzerland, Australia, Chile, Brazil, Wales and South Africa. | https://www.wikidoc.org/index.php/Tom_Hyde | |
22fab9bed19d3564ff6c1cd92a4c98dd6208d38d | wikidoc | Tonality | Tonality
# Overview
Tonality is a system of music in which certain hierarchical pitch relationships are based on a key "center" or tonic. The term tonalité originated with Alexandre-Étienne Choron (1810) and was borrowed by François-Joseph Fétis in 1840 (Reti, 1958; Simms 1975, 119; Judd, 1998; Dahlhaus 1990). Although Fétis used it as a general term for a system of musical organization and spoke of types de tonalités rather than a single system, today the term is most often used to refer to Major-Minor tonality (also called diatonic tonality or functional tonality), the system of musical organization of the common practice period and most popular music in much of the world today.
# History
Theories of tonal music are generally dated from Jean-Philippe Rameau's Treatise on Harmony (1722), where he describes music written through chord progressions, cadences and structure. He claims that his work represents "the practice of the last 40 years ", however, this is probably not the case. Rameau's work, initially controversial, was introduced to Germany by Friedrich Wilhelm Marpurg (1757) and adopted by him in his explanation of the music of Johann Sebastian Bach (Marpurg 1753–54). The vocabulary of describing notes in relationship to the tonic note, and the use of harmonic progressions and cadences becomes absorbed into the practice of Bach. Essential to this version of tonal theory are the chorales harmonizations of Bach, and the method by which a church melody is given a four part harmony by assigning cadences, and then creating a "natural", meaning in this case the most direct, thoroughbass and then filling in the middle voices.
In 1821 Castil-Blaze used tonalité for what he called cordes tonales (today primary triads), the tonic, fourth (subdominant), and fifth (dominant). All other chords were cordes melodiques. Hugo Riemann defined tonality as, "the special meaning that chords receive through their relationship to a fundamental sonority, the tonic triad."
Commonly used to refer to whether something is major or minor.
Fétis (1844) defined tonality, specifically tonalité moderne as the, "set of relationships, simultaneous or successive, among the tones of the scale," allowing for other types de tonalités among different cultures. Further he considered tonalité moderne as "trans-tonic order" and tonalité ancienne "uni-tonic order", trans-tonic meaning simply that the dominant seventh both establishes the key and allows for modulation to other keys. He described his earliest example of tonalité moderne: "In the passage quoted here from Monteverdi's madrigal , one sees a tonality determined by the accord parfait on the tonic, by the sixth chord assigned to the third and seventh degrees, by the optional choice of the accord parfait or the sixth chord on the sixth degree, and finally, by the accord parfait and, above all, by the unprepared seventh chord (with major third) on the dominant." (p.171)
Fétis believed that tonality, tonalité moderne, was entirely cultural, "For the elements of music, nature provides nothing but a multitude of tones differing in pitch, duration, and intensity by the greater or least degree...The conception of the relationships that exist among them is awakened in the intellect, and, by the action of sensitivity on the one hand, and will on the other, the mind coordinates the tones into different series, each of which corresponds to a particular class of emotions, sentiments, and ideas. Hence these series become various types of tonalities." (p.11f) "But one will say, 'What is the principle behind these scales, and what, if not acoustic phenomena and the laws of mathematics, has set the order of their tones?' I respond that this principle is purely metaphysical . We conceive this order and the melodic and harmonic phenomena that spring from it out of our conformation and education." (p.249) In contrast, Hugo Riemann believed tonality, "affinites between tones" or Tonverwandtschaften, was entirely natural and, following Moritz Hauptmann (1853), that the major third and perfect fifth were the only "directly intelligible" intervals, and that I, IV, and V, the tonic, subdominant, and dominant were related by the perfect fifths between their roots. (Dahlhaus 1990, p.101-2)
By the 1840s the practice of harmony had expanded to include more chromatic notes, a wider chord vocabulary, particularly the more frequent used of the diminished seventh chord - a four note chord of all minor thirds which could lead to any other chord. It is in this era that the word "tonality" becomes more commonly used. At the same time the elaboration of both the fugue and the sonata form in terms of key relationships becomes more rigorous, and the study of harmonic progressions, voice leading and ambiguity of key becomes more precise.
Theorists such as Edward Lowinsky, Hugo Riemann, and others pushed the date at which modern tonality began, and the cadence began to be seen as the definitive way that a tonality is established in a work of music (Judd, 1998).
In response Bernhard Meier instead used a "tonality" and "modality", modern vs ancient, dichotomy, with Renaissance music being modal. The term modality has been criticized by Harold Powers, among others. However, it is widely used to describe music whose harmonic function centers on notes rather than on chords, including some of the music of Bartók, Stravinsky, Vaughan Williams, Charles Ives and composers of minimalist music. This and other modal music is, broadly, often considered tonal.
In the early 20th century the vocabulary of tonal theory is decisively influenced by two theorists: composer Arnold Schoenberg whose Harmonielehre (Theory of Harmony) describes in detail chords, chord progressions, vagrant chords, creation of tonal areas, voice leading in terms of harmony. To Schoenberg, every note has "structural function" to assert or deny a tonality, based on its tendency to establish or undermine a single tonic triad as central. At the same time Heinrich Schenker was evolving a theory based on expansion of horizontal relationships. To Schenker the background of every successful tonal piece is based on a simple cadence, which is then elaborated and elongated in the middleground and the background. Though adherents of the two theorists argued back and forth, in the mid-century a synthesis of their ideas was widely taught as "tonal theory", most particularly Schenker's use of graphical analysis, and Schoenberg's emphasis on tonal distance.
The practice of jazz developed its own theory of tonality, stating that while the cadence is not central to establishing a tonality—the presence of the I and V chords and either the IV or ii chord in progression is. This theory emphasized the play of modal elements against tonal elements, in an effort to allow improvisation, and inflection of standard melodies. Among theorists influenced by this view are Meier, Schillinger and the be-bop school of Jazz.
While many regard the works of Schoenberg post 1911 as "atonal," one influential school of thought, to which Schoenberg himself belonged, argued that chromatic composition led to a "new tonality", this view is argued by George Perle in his works on "post diatonic tonality". The central idea of this theory is that music is always perceived as having a center, and even in a fully chromatic work, composers establish and disintegrate centers in a manner analogous to traditional harmony. This view is highly controversial, and remains a topic of intense debate.
However, tonality may be considered generally with no restrictions as to the date or place at which the music was produced, or (very little) restriction as to the materials and methods used. This definition includes much non-western music and western music before 17th century. By the middle of the twentieth century, it had become "evident that triadic structure does not necessarily generate a tone center, that nontriadic harmonic formations may be made to function as referential elements, and that the assumption of a twelve-tone complex does not preclude the existence of tone centers" (Perle 1991, 8). Centric is sometimes used to describe music which is not traditionally tonal but which nevertheless has a relatively strong tonal center. See: pitch center.
In the early 20th century, the tonality which had prevailed since the 1600s was seen to have reached a crisis or break down point. Because of the "increased use of ambiguous chords, the less probable harmonic progressions, and the more unusual melodic and rhythmic inflections", the syntax of functional harmony was loosened to the point where "At best, the felt probabilities of the style system had become obscure; at worst, they were approaching a uniformity which provided few guides for either composition or listening" (Meyer 1967, 241). This led to a series of responses, many of which were considered irreconcilable with tonal theory or tonality at all. At the same time, other composers and theorists maintained that tonality had been stretched but not broken. This led to more technical vocabularies to describe tonality, including pitch classes, pitch sets, graphical analysis, and describing works in terms, not of their notes, but of their dominant intervals.
While tonality is the most common form of organizing Western Music, it is not universal, nor is the seven-note scale universal. However, Alfred Einstein wrote, regarding the ancient civilizations, that in ancient China "the development from the non-semitonal pentatonic to the seven-note scale is certainly traceable, even though the old pentatonic always remained the foundation of its music" (Einstein 1954, 7). He similarly notes the same kind of thing regarding ancient Japan, and Java. Much folk music and the art music of many cultures focus on a pentatonic, or five-note scale, including Beijing Opera, the folk music of Hungary, and the musical traditions of Japan.
Pre-classical concert music was largely modal, as is much folk and some popular music. In the early 20th century many techniques were developed and applied to tonal music, such as non-tertian secundal or quartal music. Some, such as Benjamin Boretz, consider tonal theory a specific part of atonal theory or musical set theory, which is in turn part of a more general theory of music. Many composers such as Darius Milhaud and Philip Glass have been interested in bitonality. While at one point in the middle of the 20th century classical composers interested in the twelve tone technique and serialism declared tonality dead, many composers have since returned to tonality, including many minimalists and older composers such as George Rochberg. Other composers never abandoned tonality entirely such as Lou Harrison who says he has "always composed both modally and chromatically" (Harrison, 1992) (page#). Much music today that is described as tonal is nonfunctional tonality such as in that of Claude Debussy, Steve Reich, Aaron Copland and many others.
# Terms
David Cope (1997) considers key, consonance or relaxation and dissonance or tension, and hierarchical relationships to be the three most basic concepts in tonality. In describing these tenets of tonal music, several known terms are used to refer to various elements of tonal
## Tonality
Music is considered to be tonal if it includes the following five features:
(1) it uses a Major or minor (diatonic) scale system
(2) it contains triadic harmonies (three note chords built from major and minor thirds)
(3) it has a tonic (central tone)
(4) it has a leading tone (7th scale degree a semitone below the tonic)
(5) resolution of active tones (that is, if a chord or note is played that doesn't sound final (like a leading tone 7th scale degree, in most circumstances), a more final-sounding chord or tone is played after it (like the tonic) to resolve the piece)
Since the mid-18th century, tonal music has been increasingly composed of a 12-note chromatic scale in a system of equal temperament. Tonal music makes reference to "scales" of notes selected as a series of steps from the chromatic scale. Most of these scales are of 5, 6, or 7 notes with the vast majority of tonal music pitches conforming to one of four specific seven-note scales: major, natural minor, melodic minor, and harmonic minor.
C major scale:
C major scale ascending and descending
A natural minor scale:
A natural minor scale ascending
Other scales or modes are often introduced for variety within the context of a major-minor tonal system without disturbing the diatonic nature of the work. The major scale predominates and the melodic minor contains nine pitches (seven with two alterable). The seven basic notes of a scale are notated in the key signature, and whether the piece is in the major or minor key is either stated in the title or implied in the piece (there is a major and minor key for each key signature). While other scales and modes are used in tonal music, particularly after 1890, these two scales are the reference point for most tonal music and its vocabulary.
Other important scales include the other church modes, the blues scale, the whole tone scale used by many Russian composers, pentatonic scale and the chromatic scale. Since none of these are the major or minor diatonic scales, music written exclusively with them is, by the definition above, not tonal.
Tone-centric music composed in other scale systems may be microtonal, and while microtonal music theory may draw from tonal theory, it is generally treated separately in textbooks and other works on musicTemplate:Weasel-inline. However, within the tonal system, notes "between" the chromatic system are used in various contexts, including quarter tones and various effects such as portamento or glissando, where the instrumentalist moves between established notes of the diatonic scale. These are usually thought ofTemplate:Weasel-inline as being for "colour" rather than harmonic function, and do not disturb the fundamental (diatonic) scale being used.
Chords are built from notes of a diatonic scale, or secondarily on chromatic notes treated as variations or embellishments of the basic scale. The identity of the scale is important in that the scale's steps used as roots determine the system of chord relationships. At any given time one scale degree is heard as the most important (the "tonic"), and the chord built on it, always a major or minor triad, is heard as the most forceful closure.
### Roman numerals
In notation, each note or degree of the scale is often designated by a Roman numeral, or, less commonly, solfege:
## Chords
These numerals also may indicate chords which are built upon the indicated degree. This degree is then known as the root of that chord. Thus "I" describes the tonic chord, the chord built on the tonic note, at a given time. These chords are generally all triads (having three notes, built from thirds, and having a diatonic function).
C triad, major chord built on the note C and in root position
The degree of a scale is both the pitch (frequency) of that note and that pitch's diatonic function (role), which is why chords are named by scale degree. Thus the notes of a chord do not have to be sounded simultaneously, and one to two notes may function as, or imply, a three (or more) note chord. Thus a chord described as "V" is based on the fifth note of the prevailing tonic scale (V-VII-II). In C Major, that would be a triad based on G, and would be the G Major triad (G-B-D). To describe a chord progression, the Roman numerals of the chords are listed. Thus IV-V-I describes a chord progression of a chord based on the fourth note of a scale, then one based on the fifth note of the scale, and then one on the first note of the scale.
Chords are then further named according to their quality or makeup, determined by the scale notes which lie a third and fifth (two thirds) above the degree a chord is built upon. Capital Roman numerals refer to the major chord, and lower-case Roman numerals refer to the minor chord. Quality is generally not as important as the chord's root.
This means that in the traditional major scale, the ii, iii and vi are minor chords, where as I, IV, V are major. The chord on the seventh note is a diminished triad and is written vii with a degree sign. Numbers attached to a chord indicate additional notes, and one of the most important chords in tonal harmony is the V7 chord, which is a four note chord that includes the fourth note of the tonic scale. The "7" refers to a note seven diatonic steps up from the fundamental note of the chord, not the seventh note of the tonic scale.
### Inversion
A chord's root is determined by which note establishes the chord's relationship to the tonic and not which is in the bass, or the lowest played note. Thus chords are said to be "inverted" when this root note is not sounded as the lowest. For example in C Major C-E-G is the tonic chord. If C is not the lowest note played, it is said to be in "inversion". The first inversion would be E-G-C, and the second inversion would be G-C-E. Since inverted chords are also chords in their own right, in context a chord is sometimes thought to be inverted only when voice leading implies it.
## Form
The traditional form of tonal music begins and ends on the tonic of the piece, and many tonal works move to a closely related key, such as the dominant of the main tonality (for example sonata form). Establishing a tonality is traditionally accomplished through a cadence which is two chords in succession which give a feeling of completion or rest - the most common being V7-I cadence. Other cadences are considered to be less powerful. The cadences determines the form of a tonal piece of music, and the placement of cadences, their preparation and establishment as cadences, as opposed to simply chord progressions, is central to the theory and practice of tonal music.
## Harmony
Most tonality uses "functional harmony", which is a term used to describe music where changes in the predominate scale or additional notes to chords are explainable by their place in stabilizing or destabilizing a tonality. This is a complex way of saying that it is possible to explain why a particular note was included, and what that note means in relation to the tonic chord. Harmony with a large number of notes which do not have clear structural function is called "nonfunctional" harmony, which is not to imply "dysfunctional", but merely that the additional notes are not to be played or heard as restricting or advancing the harmonic progression.
## Consonance and dissonance
In the context of tonal organization a chord or a note is said to be "consonant" when it implies stability, and "dissonant" when it implies instability. This is not the same as the ordinary use of the words consonant and dissonant. A dissonant chord is in tension against the tonic, and implies that the music is distant from that tonic chord. "Resolution" is the process by which the harmonic progression moves from dissonant chords to consonant chords and follows counterpoint or voice leading. Voice leading is a description of the "horizontal" movement of the music, as opposed to chords which are considered the "vertical".
Traditional tonal music is described in terms of a scale of notes. On the notes of that scale are built chords. Chords in order form a progression. Progressions establish or deny a particular chord as being the tonic chord. The cadence is held to be the sequence of chords which establishes one chord as being the tonic chord; more powerful cadences create a greater sense of closure and a stronger sense of key. Chords have a function when it can be explained how they lead the music towards or away from a particular tonic chord. When the sense of which tonic chord is changed, the music is said to have "changed key" or "modulated". Roman numerals and numbers are used to describe the relationship of a particular chord to the tonic chord.
The techniques of accomplishing this process, are the subject of tonal music theory and compositional practice.
# Theoretical underpinnings
Tonality allows for a great range of musical materials, structures, meanings, and understandings. It does this through establishing a tonic, or central chord based on a pitch which is the lowest degree of a scale, and a somewhat flexible network of relations between any pitch or chord and the tonic similar to perspective in painting. This is what is meant by tonality having a hierarchical relationship, one triad, the tonic triad, is the "center of gravity" to which other chords are supposed to lead. Changing which chord is felt to be the tonic triad is referred to as "modulation". As within a musical phrase, interest and tension may be created through the move from consonance to dissonance and back, a larger piece will also create interest by moving away from and back to the tonic and tension by destabilizing and re-establishing the key. Distantly related pitches and chords may be considered dissonant in and of themselves since their resolution to the tonic is implied. Further, temporary secondary tonal centers may be established by cadences or simply passed through in a process called modulation, or simultaneous tonal centers may be established through polytonality. Additionally, the structure of these features and processes may be linear, cyclical, or both. This allows for a huge variety of relations to be expressed through dissonance and consonance, distance or proximity to the tonic, the establishment of temporary or secondary tonal centers, and/or ambiguity as to tonal center. Music notation was created to accommodate tonality and facilitates interpretation.
The majority of tonal music assumes that notes spaced over several octaves are perceived the same way as if they were played in one octave or octave equivalency. Tonal music also assumes that scales have harmonic implication or diatonic functionality. This is generally held to imply that a note which has different places in a chord will be heard differently, and that therefore there is not enharmonic equivalency. In tonal music chords which are moved to different keys, or played with different root notes are not perceived as being the same, and thus transpositional equivalency and far less still inversional equivalency are not generally held to apply.
A successful tonal piece of music, or a successful performance of one, will give the listener a feeling that a particular chord — the tonic chord — is the most stable and final. It will then use musical materials to tell the musician and the listener how far the music is from that tonal center, most commonly, though not always, to heighten the sense of movement and drama as to how the music will resolve the tonic chord. The means for doing this are described by the rules of harmony and counterpoint (some influential theorists prefer the term "thoroughbass" instead of harmony, but the concept is the same). Counterpoint is the study of linear resolutions of music, while harmony encompasses the sequences of chords which form a chord progression.
Though modulation may occur instantaneously without indication or preparation, the least ambiguous way to establish a new tonal center is through a cadence, a succession of two or more chords which ends a section and/or gives a feeling of closure or finality, or series of cadences. Traditionally cadences act both harmonically to establish tonal centers and formally to articulate the end of sections, just as the tonic triad is harmonically central, a dominant-tonic cadence will be structurally central. The more powerful the cadence, the larger the section of music it can close. The strongest cadence is the perfect authentic cadence, which moves from the dominant to the tonic, most strongly establishes tonal center, and ends the most important sections of tonal pieces, including the final section. This is the basis of the "dominant-tonic" or "tonic-dominant" relationship. Common practice placed a great deal of emphasis on the correct use of cadences to structure music, and cadences were placed precisely to define the sections of a work. However, such strict use of cadences gradually gave way to more complex procedures where whole families of chords were used to imply particular distance from the tonal center. Composers, beginning in the late 18th Century began using chords (such as the Neapolitan, French or Italian Sixth) which temporarily suspended a sense of key, and by freely changing between the major and minor voicing for the tonic chord, thereby making the listener unsure whether the music was major or minor. There was also a gradual increase in the use of notes which were not part of the basic 7 notes, called chromaticism, culminating in post-Wagnerian music such as that by Mahler and Strauss and trends such as impressionism and dodecaphony.
One area of disagreement, going back to the origin of the term tonality, is whether, and to what degree, tonality is "natural" or inherent in acoustical phenomena, and whether, and to what degree, it is inherent in the human nervous system, or a psychological construct and, if the latter, whether it is inborn or learned, or some combination of these possibilities (Meyer 1967, 236). A viewpoint held by many theorists since the third quarter of the 19th century holds that diatonic scales and tonality arise from natural overtones (Riemann 1872, 1875, 1882, 1893, 1905, 1914–15; Schenker 1906–35; Hindemith 1937–70), following the publication in 1862 of the first edition of Helmholtz's On the Sensation of Tone (Helmholtz 1877).
## Effect
Rudolph Réti differentiates between harmonic tonality, of the traditional homophonic kind, and melodic tonality, as in monophonic. He argues that in the progression I-x-V-I (and all progressions), V-I is the only step "which as such produces the effect of tonality," and that all other chord successions, diatonic or not, though being closer or farther from the tonic-dominant, are "the composer's free invention." He describes melodic tonality as being "entirely different from the classical type," wherein, "the whole line is to be understood as a musical unit mainly through its relationship to this basic note ," this note not always being the tonic that would be interpreted according to harmonic tonality. His examples are ancient Jewish and Gregorian chant and other Eastern music, and he points out how these melodies often may be interrupted at any point and returned to the tonic, yet harmonically tonal melodies, such as that from Mozart's The Magic Flute below, are actually "strict harmonic-rhythmic pattern," and include many points "from which it is impossible, that is, illogical, unless we want to destroy the innermost sense of the whole line." (Reti, 1958)
The tonic feels more or less natural after each note of, for example, Mozart's The Magic Flute
Consequently, he argues, melodically tonal melodies resist harmonization and only reemerge in western music after, "harmonic tonality was abandoned," as in the music of Claude Debussy: "melodic tonality plus modulation is modern tonality." (page 23) | Tonality
# Overview
Tonality is a system of music in which certain hierarchical pitch relationships are based on a key "center" or tonic. The term tonalité originated with Alexandre-Étienne Choron (1810) and was borrowed by François-Joseph Fétis in 1840 (Reti, 1958; Simms 1975, 119; Judd, 1998; Dahlhaus 1990). Although Fétis used it as a general term for a system of musical organization and spoke of types de tonalités rather than a single system, today the term is most often used to refer to Major-Minor tonality (also called diatonic tonality or functional tonality), the system of musical organization of the common practice period and most popular music in much of the world today.
# History
Theories of tonal music are generally dated from Jean-Philippe Rameau's Treatise on Harmony (1722), where he describes music written through chord progressions, cadences and structure. He claims that his work represents "the practice of the last 40 years [1682-1722]", however, this is probably not the case. Rameau's work, initially controversial, was introduced to Germany by Friedrich Wilhelm Marpurg (1757) and adopted by him in his explanation of the music of Johann Sebastian Bach (Marpurg 1753–54). The vocabulary of describing notes in relationship to the tonic note, and the use of harmonic progressions and cadences becomes absorbed into the practice of Bach. Essential to this version of tonal theory are the chorales harmonizations of Bach, and the method by which a church melody is given a four part harmony by assigning cadences, and then creating a "natural", meaning in this case the most direct, thoroughbass and then filling in the middle voices.
In 1821 Castil-Blaze used tonalité for what he called cordes tonales (today primary triads), the tonic, fourth (subdominant), and fifth (dominant). All other chords were cordes melodiques.[citation needed] Hugo Riemann defined tonality as, "the special meaning [functions] that chords receive through their relationship to a fundamental sonority, the tonic triad."[citation needed]
Commonly used to refer to whether something is major or minor.
Fétis (1844) defined tonality, specifically tonalité moderne as the, "set of relationships, simultaneous or successive, among the tones of the scale," allowing for other types de tonalités among different cultures. Further he considered tonalité moderne as "trans-tonic order" and tonalité ancienne "uni-tonic order", trans-tonic meaning simply that the dominant seventh both establishes the key and allows for modulation to other keys. He described his earliest example of tonalité moderne: "In the passage quoted here from Monteverdi's madrigal [Cruda amarilli, mm.9-19 and 24-30], one sees a tonality determined by the accord parfait [root position major chord] on the tonic, by the sixth chord assigned to the third and seventh degrees, by the optional choice of the accord parfait or the sixth chord on the sixth degree, and finally, by the accord parfait and, above all, by the unprepared seventh chord (with major third) on the dominant." (p.171)
Fétis believed that tonality, tonalité moderne, was entirely cultural, "For the elements of music, nature provides nothing but a multitude of tones differing in pitch, duration, and intensity by the greater or least degree...The conception of the relationships that exist among them is awakened in the intellect, and, by the action of sensitivity on the one hand, and will on the other, the mind coordinates the tones into different series, each of which corresponds to a particular class of emotions, sentiments, and ideas. Hence these series become various types of tonalities." (p.11f) "But one will say, 'What is the principle behind these scales, and what, if not acoustic phenomena and the laws of mathematics, has set the order of their tones?' I respond that this principle is purely metaphysical [anthropological]. We conceive this order and the melodic and harmonic phenomena that spring from it out of our conformation and education." (p.249) In contrast, Hugo Riemann believed tonality, "affinites between tones" or Tonverwandtschaften, was entirely natural and, following Moritz Hauptmann (1853), that the major third and perfect fifth were the only "directly intelligible" intervals, and that I, IV, and V, the tonic, subdominant, and dominant were related by the perfect fifths between their roots. (Dahlhaus 1990, p.101-2)
By the 1840s the practice of harmony had expanded to include more chromatic notes, a wider chord vocabulary, particularly the more frequent used of the diminished seventh chord - a four note chord of all minor thirds which could lead to any other chord. It is in this era that the word "tonality" becomes more commonly used. At the same time the elaboration of both the fugue and the sonata form in terms of key relationships becomes more rigorous, and the study of harmonic progressions, voice leading and ambiguity of key becomes more precise.
Theorists such as Edward Lowinsky, Hugo Riemann, and others pushed the date at which modern tonality began, and the cadence began to be seen as the definitive way that a tonality is established in a work of music (Judd, 1998).
In response Bernhard Meier instead used a "tonality" and "modality", modern vs ancient, dichotomy, with Renaissance music being modal. The term modality has been criticized by Harold Powers, among others. However, it is widely used to describe music whose harmonic function centers on notes rather than on chords, including some of the music of Bartók, Stravinsky, Vaughan Williams, Charles Ives and composers of minimalist music. This and other modal music is, broadly, often considered tonal.
In the early 20th century the vocabulary of tonal theory is decisively influenced by two theorists: composer Arnold Schoenberg whose Harmonielehre (Theory of Harmony) describes in detail chords, chord progressions, vagrant chords, creation of tonal areas, voice leading in terms of harmony. To Schoenberg, every note has "structural function" to assert or deny a tonality, based on its tendency to establish or undermine a single tonic triad as central. At the same time Heinrich Schenker was evolving a theory based on expansion of horizontal relationships. To Schenker the background of every successful tonal piece is based on a simple cadence, which is then elaborated and elongated in the middleground and the background. Though adherents of the two theorists argued back and forth, in the mid-century a synthesis of their ideas was widely taught as "tonal theory", most particularly Schenker's use of graphical analysis, and Schoenberg's emphasis on tonal distance.
The practice of jazz developed its own theory of tonality, stating that while the cadence is not central to establishing a tonality—the presence of the I and V chords and either the IV or ii chord in progression is. This theory emphasized the play of modal elements against tonal elements, in an effort to allow improvisation, and inflection of standard melodies. Among theorists influenced by this view are Meier, Schillinger and the be-bop school of Jazz.
While many regard the works of Schoenberg post 1911 as "atonal," one influential school of thought, to which Schoenberg himself belonged, argued that chromatic composition led to a "new tonality", this view is argued by George Perle in his works on "post diatonic tonality".[verification needed] The central idea of this theory is that music is always perceived as having a center, and even in a fully chromatic work, composers establish and disintegrate centers in a manner analogous to traditional harmony. This view is highly controversial, and remains a topic of intense debate.
However, tonality may be considered generally with no restrictions as to the date or place at which the music was produced, or (very little) restriction as to the materials and methods used. This definition includes much non-western music and western music before 17th century. By the middle of the twentieth century, it had become "evident that triadic structure does not necessarily generate a tone center, that nontriadic harmonic formations may be made to function as referential elements, and that the assumption of a twelve-tone complex does not preclude the existence of tone centers" (Perle 1991, 8). Centric is sometimes used to describe music which is not traditionally tonal but which nevertheless has a relatively strong tonal center. See: pitch center.
In the early 20th century, the tonality which had prevailed since the 1600s was seen to have reached a crisis or break down point. Because of the "increased use of ambiguous chords, the less probable harmonic progressions, and the more unusual melodic and rhythmic inflections", the syntax of functional harmony was loosened to the point where "At best, the felt probabilities of the style system had become obscure; at worst, they were approaching a uniformity which provided few guides for either composition or listening" (Meyer 1967, 241). This led to a series of responses, many of which were considered irreconcilable with tonal theory or tonality at all. At the same time, other composers and theorists maintained that tonality had been stretched but not broken. This led to more technical vocabularies to describe tonality, including pitch classes, pitch sets, graphical analysis, and describing works in terms, not of their notes, but of their dominant intervals.
While tonality is the most common form of organizing Western Music, it is not universal,[citation needed] nor is the seven-note scale universal.[citation needed] However, Alfred Einstein wrote, regarding the ancient civilizations, that in ancient China "the development from the non-semitonal pentatonic to the seven-note scale is certainly traceable, even though the old pentatonic always remained the foundation of its music" (Einstein 1954, 7). He similarly notes the same kind of thing regarding ancient Japan, and Java. Much folk music and the art music of many cultures focus on a pentatonic, or five-note scale, including Beijing Opera, the folk music of Hungary, and the musical traditions of Japan.
Pre-classical concert music was largely modal,[citation needed] as is much folk and some popular music.[citation needed] In the early 20th century many techniques were developed and applied to tonal music, such as non-tertian secundal or quartal music.[citation needed] Some, such as Benjamin Boretz,[citation needed] consider tonal theory a specific part of atonal theory or musical set theory, which is in turn part of a more general theory of music.[citation needed] Many composers such as Darius Milhaud and Philip Glass have been interested in bitonality. While at one point in the middle of the 20th century classical composers interested in the twelve tone technique and serialism declared tonality dead,[citation needed] many composers have since returned to tonality,[citation needed] including many minimalists and older composers such as George Rochberg. Other composers never abandoned tonality entirely such as Lou Harrison who says he has "always composed both modally and chromatically" (Harrison, 1992)[citation needed] (page#). Much music today that is described as tonal is nonfunctional tonality such as in that of Claude Debussy, Steve Reich, Aaron Copland and many others.[citation needed]
# Terms
Template:CopyeditCarl Dahlhaus (1990) lists the characteristic schemata of tonal harmony, "typified in the compositional formulas of the 16th and early 17th centuries," as the "complete cadence" (vollständige Kadenz), I-IV-V-I, I-IV-I-V-I, or even I-ii-V-I; the circle of fifths progression: I-IV-vii-iii-vi-ii-V-I, and the "major-minor parallelism", minor: v-i-VII-III = major: iii-vi-V-I or minor: III-VII-i-v = major: I-V-vi-iii.
David Cope (1997) considers key, consonance or relaxation and dissonance or tension, and hierarchical relationships to be the three most basic concepts in tonality. In describing these tenets of tonal music, several known terms are used to refer to various elements of tonal
## Tonality
Music is considered to be tonal if it includes the following five features[citation needed]:
(1) it uses a Major or minor (diatonic) scale system
(2) it contains triadic harmonies (three note chords built from major and minor thirds)
(3) it has a tonic (central tone)
(4) it has a leading tone (7th scale degree a semitone below the tonic)
(5) resolution of active tones (that is, if a chord or note is played that doesn't sound final (like a leading tone 7th scale degree, in most circumstances), a more final-sounding chord or tone is played after it (like the tonic) to resolve the piece)
Since the mid-18th century, tonal music has been increasingly composed of a 12-note chromatic scale in a system of equal temperament. Tonal music makes reference to "scales" of notes selected as a series of steps from the chromatic scale.[citation needed] Most of these scales are of 5, 6, or 7 notes with the vast majority of tonal music pitches conforming to one of four specific seven-note scales: major, natural minor, melodic minor, and harmonic minor.[citation needed]
C major scale:
C major scale ascending and descending
A natural minor scale:
A natural minor scale ascending
Other scales or modes are often introduced for variety within the context of a major-minor tonal system without disturbing the diatonic nature of the work. The major scale predominates and the melodic minor contains nine pitches (seven with two alterable). The seven basic notes of a scale are notated in the key signature, and whether the piece is in the major or minor key is either stated in the title or implied in the piece (there is a major and minor key for each key signature). While other scales and modes are used in tonal music, particularly after 1890,[citation needed] these two scales are the reference point for most tonal music and its vocabulary.
Other important scales include the other church modes,[citation needed] the blues scale, the whole tone scale used by many Russian composers,[citation needed] pentatonic scale and the chromatic scale. Since none of these are the major or minor diatonic scales, music written exclusively with them is, by the definition above, not tonal.
Tone-centric music composed in other scale systems may be microtonal, and while microtonal music theory may draw from tonal theory, it is generally treated separately in textbooks and other works on musicTemplate:Weasel-inline. However, within the tonal system, notes "between" the chromatic system are used in various contexts, including quarter tones and various effects such as portamento or glissando, where the instrumentalist moves between established notes of the diatonic scale. These are usually thought ofTemplate:Weasel-inline as being for "colour" rather than harmonic function, and do not disturb the fundamental (diatonic) scale being used.
Chords are built from notes of a diatonic scale, or secondarily on chromatic notes treated as variations or embellishments of the basic scale. The identity of the scale is important in that the scale's steps used as roots determine the system of chord relationships. At any given time one scale degree is heard as the most important (the "tonic"), and the chord built on it, always a major or minor triad, is heard as the most forceful closure.
### Roman numerals
In notation, each note or degree of the scale is often designated by a Roman numeral, or, less commonly, solfege:
## Chords
These numerals also may indicate chords which are built upon the indicated degree. This degree is then known as the root of that chord. Thus "I" describes the tonic chord, the chord built on the tonic note, at a given time. These chords are generally all triads (having three notes, built from thirds, and having a diatonic function).
C triad, major chord built on the note C and in root position
The degree of a scale is both the pitch (frequency) of that note and that pitch's diatonic function (role), which is why chords are named by scale degree. Thus the notes of a chord do not have to be sounded simultaneously, and one to two notes may function as, or imply, a three (or more) note chord. Thus a chord described as "V" is based on the fifth note of the prevailing tonic scale (V-VII-II). In C Major, that would be a triad based on G, and would be the G Major triad (G-B-D). To describe a chord progression, the Roman numerals of the chords are listed. Thus IV-V-I describes a chord progression of a chord based on the fourth note of a scale, then one based on the fifth note of the scale, and then one on the first note of the scale.
Chords are then further named according to their quality or makeup, determined by the scale notes which lie a third and fifth (two thirds) above the degree a chord is built upon. Capital Roman numerals refer to the major chord, and lower-case Roman numerals refer to the minor chord. Quality is generally not as important as the chord's root.
This means that in the traditional major scale, the ii, iii and vi are minor chords, where as I, IV, V are major. The chord on the seventh note is a diminished triad and is written vii with a degree sign. Numbers attached to a chord indicate additional notes, and one of the most important chords in tonal harmony is the V7 chord, which is a four note chord that includes the fourth note of the tonic scale. The "7" refers to a note seven diatonic steps up from the fundamental note of the chord, not the seventh note of the tonic scale.
### Inversion
A chord's root is determined by which note establishes the chord's relationship to the tonic and not which is in the bass, or the lowest played note. Thus chords are said to be "inverted" when this root note is not sounded as the lowest. For example in C Major C-E-G is the tonic chord. If C is not the lowest note played, it is said to be in "inversion". The first inversion would be E-G-C, and the second inversion would be G-C-E. Since inverted chords are also chords in their own right, in context a chord is sometimes thought to be inverted only when voice leading implies it.
## Form
The traditional form of tonal music begins and ends on the tonic of the piece, and many tonal works move to a closely related key, such as the dominant of the main tonality (for example sonata form). Establishing a tonality is traditionally accomplished through a cadence which is two chords in succession which give a feeling of completion or rest - the most common being V7-I cadence. Other cadences are considered to be less powerful. The cadences determines the form of a tonal piece of music, and the placement of cadences, their preparation and establishment as cadences, as opposed to simply chord progressions, is central to the theory and practice of tonal music.
## Harmony
Most tonality uses "functional harmony", which is a term used to describe music where changes in the predominate scale or additional notes to chords are explainable by their place in stabilizing or destabilizing a tonality. This is a complex way of saying that it is possible to explain why a particular note was included, and what that note means in relation to the tonic chord. Harmony with a large number of notes which do not have clear structural function is called "nonfunctional" harmony, which is not to imply "dysfunctional", but merely that the additional notes are not to be played or heard as restricting or advancing the harmonic progression.
## Consonance and dissonance
In the context of tonal organization a chord or a note is said to be "consonant" when it implies stability, and "dissonant" when it implies instability. This is not the same as the ordinary use of the words consonant and dissonant. A dissonant chord is in tension against the tonic, and implies that the music is distant from that tonic chord. "Resolution" is the process by which the harmonic progression moves from dissonant chords to consonant chords and follows counterpoint or voice leading. Voice leading is a description of the "horizontal" movement of the music, as opposed to chords which are considered the "vertical".
Traditional tonal music is described in terms of a scale of notes. On the notes of that scale are built chords. Chords in order form a progression. Progressions establish or deny a particular chord as being the tonic chord. The cadence is held to be the sequence of chords which establishes one chord as being the tonic chord; more powerful cadences create a greater sense of closure and a stronger sense of key. Chords have a function when it can be explained how they lead the music towards or away from a particular tonic chord. When the sense of which tonic chord is changed, the music is said to have "changed key" or "modulated". Roman numerals and numbers are used to describe the relationship of a particular chord to the tonic chord.
The techniques of accomplishing this process, are the subject of tonal music theory and compositional practice.
# Theoretical underpinnings
Tonality allows for a great range of musical materials, structures, meanings, and understandings. It does this through establishing a tonic, or central chord based on a pitch which is the lowest degree of a scale, and a somewhat flexible network of relations between any pitch or chord and the tonic similar to perspective in painting. This is what is meant by tonality having a hierarchical relationship, one triad, the tonic triad, is the "center of gravity" to which other chords are supposed to lead. Changing which chord is felt to be the tonic triad is referred to as "modulation". As within a musical phrase, interest and tension may be created through the move from consonance to dissonance and back, a larger piece will also create interest by moving away from and back to the tonic and tension by destabilizing and re-establishing the key. Distantly related pitches and chords may be considered dissonant in and of themselves since their resolution to the tonic is implied. Further, temporary secondary tonal centers may be established by cadences or simply passed through in a process called modulation, or simultaneous tonal centers may be established through polytonality. Additionally, the structure of these features and processes may be linear, cyclical, or both. This allows for a huge variety of relations to be expressed through dissonance and consonance, distance or proximity to the tonic, the establishment of temporary or secondary tonal centers, and/or ambiguity as to tonal center. Music notation was created to accommodate tonality and facilitates interpretation.
The majority of tonal music assumes that notes spaced over several octaves are perceived the same way as if they were played in one octave or octave equivalency. Tonal music also assumes that scales have harmonic implication or diatonic functionality. This is generally held to imply that a note which has different places in a chord will be heard differently, and that therefore there is not enharmonic equivalency. In tonal music chords which are moved to different keys, or played with different root notes are not perceived as being the same, and thus transpositional equivalency and far less still inversional equivalency are not generally held to apply.
A successful tonal piece of music, or a successful performance of one, will give the listener a feeling that a particular chord — the tonic chord — is the most stable and final. It will then use musical materials to tell the musician and the listener how far the music is from that tonal center, most commonly, though not always, to heighten the sense of movement and drama as to how the music will resolve the tonic chord. The means for doing this are described by the rules of harmony and counterpoint (some influential theorists prefer the term "thoroughbass" instead of harmony, but the concept is the same). Counterpoint is the study of linear resolutions of music, while harmony encompasses the sequences of chords which form a chord progression.
Though modulation may occur instantaneously without indication or preparation, the least ambiguous way to establish a new tonal center is through a cadence, a succession of two or more chords which ends a section and/or gives a feeling of closure or finality, or series of cadences. Traditionally cadences act both harmonically to establish tonal centers and formally to articulate the end of sections, just as the tonic triad is harmonically central, a dominant-tonic cadence will be structurally central. The more powerful the cadence, the larger the section of music it can close. The strongest cadence is the perfect authentic cadence, which moves from the dominant to the tonic, most strongly establishes tonal center, and ends the most important sections of tonal pieces, including the final section. This is the basis of the "dominant-tonic" or "tonic-dominant" relationship. Common practice placed a great deal of emphasis on the correct use of cadences to structure music, and cadences were placed precisely to define the sections of a work. However, such strict use of cadences gradually gave way to more complex procedures where whole families of chords were used to imply particular distance from the tonal center. Composers, beginning in the late 18th Century began using chords (such as the Neapolitan, French or Italian Sixth) which temporarily suspended a sense of key, and by freely changing between the major and minor voicing for the tonic chord, thereby making the listener unsure whether the music was major or minor. There was also a gradual increase in the use of notes which were not part of the basic 7 notes, called chromaticism, culminating in post-Wagnerian music such as that by Mahler and Strauss and trends such as impressionism and dodecaphony.
One area of disagreement, going back to the origin of the term tonality, is whether, and to what degree, tonality is "natural" or inherent in acoustical phenomena, and whether, and to what degree, it is inherent in the human nervous system, or a psychological construct and, if the latter, whether it is inborn or learned, or some combination of these possibilities (Meyer 1967, 236). A viewpoint held by many theorists since the third quarter of the 19th century holds that diatonic scales and tonality arise from natural overtones (Riemann 1872, 1875, 1882, 1893, 1905, 1914–15; Schenker 1906–35; Hindemith 1937–70), following the publication in 1862 of the first edition of Helmholtz's On the Sensation of Tone (Helmholtz 1877).
## Effect
Rudolph Réti differentiates between harmonic tonality, of the traditional homophonic kind, and melodic tonality, as in monophonic. He argues that in the progression I-x-V-I (and all progressions), V-I is the only step "which as such produces the effect of tonality," and that all other chord successions, diatonic or not, though being closer or farther from the tonic-dominant, are "the composer's free invention." He describes melodic tonality as being "entirely different from the classical type," wherein, "the whole line is to be understood as a musical unit mainly through its relationship to this basic note [the tonic]," this note not always being the tonic that would be interpreted according to harmonic tonality. His examples are ancient Jewish and Gregorian chant and other Eastern music, and he points out how these melodies often may be interrupted at any point and returned to the tonic, yet harmonically tonal melodies, such as that from Mozart's The Magic Flute below, are actually "strict harmonic-rhythmic pattern[s]," and include many points "from which it is impossible, that is, illogical, unless we want to destroy the innermost sense of the whole line." (Reti, 1958)
The tonic feels more or less natural after each note of, for example, Mozart's The Magic Flute
Consequently, he argues, melodically tonal melodies resist harmonization and only reemerge in western music after, "harmonic tonality was abandoned," as in the music of Claude Debussy: "melodic tonality plus modulation is [Debussy's] modern tonality." (page 23) | https://www.wikidoc.org/index.php/Tonality | |
b21578e5a5dbd2de156bc70c5930648b1452cb82 | wikidoc | Toxicity | Toxicity
Toxicity is a measure of the degree to which something is toxic or poisonous. The study of poisons is known as toxicology. Toxicity can refer to the effect on a whole organism, such as a human or a bacterium or a plant, or to a substructure, such as a cell (cytotoxicity) or an organ (organotoxicity such as the liver (hepatotoxicity). By extension, the word may be metaphorically used to describe toxic effects on larger and more complex groups, such as the family unit or "society at large".
In the science of toxicology, the impact of an external substance or condition and its deleterious effects on living things: organisms, organ systems, individual organs, tissues, cells, subcellular units is the subject of study. A central concept of toxicology is that effects are dose-dependent; even water – generally not considered to be toxic – can lead to water intoxication when taken in large enough doses, whereas for even a very toxic substance such as snake venom there is a dose below which there is no detectable toxic effect.
Toxicity is the ability of a chemical or physical agent to induce detrimental temporary or permanent tissue change or to detrimentally interfere with normal biochemical processing.
# Types of toxicity
There are generally three types of toxic entities; chemical, biological, and physical.
- Chemicals include inorganic substances such as lead, hydrofluoric acid, and chlorine gas, organic compounds such as methyl alcohol, most medications, and poisons from living things.
- Biological toxic entities include those bacteria and viruses that are able to induce disease in living organisms. Biological toxicity can be complicated to measure because the "threshold dose" may be a single organism. Theoretically one virus, bacterium or worm can reproduce to cause a serious infection. However, in a host with an intact immune system the inherent toxicity of the organism is balanced by the host's ability to fight back; the effective toxicity is then a combination of both parts of the relationship. A similar situation is also present with other types of toxic agents.
- Physically toxic entities include things not usually thought of under the heading of "toxic" by many people: direct blows, concussion, sound and vibration, heat and cold, non-ionizing electromagnetic radiation such as infrared and visible light, and ionizing radiation such as X-rays and alpha, beta, and gamma radiation.
Toxicity can be measured by the effects on the target (organism, organ, tissue or cell). Because individuals typically have different levels of response to the same dose of a toxin, a population-level measure of toxicity is often used which relates the probability of an outcome for a given individual in a population. One such measure is the LD50. When such data does not exist, estimates are made by comparison to known similar toxic things, or to similar exposures in similar organisms. Then "safety factors" are added to account for uncertainties in data and evaluation processes. For example, if a dose of toxin is safe for a laboratory rat, one might assume that one tenth that dose would be safe for a human, allowing a safety factor of 10 to allow for interspecies differences between two mammals; if the data are from fish, one might use a factor of 100 to account for the greater difference between two chordate classes (fish and mammals). Similarly, an extra protection factor may be used for individuals believed to be more susceptible to toxic effects such as in pregnancy or with certain diseases. Or, a newly synthesized and previously unstudied chemical that is believed to be very similar in effect to another compound could be assigned an additional protection factor of 10 to account for possible differences in effects that are probably much smaller. Obviously, this approach is very approximate; but such protection factors are deliberately very conservative and the method has been found to be useful in a wide variety of applications.
The toxicity of cancer-causing agents is problematic, since for many such substances it is not certain if there is a minimal effective dose or whether the risk is just too small to see. There too the possibility exists that a single cell transformed into a cancer cell is all it takes to develop the full effect. Mixtures of chemicals are more difficult to assess in terms of toxicity than are single pure chemicals. Common mixture include gasoline, cigarette smoke, and industrial waste. Even more complex are situations with more than one type of toxic entity, such as the discharge from a malfunctioning sewage treatment plant, with both chemical and biological agents.
# Factors influencing toxicity
Toxicity of a substance can be affected by many different factors, such as the pathway of administration (whether the toxin is applied to the skin, ingested, inhaled, injected), the time of exposure (a brief encounter or long term), the number of exposures (a single dose or multiple doses over time), the physical form of the toxin (solid, liquid, gas), the genetic makeup of an individual, an individual's overall health, and many others. Several of the terms used to describe these factors have been included here.
# Etymology
"Toxic" and similar words came from Greek τοξον = "bow (weapon)" and via "poisoned arrow," which came to be used for "poison" in scientific language, as the usual Classical Greek word ('ιον) for "poison" would transcribe as "io-", which is not distinctive enough. In some biological names, "toxo-" still means "bow", as in Toxodon = "bow-toothed" from the shape. | Toxicity
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Toxicity is a measure of the degree to which something is toxic or poisonous. The study of poisons is known as toxicology. Toxicity can refer to the effect on a whole organism, such as a human or a bacterium or a plant, or to a substructure, such as a cell (cytotoxicity) or an organ (organotoxicity such as the liver (hepatotoxicity). By extension, the word may be metaphorically used to describe toxic effects on larger and more complex groups, such as the family unit or "society at large".
In the science of toxicology, the impact of an external substance or condition and its deleterious effects on living things: organisms, organ systems, individual organs, tissues, cells, subcellular units is the subject of study. A central concept of toxicology is that effects are dose-dependent; even water – generally not considered to be toxic – can lead to water intoxication when taken in large enough doses, whereas for even a very toxic substance such as snake venom there is a dose below which there is no detectable toxic effect.
Toxicity is the ability of a chemical or physical agent to induce detrimental temporary or permanent tissue change or to detrimentally interfere with normal biochemical processing.
# Types of toxicity
There are generally three types of toxic entities; chemical, biological, and physical.
- Chemicals include inorganic substances such as lead, hydrofluoric acid, and chlorine gas, organic compounds such as methyl alcohol, most medications, and poisons from living things.
- Biological toxic entities include those bacteria and viruses that are able to induce disease in living organisms. Biological toxicity can be complicated to measure because the "threshold dose" may be a single organism. Theoretically one virus, bacterium or worm can reproduce to cause a serious infection. However, in a host with an intact immune system the inherent toxicity of the organism is balanced by the host's ability to fight back; the effective toxicity is then a combination of both parts of the relationship. A similar situation is also present with other types of toxic agents.
- Physically toxic entities include things not usually thought of under the heading of "toxic" by many people: direct blows, concussion, sound and vibration, heat and cold, non-ionizing electromagnetic radiation such as infrared and visible light, and ionizing radiation such as X-rays and alpha, beta, and gamma radiation.
Toxicity can be measured by the effects on the target (organism, organ, tissue or cell). Because individuals typically have different levels of response to the same dose of a toxin, a population-level measure of toxicity is often used which relates the probability of an outcome for a given individual in a population. One such measure is the LD50. When such data does not exist, estimates are made by comparison to known similar toxic things, or to similar exposures in similar organisms. Then "safety factors" are added to account for uncertainties in data and evaluation processes. For example, if a dose of toxin is safe for a laboratory rat, one might assume that one tenth that dose would be safe for a human, allowing a safety factor of 10 to allow for interspecies differences between two mammals; if the data are from fish, one might use a factor of 100 to account for the greater difference between two chordate classes (fish and mammals). Similarly, an extra protection factor may be used for individuals believed to be more susceptible to toxic effects such as in pregnancy or with certain diseases. Or, a newly synthesized and previously unstudied chemical that is believed to be very similar in effect to another compound could be assigned an additional protection factor of 10 to account for possible differences in effects that are probably much smaller. Obviously, this approach is very approximate; but such protection factors are deliberately very conservative and the method has been found to be useful in a wide variety of applications.
The toxicity of cancer-causing agents is problematic, since for many such substances it is not certain if there is a minimal effective dose or whether the risk is just too small to see. There too the possibility exists that a single cell transformed into a cancer cell is all it takes to develop the full effect. Mixtures of chemicals are more difficult to assess in terms of toxicity than are single pure chemicals. Common mixture include gasoline, cigarette smoke, and industrial waste. Even more complex are situations with more than one type of toxic entity, such as the discharge from a malfunctioning sewage treatment plant, with both chemical and biological agents.
# Factors influencing toxicity
Toxicity of a substance can be affected by many different factors, such as the pathway of administration (whether the toxin is applied to the skin, ingested, inhaled, injected), the time of exposure (a brief encounter or long term), the number of exposures (a single dose or multiple doses over time), the physical form of the toxin (solid, liquid, gas), the genetic makeup of an individual, an individual's overall health, and many others. Several of the terms used to describe these factors have been included here.
# Etymology
"Toxic" and similar words came from Greek τοξον = "bow (weapon)" and via "poisoned arrow," which came to be used for "poison" in scientific language, as the usual Classical Greek word ('ιον) for "poison" would transcribe as "io-", which is not distinctive enough. In some biological names, "toxo-" still means "bow", as in Toxodon = "bow-toothed" from the shape. | https://www.wikidoc.org/index.php/Toxic | |
636060b55c404355d7c4bef2df035f31b0c15f47 | wikidoc | Transect | Transect
A transect is a path along which one records and counts occurrences of the phenomenon of study (e.g. plants noting each instance).
It requires an observer to move along a fixed path and to count occurrences along the path and, at the same time, obtain the distance of the object from the path. This results in an estimate of the area covered, an estimate of the way in which detectability increases from probability 0 to 1 as one approaches the path. Using these two figures one can arrive at an estimate of the actual density of objects.
The estimation of the abundance of biological populations (such as terrestrial mammal species) can be achieved using a number of different types of transect methods could be used, such as strip transects, line transects, belt transects, point transects and curved line transects.
New Urbanist town planners use the term transect to refer to the varieties of land use from an urban core to a rural boundary. General New Urban transect classifications (from highest to lowest density) are: urban core, urban center, general urban, suburban, rural, and natural. | Transect
A transect is a path along which one records and counts occurrences of the phenomenon of study (e.g. plants noting each instance).
It requires an observer to move along a fixed path and to count occurrences along the path and, at the same time, obtain the distance of the object from the path. This results in an estimate of the area covered, an estimate of the way in which detectability increases from probability 0 to 1 as one approaches the path. Using these two figures one can arrive at an estimate of the actual density of objects.
The estimation of the abundance of biological populations (such as terrestrial mammal species) can be achieved using a number of different types of transect methods could be used, such as strip transects, line transects, belt transects, point transects[1] and curved line transects.[2]
New Urbanist town planners use the term transect to refer to the varieties of land use from an urban core to a rural boundary.[3] General New Urban transect classifications (from highest to lowest density) are: urban core, urban center, general urban, suburban, rural, and natural.[4] | https://www.wikidoc.org/index.php/Transect | |
0cc513020d79b06b40cdf4efb0281908f38f6a59 | wikidoc | Trichome | Trichome
Trichomes, from the Greek meaning "growth of hair", are fine outgrowths or appendages on plants and certain protists. These are of diverse structure and function. Examples are hairs, glandular hairs, scales, and papillae.
# Algal trichomes
Certain—usually filamentous—algae, have the terminal cell produced into an elongate "hair-like" structure called a trichome. The same term is applied to such structures in some cyanobacteria.
# Plant trichomes
## Aerial surface hairs
Trichomes on plants are epidermal outgrowths of various kinds. The terms emergences or prickles refer to outgrowths that involve more than the epidermis. This distinction is not always easily applied (see Wait-a-bit climber). Also, there are nontrichomatous epidermal cells that protrude from the surface.
A common type of trichome is a hair. Plant hairs may be unicellular or multicellular, branched or unbranched. Multicellular hairs may have one or several layers of cells. Branched hairs can be dendritic (tree-like), tufted, or stellate (star-shaped).,
A common type of trichome is the scale or peltate hair: a plate or shield-shaped cluster of cells attached directly to the surface or borne on a stalk of some kind.
Any of the various types of hairs may be glandular.
In describing the surface appearance of plant organs, such as stems and leaves, many terms are used in reference to the presence, form, and appearance of trichomes. The most basic terms used are glabrous—lacking hairs— and pubescent—having hairs. Details are provided by:
- glabrous, glabrate – lacking hairs or trichomes; surface smooth.
- hirsute – coarsely hairy
- hispid – having bristly hairs
- downy – having an almost wool-like covering of long hairs
- pilose – pubescent with long, straight, soft, spreading or erect hairs
- puberulent – minutely pubescent; having fine, short, usually curly, hairs
- pubescent – bearing hairs or trichomes of any type
- strigillose – minutely strigose
- strigose – having straight hairs all pointing in more or less the same direction as along a margin or midrib.
- villosulous – minutely villous
- villous – having long, soft hairs, often curved, but not matted
Hairs on plants are extremely variable in their presence across species, location on plant organs, density (even within a species), and therefore functionality. However, several basic functions or advantages of having surface hairs can be listed. It is likely that in many cases, hairs interfere with the feeding of at least some small herbivores and, depending upon stiffness and irritability to the "palate", large herbivores as well. Hairs on plants growing in areas subject to frost keep the frost away from the living surface cells. In windy locations, hairs break-up the flow of air across the plant surface, reducing evaporation. Dense coatings of hairs reflect solar radiation, protecting the more delicate tissues underneath in hot, dry, open habitats. And in locations where much of the available moisture comes from cloud drip, hairs appear to enhance this process.
## Root hairs
Root hairs, the rhizoids of many vascular plants, are tubular outgrowths of trichoblasts, the hair-forming cells on the epidermis of a plant root. That is, root hairs are lateral extensions of a single cell and only rarely branched. Just prior to the root hair development, there is a point of elevated phosphorylase activity.
Root hairs vary between 5 and 17 micrometres in diameter, and 80 to 1,500 micrometres in length (Dittmar, cited in Esau, 1965).
Root hairs can survive for 2 to 3 weeks and then die off. At the same time new root hairs are continually being formed at the top of the root. This way, the root hair coverage stays the same.
It is therefore understandable that repotting must be done with care, because the root hairs are being pulled off for the most part. This is why planting out, leaves the plant withered for some time. | Trichome
Trichomes, from the Greek meaning "growth of hair", are fine outgrowths or appendages on plants and certain protists. These are of diverse structure and function. Examples are hairs, glandular hairs, scales, and papillae.
# Algal trichomes
Certain—usually filamentous—algae, have the terminal cell produced into an elongate "hair-like" structure called a trichome. The same term is applied to such structures in some cyanobacteria.
# Plant trichomes
## Aerial surface hairs
Trichomes on plants are epidermal outgrowths of various kinds. The terms emergences or prickles refer to outgrowths that involve more than the epidermis. This distinction is not always easily applied (see Wait-a-bit climber). Also, there are nontrichomatous epidermal cells that protrude from the surface.
A common type of trichome is a hair. Plant hairs may be unicellular or multicellular, branched or unbranched. Multicellular hairs may have one or several layers of cells. Branched hairs can be dendritic (tree-like), tufted, or stellate (star-shaped).,
A common type of trichome is the scale or peltate hair: a plate or shield-shaped cluster of cells attached directly to the surface or borne on a stalk of some kind.
Any of the various types of hairs may be glandular.
In describing the surface appearance of plant organs, such as stems and leaves, many terms are used in reference to the presence, form, and appearance of trichomes. The most basic terms used are glabrous—lacking hairs— and pubescent—having hairs. Details are provided by:
- glabrous, glabrate – lacking hairs or trichomes; surface smooth.
- hirsute – coarsely hairy
- hispid – having bristly hairs
- downy – having an almost wool-like covering of long hairs
- pilose – pubescent with long, straight, soft, spreading or erect hairs
- puberulent – minutely pubescent; having fine, short, usually curly, hairs
- pubescent – bearing hairs or trichomes of any type
- strigillose – minutely strigose
- strigose – having straight hairs all pointing in more or less the same direction as along a margin or midrib.
- villosulous – minutely villous
- villous – having long, soft hairs, often curved, but not matted
Hairs on plants are extremely variable in their presence across species, location on plant organs, density (even within a species), and therefore functionality. However, several basic functions or advantages of having surface hairs can be listed. It is likely that in many cases, hairs interfere with the feeding of at least some small herbivores and, depending upon stiffness and irritability to the "palate", large herbivores as well. Hairs on plants growing in areas subject to frost keep the frost away from the living surface cells. In windy locations, hairs break-up the flow of air across the plant surface, reducing evaporation. Dense coatings of hairs reflect solar radiation, protecting the more delicate tissues underneath in hot, dry, open habitats. And in locations where much of the available moisture comes from cloud drip, hairs appear to enhance this process.
## Root hairs
Root hairs, the rhizoids of many vascular plants, are tubular outgrowths of trichoblasts, the hair-forming cells on the epidermis of a plant root. That is, root hairs are lateral extensions of a single cell and only rarely branched. Just prior to the root hair development, there is a point of elevated phosphorylase activity.
Root hairs vary between 5 and 17 micrometres in diameter, and 80 to 1,500 micrometres in length (Dittmar, cited in Esau, 1965).
Root hairs can survive for 2 to 3 weeks and then die off. At the same time new root hairs are continually being formed at the top of the root. This way, the root hair coverage stays the same.
It is therefore understandable that repotting must be done with care, because the root hairs are being pulled off for the most part. This is why planting out, leaves the plant withered for some time. | https://www.wikidoc.org/index.php/Trichome | |
b4efcfeb49ad747c6266aeaea52cd5c68ad2691d | wikidoc | Triptans | Triptans
# Overview
Triptans are a family of tryptamine-based drugs used as abortive medication in the treatment of migraines and cluster headaches. Triptans are generally more effective than ergots and cause less nausea for migraine attacks, but they do not provide preventative therapy and are not considered as a cure.
Triptans include sumatriptan (Imitrex, Imigran, Cinie, Illument, Migriptan), rizatriptan (Maxalt), naratriptan (Amerge, Naramig), zolmitriptan (Zomig), eletriptan (Relpax), almotriptan (Axert, Almogran), frovatriptan (Frova, Migard, Frovamig), and avitriptan (BMS-180,048).
# Medical Uses
Triptans are used in the treatment of migraines and cluster headaches.
# Mechanism of Action
Their action is attributed to their agonist effects on serotonin 5-HT1B and 5-HT1D receptors in cranial blood vessels (causing their constriction) and subsequent inhibition of pro-inflammatory neuropeptide release. Evidence is accumulating that these drugs are effective because they act on serotonin receptors in nerve endings as well as the blood vessels. This leads to a decrease in the release of several peptides, including CGRP and substance P.
# Availability
These drugs have been available only by prescription (US, Canada and UK), but sumatriptan became available over-the-counter in the UK in June, 2006. The brand name of the OTC product in the UK is Imigran Recovery. The patent on Imitrex STATDose expired in December 2006, and injectable sumatriptan became available in generic formula in August 2008. Sumavel Dosepro is a needle free delivery of injectable sumatriptan that was approved in the US by the FDA in July 2009. Sumatriptan became available as a generic in the US in late 2009. Sumatriptan is over-the-counter in Romania, under the Imigran brand.
Sumatriptan is also available as a nasal spray, and Phase III clinical trials with a iontophoretic patch (Zelrix) are under way.
# Effectiveness
## Migraine
Sumatriptan and related selective serotonin receptor agonists are excellent for severe migraine attacks or those that do not respond to NSAIDs or other over-the-counter drugs. Triptans are a mid-line treatment suitable for many migraineurs with typical attacks. They may not work for atypical or unusually severe migraine attacks, transformed migraine, or status (continuous) migrainosus.
Triptans are highly effective, reducing the symptoms or aborting the attack within 30 to 90 minutes in 70-80% of patients.
Assessment of efficacy may be contaminated by how the triptan is encapsulated in order to mask active treatment.
A test measuring a person's skin sensitivity during a migraine may indicate whether the individual will respond to treatment with triptans. Triptans are most effective in those with no skin sensitivity; with skin sensitivity, it is best to take triptans within twenty minutes of the headache's onset.
## Altitude Sickness
A single randomized controlled trial found that sumatriptan may be able to prevent altitude sickness.
# Adverse Reactions
Triptans have few side effects if used in correct dosage and frequency. The most common adverse effect is recurrence of migraine. A systematic review found that "rizatriptan 10 mg was the only triptan with a recurrence rate greater than that of placebo".
There is a theoretical risk of coronary spasm in patients with established heart disease, and cardiac events after taking triptans may rarely occur.
There is the potential for life-threatening serotonin syndrome (a syndrome of changes in mental status, autonomic instability, neuromuscular abnormalities, and gastrointestinal symptoms) in patients taking triptans and selective serotonin reuptake inhibitors (SSRIs) or selective serotonin/norepinephrine reuptake inhibitors (SNRIs) at the same time.
At least two types of triptans (sumatriptan and rizatriptan) have been listed under the unacceptable medication by the Canadian Blood Services, as a potential risk to the recipient; hence, donors are required not to have taken the medication for the last 72 hours.
# Formulations of Triptans
### Oral Formulation
- Almotriptan
- Eletriptan
- Frovatriptan
- Naratriptan
- Rizatriptan
- Zolmitriptan
### Subcutaneous, Oral, and Spray Formulations
- Sumatriptan | Triptans
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Triptans are a family of tryptamine-based drugs used as abortive medication in the treatment of migraines and cluster headaches. Triptans are generally more effective than ergots and cause less nausea for migraine attacks, but they do not provide preventative therapy and are not considered as a cure.
Triptans include sumatriptan (Imitrex, Imigran, Cinie, Illument, Migriptan), rizatriptan (Maxalt), naratriptan (Amerge, Naramig), zolmitriptan (Zomig), eletriptan (Relpax), almotriptan (Axert, Almogran), frovatriptan (Frova, Migard, Frovamig), and avitriptan (BMS-180,048).
# Medical Uses
Triptans are used in the treatment of migraines and cluster headaches.
# Mechanism of Action
Their action is attributed to their agonist[2] effects on serotonin 5-HT1B and 5-HT1D receptors in cranial blood vessels (causing their constriction) and subsequent inhibition of pro-inflammatory neuropeptide release. Evidence is accumulating that these drugs are effective because they act on serotonin receptors in nerve endings as well as the blood vessels. This leads to a decrease in the release of several peptides, including CGRP and substance P.
# Availability
These drugs have been available only by prescription (US, Canada and UK), but sumatriptan became available over-the-counter in the UK in June, 2006.[3] The brand name of the OTC product in the UK is Imigran Recovery. The patent on Imitrex STATDose expired in December 2006, and injectable sumatriptan became available in generic formula in August 2008. Sumavel Dosepro is a needle free delivery of injectable sumatriptan that was approved in the US by the FDA in July 2009.[4] Sumatriptan became available as a generic in the US in late 2009. Sumatriptan is over-the-counter in Romania, under the Imigran brand.
Sumatriptan is also available as a nasal spray, and Phase III clinical trials with a iontophoretic patch (Zelrix) are under way.
# Effectiveness
## Migraine
Sumatriptan and related selective serotonin receptor agonists are excellent for severe migraine attacks or those that do not respond to NSAIDs [5] or other over-the-counter drugs.[6] Triptans are a mid-line treatment suitable for many migraineurs with typical attacks. They may not work for atypical or unusually severe migraine attacks, transformed migraine, or status (continuous) migrainosus.
Triptans are highly effective, reducing the symptoms or aborting the attack within 30 to 90 minutes in 70-80% of patients.[citation needed]
Assessment of efficacy may be contaminated by how the triptan is encapsulated in order to mask active treatment.[7]
A test measuring a person's skin sensitivity during a migraine may indicate whether the individual will respond to treatment with triptans.[8] Triptans are most effective in those with no skin sensitivity; with skin sensitivity, it is best to take triptans within twenty minutes of the headache's onset.
## Altitude Sickness
A single randomized controlled trial found that sumatriptan may be able to prevent altitude sickness.[9]
# Adverse Reactions
Triptans have few side effects if used in correct dosage and frequency. The most common adverse effect is recurrence of migraine. A systematic review found that "rizatriptan 10 mg was the only triptan with a recurrence rate greater than that of placebo".[10]
There is a theoretical risk of coronary spasm in patients with established heart disease, and cardiac events after taking triptans may rarely occur.[11]
There is the potential for life-threatening serotonin syndrome (a syndrome of changes in mental status, autonomic instability, neuromuscular abnormalities, and gastrointestinal symptoms) in patients taking triptans and selective serotonin reuptake inhibitors (SSRIs) or selective serotonin/norepinephrine reuptake inhibitors (SNRIs) at the same time.[12]
At least two types of triptans (sumatriptan and rizatriptan) have been listed under the unacceptable medication by the Canadian Blood Services, as a potential risk to the recipient; hence, donors are required not to have taken the medication for the last 72 hours.
# Formulations of Triptans
### Oral Formulation
- Almotriptan
- Eletriptan
- Frovatriptan
- Naratriptan
- Rizatriptan
- Zolmitriptan
### Subcutaneous, Oral, and Spray Formulations
- Sumatriptan | https://www.wikidoc.org/index.php/Triptans | |
53b893d692c7de6607b86a502522be11c2a04dad | wikidoc | Triticum | Triticum
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Triticum is a gastrointestinal drug that is FDA approved for the treatment of nutrition. Common adverse reactions include hypersensitivity.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
Dissolve pellets under the tongue 3-4 times daily. Ages 12 and older: 10 pellets. Ages 2-11: 5 pellets. Under age 2: Consult a doctor.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Triticum in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Triticum in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Triticum FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Triticum in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Triticum in pediatric patients.
# Contraindications
There is limited information regarding Triticum Contraindications in the drug label.
# Warnings
- Contains sugar. Diabetics and persons intolerant of sucrose (sugar): Consult a doctor before use. Do not use if allergic to any ingredient. Consult a doctor before use for serious conditions or if conditions worsen or persist. If pregnant or nursing, consult a doctor before use. Do not use if safety seal is broken or missing
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Triticum Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Triticum Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Triticum Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Triticum in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Triticum in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Triticum during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Triticum in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Triticum in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Triticum in geriatric settings.
### Gender
There is no FDA guidance on the use of Triticum with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Triticum with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Triticum in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Triticum in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Triticum in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Triticum in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Triticum Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Triticum and IV administrations.
# Overdosage
There is limited information regarding Triticum overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Triticum Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Triticum Mechanism of Action in the drug label.
## Structure
There is limited information regarding Triticum Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Triticum Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Triticum Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Triticum Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Triticum Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Triticum How Supplied in the drug label.
## Storage
There is limited information regarding Triticum Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Triticum Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Triticum interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- TRITICUM 3®
# Look-Alike Drug Names
There is limited information regarding Triticum Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Triticum
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Ammu Susheela, M.D. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Triticum is a gastrointestinal drug that is FDA approved for the treatment of nutrition. Common adverse reactions include hypersensitivity.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
Dissolve pellets under the tongue 3-4 times daily. Ages 12 and older: 10 pellets. Ages 2-11: 5 pellets. Under age 2: Consult a doctor.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Triticum in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Triticum in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Triticum FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Triticum in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Triticum in pediatric patients.
# Contraindications
There is limited information regarding Triticum Contraindications in the drug label.
# Warnings
- Contains sugar. Diabetics and persons intolerant of sucrose (sugar): Consult a doctor before use. Do not use if allergic to any ingredient. Consult a doctor before use for serious conditions or if conditions worsen or persist. If pregnant or nursing, consult a doctor before use. Do not use if safety seal is broken or missing
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Triticum Clinical Trials Experience in the drug label.
## Postmarketing Experience
There is limited information regarding Triticum Postmarketing Experience in the drug label.
# Drug Interactions
There is limited information regarding Triticum Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
There is no FDA guidance on usage of Triticum in women who are pregnant.
Pregnancy Category (AUS):
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Triticum in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Triticum during labor and delivery.
### Nursing Mothers
There is no FDA guidance on the use of Triticum in women who are nursing.
### Pediatric Use
There is no FDA guidance on the use of Triticum in pediatric settings.
### Geriatic Use
There is no FDA guidance on the use of Triticum in geriatric settings.
### Gender
There is no FDA guidance on the use of Triticum with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Triticum with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Triticum in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Triticum in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Triticum in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Triticum in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Triticum Monitoring in the drug label.
# IV Compatibility
There is limited information regarding the compatibility of Triticum and IV administrations.
# Overdosage
There is limited information regarding Triticum overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
There is limited information regarding Triticum Pharmacology in the drug label.
## Mechanism of Action
There is limited information regarding Triticum Mechanism of Action in the drug label.
## Structure
There is limited information regarding Triticum Structure in the drug label.
## Pharmacodynamics
There is limited information regarding Triticum Pharmacodynamics in the drug label.
## Pharmacokinetics
There is limited information regarding Triticum Pharmacokinetics in the drug label.
## Nonclinical Toxicology
There is limited information regarding Triticum Nonclinical Toxicology in the drug label.
# Clinical Studies
There is limited information regarding Triticum Clinical Studies in the drug label.
# How Supplied
There is limited information regarding Triticum How Supplied in the drug label.
## Storage
There is limited information regarding Triticum Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
There is limited information regarding Triticum Patient Counseling Information in the drug label.
# Precautions with Alcohol
Alcohol-Triticum interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- TRITICUM 3®[1]
# Look-Alike Drug Names
There is limited information regarding Triticum Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Triticum | |
66fe55267b059f9fb72013151266f7c514b61a02 | wikidoc | Trochlea | Trochlea
Trochlea (Latin for pulley) is a term in anatomy. It refers to a grooved structure reminiscent of a pulley's wheel.
Most commonly, trochleae bear the articular surface of saddle and other joints:
- Trochlea of humerus
- Trochlear process of the Calcaneus
- The area where the tarsometatarsus articulates with the proximal phalanges in a bird's foot
It also can refer to structures which serve as a guide for muscles:
- Trochlea of superior oblique (see also superior oblique muscle). This use is the source of the name for the Trochlear nerve. | Trochlea
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Trochlea (Latin for pulley) is a term in anatomy. It refers to a grooved structure reminiscent of a pulley's wheel.
Most commonly, trochleae bear the articular surface of saddle and other joints:
- Trochlea of humerus
- Trochlear process of the Calcaneus
- The area where the tarsometatarsus articulates with the proximal phalanges in a bird's foot
It also can refer to structures which serve as a guide for muscles:
- Trochlea of superior oblique (see also superior oblique muscle). This use is the source of the name for the Trochlear nerve.
Template:Disambig
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Trochlea | |
c427553e84a6828f38530e56b78a281839eed896 | wikidoc | Tuftelin | Tuftelin
Tuftelin is an acidic phosphorylated glycoprotein found in tooth enamel. In humans, the Tuftelin protein is encoded by the TUFT1 gene. It is an acidic protein that is thought to play a role in dental enamel mineralization and is implicated in caries susceptibility. It is also thought to be involved with adaptation to hypoxia, mesenchymal stem cell function, and neurotrophin nerve growth factor mediated neuronal differentiation.
# Classification
There are two kinds of enamel proteins: Amelogenins & Nonamelogenins. Tuftelin falls under nonamelogenins.
# Function
This protein is formed for a short time during amelogenesis. The function of tuftelins is under contention, but it is proposed that it acts to start the mineralization process of enamel during tooth development.
Other significant proteins in enamel are amelogenins, enamelins, and ameloblastins.
# Research
The human encoding gene for tuftelin (TUFT1) was cloned by Profs. Dany Deutsch and Aharon Palmon from the Hebrew University-Hadassah School of Dental Medicine in Jerusalem.
# Interactions
Tuftelin has been shown to interact with TFIP11. | Tuftelin
Tuftelin is an acidic phosphorylated glycoprotein found in tooth enamel. In humans, the Tuftelin protein is encoded by the TUFT1 gene.[1][2] It is an acidic protein that is thought to play a role in dental enamel mineralization and is implicated in caries susceptibility. It is also thought to be involved with adaptation to hypoxia, mesenchymal stem cell function, and neurotrophin nerve growth factor mediated neuronal differentiation.[3]
# Classification
There are two kinds of enamel proteins: Amelogenins & Nonamelogenins. Tuftelin falls under nonamelogenins.[4]
# Function
This protein is formed for a short time during amelogenesis. The function of tuftelins is under contention, but it is proposed that it acts to start the mineralization process of enamel during tooth development.[5][6]
Other significant proteins in enamel are amelogenins, enamelins, and ameloblastins.
# Research
The human encoding gene for tuftelin (TUFT1) was cloned by Profs. Dany Deutsch and Aharon Palmon from the Hebrew University-Hadassah School of Dental Medicine in Jerusalem.[2]
# Interactions
Tuftelin has been shown to interact with TFIP11.[7] | https://www.wikidoc.org/index.php/Tuftelin | |
0fd70871a74a2a8baff3f1aeef96f3983fc77340 | wikidoc | Tunicate | Tunicate
Tunicate, also known as urochordata, tunicata (and by the common names of urochordates, sea squirts, and sea pork) is the subphylum of a group of underwater saclike filter feeders with incurrent and excurrent siphons, that are members of the phylum Chordata. Most tunicates feed by filtering sea water through pharyngeal slits, but some are sub-marine predators such as the Megalodicopia hians. Like other chordates, tunicates have a notochord during their early development, but lack myomeric segmentation throughout the body and tail as adults. Tunicates lack the kidney-like metanephridial organs, and the original coelom body-cavity develops into a pericardial cavity and gonads. Except for the pharynx, heart and gonads, the organs are enclosed in a membrane called an epicardium, which is surrounded by the jelly-like mesenchyme. Tunicates begin life in a mobile larval stages that resembles a tadpole, later developing into a barrel-like, sedentary adult form.
# Life cycle
Most tunicates are hermaphrodites. The eggs are kept inside their body until they hatch, while sperm is released into the water where it fertilizes other individuals when brought in with incoming water.
Some larval forms appear very much like primitive chordates or hemichordates with a notochord (primitive spinal cord). Superficially the larva resemble small tadpoles. Some forms have a calcereous spicule that may be preserved as a fossil. They have appeared from the Jurassic to the present, with one proposed Neoproterozoic form, Yarnemia.
The larval stage ends when the tunicate finds a suitable rock to affix to and cements itself in place. The larval form is not capable of feeding, and is only a dispersal mechanism. Many physical changes occur to the tunicate's body, one of the most interesting being the digestion of the cerebral ganglion previously used to control movement. From this comes the common saying that the sea squirt "eats its own brain". In some classes, the adults remain pelagic (swimming or drifting in the open sea), although their larvae undergo similar metamorphoses to a higher or lower degree.
Once grown, adults can develop a thick covering, called a tunic, to protect their barrel-shaped bodies from enemies.
# Feeding
Tunicates are suspension feeders. They have two openings in their body cavity: an in-current and an ex-current siphon. The in-current siphon is used to intake food and water, and the ex-current siphon expels waste and water. The tunicate's primary food source is plankton. Plankton gets entangled in the mucus secreted from the endostyle. The tunicate's pharynx is covered by miniature hairs called ciliated cells which allow the consumed plankton to pass down through to the esophagus. Their guts are U-shaped, and their anuses empty directly to the outside environment. Tunicates are also the only animals able to create cellulose.
Tunicate blood is particularly interesting. It contains high concentrations of the transition metal vanadium and vanadium-associated proteins. Some Tunicates can concentrate vanadium up to a level one million times that of the surrounding seawater. Specialized cells can concentrate heavy metals, which are then deposited in the tunic.
# Classification
Sea squirts are more closely related to fish, birds, and humans than worms, sea stars, or other invertebrates.
The Tunicata contains about 3,000 species, usually divided into the following classes:
- Ascidiacea, (Aplousobranchia, Phlebobranchia, and Stolidobranchia)
- Thaliacea
- Appendicularia (Larvacea)
- Sorberacea.
Although the traditional classification is followed for now, newer evidence suggests that the Ascidiacea is an artificial group. The new classification would be:
- Stolidobranchia,
- Phlebobranchia and Thaliacea,
- Aplousobranchia and Appendicularia,
- Sorberacea would belong somewhere in Ascidiacea, or be in a taxon on its own.
The species Ciona intestinalis and Ciona savignyi have attracted interest in biology for developmental studies. Both species' genomes have been sequenced.
# Fossil record
Undisputed fossils of tunicates are rare. The best known (and earliest) is Shankouclava shankouense from the Lower Cambrian Maotianshan Shale at Shankou village, Anning, near Kunming (South China). There is also a common bioimmuration of a tunicate (Catellocaula vallata) found in Upper Ordovician bryozoan skeletons of the upper midwestern United States.
# Invasive species
Over the past few years, urochordates (notably of the genera Didemnum and Styela) have been invading coastal waters in many countries, and are spreading quickly. These mat-like organisms can smother other sea life, have very few natural predators, and are causing much concern. Transportation of invasive tunicates is usually in the ballast water or on the hulls of ships. Current research indicates that many tunicates previously thought to be indigenous to Europe and the Americas are, in fact, invaders. Some of these invasions may have occurred centuries or even millennia ago. In some areas, tunicates are proving to be a major threat to aquaculture operations.
# Medical uses
Tunicates contain a host of potentially useful chemical compounds, including:
- Didemnins, effective against various types of cancer, as antivirals and immunosuppressants
- Aplidine, effective against various types of cancer
- Esteinascidin 743, effective against various types of cancer
In the May 2007 issue of The FASEB Journal, researchers from Stanford University showed that tunicates can correct abnormalities over a series of generations, and they suggest that a similar regenerative process may be possible for humans. The mechanisms underlying the phenomenon may lead to insights about the potential of cells and tissues to be reprogrammed and regenerate compromised human organs. Gerald Weissman, editor-in-chief of the journal, said "This study is a landmark in regenerative medicine; the Stanford group has accomplished the biological equivalent of turning a sow's ear into a silk purse and back again." | Tunicate
Tunicate, also known as urochordata, tunicata (and by the common names of urochordates, sea squirts, and sea pork[1]) is the subphylum of a group of underwater saclike filter feeders with incurrent and excurrent siphons, that are members of the phylum Chordata. Most tunicates feed by filtering sea water through pharyngeal slits, but some are sub-marine predators such as the Megalodicopia hians. Like other chordates, tunicates have a notochord during their early development, but lack myomeric segmentation throughout the body and tail as adults. Tunicates lack the kidney-like metanephridial organs, and the original coelom body-cavity develops into a pericardial cavity and gonads. Except for the pharynx, heart and gonads, the organs are enclosed in a membrane called an epicardium, which is surrounded by the jelly-like mesenchyme. Tunicates begin life in a mobile larval stages that resembles a tadpole, later developing into a barrel-like, sedentary adult form.
# Life cycle
Most tunicates are hermaphrodites. The eggs are kept inside their body until they hatch, while sperm is released into the water where it fertilizes other individuals when brought in with incoming water.
Some larval forms appear very much like primitive chordates or hemichordates with a notochord (primitive spinal cord). Superficially the larva resemble small tadpoles. Some forms have a calcereous spicule that may be preserved as a fossil. They have appeared from the Jurassic to the present, with one proposed Neoproterozoic form, Yarnemia.
The larval stage ends when the tunicate finds a suitable rock to affix to and cements itself in place. The larval form is not capable of feeding, and is only a dispersal mechanism. Many physical changes occur to the tunicate's body, one of the most interesting being the digestion of the cerebral ganglion previously used to control movement. From this comes the common saying that the sea squirt "eats its own brain".[2] In some classes, the adults remain pelagic (swimming or drifting in the open sea), although their larvae undergo similar metamorphoses to a higher or lower degree.
Once grown, adults can develop a thick covering, called a tunic, to protect their barrel-shaped bodies from enemies.
# Feeding
Tunicates are suspension feeders. They have two openings in their body cavity: an in-current and an ex-current siphon. The in-current siphon is used to intake food and water, and the ex-current siphon expels waste and water. The tunicate's primary food source is plankton. Plankton gets entangled in the mucus secreted from the endostyle. The tunicate's pharynx is covered by miniature hairs called ciliated cells which allow the consumed plankton to pass down through to the esophagus. Their guts are U-shaped, and their anuses empty directly to the outside environment. Tunicates are also the only animals able to create cellulose.
Tunicate blood is particularly interesting. It contains high concentrations of the transition metal vanadium and vanadium-associated proteins. Some Tunicates can concentrate vanadium up to a level one million times that of the surrounding seawater. Specialized cells can concentrate heavy metals, which are then deposited in the tunic.
# Classification
Sea squirts are more closely related to fish, birds, and humans than worms, sea stars, or other invertebrates.
The Tunicata contains about 3,000 species, usually divided into the following classes:
- Ascidiacea, (Aplousobranchia, Phlebobranchia, and Stolidobranchia)
- Thaliacea
- Appendicularia (Larvacea)
- Sorberacea.
Although the traditional classification is followed for now, newer evidence suggests that the Ascidiacea is an artificial group. The new classification would be:
- Stolidobranchia,
- Phlebobranchia and Thaliacea,
- Aplousobranchia and Appendicularia,
- Sorberacea would belong somewhere in Ascidiacea, or be in a taxon on its own.
The species Ciona intestinalis and Ciona savignyi have attracted interest in biology for developmental studies. Both species' genomes have been sequenced.
# Fossil record
Undisputed fossils of tunicates are rare. The best known (and earliest) is Shankouclava shankouense from the Lower Cambrian Maotianshan Shale at Shankou village, Anning, near Kunming (South China).[3] There is also a common bioimmuration of a tunicate (Catellocaula vallata) found in Upper Ordovician bryozoan skeletons of the upper midwestern United States.[4]
# Invasive species
Over the past few years, urochordates (notably of the genera Didemnum and Styela) have been invading coastal waters in many countries, and are spreading quickly. These mat-like organisms can smother other sea life, have very few natural predators, and are causing much concern.[5] Transportation of invasive tunicates is usually in the ballast water or on the hulls of ships. Current research indicates that many tunicates previously thought to be indigenous to Europe and the Americas are, in fact, invaders. Some of these invasions may have occurred centuries or even millennia ago. In some areas, tunicates are proving to be a major threat to aquaculture operations.[6][7]
# Medical uses
Tunicates contain a host of potentially useful chemical compounds, including:
- Didemnins, effective against various types of cancer, as antivirals and immunosuppressants
- Aplidine, effective against various types of cancer
- Esteinascidin 743, effective against various types of cancer
In the May 2007 issue of The FASEB Journal, researchers from Stanford University showed that tunicates can correct abnormalities over a series of generations, and they suggest that a similar regenerative process may be possible for humans. The mechanisms underlying the phenomenon may lead to insights about the potential of cells and tissues to be reprogrammed and regenerate compromised human organs. Gerald Weissman, editor-in-chief of the journal, said "This study is a landmark in regenerative medicine; the Stanford group has accomplished the biological equivalent of turning a sow's ear into a silk purse and back again."[8] | https://www.wikidoc.org/index.php/Tunicate | |
deaed4e1f7b0b15f7223c8830b4e1b6c27d859fe | wikidoc | Turmeric | Turmeric
Turmeric (Curcuma longa) is a rhizomatous herbaceous perennial plant of the ginger family, Zingiberaceae which is native to tropical South Asia. It needs temperatures between 20 and 30 deg. C. and a considerable amount of annual rainfall to thrive. Plants are gathered annually for their rhizomes, and re-seeded from some of those rhizomes in the following season.
It is also often misspelled (or pronounced) as tumeric. It sometimes also known as kunyit in some Asian countries.
Its rhizomes are boiled for several hours and then dried in hot ovens, after which they are ground into a deep orange-yellow powder commonly used as a spice in curries and other South Asian cuisine, for dyeing, and to impart color to mustard condiments. Its active ingredient is curcumin and it has an earthy, bitter, peppery flavor and has a mustardy smell.
Sangli, a town in the southern part of the Indian state of Maharashtra, is the largest and most important trading centre for turmeric in Asia or perhaps in the entire world.
# Uses
## Food
Turmeric has found application in canned beverages, baked products, dairy products, ice cream, yogurt, yellow cakes, biscuits, popcorn-color, sweets, cake icings, cereals, sauces, gelatins, etc. It is a significant ingredient in most commercial curry powders.
Turmeric (coded as E100 when used as a food additive) is used to protect food products from sunlight. The oleoresin is used for oil-containing products. The curcumin/polysorbate solution or curcumin powder dissolved in alcohol is used for water containing products. Over-coloring, such as in pickles, relishes and mustard, is sometimes used to compensate for fading.
In combination with annatto (E160b), turmeric has been used to color cheeses, yogurt, dry mixes, salad dressings, winter butter and margarine. Turmeric is also used to give a yellow color to some prepared mustards, canned chicken broths and other foods (often as a much cheaper replacement for saffron).
Turmeric is widely used as a spice in Indian and other South Asian cooking. Momos (Nepali meat dumplings), a traditional dish in South Asia, are spiced with turmeric.
## Medicine
In the Ayurvedic medicine, turmeric is thought to have many medicinal properties and many in India use it as a readily available antiseptic for cuts and burns. Whenever there is a cut or a bruise, the home remedy is to reach for turmeric powder. Ayurvedic doctors say it has fluoride which is thought to be essential for teeth. It is also used as an antibacterial agent.
It is taken in some Asian countries as a dietary supplement, which allegedly helps with stomach problems and other ailments. It is popular as a tea in Okinawa, Japan. It is currently being investigated for possible benefits in Alzheimer's disease, cancer and liver disorders.
Turmeric, under the name Avea, is becoming popular to treat depression.
It is only in recent years that Western scientists have increasingly recognised the medicinal properties of turmeric. According to a 2005 article in the Wall Street Journal titled, "Common Indian Spice Stirs Hope," research activity into curcumin, the active ingredient in turmeric, is exploding. Two hundred and fifty-six curcumin papers were published in the past year according to a search of the U.S. National Library of Medicine. Supplement sales have increased 35% from 2004, and the U.S. National Institutes of Health has four clinical trials underway to study curcumin treatment for pancreatic cancer, multiple myeloma, Alzheimer's, and colorectal cancer.
A 2004 UCLA-Veterans Affairs study involving genetically altered mice suggests that curcumin, the active ingredient in turmeric, might inhibit the accumulation of destructive beta amyloids in the brains of Alzheimer's disease patients and also break up existing plaques. "Curcumin has been used for thousands of years as a safe anti-inflammatory in a variety of ailments as part of Indian traditional medicine," Gregory Cole, Professor of medicine and neurology at the David Geffen School of Medicine at UCLA said.
Another 2004 study conducted at Yale University involved oral administration of curcumin to mice homozygous for the most common allele implicated in cystic fibrosis. Treatment with curcumin restored physiologically-relevant levels of protein function.
Anti-tumoral effects against melanoma cells have been demonstrated .
Curry Pharmaceuticals, based in North Carolina, is studying the use of a curcumin cream for psoriasis treatment. Another company is already selling a cream based on curcumin called "Psoria-Gold," which shows anecdotal promise of treating the disease.
A recent study involving mice has shown that turmeric slows the spread of breast cancer into lungs and other body parts. Turmeric also enhances the effect of taxol in reducing metastasis of breast cancer .
Curcumin is thought to be a powerful antinociceptive (pain-relieving) agent. In the November 2006 issue of Arthritis & Rheumatism, a study was published that showed the effectiveness of turmeric in the reduction of joint inflammation, and recommended clinical trials as a possible treatment for the alleviation of arthritis symptoms. It is thought to work as a natural inhibitor of the cox-2 enzyme, and has been shown effective in animal models for neuropathic pain secondary to diabetes, among others.
## Cosmetics
Turmeric is currently used in the formulation of some sunscreens. Turmeric paste is used by some Indian women to keep them free of superfluous hair. Turmeric paste is applied to bride and groom before marriage in some places of India and Pakistan, where it is believed turmeric gives glow to skin and keeps some harmful bacteria away from the body. It also acts as an excellent anti-scarring agent when mixed with milk and applied on skin.
The Government of Thailand is funding a project to extract and isolate tetrahydrocurcuminoids (THC) from turmeric. THCs (not to be confused with tetrahydrocannabinol, also known as THC) are colorless compounds that might have antioxidant and skin lightening properties and might be used to treat skin inflammations, making these compounds useful in cosmetics formulations.
## Dye
Turmeric makes a poor fabric dye as it is not very lightfast (the degree to which a dye resists fading due to light exposure).
## Gardening
Turmeric can also be used to deter ants. The exact reasons why turmeric repels ants is unknown, but anecdotal evidence suggests it works.
# Chemistry
Turmeric contains up to 5% essential oils and up to 3% curcumin, a polyphenol. It is the active substance of turmeric and it is also known as C.I. 75300, or Natural Yellow 3. The systematic chemical name is (1E,6E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione.
It can exist at least in two tautomeric forms, keto and enol. The keto form is preferred in solid phase and the enol form in solution. | Turmeric
Turmeric (Curcuma longa) is a rhizomatous herbaceous perennial plant of the ginger family, Zingiberaceae which is native to tropical South Asia. It needs temperatures between 20 and 30 deg. C. and a considerable amount of annual rainfall to thrive. Plants are gathered annually for their rhizomes, and re-seeded from some of those rhizomes in the following season.
It is also often misspelled (or pronounced) as tumeric. It sometimes also known as kunyit in some Asian countries[1].
Its rhizomes are boiled for several hours and then dried in hot ovens, after which they are ground into a deep orange-yellow powder commonly used as a spice in curries and other South Asian cuisine, for dyeing, and to impart color to mustard condiments. Its active ingredient is curcumin and it has an earthy, bitter, peppery flavor and has a mustardy smell.
Sangli, a town in the southern part of the Indian state of Maharashtra, is the largest and most important trading centre for turmeric in Asia or perhaps in the entire world.[citation needed]
# Uses
## Food
Turmeric has found application in canned beverages, baked products, dairy products, ice cream, yogurt, yellow cakes, biscuits, popcorn-color, sweets, cake icings, cereals, sauces, gelatins, etc. It is a significant ingredient in most commercial curry powders.
Turmeric (coded as E100 when used as a food additive) is used to protect food products from sunlight. The oleoresin is used for oil-containing products. The curcumin/polysorbate solution or curcumin powder dissolved in alcohol is used for water containing products. Over-coloring, such as in pickles, relishes and mustard, is sometimes used to compensate for fading.
In combination with annatto (E160b), turmeric has been used to color cheeses, yogurt, dry mixes, salad dressings, winter butter and margarine. Turmeric is also used to give a yellow color to some prepared mustards, canned chicken broths and other foods (often as a much cheaper replacement for saffron).
Turmeric is widely used as a spice in Indian and other South Asian cooking. Momos (Nepali meat dumplings), a traditional dish in South Asia, are spiced with turmeric.
## Medicine
In the Ayurvedic medicine, turmeric is thought to have many medicinal properties and many in India use it as a readily available antiseptic for cuts and burns. Whenever there is a cut or a bruise, the home remedy is to reach for turmeric powder. Ayurvedic doctors say it has fluoride which is thought to be essential for teeth. It is also used as an antibacterial agent.
It is taken in some Asian countries as a dietary supplement, which allegedly helps with stomach problems and other ailments. It is popular as a tea in Okinawa, Japan. It is currently being investigated for possible benefits in Alzheimer's disease, cancer and liver disorders.
Turmeric, under the name Avea, is becoming popular to treat depression.
It is only in recent years that Western scientists have increasingly recognised the medicinal properties of turmeric. According to a 2005 article in the Wall Street Journal titled, "Common Indian Spice Stirs Hope," research activity into curcumin, the active ingredient in turmeric, is exploding. Two hundred and fifty-six curcumin papers were published in the past year according to a search of the U.S. National Library of Medicine. Supplement sales have increased 35% from 2004, and the U.S. National Institutes of Health has four clinical trials underway to study curcumin treatment for pancreatic cancer, multiple myeloma, Alzheimer's, and colorectal cancer.
A 2004 UCLA-Veterans Affairs study involving genetically altered mice suggests that curcumin, the active ingredient in turmeric, might inhibit the accumulation of destructive beta amyloids in the brains of Alzheimer's disease patients and also break up existing plaques. "Curcumin has been used for thousands of years as a safe anti-inflammatory in a variety of ailments as part of Indian traditional medicine," Gregory Cole, Professor of medicine and neurology at the David Geffen School of Medicine at UCLA said.
Another 2004 study conducted at Yale University involved oral administration of curcumin to mice homozygous for the most common allele implicated in cystic fibrosis. Treatment with curcumin restored physiologically-relevant levels of protein function. [1]
Anti-tumoral effects against melanoma cells have been demonstrated [2].
Curry Pharmaceuticals, based in North Carolina, is studying the use of a curcumin cream for psoriasis treatment. Another company is already selling a cream based on curcumin called "Psoria-Gold," which shows anecdotal promise of treating the disease.
A recent study involving mice has shown that turmeric slows the spread of breast cancer into lungs and other body parts. Turmeric also enhances the effect of taxol in reducing metastasis of breast cancer [3].
Curcumin is thought to be a powerful antinociceptive (pain-relieving) agent. In the November 2006 issue of Arthritis & Rheumatism, a study was published that showed the effectiveness of turmeric in the reduction of joint inflammation, and recommended clinical trials as a possible treatment for the alleviation of arthritis symptoms.[4] It is thought to work as a natural inhibitor of the cox-2 enzyme, and has been shown effective in animal models for neuropathic pain secondary to diabetes, among others.[2]
## Cosmetics
Turmeric is currently used in the formulation of some sunscreens. Turmeric paste is used by some Indian women to keep them free of superfluous hair. Turmeric paste is applied to bride and groom before marriage in some places of India and Pakistan, where it is believed turmeric gives glow to skin and keeps some harmful bacteria away from the body. It also acts as an excellent anti-scarring agent when mixed with milk and applied on skin[citation needed].
The Government of Thailand is funding a project to extract and isolate tetrahydrocurcuminoids (THC) from turmeric. THCs (not to be confused with tetrahydrocannabinol, also known as THC) are colorless compounds that might have antioxidant and skin lightening properties and might be used to treat skin inflammations, making these compounds useful in cosmetics formulations.
## Dye
Turmeric makes a poor fabric dye as it is not very lightfast (the degree to which a dye resists fading due to light exposure).
## Gardening
Turmeric can also be used to deter ants. The exact reasons why turmeric repels ants is unknown, but anecdotal evidence suggests it works. [5]
# Chemistry
Turmeric contains up to 5% essential oils and up to 3% curcumin, a polyphenol. It is the active substance of turmeric and it is also known as C.I. 75300, or Natural Yellow 3. The systematic chemical name is (1E,6E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione.
It can exist at least in two tautomeric forms, keto and enol. The keto form is preferred in solid phase and the enol form in solution. | https://www.wikidoc.org/index.php/Turmeric | |
a8410832386957a7085992ed8118275aa92c7b02 | wikidoc | Twinject | Twinject
Twinject is the registered trademark of the first epinephrine autoinjector that contains two doses. It is used in medicine as an emergency treatment for severe allergic reaction (anaphylaxis.)
# History and Development
Twinject was originally designed and manufactured by Verus Pharmaceuticals in the United States. The Twinject was developed after some studies showed that more than one dose of epinephrine may be required in up to 35 percent of anaphylaxis cases to properly address the allergic reaction. It is currently available in two models Twinject 0.3mg, and the Twinject 0.15mg (see Dosing information below) in both the United States and Canada.
## United States
Twinject was released in the United States on August 16, 2005. It was the first, and currently only, two dose epinephrine autoinjector approved for use in the United States by the FDA. In the U.S. autoinjectors are a regulated medical device and require a prescription from a medical doctor. The device is available in two strengths. In April 2007 Verus announced that changes were being made to the device, but the actual proposed modifications have not yet been made public.
## Canada
On July 27, 2005, Verus announced that it had entered into an exclusive agreement with Paladin Labs to commercialize the Twinject in Canada. Paladin released the Twinject in Canada on September 22, 2005, after approval of Health Canada. In Canada the Twinject is not a regulated medical device, per se (it is kept behind the counter in pharmacies.) While it does not require a prescription, many patients choose to have it prescribed as many insurance companies will only cover the cost of the device if it is prescribed. In Canada the Twinject usually retails between $95 CAD and $115 CAD
## Europe
On August 21, 2006, Verus announced that UCB, a European pharmaceutical company, will begin marketing and producing the Twinject for distribution in Europe. While the Twinject has yet to be sold outside Canada or the U.S., UCB has the option of commercialize the entire Twinject product line in all other territories beyond Europe (excluding the U.S. and Canada). Most markets in Europe require a prescription for epinephrine autoinjectors.
# Dosage
The Twinject is available in two doses:
- In an anaphylactic emergency Adults weighing 30 kilograms/66 lbs or more require a dosage of 0.3 mg of 1:1000 epinephrine. The Twinject 0.3mg includes two adult doses.
- For children weighing 15 to 30 kilograms/33-66 lbs, the standard dose is of 0.15 mg of 1:1000 epinephrine. The Twinject 0.15 mg contains two doses of 0.15mg.
- For children weighing less that 15 kilograms/33 lbs a dosage of 0.01mg/kg of 1:1000 epinephrine is recommended. As the smallest dose available with the Twinject is 0.15mg, for children weighing less that 15kg other forms of injectable epinephrine may need to be considered.
# Usage
The Twinject is used to temporarily reverse the effects of a severe allergic reaction. Advanced medical care is required immediately after administering the epinephrine.
The Twinject contains a spring-loaded needle that shoots through a membrane in the tip and into the recipient's body to deliver the medication. A patient uses the device by removing the green locking cap from the bottom of the device, then the red cap at the top, forming a fist around the unit, and jabbing it firmly into a thigh until the click of the spring-loaded needle activating is heard. The patient holds the device in place for 10-15 seconds as the epinephrine is delivered. Using the device intravenously or subcutaneously is highly discouraged.
After administering the device, patients are advised to seek immediate medical attention as epinephrine will temporarily relieve the symptoms of anaphylaxis but advanced medical care is required to permanently reverse the reaction. The second dose can be used after 10 minutes if the symptoms have not receded or if they begin to return before medical help has been reached.
To administer the second dose, the gray cap must be removed. Then, being careful with the exposed needle, the full syringe needs to be removed. Then a yellow (in the 0.3mg dose autoinjector) or orange cap (in the 0.15mg dose autoinjector) needs to be taken off the plunger. Then can the needle be inserted into the thigh and the plunger can be pushed completely down. It is advised that the second dose be prepared immediately following the first dose in order for it to be ready to administer when required.
## Contraindications
There are no known contraindications to the use of epinephrine in a life-threatening allergic reaction.
# Storage
The Twinject usually has a shelf life of about 12 months or until the epinephrine (usually a clear liquid) begins to contain a precipitate, discolor (pinkish color, or more than only a slight yellow color.) Once either of these occurs the Twinject should be immediately replaced. However, in the event of a life-threatening allergic reaction, even if the epinephrine has expired, the Twinject should be used.
The Twinject should be stored between 20° and 25°C/68°-77°F. During excursions, epinephrine may be kept at a temperature of 15°-30°C/59°-86°F . It should not be allowed to freeze and should not be refrigerated.
# See Also
- Anaphylaxis
- Autoinjector
- Epinephrine
- Epipen | Twinject
Twinject is the registered trademark of the first epinephrine autoinjector that contains two doses. It is used in medicine as an emergency treatment for severe allergic reaction (anaphylaxis.)
# History and Development
Twinject was originally designed and manufactured by Verus Pharmaceuticals in the United States. The Twinject was developed after some studies showed that more than one dose of epinephrine may be required in up to 35 percent of anaphylaxis cases to properly address the allergic reaction.[1] It is currently available in two models Twinject 0.3mg, and the Twinject 0.15mg (see Dosing information below) in both the United States and Canada.
## United States
Twinject was released in the United States on August 16, 2005. It was the first, and currently only, two dose epinephrine autoinjector approved for use in the United States by the FDA. In the U.S. autoinjectors are a regulated medical device and require a prescription from a medical doctor. [2] The device is available in two strengths. In April 2007 Verus announced that changes were being made to the device, but the actual proposed modifications have not yet been made public.
## Canada
On July 27, 2005, Verus announced that it had entered into an exclusive agreement with Paladin Labs to commercialize the Twinject in Canada. Paladin released the Twinject in Canada on September 22, 2005, after approval of Health Canada.[3] In Canada the Twinject is not a regulated medical device, per se (it is kept behind the counter in pharmacies.) While it does not require a prescription, many patients choose to have it prescribed as many insurance companies will only cover the cost of the device if it is prescribed. In Canada the Twinject usually retails between $95 CAD and $115 CAD[4]
## Europe
On August 21, 2006, Verus announced that UCB, a European pharmaceutical company, will begin marketing and producing the Twinject for distribution in Europe. While the Twinject has yet to be sold outside Canada or the U.S., UCB has the option of commercialize the entire Twinject product line in all other territories beyond Europe (excluding the U.S. and Canada). [5] Most markets in Europe require a prescription for epinephrine autoinjectors.
# Dosage
The Twinject is available in two doses:
- In an anaphylactic emergency Adults weighing 30 kilograms/66 lbs or more require a dosage of 0.3 mg of 1:1000 epinephrine. The Twinject 0.3mg includes two adult doses.
- For children weighing 15 to 30 kilograms/33-66 lbs, the standard dose is of 0.15 mg of 1:1000 epinephrine. The Twinject 0.15 mg contains two doses of 0.15mg.
- For children weighing less that 15 kilograms/33 lbs a dosage of 0.01mg/kg of 1:1000 epinephrine is recommended. As the smallest dose available with the Twinject is 0.15mg, for children weighing less that 15kg other forms of injectable epinephrine may need to be considered. [6]
# Usage
The Twinject is used to temporarily reverse the effects of a severe allergic reaction. Advanced medical care is required immediately after administering the epinephrine.
The Twinject contains a spring-loaded needle that shoots through a membrane in the tip and into the recipient's body to deliver the medication. A patient uses the device by removing the green locking cap from the bottom of the device, then the red cap at the top, forming a fist around the unit, and jabbing it firmly into a thigh until the click of the spring-loaded needle activating is heard. The patient holds the device in place for 10-15 seconds as the epinephrine is delivered. Using the device intravenously or subcutaneously is highly discouraged.
After administering the device, patients are advised to seek immediate medical attention as epinephrine will temporarily relieve the symptoms of anaphylaxis but advanced medical care is required to permanently reverse the reaction. The second dose can be used after 10 minutes if the symptoms have not receded or if they begin to return before medical help has been reached.
To administer the second dose, the gray cap must be removed. Then, being careful with the exposed needle, the full syringe needs to be removed. Then a yellow (in the 0.3mg dose autoinjector) or orange cap (in the 0.15mg dose autoinjector) needs to be taken off the plunger. Then can the needle be inserted into the thigh and the plunger can be pushed completely down. It is advised that the second dose be prepared immediately following the first dose in order for it to be ready to administer when required.[6]
## Contraindications
There are no known contraindications to the use of epinephrine in a life-threatening allergic reaction. [6]
# Storage
The Twinject usually has a shelf life of about 12 months or until the epinephrine (usually a clear liquid) begins to contain a precipitate, discolor (pinkish color, or more than only a slight yellow color.) Once either of these occurs the Twinject should be immediately replaced. However, in the event of a life-threatening allergic reaction, even if the epinephrine has expired, the Twinject should be used.
The Twinject should be stored between 20° and 25°C/68°-77°F. During excursions, epinephrine may be kept at a temperature of 15°-30°C/59°-86°F . It should not be allowed to freeze and should not be refrigerated. [4]
# See Also
- Anaphylaxis
- Autoinjector
- Epinephrine
- Epipen
# External links
- US Twinject information
- Canadian Twinject information
- Verus Pharmaceuticals | https://www.wikidoc.org/index.php/Twinject | |
f131864b40b72ff6abaa19e81aa6d16544b147f4 | wikidoc | Tyramine | Tyramine
# Overview
In organic chemistry tyramine (4-hydroxy-phenethylamine, para-tyramine, p-tyramine) is a monoamine compound derived from the amino acid tyrosine.
# Occurrence
Tyramine occurs widely in plants and animals and is metabolized by the enzyme monoamine oxidase. In foods, it is often produced by the decarboxylation of tyrosine during fermentation or decay. Foods containing considerable amounts of tyramine include meats (fish, poultry, and beef) that are potentially spoiled or pickled, aged, smoked, fermented, or marinated, most pork (except country [cured ham), chocolate, alcoholic beverages, and fermented foods such as most cheeses (except ricotta, cottage cheese, cream cheese), sour cream, yogurt, tofu, miso soup, soy sauce and soy bean condiments, teriyaki sauce, shrimp paste, sauerkraut, broad (fava) beans, green bean pods, Italian flat (Romano) beans, Chinese (Snow) pea pods, avocados, bananas, eggplant, figs, red plums, raspberries, peanuts, Brazil nuts, coconuts, processed meat, yeast, and red wine.
# Metabolism
In humans, if monoamine metabolism is compromised by the use of monoamine oxidase inhibitors (MAOIs) and foods high in tyramine are ingested, a hypertensive crisis can result as tyramine can cause the release of stored monoamines, such as dopamine, norepinephrine, epinephrine. The first signs of this were discovered by a neurologist who noticed his wife, who at the time was on MAOI medication, had severe headaches when eating cheese. For this reason, the crisis is still called the "cheese syndrome," even though other foods can cause the same problem.
# Effects
A large dietary intake of tyramine (or a dietary intake of tyramine while taking MAO inhibitors) can cause the 'tyramine pressor response,' which is defined as an increase in systolic blood pressure of 30 mmHg or more. The displacement of norepinephrin(noradrenaline) from neuronal storage vesicles by acute tyramine ingestion is thought to cause the vasoconstriction and increased heart rate and blood pressure of the pressor response.
However, if one has had repeated exposure to tyramine, there is a decreased pressor response; Tyramine is degraded to octopamine, which is subsequently packaged in synaptic vesicles with norepinephrin(noradrenaline). Therefore, after repeated tyramine exposure, these vesicles contain an increased amount of octopamine, and a relativley reduced amount of norepinephrin(noradrenaline). Therefore, when these vesicles are secreted upon tyramine ingestion, there is a decreased pressor response, as less norepinephrin(noradrenaline) is secreted into the synpase, and octopamine does not activate alpha or beta adrenoceptors.
The possibility that tyramine acts directly as a neurotransmitter was revealed by the discovery of a G protein-coupled receptor with high affinity for tyramine, called TA1. The TA1 receptor is found in the brain as well as peripheral tissues, including the kidney. The existence of a receptor with high affinity for tyramine supports the hypothesis that tyramine may also act directly to affect blood pressure regulation.
# Migraine
Dietary tyramine intake has also been associated with migraine in select populations, leading many sufferers to restrict foods high in tyramine.
Reports on the tyramine-migraine link have been both affirmed and denied. A recent review article found that all past studies affirming a migraine-tyramine connection were scientifically inconclusive, and noted several studies showing no connection. Two studies validated as scientifically sound reported no connection in the population evaluated. | Tyramine
Template:Chembox new
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# For patient information, click here
# Overview
In organic chemistry tyramine (4-hydroxy-phenethylamine, para-tyramine, p-tyramine) is a monoamine compound derived from the amino acid tyrosine.[1]
# Occurrence
Tyramine occurs widely in plants and animals and is metabolized by the enzyme monoamine oxidase. In foods, it is often produced by the decarboxylation of tyrosine during fermentation or decay. Foods containing considerable amounts of tyramine include meats (fish, poultry, and beef) that are potentially spoiled or pickled, aged, smoked, fermented, or marinated, most pork (except country [cured ham), chocolate, alcoholic beverages, and fermented foods such as most cheeses (except ricotta, cottage cheese, cream cheese), sour cream, yogurt, tofu, miso soup, soy sauce and soy bean condiments, teriyaki sauce, shrimp paste, sauerkraut, broad (fava) beans, green bean pods, Italian flat (Romano) beans, Chinese (Snow) pea pods, avocados, bananas, eggplant, figs, red plums, raspberries, peanuts, Brazil nuts, coconuts, processed meat, yeast, and red wine.
# Metabolism
In humans, if monoamine metabolism is compromised by the use of monoamine oxidase inhibitors (MAOIs) and foods high in tyramine are ingested, a hypertensive crisis can result as tyramine can cause the release of stored monoamines, such as dopamine, norepinephrine, epinephrine. The first signs of this were discovered by a neurologist who noticed his wife, who at the time was on MAOI medication, had severe headaches when eating cheese. For this reason, the crisis is still called the "cheese syndrome," even though other foods can cause the same problem.
# Effects
A large dietary intake of tyramine (or a dietary intake of tyramine while taking MAO inhibitors) can cause the 'tyramine pressor response,' which is defined as an increase in systolic blood pressure of 30 mmHg or more. The displacement of norepinephrin(noradrenaline) from neuronal storage vesicles by acute tyramine ingestion is thought to cause the vasoconstriction and increased heart rate and blood pressure of the pressor response.
However, if one has had repeated exposure to tyramine, there is a decreased pressor response; Tyramine is degraded to octopamine, which is subsequently packaged in synaptic vesicles with norepinephrin(noradrenaline). Therefore, after repeated tyramine exposure, these vesicles contain an increased amount of octopamine, and a relativley reduced amount of norepinephrin(noradrenaline). Therefore, when these vesicles are secreted upon tyramine ingestion, there is a decreased pressor response, as less norepinephrin(noradrenaline) is secreted into the synpase, and octopamine does not activate alpha or beta adrenoceptors.
The possibility that tyramine acts directly as a neurotransmitter was revealed by the discovery of a G protein-coupled receptor with high affinity for tyramine, called TA1. The TA1 receptor is found in the brain as well as peripheral tissues, including the kidney. The existence of a receptor with high affinity for tyramine supports the hypothesis that tyramine may also act directly to affect blood pressure regulation.
# Migraine
Dietary tyramine intake has also been associated with migraine in select populations, leading many sufferers to restrict foods high in tyramine.[2]
Reports on the tyramine-migraine link have been both affirmed and denied. A recent review article found that all past studies affirming a migraine-tyramine connection were scientifically inconclusive, and noted several studies showing no connection. Two studies validated as scientifically sound reported no connection in the population evaluated. | https://www.wikidoc.org/index.php/Tyramine | |
9ff55389343bd888db1e988bb322a7cd2b56577c | wikidoc | Ungulate | Ungulate
Ungulates (meaning roughly "being hoofed" or "hoofed animal") are several groups of mammals most of which use the tips of their toes, usually hoofed, to sustain their whole bodyweight while moving. They make up several orders of mammals, of which six to eight survive. There is some dispute as to whether Ungulata are a cladistic (evolution-based) group, or merely a phenetic group (similar, but not necessarily related), because not all ungulates appear as closely related as once believed. Ungulata was considered an order which has been split into Perissodactyla, Artiodactyla, Tubulidentata, Hyracoidea, Sirenia, and Proboscidea. Members of the orders Perissodactyla, Artiodactyla, and Cetacea are called the 'true ungulates' to distinguish them from 'subungulates' (paenungulata) which include members from the Proboscidea, Sirenia, Hyracoidea, and Tubulidentata orders.
Commonly known examples of ungulates living today are the horse, zebra, donkey, cattle/bison, rhinoceros, camel, hippopotamus, goat, pig, sheep, giraffe, okapi, deer, tapir, antelope, and gazelle.
# Relationships
The Perissodactyla and Artiodactyla make up the largest portion of ungulates, and also comprise the majority of large land mammals. These two groups first appeared during the late Paleocene and early Eocene (about 54 million years ago), rapidly spreading to a wide variety of species on numerous continents, and have developed in parallel since that time.
Although whales and dolphins (Cetacea) do not possess most of the typical morphological characteristics of ungulates, recent discoveries have suggested that they are likely descended from early artiodactyls, and thus are directly related to other even-toed ungulates such as cattle and hippopotami. As a result of these discoveries, a new order of Cetartiodactyla has also been proposed to include the members of Artiodactyla and Cetacea, to reflect their common ancestry; however, strictly speaking, this is not necessary, as it is possible simply to recognize Cetacea as a subgroup of Artiodactyla.
The Hyracoidea, Sirenia and Proboscidea are the Paenungulata. The Tubulidentata are also thought to be ungulates. The Macroscelidea have been interpreted as ungulates, and there is dental as well as genetic evidence supporting this interpretation. Some recent studies link Tubulidentata with the Paenungulata in the Pseudoungulata. Genetic studies indicate that these animals are not closely related to the artiodactyls and perissodactyls. Instead, the closest relatives of pseudungulates are the Afrosoricida; the Pseudungulata and Afrosoricida make up the Afrotheria.
Ungulate groups represented in the fossil record include the embrithopods, demostylians, mesonychids, "condylarths" and various South American and Paleogene lineages.
In addition to hooves, most ungulates have developed reduced canine teeth, bunodont molars (molars with low, rounded cusps), and an astragalus (one of the ankle bones at the end of the lower leg) with a short, robust head.
Another characteristic of most ungulates is the fusion of the front forelimbs. In ungulates, the radius and ulna are fused along the length of the forelimb. This is a trait of most modern ungulates, as early ungulates, such as the arctocyonids did not share this unique skeletal structure. The fusion of the radius and ulna prevents an ungulate from rotating its forelimb. Since this skeletal structure has no specific function in ungulates, it is considered to be a homologous characteristic that ungulates share with other mammals. This trait would have been passed down from a common ancestor.
Ungulates diversified rapidly in the Eocene, but are thought to date back as far as the late Cretaceous. Most ungulates are herbivores, but a few are omnivores or even predators: the Mesonychia and whales.
This is the family tree of the ungulates (notice below, it's excluding the paenungulates, but including the whales and the South American ungulates, and the common ancestor, as some scientists believe).
# Recent developments
That these groups of mammals are most closely related to each other has occasionally been questioned on anatomical and genetic grounds. Molecular phylogenetic studies have suggested that Perissodactyla and Cetartiodactyla are closest to Carnivora and Pholidota rather than to the Pseudungulata.
The Pseudungulata are by some scientists united with the Afrosoricida in the cohort or super-order Afrotheria based on molecular and DNA analysis. This means they are not related to other ungulates.
The orders of the extinct South-American ungulates, which arose when the continent was in isolation some time during the mid to late Paleocene, are united in the super-order Meridiungulata. They are by some thought to be unrelated to the other ungulates. Instead, they are united with the Afrotheria and the Xenarthra in the supercohort Atlantogenata.
The position of other extinct ungulates is unclear. Embrithopods, Desmostylians and other related groups are seen as relatives of the Paenungulata, thus members of the Afrotheria. The condylarths are, as a result, no longer seen as the ancestors of all ungulates. Instead, it is now believed the condylarths are members of the cohort Laurasiatheria. So it seems that, of all the ungulates, only the Perissiodacyla and Artiodactyla descended from the condylarths—assuming that the animals lumped by scientists into Condylarthra over the years are even related to one another.
As a result of all this, it seems the typical ungulate morphology originated three times independently: in the Meridiungulata, the Afrotheria and the "true" ungulates in the Laurasiatheria. This is a great example of convergent evolution. This is met with scepticism by some scientists, who say there is no morphological evidence to split the ungulates up into so many unrelated clades. | Ungulate
Ungulates (meaning roughly "being hoofed" or "hoofed animal") are several groups of mammals most of which use the tips of their toes, usually hoofed, to sustain their whole bodyweight while moving. They make up several orders of mammals, of which six to eight survive. There is some dispute as to whether Ungulata are a cladistic (evolution-based) group, or merely a phenetic group (similar, but not necessarily related), because not all ungulates appear as closely related as once believed. Ungulata was considered an order which has been split into Perissodactyla, Artiodactyla, Tubulidentata, Hyracoidea, Sirenia, and Proboscidea. Members of the orders Perissodactyla, Artiodactyla, and Cetacea are called the 'true ungulates' to distinguish them from 'subungulates' (paenungulata) which include members from the Proboscidea, Sirenia, Hyracoidea, and Tubulidentata orders.[1]
Commonly known examples of ungulates living today are the horse, zebra, donkey, cattle/bison, rhinoceros, camel, hippopotamus, goat, pig, sheep, giraffe, okapi, deer, tapir, antelope, and gazelle.
# Relationships
The Perissodactyla and Artiodactyla make up the largest portion of ungulates, and also comprise the majority of large land mammals. These two groups first appeared during the late Paleocene and early Eocene (about 54 million years ago), rapidly spreading to a wide variety of species on numerous continents, and have developed in parallel since that time.
Although whales and dolphins (Cetacea) do not possess most of the typical morphological characteristics of ungulates, recent discoveries have suggested that they are likely descended from early artiodactyls, and thus are directly related to other even-toed ungulates such as cattle and hippopotami. As a result of these discoveries, a new order of Cetartiodactyla has also been proposed to include the members of Artiodactyla and Cetacea, to reflect their common ancestry; however, strictly speaking, this is not necessary, as it is possible simply to recognize Cetacea as a subgroup of Artiodactyla.
The Hyracoidea, Sirenia and Proboscidea are the Paenungulata. The Tubulidentata are also thought to be ungulates. The Macroscelidea have been interpreted as ungulates, and there is dental as well as genetic evidence supporting this interpretation. Some recent studies link Tubulidentata with the Paenungulata in the Pseudoungulata.[2] Genetic studies indicate that these animals are not closely related to the artiodactyls and perissodactyls. Instead, the closest relatives of pseudungulates are the Afrosoricida; the Pseudungulata and Afrosoricida make up the Afrotheria.
Ungulate groups represented in the fossil record include the embrithopods, demostylians, mesonychids, "condylarths" and various South American and Paleogene lineages.
In addition to hooves, most ungulates have developed reduced canine teeth, bunodont molars (molars with low, rounded cusps), and an astragalus (one of the ankle bones at the end of the lower leg) with a short, robust head.
Another characteristic of most ungulates is the fusion of the front forelimbs. In ungulates, the radius and ulna are fused along the length of the forelimb. This is a trait of most modern ungulates, as early ungulates, such as the arctocyonids did not share this unique skeletal structure[3]. The fusion of the radius and ulna prevents an ungulate from rotating its forelimb. Since this skeletal structure has no specific function in ungulates, it is considered to be a homologous characteristic that ungulates share with other mammals. This trait would have been passed down from a common ancestor.
Ungulates diversified rapidly in the Eocene, but are thought to date back as far as the late Cretaceous. Most ungulates are herbivores, but a few are omnivores or even predators: the Mesonychia and whales.
This is the family tree of the ungulates (notice below, it's excluding the paenungulates, but including the whales and the South American ungulates, and the common ancestor, as some scientists believe).
# Recent developments
That these groups of mammals are most closely related to each other has occasionally been questioned on anatomical and genetic grounds. Molecular phylogenetic studies have suggested that Perissodactyla and Cetartiodactyla are closest to Carnivora and Pholidota rather than to the Pseudungulata.
The Pseudungulata are by some scientists united with the Afrosoricida in the cohort or super-order Afrotheria based on molecular and DNA analysis. This means they are not related to other ungulates.
The orders of the extinct South-American ungulates, which arose when the continent was in isolation some time during the mid to late Paleocene, are united in the super-order Meridiungulata. They are by some thought to be unrelated to the other ungulates. Instead, they are united with the Afrotheria and the Xenarthra in the supercohort Atlantogenata.
The position of other extinct ungulates is unclear. Embrithopods, Desmostylians and other related groups are seen as relatives of the Paenungulata, thus members of the Afrotheria. The condylarths are, as a result, no longer seen as the ancestors of all ungulates. Instead, it is now believed the condylarths are members of the cohort Laurasiatheria. So it seems that, of all the ungulates, only the Perissiodacyla and Artiodactyla descended from the condylarths—assuming that the animals lumped by scientists into Condylarthra over the years are even related to one another.
As a result of all this, it seems the typical ungulate morphology originated three times independently: in the Meridiungulata, the Afrotheria and the "true" ungulates in the Laurasiatheria. This is a great example of convergent evolution. This is met with scepticism by some scientists, who say there is no morphological evidence to split the ungulates up into so many unrelated clades. | https://www.wikidoc.org/index.php/Ungulate | |
b46f0fdfd43278b1e30af91453b3f9585762cde5 | wikidoc | Up quark | Up quark
The up quark is a particle described by the Standard Model theory of physics. It is a first-generation quark with a charge of +(2/3)e. It is the lightest of all quarks. Its bare mass is not well determined, but probably lies between 1.5 and 4 MeV. According to the Standard Model of particle physics, there are six quark types. Ordinary matter, such as atoms, contains electrons and a nucleus. The protons and neutrons inside the nucleus are called nucleons, and the up quark—along with the down quark—are the fundamental constituents of these nucleons. The proton contains two up quarks and a down quark, while the neutron contains one up quark and two down quarks.
The equivalence of mass and energy described in the theory of Special Relativity means that quickly moving particles have greater energy and so appear to have a greater mass at high speeds than while at rest. The strength of the strong forces holding the quarks in the nucleus suggests they are moving with relativistic speeds. Therefore, the majority of the mass in nucleons comes from the energy in the gluon field holding the quarks together, and not the quark masses themselves.
The existence of up quarks was first postulated when Gell-Mann and Zweig developed the quark model in 1964, and the first evidence for them was found in deep inelastic scattering experiments at SLAC in 1967.
# Hadrons containing up quarks
Some of the hadrons containing up quarks include:
- Charged Pions (Template:SubatomicParticle) are mesons containing an up quark and an anti-down quark, or vice versa.
- The neutral pion (Template:SubatomicParticle) is a linear combination of up-antiup and down-antidown, as are the ρ and ω mesons.
- The Template:SubatomicParticle and Template:SubatomicParticle flavorless mesons are linear combinations of several quark-antiquark pairs, including up-antiup.
- A large number of detected baryons contain one or more up quarks. Like the nucleons, the Template:SubatomicParticle baryons are made of only up and down quarks: the Template:SubatomicParticle contains three up quarks, the Template:SubatomicParticle contains two, the Template:SubatomicParticle contains only one while the Template:SubatomicParticlecontains none. | Up quark
Template:Infobox Particle
The up quark is a particle described by the Standard Model theory of physics. It is a first-generation quark with a charge of +(2/3)e. It is the lightest of all quarks. Its bare mass is not well determined, but probably lies between 1.5 and 4 MeV. According to the Standard Model of particle physics, there are six quark types. Ordinary matter, such as atoms, contains electrons and a nucleus. The protons and neutrons inside the nucleus are called nucleons, and the up quark—along with the down quark—are the fundamental constituents of these nucleons. The proton contains two up quarks and a down quark, while the neutron contains one up quark and two down quarks.
The equivalence of mass and energy described in the theory of Special Relativity means that quickly moving particles have greater energy and so appear to have a greater mass at high speeds than while at rest.[1] The strength of the strong forces holding the quarks in the nucleus suggests they are moving with relativistic speeds. Therefore, the majority of the mass in nucleons comes from the energy in the gluon field holding the quarks together, and not the quark masses themselves.
The existence of up quarks was first postulated when Gell-Mann and Zweig developed the quark model in 1964, and the first evidence for them was found in deep inelastic scattering experiments at SLAC in 1967.
# Hadrons containing up quarks
Some of the hadrons containing up quarks include:
- Charged Pions (Template:SubatomicParticle) are mesons containing an up quark and an anti-down quark, or vice versa.
- The neutral pion (Template:SubatomicParticle) is a linear combination of up-antiup and down-antidown, as are the ρ and ω mesons.
- The Template:SubatomicParticle and Template:SubatomicParticle flavorless mesons are linear combinations of several quark-antiquark pairs, including up-antiup.
- A large number of detected baryons contain one or more up quarks. Like the nucleons, the Template:SubatomicParticle baryons are made of only up and down quarks: the Template:SubatomicParticle contains three up quarks, the Template:SubatomicParticle contains two, the Template:SubatomicParticle contains only one while the Template:SubatomicParticlecontains none. | https://www.wikidoc.org/index.php/Up_quark | |
fec3533511193d97fd9e3db91d27029c54b3e9ac | wikidoc | Uroscopy | Uroscopy
# Overview
Uroscopy is the historic medical practice of visually examining a patient's urine for pus, blood, or other symptoms of disease. It dates back to ancient Egypt, Babylon, and India. It was particularly emphasized in Byzantine medicine.
By modern medical standards, Uroscopy is considered to be a very limited means of obtaining evidence for the correct diagnosis of a patient's condition. In addition, many of the assumptions made by ancient physicians regarding uroscopy have proved to be quite incorrect and unscientific. However, visual examination of a patient's urine may provide preliminary evidence for a diagnosis, but is generally limited to conditions that affect the urinary system (such as infection (turbidity) or blood (infection or haemorrhage)).
# The procedure
## How Uroscopy Flask is Used
A uroscopy flask is a piece of glass that is circular at the bottom, while there is a thin neck at the top, and on top of that neck there is an opening for urine. In order for a doctor to examine a patients urine one would have to urinate into a uroscopy flask. A uroscopy flask is a glass bottle that must be transparent. If there is any color to the uroscopy flask, diagnosis could be wrong. In the process of uroscopy, color is very crucial to find diseases. If the uroscopy flask has a tint of color, the doctor may not be able effectively diagnose the patient. The glass must also have an even thickness throughout the flask. If the top is very thin glass and the bottom is thick glass, then the impurities in the top may look different from the top and bottom. While in all actuality they could be the very same impurities. The impurities in urine have varying shapes, uneven glass will corrupt the diagnosis.
## Uroscopy Wheel
The uroscopy wheel is a diagram that linked the color of urine to a particular disease. It usually has twenty different uroscopy flasks with urine of different colors aligned around the boarder of the circle. Each flask has a line that connects it to a summary of a particular disease. This allowed doctors to have a quick reference guide to twenty different types of urine.
## Temperature When Testing
The temperature at which the urine is examined is a very important factor to consider in the process of uroscopy. When a patient urinates, the urine will be warm, so it is necessary for it to stay warm for proper evaluation. The external temperature should be the same as the internal temperature. When the temperature of urine goes down the bubbles in it will change. Some of them will disappear, but some will remain. With the temperature decrease particles and impurities will be more difficult to evaluate. They will toward the middle of the flask, then sink to the bottom. They will all mix together, making it more difficult to see the impurities.
Another problem with urine cooling is that it would become thicker. The longer that it had to cool down the more likely it was that the crystals in the it would bond together, causing it to thicken. This could lead to a false diagnosis, that is why doctors usually inspected the urine quickly.
Richard Bright in the 19th century A.D. invented a technique that allowed doctors to examine a patients urine effectively after the temperature had dropped. The process involved heating water, then inserting the uroscopy flask containing cooled urine. This would heat the urine causing the crystals that formed during loss of temperature to break down. As a result the urine will become thin again. This process is very effective, but a doctor should “also be careful not to shake them much before you inspect them for you will move the particles and destroy the bubbles and dilute the deposits and confuse the situation,” (The Late Greco-Roman and Byzantine Contribution to the Evolution of Laboratory Examinations of Bodily Excrement. Part1: Urine, Sperm, Menses and Stools, Pavlos C. Goudas).
## Lighting When Testing
Since the identifying the color of the urine is essential for a proper diagnosis, the lighting is crucial. This is a very complicated step in the uroscopy test. The doctor must can not visually examine the urine in an overly lit location, because it will make the urine seem too bright. He can not examine the urine in a poorly lit location, because he will not be able to properly see the urine. So, he must examine the urine in both conditions. This is done to offset the effects of not enough light and too much light. After he examines in both conditions the doctor must use his best judgment, to make a diagnosis.
# Common Diseases Found
## Diabetes mellitus
Disease in which the pancreas does not function properly. Victims of this disease will have high glucose blood sugar. Victims may suffer from: cardiovascular disease (doubled risk), chronic renal failure (it is the main cause for dialysis in developed world adults), retinal damage which can lead to blindness and is the most significant cause of adult blindness in the non-elderly in the developed world, nerve damage, erectile dysfunction (impotence), to gangrene with risk of amputation of toes, feet, and even legs.
Doctors would test by tasting the urine. A sweet taste meant the patient had diabetes.
## Jaundice
Yellowish discoloration of the whites of the eyes, skin, and mucous membranes caused by deposition of bile salts in these tissues. It occurs as a symptom of various diseases, such as hepatitis, that affect the processing of bile. Also called icterus.
Doctors would test by using their vision. If the urine had a brownish tint then the patient would most likely have jaundice.
## Kidney Disease
The kidneys are supposed to filter wastes (especially urea) from the blood and excrete them, along with water, as urine. When they are not performing this task the patient is suffering from kidney disease. The medical field that studies the kidneys and diseases affecting the kidney is called nephrology, from the Ancient Greek name for kidney.
Doctors would test urine using a visual examination. If the urine was red and/or foamy the patient was suffering from kidney disease.
## Tumors of urinary tract
When a patient develops an uncontrolled, abnormal, circumscribed growth of cells in the urinary tract.
Doctors would test urine by using a visual examination. If the urine had blood in it the patient was suffering from tumors in the urinary tract.
# Importance of uroscopy
Uroscopy was important to the Roman and Byzantine eras, because it allowed doctors to diagnose patients without technology. This was an era in which there was no microscope, stethoscope, or even thermometers. All that was needed was a uroscopy wheel, uroscopy flask, and an experienced doctor to be able to give a diagnosis. It was a very simple procedure that a doctor could determine a patients problem by simply tasting and/or looking at their urine.
Uroscopy was also necessary, because the Hippocratic Oath did not allow doctors to perform any type of surgery. It stated “I will not cut for stone, even for patients in whom the disease is manifest . . .” (Hippocratic Oath). Doctors needed a different way to find out the problems with their patients. That is when the uroscopy test became involved. It followed the Hippocratic Oath and was a very effective test for that particular time period. | Uroscopy
# Overview
Uroscopy is the historic medical practice of visually examining a patient's urine for pus, blood, or other symptoms of disease. It dates back to ancient Egypt, Babylon, and India. It was particularly emphasized in Byzantine medicine.
By modern medical standards, Uroscopy is considered to be a very limited means of obtaining evidence for the correct diagnosis of a patient's condition. In addition, many of the assumptions made by ancient physicians regarding uroscopy have proved to be quite incorrect and unscientific. However, visual examination of a patient's urine may provide preliminary evidence for a diagnosis, but is generally limited to conditions that affect the urinary system (such as infection (turbidity) or blood (infection or haemorrhage)).
# The procedure
## How Uroscopy Flask is Used
A uroscopy flask is a piece of glass that is circular at the bottom, while there is a thin neck at the top, and on top of that neck there is an opening for urine. In order for a doctor to examine a patients urine one would have to urinate into a uroscopy flask. A uroscopy flask is a glass bottle that must be transparent. If there is any color to the uroscopy flask, diagnosis could be wrong. In the process of uroscopy, color is very crucial to find diseases. If the uroscopy flask has a tint of color, the doctor may not be able effectively diagnose the patient. The glass must also have an even thickness throughout the flask. If the top is very thin glass and the bottom is thick glass, then the impurities in the top may look different from the top and bottom. While in all actuality they could be the very same impurities. The impurities in urine have varying shapes, uneven glass will corrupt the diagnosis.
## Uroscopy Wheel
The uroscopy wheel is a diagram that linked the color of urine to a particular disease. It usually has twenty different uroscopy flasks with urine of different colors aligned around the boarder of the circle. Each flask has a line that connects it to a summary of a particular disease. This allowed doctors to have a quick reference guide to twenty different types of urine.
## Temperature When Testing
The temperature at which the urine is examined is a very important factor to consider in the process of uroscopy. When a patient urinates, the urine will be warm, so it is necessary for it to stay warm for proper evaluation. The external temperature should be the same as the internal temperature. When the temperature of urine goes down the bubbles in it will change. Some of them will disappear, but some will remain. With the temperature decrease particles and impurities will be more difficult to evaluate. They will toward the middle of the flask, then sink to the bottom. They will all mix together, making it more difficult to see the impurities.
Another problem with urine cooling is that it would become thicker. The longer that it had to cool down the more likely it was that the crystals in the it would bond together, causing it to thicken. This could lead to a false diagnosis, that is why doctors usually inspected the urine quickly.
Richard Bright in the 19th century A.D. invented a technique that allowed doctors to examine a patients urine effectively after the temperature had dropped. The process involved heating water, then inserting the uroscopy flask containing cooled urine. This would heat the urine causing the crystals that formed during loss of temperature to break down. As a result the urine will become thin again. This process is very effective, but a doctor should “also be careful not to shake them much before you inspect them for you will move the particles and destroy the bubbles and dilute the deposits and confuse the situation,” (The Late Greco-Roman and Byzantine Contribution to the Evolution of Laboratory Examinations of Bodily Excrement. Part1: Urine, Sperm, Menses and Stools, Pavlos C. Goudas).
## Lighting When Testing
Since the identifying the color of the urine is essential for a proper diagnosis, the lighting is crucial. This is a very complicated step in the uroscopy test. The doctor must can not visually examine the urine in an overly lit location, because it will make the urine seem too bright. He can not examine the urine in a poorly lit location, because he will not be able to properly see the urine. So, he must examine the urine in both conditions. This is done to offset the effects of not enough light and too much light. After he examines in both conditions the doctor must use his best judgment, to make a diagnosis.
# Common Diseases Found
## Diabetes mellitus
Disease in which the pancreas does not function properly. Victims of this disease will have high glucose blood sugar. Victims may suffer from: cardiovascular disease (doubled risk), chronic renal failure (it is the main cause for dialysis in developed world adults), retinal damage which can lead to blindness and is the most significant cause of adult blindness in the non-elderly in the developed world, nerve damage, erectile dysfunction (impotence), to gangrene with risk of amputation of toes, feet, and even legs.
Doctors would test by tasting the urine. A sweet taste meant the patient had diabetes.
## Jaundice
Yellowish discoloration of the whites of the eyes, skin, and mucous membranes caused by deposition of bile salts in these tissues. It occurs as a symptom of various diseases, such as hepatitis, that affect the processing of bile. Also called icterus.
Doctors would test by using their vision. If the urine had a brownish tint then the patient would most likely have jaundice.
## Kidney Disease
The kidneys are supposed to filter wastes (especially urea) from the blood and excrete them, along with water, as urine. When they are not performing this task the patient is suffering from kidney disease. The medical field that studies the kidneys and diseases affecting the kidney is called nephrology, from the Ancient Greek name for kidney.
Doctors would test urine using a visual examination. If the urine was red and/or foamy the patient was suffering from kidney disease.
## Tumors of urinary tract
When a patient develops an uncontrolled, abnormal, circumscribed growth of cells in the urinary tract.
Doctors would test urine by using a visual examination. If the urine had blood in it the patient was suffering from tumors in the urinary tract.
# Importance of uroscopy
Uroscopy was important to the Roman and Byzantine eras, because it allowed doctors to diagnose patients without technology. This was an era in which there was no microscope, stethoscope, or even thermometers. All that was needed was a uroscopy wheel, uroscopy flask, and an experienced doctor to be able to give a diagnosis. It was a very simple procedure that a doctor could determine a patients problem by simply tasting and/or looking at their urine.
Uroscopy was also necessary, because the Hippocratic Oath did not allow doctors to perform any type of surgery. It stated “I will not cut for stone, even for patients in whom the disease is manifest . . .” (Hippocratic Oath). Doctors needed a different way to find out the problems with their patients. That is when the uroscopy test became involved. It followed the Hippocratic Oath and was a very effective test for that particular time period. | https://www.wikidoc.org/index.php/Uroscopy | |
c5f6bf7fb156440e4741234ac3f1de213eba1189 | wikidoc | Utrophin | Utrophin
Utrophin is a protein that in humans is encoded by the UTRN gene.
The protein encoded by this gene is a component of the cytoskeleton. Utrophin was found during research into Duchenne's muscular dystrophy. The name is a contraction for ubiquitous dystrophin. The 900 kb gene for utrophin is found on the long arm of human chromosome 6. Utrophin was discovered due to its homology with dystrophin. It was found by screening a peptide containing the C-terminal domain of dystrophin against cDNA libraries. The homology varies over its full length from less than 30% in regions of the central rod structural domain to 85% (identity 73%) for the actin binding domain.
The tertiary structure of utrophin contains a C-terminus that consists of protein–protein interaction motifs that interact with dystroglycan, a central rod region consisting of a triple coiled-coil repeat, and an actin-binding N-terminus.
In normal muscle cells, utrophin is located at the neuromuscular synapse and myotendinous junctions. It is necessary for normal membrane maintenance, and for the clustering of the acetylcholine receptor. In adult humans, utrophin RNA is found ubiquitously, as the name implies, being abundant in the brain, kidney, liver, lung, muscle, spleen and stomach. In the human fetus during muscle differentiation, utrophin is found at the sarcolemma. It disappears when the fetus begins to express dystrophin.
Utrophin expression is dramatically increased in patients with Duchenne's muscular dystrophy (and female carriers), both in those muscle fibers lacking dystrophin and in rare, revertant fibers that express dystrophin.
No reports have yet associated mutation in the utrophin gene with disease, but it does not seem to play a critical role in development, since mice without utrophin develop normally. | Utrophin
Utrophin is a protein that in humans is encoded by the UTRN gene.[1][2]
The protein encoded by this gene is a component of the cytoskeleton. Utrophin was found during research into Duchenne's muscular dystrophy. The name is a contraction for ubiquitous dystrophin. The 900 kb gene for utrophin is found on the long arm of human chromosome 6. Utrophin was discovered due to its homology with dystrophin. It was found by screening a peptide containing the C-terminal domain of dystrophin against cDNA libraries. The homology varies over its full length from less than 30% in regions of the central rod structural domain to 85% (identity 73%) for the actin binding domain.
The tertiary structure of utrophin contains a C-terminus that consists of protein–protein interaction motifs that interact with dystroglycan, a central rod region consisting of a triple coiled-coil repeat, and an actin-binding N-terminus.
In normal muscle cells, utrophin is located at the neuromuscular synapse and myotendinous junctions. It is necessary for normal membrane maintenance, and for the clustering of the acetylcholine receptor. In adult humans, utrophin RNA is found ubiquitously, as the name implies, being abundant in the brain, kidney, liver, lung, muscle, spleen and stomach. In the human fetus during muscle differentiation, utrophin is found at the sarcolemma. It disappears when the fetus begins to express dystrophin.
Utrophin expression is dramatically increased in patients with Duchenne's muscular dystrophy (and female carriers), both in those muscle fibers lacking dystrophin and in rare, revertant fibers that express dystrophin.
No reports have yet associated mutation in the utrophin gene with disease, but it does not seem to play a critical role in development, since mice without utrophin develop normally. | https://www.wikidoc.org/index.php/Utrophin | |
6c92a93a35dac9a1f155f02c39aadcebdf5b91c7 | wikidoc | Vaccinia | Vaccinia
# Overview
Vaccinia virus (VACV or VV) is a large, complex, enveloped virus belonging to the poxvirus family. It has a linear, double-stranded DNA genome approximately 190 kbp in length, and which encodes for approximately 250 genes. The dimensions of the virion are roughly 360 × 270 × 250 nm. Vaccinia virus is well-known for its role as a vaccine that eradicated the smallpox disease, making it the first human disease to be successfully eradicated by mankind. This endeavour was carried out by the World Health Organization under the Smallpox Eradication Program. Post eradication of smallpox, scientists study Vaccinia virus to use as a tool for delivering genes into biological tissues (gene therapy and genetic engineering). Moreover, due to recent concerns about smallpox resurfacing as a possible agent for bioterrorism, scientists have renewed their interests in studying Vaccinia virus.
# Origin
Vaccinia virus is closely related to the virus that causes cowpox; historically the two were often considered to be one in the same. The precise origin of Vaccinia virus is unknown, however, due to the lack of record-keeping as the virus was repeatedly cultivated and passaged in research laboratories for many decades. The most common notion is that Vaccinia virus, cowpox virus, and Variola virus (the causative agent of smallpox), were all derived from a common ancestral virus. There is also speculation that Vaccinia virus was originally isolated from horses.
# Basic biology
Vaccinia virus is unique among DNA viruses because it replicates only in the cytoplasm of the host cell, outside of the nucleus. Therefore, the large genome is required for encoding various enzymes and proteins involved in viral DNA replication and gene transcription. During its replication cycle, VV produces four infectious forms which differ in their outer membranes: intracellular mature virion (IMV), the intracellular enveloped virion (IEV), the cell-associated enveloped virion (CEV) and the extracellular enveloped virion (EEV). Although the issue remains contentious, the prevailing view is that the IMV consists of a single lipoprotein membrane, while the CEV and EEV are both surrounded by two membrane layers and the IEV has three envelopes. The IMV is the most abundant infectious form and is thought to be responsible for spread between hosts. On the other hand, the CEV is believed to play a role in cell-to-cell spread and the EEV is thought to be important for long range dissemination within the host organism.
# Host resistance
Vaccinia contains within its genome several proteins that give the virus resistance to interferons. K3L is a protein with homology to the protein eukaryotic initiation factor 2 (eIF-2alpha). K3L protein inhibits the action of PKR, an activator of interferons. E3L is another protein encoded by Vaccinia. E3L also inhibits PKR activation; and is also able to bind to double stranded RNA.
# Use as a vaccine
A Vaccinia virus infection is very mild and is typically asymptomatic in healthy individuals, but it may cause a mild rash and fever. Immune responses generated from a Vaccinia virus infection protects the person against a lethal smallpox infection. For this reason, Vaccinia virus was, and is still being used as a live-virus vaccine against smallpox. Unlike vaccines that use weakened forms of the virus being vaccinated against, the Vaccinia virus vaccine cannot because it does not contain the smallpox virus. However, certain complications and/or vaccine adverse effects occasionally arise. The chance of this happening is significantly increased in people who are immunocompromised. Approximately one in one million individuals will develop a fatal response to the vaccination. Currently, the vaccine is only administered to health care workers or research personnel who have a high risk of contracting Vaccinia virus, and to the military personnel of the United States of America. Due to the present threat of smallpox-related bioterrorism, there is a possibility the vaccine may have to be widely administered again in the future. Therefore, scientists are currently developing novel vaccine strategies against smallpox which are safer and much faster to deploy during a bioterrorism event.
On September 1, 2007, the U.S. Food and Drug Administration (FDA) licensed a new vaccine ACAM2000 against smallpox which can be produced quickly upon need. Manufactured by Acambis Inc. of Cambridge, England, and Cambridge, Massachusets, the U.S. Centers for Disease Control and Prevention stockpiled 192.5 million doses of the new vaccine (derived from the old Dryvax, and made using a pox virus vaccinia).
# History
The original vaccine for smallpox, and the origin of the idea of vaccination, was cowpox, reported on by Edward Jenner in 1796. The Latin term used for cowpox was variolae vaccinae, essentially a direct translation of "cow-related pox". That term lent its name to the whole idea of vaccination. When it was realized that the virus used in smallpox vaccination was not, or was no longer, the same as the cowpox virus, the name 'vaccinia' stayed with the vaccine-related virus. (See OED.)
# Recent cases
In March 2007, a 2-year-old Indiana boy and his mother contracted the life-threatening vaccinia infection from the boy's father. The boy developed the telltale rash over 80 percent of his body after coming into close contact with his father, who was vaccinated for smallpox before being deployed overseas by the United States Army. The United States military resumed smallpox vaccinations in 2002. The child acquired the infection due to eczema, which is a known risk factor for vaccinia infection. The boy was treated with intravenous immunoglobulin, cidofovir, and an experimental drug being developed by SIGA Technologies. On April 19, 2007, he was sent home with no after effects except for possible scarring of the skin. | Vaccinia
Template:DiseaseDisorder infobox
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Vaccinia virus (VACV or VV) is a large, complex, enveloped virus belonging to the poxvirus family.[1] It has a linear, double-stranded DNA genome approximately 190 kbp in length, and which encodes for approximately 250 genes. The dimensions of the virion are roughly 360 × 270 × 250 nm. Vaccinia virus is well-known for its role as a vaccine that eradicated the smallpox disease, making it the first human disease to be successfully eradicated by mankind. This endeavour was carried out by the World Health Organization under the Smallpox Eradication Program. Post eradication of smallpox, scientists study Vaccinia virus to use as a tool for delivering genes into biological tissues (gene therapy and genetic engineering). Moreover, due to recent concerns about smallpox resurfacing as a possible agent for bioterrorism, scientists have renewed their interests in studying Vaccinia virus.
# Origin
Vaccinia virus is closely related to the virus that causes cowpox; historically the two were often considered to be one in the same.[2] The precise origin of Vaccinia virus is unknown, however, due to the lack of record-keeping as the virus was repeatedly cultivated and passaged in research laboratories for many decades.[3] The most common notion is that Vaccinia virus, cowpox virus, and Variola virus (the causative agent of smallpox), were all derived from a common ancestral virus. There is also speculation that Vaccinia virus was originally isolated from horses.[2]
# Basic biology
Vaccinia virus is unique among DNA viruses because it replicates only in the cytoplasm of the host cell, outside of the nucleus.[4] Therefore, the large genome is required for encoding various enzymes and proteins involved in viral DNA replication and gene transcription. During its replication cycle, VV produces four infectious forms which differ in their outer membranes: intracellular mature virion (IMV), the intracellular enveloped virion (IEV), the cell-associated enveloped virion (CEV) and the extracellular enveloped virion (EEV).[5] Although the issue remains contentious, the prevailing view is that the IMV consists of a single lipoprotein membrane, while the CEV and EEV are both surrounded by two membrane layers and the IEV has three envelopes. The IMV is the most abundant infectious form and is thought to be responsible for spread between hosts. On the other hand, the CEV is believed to play a role in cell-to-cell spread and the EEV is thought to be important for long range dissemination within the host organism.
# Host resistance
Vaccinia contains within its genome several proteins that give the virus resistance to interferons. K3L is a protein with homology to the protein eukaryotic initiation factor 2 (eIF-2alpha). K3L protein inhibits the action of PKR, an activator of interferons. E3L is another protein encoded by Vaccinia. E3L also inhibits PKR activation; and is also able to bind to double stranded RNA.[6]
# Use as a vaccine
A Vaccinia virus infection is very mild and is typically asymptomatic in healthy individuals, but it may cause a mild rash and fever. Immune responses generated from a Vaccinia virus infection protects the person against a lethal smallpox infection. For this reason, Vaccinia virus was, and is still being used as a live-virus vaccine against smallpox. Unlike vaccines that use weakened forms of the virus being vaccinated against, the Vaccinia virus vaccine cannot because it does not contain the smallpox virus. However, certain complications and/or vaccine adverse effects occasionally arise. The chance of this happening is significantly increased in people who are immunocompromised. Approximately one in one million individuals will develop a fatal response to the vaccination. Currently, the vaccine is only administered to health care workers or research personnel who have a high risk of contracting Vaccinia virus, and to the military personnel of the United States of America. Due to the present threat of smallpox-related bioterrorism, there is a possibility the vaccine may have to be widely administered again in the future. Therefore, scientists are currently developing novel vaccine strategies against smallpox which are safer and much faster to deploy during a bioterrorism event.
On September 1, 2007, the U.S. Food and Drug Administration (FDA) licensed a new vaccine ACAM2000 against smallpox which can be produced quickly upon need. Manufactured by Acambis Inc. of Cambridge, England, and Cambridge, Massachusets, the U.S. Centers for Disease Control and Prevention stockpiled 192.5 million doses of the new vaccine (derived from the old Dryvax, and made using a pox virus vaccinia).[7]
# History
The original vaccine for smallpox, and the origin of the idea of vaccination, was cowpox, reported on by Edward Jenner in 1796.[3] The Latin term used for cowpox was variolae vaccinae, essentially a direct translation of "cow-related pox". That term lent its name to the whole idea of vaccination. When it was realized that the virus used in smallpox vaccination was not, or was no longer, the same as the cowpox virus, the name 'vaccinia' stayed with the vaccine-related virus. (See OED.)
# Recent cases
In March 2007, a 2-year-old Indiana boy and his mother contracted the life-threatening vaccinia infection from the boy's father.[8] The boy developed the telltale rash over 80 percent of his body after coming into close contact with his father, who was vaccinated for smallpox before being deployed overseas by the United States Army. The United States military resumed smallpox vaccinations in 2002. The child acquired the infection due to eczema, which is a known risk factor for vaccinia infection. The boy was treated with intravenous immunoglobulin, cidofovir, and an experimental drug being developed by SIGA Technologies.[9] On April 19, 2007, he was sent home with no after effects except for possible scarring of the skin.[8] | https://www.wikidoc.org/index.php/Vaccinia | |
f8a307da490e09fbbbf0a7ed32e1126a646bfe87 | wikidoc | Vanadium | Vanadium
Vanadium (Template:IPAEng) is a chemical element that has the symbol V and atomic number 23. A soft and ductile element, vanadium naturally occurs in certain minerals and is used mainly to produce certain alloys. It is one of the 26 elements found in most living organisms.
# Notable characteristics
Vanadium is a soft and ductile, silver-grey metal. It has good resistance to corrosion by alkalis, sulfuric and hydrochloric acid. It oxidizes readily at about 933 K (660 C). Vanadium has good structural strength and a low fission neutron cross section, making it useful in nuclear applications. Although a metal, it shares with chromium and manganese the property of having valency oxides with acid properties.
Common oxidation states of vanadium include +2, +3, +4 and +5. A popular experiment with ammonium vanadate NH4VO3, reducing the compound with zinc metal, can demonstrate colorimetrically all four of these vanadium oxidation states. A +1 oxidation state is rarely seen.
# Applications
Approximately 80% of vanadium produced is used as ferrovanadium or as a steel additive. Other uses:
- In such alloys as
specialty stainless steel, e.g. for use in surgical instruments and tools.
rust resistant and high speed tool steels.
mixed with aluminium in titanium alloys used in jet engines and high-speed airframes
- specialty stainless steel, e.g. for use in surgical instruments and tools.
- rust resistant and high speed tool steels.
- mixed with aluminium in titanium alloys used in jet engines and high-speed airframes
- Vanadium steel alloys are used in axles, crankshafts, gears, and other critical components.
- It is an important carbide stabilizer in making steels.
- Because of its low fission neutron cross section, vanadium has nuclear applications.
- Vanadium foil is used in cladding titanium to steel.
- Vanadium-gallium tape is used in superconducting magnets (175,000 gauss).
- Vanadium pentoxide V2O5 is used as a catalyst in manufacturing sulfuric acid (via the contact process) and maleic anhydride. It is also used in making ceramics.
- Glass coated with vanadium dioxide VO2 can block infrared radiation (and not visible light) at a specific temperature.
- Electrical fuel cells and storage batteries such as vanadium redox batteries.
- Added to corundum to make simulated alexandrite jewelry.
- Vanadate electrochemical conversion coatings for protecting steel against rust and corrosion
- Used to make lacrosse shafts
- Possibly used to make Wootz steel and Damascus steel.
# History
Vanadium was originally discovered by Andrés Manuel del Río (a Spanish-born Mexican mineralogist) in Mexico City, in 1801. He called it "brown lead" (now named vanadinite). Through experimentation, its colors reminded him of chromium, so he named the element panchromium. He later renamed this compound erythronium, since most of the salts turned red when heated. The French chemist Hippolyte Victor Collet-Descotils incorrectly declared that del Río's new element was only impure chromium. Del Río thought himself to be mistaken and accepted the statement of the French chemist that was also backed by del Río's friend Baron Alexander von Humboldt.
In 1831, Sefström of Sweden rediscovered vanadium in a new oxide he found while working with some iron ores and later that same year Friedrich Wöhler confirmed del Río's earlier work. Later,
George William Featherstonhaugh, one of the first US geologists, suggested that the element should be named "rionium" after del Río, but this never happened.
Metallic vanadium was isolated by Henry Enfield Roscoe in 1867, who reduced vanadium(III) chloride VCl3 with hydrogen. The name vanadium comes from Vanadis, a goddess in Scandinavian mythology, because the element has beautiful multicolored chemical compounds.
# Biological role
In biology, a vanadium atom is an essential component of some enzymes, particularly the vanadium nitrogenase used by some nitrogen-fixing micro-organisms. Vanadium is essential to ascidians or sea squirts in vanadium chromagen proteins. The concentration of vanadium in their blood is more than 100 times higher than the concentration of vanadium in the seawater around them. Rats and chickens are also known to require vanadium in very small amounts and deficiencies result in reduced growth and impaired reproduction.
Ten percent of the blood cell pigment of the sea cucumber is vanadium. Just as the horseshoe crab has blue blood rather than red blood (colored by iron in hemoglobin) because of copper in the hemocyanin pigment, the blood of the sea cucumber is yellow because of the vanadium in the vanabin pigment. Nonetheless, there is no evidence that vanabins carry oxygen, in contrast to hemoglobin and hemocyanin.
A form of vanadium, vanadyl sulfate, seems to improve glucose control in people with type 2 diabetes.
## Mineral supplement in drinking water
Most continental waters show a vanadium concentration of less than 3 ppb. However, the groundwater of Mt. Fuji contains a very high concentration of vanadium—up to 150 ppb. This vanadium is solubilized from the basalt by the groundwater. The vanadium content in Mt. Fuji becomes higher at places nearer the summit and deeper in the ground. Recently this high-vanadium water of Mt. Fuji has been sold by many companies as an agent to cope with diabetes. However, there is no concrete evidence for its efficacy. The rainbow trout living in the Mt. Fuji water showed much higher accumulation of vanadium in kidneys and bone.
# Occurrence
Vanadium is never found unbound in nature but it does occur in about 65 different minerals among which are patronite VS4, vanadinite Pb5(VO4)3Cl, and carnotite K2(UO2)2(VO4)2.3H2O. Vanadium is also present in bauxite, and in carbon containing deposits such as crude oil, coal, oil shale and tar sands. Vanadium has also been detected spectroscopically in light from the Sun and some other stars.
Much of the vanadium metal being produced is now made by calcium reduction of V2O5 in a pressure vessel. Vanadium is usually recovered as a by-product or co-product, and so world resources of the element are not really indicative of available supply.
# Isolation
Vanadium is available commercially and production of a sample in the laboratory is not normally required. Commercially, routes leading to metallic vanadium as main product are not usually required as enough is produced as byproduct in other processes.
In industry, heating of vanadium ore or residues from other processes with salt NaCl or sodium carbonate Na2CO3 at about 850°C gives sodium vanadate NaVO3. This is dissolved in water and acidified to give a red solid which in turn is melted to form a crude form of vanadium pentoxide V2O5. Reduction of vanadium pentoxide with calcium gives pure vanadium. An alternative suitable for small scales is the reduction of vanadium pentachloride VCl5 with hydrogen or magnesium. Many other methods are also in use.
Industrially, most vanadium is used as an additive to improve steels. Rather than proceed via pure vanadium metal it is often sufficient to react the crude of vanadium pentoxide V2O5 with crude iron. This produces ferrovanadium suitable for further work.
# Compounds
Vanadium pentoxide V2O5 is used as a catalyst principally in the production of sulfuric acid. It is the source of vanadium used in the manufacture of ferrovanadium. It can be used as a dye and color-fixer.
Vanadyl sulfate VOSO4, also called vanadium(IV) sulfate oxide hydrate, is used as a relatively controversial dietary supplement, primarily for increasing insulin sensitivity and body-building. Whether it works for the latter purpose has not been proven, and there is some evidence that athletes who take it are merely experiencing a placebo effect.
Vanadium(IV) chloride VCl4 is a soluble form of vanadium that is commonly used in the laboratory. V(IV) is the reduced form of V(V), and commonly occurs after anaerobic respiration by dissimilatory metal reducing bacteria. VCl4 reacts violently with water.
## Toxicity of vanadium compounds
The toxicity of vanadium depends on its physico-chemical state; particularly on its valence state and solubility. Tetravalent VOSO4 has been reported to be more than 5 times as toxic as trivalent V2O3 (Roschin, 1967). Vanadium compounds are poorly absorbed through the gastrointestinal system. Inhalation exposures to vanadium and vanadium compounds result primarily in adverse effects to the respiratory system (Sax, 1984; ATSDR, 1990; Ress et al., 2003; Worle-Knirsch et al., 2007). Quantitative data are, however, insufficient to derive a subchronic or chronic inhalation reference dose. Other effects have been reported on blood parameters after oral or inhalation exposures (Scibior et al., 2006; Gonzalez-Villalva et al., 2006), on liver (Kobayashi et al., 2006), neurological development in rats (Soaso and Garcia, 2007), and other organs.
There is little evidence that vanadium or vanadium compounds are reproductive toxins or teratogens. Vanadium pentoxide was reported to be carcinogenic in male rats and male and female mice by inhalation in an NTP study (Ress et al., 2003), although the interpretation of the results has recently been disputed (Duffus, 2007). Vanadium has not been classified as to carcinogenicity by the U.S. EPA (1991a).
## Various oxidation states of vanadium ions
It is known that vanadium gets the oxidation states +2, +3, +4, +5.
To observe the colours of these states, ammonium metavanadate (NH4VO3) can be used as a starting agent.
It must be acidified beforehand so dioxovanadium(V) ion, VO2+ (yellow +5 oxidation number) is produced. In alkaline medium, the stable form of vanadium(V) state is VO3-.
Adding zinc powder and concentrated hydrochloric acid continuously, VO2+ is reduced into blue VO2+.
It can be seen that during the reaction, the mixture is green in colour as the original yellow of the +5 state and the blue of the +4 are present.
Continuously adding Zn powder and concentrated HCl, blue VO2+ is reduced to green V3+. V3+ is then reduced to violet V2+ by Zn powder and concentrated HCl again.
# Isotopes
Naturally occurring vanadium is composed of one stable isotope 51V and one radioactive isotope 50V with a half-life of 1.5×1017 years. 24 artificial radioisotopes have been characterized (in the range of mass number between 40 and 65) with the most stable being 49V with a half-life of 330 days, and 48V with a half-life of 15.9735 days. All of the remaining radioactive isotopes have half-lives shorter than an hour, the majority of them below 10 seconds. In 4 isotopes, metastable excited states were found (including 2 metastable states for 60V).
The primary decay mode before the most abundant stable isotope 51V is electron capture. The next most common mode is beta decay. The primary decay products before 51V are element 22 (titanium) isotopes and the primary products after are element 24 (chromium) isotopes.
# Precautions
Powdered metallic vanadium is a fire hazard, and unless known otherwise, all vanadium compounds should be considered highly toxic. Generally, the higher the oxidation state of vanadium, the more toxic the compound is. The most dangerous compound is vanadium pentoxide.
The Occupational Safety and Health Administration (OSHA) has set an exposure limit of 0.05 mg/m3 for vanadium pentoxide dust and 0.1 mg/m3 for vanadium pentoxide fumes in workplace air for an 8-hour workday, 40-hour work week.
The National Institute for Occupational Safety and Health (NIOSH) has recommended that 35 mg/m3 of vanadium be considered immediately dangerous to life and health. This is the exposure level of a chemical that is likely to cause permanent health problems or death. | Vanadium
Template:Infobox vanadium
Vanadium (Template:IPAEng) is a chemical element that has the symbol V and atomic number 23. A soft and ductile element, vanadium naturally occurs in certain minerals and is used mainly to produce certain alloys. It is one of the 26 elements found in most living organisms.
# Notable characteristics
Vanadium is a soft and ductile, silver-grey metal. It has good resistance to corrosion by alkalis, sulfuric and hydrochloric acid. It oxidizes readily at about 933 K (660 C). Vanadium has good structural strength and a low fission neutron cross section, making it useful in nuclear applications. Although a metal, it shares with chromium and manganese the property of having valency oxides with acid properties.
Common oxidation states of vanadium include +2, +3, +4 and +5. A popular experiment with ammonium vanadate NH4VO3, reducing the compound with zinc metal, can demonstrate colorimetrically all four of these vanadium oxidation states. A +1 oxidation state is rarely seen.
# Applications
Approximately 80% of vanadium produced is used as ferrovanadium or as a steel additive. Other uses:
- In such alloys as
specialty stainless steel, e.g. for use in surgical instruments and tools.
rust resistant and high speed tool steels.
mixed with aluminium in titanium alloys used in jet engines and high-speed airframes
- specialty stainless steel, e.g. for use in surgical instruments and tools.
- rust resistant and high speed tool steels.
- mixed with aluminium in titanium alloys used in jet engines and high-speed airframes
- Vanadium steel alloys are used in axles, crankshafts, gears, and other critical components.
- It is an important carbide stabilizer in making steels.
- Because of its low fission neutron cross section, vanadium has nuclear applications.
- Vanadium foil is used in cladding titanium to steel.
- Vanadium-gallium tape is used in superconducting magnets (175,000 gauss).
- Vanadium pentoxide V2O5 is used as a catalyst in manufacturing sulfuric acid (via the contact process) and maleic anhydride. It is also used in making ceramics.
- Glass coated with vanadium dioxide VO2 can block infrared radiation (and not visible light) at a specific temperature.
- Electrical fuel cells and storage batteries such as vanadium redox batteries.
- Added to corundum to make simulated alexandrite jewelry.
- Vanadate electrochemical conversion coatings for protecting steel against rust and corrosion
- Used to make lacrosse shafts
- Possibly used to make Wootz steel and Damascus steel.
# History
Vanadium was originally discovered by Andrés Manuel del Río (a Spanish-born Mexican mineralogist) in Mexico City, in 1801. He called it "brown lead" (now named vanadinite). Through experimentation, its colors reminded him of chromium, so he named the element panchromium. He later renamed this compound erythronium, since most of the salts turned red when heated. The French chemist Hippolyte Victor Collet-Descotils incorrectly declared that del Río's new element was only impure chromium. Del Río thought himself to be mistaken and accepted the statement of the French chemist that was also backed by del Río's friend Baron Alexander von Humboldt.
In 1831, Sefström of Sweden rediscovered vanadium in a new oxide he found while working with some iron ores and later that same year Friedrich Wöhler confirmed del Río's earlier work. Later,
George William Featherstonhaugh, one of the first US geologists, suggested that the element should be named "rionium" after del Río, but this never happened.
Metallic vanadium was isolated by Henry Enfield Roscoe in 1867, who reduced vanadium(III) chloride VCl3 with hydrogen. The name vanadium comes from Vanadis, a goddess in Scandinavian mythology, because the element has beautiful multicolored chemical compounds.
# Biological role
In biology, a vanadium atom is an essential component of some enzymes, particularly the vanadium nitrogenase used by some nitrogen-fixing micro-organisms. Vanadium is essential to ascidians or sea squirts in vanadium chromagen proteins. The concentration of vanadium in their blood is more than 100 times higher than the concentration of vanadium in the seawater around them. Rats and chickens are also known to require vanadium in very small amounts and deficiencies result in reduced growth and impaired reproduction.
Ten percent of the blood cell pigment of the sea cucumber is vanadium. Just as the horseshoe crab has blue blood rather than red blood (colored by iron in hemoglobin) because of copper in the hemocyanin pigment, the blood of the sea cucumber is yellow because of the vanadium in the vanabin pigment[1]. Nonetheless, there is no evidence that vanabins carry oxygen, in contrast to hemoglobin and hemocyanin.
A form of vanadium, vanadyl sulfate, seems to improve glucose control in people with type 2 diabetes.[2][3][4][5][6]
## Mineral supplement in drinking water
Most continental waters show a vanadium concentration of less than 3 ppb. However, the groundwater of Mt. Fuji contains a very high concentration of vanadium—up to 150 ppb. This vanadium is solubilized from the basalt by the groundwater. The vanadium content in Mt. Fuji becomes higher at places nearer the summit and deeper in the ground. Recently this high-vanadium water of Mt. Fuji has been sold by many companies as an agent to cope with diabetes. However, there is no concrete evidence for its efficacy. The rainbow trout living in the Mt. Fuji water showed much higher accumulation of vanadium in kidneys and bone.
# Occurrence
Vanadium is never found unbound in nature but it does occur in about 65 different minerals among which are patronite VS4, vanadinite Pb5(VO4)3Cl, and carnotite K2(UO2)2(VO4)2.3H2O. Vanadium is also present in bauxite, and in carbon containing deposits such as crude oil, coal, oil shale and tar sands. Vanadium has also been detected spectroscopically in light from the Sun and some other stars.
Much of the vanadium metal being produced is now made by calcium reduction of V2O5 in a pressure vessel. Vanadium is usually recovered as a by-product or co-product, and so world resources of the element are not really indicative of available supply.
# Isolation
Vanadium is available commercially and production of a sample in the laboratory is not normally required. Commercially, routes leading to metallic vanadium as main product are not usually required as enough is produced as byproduct in other processes.
In industry, heating of vanadium ore or residues from other processes with salt NaCl or sodium carbonate Na2CO3 at about 850°C gives sodium vanadate NaVO3. This is dissolved in water and acidified to give a red solid which in turn is melted to form a crude form of vanadium pentoxide V2O5. Reduction of vanadium pentoxide with calcium gives pure vanadium. An alternative suitable for small scales is the reduction of vanadium pentachloride VCl5 with hydrogen or magnesium. Many other methods are also in use.
Industrially, most vanadium is used as an additive to improve steels. Rather than proceed via pure vanadium metal it is often sufficient to react the crude of vanadium pentoxide V2O5 with crude iron. This produces ferrovanadium suitable for further work.
# Compounds
Vanadium pentoxide V2O5 is used as a catalyst principally in the production of sulfuric acid. It is the source of vanadium used in the manufacture of ferrovanadium. It can be used as a dye and color-fixer.
Vanadyl sulfate VOSO4, also called vanadium(IV) sulfate oxide hydrate, is used as a relatively controversial dietary supplement, primarily for increasing insulin sensitivity and body-building. Whether it works for the latter purpose has not been proven, and there is some evidence that athletes who take it are merely experiencing a placebo effect.
Vanadium(IV) chloride VCl4 is a soluble form of vanadium that is commonly used in the laboratory. V(IV) is the reduced form of V(V), and commonly occurs after anaerobic respiration by dissimilatory metal reducing bacteria. VCl4 reacts violently with water.
## Toxicity of vanadium compounds
The toxicity of vanadium depends on its physico-chemical state; particularly on its valence state and solubility. Tetravalent VOSO4 has been reported to be more than 5 times as toxic as trivalent V2O3 (Roschin, 1967). Vanadium compounds are poorly absorbed through the gastrointestinal system. Inhalation exposures to vanadium and vanadium compounds result primarily in adverse effects to the respiratory system (Sax, 1984; ATSDR, 1990; Ress et al., 2003; Worle-Knirsch et al., 2007). Quantitative data are, however, insufficient to derive a subchronic or chronic inhalation reference dose. Other effects have been reported on blood parameters after oral or inhalation exposures (Scibior et al., 2006; Gonzalez-Villalva et al., 2006), on liver (Kobayashi et al., 2006), neurological development in rats (Soaso and Garcia, 2007), and other organs.
There is little evidence that vanadium or vanadium compounds are reproductive toxins or teratogens. Vanadium pentoxide was reported to be carcinogenic in male rats and male and female mice by inhalation in an NTP study (Ress et al., 2003), although the interpretation of the results has recently been disputed (Duffus, 2007). Vanadium has not been classified as to carcinogenicity by the U.S. EPA (1991a).
## Various oxidation states of vanadium ions
It is known that vanadium gets the oxidation states +2, +3, +4, +5.
To observe the colours of these states, ammonium metavanadate (NH4VO3) can be used as a starting agent.
It must be acidified beforehand so dioxovanadium(V) ion, VO2+ (yellow +5 oxidation number) is produced. In alkaline medium, the stable form of vanadium(V) state is VO3-.
Adding zinc powder and concentrated hydrochloric acid continuously, VO2+ is reduced into blue VO2+.
It can be seen that during the reaction, the mixture is green in colour as the original yellow of the +5 state and the blue of the +4 are present.
Continuously adding Zn powder and concentrated HCl, blue VO2+ is reduced to green V3+. V3+ is then reduced to violet V2+ by Zn powder and concentrated HCl again.
# Isotopes
Naturally occurring vanadium is composed of one stable isotope 51V and one radioactive isotope 50V with a half-life of 1.5×1017 years. 24 artificial radioisotopes have been characterized (in the range of mass number between 40 and 65) with the most stable being 49V with a half-life of 330 days, and 48V with a half-life of 15.9735 days. All of the remaining radioactive isotopes have half-lives shorter than an hour, the majority of them below 10 seconds. In 4 isotopes, metastable excited states were found (including 2 metastable states for 60V).
The primary decay mode before the most abundant stable isotope 51V is electron capture. The next most common mode is beta decay. The primary decay products before 51V are element 22 (titanium) isotopes and the primary products after are element 24 (chromium) isotopes.
# Precautions
Powdered metallic vanadium is a fire hazard, and unless known otherwise, all vanadium compounds should be considered highly toxic. Generally, the higher the oxidation state of vanadium, the more toxic the compound is. The most dangerous compound is vanadium pentoxide.
The Occupational Safety and Health Administration (OSHA) has set an exposure limit of 0.05 mg/m3 for vanadium pentoxide dust and 0.1 mg/m3 for vanadium pentoxide fumes in workplace air for an 8-hour workday, 40-hour work week.
The National Institute for Occupational Safety and Health (NIOSH) has recommended that 35 mg/m3 of vanadium be considered immediately dangerous to life and health. This is the exposure level of a chemical that is likely to cause permanent health problems or death. | https://www.wikidoc.org/index.php/Vanadium | |
ef3fcb4170f7a09d5fd997164b99f2249942e453 | wikidoc | Vanillin | Vanillin
Vanillin, methyl vanillin, or 4-hydroxy-3-methoxybenzaldehyde, is an organic compound with the molecular formula C8H8O3. Its functional groups include aldehyde, ether, and phenol. It is the primary component of the extract of the vanilla bean. Synthetic vanillin is used as a flavoring agent in foods, beverages, and pharmaceuticals.
Methyl vanillin is used by the food industry as well as ethyl vanillin. The ethyl is more expensive but has a stronger note, and differs by having an ethoxy group (-O-CH2CH3) instead of a methoxy group (-O-CH3).
Natural vanilla extract is a mixture of several hundred different compounds in addition to vanillin. Artificial vanilla flavoring is a solution of pure vanillin, usually of synthetic origin. Because of the scarcity and expense of natural vanilla extract, there has long been interest in the synthetic preparation of its predominant component. The first commercial synthesis of vanillin began with the more readily available natural compound eugenol. Today, artificial vanillin is made from either the petrochemical guaiacol, or from lignin, a natural constituent of wood which is a byproduct of the paper industry.
Lignin-based artificial vanilla flavoring is alleged to have a richer flavor profile than oil-based flavoring; the difference is due to the presence of acetovanillone in the lignin-derived product, an impurity not found in vanillin synthesized from guaiacol.
# History
Vanilla was cultivated as a flavoring by pre-Columbian Mesoamerican peoples; at the time of their conquest by Hernándo Cortés, the Aztecs used it as a flavoring for chocolate. Europeans became aware of both chocolate and vanilla around the year 1520.
Vanillin was first isolated as a relatively pure substance in 1858 by Nicolas-Theodore Gobley, who obtained it by evaporating a vanilla extract to dryness, and recrystallizing the resulting solids from hot water. In 1874, the German scientists Ferdinand Tiemann and Wilhelm Haarmann deduced its chemical structure, at the same time finding a synthesis for vanillin from coniferin, a glycoside of isoeugenol found in pine bark, and in 1876, Karl Reimer synthesized vanillin from guaiacol. By the late 19th century, semisynthetic vanillin derived from the eugenol found in clove oil was commercially available.
Synthetic vanillin became significantly more available in the 1930s, when production from clove oil was supplanted by production from the lignin-containing waste produced by the Kraft process for preparing wood pulp for the paper industry. By 1981, a single pulp and paper mill in Ontario supplied 60% of the world market for synthetic vanillin. However, subsequent developments in the wood pulp industry have made its lignin wastes less attractive as a raw material for vanillin synthesis. While some vanillin is still made from lignin wastes, most synthetic vanillin is today synthesized in a two-step process from the petrochemical precursors guaiacol and glyoxylic acid.
Beginning in 2000, Rhodia began marketing biosynthetic vanillin prepared by the action of microorganisms on ferulic acid extracted from rice bran. At $700/kg, this product, sold under the trademarked name Rhovanil Natural, is not cost-competitive with petrochemical vanillin, which sells for around $15/kg. However, unlike vanillin synthesized from lignin or guaiacol, it can be labeled as a natural flavoring.
# Occurrence
Vanillin is most prominent as the principal flavor and aroma compound in vanilla. Cured vanilla pods contain approximately 2% by dry weight vanillin; on cured pods of high quality, relatively pure vanillin may be visible as a white dust or "frost" on the exterior of the pod.
At smaller concentrations, vanillin contributes to the flavor and aroma profiles of foodstuffs as diverse as olive oil, butter, and raspberry and lychee fruits. Aging in oak barrels imparts vanillin to some wines and spirits. In other foods, heat treatment evolves vanillin from other chemicals. In this way, vanillin contributes to the flavor and aroma of coffee, maple syrup, and whole grain products including corn tortillas and oatmeal.
# Production
## Natural production
Natural vanillin is extracted from the seed pods of Vanilla planifola, a vining orchid native to Mexico, but now grown in tropical areas around the globe. Madagascar is presently the largest producer of natural vanillin.
As harvested, the green seed pods contain vanillin in the form of its β-D-glycoside; the green pods do not have the flavor or odor of vanilla. After being harvested, their flavor is developed by a months-long curing process, the details of which vary among vanilla-producing regions, but in broad terms it proceeds as follows:
First, the seed pods are blanched in hot water, to arrest the processes of the living plant tissues. Then, for 1–2 weeks, the pods are alternately sunned and sweated: during the day, they are laid out in the sun, and each night, wrapped in cloth and packed in airtight boxes to sweat. During this process, the pods become a dark brown, and enzymes in the pod release vanillin as the free molecule. Finally, the pods are dried and further aged for several months, during which time their flavors further develop. Several methods have been described for curing vanilla in days rather than months, although they have not been widely developed in the natural vanilla industry, with its focus on producing a premium product by established methods, rather than on innovations that might alter the product's flavor profile.
Vanillin accounts for about 2% of the dry weight of cured vanilla beans, and is the chief among about 200 other flavor compounds found in vanilla.
## Chemical synthesis
The demand for vanilla flavoring has long exceeded the supply of vanilla beans. As of 2001, the annual demand for vanillin was 12,000 tons, but only 1800 tons of natural vanillin were produced. The remainder was produced by chemical synthesis. Vanillin was first synthesized from eugenol (found in oil of clove) in 1874–75, less than 20 years after it was first identified and isolated. Vanillin was commercially produced from eugenol until the 1920s. Later it was synthesized from lignin-containing sulfite liquor, a byproduct of wood pulp processing in paper manufacture. Counter-intuitively, even though it uses waste materials, the lignin process is no longer popular because of environmental concerns, and today most vanillin is produced from the petrochemical raw material guaiacol. Several routes exist for synthesizing vanillin from guaiacol. At present, the most significant of these is the two-step process practiced by Rhodia since the 1970s, in which guaiacol reacts with glyoxylic acid by electrophilic aromatic substitution. The resulting vanilmandelic acid is then converted to vanillin by oxidative decarboxylation.
# Uses
The largest single use of vanillin is as a flavoring, usually in sweet foods. The ice cream and chocolate industries together comprise 75% of the market for vanillin as a flavoring, with smaller amounts being used in confections and baked goods.
Vanillin is also used in the fragrance industry, in perfumes, and to mask unpleasant odors or tastes in medicines, livestock fodder, and cleaning products.
Vanillin has been used as a chemical intermediate in the production of pharmaceuticals and other fine chemicals. In 1970, more than half the world's vanillin production was used in the synthesis of other chemicals, but as of 2004 this use accounts for only 13% of the market for vanillin. | Vanillin
Template:Chembox new
Vanillin, methyl vanillin, or 4-hydroxy-3-methoxybenzaldehyde, is an organic compound with the molecular formula C8H8O3. Its functional groups include aldehyde, ether, and phenol. It is the primary component of the extract of the vanilla bean. Synthetic vanillin is used as a flavoring agent in foods, beverages, and pharmaceuticals.
Methyl vanillin is used by the food industry as well as ethyl vanillin. The ethyl is more expensive but has a stronger note, and differs by having an ethoxy group (-O-CH2CH3) instead of a methoxy group (-O-CH3).
Natural vanilla extract is a mixture of several hundred different compounds in addition to vanillin. Artificial vanilla flavoring is a solution of pure vanillin, usually of synthetic origin. Because of the scarcity and expense of natural vanilla extract, there has long been interest in the synthetic preparation of its predominant component. The first commercial synthesis of vanillin began with the more readily available natural compound eugenol. Today, artificial vanillin is made from either the petrochemical guaiacol, or from lignin, a natural constituent of wood which is a byproduct of the paper industry.
Lignin-based artificial vanilla flavoring is alleged to have a richer flavor profile than oil-based flavoring; the difference is due to the presence of acetovanillone in the lignin-derived product, an impurity not found in vanillin synthesized from guaiacol.[1]
# History
Vanilla was cultivated as a flavoring by pre-Columbian Mesoamerican peoples; at the time of their conquest by Hernándo Cortés, the Aztecs used it as a flavoring for chocolate. Europeans became aware of both chocolate and vanilla around the year 1520.[2]
Vanillin was first isolated as a relatively pure substance in 1858 by Nicolas-Theodore Gobley, who obtained it by evaporating a vanilla extract to dryness, and recrystallizing the resulting solids from hot water.[3] In 1874, the German scientists Ferdinand Tiemann and Wilhelm Haarmann deduced its chemical structure, at the same time finding a synthesis for vanillin from coniferin, a glycoside of isoeugenol found in pine bark,[4] and in 1876, Karl Reimer synthesized vanillin from guaiacol.[5] By the late 19th century, semisynthetic vanillin derived from the eugenol found in clove oil was commercially available.[6]
Synthetic vanillin became significantly more available in the 1930s, when production from clove oil was supplanted by production from the lignin-containing waste produced by the Kraft process for preparing wood pulp for the paper industry. By 1981, a single pulp and paper mill in Ontario supplied 60% of the world market for synthetic vanillin.[7] However, subsequent developments in the wood pulp industry have made its lignin wastes less attractive as a raw material for vanillin synthesis. While some vanillin is still made from lignin wastes, most synthetic vanillin is today synthesized in a two-step process from the petrochemical precursors guaiacol and glyoxylic acid.[8]
Beginning in 2000, Rhodia began marketing biosynthetic vanillin prepared by the action of microorganisms on ferulic acid extracted from rice bran. At $700/kg, this product, sold under the trademarked name Rhovanil Natural, is not cost-competitive with petrochemical vanillin, which sells for around $15/kg.[9] However, unlike vanillin synthesized from lignin or guaiacol, it can be labeled as a natural flavoring.
# Occurrence
Vanillin is most prominent as the principal flavor and aroma compound in vanilla. Cured vanilla pods contain approximately 2% by dry weight vanillin; on cured pods of high quality, relatively pure vanillin may be visible as a white dust or "frost" on the exterior of the pod.
At smaller concentrations, vanillin contributes to the flavor and aroma profiles of foodstuffs as diverse as olive oil,[10] butter,[11] and raspberry[12] and lychee[13] fruits. Aging in oak barrels imparts vanillin to some wines and spirits.[14] In other foods, heat treatment evolves vanillin from other chemicals. In this way, vanillin contributes to the flavor and aroma of coffee,[15] maple syrup,[16] and whole grain products including corn tortillas[17] and oatmeal.[18]
# Production
## Natural production
Natural vanillin is extracted from the seed pods of Vanilla planifola, a vining orchid native to Mexico, but now grown in tropical areas around the globe. Madagascar is presently the largest producer of natural vanillin.
As harvested, the green seed pods contain vanillin in the form of its β-D-glycoside; the green pods do not have the flavor or odor of vanilla.[19] After being harvested, their flavor is developed by a months-long curing process, the details of which vary among vanilla-producing regions, but in broad terms it proceeds as follows:
First, the seed pods are blanched in hot water, to arrest the processes of the living plant tissues. Then, for 1–2 weeks, the pods are alternately sunned and sweated: during the day, they are laid out in the sun, and each night, wrapped in cloth and packed in airtight boxes to sweat. During this process, the pods become a dark brown, and enzymes in the pod release vanillin as the free molecule. Finally, the pods are dried and further aged for several months, during which time their flavors further develop. Several methods have been described for curing vanilla in days rather than months, although they have not been widely developed in the natural vanilla industry,[20] with its focus on producing a premium product by established methods, rather than on innovations that might alter the product's flavor profile.
Vanillin accounts for about 2% of the dry weight of cured vanilla beans, and is the chief among about 200 other flavor compounds found in vanilla.
## Chemical synthesis
The demand for vanilla flavoring has long exceeded the supply of vanilla beans. As of 2001, the annual demand for vanillin was 12,000 tons, but only 1800 tons of natural vanillin were produced.[21] The remainder was produced by chemical synthesis. Vanillin was first synthesized from eugenol (found in oil of clove) in 1874–75, less than 20 years after it was first identified and isolated. Vanillin was commercially produced from eugenol until the 1920s.[22] Later it was synthesized from lignin-containing sulfite liquor, a byproduct of wood pulp processing in paper manufacture.[23] Counter-intuitively, even though it uses waste materials, the lignin process is no longer popular because of environmental concerns, and today most vanillin is produced from the petrochemical raw material guaiacol.[24] Several routes exist for synthesizing vanillin from guaiacol.[25] At present, the most significant of these is the two-step process practiced by Rhodia since the 1970s, in which guaiacol reacts with glyoxylic acid by electrophilic aromatic substitution. The resulting vanilmandelic acid is then converted to vanillin by oxidative decarboxylation.[26]
# Uses
The largest single use of vanillin is as a flavoring, usually in sweet foods. The ice cream and chocolate industries together comprise 75% of the market for vanillin as a flavoring, with smaller amounts being used in confections and baked goods.[27]
Vanillin is also used in the fragrance industry, in perfumes, and to mask unpleasant odors or tastes in medicines, livestock fodder, and cleaning products.[28]
Vanillin has been used as a chemical intermediate in the production of pharmaceuticals and other fine chemicals. In 1970, more than half the world's vanillin production was used in the synthesis of other chemicals,[29] but as of 2004 this use accounts for only 13% of the market for vanillin.[30] | https://www.wikidoc.org/index.php/Vanillin | |
f01fba603d1be2a44b3886978503e018f7d37273 | wikidoc | Variance | Variance
In probability theory and statistics, the variance of a random variable (or somewhat more precisely, of a probability distribution) is one measure of statistical dispersion, averaging the squared distance of its possible values from the expected value. Whereas the mean is a way to describe the location of a distribution, the variance is a way to capture its scale or degree of being spread out. The unit of variance is the square of the unit of the original variable. The square root of the variance, called the standard deviation, has the same units as the original variable and can be easier to interpret for this reason.
The variance of a real-valued random variable is its second central moment, and it also happens to be its second cumulant. Just as some distributions do not have a mean, some do not have a variance as well. The mean exists whenever the variance exists, but not vice versa.
# Definition
If μ = E(X) is the expected value (mean) of the random variable X, then the variance is
If the random variable is discrete with probability mass function p1, ..., pn, this is equivalent to
(Note: this variance should be divided by the sum of weights in the case of a discrete weighted variance.)
That is, it is the expected value of the square of the deviation of X from its own mean. In plain language, it can be expressed as "The average of the square of the distance of each data point from the mean". It is thus the mean squared deviation. The variance of random variable X is typically designated as Var(X), \scriptstyle\sigma_X^2, or simply σ2.
Note that the above definition can be used for both discrete and continuous random variables. Of all the points about which squared deviations could have been calculated, it is fairly easy to prove that using the mean produces the minimum value for the sum (and average) of squared deviations.
Many distributions, such as the Cauchy distribution, do not have a variance because the relevant integral diverges. In particular, if a distribution does not have an expected value, it does not have a variance either. The converse is not true: there are distributions for which the expected value exists, but the variance does not.
# Properties, introduction
- Variance is non-negative because the squares are positive or zero.
- If all values of a random variable are equal, then its variance is 0.
- In a finite population or sample, if some elements of the variable are unequal, then the variance is larger than 0.
- In a finite population, if the list is extended with a number that is equal to the mean, then the variance decreases unless it was 0. For example, the variance of 1, 2, 3 is smaller than the variance of 1, 3.
- Scaling:
Adding a constant: If a constant number is added to all values of the variable, then the variance does not change. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 11, 12, 13, 14 is also 1.25.
Multiplying by a constant: If the values of the variable are multiplied by a constant number, then the variance is multiplied by the square of the constant. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 10, 20, 30, 40 is 125. In this example, the values of the variable were multiplied by 10 and then the variance is multiplied by 100.
Properties 5.1 (adding a constant) and 5.2 (multiplying by a constant) jointly determine what happens with the variance after a scale transformation of the values: If a and b are constant numbers, and the variables X and Y are related by Y = aX + b, then Var(Y) = a2 Var(X). For example, suppose that the temperatures on several days have been measured in degrees Celsius and that the variance was 10. Suppose that the temperatures are converted to degrees Fahrenheit. These two temperature scales are related by the equation °F = 1.8 × °C + 32. So with a = 1.8 and b = 32 we obtain that the variance of the list of converted temperatures will be 1.8 × 1.8 × 10 = 32.4.
- Adding a constant: If a constant number is added to all values of the variable, then the variance does not change. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 11, 12, 13, 14 is also 1.25.
- Multiplying by a constant: If the values of the variable are multiplied by a constant number, then the variance is multiplied by the square of the constant. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 10, 20, 30, 40 is 125. In this example, the values of the variable were multiplied by 10 and then the variance is multiplied by 100.
- Properties 5.1 (adding a constant) and 5.2 (multiplying by a constant) jointly determine what happens with the variance after a scale transformation of the values: If a and b are constant numbers, and the variables X and Y are related by Y = aX + b, then Var(Y) = a2 Var(X). For example, suppose that the temperatures on several days have been measured in degrees Celsius and that the variance was 10. Suppose that the temperatures are converted to degrees Fahrenheit. These two temperature scales are related by the equation °F = 1.8 × °C + 32. So with a = 1.8 and b = 32 we obtain that the variance of the list of converted temperatures will be 1.8 × 1.8 × 10 = 32.4.
- Chebyshev's inequality
- The variance of a finite sum of uncorrelated random variables is equal to the sum of their variances. For example, suppose that in a population of married couples the hourly income of the women is independent of the income of the men. Suppose that income of the women has variance 100 and the income of the men has variance 200. Then the variance of their joint income is 100 + 200 = 300. Another example is this: We have seen that the variance of 1, 2, 3, 4 is 1.25. So if 40 persons draw independently a random number from this list, and we add their choices, then the variance of the sum will be 40 × 1.25 = 50.
- Suppose that the observations can be partitioned into subgroups according to some second variable. Then the variance of the total group is equal to the mean of the variances of the subgroups plus the variance of the means of the subgroups. This property is known as variance decomposition or the law of total variance and plays an important role in the analysis of variance. For example, suppose that a group consists of a subgroup of men and an equally large subgroup of women. Suppose that the men have a mean body length of 180 and that the variance of their lengths is 100. Suppose that the women have a mean length of 160 and that the variance of their lengths is 50. Then the mean of the variances is (100 + 50) / 2 = 75; the variance of the means is the variance of 180, 160 which is 100. Then, for the total group of men and women combined, the variance of the body lengths will be 75 + 100 = 175. Note that this uses N for the denominator instead of N - 1. In a more general case, if the subgroups have unequal sizes, then they must be weighted proportionally to their size in the computations of the means and variances. The formula is also valid with more than two groups, and even if the grouping variable is continuous.This formula implies that the variance of the total group cannot be smaller than the mean of the variances of the subgroups. Note, however, that the total variance is not necessarily larger than the variances of the subgroups. In the above example, when the subgroups are analyzed separately, the variance is influenced only by the man-man differences and the woman-woman differences. If the two groups are combined, however, then the men-women differences enter into the variance also.
- Many computational formulas for the variance are based on this equality: The variance is equal to the mean of the squares minus the square of the mean. For example, if we consider the numbers 1, 2, 3, 4 then the mean of the squares is (1 × 1 + 2 × 2 + 3 × 3 + 4 × 4) / 4 = 7.5. The mean is 2.5, so the square of the mean is 6.25. Therefore the variance is 7.5 − 6.25 = 1.25, which is indeed the same result obtained earlier with the definition formulas. Many pocket calculators use an algorithm that is based on this formula and that allows them to compute the variance while the data are entered, without storing all values in memory. The algorithm is to adjust only three variables when a new data value is entered: The number of data entered so far (n), the sum of the values so far (S), and the sum of the squared values so far (SS). For example, if the data are 1, 2, 3, 4, then after entering the first value, the algorithm would have n = 1, S = 1 and SS = 1. After entering the second value (2), it would have n = 2, S = 3 and SS = 5. When all data are entered, it would have n = 4, S = 10 and SS = 30. Next, the mean is computed as M = S / n, and finally the variance is computed as SS / n − M × M. In this example the outcome would be 30 / 4 - 2.5 × 2.5 = 7.5 − 6.25 = 1.25. If the unbiased sample estimate is to be computed, the outcome will be multiplied by n / (n − 1), which yields 1.667 in this example.
# Properties, formal
This section provides a more formal treatment of the material in the previous section, with the same numbering scheme.
6. Effect of a linear transformation
It can be shown from the definition that the variance does not depend on the mean value μ. That is, if the variable is "displaced" an amount b by taking X + b, the variance of the resulting random variable is left untouched. By contrast, if the variable is multiplied by a scaling factor a, the variance is multiplied by a2. More formally, if a and b are real constants and X is a random variable whose variance is defined, then
8.a. Variance of the sum of uncorrelated variables
One reason for the use of the variance in preference to other measures of dispersion is that the variance of the sum (or the difference) of uncorrelated random variables is the sum of their variances:
This statement is often made with the stronger condition that the variables are independent, but uncorrelatedness suffices. So if the variables have the same variance σ2, then, since division by n is a linear transformation, this formula immediately implies that the variance of their mean is
That is, the variance of the mean decreases with n. This fact is used in the definition of the standard error of the sample mean, which is used in the central limit theorem.
8.b. Variance of the sum of correlated variables
In general, if the variables are correlated, then the variance of their sum is the sum of their covariances:
Here Cov is the covariance, which is zero for independent random variables (if it exists). The formula states that the variance of a sum is equal to the sum of all elements in the covariance matrix of the components. This formula is used in the theory of Cronbach's alpha in classical test theory.
So if the variables have equal variance σ2 and the average correlation of distinct variables is ρ, then the variance of their mean is
This implies that the variance of the mean increases with the average of the correlations. Moreover, if the variables have unit variance, for example if they are standardized, then this simplifies to
This formula is used in the Spearman-Brown prediction formula of classical test theory. This converges to ρ if n goes to infinity, provided that the average correlation remains constant or converges too. So for the variance of the mean of standardized variables with equal correlations or converging average correlation we have
Therefore, the variance of the mean of a large number of standardized variables is approximately equal to their average correlation. This makes clear that the sample mean of correlated variables does generally not converge to the population mean, even though the Law of large numbers states that the sample mean will converge for independent variables.
8.c. Variance of a weighted sum of variables
Properties 6 and 8, along with this property from the covariance page: Cov(aX, bY) = ab Cov(X, Y) jointly imply that
This implies that in a weighted sum of variables, the variable with the largest weight will have a disproportionally large weight in the variance of the total. For example, if X and Y are uncorrelated and the weight of X is two times the weight of Y, then the weight of the variance of X will be four times the weight of the variance of Y.
9. Decomposition of variance
The general formula for variance decomposition or the law of total variance is: If X and Y are two random variables and the variance of X exists, then
Here, E(X|Y) is the conditional expectation of X given Y, and Var(X|Y) is the conditional variance of X given Y. (A more intuitive explanation is that given a particular value of Y, then X follows a distribution with mean E(X|Y) and variance Var(X|Y). The above formula tells how to find Var(X) based on the distributions of these two quantities when Y is allowed to vary.) This formula is often applied in analysis of variance, where the corresponding formula is
It is also used in linear regression analysis, where the corresponding formula is
This can also be derived from the additivity of variances (property 8), since the total (observed) score is the sum of the predicted score and the error score, where the latter two are uncorrelated.
10. Computational formula for variance
The computational formula for the variance follows in a straightforward manner from the linearity of expected values and the above definition:
This is often used to calculate the variance in practice, although it suffers from numerical approximation error if the two components of the equation are similar in magnitude.
## Characteristic property
The second moment of a random variable attains the minimum value when taken around the mean of the random variable, i.e. \mathrm{E} X = \mathrm{argmin}_a \mathrm{E} (X - a)^2. This property could be reversed, i.e. if the function \phi satisfies \mathrm{E} X = \mathrm{argmin}_a \mathrm{E} \phi(X - a) then it is necessary of the form \phi = a x^2 + b. This is also true in multidimensional case .
# Approximating the variance of a function
The delta method uses second-order Taylor expansions to approximate the variance of a function of one or more random variables. For example, the approximate variance of a function of one variable is given by
provided that f is twice differentiable and that the mean and variance of X are finite.
# Population variance and sample variance
In general, the population variance of a finite population of size N is given by
-r if the population is an abstract population with probability distribution Pr:
where \overline{x} is the population mean. This is merely a special case of the general definition of variance introduced above, but restricted to finite populations.
In many practical situations, the true variance of a population is not known a priori and must be computed somehow. When dealing with infinite populations, this is generally impossible.
A common method is estimating the variance of large (finite or infinite) populations from a sample. We take a sample (y_1,\dots,y_n) of n values from the population, and estimate the variance on the basis of this sample. There are several good estimators. Two of them are well known:
and
Both are referred to as sample variance. Most advanced electronic calculators can calculate both s_n^2 and s^2at the press of a button, in which case that button is usually labeled \sigma^2 or \sigma_n^2 for s_n^2 and \sigma_{n-1}^2 for s^2.
The two estimators only differ slightly as we see, and for larger values of the sample size n the difference is negligible. The second one is an unbiased estimator of the population variance, meaning that its expected value E is equal to the true variance of the sampled random variable. The first one may be seen as the variance of the sample considered as a population.
Common sense would suggest to apply the population formula to the sample as well. The reason that it is biased is that the sample mean is generally somewhat closer to the observations in the sample than the population mean is to these observations. This is so because the sample mean is by definition in the middle of the sample, while the population mean may even lie outside the sample. So the deviations to the sample mean will often be smaller than the deviations to the population mean, and so, if the same formula is applied to both, then this variance estimate will on average be somewhat smaller in the sample than in the population.
One common source of confusion is that the term sample variance may refer to either the unbiased estimator s^2 of the population variance, or to the variance \sigma^2 of the sample viewed as a finite population. Both can be used to estimate the true population variance. Apart from theoretical considerations, it doesn't really matter which one is used, as for small sample sizes both are inaccurate and for large values of n they are practically the same. Naively computing the variance by dividing by n instead of n-1 systematically underestimates the population variance. Moreover, in practical applications most people report the standard deviation rather than the sample variance, and the standard deviation that is obtained from the unbiased n-1 version of the sample variance has a slight negative bias (though for normally distributed samples a theoretically interesting but rarely used slight correction exists to eliminate this bias). Nevertheless, in applied statistics it is a convention to use the n-1 version if the variance or the standard deviation is computed from a sample.
In practice, for large n, the distinction is often a minor one. In the course of statistical measurements, sample sizes so small as to warrant the use of the unbiased variance
virtually never occur. In this context Press et al. commented that if the difference between n and n−1 ever matters to you, then you are probably up to no good anyway - e.g., trying to substantiate a questionable hypothesis with marginal data.
## Distribution of the sample variance
Being a function of random variables, the sample variance is itself a random variable, and it is natural to study its distribution. In the case that y_i are independent Gaussian realizations, Cochran's theorem shows that s^2 follows a scaled chi-square distribution:
(n-1)\frac{s^2}{\sigma^2}\sim\chi^2_{n-1}
As a direct consequence, it follows that \operatorname{E}(s^2)=\sigma^2.
However, even in the absence of the Gaussian assumption, it is still possible to prove that s^2 is unbiased for \sigma^2:
# Generalizations
If X is a vector-valued random variable, with values in \mathbb{R}^n, and thought of as a column vector, then the natural generalization of variance is \operatorname{E}((X - \mu)(X - \mu)^\operatorname{T}), where \mu = \operatorname{E}(X) and X^\operatorname{T} is the transpose of X, and so is a row vector. This variance is a positive semi-definite square matrix, commonly referred to as the covariance matrix.
If X is a complex-valued random variable, with values in \mathbb{C}, then its variance is \operatorname{E}((X - \mu)(X - \mu)^*), where X^- is the complex conjugate of X. This variance is also a positive semi-definite square matrix.
# History
The term variance was first introduced by Ronald Fisher in his 1918 paper The Correlation Between Relatives on the Supposition of Mendelian Inheritance.
# Moment of inertia
The variance of a probability distribution is analogous to the moment of inertia in classical mechanics of a corresponding mass distribution along a line, with respect to rotation about its center of mass. It is because of this analogy that such things as the variance are called moments of probability distributions. (The covariance matrix is analogous to the moment of inertia tensor for multivariate distributions.) | Variance
Template:Otheruses4
In probability theory and statistics, the variance of a random variable (or somewhat more precisely, of a probability distribution) is one measure of statistical dispersion, averaging the squared distance of its possible values from the expected value. Whereas the mean is a way to describe the location of a distribution, the variance is a way to capture its scale or degree of being spread out. The unit of variance is the square of the unit of the original variable. The square root of the variance, called the standard deviation, has the same units as the original variable and can be easier to interpret for this reason.
The variance of a real-valued random variable is its second central moment, and it also happens to be its second cumulant. Just as some distributions do not have a mean, some do not have a variance as well. The mean exists whenever the variance exists, but not vice versa.
# Definition
If μ = E(X) is the expected value (mean) of the random variable X, then the variance is
If the random variable is discrete with probability mass function p1, ..., pn, this is equivalent to
(Note: this variance should be divided by the sum of weights in the case of a discrete weighted variance.)
That is, it is the expected value of the square of the deviation of X from its own mean. In plain language, it can be expressed as "The average of the square of the distance of each data point from the mean". It is thus the mean squared deviation. The variance of random variable X is typically designated as Var(X), <math>\scriptstyle\sigma_X^2</math>, or simply σ2.
Note that the above definition can be used for both discrete and continuous random variables. Of all the points about which squared deviations could have been calculated, it is fairly easy to prove that using the mean produces the minimum value for the sum (and average) of squared deviations.
Many distributions, such as the Cauchy distribution, do not have a variance because the relevant integral diverges. In particular, if a distribution does not have an expected value, it does not have a variance either. The converse is not true: there are distributions for which the expected value exists, but the variance does not.
# Properties, introduction
- Variance is non-negative because the squares are positive or zero.
- If all values of a random variable are equal, then its variance is 0.
- In a finite population or sample, if some elements of the variable are unequal, then the variance is larger than 0.
- In a finite population, if the list is extended with a number that is equal to the mean, then the variance decreases unless it was 0. For example, the variance of 1, 2, 3 is smaller than the variance of 1, 3.
- Scaling:
Adding a constant: If a constant number is added to all values of the variable, then the variance does not change. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 11, 12, 13, 14 is also 1.25.
Multiplying by a constant: If the values of the variable are multiplied by a constant number, then the variance is multiplied by the square of the constant. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 10, 20, 30, 40 is 125. In this example, the values of the variable were multiplied by 10 and then the variance is multiplied by 100.
Properties 5.1 (adding a constant) and 5.2 (multiplying by a constant) jointly determine what happens with the variance after a scale transformation of the values: If a and b are constant numbers, and the variables X and Y are related by Y = aX + b, then Var(Y) = a2 Var(X). For example, suppose that the temperatures on several days have been measured in degrees Celsius and that the variance was 10. Suppose that the temperatures are converted to degrees Fahrenheit. These two temperature scales are related by the equation °F = 1.8 × °C + 32. So with a = 1.8 and b = 32 we obtain that the variance of the list of converted temperatures will be 1.8 × 1.8 × 10 = 32.4.
- Adding a constant: If a constant number is added to all values of the variable, then the variance does not change. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 11, 12, 13, 14 is also 1.25.
- Multiplying by a constant: If the values of the variable are multiplied by a constant number, then the variance is multiplied by the square of the constant. For example, the variance of 1, 2, 3, 4 is 1.25 and the variance of 10, 20, 30, 40 is 125. In this example, the values of the variable were multiplied by 10 and then the variance is multiplied by 100.
- Properties 5.1 (adding a constant) and 5.2 (multiplying by a constant) jointly determine what happens with the variance after a scale transformation of the values: If a and b are constant numbers, and the variables X and Y are related by Y = aX + b, then Var(Y) = a2 Var(X). For example, suppose that the temperatures on several days have been measured in degrees Celsius and that the variance was 10. Suppose that the temperatures are converted to degrees Fahrenheit. These two temperature scales are related by the equation °F = 1.8 × °C + 32. So with a = 1.8 and b = 32 we obtain that the variance of the list of converted temperatures will be 1.8 × 1.8 × 10 = 32.4.
- Chebyshev's inequality
- The variance of a finite sum of uncorrelated random variables is equal to the sum of their variances. For example, suppose that in a population of married couples the hourly income of the women is independent of the income of the men. Suppose that income of the women has variance 100 and the income of the men has variance 200. Then the variance of their joint income is 100 + 200 = 300. Another example is this: We have seen that the variance of 1, 2, 3, 4 is 1.25. So if 40 persons draw independently a random number from this list, and we add their choices, then the variance of the sum will be 40 × 1.25 = 50.
- Suppose that the observations can be partitioned into subgroups according to some second variable. Then the variance of the total group is equal to the mean of the variances of the subgroups plus the variance of the means of the subgroups. This property is known as variance decomposition or the law of total variance and plays an important role in the analysis of variance. For example, suppose that a group consists of a subgroup of men and an equally large subgroup of women. Suppose that the men have a mean body length of 180 and that the variance of their lengths is 100. Suppose that the women have a mean length of 160 and that the variance of their lengths is 50. Then the mean of the variances is (100 + 50) / 2 = 75; the variance of the means is the variance of 180, 160 which is 100. Then, for the total group of men and women combined, the variance of the body lengths will be 75 + 100 = 175. Note that this uses N for the denominator instead of N - 1. In a more general case, if the subgroups have unequal sizes, then they must be weighted proportionally to their size in the computations of the means and variances. The formula is also valid with more than two groups, and even if the grouping variable is continuous.[1]This formula implies that the variance of the total group cannot be smaller than the mean of the variances of the subgroups. Note, however, that the total variance is not necessarily larger than the variances of the subgroups. In the above example, when the subgroups are analyzed separately, the variance is influenced only by the man-man differences and the woman-woman differences. If the two groups are combined, however, then the men-women differences enter into the variance also.
- Many computational formulas for the variance are based on this equality: The variance is equal to the mean of the squares minus the square of the mean. For example, if we consider the numbers 1, 2, 3, 4 then the mean of the squares is (1 × 1 + 2 × 2 + 3 × 3 + 4 × 4) / 4 = 7.5. The mean is 2.5, so the square of the mean is 6.25. Therefore the variance is 7.5 − 6.25 = 1.25, which is indeed the same result obtained earlier with the definition formulas. Many pocket calculators use an algorithm that is based on this formula and that allows them to compute the variance while the data are entered, without storing all values in memory. The algorithm is to adjust only three variables when a new data value is entered: The number of data entered so far (n), the sum of the values so far (S), and the sum of the squared values so far (SS). For example, if the data are 1, 2, 3, 4, then after entering the first value, the algorithm would have n = 1, S = 1 and SS = 1. After entering the second value (2), it would have n = 2, S = 3 and SS = 5. When all data are entered, it would have n = 4, S = 10 and SS = 30. Next, the mean is computed as M = S / n, and finally the variance is computed as SS / n − M × M. In this example the outcome would be 30 / 4 - 2.5 × 2.5 = 7.5 − 6.25 = 1.25. If the unbiased sample estimate is to be computed, the outcome will be multiplied by n / (n − 1), which yields 1.667 in this example.
# Properties, formal
This section provides a more formal treatment of the material in the previous section, with the same numbering scheme.
6. Effect of a linear transformation
It can be shown from the definition that the variance does not depend on the mean value μ. That is, if the variable is "displaced" an amount b by taking X + b, the variance of the resulting random variable is left untouched. By contrast, if the variable is multiplied by a scaling factor a, the variance is multiplied by a2. More formally, if a and b are real constants and X is a random variable whose variance is defined, then
8.a. Variance of the sum of uncorrelated variables
One reason for the use of the variance in preference to other measures of dispersion is that the variance of the sum (or the difference) of uncorrelated random variables is the sum of their variances:
This statement is often made with the stronger condition that the variables are independent, but uncorrelatedness suffices. So if the variables have the same variance σ2, then, since division by n is a linear transformation, this formula immediately implies that the variance of their mean is
That is, the variance of the mean decreases with n. This fact is used in the definition of the standard error of the sample mean, which is used in the central limit theorem.
8.b. Variance of the sum of correlated variables
In general, if the variables are correlated, then the variance of their sum is the sum of their covariances:
Here Cov is the covariance, which is zero for independent random variables (if it exists). The formula states that the variance of a sum is equal to the sum of all elements in the covariance matrix of the components. This formula is used in the theory of Cronbach's alpha in classical test theory.
So if the variables have equal variance σ2 and the average correlation of distinct variables is ρ, then the variance of their mean is
This implies that the variance of the mean increases with the average of the correlations. Moreover, if the variables have unit variance, for example if they are standardized, then this simplifies to
This formula is used in the Spearman-Brown prediction formula of classical test theory. This converges to ρ if n goes to infinity, provided that the average correlation remains constant or converges too. So for the variance of the mean of standardized variables with equal correlations or converging average correlation we have
Therefore, the variance of the mean of a large number of standardized variables is approximately equal to their average correlation. This makes clear that the sample mean of correlated variables does generally not converge to the population mean, even though the Law of large numbers states that the sample mean will converge for independent variables.
8.c. Variance of a weighted sum of variables
Properties 6 and 8, along with this property from the covariance page: Cov(aX, bY) = ab Cov(X, Y) jointly imply that
This implies that in a weighted sum of variables, the variable with the largest weight will have a disproportionally large weight in the variance of the total. For example, if X and Y are uncorrelated and the weight of X is two times the weight of Y, then the weight of the variance of X will be four times the weight of the variance of Y.
9. Decomposition of variance
The general formula for variance decomposition or the law of total variance is: If X and Y are two random variables and the variance of X exists, then
Here, E(X|Y) is the conditional expectation of X given Y, and Var(X|Y) is the conditional variance of X given Y. (A more intuitive explanation is that given a particular value of Y, then X follows a distribution with mean E(X|Y) and variance Var(X|Y). The above formula tells how to find Var(X) based on the distributions of these two quantities when Y is allowed to vary.) This formula is often applied in analysis of variance, where the corresponding formula is
It is also used in linear regression analysis, where the corresponding formula is
This can also be derived from the additivity of variances (property 8), since the total (observed) score is the sum of the predicted score and the error score, where the latter two are uncorrelated.
10. Computational formula for variance
The computational formula for the variance follows in a straightforward manner from the linearity of expected values and the above definition:
This is often used to calculate the variance in practice, although it suffers from numerical approximation error if the two components of the equation are similar in magnitude.
## Characteristic property
The second moment of a random variable attains the minimum value when taken around the mean of the random variable, i.e. <math>\mathrm{E} X = \mathrm{argmin}_a \mathrm{E} (X - a)^2</math>. This property could be reversed, i.e. if the function <math>\phi</math> satisfies <math>\mathrm{E} X = \mathrm{argmin}_a \mathrm{E} \phi(X - a)</math> then it is necessary of the form <math>\phi = a x^2 + b</math>. This is also true in multidimensional case [1].
# Approximating the variance of a function
The delta method uses second-order Taylor expansions to approximate the variance of a function of one or more random variables. For example, the approximate variance of a function of one variable is given by
provided that f is twice differentiable and that the mean and variance of X are finite.
# Population variance and sample variance
In general, the population variance of a finite population of size N is given by
or if the population is an abstract population with probability distribution Pr:
where <math>\overline{x}</math> is the population mean. This is merely a special case of the general definition of variance introduced above, but restricted to finite populations.
In many practical situations, the true variance of a population is not known a priori and must be computed somehow. When dealing with infinite populations, this is generally impossible.
A common method is estimating the variance of large (finite or infinite) populations from a sample. We take a sample <math>(y_1,\dots,y_n)</math> of n values from the population, and estimate the variance on the basis of this sample. There are several good estimators. Two of them are well known:
and
Both are referred to as sample variance. Most advanced electronic calculators can calculate both <math>s_n^2</math> and <math>s^2</math>at the press of a button, in which case that button is usually labeled <math>\sigma^2</math> or <math>\sigma_n^2</math> for <math>s_n^2</math> and <math>\sigma_{n-1}^2</math> for <math>s^2</math>.
The two estimators only differ slightly as we see, and for larger values of the sample size n the difference is negligible. The second one is an unbiased estimator of the population variance, meaning that its expected value <math>E[s^2]</math> is equal to the true variance of the sampled random variable. The first one may be seen as the variance of the sample considered as a population.
Common sense would suggest to apply the population formula to the sample as well. The reason that it is biased is that the sample mean is generally somewhat closer to the observations in the sample than the population mean is to these observations. This is so because the sample mean is by definition in the middle of the sample, while the population mean may even lie outside the sample. So the deviations to the sample mean will often be smaller than the deviations to the population mean, and so, if the same formula is applied to both, then this variance estimate will on average be somewhat smaller in the sample than in the population.
One common source of confusion is that the term sample variance may refer to either the unbiased estimator <math>s^2</math> of the population variance, or to the variance <math>\sigma^2</math> of the sample viewed as a finite population. Both can be used to estimate the true population variance. Apart from theoretical considerations, it doesn't really matter which one is used, as for small sample sizes both are inaccurate and for large values of n they are practically the same. Naively computing the variance by dividing by n instead of n-1 systematically underestimates the population variance. Moreover, in practical applications most people report the standard deviation rather than the sample variance, and the standard deviation that is obtained from the unbiased n-1 version of the sample variance has a slight negative bias (though for normally distributed samples a theoretically interesting but rarely used slight correction exists to eliminate this bias). Nevertheless, in applied statistics it is a convention to use the n-1 version if the variance or the standard deviation is computed from a sample.
In practice, for large <math>n</math>, the distinction is often a minor one. In the course of statistical measurements, sample sizes so small as to warrant the use of the unbiased variance
virtually never occur. In this context Press et al.[2] commented that if the difference between n and n−1 ever matters to you, then you are probably up to no good anyway - e.g., trying to substantiate a questionable hypothesis with marginal data.
## Distribution of the sample variance
Being a function of random variables, the sample variance is itself a random variable, and it is natural to study its distribution. In the case that <math>y_i</math> are independent Gaussian realizations, Cochran's theorem shows that <math>s^2</math> follows a scaled chi-square distribution:
(n-1)\frac{s^2}{\sigma^2}\sim\chi^2_{n-1}
</math>
As a direct consequence, it follows that <math> \operatorname{E}(s^2)=\sigma^2</math>.
However, even in the absence of the Gaussian assumption, it is still possible to prove that <math>s^2</math> is unbiased for <math>\sigma^2</math>:
# Generalizations
If <math>X</math> is a vector-valued random variable, with values in <math>\mathbb{R}^n</math>, and thought of as a column vector, then the natural generalization of variance is <math>\operatorname{E}((X - \mu)(X - \mu)^\operatorname{T})</math>, where <math>\mu = \operatorname{E}(X)</math> and <math>X^\operatorname{T}</math> is the transpose of <math>X</math>, and so is a row vector. This variance is a positive semi-definite square matrix, commonly referred to as the covariance matrix.
If <math>X</math> is a complex-valued random variable, with values in <math>\mathbb{C}</math>, then its variance is <math>\operatorname{E}((X - \mu)(X - \mu)^*)</math>, where <math>X^*</math> is the complex conjugate of <math>X</math>. This variance is also a positive semi-definite square matrix.
# History
The term variance was first introduced by Ronald Fisher in his 1918 paper The Correlation Between Relatives on the Supposition of Mendelian Inheritance.
# Moment of inertia
The variance of a probability distribution is analogous to the moment of inertia in classical mechanics of a corresponding mass distribution along a line, with respect to rotation about its center of mass. It is because of this analogy that such things as the variance are called moments of probability distributions. (The covariance matrix is analogous to the moment of inertia tensor for multivariate distributions.) | https://www.wikidoc.org/index.php/Variance | |
bf82c480b5e7788b37e4233f56d5a0d363d1c647 | wikidoc | Ventouse | Ventouse
# Overview
Ventouse is a vacuum device used to assist the delivery of a baby when labour has not progressed adequately. It is an alternative to a forceps delivery. It is not usually used when the baby is in the breech position or for premature births. This technique is also called vacuum-assisted vaginal delivery.
# Technique
The woman is placed in the lithotomy position and assists throughout the process by pushing. A suction cup is placed onto the head of the baby and the suction draws the skin from the scalp into the cup. Most ventouse devices have handles and when the head is born the device can be detached, allowing the woman to complete the delivery of her child.
Some ventouse births have been conducted before the cervix was fully dilated though some medical practitioners disagree whether this should be done.
If the ventouse attempt fails it may be necessary to deliver the infant by caesarean section.
# Indications for use of vacuum
There are three generally accepted indications to use a ventouse to aid delivery:
- Prolonged pushing in the second stage of labor or maternal exhaustion
- Fetal emergency in the second stage of labour, generally indicated by changes in the fetal heart rate
- Maternal illness where "bearing down" or pushing efforts would be risky (e.g. cardiac conditions, blood pressure)
# Comparisons to other forms of assisted delivery
## Positive aspects
- An episiotomy is not usually required and there is little internal bruising
- The mother still takes an active role in the birth
- The force applied to the baby can be less than that of a forceps delivery leaving less marking on the head and face
## Negative aspects
- The baby is left with a temporary lump on its head, known as a chignon
- The baby may become distressed due to strong suction to its head
Ventouse is also a commune of the Charente département, in France. | Ventouse
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Ventouse is a vacuum device used to assist the delivery of a baby when labour has not progressed adequately. It is an alternative to a forceps delivery. It is not usually used when the baby is in the breech position or for premature births. This technique is also called vacuum-assisted vaginal delivery.
# Technique
The woman is placed in the lithotomy position and assists throughout the process by pushing. A suction cup is placed onto the head of the baby and the suction draws the skin from the scalp into the cup. Most ventouse devices have handles and when the head is born the device can be detached, allowing the woman to complete the delivery of her child.
Some ventouse births have been conducted before the cervix was fully dilated though some medical practitioners disagree whether this should be done.
If the ventouse attempt fails it may be necessary to deliver the infant by caesarean section.
# Indications for use of vacuum
There are three generally accepted indications to use a ventouse to aid delivery:
- Prolonged pushing in the second stage of labor or maternal exhaustion
- Fetal emergency in the second stage of labour, generally indicated by changes in the fetal heart rate
- Maternal illness where "bearing down" or pushing efforts would be risky (e.g. cardiac conditions, blood pressure)
# Comparisons to other forms of assisted delivery
## Positive aspects
- An episiotomy is not usually required and there is little internal bruising
- The mother still takes an active role in the birth
- The force applied to the baby can be less than that of a forceps delivery leaving less marking on the head and face
## Negative aspects
- The baby is left with a temporary lump on its head, known as a chignon
- The baby may become distressed due to strong suction to its head
Ventouse is also a commune of the Charente département, in France.
Template:WH
Template:WS | https://www.wikidoc.org/index.php/Ventouse | |
3d193478ba4a11a00eed8732948babd7b241979e | wikidoc | Veratrum | Veratrum
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Veratrum is a OTC that is FDA approved for the treatment of acute self-limiting conditions according to standard homeopathic indications. Common adverse reactions include .
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Indications
- To be used for acute self-limiting conditions according to standard homeopathic indications
### Purpose
- Diarrhea , Vomiting
### Dosage
- Take at onset of symptoms. Repeat every 2 hours or as needed until relieved. If condition persists or worsens discontinue use and consult a practitioner.
- dissolve 5-10 pellets in 1 oz. of filtered water or take dry by mouth.
- 1-5 pellets.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Veratrum in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Veratrum in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding FDA-Labeled Use of Veratrum in pediatric patients.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Veratrum in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Veratrum in pediatric patients.
# Contraindications
There is limited information regarding Veratrum Contraindications in the drug label.
# Warnings
- If pregnant or nursing, consult a practitioner before using.
- Keep these and all medications out of the reach of children.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Clinical Trial Experience of Veratrum in the drug label.
## Postmarketing Experience
There is limited information regarding Postmarketing Experience of Veratrum in the drug label.
# Drug Interactions
There is limited information regarding Veratrum Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- If pregnant or nursing, consult a practitioner before using.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Veratrum in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Veratrum during labor and delivery.
### Nursing Mothers
- If pregnant or nursing, consult a practitioner before using.
### Pediatric Use
There is no FDA guidance on the use of Veratrum with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Veratrum with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Veratrum with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Veratrum with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Veratrum in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Veratrum in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Veratrum in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Veratrum in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Monitoring of Veratrum in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Veratrum in the drug label.
# Overdosage
There is limited information regarding Overdose of Veratrum in the drug label.
# Pharmacology
## Mechanism of Action
There is limited information regarding Veratrum Mechanism of Action in the drug label.
## Structure
- VERATRUM ALBUM
- Inactive Ingredients - Lactose, Sucrose
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Veratrum in the drug label.
## Pharmacokinetics
There is limited information regarding Pharmacokinetics of Veratrum in the drug label.
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Veratrum in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Veratrum in the drug label.
# How Supplied
There is limited information regarding Veratrum How Supplied in the drug label.
## Storage
There is limited information regarding Veratrum Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
### PACKAGE LABEL
Est. No. 1724217
Natural Health Supply
Homeopathic Medicated Pellets
Do not use if clear bottle seal is broken
VERATRUM ALBUM 30C
Diarrhea Vomiting
Lot #__________________
### Ingredients and Appearance
# Patient Counseling Information
There is limited information regarding Patient Counseling Information of Veratrum in the drug label.
# Precautions with Alcohol
- Alcohol-Veratrum interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- DIARRHEA VOMITING®
# Look-Alike Drug Names
There is limited information regarding Veratrum Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | Veratrum
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Rabin Bista, M.B.B.S. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
NOTE: Most over the counter (OTC) are not reviewed and approved by the FDA. However, they may be marketed if they comply with applicable regulations and policies. FDA has not evaluated whether this product complies.
# Overview
Veratrum is a OTC that is FDA approved for the treatment of acute self-limiting conditions according to standard homeopathic indications. Common adverse reactions include .
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Indications
- To be used for acute self-limiting conditions according to standard homeopathic indications
### Purpose
- Diarrhea , Vomiting
### Dosage
- Take at onset of symptoms. Repeat every 2 hours or as needed until relieved. If condition persists or worsens discontinue use and consult a practitioner.
- dissolve 5-10 pellets in 1 oz. of filtered water or take dry by mouth.
- 1-5 pellets.
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Veratrum in adult patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Veratrum in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding FDA-Labeled Use of Veratrum in pediatric patients.
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
There is limited information regarding Off-Label Guideline-Supported Use of Veratrum in pediatric patients.
### Non–Guideline-Supported Use
There is limited information regarding Off-Label Non–Guideline-Supported Use of Veratrum in pediatric patients.
# Contraindications
There is limited information regarding Veratrum Contraindications in the drug label.
# Warnings
- If pregnant or nursing, consult a practitioner before using.
- Keep these and all medications out of the reach of children.
# Adverse Reactions
## Clinical Trials Experience
There is limited information regarding Clinical Trial Experience of Veratrum in the drug label.
## Postmarketing Experience
There is limited information regarding Postmarketing Experience of Veratrum in the drug label.
# Drug Interactions
There is limited information regarding Veratrum Drug Interactions in the drug label.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
- If pregnant or nursing, consult a practitioner before using.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Veratrum in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Veratrum during labor and delivery.
### Nursing Mothers
- If pregnant or nursing, consult a practitioner before using.
### Pediatric Use
There is no FDA guidance on the use of Veratrum with respect to pediatric patients.
### Geriatic Use
There is no FDA guidance on the use of Veratrum with respect to geriatric patients.
### Gender
There is no FDA guidance on the use of Veratrum with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Veratrum with respect to specific racial populations.
### Renal Impairment
There is no FDA guidance on the use of Veratrum in patients with renal impairment.
### Hepatic Impairment
There is no FDA guidance on the use of Veratrum in patients with hepatic impairment.
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Veratrum in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Veratrum in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
There is limited information regarding Monitoring of Veratrum in the drug label.
# IV Compatibility
There is limited information regarding IV Compatibility of Veratrum in the drug label.
# Overdosage
There is limited information regarding Overdose of Veratrum in the drug label.
# Pharmacology
## Mechanism of Action
There is limited information regarding Veratrum Mechanism of Action in the drug label.
## Structure
- VERATRUM ALBUM
- Inactive Ingredients - Lactose, Sucrose
## Pharmacodynamics
There is limited information regarding Pharmacodynamics of Veratrum in the drug label.
## Pharmacokinetics
There is limited information regarding Pharmacokinetics of Veratrum in the drug label.
## Nonclinical Toxicology
There is limited information regarding Nonclinical Toxicology of Veratrum in the drug label.
# Clinical Studies
There is limited information regarding Clinical Studies of Veratrum in the drug label.
# How Supplied
There is limited information regarding Veratrum How Supplied in the drug label.
## Storage
There is limited information regarding Veratrum Storage in the drug label.
# Images
## Drug Images
## Package and Label Display Panel
### PACKAGE LABEL
Est. No. 1724217
Natural Health Supply
505-474-9175
Homeopathic Medicated Pellets
Do not use if clear bottle seal is broken
VERATRUM ALBUM 30C
Diarrhea Vomiting
Lot #__________________
### Ingredients and Appearance
# Patient Counseling Information
There is limited information regarding Patient Counseling Information of Veratrum in the drug label.
# Precautions with Alcohol
- Alcohol-Veratrum interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- DIARRHEA VOMITING®[1]
# Look-Alike Drug Names
There is limited information regarding Veratrum Look-Alike Drug Names in the drug label.
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Veratrum | |
77136a9513172db823398ca6becbd902ca5cb437 | wikidoc | Versican | Versican
Versican is a large extracellular matrix proteoglycan that is present in a variety of human tissues. It is encoded by the VCAN gene.
Versican is a large chondroitin sulfate proteoglycan with an apparent molecular mass of more than 1000kDa. In 1989, Zimmermann and Ruoslahti cloned and sequenced the core protein of fibroblast chondroitin sulfate proteoglycan. They designated it versican in recognition of its versatile modular structure.
Versican belongs to the lectican protein family, with aggrecan (abundant in cartilage), brevican and neurocan (nervous system proteoglycans) as other members. Versican is also known as chondroitin sulfate proteoglycan core protein 2 or chondroitin sulfate proteoglycan 2 (CSPG2), and PG-M.
# Structure
These proteoglycans share a homologous globular N-terminal, C-terminal, and glycosaminoglycan (GAG) binding regions.
The N-terminal (G1) globular domain consists of Ig-like loop and two link modules, and has Hyaluronan (HA) binding properties.
Versican occurs in 5 isoforms : V0, V1, V2, V3, V4.
The central domain of versican V0 contains both the GAG-α and GAG-β domains. V1 isoforms has the GAG-β domain, V2 has the GAG-α domain, V3 is void of any GAG attachment domains and V4 has a portion of the GAG-β domain. The GAGs, being composed of repeating disaccharide units, contribute to the negative charge and many other properties of proteoglycans.
The C-terminal (G3) globular domain consists of one or two Epidermal growth factor (EGF) repeats, a C-type lectin domain and complement regulatory protein (CRP)-like domain. The C-terminal domain binds a variety of ligands in ECM which contribute significantly to the functions of lecticans.
# Function
The role of versican in cell adhesion, migration, and proliferation has been extensively studied. Versican is often considered an anti-adhesion molecule. Considering the large size (>1000 kDa) and hydration capability of versican, it is possible that the interaction of integrins (large family of cell adhesion molecules) with their cell surface receptors is sterically hindered.
Expression of versican is observed in various adult tissues such as blood vessels, skin, and developing heart. Smooth muscle cells of blood vessels, epithelial cells of skin, and the cells of central and peripheral nervous system are a few examples of cell types that express versican physiologically. Versican is involved in development, guiding embryonic cell migration important in the formation of the heart and outlining the path for neural crest cell migration.
## N-terminus
The N-terminal of versican has an important role in maintaining the integrity of the ECM by interacting with hyaluronan. Its interactions with link protein has also been studied.
## Glycosaminoglycan binding region
The central domain of Versican is decorated with glycosaminoglycans. The structural and functional diversity of Versican is increased by variations in GAG sulfation patterns and the type of GAG chains bound to the core protein. There is a single versican gene, however alternative splicing of its mRNA produces 4 distinct versican isoforms that differ in their potential number of GAG chains. All isoforms have homologous N-terminal (HA binding) and C-terminal (lectin-like) domains. The central domain of versican V0 contains both the GAG-α and GAG-β domains. V1 isoforms has the GAG-β domain, V2 has the GAG-α domain, and V3 is void of any GAG attachment domains, and only consists of the N-terminal and C-terminal globular domains. It is known that the isoforms are differentially expressed in different tissue types. The biological significance of alternative splicing is yet to be determined.
Because of their negatively charged sulfates or carboxyl groups, chondroitin sulfate chains are attracted to various positively charged molecules such as certain growth factors, cytokines, and chemokines. This interaction in the extracellular matrix or on the cell surface is important in the formation of immobilized gradients of these factors, their protection from proteolytic cleavage, and their presentation to specific cell-surface receptors. The binding of versican with leukocyte adhesion molecules L-selectin, P-selectin, and CD44 is also mediated by the interaction of CS chains of versican with the carbohydrate-binding domain of these molecules. Both CD44 and L-selectin have been implicated in leukocyte trafficking. The ability of versican to bind a large panel of chemokines and the biological consequences of such binding has also been examined. Versican can bind specific chemokines through its CS chains and this interaction down-regulates the chemokines function. Recently, in light of results that V1 and V2 isoforms of versican have opposite effects on cell proliferation, glycosaminoglycan domain GAG-β has been implicated in versican-enhanced cell proliferation and versican-induced reduction of cell apoptosis.
## C-terminus
The C-terminal of Versican interacts with a variety of molecules in the matrix. One important family of ligands is the tenascin family. For example, The C-lectin domain of versican interacts with tenascin R through its fibronectin type III (FnIII) repeat 3-5 domain in a calcium dependent manner, in vivo. Different tenascin domains interact with a wide range of cellular receptors, including integrins, cell adhesion molecules and members of the syndecan and glypican proteoglycan families. Versican’s C-terminal domain interacts with fibulin-2, a protein whose expression is associated with that of versican in the developing heart. The EGF domain of the C-terminal of versican also binds the EGF-receptor molecule in vivo.
# Clinical significance
Versican is a key factor in inflammation through interactions with adhesion molecules on the surfaces of inflammatory leukocytes and interactions with chemokines that are involved in recruiting inflammatory cells.
In the adult central nervous system, versican is found in perineuronal nets, where it may stabilize synaptic connections. Versican can also inhibit nervous system regeneration and axonal growth following an injury to the central nervous system.
## Cancer and metastasis
Increased versican expression is often observed in tumor growth in tissues such as breast, brain, ovary, gastrointestinal tract, prostate, and melanoma, sarcoma, and peritoneal mesothelioma. A fifth isoform of versican, V4, that is similar to V1 but with a shortened beta-GAG region, is present and upregulated in human breast cancer.
Versican is required for Lewis lung carcinoma in mice to metastasize to lung, liver and adrenal glands, acting via TLR2 to activate myeloid cells and produce TNF-alpha.
## Lung disorders
Versican is increased in the changing tissue extracellular matrix in inflammatory lung disorders such as chronic obstructive pulmonary disease (COPD), asthma and bronchiolitis obliterans syndrome (BOS). Cells (myofibroblasts, macrophages and other inflammatory cells) can migrate more easily through extracellular matrix that has a higher versican content.
## Skin disorders
Deposits of versican are not present in normal skin but are found in the reticular dermis during keloid scarring, a condition where scar formation becomes uncontrolled and overgrowth of skin tissue occurs at the site of the wound.
# Interactions
Versican has been shown to interact with hyaluronan and a link protein (hyaluronan and proteoglycan link protein 1; HAPLN1). | Versican
Versican is a large extracellular matrix proteoglycan that is present in a variety of human tissues. It is encoded by the VCAN gene.[1][2]
Versican is a large chondroitin sulfate proteoglycan with an apparent molecular mass of more than 1000kDa. In 1989, Zimmermann and Ruoslahti cloned and sequenced the core protein of fibroblast chondroitin sulfate proteoglycan.[3] They designated it versican in recognition of its versatile modular structure.
Versican belongs to the lectican protein family, with aggrecan (abundant in cartilage), brevican and neurocan (nervous system proteoglycans) as other members. Versican is also known as chondroitin sulfate proteoglycan core protein 2 or chondroitin sulfate proteoglycan 2 (CSPG2), and PG-M.
# Structure
These proteoglycans share a homologous globular N-terminal, C-terminal, and glycosaminoglycan (GAG) binding regions.
The N-terminal (G1) globular domain consists of Ig-like loop and two link modules, and has Hyaluronan (HA) binding properties.
Versican occurs in 5 isoforms : V0, V1, V2, V3, V4.[4]
The central domain of versican V0 contains both the GAG-α and GAG-β domains. V1 isoforms has the GAG-β domain, V2 has the GAG-α domain, V3 is void of any GAG attachment domains and V4 has a portion of the GAG-β domain. The GAGs, being composed of repeating disaccharide units, contribute to the negative charge and many other properties of proteoglycans.
The C-terminal (G3) globular domain consists of one or two Epidermal growth factor (EGF) repeats, a C-type lectin domain and complement regulatory protein (CRP)-like domain. The C-terminal domain binds a variety of ligands in ECM which contribute significantly to the functions of lecticans.
# Function
The role of versican in cell adhesion, migration, and proliferation has been extensively studied. Versican is often considered an anti-adhesion molecule. Considering the large size (>1000 kDa) and hydration capability of versican, it is possible that the interaction of integrins (large family of cell adhesion molecules) with their cell surface receptors is sterically hindered.
Expression of versican is observed in various adult tissues such as blood vessels, skin, and developing heart. Smooth muscle cells of blood vessels, epithelial cells of skin, and the cells of central and peripheral nervous system are a few examples of cell types that express versican physiologically. Versican is involved in development, guiding embryonic cell migration important in the formation of the heart and outlining the path for neural crest cell migration.
## N-terminus
The N-terminal of versican has an important role in maintaining the integrity of the ECM by interacting with hyaluronan. Its interactions with link protein has also been studied.
## Glycosaminoglycan binding region
The central domain of Versican is decorated with glycosaminoglycans. The structural and functional diversity of Versican is increased by variations in GAG sulfation patterns and the type of GAG chains bound to the core protein. There is a single versican gene, however alternative splicing of its mRNA produces 4 distinct versican isoforms that differ in their potential number of GAG chains. All isoforms have homologous N-terminal (HA binding) and C-terminal (lectin-like) domains. The central domain of versican V0 contains both the GAG-α and GAG-β domains. V1 isoforms has the GAG-β domain, V2 has the GAG-α domain, and V3 is void of any GAG attachment domains, and only consists of the N-terminal and C-terminal globular domains. It is known that the isoforms are differentially expressed in different tissue types. The biological significance of alternative splicing is yet to be determined.
Because of their negatively charged sulfates or carboxyl groups, chondroitin sulfate chains are attracted to various positively charged molecules such as certain growth factors, cytokines, and chemokines. This interaction in the extracellular matrix or on the cell surface is important in the formation of immobilized gradients of these factors, their protection from proteolytic cleavage, and their presentation to specific cell-surface receptors. The binding of versican with leukocyte adhesion molecules L-selectin, P-selectin, and CD44 is also mediated by the interaction of CS chains of versican with the carbohydrate-binding domain of these molecules. Both CD44 and L-selectin have been implicated in leukocyte trafficking. The ability of versican to bind a large panel of chemokines and the biological consequences of such binding has also been examined. Versican can bind specific chemokines through its CS chains and this interaction down-regulates the chemokines function. Recently, in light of results that V1 and V2 isoforms of versican have opposite effects on cell proliferation, glycosaminoglycan domain GAG-β has been implicated in versican-enhanced cell proliferation and versican-induced reduction of cell apoptosis.
## C-terminus
The C-terminal of Versican interacts with a variety of molecules in the matrix. One important family of ligands is the tenascin family.[5] For example, The C-lectin domain of versican interacts with tenascin R through its fibronectin type III (FnIII) repeat 3-5 domain in a calcium dependent manner, in vivo. Different tenascin domains interact with a wide range of cellular receptors, including integrins, cell adhesion molecules and members of the syndecan and glypican proteoglycan families. Versican’s C-terminal domain interacts with fibulin-2, a protein whose expression is associated with that of versican in the developing heart. The EGF domain of the C-terminal of versican also binds the EGF-receptor molecule in vivo.
# Clinical significance
Versican is a key factor in inflammation through interactions with adhesion molecules on the surfaces of inflammatory leukocytes and interactions with chemokines that are involved in recruiting inflammatory cells.
In the adult central nervous system, versican is found in perineuronal nets, where it may stabilize synaptic connections. Versican can also inhibit nervous system regeneration and axonal growth following an injury to the central nervous system.
## Cancer and metastasis
Increased versican expression is often observed in tumor growth in tissues such as breast, brain,[6] ovary, gastrointestinal tract, prostate, and melanoma, sarcoma, and peritoneal mesothelioma. A fifth isoform of versican, V4, that is similar to V1 but with a shortened beta-GAG region, is present and upregulated in human breast cancer.[4]
Versican is required for Lewis lung carcinoma in mice to metastasize to lung, liver and adrenal glands, acting via TLR2 to activate myeloid cells and produce TNF-alpha.[7]
## Lung disorders
Versican is increased in the changing tissue extracellular matrix in inflammatory lung disorders such as chronic obstructive pulmonary disease (COPD), asthma and bronchiolitis obliterans syndrome (BOS).[8] Cells (myofibroblasts, macrophages and other inflammatory cells) can migrate more easily through extracellular matrix that has a higher versican content.
## Skin disorders
Deposits of versican are not present in normal skin but are found in the reticular dermis during keloid scarring, a condition where scar formation becomes uncontrolled and overgrowth of skin tissue occurs at the site of the wound.[9]
# Interactions
Versican has been shown to interact with hyaluronan and a link protein (hyaluronan and proteoglycan link protein 1; HAPLN1).[10] | https://www.wikidoc.org/index.php/Versican | |
99e22afb0dae3f15f127e4f8e70a267eeb68f517 | wikidoc | Vertebra | Vertebra
# Overview
The Vetebral Column (singular: vertebra) are the individual irregular bones that make up the spinal column (aka ischis) — a flexuous and flexible column.
There are normally thirty-three (33) vertebrae in humans, including the five that are fused to form the sacrum (the others are separated by intervertebral discs) and the four coccygeal bones which form the tailbone.
The upper three regions comprise the remaining 24, and are grouped under the names cervical (7 vertebrae), thoracic (12 vertebrae) and lumbar (5 vertebrae), according to the regions they occupy.
This number is sometimes increased by an additional vertebra in one region, or it may be diminished in one region, the deficiency often being supplied by an additional vertebra in another.
The number of cervical vertebrae is, however, very rarely increased or diminished.
With the exception of the first and second cervical, the true or movable vertebrae (the upper three regions) present certain common characteristics which are best studied by examining one from the middle of the thoracic region.
# General structure
A typical vertebra consists of two essential parts: an anterior (front) segment, which is the vertebral body; and a posterior part – the vertebral (neural) arch – which encloses the vertebral foramen.
The vertebral arch is formed by a pair of pedicles and a pair of laminae, and supports seven processes, four articular, two transverse, and one spinous, the latter also being known as the neural spine.
When the vertebrae are articulated with each other, the bodies form a strong pillar for the support of the head and trunk, and the vertebral foramina constitute a canal for the protection of the medulla spinalis (spinal cord), while between every pair of vertebrae are two apertures, the intervertebral foramina, one on either side, for the transmission of the spinal nerves and vessels.
Two transverse processes and one spinous process are posterior to (behind) the vertebral body. The spinous process comes out the back, one transverse process comes out the left, and one on the right. The spinous processes of the cervical and lumbar regions can be felt through the skin.
Superior and inferior articular facets on each vertebra act to restrict the range of movement possible. These facets are joined by a thin portion of the neural arch called the pars interarticularis.
# Regions
## Cervical
Note: For more detailed information, see Cervical vertebrae
These are generally small and delicate. Their spinous processes are short (with the exception of C2 and C7, which have palpable spinous processes), and often split. Numbered top-to-bottom from C1-C7, atlas (C1) and axis (C2), are the vertebrae that allow the neck and head so much movement. For the most part, the atlanto-occipital joint allows the skull to move up and down, while the atlanto-axial joint allows the upper neck to twist left and right. The axis also sits upon the first intervertebral disk of the spinal column. All mammals except manatees and sloths have seven cervical vertebrae, whatever the length of the neck.
## Thoracic
Note: For more detailed information, see Thoracic vertebrae
Their spinous processes have surfaces that articulate with the ribs. Some rotation can occur between the thoracic vertebrae, but their connection with the rib cage prevents much flexion or other excursion. They may also be known as 'dorsal vertebrae', in the human context.
## Lumbar
Note: For more detailed information, see Lumbar vertebrae
These vertebrae are very robust in construction, as they must support more weight than other vertebrae. They allow significant flexion and extension, moderate lateral flexion (sidebending), and a small degree of rotation. The discs between these vertebrae create a lumbar lordosis (curvature that is concave posteriorly) in the human spine.
## Sacral
Note: For more detailed information, see Sacral vertebrae
There are 5 vertebrae (S1-S5). They are fused in maturity, with no intervertebral discs.
## Coccygeal
Note: For more detailed information, see Coccygeal vertebrae
There are 3-5 vertebrae (Co1-Co5), again fused, with no intervertebral discs. Many animals have a greater number of 'tail vertebrae' and, in animals, they are more commonly known as caudal vertebrae. Pain at the coccyx (tailbone) is known as coccydynia.
# Development
During the fourth week of embryonic development, the sclerotomes shift their position to surround the spinal cord and the notochord. The sclerotome is made of mesoderm and originates from the ventromedial part of the somites. This column of tissue has a segmented appearance, with alternating areas of dense and less dense areas.
As the sclerotome develops, it condenses further eventually developing into the vertebral body. Development of the appropriate shapes of the vertebral bodies is regulated by HOX genes.
The less dense tissue that separates the sclerotome segments develop into the intervertebral discs.
The notochord disappears in the sclerotome (vertebral body) segments, but persists in the region of the intervertebral discs as the nucleus pulposus. The nucleus pulposus and the fibers of the annulus fibrosus make up the intervertebral disc.
The primary curves (thoracic and sacral curvatures) form during fetal development. The secondary curves develop after birth. The cervical curvature forms as a result of lifting the head and the lumbar curvature forms as a result of walking.
There are various defects associated with vertebral development. Scoliosis can result from improper fusion of the vertebrae. In Klippel-Feil anomaly patients have two or more cervical vertebrae that are fused together, along with other associated birth defects. One of the most serious defects is failure of the vertebral arches to fuse. This results in a condition called spina bifida. There are several variations of spina bifida that reflect the severity of the defect.
# Vertebral Diseases
## Osteomyelitis and chondritis of Vertebrae
# Footnotes
- ↑ Anatomy Compendium (Godfried Roomans and Anca Dragomir) | Vertebra
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
The Vetebral Column (singular: vertebra) are the individual irregular bones that make up the spinal column (aka ischis) — a flexuous and flexible column.
There are normally thirty-three (33) vertebrae in humans, including the five that are fused to form the sacrum (the others are separated by intervertebral discs) and the four coccygeal bones which form the tailbone.
The upper three regions comprise the remaining 24, and are grouped under the names cervical (7 vertebrae), thoracic (12 vertebrae) and lumbar (5 vertebrae), according to the regions they occupy.
This number is sometimes increased by an additional vertebra in one region, or it may be diminished in one region, the deficiency often being supplied by an additional vertebra in another.
The number of cervical vertebrae is, however, very rarely increased or diminished.
With the exception of the first and second cervical, the true or movable vertebrae (the upper three regions) present certain common characteristics which are best studied by examining one from the middle of the thoracic region.
# General structure
A typical vertebra consists of two essential parts: an anterior (front) segment, which is the vertebral body; and a posterior part – the vertebral (neural) arch – which encloses the vertebral foramen.
The vertebral arch is formed by a pair of pedicles and a pair of laminae, and supports seven processes, four articular, two transverse, and one spinous, the latter also being known as the neural spine.
When the vertebrae are articulated with each other, the bodies form a strong pillar for the support of the head and trunk, and the vertebral foramina constitute a canal for the protection of the medulla spinalis (spinal cord), while between every pair of vertebrae are two apertures, the intervertebral foramina, one on either side, for the transmission of the spinal nerves and vessels.
Two transverse processes and one spinous process are posterior to (behind) the vertebral body. The spinous process comes out the back, one transverse process comes out the left, and one on the right. The spinous processes of the cervical and lumbar regions can be felt through the skin.
Superior and inferior articular facets on each vertebra act to restrict the range of movement possible. These facets are joined by a thin portion of the neural arch called the pars interarticularis.
# Regions
## Cervical
Note: For more detailed information, see Cervical vertebrae
These are generally small and delicate. Their spinous processes are short (with the exception of C2 and C7, which have palpable spinous processes), and often split. Numbered top-to-bottom from C1-C7, atlas (C1) and axis (C2), are the vertebrae that allow the neck and head so much movement. For the most part, the atlanto-occipital joint allows the skull to move up and down, while the atlanto-axial joint allows the upper neck to twist left and right. The axis also sits upon the first intervertebral disk of the spinal column. All mammals except manatees and sloths have seven cervical vertebrae, whatever the length of the neck.
## Thoracic
Note: For more detailed information, see Thoracic vertebrae
Their spinous processes have surfaces that articulate with the ribs. Some rotation can occur between the thoracic vertebrae, but their connection with the rib cage prevents much flexion or other excursion. They may also be known as 'dorsal vertebrae', in the human context.
## Lumbar
Note: For more detailed information, see Lumbar vertebrae
These vertebrae are very robust in construction, as they must support more weight than other vertebrae. They allow significant flexion and extension, moderate lateral flexion (sidebending), and a small degree of rotation. The discs between these vertebrae create a lumbar lordosis (curvature that is concave posteriorly) in the human spine.
## Sacral
Note: For more detailed information, see Sacral vertebrae
There are 5 vertebrae (S1-S5). They are fused in maturity, with no intervertebral discs.
## Coccygeal
Note: For more detailed information, see Coccygeal vertebrae
There are 3-5 vertebrae (Co1-Co5), again fused, with no intervertebral discs. Many animals have a greater number of 'tail vertebrae' and, in animals, they are more commonly known as caudal vertebrae. Pain at the coccyx (tailbone) is known as coccydynia.
# Development
During the fourth week of embryonic development, the sclerotomes shift their position to surround the spinal cord and the notochord. The sclerotome is made of mesoderm and originates from the ventromedial part of the somites. This column of tissue has a segmented appearance, with alternating areas of dense and less dense areas.
As the sclerotome develops, it condenses further eventually developing into the vertebral body. Development of the appropriate shapes of the vertebral bodies is regulated by HOX genes.
The less dense tissue that separates the sclerotome segments develop into the intervertebral discs.
The notochord disappears in the sclerotome (vertebral body) segments, but persists in the region of the intervertebral discs as the nucleus pulposus. The nucleus pulposus and the fibers of the annulus fibrosus make up the intervertebral disc.
The primary curves (thoracic and sacral curvatures) form during fetal development. The secondary curves develop after birth. The cervical curvature forms as a result of lifting the head and the lumbar curvature forms as a result of walking.
There are various defects associated with vertebral development. Scoliosis can result from improper fusion of the vertebrae. In Klippel-Feil anomaly patients have two or more cervical vertebrae that are fused together, along with other associated birth defects. One of the most serious defects is failure of the vertebral arches to fuse. This results in a condition called spina bifida. There are several variations of spina bifida that reflect the severity of the defect.
# Vertebral Diseases
## Osteomyelitis and chondritis of Vertebrae
# Footnotes
- ↑ Anatomy Compendium (Godfried Roomans and Anca Dragomir) | https://www.wikidoc.org/index.php/Vertabrae | |
a4d6653560c3ab3599a313a390bc9688e36b66c7 | wikidoc | Vimentin | Vimentin
Vimentin is a structural protein that in humans is encoded by the VIM gene.
Vimentin is a type III intermediate filament (IF) protein that is expressed in mesenchymal cells. IF proteins are found in all animal cells as well as bacteria. IF, along with tubulin-based microtubules and actin-based microfilaments, comprises the cytoskeleton. All IF proteins are expressed in a highly developmentally-regulated fashion; vimentin is the major cytoskeletal component of mesenchymal cells. Because of this, vimentin is often used as a marker of mesenchymally-derived cells or cells undergoing an epithelial-to-mesenchymal transition (EMT) during both normal development and metastatic progression.
# Structure
A vimentin monomer, like all other intermediate filaments, has a central α-helical domain, capped on each end by non-helical amino (head) and carboxyl (tail) domains. Two monomers are likely co-translationally expressed in a way that facilitates their formation of a coiled-coil dimer, which is the basic subunit of vimentin assembly.
The α-helical sequences contain a pattern of hydrophobic amino acids that contribute to forming a "hydrophobic seal" on the surface of the helix. In addition, there is a periodic distribution of acidic and basic amino acids that seems to play an important role in stabilizing coiled-coil dimers. The spacing of the charged residues is optimal for ionic salt bridges, which allows for the stabilization of the α-helix structure. While this type of stabilization is intuitive for intrachain interactions, rather than interchain interactions, scientists have proposed that perhaps the switch from intrachain salt bridges formed by acidic and basic residues to the interchain ionic associations contributes to the assembly of the filament.
# Function
Vimentin plays a significant role in supporting and anchoring the position of the organelles in the cytosol. Vimentin is attached to the nucleus, endoplasmic reticulum, and mitochondria, either laterally or terminally.
The dynamic nature of vimentin is important when offering flexibility to the cell. Scientists found that vimentin provided cells with a resilience absent from the microtubule or actin filament networks, when under mechanical stress in vivo. Therefore, in general, it is accepted that vimentin is the cytoskeletal component responsible for maintaining cell integrity. (It was found that cells without vimentin are extremely delicate when disturbed with a micropuncture). Transgenic mice that lack vimentin appeared normal and did not show functional differences. It is possible that the microtubule network may have compensated for the absence of the intermediate network. This result supports an intimate interactions between microtubules and vimentin. Moreover, when microtubule depolymerizers were present, vimentin reorganization occurred, once again implying a relationship between the two systems. On the other hand, wounded mice that lack the vimentin gene heal slower than their wild type counterparts.
In essence, vimentin is responsible for maintaining cell shape, integrity of the cytoplasm, and stabilizing cytoskeletal interactions. Vimentin has been shown to eliminate toxic proteins in JUNQ and IPOD inclusion bodies in asymmetric division of mammalian cell lines.
Also, vimentin is found to control the transport of low-density lipoprotein, LDL, -derived cholesterol from a lysosome to the site of esterification. With the blocking of transport of LDL-derived cholesterol inside the cell, cells were found to store a much lower percentage of the lipoprotein than normal cells with vimentin. This dependence seems to be the first process of a biochemical function in any cell that depends on a cellular intermediate filament network. This type of dependence has ramifications on the adrenal cells, which rely on cholesteryl esters derived from LDL.
Vimentin plays a role in aggresome formation, where it forms a cage surrounding a core of aggregated protein.
# Clinical significance
It has been used as a sarcoma tumor marker to identify mesenchyme.
Methylation of the vimentin gene has been established as a biomarker of colon cancer and this is being utilized in the development of fecal tests for colon cancer. Statistically significant levels of vimentin gene methylation have also been observed in certain upper gastrointestinal pathologies such as Barrett's esophagus, esophageal adenocarcinoma, and intestinal type gastric cancer. High levels of DNA methylation in the promotor region have also been associated with markedly decreased survival in hormone positive breast cancers.
Downregulation of vimentin was identified in cystic variant of papillary thyroid carcinoma using a proteomic approach.
See also Anti-citrullinated protein antibody for its use in diagnosis of rheumatoid arthritis.
# Interactions
Vimentin has been shown to interact with:
- DSP
- MEN1
- MYST2
- PLEC
- PKN1
- SPTAN1
- UPP1
- YWHAZ
- PRKCI
The 3' UTR of Vimentin mRNA has been found to bind a 46kDa protein. | Vimentin
Vimentin is a structural protein that in humans is encoded by the VIM gene.
Vimentin is a type III intermediate filament (IF) protein that is expressed in mesenchymal cells. IF proteins are found in all animal cells[1] as well as bacteria.[2] IF, along with tubulin-based microtubules and actin-based microfilaments, comprises the cytoskeleton. All IF proteins are expressed in a highly developmentally-regulated fashion; vimentin is the major cytoskeletal component of mesenchymal cells. Because of this, vimentin is often used as a marker of mesenchymally-derived cells or cells undergoing an epithelial-to-mesenchymal transition (EMT) during both normal development and metastatic progression.
# Structure
A vimentin monomer, like all other intermediate filaments, has a central α-helical domain, capped on each end by non-helical amino (head) and carboxyl (tail) domains.[3] Two monomers are likely co-translationally expressed in a way that facilitates their formation of a coiled-coil dimer, which is the basic subunit of vimentin assembly.[4]
The α-helical sequences contain a pattern of hydrophobic amino acids that contribute to forming a "hydrophobic seal" on the surface of the helix.[3] In addition, there is a periodic distribution of acidic and basic amino acids that seems to play an important role in stabilizing coiled-coil dimers.[3] The spacing of the charged residues is optimal for ionic salt bridges, which allows for the stabilization of the α-helix structure. While this type of stabilization is intuitive for intrachain interactions, rather than interchain interactions, scientists have proposed that perhaps the switch from intrachain salt bridges formed by acidic and basic residues to the interchain ionic associations contributes to the assembly of the filament.[3]
# Function
Vimentin plays a significant role in supporting and anchoring the position of the organelles in the cytosol. Vimentin is attached to the nucleus, endoplasmic reticulum, and mitochondria, either laterally or terminally.[5]
The dynamic nature of vimentin is important when offering flexibility to the cell. Scientists found that vimentin provided cells with a resilience absent from the microtubule or actin filament networks, when under mechanical stress in vivo. Therefore, in general, it is accepted that vimentin is the cytoskeletal component responsible for maintaining cell integrity. (It was found that cells without vimentin are extremely delicate when disturbed with a micropuncture).[6] Transgenic mice that lack vimentin appeared normal and did not show functional differences.[7] It is possible that the microtubule network may have compensated for the absence of the intermediate network. This result supports an intimate interactions between microtubules and vimentin. Moreover, when microtubule depolymerizers were present, vimentin reorganization occurred, once again implying a relationship between the two systems.[6] On the other hand, wounded mice that lack the vimentin gene heal slower than their wild type counterparts.[8]
In essence, vimentin is responsible for maintaining cell shape, integrity of the cytoplasm, and stabilizing cytoskeletal interactions. Vimentin has been shown to eliminate toxic proteins in JUNQ and IPOD inclusion bodies in asymmetric division of mammalian cell lines.[9]
Also, vimentin is found to control the transport of low-density lipoprotein, LDL, -derived cholesterol from a lysosome to the site of esterification.[10] With the blocking of transport of LDL-derived cholesterol inside the cell, cells were found to store a much lower percentage of the lipoprotein than normal cells with vimentin. This dependence seems to be the first process of a biochemical function in any cell that depends on a cellular intermediate filament network. This type of dependence has ramifications on the adrenal cells, which rely on cholesteryl esters derived from LDL.[10]
Vimentin plays a role in aggresome formation, where it forms a cage surrounding a core of aggregated protein.[11]
# Clinical significance
It has been used as a sarcoma tumor marker to identify mesenchyme.[12][13]
Methylation of the vimentin gene has been established as a biomarker of colon cancer and this is being utilized in the development of fecal tests for colon cancer. Statistically significant levels of vimentin gene methylation have also been observed in certain upper gastrointestinal pathologies such as Barrett's esophagus, esophageal adenocarcinoma, and intestinal type gastric cancer.[14] High levels of DNA methylation in the promotor region have also been associated with markedly decreased survival in hormone positive breast cancers.[15]
Downregulation of vimentin was identified in cystic variant of papillary thyroid carcinoma using a proteomic approach.[16]
See also Anti-citrullinated protein antibody for its use in diagnosis of rheumatoid arthritis.
# Interactions
Vimentin has been shown to interact with:
- DSP [17]
- MEN1 [18]
- MYST2 [19][20]
- PLEC [21][22]
- PKN1 [23]
- SPTAN1 [22]
- UPP1 [24]
- YWHAZ [25]
- PRKCI [26]
[27]
The 3' UTR of Vimentin mRNA has been found to bind a 46kDa protein.[28] | https://www.wikidoc.org/index.php/Vimentin | |
35baaa600d84a987431d94a73ae3ab88b13d8691 | wikidoc | Vinculin | Vinculin
In mammalian cells, vinculin is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. Vinculin is a cytoskeletal protein associated with cell-cell and cell-matrix junctions, where it is thought to function as one of several interacting proteins involved in anchoring F-actin to the membrane.
Discovered independently by Benny Geiger and Keith Burridge, its sequence is 20%-30% similar to α-catenin, which serves a similar function.
Binding alternately to talin or α-actinin, vinculin's shape and, as a consequence, its binding properties are changed. The vinculin gene occurs as a single copy and what appears to be no close relative to take over functions in its absence. Its splice variant metavinculin (see below) also needs vinculin to heterodimerize and work in a dependent fashion.
# Structure
Vinculin is a 117-kDa cytoskeletal protein with 1066 amino acids. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. Vinculin consists of a globular head domain that contains binding sites for talin and α-actinin as well as a tyrosine phosphorylation site, while the tail region contains binding sites for F-actin, paxillin, and lipids.
Essentially, there is an 835 amino acid N-terminal head, which is split into four domains. This is linked to the C-terminal tail with a linker region.
The recent discovery of the 3D structure sheds light on how this protein tailors its shape to perform a variety of functions. For example, vinculin is able to control the cell’s motility by simply altering its shape from active to inactive. When in its ‘inactive’ state, vinculin’s conformation is characterized by the interaction between its head and tail domains. And, when transforming to the ‘active’ form, such as when talin triggers binding, the intramolecular interaction between the tail and head is severed. In other words, when talin’s binding sites (VBS) of α-helices bind to a helical bundle structure in vinculin’s head domain, the ‘helical bundle conversion’ is initiated, which leads to the reorganization of the α-helices (α1- α-4), resulting in an entirely new five-helical bundle structure. This function also extends to cancer cells, and regulating their movement and proliferation of cancer to other parts of the body.
# Mechanism and function
Cell spreading and movement occur through the process of binding of cell surface integrin receptors to extracellular matrix adhesion molecules. Vinculin is associated with focal adhesion and adherens junctions, which are complexes that nucleate actin filaments and crosslinkers between the external medium, plasma membrane, and actin cytoskeleton. The complex at the focal adhesions consists of several proteins such as vinculin, α-actin, paxillin, and talin, at the intracellular face of the plasma membrane.
In more specific terms, the amino-terminus of vinculin binds to talin, which, in turn, binds to β-integrins, and the carboxy-terminus binds to actin, phospholipids, and paxillin-forming homodimers. The binding of vinculin to talin and actin is regulated by polyphosphoinositides and inhibited by acidic phospholipids. The complex then serves to anchor actin filaments to the membrane and thus, helps to reinforce force on talin within the focal adhesions.
The loss of vinculin impacts a variety of cell functions; it disrupts the formation of the complex, and prevents cell adhesion and spreading. The absence of the protein demonstrates a decrease in spreading of cells, accompanied by reduced stress fiber formation, formation of fewer focal adhesions, and inhibition of lamellipodia extension. It was discovered that cells that are deficient in vinculin have growth cones that advance more slowly, as well as filopodia and lamellipoida that were less stable than the wild-type. Based on research, it has been postulated that the lack of vinculin may decrease cell adhesion by inhibiting focal adhesion assembly and preventing actin polymerization. On the other hand, overexpression of vinculin may restore adhesion and spreading by promoting recruitment of cytoskeletal proteins to the focal adhesion complex at the site of integrin binding. Vinculin's ability to interact with integrins to the cytoskeleton at the focal adhesion appears to be critical for control of cytoskeletal mechanics, cell spreading, and lamellipodia formation. Thus, vinculin appears to play a key role in shape control based on its ability to modulate focal adhesion structure and function.
# Activation
Vinculin is present in equilibrium between an active and inactive state. The active state is triggered upon binding to its designated partner. These changes occur when vinculin interacts with focal adhesion points to which it is binding to. When vinculin resides in its inactive form, the protein is kept designated to the cytoplasm unlike the focal adhesion points bound from the active state. The molecule talin is thought to be the major initiator of vinculin activation due to its presence in focal complexes. The combinatorial model of vinculin states that either α-actinin or talin can activate vinculin either alone or with the assistance of PIP2 or actin. This activation takes place by separation of the head-tail connection within inactive vinculin.
# Binding site
Vinculin binding sites are predominantly found in talin and talin-like molecules, enabling binding of vinculin to talin, stabilising integrin-mediated cell-matrix junctions. Talin, in turn, links integrins to the actin cytoskeleton. The consensus sequence for Vinculin binding sites is LxxAAxxVAxxVxxLIxxA, with a secondary structure prediction of four amphipathic helices. The hydrophobic residues that define the VBS are themselves 'masked' and are buried in the core of a series of helical bundles that make up the talin rod.
# Splice variants
Smooth muscles and skeletal muscles (and probably to a lower extent in cardiac muscle) in their well-differentiated (contractile) state co-express (along with vinculin) a splice variant carrying an extra exon in the 3' coding region, thus encoding a longer isoform meta-vinculin (meta VCL) of ~150KD molecular weight — a protein whose existence has been known since the 1980s. Translation of the extra exon causes a 68- to 79-amino acid acid-rich insert between helices I and II within the C-terminal tail domain. Mutations within the insert region correlate with hereditary idiopathic dilated cardiomyopathy.
The length of the insert in metavinculin is 68 AA in mammals and 79 in frog. Compared metavinculin sequences from pig, man, chicken, and frog, and found the insert to be bipartite: the first part variable and the second highly conserved. Both vinculin isoforms co-localize in muscular adhesive structures, such as dense plaques in smooth muscles, intercalated discs in cardiomyocytes, and costameres in skeletal muscles. Metavinculin tail domain has a lower affinity for the head as compared with the vinculin tail. In case of metavinculin, unfurling of the C-terminal hydrophobic hairpin loop of tail domain is impaired by the negative charges of the 68-amino acid insert, thus requiring phospholipid-activated regular isoform of vinculin to fully activate the metavinculin molecule.
# Interactions
Vinculin has been shown to interact with:
- CDH1,
- Paxillin, and
- SORBS1.
In cases of Small Intestinal Bacterial Overgrowth presented as IBS symptoms, anti-cdtb antibodies have been identified to affect vinculin function, which is required in gut motility. | Vinculin
In mammalian cells, vinculin is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. Vinculin is a cytoskeletal protein associated with cell-cell and cell-matrix junctions, where it is thought to function as one of several interacting proteins involved in anchoring F-actin to the membrane.
Discovered independently by Benny Geiger[1] and Keith Burridge,[2] its sequence is 20%-30% similar to α-catenin, which serves a similar function.
Binding alternately to talin or α-actinin, vinculin's shape and, as a consequence, its binding properties are changed. The vinculin gene occurs as a single copy and what appears to be no close relative to take over functions in its absence. Its splice variant metavinculin (see below) also needs vinculin to heterodimerize and work in a dependent fashion.
# Structure
Vinculin is a 117-kDa cytoskeletal protein with 1066 amino acids. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. Vinculin consists of a globular head domain that contains binding sites for talin and α-actinin as well as a tyrosine phosphorylation site, while the tail region contains binding sites for F-actin, paxillin, and lipids.[3]
Essentially, there is an 835 amino acid N-terminal head, which is split into four domains. This is linked to the C-terminal tail with a linker region.
The recent discovery of the 3D structure sheds light on how this protein tailors its shape to perform a variety of functions. For example, vinculin is able to control the cell’s motility by simply altering its shape from active to inactive. When in its ‘inactive’ state, vinculin’s conformation is characterized by the interaction between its head and tail domains. And, when transforming to the ‘active’ form, such as when talin triggers binding, the intramolecular interaction between the tail and head is severed. In other words, when talin’s binding sites (VBS) of α-helices bind to a helical bundle structure in vinculin’s head domain, the ‘helical bundle conversion’ is initiated, which leads to the reorganization of the α-helices (α1- α-4), resulting in an entirely new five-helical bundle structure. This function also extends to cancer cells, and regulating their movement and proliferation of cancer to other parts of the body.
# Mechanism and function
Cell spreading and movement occur through the process of binding of cell surface integrin receptors to extracellular matrix adhesion molecules. Vinculin is associated with focal adhesion and adherens junctions, which are complexes that nucleate actin filaments and crosslinkers between the external medium, plasma membrane, and actin cytoskeleton.[4] The complex at the focal adhesions consists of several proteins such as vinculin, α-actin, paxillin, and talin, at the intracellular face of the plasma membrane.
In more specific terms, the amino-terminus of vinculin binds to talin, which, in turn, binds to β-integrins, and the carboxy-terminus binds to actin, phospholipids, and paxillin-forming homodimers. The binding of vinculin to talin and actin is regulated by polyphosphoinositides and inhibited by acidic phospholipids. The complex then serves to anchor actin filaments to the membrane and thus, helps to reinforce force on talin within the focal adhesions.[5][6]
The loss of vinculin impacts a variety of cell functions; it disrupts the formation of the complex, and prevents cell adhesion and spreading. The absence of the protein demonstrates a decrease in spreading of cells, accompanied by reduced stress fiber formation, formation of fewer focal adhesions, and inhibition of lamellipodia extension.[3] It was discovered that cells that are deficient in vinculin have growth cones that advance more slowly, as well as filopodia and lamellipoida that were less stable than the wild-type. Based on research, it has been postulated that the lack of vinculin may decrease cell adhesion by inhibiting focal adhesion assembly and preventing actin polymerization. On the other hand, overexpression of vinculin may restore adhesion and spreading by promoting recruitment of cytoskeletal proteins to the focal adhesion complex at the site of integrin binding.[5] Vinculin's ability to interact with integrins to the cytoskeleton at the focal adhesion appears to be critical for control of cytoskeletal mechanics, cell spreading, and lamellipodia formation. Thus, vinculin appears to play a key role in shape control based on its ability to modulate focal adhesion structure and function.
# Activation
Vinculin is present in equilibrium between an active and inactive state.[7] The active state is triggered upon binding to its designated partner. These changes occur when vinculin interacts with focal adhesion points to which it is binding to. When vinculin resides in its inactive form, the protein is kept designated to the cytoplasm unlike the focal adhesion points bound from the active state. The molecule talin is thought to be the major initiator of vinculin activation due to its presence in focal complexes. The combinatorial model of vinculin states that either α-actinin or talin can activate vinculin either alone or with the assistance of PIP2 or actin. This activation takes place by separation of the head-tail connection within inactive vinculin.[7]
# Binding site
Vinculin binding sites are predominantly found in talin and talin-like molecules, enabling binding of vinculin to talin, stabilising integrin-mediated cell-matrix junctions. Talin, in turn, links integrins to the actin cytoskeleton. The consensus sequence for Vinculin binding sites is LxxAAxxVAxxVxxLIxxA, with a secondary structure prediction of four amphipathic helices. The hydrophobic residues that define the VBS are themselves 'masked' and are buried in the core of a series of helical bundles that make up the talin rod.[8]
# Splice variants
Smooth muscles and skeletal muscles (and probably to a lower extent in cardiac muscle) in their well-differentiated (contractile) state co-express (along with vinculin) a splice variant carrying an extra exon in the 3' coding region, thus encoding a longer isoform meta-vinculin (meta VCL) of ~150KD molecular weight — a protein whose existence has been known since the 1980s.[9] Translation of the extra exon causes a 68- to 79-amino acid acid-rich insert between helices I and II within the C-terminal tail domain. Mutations within the insert region correlate with hereditary idiopathic dilated cardiomyopathy.[10]
The length of the insert in metavinculin is 68 AA in mammals and 79 in frog.[11] Compared metavinculin sequences from pig, man, chicken, and frog, and found the insert to be bipartite: the first part variable and the second highly conserved. Both vinculin isoforms co-localize in muscular adhesive structures, such as dense plaques in smooth muscles, intercalated discs in cardiomyocytes, and costameres in skeletal muscles.[12] Metavinculin tail domain has a lower affinity for the head as compared with the vinculin tail. In case of metavinculin, unfurling of the C-terminal hydrophobic hairpin loop of tail domain is impaired by the negative charges of the 68-amino acid insert, thus requiring phospholipid-activated regular isoform of vinculin to fully activate the metavinculin molecule.
# Interactions
Vinculin has been shown to interact with:
- CDH1,[13][14]
- Paxillin,[15][16][17] and
- SORBS1.[18]
In cases of Small Intestinal Bacterial Overgrowth presented as IBS symptoms, anti-cdtb antibodies have been identified to affect vinculin function, which is required in gut motility.[19] | https://www.wikidoc.org/index.php/Vinculin | |
31635495febd7f811b7275a6559a98869bfd5ff2 | wikidoc | Viologen | Viologen
The Viologens are diquaternary derivatives of 4,4'-bipyridyl. The name comes from the fact that this class of compounds is easily reduced to the radical mono cation, which is intensely blue coloured. In an experimental electrolysis setup, viologen in solution with sodium sulfate is reduced at the cathode with simultaneous formation of hydrogen gas. oxygen generated at the anode is capable of oxidizing the radical ion back to the viologen.
Further reduction yields a yellow quinoid compound. Diquaternary derivatives of 2,2'-bipyridyl give a green radical anion.
Viologens are investigated for use in electrochromic systems because of their ability to change color reversibly many times upon reduction and oxidation. Paraquat is a viologen used as a herbicide.
In extended viologens conjugated oligomers such as based on aryl, ethylene and thiophene units are inserted between the pyridine units. The bipolaron di-oktyl bis(4-pyridyl)biphenyl viologen 2 in scheme 2 can be reduced by sodium amalgam in DMF to the neutral viologen 3.
The resonance structures of the quinoid 3a and the diradical 3b contribute equally to the hybrid structure. The driving force for the contributing 3b is the restoration of aromaticity with the biphenyl unit. From X-ray crystallography it is established that the molecule is coplanar and with slight nitrogen pyramidalization and that the central carbon bonds a longer (144 pm) than what would be expected for a double bond (136 pm). Further research shows that the diradical exists as a mixture of triplets and singlets although remarkably an ESR signal is absent. In this sense the molecule resembles Chichibabin's hydrocarbon discovered in 1907. The blue color in solution and metallic green color as crystals are also in common.
Compound 3 is a very strong reducing agent with a redox potential of - 1.48 V again because aromaticity is restored. The compound is also a liquid crystal with multiple liquid crystal phases in the melt as a result of the molecule's structure with a flat and rigid core and flexible linear alkyl arms. | Viologen
The Viologens are diquaternary derivatives of 4,4'-bipyridyl. The name comes from the fact that this class of compounds is easily reduced to the radical mono cation, which is intensely blue coloured. In an experimental electrolysis setup, viologen in solution with sodium sulfate is reduced at the cathode with simultaneous formation of hydrogen gas. oxygen generated at the anode is capable of oxidizing the radical ion back to the viologen.
Further reduction yields a yellow quinoid compound. Diquaternary derivatives of 2,2'-bipyridyl give a green radical anion.
Viologens are investigated for use in electrochromic systems because of their ability to change color reversibly many times upon reduction and oxidation. Paraquat is a viologen used as a herbicide.
In extended viologens conjugated oligomers such as based on aryl, ethylene and thiophene units are inserted between the pyridine units.[1] The bipolaron di-oktyl bis(4-pyridyl)biphenyl viologen 2 in scheme 2 can be reduced by sodium amalgam in DMF to the neutral viologen 3.
The resonance structures of the quinoid 3a and the diradical 3b contribute equally to the hybrid structure. The driving force for the contributing 3b is the restoration of aromaticity with the biphenyl unit. From X-ray crystallography it is established that the molecule is coplanar and with slight nitrogen pyramidalization and that the central carbon bonds a longer (144 pm) than what would be expected for a double bond (136 pm). Further research shows that the diradical exists as a mixture of triplets and singlets although remarkably an ESR signal is absent. In this sense the molecule resembles Chichibabin's hydrocarbon discovered in 1907. The blue color in solution and metallic green color as crystals are also in common.
Compound 3 is a very strong reducing agent with a redox potential of - 1.48 V again because aromaticity is restored. The compound is also a liquid crystal with multiple liquid crystal phases in the melt as a result of the molecule's structure with a flat and rigid core and flexible linear alkyl arms.
# External links
- Experimental details viologen electrolysis including a movie from the University of Regensburg Link | https://www.wikidoc.org/index.php/Viologen | |
162bb26b18e14ff2829657292eccd733b1ae6b6d | wikidoc | Virokine | Virokine
A virokine is a competitive inhibitor of a cytokine encoded within some viral genomes.
The word "virokine" was originally coined by Dr. Bernard Moss. It is used to designate viral proteins that interfere with immune response by reducing cytokine levels or effectiveness. They may do so by suppressing cytokine secretion, competing for cytokine receptors, interfering with cytokine signalling pathways, or otherwise antagonizing cytokines of the host organism. Many virokines are similar to host cytokines and may have been acquired by gene transfer from the host and subsequently modified.
# Further reading
- Girish J. Kotwal (1999). "Virokines: mediators of virus-host interaction and future immunomodulators in medicine" (PDF). Archivum Immunologiae et Therapiae Experimentalis (Warsz). 47 (3): 135&ndash, 138. PMID 10470439..mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}
- Smith S.A. and Kotwal G.J. (May 2001). "Virokines: novel immunomodulatory agents". Expert Opinion on Biological Therapy. 1 (3): 343&ndash, 357.
- MARIAM KLOUCHE, GIUSEPPE CARRUBA, LUIGI CASTAGNETTA, AND STEFAN ROSE-JOHN (December 2004). "Virokines in the Pathogenesis of Cancer: Focus on Human Herpesvirus". Annals of the. New York Academy of Sciences. New York Academy of Sciences. 1028: 329&ndash, 339. doi:10.1196/annals.1322.038.CS1 maint: Multiple names: authors list (link) | Virokine
Template:Expert
A virokine is a competitive inhibitor of a cytokine encoded within some viral genomes.
The word "virokine" was originally coined by Dr. Bernard Moss.[1] It is used to designate viral proteins that interfere with immune response by reducing cytokine levels or effectiveness. They may do so by suppressing cytokine secretion, competing for cytokine receptors, interfering with cytokine signalling pathways, or otherwise antagonizing cytokines of the host organism. Many virokines are similar to host cytokines and may have been acquired by gene transfer from the host and subsequently modified.[2]
# Further reading
- Girish J. Kotwal (1999). "Virokines: mediators of virus-host interaction and future immunomodulators in medicine" (PDF). Archivum Immunologiae et Therapiae Experimentalis (Warsz). 47 (3): 135&ndash, 138. PMID 10470439..mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/d/d6/Lock-gray-alt-2.svg/9px-Lock-gray-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/a/aa/Lock-red-alt-2.svg/9px-Lock-red-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}
- Smith S.A. and Kotwal G.J. (May 2001). "Virokines: novel immunomodulatory agents". Expert Opinion on Biological Therapy. 1 (3): 343&ndash, 357.
- MARIAM KLOUCHE, GIUSEPPE CARRUBA, LUIGI CASTAGNETTA, AND STEFAN ROSE-JOHN (December 2004). "Virokines in the Pathogenesis of Cancer: Focus on Human Herpesvirus". Annals of the. New York Academy of Sciences. New York Academy of Sciences. 1028: 329&ndash, 339. doi:10.1196/annals.1322.038.CS1 maint: Multiple names: authors list (link) | https://www.wikidoc.org/index.php/Virokine | |
fcbd2eed5bb6939013da3c62c4ab2c74583bf82a | wikidoc | Virology | Virology
# Overview
Virology, often considered a part of microbiology or of pathology, is the study of biological viruses and virus-like agents: their structure and classification, their ways to infect and exploit cells for virus reproduction, the diseases they cause, the techniques to isolate and culture them, and their potential uses in research and therapy.
# Virus structure and classification
A major branch of virology is virus classification. Viruses can be classified according to the host cell they infect: animal viruses, plant viruses, fungal viruses, and bacteriophages (viruses infecting bacteria, which include the most complex viruses). Another classification uses the geometrical shape of their capsid (often a helix or an icosahedron) or the virus's structure (e.g. presence or nhnm a lipid envelope). Viruses range in size from about 30 nm to about 450 nm, which means that most of them cannot be seen with light microscopes. The shape and structure of viruses can be studied with electron microscopy, with NMR spectroscopy, and most importantly with X-ray crystallography.
The most useful and most widely used classification system distinguishes viruses according to the type of nucleic acid they use as genetic material and the viral replication method they employ to coax host cells into producing more viruses:
- DNA viruses (divided into double-stranded DNA viruses and the much less common single-stranded DNA viruses),
- RNA viruses (divided into positive-sense single-stranded RNA viruses, negative-sense single-stranded RNA viruses and the much less common double-stranded RNA viruses),
- reverse transcribing viruses (double-stranded reverse-transcribing DNA viruses and single-stranded reverse-transcribing RNA viruses including retroviruses).
In addition virologists also study subviral particles, infectious entities even smaller than viruses: viroids (naked circular RNA molecules infecting plants), satellites (nucleic acid molecules with or without a capsid that require a helper virus for infection and reproduction), and prions (proteins that can exist in a conformation which induces other protein molecules to assume that same conformation).
The latest report by the International Committee on Taxonomy of Viruses (2005) lists 5450 viruses, organized in over 2,000 species, 287 genera, 73 families and 3 orders.
The taxa in virology are not necessarily monophyletic. In fact, the evolutionary relationships of the various virus groups remain unclear, and three hypotheses regarding their origin exist:
- Viruses arose from non-living matter, separately from and in parallel to other life forms, possibly in the form of self-reproducing RNA ribozymes similar to viroids.
- Viruses arose from earlier, more competent cellular life forms that became parasites to host cells and subsequently lost most of their functionality; examples of such tiny parasitic prokaryotes are Mycoplasma and Nanoarchaea.
- Viruses arose as parts of the genome of cells, most likely transposons or plasmids, that acquired the ability to "break free" from the host cell and infect other cells.
It is of course possible that different alternatives apply to different virus groups.
Of particular interest here is mimivirus, a giant virus that infects amoebae and carries much of the molecular machinery traditionally associated with bacteria. Is it a simplified version of a parasitic prokaryote, or did it originate as a simpler virus that acquired genes from its host?
While viruses reproduce and evolve, they don't engage in metabolism and depend on a host cell for reproduction. The often-debated question of whether they are alive or not is a matter of definition that does not affect the biological reality of viruses.
# Viral diseases and host defenses
One main motivation for the study of viruses is the fact that they cause many important infectious diseases, among them the common cold, influenza, rabies, measles, many forms of diarrhea, hepatitis, yellow fever, polio, smallpox and AIDS. Some viruses, known as oncoviruses, contribute to certain forms of cancer; the best studied example is the association between Human papillomavirus and cervical cancer. Some subviral particles also cause disease: Kuru and Creutzfeldt-Jakob disease are caused by prions, and hepatitis D is due to a satellite virus.
The study of the manner in which viruses cause disease is viral pathogenesis. The degree to which a virus causes disease is its virulence.
When the immune system of a vertebrate encounters a virus, it produces specific antibodies which bind to the virus and mark it for destruction. The presence of these antibodies is often used to determine whether a person has been exposed to a given virus in the past, with tests such as ELISA. Vaccinations protect against viral diseases, in part, by eliciting the production of antibodies. Specifically constructed monoclonal antibodies can also be used to detect the presence of viruses, with a technique called fluorescence microscopy.
A second defense of vertebrates against viruses, cell-mediated immunity, involves immune cells known as T cells: the body's cells constantly display short fragments of their proteins on the cell's surface, and if a T cell recognizes a suspicious viral fragment there, the host cell is destroyed and the virus-specific T-cells proliferate. This mechanism is jump-started by certain vaccinations.
RNA interference, an important cellular mechanism found in plants, animals and many other eukaryotes, most likely evolved as a defense against viruses. An elaborate machinery of interacting enzymes detects double-stranded RNA molecules (which occur as part of the life cycle of many viruses) and then proceeds to destroy all single-stranded versions of those detected RNA molecules.
Every lethal viral disease presents a paradox: killing its host is obviously of no benefit to the virus, so how and why did it evolve? Today it is believed that most viruses are relatively benign in their natural host; the lethal viral diseases are explained as resulting from an "accidental" jump of the virus from a species in which it is benign to a new one that is not accustomed to it (see zoonosis). For example, serious influenza viruses probably have pigs or birds as their natural host, and HIV is thought to derive from the benign monkey virus SIV.
While it has been possible to prevent (certain) viral diseases by vaccination for a long time, the development of antiviral drugs to treat viral diseases is a comparatively recent development. The first such drug was interferon, a substance that is naturally produced by certain immune cells when an infection is detected, thus stimulating other parts of the immune system.
# Molecular biology research and viral therapy
Bacteriophages, the viruses which infect bacteria, can be relatively easily grown as viral plaques on bacterial cultures. Bacteriophages occasionally move genetic material from one bacterial cell to another in a process known as transduction, and this horizontal gene transfer is one reason why they served as a major research tool in the early development of molecular biology. The genetic code, the function of ribozymes, the first recombinant DNA and early genetic libraries were all arrived at using bacteriophages. Certain genetic elements derived from viruses, such as highly effective promoters, are commonly used in molecular biology research today.
Growing animal viruses outside of the living host animal is more difficult. Classically, fertilized chicken eggs have often been used, but cell cultures are increasingly employed for this purpose today.
Since viruses that infect eukaryotes need to transport their genetic material into the host cell's nucleus, they are attractive tools for introducing new genes into the host (known as transformation or transfection), and this approach of using viruses as gene vectors is being pursued in the gene therapy of genetic diseases. An obvious problem to be overcome in viral gene therapy is the rejection of the transforming virus by the immune system.
Oncolytic viruses are viruses that preferably infect cancer cells. While early efforts to employ these viruses in the therapy of cancer failed, there have been reports in 2005 and 2006 of encouraging preliminary results.
# Other uses of viruses
A new application of genetically engineered viruses in nanotechnology was recently described; seeVirus#Materials science and nanotechnology.
# History
A very early form of vaccination known as variolation was developed several thousand years ago in China. It involved the application of materials from smallpox sufferers in order to immunize others. In 1796 Edward Jenner used cowpox to successfully immunize a young boy against smallpox, and this practice was widely adopted. Vaccinations against other viral diseases followed, including the successful rabies vaccination by Louis Pasteur in 1886. The nature of viruses however was not clear to these researchers.
In 1892 Eugene A. Rolfjohns showed that a disease of tobacco plants, tobacco mosaic disease, could be transmitted by extracts that were passed through filters fine enough to exclude even the smallest known bacteria. In 1898 Martinus Beijerinck, also working on tobacco plants, found that this "filterable agent" grew in the host and was thus not a mere toxin. The question of whether the agent was a "living fluid" or a particle was however still open.
In 1903 it was suggested for the first time that transduction by viruses might cause cancer. Such an oncovirus in chickens was described by Francis Peyton Rous in 1911; it was later called Rous sarcoma virus 1 and understood to be a retrovirus. Several other cancer-causing retroviruses have since been described.
The existence of viruses that infect bacteria was first recognized by Frederick Twort in 1911, and, independently, by Felix d'Herelle in 1917. Since bacteria could be grown easily in culture, this led to an explosion of virology research. An important investigator in this area, Max Delbrück, described the basic life cycle of a virus in 1937: rather than "growing", a virus particle is assembled from its constituent pieces in one step; eventually it leaves the host cell to infect other cells. The Hershey-Chase experiment in 1952 showed that only DNA and not protein enters a bacterial cell upon infection with bacteriophage T2. Transduction of bacteria by bacteriophages was first described in the same year.
While plant viruses and bacteriophages can be grown comparatively easily, animal viruses normally require a living host animal, which complicates their study immensely. In 1931 it was shown that influenza virus could be grown in fertilized chicken eggs, a method that is still used today to produce vaccines. In 1937, Max Theiler managed to grow the yellow fever virus in chicken eggs and produced a vaccine from an attenuated virus strain; this vaccine saved millions of lives and is still being used today.
In 1949 John F. Enders, Thomas Weller and Frederick Robbins reported that they had been able to grow poliovirus in cultured human embryonal cells, the first significant example of an animal virus grown outside of animals and chicken eggs. This work aided Jonas Salk in deriving a polio vaccine from killed polio viruses; this vaccine was shown to be effective in 1955.
The first virus which could be crystalized and whose structure could therefore be elucidated in detail was tobacco mosaic virus (TMV), the virus that had been studied earlier by Ivanovski and Beijerink. In 1935, Wendell Stanley achieved its crystallization for electron microscopy and showed that it remains active even after crystallization. Clear X-ray diffraction pictures of the crystallized virus were obtained by Bernal and Fankuchen in 1941. Based on such pictures, Rosalind Franklin proposed the full structure of the tobacco mosaic virus in 1955. Also in 1955, Heinz Fraenkel-Conrat and Robley Williams showed that purified TMV RNA and its capsid (coat) protein can assemble by themselves to form functional viruses, suggesting that this simple mechanism is likely the natural assembly mechanism within the host cell.
In 1963, the Hepatitis B virus was discovered by Baruch Blumberg who went on to construct a vaccine against Hepatitis B.
In 1965, Howard Temin described the first retrovirus: a RNA-virus that was able to insert its genome in the form of DNA into the host's genome. Reverse transcriptase, the key enzyme that retroviruses use to translate their RNA into DNA, was first described in 1970, independently by Howard Temin and David Baltimore. The first retrovirus infecting humans was identified by Robert Gallo in 1974. Later it was found that reverse transcriptase is not specific to retroviruses; retrotransposons which code for reverse transcriptase are abundant in the genomes of all eukaryotes. About 10-40% of the human genome derives from such retrotransposons.
In 1975 the functioning of oncoviruses was clarified considerably. Until that time, it was thought that these viruses carried certain genes called oncogenes which, when inserted into the host's genome, would cause cancer. Michael Bishop and Harold Varmus showed that the oncogene of Rous sarcoma virus is in fact not specific to the virus but is contained in healthy animals of many species. The oncovirus can switch this pre-existing benign proto-oncogene on, turning it into a true oncogene.
1976 saw the first recorded outbreak of Ebola hemorrhagic fever, a highly lethal virally transmitted disease.
In 1977, Frederick Sanger achieved the first complete sequencing of the genome of any organism, a bacteriophage. In the same year, Richard Roberts and Phillip Sharp independently showed that the genes of adenovirus contain introns and therefore require gene splicing. It was later realized that almost all genes of eukaryotes have introns as well.
A world-wide vaccination campaign lead by the UN World Health Organization lead to the eradication of smallpox in 1979.
In 1982, Stanley Prusiner discovered prions and showed that they cause scrapie.
The first cases of AIDS were reported in 1981, and HIV, the retrovirus causing it, was identified in 1983 by Robert Gallo and Luc Montagnier. Tests detecting HIV infection by detecting the presence of HIV antibody were developed. Subsequent tremendous research efforts turned HIV into the best studied virus. Human Herpes Virus 8, the cause of Kaposi's sarcoma which is often seen in AIDS patients, was identified in 1994. Several anti-retroviral drugs were developed in the late 1990s, decreasing AIDS mortality dramatically in developed countries.
The first attempts at gene therapy involving viral vectors began in the early 1980s, when retroviruses were developed that could insert a foreign gene into the host's genome. They contained the foreign gene but did not contain the viral genome and therefore could not reproduce. Tests in mice were followed by tests in humans, beginning in 1989. The first human studies tried to correct the genetic disease severe combined immunodeficiency (SCID), but clinical success was limited. In the period from 1990 to 1995, gene therapy was tried on several other diseases and with different viral vectors, but it became clear that the initially high expectations were overstated. In 1999 a further setback occurred when 18-year-old Jesse Gelsinger died in a gene therapy trial. He suffered a severe immune response after having received an adenovirus vector. Success in the gene therapy of two cases of X-linked SCID was reported in 2000.
The giant mimivirus, in some sense an intermediate between tiny prokaryotes and ordinary viruses, was described in 2003 and sequenced in 2004.
Two vaccines protecting against several cervical cancer-causing strands of human papillomavirus (HPV) were released in 2006. | Virology
# Overview
Virology, often considered a part of microbiology or of pathology, is the study of biological viruses and virus-like agents: their structure and classification, their ways to infect and exploit cells for virus reproduction, the diseases they cause, the techniques to isolate and culture them, and their potential uses in research and therapy.
# Virus structure and classification
A major branch of virology is virus classification. Viruses can be classified according to the host cell they infect: animal viruses, plant viruses, fungal viruses, and bacteriophages (viruses infecting bacteria, which include the most complex viruses). Another classification uses the geometrical shape of their capsid (often a helix or an icosahedron) or the virus's structure (e.g. presence or nhnm a lipid envelope). Viruses range in size from about 30 nm to about 450 nm, which means that most of them cannot be seen with light microscopes. The shape and structure of viruses can be studied with electron microscopy, with NMR spectroscopy, and most importantly with X-ray crystallography.
The most useful and most widely used classification system distinguishes viruses according to the type of nucleic acid they use as genetic material and the viral replication method they employ to coax host cells into producing more viruses:
- DNA viruses (divided into double-stranded DNA viruses and the much less common single-stranded DNA viruses),
- RNA viruses (divided into positive-sense single-stranded RNA viruses, negative-sense single-stranded RNA viruses and the much less common double-stranded RNA viruses),
- reverse transcribing viruses (double-stranded reverse-transcribing DNA viruses and single-stranded reverse-transcribing RNA viruses including retroviruses).
In addition virologists also study subviral particles, infectious entities even smaller than viruses: viroids (naked circular RNA molecules infecting plants), satellites (nucleic acid molecules with or without a capsid that require a helper virus for infection and reproduction), and prions (proteins that can exist in a conformation which induces other protein molecules to assume that same conformation).
The latest report by the International Committee on Taxonomy of Viruses (2005) lists 5450 viruses, organized in over 2,000 species, 287 genera, 73 families and 3 orders.
The taxa in virology are not necessarily monophyletic. In fact, the evolutionary relationships of the various virus groups remain unclear, and three hypotheses regarding their origin exist:
- Viruses arose from non-living matter, separately from and in parallel to other life forms, possibly in the form of self-reproducing RNA ribozymes similar to viroids.
- Viruses arose from earlier, more competent cellular life forms that became parasites to host cells and subsequently lost most of their functionality; examples of such tiny parasitic prokaryotes are Mycoplasma and Nanoarchaea.
- Viruses arose as parts of the genome of cells, most likely transposons or plasmids, that acquired the ability to "break free" from the host cell and infect other cells.
It is of course possible that different alternatives apply to different virus groups.
Of particular interest here is mimivirus, a giant virus that infects amoebae and carries much of the molecular machinery traditionally associated with bacteria. Is it a simplified version of a parasitic prokaryote, or did it originate as a simpler virus that acquired genes from its host?
While viruses reproduce and evolve, they don't engage in metabolism and depend on a host cell for reproduction. The often-debated question of whether they are alive or not is a matter of definition that does not affect the biological reality of viruses.
# Viral diseases and host defenses
One main motivation for the study of viruses is the fact that they cause many important infectious diseases, among them the common cold, influenza, rabies, measles, many forms of diarrhea, hepatitis, yellow fever, polio, smallpox and AIDS. Some viruses, known as oncoviruses, contribute to certain forms of cancer; the best studied example is the association between Human papillomavirus and cervical cancer. Some subviral particles also cause disease: Kuru and Creutzfeldt-Jakob disease are caused by prions, and hepatitis D is due to a satellite virus.
The study of the manner in which viruses cause disease is viral pathogenesis. The degree to which a virus causes disease is its virulence.
When the immune system of a vertebrate encounters a virus, it produces specific antibodies which bind to the virus and mark it for destruction. The presence of these antibodies is often used to determine whether a person has been exposed to a given virus in the past, with tests such as ELISA. Vaccinations protect against viral diseases, in part, by eliciting the production of antibodies. Specifically constructed monoclonal antibodies can also be used to detect the presence of viruses, with a technique called fluorescence microscopy.
A second defense of vertebrates against viruses, cell-mediated immunity, involves immune cells known as T cells: the body's cells constantly display short fragments of their proteins on the cell's surface, and if a T cell recognizes a suspicious viral fragment there, the host cell is destroyed and the virus-specific T-cells proliferate. This mechanism is jump-started by certain vaccinations.
RNA interference, an important cellular mechanism found in plants, animals and many other eukaryotes, most likely evolved as a defense against viruses. An elaborate machinery of interacting enzymes detects double-stranded RNA molecules (which occur as part of the life cycle of many viruses) and then proceeds to destroy all single-stranded versions of those detected RNA molecules.
Every lethal viral disease presents a paradox: killing its host is obviously of no benefit to the virus, so how and why did it evolve? Today it is believed that most viruses are relatively benign in their natural host; the lethal viral diseases are explained as resulting from an "accidental" jump of the virus from a species in which it is benign to a new one that is not accustomed to it (see zoonosis). For example, serious influenza viruses probably have pigs or birds as their natural host, and HIV is thought to derive from the benign monkey virus SIV.
While it has been possible to prevent (certain) viral diseases by vaccination for a long time, the development of antiviral drugs to treat viral diseases is a comparatively recent development. The first such drug was interferon, a substance that is naturally produced by certain immune cells when an infection is detected, thus stimulating other parts of the immune system.
# Molecular biology research and viral therapy
Bacteriophages, the viruses which infect bacteria, can be relatively easily grown as viral plaques on bacterial cultures. Bacteriophages occasionally move genetic material from one bacterial cell to another in a process known as transduction, and this horizontal gene transfer is one reason why they served as a major research tool in the early development of molecular biology. The genetic code, the function of ribozymes, the first recombinant DNA and early genetic libraries were all arrived at using bacteriophages. Certain genetic elements derived from viruses, such as highly effective promoters, are commonly used in molecular biology research today.
Growing animal viruses outside of the living host animal is more difficult. Classically, fertilized chicken eggs have often been used, but cell cultures are increasingly employed for this purpose today.
Since viruses that infect eukaryotes need to transport their genetic material into the host cell's nucleus, they are attractive tools for introducing new genes into the host (known as transformation or transfection), and this approach of using viruses as gene vectors is being pursued in the gene therapy of genetic diseases. An obvious problem to be overcome in viral gene therapy is the rejection of the transforming virus by the immune system.
Oncolytic viruses are viruses that preferably infect cancer cells. While early efforts to employ these viruses in the therapy of cancer failed, there have been reports in 2005 and 2006 of encouraging preliminary results.[1]
# Other uses of viruses
A new application of genetically engineered viruses in nanotechnology was recently described; seeVirus#Materials science and nanotechnology.
# History
A very early form of vaccination known as variolation was developed several thousand years ago in China. It involved the application of materials from smallpox sufferers in order to immunize others. In 1796 Edward Jenner used cowpox to successfully immunize a young boy against smallpox, and this practice was widely adopted. Vaccinations against other viral diseases followed, including the successful rabies vaccination by Louis Pasteur in 1886. The nature of viruses however was not clear to these researchers.
In 1892 Eugene A. Rolfjohns showed that a disease of tobacco plants, tobacco mosaic disease, could be transmitted by extracts that were passed through filters fine enough to exclude even the smallest known bacteria. In 1898 Martinus Beijerinck, also working on tobacco plants, found that this "filterable agent" grew in the host and was thus not a mere toxin. The question of whether the agent was a "living fluid" or a particle was however still open.
In 1903 it was suggested for the first time that transduction by viruses might cause cancer. Such an oncovirus in chickens was described by Francis Peyton Rous in 1911; it was later called Rous sarcoma virus 1 and understood to be a retrovirus. Several other cancer-causing retroviruses have since been described.
The existence of viruses that infect bacteria was first recognized by Frederick Twort in 1911, and, independently, by Felix d'Herelle in 1917. Since bacteria could be grown easily in culture, this led to an explosion of virology research. An important investigator in this area, Max Delbrück, described the basic life cycle of a virus in 1937: rather than "growing", a virus particle is assembled from its constituent pieces in one step; eventually it leaves the host cell to infect other cells. The Hershey-Chase experiment in 1952 showed that only DNA and not protein enters a bacterial cell upon infection with bacteriophage T2. Transduction of bacteria by bacteriophages was first described in the same year.
While plant viruses and bacteriophages can be grown comparatively easily, animal viruses normally require a living host animal, which complicates their study immensely. In 1931 it was shown that influenza virus could be grown in fertilized chicken eggs, a method that is still used today to produce vaccines. In 1937, Max Theiler managed to grow the yellow fever virus in chicken eggs and produced a vaccine from an attenuated virus strain; this vaccine saved millions of lives and is still being used today.
In 1949 John F. Enders, Thomas Weller and Frederick Robbins reported that they had been able to grow poliovirus in cultured human embryonal cells, the first significant example of an animal virus grown outside of animals and chicken eggs. This work aided Jonas Salk in deriving a polio vaccine from killed polio viruses; this vaccine was shown to be effective in 1955.
The first virus which could be crystalized and whose structure could therefore be elucidated in detail was tobacco mosaic virus (TMV), the virus that had been studied earlier by Ivanovski and Beijerink. In 1935, Wendell Stanley achieved its crystallization for electron microscopy and showed that it remains active even after crystallization. Clear X-ray diffraction pictures of the crystallized virus were obtained by Bernal and Fankuchen in 1941. Based on such pictures, Rosalind Franklin proposed the full structure of the tobacco mosaic virus in 1955. Also in 1955, Heinz Fraenkel-Conrat and Robley Williams showed that purified TMV RNA and its capsid (coat) protein can assemble by themselves to form functional viruses, suggesting that this simple mechanism is likely the natural assembly mechanism within the host cell.
In 1963, the Hepatitis B virus was discovered by Baruch Blumberg who went on to construct a vaccine against Hepatitis B.
In 1965, Howard Temin described the first retrovirus: a RNA-virus that was able to insert its genome in the form of DNA into the host's genome. Reverse transcriptase, the key enzyme that retroviruses use to translate their RNA into DNA, was first described in 1970, independently by Howard Temin and David Baltimore. The first retrovirus infecting humans was identified by Robert Gallo in 1974. Later it was found that reverse transcriptase is not specific to retroviruses; retrotransposons which code for reverse transcriptase are abundant in the genomes of all eukaryotes. About 10-40% of the human genome derives from such retrotransposons.
In 1975 the functioning of oncoviruses was clarified considerably. Until that time, it was thought that these viruses carried certain genes called oncogenes which, when inserted into the host's genome, would cause cancer. Michael Bishop and Harold Varmus showed that the oncogene of Rous sarcoma virus is in fact not specific to the virus but is contained in healthy animals of many species. The oncovirus can switch this pre-existing benign proto-oncogene on, turning it into a true oncogene.
1976 saw the first recorded outbreak of Ebola hemorrhagic fever, a highly lethal virally transmitted disease.
In 1977, Frederick Sanger achieved the first complete sequencing of the genome of any organism, a bacteriophage. In the same year, Richard Roberts and Phillip Sharp independently showed that the genes of adenovirus contain introns and therefore require gene splicing. It was later realized that almost all genes of eukaryotes have introns as well.
A world-wide vaccination campaign lead by the UN World Health Organization lead to the eradication of smallpox in 1979.
In 1982, Stanley Prusiner discovered prions and showed that they cause scrapie.
The first cases of AIDS were reported in 1981, and HIV, the retrovirus causing it, was identified in 1983 by Robert Gallo and Luc Montagnier. Tests detecting HIV infection by detecting the presence of HIV antibody were developed. Subsequent tremendous research efforts turned HIV into the best studied virus. Human Herpes Virus 8, the cause of Kaposi's sarcoma which is often seen in AIDS patients, was identified in 1994. Several anti-retroviral drugs were developed in the late 1990s, decreasing AIDS mortality dramatically in developed countries.
The first attempts at gene therapy involving viral vectors began in the early 1980s, when retroviruses were developed that could insert a foreign gene into the host's genome. They contained the foreign gene but did not contain the viral genome and therefore could not reproduce. Tests in mice were followed by tests in humans, beginning in 1989. The first human studies tried to correct the genetic disease severe combined immunodeficiency (SCID), but clinical success was limited. In the period from 1990 to 1995, gene therapy was tried on several other diseases and with different viral vectors, but it became clear that the initially high expectations were overstated. In 1999 a further setback occurred when 18-year-old Jesse Gelsinger died in a gene therapy trial. He suffered a severe immune response after having received an adenovirus vector. Success in the gene therapy of two cases of X-linked SCID was reported in 2000.[1]
The giant mimivirus, in some sense an intermediate between tiny prokaryotes and ordinary viruses, was described in 2003 and sequenced in 2004.
Two vaccines protecting against several cervical cancer-causing strands of human papillomavirus (HPV) were released in 2006. | https://www.wikidoc.org/index.php/Virology | |
ad2c23d485bcbee60784054f57cafb0a6ec2728a | wikidoc | Vitalism | Vitalism
Vitalism, as defined by the Merriam-Webster dictionary, is
- a doctrine that the functions of a living organism are due to a vital principle distinct from physicochemical forces
- a doctrine that the processes of life are not explicable by the laws of physics and chemistry alone and that life is in some part self-determining
Where vitalism explicitly invokes a vital principle, that element is often referred to as the "vital spark," "energy" or "élan vital," which some equate with the "soul."
Vitalism has a long history in medical philosophies: most traditional healing practices posited that disease was the result of some imbalance in the vital energies which distinguish living from non-living matter. In the Western tradition, associated with Hippocrates, these vital forces were identified as the humours; Eastern traditions posited similar forces such as qi and prana. Vitalistic thinking has also been identified in the naive biological theories of children.
# Development
The notion that bodily functions are due to a vitalistic principle existing in all living creatures has roots going back at least to ancient Egypt. While vitalist ideas have been commonplace in traditional medicine, attempts to construct workable scientific models date from the 1600s, when it was argued that matter existed in two radically different forms, observable by their behavior with regard to heat. These two forms of matter were termed organic and inorganic. Inorganic matter could be melted, but could also be restored to its former condition by removing the heat. Organic compounds "cooked" when heated, transforming into new forms that could not be restored to the original. It was argued that the essential difference between the two forms of matter was the "vital force", present only in organic material.
Aided by the invention of the microscope in the 16th century, the germ theory of disease challenged the role of vitalism in Western medicine, and the roles of the organs of the human anatomy in the maintenance of life became better understood, reducing the need to explain things in terms of mystical "vital forces". Nevertheless, vitalist ideas were still thought necessary by many scientists to explain how organisms maintained life.
In the early 19th century, Jöns Jakob Berzelius, known as one of the "fathers" of modern chemistry, rejected mystical explanations of vitalism, but nevertheless argued that a regulative force must exist within living matter to maintain its functions. Carl Reichenbach later developed the theory of Odic force, a form of life-energy that permeated living things; this concept never gained much support despite Reichenbach's prestige. Vitalism is now often used as a pejorative epithet. By contrast, Ernst Mayr, co-founder of the modern evolutionary synthesis and a critic of both vitalism and reductionism, writing in 2002 after the mathematical development of theories underlying emergent behavior, stated:
It would be ahistorical to ridicule vitalists. When one reads the writings of one of the leading vitalists like Driesch one is forced to agree with him that many of the basic problems of biology simply cannot be solved by a philosophy as that of Descartes, in which the organism is simply considered a machine…..The logic of the critique of the vitalists was impeccable. But all their efforts to find a scientific answer to all the so-called vitalistic phenomena were failures.… rejecting the philosophy of reductionism is not an attack on analysis. No complex system can be understood except through careful analysis. However the interactions of the components must be considered as much as the properties of the isolated components.
# Mesmerism
A popular vitalist theory of the eighteenth century was "animal magnetism", in the theories of Franz Anton Mesmer (1734–1815). However, the use of the (conventional) English term animal magnetism to translate Mesmer's magnétisme animal is extremely misleading for three reasons:
- Mesmer chose his term to clearly distinguish his variant of magnetic force from those which were referred to, at that time, as mineral magnetism, cosmic magnetism and planetary magnetism.
- Mesmer felt that this particular force/power only resided in the bodies of humans and animals.
- Mesmer chose the word "animal", for its root meaning (from Latin animus = "breath") specifically to identify his force/power as a quality that belonged to all creatures with breath; viz., the animate beings: humans and animals.
So popular did Mesmer's ideas become that King Louis XVI of France appointed two commissions to investigate mesmerism; one was led by Joseph-Ignace Guillotin, the other, led by Benjamin Franklin, included Bailly and Lavoisier. The commissioners learned about Mesmeric theory, and saw its patients fall into fits and trances. In Franklin’s garden, a patient was led to each of five trees, one of which had been "mesmerized"; he hugged each in turn to receive the "vital fluid", but fainted at the foot of a 'wrong' one. At Lavoisier’s house, four normal cups of water were held before a "sensitive" woman; the fourth produced convulsions, but she calmly swallowed the mesmerized contents of a fifth, believing it to be plain water. The commissioners concluded that "the fluid without imagination is powerless, whereas imagination without the fluid can produce the effects of the fluid." This was an important example of the power of reason and controlled experiment to falsify theories. It is sometimes claimed that vitalist ideas are unscientific because they are not testable; here at least is an example of a vitalist theory that was not merely testable but actually falsified.
# Foundations of chemistry
In the history of chemistry, vitalism played a pivotal role, giving rise to the basic distinction between organic and inorganic substances, following Aristotle's distinction between the mineral kingdom and the animal and vegetative kingdoms. The basic premise of these vitalist notions was that organic materials differed from inorganic materials in possessing a "vital force"; accordingly, vitalist theory predicted that organic materials could not be synthesized from inorganic components. However, as chemical techniques advanced, Friedrich Wöhler synthesised urea from inorganic components in 1828. Wöhler subsequently wrote to Berzelius, saying that he had witnessed "The great tragedy of science, the slaying of a beautiful hypothesis by an ugly fact." The "beautiful hypothesis" was vitalism; the ugly fact was a dish of urea crystals.
According to the conventional view of the subsequent progress of chemistry, further discoveries pushed aside the "vital force" explanation, as more and more life processes came to be described in chemical or physical terms. However, contemporary accounts do not support the claim that vitalism died when Wöhler made urea. The Wöhler Myth, as it was called by historian of science Peter J. Ramberg , originates from a popular history of chemistry published in 1931 which, "Ignoring all pretense of historical accuracy, turned Wöhler into a crusader who made attempt after attempt to synthesize a natural product that would refute vitalism and lift the veil of ignorance, until 'one afternoon the miracle happened'."
Some of the greatest scientific minds of the time continued to investigate these vital properties. Louis Pasteur, shortly after his famous rebuttal of spontaneous generation, made several experiments that he felt supported the vital concepts of life. According to Bechtel, Pasteur "fitted fermentation into a more general programme describing special reactions that only occur in living organisms. These are irreducibly vital phenomena." In 1858, Pasteur showed that fermentation only occurs when living cells are present and, that fermentation only occurs in the absence of oxygen; he was thus led to describe fermentation as ‘life without air’. He found no support for the claims of Berzelius, Liebig, Traube and others that fermentation resulted from chemical agents or catalysts within cells, and so he concluded that fermentation was a "vital action".
# Psychology
Perhaps more than any other area of science, psychology has been rich in vitalist concepts, particularly through the ideas of Sigmund Freud and Carl Jung. Freud was a student of the notable anti-vitalist Hermann von Helmholtz, and initially struggled to express his concepts in strictly neurological terms. Abandoning this effort as fruitless, he became famous for his theory that behaviour is determined by an unconscious mind, of which the waking mind is unaware. In 1923, in The Ego and the Id, he developed the concept of "psychic energy" as the energy by which the work of the personality is performed.
Although Freud and Jung remain hugely influential, psychology has made a determined effort to rid itself of the most mystical of these concepts in an attempt to appear more like the "hard" sciences of chemistry and physics. Although research within cognitive neuroscience has made substantial progress in explaining mental processes such as perception, memory and motivational states such as anger and fear, larger concepts such as mind and intelligence, remain essentially higher level constructs, with observable neural correlates distributed throughout the
The neuroscientist Roger Sperry, in his Nobel Prize lecture in 1981, described modern scientific concepts of the nature of consciousness and its relation to brain processing as follows:
The events of inner experience, as emergent properties of brain processes, become themselves explanatory causal constructs in their own right, interacting at their own level with their own laws and dynamics. The whole world of inner experience (the world of the humanities) long rejected by 20th century scientific materialism, thus becomes recognized and included within the domain of science."
Anti-reductionism has been identified as a problem in psychology. Thomas (2001) states that "It is now generally considered that biology had to rid itself of vitalism to enable significant progress to occur. It is suggested that psychology will develop as a science only after it rids itself of anti-reductionistic, 'emergentism'."
# Developmental biology
Caspar Friedrich Wolff (1733-1794) is considered to be the father of epigenetic descriptive embryology. In his Theoria Generationis (1759), he endeavoured to explain the emergence of the organism by the actions of a "vis essentialis", an organizing, formative force, and declared that "All believers in epigenesis are Vitalists." However, even early vitalists were aware that the vital forces that they proposed were to be understood metaphorically, not literally. For example, Johann Friedrich Blumenbach, established epigenesis as the model of thought in the life sciences in 1781, with his publication of Über den Bildungstrieb and das Zeugungsgeschäfte. Blumenbach cut up freshwater polyps and established that the removed parts would regenerate; he inferred the presence of a "formative drive", an organic force, which he called "Bildungstrieb". He pointed out that this, "like names applied to every other kind of vital power, of itself, explains nothing: it serves merely to designate a peculiar power formed by the combination of the mechanical principle with that which is susceptible of modification."
Vitalism was also important in the thinking of later teleologists such as Hans Driesch (1867-1941).
In 1894, Driesch wrote a theoretical essay entitled Analytische Theorie der organischen Entwicklung, in which he declared that
This comment came from his experiments on sea urchin eggs. Driesch, already a famous biologist, became a vitalist, but his reputation as a biologist deteriorated in later life. He moved to Heidelberg and became a Professor of Natural Philosophy, seeing his vitalism an extension of Immanuel Kant's notion that the organism develops as if it had a purposeful intelligence.
# Foundations of medicine
While conventional medicine has distanced itself from the less reductionistic and more vitalistic approach of traditional medicine, some complementary medical fields continue to espouse various guises of vitalistic concepts and worldview. The National Center for Complementary and Alternative Medicine (NCCAM) classifies CAM therapies into five categories or domains:
- alternative medical systems, or complete systems of therapy and practice;
- mind-body interventions, or techniques designed to facilitate the mind's effect on bodily functions and symptoms;
- biologically based systems, including herbalism;
- manipulative and body-based methods, such as chiropractic and massage therapy; and
- energy therapy.
The therapies that continue to be most intimately associated with vitalism are bioenergetic medicines, in the category of energy therapies. This field may be further divided into bioelectromagnetic medicines (BEM) and biofield therapies (BT). Compared with bioenergetic medicines, biofield therapies have a stronger identity with vitalism. Examples of biofield therapies include therapeutic touch, Reiki, external qi, chakra healing and SHEN therapy. Biofield therapies are medical treatments in which the "subtle energy" field of a patient is manipulated by a biofield practitioner. The subtle energy is held to exist beyond the electromagnetic (EM) energy that is produced by the heart and brain. Beverly Rubik describes the biofield as a "complex, dynamic, extremely weak EM field within and around the human body..."
Acupuncture and chiropractic emphasize a holistic approach to the cause and treatment of disease (see main articles on these subjects). For example, in a paper named "The Meanings of Innate", Keating says that "Innate Intelligence" in chiropractic can be used to represent four concepts: a synonym for homeostasis, a label for a doctor's ignorance, a vitalistic explanation of health and disease, and a metaphysical premise for treatment.
The founder of homeopathy, Hahnemann, promoted an immaterial, vitalistic view of disease: "...they are solely spirit-like (dynamic) derangements of the spirit-like power (the vital principle) that animates the human body." As practised by some homeopaths today, homeopathy simply rests on the premise of treating sick persons with extremely diluted agents that - in undiluted doses - are deemed to produce similar symptoms in a healthy individual. Nevertheless it remains equally true that the view of disease as a dynamic disturbance of the immaterial and dynamic vital force is taught in many homeopathic colleges and constitutes a fundamental principle for many contemporary practising homeopaths.
# "New Age" mysticism
Vitalism is also an aspect of many "New Age" theories. Examples include Rupert Sheldrake's concept of "morphic resonance" - the idea of telepathy-type interconnections between organisms and of collective memories within species, and revivals of Reichenbach's Odic force, which is sometimes used to explain colored auras. Anthroposophy, founded by Rudolf Steiner, is a quasi-religious cult whose teachings, in Steiner's words, lead "from the spirit in the human being to the spirit in the universe." An early form of sustainable agriculture, biodynamic agriculture, was fostered by this movement.
# Relation to emergentism
In terms of the biology of the cell, a variation of vitalism can be recognized in contemporary molecular biology; for example in the proposal that some key organising and structuring features of organisms, perhaps including even life itself, are examples of emergent processes in which complexity arises out of the interactions of the chemical processes which occur in the cell; When individual chemical processes form interconnected feedback cycles which produce products perpetuating these cycles rather than unconnected products, they can form systems with properties that the reactions, taken individually, lack.
Whether emergent system properties should be characterized with traditional vitalist concepts is a matter of semantic controversy. In a light-hearted millennial vein, Kirshner and Michison call research into integrated cell and organismal physiology “molecular vitalism.”
According to Emmeche et. al. (1997):
"On the one hand, many scientists and philosophers regard emergence as having only a pseudo-scientific status. On the other hand, new developments in physics, biology, psychology, and crossdisciplinary fields such as cognitive science, artificial life, and the study of non-linear dynamical systems have focused strongly on the high level 'collective behaviour' of complex systems which is often said to be truly emergent, and the term is increasingly used to characterize such systems."
Emmeche et. al. (1998) state that "there is a very important difference between the vitalists and the emergentists: the vitalist's creative forces were relevant only in organic substances, not in inorganic matter. Emergence hence is creation of new properties regardless of the substance involved." "The assumption of an extra-physical vitalis (vital force, entelechy, élan vital, etc.), as formulated in most forms (old or new) of vitalism, is usually without any genuine explanatory power. It has served altogether too often as an intellectual tranquilizer or verbal sedative—stifling scientific inquiry rather than encouraging it to proceed in new directions."
# Critical opinions
Opponents of vitalism believe that it is pseudoscience, since its core ideas are metaphysical and impossible to prove or disprove using scientific method.
Bechtel and Richardson state that vitalism lacks credibility because it is often viewed as unfalsifiable, and is "therefore a pernicious metaphysical doctrine." While many vitalistic theories have in fact been falsified, notably Mesmerism and the phlogiston theory (see above), the pseudoscientific retention of these falsified theories continues to this day in a fashion that ignores the testability criterion of the scientific method.
For many scientists, "vitalist" theories are unsatisfactory "holding positions" on the pathway to mechanistic understanding. In 1967, Francis Crick, the co-discoverer of the structure of DNA, stated “And so to those of you who may be vitalists I would make this prophecy: what everyone believed yesterday, and you believe today, only cranks will believe tomorrow.”
Alan Sokal published an analysis of efforts within the field of nursing to describe vitalistic beliefs as "new science" (Pseudoscience and Postmodernism: Antagonists or Fellow-Travelers?). Pseudoscientific accounts within the field of nursing of practices such as therapeutic touch were reviewed by Sokal and he concluded, “nearly all the pseudoscientific systems to be examined in this essay are based philosophically on vitalism”. Sokal also noted that, "Mainstream science has rejected vitalism since at least the 1930s, for a plethora of good reasons that have only become stronger with time.”
In his book "Kinds of Minds", philosopher Daniel Dennett wrote, "Dualism...and Vitalism (the view that living things contain some special physical but equally mysterious stuff -élan vital- have been relegated to the trash heap of history...." (Chapter 2).
Joseph C. Keating, Jr., PhD, discusses vitalism's past and present roles in chiropractic and calls vitalism "a form of bio-theology." He further explains that:
Vitalism is that rejected tradition in biology which proposes that life is sustained and explained by an unmeasurable, intelligent force or energy. The supposed effects of vitalism are the manifestations of life itself, which in turn are the basis for inferring the concept in the first place. This circular reasoning offers pseudo-explanation, and may deceive us into believing we have explained some aspect of biology when in fact we have only labeled our ignorance. 'Explaining an unknown (life) with an unknowable (Innate),' suggests philosopher Joseph Donahue, D.C., 'is absurd'.
He views vitalism as incompatible with scientific thinking:
Chiropractors are not unique in recognizing a tendency and capacity for self-repair and auto-regulation of human physiology. But we surely stick out like a sore thumb among professions which claim to be scientifically based by our unrelenting commitment to vitalism. So long as we propound the 'One cause, one cure' rhetoric of Innate, we should expect to be met by ridicule from the wider health science community. Chiropractors can’t have it both ways. Our theories cannot be both dogmatically held vitalistic constructs and be scientific at the same time. The purposiveness, consciousness and rigidity of the Palmers’ Innate should be rejected.
He also mentions Skinner's viewpoint:
Vitalism has many faces and has sprung up in many areas of scientific inquiry. Psychologist B.F. Skinner, for example, pointed out the irrationality of attributing behavior to mental states and traits. Such 'mental way stations,' he argued, amount to excess theoretical baggage which fails to advance cause-and-effect explanations by substituting an unfathomable psychology of 'mind'.
According to Williams, "today, vitalism is one of the ideas that form the basis for many pseudoscientific health systems that claim that illnesses are caused by a disturbance or imbalance of the body's vital force." "Vitalists claim to be scientific, but in fact they reject the scientific method with its basic postulates of cause and effect and of provability. They often regard subjective experience to be more valid than objective material reality."
Stenger states that "This term is applied in biochemistry to refer to the readily measurable exchanges of energy within organisms, and between organisms and the environment, which occur by normal physical and chemical processes. This is not, however, what the new vitalists have in mind. They imagine the bioenergetic field as a holistic living force that goes beyond reductionist physics and chemistry."
Vitalism, or bioenergy, is often explained as being an electromagnetic(EM) field and advocates argue that this idea is supported by the theory of quantum physics. Joanne Stefanatos states that "The principles of energy medicine originate in quantum physics." Victor Stenger offers several explanations as to why this line of reasoning may be misplaced. He explains that energy is recognized as matter and exists in discrete packets called quanta. The quanta of EM fields are known to be photons. Energy fields are composed of their component parts and so only exist when quanta are present. Therefore energy fields are not holistic, but are rather a system of discrete parts that must obey by the laws of physics. This also means that energy fields are not instantaneous. These facts of quantum physics place limitations on the infinite, continuous field that is used by some theorists to describe so-called "human energy fields". Stenger continues, explaining that the effects of EM forces have been measured by physicists as accurately as one part in a billion and there is yet to be any evidence that living organisms emit a unique field. | Vitalism
Template:Otheruses4
Vitalism, as defined by the Merriam-Webster dictionary,[1] is
- a doctrine that the functions of a living organism are due to a vital principle distinct from physicochemical forces
- a doctrine that the processes of life are not explicable by the laws of physics and chemistry alone and that life is in some part self-determining
Where vitalism explicitly invokes a vital principle, that element is often referred to as the "vital spark," "energy" or "élan vital," which some equate with the "soul."
Vitalism has a long history in medical philosophies: most traditional healing practices posited that disease was the result of some imbalance in the vital energies which distinguish living from non-living matter. In the Western tradition, associated with Hippocrates, these vital forces were identified as the humours; Eastern traditions posited similar forces such as qi and prana. Vitalistic thinking has also been identified in the naive biological theories of children.[2]
# Development
The notion that bodily functions are due to a vitalistic principle existing in all living creatures has roots going back at least to ancient Egypt.[3] While vitalist ideas have been commonplace in traditional medicine,[4] attempts to construct workable scientific models date from the 1600s, when it was argued that matter existed in two radically different forms, observable by their behavior with regard to heat. These two forms of matter were termed organic and inorganic. Inorganic matter could be melted, but could also be restored to its former condition by removing the heat. Organic compounds "cooked" when heated, transforming into new forms that could not be restored to the original. It was argued that the essential difference between the two forms of matter was the "vital force", present only in organic material.
Aided by the invention of the microscope in the 16th century, the germ theory of disease challenged the role of vitalism in Western medicine, and the roles of the organs of the human anatomy in the maintenance of life became better understood, reducing the need to explain things in terms of mystical "vital forces". Nevertheless, vitalist ideas were still thought necessary by many scientists to explain how organisms maintained life.
In the early 19th century, Jöns Jakob Berzelius, known as one of the "fathers" of modern chemistry, rejected mystical explanations of vitalism, but nevertheless argued that a regulative force must exist within living matter to maintain its functions. Carl Reichenbach later developed the theory of Odic force, a form of life-energy that permeated living things; this concept never gained much support despite Reichenbach's prestige. Vitalism is now often used as a pejorative epithet.[5] By contrast, Ernst Mayr, co-founder of the modern evolutionary synthesis and a critic of both vitalism and reductionism, writing in 2002 after the mathematical development of theories underlying emergent behavior, stated:
It would be ahistorical to ridicule vitalists. When one reads the writings of one of the leading vitalists like Driesch one is forced to agree with him that many of the basic problems of biology simply cannot be solved by a philosophy as that of Descartes, in which the organism is simply considered a machine…..The logic of the critique of the vitalists was impeccable. But all their efforts to find a scientific answer to all the so-called vitalistic phenomena were failures.… rejecting the philosophy of reductionism is not an attack on analysis. No complex system can be understood except through careful analysis. However the interactions of the components must be considered as much as the properties of the isolated components.[6]
# Mesmerism
A popular vitalist theory of the eighteenth century was "animal magnetism", in the theories of Franz Anton Mesmer (1734–1815). However, the use of the (conventional) English term animal magnetism to translate Mesmer's magnétisme animal is extremely misleading for three reasons:
- Mesmer chose his term to clearly distinguish his variant of magnetic force from those which were referred to, at that time, as mineral magnetism, cosmic magnetism and planetary magnetism.
- Mesmer felt that this particular force/power only resided in the bodies of humans and animals.
- Mesmer chose the word "animal", for its root meaning (from Latin animus = "breath") specifically to identify his force/power as a quality that belonged to all creatures with breath; viz., the animate beings: humans and animals.
So popular did Mesmer's ideas become that King Louis XVI of France appointed two commissions to investigate mesmerism; one was led by Joseph-Ignace Guillotin, the other, led by Benjamin Franklin, included Bailly and Lavoisier. The commissioners learned about Mesmeric theory, and saw its patients fall into fits and trances. In Franklin’s garden, a patient was led to each of five trees, one of which had been "mesmerized"; he hugged each in turn to receive the "vital fluid", but fainted at the foot of a 'wrong' one. At Lavoisier’s house, four normal cups of water were held before a "sensitive" woman; the fourth produced convulsions, but she calmly swallowed the mesmerized contents of a fifth, believing it to be plain water. The commissioners concluded that "the fluid without imagination is powerless, whereas imagination without the fluid can produce the effects of the fluid." This was an important example of the power of reason and controlled experiment to falsify theories.[7] It is sometimes claimed[8] that vitalist ideas are unscientific because they are not testable; here at least is an example of a vitalist theory that was not merely testable but actually falsified.
# Foundations of chemistry
In the history of chemistry, vitalism played a pivotal role, giving rise to the basic distinction between organic and inorganic substances, following Aristotle's distinction between the mineral kingdom and the animal and vegetative kingdoms.[9] The basic premise of these vitalist notions was that organic materials differed from inorganic materials in possessing a "vital force"; accordingly, vitalist theory predicted that organic materials could not be synthesized from inorganic components. However, as chemical techniques advanced, Friedrich Wöhler synthesised urea from inorganic components in 1828.[10] Wöhler subsequently wrote to Berzelius, saying that he had witnessed "The great tragedy of science, the slaying of a beautiful hypothesis by an ugly fact." The "beautiful hypothesis" was vitalism; the ugly fact was a dish of urea crystals.[11]
According to the conventional view of the subsequent progress of chemistry, further discoveries pushed aside the "vital force" explanation, as more and more life processes came to be described in chemical or physical terms. However, contemporary accounts do not support the claim that vitalism died when Wöhler made urea. The Wöhler Myth, as it was called by historian of science Peter J. Ramberg , originates from a popular history of chemistry published in 1931 which, "Ignoring all pretense of historical accuracy, turned Wöhler into a crusader who made attempt after attempt to synthesize a natural product that would refute vitalism and lift the veil of ignorance, until 'one afternoon the miracle happened'."[12]
Some of the greatest scientific minds of the time continued to investigate these vital properties. Louis Pasteur, shortly after his famous rebuttal of spontaneous generation, made several experiments that he felt supported the vital concepts of life. According to Bechtel, Pasteur "fitted fermentation into a more general programme describing special reactions that only occur in living organisms. These are irreducibly vital phenomena." In 1858, Pasteur showed that fermentation only occurs when living cells are present and, that fermentation only occurs in the absence of oxygen; he was thus led to describe fermentation as ‘life without air’. He found no support for the claims of Berzelius, Liebig, Traube and others that fermentation resulted from chemical agents or catalysts within cells, and so he concluded that fermentation was a "vital action".[8]
# Psychology
Perhaps more than any other area of science, psychology has been rich in vitalist concepts, particularly through the ideas of Sigmund Freud and Carl Jung. Freud was a student of the notable anti-vitalist Hermann von Helmholtz, and initially struggled to express his concepts in strictly neurological terms. Abandoning this effort as fruitless, he became famous for his theory that behaviour is determined by an unconscious mind, of which the waking mind is unaware. In 1923, in The Ego and the Id, he developed the concept of "psychic energy" as the energy by which the work of the personality is performed.
Although Freud and Jung remain hugely influential, psychology has made a determined effort to rid itself of the most mystical of these concepts in an attempt to appear more like the "hard" sciences of chemistry and physics.[13] Although research within cognitive neuroscience has made substantial progress in explaining mental processes such as perception, memory and motivational states such as anger and fear,[14] larger concepts such as mind and intelligence, remain essentially higher level constructs, with observable neural correlates distributed throughout the
The neuroscientist Roger Sperry, in his Nobel Prize lecture in 1981, described modern scientific concepts of the nature of consciousness and its relation to brain processing as follows:
The events of inner experience, as emergent properties of brain processes, become themselves explanatory causal constructs in their own right, interacting at their own level with their own laws and dynamics. The whole world of inner experience (the world of the humanities) long rejected by 20th century scientific materialism, thus becomes recognized and included within the domain of science."[15]
Anti-reductionism has been identified as a problem in psychology. Thomas (2001) states that "It is now generally considered that biology had to rid itself of vitalism to enable significant progress to occur. It is suggested that psychology will develop as a science only after it rids itself of anti-reductionistic, 'emergentism'."[16]
# Developmental biology
Caspar Friedrich Wolff (1733-1794) is considered to be the father of epigenetic descriptive embryology. In his Theoria Generationis (1759), he endeavoured to explain the emergence of the organism by the actions of a "vis essentialis", an organizing, formative force, and declared that "All believers in epigenesis are Vitalists." However, even early vitalists were aware that the vital forces that they proposed were to be understood metaphorically, not literally. For example, Johann Friedrich Blumenbach, established epigenesis as the model of thought in the life sciences in 1781, with his publication of Über den Bildungstrieb and das Zeugungsgeschäfte. Blumenbach cut up freshwater polyps and established that the removed parts would regenerate; he inferred the presence of a "formative drive", an organic force, which he called "Bildungstrieb". He pointed out that this, "like names applied to every other kind of vital power, of itself, explains nothing: it serves merely to designate a peculiar power formed by the combination of the mechanical principle with that which is susceptible of modification."
Vitalism was also important in the thinking of later teleologists such as Hans Driesch (1867-1941).[17]
In 1894, Driesch wrote a theoretical essay entitled Analytische Theorie der organischen Entwicklung, in which he declared that
This comment came from his experiments on sea urchin eggs. Driesch, already a famous biologist, became a vitalist, but his reputation as a biologist deteriorated in later life.[17] He moved to Heidelberg and became a Professor of Natural Philosophy, seeing his vitalism an extension of Immanuel Kant's notion that the organism develops as if it had a purposeful intelligence.[18]
# Foundations of medicine
While conventional medicine has distanced itself from the less reductionistic and more vitalistic approach of traditional medicine, some complementary medical fields continue to espouse various guises of vitalistic concepts and worldview. The National Center for Complementary and Alternative Medicine (NCCAM) classifies CAM therapies into five categories or domains:[19]
- alternative medical systems, or complete systems of therapy and practice;
- mind-body interventions, or techniques designed to facilitate the mind's effect on bodily functions and symptoms;
- biologically based systems, including herbalism;
- manipulative and body-based methods, such as chiropractic and massage therapy; and
- energy therapy.
The therapies that continue to be most intimately associated with vitalism are bioenergetic medicines, in the category of energy therapies. This field may be further divided into bioelectromagnetic medicines (BEM) and biofield therapies (BT). Compared with bioenergetic medicines, biofield therapies have a stronger identity with vitalism. Examples of biofield therapies include therapeutic touch, Reiki, external qi, chakra healing and SHEN therapy.[20] Biofield therapies are medical treatments in which the "subtle energy" field of a patient is manipulated by a biofield practitioner. The subtle energy is held to exist beyond the electromagnetic (EM) energy that is produced by the heart and brain. Beverly Rubik describes the biofield as a "complex, dynamic, extremely weak EM field within and around the human body..."[20]
Acupuncture and chiropractic emphasize a holistic approach to the cause and treatment of disease (see main articles on these subjects). For example, in a paper named "The Meanings of Innate", Keating says that "Innate Intelligence" in chiropractic can be used to represent four concepts: a synonym for homeostasis, a label for a doctor's ignorance, a vitalistic explanation of health and disease, and a metaphysical premise for treatment.[21]
The founder of homeopathy, Hahnemann, promoted an immaterial, vitalistic view of disease: "...they are solely spirit-like (dynamic) derangements of the spirit-like power (the vital principle) that animates the human body." As practised by some homeopaths today, homeopathy simply rests on the premise of treating sick persons with extremely diluted agents that - in undiluted doses - are deemed to produce similar symptoms in a healthy individual. Nevertheless it remains equally true that the view of disease as a dynamic disturbance of the immaterial and dynamic vital force is taught in many homeopathic colleges and constitutes a fundamental principle for many contemporary practising homeopaths.
# "New Age" mysticism
Vitalism is also an aspect of many "New Age" theories. Examples include Rupert Sheldrake's concept of "morphic resonance" - the idea of telepathy-type interconnections between organisms and of collective memories[22] within species[11], and revivals of Reichenbach's Odic force, which is sometimes used to explain colored auras.[23] Anthroposophy, founded by Rudolf Steiner, is a quasi-religious cult whose teachings, in Steiner's words, lead "from the spirit in the human being to the spirit in the universe."[24] An early form of sustainable agriculture, biodynamic agriculture, was fostered by this movement.
# Relation to emergentism
In terms of the biology of the cell, a variation of vitalism can be recognized in contemporary molecular biology; for example in the proposal that some key organising and structuring features of organisms, perhaps including even life itself, are examples of emergent processes in which complexity arises out of the interactions of the chemical processes which occur in the cell;[25] When individual chemical processes form interconnected feedback cycles which produce products perpetuating these cycles rather than unconnected products, they can form systems with properties that the reactions, taken individually, lack.[26]
Whether emergent system properties should be characterized with traditional vitalist concepts is a matter of semantic controversy.[27] In a light-hearted millennial vein, Kirshner and Michison call research into integrated cell and organismal physiology “molecular vitalism.”[28]
According to Emmeche et. al. (1997):
"On the one hand, many scientists and philosophers regard emergence as having only a pseudo-scientific status. On the other hand, new developments in physics, biology, psychology, and crossdisciplinary fields such as cognitive science, artificial life, and the study of non-linear dynamical systems have focused strongly on the high level 'collective behaviour' of complex systems which is often said to be truly emergent, and the term is increasingly used to characterize such systems."[29]
Emmeche et. al. (1998) state that "there is a very important difference between the vitalists and the emergentists: the vitalist's creative forces were relevant only in organic substances, not in inorganic matter. Emergence hence is creation of new properties regardless of the substance involved." "The assumption of an extra-physical vitalis (vital force, entelechy, élan vital, etc.), as formulated in most forms (old or new) of vitalism, is usually without any genuine explanatory power. It has served altogether too often as an intellectual tranquilizer or verbal sedative—stifling scientific inquiry rather than encouraging it to proceed in new directions."[30]
# Critical opinions
Opponents of vitalism believe that it is pseudoscience, since its core ideas are metaphysical and impossible to prove or disprove using scientific method.
Bechtel and Richardson[8] state that vitalism lacks credibility because it is often viewed as unfalsifiable, and is "therefore a pernicious metaphysical doctrine." While many vitalistic theories have in fact been falsified, notably Mesmerism and the phlogiston theory (see above), the pseudoscientific retention of these falsified theories continues to this day in a fashion that ignores the testability criterion of the scientific method.
For many scientists, "vitalist" theories are unsatisfactory "holding positions" on the pathway to mechanistic understanding. In 1967, Francis Crick, the co-discoverer of the structure of DNA, stated “And so to those of you who may be vitalists I would make this prophecy: what everyone believed yesterday, and you believe today, only cranks will believe tomorrow.”[31]
Alan Sokal published an analysis of efforts within the field of nursing to describe vitalistic beliefs as "new science" (Pseudoscience and Postmodernism: Antagonists or Fellow-Travelers?).[32] Pseudoscientific accounts within the field of nursing of practices such as therapeutic touch were reviewed by Sokal and he concluded, “nearly all the pseudoscientific systems to be examined in this essay are based philosophically on vitalism”. Sokal also noted that, "Mainstream science has rejected vitalism since at least the 1930s, for a plethora of good reasons that have only become stronger with time.”[32]
In his book "Kinds of Minds", philosopher Daniel Dennett wrote, "Dualism...and Vitalism (the view that living things contain some special physical but equally mysterious stuff -élan vital- have been relegated to the trash heap of history...." (Chapter 2).[33]
Joseph C. Keating, Jr., PhD,[34] discusses vitalism's past and present roles in chiropractic and calls vitalism "a form of bio-theology." He further explains that:
Vitalism is that rejected tradition in biology which proposes that life is sustained and explained by an unmeasurable, intelligent force or energy. The supposed effects of vitalism are the manifestations of life itself, which in turn are the basis for inferring the concept in the first place. This circular reasoning offers pseudo-explanation, and may deceive us into believing we have explained some aspect of biology when in fact we have only labeled our ignorance. 'Explaining an unknown (life) with an unknowable (Innate),' suggests philosopher Joseph Donahue, D.C., 'is absurd'.[21]
He views vitalism as incompatible with scientific thinking:
Chiropractors are not unique in recognizing a tendency and capacity for self-repair and auto-regulation of human physiology. But we surely stick out like a sore thumb among professions which claim to be scientifically based by our unrelenting commitment to vitalism. So long as we propound the 'One cause, one cure' rhetoric of Innate, we should expect to be met by ridicule from the wider health science community. Chiropractors can’t have it both ways. Our theories cannot be both dogmatically held vitalistic constructs and be scientific at the same time. The purposiveness, consciousness and rigidity of the Palmers’ Innate should be rejected.[21]
He also mentions Skinner's viewpoint:
Vitalism has many faces and has sprung up in many areas of scientific inquiry. Psychologist B.F. Skinner, for example, pointed out the irrationality of attributing behavior to mental states and traits. Such 'mental way stations,' he argued, amount to excess theoretical baggage which fails to advance cause-and-effect explanations by substituting an unfathomable psychology of 'mind'.[21]
According to Williams,[35] "today, vitalism is one of the ideas that form the basis for many pseudoscientific health systems that claim that illnesses are caused by a disturbance or imbalance of the body's vital force." "Vitalists claim to be scientific, but in fact they reject the scientific method with its basic postulates of cause and effect and of provability. They often regard subjective experience to be more valid than objective material reality."
Stenger[36] states that "This term is applied in biochemistry to refer to the readily measurable exchanges of energy within organisms, and between organisms and the environment, which occur by normal physical and chemical processes. This is not, however, what the new vitalists have in mind. They imagine the bioenergetic field as a holistic living force that goes beyond reductionist physics and chemistry."[37]
Vitalism, or bioenergy, is often explained as being an electromagnetic(EM) field and advocates argue that this idea is supported by the theory of quantum physics.[20] Joanne Stefanatos states that "The principles of energy medicine originate in quantum physics."[38] Victor Stenger[37] offers several explanations as to why this line of reasoning may be misplaced. He explains that energy is recognized as matter and exists in discrete packets called quanta. The quanta of EM fields are known to be photons. Energy fields are composed of their component parts and so only exist when quanta are present. Therefore energy fields are not holistic, but are rather a system of discrete parts that must obey by the laws of physics. This also means that energy fields are not instantaneous. These facts of quantum physics place limitations on the infinite, continuous field that is used by some theorists to describe so-called "human energy fields".[39] Stenger continues, explaining that the effects of EM forces have been measured by physicists as accurately as one part in a billion and there is yet to be any evidence that living organisms emit a unique field.[37] | https://www.wikidoc.org/index.php/Vis_medicatrix_naturae | |
4b55c927bfd1ab0ef48520dab1237214d3d3cd5a | wikidoc | Waveform | Waveform
Waveform means the shape and form of a signal such as a wave moving in a solid, liquid or gaseous medium.
In many cases the medium in which the wave is being propagated does not permit a direct visual image of the form. In these cases, the term 'waveform' refers to the shape of a graph of the varying quantity against time or distance. An instrument called an oscilloscope can be used to pictorially represent the wave as a repeating image on a CRT or LCD screen.
By extension of the above, the term 'waveform' is now also sometimes used to describe the shape of the graph of any varying quantity against time.
# Examples of waveforms
Common periodic waveforms include
- Sine wave: sin (2 π t). The amplitude of the waveform follows a trigonometric sine function with respect to time.
- Sawtooth wave: 2 (t − floor(t)) − 1. This looks like the teeth of a saw. Found often in time bases for display scanning. It is used as the starting point for subtractive synthesis, as a sawtooth wave of constant period contains odd and even harmonics that fall off at −6 dB/octave.
- Square wave: saw(x) − saw (x − duty). This waveform is commonly used to represent digital information. It is square wave of constant period contains odd harmonics that fall off at −6 dB/octave.
- Triangle wave: (t − 2 floor ((t + 1) /2)) (−1)floor ((t + 1) /2). This is the integral of the square wave. It contains odd harmonics that fall off at −12 dB/octave.
Other waveforms are often called composite waveforms and can often be described as a combination of a number of sinusoidal waves or other basis functions added together.
The Fourier series describes the decomposition of periodic waveforms, such that any periodic waveform can be formed by the sum of a fundamental component and harmonic components. Finite-energy non-periodic waveforms can be analyzed into sinusoids by the Fourier transform. | Waveform
Waveform means the shape and form of a signal such as a wave moving in a solid, liquid or gaseous medium.
In many cases the medium in which the wave is being propagated does not permit a direct visual image of the form. In these cases, the term 'waveform' refers to the shape of a graph of the varying quantity against time or distance. An instrument called an oscilloscope can be used to pictorially represent the wave as a repeating image on a CRT or LCD screen.
By extension of the above, the term 'waveform' is now also sometimes used to describe the shape of the graph of any varying quantity against time.
# Examples of waveforms
Common periodic waveforms include
- Sine wave: sin (2 π t). The amplitude of the waveform follows a trigonometric sine function with respect to time.
- Sawtooth wave: 2 (t − floor(t)) − 1. This looks like the teeth of a saw. Found often in time bases for display scanning. It is used as the starting point for subtractive synthesis, as a sawtooth wave of constant period contains odd and even harmonics that fall off at −6 dB/octave.
- Square wave: saw(x) − saw (x − duty). This waveform is commonly used to represent digital information. It is square wave of constant period contains odd harmonics that fall off at −6 dB/octave.
- Triangle wave: (t − 2 floor ((t + 1) /2)) (−1)floor ((t + 1) /2). This is the integral of the square wave. It contains odd harmonics that fall off at −12 dB/octave.
Other waveforms are often called composite waveforms and can often be described as a combination of a number of sinusoidal waves or other basis functions added together.
The Fourier series describes the decomposition of periodic waveforms, such that any periodic waveform can be formed by the sum of a fundamental component and harmonic components. Finite-energy non-periodic waveforms can be analyzed into sinusoids by the Fourier transform. | https://www.wikidoc.org/index.php/Waveform | |
00d5c664eaa944da2c14f78c8f2e6738b687e0ef | wikidoc | Weet-Bix | Weet-Bix
Weet-Bix is the name of high-fibre breakfast cereal biscuits manufactured in Australia, New Zealand, and South Africa by Sanitarium Health Food Company. The name is probably a derivative of wheat bricks or wheat biscuits and as such the plural for "Weet-Bix" is generally "Weet-Bix".
# History
Sanitarium's wheat biscuits originated in the form of a product called Granose which was created as early as the 1900s. In the 1920s a company called Grain Products created a new sweetened biscuit by the name of Weet-Bix. In 1930, Sanitarium acquired Grain Products, which like Sanitarium had ties with the Seventh-day Adventist Church and made Weet-Bix a Sanitarium product.
Weet-Bix are seen in Australia as an iconic Australian foodstuff. The product was marketed in Australia using the tagline "Aussie Kids are Weet-Bix kids". This slogan was adapted for the New Zealand market as "Kiwi Kids are Weet-Bix kids". A closely related product is Weetabix, manufactured in England by Weetabix Limited of Kettering, Northamptonshire. The two products are nearly identical, the chief differences between the two are that Weetabix are smaller, sweeter, and are more brick-like in appearance than Weet-Bix. In South Africa Weet-Bix is manufactured by Bolandse Kooperatiewe Molenaars (Bokomo) in Malmesbury.
Weet-Bix was invented by Bennison Osborne in NSW, Australia in the mid 1920s. Benn set out to make a product more palatable than "Granose." He tried his new product on his little nieces and nephews until he had it perfected, and in 1928 he registered the tradename "Weetbix" and production started at 659 Parramatta Road, Leichhardt, NSW with the financial backing of Mr. Arthur Shannon. Benn's friend Malcolm Ian "Mac" Macfarlane from N.Z. joined him and proved a brilliant marketer. The product was so successful that in October of 1928, Mr. Shannon sold the rights in the product to the Sanitarium Health Food Company, at which point Mac suggested that they take the product to N.Z. The product proved so successful in N.Z. that it quickly became apparent that it would be difficult to adequately supply the market from Australia. Again, with the financial assistance of Mr. Arthur Shannon, factories were established in both Auckland and Christchurch. The enterprise was such a great success that Mr. Shannon again sold out (in 1930) to the Sanitarium Health Food Company.
Benn and Mac then exported the product to South Africa where they obtained other financial backing and installed a factory in Cape Town, forming the "British & African Cereal Company Pty. Ltd.," which was registered in London with Benn as the Managing Director. For the purpose of differentiating between the various countries, it was decided that the product, when introduced into England, should be known as "Weetabix." In England, Benn and Mac became the Joint Managing Directors with Benn controlling production and Mac controlling marketing. Thirty-three potential sites for the factory were examined, with Burton Latimer eventually being chosen, due in part to the offer of a disused flour mill by a Mr. George who was allotted shares in the company. For records see the 1932 and 1933 papers (Kettering Leader & Guardian," and "Northamptonshire Advisor" and also the May 19, 1933, "Town and Country News.") When the business was firmly established, Mr. Shannon offered to finance an expansion of the business. However, cash flow was such that additional financing was not necessary. Mr. Shannon however, did suggest investigating the Canadian market.
At this point, Mac left the business to go overseas and Benn became the sole Managing Director with Mr. George as Chairman of Directors. A fleet of cars was purchased and salesmen employed throughout England. At the height of its success in 1936, Benn sold his share holding to the Directors and left the Company to go to the U.S.A. Weetabix was unsuccessful in the U.S.A. (Clinton, Mass.) and Benn eventually became the wartime supervisor of the Army Air Force Base in Zephyr Hills, Florida. After the war, in 1946, he took his wife and three daughters by freighter back to Australia, where he died in 1980. Around 1992, Weetabix successfully entered the U.S.A. market from Canada via Clinton, Mass., the site of the unsuccessful U.S. factory.
# The Cereal Wars
Weet-Bix vies neck and neck with Nutri-Grain, manufactured by the market dominant Kellogg's company, as Australia's best selling cereal. The two brands have been known to clash in TV advertising. Kellogg's aired an ad which mocked the purportedly bland taste of Weet-Bix, to which Sanitarium responded with a commercial exposing the high sugar content of Nutri-Grain - a campaign which caused some damage to sales of the latter product. It was rumoured following this campaign that the two companies agreed on a 'truce' in which neither would denigrate the other's product in advertising again.
The jingle employed in Australia as of March 2006 contains the line "Hope you've had your Weet-Bix, all-Australian Weet-Bix, for breakfast everyday!". The phrase "I hope he's had his Weet-Bix today", or similar, is established in sports commentary in Australia.
SBS commentator Simon Hill also said, "Cahill is ecstatic. He did have his Weet-Bix this morning." after Tim Cahill scored Australia's first goal at World Cup 2006 against Japan.
# Awards
The trademark for Weet-bix has been awarded Australia's favourite trade mark by IP Australia, a federal government department. | Weet-Bix
Weet-Bix is the name of high-fibre breakfast cereal biscuits manufactured in Australia, New Zealand, and South Africa by Sanitarium Health Food Company. The name is probably a derivative of wheat bricks or wheat biscuits and as such the plural for "Weet-Bix" is generally "Weet-Bix".
# History
Sanitarium's wheat biscuits originated in the form of a product called Granose which was created as early as the 1900s. In the 1920s a company called Grain Products created a new sweetened biscuit by the name of Weet-Bix. In 1930, Sanitarium acquired Grain Products, which like Sanitarium had ties with the Seventh-day Adventist Church and made Weet-Bix a Sanitarium product.
Weet-Bix are seen in Australia as an iconic Australian foodstuff. The product was marketed in Australia using the tagline "Aussie Kids are Weet-Bix kids". This slogan was adapted for the New Zealand market as "Kiwi Kids are Weet-Bix kids". A closely related product is Weetabix, manufactured in England by Weetabix Limited of Kettering, Northamptonshire. The two products are nearly identical, the chief differences between the two are that Weetabix are smaller, sweeter, and are more brick-like in appearance than Weet-Bix. In South Africa Weet-Bix is manufactured by Bolandse Kooperatiewe Molenaars (Bokomo) in Malmesbury.
Weet-Bix was invented by Bennison Osborne in NSW, Australia in the mid 1920s. Benn set out to make a product more palatable than "Granose." He tried his new product on his little nieces and nephews until he had it perfected, and in 1928 he registered the tradename "Weetbix" and production started at 659 Parramatta Road, Leichhardt, NSW with the financial backing of Mr. Arthur Shannon. Benn's friend Malcolm Ian "Mac" Macfarlane from N.Z. joined him and proved a brilliant marketer. The product was so successful that in October of 1928, Mr. Shannon sold the rights in the product to the Sanitarium Health Food Company, at which point Mac suggested that they take the product to N.Z. The product proved so successful in N.Z. that it quickly became apparent that it would be difficult to adequately supply the market from Australia. Again, with the financial assistance of Mr. Arthur Shannon, factories were established in both Auckland and Christchurch. The enterprise was such a great success that Mr. Shannon again sold out (in 1930) to the Sanitarium Health Food Company.
Benn and Mac then exported the product to South Africa where they obtained other financial backing and installed a factory in Cape Town, forming the "British & African Cereal Company Pty. Ltd.," which was registered in London with Benn as the Managing Director. For the purpose of differentiating between the various countries, it was decided that the product, when introduced into England, should be known as "Weetabix." In England, Benn and Mac became the Joint Managing Directors with Benn controlling production and Mac controlling marketing. Thirty-three potential sites for the factory were examined, with Burton Latimer eventually being chosen, due in part to the offer of a disused flour mill by a Mr. George who was allotted shares in the company. For records see the 1932 and 1933 papers (Kettering Leader & Guardian," and "Northamptonshire Advisor" and also the May 19, 1933, "Town and Country News.") When the business was firmly established, Mr. Shannon offered to finance an expansion of the business. However, cash flow was such that additional financing was not necessary. Mr. Shannon however, did suggest investigating the Canadian market.
At this point, Mac left the business to go overseas and Benn became the sole Managing Director with Mr. George as Chairman of Directors. A fleet of cars was purchased and salesmen employed throughout England. At the height of its success in 1936, Benn sold his share holding to the Directors and left the Company to go to the U.S.A. Weetabix was unsuccessful in the U.S.A. (Clinton, Mass.) and Benn eventually became the wartime supervisor of the Army Air Force Base in Zephyr Hills, Florida. After the war, in 1946, he took his wife and three daughters by freighter back to Australia, where he died in 1980. Around 1992, Weetabix successfully entered the U.S.A. market from Canada via Clinton, Mass., the site of the unsuccessful U.S. factory.
# The Cereal Wars
Weet-Bix vies neck and neck with Nutri-Grain, manufactured by the market dominant Kellogg's company, as Australia's best selling cereal. The two brands have been known to clash in TV advertising. Kellogg's aired an ad which mocked the purportedly bland taste of Weet-Bix, to which Sanitarium responded with a commercial exposing the high sugar content of Nutri-Grain - a campaign which caused some damage to sales of the latter product. It was rumoured following this campaign that the two companies agreed on a 'truce' in which neither would denigrate the other's product in advertising again.[citation needed]
The jingle employed in Australia as of March 2006 contains the line "Hope you've had your Weet-Bix, all-Australian Weet-Bix, for breakfast everyday!". The phrase "I hope he's had his Weet-Bix today", or similar, is established in sports commentary in Australia.
SBS commentator Simon Hill also said, "Cahill is ecstatic. He did have his Weet-Bix this morning." after Tim Cahill scored Australia's first goal at World Cup 2006 against Japan.
# Awards
The trademark for Weet-bix has been awarded Australia's favourite trade mark by IP Australia, a federal government department. [2] | https://www.wikidoc.org/index.php/Weet-Bix | |
67d480cf1c2ca67674692aeb7ea15b02b94ddf33 | wikidoc | Wellsoft | Wellsoft
Wellsoft Corporation is an Electronic Medical Record software vendor based in Somerset, NJ. It has been incorporated for over eighteen years, and is currently rated #1 in the KLAS Report for best EDIS (Emergency Department Information Systems) systems as of Nov 17th, 2006.
Some competitors include GE Healthcare, Siemens AG, and Cerner. Healthcare Information Technology is one of the fastest growing fields which has increased the number of EDIS (Emergency Department Information Systems) vendors tremendously.
# Wellsoft tracking
The Wellsoft Suite started out as DOS based "HomeEasy" Discharge Instructions. This version is no longer deployed, although it maintains quite a few installations throughout the United States.
The recent version (Wellsoft v11) is Windows based, with optional web deployment via Citrix. It currently uses the Oracle database (which can be deployed on Windows or Linux).
Wellsoft Tracking Display - Version 11
File:Tracking screen.png
# Web-based access
Many EDIS systems offer internet-based access, and there are two basic routes with which this can be accomplished. Web based applications generally support thin client deployments through Java or HTML, while compiled applications typically use Citrix. Wellsoft currently uses Citrix.
There are advantages and disadvantages to each method. Citrix deployments are capable of running both compiled and web-based applications, however they require that a Citrix Client be loaded onto the machines. While this is practical in an Emergency Department, it is less practical for providing access to patient information over the internet.
# Compiled Applications vs Web-based Applications
Wellsoft is a compiled application, which is web-enabled (through Citrix) but not web-based.
HTML-based applications are almost universally portable. They can be used on any machine, with any operating system, including thin clients. While the portability is ideal for displaying web-pages with information, the poor stability of Internet Explorer and lack of user interface control make HTML-based applications a poor choice for serious applications.
Java-based applications are very similar to compiled applications. While it is more portable than compiled applications, Java applications are also significantly slower. This type of application is well suited for remote doctors offices, but ill suited to time-critical tasks such as those in the Emergency Department.
Compiled applications have been optimized for a particular operating system. While this makes compiled applications faster, it also restricts them to running on a particular operating system (for example, Windows). In the Emergency Department this is typically not an issue, since remote access is usually less important than speed.
# Update architecture
The system updates are deployed via the server. The workstations check the server for updates, and installation occurs automatically. This allows update distribution to occur without taking down the system.
Wellsoft takes approximately five minutes. However, the update time varies dramatically from vendor to vendor, with updates taking anywhere from a minute to several hours. This is especially important in the Emergency Department, and in fact has been a barrier to entry for many other hospital-wide systems. | Wellsoft
Template:Infobox Company
Wellsoft Corporation is an Electronic Medical Record software vendor based in Somerset, NJ. It has been incorporated for over eighteen years, and is currently rated #1 in the KLAS Report for best EDIS (Emergency Department Information Systems) systems as of Nov 17th, 2006.
Some competitors include GE Healthcare, Siemens AG, and Cerner. Healthcare Information Technology is one of the fastest growing fields [1] which has increased the number of EDIS (Emergency Department Information Systems) vendors tremendously.
# Wellsoft tracking
The Wellsoft Suite started out as DOS based "HomeEasy" Discharge Instructions. This version is no longer deployed, although it maintains quite a few installations throughout the United States.
The recent version (Wellsoft v11) is Windows based, with optional web deployment via Citrix. It currently uses the Oracle database (which can be deployed on Windows or Linux).
Wellsoft Tracking Display - Version 11
File:Tracking screen.png
# Web-based access
Many EDIS systems offer internet-based access, and there are two basic routes with which this can be accomplished. Web based applications generally support thin client deployments through Java or HTML, while compiled applications typically use Citrix. Wellsoft currently uses Citrix.
There are advantages and disadvantages to each method. Citrix deployments are capable of running both compiled and web-based applications, however they require that a Citrix Client be loaded onto the machines. While this is practical in an Emergency Department, it is less practical for providing access to patient information over the internet.
# Compiled Applications vs Web-based Applications
Wellsoft is a compiled application, which is web-enabled (through Citrix) but not web-based.
HTML-based applications are almost universally portable. They can be used on any machine, with any operating system, including thin clients. While the portability is ideal for displaying web-pages with information, the poor stability of Internet Explorer and lack of user interface control make HTML-based applications a poor choice for serious applications.
Java-based applications are very similar to compiled applications. While it is more portable than compiled applications, Java applications are also significantly slower. This type of application is well suited for remote doctors offices, but ill suited to time-critical tasks such as those in the Emergency Department.
Compiled applications have been optimized for a particular operating system. While this makes compiled applications faster, it also restricts them to running on a particular operating system (for example, Windows). In the Emergency Department this is typically not an issue, since remote access is usually less important than speed.
# Update architecture
The system updates are deployed via the server. The workstations check the server for updates, and installation occurs automatically. This allows update distribution to occur without taking down the system.
Wellsoft takes approximately five minutes. However, the update time varies dramatically from vendor to vendor, with updates taking anywhere from a minute to several hours. This is especially important in the Emergency Department, and in fact has been a barrier to entry for many other hospital-wide systems. | https://www.wikidoc.org/index.php/Wellsoft | |
02f90cdb1d5b7f9993cd25a309fb1f83355e86d6 | wikidoc | Wernicke | Wernicke
Carl Wernicke (born 15 May 1848 in Tarnowitz, Upper Silesia, then Prussia, now Tarnowskie Gory, Poland – died 15 June 1905 in Gräfenroda, Germany) was a German physician, anatomist, psychiatrist and neuropathologist. He earned his medical degree at the University of Breslau (1870). He died in Germany due to injuries suffered during a bicycle accident .
Shortly after Paul Broca published his findings on language deficits caused by damage to what is now referred to as Broca's area, Wernicke began pursuing his own research into the effects of brain disease on speech and language. Wernicke noticed that not all language deficits were the result of damage to Broca's area. Rather he found that damage to the left posterior, superior temporal gyrus resulted in deficits in language comprehension. This region is now referred to as Wernicke's area, and the associated syndrome is known as Wernicke's aphasia, for his discovery.
# The Wernicke-Geschwind model of language
Wernicke created an early neurological model of language, that later was revived by Norman Geschwind. The model is known as the Wernicke-Geschwind model.
- For listening to and understanding spoken words, the sounds of the words are sent through the auditory pathways to area 41, which is the primary auditory cortex (Heschl’s gyrus). From there, they continue to Wernicke’s area, where the meaning of the words is extracted.
- In order to speak, the meanings of words are sent from Wernicke’s area via the arcuate fasciculus to Broca’s area, where morphemes are assembled. The model proposes that Broca’s area holds a representation for articulating words. Instructions for speech are sent from Broca’s area to the facial area of the motor cortex, and from there instructions are sent to facial motor neurons in the brainstem, which relay movement orders to facial muscles.
- In order to read, information concerning the written text is sent from visual areas 17, 18, and 19 to the angular gyrus (area 39) and from there to Wernicke’s area, for silent reading or, together with Broca’s area, for reading out loud.
This model is now obsolete. Nevertheless it has been very useful in directing research and organizing research results, because it is based on the idea that language consists of two basic functions: comprehension, which is a sensory/perceptual function, and speaking, which is a motor function. However, the neural organization of language is more complex than the Wernicke-Geschwind model of language suggests. The localization of speech in Broca’s area is one of the weakest points of this model.
# Neurological syndromes described by Wernicke
- Wernicke aphasia: the eponymous term for receptive or sensory aphasia. It is the inability to understand speech, or to produce meaningful speech, caused by lesions to the posterior superior temporal gyrus.
- Wernicke encephalopathy: an acute neurological syndrome of ophthalmoparesis, ataxia, and encephalopathy brought on by thiamine deficiency. Wernicke's encephalopathy can occur combined with Korsakoff psychosis, which is a subacute dementia syndrome. It is then called the Wernicke-Korsakoff syndrome. | Wernicke
Template:Infobox Scientist
Carl Wernicke (born 15 May 1848 in Tarnowitz, Upper Silesia, then Prussia, now Tarnowskie Gory, Poland – died 15 June 1905 in Gräfenroda, Germany) was a German physician, anatomist, psychiatrist and neuropathologist. He earned his medical degree at the University of Breslau (1870). He died in Germany due to injuries suffered during a bicycle accident [1].
Shortly after Paul Broca published his findings on language deficits caused by damage to what is now referred to as Broca's area, Wernicke began pursuing his own research into the effects of brain disease on speech and language. Wernicke noticed that not all language deficits were the result of damage to Broca's area. Rather he found that damage to the left posterior, superior temporal gyrus resulted in deficits in language comprehension. This region is now referred to as Wernicke's area, and the associated syndrome is known as Wernicke's aphasia, for his discovery.
# The Wernicke-Geschwind model of language
Wernicke created an early neurological model of language, that later was revived by Norman Geschwind. The model is known as the Wernicke-Geschwind model.
- For listening to and understanding spoken words, the sounds of the words are sent through the auditory pathways to area 41, which is the primary auditory cortex (Heschl’s gyrus). From there, they continue to Wernicke’s area, where the meaning of the words is extracted.
- In order to speak, the meanings of words are sent from Wernicke’s area via the arcuate fasciculus to Broca’s area, where morphemes are assembled. The model proposes that Broca’s area holds a representation for articulating words. Instructions for speech are sent from Broca’s area to the facial area of the motor cortex, and from there instructions are sent to facial motor neurons in the brainstem, which relay movement orders to facial muscles.
- In order to read, information concerning the written text is sent from visual areas 17, 18, and 19 to the angular gyrus (area 39) and from there to Wernicke’s area, for silent reading or, together with Broca’s area, for reading out loud.
This model is now obsolete. Nevertheless it has been very useful in directing research and organizing research results, because it is based on the idea that language consists of two basic functions: comprehension, which is a sensory/perceptual function, and speaking, which is a motor function. However, the neural organization of language is more complex than the Wernicke-Geschwind model of language suggests. The localization of speech in Broca’s area is one of the weakest points of this model.[2]
# Neurological syndromes described by Wernicke
- Wernicke aphasia: the eponymous term for receptive or sensory aphasia. It is the inability to understand speech, or to produce meaningful speech, caused by lesions to the posterior superior temporal gyrus.
- Wernicke encephalopathy: an acute neurological syndrome of ophthalmoparesis, ataxia, and encephalopathy brought on by thiamine deficiency. Wernicke's encephalopathy can occur combined with Korsakoff psychosis, which is a subacute dementia syndrome. It is then called the Wernicke-Korsakoff syndrome. | https://www.wikidoc.org/index.php/Wernicke | |
98c23a3c8fbc5c42053e7bf4c64ef9df2eb25f70 | wikidoc | Wet wipe | Wet wipe
A wet wipe, also known as a wet nap or a moist towelette, is a small moistened piece of paper or cloth that often comes folded and individually wrapped in its own wrapper for convenience, much like a packet of sugar or a condom. Such towelettes are for cleansing or disinfecting.
Cleansing towelettes are generally moistened with scented water, while disinfecting towelettes are moistened with alcohol. They are often dispensed in restaurants, at service stations, along with airline meals, in doctors' offices, and other similar places. They are often included as part of a standard sealed cutlery package.
Wet wipes can also be bought in stores for private usage. In South East Asia, wet wipes are often sold out of refrigerators to gain the refreshing effect. | Wet wipe
A wet wipe, also known as a wet nap or a moist towelette, is a small moistened piece of paper or cloth that often comes folded and individually wrapped in its own wrapper for convenience, much like a packet of sugar or a condom. Such towelettes are for cleansing or disinfecting.
Cleansing towelettes are generally moistened with scented water, while disinfecting towelettes are moistened with alcohol. They are often dispensed in restaurants, at service stations, along with airline meals, in doctors' offices, and other similar places. They are often included as part of a standard sealed cutlery package.
Wet wipes can also be bought in stores for private usage. In South East Asia, wet wipes are often sold out of refrigerators to gain the refreshing effect. | https://www.wikidoc.org/index.php/Wet_wipe | |
af2eb0ba618186598b5abf8c6ca2168c0a292ef4 | wikidoc | Wildlife | Wildlife
Wildlife refers to all non-domesticated plants, animals, and other organisms. Domesticated organisms are those that have adapted to survival with the help of (or under the control of) humans, after many generations. Domesticating wild plant and animal species for human benefit has occurred many times all over the planet, and has had a major impact on the environment, both positive and negative.
Wildlife can be found in all ecosystems. Deserts, rainforests, plains, and other areas—including the most developed urban sites—all have distinct forms of wildlife. While the term in popular culture usually refers to animals that are untouched by human factors, most scientists agree that wildlife around the world is impacted by human activities.
Humans have historically tended to separate civilization from wildlife in a number of ways including the legal, social, and moral sense. This has been a reason for debate throughout recorded history. Religions have often declared certain animals to be sacred, and in modern times concern for the environment has provoked activists to protest the exploitation of wildlife for human benefit or entertainment.
Literature has also made use of the traditional human separation from wildlife.
# Food
Anthropologists believe that the Stone Age peoples and hunter-gatherers relied on wildlife, both plant and animal, for their food. In fact, some species may have been hunted to extinction by early human hunters. Today, hunting, fishing, or gathering wildlife is still a significant food source in some parts of the world. In other areas, hunting and non-commercial fishing are mainly seen as a sport or recreation, with the edible meat as mostly a side benefit. Meat sourced from wildlife that is not traditionally regarded as game is known as bushmeat. The increasing demand for wildlife as a source of traditional food in East Asia is decimating populations of sharks, primates, pangolins and other animals, which they believe have aphrodisiac properties.
# Religion
Many wildlife species have spiritual significance in different cultures around the world, and they and their products may be used as sacred objects in religious rituals. For example, eagles, hawks and their feathers have great cultural and spiritual value to Native Americans as religious objects.inu
# Television
Wildlife has long been a common subject for educational television shows. National Geographic specials appeared on CBS beginning in 1965, later moving to ABC and then PBS. In 1963, NBC debuted Wild Kingdom, a popular program featuring zoologist Marlin Perkins as host. The BBC natural history unit in the UK was a similar pioneer, the first wildlife series LOOK presented by Sir Peter Scott, was a studio-based show, with filmed inserts. It was in this series that David Attenborough first made his appearance which led to the series Zoo Quest during which he and cameraman Charles Lagus went to many exotic places looking for elusive wildlife -- notably the Komodo dragon in Indonesia and lemurs in Madagascar. Since 1984, the Discovery Channel and its spinoff Animal Planet in the USA have dominated the market for shows about wildlife on cable television, while on PBS the NATURE strand made by WNET-13 in New York and NOVA by WGBH in Boston are notable. See also Nature documentary. Wildlife television is now a multi-million dollar industry with specialist documentary film-makers in many countries including UK, USA, New Zealand NHNZ, Australia, Austria, Germany, Japan, and Canada.
# Tourism
Fuelled by media coverage and inclusion of conservation education in early school curriculum, Wildlife tourism & Ecotourism has fast become a popular industry generating substantial income for poor nations with rich wildlife specially in Africa and India. This ever growing and ever becoming more popular form of tourism is providing the much needed incentive for poor nations to conserve their rich wildlife heritage and it's habitat.
# Destruction
This subsection focuses on anthropogenic forms of wildlife destruction.
Exploitation of wild populations has been a characteristic of modern man since our exodus from Africa 130,000 – 70,000 years ago. The rate of extinctions of entire species of plants and animals across the planet has been so high in the last few hundred years it is widely considered that we are in the sixth great extinction event on this planet; the Holocene Mass Extinction.
Destruction of wildlife does not always lead to an extinction of the species in question, however, the dramatic loss of entire species across Earth dominates any review of wildlife destruction as extinction is the level of damage to a wild population from which there is no return.
The four most general reasons that lead to destruction of wildlife include overkill, habitat destruction and fragmentation, impact of introduced species and chains of extinction.
## Overkill
Overkill occurs whenever hunting occurs at rate greater than the reproductive capacity of the population being exploited. The effects of this are often noticed much more dramatically in slow growing populations such as many larger species of fish. Initially when a portion of a wild population is hunted, an increased availability of resources (food, etc) is experienced increasing growth and reproduction as Density dependent inhibition is lowered. Hunting, fishing and so on, has lowered the competition between members of a population. However, if this hunting continues at rate greater than the rate at which new members of the population can reach breeding age and produce more young, the population will begin to decrease in numbers.
Populations in confined to islands – whether literal islands or just areas of habitat that are effectively an “island” for the species concerned – have also been observed to be at greater risk of dramatic population declines following unsustainable hunting.Overkill is really very very dangerous to our animals.
## Habitat destruction and fragmentation
The habitat of any given species is considered its preferred area or territory. Many processes associated human habitation of an area cause loss of this area and the decrease the carrying capacity of the land for that species. In many cases these changes in land use cause a patchy break-up of the wild landscape. Agricultural land frequently displays this type of extremely fragmented, or relictual, habitat. Farms sprawl across the landscape with patches of uncleared woodland or forest dotted in-between occasional paddocks.
Examples of habitat destruction include grazing of bushland by farmed animals, changes to natural fire regimes, forest clearing for timber production and wetland draining for city expansion.
## Impact of introduced species
Rats, cats, rabbits, dandelions and poison ivy are all examples of species that have become invasive threats to wild species in various parts of the world. Frequently species that are uncommon in their home range become out of control invasions in distant but similar climates. The reasons for this have not always been clear and Charles Darwin felt it was unlikely that exotic species would ever be able to grow abundantly in a place they had not evolved in. The reality is that the vast majority of species exposed to a new habitat do not reproduce successfully. However occasionally some populations do take hold and after a period of acclimation can increase in numbers significantly having destructive effects on many elements of the native environment they have become part of.
## Chains of extinction
This final group is one of secondary effects. All wild populations of living things have many complex intertwining links with other living things around them. Large herbivorous animals such as the hippopotamus have populations of insectivorous birds that feed off the many parasitic insects that grow on the hippo. Should the hippo die out so to will these groups of birds, leading to further destruction as other species dependant on the birds are affected. Also referred to as a Domino effect, this series of chain reactions is by far the most destructive process that can occur in any ecological community. | Wildlife
Wildlife refers to all non-domesticated plants, animals, and other organisms. Domesticated organisms are those that have adapted to survival with the help of (or under the control of) humans, after many generations. Domesticating wild plant and animal species for human benefit has occurred many times all over the planet, and has had a major impact on the environment, both positive and negative.
Wildlife can be found in all ecosystems. Deserts, rainforests, plains, and other areas—including the most developed urban sites—all have distinct forms of wildlife. While the term in popular culture usually refers to animals that are untouched by human factors, most scientists agree that wildlife around the world is impacted by human activities.
Humans have historically tended to separate civilization from wildlife in a number of ways including the legal, social, and moral sense. This has been a reason for debate throughout recorded history. Religions have often declared certain animals to be sacred, and in modern times concern for the environment has provoked activists to protest the exploitation of wildlife for human benefit or entertainment.
Literature has also made use of the traditional human separation from wildlife.
# Food
Anthropologists believe that the Stone Age peoples and hunter-gatherers relied on wildlife, both plant and animal, for their food. In fact, some species may have been hunted to extinction by early human hunters. Today, hunting, fishing, or gathering wildlife is still a significant food source in some parts of the world. In other areas, hunting and non-commercial fishing are mainly seen as a sport or recreation, with the edible meat as mostly a side benefit.[citation needed] Meat sourced from wildlife that is not traditionally regarded as game is known as bushmeat. The increasing demand for wildlife as a source of traditional food in East Asia is decimating populations of sharks, primates, pangolins and other animals, which they believe have aphrodisiac properties.
# Religion
Many wildlife species have spiritual significance in different cultures around the world, and they and their products may be used as sacred objects in religious rituals. For example, eagles, hawks and their feathers have great cultural and spiritual value to Native Americans as religious objects.inu
# Television
Wildlife has long been a common subject for educational television shows. National Geographic specials appeared on CBS beginning in 1965, later moving to ABC and then PBS. In 1963, NBC debuted Wild Kingdom, a popular program featuring zoologist Marlin Perkins as host. The BBC natural history unit in the UK was a similar pioneer, the first wildlife series LOOK presented by Sir Peter Scott, was a studio-based show, with filmed inserts. It was in this series that David Attenborough first made his appearance which led to the series Zoo Quest during which he and cameraman Charles Lagus went to many exotic places looking for elusive wildlife -- notably the Komodo dragon in Indonesia and lemurs in Madagascar. Since 1984, the Discovery Channel and its spinoff Animal Planet in the USA have dominated the market for shows about wildlife on cable television, while on PBS the NATURE strand made by WNET-13 in New York and NOVA by WGBH in Boston are notable. See also Nature documentary. Wildlife television is now a multi-million dollar industry with specialist documentary film-makers in many countries including UK, USA, New Zealand NHNZ, Australia, Austria, Germany, Japan, and Canada.
# Tourism
Fuelled by media coverage and inclusion of conservation education in early school curriculum, Wildlife tourism & Ecotourism has fast become a popular industry generating substantial income for poor nations with rich wildlife specially in Africa and India. This ever growing and ever becoming more popular form of tourism is providing the much needed incentive for poor nations to conserve their rich wildlife heritage and it's habitat.
# Destruction
This subsection focuses on anthropogenic forms of wildlife destruction.
Exploitation of wild populations has been a characteristic of modern man since our exodus from Africa 130,000 – 70,000 years ago. The rate of extinctions of entire species of plants and animals across the planet has been so high in the last few hundred years it is widely considered that we are in the sixth great extinction event on this planet; the Holocene Mass Extinction.
Destruction of wildlife does not always lead to an extinction of the species in question, however, the dramatic loss of entire species across Earth dominates any review of wildlife destruction as extinction is the level of damage to a wild population from which there is no return.
The four most general reasons that lead to destruction of wildlife include overkill, habitat destruction and fragmentation, impact of introduced species and chains of extinction.[1]
## Overkill
Overkill occurs whenever hunting occurs at rate greater than the reproductive capacity of the population being exploited. The effects of this are often noticed much more dramatically in slow growing populations such as many larger species of fish. Initially when a portion of a wild population is hunted, an increased availability of resources (food, etc) is experienced increasing growth and reproduction as Density dependent inhibition is lowered. Hunting, fishing and so on, has lowered the competition between members of a population. However, if this hunting continues at rate greater than the rate at which new members of the population can reach breeding age and produce more young, the population will begin to decrease in numbers.
Populations in confined to islands – whether literal islands or just areas of habitat that are effectively an “island” for the species concerned – have also been observed to be at greater risk of dramatic population declines following unsustainable hunting.Overkill is really very very dangerous to our animals.
## Habitat destruction and fragmentation
The habitat of any given species is considered its preferred area or territory. Many processes associated human habitation of an area cause loss of this area and the decrease the carrying capacity of the land for that species. In many cases these changes in land use cause a patchy break-up of the wild landscape. Agricultural land frequently displays this type of extremely fragmented, or relictual, habitat. Farms sprawl across the landscape with patches of uncleared woodland or forest dotted in-between occasional paddocks.
Examples of habitat destruction include grazing of bushland by farmed animals, changes to natural fire regimes, forest clearing for timber production and wetland draining for city expansion.
## Impact of introduced species
Rats, cats, rabbits, dandelions and poison ivy are all examples of species that have become invasive threats to wild species in various parts of the world. Frequently species that are uncommon in their home range become out of control invasions in distant but similar climates. The reasons for this have not always been clear and Charles Darwin felt it was unlikely that exotic species would ever be able to grow abundantly in a place they had not evolved in. The reality is that the vast majority of species exposed to a new habitat do not reproduce successfully. However occasionally some populations do take hold and after a period of acclimation can increase in numbers significantly having destructive effects on many elements of the native environment they have become part of.
## Chains of extinction
This final group is one of secondary effects. All wild populations of living things have many complex intertwining links with other living things around them. Large herbivorous animals such as the hippopotamus have populations of insectivorous birds that feed off the many parasitic insects that grow on the hippo. Should the hippo die out so to will these groups of birds, leading to further destruction as other species dependant on the birds are affected. Also referred to as a Domino effect, this series of chain reactions is by far the most destructive process that can occur in any ecological community. | https://www.wikidoc.org/index.php/Wildlife | |
ab386d69b21aba3a51d53b9ab4defc96604848e3 | wikidoc | Windburn | Windburn
Windburn is a skin burn condition where wind removes the top layer of oil from the skin. The lack of oil causes excessive dryness of the skin, leading to redness and a burning and maybe itchy feeling. Redness and burning are also common symptoms of a sunburn, so the two conditions are often mistaken for each other.
Pure windburn is usually not protected against by sunscreen effectively, since wind exposure will chap the skin even without the sun exposure. However, the moisturization agent in sunscreens does help windburns, and windburn does not seem to have the long term damage effect of the sun.
# Common cause
On cold days, people will often confuse their sunburn as a windburn. Windburn is actually a distinct condition whereby the top layer of oil is removed from the skin, causing excessive dryness that leads to redness and a burning feeling.
People commonly believe that any burn that happens on a cold day is windburn, but this is not the case. Sunburns are caused as a result of ultraviolet light, not by the temperature, hence it doesn't matter whether high temperatures are present or not. The condition is commonly associated with skiing, where one can experience both windburn and sunburn very easily. This is due to the fact that strong winds are frequent at higher altitudes, and snow is an excellent reflector for ultraviolet rays. Also, at higher altitudes you have a smaller cushion sphere above you; thus, the level of exposure on a mountain is much higher than it would be at sea level on a beach.
# Prevention
The prevention of windburn and sunburn should go hand in hand. Covering the skin, using sunscreen, and moisturizing are important prevention methods for both windburn and sunburn.
(1) Sunscreen: For prevention of sunburns, one should not to forget the sunscreen in the winter. The moisturizer in the sunscreen can help prevent windburn. Moreover, most people do not think they are receiving ultraviolet light when it is cold or snowing outside but, in fact, sunscreen acts as environmental protection against UV-UVB light as well as providing moisturizing agents. Suncreen needs to be replaced every couple of hours. Moisturizing with sunscreen while going up a ski lift will be good to protect your skin. Use highest SPF, 30 to 50, and preferably a zinc-based or avobenzone based sunscreen.
(2) Lips: Also, the lips should be moisturized with a sun block lip protector.
(3) Covering: A skier faces low humidity, direct wind, and cold temperatures. Ideally, one should wear fleece-based protection for the entire face to both comfort the skin and protect it from wind.
(4) Goggles: Goggles are also extremely important.
# Treatment
Aloe-based moisturizer alleviates the symptoms of windburn. Cocoa butter works well too. Avoid scratching or rubbing the affected area too much.
# Links
- treating windburn | Windburn
Windburn is a skin burn condition where wind removes the top layer of oil from the skin. The lack of oil causes excessive dryness of the skin, leading to redness and a burning and maybe itchy feeling. Redness and burning are also common symptoms of a sunburn, so the two conditions are often mistaken for each other.
Pure windburn is usually not protected against by sunscreen effectively, since wind exposure will chap the skin even without the sun exposure. However, the moisturization agent in sunscreens does help windburns, and windburn does not seem to have the long term damage effect of the sun.
# Common cause
On cold days, people will often confuse their sunburn as a windburn. Windburn is actually a distinct condition whereby the top layer of oil is removed from the skin, causing excessive dryness that leads to redness and a burning feeling.
People commonly believe that any burn that happens on a cold day is windburn, but this is not the case. Sunburns are caused as a result of ultraviolet light, not by the temperature, hence it doesn't matter whether high temperatures are present or not. The condition is commonly associated with skiing, where one can experience both windburn and sunburn very easily. This is due to the fact that strong winds are frequent at higher altitudes, and snow is an excellent reflector for ultraviolet rays. Also, at higher altitudes you have a smaller cushion sphere above you; thus, the level of exposure on a mountain is much higher than it would be at sea level on a beach.
# Prevention
The prevention of windburn and sunburn should go hand in hand. Covering the skin, using sunscreen, and moisturizing are important prevention methods for both windburn and sunburn.
(1) Sunscreen: For prevention of sunburns, one should not to forget the sunscreen in the winter. The moisturizer in the sunscreen can help prevent windburn. Moreover, most people do not think they are receiving ultraviolet light when it is cold or snowing outside but, in fact, sunscreen acts as environmental protection against UV-UVB light as well as providing moisturizing agents. Suncreen needs to be replaced every couple of hours. Moisturizing with sunscreen while going up a ski lift will be good to protect your skin. Use highest SPF, 30 to 50, and preferably a zinc-based or avobenzone based sunscreen.
(2) Lips: Also, the lips should be moisturized with a sun block lip protector.
(3) Covering: A skier faces low humidity, direct wind, and cold temperatures. Ideally, one should wear fleece-based protection for the entire face to both comfort the skin and protect it from wind.
(4) Goggles: Goggles are also extremely important.
# Treatment
Aloe-based moisturizer alleviates the symptoms of windburn. Cocoa butter works well too. Avoid scratching or rubbing the affected area too much.
# Links
- treating windburn
Template:WS
Template:Jb1 | https://www.wikidoc.org/index.php/Windburn | |
f94add03507d870acfd61a8cbfe830fc79ea9ed7 | wikidoc | Woodruff | Woodruff
Woodruff (Galium odoratum) is a herbaceous perennial plant in the family Rubiaceae, native to Europe, North Africa and western Asia. It grows to 30-50 cm (12-20 ins.) long, often lying flat on the ground or supported by other plants. The plant is also known in English as Sweet Woodruff or Wild Baby's Breath. "Master of the woods" is probably a translation of the German name Waldmeister. Names like "Sweetscented bedstraw", "Cudweed" and "Ladies' Bedstraw" should be avoided; the former two properly refer to Galium triflorum, the latter to Galium verum.
The leaves are simple, lanceolate, glabrous, 2-5 cm long, and borne in whorls of 6-9. The small (4-7 mm diameter) flowers are produced in cymes, each white with four petals joined together at the base. The seeds are 2-4 mm diameter, produced singly, and each seed is covered in tiny hooked bristles which help disperse the seed by sticking temporarily to clothing and animal fur.
This plant prefers partial to full shade in moist, rich soils. In dry summers it needs frequent irrigation. Propagation is by crown division, separation of the rooted stems, or digging up of the barely submerged perimeter stolons.
# Uses
Woodruff, as the scientific name odoratum suggests, is a strongly scented plant, the sweet scent being derived from coumarin.This scent increases on wilting and then persists on drying, and woodruff is used in pot-pourri and as a moth deterrent. It is also used, mainly in Germany, to flavour May wine (called "Maiwein" or "Maibowle" in German), beer (Berliner Weisse), brandy, sausages, jelly, jam, a soft drink (Tarhun), ice cream, and a herbal tea with gentle sedative properties.
High doses can cause headaches, due to the toxity of coumarin. Very high doses of coumarin can cause vertigo, somnolence or even central paralysis and apnoea while in a coma. Since 1981, woodruff may no longer be used as an ingredient of industrially produced drinks and foodstuffs in Germany; it has been replaced by artificial aromas and colorings. | Woodruff
Template:Otheruses1
Woodruff (Galium odoratum) is a herbaceous perennial plant in the family Rubiaceae, native to Europe, North Africa and western Asia. It grows to 30-50 cm (12-20 ins.) long, often lying flat on the ground or supported by other plants. The plant is also known in English as Sweet Woodruff or Wild Baby's Breath. "Master of the woods" is probably a translation of the German name Waldmeister. Names like "Sweetscented bedstraw", "Cudweed" and "Ladies' Bedstraw" should be avoided; the former two properly refer to Galium triflorum, the latter to Galium verum.
The leaves are simple, lanceolate, glabrous, 2-5 cm long, and borne in whorls of 6-9. The small (4-7 mm diameter) flowers are produced in cymes, each white with four petals joined together at the base. The seeds are 2-4 mm diameter, produced singly, and each seed is covered in tiny hooked bristles which help disperse the seed by sticking temporarily to clothing and animal fur.
This plant prefers partial to full shade in moist, rich soils. In dry summers it needs frequent irrigation. Propagation is by crown division, separation of the rooted stems, or digging up of the barely submerged perimeter stolons.
# Uses
Woodruff, as the scientific name odoratum suggests, is a strongly scented plant, the sweet scent being derived from coumarin.This scent increases on wilting and then persists on drying, and woodruff is used in pot-pourri and as a moth deterrent. It is also used, mainly in Germany, to flavour May wine (called "Maiwein" or "Maibowle" in German), beer (Berliner Weisse), brandy, sausages, jelly, jam, a soft drink (Tarhun), ice cream, and a herbal tea with gentle sedative properties.
High doses can cause headaches, due to the toxity of coumarin. Very high doses of coumarin can cause vertigo, somnolence or even central paralysis and apnoea while in a coma. Since 1981, woodruff may no longer be used as an ingredient of industrially produced drinks and foodstuffs in Germany; it has been replaced by artificial aromas and colorings. | https://www.wikidoc.org/index.php/Woodruff | |
ab92ad87a44f635213266a39f98ca1e6740937d8 | wikidoc | Xanthone | Xanthone
Xanthone is an organic compound with the molecular formula C13H8O2. It can be prepared by the heating of phenyl salicylate. In 1939, xanthone was introduced as an insecticide. Xanthone currently finds uses as ovicide for codling moth eggs and as a larvicide. It is also used in the preparation of xanthydrol, used in the determination of urea levels in the blood.
Xanthones are natural constituents of plants in the families Bonnetiaceae and Clusiaceae. Xanthones are also reported from some species in the family Podostemaceae.
# Similar compounds
The chemical structure of xanthone forms the central core of a variety of naturally occurring organic compounds, such as mangostin, which are sometimes collectively referred to as xanthones. Over 200 xanthones have been identified. Many of these xanthones are found in the pericarp of the mangosteen fruit (Garcinia mangostana), which can be found in the region of Southeast Asia. | Xanthone
Xanthone is an organic compound with the molecular formula C13H8O2. It can be prepared by the heating of phenyl salicylate.[2] In 1939, xanthone was introduced as an insecticide. Xanthone currently finds uses as ovicide for codling moth eggs and as a larvicide.[3] It is also used in the preparation of xanthydrol, used in the determination of urea levels in the blood.
Xanthones are natural constituents of plants in the families Bonnetiaceae and Clusiaceae. Xanthones are also reported from some species in the family Podostemaceae. [4]
# Similar compounds
The chemical structure of xanthone forms the central core of a variety of naturally occurring organic compounds, such as mangostin, which are sometimes collectively referred to as xanthones.[5] Over 200 xanthones have been identified. Many of these xanthones are found in the pericarp of the mangosteen fruit (Garcinia mangostana), which can be found in the region of Southeast Asia. | https://www.wikidoc.org/index.php/Xanthone | |
298684b097b16c24ffc7865b290378c28fbafa05 | wikidoc | Zoonosis | Zoonosis
# Overview
A zoonosis (pronounced Template:IPA) is any infectious disease that is able to be transmitted (vectored) from other animals, both wild and domestic, to humans or from humans to animals (the latter is sometimes called reverse zoonosis).Many serious diseases fall under this category.
The word is derived from the Greek words zoon (animal) (IPA: zo'on) and nosos (disease). The plural of zoonosis is zoonoses, from which an alternative singular zoonose'.
The simplest definition of a zoonosis is a disease that can be transmitted from other animals to humans. A slightly more technical definition is a disease that normally exists in other animals, but also infects humans.
The emerging interdisciplinary field of conservation medicine, which integrates human and veterinary medicine, and environmental sciences, is largely concerned with zoonoses.
# Partial list of carriers
A partial list of agents that can carry infectious organisms that may be zoonotic includes: bats, birds, cats, cattle, chimpanzees, dogs, fish, fleas, geese, goats, horses, humans, monkeys, mosquitos, opposums, pigs, rabbits, raccoons, rats, rodents, snails, sloths, sheep
# List of infective agents
Zoonoses can be listed according to the infective agent:
- Parasites which includes protozoa, helminths, cestodes and trematodes
- Bacteria
- Viruses
- Fungi
- Prions
# Partial list of important zoonoses
Some of the more important zoonoses are:
- Anthrax
- Avian Influenza (Bird Flu)
- Bolivian hemorrhagic fever
- Brucellosis
- Borrelia
- Borna virus infection
- Bubonic plague
- Campylobacteriosis
- Chagas disease
- Creutzfeldt-Jakob disease (vCJD) a Transmissible spongiform encephalopathy (TSE) from Bovine spongiform encephalopathy (BSE) or "Mad cow disease"
- Crimean-Congo hemorrhagic fever
- Cutaneous larval migrans
- Dengue Fever
- Ebola fever
- Echinococcosis
- Hantavirus
- Korean hemorrhagic fever
- Lábrea fever
- Lassa fever
- Leishmaniasis
- Leptospirosis
- Listeriosis
- Marburg virus infection
- Monkey B virus
- Nipah virus
- Ocular larval migrans
- Ornithosis (psitacosis)
- Oropouche fever
- Q-Fever
- Psittacosis also called "parrot fever"
- Plague
- Rabies
- Rift Valley fever
- Ringworms (Tinea canis, mainly)
- Salmonellosis
- Sodoku
- Toxoplasmosis
- Trichinosis
- Typhus and other Rickettsial diseases
- Venezuelan hemorrhagic fever
- Visceral larval migrans
- Yellow fever
Other zoonoses might be
- Glanders
- SARS (possibly; civet cats may spread the disease, or may catch the disease from humans.)
This list is by no means complete. The influenza virus is an interesting example: it continually recombines genes between strains found in humans, swine and avians, producing new strains with changed characteristics, and occasionally, as in 1918, killing millions worldwide.
# Historical development of zoonotic diseases
Most of human prehistory was spent as small bands of hunter-gatherers; these bands were rarely larger than 150 individuals, and were not in contact with other bands very often. Because of this, epidemic or pandemic diseases, which depend on a constant influx of humans who have not developed an immune response, tended to burn out after their first run through a population. To survive, a biological pathogen had to be a chronic infection, stay alive in the host for long periods of time, or have a non-human reservoir in which to live while waiting for new hosts to pass by. In fact, for many 'human' diseases, the human is actually an accidental victim and a dead-end host. (This is the case with rabies, anthrax, tularemia, West Nile virus, and many others). Thus much of human development has been in relation to zoonotic, not epidemic, diseases.
Many modern diseases, even epidemic diseases, started out as zoonotic diseases. It is hard to be certain which diseases jumped from other animals to humans, but there is good evidence that measles, smallpox, influenza, and diphtheria came to us this way. HIV, the common cold, and tuberculosis may also have started in other species.
In modern days, zoonoses are of practical interest because they are often previously unrecognized diseases or have increased virulence in populations lacking immunity. The West Nile virus appeared in the United States in 1999 in the New York City area, and moved through the country in the summer of 2002, causing much distress. Bubonic plague is a zoonotic disease, as are salmonella, Rocky Mountain spotted fever, and Lyme disease.
The major factor contributing to the appearance of new zoonotic pathogens in human populations is increased contact between humans and wildlife (Daszak et al., 2001). This can be caused either by encroachment of human activity into wilderness areas or by movement of wild animals into areas of human activity due to anthropological or environmental disturbances. An example of this is the outbreak of Nipah virus in peninsular Malaysia in 1999, when intensive pig farming intruded into the natural habitat of fruit bats carrying the virus. Unidentified spillover events caused infection of the pig population which acted as an amplifier host, eventually transmitting the virus to farmers and resulting in 105 human deaths (Field et al., 2001).
Similarly, in recent times avian influenza and West Nile virus have spilled over into human populations probably due to interactions between the carrier host and domestic animals. Highly mobile animals such as bats and birds may present a greater risk of zoonotic transmission than other animals due to the ease with which they can move into areas of human habitation.
Diseases like malaria, schistosomiasis, river blindness, and elephantiasis are not zoonotic, even though they may be transmitted by insects or use intermediate hosts vectors, because they depend on the human host for part of their life-cycle.
# Partial List of Outbreaks of Zoonosis Associated with Fairs and Petting Zoos
Outbreaks of zoonosis have been traced to human interaction with and exposure to animals at fairs, petting zoos, and in other settings. In 2005, the Centers for Disease Control and Prevention (CDC) issued an updated list of recommendations for preventing zoonosis transmission in public settings. The CDC recommendations, which were developed in conjunction with the National Association of State Public Health Veterinarians, include sections on the educational responsibilities of venue operators, managing public and animal contact, and animal care and management.
In 1988, a person became ill with Swine Influenza Virus (Swine Flu) and died after visiting the display area of the pig barn at a Wisconsin county fair. Three healthcare personnel treating the case patient also developed flu-like illness with laboratory evidence of Swine Influenza Virus infection. Investigators from the CDC indicated in their final report that the Swine Flu had been transmitted directly from pig to human host.
In 1994, seven cases of ‘’E. coli’’ O157:H7 infection were traced to a farm in Leicestershire, United Kingdom. An epidemiological investigation into the outbreak revealed that the strain of ‘’E. coli’’ O157:H7 isolated from nine animals on the farm was indistinguishable from the strain isolated from human samples. Investigators concluded that the most likely cause of this outbreak was direct human contact with animals.
In 1995, 43 children who had visited a rural farm in Wales became ill with Cryptosporidiosis. ‘’Cryptosporidium’’ was isolated from seven of the ill children. An epidemiological investigation indicated that the source of the children’s illness was contact with calves at the farm.
Also in 1995, at least thirteen children became ill with ‘’Cryptosporidiosis’’ after visiting a farm in Dublin, Ireland. In a case-control study, researchers compared the activities of the thirteen ill children, or cases, to the activities of 52 out of 55 people who had visited the farm – the controls. The study revealed that illness was significantly associated with playing in the sand in a picnic area beside a stream where animals had access.
In 1997, an ‘’E. coli’’ O157:H7 outbreak was identified among one child who lived on an open farm and two children who visited the farm during school parties. Two of the three children developed hemolytic uremic syndrome (HUS). Isolates collected from the three children and from samples taken at the farm were indistinguishable, demonstrating evidence of the link between the farm and the children’s illness.
In 1999, what is believed to be the largest outbreak of waterborne ‘’E. coli’’ O157:H7 illness in United States history occurred at the Washington County, New York, fair. The New York State Department of Health identified 781 individuals who were suspected of being infected with either ‘’E. coli’’ O157:H7 or ‘’Campylobacter jejuni’’. An investigation into the outbreak revealed that consumption of beverages purchased from vendors supplied with water drawn from an unchlorinated fairgrounds well was associated with illness. In all, 127 outbreak victims were confirmed ill with ‘’E. coli’’ O157:H7 infections; 71 were hospitalized, 14 developed HUS, and two died.
In 2000, 51 people became ill with confirmed or suspected ‘’E. coli’’ O157:H7 infections after visiting a dairy farm in Pennsylvania. Eight children developed HUS. A case-control study among visitors to the dairy was conducted jointly by the CDC, Pennsylvania Department of Health, and the Montgomery County Health Department. The study’s authors concluded that ‘’E. coli’’ was transmitted to visitors as a result of contamination on animal hides and in the environment.
Also in 2000, 43 visitors to the Medina County fair in Ohio were confirmed ill with ‘’E. coli’’ O157:H7 infections. An investigation into the outbreak suggested that the water system from which food vendors were supplied was the source of the ‘’E. coli’’ outbreak. Several months later, five children became ill with ‘’E. coli’’ infections after attending a “Carnival of Horrors” event held at the Medina County fairgrounds. PFGE analysis of the strains of ‘’E. coli’’ isolated from members of both outbreaks revealed an indistinguishable pattern, and investigators from the Medina County Health Department and the CDC determined that the Medina County Fairgrounds water distribution system was the source of both ‘’E. coli’’ outbreaks.
In 2001, an ‘’E. coli’’ O157:H7 outbreak was traced to exposure in the Cow Palace at the Lorain County Fair in Ohio. CDC investigators identified 23 cases of ‘’E. coli’’ infection associated with attendance at the Lorain County Fair, with additional secondary cases likely. Two people developed HUS. An environmental and site investigation revealed ‘’E. coli’’ contamination on doorways, rails, bleachers, and sawdust. Investigators concluded that the Lorain County Fair was the source of the outbreak.
Wyandot County, Ohio, also reported an ‘’E. coli’’ O157:H7 outbreak in 2001. Ninety-two ‘’E. coli’’ infections were reported to the Wyandot County Health Department and the CDC, with 27 cases confirmed using laboratory analysis. Two cases developed HUS. Contact with infected cattle was believed to be the source of the outbreak; however, a specific cause was never identified.
In 2002, seven people became ill with ‘’E. coli’’ O157:H7 infections after visiting a large agricultural fair in Ontario, Canada. Outbreak investigators conducted a case-control study, which indicated that goats and sheep from a petting zoo were the source of the ‘’E. coli’’ among fair visitors. Other indications were that the fencing and environment surrounding the petting zoo could have been a source of transmission.
What is believed to be the largest ‘’E. coli’’ O157:H7 outbreak in Oregon State history occurred among attendees at the Lane County Fair in 2002. An Oregon Department of Human Services – Health Services investigation led to the belief that the ‘’E. coli’’ outbreak originated from exposure in the sheep and goat barn. In all, 79 people were confirmed ill with ‘’E. coli’’ infections as part of the outbreak; 22 were hospitalized, and 12 suffered HUS.
In 200, fair visitors and animal exhibitors at the Fort Bend County Fair in Texas became ill with ‘’E. coli’’ O157:H7 infections. An outbreak investigation led to the determination that 25 people had become ill with ‘’E. coli’’ infections after attending the Fort Bend County Fair; seven people were laboratory-confirmed with ‘’E. coli’’, and 5 developed HUS or TTP (Thrombotic Thrombocytopenic Purpura). Investigators isolated a strain of ‘’E. coli’’ indistinguishable from the outbreak strain from four animal husbandry sites, and found high levels of ‘’E. coli’’ contamination in both rodeo and animal exhibit areas.
In 2004, a large ‘’E. coli’’ O157:H7 outbreak occurred among visitors at the 2004 North Carolina State Fair. During its investigation into the outbreak, the North Carolina Department of Health and Human Services (NCDHHS) received over 180 reports of illness, and documented 33 culture-confirmed cases of ‘’E. coli’’ O157:H7 associated with attendance at the fair, with 15 children developing HUS. In its final investigation report, NCDHHS concluded that the North Carolina State Fair ‘’E. coli’’ outbreak had originated at a petting zoo exhibit. The conclusion was supported by a case-control study, environmental sampling, and laboratory analysis of samples collected from the fair and members of the outbreak.
In 2005, a petting zoo that exhibited at two Florida fairs and a festival was traced as the source of an ‘’E. coli’’ O157:H7 outbreak. Sixty-three people who had visited either the Florida State Fair, the Central Florida Fair, or the Florida Strawberry Festival reported illness to investigators for the Florida Department of Health, including 20 who were culture-confirmed and 7 with HUS. A case-control study revealed that illness was associated with exposure to a petting zoo exhibit present at all three events. | Zoonosis
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
A zoonosis (pronounced Template:IPA) is any infectious disease that is able to be transmitted (vectored) from other animals, both wild and domestic, to humans or from humans to animals (the latter is sometimes called reverse zoonosis).Many serious diseases fall under this category.
The word is derived from the Greek words zoon (animal) (IPA: zo'on) and nosos (disease). The plural of zoonosis is zoonoses, from which an alternative singular zoonose'.
The simplest definition of a zoonosis is a disease that can be transmitted from other animals to humans. A slightly more technical definition is a disease that normally exists in other animals, but also infects humans.
The emerging interdisciplinary field of conservation medicine, which integrates human and veterinary medicine, and environmental sciences, is largely concerned with zoonoses.
# Partial list of carriers
A partial list of agents that can carry infectious organisms that may be zoonotic includes: bats, birds, cats, cattle, chimpanzees, dogs, fish, fleas, geese, goats, horses, humans, monkeys, mosquitos, opposums, pigs, rabbits, raccoons, rats, rodents, snails, sloths, sheep
# List of infective agents
Zoonoses can be listed according to the infective agent:
- Parasites which includes protozoa, helminths, cestodes and trematodes
- Bacteria
- Viruses
- Fungi
- Prions
# Partial list of important zoonoses
Some of the more important zoonoses are:
- Anthrax
- Avian Influenza (Bird Flu)
- Bolivian hemorrhagic fever
- Brucellosis
- Borrelia
- Borna virus infection
- Bubonic plague
- Campylobacteriosis
- Chagas disease
- Creutzfeldt-Jakob disease (vCJD) a Transmissible spongiform encephalopathy (TSE) from Bovine spongiform encephalopathy (BSE) or "Mad cow disease"
- Crimean-Congo hemorrhagic fever
- Cutaneous larval migrans
- Dengue Fever
- Ebola fever
- Echinococcosis
- Hantavirus
- Korean hemorrhagic fever
- Lábrea fever
- Lassa fever
- Leishmaniasis
- Leptospirosis
- Listeriosis
- Marburg virus infection
- Monkey B virus
- Nipah virus
- Ocular larval migrans
- Ornithosis (psitacosis)
- Oropouche fever
- Q-Fever
- Psittacosis also called "parrot fever"
- Plague
- Rabies
- Rift Valley fever
- Ringworms (Tinea canis, mainly)
- Salmonellosis
- Sodoku
- Toxoplasmosis
- Trichinosis
- Typhus and other Rickettsial diseases
- Venezuelan hemorrhagic fever
- Visceral larval migrans
- Yellow fever
Other zoonoses might be
- Glanders
- SARS (possibly; civet cats may spread the disease, or may catch the disease from humans.)
This list is by no means complete. The influenza virus is an interesting example: it continually recombines genes between strains found in humans, swine and avians, producing new strains with changed characteristics, and occasionally, as in 1918, killing millions worldwide.
# Historical development of zoonotic diseases
Most of human prehistory was spent as small bands of hunter-gatherers; these bands were rarely larger than 150 individuals, and were not in contact with other bands very often. Because of this, epidemic or pandemic diseases, which depend on a constant influx of humans who have not developed an immune response, tended to burn out after their first run through a population. To survive, a biological pathogen had to be a chronic infection, stay alive in the host for long periods of time, or have a non-human reservoir in which to live while waiting for new hosts to pass by. In fact, for many 'human' diseases, the human is actually an accidental victim and a dead-end host. (This is the case with rabies, anthrax, tularemia, West Nile virus, and many others). Thus much of human development has been in relation to zoonotic, not epidemic, diseases.
Many modern diseases, even epidemic diseases, started out as zoonotic diseases. It is hard to be certain which diseases jumped from other animals to humans, but there is good evidence that measles, smallpox, influenza, and diphtheria came to us this way. HIV, the common cold, and tuberculosis may also have started in other species.
In modern days, zoonoses are of practical interest because they are often previously unrecognized diseases or have increased virulence in populations lacking immunity. The West Nile virus appeared in the United States in 1999 in the New York City area, and moved through the country in the summer of 2002, causing much distress. Bubonic plague is a zoonotic disease, as are salmonella, Rocky Mountain spotted fever, and Lyme disease.
The major factor contributing to the appearance of new zoonotic pathogens in human populations is increased contact between humans and wildlife (Daszak et al., 2001). This can be caused either by encroachment of human activity into wilderness areas or by movement of wild animals into areas of human activity due to anthropological or environmental disturbances. An example of this is the outbreak of Nipah virus in peninsular Malaysia in 1999, when intensive pig farming intruded into the natural habitat of fruit bats carrying the virus. Unidentified spillover events caused infection of the pig population which acted as an amplifier host, eventually transmitting the virus to farmers and resulting in 105 human deaths (Field et al., 2001).
Similarly, in recent times avian influenza and West Nile virus have spilled over into human populations probably due to interactions between the carrier host and domestic animals. Highly mobile animals such as bats and birds may present a greater risk of zoonotic transmission than other animals due to the ease with which they can move into areas of human habitation.
Diseases like malaria, schistosomiasis, river blindness, and elephantiasis are not zoonotic, even though they may be transmitted by insects or use intermediate hosts vectors, because they depend on the human host for part of their life-cycle.
# Partial List of Outbreaks of Zoonosis Associated with Fairs and Petting Zoos
Outbreaks of zoonosis have been traced to human interaction with and exposure to animals at fairs, petting zoos, and in other settings. In 2005, the Centers for Disease Control and Prevention (CDC) issued an updated list of recommendations for preventing zoonosis transmission in public settings.[1] The CDC recommendations, which were developed in conjunction with the National Association of State Public Health Veterinarians, include sections on the educational responsibilities of venue operators, managing public and animal contact, and animal care and management.
In 1988, a person became ill with Swine Influenza Virus (Swine Flu) and died after visiting the display area of the pig barn at a Wisconsin county fair. Three healthcare personnel treating the case patient also developed flu-like illness with laboratory evidence of Swine Influenza Virus infection.[2] Investigators from the CDC indicated in their final report that the Swine Flu had been transmitted directly from pig to human host.[3]
In 1994, seven cases of ‘’E. coli’’ O157:H7 infection were traced to a farm in Leicestershire, United Kingdom. An epidemiological investigation into the outbreak revealed that the strain of ‘’E. coli’’ O157:H7 isolated from nine animals on the farm was indistinguishable from the strain isolated from human samples. Investigators concluded that the most likely cause of this outbreak was direct human contact with animals.[4]
In 1995, 43 children who had visited a rural farm in Wales became ill with Cryptosporidiosis. ‘’Cryptosporidium’’ was isolated from seven of the ill children. An epidemiological investigation indicated that the source of the children’s illness was contact with calves at the farm.[5]
Also in 1995, at least thirteen children became ill with ‘’Cryptosporidiosis’’ after visiting a farm in Dublin, Ireland. In a case-control study, researchers compared the activities of the thirteen ill children, or cases, to the activities of 52 out of 55 people who had visited the farm – the controls. The study revealed that illness was significantly associated with playing in the sand in a picnic area beside a stream where animals had access.[6]
In 1997, an ‘’E. coli’’ O157:H7 outbreak was identified among one child who lived on an open farm and two children who visited the farm during school parties. Two of the three children developed hemolytic uremic syndrome (HUS). Isolates collected from the three children and from samples taken at the farm were indistinguishable, demonstrating evidence of the link between the farm and the children’s illness.[7]
In 1999, what is believed to be the largest outbreak of waterborne ‘’E. coli’’ O157:H7 illness in United States history occurred at the Washington County, New York, fair. The New York State Department of Health identified 781 individuals who were suspected of being infected with either ‘’E. coli’’ O157:H7 or ‘’Campylobacter jejuni’’. An investigation into the outbreak revealed that consumption of beverages purchased from vendors supplied with water drawn from an unchlorinated fairgrounds well was associated with illness. In all, 127 outbreak victims were confirmed ill with ‘’E. coli’’ O157:H7 infections; 71 were hospitalized, 14 developed HUS, and two died.[8]
In 2000, 51 people became ill with confirmed or suspected ‘’E. coli’’ O157:H7 infections after visiting a dairy farm in Pennsylvania. Eight children developed HUS. A case-control study among visitors to the dairy was conducted jointly by the CDC, Pennsylvania Department of Health, and the Montgomery County Health Department. The study’s authors concluded that ‘’E. coli’’ was transmitted to visitors as a result of contamination on animal hides and in the environment.[9]
Also in 2000, 43 visitors to the Medina County fair in Ohio were confirmed ill with ‘’E. coli’’ O157:H7 infections. An investigation into the outbreak suggested that the water system from which food vendors were supplied was the source of the ‘’E. coli’’ outbreak. Several months later, five children became ill with ‘’E. coli’’ infections after attending a “Carnival of Horrors” event held at the Medina County fairgrounds. PFGE analysis of the strains of ‘’E. coli’’ isolated from members of both outbreaks revealed an indistinguishable pattern, and investigators from the Medina County Health Department and the CDC determined that the Medina County Fairgrounds water distribution system was the source of both ‘’E. coli’’ outbreaks.[10]
In 2001, an ‘’E. coli’’ O157:H7 outbreak was traced to exposure in the Cow Palace at the Lorain County Fair in Ohio. CDC investigators identified 23 cases of ‘’E. coli’’ infection associated with attendance at the Lorain County Fair, with additional secondary cases likely. Two people developed HUS. An environmental and site investigation revealed ‘’E. coli’’ contamination on doorways, rails, bleachers, and sawdust. Investigators concluded that the Lorain County Fair was the source of the outbreak.[11]
Wyandot County, Ohio, also reported an ‘’E. coli’’ O157:H7 outbreak in 2001. Ninety-two ‘’E. coli’’ infections were reported to the Wyandot County Health Department and the CDC, with 27 cases confirmed using laboratory analysis. Two cases developed HUS. Contact with infected cattle was believed to be the source of the outbreak; however, a specific cause was never identified.[11]
In 2002, seven people became ill with ‘’E. coli’’ O157:H7 infections after visiting a large agricultural fair in Ontario, Canada. Outbreak investigators conducted a case-control study, which indicated that goats and sheep from a petting zoo were the source of the ‘’E. coli’’ among fair visitors. Other indications were that the fencing and environment surrounding the petting zoo could have been a source of transmission.[12]
What is believed to be the largest ‘’E. coli’’ O157:H7 outbreak in Oregon State history occurred among attendees at the Lane County Fair in 2002.[13] An Oregon Department of Human Services – Health Services investigation led to the belief that the ‘’E. coli’’ outbreak originated from exposure in the sheep and goat barn. In all, 79 people were confirmed ill with ‘’E. coli’’ infections as part of the outbreak; 22 were hospitalized, and 12 suffered HUS.[14]
In 200, fair visitors and animal exhibitors at the Fort Bend County Fair in Texas became ill with ‘’E. coli’’ O157:H7 infections. An outbreak investigation led to the determination that 25 people had become ill with ‘’E. coli’’ infections after attending the Fort Bend County Fair; seven people were laboratory-confirmed with ‘’E. coli’’, and 5 developed HUS or TTP (Thrombotic Thrombocytopenic Purpura). Investigators isolated a strain of ‘’E. coli’’ indistinguishable from the outbreak strain from four animal husbandry sites, and found high levels of ‘’E. coli’’ contamination in both rodeo and animal exhibit areas.[15]
In 2004, a large ‘’E. coli’’ O157:H7 outbreak occurred among visitors at the 2004 North Carolina State Fair. During its investigation into the outbreak, the North Carolina Department of Health and Human Services (NCDHHS) received over 180 reports of illness, and documented 33 culture-confirmed cases of ‘’E. coli’’ O157:H7 associated with attendance at the fair, with 15 children developing HUS. In its final investigation report, NCDHHS concluded that the North Carolina State Fair ‘’E. coli’’ outbreak had originated at a petting zoo exhibit. The conclusion was supported by a case-control study, environmental sampling, and laboratory analysis of samples collected from the fair and members of the outbreak.[16]
In 2005, a petting zoo that exhibited at two Florida fairs and a festival was traced as the source of an ‘’E. coli’’ O157:H7 outbreak. Sixty-three people who had visited either the Florida State Fair, the Central Florida Fair, or the Florida Strawberry Festival reported illness to investigators for the Florida Department of Health, including 20 who were culture-confirmed and 7 with HUS. A case-control study revealed that illness was associated with exposure to a petting zoo exhibit present at all three events.[17] | https://www.wikidoc.org/index.php/Xenozoonosis | |
e2bd064284aa11db8e0c8eb4f5089bd304bbe4bf | wikidoc | Xipamide | Xipamide
# Overview
Xipamide is a sulfonamide diuretic drug marketed by Eli Lilly under the trade names Aquaphor (in Germany) and Aquaphoril (in Austria). It is used for the treatment of oedema and hypertension.
# Mechanism of Action
Like the structurally related thiazide diuretics, xipamide acts on the kidneys to reduce sodium reabsorption in the distal convoluted tubule. This increases the osmolarity in the lumen, causing less water to be reabsorbed by the collecting ducts. This leads to increased urinary output. Unlike the thiazides, xipamide reaches its target from the peritubular side (blood side).
Additionally, it increases the secretion of potassium in the distal tubule and collecting ducts. In high doses it also inhibits the enzyme carbonic anhydrase which leads to increased secretion of bicarbonate and alkalizes the urine.
Unlike with thiazides, only terminal renal failure renders xipamide ineffective.
# Uses
Xipamide is used for
- cardiac oedema caused by decompensation of heart failure
- renal oedema, chronic renal disease (but not with anuria)
- hepatic oedema caused by cirrhosis
- ascites
- lymphoedema
- hypertension in combination with chronic renal disease
# Pharmacokinetics
After oral administration, 20 mg of xipamide are resorbed quickly and reach the peak plasma concentration of 3 mg/l within an hour. The diuretic effect starts about an hour after administration, reaches its peak between the third and sixth hour, and lasts for nearly 24 hours.
One third of the dose is glucuronidized, the rest is excreted directly through the kidney (1/3) and the faeces (2/3). The total plasma clearance is 30-40 ml/min. Xipamide can be filtrated by haemodialysis but not by peritoneal dialysis.
# Dosage
Initially 40 mg, it can be reduced to 10–20 mg to prevent a relapse.
The lowest effective dose is 5 mg. More than 60 mg have no additional effects.
# Adverse Effects
- more than 1/10 of all patients
hypokalaemia, which can lead to nausea, muscular weakness or cramps, and ECG abnormities
- hypokalaemia, which can lead to nausea, muscular weakness or cramps, and ECG abnormities
- 1/100 to 1/10
hyponatraemia, which can lead to headache, nausea, drowsiness or confusion
-rthostatic hypotension
initially increase of urea, uric acid and creatinine, which can lead to a gout attack in predisposed patients
- hyponatraemia, which can lead to headache, nausea, drowsiness or confusion
- orthostatic hypotension
- initially increase of urea, uric acid and creatinine, which can lead to a gout attack in predisposed patients
- 1/1000 to 1/10,000
allergic reactions of the skin
hyperlipidaemia
- allergic reactions of the skin
- hyperlipidaemia
- less than 1/10,000
haemorrhagic pancreatitis
acute interstitial nephritis
thrombocytopenia, leucopenia
- haemorrhagic pancreatitis
- acute interstitial nephritis
- thrombocytopenia, leucopenia
# Contraindications
- anuria
- praecoma and coma hepaticum
- hypovolemia, hyponatremia, hypokalemia
- hypercalcemia
- gout
- sulfonamide hypersensitivity
- pregnancy, lactation period
# Interactions
## Not recommended combinations
- Xipamide lowers the renal clearance of lithium which can lead to lithium intoxication. (This interaction is classified as medium.)
## Combinations requiring special precautions
The product information requests special precautions for these combinations:
- The antihypertensive effect can be increased by ACE inhibitors, barbiturates, phenothiazines, tricyclic antidepressants, alcohol, etc. (Classified as minor.)
- NSAIDs can reduce the antihypertensive and diuretic effects. Xipamide increases the neurotoxicity of high doses of salicylates. (Classified as minor.)
- Toxicity of cardiac glycosides is increased due to hypokalemia and hypomagnesemia.(Classified as minor.)
- Antiarrhythmic agents (classes Ia and III), phenothiazines and other antipsychotics increase the risk of torsade de pointes due to hypokalemia.
## Interactions not included in the product information
- Xipamide can reduce the effect of antidiabetics. (Classified as minor.)
# Banned use in sport
On 17 July 2012, cyclist Fränk Schleck was removed from the Tour de France by his team RadioShack-Nissan after his A-sample returned traces of xipamide. | Xipamide
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Xipamide is a sulfonamide diuretic drug marketed by Eli Lilly under the trade names Aquaphor (in Germany) and Aquaphoril (in Austria). It is used for the treatment of oedema and hypertension.
# Mechanism of Action
Like the structurally related thiazide diuretics, xipamide acts on the kidneys to reduce sodium reabsorption in the distal convoluted tubule. This increases the osmolarity in the lumen, causing less water to be reabsorbed by the collecting ducts. This leads to increased urinary output. Unlike the thiazides, xipamide reaches its target from the peritubular side (blood side).[1]
Additionally, it increases the secretion of potassium in the distal tubule and collecting ducts. In high doses it also inhibits the enzyme carbonic anhydrase which leads to increased secretion of bicarbonate and alkalizes the urine.
Unlike with thiazides, only terminal renal failure renders xipamide ineffective.[2]
# Uses
Xipamide is used for[1][2]
- cardiac oedema caused by decompensation of heart failure
- renal oedema, chronic renal disease (but not with anuria)
- hepatic oedema caused by cirrhosis
- ascites
- lymphoedema
- hypertension in combination with chronic renal disease
# Pharmacokinetics
After oral administration, 20 mg of xipamide are resorbed quickly and reach the peak plasma concentration of 3 mg/l within an hour. The diuretic effect starts about an hour after administration, reaches its peak between the third and sixth hour, and lasts for nearly 24 hours.
One third of the dose is glucuronidized, the rest is excreted directly through the kidney (1/3) and the faeces (2/3). The total plasma clearance is 30-40 ml/min. Xipamide can be filtrated by haemodialysis but not by peritoneal dialysis.[2]
# Dosage
Initially 40 mg, it can be reduced to 10–20 mg to prevent a relapse.[2]
The lowest effective dose is 5 mg. More than 60 mg have no additional effects.[1]
# Adverse Effects
- more than 1/10 of all patients[1]
hypokalaemia, which can lead to nausea, muscular weakness or cramps, and ECG abnormities
- hypokalaemia, which can lead to nausea, muscular weakness or cramps, and ECG abnormities
- 1/100 to 1/10
hyponatraemia, which can lead to headache, nausea, drowsiness or confusion
orthostatic hypotension
initially increase of urea, uric acid and creatinine, which can lead to a gout attack in predisposed patients
- hyponatraemia, which can lead to headache, nausea, drowsiness or confusion
- orthostatic hypotension
- initially increase of urea, uric acid and creatinine, which can lead to a gout attack in predisposed patients
- 1/1000 to 1/10,000
allergic reactions of the skin
hyperlipidaemia
- allergic reactions of the skin
- hyperlipidaemia
- less than 1/10,000
haemorrhagic pancreatitis
acute interstitial nephritis
thrombocytopenia, leucopenia
- haemorrhagic pancreatitis
- acute interstitial nephritis
- thrombocytopenia, leucopenia
# Contraindications
- anuria
- praecoma and coma hepaticum
- hypovolemia, hyponatremia, hypokalemia
- hypercalcemia
- gout
- sulfonamide hypersensitivity
- pregnancy, lactation period[1][2]
# Interactions
## Not recommended combinations
- Xipamide lowers the renal clearance of lithium which can lead to lithium intoxication.[1] (This interaction is classified as medium.[3])
## Combinations requiring special precautions
The product information requests special precautions for these combinations:[1]
- The antihypertensive effect can be increased by ACE inhibitors, barbiturates, phenothiazines, tricyclic antidepressants, alcohol, etc. (Classified as minor.[3])
- NSAIDs can reduce the antihypertensive and diuretic effects. Xipamide increases the neurotoxicity of high doses of salicylates. (Classified as minor.[3])
- Toxicity of cardiac glycosides is increased due to hypokalemia and hypomagnesemia.(Classified as minor.[3])
- Antiarrhythmic agents (classes Ia and III), phenothiazines and other antipsychotics increase the risk of torsade de pointes due to hypokalemia.
## Interactions not included in the product information
- Xipamide can reduce the effect of antidiabetics. (Classified as minor.[3])
# Banned use in sport
On 17 July 2012, cyclist Fränk Schleck was removed from the Tour de France by his team RadioShack-Nissan after his A-sample returned traces of xipamide.[4] | https://www.wikidoc.org/index.php/Xipamide | |
893fd4b8382aa111a073acc6f20f9f779d4cfcb4 | wikidoc | Yersinia | Yersinia
# Overview
Yersinia is a genus of bacteria in the family Enterobacteriaceae. Yersinia are Gram-negative rod shaped bacteria, a few micrometers long and fractions of a micrometer in diameter, and are facultative anaerobes. Some members of Yersinia are pathogenic in humans. Rodents are the natural reservoirs of Yersinia; less frequently other mammals serve as the host. Infection may occur either through blood (in the case of Y. pestis) or in an alimentary fashion, through occasionally via consumption of food products (especially vegetables, milk-derived products and meat) contaminated with infected urine or feces.
Speculations exist as to whether or not certain Yersinia can also be spread via protozoonotic mechanisms, since Yersinia are known to be facultative intracellular parasites; studies and discussions of the possibility of amoeba-vectored (through the cyst form of the protozoan) Yersinia propagation and proliferation are now in progress.
# Historical Perspective
The genus is named for A.E.J. Yersin, a Swiss bacteriologist, who discovered the Yersinia pestis bacterium - the causative agent of the bubonic plague. The special genus Yersinia has been recognized since 1971, mainly for taxonomic reasons.
# Pathophysiology
## Pathogenesis
The disease caused by Y. enterocolitica is called Yersiniosis.
Another pathogen is Y. pseudotuberculosis, which is the least common species of Yersinia causing disease in humans. Yersinia is implicated as one of the pathogenic causes of reactive arthritis worldwide.
## Microbial Physiology
An interesting feature peculiar to some of the Yersinia bacteria is the ability not only to survive, but also to proliferate at temperatures as low as 1-4 degrees Celsius (e.g., on cut salads and other food products in a refrigerator). Yersinia representatives also reveal relatively high heat resistantance, some of them being able to survive 50-60 degrees Celsius temperature for up to 20-30 minutes and (arguably, might be due to misreading of information like the first external link below) surviving standard pasteurization process (15 seconds at 72 degrees Celsius) in milk. Yersinia bacteria are relatively quickly inactivated by oxidizing agents such as hydrogen peroxide and potassium permanganate solutions. | Yersinia
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Yersinia is a genus of bacteria in the family Enterobacteriaceae. Yersinia are Gram-negative rod shaped bacteria, a few micrometers long and fractions of a micrometer in diameter, and are facultative anaerobes.[1] Some members of Yersinia are pathogenic in humans. Rodents are the natural reservoirs of Yersinia; less frequently other mammals serve as the host. Infection may occur either through blood (in the case of Y. pestis) or in an alimentary fashion, through occasionally via consumption of food products (especially vegetables, milk-derived products and meat) contaminated with infected urine or feces.
Speculations exist as to whether or not certain Yersinia can also be spread via protozoonotic mechanisms, since Yersinia are known to be facultative intracellular parasites; studies and discussions of the possibility of amoeba-vectored (through the cyst form of the protozoan) Yersinia propagation and proliferation are now in progress.
# Historical Perspective
The genus is named for A.E.J. Yersin, a Swiss bacteriologist, who discovered the Yersinia pestis bacterium - the causative agent of the bubonic plague. The special genus Yersinia has been recognized since 1971, mainly for taxonomic reasons.
# Pathophysiology
## Pathogenesis
The disease caused by Y. enterocolitica is called Yersiniosis.
Another pathogen is Y. pseudotuberculosis, which is the least common species of Yersinia causing disease in humans. Yersinia is implicated as one of the pathogenic causes of reactive arthritis worldwide.
## Microbial Physiology
An interesting feature peculiar to some of the Yersinia bacteria is the ability not only to survive, but also to proliferate at temperatures as low as 1-4 degrees Celsius (e.g., on cut salads and other food products in a refrigerator). Yersinia representatives also reveal relatively high heat resistantance, some of them being able to survive 50-60 degrees Celsius temperature for up to 20-30 minutes and (arguably, might be due to misreading of information like the first external link below) surviving standard pasteurization process (15 seconds at 72 degrees Celsius) in milk. Yersinia bacteria are relatively quickly inactivated by oxidizing agents such as hydrogen peroxide and potassium permanganate solutions. | https://www.wikidoc.org/index.php/Yersinia | |
53044d87051fcfda9ed849b8ea8ec24b2a169f02 | wikidoc | Yolk sac | Yolk sac
# Overview
The yolk sac is the first element seen in the gestational sac during pregnancy, usually at 5 weeks gestation.
It is a critical landmark, identifying a true gestation sac.
It is quite echogenic (light) to ultrasound, and reliably seen early.
# In mice
In the mouse, the yolk sac is the first site of blood formation, generating primitive macrophages and erythrocytes.
# In humans
The yolk-sac is situated on the ventral aspect of the embryo; it is lined by endoderm, outside of which is a layer of mesoderm.
It is filled with fluid, the vitelline fluid, which possibly may be utilized for the nourishment of the embryo during the earlier stages of its existence.
Blood is conveyed to the wall of the sac by the primitive aorta, and after circulating through a wide-meshed capillary plexus, is returned by the vitelline veins to the tubular heart of the embryo. This constitutes the vitelline circulation, and by means of it nutritive material is absorbed from the yolk-sac and conveyed to the embryo.
At the end of the fourth week the yolk-sac presents the appearance of a small pear-shaped vesicle (umbilical vesicle) opening into the digestive tube by a long narrow tube, the vitelline duct.
The vesicle can be seen in the after-birth as a small, somewhat oval-shaped body whose diameter varies from 1 mm. to 5 mm.; it is situated between the amnion and the chorion and may lie on or at a varying distance from the placenta.
As a rule the duct undergoes complete obliteration during the seventh week, but in about two percent of cases its proximal part persists as a diverticulum from the small intestine, Meckel's diverticulum, which is situated about three or four feet above the ileocecal valve, and may be attached by a fibrous cord to the abdominal wall at the umbilicus.
Sometimes a narrowing of the lumen of the ileum is seen opposite the site of attachment of the duct.
# Histogenesis
The Yolk sac starts forming itself during the second week of the embryonic development, at the same time of the shaping of the amniotic sac. The hypoblast starts proliferating laterally and descending down.
In the meantime the Heuser membrane, located on the opposite pole of the developing vesicle, starts its upward proliferation and meets the ipoblast. The last one keeps on descending for a little bit more.
We have arrived to the constitution of the Yolk sac.
# Modifications
- Primary yolk sac: it is the vesicle constituted in the second week, its floor is represented by the Heuser membrane and its ceiling by the ipoblast.
- Secondary yolk sac: this first transformation is determined by the modification of its cover, in the connection zone between the ipoblast and the Heuser membrane. We can observe a stricure. The two parts detach and the inferior one, which is smaller, forms a cyst destined to be eliminated. The upper one is now covered only by the ipoblst.
- The final yolk sac: during the fourth week of development, during which we can see the shaping of the embryonic areas, the yolk sac undergoes externally the pression of the fore folding, of the posterior one and of the lateral ones. A little portion of the sac, in the upper part, constitutes the intestinal tube. On the other side, the distal part forms a little vesicle, that is what remains of the yolk sac. | Yolk sac
Template:Infobox Anatomy
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
The yolk sac is the first element seen in the gestational sac during pregnancy, usually at 5 weeks gestation.
It is a critical landmark, identifying a true gestation sac.
It is quite echogenic (light) to ultrasound, and reliably seen early.
# In mice
In the mouse, the yolk sac is the first site of blood formation, generating primitive macrophages and erythrocytes.
# In humans
The yolk-sac is situated on the ventral aspect of the embryo; it is lined by endoderm, outside of which is a layer of mesoderm.
It is filled with fluid, the vitelline fluid, which possibly may be utilized for the nourishment of the embryo during the earlier stages of its existence.
Blood is conveyed to the wall of the sac by the primitive aorta, and after circulating through a wide-meshed capillary plexus, is returned by the vitelline veins to the tubular heart of the embryo. This constitutes the vitelline circulation, and by means of it nutritive material is absorbed from the yolk-sac and conveyed to the embryo.
At the end of the fourth week the yolk-sac presents the appearance of a small pear-shaped vesicle (umbilical vesicle) opening into the digestive tube by a long narrow tube, the vitelline duct.
The vesicle can be seen in the after-birth as a small, somewhat oval-shaped body whose diameter varies from 1 mm. to 5 mm.; it is situated between the amnion and the chorion and may lie on or at a varying distance from the placenta.
As a rule the duct undergoes complete obliteration during the seventh week, but in about two percent of cases its proximal part persists as a diverticulum from the small intestine, Meckel's diverticulum, which is situated about three or four feet above the ileocecal valve, and may be attached by a fibrous cord to the abdominal wall at the umbilicus.
Sometimes a narrowing of the lumen of the ileum is seen opposite the site of attachment of the duct.
# Histogenesis
The Yolk sac starts forming itself during the second week of the embryonic development, at the same time of the shaping of the amniotic sac. The hypoblast starts proliferating laterally and descending down.
In the meantime the Heuser membrane, located on the opposite pole of the developing vesicle, starts its upward proliferation and meets the ipoblast. The last one keeps on descending for a little bit more.
We have arrived to the constitution of the Yolk sac.
# Modifications
- Primary yolk sac: it is the vesicle constituted in the second week, its floor is represented by the Heuser membrane and its ceiling by the ipoblast.
- Secondary yolk sac: this first transformation is determined by the modification of its cover, in the connection zone between the ipoblast and the Heuser membrane. We can observe a stricure. The two parts detach and the inferior one, which is smaller, forms a cyst destined to be eliminated. The upper one is now covered only by the ipoblst.
- The final yolk sac: during the fourth week of development, during which we can see the shaping of the embryonic areas, the yolk sac undergoes externally the pression of the fore folding, of the posterior one and of the lateral ones. A little portion of the sac, in the upper part, constitutes the intestinal tube. On the other side, the distal part forms a little vesicle, that is what remains of the yolk sac.
Template:Embryology
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/Yolk-sac | |
d9c7db796db160d5cb1d8f760c832582e25c9af7 | wikidoc | Zaleplon | Zaleplon
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Zaleplon is a central nervous system agent that is FDA approved for the treatment of insomnia. Common adverse reactions include dizziness, headache.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Insomnia
- Sonata is indicated for the short-term treatment of insomnia. Sonata has been shown to decrease the time to sleep onset for up to 30 days in controlled clinical studies. It has not been shown to increase total sleep time or decrease the number of awakenings.
- The clinical trials performed in support of efficacy ranged from a single night to 5 weeks in duration. The final formal assessments of sleep latency were performed at the end of treatment.
- Dosing Information
- The dose of Sonata should be individualized. The recommended dose of Sonata for most nonelderly adults is 10 mg. For certain low weight individuals, 5 mg may be a sufficient dose. Although the risk of certain adverse events associated with the use of Sonata appears to be dose dependent, the 20 mg dose has been shown to be adequately tolerated and may be considered for the occasional patient who does not benefit from a trial of a lower dose. Doses above 20 mg have not been adequately evaluated and are not recommended.
- Sonata should be taken immediately before bedtime or after the patient has gone to bed and has experienced difficulty falling asleep. Taking Sonata with or immediately after a heavy, high-fat meal results in slower absorption and would be expected to reduce the effect of Sonata on sleep latency.
- Special Populations
- Elderly patients and debilitated patients appear to be more sensitive to the effects of hypnotics, and respond to 5 mg of Sonata. The recommended dose for these patients is therefore 5 mg. Doses over 10 mg are not recommended.
- Hepatic insufficiency: Patients with mild to moderate hepatic impairment should be treated with Sonata 5 mg because clearance is reduced in this population. Sonata is not recommended for use in patients with severe hepatic impairment.
- Renal insufficiency: No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
- An initial dose of 5 mg should be given to patients concomitantly taking cimetidine because zaleplon clearance is reduced in this population.
## Off-Label Use and Dosage (Adult)
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Zaleplon FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
# Contraindications
- Hypersensitivity to zaleplon or any excipients in the formulation (see also PRECAUTIONS).
# Warnings
- Because sleep disturbances may be the presenting manifestation of a physical and/or psychiatric disorder, symptomatic treatment of insomnia should be initiated only after a careful evaluation of the patient. The failure of insomnia to remit after 7 to 10 days of treatment may indicate the presence of a primary psychiatric and/or medical illness that should be evaluated. Worsening of insomnia or the emergence of new thinking or behavior abnormalities may be the consequence of an unrecognized psychiatric or physical disorder. Such findings have emerged during the course of treatment with sedative/hypnotic drugs, including Sonata. Because some of the important adverse effects of Sonata appear to be dose-related, it is important to use the lowest possible effective dose, especially in the elderly (see ADMINISTRATION).
- A variety of abnormal thinking and behavior changes have been reported to occur in association with the use of sedative/hypnotics. Some of these changes may be characterized by decreased inhibition (e.g., aggressiveness and extroversion that seem out of character), similar to effects produced by alcohol and other CNS depressants. Other reported behavioral changes have included bizarre behavior, agitation, hallucinations, and depersonalization.
Abnormal Thinking and Behavioral Changes
- Complex behaviors such as "sleep-driving" (i.e., driving while not fully awake after ingestion of a sedative-hypnotic, with amnesia for the event) have been reported. These events can occur in sedative-hypnotic-naive as well as in sedative-hypnotic-experienced persons. Although behaviors such as sleep-driving may occur with Sonata alone at therapeutic doses, the use of alcohol and other CNS depressants with Sonata appears to increase the risk of such behaviors, as does the use of Sonata at doses exceeding the maximum recommended dose. Due to the risk to the patient and the community, discontinuation of Sonata should be strongly considered for patients who report a "sleep-driving" episode. Other complex behaviors (e.g., preparing and eating food, making phone calls, or having sex) have been reported in patients who are not fully awake after taking a sedative-hypnotic. As with sleep-driving, patients usually do not remember these events. Amnesia and other neuropsychiatric symptoms may occur unpredictably. In primarily depressed patients, worsening of depression, including suicidal thoughts and actions (including completed suicides), has been reported in association with the use of sedative/hypnotics.
- It can rarely be determined with certainty whether a particular instance of the abnormal behaviors listed above is drug induced, spontaneous in origin, or a result of an underlying psychiatric or physical disorder. Nonetheless, the emergence of any new behavioral sign or symptom of concern requires careful and immediate evaluation.
- Following rapid dose decrease or abrupt discontinuation of the use of sedative/hypnotics, there have been reports of signs and symptoms similar to those associated with withdrawal from other CNS-depressant drugs.
- Sonata, like other hypnotics, has CNS-depressant effects. Because of the rapid onset of action, Sonata should only be ingested immediately prior to going to bed or after the patient has gone to bed and has experienced difficulty falling asleep. Patients receiving Sonata should be cautioned against engaging in hazardous occupations requiring complete mental alertness or motor coordination (e.g., operating machinery or driving a motor vehicle) after ingesting the drug, including potential impairment of the performance of such activities that may occur the day following ingestion of Sonata. Sonata, as well as other hypnotics, may produce additive CNS-depressant effects when coadministered with other psychotropic medications, anticonvulsants, antihistamines, narcotic analgesics, anesthetics, ethanol, and other drugs that themselves produce CNS depression. Sonata should not be taken with alcohol. Dosage adjustment may be necessary when Sonata is administered with other CNS-depressant agents because of the potentially additive effects.
Severe anaphylactic and anaphylactoid reactions
- Rare cases of angioedema involving the tongue, glottis or larynx have been reported in patients after taking the first or subsequent doses of sedative-hypnotics, including Sonata. Some patients have had additional symptoms such as dyspnea, throat closing, or nausea and vomiting that suggest anaphylaxis. Some patients have required medical therapy in the emergency department. If angioedema involves the tongue, glottis or larynx, airway obstruction may occur and be fatal. Patients who develop angioedema after treatment with Sonata should not be rechallenged with the drug.
### Precautions
- General
Timing of Drug Administration
- Sonata should be taken immediately before bedtime or after the patient has gone to bed and has experienced difficulty falling asleep. As with all sedative/hypnotics, taking Sonata while still up and about may result in short-term memory impairment, hallucinations, impaired coordination, dizziness, and lightheadedness.
Use in the elderly and/or debilitated patients
- Impaired motor and/or cognitive performance after repeated exposure or unusual sensitivity to sedative/hypnotic drugs is a concern in the treatment of elderly and/or debilitated patients. A dose of 5 mg is recommended for elderly patients to decrease the possibility of side effects. Elderly and/or debilitated patients should be monitored closely.
Use in patients with concomitant illness
- Clinical experience with Sonata in patients with concomitant systemic illness is limited. Sonata should be used with caution in patients with diseases or conditions that could affect metabolism or hemodynamic responses.
- Although preliminary studies did not reveal respiratory depressant effects at hypnotic doses of Sonata in normal subjects, caution should be observed if Sonata (zaleplon) is prescribed to patients with compromised respiratory function, because sedative/hypnotics have the capacity to depress respiratory drive. Controlled trials of acute administration of Sonata 10 mg in patients with mild to moderate chronic obstructive pulmonary disease or moderate obstructive sleep apnea showed no evidence of alterations in blood gases or apnea/hypopnea index, respectively. However, patients with compromised respiration due to preexisting illness should be monitored carefully.
- The dose of Sonata should be reduced to 5 mg in patients with mild to moderate hepatic impairment. It is not recommended for use in patients with severe hepatic impairment.
- No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
Use in patients with depression
- As with other sedative/hypnotic drugs, Sonata should be administered with caution to patients exhibiting signs or symptoms of depression. Suicidal tendencies may be present in such patients and protective measures may be required. Intentional overdosage is more common in this group of patients (see OVERDOSAGE); therefore, the least amount of drug that is feasible should be prescribed for the patient at any one time.
- This product contains FD&C Yellow No. 5 (tartrazine) which may cause allergic-type reactions (including bronchial asthma) in certain susceptible persons. Although the overall incidence of FD&C Yellow No. 5 (tartrazine) sensitivity in the general population is low, it is frequently seen in patients who also have aspirin hypersensitivity.
Information for Patients
- A patient Medication Guide is also available for Sonata. The prescriber or health professional should instruct patients, their families, and their caregivers to read the Medication Guide and should assist them in understanding its contents. Patients should be given the opportunity to discuss the contents of the Medication Guide and to obtain answers to any questions that they may have.
SPECIAL CONCERNS "Sleep-Driving" and other complex behaviors
- There have been reports of people getting out of bed after taking a sedative hypnotic medicine and driving their cars while not fully awake, often with no memory of the event. If a patient experiences such an episode, it should be reported to his or her doctor immediately, since "sleep-driving" can be dangerous. This behavior is more likely to occur when Sonata is taken with alcohol or other central nervous system depressants (see WARNINGS). Other complex behaviors (e.g., preparing and eating food, making phone calls, or having sex) have been reported in patients who are not fully awake after taking a sleep medicine. As with sleep-driving, patients usually do not remember these events.
Laboratory Tests
- There are no specific laboratory tests recommended.
DOSAGE AND ADMINISTRATION
- The dose of Sonata should be individualized. The recommended dose of Sonata for most nonelderly adults is 10 mg. For certain low weight individuals, 5 mg may be a sufficient dose. Although the risk of certain adverse events associated with the use of Sonata appears to be dose dependent, the 20 mg dose has been shown to be adequately tolerated and may be considered for the occasional patient who does not benefit from a trial of a lower dose. Doses above 20 mg have not been adequately evaluated and are not recommended.
- Sonata should be taken immediately before bedtime or after the patient has gone to bed and has experienced difficulty falling asleep. Taking Sonata with or immediately after a heavy, high-fat meal results in slower absorption and would be expected to reduce the effect of Sonata on sleep latency.
Special Populations
- Elderly patients and debilitated patients appear to be more sensitive to the effects of hypnotics, and respond to 5 mg of Sonata. The recommended dose for these patients is therefore 5 mg. Doses over 10 mg are not recommended.
- Hepatic insufficiency: Patients with mild to moderate hepatic impairment should be treated with Sonata 5 mg because clearance is reduced in this population. Sonata is not recommended for use in patients with severe hepatic impairment.
- Renal insufficiency: No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
- An initial dose of 5 mg should be given to patients concomitantly taking cimetidine because zaleplon clearance is reduced in this population (see Drug Interactions under PRECAUTIONS).
# Adverse Reactions
## Clinical Trials Experience
- The premarketing development program for Sonata included zaleplon exposures in patients and/or normal subjects from 2 different groups of studies: approximately 900 normal subjects in clinical pharmacology/pharmacokinetic studies; and approximately 2,900 exposures from patients in placebo-controlled clinical effectiveness studies, corresponding to approximately 450 patient exposure years. The conditions and duration of treatment with Sonata varied greatly and included (in overlapping categories) open-label and double-blind phases of studies, inpatients and outpatients, and short-term or longer-term exposure. Adverse reactions were assessed by collecting adverse events, results of physical examinations, vital signs, weights, laboratory analyses, and ECGs.
- Adverse events during exposure were obtained primarily by general inquiry and recorded by clinical investigators using terminology of their own choosing. Consequently, it is not possible to provide a meaningful estimate of the proportion of individuals experiencing adverse events without first grouping similar types of events into a smaller number of standardized event categories. In the tables and tabulations that follow, COSTART terminology has been used to classify reported adverse events.
- The stated frequencies of adverse events represent the proportion of individuals who experienced, at least once, a treatment-emergent adverse event of the type listed. An event was considered treatment-emergent if it occurred for the first time or worsened while receiving therapy following baseline evaluation.
Adverse Findings Observed in Short-Term, Placebo-Controlled Trials
Adverse Events Associated With Discontinuation of Treatment
- In premarketing placebo-controlled, parallel-group phase 2 and phase 3 clinical trials, 3.1% of 744 patients who received placebo and 3.7% of 2,149 patients who received Sonata discontinued treatment because of an adverse clinical event. This difference was not statistically significant. No event that resulted in discontinuation occurred at a rate of ≥ 1%.
Adverse Events Occurring at an Incidence of 1% or More Among Sonata 20 mg-Treated Patients
- Table 1 enumerates the incidence of treatment-emergent adverse events for a pool of three 28-night and one 35-night placebo-controlled studies of Sonata at doses of 5 mg or 10 mg and 20 mg. The table includes only those events that occurred in 1% or more of patients treated with Sonata 20 mg and that had a higher incidence in patients treated with Sonata 20 mg than in placebo-treated patients.
- The prescriber should be aware that these figures cannot be used to predict the incidence of adverse events in the course of usual medical practice where patient characteristics and other factors differ from those which prevailed in the clinical trials. Similarly, the cited frequencies cannot be compared with figures obtained from other clinical investigations involving different treatments, uses, and investigators. The cited figures, however, do provide the prescribing physician with some basis for estimating the relative contribution of drug and non-drug factors to the adverse event incidence rate in the population studied.
Other Adverse Events Observed During the Premarketing Evaluation of Sonata
- Listed below are COSTART terms that reflect treatment-emergent adverse events as defined in the introduction to the ADVERSE REACTIONS section. These events were reported by patients treated with Sonata (zaleplon) at doses in a range of 5 mg/day to 20 mg/day during premarketing phase 2 and phase 3 clinical trials throughout the United States, Canada, and Europe, including approximately 2,900 patients. All reported events are included except those already listed in Table 1 or elsewhere in labeling, those events for which a drug cause was remote, and those event terms that were so general as to be uninformative. It is important to emphasize that although the events reported occurred during treatment with Sonata, they were not necessarily caused by it.
- Events are further categorized by body system and listed in order of decreasing frequency according to the following definitions: frequent adverse events are those occurring on one or more occasions in at least 1/100 patients; infrequent adverse events are those occurring in less than 1/100 patients but at least 1/1,000 patients; rare events are those occurring in fewer than 1/1,000 patients.
- Body as a whole - Frequent: back pain, chest pain, fever; Infrequent: chest pain substernal, chills, face edema, generalized edema, hangover effect, neck rigidity.
- Cardiovascular system - Frequent: migraine; Infrequent: angina pectoris, bundle branch block, hypertension, hypotension, palpitation, syncope, tachycardia, vasodilatation, ventricular extrasystoles; Rare: bigeminy, cerebral ischemia, cyanosis, pericardial effusion, postural hypotension, pulmonary embolus, sinus bradycardia, thrombophlebitis, ventricular tachycardia.
- Digestive system - Frequent: constipation, dry mouth, dyspepsia; Infrequent: eructation, esophagitis, flatulence, gastritis, gastroenteritis, gingivitis, glossitis, increased appetite, melena, mouth ulceration, rectal hemorrhage, stomatitis; Rare: aphthous stomatitis, biliary pain, bruxism, cardiospasm, cheilitis, cholelithiasis, duodenal ulcer, dysphagia, enteritis, gum hemorrhage, increased salivation, intestinal obstruction, abnormal liver function tests, peptic ulcer, tongue discoloration, tongue edema, ulcerative stomatitis.
- Endocrine system - Rare: diabetes mellitus, goiter, hypothyroidism.
- Hemic and lymphatic system - Infrequent: anemia, ecchymosis, lymphadenopathy; Rare: eosinophilia, leukocytosis, lymphocytosis, purpura.
- Metabolic and nutritional - Infrequent: edema, gout, hypercholesteremia, thirst, weight gain; Rare: bilirubinemia, hyperglycemia, hyperuricemia, hypoglycemia, hypoglycemic reaction, ketosis, lactose intolerance, AST (SGOT) increased, ALT (SGPT) increased, weight loss.
- Musculoskeletal system - Frequent: arthralgia, arthritis, myalgia; Infrequent: arthrosis, bursitis, joint disorder (mainly swelling, stiffness, and pain), myasthenia, tenosynovitis; Rare: myositis, osteoporosis.
- Nervous system - Frequent: anxiety, depression, nervousness, thinking abnormal (mainly difficulty concentrating); Infrequent: abnormal gait, agitation, apathy, ataxia, circumoral paresthesia, emotional lability, euphoria, hyperesthesia, hyperkinesia, hypotonia, incoordination, insomnia, libido decreased, neuralgia, nystagmus; Rare: CNS stimulation, delusions, dysarthria, dystonia, facial paralysis, hostility, hypokinesia, myoclonus, neuropathy, psychomotor retardation, ptosis, reflexes decreased, reflexes increased, sleep talking, sleep walking, slurred speech, stupor, trismus.
- Respiratory system - Frequent: bronchitis; Infrequent: asthma, dyspnea, laryngitis, pneumonia, snoring, voice alteration; Rare: apnea, hiccup, hyperventilation, pleural effusion, sputum increased.
- Skin and appendages - Frequent: pruritus, rash; Infrequent: acne, alopecia, contact dermatitis, dry skin, eczema, maculopapular rash, skin hypertrophy, sweating, urticaria, vesiculobullous rash; Rare: melanosis, psoriasis, pustular rash, skin discoloration.
- Special senses - Frequent: conjunctivitis, taste perversion; Infrequent: diplopia, dry eyes, photophobia, tinnitus, watery eyes; Rare: abnormality of accommodation, blepharitis, cataract specified, corneal erosion, deafness, eye hemorrhage, glaucoma, labyrinthitis, retinal detachment, taste loss, visual field defect.
- Urogenital system - Infrequent: bladder pain, breast pain, cystitis, decreased urine stream, dysuria, hematuria, impotence, kidney calculus, kidney pain, menorrhagia, metrorrhagia, urinary frequency, urinary incontinence, urinary urgency, vaginitis; Rare: albuminuria, delayed menstrual period, leukorrhea, menopause, urethritis, urinary retention, vaginal hemorrhage.
## Postmarketing Experience
- Anaphylactic/anaphylactoid reactions, including severe reactions and nightmares.
# Drug Interactions
- As with all drugs, the potential exists for interaction with other drugs by a variety of mechanisms.
CNS-Active Drugs
- Ethanol: Sonata 10 mg potentiated the CNS-impairing effects of ethanol 0.75 g/kg on balance testing and reaction time for 1 hour after ethanol administration and on the digit symbol substitution test (DSST), symbol copying test, and the variability component of the divided attention test for 2.5 hours after ethanol administration. The potentiation resulted from a CNS pharmacodynamic interaction; zaleplon did not affect the pharmacokinetics of ethanol.
- Imipramine: Coadministration of single doses of Sonata 20 mg and imipramine 75 mg produced additive effects on decreased alertness and impaired psychomotor performance for 2 to 4 hours after administration. The interaction was pharmacodynamic with no alteration of the pharmacokinetics of either drug.
- Paroxetine: Coadministration of a single dose of Sonata 20 mg and paroxetine 20 mg daily for 7 days did not produce any interaction on psychomotor performance. Additionally, paroxetine did not alter the pharmacokinetics of Sonata, reflecting the absence of a role of CYP2D6 in zaleplon's metabolism.
- Thioridazine: Coadministration of single doses of Sonata 20 mg and thioridazine 50 mg produced additive effects on decreased alertness and impaired psychomotor performance for 2 to 4 hours after administration. The interaction was pharmacodynamic with no alteration of the pharmacokinetics of either drug.
- Venlafaxine: Coadministration of a single dose of zaleplon 10 mg and multiple doses of venlafaxine ER (extended release) 150 mg did not result in any significant changes in the pharmacokinetics of either zaleplon or venlafaxine. In addition, there was no pharmacodynamic interaction as a result of coadministration of zaleplon and venlafaxine ER.
- Promethazine: Coadministration of a single dose of zaleplon and promethazine (10 and 25 mg, respectively) resulted in a 15% decrease in maximal plasma concentrations of zaleplon, but no change in the area under the plasma concentration-time curve. However, the pharmacodynamics of coadministration of zaleplon and promethazine have not been evaluated. Caution should be exercised when these 2 agents are coadministered.
Drugs That Induce CYP3A4
- Rifampin: CYP3A4 is ordinarily a minor metabolizing enzyme of zaleplon. Multiple-dose administration of the potent CYP3A4 inducer rifampin (600 mg every 24 hours, q24h, for 14 days), however, reduced zaleplon Cmax and AUC by approximately 80%. The coadministration of a potent CYP3A4 enzyme inducer, although not posing a safety concern, thus could lead to ineffectiveness of zaleplon. An alternative non-CYP3A4 substrate hypnotic agent may be considered in patients taking CYP3A4 inducers such as rifampin, phenytoin, carbamazepine, and phenobarbital.
Drugs That Inhibit CYP3A4
- CYP3A4 is a minor metabolic pathway for the elimination of zaleplon because the sum of desethylzaleplon (formed via CYP3A4 in vitro) and its metabolites, 5-oxo-desethylzaleplon and 5-oxo-desethylzaleplon glucuronide, account for only 9% of the urinary recovery of a zaleplon dose. Coadministration of single, oral doses of zaleplon with erythromycin (10 mg and 800 mg respectively), a strong, selective CYP3A4 inhibitor, produced a 34% increase in zaleplon's maximal plasma concentrations and a 20% increase in the area under the plasma concentration-time curve. The magnitude of interaction with multiple doses of erythromycin is unknown. Other strong selective CYP3A4 inhibitors such as ketoconazole can also be expected to increase the exposure of zaleplon. A routine dosage adjustment of zaleplon is not considered necessary.
Drugs That Inhibit Aldehyde Oxidase
- The aldehyde oxidase enzyme system is less well studied than the cytochrome P450 enzyme system.
- Diphenhydramine: Diphenhydramine is reported to be a weak inhibitor of aldehyde oxidase in rat liver, but its inhibitory effects in human liver are not known. There is no pharmacokinetic interaction between zaleplon and diphenhydramine following the administration of a single dose (10 mg and 50 mg, respectively) of each drug. However, because both of these compounds have CNS effects, an additive pharmacodynamic effect is possible.
Drugs That Inhibit Both Aldehyde Oxidase and CYP3A4
- Cimetidine: Cimetidine inhibits both aldehyde oxidase (in vitro) and CYP3A4 (in vitro and in vivo), the primary and secondary enzymes, respectively, responsible for zaleplon metabolism. Concomitant administration of Sonata (10 mg) and cimetidine (800 mg) produced an 85% increase in the mean Cmax and AUC of zaleplon. An initial dose of 5 mg should be given to patients who are concomitantly being treated with cimetidine (see DOSAGE AND ADMINISTRATION).
Drugs Highly Bound to Plasma Protein
- Zaleplon is not highly bound to plasma proteins (fraction bound 60%±15%); therefore, the disposition of zaleplon is not expected to be sensitive to alterations in protein binding. In addition, administration of Sonata to a patient taking another drug that is highly protein bound should not cause transient increase in free concentrations of the other drug.
Drugs with a Narrow Therapeutic Index
- Digoxin: Sonata (10 mg) did not affect the pharmacokinetic or pharmacodynamic profile of digoxin (0.375 mg q24h for 8 days).
- Warfarin: Multiple oral doses of Sonata (20 mg q24h for 13 days) did not affect the pharmacokinetics of warfarin (R+)- or (S-)-enantiomers or the pharmacodynamics (prothrombin time) following a single 25-mg oral dose of warfarin.
Drugs That Alter Renal Excretion
- Ibuprofen: Ibuprofen is known to affect renal function and, consequently, alter the renal excretion of other drugs. There was no apparent pharmacokinetic interaction between zaleplon and ibuprofen following single dose administration (10 mg and 600 mg, respectively) of each drug. This was expected because zaleplon is primarily metabolized and renal excretion of unchanged zaleplon accounts for less than 1% of the administered dose.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): C
Pregnancy: Pregnancy Category C
- In embryofetal development studies in rats and rabbits, oral administration of up to 100 mg/kg/day and 50 mg/kg/day, respectively, to pregnant animals throughout organogenesis produced no evidence of teratogenicity. These doses are equivalent to 49 (rat) and 48 (rabbit) times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. In rats, pre- and postnatal growth was reduced in the offspring of dams receiving 100 mg/kg/day. This dose was also maternally toxic, as evidenced by clinical signs and decreased maternal body weight gain during gestation. The no-effect dose for rat offspring growth reduction was 10 mg/kg (a dose equivalent to 5 times the MRHD of 20 mg on a mg/m2 basis). No adverse effects on embryofetal development were observed in rabbits at the doses examined.
- In a pre- and postnatal development study in rats, increased stillbirth and postnatal mortality, and decreased growth and physical development, were observed in the offspring of females treated with doses of 7 mg/kg/day or greater during the latter part of gestation and throughout lactation. There was no evidence of maternal toxicity at this dose. The no-effect dose for offspring development was 1 mg/kg/day (a dose equivalent to 0.5 times the MRHD of 20 mg on a mg/m2 basis). When the adverse effects on offspring viability and growth were examined in a cross-fostering study, they appeared to result from both in utero and lactational exposure to the drug.
- There are no studies of zaleplon in pregnant women; therefore, Sonata® (zaleplon) is not recommended for use in women during pregnancy.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
- There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Zaleplon in women who are pregnant.
### Labor and Delivery
- Sonata has no established use in labor and delivery.
### Nursing Mothers
- A study in lactating mothers indicated that the clearance and half-life of zaleplon is similar to that in young normal subjects. A small amount of zaleplon is excreted in breast milk, with the highest excreted amount occurring during a feeding at approximately 1 hour after Sonata administration. Since the small amount of the drug from breast milk may result in potentially important concentrations in infants, and because the effects of zaleplon on a nursing infant are not known, it is recommended that nursing mothers not take Sonata.
### Pediatric Use
- The safety and effectiveness of Sonata in pediatric patients have not been established.
### Geriatic Use
- A total of 628 patients in double-blind, placebo-controlled, parallel-group clinical trials who received Sonata were at least 65 years of age; of these, 311 received 5 mg and 317 received 10 mg. In both sleep laboratory and outpatient studies, elderly patients with insomnia responded to a 5 mg dose with a reduced sleep latency, and thus 5 mg is the recommended dose in this population. During short-term treatment (14 night studies) of elderly patients with Sonata, no adverse event with a frequency of at least 1% occurred at a significantly higher rate with either 5 mg or 10 mg Sonata than with placebo.
### Gender
- There is no FDA guidance on the use of Zaleplon with respect to specific gender populations.
### Race
- There is no FDA guidance on the use of Zaleplon with respect to specific racial populations.
### Renal Impairment
- There is no FDA guidance on the use of Zaleplon in patients with renal impairment.
### Hepatic Impairment
- There is no FDA guidance on the use of Zaleplon in patients with hepatic impairment.
### Females of Reproductive Potential and Males
- There is no FDA guidance on the use of Zaleplon in women of reproductive potentials and males.
### Immunocompromised Patients
- There is no FDA guidance one the use of Zaleplon in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
- Intravenous
### Monitoring
- There is limited information regarding Monitoring of Zaleplon in the drug label.
- Description
# IV Compatibility
- There is limited information regarding IV Compatibility of Zaleplon in the drug label.
# Overdosage
There is limited information regarding Zaleplon overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
## Mechanism of Action
## Structure
- Zaleplon is a nonbenzodiazepine hypnotic from the pyrazolopyrimidine class. The chemical name of zaleplon is N-pyrimidin-7-yl)phenyl]-N-ethylacetamide. Its empirical formula is C17H15N5O, and its molecular weight is 305.34. The structural formula is shown below.
- Zaleplon is a white to off-white powder that is practically insoluble in water and sparingly soluble in alcohol or propylene glycol. Its partition coefficient in octanol/water is constant (log PC = 1.23) over the pH range of 1 to 7.
- Sonata® capsules contain zaleplon as the active ingredient. Inactive ingredients consist of microcrystalline cellulose, pregelatinized starch, silicon dioxide, sodium lauryl sulfate, magnesium stearate, lactose, gelatin, titanium dioxide, D&C yellow #10, FD&C blue #1, FD&C green #3, and FD&C yellow #5.
## Pharmacodynamics
- While Sonata (zaleplon) is a hypnotic agent with a chemical structure unrelated to benzodiazepines, barbiturates, or other drugs with known hypnotic properties, it interacts with the gamma-aminobutyric acid-benzodiazepine (GABA-BZ) receptor complex. Subunit modulation of the GABA-BZ receptor chloride channel macromolecular complex is hypothesized to be responsible for some of the pharmacological properties of benzodiazepines, which include sedative, anxiolytic, muscle relaxant, and anticonvulsive effects in animal models.
- Other nonclinical studies have also shown that zaleplon binds selectively to the brain omega-1 receptor situated on the alpha subunit of the GABAA/chloride ion channel receptor complex and potentiates t-butyl-bicyclophosphorothionate (TBPS) binding. Studies of binding of zaleplon to recombinant GABAA receptors (α1β1γ2 and α2β1γ2 ) have shown that zaleplon has a low affinity for these receptors, with preferential binding to the omega-1 receptor.
## Pharmacokinetics
- The pharmacokinetics of zaleplon have been investigated in more than 500 healthy subjects (young and elderly), nursing mothers, and patients with hepatic disease or renal disease. In healthy subjects, the pharmacokinetic profile has been examined after single doses of up to 60 mg and once-daily administration at 15 mg and 30 mg for 10 days. Zaleplon was rapidly absorbed with a time to peak concentration (tmax) of approximately 1 hour and a terminal-phase elimination half-life (t1/2) of approximately 1 hour. Zaleplon does not accumulate with once-daily administration and its pharmacokinetics are dose proportional in the therapeutic range.
Absorption
- Zaleplon is rapidly and almost completely absorbed following oral administration. Peak plasma concentrations are attained within approximately 1 hour after oral administration. Although zaleplon is well absorbed, its absolute bioavailability is approximately 30% because it undergoes significant presystemic metabolism.
Distribution
- Zaleplon is a lipophilic compound with a volume of distribution of approximately 1.4 L/kg following intravenous (IV) administration, indicating substantial distribution into extravascular tissues. The in vitro plasma protein binding is approximately 60%±15% and is independent of zaleplon concentration over the range of 10 ng/mL to 1000 ng/mL. This suggests that zaleplon disposition should not be sensitive to alterations in protein binding. The blood to plasma ratio for zaleplon is approximately 1, indicating that zaleplon is uniformly distributed throughout the blood with no extensive distribution into red blood cells.
Metabolism
- After oral administration, zaleplon is extensively metabolized, with less than 1% of the dose excreted unchanged in urine. Zaleplon is primarily metabolized by aldehyde oxidase to form 5-oxo-zaleplon. Zaleplon is metabolized to a lesser extent by cytochrome P450 (CYP) 3A4 to form desethylzaleplon, which is quickly converted, presumably by aldehyde oxidase, to 5-oxo-desethylzaleplon. These oxidative metabolites are then converted to glucuronides and eliminated in urine. All of zaleplon's metabolites are pharmacologically inactive.
Elimination
- After either oral or IV administration, zaleplon is rapidly eliminated with a mean t1/2 of approximately 1 hour. The oral-dose plasma clearance of zaleplon is about 3 L/h/kg and the IV zaleplon plasma clearance is approximately 1 L/h/kg. Assuming normal hepatic blood flow and negligible renal clearance of zaleplon, the estimated hepatic extraction ratio of zaleplon is approximately 0.7, indicating that zaleplon is subject to high first-pass metabolism.
- After administration of a radiolabeled dose of zaleplon, 70% of the administered dose is recovered in urine within 48 hours (71% recovered within 6 days), almost all as zaleplon metabolites and their glucuronides. An additional 17% is recovered in feces within 6 days, most as 5-oxo-zaleplon.
Effect of Food
- In healthy adults a high-fat/heavy meal prolonged the absorption of zaleplon compared to the fasted state, delaying tmax by approximately 2 hours and reducing Cmax by approximately 35%. Zaleplon AUC and elimination half-life were not significantly affected. These results suggest that the effects of Sonata on sleep onset may be reduced if it is taken with or immediately after a high-fat/heavy meal.
Special Populations
- Age: The pharmacokinetics of Sonata (zaleplon) have been investigated in three studies with elderly men and women ranging in age from 65 to 85 years. The pharmacokinetics of Sonata in elderly subjects, including those over 75 years of age, are not significantly different from those in young healthy subjects.
- Gender: There is no significant difference in the pharmacokinetics of Sonata in men and women.
- Race: The pharmacokinetics of zaleplon have been studied in Japanese subjects as representative of Asian populations. For this group, Cmax and AUC were increased 37% and 64%, respectively. This finding can likely be attributed to differences in body weight, or alternatively, may represent differences in enzyme activities resulting from differences in diet, environment, or other factors. The effects of race on pharmacokinetic characteristics in other ethnic groups have not been well characterized.
- Hepatic impairment: Zaleplon is metabolized primarily by the liver and undergoes significant presystemic metabolism. Consequently, the oral clearance of zaleplon was reduced by 70% and 87% in compensated and decompensated cirrhotic patients, respectively, leading to marked increases in mean Cmax and AUC (up to 4-fold and 7-fold in compensated and decompensated patients, respectively), in comparison with healthy subjects. The dose of Sonata should therefore be reduced in patients with mild to moderate hepatic impairment. Sonata is not recommended for use in patients with severe hepatic impairment.
- Renal impairment: Because renal excretion of unchanged zaleplon accounts for less than 1% of the administered dose, the pharmacokinetics of zaleplon are not altered in patients with renal insufficiency. No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
Drug-Drug Interactions
- Because zaleplon is primarily metabolized by aldehyde oxidase, and to a lesser extent by CYP3A4, inhibitors of these enzymes might be expected to decrease zaleplon's clearance and inducers of these enzymes might be expected to increase its clearance. Zaleplon has been shown to have minimal effects on the kinetics of warfarin (both R- and S- forms), imipramine, ethanol, ibuprofen, diphenhydramine, thioridazine, and digoxin. However, the effects of zaleplon on inhibition of enzymes involved in the metabolism of other drugs have not been studied.
Clinical Trials
Controlled Trials Supporting Effectiveness
- Sonata (typically administered in doses of 5 mg, 10 mg, or 20 mg) has been studied in patients with chronic insomnia (n = 3,435) in 12 placebo- and active-drug-controlled trials. Three of the trials were in elderly patients (n = 1,019). It has also been studied in transient insomnia (n = 264). Because of its very short half-life, studies focused on decreasing sleep latency, with less attention to duration of sleep and number of awakenings, for which consistent differences from placebo were not demonstrated. Studies were also carried out to examine the time course of effects on memory and psychomotor function, and to examine withdrawal phenomena.
Transient Insomnia
- Normal adults experiencing transient insomnia during the first night in a sleep laboratory were evaluated in a double-blind, parallel-group trial comparing the effects of two doses of Sonata (5 mg and 10 mg) with placebo. Sonata 10 mg, but not 5 mg, was superior to placebo in decreasing latency to persistent sleep (LPS), a polysomnographic measure of time to onset of sleep.
Chronic Insomnia
- Non-elderly patients:
- Adult outpatients with chronic insomnia were evaluated in three double-blind, parallel-group outpatient studies, one of 2 weeks duration and two of 4 weeks duration, that compared the effects of Sonata at doses of 5 mg (in two studies), 10 mg, and 20 mg with placebo on a subjective measure of time to sleep onset (TSO). Sonata 10 mg and 20 mg were consistently superior to placebo for TSO, generally for the full duration of all three studies. Although both doses were effective, the effect was greater and more consistent for the 20-mg dose. The 5-mg dose was less consistently effective than were the 10-mg and 20-mg doses. Sleep latency with Sonata 10 mg and 20 mg was on the order of 10-20 minutes (15%-30%) less than with placebo in these studies.
- Adult outpatients with chronic insomnia were evaluated in six double-blind, parallel-group sleep laboratory studies that varied in duration from a single night up to 35 nights. Overall, these studies demonstrated a superiority of Sonata 10 mg and 20 mg over placebo in reducing LPS on the first 2 nights of treatment. At later time points in 5-, 14-, and 28-night studies, a reduction in LPS from baseline was observed for all treatment groups, including the placebo group, and thus, a significant difference between Sonata and placebo was not seen beyond 2 nights. In a 35-night study, Sonata 10 mg was significantly more effective than placebo in reducing LPS at the primary efficacy endpoint on nights 29 and 30.
- Elderly patients:
- Elderly outpatients with chronic insomnia were evaluated in two 2-week, double-blind, parallel-group outpatient studies that compared the effects of Sonata 5 mg and 10 mg with placebo on a subjective measure of time to sleep onset (TSO). Sonata at both doses was superior to placebo on TSO, generally for the full duration of both studies, with an effect size generally similar to that seen in younger persons. The 10-mg dose tended to have a greater effect in reducing TSO.
- Elderly outpatients with chronic insomnia were also evaluated in a 2-night sleep laboratory study involving doses of 5 mg and 10 mg. Both 5-mg and 10-mg doses of Sonata were superior to placebo in reducing latency to persistent sleep (LPS).
- Generally in these studies, there was a slight increase in sleep duration, compared to baseline, for all treatment groups, including placebo, and thus, a significant difference from placebo on sleep duration was not demonstrated.
Studies Pertinent to Safety Concerns for Sedative/Hypnotic Drugs
Memory Impairment
- Studies involving the exposure of normal subjects to single fixed doses of Sonata (10 mg or 20 mg) with structured assessments of short-term memory at fixed times after dosing (e.g., 1, 2, 3, 4, 5, 8, and 10 hours) generally revealed the expected impairment of short-term memory at 1 hour, the time of peak exposure to zaleplon, for both doses, with a tendency for the effect to be greater after 20 mg. Consistent with the rapid clearance of zaleplon, memory impairment was no longer present as early as 2 hours post dosing in one study, and in none of the studies after 3-4 hours. Nevertheless, spontaneous reporting of adverse events in larger premarketing clinical trials revealed a difference between Sonata and placebo in the risk of next-day amnesia (3% vs 1%), and an apparent dose-dependency for this event (see ADVERSE REACTIONS).
Sedative/Psychomotor Effects
- Studies involving the exposure of normal subjects to single fixed doses of Sonata (zaleplon) (10 mg or 20 mg) with structured assessments of sedation and psychomotor function (e.g., reaction time and subjective ratings of alertness) at fixed times after dosing (e.g., 1, 2, 3, 4, 5, 8, and 10 hours) generally revealed the expected sedation and impairment of psychomotor function at 1 hour, the time of peak exposure to zaleplon, for both doses. Consistent with the rapid clearance of zaleplon, impairment of psychomotor function was no longer present as early as 2 hours post dosing in one study, and in none of the studies after 3-4 hours. Spontaneous reporting of adverse events in larger premarketing clinical trials did not suggest a difference between Sonata and placebo in the risk of next-day somnolence (see ADVERSE REACTIONS).
Withdrawal-Emergent Anxiety and Insomnia
- During nightly use for an extended period, pharmacodynamic tolerance or adaptation to some effects of hypnotics may develop. If the drug has a short elimination half-life, it is possible that a relative deficiency of the drug or its active metabolites (i.e., in relationship to the receptor site) may occur at some point in the interval between each night's use. This sequence of events is believed to be responsible for two clinical findings reported to occur after several weeks of nightly use of other rapidly eliminated hypnotics: increased wakefulness during the last quarter of the night and the appearance of increased signs of daytime anxiety.
- Zaleplon has a short half-life and no active metabolites. At the primary efficacy endpoint (nights 29 and 30) in a 35-night sleep laboratory study, polysomnographic recordings showed that wakefulness was not significantly longer with Sonata than with placebo during the last quarter of the night. No increase in the signs of daytime anxiety was observed in clinical trials with Sonata. In two sleep laboratory studies involving 14- and 28-nightly doses of Sonata (5 mg and 10 mg in one study and 10 mg and 20 mg in the second) and structured assessments of daytime anxiety, no increases in daytime anxiety were detected. Similarly, in a pooled analysis (all the parallel-group, placebo-controlled studies) of spontaneously reported daytime anxiety, no difference was observed between Sonata and placebo.
- Rebound insomnia, defined as a dose-dependent temporary worsening in sleep parameters (latency, total sleep time, and number of awakenings) compared to baseline following discontinuation of treatment, is observed with short- and intermediate-acting hypnotics. Rebound insomnia following discontinuation of Sonata relative to baseline was examined at both nights 1 and 2 following discontinuation in three sleep laboratory studies (14, 28, and 35 nights) and five outpatient studies utilizing patient diaries (14 and 28 nights). Overall, the data suggest that rebound insomnia may be dose dependent. At 20 mg, there appeared to be both objective (polysomnographic) and subjective (diary) evidence of rebound insomnia on the first night after discontinuation of treatment with Sonata. At 5 mg and 10 mg, there was no objective and minimal subjective evidence of rebound insomnia on the first night after discontinuation of treatment with Sonata. At all doses, the rebound effect appeared to resolve by the second night following withdrawal. In the 35-night study, there was a worsening in sleep on the first night off for both the 10-mg and 20-mg groups compared to placebo, but not to baseline. This discontinuation-emergent effect was mild, had the characteristics of the return of the symptoms of chronic insomnia, and appeared to resolve by the second night after zaleplon discontinuation.
Other Withdrawal-Emergent Phenomena
- The potential for other withdrawal phenomena was also assessed in 14- to 28-night studies, including both the sleep laboratory studies and the outpatient studies, and in open-label studies of 6- and 12-month durations. The Benzodiazepine Withdrawal Symptom Questionnaire was used in several of these studies, both at baseline and then during days 1 and 2 following discontinuation. Withdrawal was operationally defined as the emergence of 3 or more new symptoms after discontinuation. Sonata was not distinguishable from placebo at doses of 5 mg, 10 mg, or 20 mg on this measure, nor was Sonata distinguishable from placebo on spontaneously reported withdrawal-emergent adverse events. There were no instances of withdrawal delirium, withdrawal associated hallucinations, or any other manifestations of severe sedative/hypnotic withdrawal.
## Nonclinical Toxicology
Carcinogenesis, Mutagenesis, and Impairment of Fertility
Carcinogenesis
- Lifetime carcinogenicity studies of zaleplon were conducted in mice and rats. Mice received doses of 25 mg/kg/day, 50 mg/kg/day, 100 mg/kg/day, and 200 mg/kg/day in the diet for two years. These doses are equivalent to 6 to 49 times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. There was a significant increase in the incidence of hepatocellular adenomas in female mice in the high dose group. Rats received doses of 1 mg/kg/day, 10 mg/kg/day, and 20 mg/kg/day in the diet for two years. These doses are equivalent to 0.5 to 10 times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. Zaleplon was not carcinogenic in rats.
Mutagenesis
- Zaleplon was clastogenic, both in the presence and absence of metabolic activation, causing structural and numerical aberrations (polyploidy and endoreduplication), when tested for chromosomal aberrations in the in vitro Chinese hamster ovary cell assay. In the in vitro human lymphocyte assay, zaleplon caused numerical, but not structural, aberrations only in the presence of metabolic activation at the highest concentrations tested. In other in vitro assays, zaleplon was not mutagenic in the Ames bacterial gene mutation assay or the Chinese hamster ovary HGPRT gene mutation assay. Zaleplon was not clastogenic in two in vivo assays, the mouse bone marrow micronucleus assay and the rat bone marrow chromosomal aberration assay, and did not cause DNA damage in the rat hepatocyte unscheduled DNA synthesis assay.
Impairment of Fertility
- In a fertility and reproductive performance study in rats, mortality and decreased fertility were associated with administration of an oral dose of zaleplon of 100 mg/kg/day to males and females prior to and during mating. This dose is equivalent to 49 times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. Follow-up studies indicated that impaired fertility was due to an effect on the female.
# Clinical Studies
There is limited information regarding Clinical Studies of Zaleplon in the drug label.
# How Supplied
- Sonata (zaleplon) capsules are supplied as follows:
## Storage
- Store at controlled room temperature, 20°C to 25°C (68°F to 77°F).
- Dispense in a light-resistant container as defined in the USP.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
Information for Patients
- A patient Medication Guide is also available for Sonata. The prescriber or health professional should instruct patients, their families, and their caregivers to read the Medication Guide and should assist them in understanding its contents. Patients should be given the opportunity to discuss the contents of the Medication Guide and to obtain answers to any questions that they may have.
SPECIAL CONCERNS "Sleep-Driving" and other complex behaviors
- There have been reports of people getting out of bed after taking a sedative hypnotic medicine and driving their cars while not fully awake, often with no memory of the event. If a patient experiences such an episode, it should be reported to his or her doctor immediately, since "sleep-driving" can be dangerous. This behavior is more likely to occur when Sonata is taken with alcohol or other central nervous system depressants (see WARNINGS). Other complex behaviors (e.g., preparing and eating food, making phone calls, or having sex) have been reported in patients who are not fully awake after taking a sleep medicine. As with sleep-driving, patients usually do not remember these events.
# Precautions with Alcohol
- Alcohol-Zaleplon interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
Sonata
# Look-Alike Drug Names
- A® — B®
# Drug Shortage Status
# Price | Zaleplon
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Deepika Beereddy, MBBS [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Zaleplon is a central nervous system agent that is FDA approved for the treatment of insomnia. Common adverse reactions include dizziness, headache.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
### Insomnia
- Sonata is indicated for the short-term treatment of insomnia. Sonata has been shown to decrease the time to sleep onset for up to 30 days in controlled clinical studies. It has not been shown to increase total sleep time or decrease the number of awakenings.
- The clinical trials performed in support of efficacy ranged from a single night to 5 weeks in duration. The final formal assessments of sleep latency were performed at the end of treatment.
- Dosing Information
- The dose of Sonata should be individualized. The recommended dose of Sonata for most nonelderly adults is 10 mg. For certain low weight individuals, 5 mg may be a sufficient dose. Although the risk of certain adverse events associated with the use of Sonata appears to be dose dependent, the 20 mg dose has been shown to be adequately tolerated and may be considered for the occasional patient who does not benefit from a trial of a lower dose. Doses above 20 mg have not been adequately evaluated and are not recommended.
- Sonata should be taken immediately before bedtime or after the patient has gone to bed and has experienced difficulty falling asleep. Taking Sonata with or immediately after a heavy, high-fat meal results in slower absorption and would be expected to reduce the effect of Sonata on sleep latency.
- Special Populations
- Elderly patients and debilitated patients appear to be more sensitive to the effects of hypnotics, and respond to 5 mg of Sonata. The recommended dose for these patients is therefore 5 mg. Doses over 10 mg are not recommended.
- Hepatic insufficiency: Patients with mild to moderate hepatic impairment should be treated with Sonata 5 mg because clearance is reduced in this population. Sonata is not recommended for use in patients with severe hepatic impairment.
- Renal insufficiency: No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
- An initial dose of 5 mg should be given to patients concomitantly taking cimetidine because zaleplon clearance is reduced in this population.
## Off-Label Use and Dosage (Adult)
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
There is limited information regarding Zaleplon FDA-Labeled Indications and Dosage (Pediatric) in the drug label.
## Off-Label Use and Dosage (Pediatric)
# Contraindications
- Hypersensitivity to zaleplon or any excipients in the formulation (see also PRECAUTIONS).
# Warnings
- Because sleep disturbances may be the presenting manifestation of a physical and/or psychiatric disorder, symptomatic treatment of insomnia should be initiated only after a careful evaluation of the patient. The failure of insomnia to remit after 7 to 10 days of treatment may indicate the presence of a primary psychiatric and/or medical illness that should be evaluated. Worsening of insomnia or the emergence of new thinking or behavior abnormalities may be the consequence of an unrecognized psychiatric or physical disorder. Such findings have emerged during the course of treatment with sedative/hypnotic drugs, including Sonata. Because some of the important adverse effects of Sonata appear to be dose-related, it is important to use the lowest possible effective dose, especially in the elderly (see ADMINISTRATION).
- A variety of abnormal thinking and behavior changes have been reported to occur in association with the use of sedative/hypnotics. Some of these changes may be characterized by decreased inhibition (e.g., aggressiveness and extroversion that seem out of character), similar to effects produced by alcohol and other CNS depressants. Other reported behavioral changes have included bizarre behavior, agitation, hallucinations, and depersonalization.
Abnormal Thinking and Behavioral Changes
- Complex behaviors such as "sleep-driving" (i.e., driving while not fully awake after ingestion of a sedative-hypnotic, with amnesia for the event) have been reported. These events can occur in sedative-hypnotic-naive as well as in sedative-hypnotic-experienced persons. Although behaviors such as sleep-driving may occur with Sonata alone at therapeutic doses, the use of alcohol and other CNS depressants with Sonata appears to increase the risk of such behaviors, as does the use of Sonata at doses exceeding the maximum recommended dose. Due to the risk to the patient and the community, discontinuation of Sonata should be strongly considered for patients who report a "sleep-driving" episode. Other complex behaviors (e.g., preparing and eating food, making phone calls, or having sex) have been reported in patients who are not fully awake after taking a sedative-hypnotic. As with sleep-driving, patients usually do not remember these events. Amnesia and other neuropsychiatric symptoms may occur unpredictably. In primarily depressed patients, worsening of depression, including suicidal thoughts and actions (including completed suicides), has been reported in association with the use of sedative/hypnotics.
- It can rarely be determined with certainty whether a particular instance of the abnormal behaviors listed above is drug induced, spontaneous in origin, or a result of an underlying psychiatric or physical disorder. Nonetheless, the emergence of any new behavioral sign or symptom of concern requires careful and immediate evaluation.
- Following rapid dose decrease or abrupt discontinuation of the use of sedative/hypnotics, there have been reports of signs and symptoms similar to those associated with withdrawal from other CNS-depressant drugs.
- Sonata, like other hypnotics, has CNS-depressant effects. Because of the rapid onset of action, Sonata should only be ingested immediately prior to going to bed or after the patient has gone to bed and has experienced difficulty falling asleep. Patients receiving Sonata should be cautioned against engaging in hazardous occupations requiring complete mental alertness or motor coordination (e.g., operating machinery or driving a motor vehicle) after ingesting the drug, including potential impairment of the performance of such activities that may occur the day following ingestion of Sonata. Sonata, as well as other hypnotics, may produce additive CNS-depressant effects when coadministered with other psychotropic medications, anticonvulsants, antihistamines, narcotic analgesics, anesthetics, ethanol, and other drugs that themselves produce CNS depression. Sonata should not be taken with alcohol. Dosage adjustment may be necessary when Sonata is administered with other CNS-depressant agents because of the potentially additive effects.
Severe anaphylactic and anaphylactoid reactions
- Rare cases of angioedema involving the tongue, glottis or larynx have been reported in patients after taking the first or subsequent doses of sedative-hypnotics, including Sonata. Some patients have had additional symptoms such as dyspnea, throat closing, or nausea and vomiting that suggest anaphylaxis. Some patients have required medical therapy in the emergency department. If angioedema involves the tongue, glottis or larynx, airway obstruction may occur and be fatal. Patients who develop angioedema after treatment with Sonata should not be rechallenged with the drug.
### Precautions
- General
Timing of Drug Administration
- Sonata should be taken immediately before bedtime or after the patient has gone to bed and has experienced difficulty falling asleep. As with all sedative/hypnotics, taking Sonata while still up and about may result in short-term memory impairment, hallucinations, impaired coordination, dizziness, and lightheadedness.
Use in the elderly and/or debilitated patients
- Impaired motor and/or cognitive performance after repeated exposure or unusual sensitivity to sedative/hypnotic drugs is a concern in the treatment of elderly and/or debilitated patients. A dose of 5 mg is recommended for elderly patients to decrease the possibility of side effects. Elderly and/or debilitated patients should be monitored closely.
Use in patients with concomitant illness
- Clinical experience with Sonata in patients with concomitant systemic illness is limited. Sonata should be used with caution in patients with diseases or conditions that could affect metabolism or hemodynamic responses.
- Although preliminary studies did not reveal respiratory depressant effects at hypnotic doses of Sonata in normal subjects, caution should be observed if Sonata (zaleplon) is prescribed to patients with compromised respiratory function, because sedative/hypnotics have the capacity to depress respiratory drive. Controlled trials of acute administration of Sonata 10 mg in patients with mild to moderate chronic obstructive pulmonary disease or moderate obstructive sleep apnea showed no evidence of alterations in blood gases or apnea/hypopnea index, respectively. However, patients with compromised respiration due to preexisting illness should be monitored carefully.
- The dose of Sonata should be reduced to 5 mg in patients with mild to moderate hepatic impairment. It is not recommended for use in patients with severe hepatic impairment.
- No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
Use in patients with depression
- As with other sedative/hypnotic drugs, Sonata should be administered with caution to patients exhibiting signs or symptoms of depression. Suicidal tendencies may be present in such patients and protective measures may be required. Intentional overdosage is more common in this group of patients (see OVERDOSAGE); therefore, the least amount of drug that is feasible should be prescribed for the patient at any one time.
- This product contains FD&C Yellow No. 5 (tartrazine) which may cause allergic-type reactions (including bronchial asthma) in certain susceptible persons. Although the overall incidence of FD&C Yellow No. 5 (tartrazine) sensitivity in the general population is low, it is frequently seen in patients who also have aspirin hypersensitivity.
Information for Patients
- A patient Medication Guide is also available for Sonata. The prescriber or health professional should instruct patients, their families, and their caregivers to read the Medication Guide and should assist them in understanding its contents. Patients should be given the opportunity to discuss the contents of the Medication Guide and to obtain answers to any questions that they may have.
SPECIAL CONCERNS "Sleep-Driving" and other complex behaviors
- There have been reports of people getting out of bed after taking a sedative hypnotic medicine and driving their cars while not fully awake, often with no memory of the event. If a patient experiences such an episode, it should be reported to his or her doctor immediately, since "sleep-driving" can be dangerous. This behavior is more likely to occur when Sonata is taken with alcohol or other central nervous system depressants (see WARNINGS). Other complex behaviors (e.g., preparing and eating food, making phone calls, or having sex) have been reported in patients who are not fully awake after taking a sleep medicine. As with sleep-driving, patients usually do not remember these events.
Laboratory Tests
- There are no specific laboratory tests recommended.
DOSAGE AND ADMINISTRATION
- The dose of Sonata should be individualized. The recommended dose of Sonata for most nonelderly adults is 10 mg. For certain low weight individuals, 5 mg may be a sufficient dose. Although the risk of certain adverse events associated with the use of Sonata appears to be dose dependent, the 20 mg dose has been shown to be adequately tolerated and may be considered for the occasional patient who does not benefit from a trial of a lower dose. Doses above 20 mg have not been adequately evaluated and are not recommended.
- Sonata should be taken immediately before bedtime or after the patient has gone to bed and has experienced difficulty falling asleep. Taking Sonata with or immediately after a heavy, high-fat meal results in slower absorption and would be expected to reduce the effect of Sonata on sleep latency.
Special Populations
- Elderly patients and debilitated patients appear to be more sensitive to the effects of hypnotics, and respond to 5 mg of Sonata. The recommended dose for these patients is therefore 5 mg. Doses over 10 mg are not recommended.
- Hepatic insufficiency: Patients with mild to moderate hepatic impairment should be treated with Sonata 5 mg because clearance is reduced in this population. Sonata is not recommended for use in patients with severe hepatic impairment.
- Renal insufficiency: No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
- An initial dose of 5 mg should be given to patients concomitantly taking cimetidine because zaleplon clearance is reduced in this population (see Drug Interactions under PRECAUTIONS).
# Adverse Reactions
## Clinical Trials Experience
- The premarketing development program for Sonata included zaleplon exposures in patients and/or normal subjects from 2 different groups of studies: approximately 900 normal subjects in clinical pharmacology/pharmacokinetic studies; and approximately 2,900 exposures from patients in placebo-controlled clinical effectiveness studies, corresponding to approximately 450 patient exposure years. The conditions and duration of treatment with Sonata varied greatly and included (in overlapping categories) open-label and double-blind phases of studies, inpatients and outpatients, and short-term or longer-term exposure. Adverse reactions were assessed by collecting adverse events, results of physical examinations, vital signs, weights, laboratory analyses, and ECGs.
- Adverse events during exposure were obtained primarily by general inquiry and recorded by clinical investigators using terminology of their own choosing. Consequently, it is not possible to provide a meaningful estimate of the proportion of individuals experiencing adverse events without first grouping similar types of events into a smaller number of standardized event categories. In the tables and tabulations that follow, COSTART terminology has been used to classify reported adverse events.
- The stated frequencies of adverse events represent the proportion of individuals who experienced, at least once, a treatment-emergent adverse event of the type listed. An event was considered treatment-emergent if it occurred for the first time or worsened while receiving therapy following baseline evaluation.
Adverse Findings Observed in Short-Term, Placebo-Controlled Trials
Adverse Events Associated With Discontinuation of Treatment
- In premarketing placebo-controlled, parallel-group phase 2 and phase 3 clinical trials, 3.1% of 744 patients who received placebo and 3.7% of 2,149 patients who received Sonata discontinued treatment because of an adverse clinical event. This difference was not statistically significant. No event that resulted in discontinuation occurred at a rate of ≥ 1%.
Adverse Events Occurring at an Incidence of 1% or More Among Sonata 20 mg-Treated Patients
- Table 1 enumerates the incidence of treatment-emergent adverse events for a pool of three 28-night and one 35-night placebo-controlled studies of Sonata at doses of 5 mg or 10 mg and 20 mg. The table includes only those events that occurred in 1% or more of patients treated with Sonata 20 mg and that had a higher incidence in patients treated with Sonata 20 mg than in placebo-treated patients.
- The prescriber should be aware that these figures cannot be used to predict the incidence of adverse events in the course of usual medical practice where patient characteristics and other factors differ from those which prevailed in the clinical trials. Similarly, the cited frequencies cannot be compared with figures obtained from other clinical investigations involving different treatments, uses, and investigators. The cited figures, however, do provide the prescribing physician with some basis for estimating the relative contribution of drug and non-drug factors to the adverse event incidence rate in the population studied.
Other Adverse Events Observed During the Premarketing Evaluation of Sonata
- Listed below are COSTART terms that reflect treatment-emergent adverse events as defined in the introduction to the ADVERSE REACTIONS section. These events were reported by patients treated with Sonata (zaleplon) at doses in a range of 5 mg/day to 20 mg/day during premarketing phase 2 and phase 3 clinical trials throughout the United States, Canada, and Europe, including approximately 2,900 patients. All reported events are included except those already listed in Table 1 or elsewhere in labeling, those events for which a drug cause was remote, and those event terms that were so general as to be uninformative. It is important to emphasize that although the events reported occurred during treatment with Sonata, they were not necessarily caused by it.
- Events are further categorized by body system and listed in order of decreasing frequency according to the following definitions: frequent adverse events are those occurring on one or more occasions in at least 1/100 patients; infrequent adverse events are those occurring in less than 1/100 patients but at least 1/1,000 patients; rare events are those occurring in fewer than 1/1,000 patients.
- Body as a whole - Frequent: back pain, chest pain, fever; Infrequent: chest pain substernal, chills, face edema, generalized edema, hangover effect, neck rigidity.
- Cardiovascular system - Frequent: migraine; Infrequent: angina pectoris, bundle branch block, hypertension, hypotension, palpitation, syncope, tachycardia, vasodilatation, ventricular extrasystoles; Rare: bigeminy, cerebral ischemia, cyanosis, pericardial effusion, postural hypotension, pulmonary embolus, sinus bradycardia, thrombophlebitis, ventricular tachycardia.
- Digestive system - Frequent: constipation, dry mouth, dyspepsia; Infrequent: eructation, esophagitis, flatulence, gastritis, gastroenteritis, gingivitis, glossitis, increased appetite, melena, mouth ulceration, rectal hemorrhage, stomatitis; Rare: aphthous stomatitis, biliary pain, bruxism, cardiospasm, cheilitis, cholelithiasis, duodenal ulcer, dysphagia, enteritis, gum hemorrhage, increased salivation, intestinal obstruction, abnormal liver function tests, peptic ulcer, tongue discoloration, tongue edema, ulcerative stomatitis.
- Endocrine system - Rare: diabetes mellitus, goiter, hypothyroidism.
- Hemic and lymphatic system - Infrequent: anemia, ecchymosis, lymphadenopathy; Rare: eosinophilia, leukocytosis, lymphocytosis, purpura.
- Metabolic and nutritional - Infrequent: edema, gout, hypercholesteremia, thirst, weight gain; Rare: bilirubinemia, hyperglycemia, hyperuricemia, hypoglycemia, hypoglycemic reaction, ketosis, lactose intolerance, AST (SGOT) increased, ALT (SGPT) increased, weight loss.
- Musculoskeletal system - Frequent: arthralgia, arthritis, myalgia; Infrequent: arthrosis, bursitis, joint disorder (mainly swelling, stiffness, and pain), myasthenia, tenosynovitis; Rare: myositis, osteoporosis.
- Nervous system - Frequent: anxiety, depression, nervousness, thinking abnormal (mainly difficulty concentrating); Infrequent: abnormal gait, agitation, apathy, ataxia, circumoral paresthesia, emotional lability, euphoria, hyperesthesia, hyperkinesia, hypotonia, incoordination, insomnia, libido decreased, neuralgia, nystagmus; Rare: CNS stimulation, delusions, dysarthria, dystonia, facial paralysis, hostility, hypokinesia, myoclonus, neuropathy, psychomotor retardation, ptosis, reflexes decreased, reflexes increased, sleep talking, sleep walking, slurred speech, stupor, trismus.
- Respiratory system - Frequent: bronchitis; Infrequent: asthma, dyspnea, laryngitis, pneumonia, snoring, voice alteration; Rare: apnea, hiccup, hyperventilation, pleural effusion, sputum increased.
- Skin and appendages - Frequent: pruritus, rash; Infrequent: acne, alopecia, contact dermatitis, dry skin, eczema, maculopapular rash, skin hypertrophy, sweating, urticaria, vesiculobullous rash; Rare: melanosis, psoriasis, pustular rash, skin discoloration.
- Special senses - Frequent: conjunctivitis, taste perversion; Infrequent: diplopia, dry eyes, photophobia, tinnitus, watery eyes; Rare: abnormality of accommodation, blepharitis, cataract specified, corneal erosion, deafness, eye hemorrhage, glaucoma, labyrinthitis, retinal detachment, taste loss, visual field defect.
- Urogenital system - Infrequent: bladder pain, breast pain, cystitis, decreased urine stream, dysuria, hematuria, impotence, kidney calculus, kidney pain, menorrhagia, metrorrhagia, urinary frequency, urinary incontinence, urinary urgency, vaginitis; Rare: albuminuria, delayed menstrual period, leukorrhea, menopause, urethritis, urinary retention, vaginal hemorrhage.
## Postmarketing Experience
- Anaphylactic/anaphylactoid reactions, including severe reactions and nightmares.
# Drug Interactions
- As with all drugs, the potential exists for interaction with other drugs by a variety of mechanisms.
CNS-Active Drugs
- Ethanol: Sonata 10 mg potentiated the CNS-impairing effects of ethanol 0.75 g/kg on balance testing and reaction time for 1 hour after ethanol administration and on the digit symbol substitution test (DSST), symbol copying test, and the variability component of the divided attention test for 2.5 hours after ethanol administration. The potentiation resulted from a CNS pharmacodynamic interaction; zaleplon did not affect the pharmacokinetics of ethanol.
- Imipramine: Coadministration of single doses of Sonata 20 mg and imipramine 75 mg produced additive effects on decreased alertness and impaired psychomotor performance for 2 to 4 hours after administration. The interaction was pharmacodynamic with no alteration of the pharmacokinetics of either drug.
- Paroxetine: Coadministration of a single dose of Sonata 20 mg and paroxetine 20 mg daily for 7 days did not produce any interaction on psychomotor performance. Additionally, paroxetine did not alter the pharmacokinetics of Sonata, reflecting the absence of a role of CYP2D6 in zaleplon's metabolism.
- Thioridazine: Coadministration of single doses of Sonata 20 mg and thioridazine 50 mg produced additive effects on decreased alertness and impaired psychomotor performance for 2 to 4 hours after administration. The interaction was pharmacodynamic with no alteration of the pharmacokinetics of either drug.
- Venlafaxine: Coadministration of a single dose of zaleplon 10 mg and multiple doses of venlafaxine ER (extended release) 150 mg did not result in any significant changes in the pharmacokinetics of either zaleplon or venlafaxine. In addition, there was no pharmacodynamic interaction as a result of coadministration of zaleplon and venlafaxine ER.
- Promethazine: Coadministration of a single dose of zaleplon and promethazine (10 and 25 mg, respectively) resulted in a 15% decrease in maximal plasma concentrations of zaleplon, but no change in the area under the plasma concentration-time curve. However, the pharmacodynamics of coadministration of zaleplon and promethazine have not been evaluated. Caution should be exercised when these 2 agents are coadministered.
Drugs That Induce CYP3A4
- Rifampin: CYP3A4 is ordinarily a minor metabolizing enzyme of zaleplon. Multiple-dose administration of the potent CYP3A4 inducer rifampin (600 mg every 24 hours, q24h, for 14 days), however, reduced zaleplon Cmax and AUC by approximately 80%. The coadministration of a potent CYP3A4 enzyme inducer, although not posing a safety concern, thus could lead to ineffectiveness of zaleplon. An alternative non-CYP3A4 substrate hypnotic agent may be considered in patients taking CYP3A4 inducers such as rifampin, phenytoin, carbamazepine, and phenobarbital.
Drugs That Inhibit CYP3A4
- CYP3A4 is a minor metabolic pathway for the elimination of zaleplon because the sum of desethylzaleplon (formed via CYP3A4 in vitro) and its metabolites, 5-oxo-desethylzaleplon and 5-oxo-desethylzaleplon glucuronide, account for only 9% of the urinary recovery of a zaleplon dose. Coadministration of single, oral doses of zaleplon with erythromycin (10 mg and 800 mg respectively), a strong, selective CYP3A4 inhibitor, produced a 34% increase in zaleplon's maximal plasma concentrations and a 20% increase in the area under the plasma concentration-time curve. The magnitude of interaction with multiple doses of erythromycin is unknown. Other strong selective CYP3A4 inhibitors such as ketoconazole can also be expected to increase the exposure of zaleplon. A routine dosage adjustment of zaleplon is not considered necessary.
Drugs That Inhibit Aldehyde Oxidase
- The aldehyde oxidase enzyme system is less well studied than the cytochrome P450 enzyme system.
- Diphenhydramine: Diphenhydramine is reported to be a weak inhibitor of aldehyde oxidase in rat liver, but its inhibitory effects in human liver are not known. There is no pharmacokinetic interaction between zaleplon and diphenhydramine following the administration of a single dose (10 mg and 50 mg, respectively) of each drug. However, because both of these compounds have CNS effects, an additive pharmacodynamic effect is possible.
Drugs That Inhibit Both Aldehyde Oxidase and CYP3A4
- Cimetidine: Cimetidine inhibits both aldehyde oxidase (in vitro) and CYP3A4 (in vitro and in vivo), the primary and secondary enzymes, respectively, responsible for zaleplon metabolism. Concomitant administration of Sonata (10 mg) and cimetidine (800 mg) produced an 85% increase in the mean Cmax and AUC of zaleplon. An initial dose of 5 mg should be given to patients who are concomitantly being treated with cimetidine (see DOSAGE AND ADMINISTRATION).
Drugs Highly Bound to Plasma Protein
- Zaleplon is not highly bound to plasma proteins (fraction bound 60%±15%); therefore, the disposition of zaleplon is not expected to be sensitive to alterations in protein binding. In addition, administration of Sonata to a patient taking another drug that is highly protein bound should not cause transient increase in free concentrations of the other drug.
Drugs with a Narrow Therapeutic Index
- Digoxin: Sonata (10 mg) did not affect the pharmacokinetic or pharmacodynamic profile of digoxin (0.375 mg q24h for 8 days).
- Warfarin: Multiple oral doses of Sonata (20 mg q24h for 13 days) did not affect the pharmacokinetics of warfarin (R+)- or (S-)-enantiomers or the pharmacodynamics (prothrombin time) following a single 25-mg oral dose of warfarin.
Drugs That Alter Renal Excretion
- Ibuprofen: Ibuprofen is known to affect renal function and, consequently, alter the renal excretion of other drugs. There was no apparent pharmacokinetic interaction between zaleplon and ibuprofen following single dose administration (10 mg and 600 mg, respectively) of each drug. This was expected because zaleplon is primarily metabolized and renal excretion of unchanged zaleplon accounts for less than 1% of the administered dose.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA): C
Pregnancy: Pregnancy Category C
- In embryofetal development studies in rats and rabbits, oral administration of up to 100 mg/kg/day and 50 mg/kg/day, respectively, to pregnant animals throughout organogenesis produced no evidence of teratogenicity. These doses are equivalent to 49 (rat) and 48 (rabbit) times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. In rats, pre- and postnatal growth was reduced in the offspring of dams receiving 100 mg/kg/day. This dose was also maternally toxic, as evidenced by clinical signs and decreased maternal body weight gain during gestation. The no-effect dose for rat offspring growth reduction was 10 mg/kg (a dose equivalent to 5 times the MRHD of 20 mg on a mg/m2 basis). No adverse effects on embryofetal development were observed in rabbits at the doses examined.
- In a pre- and postnatal development study in rats, increased stillbirth and postnatal mortality, and decreased growth and physical development, were observed in the offspring of females treated with doses of 7 mg/kg/day or greater during the latter part of gestation and throughout lactation. There was no evidence of maternal toxicity at this dose. The no-effect dose for offspring development was 1 mg/kg/day (a dose equivalent to 0.5 times the MRHD of 20 mg on a mg/m2 basis). When the adverse effects on offspring viability and growth were examined in a cross-fostering study, they appeared to result from both in utero and lactational exposure to the drug.
- There are no studies of zaleplon in pregnant women; therefore, Sonata® (zaleplon) is not recommended for use in women during pregnancy.
Pregnancy Category (AUS):
- Australian Drug Evaluation Committee (ADEC) Pregnancy Category
- There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Zaleplon in women who are pregnant.
### Labor and Delivery
- Sonata has no established use in labor and delivery.
### Nursing Mothers
- A study in lactating mothers indicated that the clearance and half-life of zaleplon is similar to that in young normal subjects. A small amount of zaleplon is excreted in breast milk, with the highest excreted amount occurring during a feeding at approximately 1 hour after Sonata administration. Since the small amount of the drug from breast milk may result in potentially important concentrations in infants, and because the effects of zaleplon on a nursing infant are not known, it is recommended that nursing mothers not take Sonata.
### Pediatric Use
- The safety and effectiveness of Sonata in pediatric patients have not been established.
### Geriatic Use
- A total of 628 patients in double-blind, placebo-controlled, parallel-group clinical trials who received Sonata were at least 65 years of age; of these, 311 received 5 mg and 317 received 10 mg. In both sleep laboratory and outpatient studies, elderly patients with insomnia responded to a 5 mg dose with a reduced sleep latency, and thus 5 mg is the recommended dose in this population. During short-term treatment (14 night studies) of elderly patients with Sonata, no adverse event with a frequency of at least 1% occurred at a significantly higher rate with either 5 mg or 10 mg Sonata than with placebo.
### Gender
- There is no FDA guidance on the use of Zaleplon with respect to specific gender populations.
### Race
- There is no FDA guidance on the use of Zaleplon with respect to specific racial populations.
### Renal Impairment
- There is no FDA guidance on the use of Zaleplon in patients with renal impairment.
### Hepatic Impairment
- There is no FDA guidance on the use of Zaleplon in patients with hepatic impairment.
### Females of Reproductive Potential and Males
- There is no FDA guidance on the use of Zaleplon in women of reproductive potentials and males.
### Immunocompromised Patients
- There is no FDA guidance one the use of Zaleplon in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
- Intravenous
### Monitoring
- There is limited information regarding Monitoring of Zaleplon in the drug label.
- Description
# IV Compatibility
- There is limited information regarding IV Compatibility of Zaleplon in the drug label.
# Overdosage
There is limited information regarding Zaleplon overdosage. If you suspect drug poisoning or overdose, please contact the National Poison Help hotline (1-800-222-1222) immediately.
# Pharmacology
## Mechanism of Action
-
## Structure
- Zaleplon is a nonbenzodiazepine hypnotic from the pyrazolopyrimidine class. The chemical name of zaleplon is N-[3-(3-cyanopyrazolo[1,5-a]pyrimidin-7-yl)phenyl]-N-ethylacetamide. Its empirical formula is C17H15N5O, and its molecular weight is 305.34. The structural formula is shown below.
- Zaleplon is a white to off-white powder that is practically insoluble in water and sparingly soluble in alcohol or propylene glycol. Its partition coefficient in octanol/water is constant (log PC = 1.23) over the pH range of 1 to 7.
- Sonata® capsules contain zaleplon as the active ingredient. Inactive ingredients consist of microcrystalline cellulose, pregelatinized starch, silicon dioxide, sodium lauryl sulfate, magnesium stearate, lactose, gelatin, titanium dioxide, D&C yellow #10, FD&C blue #1, FD&C green #3, and FD&C yellow #5.
## Pharmacodynamics
- While Sonata (zaleplon) is a hypnotic agent with a chemical structure unrelated to benzodiazepines, barbiturates, or other drugs with known hypnotic properties, it interacts with the gamma-aminobutyric acid-benzodiazepine (GABA-BZ) receptor complex. Subunit modulation of the GABA-BZ receptor chloride channel macromolecular complex is hypothesized to be responsible for some of the pharmacological properties of benzodiazepines, which include sedative, anxiolytic, muscle relaxant, and anticonvulsive effects in animal models.
- Other nonclinical studies have also shown that zaleplon binds selectively to the brain omega-1 receptor situated on the alpha subunit of the GABAA/chloride ion channel receptor complex and potentiates t-butyl-bicyclophosphorothionate (TBPS) binding. Studies of binding of zaleplon to recombinant GABAA receptors (α1β1γ2 [omega-1] and α2β1γ2 [omega-2]) have shown that zaleplon has a low affinity for these receptors, with preferential binding to the omega-1 receptor.
## Pharmacokinetics
- The pharmacokinetics of zaleplon have been investigated in more than 500 healthy subjects (young and elderly), nursing mothers, and patients with hepatic disease or renal disease. In healthy subjects, the pharmacokinetic profile has been examined after single doses of up to 60 mg and once-daily administration at 15 mg and 30 mg for 10 days. Zaleplon was rapidly absorbed with a time to peak concentration (tmax) of approximately 1 hour and a terminal-phase elimination half-life (t1/2) of approximately 1 hour. Zaleplon does not accumulate with once-daily administration and its pharmacokinetics are dose proportional in the therapeutic range.
Absorption
- Zaleplon is rapidly and almost completely absorbed following oral administration. Peak plasma concentrations are attained within approximately 1 hour after oral administration. Although zaleplon is well absorbed, its absolute bioavailability is approximately 30% because it undergoes significant presystemic metabolism.
Distribution
- Zaleplon is a lipophilic compound with a volume of distribution of approximately 1.4 L/kg following intravenous (IV) administration, indicating substantial distribution into extravascular tissues. The in vitro plasma protein binding is approximately 60%±15% and is independent of zaleplon concentration over the range of 10 ng/mL to 1000 ng/mL. This suggests that zaleplon disposition should not be sensitive to alterations in protein binding. The blood to plasma ratio for zaleplon is approximately 1, indicating that zaleplon is uniformly distributed throughout the blood with no extensive distribution into red blood cells.
Metabolism
- After oral administration, zaleplon is extensively metabolized, with less than 1% of the dose excreted unchanged in urine. Zaleplon is primarily metabolized by aldehyde oxidase to form 5-oxo-zaleplon. Zaleplon is metabolized to a lesser extent by cytochrome P450 (CYP) 3A4 to form desethylzaleplon, which is quickly converted, presumably by aldehyde oxidase, to 5-oxo-desethylzaleplon. These oxidative metabolites are then converted to glucuronides and eliminated in urine. All of zaleplon's metabolites are pharmacologically inactive.
Elimination
- After either oral or IV administration, zaleplon is rapidly eliminated with a mean t1/2 of approximately 1 hour. The oral-dose plasma clearance of zaleplon is about 3 L/h/kg and the IV zaleplon plasma clearance is approximately 1 L/h/kg. Assuming normal hepatic blood flow and negligible renal clearance of zaleplon, the estimated hepatic extraction ratio of zaleplon is approximately 0.7, indicating that zaleplon is subject to high first-pass metabolism.
- After administration of a radiolabeled dose of zaleplon, 70% of the administered dose is recovered in urine within 48 hours (71% recovered within 6 days), almost all as zaleplon metabolites and their glucuronides. An additional 17% is recovered in feces within 6 days, most as 5-oxo-zaleplon.
Effect of Food
- In healthy adults a high-fat/heavy meal prolonged the absorption of zaleplon compared to the fasted state, delaying tmax by approximately 2 hours and reducing Cmax by approximately 35%. Zaleplon AUC and elimination half-life were not significantly affected. These results suggest that the effects of Sonata on sleep onset may be reduced if it is taken with or immediately after a high-fat/heavy meal.
Special Populations
- Age: The pharmacokinetics of Sonata (zaleplon) have been investigated in three studies with elderly men and women ranging in age from 65 to 85 years. The pharmacokinetics of Sonata in elderly subjects, including those over 75 years of age, are not significantly different from those in young healthy subjects.
- Gender: There is no significant difference in the pharmacokinetics of Sonata in men and women.
- Race: The pharmacokinetics of zaleplon have been studied in Japanese subjects as representative of Asian populations. For this group, Cmax and AUC were increased 37% and 64%, respectively. This finding can likely be attributed to differences in body weight, or alternatively, may represent differences in enzyme activities resulting from differences in diet, environment, or other factors. The effects of race on pharmacokinetic characteristics in other ethnic groups have not been well characterized.
- Hepatic impairment: Zaleplon is metabolized primarily by the liver and undergoes significant presystemic metabolism. Consequently, the oral clearance of zaleplon was reduced by 70% and 87% in compensated and decompensated cirrhotic patients, respectively, leading to marked increases in mean Cmax and AUC (up to 4-fold and 7-fold in compensated and decompensated patients, respectively), in comparison with healthy subjects. The dose of Sonata should therefore be reduced in patients with mild to moderate hepatic impairment. Sonata is not recommended for use in patients with severe hepatic impairment.
- Renal impairment: Because renal excretion of unchanged zaleplon accounts for less than 1% of the administered dose, the pharmacokinetics of zaleplon are not altered in patients with renal insufficiency. No dose adjustment is necessary in patients with mild to moderate renal impairment. Sonata has not been adequately studied in patients with severe renal impairment.
Drug-Drug Interactions
- Because zaleplon is primarily metabolized by aldehyde oxidase, and to a lesser extent by CYP3A4, inhibitors of these enzymes might be expected to decrease zaleplon's clearance and inducers of these enzymes might be expected to increase its clearance. Zaleplon has been shown to have minimal effects on the kinetics of warfarin (both R- and S- forms), imipramine, ethanol, ibuprofen, diphenhydramine, thioridazine, and digoxin. However, the effects of zaleplon on inhibition of enzymes involved in the metabolism of other drugs have not been studied.
Clinical Trials
Controlled Trials Supporting Effectiveness
- Sonata (typically administered in doses of 5 mg, 10 mg, or 20 mg) has been studied in patients with chronic insomnia (n = 3,435) in 12 placebo- and active-drug-controlled trials. Three of the trials were in elderly patients (n = 1,019). It has also been studied in transient insomnia (n = 264). Because of its very short half-life, studies focused on decreasing sleep latency, with less attention to duration of sleep and number of awakenings, for which consistent differences from placebo were not demonstrated. Studies were also carried out to examine the time course of effects on memory and psychomotor function, and to examine withdrawal phenomena.
Transient Insomnia
- Normal adults experiencing transient insomnia during the first night in a sleep laboratory were evaluated in a double-blind, parallel-group trial comparing the effects of two doses of Sonata (5 mg and 10 mg) with placebo. Sonata 10 mg, but not 5 mg, was superior to placebo in decreasing latency to persistent sleep (LPS), a polysomnographic measure of time to onset of sleep.
Chronic Insomnia
- Non-elderly patients:
- Adult outpatients with chronic insomnia were evaluated in three double-blind, parallel-group outpatient studies, one of 2 weeks duration and two of 4 weeks duration, that compared the effects of Sonata at doses of 5 mg (in two studies), 10 mg, and 20 mg with placebo on a subjective measure of time to sleep onset (TSO). Sonata 10 mg and 20 mg were consistently superior to placebo for TSO, generally for the full duration of all three studies. Although both doses were effective, the effect was greater and more consistent for the 20-mg dose. The 5-mg dose was less consistently effective than were the 10-mg and 20-mg doses. Sleep latency with Sonata 10 mg and 20 mg was on the order of 10-20 minutes (15%-30%) less than with placebo in these studies.
- Adult outpatients with chronic insomnia were evaluated in six double-blind, parallel-group sleep laboratory studies that varied in duration from a single night up to 35 nights. Overall, these studies demonstrated a superiority of Sonata 10 mg and 20 mg over placebo in reducing LPS on the first 2 nights of treatment. At later time points in 5-, 14-, and 28-night studies, a reduction in LPS from baseline was observed for all treatment groups, including the placebo group, and thus, a significant difference between Sonata and placebo was not seen beyond 2 nights. In a 35-night study, Sonata 10 mg was significantly more effective than placebo in reducing LPS at the primary efficacy endpoint on nights 29 and 30.
- Elderly patients:
- Elderly outpatients with chronic insomnia were evaluated in two 2-week, double-blind, parallel-group outpatient studies that compared the effects of Sonata 5 mg and 10 mg with placebo on a subjective measure of time to sleep onset (TSO). Sonata at both doses was superior to placebo on TSO, generally for the full duration of both studies, with an effect size generally similar to that seen in younger persons. The 10-mg dose tended to have a greater effect in reducing TSO.
- Elderly outpatients with chronic insomnia were also evaluated in a 2-night sleep laboratory study involving doses of 5 mg and 10 mg. Both 5-mg and 10-mg doses of Sonata were superior to placebo in reducing latency to persistent sleep (LPS).
- Generally in these studies, there was a slight increase in sleep duration, compared to baseline, for all treatment groups, including placebo, and thus, a significant difference from placebo on sleep duration was not demonstrated.
Studies Pertinent to Safety Concerns for Sedative/Hypnotic Drugs
Memory Impairment
- Studies involving the exposure of normal subjects to single fixed doses of Sonata (10 mg or 20 mg) with structured assessments of short-term memory at fixed times after dosing (e.g., 1, 2, 3, 4, 5, 8, and 10 hours) generally revealed the expected impairment of short-term memory at 1 hour, the time of peak exposure to zaleplon, for both doses, with a tendency for the effect to be greater after 20 mg. Consistent with the rapid clearance of zaleplon, memory impairment was no longer present as early as 2 hours post dosing in one study, and in none of the studies after 3-4 hours. Nevertheless, spontaneous reporting of adverse events in larger premarketing clinical trials revealed a difference between Sonata and placebo in the risk of next-day amnesia (3% vs 1%), and an apparent dose-dependency for this event (see ADVERSE REACTIONS).
Sedative/Psychomotor Effects
- Studies involving the exposure of normal subjects to single fixed doses of Sonata (zaleplon) (10 mg or 20 mg) with structured assessments of sedation and psychomotor function (e.g., reaction time and subjective ratings of alertness) at fixed times after dosing (e.g., 1, 2, 3, 4, 5, 8, and 10 hours) generally revealed the expected sedation and impairment of psychomotor function at 1 hour, the time of peak exposure to zaleplon, for both doses. Consistent with the rapid clearance of zaleplon, impairment of psychomotor function was no longer present as early as 2 hours post dosing in one study, and in none of the studies after 3-4 hours. Spontaneous reporting of adverse events in larger premarketing clinical trials did not suggest a difference between Sonata and placebo in the risk of next-day somnolence (see ADVERSE REACTIONS).
Withdrawal-Emergent Anxiety and Insomnia
- During nightly use for an extended period, pharmacodynamic tolerance or adaptation to some effects of hypnotics may develop. If the drug has a short elimination half-life, it is possible that a relative deficiency of the drug or its active metabolites (i.e., in relationship to the receptor site) may occur at some point in the interval between each night's use. This sequence of events is believed to be responsible for two clinical findings reported to occur after several weeks of nightly use of other rapidly eliminated hypnotics: increased wakefulness during the last quarter of the night and the appearance of increased signs of daytime anxiety.
- Zaleplon has a short half-life and no active metabolites. At the primary efficacy endpoint (nights 29 and 30) in a 35-night sleep laboratory study, polysomnographic recordings showed that wakefulness was not significantly longer with Sonata than with placebo during the last quarter of the night. No increase in the signs of daytime anxiety was observed in clinical trials with Sonata. In two sleep laboratory studies involving 14- and 28-nightly doses of Sonata (5 mg and 10 mg in one study and 10 mg and 20 mg in the second) and structured assessments of daytime anxiety, no increases in daytime anxiety were detected. Similarly, in a pooled analysis (all the parallel-group, placebo-controlled studies) of spontaneously reported daytime anxiety, no difference was observed between Sonata and placebo.
- Rebound insomnia, defined as a dose-dependent temporary worsening in sleep parameters (latency, total sleep time, and number of awakenings) compared to baseline following discontinuation of treatment, is observed with short- and intermediate-acting hypnotics. Rebound insomnia following discontinuation of Sonata relative to baseline was examined at both nights 1 and 2 following discontinuation in three sleep laboratory studies (14, 28, and 35 nights) and five outpatient studies utilizing patient diaries (14 and 28 nights). Overall, the data suggest that rebound insomnia may be dose dependent. At 20 mg, there appeared to be both objective (polysomnographic) and subjective (diary) evidence of rebound insomnia on the first night after discontinuation of treatment with Sonata. At 5 mg and 10 mg, there was no objective and minimal subjective evidence of rebound insomnia on the first night after discontinuation of treatment with Sonata. At all doses, the rebound effect appeared to resolve by the second night following withdrawal. In the 35-night study, there was a worsening in sleep on the first night off for both the 10-mg and 20-mg groups compared to placebo, but not to baseline. This discontinuation-emergent effect was mild, had the characteristics of the return of the symptoms of chronic insomnia, and appeared to resolve by the second night after zaleplon discontinuation.
Other Withdrawal-Emergent Phenomena
- The potential for other withdrawal phenomena was also assessed in 14- to 28-night studies, including both the sleep laboratory studies and the outpatient studies, and in open-label studies of 6- and 12-month durations. The Benzodiazepine Withdrawal Symptom Questionnaire was used in several of these studies, both at baseline and then during days 1 and 2 following discontinuation. Withdrawal was operationally defined as the emergence of 3 or more new symptoms after discontinuation. Sonata was not distinguishable from placebo at doses of 5 mg, 10 mg, or 20 mg on this measure, nor was Sonata distinguishable from placebo on spontaneously reported withdrawal-emergent adverse events. There were no instances of withdrawal delirium, withdrawal associated hallucinations, or any other manifestations of severe sedative/hypnotic withdrawal.
## Nonclinical Toxicology
Carcinogenesis, Mutagenesis, and Impairment of Fertility
Carcinogenesis
- Lifetime carcinogenicity studies of zaleplon were conducted in mice and rats. Mice received doses of 25 mg/kg/day, 50 mg/kg/day, 100 mg/kg/day, and 200 mg/kg/day in the diet for two years. These doses are equivalent to 6 to 49 times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. There was a significant increase in the incidence of hepatocellular adenomas in female mice in the high dose group. Rats received doses of 1 mg/kg/day, 10 mg/kg/day, and 20 mg/kg/day in the diet for two years. These doses are equivalent to 0.5 to 10 times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. Zaleplon was not carcinogenic in rats.
Mutagenesis
- Zaleplon was clastogenic, both in the presence and absence of metabolic activation, causing structural and numerical aberrations (polyploidy and endoreduplication), when tested for chromosomal aberrations in the in vitro Chinese hamster ovary cell assay. In the in vitro human lymphocyte assay, zaleplon caused numerical, but not structural, aberrations only in the presence of metabolic activation at the highest concentrations tested. In other in vitro assays, zaleplon was not mutagenic in the Ames bacterial gene mutation assay or the Chinese hamster ovary HGPRT gene mutation assay. Zaleplon was not clastogenic in two in vivo assays, the mouse bone marrow micronucleus assay and the rat bone marrow chromosomal aberration assay, and did not cause DNA damage in the rat hepatocyte unscheduled DNA synthesis assay.
Impairment of Fertility
- In a fertility and reproductive performance study in rats, mortality and decreased fertility were associated with administration of an oral dose of zaleplon of 100 mg/kg/day to males and females prior to and during mating. This dose is equivalent to 49 times the maximum recommended human dose (MRHD) of 20 mg on a mg/m2 basis. Follow-up studies indicated that impaired fertility was due to an effect on the female.
# Clinical Studies
There is limited information regarding Clinical Studies of Zaleplon in the drug label.
# How Supplied
- Sonata (zaleplon) capsules are supplied as follows:
## Storage
- Store at controlled room temperature, 20°C to 25°C (68°F to 77°F).
- Dispense in a light-resistant container as defined in the USP.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
Information for Patients
- A patient Medication Guide is also available for Sonata. The prescriber or health professional should instruct patients, their families, and their caregivers to read the Medication Guide and should assist them in understanding its contents. Patients should be given the opportunity to discuss the contents of the Medication Guide and to obtain answers to any questions that they may have.
SPECIAL CONCERNS "Sleep-Driving" and other complex behaviors
- There have been reports of people getting out of bed after taking a sedative hypnotic medicine and driving their cars while not fully awake, often with no memory of the event. If a patient experiences such an episode, it should be reported to his or her doctor immediately, since "sleep-driving" can be dangerous. This behavior is more likely to occur when Sonata is taken with alcohol or other central nervous system depressants (see WARNINGS). Other complex behaviors (e.g., preparing and eating food, making phone calls, or having sex) have been reported in patients who are not fully awake after taking a sleep medicine. As with sleep-driving, patients usually do not remember these events.
# Precautions with Alcohol
- Alcohol-Zaleplon interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
Sonata
# Look-Alike Drug Names
- A® — B®[1]
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Zaleplon | |
24e07e9a3e5c6558fe90fdd12ff8f3caafd6470c | wikidoc | Zileuton | Zileuton
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Zileuton is a leukotriene synthesis inhibitor that is FDA approved for the treatment of asthma in adults and children 12 years of age and older. Common adverse reactions include sinusitis, nausea, and pharyngolaryngeal pain.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
# Indications
- ZYFLO CR is indicated for the prophylaxis and chronic treatment of asthma in adults.
- ZYFLO CR is not indicated for use in the reversal of bronchospasm in acute asthma attacks. Therapy with ZYFLO CR can be continued during acute exacerbations of asthma.
# Dosage
- The recommended dosage of ZYFLO CR for the treatment of patients with asthma is two 600 mg extended-release tablets twice daily, within one hour after morning and evening meals, for a total daily dose of 2400 mg. Tablets should not be chewed, cut or crushed. If a dose is missed, the patient should take the next dose at the scheduled time and not double the dose. Assess hepatic function enzymes prior to initiation of ZYFLO CR and periodically during treatment.
# DOSAGE FORMS AND STRENGTHS
- Extended-release tablets, 600 mg
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Zileuton in adult patients.
### Non–Guideline-Supported Use
- There is limited information regarding Off-Label Non–Guideline-Supported Use of Zileuton in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
# Indications
- ZYFLO CR is indicated for the prophylaxis and chronic treatment of asthma in 12 years of age and older.
- ZYFLO CR is not indicated for use in the reversal of bronchospasm in acute asthma attacks. Therapy with ZYFLO CR can be continued during acute exacerbations of asthma.
# Dosage
- The recommended dosage of ZYFLO CR for the treatment of patients with asthma is two 600 mg extended-release tablets twice daily, within one hour after morning and evening meals, for a total daily dose of 2400 mg. Tablets should not be chewed, cut or crushed. If a dose is missed, the patient should take the next dose at the scheduled time and not double the dose. Assess hepatic function enzymes prior to initiation of ZYFLO CR and periodically during treatment.
# DOSAGE FORMS AND STRENGTHS
- Extended-release tablets, 600 mg
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Zileuton in pediatric patients.
### Non–Guideline-Supported Use
- There is limited information regarding Off-Label Non–Guideline-Supported Use of Zileuton in pediatric patients.
# Contraindications
The use of ZYFLO CR is contraindicated in patients with:
- Active liver disease or persistent hepatic function enzyme elevations greater than or equal to 3 times the upper limit of normal (≥3×ULN).
- A history of allergic reaction to zileuton or any of the ingredients of ZYFLO CR (e.g., rash, eosinophilia, etc.).
# Warnings
Hepatotoxicity
- Elevations of one or more hepatic function enzymes and bilirubin may occur during ZYFLO CR therapy. These laboratory abnormalities may progress to clinically significant liver injury, remain unchanged, or resolve with continued treatment, usually within three weeks. The ALT (SGPT) test is considered the most sensitive indicator of liver injury for ZYFLO CR.
- Assess hepatic function enzymes prior to initiation of, and during therapy with, ZYFLO CR. Assess serum ALT before treatment begins, once a month for the first 3 months, every 2-3 months for the remainder of the first year, and periodically thereafter for patients receiving long-term ZYFLO CR therapy. If clinical signs and/or symptoms of liver dysfunction develop (e.g., right upper quadrant pain, nausea, fatigue, lethargy, pruritus, jaundice, or "flu-like" symptoms) or transaminase elevations ≥5×ULN occur, discontinue ZYFLO CR and follow hepatic function enzymes until normal.
- In controlled and open-label clinical studies involving more than 5000 patients treated with zileuton immediate-release tablets, the overall rate of ALT elevation ≥3×ULN was 3.2%. In these trials, one patient developed symptomatic hepatitis with jaundice, which resolved upon discontinuation of therapy. An additional 3 patients with transaminase elevations developed mild hyperbilirubinemia that was less than 3×ULN. There was no evidence of hypersensitivity or other alternative etiologies for these findings.
- Since treatment with ZYFLO CR may result in increased hepatic function enzymes and liver injury, ZYFLO CR should be used with caution in patients who consume substantial quantities of alcohol and/or have a past history of liver disease.
Neuropsychiatric Events
- Neuropsychiatric events have been reported in adult and adolescent patients taking zileuton, the active ingredient in ZYFLO CR and zileuton immediate-release tablets. Post-marketing reports with zileuton include sleep disorders and behavior changes. The clinical details of some post-marketing reports involving zileuton appear consistent with a drug-induced effect. Patients and prescribers should be alert for neuropsychiatric events. Patients should be instructed to notify their prescriber if these changes occur. Prescribers should carefully evaluate the risks and benefits of continuing treatment with ZYFLO CR if such events occur.
# Adverse Reactions
## Clinical Trials Experience
- Hepatotoxicity: Elevations of one or more hepatic function enzymes and bilirubin may occur during ZYFLO CR therapy.
- The most commonly occurring adverse reactions (≥5%) with ZYFLO CR are sinusitis, nausea, and pharyngolaryngeal pain.
Short-Term Clinical Studies Experience
- The safety data described below reflect exposure to ZYFLO CR in 199 patients for 12 weeks duration. In a 12-week, randomized, double-blind, placebo-controlled trial in adults and adolescents 12 years of age and older with asthma, patients received ZYFLO CR two 600 mg tablets (n=199) or placebo (n=198) twice daily by mouth. Eighty-three percent of patients were white, 48% were male, and the mean age was 34 years.
- Because clinical studies are conducted under widely varying conditions, adverse reaction rates observed in the clinical studies of a drug cannot be directly compared to rates in the clinical studies of another drug and may not reflect the rates observed in practice.
- The most commonly reported adverse reactions (occurring at a frequency of ≥5%) in ZYFLO CR-treated patients and at a frequency greater than placebo-treated patients are reflected in Table 1.
- Less common adverse reactions occurring at a frequency ≥1% and more often in the ZYFLO CR group than in the placebo group included gastrointestinal disorders (upper abdominal pain, diarrhea, dyspepsia, vomiting, rash, hypersensitivity, and hepatotoxicity.
- There were no differences in the incidence of adverse reactions based upon gender. The clinical trials did not include sufficient numbers of patients <18 years of age or non-Caucasians to determine whether there is any difference in adverse reactions based upon age or race.
Hepatotoxicity
- In the 12-week placebo-controlled trial, the incidence of ALT elevations (≥3×ULN) was 2.5% (5 of 199) in the ZYFLO CR group, compared to 0.5% (1 of 198) in the placebo group. In the ZYFLO CR group, the majority of ALT elevations (60%) occurred in the first month of treatment, and in 2 of the 5 patients in the ZYFLO CR group, ALT elevations were detected 14 days after completion of the 3-month study treatment. The levels returned to <2×ULN or normal within 9 and 12 days, respectively. The ALT elevations in the other 3 patients were observed to return to <2×ULN or normal within 15, 19, and 31 days after ZYFLO CR discontinuation. There appeared to be no clinically relevant relationship between the time of onset and the magnitude of the first elevation or the magnitude of first elevation and time to resolution. The hepatic function enzyme elevations attributed to ZYFLO CR did not result in any cases of jaundice, development of chronic liver disease, or death in this clinical trial.
Long-Term Clinical Studies Experience
- The safety of ZYFLO CR was evaluated in one 6-month, randomized, double-blind, placebo-controlled clinical trial in adults and adolescents 12 years of age and older with asthma. Patients received two 600 mg ZYFLO CR tablets (n=619) or placebo (n=307) twice daily by mouth along with usual asthma care. Eighty-six percent of patients were white, 40% were male, and the overall mean age was 36.
- The rate and type of adverse reactions observed in this study were comparable to the adverse reactions observed in the 12-week study. Other commonly reported adverse reactions (occurring at a frequency of ≥5%) in ZYFLO CR-treated patients and at a frequency greater than placebo-treated patients included the following: headache (23%), upper respiratory tract infection (9%), myalgia (7%), and diarrhea (5%) compared to 21%, 7%, 5% and 2%, respectively, in the placebo-treated group.
- ALT elevations (≥3×ULN) were observed in 1.8% of patients treated with ZYFLO CR compared to 0.7% in patients treated with placebo. The majority of elevations (82%) were reported within the first 3 months of treatment and resolved within 21 days for most of these patients after discontinuation of the drug. The hepatic function enzyme elevations attributed to ZYFLO CR did not result in any cases of jaundice, development of chronic liver disease, or death in this clinical trial.
- Occurrences of low white blood cell (WBC) count (<3.0 × 109/L) were observed in 2.6% (15 of 619) of the ZYFLO CR-treated patients and in 1.7% (5 of 307) of the placebo-treated patients. The WBC counts returned to normal or baseline following discontinuation of ZYFLO CR. The clinical significance of these findings is not known.
## Postmarketing Experience
- The following adverse reactions have been identified during post-approval use of zileuton immediate-release tablets and may be applicable to ZYFLO CR. Because these reactions are reported voluntarily from a population of uncertain size, it is not always possible to reliably estimate their frequency or establish a causal relationship.
- Cases of severe hepatic injury have been reported in patients taking zileuton immediate-release tablets. These cases included death, life-threatening liver injury with recovery, symptomatic jaundice, hyperbilirubinemia, and elevations of ALT >8×ULN.
- Cases of sleep disorders and behavior changes have also been reported
# Drug Interactions
- The following study results were obtained using zileuton immediate-release tablets but the conclusions also apply to ZYFLO CR.
Theophylline
- In a drug-interaction study in 16 healthy subjects, co-administration of multiple doses of zileuton immediate-release tablets (800 mg every 12 hours) and theophylline (200 mg every 6 hours) for 5 days resulted in a significant decrease (approximately 50%) in steady-state clearance of theophylline, an approximate doubling of theophylline AUC, and an increase in theophylline Cmax (by 73%). The elimination half-life of theophylline was increased by 24%. Also, during co-administration, theophylline-related adverse reactions were observed more frequently than after theophylline alone. Upon initiation of ZYFLO CR in patients receiving theophylline, the theophylline dosage should be reduced by approximately one-half and plasma theophylline concentrations monitored. Similarly, when initiating therapy with theophylline in a patient receiving ZYFLO CR, the maintenance dose and/or dosing interval of theophylline should be adjusted accordingly and guided by serum theophylline determinations.
Warfarin
- Concomitant administration of multiple doses of zileuton immediate-release tablets (600 mg every 6 hours) and warfarin (fixed daily dose obtained by titration in each subject) to 30 healthy male subjects resulted in a 15% decrease in R-warfarin clearance and an increase in AUC of 22%. The pharmacokinetics of S-warfarin were not affected. These pharmacokinetic changes were accompanied by a clinically significant increase in prothrombin times. Monitoring of prothrombin time, or other suitable coagulation tests, with the appropriate dose titration of warfarin is recommended in patients receiving concomitant ZYFLO CR and warfarin therapy.
Propranolol
- Co-administration of zileuton immediate-release tablets and propranolol results in a significant increase in propranolol concentrations. Administration of a single 80 mg dose of propranolol in 16 healthy male subjects who received zileuton immediate-release tablets 600 mg every 6 hours for 5 days resulted in a 42% decrease in propranolol clearance. This resulted in an increase in propranolol Cmax, AUC, and elimination half-life by 52%, 104%, and 25%, respectively. There was an increase in β-blockade as shown by a decrease in heart rate associated with the co-administration of these drugs. Patients concomitantly on ZYFLO CR and propranolol should be closely monitored and the dose of propranolol reduced as necessary. No formal drug-drug interaction studies between zileuton and other beta-adrenergic blocking agents (i.e., β-blockers) have been conducted. It is reasonable to employ appropriate clinical monitoring when these drugs are co-administered with ZYFLO CR.
Other Concomitant Drug Therapy
- Drug-drug interaction studies conducted in healthy subjects between zileuton immediate-release tablets and prednisone and ethinyl estradiol (oral contraceptive), drugs known to be metabolized by the CYP3A4 isoenzyme, have shown no significant interaction. However, no formal drug-drug interaction studies between zileuton and CYP3A4 inhibitors, such as ketaconazole, have been conducted. It is reasonable to employ appropriate clinical monitoring when these drugs are co-administered with ZYFLO CR.
- Drug-drug interaction studies in healthy subjects have been conducted with zileuton immediate-release tablets and digoxin, phenytoin, sulfasalazine, and naproxen. There was no significant interaction between zileuton and any of these drugs.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
Pregnancy Category C:
- Developmental studies indicated adverse effects (reduced body weight and increased skeletal variations) in rats at an oral dose of 300 mg/kg/day (providing greater than 10 times the systemic exposure achieved at the maximum recommended human daily oral dose). Comparative systemic exposure is based on measurements in nonpregnant female rats at a similar dosage. Zileuton and/or its metabolites cross the placental barrier of rats. Three of 118 (2.5%) rabbit fetuses had cleft palates at an oral dose of 150 mg/kg/day (equivalent to the maximum recommended human daily oral dose on a mg/m2 basis). There are no adequate and well-controlled studies in pregnant women. ZYFLO CR should be used during pregnancy only if the potential benefit justifies the potential risk to the fetus.
Pregnancy Category (AUS):
- There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Zileuton in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Zileuton during labor and delivery.
### Nursing Mothers
- Zileuton and/or its metabolites are excreted in rat milk. It is not known if zileuton is excreted in human milk. Because many drugs are excreted in human milk, and because of the potential for tumorigenicity shown for zileuton in animal studies, a decision should be made whether to discontinue nursing or to discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
- The safety and effectiveness of ZYFLO CR in pediatric patients under 12 years of age have not been established. FDA has not required pediatric studies in patients under the age of 12 years due to the risk of hepatotoxicity. ZYFLO CR is not appropriate for children less than 12 years of age.
### Geriatic Use
- Subgroup analysis of controlled and open-label clinical studies with zileuton immediate-release tablets suggests that females ≥65 years of age appear to be at increased risk of ALT elevations. In ZYFLO CR placebo-controlled studies there were no discernable trends in ALT elevations noted in subset analyses for patients ≥65 years of age, although the database may not have been sufficiently large to detect a trend.
### Gender
There is no FDA guidance on the use of Zileuton with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Zileuton with respect to specific racial populations.
### Renal Impairment
- Dosing adjustment in patients with renal dysfunction or patients undergoing hemodialysis is not necessary
### Hepatic Impairment
- ZYFLO CR is contraindicated in patients with active liver disease or persistent ALT elevations ≥3×ULN
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Zileuton in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Zileuton in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
- There is limited information regarding Monitoring of Zileuton in the drug label.
# IV Compatibility
- There is limited information regarding IV Compatibility of Zileuton in the drug label.
# Overdosage
- Human experience of acute overdose with zileuton is limited. A patient in a clinical study took between 6.6 and 9.0 grams of zileuton immediate-release tablets in a single dose. Vomiting was induced and the patient recovered without sequelae. Zileuton is not removed by dialysis. Should an overdose occur, the patient should be treated symptomatically and supportive measures instituted as required. If indicated, elimination of unabsorbed drug should be achieved by emesis or gastric lavage; usual precautions should be observed to maintain the airway. A Certified Poison Control Center should be consulted for up-to-date information on management of overdose with ZYFLO CR.
- The oral minimum lethal doses in mice and rats were 500-4000 and 300-1000 mg/kg, respectively (providing greater than 3 and 9 times the systemic exposure achieved at the maximum recommended human daily oral dose, respectively). In dogs, at an oral dose of 1000 mg/kg (providing in excess of 12 times the systemic exposure achieved at the maximum recommended human daily oral dose) no deaths occurred but nephritis was reported.
# Pharmacology
## Mechanism of Action
- Zileuton is an inhibitor of 5-lipoxygenase and thus inhibits leukotriene (LTB4, LTC4, LTD4 and LTE4) formation. Both the R(+) and S(-) enantiomers are pharmacologically active as 5-lipoxygenase inhibitors in in vitro and in vivo systems. Leukotrienes are substances that induce numerous biological effects including augmentation of neutrophil and eosinophil migration, neutrophil and monocyte aggregation, leukocyte adhesion, increased capillary permeability, and smooth muscle contraction. These effects contribute to inflammation, edema, mucus secretion, and bronchoconstriction in the airways of asthmatic patients. LTB4, a chemoattractant for neutrophils and eosinophils, and cysteinyl leukotrienes (LTC4, LTD4, LTE4) can be measured in a number of biological fluids including bronchoalveolar lavage fluid (BALF), blood, urine and sputum from asthmatic patients.
- Zileuton is an orally active inhibitor of ex vivo LTB4 formation in several species, including mice, rats, rabbits, dogs, sheep, and monkeys. Zileuton inhibits arachidonic acid-induced ear edema in mice, neutrophil migration in mice in response to polyacrylamide gel, and eosinophil migration into the lungs of antigen-challenged sheep. In a mouse model of allergic inflammation, zileuton inhibited neutrophil and eosinophil influx, reduced the levels of multiple cytokines in the BALF, and reduced serum IgE levels. Zileuton inhibits leukotriene-dependent smooth muscle contractions in vitro in guinea pig and human airways. The compound inhibits leukotriene-dependent bronchospasm in antigen and arachidonic acid-challenged guinea pigs. In antigen-challenged sheep, zileuton inhibits late-phase bronchoconstriction and airway hyperreactivity. The clinical relevance of these findings is
## Structure
- Zileuton is an orally active inhibitor of 5-lipoxygenase, the enzyme that catalyzes the formation of leukotrienes from arachidonic acid. Zileuton has the chemical name (±)-1-(1-Benzothien-2-ylethyl)-1-hydroxyurea and the following chemical structure:
- Zileuton has the molecular formula C 11H 12N 2O 2S and a molecular weight of 236.29. It is a racemic mixture (50:50) of R(+) and S(-) enantiomers. Zileuton is a practically odorless, white, crystalline powder that is soluble in methanol and ethanol, slightly soluble in acetonitrile, and practically insoluble in water and hexane. The melting point ranges from 144.2°C to 145.2°C.
- ZYFLO CR (zileuton) extended-release tablets for oral administration are triple-layer tablets comprised of an immediate-release layer, a middle (barrier) layer, and an extended-release layer. ZYFLO CR tablets are oblong, film-coated tablets with one red layer between two white layers, debossed on one side with "CT2". Each tablet contains 600 mg of zileuton and the following inactive ingredients: crospovidone, ferric oxide, glyceryl behenate, hydroxypropyl cellulose, hypromellose, magnesium stearate, mannitol, microcrystalline cellulose, povidone, pregelatinized starch, propylene glycol, sodium starch glycolate, and talc.
## Pharmacodynamics
- Zileuton is an orally active inhibitor of ex vivo LTB4 formation in humans. The inhibition of LTB4 formation in whole blood is directly related to zileuton plasma levels. In patients with asthma, the IC50 is estimated to be 0.46 µg/mL, and maximum inhibition ≥80% is reached at a zileuton concentration of 2 µg/mL. In patients with asthma receiving zileuton immediate-release tablets 600 mg four times daily, peak plasma levels averaging 5.9 µg/mL were associated with a mean LTB4 inhibition of 98%. Zileuton inhibits the synthesis of cysteinyl leukotrienes as demonstrated by reduced urinary LTE4 levels.
## Pharmacokinetics
- Information on the pharmacokinetics of zileuton following the administration of zileuton immediate-release tablets is available in healthy subjects. The results of two clinical pharmacology studies using ZYFLO CR are described below.
Absorption
- A three-way crossover study was conducted in healthy male and female subjects (n=23) with a mean age of 33 (range 20-55) following single dose of 1200 mg (2 × 600 mg) ZYFLO CR tablets under fasted and fed conditions, and two doses of 600 mg zileuton immediate-release tablets every 6 hours under fasted conditions. Food increased the peak mean plasma concentrations (Cmax) and the mean extent of absorption (AUC) of ZYFLO CR by 18 and 34%, respectively, and prolonged Tmax from 2.1 hours to 4.3 hours. The relative bioavailability of ZYFLO CR to zileuton immediate-release tablets with respect to Cmax and AUC under fasted conditions were 0.39 (90% CI: 0.36, 0.43) and 0.57 (90% CI: 0.52, 0.62), respectively. Similarly, relative bioavailability of ZYFLO CR to zileuton immediate-release tablets with respect to Cmax and AUC under fed conditions were 0.45 (90% CI: 0.41, 0.49) and 0.76 (90% CI: 0.70, 0.83), respectively.
- A three-way crossover study was conducted in healthy male and female subjects (n=24) with a mean age of 35 (range 19-56) following multiple doses of 1200 mg (2 × 600 mg) ZYFLO CR tablets administered every 12 hours under fasted and fed conditions, and 600 mg zileuton immediate-release tablets every 6 hours under fed conditions until steady state zileuton levels were achieved. Food increased AUC and Cmin of ZYFLO CR by 43% and 170%, respectively, but had no effect on Cmax. Therefore, ZYFLO CR is recommended to be administered with food. At steady state, relative bioavailability of ZYFLO CR to zileuton immediate-release tablets with respect to Cmax, Cmin, and AUC were 0.65 (90% CI: 0.60, 0.71), 1.05 (90% CI: 0.88, 1.25) and 0.85 (90% CI: 0.78, 0.92) respectively. These data indicate that at steady state under fed conditions the Cmax of ZYFLO CR is about 35% lower than that of zileuton immediate-release tablets but the Cmin and AUC are similar for both formulations.
Distribution
- The apparent volume of distribution (V/F) of zileuton is approximately 1.2 L/kg. Zileuton is 93% bound to plasma proteins, primarily to albumin, with minor binding to α1‑acid glycoprotein.
Elimination
- Elimination of zileuton is predominantly via metabolism with a mean terminal half-life of 3.2 hours. Apparent oral clearance (CL/F) of zileuton is 669 mL/min. Zileuton activity is primarily due to the parent drug. Studies with radiolabeled drug have demonstrated that orally administered zileuton is well absorbed into the systemic circulation with 94.5% and 2.2% of the radiolabeled dose recovered in urine and feces, respectively.
Metabolism
- In vitro studies utilizing human liver microsomes have shown that zileuton and its N-dehydroxylated metabolite can be oxidatively metabolized by CYP1A2, CYP2C9 and CYP3A4.
- Several zileuton metabolites have been identified in human plasma and urine. These include two diastereomeric O-glucuronide conjugates (major metabolites) and an N-dehydroxylated metabolite (A-66193) of zileuton. The urinary excretion of the inactive A-66193 metabolite and unchanged zileuton each accounted for less than 0.5% of the single radiolabeled dose. Multiple doses of 1200 mg ZYFLO CR twice daily resulted in peak plasma levels of 4.9 µg/mL of the inactive metabolite A-66193 with an AUC of 93 µg∙hr/mL, showing large inter-subject variability. This inactive metabolite has been shown to be formed by the gastrointestinal microflora prior to the absorption of zileuton and its formation increases with delayed absorption of zileuton.
Renal Impairment
- The pharmacokinetics of zileuton immediate-release tablets were similar in healthy subjects and in subjects with mild, moderate, and severe renal insufficiency. In subjects with renal failure requiring hemodialysis, zileuton pharmacokinetics were not altered by hemodialysis and a very small percentage of the administered zileuton dose (<0.5%) was removed by hemodialysis. Hence, dosing adjustment in patients with renal dysfunction or undergoing hemodialysis is not necessary.
Hepatic Impairment
- The pharmacokinetics of zileuton immediate-release tablets were compared between subjects with mild and moderate chronic hepatic insufficiency. The mean apparent plasma clearance of total zileuton in subjects with hepatic impairment was approximately half the value of the healthy subjects. The percent binding of zileuton to plasma proteins after multiple dosing was significantly reduced in patients with moderate hepatic impairment. ZYFLO CR is contraindicated in patients with active liver disease or persistent ALT elevations ≥3×ULN .
Geriatric Use
- The pharmacokinetics of zileuton immediate-release tablets were investigated in healthy elderly subjects (ages 65 to 81 years, 9 males, 9 females) and healthy young subjects (ages 20 to 40 years, 5 males, 4 females) after single and multiple oral doses of 600 mg zileuton every 6 hours. Zileuton pharmacokinetics were similar in healthy elderly subjects (≥65 years) compared to healthy younger adults (20 to 40 years).
## Nonclinical Toxicology
Carcinogenesis, Mutagenesis, Impairment of Fertility
- In 2-year carcinogenicity studies, increases in the incidence of liver, kidney, and vascular tumors in female mice and a trend toward an increase in the incidence of liver tumors in male mice were observed at 450 mg/kg/day (providing approximately 5 times or 8 times the systemic exposure achieved at the maximum recommended human daily oral dose). No increase in the incidence of tumors was observed at 150 mg/kg/day (providing approximately 2-3 times the systemic exposure achieved at the maximum recommended human daily oral dose). In rats, an increase in the incidence of kidney tumors was observed in both sexes at 170 mg/kg/day (providing approximately 8 times or 16 times the systemic exposure achieved at the maximum recommended human daily oral dose). No increased incidence of kidney tumors was seen at 80 mg/kg/day (providing approximately 4 times or 7 times the systemic exposure achieved at the maximum recommended human daily oral dose). Although a dose-related increased incidence of benign Leydig cell tumors was observed, Leydig cell tumorigenesis was prevented by supplementing male rats with testosterone.
- Zileuton was negative in genotoxicity studies including bacterial reverse mutation (Ames) using S. typhimurium and E. coli, chromosome aberration in human lymphocytes, in vitro unscheduled DNA synthesis (UDS), in rat hepatocytes with or without zileuton pretreatment and in mouse and rat kidney cells with zileuton pretreatment, and mouse micronucleus assays. However, a dose-related increase in DNA adduct formation was reported in kidneys and livers of female mice treated with zileuton. Although some evidence of DNA damage was observed in a UDS assay in hepatocytes isolated from Aroclor-1254-treated rats, no such finding was noticed in hepatocytes isolated from monkeys, where the metabolic profile of zileuton is more similar to that of humans.
- In reproductive performance/fertility studies, zileuton produced no effects on fertility in rats at oral doses up to 300 mg/kg/day (providing approximately 12 times and greater than 10 times the systemic exposure achieved at the maximum recommended human daily oral dose). Comparative systemic exposure (AUC) is based on measurements in male rats or nonpregnant female rats at similar dosages. However, reduction in fetal implants was observed at oral doses of 150 mg/kg/day and higher (providing approximately 10 times the systemic exposure achieved at the maximum recommended human daily oral dose). These effects were not seen at an estimated 4 times clinical exposure. Increases in gestation length, prolongation of estrus cycle, and increases in stillbirths were observed at oral doses of 70 mg/kg/day and higher (providing approximately 3 times the systemic exposure achieved at the maximum recommended human daily oral dose). In a perinatal/postnatal study in rats, reduced pup survival and growth were noted at an oral dose of 300 mg/kg/day (providing approximately greater than 10 times the systemic exposure achieved at the maximum recommended human daily oral dose).
# Clinical Studies
- The efficacy of ZYFLO CR was evaluated in a randomized, double-blind, parallel-group, placebo-controlled, multicenter trial of 12 weeks duration in patients 12 years of age and older with asthma. The 12-week trial included 199 patients randomized to ZYFLO CR (two 600 mg tablets twice daily) and 198 to placebo. Eighty-three percent of patients were white, 48% were male, and the mean age was 34 years. The mean baseline FEV1 percent predicted was 58.5%.
- Assessment of efficacy was based upon forced expiratory volume in one second (FEV1) at 12 weeks. ZYFLO CR demonstrated a significantly greater improvement in mean change from baseline trough FEV1 at 12 weeks compared to placebo (0.39 L vs. 0.27 L; p=0.021). The mean change from baseline FEV1 over the course of the 12-week study is shown in Figure 1. Secondary endpoints (PEFR and rescue beta-agonist use) were supportive of efficacy.
- Examination of gender subgroups did not identify differences in response between men and women. The database was not large enough to assess whether there were differences in response in age or racial subgroups.
# How Supplied
- ZYFLO CR (zileuton) extended-release tablets are debossed on one side with "CT2"; they are available in bottles of 120 tablets (NDC 10122-902-12) and as samples in bottles of 20 tablets (NDC 10122-902-20).
## Storage
- Store between 20 and 25°C (68-77ºF); excursions permitted to 15-30°C (59-86°F) . Protect from light.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
Information for Patients
Patients should be told that:
- ZYFLO CR is indicated for the chronic treatment of asthma and should be taken regularly as prescribed, even during symptom-free periods.
- ZYFLO CR is a leukotriene synthesis inhibitor which works by inhibiting the formation of leukotrienes.
- ZYFLO CR should be taken within one hour after morning and evening meals.
ZYFLO CR tablets should not be cut, chewed or crushed.
- ZYFLO CR is not a bronchodilator and should not be used to treat acute episodes of asthma.
- When taking ZYFLO CR, they should not decrease the dose or stop taking any other antiasthma medications unless instructed by a health care provider. If a dose is missed, they should take the next dose at the scheduled time and not double the dose.
- While using ZYFLO CR, medical attention should be sought if short-acting bronchodilators are needed more often than usual, or if more than the maximum number of inhalations of short-acting bronchodilator treatment prescribed for a 24-hour period are needed.
- The most serious side effect of ZYFLO CR is potential elevation of liver enzymes (in 2% of patients) and that, while taking ZYFLO CR, they must return for liver enzyme test monitoring on a regular basis.
- If they experience signs and/or symptoms of liver dysfunction (e.g., right upper quadrant pain, nausea, fatigue, lethargy, pruritus, jaundice, or "flu-like" symptoms), they should contact their health care provider immediately.
- Patients should be instructed to notify their healthcare provider if neuropsychiatric events occur while using ZYFLO CR.
- ZYFLO CR can interact with other drugs and that, while taking ZYFLO CR, they should consult their health care provider before starting or stopping any prescription or non-prescription medicines.
- A patient leaflet is included with the tablets.
# Precautions with Alcohol
- Alcohol-Zileuton interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- ZYFLO CR®
# Look-Alike Drug Names
- A® — B®
# Drug Shortage Status
# Price | Zileuton
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]; Associate Editor(s)-in-Chief: Kiran Singh, M.D. [2]
# Disclaimer
WikiDoc MAKES NO GUARANTEE OF VALIDITY. WikiDoc is not a professional health care provider, nor is it a suitable replacement for a licensed healthcare provider. WikiDoc is intended to be an educational tool, not a tool for any form of healthcare delivery. The educational content on WikiDoc drug pages is based upon the FDA package insert, National Library of Medicine content and practice guidelines / consensus statements. WikiDoc does not promote the administration of any medication or device that is not consistent with its labeling. Please read our full disclaimer here.
# Overview
Zileuton is a leukotriene synthesis inhibitor that is FDA approved for the treatment of asthma in adults and children 12 years of age and older. Common adverse reactions include sinusitis, nausea, and pharyngolaryngeal pain.
# Adult Indications and Dosage
## FDA-Labeled Indications and Dosage (Adult)
# Indications
- ZYFLO CR is indicated for the prophylaxis and chronic treatment of asthma in adults.
- ZYFLO CR is not indicated for use in the reversal of bronchospasm in acute asthma attacks. Therapy with ZYFLO CR can be continued during acute exacerbations of asthma.
# Dosage
- The recommended dosage of ZYFLO CR for the treatment of patients with asthma is two 600 mg extended-release tablets twice daily, within one hour after morning and evening meals, for a total daily dose of 2400 mg. Tablets should not be chewed, cut or crushed. If a dose is missed, the patient should take the next dose at the scheduled time and not double the dose. Assess hepatic function enzymes prior to initiation of ZYFLO CR and periodically during treatment.
# DOSAGE FORMS AND STRENGTHS
- Extended-release tablets, 600 mg
## Off-Label Use and Dosage (Adult)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Zileuton in adult patients.
### Non–Guideline-Supported Use
- There is limited information regarding Off-Label Non–Guideline-Supported Use of Zileuton in adult patients.
# Pediatric Indications and Dosage
## FDA-Labeled Indications and Dosage (Pediatric)
# Indications
- ZYFLO CR is indicated for the prophylaxis and chronic treatment of asthma in 12 years of age and older.
- ZYFLO CR is not indicated for use in the reversal of bronchospasm in acute asthma attacks. Therapy with ZYFLO CR can be continued during acute exacerbations of asthma.
# Dosage
- The recommended dosage of ZYFLO CR for the treatment of patients with asthma is two 600 mg extended-release tablets twice daily, within one hour after morning and evening meals, for a total daily dose of 2400 mg. Tablets should not be chewed, cut or crushed. If a dose is missed, the patient should take the next dose at the scheduled time and not double the dose. Assess hepatic function enzymes prior to initiation of ZYFLO CR and periodically during treatment.
# DOSAGE FORMS AND STRENGTHS
- Extended-release tablets, 600 mg
## Off-Label Use and Dosage (Pediatric)
### Guideline-Supported Use
- There is limited information regarding Off-Label Guideline-Supported Use of Zileuton in pediatric patients.
### Non–Guideline-Supported Use
- There is limited information regarding Off-Label Non–Guideline-Supported Use of Zileuton in pediatric patients.
# Contraindications
The use of ZYFLO CR is contraindicated in patients with:
- Active liver disease or persistent hepatic function enzyme elevations greater than or equal to 3 times the upper limit of normal (≥3×ULN).
- A history of allergic reaction to zileuton or any of the ingredients of ZYFLO CR (e.g., rash, eosinophilia, etc.).
# Warnings
Hepatotoxicity
- Elevations of one or more hepatic function enzymes and bilirubin may occur during ZYFLO CR therapy. These laboratory abnormalities may progress to clinically significant liver injury, remain unchanged, or resolve with continued treatment, usually within three weeks. The ALT (SGPT) test is considered the most sensitive indicator of liver injury for ZYFLO CR.
- Assess hepatic function enzymes prior to initiation of, and during therapy with, ZYFLO CR. Assess serum ALT before treatment begins, once a month for the first 3 months, every 2-3 months for the remainder of the first year, and periodically thereafter for patients receiving long-term ZYFLO CR therapy. If clinical signs and/or symptoms of liver dysfunction develop (e.g., right upper quadrant pain, nausea, fatigue, lethargy, pruritus, jaundice, or "flu-like" symptoms) or transaminase elevations ≥5×ULN occur, discontinue ZYFLO CR and follow hepatic function enzymes until normal.
- In controlled and open-label clinical studies involving more than 5000 patients treated with zileuton immediate-release tablets, the overall rate of ALT elevation ≥3×ULN was 3.2%. In these trials, one patient developed symptomatic hepatitis with jaundice, which resolved upon discontinuation of therapy. An additional 3 patients with transaminase elevations developed mild hyperbilirubinemia that was less than 3×ULN. There was no evidence of hypersensitivity or other alternative etiologies for these findings.
- Since treatment with ZYFLO CR may result in increased hepatic function enzymes and liver injury, ZYFLO CR should be used with caution in patients who consume substantial quantities of alcohol and/or have a past history of liver disease.
Neuropsychiatric Events
- Neuropsychiatric events have been reported in adult and adolescent patients taking zileuton, the active ingredient in ZYFLO CR and zileuton immediate-release tablets. Post-marketing reports with zileuton include sleep disorders and behavior changes. The clinical details of some post-marketing reports involving zileuton appear consistent with a drug-induced effect. Patients and prescribers should be alert for neuropsychiatric events. Patients should be instructed to notify their prescriber if these changes occur. Prescribers should carefully evaluate the risks and benefits of continuing treatment with ZYFLO CR if such events occur.
# Adverse Reactions
## Clinical Trials Experience
- Hepatotoxicity: Elevations of one or more hepatic function enzymes and bilirubin may occur during ZYFLO CR therapy.
- The most commonly occurring adverse reactions (≥5%) with ZYFLO CR are sinusitis, nausea, and pharyngolaryngeal pain.
Short-Term Clinical Studies Experience
- The safety data described below reflect exposure to ZYFLO CR in 199 patients for 12 weeks duration. In a 12-week, randomized, double-blind, placebo-controlled trial in adults and adolescents 12 years of age and older with asthma, patients received ZYFLO CR two 600 mg tablets (n=199) or placebo (n=198) twice daily by mouth. Eighty-three percent of patients were white, 48% were male, and the mean age was 34 years.
- Because clinical studies are conducted under widely varying conditions, adverse reaction rates observed in the clinical studies of a drug cannot be directly compared to rates in the clinical studies of another drug and may not reflect the rates observed in practice.
- The most commonly reported adverse reactions (occurring at a frequency of ≥5%) in ZYFLO CR-treated patients and at a frequency greater than placebo-treated patients are reflected in Table 1.
- Less common adverse reactions occurring at a frequency ≥1% and more often in the ZYFLO CR group than in the placebo group included gastrointestinal disorders (upper abdominal pain, diarrhea, dyspepsia, vomiting, rash, hypersensitivity, and hepatotoxicity.
- There were no differences in the incidence of adverse reactions based upon gender. The clinical trials did not include sufficient numbers of patients <18 years of age or non-Caucasians to determine whether there is any difference in adverse reactions based upon age or race.
Hepatotoxicity
- In the 12-week placebo-controlled trial, the incidence of ALT elevations (≥3×ULN) was 2.5% (5 of 199) in the ZYFLO CR group, compared to 0.5% (1 of 198) in the placebo group. In the ZYFLO CR group, the majority of ALT elevations (60%) occurred in the first month of treatment, and in 2 of the 5 patients in the ZYFLO CR group, ALT elevations were detected 14 days after completion of the 3-month study treatment. The levels returned to <2×ULN or normal within 9 and 12 days, respectively. The ALT elevations in the other 3 patients were observed to return to <2×ULN or normal within 15, 19, and 31 days after ZYFLO CR discontinuation. There appeared to be no clinically relevant relationship between the time of onset and the magnitude of the first elevation or the magnitude of first elevation and time to resolution. The hepatic function enzyme elevations attributed to ZYFLO CR did not result in any cases of jaundice, development of chronic liver disease, or death in this clinical trial.
Long-Term Clinical Studies Experience
- The safety of ZYFLO CR was evaluated in one 6-month, randomized, double-blind, placebo-controlled clinical trial in adults and adolescents 12 years of age and older with asthma. Patients received two 600 mg ZYFLO CR tablets (n=619) or placebo (n=307) twice daily by mouth along with usual asthma care. Eighty-six percent of patients were white, 40% were male, and the overall mean age was 36.
- The rate and type of adverse reactions observed in this study were comparable to the adverse reactions observed in the 12-week study. Other commonly reported adverse reactions (occurring at a frequency of ≥5%) in ZYFLO CR-treated patients and at a frequency greater than placebo-treated patients included the following: headache (23%), upper respiratory tract infection (9%), myalgia (7%), and diarrhea (5%) compared to 21%, 7%, 5% and 2%, respectively, in the placebo-treated group.
- ALT elevations (≥3×ULN) were observed in 1.8% of patients treated with ZYFLO CR compared to 0.7% in patients treated with placebo. The majority of elevations (82%) were reported within the first 3 months of treatment and resolved within 21 days for most of these patients after discontinuation of the drug. The hepatic function enzyme elevations attributed to ZYFLO CR did not result in any cases of jaundice, development of chronic liver disease, or death in this clinical trial.
- Occurrences of low white blood cell (WBC) count (<3.0 × 109/L) were observed in 2.6% (15 of 619) of the ZYFLO CR-treated patients and in 1.7% (5 of 307) of the placebo-treated patients. The WBC counts returned to normal or baseline following discontinuation of ZYFLO CR. The clinical significance of these findings is not known.
## Postmarketing Experience
- The following adverse reactions have been identified during post-approval use of zileuton immediate-release tablets and may be applicable to ZYFLO CR. Because these reactions are reported voluntarily from a population of uncertain size, it is not always possible to reliably estimate their frequency or establish a causal relationship.
- Cases of severe hepatic injury have been reported in patients taking zileuton immediate-release tablets. These cases included death, life-threatening liver injury with recovery, symptomatic jaundice, hyperbilirubinemia, and elevations of ALT >8×ULN.
- Cases of sleep disorders and behavior changes have also been reported
# Drug Interactions
- The following study results were obtained using zileuton immediate-release tablets but the conclusions also apply to ZYFLO CR.
Theophylline
- In a drug-interaction study in 16 healthy subjects, co-administration of multiple doses of zileuton immediate-release tablets (800 mg every 12 hours) and theophylline (200 mg every 6 hours) for 5 days resulted in a significant decrease (approximately 50%) in steady-state clearance of theophylline, an approximate doubling of theophylline AUC, and an increase in theophylline Cmax (by 73%). The elimination half-life of theophylline was increased by 24%. Also, during co-administration, theophylline-related adverse reactions were observed more frequently than after theophylline alone. Upon initiation of ZYFLO CR in patients receiving theophylline, the theophylline dosage should be reduced by approximately one-half and plasma theophylline concentrations monitored. Similarly, when initiating therapy with theophylline in a patient receiving ZYFLO CR, the maintenance dose and/or dosing interval of theophylline should be adjusted accordingly and guided by serum theophylline determinations.
Warfarin
- Concomitant administration of multiple doses of zileuton immediate-release tablets (600 mg every 6 hours) and warfarin (fixed daily dose obtained by titration in each subject) to 30 healthy male subjects resulted in a 15% decrease in R-warfarin clearance and an increase in AUC of 22%. The pharmacokinetics of S-warfarin were not affected. These pharmacokinetic changes were accompanied by a clinically significant increase in prothrombin times. Monitoring of prothrombin time, or other suitable coagulation tests, with the appropriate dose titration of warfarin is recommended in patients receiving concomitant ZYFLO CR and warfarin therapy.
Propranolol
- Co-administration of zileuton immediate-release tablets and propranolol results in a significant increase in propranolol concentrations. Administration of a single 80 mg dose of propranolol in 16 healthy male subjects who received zileuton immediate-release tablets 600 mg every 6 hours for 5 days resulted in a 42% decrease in propranolol clearance. This resulted in an increase in propranolol Cmax, AUC, and elimination half-life by 52%, 104%, and 25%, respectively. There was an increase in β-blockade as shown by a decrease in heart rate associated with the co-administration of these drugs. Patients concomitantly on ZYFLO CR and propranolol should be closely monitored and the dose of propranolol reduced as necessary. No formal drug-drug interaction studies between zileuton and other beta-adrenergic blocking agents (i.e., β-blockers) have been conducted. It is reasonable to employ appropriate clinical monitoring when these drugs are co-administered with ZYFLO CR.
Other Concomitant Drug Therapy
- Drug-drug interaction studies conducted in healthy subjects between zileuton immediate-release tablets and prednisone and ethinyl estradiol (oral contraceptive), drugs known to be metabolized by the CYP3A4 isoenzyme, have shown no significant interaction. However, no formal drug-drug interaction studies between zileuton and CYP3A4 inhibitors, such as ketaconazole, have been conducted. It is reasonable to employ appropriate clinical monitoring when these drugs are co-administered with ZYFLO CR.
- Drug-drug interaction studies in healthy subjects have been conducted with zileuton immediate-release tablets and digoxin, phenytoin, sulfasalazine, and naproxen. There was no significant interaction between zileuton and any of these drugs.
# Use in Specific Populations
### Pregnancy
Pregnancy Category (FDA):
Pregnancy Category C:
- Developmental studies indicated adverse effects (reduced body weight and increased skeletal variations) in rats at an oral dose of 300 mg/kg/day (providing greater than 10 times the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose). Comparative systemic exposure [AUC] is based on measurements in nonpregnant female rats at a similar dosage. Zileuton and/or its metabolites cross the placental barrier of rats. Three of 118 (2.5%) rabbit fetuses had cleft palates at an oral dose of 150 mg/kg/day (equivalent to the maximum recommended human daily oral dose on a mg/m2 basis). There are no adequate and well-controlled studies in pregnant women. ZYFLO CR should be used during pregnancy only if the potential benefit justifies the potential risk to the fetus.
Pregnancy Category (AUS):
- There is no Australian Drug Evaluation Committee (ADEC) guidance on usage of Zileuton in women who are pregnant.
### Labor and Delivery
There is no FDA guidance on use of Zileuton during labor and delivery.
### Nursing Mothers
- Zileuton and/or its metabolites are excreted in rat milk. It is not known if zileuton is excreted in human milk. Because many drugs are excreted in human milk, and because of the potential for tumorigenicity shown for zileuton in animal studies, a decision should be made whether to discontinue nursing or to discontinue the drug, taking into account the importance of the drug to the mother.
### Pediatric Use
- The safety and effectiveness of ZYFLO CR in pediatric patients under 12 years of age have not been established. FDA has not required pediatric studies in patients under the age of 12 years due to the risk of hepatotoxicity. ZYFLO CR is not appropriate for children less than 12 years of age.
### Geriatic Use
- Subgroup analysis of controlled and open-label clinical studies with zileuton immediate-release tablets suggests that females ≥65 years of age appear to be at increased risk of ALT elevations. In ZYFLO CR placebo-controlled studies there were no discernable trends in ALT elevations noted in subset analyses for patients ≥65 years of age, although the database may not have been sufficiently large to detect a trend.
### Gender
There is no FDA guidance on the use of Zileuton with respect to specific gender populations.
### Race
There is no FDA guidance on the use of Zileuton with respect to specific racial populations.
### Renal Impairment
- Dosing adjustment in patients with renal dysfunction or patients undergoing hemodialysis is not necessary
### Hepatic Impairment
- ZYFLO CR is contraindicated in patients with active liver disease or persistent ALT elevations ≥3×ULN
### Females of Reproductive Potential and Males
There is no FDA guidance on the use of Zileuton in women of reproductive potentials and males.
### Immunocompromised Patients
There is no FDA guidance one the use of Zileuton in patients who are immunocompromised.
# Administration and Monitoring
### Administration
- Oral
### Monitoring
- There is limited information regarding Monitoring of Zileuton in the drug label.
# IV Compatibility
- There is limited information regarding IV Compatibility of Zileuton in the drug label.
# Overdosage
- Human experience of acute overdose with zileuton is limited. A patient in a clinical study took between 6.6 and 9.0 grams of zileuton immediate-release tablets in a single dose. Vomiting was induced and the patient recovered without sequelae. Zileuton is not removed by dialysis. Should an overdose occur, the patient should be treated symptomatically and supportive measures instituted as required. If indicated, elimination of unabsorbed drug should be achieved by emesis or gastric lavage; usual precautions should be observed to maintain the airway. A Certified Poison Control Center should be consulted for up-to-date information on management of overdose with ZYFLO CR.
- The oral minimum lethal doses in mice and rats were 500-4000 and 300-1000 mg/kg, respectively (providing greater than 3 and 9 times the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose, respectively). In dogs, at an oral dose of 1000 mg/kg (providing in excess of 12 times the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose) no deaths occurred but nephritis was reported.
# Pharmacology
## Mechanism of Action
- Zileuton is an inhibitor of 5-lipoxygenase and thus inhibits leukotriene (LTB4, LTC4, LTD4 and LTE4) formation. Both the R(+) and S(-) enantiomers are pharmacologically active as 5-lipoxygenase inhibitors in in vitro and in vivo systems. Leukotrienes are substances that induce numerous biological effects including augmentation of neutrophil and eosinophil migration, neutrophil and monocyte aggregation, leukocyte adhesion, increased capillary permeability, and smooth muscle contraction. These effects contribute to inflammation, edema, mucus secretion, and bronchoconstriction in the airways of asthmatic patients. LTB4, a chemoattractant for neutrophils and eosinophils, and cysteinyl leukotrienes (LTC4, LTD4, LTE4) can be measured in a number of biological fluids including bronchoalveolar lavage fluid (BALF), blood, urine and sputum from asthmatic patients.
- Zileuton is an orally active inhibitor of ex vivo LTB4 formation in several species, including mice, rats, rabbits, dogs, sheep, and monkeys. Zileuton inhibits arachidonic acid-induced ear edema in mice, neutrophil migration in mice in response to polyacrylamide gel, and eosinophil migration into the lungs of antigen-challenged sheep. In a mouse model of allergic inflammation, zileuton inhibited neutrophil and eosinophil influx, reduced the levels of multiple cytokines in the BALF, and reduced serum IgE levels. Zileuton inhibits leukotriene-dependent smooth muscle contractions in vitro in guinea pig and human airways. The compound inhibits leukotriene-dependent bronchospasm in antigen and arachidonic acid-challenged guinea pigs. In antigen-challenged sheep, zileuton inhibits late-phase bronchoconstriction and airway hyperreactivity. The clinical relevance of these findings is
## Structure
- Zileuton is an orally active inhibitor of 5-lipoxygenase, the enzyme that catalyzes the formation of leukotrienes from arachidonic acid. Zileuton has the chemical name (±)-1-(1-Benzo[b]thien-2-ylethyl)-1-hydroxyurea and the following chemical structure:
- Zileuton has the molecular formula C 11H 12N 2O 2S and a molecular weight of 236.29. It is a racemic mixture (50:50) of R(+) and S(-) enantiomers. Zileuton is a practically odorless, white, crystalline powder that is soluble in methanol and ethanol, slightly soluble in acetonitrile, and practically insoluble in water and hexane. The melting point ranges from 144.2°C to 145.2°C.
- ZYFLO CR (zileuton) extended-release tablets for oral administration are triple-layer tablets comprised of an immediate-release layer, a middle (barrier) layer, and an extended-release layer. ZYFLO CR tablets are oblong, film-coated tablets with one red layer between two white layers, debossed on one side with "CT2". Each tablet contains 600 mg of zileuton and the following inactive ingredients: crospovidone, ferric oxide, glyceryl behenate, hydroxypropyl cellulose, hypromellose, magnesium stearate, mannitol, microcrystalline cellulose, povidone, pregelatinized starch, propylene glycol, sodium starch glycolate, and talc.
## Pharmacodynamics
- Zileuton is an orally active inhibitor of ex vivo LTB4 formation in humans. The inhibition of LTB4 formation in whole blood is directly related to zileuton plasma levels. In patients with asthma, the IC50 is estimated to be 0.46 µg/mL, and maximum inhibition ≥80% is reached at a zileuton concentration of 2 µg/mL. In patients with asthma receiving zileuton immediate-release tablets 600 mg four times daily, peak plasma levels averaging 5.9 µg/mL were associated with a mean LTB4 inhibition of 98%. Zileuton inhibits the synthesis of cysteinyl leukotrienes as demonstrated by reduced urinary LTE4 levels.
## Pharmacokinetics
- Information on the pharmacokinetics of zileuton following the administration of zileuton immediate-release tablets is available in healthy subjects. The results of two clinical pharmacology studies using ZYFLO CR are described below.
Absorption
- A three-way crossover study was conducted in healthy male and female subjects (n=23) with a mean age of 33 (range 20-55) following single dose of 1200 mg (2 × 600 mg) ZYFLO CR tablets under fasted and fed conditions, and two doses of 600 mg zileuton immediate-release tablets every 6 hours under fasted conditions. Food increased the peak mean plasma concentrations (Cmax) and the mean extent of absorption (AUC) of ZYFLO CR by 18 and 34%, respectively, and prolonged Tmax from 2.1 hours to 4.3 hours. The relative bioavailability of ZYFLO CR to zileuton immediate-release tablets with respect to Cmax and AUC under fasted conditions were 0.39 (90% CI: 0.36, 0.43) and 0.57 (90% CI: 0.52, 0.62), respectively. Similarly, relative bioavailability of ZYFLO CR to zileuton immediate-release tablets with respect to Cmax and AUC under fed conditions were 0.45 (90% CI: 0.41, 0.49) and 0.76 (90% CI: 0.70, 0.83), respectively.
- A three-way crossover study was conducted in healthy male and female subjects (n=24) with a mean age of 35 (range 19-56) following multiple doses of 1200 mg (2 × 600 mg) ZYFLO CR tablets administered every 12 hours under fasted and fed conditions, and 600 mg zileuton immediate-release tablets every 6 hours under fed conditions until steady state zileuton levels were achieved. Food increased AUC and Cmin of ZYFLO CR by 43% and 170%, respectively, but had no effect on Cmax. Therefore, ZYFLO CR is recommended to be administered with food. At steady state, relative bioavailability of ZYFLO CR to zileuton immediate-release tablets with respect to Cmax, Cmin, and AUC were 0.65 (90% CI: 0.60, 0.71), 1.05 (90% CI: 0.88, 1.25) and 0.85 (90% CI: 0.78, 0.92) respectively. These data indicate that at steady state under fed conditions the Cmax of ZYFLO CR is about 35% lower than that of zileuton immediate-release tablets but the Cmin and AUC are similar for both formulations.
Distribution
- The apparent volume of distribution (V/F) of zileuton is approximately 1.2 L/kg. Zileuton is 93% bound to plasma proteins, primarily to albumin, with minor binding to α1‑acid glycoprotein.
Elimination
- Elimination of zileuton is predominantly via metabolism with a mean terminal half-life of 3.2 hours. Apparent oral clearance (CL/F) of zileuton is 669 mL/min. Zileuton activity is primarily due to the parent drug. Studies with radiolabeled drug have demonstrated that orally administered zileuton is well absorbed into the systemic circulation with 94.5% and 2.2% of the radiolabeled dose recovered in urine and feces, respectively.
Metabolism
- In vitro studies utilizing human liver microsomes have shown that zileuton and its N-dehydroxylated metabolite can be oxidatively metabolized by CYP1A2, CYP2C9 and CYP3A4.
- Several zileuton metabolites have been identified in human plasma and urine. These include two diastereomeric O-glucuronide conjugates (major metabolites) and an N-dehydroxylated metabolite (A-66193) of zileuton. The urinary excretion of the inactive A-66193 metabolite and unchanged zileuton each accounted for less than 0.5% of the single radiolabeled dose. Multiple doses of 1200 mg ZYFLO CR twice daily resulted in peak plasma levels of 4.9 µg/mL of the inactive metabolite A-66193 with an AUC of 93 µg∙hr/mL, showing large inter-subject variability. This inactive metabolite has been shown to be formed by the gastrointestinal microflora prior to the absorption of zileuton and its formation increases with delayed absorption of zileuton.
Renal Impairment
- The pharmacokinetics of zileuton immediate-release tablets were similar in healthy subjects and in subjects with mild, moderate, and severe renal insufficiency. In subjects with renal failure requiring hemodialysis, zileuton pharmacokinetics were not altered by hemodialysis and a very small percentage of the administered zileuton dose (<0.5%) was removed by hemodialysis. Hence, dosing adjustment in patients with renal dysfunction or undergoing hemodialysis is not necessary.
Hepatic Impairment
- The pharmacokinetics of zileuton immediate-release tablets were compared between subjects with mild and moderate chronic hepatic insufficiency. The mean apparent plasma clearance of total zileuton in subjects with hepatic impairment was approximately half the value of the healthy subjects. The percent binding of zileuton to plasma proteins after multiple dosing was significantly reduced in patients with moderate hepatic impairment. ZYFLO CR is contraindicated in patients with active liver disease or persistent ALT elevations ≥3×ULN [see WARNINGS AND PRECAUTIONS (5)].
Geriatric Use
- The pharmacokinetics of zileuton immediate-release tablets were investigated in healthy elderly subjects (ages 65 to 81 years, 9 males, 9 females) and healthy young subjects (ages 20 to 40 years, 5 males, 4 females) after single and multiple oral doses of 600 mg zileuton every 6 hours. Zileuton pharmacokinetics were similar in healthy elderly subjects (≥65 years) compared to healthy younger adults (20 to 40 years).
## Nonclinical Toxicology
Carcinogenesis, Mutagenesis, Impairment of Fertility
- In 2-year carcinogenicity studies, increases in the incidence of liver, kidney, and vascular tumors in female mice and a trend toward an increase in the incidence of liver tumors in male mice were observed at 450 mg/kg/day (providing approximately 5 times [females] or 8 times [males] the systemic exposure [AUC=64 µg∙hr/mL] achieved at the maximum recommended human daily oral dose). No increase in the incidence of tumors was observed at 150 mg/kg/day (providing approximately 2-3 times the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose). In rats, an increase in the incidence of kidney tumors was observed in both sexes at 170 mg/kg/day (providing approximately 8 times [males] or 16 times [females] the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose). No increased incidence of kidney tumors was seen at 80 mg/kg/day (providing approximately 4 times [males] or 7 times [females] the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose). Although a dose-related increased incidence of benign Leydig cell tumors was observed, Leydig cell tumorigenesis was prevented by supplementing male rats with testosterone.
- Zileuton was negative in genotoxicity studies including bacterial reverse mutation (Ames) using S. typhimurium and E. coli, chromosome aberration in human lymphocytes, in vitro unscheduled DNA synthesis (UDS), in rat hepatocytes with or without zileuton pretreatment and in mouse and rat kidney cells with zileuton pretreatment, and mouse micronucleus assays. However, a dose-related increase in DNA adduct formation was reported in kidneys and livers of female mice treated with zileuton. Although some evidence of DNA damage was observed in a UDS assay in hepatocytes isolated from Aroclor-1254-treated rats, no such finding was noticed in hepatocytes isolated from monkeys, where the metabolic profile of zileuton is more similar to that of humans.
- In reproductive performance/fertility studies, zileuton produced no effects on fertility in rats at oral doses up to 300 mg/kg/day (providing approximately 12 times [male rats] and greater than 10 times [female rats] the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose). Comparative systemic exposure (AUC) is based on measurements in male rats or nonpregnant female rats at similar dosages. However, reduction in fetal implants was observed at oral doses of 150 mg/kg/day and higher (providing approximately 10 times the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose). These effects were not seen at an estimated 4 times clinical exposure. Increases in gestation length, prolongation of estrus cycle, and increases in stillbirths were observed at oral doses of 70 mg/kg/day and higher (providing approximately 3 times the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose). In a perinatal/postnatal study in rats, reduced pup survival and growth were noted at an oral dose of 300 mg/kg/day (providing approximately greater than 10 times the systemic exposure [AUC] achieved at the maximum recommended human daily oral dose).
# Clinical Studies
- The efficacy of ZYFLO CR was evaluated in a randomized, double-blind, parallel-group, placebo-controlled, multicenter trial of 12 weeks duration in patients 12 years of age and older with asthma. The 12-week trial included 199 patients randomized to ZYFLO CR (two 600 mg tablets twice daily) and 198 to placebo. Eighty-three percent of patients were white, 48% were male, and the mean age was 34 years. The mean baseline FEV1 percent predicted was 58.5%.
- Assessment of efficacy was based upon forced expiratory volume in one second (FEV1) at 12 weeks. ZYFLO CR demonstrated a significantly greater improvement in mean change from baseline trough FEV1 at 12 weeks compared to placebo (0.39 L vs. 0.27 L; p=0.021). The mean change from baseline FEV1 over the course of the 12-week study is shown in Figure 1. Secondary endpoints (PEFR and rescue beta-agonist use) were supportive of efficacy.
- Examination of gender subgroups did not identify differences in response between men and women. The database was not large enough to assess whether there were differences in response in age or racial subgroups.
# How Supplied
- ZYFLO CR (zileuton) extended-release tablets are debossed on one side with "CT2"; they are available in bottles of 120 tablets (NDC 10122-902-12) and as samples in bottles of 20 tablets (NDC 10122-902-20).
## Storage
- Store between 20 and 25°C (68-77ºF); excursions permitted to 15-30°C (59-86°F) [see USP Controlled Room Temperature]. Protect from light.
# Images
## Drug Images
## Package and Label Display Panel
# Patient Counseling Information
Information for Patients
Patients should be told that:
- ZYFLO CR is indicated for the chronic treatment of asthma and should be taken regularly as prescribed, even during symptom-free periods.
- ZYFLO CR is a leukotriene synthesis inhibitor which works by inhibiting the formation of leukotrienes.
- ZYFLO CR should be taken within one hour after morning and evening meals.
ZYFLO CR tablets should not be cut, chewed or crushed.
- ZYFLO CR is not a bronchodilator and should not be used to treat acute episodes of asthma.
- When taking ZYFLO CR, they should not decrease the dose or stop taking any other antiasthma medications unless instructed by a health care provider. If a dose is missed, they should take the next dose at the scheduled time and not double the dose.
- While using ZYFLO CR, medical attention should be sought if short-acting bronchodilators are needed more often than usual, or if more than the maximum number of inhalations of short-acting bronchodilator treatment prescribed for a 24-hour period are needed.
- The most serious side effect of ZYFLO CR is potential elevation of liver enzymes (in 2% of patients) and that, while taking ZYFLO CR, they must return for liver enzyme test monitoring on a regular basis.
- If they experience signs and/or symptoms of liver dysfunction (e.g., right upper quadrant pain, nausea, fatigue, lethargy, pruritus, jaundice, or "flu-like" symptoms), they should contact their health care provider immediately.
- Patients should be instructed to notify their healthcare provider if neuropsychiatric events occur while using ZYFLO CR.
- ZYFLO CR can interact with other drugs and that, while taking ZYFLO CR, they should consult their health care provider before starting or stopping any prescription or non-prescription medicines.
- A patient leaflet is included with the tablets.
# Precautions with Alcohol
- Alcohol-Zileuton interaction has not been established. Talk to your doctor about the effects of taking alcohol with this medication.
# Brand Names
- ZYFLO CR®[1]
# Look-Alike Drug Names
- A® — B®[2]
# Drug Shortage Status
# Price | https://www.wikidoc.org/index.php/Zileuton | |
f44624bf6efc737a33390e3d619c7b70d138f215 | wikidoc | Zoonotic | Zoonotic
A zoonosis (pronounced Template:IPA) is any infectious disease that is able to be transmitted (vectored) from other animals, both wild and domestic, to humans or from humans to animals (the latter is sometimes called reverse zoonosis).
The word is derived from the Greek words zoon (animal) (IPA: zo'on) and nosos (disease). Many serious diseases fall under this category.
The plural of zoonosis is zoonoses, from which an alternative singular zoonose is derived by back-formation.
The simplest definition of a zoonosis is a disease that can be transmitted from other animals to humans. A slightly more technical definition is a disease that normally exists in other animals, but also infects humans.
The emerging interdisciplinary field of conservation medicine, which integrates human and veterinary medicine, and environmental sciences, is largely concerned with zoonoses.
# Partial list of carriers
A partial list of agents that can carry infectious organisms that may be zoonotic includes:
- Bats
- Birds
- Cats
- Cattle
- Chimpanzees
- Dogs
- Geese
- Goats
- Horses
- Humans
- Monkeys
- Mosquitos
- Fleas
- Opossums
- Pigs
- Rabbits and hares
- Raccoons
- Rats
- Rodents
- Snails
- Sloths
- Fish
- Sheep
# List of infective agents
Zoonoses can be listed according to the infective agent:
- Parasites which includes protozoa, helminths (cestodes and trematodes)
- Bacteria
- Viruses
- Fungi
- Prions
# Partial list of important zoonoses
- Anthrax
- Avian Influenza (Bird Flu)
- Bolivian hemorrhagic fever
- Brucellosis
- Borrelia
- Borna virus infection
- Bovine tubercolosis
- Bubonic plague
- Campylobacteriosis
- Chagas disease
- Creutzfeldt-Jakob disease (vCJD) a Transmissible spongiform encephalopathy (TSE) from Bovine spongiform encephalopathy (BSE) or "Mad cow disease"
- Crimean-Congo hemorrhagic fever
- Cutaneous larva migrans
- Dengue Fever
- Ebola fever
- Echinococcosis
- Hantavirus
- Hendra virus
- Henipavirus
- Korean hemorrhagic fever
- Lábrea fever
- Lassa fever
- Leishmaniasis
- Leptospirosis
- Listeriosis
- Malaria
- Marburg virus infection
- Monkey B virus
- Nipah virus
- Ocular larva migrans
- Ornithosis (psitacosis)
- Oropouche fever
- Q-Fever
- Psittacosis, also called "parrot fever"
- Rabies
- Rift Valley fever
- Ringworms (Tinea canis, mainly)
- Salmonellosis
- Sodoku
- Toxoplasmosis
- Trichinosis
- Typhus and other Rickettsial diseases
- Venezuelan hemorrhagic fever
- Visceral larva migrans
- Yellow fever
Other zoonoses might be
- Glanders
- SARS (possibly; civet cats may spread the disease, or may catch the disease from humans.)
This list is by no means complete. The influenza virus is an interesting example: It continually recombines genes between strains found in humans, swine and avians, producing new strains with changed characteristics, and occasionally, as in 1918, killing millions worldwide.
# Historical development of zoonotic diseases
Most of human prehistory was spent as small bands of hunter-gatherers; these bands were rarely larger than 150 individuals, and were not in contact with other bands very often. Because of this, epidemic or pandemic diseases, which depend on a constant influx of humans who have not developed an immune response, tended to burn out after their first run through a population. To survive, a biological pathogen had to be a chronic infection, stay alive in the host for long periods of time, or have a non-human reservoir in which to live while waiting for new hosts to pass by. In fact, for many 'human' diseases, the human is actually an accidental victim and a dead-end host. (This is the case with rabies, anthrax, tularemia, West Nile virus, and many others). Thus much of human development has been in relation to zoonotic, not epidemic, diseases.
Many modern diseases, even epidemic diseases, started out as zoonotic diseases. It is hard to be certain which diseases jumped from other animals to humans, but there is good evidence that measles, smallpox, influenza, and diphtheria came to us this way. HIV, the common cold, and tuberculosis may also have started in other species.
In modern days, zoonoses are of practical interest because they are often previously unrecognized diseases or have increased virulence in populations lacking immunity. The West Nile virus appeared in the United States in 1999 in the New York City area, and moved through the country in the summer of 2002, causing much distress. Bubonic plague is a zoonotic disease, as are salmonella, Rocky Mountain spotted fever, and Lyme disease.
The major factor contributing to the appearance of new zoonotic pathogens in human populations is increased contact between humans and wildlife (Daszak et al., 2001). This can be caused either by encroachment of human activity into wilderness areas or by movement of wild animals into areas of human activity due to anthropological or environmental disturbances. An example of this is the outbreak of Nipah virus in peninsular Malaysia in 1999, when intensive pig farming intruded into the natural habitat of fruit bats carrying the virus. Unidentified spillover events caused infection of the pig population which acted as an amplifier host, eventually transmitting the virus to farmers and resulting in 105 human deaths (Field et al., 2001).
Similarly, in recent times avian influenza and West Nile virus have spilled over into human populations probably due to interactions between the carrier host and domestic animals. Highly mobile animals such as bats and birds may present a greater risk of zoonotic transmission than other animals due to the ease with which they can move into areas of human habitation.
Diseases like malaria, schistosomiasis, river blindness, and elephantiasis are not zoonotic, even though they may be transmitted by insects or use intermediate hosts vectors, because they depend on the human host for part of their life-cycle.
# Partial List of Outbreaks of Zoonosis Associated with Fairs and Petting Zoos
Outbreaks of zoonosis have been traced to human interaction with and exposure to animals at fairs, petting zoos, and in other settings. In 2005, the Centers for Disease Control and Prevention (CDC) issued an updated list of recommendations for preventing zoonosis transmission in public settings. The CDC recommendations, which were developed in conjunction with the National Association of State Public Health Veterinarians, include sections on the educational responsibilities of venue operators, managing public and animal contact, and animal care and management.
In 1988, a person became ill with Swine Influenza Virus (Swine Flu) and died after visiting the display area of the pig barn at a Wisconsin county fair. Three healthcare personnel treating the case patient also developed flu-like illness with laboratory evidence of Swine Influenza Virus infection. Investigators from the CDC indicated in their final report that the Swine Flu had been transmitted directly from pig to human host.
In 1994, seven cases of ‘’E. coli’’ O157:H7 infection were traced to a farm in Leicestershire, United Kingdom. An epidemiological investigation into the outbreak revealed that the strain of ‘’E. coli’’ O157:H7 isolated from nine animals on the farm was indistinguishable from the strain isolated from human samples. Investigators concluded that the most likely cause of this outbreak was direct human contact with animals.
In 1995, 43 children who had visited a rural farm in Wales became ill with Cryptosporidiosis. ‘’Cryptosporidium’’ was isolated from seven of the ill children. An epidemiological investigation indicated that the source of the children’s illness was contact with calves at the farm.
Also in 1995, at least thirteen children became ill with ‘’Cryptosporidiosis’’ after visiting a farm in Dublin, Ireland. In a case-control study, researchers compared the activities of the thirteen ill children, or cases, to the activities of 52 out of 55 people who had visited the farm – the controls. The study revealed that illness was significantly associated with playing in the sand in a picnic area beside a stream where animals had access.
In 1997, an ‘’E. coli’’ O157:H7 outbreak was identified among one child who lived on an open farm and two children who visited the farm during school parties. Two of the three children developed hemolytic uremic syndrome (HUS). Isolates collected from the three children and from samples taken at the farm were indistinguishable, demonstrating evidence of the link between the farm and the children’s illness.
In 1999, what is believed to be the largest outbreak of waterborne ‘’E. coli’’ O157:H7 illness in United States history occurred at the Washington County, New York fair. The New York State Department of Health identified 781 individuals who were suspected of being infected with either ‘’E. coli’’ O157:H7 or ‘’Campylobacter jejuni’’. An investigation into the outbreak revealed that consumption of beverages purchased from vendors supplied with water drawn from an unchlorinated fairgrounds well was associated with illness. In all, 127 outbreak victims were confirmed ill with ‘’E. coli’’ O157:H7 infections; 71 were hospitalized, 14 developed HUS, and two died.
In 2000, 51 people became ill with confirmed or suspected ‘’E. coli’’ O157:H7 infections after visiting a dairy farm in Pennsylvania. Eight children developed HUS. A case-control study among visitors to the dairy was conducted jointly by the CDC, Pennsylvania Department of Health, and the Montgomery County Health Department. The study’s authors concluded that ‘’E. coli’’ was transmitted to visitors as a result of contamination on animal hides and in the environment.
Also in 2000, 43 visitors to the Medina County fair in Ohio were confirmed ill with ‘’E. coli’’ O157:H7 infections. An investigation into the outbreak suggested that the water system from which food vendors were supplied was the source of the ‘’E. coli’’ outbreak. Several months later, five children became ill with ‘’E. coli’’ infections after attending a “Carnival of Horrors” event held at the Medina County fairgrounds. PFGE analysis of the strains of ‘’E. coli’’ isolated from members of both outbreaks revealed an indistinguishable pattern, and investigators from the Medina County Health Department and the CDC determined that the Medina County Fairgrounds water distribution system was the source of both ‘’E. coli’’ outbreaks.
In 2001, an ‘’E. coli’’ O157:H7 outbreak was traced to exposure in the Cow Palace at the Lorain County Fair in Ohio. CDC investigators identified 23 cases of ‘’E. coli’’ infection associated with attendance at the Lorain County Fair, with additional secondary cases likely. Two people developed HUS. An environmental and site investigation revealed ‘’E. coli’’ contamination on doorways, rails, bleachers, and sawdust. Investigators concluded that the Lorain County Fair was the source of the outbreak.
Wyandot County, Ohio, also reported an ‘’E. coli’’ O157:H7 outbreak in 2001. Ninety-two ‘’E. coli’’ infections were reported to the Wyandot County Health Department and the CDC, with 27 cases confirmed using laboratory analysis. Two cases developed HUS. Contact with infected cattle was believed to be the source of the outbreak; however, a specific cause was never identified.
In 2002, seven people became ill with ‘’E. coli’’ O157:H7 infections after visiting a large agricultural fair in Ontario, Canada. Outbreak investigators conducted a case-control study, which indicated that goats and sheep from a petting zoo were the source of the ‘’E. coli’’ among fair visitors. Other indications were that the fencing and environment surrounding the petting zoo could have been a source of transmission.
What is believed to be the largest ‘’E. coli’’ O157:H7 outbreak in Oregon State history occurred among attendees at the Lane County Fair in 2002. An Oregon Department of Human Services – Health Services investigation led to the belief that the ‘’E. coli’’ outbreak originated from exposure in the sheep and goat barn. In all, 79 people were confirmed ill with ‘’E. coli’’ infections as part of the outbreak; 22 were hospitalized, and 12 suffered HUS.
In 2003, fair visitors and animal exhibitors at the Fort Bend County Fair in Texas became ill with ‘’E. coli’’ O157:H7 infections. An outbreak investigation led to the determination that 25 people had become ill with ‘’E. coli’’ infections after attending the Fort Bend County Fair; seven people were laboratory-confirmed with ‘’E. coli’’, and 5 developed HUS or TTP (Thrombotic Thrombocytopenic Purpura). Investigators isolated a strain of ‘’E. coli’’ indistinguishable from the outbreak strain from four animal husbandry sites, and found high levels of ‘’E. coli’’ contamination in both rodeo and animal exhibit areas.
In 2004, a large ‘’E. coli’’ O157:H7 outbreak occurred among visitors at the 2004 North Carolina State Fair. During its investigation into the outbreak, the North Carolina Department of Health and Human Services (NCDHHS) received over 180 reports of illness, and documented 33 culture-confirmed cases of ‘’E. coli’’ O157:H7 associated with attendance at the fair, with 15 children developing HUS. In its final investigation report, NCDHHS concluded that the North Carolina State Fair ‘’E. coli’’ outbreak had originated at a petting zoo exhibit. The conclusion was supported by a case-control study, environmental sampling, and laboratory analysis of samples collected from the fair and members of the outbreak.
In 2005, a petting zoo that exhibited at two Florida fairs and a festival was traced as the source of an ‘’E. coli’’ O157:H7 outbreak. Sixty-three people who had visited either the Florida State Fair, the Central Florida Fair, or the Florida Strawberry Festival reported illness to investigators for the Florida Department of Health, including 20 who were culture-confirmed and 7 with HUS. A case-control study revealed that illness was associated with exposure to a petting zoo exhibit present at all three events. | Zoonotic
A zoonosis (pronounced Template:IPA) is any infectious disease that is able to be transmitted (vectored) from other animals, both wild and domestic, to humans or from humans to animals (the latter is sometimes called reverse zoonosis).
The word is derived from the Greek words zoon (animal) (IPA: zo'on) and nosos (disease). Many serious diseases fall under this category.
The plural of zoonosis is zoonoses, from which an alternative singular zoonose is derived by back-formation.
The simplest definition of a zoonosis is a disease that can be transmitted from other animals to humans. A slightly more technical definition is a disease that normally exists in other animals, but also infects humans.
The emerging interdisciplinary field of conservation medicine, which integrates human and veterinary medicine, and environmental sciences, is largely concerned with zoonoses.
# Partial list of carriers
A partial list of agents that can carry infectious organisms that may be zoonotic includes:
- Bats
- Birds
- Cats
- Cattle
- Chimpanzees
- Dogs
- Geese
- Goats
- Horses
- Humans
- Monkeys
- Mosquitos
- Fleas
- Opossums
- Pigs
- Rabbits and hares
- Raccoons
- Rats
- Rodents
- Snails
- Sloths
- Fish
- Sheep
# List of infective agents
Zoonoses can be listed according to the infective agent:
- Parasites which includes protozoa, helminths (cestodes and trematodes)
- Bacteria
- Viruses
- Fungi
- Prions
# Partial list of important zoonoses
- Anthrax
- Avian Influenza (Bird Flu)
- Bolivian hemorrhagic fever
- Brucellosis
- Borrelia
- Borna virus infection
- Bovine tubercolosis
- Bubonic plague
- Campylobacteriosis
- Chagas disease
- Creutzfeldt-Jakob disease (vCJD) a Transmissible spongiform encephalopathy (TSE) from Bovine spongiform encephalopathy (BSE) or "Mad cow disease"
- Crimean-Congo hemorrhagic fever
- Cutaneous larva migrans
- Dengue Fever
- Ebola fever
- Echinococcosis
- Hantavirus
- Hendra virus
- Henipavirus
- Korean hemorrhagic fever
- Lábrea fever
- Lassa fever
- Leishmaniasis
- Leptospirosis
- Listeriosis
- Malaria
- Marburg virus infection
- Monkey B virus
- Nipah virus
- Ocular larva migrans
- Ornithosis (psitacosis)
- Oropouche fever
- Q-Fever
- Psittacosis, also called "parrot fever"
- Rabies
- Rift Valley fever
- Ringworms (Tinea canis, mainly)
- Salmonellosis
- Sodoku
- Toxoplasmosis
- Trichinosis
- Typhus and other Rickettsial diseases
- Venezuelan hemorrhagic fever
- Visceral larva migrans
- Yellow fever
Other zoonoses might be
- Glanders
- SARS (possibly; civet cats may spread the disease, or may catch the disease from humans.)
This list is by no means complete. The influenza virus is an interesting example: It continually recombines genes between strains found in humans, swine and avians, producing new strains with changed characteristics, and occasionally, as in 1918, killing millions worldwide.
# Historical development of zoonotic diseases
Most of human prehistory was spent as small bands of hunter-gatherers; these bands were rarely larger than 150 individuals, and were not in contact with other bands very often. Because of this, epidemic or pandemic diseases, which depend on a constant influx of humans who have not developed an immune response, tended to burn out after their first run through a population. To survive, a biological pathogen had to be a chronic infection, stay alive in the host for long periods of time, or have a non-human reservoir in which to live while waiting for new hosts to pass by. In fact, for many 'human' diseases, the human is actually an accidental victim and a dead-end host. (This is the case with rabies, anthrax, tularemia, West Nile virus, and many others). Thus much of human development has been in relation to zoonotic, not epidemic, diseases.
Many modern diseases, even epidemic diseases, started out as zoonotic diseases. It is hard to be certain which diseases jumped from other animals to humans, but there is good evidence that measles, smallpox, influenza, and diphtheria came to us this way. HIV, the common cold, and tuberculosis may also have started in other species.
In modern days, zoonoses are of practical interest because they are often previously unrecognized diseases or have increased virulence in populations lacking immunity. The West Nile virus appeared in the United States in 1999 in the New York City area, and moved through the country in the summer of 2002, causing much distress. Bubonic plague is a zoonotic disease, as are salmonella, Rocky Mountain spotted fever, and Lyme disease.
The major factor contributing to the appearance of new zoonotic pathogens in human populations is increased contact between humans and wildlife (Daszak et al., 2001). This can be caused either by encroachment of human activity into wilderness areas or by movement of wild animals into areas of human activity due to anthropological or environmental disturbances. An example of this is the outbreak of Nipah virus in peninsular Malaysia in 1999, when intensive pig farming intruded into the natural habitat of fruit bats carrying the virus. Unidentified spillover events caused infection of the pig population which acted as an amplifier host, eventually transmitting the virus to farmers and resulting in 105 human deaths (Field et al., 2001).
Similarly, in recent times avian influenza and West Nile virus have spilled over into human populations probably due to interactions between the carrier host and domestic animals. Highly mobile animals such as bats and birds may present a greater risk of zoonotic transmission than other animals due to the ease with which they can move into areas of human habitation.
Diseases like malaria, schistosomiasis, river blindness, and elephantiasis are not zoonotic, even though they may be transmitted by insects or use intermediate hosts vectors, because they depend on the human host for part of their life-cycle.
# Partial List of Outbreaks of Zoonosis Associated with Fairs and Petting Zoos
Template:Worldwide
Outbreaks of zoonosis have been traced to human interaction with and exposure to animals at fairs, petting zoos, and in other settings. In 2005, the Centers for Disease Control and Prevention (CDC) issued an updated list of recommendations for preventing zoonosis transmission in public settings.[1] The CDC recommendations, which were developed in conjunction with the National Association of State Public Health Veterinarians, include sections on the educational responsibilities of venue operators, managing public and animal contact, and animal care and management.
In 1988, a person became ill with Swine Influenza Virus (Swine Flu) and died after visiting the display area of the pig barn at a Wisconsin county fair. Three healthcare personnel treating the case patient also developed flu-like illness with laboratory evidence of Swine Influenza Virus infection.[2] Investigators from the CDC indicated in their final report that the Swine Flu had been transmitted directly from pig to human host.[3]
In 1994, seven cases of ‘’E. coli’’ O157:H7 infection were traced to a farm in Leicestershire, United Kingdom. An epidemiological investigation into the outbreak revealed that the strain of ‘’E. coli’’ O157:H7 isolated from nine animals on the farm was indistinguishable from the strain isolated from human samples. Investigators concluded that the most likely cause of this outbreak was direct human contact with animals.[4]
In 1995, 43 children who had visited a rural farm in Wales became ill with Cryptosporidiosis. ‘’Cryptosporidium’’ was isolated from seven of the ill children. An epidemiological investigation indicated that the source of the children’s illness was contact with calves at the farm.[5]
Also in 1995, at least thirteen children became ill with ‘’Cryptosporidiosis’’ after visiting a farm in Dublin, Ireland. In a case-control study, researchers compared the activities of the thirteen ill children, or cases, to the activities of 52 out of 55 people who had visited the farm – the controls. The study revealed that illness was significantly associated with playing in the sand in a picnic area beside a stream where animals had access.[6]
In 1997, an ‘’E. coli’’ O157:H7 outbreak was identified among one child who lived on an open farm and two children who visited the farm during school parties. Two of the three children developed hemolytic uremic syndrome (HUS). Isolates collected from the three children and from samples taken at the farm were indistinguishable, demonstrating evidence of the link between the farm and the children’s illness.[7]
In 1999, what is believed to be the largest outbreak of waterborne ‘’E. coli’’ O157:H7 illness in United States history occurred at the Washington County, New York fair. The New York State Department of Health identified 781 individuals who were suspected of being infected with either ‘’E. coli’’ O157:H7 or ‘’Campylobacter jejuni’’. An investigation into the outbreak revealed that consumption of beverages purchased from vendors supplied with water drawn from an unchlorinated fairgrounds well was associated with illness. In all, 127 outbreak victims were confirmed ill with ‘’E. coli’’ O157:H7 infections; 71 were hospitalized, 14 developed HUS, and two died.[8]
In 2000, 51 people became ill with confirmed or suspected ‘’E. coli’’ O157:H7 infections after visiting a dairy farm in Pennsylvania. Eight children developed HUS. A case-control study among visitors to the dairy was conducted jointly by the CDC, Pennsylvania Department of Health, and the Montgomery County Health Department. The study’s authors concluded that ‘’E. coli’’ was transmitted to visitors as a result of contamination on animal hides and in the environment.[9]
Also in 2000, 43 visitors to the Medina County fair in Ohio were confirmed ill with ‘’E. coli’’ O157:H7 infections. An investigation into the outbreak suggested that the water system from which food vendors were supplied was the source of the ‘’E. coli’’ outbreak. Several months later, five children became ill with ‘’E. coli’’ infections after attending a “Carnival of Horrors” event held at the Medina County fairgrounds. PFGE analysis of the strains of ‘’E. coli’’ isolated from members of both outbreaks revealed an indistinguishable pattern, and investigators from the Medina County Health Department and the CDC determined that the Medina County Fairgrounds water distribution system was the source of both ‘’E. coli’’ outbreaks.[10]
In 2001, an ‘’E. coli’’ O157:H7 outbreak was traced to exposure in the Cow Palace at the Lorain County Fair in Ohio. CDC investigators identified 23 cases of ‘’E. coli’’ infection associated with attendance at the Lorain County Fair, with additional secondary cases likely. Two people developed HUS. An environmental and site investigation revealed ‘’E. coli’’ contamination on doorways, rails, bleachers, and sawdust. Investigators concluded that the Lorain County Fair was the source of the outbreak.[11]
Wyandot County, Ohio, also reported an ‘’E. coli’’ O157:H7 outbreak in 2001. Ninety-two ‘’E. coli’’ infections were reported to the Wyandot County Health Department and the CDC, with 27 cases confirmed using laboratory analysis. Two cases developed HUS. Contact with infected cattle was believed to be the source of the outbreak; however, a specific cause was never identified.[11]
In 2002, seven people became ill with ‘’E. coli’’ O157:H7 infections after visiting a large agricultural fair in Ontario, Canada. Outbreak investigators conducted a case-control study, which indicated that goats and sheep from a petting zoo were the source of the ‘’E. coli’’ among fair visitors. Other indications were that the fencing and environment surrounding the petting zoo could have been a source of transmission.[12]
What is believed to be the largest ‘’E. coli’’ O157:H7 outbreak in Oregon State history occurred among attendees at the Lane County Fair in 2002.[13] An Oregon Department of Human Services – Health Services investigation led to the belief that the ‘’E. coli’’ outbreak originated from exposure in the sheep and goat barn. In all, 79 people were confirmed ill with ‘’E. coli’’ infections as part of the outbreak; 22 were hospitalized, and 12 suffered HUS.[14]
In 2003, fair visitors and animal exhibitors at the Fort Bend County Fair in Texas became ill with ‘’E. coli’’ O157:H7 infections. An outbreak investigation led to the determination that 25 people had become ill with ‘’E. coli’’ infections after attending the Fort Bend County Fair; seven people were laboratory-confirmed with ‘’E. coli’’, and 5 developed HUS or TTP (Thrombotic Thrombocytopenic Purpura). Investigators isolated a strain of ‘’E. coli’’ indistinguishable from the outbreak strain from four animal husbandry sites, and found high levels of ‘’E. coli’’ contamination in both rodeo and animal exhibit areas.[15]
In 2004, a large ‘’E. coli’’ O157:H7 outbreak occurred among visitors at the 2004 North Carolina State Fair. During its investigation into the outbreak, the North Carolina Department of Health and Human Services (NCDHHS) received over 180 reports of illness, and documented 33 culture-confirmed cases of ‘’E. coli’’ O157:H7 associated with attendance at the fair, with 15 children developing HUS. In its final investigation report, NCDHHS concluded that the North Carolina State Fair ‘’E. coli’’ outbreak had originated at a petting zoo exhibit. The conclusion was supported by a case-control study, environmental sampling, and laboratory analysis of samples collected from the fair and members of the outbreak.[16]
In 2005, a petting zoo that exhibited at two Florida fairs and a festival was traced as the source of an ‘’E. coli’’ O157:H7 outbreak. Sixty-three people who had visited either the Florida State Fair, the Central Florida Fair, or the Florida Strawberry Festival reported illness to investigators for the Florida Department of Health, including 20 who were culture-confirmed and 7 with HUS. A case-control study revealed that illness was associated with exposure to a petting zoo exhibit present at all three events.[17] | https://www.wikidoc.org/index.php/Zoonotic | |
2d2f3948ba5d8fd88b69652964e380f8801cbb3b | wikidoc | Zostavax | Zostavax
Zostavax is a live vaccine developed by Merck & Co. which has been shown to reduce the incidence of herpes zoster (known as Shingles) by 51.3% in a pivotal phase III study of 38,000 adults aged 60 and older who received the vaccine. The vaccine also reduced by 66.5% the number of cases of postherpetic neuralgia and reduced the severity and duration of pain and discomfort associated with shingles, by 61.1%.
Zostovax was approved by the FDA in May, 2006. The FDA recommended it only for adults aged 60 who meet the following requirements:
- Has not had a life-threatening allergic reaction to gelatin, the antibiotic neomycin, or other component of the herpes zoster vaccine.
- Does not have a weakened immune system due to HIV/AIDS or another disease or medications (such as steroids, radiation and chemotherapy) that affect the immune system.
- Does not have a history of cancer affecting the bone marrow or lymphatic system, such as leukemia or lymphoma.
- Does not have active, untreated tuberculosis.
On October 25th, 2006, the CDC's Advisory Committee on Immunization Practices (ACIP) voted to recommend that Zostavax be given to all adults age 60 and over, including those who have had a previous episode of shingles. | Zostavax
Zostavax is a live vaccine developed by Merck & Co. which has been shown to reduce the incidence of herpes zoster (known as Shingles) by 51.3% in a pivotal phase III study of 38,000 adults aged 60 and older who received the vaccine. The vaccine also reduced by 66.5% the number of cases of postherpetic neuralgia and reduced the severity and duration of pain and discomfort associated with shingles, by 61.1%.[1]
Zostovax was approved by the FDA in May, 2006[2]. The FDA recommended it only for adults aged 60 who meet the following requirements[1]:
- Has not had a life-threatening allergic reaction to gelatin, the antibiotic neomycin, or other component of the herpes zoster vaccine.
- Does not have a weakened immune system due to HIV/AIDS or another disease or medications (such as steroids, radiation and chemotherapy) that affect the immune system.
- Does not have a history of cancer affecting the bone marrow or lymphatic system, such as leukemia or lymphoma.
- Does not have active, untreated tuberculosis.
On October 25th, 2006, the CDC's Advisory Committee on Immunization Practices (ACIP) voted to recommend that Zostavax be given to all adults age 60 and over, including those who have had a previous episode of shingles[3]. | https://www.wikidoc.org/index.php/Zostavax | |
5a4bb43cfb1d402bc254b4d43019daad948fed4f | wikidoc | Zotepine | Zotepine
# Overview
Zotepine (brand names: Losizopilon (JP), Lodopin (ID, JP), Setous (JP), Zoleptil (CZ, PT, TR, UK†); where † indicates a formulation that has been discontinued) is an atypical antipsychotic drug indicated for acute and chronic schizophrenia. It has been used in Germany since 1990 (although it has been discontinued in Germany) and Japan since 1982.
Zotepine is not approved for use in the United States, United Kingdom, Australia, Canada or New Zealand.
# Medical Uses
Zotepine's primary use is as a treatment for schizophrenia although clinical trials have been conducted (with positive results) into its efficacy as an antimanic agent in patients with acute bipolar mania.
# Side effects
- Tachycardia
- Hypotension
- Orthostatic hypotension
- Palpitations
- Hyperprolactinaemia
- Weight gain (produces a similar degree of weight gain to that seen with clozapine and olanzapine treatment)
- Somnolence (2nd highest effect size for causing sedation out of fifteen antipsychotics compared in a recent meta-analysis)
- Extrapyramidal side effects (2nd largest odds ratio for causing EPSE out of fifteen antipsychotics compared in a recent meta-analysis, second only to haloperidol)
- Constipation
- Xerostomia (dry mouth)
- Blurred vision
- Hypersalivation (drooling)
- Mydriasis
- Anxiety
- Agitation
- Rhinitis
- Sexual dysfunction
- Dyspnoea
- Diarrhoea
- Influenza-like symptoms
- Cough
- Vertigo
- Confusion
- Dyspepsia
- Flushing dry skin
- Arthralgia
- Myalgia
- Acne
- Conjunctivitis
- Thrombocythaemia
- QT interval prolongation
- Hyperthermia
- Hypothermia
- Increased serum creatinine
- Hyperglycaemia
- Hypoglycaemia
- Hyperlipidaemia
- Thirst
- Urinary incontinence
- Angle-closure glaucoma
- Agranulocytosis
- Neutropaenia
- Eosinophilia
- Leukocytopenia
- Hypoesthesia
- Anaemia
- Myoclonus
- Myasthenia
- Alopecia
- Thrombocytopaenia
- Bradycardia
- Epistaxis
- Abdominal enlargement
- Deep vein thrombosis
- Paralytic ileus
- Leukopenia
- Tardive dyskinesia
- Neuroleptic malignant syndrome
- Laryngeal edema
- Urinary retention
- Depression
- Ataxia
- Amnesia
- Seizure (dose-dependent risk)
- Metabolic syndrome
- Diabetes mellitus type II
- Cholestasis
- Increased liver enzymes
- Photosensitivity
- Exanthema
- Pruritus
- Hypouricemia
- Oedema
# Pharmacology
The antipsychotic effect of zotepine is thought to be mediated through antagonist activity at dopamine and serotonin receptors. Zotepine has a high affinity for the D1 and D2 receptors. It also affects the 5-HT2A, 5-HT2C, 5-HT6, and 5-HT7 receptors. In addition, its active metabolite, norzotepine, serves as a potent norepinephrine reuptake inhibitor.
# Dosing
The most common dosage used is 150 mg daily. It is suggested that zotepine therapy starts at 75 mg to 150 mg divided into three daily doses. Some people may need to have their dosage increased to 300 mg. | Zotepine
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
# Overview
Zotepine (brand names: Losizopilon (JP), Lodopin (ID, JP), Setous (JP), Zoleptil (CZ, PT, TR, UK†); where † indicates a formulation that has been discontinued) is an atypical antipsychotic drug indicated for acute and chronic schizophrenia. It has been used in Germany since 1990 (although it has been discontinued in Germany) and Japan since 1982.
Zotepine is not approved for use in the United States, United Kingdom, Australia, Canada or New Zealand.[2]
# Medical Uses
Zotepine's primary use is as a treatment for schizophrenia[3] although clinical trials have been conducted (with positive results) into its efficacy as an antimanic agent in patients with acute bipolar mania.[4][5][6]
# Side effects
- Tachycardia
- Hypotension
- Orthostatic hypotension
- Palpitations
- Hyperprolactinaemia
- Weight gain (produces a similar degree of weight gain to that seen with clozapine and olanzapine treatment)[7]
- Somnolence (2nd highest effect size for causing sedation out of fifteen antipsychotics compared in a recent meta-analysis)[7]
- Extrapyramidal side effects [EPSE] (2nd largest odds ratio for causing EPSE out of fifteen antipsychotics compared in a recent meta-analysis, second only to haloperidol)[7]
- Constipation
- Xerostomia (dry mouth)
- Blurred vision
- Hypersalivation (drooling)
- Mydriasis
- Anxiety
- Agitation
- Rhinitis
- Sexual dysfunction
- Dyspnoea
- Diarrhoea
- Influenza-like symptoms
- Cough
- Vertigo
- Confusion
- Dyspepsia
- Flushing dry skin
- Arthralgia
- Myalgia
- Acne
- Conjunctivitis
- Thrombocythaemia
- QT interval prolongation
- Hyperthermia
- Hypothermia
- Increased serum creatinine
- Hyperglycaemia
- Hypoglycaemia
- Hyperlipidaemia
- Thirst
- Urinary incontinence
- Angle-closure glaucoma
- Agranulocytosis
- Neutropaenia
- Eosinophilia
- Leukocytopenia
- Hypoesthesia
- Anaemia
- Myoclonus
- Myasthenia
- Alopecia
- Thrombocytopaenia
- Bradycardia
- Epistaxis
- Abdominal enlargement
- Deep vein thrombosis
- Paralytic ileus
- Leukopenia
- Tardive dyskinesia
- Neuroleptic malignant syndrome
- Laryngeal edema
- Urinary retention
- Depression
- Ataxia
- Amnesia
- Seizure (dose-dependent risk)[2]
- Metabolic syndrome
- Diabetes mellitus type II
- Cholestasis
- Increased liver enzymes
- Photosensitivity
- Exanthema
- Pruritus
- Hypouricemia
- Oedema
# Pharmacology
The antipsychotic effect of zotepine is thought to be mediated through antagonist activity at dopamine and serotonin receptors. Zotepine has a high affinity for the D1 and D2 receptors. It also affects the 5-HT2A, 5-HT2C, 5-HT6, and 5-HT7 receptors.[8] In addition, its active metabolite, norzotepine, serves as a potent norepinephrine reuptake inhibitor.[9]
# Dosing
The most common dosage used is 150 mg daily. It is suggested that zotepine therapy starts at 75 mg to 150 mg divided into three daily doses. Some people may need to have their dosage increased to 300 mg.[2] | https://www.wikidoc.org/index.php/Zotepine | |
2c69d07b3e94bd3ffe76a55bd1b5a68bf65439d9 | wikidoc | CYP17A1 | CYP17A1
Cytochrome P450 17A1, also called steroid 17α-monooxygenase, 17α-hydroxylase, 17,20-lyase, or 17,20-desmolase, is an enzyme of the hydroxylase type that in humans is encoded by the CYP17A1 gene on chromosome 10. It is ubiquitously expressed in many tissues and cell types, including the zona reticularis of the adrenal cortex and zona fasciculata as well as gonadal tissues. This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are generally regarded as monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids, and other lipids, including the remarkable carbon-carbon bond scission catalyzed by this enzyme. This protein localizes to the endoplasmic reticulum. It has both 17α-hydroxylase and 17,20-lyase activities, and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. More specifically, CYP17A1 acts upon pregnenolone and progesterone to add a hydroxyl (-OH) group at carbon 17 of the steroid D ring (the hydroxylase activity), or acts upon 17α-hydroxyprogesterone and 17α-hydroxypregnenolone to split the side-chain off the steroid nucleus (the lyase activity). The CYP17A1 gene also contains one of 27 SNPs associated with increased risk of coronary artery disease.
# Structure
## Gene
The CYP17A1 gene resides on chromosome 10 at the band 10q24.3 and contains 8 exons. The cDNA of this gene spans a length of 1527 bp.
## Protein
CYP17A1 is a 57.4 kDa protein that belongs to the cytochrome P450 family. The protein encoded by its cDNA is composed of 508 amino acid residues. As an enzyme, CYP17A1 possesses an active site that associates with a heme prosthetic group to catalyze biosynthetic reactions. Based on its known structures while bound to two steroidal inhibitors, abiraterone and galeterone, CYP17A1 possesses the canonical cytochrome P450 fold present in other complex P450 enzymes that participate in steroidogenesis or cholesterol metabolism, though it orients the steroid ligands toward the F and G helices, perpendicular to the heme group, rather than the β1 sheet.
# Expression
Expression of CYP17A1 has been found in all of the traditional steroidogenic tissues except the placenta, including the zona reticularis and zona fasciculata of the adrenal cortex, the Leydig cells of the testes, the thecal cells of the ovaries, and, more recently, in luteinized granulosa cells in ovarian follicles. In addition to classical steroidogenic tissue, CYP17A1 has also been detected in the heart, kidney, and adipose tissue. In the fetus, CYP17A1 has been reported in the kidney, thymus, and spleen.
# Function
CYP17A1 is a member of the cytochrome P450 superfamily of enzymes localized in the endoplasmic reticulum. Proteins in this family are monooxygenases that catalyze synthesis of cholesterol, steroids and other lipids and are involved in drug metabolism. CYP17A1 has both 17α-hydroxylase activity and 17,20-lyase activity. The 17α-hydroxylase activity of CYP17A1 is required for the generation of glucocorticoids such as cortisol, but both the hydroxylase and 17,20-lyase activities of CYP17A1 are required for the production of androgenic and oestrogenic sex steroids by converting 17α-hydroxypregnenolone to dehydroepiandrosterone (DHEA). Mutations in this gene are associated with isolated steroid-17α-hydroxylase deficiency, 17α-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia.
Furthermore, the 17,20-lyase activity is dependent on cytochrome P450 oxidoreductase (POR) cytochrome b5 (CYB5) and phosphorylation. Cytochrome b5 acts as a facilitator for 17,20 lyase activity of CYP17A1 and can donate a second electron to some P450s. In humans the production of testosterone via pregnenolone to17-OHPreg and DHEA by the CYP17A1 requires POR. Human P450c17 is phosphorylated on serine and threonine residues by a cAMP-dependent protein kinase. Phosphorylation of P450c17 increases 17,20-lyase activity, while dephosphorylation virtually eliminates this activity.
# Clinical significance
Mutations in this gene are associated with rare forms of congenital adrenal hyperplasia, specifically 17α-hydroxylase deficiency/17,20-lyase deficiency and isolated 17,20-lyase deficiency.
In humans, the CYP17A1 gene is largely associated with endocrine effects and steroid hormone metabolism. Furthermore, mutations in the CYP17A1 gene are associated with rare forms of congenital adrenal hyperplasia, in particular 17α-hydroxylase deficiency/17,20-lyase deficiency and isolated 17,20-lyase deficiency. Overall, CYP17A1 is an important target for inhibition in the treatment of prostate cancer because it produces androgen that is required for tumor cell growth. Currently, the FDA has approved only one CYP17A1 inhibitor, abiraterone, which contains a steroidal scaffold that is similar to the endogenous CYP17A1 substrates. Abiraterone is structurally similar to the substrates of other cytochrome P450 enzymes involved in steroidogenesis, and interference can pose a liability in terms of side effects. Using nonsteroidal scaffolds is expected to enable the design of compounds that interact more selectively with CYP17A1. Potent inhibitors of the CYP17A1 enzyme provide a last line defense against ectopic androgenesis in advanced prostate cancer.
## Clinical marker
A multi-locus genetic risk score study based on a combination of 27 loci, including the CYP17A1 gene, identified individuals at increased risk for both incident and recurrent coronary artery disease events, as well as an enhanced clinical benefit from statin therapy. The study was based on a community cohort study (the Malmo Diet and Cancer study) and four additional randomized controlled trials of primary prevention cohorts (JUPITER and ASCOT) and secondary prevention cohorts (CARE and PROVE IT-TIMI 22).
# As a drug target
## CYP17A1 inhibitors
The drug abiraterone acetate, which is used to treat castration-resistant prostate cancer, blocks the biosynthesis of androgens by inhibiting the CYP17A1 enzyme. Abiraterone acetate binds in the active site of the enzyme and coordinates the heme iron through its pyridine nitrogen, mimicking the subtrate.
Since 2014, galeterone has been in phase III clinical trials for castration-resistant prostate cancer.
Ketoconazole is an older CYP17A1 inhibitor that is now little used. However Ketoconazole competitively inhibits CYP17A1, therefore its effectiveness will depend on the concentration of Ketoconazole. The drug abiraterone acetate, permanently disables CYP17A1, once it binds to it.
Innocrine Pharmaceutical has a selective CYP17A inhibitor called Seviteronel (VT-464) which does not require co-administration of glucocortoid therapy. It is in clinical trials for resistant prostate cancer and breast cancer. Innocrine's website suggests non-cancer use for VT-464 for other androgen dependent conditions such as CAH, PCOS, precocious puberty, etc. Breast cancer trial should report out end of December 2017.
# Steroidogenesis
# Additional images
- Pregnenolone
Pregnenolone
- 17α-Hydroxypregnenolone
17α-Hydroxypregnenolone
- Progesterone
Progesterone
- 17α-Hydroxyprogesterone
17α-Hydroxyprogesterone
- Steroid numbering
Steroid numbering | CYP17A1
Cytochrome P450 17A1, also called steroid 17α-monooxygenase, 17α-hydroxylase, 17,20-lyase, or 17,20-desmolase, is an enzyme of the hydroxylase type that in humans is encoded by the CYP17A1 gene on chromosome 10.[1] It is ubiquitously expressed in many tissues and cell types, including the zona reticularis of the adrenal cortex and zona fasciculata as well as gonadal tissues.[2][3] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are generally regarded as monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids, and other lipids, including the remarkable carbon-carbon bond scission catalyzed by this enzyme. This protein localizes to the endoplasmic reticulum. It has both 17α-hydroxylase and 17,20-lyase activities, and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. More specifically, CYP17A1 acts upon pregnenolone and progesterone to add a hydroxyl (-OH) group at carbon 17 of the steroid D ring (the hydroxylase activity), or acts upon 17α-hydroxyprogesterone and 17α-hydroxypregnenolone to split the side-chain off the steroid nucleus (the lyase activity).[3] The CYP17A1 gene also contains one of 27 SNPs associated with increased risk of coronary artery disease.[4]
# Structure
## Gene
The CYP17A1 gene resides on chromosome 10 at the band 10q24.3 and contains 8 exons.[1] The cDNA of this gene spans a length of 1527 bp.[5]
## Protein
CYP17A1 is a 57.4 kDa protein that belongs to the cytochrome P450 family.[6][7] The protein encoded by its cDNA is composed of 508 amino acid residues. As an enzyme, CYP17A1 possesses an active site that associates with a heme prosthetic group to catalyze biosynthetic reactions.[5] Based on its known structures while bound to two steroidal inhibitors, abiraterone and galeterone, CYP17A1 possesses the canonical cytochrome P450 fold present in other complex P450 enzymes that participate in steroidogenesis or cholesterol metabolism, though it orients the steroid ligands toward the F and G helices, perpendicular to the heme group, rather than the β1 sheet.[8][9]
# Expression
Expression of CYP17A1 has been found in all of the traditional steroidogenic tissues except the placenta, including the zona reticularis and zona fasciculata of the adrenal cortex, the Leydig cells of the testes, the thecal cells of the ovaries, and, more recently, in luteinized granulosa cells in ovarian follicles.[10] In addition to classical steroidogenic tissue, CYP17A1 has also been detected in the heart, kidney, and adipose tissue.[10] In the fetus, CYP17A1 has been reported in the kidney, thymus, and spleen.[10]
# Function
CYP17A1 is a member of the cytochrome P450 superfamily of enzymes localized in the endoplasmic reticulum. Proteins in this family are monooxygenases that catalyze synthesis of cholesterol, steroids and other lipids and are involved in drug metabolism.[1] CYP17A1 has both 17α-hydroxylase activity and 17,20-lyase activity. The 17α-hydroxylase activity of CYP17A1 is required for the generation of glucocorticoids such as cortisol, but both the hydroxylase and 17,20-lyase activities of CYP17A1 are required for the production of androgenic and oestrogenic sex steroids by converting 17α-hydroxypregnenolone to dehydroepiandrosterone (DHEA).[11] Mutations in this gene are associated with isolated steroid-17α-hydroxylase deficiency, 17α-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia.[1]
Furthermore, the 17,20-lyase activity is dependent on cytochrome P450 oxidoreductase (POR) cytochrome b5 (CYB5) and phosphorylation.[12][13][14] Cytochrome b5 acts as a facilitator for 17,20 lyase activity of CYP17A1 and can donate a second electron to some P450s. In humans the production of testosterone via pregnenolone to17-OHPreg and DHEA by the CYP17A1 requires POR.[15] Human P450c17 is phosphorylated on serine and threonine residues by a cAMP-dependent protein kinase. Phosphorylation of P450c17 increases 17,20-lyase activity, while dephosphorylation virtually eliminates this activity.[14]
# Clinical significance
Mutations in this gene are associated with rare forms of congenital adrenal hyperplasia, specifically 17α-hydroxylase deficiency/17,20-lyase deficiency and isolated 17,20-lyase deficiency.[16]
In humans, the CYP17A1 gene is largely associated with endocrine effects and steroid hormone metabolism.[17][18][19] Furthermore, mutations in the CYP17A1 gene are associated with rare forms of congenital adrenal hyperplasia, in particular 17α-hydroxylase deficiency/17,20-lyase deficiency and isolated 17,20-lyase deficiency. Overall, CYP17A1 is an important target for inhibition in the treatment of prostate cancer because it produces androgen that is required for tumor cell growth. [20] [21] Currently, the FDA has approved only one CYP17A1 inhibitor, abiraterone, which contains a steroidal scaffold that is similar to the endogenous CYP17A1 substrates. Abiraterone is structurally similar to the substrates of other cytochrome P450 enzymes involved in steroidogenesis, and interference can pose a liability in terms of side effects. Using nonsteroidal scaffolds is expected to enable the design of compounds that interact more selectively with CYP17A1.[21] Potent inhibitors of the CYP17A1 enzyme provide a last line defense against ectopic androgenesis in advanced prostate cancer.[22]
## Clinical marker
A multi-locus genetic risk score study based on a combination of 27 loci, including the CYP17A1 gene, identified individuals at increased risk for both incident and recurrent coronary artery disease events, as well as an enhanced clinical benefit from statin therapy. The study was based on a community cohort study (the Malmo Diet and Cancer study) and four additional randomized controlled trials of primary prevention cohorts (JUPITER and ASCOT) and secondary prevention cohorts (CARE and PROVE IT-TIMI 22).[4]
# As a drug target
## CYP17A1 inhibitors
The drug abiraterone acetate, which is used to treat castration-resistant prostate cancer, blocks the biosynthesis of androgens by inhibiting the CYP17A1 enzyme. Abiraterone acetate binds in the active site of the enzyme [23] and coordinates the heme iron through its pyridine nitrogen, mimicking the subtrate.[24]
Since 2014, galeterone has been in phase III clinical trials for castration-resistant prostate cancer.[25]
Ketoconazole is an older CYP17A1 inhibitor that is now little used. However Ketoconazole competitively inhibits CYP17A1, therefore its effectiveness will depend on the concentration of Ketoconazole. The drug abiraterone acetate, permanently disables CYP17A1, once it binds to it.
Innocrine Pharmaceutical has a selective CYP17A inhibitor called Seviteronel (VT-464) which does not require co-administration of glucocortoid therapy. It is in clinical trials for resistant prostate cancer and breast cancer. Innocrine's website suggests non-cancer use for VT-464 for other androgen dependent conditions such as CAH, PCOS, precocious puberty, etc. Breast cancer trial should report out end of December 2017.
# Steroidogenesis
# Additional images
- Pregnenolone
Pregnenolone
- 17α-Hydroxypregnenolone
17α-Hydroxypregnenolone
- Progesterone
Progesterone
- 17α-Hydroxyprogesterone
17α-Hydroxyprogesterone
- Steroid numbering
Steroid numbering | https://www.wikidoc.org/index.php/17%CE%B1-hydroxylase | |
369ce9a0f74a3231a5329af06cb5b51f9a7ce491 | wikidoc | 23andMe | 23andMe
23andMe is a privately held biotechnology company that is developing new ways to help people make sense of their own genetic information. Google has invested $3.9M in the company. Genentech is also reported to have invested in 23andMe.
The founder, Anne Wojcicki, recently married Google co-founder Sergey Brin.
Thomas Söderqvist wrote:
There has not been much news about the company yet (see Blaine Bettinger’s blog The Genetic Geneaologist and Attila Csordas’ Pimm), but my guess is that we will hear more about it in the near future. Whatever its future prospects, however, it’s already a good example of how converging technologies ... are emerging at the start-up company level.
The marriage between Sergey Brin and Anne Wojcicki is thus not just a romantic Silicon Valley story; it’s also today’s counterpart to traditional politically motivated marital alliances and gives a new meaning to the concept of converging technologies.
Kevin Kelleher in GigaOM writes: " A case could be made that there is a good reason for Google to make this deal. And although I realize I may end up regretting it, I am going to make that case.... an investment in 23andMe lets Google chart yet another collision coarse with Microsoft’s ambitions. ... If Google wants to really organize the world information, it needs to consider DNA, the most personal of data. And what 23andMe is purporting to sell is the ultimate in navel gazing." | 23andMe
23andMe is a privately held biotechnology company that is developing new ways to help people make sense of their own genetic information. Google has invested $3.9M in the company. [1] Genentech is also reported to have invested in 23andMe.[2]
The founder, Anne Wojcicki, recently married Google co-founder Sergey Brin. [3]
[4]
Thomas Söderqvist wrote:
There has not been much news about the company yet (see Blaine Bettinger’s blog The Genetic Geneaologist and Attila Csordas’ Pimm), but my guess is that we will hear more about it in the near future. Whatever its future prospects, however, it’s already a good example of how converging technologies ... are emerging at the start-up company level.
The marriage between Sergey Brin and Anne Wojcicki is thus not just a romantic Silicon Valley story; it’s also today’s counterpart to traditional politically motivated marital alliances and gives a new meaning to the concept of converging technologies.[5]
Kevin Kelleher in GigaOM writes: " A case could be made that there is a good reason for Google to make this deal. And although I realize I may end up regretting it, I am going to make that case.... an investment in 23andMe lets Google chart yet another collision coarse [sic] with Microsoft’s ambitions. ... If Google wants to really organize the world information, it needs to consider DNA, the most personal of data. And what 23andMe is purporting to sell is the ultimate in navel gazing."[2] | https://www.wikidoc.org/index.php/23andMe | |
2a96e15481e3b93060ff9038b9710b46f6ed656e | wikidoc | CYP27A1 | CYP27A1
CYP27A1 is a gene encoding a cytochrome P450 oxidase, and is commonly known as sterol 27-hydroxylase. This enzyme is located in many different tissues where it is found within the mitochondria. It is most prominently involved in the biosynthesis of bile acids.
# Function
CYP27A1 participates in the degradation of cholesterol to bile acids in both the classic and acidic pathways. It is the initiating enzyme in the acidic pathway to bile acids, yielding oxysterols by introducing a hydroxyl group to the carbon at the 27 position in cholesterol. In the acidic pathway, it produces 27-hydroxycholesterol from cholesterol whereas in the classic or neutral pathway, it produces 3β-hydroxy-5-cholestenoic acid.
While CYP27A1 is present in many different tissues, its function in these tissues is largely uncharacterized. In macrophages, 27-hydroxycholesterol generated by this enzyme may be helpful against the production of inflammatory factors associated with cardiovascular disease.
# Clinical significance
Mutations in CYP27A1 are associated with cerebrotendineous xanthomatosis, a rare lipid storage disease.
Inhibitors of CYP27A1 may be effective as adjuvants in the treatment of ER-positive breast cancer due to inhibition of the production of 27-hydroxycholesterol (which has estrogenic actions and stimulates the growth of ER-positive breast cancer cells). Some marketed drugs that have been identified as CYP27A1 inhibitors include anastrozole, fadrozole, bicalutamide, dexmedetomidine, ravuconazole, and posaconazole.
# Interactive pathway map
Click on genes, proteins and metabolites below to link to respective articles.
- ↑ The interactive pathway map can be edited at WikiPathways: "VitaminDSynthesis_WP1531"..mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em} | CYP27A1
CYP27A1 is a gene encoding a cytochrome P450 oxidase, and is commonly known as sterol 27-hydroxylase. This enzyme is located in many different tissues where it is found within the mitochondria. It is most prominently involved in the biosynthesis of bile acids.
# Function
CYP27A1 participates in the degradation of cholesterol to bile acids in both the classic and acidic pathways.[1] It is the initiating enzyme in the acidic pathway to bile acids, yielding oxysterols by introducing a hydroxyl group to the carbon at the 27 position in cholesterol. In the acidic pathway, it produces 27-hydroxycholesterol from cholesterol whereas in the classic or neutral pathway, it produces 3β-hydroxy-5-cholestenoic acid.
While CYP27A1 is present in many different tissues, its function in these tissues is largely uncharacterized. In macrophages, 27-hydroxycholesterol generated by this enzyme may be helpful against the production of inflammatory factors associated with cardiovascular disease.[2]
# Clinical significance
Mutations in CYP27A1 are associated with cerebrotendineous xanthomatosis, a rare lipid storage disease.
Inhibitors of CYP27A1 may be effective as adjuvants in the treatment of ER-positive breast cancer due to inhibition of the production of 27-hydroxycholesterol (which has estrogenic actions and stimulates the growth of ER-positive breast cancer cells).[3] Some marketed drugs that have been identified as CYP27A1 inhibitors include anastrozole, fadrozole, bicalutamide, dexmedetomidine, ravuconazole, and posaconazole.[3]
# Interactive pathway map
Click on genes, proteins and metabolites below to link to respective articles. [§ 1]
- ↑ The interactive pathway map can be edited at WikiPathways: "VitaminDSynthesis_WP1531"..mw-parser-output cite.citation{font-style:inherit}.mw-parser-output q{quotes:"\"""\"""'""'"}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-lock-free a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-limited a,.mw-parser-output .cs1-lock-registration a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/d/d6/Lock-gray-alt-2.svg/9px-Lock-gray-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-lock-subscription a{background:url("https://upload.wikimedia.org/wikipedia/commons/thumb/a/aa/Lock-red-alt-2.svg/9px-Lock-red-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{display:none;font-size:100%}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em} | https://www.wikidoc.org/index.php/25-hydroxylase | |
5da586665f24aacdb41b4e31e34b425ce2dcbd82 | wikidoc | 2C-T-13 | 2C-T-13
2C-T-13 or 2,5-dimethoxy-4-(β-methoxyethylthio)phenethylamine is a psychedelic phenethylamine of the 2C family. It was presumably first synthesized by Alexander Shulgin and reported in his book PIHKAL.
# Chemistry
2C-T-13 is the 2 carbon homologue of Aleph-13. The full chemical name is 2-ethanamine. The drug has structural properties similar to mescaline and other drugs in the 2C-T series, with the most closely related compounds being 2C-T-7 and 2C-T-21.
# General Information
The dosage range of 2C-T-13 is typically 25 - 40 mg and its duration is approximately 6-8 hours according to Shulgin. 2C-T-13 produces many closed-eye visuals and geometric patterns. It also produces slight visual distortion.
# Pharmacology
The mechanism that produces 2C-T-13’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known.
# Dangers
The toxicity of 2C-T-13 is not well documented. 2C-T-13 is slightly less potent than 2C-T-7, but it may be expected that at higher doses it would display similar toxicity to that of other phenethylamines of the 2C-T family. Other phenethylamine derivatives substituted with an alkylthio group at the 4 position such as 2C-T-7 and 4-MTA are known to act as selective monoamine oxidase A inhibitors, a side effect which can lead to lethal serotonin syndrome when they are combined with stimulant drugs. Most confirmed fatalities involving 2C-T drugs involve their combination with other hard drugs such as alcohol, ecstasy or cocaine.
# Legality
2C-T-13 is not illegal, but possession and sales of 2C-T-13 could be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7.
# Reference
- ↑ Template:CitePiHKAL
# Categorization | 2C-T-13
2C-T-13 or 2,5-dimethoxy-4-(β-methoxyethylthio)phenethylamine is a psychedelic phenethylamine of the 2C family. It was presumably first synthesized by Alexander Shulgin and reported in his book PIHKAL.
# Chemistry
2C-T-13 is the 2 carbon homologue of Aleph-13. The full chemical name is 2-[4-(2-methoxyethylthio)-2,5-dimethoxyphenyl]ethanamine. The drug has structural properties similar to mescaline and other drugs in the 2C-T series, with the most closely related compounds being 2C-T-7 and 2C-T-21.
# General Information
The dosage range of 2C-T-13 is typically 25 - 40 mg and its duration is approximately 6-8 hours according to Shulgin. 2C-T-13 produces many closed-eye visuals and geometric patterns. It also produces slight visual distortion.[1]
# Pharmacology
The mechanism that produces 2C-T-13’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known.
# Dangers
The toxicity of 2C-T-13 is not well documented. 2C-T-13 is slightly less potent than 2C-T-7, but it may be expected that at higher doses it would display similar toxicity to that of other phenethylamines of the 2C-T family. Other phenethylamine derivatives substituted with an alkylthio group at the 4 position such as 2C-T-7 and 4-MTA are known to act as selective monoamine oxidase A inhibitors, a side effect which can lead to lethal serotonin syndrome when they are combined with stimulant drugs. Most confirmed fatalities involving 2C-T drugs involve their combination with other hard drugs such as alcohol, ecstasy or cocaine.
# Legality
2C-T-13 is not illegal, but possession and sales of 2C-T-13 could be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7.
# Reference
- ↑ Template:CitePiHKAL
# Categorization
Template:Hallucinogenic phenethylamines
Template:PiHKAL
# External links
- PiHKAL #46 2C-T-13
Template:Hallucinogen-stub
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/2C-T-13 | |
6459549f03d82475485c91133294a949173233c9 | wikidoc | 2C-T-15 | 2C-T-15
2C-T-15 or 2,5-dimethoxy-4-(β-cyclopropylthio)phenethylamine is a psychedelic phenethylamine of the 2C family. It was presumably first synthesized by Alexander Shulgin and reported in his book PIHKAL.
# Chemistry
2C-T-15 is the 2 carbon homologue of Aleph-15, which has not been synthesized. The full chemical name is 2-ethanamine. The drug has structural properties similar to 2C-T-2 and other drugs in the 2C-T series.
# General Information
The dosage range of 2C-T-15 is typically 30 mg or more. Its duration is unspecified by Shulgin, and its entry in PiHKAL says it lasts for "several hours." The effects are not prominent, and 2C-T-15 is not very potent.
# Pharmacology
The mechanism that produces 2C-T-15’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known.
# Dangers
The toxicity of 2C-T-15 is not well documented. 2C-T-15 is much less potent than 2C-T-7, but it may be expected that at very high doses it would display similar toxicity to that of other phenethylamines of the 2C-T family. Other phenethylamine derivatives substituted with an alkylthio group at the 4 position such as 2C-T-7 and 4-MTA are known to act as selective monoamine oxidase A inhibitors, a side effect which can lead to lethal serotonin syndrome when they are combined with stimulant drugs. Most confirmed fatalities involving 2C-T drugs involve their combination with other hard drugs such as alcohol, ecstasy or cocaine.
# Legality
2C-T-15 is not illegal, but possession and sales of 2C-T-15 could be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7.
# Reference
- ↑ Template:CitePiHKAL
# Categorization | 2C-T-15
2C-T-15 or 2,5-dimethoxy-4-(β-cyclopropylthio)phenethylamine is a psychedelic phenethylamine of the 2C family. It was presumably first synthesized by Alexander Shulgin and reported in his book PIHKAL.
# Chemistry
2C-T-15 is the 2 carbon homologue of Aleph-15, which has not been synthesized. The full chemical name is 2-[4-(2-cyclopropylthio)-2,5-dimethoxyphenyl]ethanamine. The drug has structural properties similar to 2C-T-2 and other drugs in the 2C-T series.
# General Information
The dosage range of 2C-T-15 is typically 30 mg or more. Its duration is unspecified by Shulgin, and its entry in PiHKAL says it lasts for "several hours."[1] The effects are not prominent, and 2C-T-15 is not very potent.
# Pharmacology
The mechanism that produces 2C-T-15’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known.
# Dangers
The toxicity of 2C-T-15 is not well documented. 2C-T-15 is much less potent than 2C-T-7, but it may be expected that at very high doses it would display similar toxicity to that of other phenethylamines of the 2C-T family. Other phenethylamine derivatives substituted with an alkylthio group at the 4 position such as 2C-T-7 and 4-MTA are known to act as selective monoamine oxidase A inhibitors, a side effect which can lead to lethal serotonin syndrome when they are combined with stimulant drugs. Most confirmed fatalities involving 2C-T drugs involve their combination with other hard drugs such as alcohol, ecstasy or cocaine.
# Legality
2C-T-15 is not illegal, but possession and sales of 2C-T-15 could be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7.
# Reference
- ↑ Template:CitePiHKAL
# Categorization
Template:Hallucinogenic phenethylamines
Template:PiHKAL
# External links
- PiHKAL #47 2C-T-15
Template:Hallucinogen-stub
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/2C-T-15 | |
8a5b994b3a5e7cee93c853d71d5324bf43306c7d | wikidoc | 2C-T-17 | 2C-T-17
2C-T-17 or 2,5-dimethoxy-4-(β-isobutylthio)phenethylamine is a psychedelic phenethylamine of the 2C family. It was presumably first synthesized by Alexander Shulgin and reported in his book PIHKAL.
# Chemistry
2C-T-17 is the 2 carbon homologue of Aleph-17, which has never been synthesized. The full chemical name is 2-ethanamine. The drug has structural properties similar to drugs in the 2C-T series, with the most closely related compounds being 2C-T-7 and 2C-T-8.
# General Information
The dosage range of 2C-T-17 is typically 60-100 mg and its duration is approximately 10-15 hours according to Shulgin. 2C-T-17 has highly psychedelic effects on thinking, but produces few to no visuals.
# Pharmacology
The mechanism that produces 2C-T-17’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known.
# Dangers
The toxicity of 2C-T-17 is not well documented. 2C-T-17 is much less potent than 2C-T-7, but it may be expected that at very high doses it would display similar toxicity to that of other phenethylamines of the 2C-T family. Other phenethylamine derivatives substituted with an alkylthio group at the 4 position such as 2C-T-7 and 4-MTA are known to act as selective monoamine oxidase A inhibitors, a side effect which can lead to lethal serotonin syndrome when they are combined with stimulant drugs. Most confirmed fatalities involving 2C-T drugs involve their combination with other hard drugs such as alcohol, ecstasy or cocaine.
# Legality
2C-T-17 is not illegal, but possession and sales of 2C-T-17 could be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7.
# Reference
- ↑ Template:CitePiHKAL
# Categorization | 2C-T-17
2C-T-17 or 2,5-dimethoxy-4-(β-isobutylthio)phenethylamine is a psychedelic phenethylamine of the 2C family. It was presumably first synthesized by Alexander Shulgin and reported in his book PIHKAL.
# Chemistry
2C-T-17 is the 2 carbon homologue of Aleph-17, which has never been synthesized. The full chemical name is 2-[4-(2-isobutylthio)-2,5-dimethoxyphenyl]ethanamine. The drug has structural properties similar to drugs in the 2C-T series, with the most closely related compounds being 2C-T-7 and 2C-T-8.
# General Information
The dosage range of 2C-T-17 is typically 60-100 mg and its duration is approximately 10-15 hours according to Shulgin. 2C-T-17 has highly psychedelic effects on thinking, but produces few to no visuals.[1]
# Pharmacology
The mechanism that produces 2C-T-17’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known.
# Dangers
The toxicity of 2C-T-17 is not well documented. 2C-T-17 is much less potent than 2C-T-7, but it may be expected that at very high doses it would display similar toxicity to that of other phenethylamines of the 2C-T family. Other phenethylamine derivatives substituted with an alkylthio group at the 4 position such as 2C-T-7 and 4-MTA are known to act as selective monoamine oxidase A inhibitors, a side effect which can lead to lethal serotonin syndrome when they are combined with stimulant drugs. Most confirmed fatalities involving 2C-T drugs involve their combination with other hard drugs such as alcohol, ecstasy or cocaine.
# Legality
2C-T-17 is not illegal, but possession and sales of 2C-T-17 could be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7.
# Reference
- ↑ Template:CitePiHKAL
# Categorization
Template:Hallucinogenic phenethylamines
Template:PiHKAL
# External links
- PiHKAL #48 2C-T-17
Template:Hallucinogen-stub
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/2C-T-17 | |
4f265520f89ab5dc69523d4227e03a00e9c818a0 | wikidoc | 2C-T-21 | 2C-T-21
2C-T-21 is a psychedelic phenethylamine of the 2C family. It was first synthesized by Alexander Shulgin, sometimes used as an entheogen. It was the first psychedelic drug known to contain six different atoms in the structure.
# Chemistry
The full name of 2C-T-21 is 4-(2-fluoroethylthio)-2,5-dimethoxyphenethylamine.
# Dosage
In his book PIHKAL (Phenethylamines I Have Known and Loved), Shulgin lists the dosage range as 8-12 mg.
# Effects
2C-T-21 is generally taken orally, and effects typically last 7 to 14 hours. The potential psychotherapeutic applications of this chemical were explored by Myron Stolaroff who found it a very promising substance in his experiments.
# Pharmacology
The mechanism that produces 2C-T-21’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known. Based on the relatively high potency of 2C-T-21, it is likely that this compound binds quite strongly to the 5HT2A receptor target.
The related drug 2C-T-7 is known to have a separate action as a selective monoamine oxidase A inhibitor, and it is likely that this side effect is shared by other drugs of the 2C-T family. This makes these drugs potentially dangerous as at high doses they can slow down the degradation of serotonin in the brain, which can lead to serotonin syndrome and potential death without treatment. Overdose with 2C-T-21 has been responsible for at least one fatality, so it is likely that this drug is a relatively strong MAO-A inhibitor in addition to its action as a 5HT2A agonist.
# Dangers
On March 9, 2004, a 22-year-old quadriplegic man named James Edwards Downs in St. Francisville, Louisiana, consumed an unknown dose of 2C-T-21 by sticking his tongue into a vial of powder he had purchased from www.americanchemicalsupply.com — a practice he had been engaging in since purchasing a gram. He developed temperature of 108 degrees Fahrenheit (42 degrees Celsius), had a grand mal seizure, and slipped into a coma. Four days later, on March 13, Downs died at Lane Memorial Hospital in Zachary, LA.
This death became part of a two year DEA investigation called Operation Web Tryp which was launched in 2002 following the death of a New York man who had taken unspecified chemicals purchased from David Linder (aka Pondman or Dr. Benway, the latter a reference to a character created by William S. Burroughs). On July 22, 2004, the owners of American Chemical Supply were arrested on federal charges relating to distribution of controlled substance analogues and the death of James Edwards Downs. Little is known about the toxicity of 2C-T-21 beyond this incident.
# Legality
2C-T-21 is unscheduled and uncontrolled in the United States, but possession and sales of 2C-T-21 would probably be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7 and its known potential to cause death. In the wake of Operation Web Tryp in July 2004, at least one "research chemical" distributor faced charges as a consequence of the death of James Downs from 2C-T-21 overdose.
# Reference
- ↑ Template:CitePiHKAL
# Categorization | 2C-T-21
2C-T-21 is a psychedelic phenethylamine of the 2C family. It was first synthesized by Alexander Shulgin, sometimes used as an entheogen. It was the first psychedelic drug known to contain six different atoms in the structure.
# Chemistry
The full name of 2C-T-21 is 4-(2-fluoroethylthio)-2,5-dimethoxyphenethylamine.
# Dosage
In his book PIHKAL (Phenethylamines I Have Known and Loved), Shulgin lists the dosage range as 8-12 mg.[1]
# Effects
2C-T-21 is generally taken orally, and effects typically last 7 to 14 hours. The potential psychotherapeutic applications of this chemical were explored by Myron Stolaroff who found it a very promising substance in his experiments.
# Pharmacology
The mechanism that produces 2C-T-21’s hallucinogenic and entheogenic effects has not been specifically established, however it is most likely to result from action as a 5-HT2A serotonin receptor agonist in the brain, a mechanism of action shared by all of the hallucinogenic tryptamines and phenethylamines for which the mechanism of action is known. Based on the relatively high potency of 2C-T-21, it is likely that this compound binds quite strongly to the 5HT2A receptor target.
The related drug 2C-T-7 is known to have a separate action as a selective monoamine oxidase A inhibitor, and it is likely that this side effect is shared by other drugs of the 2C-T family. This makes these drugs potentially dangerous as at high doses they can slow down the degradation of serotonin in the brain, which can lead to serotonin syndrome and potential death without treatment. Overdose with 2C-T-21 has been responsible for at least one fatality, so it is likely that this drug is a relatively strong MAO-A inhibitor in addition to its action as a 5HT2A agonist.
# Dangers
On March 9, 2004, a 22-year-old quadriplegic man named James Edwards Downs in St. Francisville, Louisiana, consumed an unknown dose of 2C-T-21 by sticking his tongue into a vial of powder he had purchased from www.americanchemicalsupply.com — a practice he had been engaging in since purchasing a gram. He developed temperature of 108 degrees Fahrenheit (42 degrees Celsius), had a grand mal seizure, and slipped into a coma. Four days later, on March 13, Downs died at Lane Memorial Hospital in Zachary, LA.
This death became part of a two year DEA investigation called Operation Web Tryp which was launched in 2002 following the death of a New York man who had taken unspecified chemicals purchased from David Linder (aka Pondman or Dr. Benway, the latter a reference to a character created by William S. Burroughs). On July 22, 2004, the owners of American Chemical Supply were arrested on federal charges relating to distribution of controlled substance analogues and the death of James Edwards Downs. Little is known about the toxicity of 2C-T-21 beyond this incident.
# Legality
2C-T-21 is unscheduled and uncontrolled in the United States, but possession and sales of 2C-T-21 would probably be prosecuted under the Federal Analog Act because of its structural similarities to 2C-T-7 and its known potential to cause death. In the wake of Operation Web Tryp in July 2004, at least one "research chemical" distributor faced charges as a consequence of the death of James Downs from 2C-T-21 overdose.
# Reference
- ↑ Template:CitePiHKAL
# Categorization
Template:Hallucinogenic phenethylamines
Template:PiHKAL
# External links
- 2C-T-21 information from www.bluelight.ru
- 2C-T-21 Entry in PIHKAL
- Erowid 2C-T-21 Vault
Template:WikiDoc Sources | https://www.wikidoc.org/index.php/2C-T-21 | |
51c6941779a305b9a92b9c6ef8ab44b290067a20 | wikidoc | 7SK RNA | 7SK RNA
In molecular biology 7SK is an abundant small nuclear RNA found in metazoans. It plays a role in regulating transcription by controlling the positive transcription elongation factor P-TEFb. 7SK is found in a small nuclear ribonucleoprotein complex (snRNP) with a number of other proteins that regulate the stability and function of the complex.
# Structure
An early study indicated that 7SK in cells is associated with a number of proteins and probing of the secondary structure suggested a model for base pairing between different regions of the RNA. A breakthrough in the function of the 7SK snRNP came with the finding that the positive transcription elongation factor P-TEFb was a component of the complex. 7SK associates with and inhibits the cyclin dependent kinase activity of P-TEFb through the action of the RNA binding proteins HEXIM1 or HEXIM2. The gamma phosphate at the 5' end of 7SK is methylated by the methylphosphate capping enzyme MEPCE which is a constitutive component of the 7SK snRNP. A La related protein LARP7 is also found associated with 7SK, presumably in part through its interaction with the 3' end of the RNA. Reduction of either MEPCE or LARP7 by siRNA mediated knockdown leads to destabilization of 7SK in vivo. A subset of 7SK snRNPs lack P-TEFb and HEXIM, but contains hnRNPs instead.
# Function
The major function of the 7SK snRNP is control of the P-TEFb, a factor that regulates the elongation phase of transcription. The kinase activity of P-TEFb is inhibited when the factor is in the 7SK snRNP. P-TEFb can be released from the 7SK snRNP by either the HIV transactivator Tat or the bromodomain containing protein BRD4. This release leads to a conformational change in 7SK RNA and the ejection of HEXIM. hnRNPs stabilize the complex lacking P-TEFb and HEXIM. After P-TEFb functions on specific genes it is re-sequestered in the 7SK snRNP by an unknown mechanism. The 7SK snRNP has been characterized in both human and Drosophila.
Detailed review. | 7SK RNA
In molecular biology 7SK is an abundant small nuclear RNA found in metazoans.[1] It plays a role in regulating transcription by controlling the positive transcription elongation factor P-TEFb.[2] 7SK is found in a small nuclear ribonucleoprotein complex (snRNP) with a number of other proteins that regulate the stability and function of the complex.
# Structure
An early study indicated that 7SK in cells is associated with a number of proteins and probing of the secondary structure suggested a model for base pairing between different regions of the RNA.[3] A breakthrough in the function of the 7SK snRNP came with the finding that the positive transcription elongation factor P-TEFb was a component of the complex.[4][5] 7SK associates with and inhibits the cyclin dependent kinase activity of P-TEFb through the action of the RNA binding proteins HEXIM1[6][7] or HEXIM2.[8][9] The gamma phosphate at the 5' end of 7SK is methylated by the methylphosphate capping enzyme MEPCE which is a constitutive component of the 7SK snRNP.[10] A La related protein LARP7 is also found associated with 7SK, presumably in part through its interaction with the 3' end of the RNA.[11][12][13] Reduction of either MEPCE or LARP7 by siRNA mediated knockdown leads to destabilization of 7SK in vivo. A subset of 7SK snRNPs lack P-TEFb and HEXIM, but contains hnRNPs instead.[14]
# Function
The major function of the 7SK snRNP is control of the P-TEFb, a factor that regulates the elongation phase of transcription.[2] The kinase activity of P-TEFb is inhibited when the factor is in the 7SK snRNP. P-TEFb can be released from the 7SK snRNP by either the HIV transactivator Tat or the bromodomain containing protein BRD4. This release leads to a conformational change in 7SK RNA and the ejection of HEXIM.[15] hnRNPs stabilize the complex lacking P-TEFb and HEXIM. After P-TEFb functions on specific genes it is re-sequestered in the 7SK snRNP by an unknown mechanism. The 7SK snRNP has been characterized in both human and Drosophila.[16]
Detailed review.[17] | https://www.wikidoc.org/index.php/7SK_RNA | |
8f84ff29a84b1c3c86228cba60ec557a302b8071 | wikidoc | ADAMTS1 | ADAMTS1
A disintegrin and metalloproteinase with thrombospondin motifs 1 is an enzyme that in humans is encoded by the ADAMTS1 gene.
# Function
This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene contains two disintegrin loops and three C-terminal TS motifs and has anti-angiogenic activity. The expression of this gene may be associated with various inflammatory processes as well as development of cancer cachexia. This gene is likely to be necessary for normal growth, fertility, and organ morphology and function.
# Interactions
ADAMTS1 has been shown to interact with Vascular endothelial growth factor A. | ADAMTS1
A disintegrin and metalloproteinase with thrombospondin motifs 1 is an enzyme that in humans is encoded by the ADAMTS1 gene.[1][2]
# Function
This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene contains two disintegrin loops and three C-terminal TS motifs and has anti-angiogenic activity. The expression of this gene may be associated with various inflammatory processes as well as development of cancer cachexia. This gene is likely to be necessary for normal growth, fertility, and organ morphology and function.[2]
# Interactions
ADAMTS1 has been shown to interact with Vascular endothelial growth factor A.[3] | https://www.wikidoc.org/index.php/ADAMTS1 | |
076e4adb1cb83fba04fc075c6c924658dff2ade9 | wikidoc | ADAMTS2 | ADAMTS2
A disintegrin and metalloproteinase with thrombospondin motifs 2 (ADAM-TS2) also known as procollagen I N-proteinase (PC I-NP) is an enzyme that in humans is encoded by the ADAMTS2 gene.
# Gene
The ADAMTS2 gene is located on the long (q) arm of chromosome 5 at the end (terminus) of the arm, from base pair 178,473,473 to base pair 178,704,934.
# Function
ADAMTS2 is responsible for processing several types of procollagen proteins. Procollagens are the precursors of collagens, the proteins that add strength and support to many body tissues. Specifically, this enzyme clips a short chain of amino acids off one end of the procollagen. This clipping step is necessary for collagen molecules to function normally and assemble into fibrils outside cells.
# Clinical significance
Ehlers-Danlos syndrome, dermatosparaxis type is caused by mutations in the ADAMTS2 gene. Several mutations in the ADAMTS2 gene have been identified in people with this syndrome. These mutations greatly reduce the production of the enzyme made by the ADAMTS2 gene. Procollagen cannot be processed correctly without this enzyme. As a result, collagen fibrils are not assembled properly; they appear ribbon-like and disorganized under the microscope. Cross-links, or chemical interactions, between collagen fibrils are also affected. These defects weaken connective tissue (the tissue that binds and supports the body's muscles, ligaments, organs, and skin), which causes the signs and symptoms of the disorder. | ADAMTS2
A disintegrin and metalloproteinase with thrombospondin motifs 2 (ADAM-TS2) also known as procollagen I N-proteinase (PC I-NP) is an enzyme[1] that in humans is encoded by the ADAMTS2 gene.[2][3]
# Gene
The ADAMTS2 gene is located on the long (q) arm of chromosome 5 at the end (terminus) of the arm, from base pair 178,473,473 to base pair 178,704,934.
# Function
ADAMTS2 is responsible for processing several types of procollagen proteins. Procollagens are the precursors of collagens, the proteins that add strength and support to many body tissues. Specifically, this enzyme clips a short chain of amino acids off one end of the procollagen. This clipping step is necessary for collagen molecules to function normally and assemble into fibrils outside cells.
# Clinical significance
Ehlers-Danlos syndrome, dermatosparaxis type is caused by mutations in the ADAMTS2 gene.[3] Several mutations in the ADAMTS2 gene have been identified in people with this syndrome. These mutations greatly reduce the production of the enzyme made by the ADAMTS2 gene. Procollagen cannot be processed correctly without this enzyme. As a result, collagen fibrils are not assembled properly; they appear ribbon-like and disorganized under the microscope. Cross-links, or chemical interactions, between collagen fibrils are also affected. These defects weaken connective tissue (the tissue that binds and supports the body's muscles, ligaments, organs, and skin), which causes the signs and symptoms of the disorder. | https://www.wikidoc.org/index.php/ADAMTS2 | |
8ad73b95253d7159a6f4ec0bc2cafaa8e7019b5f | wikidoc | ADAMTS3 | ADAMTS3
A disintegrin and metalloproteinase with thrombospondin motifs 3 is an enzyme that in humans is encoded by the ADAMTS3 gene. The protein encoded by this gene is the major procollagen II N-propeptidase.
# Structure
This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene is the major procollagen II N-propeptidase.
# Function
Because of the high similarity to ADAMTS2, the major substrate of ADAMTS3 had been erroneously assumed to be procollagen II. However, ADAMTS3 appears largely irrelevant for collagen maturation but instead is required for the activation of the lymphangiogenic growth factor VEGF-C. Hence, ADAMTS3 is essential for the development and growth of lymphatic vessels. The proteolytic processing of VEGF-C by ADAMTS3 is regulated by the CCBE1 protein.
# Clinical significance
A deficiency of this protein may be responsible for dermatosparaxis, a genetic defect of connective tissues.
Some hereditary forms of lymphedema are caused by mutations in ADAMTS3. | ADAMTS3
A disintegrin and metalloproteinase with thrombospondin motifs 3 is an enzyme that in humans is encoded by the ADAMTS3 gene.[1][2] The protein encoded by this gene is the major procollagen II N-propeptidase.[2]
# Structure
This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene is the major procollagen II N-propeptidase.[2]
# Function
Because of the high similarity to ADAMTS2, the major substrate of ADAMTS3 had been erroneously assumed to be procollagen II.[3] However, ADAMTS3 appears largely irrelevant for collagen maturation but instead is required for the activation of the lymphangiogenic growth factor VEGF-C.[4] Hence, ADAMTS3 is essential for the development and growth of lymphatic vessels. The proteolytic processing of VEGF-C by ADAMTS3 is regulated by the CCBE1 protein.
# Clinical significance
A deficiency of this protein may be responsible for dermatosparaxis, a genetic defect of connective tissues.[2]
Some hereditary forms of lymphedema are caused by mutations in ADAMTS3.[5][6] | https://www.wikidoc.org/index.php/ADAMTS3 | |
10e702b310701073e9519eeb8b0b1e42574c5d1a | wikidoc | ADAMTS4 | ADAMTS4
A disintegrin and metalloproteinase with thrombospondin motifs 4 is an enzyme that in humans is encoded by the ADAMTS4 gene.
This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. It can degrade aggrecan, a major proteoglycan of cartilage, brevican, a brain-specific extracellular matrix protein, neurocan and versican. The cleavage of aggrecan and brevican suggests key roles of this enzyme in arthritic disease and in the central nervous system, potentially, in the progression of glioma.
# Structure
ADAMTS4 is the shortest known ADAMTS, lacking the C-terminal domain and is the only non-glycosylated ADAMTS. It also only has one thrombospondin type 1 motif (TSR), whereas all the other ADAMTS have two or more TSRs. The TSR is important for binding of the enzyme to the extracellular matrix and hence its substrate specificity. Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region
that stacks against the active-site of the enzyme when in its final folded tertiary structure.
# Function
ADAMTS4 is capable of cleaving all the large chondroitin sulfate hyaluronan-binding proteoglycans (CSPGs), including aggrecan, brevican, neurocan and versican. Like ADAMTS5, it can be effectively inhibited by tissue inhibitor of metalloproteinase-3 (TIMP3) and this inhibition can be enhanced in the presence of aggrecan. In addition to TIMP3, it can also be inhibited by calcium pentosan polysulfate.
ADAMTS4 is expressed in ovary, spinal cord, adrenal cortex, ciliary ganglion, trigeminal ganglion, brain, retina, pancreas (islets), fetal lung, breast myoepithelial cells, tendon and cartilage.
# Clinical Significance
ADAMTS4 (and ADAMTS5) are the major proteinases responsible for the degradation of proteoglycans in articular cartilage in osteoarthritis. Which of these aggrecanases is more important in cartilage degradation appears to be species-specific, with ADAMTS4 more important in human disease (but ADAMTS5 more important in mouse models of osteoarthritis).
# Alternative names
- Aggrecanase-1 (initial name reflecting its ability to cleave aggrecan) | ADAMTS4
A disintegrin and metalloproteinase with thrombospondin motifs 4 is an enzyme that in humans is encoded by the ADAMTS4 gene.[1]
This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. It can degrade aggrecan, a major proteoglycan of cartilage, brevican, a brain-specific extracellular matrix protein, neurocan and versican. The cleavage of aggrecan and brevican suggests key roles of this enzyme in arthritic disease and in the central nervous system, potentially, in the progression of glioma.[2]
# Structure
ADAMTS4 is the shortest known ADAMTS, lacking the C-terminal domain and is the only non-glycosylated ADAMTS.[3] It also only has one thrombospondin type 1 motif (TSR), whereas all the other ADAMTS have two or more TSRs. The TSR is important for binding of the enzyme to the extracellular matrix and hence its substrate specificity. Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region
that stacks against the active-site of the enzyme when in its final folded tertiary structure.[4]
# Function
ADAMTS4 is capable of cleaving all the large chondroitin sulfate hyaluronan-binding proteoglycans (CSPGs), including aggrecan, brevican, neurocan and versican. Like ADAMTS5, it can be effectively inhibited by tissue inhibitor of metalloproteinase-3 (TIMP3)[5] and this inhibition can be enhanced in the presence of aggrecan.[6] In addition to TIMP3, it can also be inhibited by calcium pentosan polysulfate.[7]
ADAMTS4 is expressed in ovary, spinal cord, adrenal cortex, ciliary ganglion, trigeminal ganglion, brain, retina, pancreas (islets), fetal lung, breast myoepithelial cells, tendon and cartilage.[3]
# Clinical Significance
ADAMTS4 (and ADAMTS5) are the major proteinases responsible for the degradation of proteoglycans in articular cartilage in osteoarthritis.[8] Which of these aggrecanases is more important in cartilage degradation appears to be species-specific, with ADAMTS4 more important in human disease (but ADAMTS5 more important in mouse models of osteoarthritis).
# Alternative names
- Aggrecanase-1 (initial name reflecting its ability to cleave aggrecan) | https://www.wikidoc.org/index.php/ADAMTS4 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.