patent_number
stringlengths 0
9
| section
stringclasses 4
values | raw_text
stringlengths 0
954k
|
|---|---|---|
claims | 1. A method for treating a fluid waste, comprising adding one or more process additives to the fluid waste in an amount sufficient to change the wasteform chemistry, wherein the fluid waste comprises a spent fuel pond sludge, a radioactive sludge, or other toxic sludges or slurries, said method comprising:one or more of the following addition steps:adding one or more dispersant or a deflocculant to the waste to change the rheology of the fluid;adding one or more additives to decrease the reactive metal components;adding one or more special additives to bind fission products and decrease volatilization of toxic or radioactive elements or species during thermal treatment; andwherein when the fluid waste comprises particles the method may comprise adding one or more additives to target and react with the particles to decrease dusting and immobilize components in a durable phase,the method further comprising mixing the fluid waste to form a slurry, drying the slurry to form a free flowing powder, and calcining the free flowing powder, wherein either the drying or calcining step is performed in the presence of a process gas that has been injected with an acid. 2. The method of claim 1, wherein the special additives to bind fission products comprises an ion exchanger. 3. The method of claim 2, wherein the ion exchanger comprises a zeolite that absorbs free toxic or radioactive ions from the waste liquor and bind them during subsequent thermal processing steps chosen from pre-hot isostatic pressing, drying and calcination. 4. The method of claim 3, wherein the zeolite is chosen from clinoptilolite, (Na,K,Ca)2-3Al3(Al,Si)2Si13O36.12H2O, mordenite, (Ca,Na2,K2)Al2Si10O24.7H2O, and combinations thereof. 5. The method of claim 2, wherein the fission products comprise Cs, Ru and Tc. 6. The method of claim 1, wherein the drying step is performed by at least one dryer selected from a thin film evaporator, a pan dryer, a spray dryer, a flash dryer, a fluidized bed dryer and a rotary dryer. 7. The method of claim 1, wherein the drying step is performed at a temperature ranging from 100-350° C. 8. The method of claim 1, wherein the free-flowing powder is calcined in a calciner to remove one or more of the following: residual water, chemically bound water, hydroxides, carbonates, sulphates, organics and other salts. 9. The method of claim 1, wherein a process gas is chosen to achieve a reducing atmosphere when the waste material includes radioactive elements, so as to prevent the loss of radioactive volatile elements. 10. The method of claim 1, wherein the process gas comprises CO/CO2, H2, H2 in N2, H2 in Ar, Ar, N2, air or lower partial pressure O2 atmospheres. 11. The method of claim 1, wherein the acid is chosen from HCl, HNO3, HF, H2SO4, H3PO4, or organic acids. 12. The method of claim 1, wherein the acids are added in an amount sufficient to help break down carbonates and passivate residual metals. 13. The method of claim 8, wherein calcining occurs at a temperature ranging from 500 to 1100° C. 14. The method of claim 8, wherein calcining occurs at a temperature ranging from 500 to 800° C. 15. The method of claim 8, wherein the calciner is chosen from a vibratory, fluidized bed, a rotary, flash, vertical screw feed or conveyor. 16. The method of claim 8, wherein after calcination the powder is transferred to a mixer-hopper where it is blended with additional process additives. 17. The method of claim 16, wherein the process additives comprise (i) metal powders for redox control during hot-isostatic pressing (HIPing), and (ii) wasteform additives that become part of the phases of the wasteform and ensure the wasteform has the correct, mineralogical composition. 18. The method of claim 16, wherein the mixer-hopper is chosen from a conical mixer, Phauler mixer, Forberg Mixer, ribbon blender, tumbling mixer, or a Vblender. 19. The method of claim 16, wherein after mixing, the powder is fed into a can filling system which transfers the material into a HIP can. 20. The method of claim 19, further comprising performing at least one step on the HIP Can, chosen from evacuation, heating to remove any residual moisture, hermetically sealing, and decontamination, prior to loading it into the HIP machine. 21. The method of claim 20, where the HIP can undergoes compaction and densification, at process temperatures ranging from 800 to 1400° C. and pressures ranging from 10-300 MPa. 22. The method of claim 1, wherein the fluid waste comprises magnesium, plutonium, aluminum, graphite, uranium, and other nuclear power plant decommissioning wastes, zeolitic materials, and contaminated soils. 23. The method of claim 22, wherein the zeolitic materials comprise clinoptilolite, (Na,K,Ca)2-3Al3(Al,Si)2Si13O36.12H2O, mordenite, (Ca,Na2,K2)Al2Si10O24.7H2O, and combinations thereof. |
|
052232107 | summary | FIELD OF THE INVENTION This invention relates to an improvement in a passive cooling system for liquid metal cooled nuclear reactors having a pool of liquid metal coolant with the heat generating fissionable fuel core substantially immersed in the liquid metal pool, such as the type disclosed in U.S. Pat. No. 4,508,677, issued Apr. 2, 1985. BACKGROUND OF THE INVENTION In the operation of liquid sodium or sodium-potassium metal cooled nuclear reactors for power generation, it may be necessary to shut down the fission reaction of the fuel to deal with emergencies or carry out maintenance services. Reactor shut down is attained by inserting neutron absorbing control rods into the core of fissionable fuel to deprive the fuel of the needed fission producing neutrons. However decay of the fuel in the shut down reactor continues to produce heat in significant amounts which must be dissipated from the reactor units. The heat capacity of the liquid metal coolant and adjacent structure aid in dissipating the residual heat. However, the structural materials of the nuclear reactor may not be capable of safely withstanding prolonged high temperatures. For example the concrete of the walls of the typical housing silo may splay and crack when subjected to high temperatures. Accordingly, auxiliary cooling systems are commonly utilized to safely remove heat from the nuclear reactor structure during shut down. Conventional nuclear reactors have utilized a variety of elaborate energy driven cooling systems to dissipate heat from the reactor. In many of the situations warranting a shutdown, the energy supply to the cooling systems make the cooling systems themselves subject to failure. For example, pumps and ventilation systems to cool the core may fail. Furthermore, if operator intervention is necessary, there are foreseeable scenarios in which the operator would be unable to provide the appropriate action. The most reliable and desirable cooling system would be a completely passive system which could continuously remove the residual heat generated after shutdown. Liquid metal cooled reactors such as the modular type disclosed in U.S. Pat. No. 4,508,677, utilizing sodium or sodium-potassium as the coolant provides numerous advantages. Water cooled reactors operate at or near the boiling point of water. Any significant rise in temperature results in the generation of steam and increased pressure. By contrast, sodium or sodium-potassium has an extremely high boiling point, in the range of 1800 degrees Fahrenheit at one atmosphere pressure. The normal operating temperature of the reactor is in the range of about 900 degrees Fahrenheit. Because of the high boiling point of the liquid metal, the pressure problems associated with water cooled reactors and the steam generated thereby are eliminated. The heat capacity of the liquid metal permits the sodium or sodium-potassium to be heated several hundred degrees Fahrenheit without danger of materials failure in the reactor. The reactor vessels for pool-type liquid-metal cooled reactors are essentially open top cylindrical tanks without any perforations to interrupt the integrity of the vessel walls. Sealing of side and bottom walls is essential to prevent the leakage of liquid metal from the primary vessel. The vessel surfaces must also be accessible for the rigorous inspections required by safety considerations. In the typical sodium cooled reactor, two levels of sodium loops are used. Usually, a single primary loop and two or more secondary loops are used. The primary loop contains very radioactive sodium which is heated by the fuel rods. The primary loop passes through heat exchangers to exchange the heat with one of the non-radioactive secondary sodium loops. Upon shutdown of the reactor by fully inserting the control rods, residual heat continues to be produced and dissipated according to the heat capacity of the plant. Assuming that the reactor has been at full power for a long period of time, during the first hour following shutdown, an average of about 2% of full power continues to be generated. The residual heat produced continues to decay with time. This invention comprises an improvement upon the passive cooling system for removing shutdown decay heat from a liquid metal cooled nuclear reactor disclosed and claimed in U.S. Pat. No. 4,678,626, issued Dec. 2, 1985. The disclosed contents of the above noted U.S. Pat. Nos. 4,508,677 and 4,678,626, comprising related background art, are incorporated herein by reference. SUMMARY OF THE INVENTION This invention comprises an improved shut down, passive heat removal system for liquid metal cooled nuclear fission reactors which transfers reactor decay and sensible heat from the fuel core and liquid metal coolant by means of the inherent thermal energy transfer mechanisms of conduction, radiation, convention and natural convection of fluids out to the ambient atmosphere. The improved system of the invention is entirely passive and operates continuously through the inherent phenomenon of natural convection in fluids, conduction, convection, and thermal radiation. The invention particularly includes a primary passive cooling circuit for the flow of cooling air located adjacent to the conventional combination of reactor and containment vessels to transfer thermal energy absorbed from the outer surfaces of the containment vessel to the atmosphere which is combined with a backup secondary passive cooling system for service in the event of significant breach of the reactor and containment vessels. In the event of a reactor shutdown, after the control rods are fully inserted into the fuel core, the heat generated by the fuel rods is transferred through the reactor vessel across an inert gas gap to the surrounding containment vessel primarily by the thermal radiation, with a small fraction of the heat transferred by conduction and convection in the contained inert gas. Surfaces of high thermal emissivity provided on the outside of the reactor vessel and the interior of the containment vessel increase the efficiency of the heat transfer. Heat is then removed from the outside surface of the containment vessel partly by thermal radiation and partly by direct convection to the circulating air in the primary circuit in the passage between the containment vessel and the shield. The energy is then transported to the atmosphere by naturally circulating air. Vessels for modular-type reactors have approximately one third the diameter and are about the same height as conventional nuclear reactor vessels. In modular reactors, the ratio of the surface area to the power generated is approximately three times greater than the surface area to power ratio in a conventional and large reactor. This provides sufficient surface area over which the residual heat may be passively dissipated. The highly emissive exterior surfaces of the containment vessel also enhance the heat transfer. OBJECTS OF THE INVENTION It is a primary object of this invention to provide an improvement in a passive cooling safety system for liquid metal cooled nuclear reactors for the removal of decay and sensible heat under conditions of accidental malfunctions. It is also an object of this invention to provide measures for enhancing the protection afforded by indirect cooling safety means for the passive cooling of liquid metal cooled nuclear reactors comprising a core of fissionable fuel substantially submerged within a pool of liquid metal coolant. It is another object of this invention to provide added protective measures for passive cooling safety systems in liquid metal cooled nuclear reactors comprising an auxiliary backup passive cooling circuit for removing heat upon the occurrence of liquid metal coolant leakage due to a significant break of reactor and containment vessels. It is a further object of this invention to provide means for improving the operating safety of heat removing systems for liquid metal cooled nuclear reactors which are entirely passive and operate by the inherent phenomenon of natural convection in fluids, conduction, convection and thermal radiation. It is a still further object of this invention to provide a backup passive safety system for removing decay and sensible heat produced during shut down or an accidental interruption in a liquid metal cooled nuclear reactor which affords effective protection against the destructive effects of escaping liquid metal coolant and its escape into the atmosphere. |
abstract | The present invention provides a drawing apparatus which performs drawing on a substrate with a charged particle beam based on drawing data generated from pattern data representing a circuit pattern to be drawn on the substrate, and mark data representing a mark to be drawn on the substrate, the apparatus including an obtaining unit configured to obtain information associated with a positioning accuracy of the charged particle beam relative to the substrate, a determination unit configured to determine a drawing region for the mark based on the obtained information, and a generation unit configured to generate the drawing data by combining the pattern data and the mark data such that the mark is drawn in the determined drawing region. |
|
summary | ||
claims | 1. An apparatus comprising a wall and a seal, wherein the seal and an interior surface of the wall define a sealed volume, wherein said wall comprises a layer system on said interior surface comprising a hydrogen barrier layer formed from a ternary or quaternary oxide comprising Al and O, wherein the hydrogen barrier layer is configured to maintain a hydrogen density in said volume that is different than a hydrogen density outside of said volume, wherein said hydrogen barrier layer is formed via a physical vapor deposition method, wherein droplets formed by arc evaporation are distributed in the hydrogen barrier layer. 2. The apparatus according to claim 1, wherein said ternary oxide is substantially composed of Al, Cr and O. 3. The apparatus according to claim 1, wherein said layer system comprises at least one of the group consisting ofan adhesion layer for increasing an adhesion of said hydrogen barrier layer on a substrate;a hydrogen storage layer capable of storing and releasing hydrogen;a protective layer for protecting at least one layer of said layer system from external influences. 4. The apparatus according to claim 1, wherein said apparatus is or comprises at least one of the group consisting ofa hydrogen storage container;a hydrogen transport container;a fusion reactor;a fuel cell;a battery;a combustion engine;a superconducting electricity-grid;an electric transmission cable;a fuel tank. 5. The apparatus according to claim 1, wherein the layer system includes a second layer comprising a hydrogen storage layer comprising a hydride precursor. 6. The apparatus according to claim 1, further comprising a protecting layer overlaying the hydrogen barrier layer. 7. Method for manufacturing an apparatus according claim 1, characterized in comprising the step ofB) depositing said hydrogen barrier layer on said wall. 8. A hydrogen permeation barrier, comprising a wall and a seal, wherein the seal and an interior surface of the wall define a sealable volume, and a layer system on said interior surface that encloses the sealable volume in which a hydrogen density is established, the layer system comprising a hydrogen barrier layer comprising a ternary or quaternary oxide comprising Al and 0 that isolates the hydrogen density within the sealable volume from a volume having a different hydrogen density externally of said sealable volume, wherein the hydrogen barrier layer is formed via a physical vapor deposition method, wherein droplets formed by arc evaporation are distributed in the hydrogen barrier layer. 9. The hydrogen permeation barrier according to claim 8, wherein said ternary oxide is substantially composed of Al, Cr and O. 10. The hydrogen permeation barrier according to claim 8, wherein said layer system comprises at least one of the group consisting ofan adhesion layer for increasing an adhesion of said hydrogen barrier layer on a substrate;a hydrogen storage layer capable of storing and releasing hydrogen;a protective layer for protecting at least one layer of said layer system from external influences. 11. The hydrogen permeation barrier according to claim 8, wherein the layer system includes a second layer comprising a hydrogen storage layer comprising a hydride precursor. 12. The hydrogen permeation barrier according to claim 8, wherein the physical vapor deposition is carried out using an arc-evaporation method. 13. An apparatus comprising a wall and a seal, wherein the seal and an interior surface of the wall define a sealed volume, wherein the wall comprises a layer system on the interior surface comprising a hydrogen barrier layer formed from a ternary or quaternary oxide comprising Al and O, wherein a hydrogen density in the sealed volume is different than a hydrogen density outside of the sealed volume, wherein droplets formed by arc evaporation are distributed in the hydrogen barrier layer. |
|
052232085 | claims | 1. A nuclear power generation system which comprises an underground dam formed with a cutoff wall on groundwater basin, a reactor installed within concrete walls on a bedrock below said underground dam, and an evaporation type cooling tower which houses water piping member for the primary cooling water for said reactor and is connected to a pipe for guiding in the water pooled in said underground dam, and which is so structured that a steam outlet and an air inlet of said cooling tower are respectively communicated with the surface via stacks. 2. A construction method for an underground nuclear power generation system comprising the steps of a) exploring a desirable groundwater basin by geological survey, b) forming an underground dam by installing a cutoff wall of a predetermined height and length and substantially vertical to faults by pouring in concrete or water glass (sodium silicate) near the outlet of the groundwater basin, c) installing a reactor on the bedrock below the underground dam and covering said reactor with a concrete shielding, d) installing an evaporation type cooling tower adjacent to the reactor in such a manner that said cooling tower is communicated with the surface through a stack mounted at a steam outlet thereof and through another stack mounted at an air inlet thereof, e) guiding the primary cooling water of the reactor and the water pooled in the underground dam into the cooling tower. |
047059516 | claims | 1. A semiconductor wafer processing machine, comprising: a first loadlock means for receiving a cassette of semiconductor wafers for processing; a second loadlock means for receiving processed wafers; at least one processing chamber; at least two wedge valves; said first loadlock means being in communication with a wafer processing chamber through a first wedge valve when said first wedge valve is open; said second loadlock means being in communication with a wafer processing chamber through a second wedge valve when said second wedge valve is open; each said loadlock means, wedge valve and processing chamber being vacuum-tight and having means for attachment to an external vacuum pumping means; computer means for controlling each said loadlock means, wedge valve and processing chamber; each said wedge valve including; a valve housing having input port and output port; a valve wedge having surfaces sealing to said input and output ports, said valve wedge sealing surfaces being sloped relative to each other, said valve wedge having a storage notch between said sealing surfaces; means for sliding said valve wedge within said housing from a sealing position to an open position so that said valve wedge is clear of a line sight through said input and output ports; a workpiece handling arm capable of being stored in a folded position in said storage notch when said valve is closed. a proximal support piece; a proximal extensor piece; a distal support piece, said distal support piece having means for bearing the workpiece on a distal end; a distal extensor piece; and a pair of concentric shafts rotating about a first axis for delivering power and control to said arm, said proximal support piece being fixedly attached at right angles to a first of said concentric shafts, said proximal extensor piece being fixedly attached at right angles to a second of said pair of concentric shafts, said proximal extensor piece being pivotally attached to said distal extensor piece at a second axis, said proximal support piece and said distal extensor piece being pivotally attached to said distal support piece at third and fourth axes, respectively, said first, second, third and fourth axes being parallel, spacings between said axes forming a parallelogram. a vacuum chamber having a door; transmitter means for sending a closely collimated beam of radiation; receiver means for moving the cassette past the collimated beam of radiation at a constant rate of speed; signal processing means for translating interruptions in the collimated beam of radiation as a function of time into position information; computer means for receiving and storing information from said signal processing means; a small vacuum cell within the walls of the vacuum chamber, said small vacuum chamber having an opening facing the door; sealing means for sealing the door to the vacuum chamber; and means for connecting said small vacuum cell to a vacuum pumping means. a platform having upper surface means for supporting the workpiece; a multiplicity of clamp means for centering and holding the workpiece on the platform, said clamp means being distributed around a perimeter of said platform, each said clamp means including a thin planar hook member and a spring member, each said thin planar hook member having an upper lip shaped to fit over the workpiece, a lower lip and a lifting slot; a lifting ring arranged around and below said upper surface means, said lifting slot of each said thin planar hook engaging said lifting ring; a spreading ring arranged around and below said upper surface means and above said lifting ring, said lower lip of each said thin planar hook engaging said spreading ring; means for moving said lifting ring; and means for moving said spreading ring. 2. The machine of claim 1 wherein said arm includes: 3. The machine of claim 2 wherein said distal support arm is a flat blade. 4. The machine of claim 3 wherein said proximal extensor piece is much shorter than said proximal support piece. 5. The machine of claim 4 wherein said first loadlock means for receiving a cassette of semiconductor wafers includes: 6. The machine of claim 4 wherein said transport means is an elevator which raises and lowers the cassette with the wafers in a horizontal plane. 7. The machine of claim 5 wherein said means for connecting includes a pumping isolation valve for isolating the vacuum pumping means from the small vacuum cell. 8. The machine of claim 7 wherein said means for connecting includes a venting valve for venting said small vacuum cell to atmosphere when said isolation valve is closed. 9. The machine of claim 8 wherein said isolation valves and venting valves are operated electrically from a switch means mounted in a handle on the door. 10. The machine of claim 9 wherein said computer means includes means for operating the machine from a task locator system. 11. The machine of claim 1 including a chuck means for centering and clamping the wafer, said chuck means including: 12. The device of claim 11 including lifting pin means for receiving a workpiece from a workpiece handling mechanism and lowering said workpiece to said platform. 13. The device of claim 12 including means for temperature control of said workpiece while said workpiece is held to said platform. 14. The device of claim 13 wherein said means for temperature control includes means for passing helium gas between said upper surface means of said platform and the back of the workpiece whereby to ensure thermal contact. 15. The device of claim 14 including means for removing said platform for servicing while leaving said clamp means in place. 16. The machine of claim 15 wherein said computer means includes means for operating the machine from a task locator system. |
summary | ||
047708450 | description | DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to a self-actuated reactor shutdown system (SASS) utilizing hydrostatic supported absorber elements. While the invention is particularly applicable for use in a liquid metal fast breeder reactor (LMFBR), it can be utilized in other types of reactors, such as the gas-cooled fast reactor (GCFR). A SASS is defined as a control-rod system that can scram the reactor automatically without either a signal from an external control circuit or an operator action. Initiation of the scram in accordance with the present invention is entirely from direct sensing of inadequate flow and/or an over-power condition. Particular requirements of a SASS are as follows: 1. It must be capable of operating automatically; 2. It must be failsafe, such that no malfunction of the SASS can cause a hazardous condition; 3. It must not impose excessive restrictions on normal operation of the reactor; 4. It must have as little as possible adverse effect upon plant availability; and 5. It must contribute substantially to the overall safety of the reactor. The SASS of this invention satisfies each of the above requirements and employs reactor pressure differentials and a thermionic diode to activate a control rod scram without a signal from the reactor operating control system. The use of hydrostatic supported absorber elements wherein, during normal operation, the control rod is held above the reactor core and is dropped into the core when the hydrostatic pressure is decreased below a specified minimum, such as the weight of the absorber element, are known in the art as pointed out above. While the present invention utilizes this known principle of operation, the invention also incorporates the use of a thermionic diode which is responsive to high neutron flux (over-power) and coolant temperature (undercooling) conditions of the reactor. The diode functions to control an electromagnetically attracted slide valve which, in turn, controls the hydrostatic pressure supporting the absorber elements, whereby the SASS of this invention provides a system responsive to both low-coolant flow, high-neutron flux (over-power) and coolant over-temperature. The SASS incorporating the present invention cannot be overridden by external control, either from operators or plant control systems, with the intent to hold off a scram. Further, the SASS of this invention is able to be restored to operational or cocked condition only by deliberate operator action, and only when the reactor conditions have been corrected and will permit reactivation. In addition, the SASS of this invention is responsive to scram signals generated by the plant protection systems. Referring now to FIG. 1, a SASS incorporating the present invention is illustrated. While not shown, it is known in the art that control rods or elements of the SASS are positioned within a fuel bundle containing a plurality of fuel rods. The fuel bundles are located in the core of the reactor, while the control rod or neutron absorber element of that bundle is maintained above the core during normal reactor operation. As shown in FIG. 1, the SASS comprises a control assembly channel or casing 10 secured at the lower end to an inlet nozzle 11 and provided with an absorber element 12 composed of neutron absorbing material, as known in the art, and mechanism for controlling the location of the element 12 with respect to a reactor core region indicated at 13. A retriever rod 14 is positioned in casing 10 and extends through element 12 and longitudinally through the casing. The lower end of rod 14 is provided with a ring or member 14' which serves to raise element 12 to its ready position, and cooperates with a control assembly snubber, or dash-pot 15, or other kinetic energy absorbing means to slow the descent of the absorber element 12 after it enters the core region 13 and to return the element 12 to its ready position. The upper end of retriever rod 14 is adapted to be connected to drive grapple or mechanism (not shown) supported on the reactor top shield to perform upward movement of the absorber element and to reposition a magnetically retained slide valve 16, as described hereinafter. The absorber element 12 is provided at the lower end with plate 17 having a plurality of orifices to control cooling flow therethrough. As shown, the element 12 is in its ready or cocked position above the core region 13 and is retained hydrostatically against an absorber up-stop or face seal 18 fixedly secured to casing 10. Element 12 is held against up-stop 18 by the pressure differential across element 12 created by coolant flowing upwardly under pressure through inlet 19 in nozzle assembly 11 from a pressure plenum (not shown), as indicated by the flow arrows. The pressure differential which retains the absorber element 12 against up-stop or face seal 18 is produced, as known in the art, by the difference in surface area at the top and bottom of the elements 12 on which the pressurized coolant may act. Since the surface area at the lower end of the element 12 is greater than that at the upper end thereof, due to the element abutting against up-stop 18, the element 12 is hydrostatically retained in its up or cocked position. Any decrease in pressure differential below the minimum required to support the weight of element 12 will cause the element to fall towards core region 13. As soon as the element is separated from the face seal or up-stop 18, essentially all the pressure differential is lost, since the coolant can act against the entire upper surface of the element causing the pressure above and below the element to equalize, and the element will fall freely into the core region 13 under the influence of gravity, the drop stroke of element 12 being illustrated by legend. The fall of the absorber element 12 will be retarded only by flow resistance of the displaced fluid with casing 10, and near the bottom of its stroke or fall by the snubber or dashpot assembly 15 for absorbing the kinetic energy. The pressure differential holding the element 12 in its upper position is a function of the total core pressure drop and the relative flow resistances of any active cooling passages in the absorber element and of the inlet orifice. Since pressure drop across the core region 13 varies with the square of the flow, the available presure will decrease rapidly as flow decreases. A valve (not shown) for by-passing the face seal or up-stop 18 can be utilized to provide a control element scram as a result of excessive core outlet temperature. Such a valve is normally closed, and is designed to open on an over-temperature signal. It can be actuated, for example, by melting a fusible material, a thermionic diode without fissionable material, or by an electromagnetic device, as known in the art. A mechanical drive or grapple, not shown, is connected to the upper end of retriver rod 14, as set forth above, for raising the absorber element 12 and holding it in its upper position until adequate coolant flow is established to produce the pressure differential discussed above. The grapple must be released before reactor operation. Release of the grapple can be assured after disconnecting by raising the grapple to a higher position. To enable the plant operator to know the location of the absorber element 12 with respect to the core region 13, a plurality of position detection coils 20 (three in this embodiment) are positioned on the casing 10 along the length of the element 12. It is readily seen that the location of element 12 can be determined by the readout from the coils 20. Should the element 12 be in a partially inserted (lower position), for example the readout from the upper coil 20 would differ from that of the two lower coils. Coil readout apparatus is well known in the art and further description of such is deemed unnecessary. Positioned above the up-stop 18 is an instrument and control column 21, including a housing 22 which, at the lower end thereof, is secured in casing 10 and provided with seal means for preventing coolant flow therebetween. Housing 22 includes a chamber 23 within which slide valve 16 is movably positioned. A fluid or coolant passage 24 extends from chamber 23 to an outlet chamber 25 in control column 21, which is provided with coolant flow outlet openings 26. An electromagnetic coil 27 is positioned above slide valve 16 and is connected via an electromagnetic control circuit indicated at 28 to a power supply, not shown. A uranium-blanketed thermionic device 29 mounted in chamber 25 and secured to control column 21 is electrically connected in control circuit 28 so as to be in parallel with coil 27 and is responsive to neutron flux. The electromagnetic coil 27 is normally energized from above the reactor head via control circuit 28 such that slide valve 16 is magnetically retained in its upper position, as shown, whereby coolant flows through passage 24 into chamber 25 and out openings 26, as indicated by the flow arrows. In the event of reactor over-power (high-neutron flux), the thermionic device 29 is heated to a change of state. This change of state causes the electromagnetic coil 27 to be short-circuited and lose its holding power, whereupon the slide valve 16 drops by gravitational force and closes off the flow through passage 24. This change (decrease) in coolant flow above absorber element 12 causes a decrease in the differential pressure across element 12 such that the holding pressure is less than the weight of the element, whereby element 12 moves downwardly with respect to face seal or up-stop 18. As described above, this initial downward movement or drop of absorber element 12 results in a loss of pressure differential or equalization of the coolant pressure above and below the element such that the element drops into reactor core region 13 under full gravitational force. When normal reactor flow conditions have been reestablished, or there has been a sufficient reduction of the neutron flux, the absorber element is returned to its ready or cocked position by means of the retrieval rod 14, as described above. In addition, the retrieval process returns the slide valve 16 to its position against the electromagnet and is retained in the upper section of chamber 23 by magnetic attraction when the electromagnetic coil 27 is re-energized. The retrieval rod 14 is then lowered to permit the full drop stroke of the absorber element 12. The retrieval rod 14 is provided with a member, not shown, such as a ring, which is located on rod 14 so as to simultaneously position slide valve 16 at the top of chamber 23 adjacent electromagnetic coil 27 and element 12 against up-stop 18. The thermionic device 29 of FIG. 1 is embodied in FIGS. 2 and 3 as a thermionic diode 29. The diode 29 consists of a sealed container 30 having therein an emitter 31 and a collector plate 32 separated by a gap 33, with a uranium blanket 34 positioned around emitter 31 which causes heating of diode 29 due to neutron flux, and a quantity of thermionic material 35 located within sealed container 30. Emitter 31 and collector plate 32 are connected to an electrical potential (control circuit 28), as known in the art, via electrical leads 36 and 37, respectively, which extend through insulators 38 in container 30. By way of example, the diode 29 may be constructed of the following material: container 30 is of stainless steel; emitter 31 is of molybdenum with a diameter of 0.750 in. and wall thickness of 0.50 in.; collector plate 32 is of molybdenum with a diameter of 0.450 in. and wall thickness of 0.10 in.; gap 33 is in the range of 0.10 in.; uranium blanket 34 has a wall thickness of 0.10 in.; thermionic material 35 may be cesium or other metalic vapor at operational temperatures. The electric leads 36 and 37 are of copper; and the insulators 38 are of alumina. The thermionic material 35 is tailored to ionize at a selected temperature, for example, in the range of 1000.degree. F. to 1100.degree. F. An electrical potential, such as 10 to 15 volts, is applied to the emitter 31 and collector plate 32 and when the ionization temperature of the thermionic material 35 is reached, due to reactor over-power condition (high neutron flux) or to undesirable coolant temperature conditions, the material changes from high resistance to low resistance, thereby conducting most of the available current and, in effect, short-circuiting the electromagnetic coil 27 in FIG. 1 which is connected in parallel with the diode 29, via control circuit 28, as set forth above. It has thus been shown that the present invention provides a self-actuating shutdown system (SASS) for nuclear reactors, particularly for an LMFR, which is responsive to low coolant flow and/or high-neutron flux (over-power) and/or reactor coolant temperature (under-cooling) conditions of the reactor. The SASS of this invention satisfies each of the requirements outlined above for such a system. The thermionic diode also may be utilized to cause self-actuation of the control element due to reactor coolant over-temperature. While not shown, this may be accomplished via a coolant flow control valve controlled by an electromagnet and a thermionic diode. In a reactor over-temperature condition, the diode will be heated by the coolant to a change of state causing the electromagnet to be shorted thereby actuating the valve which provides a changed flow and pressure condition required for scramming the absorber element. While a particular embodiment of the invention has been illustrated and described, modifications will become apparent to those skilled in the art, and it is intended to cover in the appended claims all such modifications as come with the scope of the invention. |
description | The present invention relates to radiograph imaging inspection for large-sized objects, more particularly to a energy spectrum modulation apparatus, a material discrimination method and a device thereof, as well as an image processing method, which can discriminate the material in large- and medium-sized objects such as cargo containers, air cargo containers, etc. by using radiations having different energy levels. The present application claims priority of Chinese patent application Serial No. 200610011945.9, filed May 19, 2006, the content of which is hereby incorporated by reference in its entirety. The existing cargo inspection system based on radiographic imaging generally causes a single energy ray to interact with the object under inspection, and then detects the ray having penetrated through the object under inspection to obtain an image. Although such a system can reflect the change in shape and mass thickness (i.e., mass per unit area obtained by multiplying a thickness t by a density) of the object under inspection, it can't discriminate the material of the object under inspection. The dual-energy detection method for distinguishing the material attributes of objects has been proposed for a long time as disclosed in U.S. Pat. No. 5,044,002, and within low energy region, the method has been widely applied to various fields such as osteoporosis diagnosis, geographic oil layer detection and material discrimination for small objects. However, it has long been recognized that within high energy region (>1 MeV) the slight difference caused by electron pair effect is insufficient to implement material discrimination, thereby having a poor practicability. In 1990s, U.S. Pat. No. 5,524,133 disclosed that the angular distribution of Compton scatter effect and the isotropy of electron pair effect were used to analyze the scatter components of X-rays caused by each effect after the X-rays interacted with an object, thereby discriminating the substance's atomic number of the object interacting with the X-rays. In U.S. Pat. No. 5,524,133, high-energy X-rays is caused to interact with a target having a greater atomic number after interacting with the object. Then several detectors are positioned at different angles with respect to the target so as to detect Compton scatter effect and electron pair effect. Nevertheless, since it is very difficult to detect the scatter after interaction between the target and the X-rays, which have penetrated through the object, a large incident dose of X-rays is usually required. In addition, the SNR (signal to noise ratio) of detection signals is rather low because the detector array arranged at such angles within the same horizontal plane is susceptible to the interference from its neighbor channel. The above disadvantages have an adverse impact on the determination of the substance's atomic number, and the image quality is unsatisfactory. Thus this method has not been put into practical application since proposed in 1993. Later in U.S. Pat. No. 6,069,936 and international application WO 00/43760 a high-energy radiation source is employed to generate X-rays, which are filtered by means of specific materials to obtain another ray having a higher energy spectrum. The penetrating X-rays having two energy spectra are detected after they interact with the substance. The substance's atomic number and material type are then determined by computing the ratio between the two detection values. During the X-rays having two energy spectra interact with the inspected object in this method, as the inspected object grows in thickness, the two energy spectra of the X-rays, which have penetrated through the inspected object, have an ever-decreasing difference and rapidly become identical to each other. In this case, it can't discriminate the inspected object any more. In view of the problems in the prior art, the present invention is accomplished. It is an object of the present invention to generate in high energy range (>1 MeV) two beams of X-rays of which energy spectra have principal energy levels distinct from each other, detect the penetration radiation of the two X-ray beams after their interaction with an object at the same position and determine the effective atomic number range of the material of the object based on the two detection values, thereby implementing the non-destructive inspection for the object. At an aspect of the present invention, there is provided an energy spectrum modulation apparatus comprising: a first energy spectrum modulation part for modulating a first ray having a first energy spectrum; and a second energy spectrum modulation part coupled to the first energy spectrum modulation part for modulating a second ray having a second energy spectrum different from the first energy spectrum. According to an embodiment of the present invention, at least one of the first energy spectrum modulation part and the second energy spectrum modulation part is coupled onto a rotation shaft. According to an embodiment of the present invention, the first energy spectrum modulation part includes at least one first vane, and the second energy spectrum modulation part includes at least one second vane. According to an embodiment of the present invention, the first vane is made of high Z material. According to an embodiment of the present invention, the first vane is made of at least one of Pb, W, U and Cu. According to an embodiment of the present invention, the second vane is made of low Z material. According to an embodiment of the present invention, the second vane is made of at least one of B, C, polyethylene and any other hydrogen-rich organic material. According to an embodiment of the present invention, the first vane and the second vane are arranged alternately and can rotate. According to an embodiment of the present invention, the mass thickness of the first vane is smaller than or equal to that of the second vane in the direction of the rays. At another aspect of the present invention, there is provided a method of discriminating material using rays having different energy levels comprising the steps of: generating alternately a first ray having a first energy spectrum and a second ray having a second energy spectrum; performing energy spectrum modulation for the first ray and second ray respectively by the energy spectrum modulation apparatus described above; utilizing the modulated first ray and second ray to interact with an inspected object; collecting the first ray and the second ray after their interaction with the inspected object to obtain a first detection value and a second detection value; and discriminating the material of the inspected object based on the first detection value and the second detection value. According to an embodiment of the present invention, the discriminating step includes generating corresponding classification functions from the first detection value and the second detection value, and determining the material of the inspected object based on the classification functions. According to an embodiment of the present invention, the classification functions is fitting functions of the detection values obtained after the first ray and the second ray interact respectively with predetermined known materials in the case of their mass thickness varying. According to an embodiment of the present invention, the detection values are the transmission intensity of the rays after they penetrate through the inspected object. According to an embodiment of the present invention, the known materials are different materials which represent organic matter, light metal, inorganic matter and heavy metal respectively and whose atomic numbers are known. According to an embodiment of the present invention, the method further comprises collecting the first ray and the second ray after their interaction with the inspected object by a variable gain detector. According to an embodiment of the present invention, the gain of the detector at the time of detecting the first ray is different from that at the time of detecting the second ray. At another aspect of the present invention, there is provided an device for discriminating material using rays having different energy levels comprising: a ray generation apparatus for generating alternately a first ray having a first energy spectrum and a second ray having a second energy spectrum; the energy spectrum modulation apparatus for modulating the first ray and the second ray respectively, wherein the modulated first ray and the modulated second ray interact with the inspected object; a collecting apparatus for collecting the first ray and the second ray after their interaction with the inspected object to obtain a first detection value and a second detection value; and a material discrimination apparatus for discriminating the material of the inspected object based on the first detection value and the second detection value. According to an embodiment of the present invention, the discriminating includes generating corresponding classification functions from the first detection value and the second detection value, and determining the material of the inspected object based on the classification functions. According to an embodiment of the present invention, the classification functions are fitting functions of the detection values obtained after the first and second rays interact respectively with predetermined known materials in the case of their mass thickness varying. According to an embodiment of the present invention, the detection values are the transmission intensity of the rays after they penetrate through the inspected object. According to an embodiment of the present invention, the known materials are different materials which represent organic matter, light metal, inorganic matter and heavy metal respectively and whose atomic numbers are known. According to an embodiment of the present invention, the collecting apparatus has a variable gain. According to an embodiment of the present invention, the gain of the collecting apparatus at the time of detecting the first ray is different from that at the time of detecting the second ray. At another aspect of the present invention, there is provided an image processing method comprising steps of utilizing a first ray having a first energy spectrum and a second ray having a second energy spectrum to interact with an inspected object, respectively, wherein the first ray and the second ray are modulated by the energy spectrum modulation apparatus described above; collecting the first ray and the second ray after the interaction to obtain a first detection value and a second detection value; comparing the first detection value and the second detection value with a threshold value respectively to judge the mass thickness information of the inspected object; and based on the mass thickness information, combining an image obtained from the first detection value and an image obtained from the second detection value with different weighting factors. According to an embodiment of the present invention, the mass thickness information is determined based on the attenuation of the rays from the inspected object. According to an embodiment of the present invention, for the material of small mass thickness, the weighting factor for the image from the first detection value is smaller than that for the image from the second detection value. According to an embodiment of the present invention, for the material of large mass thickness, the weighting factor for the image from the first detection value is greater than that for the image from the second detection value. The two different energy spectra of the rays, which are generated alternately by the device of the present invention, are predominated by X-rays with distinct energy difference. This benefits the discrimination for a thick inspected object. In addition, optimized energy spectra of high- and low-energy rays are obtained by subjecting the generated high- and low-energy X-rays to energy spectrum modulation with different absorbing materials, which further widens the equivalent energy difference between the two X-ray beams and thus improves the discrimination accuracy for materials, particularly for the materials of small mass thickness. Further, for the different single pulse doses and energy levels of the high- and low-energy rays, the variable gain detector adjusts the amplifying gain to widen the dynamic range. This can further improve the detection effect of the same detector for rays having different energy levels, and thereby increase the detection accuracy. Hereafter, an embodiment of the present invention is described in detail with reference to the drawings. FIG. 1 is the schematic structural view of a material discrimination system according to an embodiment of the present invention. As shown in FIG. 1, the material discrimination system according to the present invention comprises a RF linac (linear accelerator) 1, an energy spectrum modulation apparatus 2, a synchronization control part 4 connected to the RF linac 1 and the energy spectrum modulation apparatus 2 via line 3, a first collimator 6A, a second collimator 6B, a third collimator 6C, a control part 9 connected to the energy spectrum modulation apparatus 2 via line 10, a detector 8 connected to the control part 9 via line 11, and a material discrimination and image processing part 13 connected to the detector 8 via line 12. In the present embodiment, the RF linac 1 alternately generates X-rays having two different energy levels. The X-rays each interact with and penetrate through the same inspected object 7, and then detected by the detector 8. The detection results of the detector 8 are analyzed by the computer 13 to obtain the radiation images of the inspected object and to further distinguish the material attributes of the inspected object. As shown in FIG. 1, the synchronization control part 4 establishes a session 5 with the RF linac 1. After status confirmation, the RF linac 1 alternately generates two kinds of X-rays having different energy levels based on the cycle parameters and control signals provided by the synchronization control part 4. The energy spectrum 1 P of the X-rays generated by the RF linac 1 has a distinct energy difference. However, such a difference can't satisfy the requirement of the system application, the energy spectrum modulation is needed for the energy spectrum 1 P to obtain the energy spectrum of high- and low-energy rays having a wider energy difference. Therefore, based on the trigger signals, the RF linac 1 can alternately generate X-rays of two different energy spectra in which different energy levels predominate respectively. Since the spectrum of the X-rays generated by the accelerator is wide, energy spectrum modulation is needed to further increase the proportion of X-rays with desired energy levels in the spectrum. Considering the energy levels of the X-rays generated by the RF linac 1, various materials can be utilized to perform energy spectrum modulation, thereby obtaining the energy spectra most suitable for material discrimination. In addition, since the energy distribution domains vary in the energy spectra of the X-rays, the materials suitable for energy spectrum modulation differ. For example, when the lower limit of the principal domain of an X-ray beam's energy distribution is higher than a threshold value (e.g., ˜3 MeV) of higher energy level, a low Z material, such as B, C, polyethylene and any other hydrogen-rich organic material, should be chosen for energy spectrum modulation of this X-ray beam. Meanwhile, in order to absorb the scatter component of low energy level in the rays, it is preferred to additionally utilize a thin high Z material for energy spectrum modulation after using a thick low Z material for energy spectrum modulation. When the lower limit of the principal domain of an X-ray beam's energy distribution is higher than a threshold value (e.g., ˜300 keV) of lower energy level, a high Z material, such as Pb, W, U, etc., should be chosen for energy spectrum modulation of this X-ray beam; a medium Z material such as Cu can also be chosen. FIG. 2 is the plan view of the energy spectrum modulation apparatus 2 in the material discrimination apparatus shown in FIG. 1. As shown in FIG. 2, the energy spectrum modulation apparatus 2 comprises a rotation shaft 201 coupled to a servo motor, a first energy spectrum modulation part 202 disposed on the rotation shaft 201, a second energy spectrum modulation part 203 coupled to the first energy spectrum modulation part 202, and a position detector (not shown). Here, the first energy spectrum modulation part 202, which is made of high Z material and coupled to the rotation shaft 201, is used for energy spectrum modulation of the low-energy rays. As shown in FIG. 2, the first energy spectrum modulation part 202 includes a number of sections spaced from each other with each section being referred as a short vane. In this case, the first energy spectrum modulation part 202 can be coupled onto the second energy spectrum modulation part 203, while the second energy spectrum modulation part 203 can be coupled directly onto the rotation shaft 201. Otherwise, as an alternative aspect, the vanes of the first energy spectrum modulation part 202 can be made as required in a similar shape to that of the vanes of the second energy spectrum modulation part 203. In this way, the first and the second energy spectrum modulation parts 202 and 203 can both be coupled onto the rotation shaft 201. The second energy spectrum modulation part 203, which is made of low Z material such as compound material, for example a material made of polyethylene plus Pb, which has a low average Z value, and formed into one or several vanes, is used for energy spectrum modulation of the high-energy ray. As shown in FIG. 2, the mass thickness of the vanes of the second energy spectrum modulation part 203 is greater than that of the first energy spectrum modulation part 202 in the direction of ray emission. To implement energy spectrum modulation, the vanes rotate around the axis at a preset frequency, and the position detector generates a trigger signal as a synchronization signal when detecting that the vanes rotate to a fixed position. The signal is sent to the synchronization control part 4 and the control part 9 via line 3 and 10 respectively, and the RF linac 1 and the detector 8 are made synchronized with the energy spectrum modulation apparatus 2 under the control of the synchronization control part 4 and the control part 9 respectively. In this way, it can be ensured that the rays having a high-energy spectrum all interact with the material of the vanes, i.e., they all undergo the modulation by the second energy spectrum modulation part 203, while all the rays of a low-energy spectrum are subjected to the absorption by the material on the axis, i.e., they all undergo the modulation by the first energy spectrum modulation part 202. As above described, the material of the first energy spectrum modulation part 202 can be a high Z material such as Pb, W, U, etc., which is selected as the material for energy spectrum modulation of X-rays; a medium Z material such as Cu can also be selected. On the contrary, the material of the second energy spectrum modulation part 203 can be a low Z material such as B, C, polyethylene and any other hydrogen-rich organic material, which is selected as the material for energy spectrum modulation of X-rays. As a result of the modulation, the energy spectra 2 P of high- and low-energy rays are obtained, where the energy spectra of two different energy levels are taken sufficiently apart from each other. Further, FIG. 3 is the schematic views of the energy spectra generated by the accelerator and the dual-energy spectra obtained after the modulation, respectively. As shown in FIG. 3(A), the energy spectra before the modulation are illustrated as normalized Curves 301a and 301b which represent the energy spectra generated by the dual-energy accelerator with the high energy level being 9 MeV and the low energy level being 4 MeV; as shown in FIG. 3(B), the energy spectra after the modulation are illustrated as normalized Curves 302a and 302b. It can be seen in this diagram that the difference between the two energy spectra is further widened. The optimized rays having both high and low energy levels, which are obtained after the modulation by the energy spectrum modulation apparatus 2, pass through the first and second collimators 6A and 6B and then interact with the inspected object 7. As shown in FIG. 1, the inspected object 7 moves along a fixed path and a fixed direction perpendicular to the radiation plane. Having penetrated through the inspected object 7, the rays pass through the third collimator 6C and then are collected by the detector 8, which collects data of high and low energy levels, such as the transmission intensity of the rays after radiating the object, based on the synchronization signal of the control system 9. In addition, based on an external trigger signal, the detector 8 can change the multiple of its amplifying gain to change its dynamic range, thereby obtaining with higher accuracy the signal values after the interaction between the dual-energy rays and the object, and accurately recognizing the difference of the dual-energy rays after their interaction with the object. For example, in the case of the rays having different energy levels, the detector 8 has different multiples of amplifying gain. The data signals outputted from the detector 8 is sent to the material discrimination and image processing part 13 via line 12. As described above, the detection values by the detector 8 are a detection value HEL for high energy level and a detection value LEL for low energy level. The obtained detection values HEL and LEL can be substituted into classification functions to determine the effective atomic number range of the material in the inspected object, thereby determining the material attributes. Here, the classification functions are acquired as follows: using the rays with two energy levels from the dual-energy system to scan an atomic-number-known material, such as polyethylene standing for organic matter, Al for light metal, Fe for inorganic matter and Pb for heavy metal, etc., with the material's mass thickness varying, and thus obtaining a series of collected values; calculating two function values from the signals for high and low energy levels collected each time, for example, calculating ln(HEL/HEL0) from the signals for high or low energy level, and calculating a*{ln(LEL/LEL0)−ln(HEL/HEL0)} from the signals for high energy level, where a is a coefficient and HEL0 and LEL0 each are predetermined reference detection values; then obtaining the fitting functions of the material based on the statistical values of the above two function values, as shown in FIG. 4. Then, the classification curves are obtained from the fitting functions by use of statistical methods such as K-means or leader clustering, vector machine, etc. For example, computing the statistical variance of the fitting function value, and then displacing the fitting curve by the corresponding variance according to the optimum classification criterion as required. In discriminating an unknown material, the classification function values for the detection values are computed from the two function values of the detection values. Then the computed values are compared with the predetermined classification function values to obtain the effective atomic number range of the material and to further determine the material attributes of the object. FIG. 5 is the flow chart of detecting and discriminating materials with two ray beams having different energy levels. As shown in FIG. 5, in Step S110, the RF linac 1 can alternately generates X-rays having two different energy spectra, such as a first X-ray having a first energy spectrum and a second X-ray having a second spectrum, based on a trigger signal. Then, in Step S120, the above-mentioned energy spectrum modulation apparatus 2 is utilized to modulate the X-rays having different energy spectra. For example, both controlled by the synchronization signal, the first energy spectrum modulation part 202 modulates the first X-ray while the second energy spectrum modulation part 203 modulates the second X-ray. Next, in Step S130, after passing through the first and second collimators 6A and 6B, the modulated X-rays radiate and interact with the inspected object 7. In Step S140, the detector 8 collects data for high and low energy levels based on the synchronization signal from the control system 9. Here, the detector 8 can change the multiple of its amplifying gain to change its dynamic range, thereby obtaining with higher accuracy the signal values after the interaction between the dual-energy rays and the object. In Step S150, the imaging signals for high and low energy levels are sent to the material discrimination and image processing part 13, in which it is judged that whether the sent signal is imaging signal for high energy level or for low energy level. The imaging signals for high and low energy levels are processed in Steps S160 and S170, respectively. In Step S180, the classification function values for the detection values are computed from the two function values for high and low energy levels. Then the computed values are compared with the predetermined classification function values to obtain the effective atomic number range of the material and to further determine the material attributes of the object. In Step S190, in order to obtain a clear image of the inspected object, a number of images obtained after the X-rays having different energy levels scan the inspected object can be combined to acquire a scan image of better quality. It is well known that the penetration factor of high-energy rays is strong, and the detection data can be obtained with a high accuracy after the rays penetrate through an object of large mass thickness, therefore, a clear gray-scale image can be acquired for the object of large mass thickness. However, when high-energy rays penetrate through an object of small mass thickness, the obtained gray-scale image is blurred and the detail information tends to be lost. Fortunately, the above disadvantage can be compensated by the gray-scale image obtained after low-energy rays penetrate through the object. FIG. 6 is the flow chart of the method of adjusting images with different mass thickness information. In the image combination, the different attenuation characteristics of the high- and low-energy rays with respect to the different mass thickness of the object are used, and the clear image can be acquired in a wide range of mass thickness by fusing two kinds of detection values. In Steps S191 and S192, the material attributes of the inspected object are determined, for example, whether the mass thickness of the inspected object 7 is thick or thin. Here, the approximate range of the mass thickness of the object is judged from the attenuation of the rays, that is, when the attenuation is great, for example, the detection value is less than a predetermined threshold value, the mass thickness of the material is referred as large; when the attenuation is little, for example, the detection value is more than a predetermined threshold value, the mass thickness of the material is referred as small. In Step S193, for the material of a small mass thickness, a smaller weighting factor, such as 30%, is given to the data for the high energy level, and a bigger weighting factor, such as 70%, is given to the data for the low energy level. In Step S194, for the material of a large mass thickness, a bigger weighting factor, such as 70%, is given to the data for the high energy level, and a smaller weighting factor, such as 30%, is given to the data for the low energy level. Then, in Step S195, the images for the high and low energy levels are synthesized using the above weighting factors to acquire the final clear image. Therefore, the present invention proposes that the detection values obtained after the X-rays of different energy levels interact with the object are compared with the corresponding predetermined threshold values, and different weighting factors are given to the data for the high and low energy levels, thereby obtaining the gray-scale information of the finally synthesized image. Although the images, which are detected after the rays interact with objects of various mass thickness, have different image characteristics, with the processing of the above method, even if the mass thickness of objects varies greatly, a clear gray image of the material can be acquired in the object scanning. The above-mentioned is only the specific embodiments of the present invention, while the scope of the present invention is not limited to it. Any modification or substitution, which is obvious to the skilled in the art within the technical range disclosed in the present invention, should be included in the scope of the present invention, which is thus defined by the claims. |
|
053533224 | description | DETAILED DESCRIPTION Any mirror-based imaging system for X-ray projection lithography cameras involves variables such as surface curvatures and spacings or thicknesses between elements, which affect the performance of the final lens design. In a three-mirror system, for example, the first-order design variables include the curvatures or radii of the three mirrors and three of the spacings or thicknesses between elements (two inter-mirror spacings and either the object or image spacing) for a total of six variables. Graphically representing all these variables would require six-dimensional space. We have found a way of compressing the six variables for a three-mirror system into two variables of magnification that allow a two-dimensional representation by means of a coordinate system. The two magnification variables can then be represented as coordinates along orthogonal axes lying in a two-dimensional magnification plane. This led to our discovery of a region of the magnification space that we have identified as containing optimum solutions for three-mirror systems. Before explaining in detail the optimum solution region, shown in FIG. 3, we will explain some of the terms and parameters involved. THREE-MIRROR SYSTEMS Our solutions for mirror-based imaging systems for X-ray projection lithography cameras are first of all limited to three-mirror systems that place a convex mirror M.sub.2 (of radius R.sub.2) optically between a pair of concave mirrors M.sub.1 (of radius R.sub.1) and M.sub.3 (of radius R.sub.3), as generally shown in FIGS. 1 and 2. Four-mirror systems may also be possible; but for a number of reasons, we believe that three-mirror systems offer the best prospects. A three-mirror system can include a substantially plane folding mirror 14, such as shown in FIG. 2, however; and such a plane mirror can be arranged in many different positions for changing the direction of the image-forming radiation beam, as is generally known. "SOFT" X-RAY RADIATION Our lithography camera lenses are intended for radiation in the X-ray portion of the electromagnetic spectrum, and preferably use radiation in the "soft" X-ray range of 2 to 20 nanometers wavelength. This region is chosen so that reflective mirror systems with multilayer coatings can be used with substantially normal incident radiation. The availability of good multilayer coatings and X-ray sources at 13 to 14 nanometers wavelength makes this wavelength range of particular interest in X-ray projection lithography. As schematically shown for lenses 10 and 20 of FIGS. 1 and 2, respectively, the radiation emanates from a source 11 that preferably includes a condenser. In lens 10 of FIG. 1, the radiation illuminates a reflective mask 12; and in lens 20 of FIG. 2, the radiation illuminates a transmissive mask 13. The radiation from masks 12 or 13 is then focused to form a reduced image on wafer 15 by reflection from mirrors M3, M2, and M1 (with an additional reflection from folding mirror 14 in lens 20). The curvatures and spacings of mirrors M1 through M3 can be varied considerably from the approximate relationships schematically shown in FIGS. 1 and 2. LENS SCALING AND NORMALIZATION Normalizing a lens design with respect to some linear dimension, such as focal length, for example, is a common practice in lens design work. Equivalent lenses with focal lengths differing by some scale factor, SF, from the original normalized lens of unity focal length, are then obtained by multiplying each linear dimension by SF. Scaling leaves all angles and ratios unchanged. In our investigation of three-mirror lens systems for X-ray projection lithography, we chose to use as a normalizing dimension the radius R.sub.2 of the convex mirror M.sub.2, which is more convenient than using focal length. Lens designs in this invention are applicable to lithography for Very Large Scale Integrated (VLSI) circuit chips with overall dimensions on the order of 1 cm or larger. The lens designs are suitable for scanning or stepping exposure methods and the appropriate scale factor would be chosen accordingly. TOTAL MAGNIFICATION The lens systems of interest are reduction lenses for projection lithography cameras, for which we have selected a total magnification within a range of 1/3.times. to 1/10.times.. (By the usual convention, we are omitting the minus sign that precedes these total magnification ratios.) A magnification presently used in lithography cameras is 1/5.times., which is familiar to workers in this art and within the range we prefer. Magnifications outside the 1/3.times. to 1/10.times. range are possible; but for a number of reasons, we believe they are not practically desirable for projection lithography cameras. The total lens magnification is the product of the individual magnifications of each mirror: EQU mt=m.sub.1 .times.m.sub.2 .times.m.sub.3 (3) Magnification, since it is a ratio, is unchanged by scaling. MIRROR POSITIONING We have also required of possible solutions that the mirrors be positioned so as to minimize interference with the radiation beam and provide space for other details of a lithography system. The disposition of the mirrors is also subject to practicalities of fabrication, mounting, and alignment. WORKING DISTANCE AND TOTAL LENGTH Working distance (WD in FIGS. 1 and 2) is the distance between the wafer and the M.sub.2 mirror surface. Working distance provides room for adequate mirror thickness, for enclosures to permit operation in a vacuum, and for the mechanical movements that are necessary between the lens and wafer to permit various exposure modes, including stepping and scanning or a combination of both. Working distance may be stated in absolute units, but we prefer to express it in dimensionless units to allow for linear scaling of the lens. Since we chose to use the radius R.sub.2 of mirror M.sub.2 as a normalizing factor, as described above, in dimensionless units, we find the practical limits of the working distance WD to lie in the range of 0.05 to 0.35. Using a typical value for R.sub.2 of 320 millimeters, as an example, the corresponding working distance range in absolute units becomes 16 to 112 millimeters. Longer and shorter working distances are possible, but we believe they are subject to practical difficulties that make our choice preferable. The total or overall length of the lens system is the maximum length, including object and image planes. In FIGS. 1 and 2, for example, the overall length is the dimension OAL. We limit our lens systems to a maximum overall length of 2 meters, independent of scaling. Longer lens systems are possible, but encounter practical difficulties in keeping all elements rigidly located with respect to each other. CHIEF RAY ANGLE AT THE WAFER AND AT THE MASK For optimum photolithographic results, the chief ray at the wafer should be telecentric, or perpendicular to the wafer surface. Departures from telecentricity of more than one or two degrees are usually unacceptable because of image displacements they cause where the wafer surface and focal plane do not coincide exactly. For a reflective mask, the chief ray angle at the mask (CRAM) must be such that the illuminating X-ray beam incident on the mask does not interfere with the beam reflected from the mask. For most of the lens systems within our invention, sufficient clearance between the two beams is realized when the chief ray angle at the mask (measured with respect to the normal to the mask) is in the range one to eight degrees, depending on total magnification and numerical aperture, and is directed as shown in FIG. 1. With transmissive masks, such as shown in FIG. 2, the chief ray angle at the mask is less critical, and values of from +8 to -8 degrees are acceptable. Lens scaling leaves chief ray angles unchanged. PETZVAL SUM AND IMAGE FIELD CURVATURE The curvature of the image surface is proportional to the Petzval sum of the lens system. We find as a practical requirement that the Petzval sum of the lens must be substantially zero in order to meet our high resolution goal. Since the wafer surface is substantially flat, the image field must also be flat to attain good line width control in the image and maintain a large depth of focus. In terms of the curvatures of the mirrors, substantially zero Petzval sum means that the curvature of the convex mirror must be substantially equal to the sum of the curvatures of the two concave mirrors as expressed by: EQU 1/R.sub.2 .apprxeq.1/R.sub.1 +1/R.sub.3 (4) When normalized with respect to the radius R.sub. 2 of mirror M.sub.2, this expression becomes: EQU 1.0.apprxeq.R.sub.2 /R.sub.1 +R.sub.2 /R.sub.3 (5) (All radii are considered positive quantities in equations 4 and 5.) For first-order solutions, a zero Petzval sum is used, but computer optimization of a first-order solution sometimes results in small departures of the Petzval sum from zero. NUMERICAL APERTURE AND DEPTH OF FOCUS The attainable resolution of a lens is inversely proportional to its numerical aperture, and the depth of focus is inversely proportional to the square of the numerical aperture as given in equations 1 and 2. We have restricted numerical aperture to the range 0.05 to 0.15 in order to achieve depth of focus larger than 1 micron and resolution equal to or better than 0.1 micron. Lens scaling leaves the numerical aperture unchanged and leaves the depth of focus of aberration-free lenses unchanged. MIRROR CURVATURE AND SPACING Surface curvatures of the mirrors, and thickness or spacing between the mirror surfaces, are parameters that determine the first-order configuration of the lens system. A total of six of these variables is involved in the design of a first-order three-mirror system, as described above. However, because we choose the Petzval sum of the lens system to be substantially zero, the curvature variables are reduced from three to two and the number of variables for the design of a three-mirror first-order system is reduced from six to five. These five variables may be effectively compressed to two variables, as described in the following section. MAGNIFICATION SPACE A preliminary step in our discovery of optimum solutions for three-mirror imaging systems for X-ray projection photolithography cameras is the realization that the five variables for mirror surface curvatures and spacings can be compressed into two parameters, which can be represented in a two-dimensional magnification space, as shown in FIG. 3. Since each of the three mirrors M.sub.1 through M.sub.3 has associated with it a magnification involving its surface curvature and its spacing from the other mirrors and from the mask or wafer, we have found it very useful to plot the magnification m.sub.2 of mirror M.sub.2 along the x-axis, against the ratio of the magnifications m.sub.1 /m.sub.3 of mirrors M.sub.1 and M.sub.3, plotted along the y-axis. In this magnification plane, three-mirror systems having particular values of total magnification mt, normalized working distance WD, and chief ray angle at the mask CRAM are represented by points along a single curved line as shown for example in FIG. 3. Three-mirror systems with different values for one or more of the parameters mt, WD, and CRAM are represented by other curved lines. In the examples presented in FIG. 3, line R represents systems with mt=1/4.times., WD=0.1, and CRAM=0 degrees. Line S represents systems with mt=1/5.times., WD=0.15, and CRAM=0 degrees. Line T represents systems with mt=1/5.times., WD=0.15, and CRAM=3 degrees. At any point along each line, all the first-order curvature and spacing parameters for a normalized three-mirror system with zero Petzval sum are determinable. Compressing the five independent variables associated with a three-mirror system into two-dimensional magnification space systematizes and expedites the search for new first-order lens designs potentially capable of meeting our performance criteria. It also leads to our discovery and mapping of boundaries for a specific region in magnification space where optimum solutions lie, as represented in FIG. 3. OPTIMUM REGION OF MAGNIFICATION SPACE The magnification space region containing our optimum lens solutions, as shown in FIG. 3, is divided into zones 30, 40, 50, and 60, which are bounded by straight lines that intersect the origin at 0,0 and are restricted to the second and fourth quadrants. The second quadrant region 40 is a preferred subregion of the larger region 30; and similarly, the fourth quadrant region 60 is a preferred subregion of the larger region 50. In the second quadrant regions 30 and 40, m.sub.2 is negative; and, since the total lens magnification mt is also negative (i.e., the final image is real and inverted), the magnifications m.sub.1 and m.sub.3 must have the same sign. For fourth quadrant solutions, where m.sub.2 is positive (implying an image that is virtual and non-inverted), the magnifications m.sub.1 and m.sub.3 must have opposite signs in order to make the total magnification negative. The boundaries of region 30, 50 are formed by lines through points 0, A, B, C, D, 0, E, F, 0. The coordinates for these points are as shown in the following table: ______________________________________ Magnification Space Region 30, 50 point m.sub.2 m.sub.1 /m.sub.3 ______________________________________ 0 0 0 A -2.13 +0.925 B -2.50 +2.24 C -0.67 +2.24 D -0.325 +1.80 0 0 0 E +0.27 -0.62 F +0.10 -0.75 0 0 0 ______________________________________ The preferred subregion 40, 60 is bounded by lines through points 0, G, H, I, 0, J, K, 0. The coordinates for these points are shown in the following table: ______________________________________ Preferred Subregion 40, 60 point m.sub.2 m.sub.1 /m.sub.3 ______________________________________ 0 0 0 G -0.55 +0.623 H -0.55 +1.25 I -0.25 +1.25 0 0 0 J +0.220 -0.50 K +0.10 -0.60 0 0 0 ______________________________________ Three-mirror imaging systems for X-ray projection lithography cameras can lie outside our magnification space region 30, 50; but the evidence we have accumulated indicates that such outside solutions are unlikely to achieve the required fine resolution and low distortion or are otherwise not likely to meet the practical requirements explained above. There may also exist first-order solutions within our region 30, 50 which are not correctable; but our accumulated evidence indicates that the best prospects for optimum solutions lie within the magnification region we have identified. Having this region available can significantly expedite the lens design process necessary to reach the performance goal within the practical requirements explained above. Any three-mirror lens system for projection lithography can be represented by a point somewhere within the overall magnification space shown in FIG. 3; and points falling within region 30, 50 represent potentially optimum solutions, many of which we have found to be correctable to a very high degree, using computer optimization programs. Workers skilled in the use of these programs, which lead to small modifications in the first-order solutions, can achieve corrected lens systems having very fine resolution and very low distortion. The modifications from computer optimization can involve parameters such as small changes in the basic spherical form of one or more mirrors by incorporation of aspheric and conic terms, small tilts or decenterings, small changes in one or more first-order radii and spacings, and small changes in working distance WD or CRAM. The modifications can move the first-order solution point slightly in magnification space, and the modifications can lead to a number of slightly different lenses occupying the same point in magnification space. Systems lying outside region 30, 50 suffer from one or more of the following problems, depending on where they lie relative to the boundaries of region 30, 50: overall length more than 2 meters; insufficiently large correctable aperture resulting in unacceptably low resolution; beam interference resulting from small inter-mirror spacing; too small a working distance; a chief ray angle at the mask that is too small or is inclined in the wrong direction, leading to beam interference when reflective masks are used, or is too large, leading to excessive distortion in the projected image; a total magnification mt that is outside the range 1/3.times. to 1/10.times.; or mirror configurations that are not easily fabricated or aligned. Some of these shortcomings tend to occur along specific portions of the boundaries of region 30, 50. For example, outside the O-A and O-E boundaries, the total magnification tends to become larger than 1/3.times.; outside the O-D-C and O-F boundaries, the total magnification tends to become smaller than 1/10.times.; and outside the O-D and O-E boundaries, the chief ray angle at the mask becomes too large and distortion becomes intolerably large. The corner points A, B, C, and D have been set by exploring limiting cases for 1/3.times., 1/5.times., 1/7.5.times., and 1/10.times., respectively, and the corner points E and F by similarly exploring limiting cases in the fourth quadrant for 1/3.times. and 1/10.times.. The important case of 1/5.times. is well within the boundaries of the 30, 50 region, as are intermediate magnifications between the extremes of 1/3.times. and 1/10.times.. Lenses with a specific total magnification, mt, normalized working distance, WD, and chief ray angle at the mask, CRAM, lie along a line as described in the paragraph headed Magnification Space, and as illustrated in FIG. 3. Cross-hatched subregion 40, 60 within overall region 30, 50 is especially likely to contain optimum solutions; and the O, G, H, I, J, K points at the corners of region 40, 60 are based on computer exploration of the overall region 30, 50. In effect, region 40, 60 is especially rich in potential optimum solutions, although these can occur outside region 40, 60 but within overall region 30, 50. The prior art suggestions for three-mirror imaging systems for X-ray projection photolithography cameras (disclosed in Canon KK published European Application EP-252-734-A cited above) include examples 1-8 through 1-15 which are plotted on the magnification plane of FIG. 3 and which all lie in the second quadrant outside of our optimum solution region 30. These are marked as points PA1-PA4 and relate to the examples in the '734 application as follows: ______________________________________ Points Examples mt m.sub.2 m.sub.1 /m.sub.3 NA WD ______________________________________ 1-8 1/5x -0.710 2.627 0.0167 0.627 1-9 1/5x -0.710 2.627 0.0167 0.627 1-10 1/5x -0.710 2.627 0.0167 0.627 1-11 1/5x -1.322 2.513 0.038 0.468 1-12 1/5x -1.322 2.513 0.038 0.468 1-13 1/5x -1.319 2.518 0.038 0.469 1-14 1/2x -0.844 3.352 0.019 1.472 PA4 1-15 1/1x -0.459 3.346 0.012 2.567 ______________________________________ All Of these prior art examples involve numerical apertures of 0.038 or smaller, which we regard as too small to meet the 0.1 micron resolution goal, and have normalized working distances WD greater than 0.35, which we regard as too large. Also, some have overall lengths in excess of 2 meters, or total magnifications in excess of 1/3.times.. FIG. 4, which is an enlargement of the region 40, 60 of FIG. 3, also shows the location in our preferred region of magnification space of a few of the examples we have found to be optimum solutions. These points are represented in the following table and are shown as points along total magnification lines drawn on FIG. 4. In the table (as elsewhere in this application), mt is the total magnification, m.sub.2 is the magnification of mirror M.sub.2, m.sub.1 /m.sub.3 is the ratio of magnifications of M.sub.1 and M.sub.3, WD is the normalized working distance, OAL is the total length in meters, and R.sub.2 is the radius of mirror M.sub.2 in millimeters. All examples have the same numerical aperture, 0.1, and therefore the same depth of focus. ______________________________________ mt m.sub.2 m.sub.1 /m.sub.3 WD OAL R.sub.2 ______________________________________ EX1 1/3x -0.331 +0.532 0.0913 1.248 451.02 EX2 1/3x -0.045 +0.086 0.1409 0.624 322.47 EX3 1/4x -0.434 +0.854 0.1718 1.088 325.38 EX4 1/4x -0.243 +0.526 0.1575 0.858 323.48 EX5 1/4x -0.026 +0.066 0.1727 0.572 328.87 EX6 1/5x -0.513 +1.155 0.1825 1.480 321.28 EX7 1/5x -0.380 +0.903 0.1536 1.268 322.61 EX8 1/5x -0.260 +0.660 0.1528 1.105 322.65 EX9 1/5x -0.166 +0.444 0.1474 0.943 321.82 EX10 1/5x -0.037 +0.113 0.1817 0.729 319.45 EX11* 1/5x +0.047 -0.138 0.1135 0.737 462.31 EX12 1/5x +0.096 -0.283 0.0954 0.887 691.60 EX13 1/8x -0.185 +0.695 0.1039 1.455 307.52 EX14 1/8x -0.048 +0.193 0.0754 0.990 359.22 ______________________________________ Examples 1-10, 13, and 14 are in the second quadrant region 40; and examples 11 and 12 are in the fourth quadrant region 60. Example 11 (noted with an *) is a particularly well-corrected lens. Two unusual lens systems having desirable properties are illustrated in FIGS. 5-7, and points occupied in magnification space by the respective lens 70 of FIG. 5 and lens 80 of FIG. 6 are indicated on FIG. 4. These lenses are unusual in having both a large chief ray angle at the mask (of about 7.degree.) and having chief rays of the radiation incident on the mask being inclined away from the optical axis in a direction from the source toward the mask. This places the illuminating beam emerging from the radiation source 11 closer to the optical axis than the beam reflecting portion of the surface of the M.sub.3 mirror, and this can require a hole in the M.sub.3 mirror to pass the radiation from the source to the mask 12. Since the mirrors are normally centered on the optical axis, the beam from source 11 would ordinarily travel outboard or farther from the optical axis than the M.sub.3 mirror, as shown in FIGS. 1 and 2. Reversing this condition so that the chief rays proceeding from source 11 to mask 12 are inclined away from the optical axis leads to important advantages, however. Inclining the chief rays away from the optical axis in a direction from source 11 to mask 12 allows the chief rays to have larger angles at the mask than were previously thought to be practical. A chief ray angle at the mask of up to 10.degree. is practical when the chief rays incline away from the optical axis as they approach the mask. A range that we prefer for chief ray angles at the mask is from 3.degree. to 10.degree. when the chief rays are inclined away from the optical axis in a direction from source 11 to mask 12. The lens system 70 of FIG. 5 is correctable throughout a useful image field having a relatively large size of about 17.times.34 millimeters. This is large enough for imaging all or a substantial portion of a microcircuit device in a non-scanning mode; and for microcircuit devices larger than 17.times.34 millimeters, a succession of two or more mask images can be juxtaposed in registry on wafer 15 in a process called "stitching". This is explained in more detail in a copending and commonly assigned patent application Ser. No. 940,537, filed Sep. 4, 1992, entitled PHOTOLITHOGRAPHIC REDUCTION IMAGING OF EXTENDED FIELD. Another advantage of lens system 70 is the possibility of a real aperture stop 71 schematically illustrated by a pair of dots on opposite sides of the rays downstream of mirror M.sub.2. Real aperture stop 71 is arranged where the chief rays all cross the optical axis, and it is very useful in blocking stray light or scattered light that would otherwise reduce image contrast. A real aperture stop is often not possible in three-mirror soft X-ray lithography lens systems, because of the beam interference that such a stop would cause. For lens system 70, though, the large chief ray angle at the mask, and a small numerical aperture (of about 0.05), separates the beams enough to permit placement of real aperture stop 71 without causing beam interference. At larger numerical apertures, for which lens 70 is also correctable, real aperture stop 71 may not be possible. Another advantage that applies to lens systems 70 and 80 is a possible simplification of a condenser lens that is included within source 11. This is attributable to the fact that chief rays converge in a direction from mask 12 to source 11, which suggests that a condenser lens system can be smaller. Lens system 80 of FIG. 6 is similar to lens system 70, but is scaled down in size and has a ring-shaped image field. It has a larger numerical aperture (of about 0.1) and is correctable throughout a narrow arc-shaped field that is suitable for scanning. Its large chief ray angle at the mask (also about 7.degree.) and its narrow image field allows use of the desirable real aperture stop 71, downstream of mirror M.sub.2, as schematically shown by dots 71. A schematic form of lens systems 70 and 80 is illustrated in FIG. 7 to indicate the thickness parameters T.sub.0 -T.sub.4. These are marked alongside chief rays leading from surface to surface, but are actually measured as surface separation distances along the optical axis. The thicknesses and the mirror surface curvatures are shown in the following tables: ______________________________________ Lens System 70 ______________________________________ Surface Radii Thickness ______________________________________ T.sub.0 572.19813000 M.sub.1 -638.23280000 T.sub.1 -470.09455000 M.sub.2 -465.71905000 T.sub.2 1000.68192000 M.sub.3 -1677.12471000 T.sub.3 -1050.68192000 Sur- Aspheric Coefficients face Conic Constant (CC) (AD, AE, AF, and AG) Data ______________________________________ CC AD AE M.sub.1 1.27070E-01 0.00000E+00 -4.25500E-16 AF AG 2.39840E-20 0.00000E+00 CC AD AE M.sub.2 3.32220E+00 0.00000E+00 9.01000E-14 AF AG -2.63720E-17 0.00000E+00 CC AD AE M.sub.3 4.41060E-01 0.00000E+00 -2.99070E-19 AF AG -1.39320E-24 0.00000E+00 ______________________________________ ______________________________________ Lens System 80 ______________________________________ Surface Radii Thickness ______________________________________ T.sub.0 233.70692000 M.sub.1 -262.40124000 T.sub.1 -192.33772000 M.sub.2 -195.39137000 T.sub.2 443.19849000 M.sub.3 -716.74740000 T.sub.3 -463.19849000 Sur- Aspheric Coefficients face Conic Constant (CC) (AD, AE, AF, and AG) Data ______________________________________ CC AD AE M.sub.1 1.34950E-01 0.00000E+00 -7.65120E-15 AF AG 5.92020E-19 0.00000E+00 CC AD AE M.sub.2 3.29769E+00 0.00000E+00 -6.77460E-13 AF AG 9.03110E-16 0.00000E+00 CC AD AE M.sub.3 3.62860E-01 0.00000E+00 -3.50160E-16 AF AG 1.57600E-21 0.00000E+00 ______________________________________ |
056132441 | summary | BACKGROUND OF THE INVENTION Field of the Invention The present invention relates generally to vitrifying or melting liquid wastes for which additional materials are needed to form a desired glass or slag composition, and more particularly to a process for vitrifying low-level radioactive high-sodium liquid wastes. BACKGROUND OF THE INVENTION Vitrification or melting of liquid Bastes requires that other materials be added to the waste, so that upon melting, a glass or slag material is formed that is resistant to natural forces such as leaching, decrepitation, and abrasion. These additional materials constitute a significant proportion of the final form, usually in the range of 70 to 80 percent by weight. The appropriate glass or slag formers, which are well known to those experienced in the art consist of metal oxides, such as boric, calcia, alumina, silica, magnesia, and others, such as titania and zirconia, to achieve special properties. Previous to the present invention, waste processors would feed glass or slag forming minerals and low-level radioactive high-sodium liquid wastes directly into the melting furnace for vitrification. This seemingly simpler procedure results in the formation of large volumes of gases containing nitrogen oxides formed by thermal decomposition of nitrates and nitrites in the waste. Nitrogen oxides pose a significant health hazard, and the gas thus generated must be treated to remove them. The present invention provides an improved technology wherein nitrates and nitrites are decomposed into nitrogen gas in a separate operation, and dry feed materials are processed by the melting furnace. SUMMARY OF THE INVENTION It is therefore an object of the present invention to provide a process for preparing radioactive and other hazardous liquid wastes for treatment by the method of vitrification or melting. DETAILED DESCRIPTION OF THE INVENTION The preferred embodiment of the present process involves the following steps: 1. Mixing of finely divided dry material including glass-forming minerals, binders to impart physical strength to intermediate product pellets, and reductants to decompose nitrogenous species in the liquid waste. 2. Pelletizing of mixed dry materials with water to form wet pellets, bricks, briquettes, plates, extrudates, or other shape by conventional methods including mixing, rolling, compacting, extruding (ring pelletizer), agglomerating (disc pelletizer), or other technique. 3. Heating to 50.degree. to 120.degree. C. to remove free moisture and to form dry physically strong intermediate product pellets with capacity to absorb liquid waste. 4. Exposing dry pellets to liquid waste by spraying, dipping, or other means to prepare loaded pellets. Proportions are determined by the extent of waste loading desired in the final waste form and the concentrations of components within the liquid waste. Proportions appropriate to treat the subject liquid waste are cited in examples 1, 2, and 3. 5. Heating loaded pellets to 50.degree. to 120.degree. C. to remove free moisture and further heating to 150.degree. to 450.degree. C. to induce reaction between reductants in the pellets and nitrogenous species in the liquid waste to prepare a dry homogeneous product suitable for melting. The invention specifically is applicable to the low-level radioactive high-sodium liquid wastes, such as those currently stored in underground tanks at the Hanford Nuclear Reservation in Washington State, but it also is applicable to the vitrification or melting of other liquid wastes requiring the addition of glass-forming materials such as Hanford site high-level liquid wastes and liquid wastes hazardous by virtue of contained heavy metals and other RCRA-listed materials. However, it is understood that the invention is broad in scope and is neither dependent upon addition of materials to react with the wastes nor chemical reaction of materials within the substrate. That is, the substrate may function only as a carrier for the appropriate hazardous component or components in the liquid waste. |
046613099 | description | BEST MODE FOR CARRYING OUT THE INVENTION Terms and Technology In referring to a nuclear steam generator, it is reasonable to describe it as a tube and shell heat exchanger which, in turn, can be utilized to actuate a turbine to produce electrical energy. In further detail, the steam generator/heat exchanger is a vessel in which is mounted a bundle of tubes with which a primary fluid, heated by nuclear energy, is passed in indirect heat exchange with feedwater flowed over the outside of the tubes of the bundle. Present attention is focused on solid objects which collect upon the upper surface of the tube sheet. A wide variety of objects, such as weld metal, bolts, welding rods, and even tools, may be loosed in the annular space between the tube bundle and inside wall of the shell. These solid objects become erratically directed projectiles relative the tubes of the bundle under the force of the secondary fluid flowing through the exchanger. The present invention provides a means for locating these solid objects, bringing them under control, and removing them from the shell. The flow pattern of feedwater over the tubes of the bundle is controlled by baffling within the vessel. The more important of these baffle structures is referred to as a wrapper which usually extends down from the upper regions of the vessel to within the order of 15" of the tube sheet. Incoming feedwater flows down the annular space, a downcomer formed between the wrapper and the inside of the vessel, and is released above the tube sheet to flow laterally to the tubes and up over the tubes of the bundle. A transporter, in which the present invention is embodied, is placed at this location on the tube sheet and beneath the lower edge of the wrapper. The transporter is a conveyance which is adapted to move along the periphery of the tube bundle within the limited space provided between the bundle, the upper surface of the tube sheet, the inside wall of the vessel shell, and the lower edge of the wrapper. The conveyance will mount a T.V. camera remotely controlled to locate and identify solid objects to be controlled and removed with devices also mounted on the transporter. The transporter is brought into the limited space at the periphery of the tube bundle through openings of limited size. Realistically, there are only two routes the transporter can utilize to reach its position on the tube sheet. First, the transporter can be taken down the annular space between the wrapper and the inside wall of the shell. This annular space is in the order of 3" wide. Alternatively, the transporter can be inserted through an aperture in the side of the shell, generally referred to as a handhole. The present invention anticipates the assembled transporter being inserted into the limited space at the periphery of the tube bundle through the handhole. Once in position within the limited space at the tube bundle periphery, the equipment for locating and removing solid objects is mounted on the transporter. It is also anticipated that when the transporter is in its operative position on the tube sheet, it will be connected to outside control and manifesting devices through control lines extending through the handhole in the side of the shell. Thereafter, the transporter can be energized and controlled to move along the periphery of the tube bundle and carry out its participation in the process of removing solid objects located on the surface of the tube sheet. The Shell, Tube Bundle and Transporter FIG. 1 is an unpretentious disclosure of the cramped, limited space available between tube bundle 1 and the inside wall 2 of shell 3 beneath the lower edge of the tube wrapper and above the surface of tube sheet 4. Access to this space is provided by handhole 5 through shell 3. As disclosed in FIG. 1, transporter 6 is positioned in the cramped space about tube bundle 1. This path on the upper surface of tube sheet 4 is traveled by transporter 6 which is supported on four wheels 8 and moved along its track between tube bundle 1 and wall 2 of shell 3. A control station 9 is mounted external shell 3 and is connected to the transporter by lines and/or conduits 10 with which the transporter's movements are controlled and with which the devices or tools mounted on the transporter may be operated. Thus, the invention provides for locating, controlling, and removing solid objects from the shell of the steam generator which can be reached from the track. Zoom In On Transporter 6 FIG. 2 moves the viewer closer to disclose transporter 6 on which tools are mounted. Wheels 8 of the transporter roll on the upper surface of tube sheet 4. Wheels 8 are attached to axles mounted on a lower platform body 11. An upper platform body 12 is sized to match the lower platform body and keyed for assembly with holes to receive tapered pins 13 extending up from the lower platform body. Two pins and holes are disclosed in FIG. 2. It is anticipated that the transporter will be broken down by lifting the upper platform body from the lower platform and reassembled in the same way. A first motor 14 is provided to drive the wheels through a gear train between the motor and the axles. All the tools of the transporter are mounted from the upper platform body 12. Some, or all, of these tools can be individually removably mounted in further breakdown of the transporter through handhole 5. Figs. 3 and 4 represent the forward section of transporter 6 with alternate retrieval tools mounted thereon. A T.V. camera 15 is mounted on top of a work station 17 on the front of the transporter and is tilted about a pivot 18 by a second motor 19 with a gear train which allows it to be remotely controlled to view within the limits of 15.degree. up and 45.degree. down. A third motor 20 is the power source for the horizontal movement of the work station to which the camera and retrieval tools are mounted and which gives the camera the capability of both pan and tilt operation for inspection viewing. A boom arm 21 is mounted in front of the transporter between yoke arms 22 attached to the work station. The boom arm provides mounting for the various tools. Each tool is inserted into the boom arm aperture 23. Each tool has a hole to align with a plunger 24 extending through the top side of the boom arm to fit into the hole in the tool. Plunger 24 is spring-urged to exert a force on the plunger, holding it in a tool-locking position. When it is desired to remove the tool from the boom arm, the force of the spring is overcome by manually tugging the plunger upward and out of engagement with the hole in the tool. Movement of work station 17 moves both the T.V. camera and any tool mounted on the boom arm. A fourth motor 25 is the power source for vertical movement of work station 17 through an appropriate gear train. These are the provisions for the eye of the camera to follow the movement of the tool or implement for the search and removal of solid objects which will be taken out handhole 5. In an actual reduction to practice of the invention, 3" diameter wheels of soft rubber (model airplane wheels) are used to support the transporter. Two W. M. Berg model No. WX64P4-3 worm wheel and helical assembly gear boxes with a drive ratio of 25 to 1 provide positive drive for all four wheels. The drive motor is Micro Mo model 2233 with a model 22/2, 308:1 ratio gear drive. Drive train couplings are Berg Model C020-11 and C020-14. Power is provided to the drive motor through electrical contacts of the type used in burglar alarm installations; Safe-House Model 49-518. The lower platform body is formed from 1/4".times.131/2".times.27/8" wide aluminum plate. The upper platform body is sized to match the lower platform. The work station on the front of the cart provides a means of vertical and horizontal movements, allowing selected implements to perform various tasks. Power is provided for these movements from two Micro Mo 12 volt D.C. motors. Berg couplings (Model No. 5Z15-00136) provide accurate alignment as well as easy assembly and replacement of parts. Gearing is accomplished with a worm gear (Berg Mod. No. W4B29-S60) and a single pitch worm (Berg Mod. No. W48S-3S). Bronze bearings are used at all pivot and gear locations. The spring plunger on the yoke is a Reid Tool Co. Model No. FR-250. In FIG. 2, bolt cutters 30 are disclosed as the specific retrieval tool mounted to extend from implement boom arm 21, with jaws extending out to within the viewing range of the T.V. camera. The jaws are operated by a hydraulic piston-cylinder 31 so they may open and close on solid objects located by the camera. With the bolt cutters and camera mounted on the same work station, the camera views the objects engaged by the bolt cutters. Lamps 32 are mounted on the yoke arms to provide the illumination of objects to be engaged by the bolt cutters. Mounting the bolt cutters on the transporter anticipates the encounter of objects which protrude into the path of the transporter. If these objects, such as welding rods, are lodged firmly so as to resist dislodgement, the bolt cutters can be utilized to remove that portion of the object that protrudes into the path. The cut portions of the objects fall onto the path and may be removed by other tools alternatively mounted on boom arm 21. The boom arm is formed and arranged to mount any number of devices or tools which can retrieve solid objects by bringing them to the handhole for manual removal. In the actual reduction to practice, a pair of 14" bolt cutters was modified to be operated with an Enerpac Model RWT-40 hydraulic cylinder. Water replaced the hydraulic fluid for use inside the steam generator. Other Retrieval Tools FIG. 3 discloses the front part of transporter 6 with retrieval pliers 33 mounted on boom arm 21. Bolt cutters 30 have been replaced by the pliers in order to retrieve solid objects in the path, including objects cut by the bolt cutters. Again, the objects to be retrieved are illuminated by the lights 32. So illuminated, the objects are viewed through the T.V. camera 15. Jaws 34 of pliers 33 are actuated by motor 35 so that by a combination of jaw actuation and rotation of station 17, the solid objects viewed by the camera may be secured and moved to handhole 5 for manual removal. In the actual reduction to practice the pliers are of the long nose type and electrically operated with a Micro Mo 12 V D.C. motor and gear reducer (Model 2233 F 012 ST+22/2 30.7:1) A No. 10-32 screw and threaded brass rod provide the power transmission to the jaws. FIG. 4 discloses, as in FIG. 3, the forward portion of transporter 6. The boom arm is now supplied a device which may be characterized as a rake 37. It is anticipated there will be solid objects which are desired to be removed, yet cannot be grasped by plier jaws 34. Therefore, rake 37 represents still another form of tool which can be employed to move solid objects along the path under the eye of the camera. It is anticipated that with rake 37, objects can be moved along the path to the handhole close enough for manual removal. The number of tools mounted on boom arm 21 is limited only by imagination. For each removal step, some sort of tool is mounted on boom arm 21 with the bottom-line result of moving all solid debris to the handhole for removal. Conclusion FIG. 1 discloses the cramped environment for the retrieval transporter in a nuclear steam generator. In FIG. 2, transporter 6 is disclosed as basically separable in two parts. Each part can be inserted into the steam generator through handhole 5. Reassembled as readily as disassembled, transporter 6 is connected by its umbilical cord to a control station 9 at which personnel can observe the path in front of the transporter through the eye of T.V. camera 15. Additionally, of course, control is exerted over the movement of the transporter and operation of any tool mounted thereon. In generating a lucid description of the preferred embodiment, each of the motors, as power sources, have been called out by both numerals and its place in the description. For example, the first motor is designated 14, the second motor is 19, etc. The basic function of the transporter is to go after solid objects which threaten the integrity of the internal parts of the steam generator. This retrieval function is carried out by the movement of the transporter along its path and operation of the tools mounted on boom arm 21. The following claims define the structure of the transporter and its numerous parts to make it perfectly clear how the combination carries out its ultimate function as a retrieval system. From the foregoing, it will be seen that this invention is one well adapted to attain all the ends and objects hereinabove set forth, together with other advantages which are obvious and inherent to the apparatus. It will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations. This is contemplated by and is within the scope of the invention. As many possible embodiments may be made of the invention without departing from the scope thereof, it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted in an illustrative and not in a limiting sense. |
051788217 | summary | FIELD OF THE INVENTION This invention relates to water cooled nuclear fission reactors of the so-called boiling water type. Boiling water nuclear reactors comprise a steam generating plant wherein reactor water coolant is circulated through a core of heat producing fissionable nuclear fuel to transfer thermal energy from the fuel to the coolant water and thereby produce steam. The steam is then used to drive turbines and other machinery employing steam, such as for electrical power generation. BACKGROUND OF THE INVENTION Due to the prodigious quantities of thermal energy produced by fissioning nuclear fuel, it is imperative to maintain the fuel core of commercial water cooled nuclear fission reactors submerged within heat transferring coolant water. The conveyance of heat out away from the energy producing fuel core by means of circulating coolant water is needed to preclude the possibility of hazardous conditions or reactor damage such as could occur with an overheating meltdown within the fuel core of the reactor plant. Such a potentially destructive occurrence can result from a loss of coolant accident (LOCA) caused by an extensive breach of a major reactor coolant receptacle or conduit. To cope with this theoretical accidental event, commercial water cooled nuclear fission reactors are provided with large reservoirs of water available for supplying supplementary coolant water to the reactor vessel for cooling the fuel core and maintaining lower or normal operating temperatures. A variety of safety measures have been proposed or employed to activate and operate systems for supplying or injecting this supplementary coolant water as needed to the fuel core for replacing or supplementing any loss of the original coolant water due to some mishap. A typical arrangement in commercial water cooled nuclear fission reactor plants for incorporating standby safety systems which feed or inject auxiliary coolant water to temper the fuel core temperatures utilize an apt gas, such as nitrogen, for a propellant to drive the supplementary liquid water or a boron solution from a source or reservoir through communicating conduits into the reactor vessel. Thus, auxiliary coolant water or an aqueous boron solution is maintained within a closed vessel or tank under sufficient gas pressure to drive the liquid contents into the reactor vessel through an appropriate arrangement of conduits upon a manually or automatically actuated signal responding to a malfunction within the reactor. However, such systems are prone to leakage and loss of gas for propelling coolant water as well as prone to malfunctioning of the manual and/or mechanical or electronic means for actuation of the system. Another means comprises gravity feed arrangements employing elevated vessels of auxiliary coolant water. However loss-of-coolant accidental events can sometimes result in overheating which in certain cases causes increased pressures above the already high pressures within the reactor pressure vessel. The occurrence of such elevated pressure conditions inhibits gravity feeding of coolant water into a highly pressurized reactor vessel. SUMMARY OF THE INVENTION This invention comprises an improved standby safety system for water cooled, nuclear fission reactor plants. The improvement of the invention comprises a totally passive delivery means for introducing a standby supply of auxiliary coolant water into the fuel core region of the nuclear reactor pressure vessel. Additionally this invention comprises a unique arrangement of auxiliary coolant water reservoirs housed within the reactor pressure vessel combined with means for providing inherently passive action or motivating force for supplying auxiliary coolant water to deal with a reactor emergency or malfunction. OBJECTS OF THE INVENTION It is a primary object of this invention to provide an improved coolant water standby safety supply system for nuclear fission reactor plants. It is an additional object of this invention to provide a coolant water standby safety supply system for water cooled nuclear fission reactor plants having a passive delivery means. It is a further object of this invention to provide a standby safety supply for water cooled nuclear fission reactor plants having an inherent passive gas propellant source and application system that enhances safe performance as well as economic benefits. It is a still further object of this invention to provide a liquid standby safety supply system for water cooled nuclear fission reactor plants having an improved arrangement of coolant water delivery which is actuated passively upon occurrence of a malfunction. It is also an object of this invention to provide improved multiple liquid standby safety supply for water cooled nuclear fission reactor plants providing for auxiliary application of coolant water to the fuel core by means of a passive system providing an inherent source of propellant gas during any period of core overheating due to a loss of coolant accident. |
summary | ||
abstract | A system and method for detecting overlay errors, the method includes (i) directing a primary electron beam to interact with an inspected object; whereas the inspected object comprises a first feature formed on a first layer of the inspected object and a second feature formed on a second layer of the object, wherein the second feature is buried under the first layer and wherein the second feature affects a shape of an area of the first layer; (ii) detecting electrons reflected or scattered from the area of the first layer; and (iii) receiving detection signals from at least one detector and determining overlay errors. |
|
claims | 1. A nuclear reactor seismic isolation assembly, comprising:an enclosure that defines a volume;a plastically-deformable member mounted, at least in part, within the volume; anda stretching member movable within the enclosure, wherein the stretching member is mounted within a bore that extends at least partially through the plastically-deformable member, wherein a first portion of the bore comprises a first diameter substantially equal to an outer dimension of the stretching member, the bore comprising another portion that comprises a second diameter smaller than the first diameter, wherein the stretching member is configured to plastically-deform the plastically-deformable member when the stretching member moves further into the bore in response to a dynamic force exerted on the enclosure, and wherein the second diameter is stretched to substantially equal the first diameter based on linear movement of the stretching member through the bore in response to the dynamic force exerted on the enclosure. 2. The nuclear reactor seismic isolation assembly of claim 1, wherein the plastically-deformable member comprises a first portion mounted within the enclosure and a second portion that extends through a die member to an exterior of the enclosure. 3. The nuclear reactor seismic isolation assembly of claim 2, wherein the second portion is welded to a reactor bay embedment. 4. The nuclear reactor seismic isolation assembly of claim 2, wherein the die member is movable with the stretching member in response to the dynamic force exerted on the enclosure. 5. The nuclear reactor seismic isolation assembly of claim 1, wherein the bore at least partially encloses a working fluid that dissipates at least a portion of energy generated by the dynamic force exerted on the enclosure based on movement of the stretching member through the bore in response to the dynamic force exerted on the enclosure. 6. The nuclear reactor seismic isolation assembly of claim 1, further comprising a fluid passage that fluidly couples the bore to the exterior of the enclosure. 7. The nuclear reactor seismic isolation assembly of claim 6, wherein the working fluid comprises a portion of a fluid enclosed in a nuclear reactor bay. 8. The nuclear reactor seismic isolation assembly of claim 1, wherein the enclosure is attachable to a portion of a nuclear reactor containment vessel. 9. A nuclear reactor system, comprising:a reactor bay that encloses a liquid;a nuclear reactor containment vessel that is mounted within the reactor bay with lugs positioned in embedments of the reactor bay; andseismic isolation assemblies mounted in the embedments and between the lugs and walls of the embedments, each of the seismic isolation assemblies comprising:an enclosure that defines a volume;a plastically-deformable member mounted, at least in part, within the volume; anda stretching member moveable within the enclosure to plastically-deform the plastically-deformable member in response to a dynamic force exerted on the reactor bay,wherein the stretching member is mounted within a bore that extends at least partially through the plastically-deformable member, and wherein the stretching member is configured to plastically-deform the plastically-deformable member when the stretching member moves further into the bore in response to the dynamic force exerted on the enclosure, andwherein the plastic deformation of the plastically-deformable member results, at least in part, from a linear movement of the stretching member into the bore, and wherein the plastic deformation of the plastically-deformable member occurs in a substantially transverse direction to the linear movement of the stretching member into the bore. 10. The nuclear reactor system of claim 9, wherein the plastically-deformable member comprises a first portion mounted within the enclosure and a second portion that extends through a die member to a wall of one of the embedments. 11. The nuclear reactor system of claim 10, wherein the second portion is anchored to the wall. 12. The nuclear reactor system of claim 10, wherein the die member is movable with the stretching member in response to the dynamic force exerted on the reactor bay. 13. The nuclear reactor system of claim 9, wherein a first portion of the bore comprises a first diameter approximately equal to an outer dimension of the stretching member, the bore comprising another portion that comprises a second diameter smaller than the first diameter. 14. The nuclear reactor system of claim 13, wherein the second diameter is stretched to approximately equal the first diameter based on the movement of the stretching member thought the bore in response to the dynamic force exerted on the reactor bay. 15. The nuclear reactor system of claim 9, wherein the bore at least partially encloses a working fluid that dissipates at least a portion of energy generated by the dynamic force exerted on the enclosure based on movement of the stretching member through the bore in response to the dynamic force exerted on the reactor bay. 16. The nuclear reactor system of claim 9, further comprising a fluid passage that fluidly couples the bore to a volume defined by the reactor bay. 17. The nuclear reactor system of claim 16, wherein the working fluid comprises a portion of a fluid enclosed in the volume. 18. The nuclear reactor system of claim 9, wherein the dynamic force comprises a seismically generated force. 19. An apparatus, comprising:an enclosure configured to receive a force from a nuclear reactor pressure vessel, wherein the force is generated, at least in part, by a seismic event;stretching means at least partially housed within the enclosure;means for transmitting the force to the stretching means, wherein the stretching means is configured to move within the enclosure in response to the force; andmeans for dissipating at least a portion of the received force based on a plastic deformation of the means for dissipating, wherein the stretching means is mounted within a bore that extends at least partially through the means for dissipating, wherein the plastic deformation of the means for dissipating results, at least in part, from a linear movement of the stretching means further into the bore, and wherein the plastic deformation of the means for dissipating occurs in a substantially transverse direction to the linear movement of the stretching means. 20. The apparatus of claim 19, wherein friction is generated between the means for dissipating and the stretching means based, at least in part, on repeated movement of the stretching means into the means for dissipating in response to the force, wherein the means for dissipating comprises means for dissipating another portion of the force based on the generated friction. 21. The apparatus of claim 19, further comprising means for compressing a working fluid enclosed in a chamber of the means for dissipating based on movement of the stretching means into the means for dissipating based on the force. 22. The apparatus of claim 21, further comprising means for expelling the working fluid to a reactor bay that encloses a liquid, and through a fluid passageway that fluidly couples the chamber and the reactor bay. 23. The apparatus of claim 22, wherein another portion of the received force is dissipated through the liquid enclosed in the reactor bay. 24. The apparatus of claim 19, further comprising one or more spring elements mounted between the enclosure and a reactor bay embedment, wherein the one or more spring elements are configured to dissipate another portion of the received force. 25. The apparatus of claim 19, wherein the means for dissipating is in contact with a structure that houses the nuclear reactor pressure vessel. 26. The nuclear reactor system of claim 9, wherein the plastic deformation of the plastically-deformable member in the transverse direction causes a portion of the bore into which the stretching member is inserted to increase in diameter. |
|
claims | 1. A method of cooling a core of a nuclear reactor, the method comprising:contacting the nuclear reactor core with an aqueous solution comprising at least one of polyhedral boron hydride anions or carborane anions dissolved in the aqueous solution. 2. The method of claim 1, wherein the at least one of polyhedral boron hydride anions or carborane anions are enriched in 10B. 3. The method of claim 1, wherein the at least one of polyhedral boron hydride anions or carborane anions comprise at least one of B10H102−, B11H14−, CB11H12−, or B12H122−. 4. The method of claim 1, wherein the aqueous solution comprises polyhedral boron hydride anions dissolved in the aqueous solution. 5. The method of claim 4, further comprising dissolving a salt selected from the group consisting of Li2B10H10, Na2B10H10, K2B10H10, (NH4)2B10H10, LiB11H14, NaB11H14, KB11H4, (NH4)B11H14, Li2B12H12, Na2B12H12, K2B12H12, (NH4)2B12H12, and combinations thereof in water to provide the aqueous solution. 6. The method of claim 1, further comprising dissolving a Group I or ammonium salt comprising the at least one of polyhedral boron hydride anions or carborane anions in water to provide the aqueous solution. 7. The method of claim 6, wherein the Group I or ammonium salt has at least 25 percent by weight boron. 8. The method of claim 1, further comprising dissolving a salt having a water solubility of at least 15 grams per 100 grams of solution at 20° C. in water to provide the aqueous solution comprising the at least one of polyhedral boron hydride anions or carborane anions dissolved in the aqueous solution. 9. The method of claim 1, wherein the nuclear reactor is a light water reactor, a boiling water reactor, a pressure water reactor, a reactor having an electricity output of less than 500 megawatts, or a heavy water reactor. 10. The method of claim 1, wherein contacting the nuclear reactor core with the aqueous solution is carried out during an emergency shutdown of the nuclear reactor. 11. A nuclear reactor comprising a nuclear reactor core including an aqueous solution,wherein the aqueous solution includes at least one of polyhedral boron hydride anions or carborane anions dissolved therein,wherein the aqueous solution is a part of at least one of:core coolant usable in operation of the nuclear reactor core, andcore coolant usable in emergency cooling of the nuclear reactor core. 12. The nuclear reactor of claim 11, wherein the at least one of polyhedral boron hydride anions or carborane anions are enriched in 10B. 13. The nuclear reactor of claim 11, wherein the at least one of polyhedral boron hydride anions or carborane anions comprise at least one of B10H102−, B11H14−, CB11H12−, or B12H122−. 14. The nuclear reactor of claim 11, wherein the aqueous solution comprises polyhedral boron hydride anions dissolved in the aqueous solution. 15. The nuclear reactor of claim 14, wherein the aqueous solution comprises a dissolved salt selected from the group consisting of Li2B10H10, Na2B10H10, K2B10H10, (NH4)2B10H10, LiB11H14, NaB11H14, KB11H14, (NH4)B11H14, Li2B12H12, Na2B12H12, K2B12H12, (NH4)2B12H12, and combinations thereof. 16. The nuclear reactor of claim 11, wherein the aqueous solution comprises a dissolved Group I or ammonium salt. 17. The nuclear reactor of claim 16, wherein the Group I or ammonium salt has at least 25 percent by weight boron. 18. The nuclear reactor of claim 11, wherein the aqueous solution comprises a dissolved salt having a water solubility of at least 15 grams per 100 grams of solution at 20° C. 19. The nuclear reactor of claim 11, wherein the nuclear reactor is a light water reactor, a boiling water reactor, a pressure water reactor, a reactor having an electricity output of less than 500 megawatts, or a heavy water reactor. 20. The nuclear reactor of claim 11,wherein the nuclear reactor comprises an emergency core cooling system,the emergency core cooling system comprising:a vessel containing an emergency aqueous solution that includes at least one of polyhedral boron hydride anions or carborane anions dissolved therein; anda conduit leading from the vessel to an applicator positioned to deliver the emergency aqueous solution to the nuclear reactor core. |
|
043814620 | abstract | Solar energy (called energy to the extent it is thermodynamically useful) is focussed by an inflated, buoyant reflector for heating lithium circulating through an MHD conversion system. Hydrogen and nitrogen are added to the heated lithium, finely divided iron serving as catalyst to obtain lithium amid. The hydrogen has been produced by electrolysis of water. The lithium-lithium amid mixture (liquid) is mixed with pressurized nitrogen to obtain a two phase flow in which the liquid is accelerated; focussed into a jet passing through the MHD converter to obtain hydrazine and additional electrical energy e.g. for the hydrogen electrolysis; and returned to the solar heater. The gas (N.sub.2) is separated; subjected to recuperative heat exchange with itself; and low temperature isothermic compression under direct contact with a liquid which in turn is, ultimately, air cooled. The entire assembly is of elongated construction wherein the main active elements are arranged along a center axis e.g. as part of a central tubing surrounded by smaller tubing which section-wise runs various fluids to their appropriate destinations while serving as support frame. The entire process runs on the basis of self-sustaining fluid circulations without moving parts; the thermo and hydrodynamics as well as the electromagnetic interactions are explained and mathematically analyzed. The use of hydrazine as universal fuel is explained on the basis of compatibility with the biosphere. Alternative modes of hydrazine synthesis including using nuclear reaction as primary heat source is discussed. |
description | This is a National Phase Application in the U.S. of International Patent Application No. PCT/JP2007/056474 filed Mar. 27, 2007, which claims priority on Japanese Patent Application No. 099477/2006, filed Mar. 31, 2006. The entire disclosures of the above patent applications are hereby incorporated by reference. The present invention relates to an ion implanting apparatus which performs a mass-separation by allowing an ion beam containing a desired type of ion extracted from an ion source to pass through a magnetic field and which performs an ion implantation by irradiating the ion beam having been subjected to the mass-separation to a substrate. In order to perform an ion implantation that impurities are implanted into silicon or a silicon thin film during a process in which a thin film transistor (TFT) is formed on a semiconductor substrate or a liquid-crystal glass substrate, an ion implanting apparatus is used. Exemplary types of ions implanted into the substrate include phosphorus (P), boron (B), and the like. In general, the ion implantation is performed in such a manner that raw material gas containing such exemplary types of ions is supplied to an ion source to be thereby plasmatized and a ribbon-shaped ion beam having a rectangular section, which is accelerated after being extracted from the plasma, is irradiated to the substrate. Since the raw material gas is used by mixing hydrogen with phosphine (PH3), diborane (B2H6) or the like, when the ion beam extracted from the ion source is directly irradiated to the substrate, unnecessary ions such as hydrogen ions are implanted into the substrate as well as P ions (PHx) or B ions (B2HX) necessary to be implanted. In order to remove such unnecessary ions, Patent Documents 1 and 2 disclose a mass-separation ion implanting apparatus in which the ion beam extracted from the ion source is mass-separated to select a desired type of ion and the selected ion is irradiated to the substrate. Such a mass-separation ion implanting apparatus includes a mass-separation electromagnet through which the ion beam extracted from the ion source passes and a slit to which the ion beam having passed through the electromagnet is irradiated. For instance, as shown in FIG. 1A, the slit disclosed in Patent Document 1 is configured such that a hole 63 is formed through a slit plate 62. As shown in FIG. 1B, the slit disclosed in Patent Document 2 is configured such that a pair of slit plates 64, 64 are opposed to each other on both sides in a thickness direction of the ion beam (a short dimension of a beam section) so that a gap therebetween is adjustable. When the ion travels in a uniform magnetic field, the ion rotates at a curvature radius in accordance with electric charge and mass thereof. Accordingly, the mass-separation in accordance with types of ions can be performed in such a manner that the slit is disposed on a path where a desired type of ion among the ion beam having passed through the mass-separation electromagnet arrives. [Patent Document 1] JP-A-H11-339711 [Patent Document 2] JP-A-2005-327713 In many cases, the mass-separation ion implanting apparatus has been used for not a liquid-crystal panel production, but a semiconductor production. Since a height of the ion implanting apparatus for the semiconductor production is 300 mm or so at maximum, a size of the ion beam may be identical with that of the semiconductor if the ion implantation is performed in a bundle without scanning the substrate. However, as a glass substrate for the liquid-crystal panel production to be subjected to an ion implantation, currently, there is known a glass substrate having a size 730 mm×920 mm. In the glass substrate having such a size, assuming that a scanning operation is performed along a long dimension of the substrate, a dimension in a width direction of the ion beam (a long dimension of the beam section) needs to be 800 mm or so. Since magnetic poles of the mass-separation electromagnet for performing the mass-separation are disposed on both sides in a width direction of the ion beam so as to be opposed to each other, a gap between the magnetic poles of the mass-separation electromagnet needs to be 800 mm or more in order to perform the mass-separation of the ion beam having a width of 800 mm or so. Considering that the gap between the magnetic poles of the electromagnet having been used for the semiconductor production or an accelerator so far is several hundreds of mm or so at maximum, the gap between the magnetic poles of the mass-separation electromagnet for the liquid-crystal panel to be subjected to the ion implantation is very large. When a magnetic field is formed within such a large gap between the magnetic poles, it is very difficult to form a uniform magnetic field throughout the entire area where the ion beam passes. For this reason, when the ion beam passes through the electromagnet having a large gap between the magnetic poles thereof, a problem arises in that a strength or a direction of the magnetic field applied to the ions within the gap between the magnetic poles becomes different in accordance with a position where the ion beam passes due to the non-uniformity of the magnetic field. When the ion beam having a rectangular section passes through an area where the magnetic field is non-uniform, the output ion beam becomes non-uniform in current density distribution or a shape of the ion beam section tends to vary from the rectangular shape to a crooked shape. For instance, since the magnetic field formed between the magnetic poles is strongly inclined at a position close to the magnetic poles, as shown in FIG. 2, the shape of the beam section tends to be crooked from the rectangular shape to a ⊂-shape. The reason is because a Lorenz force applied to the ion having passed through a strong part of the magnetic field becomes stronger than that of the ion having passed through a weak part of the magnetic field. In addition, the crooked shape of the ion beam is various in accordance with a type, a specification or a magnetic field generating method of the electromagnet to be used, but may be deformed into an inverse ⊂-shape or other shapes as well as the ⊂-shape. Since the shape of the ion beam becomes crooked in this way, when the ⊂-shaped ion beam passes through the slit in which the hole is formed through the slit plate as shown in FIG. 1A, a problem arises in that a part of the ion beam leaking from the slit is shielded not to pass therethrough and thus current loss occurs. When a slit gap becomes large in order to reduce the current loss by using the pair of the slit plates of which the gap is adjustable as shown in FIG. 1B (i.e., in order to increase current amount of the ion beam), a problem arises in that mass-separation resolution of the ion deteriorates. In addition, as a technique for forming uniform magnetic field to remove drawbacks such as non-uniformity of the current density distribution and the crooked shape of the ion beam, a shape of the magnetic poles may be optimized by configuring the magnetic poles of the electromagnet as movable multi-polar magnetic poles. However, since the magnetic pole is generally made from pure steel or low carbon steel and weighs from several hundreds of kg to 1 ton, a problem arises in that manufacture cost increases upon applying an adjustment mechanism to such magnetic poles. The present invention solves the above-described problems, and an object of the invention is to provide an ion implanting apparatus capable of reducing current loss while ensuring high mass-separation resolution upon mass-separating an ion. In addition, an object of the invention is to provide an ion implanting apparatus capable of realizing uniformity of current density distribution of an ion beam by reducing non-uniformity of the current density distribution thereof. In order to attain the above-described object, the ion implanting apparatus related to the invention adopts the following configuration. Aspect 1 of the invention provides an ion implanting apparatus which performs an ion implantation by irradiating an ion beam having passed through a separation slit to a substrate, the ion implanting apparatus including: an ion source which generates plasma containing a desired type of ion to be implanted into the substrate; an extraction electrode system which extracts an ion beam having a rectangular section and containing the desired type of ion from the plasma generated from the ion source; a mass-separation electromagnet which performs a mass-separation by bending the extracted ion beam in a thickness direction so as to derive the ion beam containing the desired type of ion; and the separation slit which receives the ion beam having passed through the mass-separation electromagnet and allows the desired type of ion to selectively pass therethrough, the separation slit being operable to vary a shape of a gap through which the ion beam passes. According to the ion implanting apparatus described in Aspect 1, since the separation slit is operable to vary the shape of the gap through which the ion beam passes, it is possible to vary the shape of the gap in accordance with a crooked shape of the ion beam having passed through the mass-separation electromagnet. For instance, it is possible to deform the gap into a ⊂-shape so as to correspond to the ⊂-shape described above. Accordingly, it is possible to reduce the current loss while ensuring the high mass-separation resolution. Aspect 2 of the invention provides an ion implanting apparatus which performs an ion implantation by irradiating an ion beam having passed through a separation slit to a substrate, the ion implanting apparatus including: an ion source which generates plasma containing a desired type of ion to be implanted into the substrate; an extraction electrode system which extracts an ion beam having a rectangular section and containing the desired type of ion from the plasma generated from the ion source; a mass-separation electromagnet which performs a mass-separation by bending the extracted ion beam in a thickness direction so as to derive the ion beam containing the desired type of ion; the separation slit which receives the ion beam having passed through the mass-separation electromagnet and allows the desired type of ion to selectively pass therethrough; and a variable slit which is disposed between the extraction electrode system and the mass-separation electromagnet so as to form a gap through which the ion beam passes and is operable to vary a shape of the gap so as to shield a part of the ion beam extracted from the ion source. According to the ion implanting apparatus described in Aspect 2, since the variable slit is operable to vary a shape of the gap so as to shield a part of the ion beam extracted from the ion source, a predicted part of the ion beam of which current density becomes relatively high after passing the mass-separation electromagnet can be shielded in advance to be thereby removed. Accordingly, it is possible to realize uniformity of the current density distribution by removing non-uniformity the current density distribution of the ion beam having passed through the mass-separation electromagnet. Aspect 3 of the invention provides an ion implanting apparatus which performs an ion implantation by irradiating an ion beam having passed through a separation slit to a substrate, the ion implanting apparatus including: an ion source which generates plasma containing a desired type of ion to be implanted into the substrate; an extraction electrode system which extracts an ion beam having a rectangular section and containing the desired type of ion from the plasma generated from the ion source; a mass-separation electromagnet which performs a mass-separation by bending the extracted ion beam in a thickness direction so as to derive the ion beam containing the desired type of ion; the separation slit which receives the ion beam having passed through the mass-separation electromagnet and allows the desired type of ion to selectively pass therethrough, the separation slit being operable to vary a shape of a gap through which the ion beam passes; and a variable slit which is disposed between the extraction electrode system and the mass-separation electromagnet so as to form a gap through which the ion beam passes and is operable to vary a shape of the gap so as to shield a part of the ion beam extracted from the ion source. According to the ion implanting apparatus described in Aspect 3, since the separation slit is operable to vary a shape of the gap through which the ion beam passes, it is possible to vary the shape of the gap in accordance with a crooked shape of the ion beam having passed through the mass-separation electromagnet. Accordingly, it is possible to reduce the current loss while ensuring the high mass-separation resolution. In addition, since the variable slit is operable to vary a shape of the gap so as to shield a part of the ion beam extracted from the ion source, a predicted part of the ion beam of which the current density becomes relatively high after passing the mass-separation electromagnet can be shielded in advance to be thereby removed. Accordingly, it is possible to realize uniformity of the current density distribution by removing non-uniformity the current density distribution of the ion beam having passed through the mass-separation electromagnet. Aspect 4 of the invention provides the ion implanting apparatus according to Aspect 1 or 3, wherein the separation slit includes a first slit and a second slit which are disposed on both sides in a thickness direction of the ion beam so as to be opposed to each other with an interval therebetween, wherein the first slit and the second slit respectively include a plurality of small slits which are separated in a width direction of the ion beam, wherein the small slits are arranged so that a gap through which the ion beam passes is not formed between the small slits which are adjacent to each other in a width direction, and wherein the small slits are operable to move independently in a thickness direction. According to the ion implanting apparatus described in Aspect 4, the first and second slits are opposed to each other on both sides in a thickness direction of the ion beam with an interval therebetween and respectively include the plurality of small slits separated in a width direction of the ion beam. Also, the small slits are independently movable in a thickness direction of the ion beam. Accordingly, it is possible to easily vary a shape of the gap so as to correspond to the crooked shape of the ion beam having passed through the mass-separation electromagnet by adjusting the positions of the small slits. Additionally, since it is possible to better imitate the crooked shape of the ion beam as the number of the separated small slits increases, it is possible to further reduce the current loss and to improve the mass-separation resolution of the ion. Aspect 5 of the invention provides ion implanting apparatus according to Aspect 4, further including: a beam profile monitor which is disposed on the downstream side of the mass-separation electromagnet in an ion beam travel direction so as to measure a shape of the section of the ion beam upon receiving the ion beam; an ion monitor which is disposed on the downstream side of the separation slit in an ion beam travel direction so as to measure types and ratios of ions contained in the ion beam upon receiving the ion beam having passed through the separation slit; and a control unit which is operable to independently control respective movements of the plurality of small slits and controls the respective small slits so as to obtain desired mass-separation resolution on the basis of measurement information obtained by the beam profile monitor and the ion monitor. According to the ion implanting apparatus described in Aspect 5, since a desired mass-separation resolution is obtained by a feedback control of the small slits of the separation slit using the beam profile monitor, the ion monitor, and the control unit, it is possible to reduce the current loss while ensuring the high mass-separation resolution in terms of an automatic control. Aspect 6 of the invention provides the ion implanting apparatus according to Aspect 2 or 3, wherein the variable slit includes a first slit and a second slit which are disposed on both sides in a thickness direction of the ion beam so as to be opposed to each other with an interval therebetween, wherein the first slit and the second slit respectively include a plurality of small slits which are separated in a width direction of the ion beam, and wherein the small slits are operable to move independently in a thickness direction. According to the ion implanting apparatus described in Aspect 6, the first and second slits are opposed to each other on both sides in a thickness direction of the ion beam with an interval therebetween and respectively include the plurality of small slits separated in a width direction of the ion beam. Also, the small slits are independently movable in a thickness direction of the ion beam. Accordingly, it is possible to easily vary a shape of the gap so as to shield a part of the ion beam extracted from the ion source by adjusting the positions of the small slits. Additionally, since it is possible to more minutely vary the shape of the gap as the number of the separated small slits increases, it is possible to more reduce non-uniformity of the current density distribution in the ion beam having passed through the mass-separation electromagnet and thus to more realize uniformity thereof. Aspect 7 of the invention provides the ion implanting apparatus according to Aspect 6, further including: a beam profile monitor which is disposed on the downstream side of the mass-separation electromagnet in an ion beam travel direction so as to measure a shape of the section of the ion beam upon receiving the ion beam; and a control unit which is operable to independently control respective movements of the plurality of small slits, predicts a part of the ion beam of which the current density becomes relatively high after passing the mass-separation electromagnet among the ion beam received by the variable slit on the basis of measurement information obtained by the beam profile monitor, and controls the respective small slits so as to shield the part of the ion beam by using the respective small slits disposed at a position corresponding to the predicted part. According to the ion implanting apparatus described in Aspect 7, a feedback control of the respective small slits of the variable slit is performed by the beam profile monitor and the control unit so that a part of the ion beam of which the current density becomes relatively high after passing the mass-separation electromagnet is predicted and the respective small slits is controlled to shield a part of the ion beam by using the small slits which are disposed at a position corresponding to the predicted part. Accordingly, it is possible to realize uniformity of the current density distribution of the ion beam having passed through the mass-separation electromagnet in terms of an automatic control. As described above, according to the invention, it is possible to provide the ion implanting apparatus capable of reducing the current loss while ensuring the high mass-separation resolution upon mass-separating the ion. In addition, it is possible to provide the ion implanting apparatus capable of realizing the uniformity of the current density distribution of the ion beam by reducing the non-uniformity of the current density distribution thereof. Hereinafter, preferred embodiment of the invention will be described in detail with reference to the accompanying drawings. In addition, in the respective drawings, the same reference numerals are given to the same components and the repetitive description thereof will be omitted. FIGS. 3 and 4 are diagrams illustrating a configuration of an ion implanting apparatus 10 related to an embodiment of the invention, where FIG. 3 is a top diagram and FIG. 4 is a side diagram. In the ion implanting apparatus 10, a substrate 3 to be processed is a semiconductor substrate 3, a liquid crystal panel glass substrate or the like. In this embodiment, the substrate 3 is formed into a rectangular shape such that a short-side dimension W1 is 730 mm and a long-side dimension W2 is 920 mm. However, the shape of the substrate is not limited to the rectangular shape, but may be a square shape or a circle shape. The ion implanting apparatus 10 performs the ion implanting operation in such a manner that an ion beam 1 which contains a desired type of ion extracted from an ion source 12 is mass-separated by a mass separating electromagnet 17 and a desired type of ion selectively passes through a separation slit 20 to thereby arrive at a process chamber 19, thereby irradiating the ion beam 1 to the substrate 3 in the process chamber 19. That is, the ion implanting apparatus 10 is a mass-separation ion implanting apparatus. A path of the ion beam 1 between the ion source 12 and the process chamber 19 is surrounded by a vacuum container 16. The ion source 12 is air-tightly connected to the vacuum container 16, the vacuum container 16 is air-tightly connected to the process chamber 19, and the inside thereof is maintained in a vacuum state by a vacuum pump (not shown). The ion source 12 is a unit for generating plasma 13 containing a desired type of ion to be implanted into the substrate 3. An example of an ion to be implanted into the substrate 3 includes a P ion or a B ion. Material gas used for such ion is supplied from a supply unit (not shown) to the ion source 12. For instance, the material gas is phosphine (PH3) in case of the P ion or is diborane (B2H6) in case of the B ion, which is mixed with hydrogen in use. The ion source 12 ionizes a molecule of the supplied material gas by generating thermal electro using a filament (not shown) so as to generate plasma 13 containing a desired type of ion. The plasma 13 containing a desired type of ion generated from the ion source 12 is extracted as the ribbon-shaped ion beam 1 having a rectangular section by an extraction electrode system 15 disposed on the outlet of the ion source 12 (see FIG. 6). The output electrode system 15 is provided with a plurality of electrodes having a plurality of holes (three electrodes in this example). However, the output electrode system 15 may be configured as a latticed, meshed or slit-shaped electrode. A long dimension of a section perpendicular to an ion beam travel direction is larger than the short-side dimension W1 of the substrate 3. In case of the short-side dimension of 730 mm, the long dimension is not less than 800 mm (or so). Hereinafter, in this specification, a section perpendicular to the ion beam travel direction is referred to as ‘ion beam section’ or simply ‘beam section’. The long dimension of the beam section is referred to as ‘ion beam width’. A short dimension of the beam section is referred to as ‘ion beam thickness’. In addition, in this specification, the rectangular section indicates an approximately rectangular section or a rectangular section as well as a perfect rectangular section. The ion beam 1 extracted from the ion source 12 passes through a variable slit 30 to be thereby introduced into a mass-separation electromagnet 17. The mass-separation electromagnet 17 has magnetic poles 18 which are disposed on both sides in a width direction of the ion beam 1 passing therethrough so as to be opposed to each other, and forms a magnetic field perpendicular to the ion beam travel direction by using the magnetic poles 18. In this embodiment, the mass-separation electromagnet 17 forms a magnetic field in a direction indicated by the arrow B shown in FIG. 4. When the width of the ion beam 1 is 800 mm or so as described above, a gap between the magnetic poles 18 is not more than 800 mm. As shown in FIG. 3, the mass-separation electromagnetic 17 with such a configuration performs a mass-separation by bending the ion beam 1 extracted from the ion source 12 in a thickness direction so as to output the ion beam 1 containing a desired type of ion. When the ion beam 1 passes a magnetic field of the mass-separation electromagnet 17, the respective types of ions contained in the ion beam 1 rotate at curvature radiuses in accordance with electric charges and mass. Accordingly, the separation slit 20 is disposed on a path where a desired type of ion arrives after passing the magnetic field so as to allow the ion beam 1 output from the mass-separation electromagnet 17 to selectively pass therethrough. In addition, the separation slit 20 can vary a shape of a gap through which the ion beam 1 passes. When a gap between magnetic poles of the mass-separation electromagnet 17 is larger than 800 mm, as described above, it is difficult to form a uniform magnetic field throughout the entire area where the ion beam passes. Then, when the ion beam 1 having a rectangular section passes through the electromagnets forming such a non-uniform magnetic field, as described above, the beam section shape deforms from a rectangular shape to a crooked shape (for instance, a ⊂-shape). In this invention, since the separation slit 20 can vary a shape of a gap through which the ion beam 1 passes, it is possible to vary a shape of the gap so as to correspond to the crooked shape of the ion beam 1 having passed through the mass-separation electromagnet 17. For instance, it is possible to deform the gap into a ⊂-shape so as to correspond to the ⊂-shape described above. Accordingly, it is possible to reduce current loss while ensuring high mass-separation resolution. In addition, the crooked shape of the ion beam 1 is various in accordance with a type, a specification or a magnetic field generating method of the electromagnet to be used, but may be deformed into an inverse ⊂-shape or other shapes as well as the ⊂-shape. The separation slit 20 related to this embodiment will be described in more detail. FIG. 5 is a diagram illustrating a configuration of the sedation slit 20 related to this embodiment. This diagram illustrates an exemplary case that the ion beam 1 is deformed into a ⊂-shape after passing through the mass-separation electromagnet 17. As shown in FIG. 5, the separation slit 20 includes a first slit 21A and a second slit 21B which are disposed on both sides in a thickness direction of the ion beam 1 so as to be opposed to each other with an interval therebetween. The ion beam 1 passes a gap formed by the first slit 21A and the second slit 21B. The first slit 21A and the second slit 21B include a plurality of small slits 23, 23 . . . which are separated in a width direction of the ion beam 1. In this embodiment, each of the small slits 23 is formed into an elongate rectangular shape. In addition, the first slit 21A and the second slit 21B are respectively separated into ten members. A pair of members is opposed to each other in a thickness direction of the ion beam 1, and ten pairs of members are arranged in this way. The small slits 23 are arranged so that a gap through which the ion beam 1 passes is not formed between the small slits 23 which are adjacent to each other in a width direction of the ion beam 1. The configuration that the small slits 23 are arranged so that the gap through which the ion beam 1 passes is not formed between the small slits 23 is not particularly limited. For instance, the small slits 23 may be arranged while being deviated from each other so that the small slits 23, which are adjacent to each other in a width direction of the ion beam 1, partly overlap with each other when viewed in a beam travel direction. Alternatively, opposed side portions of the small slits 23 which are adjacent to each other in a width direction of the ion beam 1 may be respectively formed into a convex shape and a concave shape in a section so that one small slit 23 and the other slit 23 are inserted to each other and relatively move in a width direction of the ion beam 1. In addition, the respective small slits 23 are configured to independently move in a thickness direction of the ion beam 1. In this embodiment, the respective small slits 23 can reciprocate in a thickness direction of the ion beam 1 by actuators 25, 25 . . . . The respective actuators 25 are controlled on the basis of a control signal S1 output from a control unit 38 described below. With such a configuration, it is possible to easily vary a shape of the gap so as to correspond to the crooked shape of the ion beam 1 having passed through the mass-separation electromagnet 17 by adjusting the positions of the small slits 23. Accordingly, as shown in FIG. 5, since the positions of the small slits 23 are adjusted so as to correspond to an external shape of the ion beam containing a desired type of ion, the other types of ions except the desired type of ion are shielded. In this way, since the desired type of ion can selectively pass therethrough, it is possible to reduce the current loss while ensuring the high mass-separation resolution. Additionally, since it is possible to better imitate the crooked shape of the ion beam as the number of the separated small slits 23 increases, it is possible to further reduce the current loss and to improve the mass-separation resolution of the ion. In addition, in FIG. 5, the positions of the small slits 23 are adjusted so as to correspond to the external shape of the ion beam containing the desired type of ion. However, when obtaining the higher mass-separation resolution, the positions of the small slits 23 may be adjusted so as to completely shield the other types of ions except the desired type of ion. In this case, the much higher mass-separation resolution is obtained, but a current loss reduction advantage of the example shown in FIG. 5 is slightly better than that in this case. However, even in this case, it is obvious that the current loss is still less than that of the known example. In addition, priority of the mass-separation resolution improvement or the current loss reduction is individually determined on the basis of a target product or a user, and the priority varies case by case. Then, it is possible to obtain excellent advantage that the current loss is reduced while ensuring the high mass-separation resolution all the time irrespective of the priority of the mass-separation resolution improvement or the current loss reduction. The process chamber 19 has therein a substrate slider 28 which moves the substrate 3 in a direction indicated by the arrow C while holding the substrate 3. The substrate slider 28 is driven by a drive unit (not shown) so as to reciprocate. In this embodiment, a direction of the arrow C is identical with a thickness direction of the ion beam 1 having passed through the separation slit 20. Then, the ion beam 1 having a width wider than the short-side dimension W1 of the substrate 3 is irradiated to the substrate 3 while moving the substrate 3, and thus the ion beam 1 is irradiated to the entire surface of the substrate 3. In this way, it is possible to perform the ion implanting operation. As shown in FIGS. 3 and 4, the ion implanting apparatus 10 related to this embodiment further includes a beam profile monitor 40, an ion monitor 29, and a control unit 38. The beam profile monitor 40 is disposed on the downstream side of the mass-separation electromagnet 17 in a direction where the ion beam 1 travels and measures the section shape of the ion beam 1 upon receiving the ion beam 1. In this embodiment, the beam profile monitor 40 is a movable wire collector 40A and includes a first wire 41 which can reciprocate in a direction indicated by the arrow X (in a thickness direction of the ion beam 1) and a second wire 42 which can reciprocate in a direction indicated by the arrow Y. The movable wire collector 40A moves the first wire 41 and the second wire 42 in X and Y directions, respectively, while receiving the ion beam 1 so as to obtain current values of the ion beam 1 in X and Y directions and to measure the section shape of the ion beam 1 on the basis of the current values. When measuring the section shape of the ion beam 1, it is necessary to fully open a slit width of the separation slit 20. The beam profile monitor 40 can measure (estimate) current density distribution of the ion beam 1. Then, the beam profile monitor 40 is not limited to the movable wire collector 40A, but may be configured as other general members. In this embodiment, although the beam profile monitor 40 is disposed between the separation slit 20 and the process chamber 19, the beam profile monitor 40 may be disposed on the front-surface side or the rear-surface side of the substrate slider 28 in the process chamber 19 or may be disposed between the mass-separation electromagnet 17 and the separation slit 20 within a range capable of capturing the ion beam 1. An ion monitor 29 is disposed on the downstream side of the separation slit 20 in a direction where the ion beam 1 travels and measures the types and the ratios of ions contained in the ion beam 1 upon receiving the ion beam 1 having passed through the separation slit 20. The type of the ion monitor 29 is not particularly limited, but may be, for instance, a mass analysis type using an electromagnet and one or more faraday cups or other general types. Although the ion monitor 29 related to this embodiment does not move in an X direction (in a thickness direction of the ion beam 1), the ion monitor 29 can sufficiently cope with a thickness of the ion beam 1. In addition, the ion monitor 29 is driven by a drive unit (not shown) so as to reciprocate in a Y direction (in a width direction of the ion beam 1). With such a configuration, it is possible to measure the type and the ratio of the ions within a predetermined range at an arbitrary position of the width direction of the ion beam 1. The ion monitor 29 can measure the types and the ratios of the ions contained in the ion beam within a range corresponding to one or more pairs of the small slits 23. In this embodiment, the ion monitor 29 is disposed on the rear-surface side of the substrate slider 28, but may be disposed on the front-surface side of the substrate slider 28 so long as the ion monitor 29 is disposed on the downstream side of the separation slit 20 in an ion beam travel direction. The control unit 38 can independently control the respective movements of the plurality of small slits 23 in the separation slit 20, and controls the small slits 23 on the basis of measurement information obtained by the beam profile monitor 40 and the ion monitor 29 so as to obtain desired mass-separation resolution. The control will be described in detail with reference to FIG. 5. First, the positions of the small slits 23 are adjusted so as to maximize a slit width between the first slit 21A and the second slit 21B. In this state, a section shape of the ion beam 1 having passed through the mass-separation electromagnet 17 (the shape of the entire ion beam containing the other types of ions as well as the desired type of ion in FIG. 5) is measured (estimated) by the beam profile monitor 40. On the basis of the measurement information, the respective small slits 23 are moved to a predetermined position. For instance, the small slits 23 may move to a predetermined position so as to shield both sides in a thickness direction of the ion beam by a predetermined amount with respect to the shape of the entire ion beam containing the other types of ions as well as the desired type of ion. Alternatively, the small slits 23 may move to a predetermined position on the basis of data experimentally obtained in advance with respect to the shape of the ion beam containing the desired type of ion. Next, the ion monitor 29 measures the types and the ratios of the ions contained in the ion beam 1 within a range corresponding to one pair or plural pairs of small slits 23. When the mass-separation resolution is obtained from the measurement information and the mass-separation resolution does not satisfy a desired value, the mass-separation resolution is again obtained from the measurement information of the ion monitor 29 by moving one or both of the pair of small slits 23 so as to narrow a slit width. This operation is repeated until the mass-separation resolution satisfies a desired value. On the other hand, when the mass-separation resolution satisfies a desired value, the ion monitor 29 moves within a range corresponding to the other pair of small slits 23, and then the above-described operation is performed in the same way. In this way, when the mass-separation resolution satisfies a desired value in a width direction of the ion beam 1 as a whole, a position adjustment control of the separation slit 20 using the control unit 38 ends. As described above, since a desired mass-separation resolution is obtained by a feedback control of the small slits 23 of the separation slit 20 using the beam profile monitor 40, the ion monitor 29, and the control unit 38, it is possible to reduce the current loss while ensuring the high mass-separation resolution in terms of an automatic control. The ion implanting apparatus 10 related to this embodiment further includes a variable slit 30 which is disposed between the extraction electrode system 15 and the mass-separation electromagnet 17. The variable slit 30 forms a gap through which the ion beam 1 passes, and can vary a shape of the gap so as to shield a part of the ion beam 1 extracted from the ion source 12. As described above, when a gap between the magnetic poles of the separation electromagnet 17 becomes large so as to correspond to the substrate 3 with a large area, it is difficult to ensure a uniform magnetic field throughout the entire area where the ion beam passes. In this case, in the ion beam 1 having passed through the mass-separation electromagnet 17, non-uniformity of current density occurs in the beam section due to non-uniform magnetic field. In this invention, since the variable slit 30 can vary the shape of the gap so as to shield a part of the ion beam 1 extracted from the ion beam 1, a part of the ion beam 1 can be shielded to be thereby removed in advance. At this time, a part of the ion beam 1 indicates a predicted part of the ion beam 1 of which current density becomes relatively high after the ion beam 1 passes through the mass-separation electromagnet 17. Accordingly, it is possible to realize uniformity of the ion beam 1 by reducing non-uniformity of the ion beam 1 having passed through the mass-separation electromagnet 17. The variable slit 30 related to this embodiment will be described in more detail. FIG. 6 is a diagram illustrating a configuration of the variable slit 30 related to this embodiment. As shown in FIG. 6, the variable slit 30 related to this embodiment has the same configuration as that of the separation slit 20 described above. That is, the variable slit 30 includes a first slit 31A and a second slit 31B which are disposed on both sides in a thickness direction of the ion beam 1 so as to be opposed to each other with an interval therebetween. The ion beam 1 passes a gap formed by the first slit 31A and the second slit 31B. The first slit 31A and the second slit 31B include a plurality of small slits 33, 33 . . . which are separated in a width direction of the ion beam 1. In this embodiment, each of the small slits 33 is formed into an elongate rectangular shape. In addition, the first slit 31A and the second slit 31B are respectively separated into ten members. A pair of members is opposed to each other in a thickness direction of the ion beam 1, and ten pairs of members are arranged in this way. The small slits 33 are arranged so that a gap through which the ion beam 1 passes is not formed between the small slits 33 which are adjacent to each other in a width direction of the ion beam 1. The configuration that the small slits 33 are arranged so that the gap through which the ion beam 1 passes is not formed between the small slits 33 can be realized in the same way as the separation slit 20 described above. However, although the gap through which the ion beam 1 passes is not formed in the separation slit 20 so as to select a desired type of ion by shielding the other types of ions except a desired type of ion, it is not necessary to arrange the respective small slits 33 without forming a gap through which the ion beam 1 passes between the respective small slits 33 so long as the respective small slits 33 of the variable slit 30 can shield a part of the ion beam 1. In addition, the respective small slits 33 are configured to independently move in a thickness direction of the ion beam 1. In this embodiment, the respective small slits 33 can reciprocate in a thickness direction of the ion beam 1 by actuators 35, 35 . . . . The respective actuators 35 are controlled on the basis of a control signal S2 output from the control unit 38. With such a configuration, it is possible to easily vary a shape of the gap so as to shield a part of the ion beam 1 extracted from the ion source 12 by adjusting the positions of the small slits 33. Accordingly, as shown in FIG. 6, it is possible to shield a part of the ion beam 1 to be thereby removed in advance. At this time, the part of the ion beam 1 indicates a predicted part of the ion beam 1 of which current density becomes relatively high after the ion beam 1 passes the mass-separation electromagnet 17. Specifically, for instance, when it is predicted that current density becomes relatively higher at a part around both sides in a width direction of the ion beam 1 close to the magnetic poles 18 than the center of the ion beam 1 having passed through the mass-separation electromagnet 17, as shown on FIG. 6, a part of the ion beam 1 is removed in advance by narrowing a slit width of the respective small slits 33 which are disposed at a position corresponding to both sides of the width direction of the ion beam 1. Accordingly, it is possible to restrict current density of the ion beam 1 from being relatively high at a part around both sides in a width direction of the ion beam 1 by removing a part of the ion beam 1 having passed through the mass-separation electromagnet 17. As a result, it is possible to alleviate current density difference between the part around both sides and the center of the ion beam 1 and thus to realize uniformity of the current density distribution throughout the entire ion beam 1. Additionally, since it is possible to more minutely vary the shape of the gap as the number of the separated small slits 33 increases, it is possible to more reduce non-uniformity of the current density distribution in the ion beam 1 having passed through the mass-separation electromagnet 17 and thus to more realize uniformity thereof. The variable slit 30 is controlled on the basis of the control signal S2 output from the control unit 38. The control unit 38 can independently control the respective movements of the plurality of small slits 33. The control unit 38 predicts a part of the ion beam 1 of which current density becomes relatively high after passing the mass-separation electromagnet 17 among the ion beam 1 received by the variable slit 30 on the basis of the measurement information obtained by the beam profile monitor 40 and controls the respective small slits 33 so as to shield a part of the ion beam 1 by using the respective small slits 33 disposed at a position corresponding to the predicted part. In this embodiment, the variable slit 30 and the separation slit 20 are controlled by the same control unit 38, but may be controlled by different control units 38, respectively. The control will be described in detail with reference to FIG. 6. First, the positions of the small slits 33 are adjusted so as to maximize a slit width between the first slit 31A and the second slit 31B of the variable slit 30. In this state, a section shape and current density distribution of the ion beam 1 are measured (estimated) by the beam profile monitor 40. Since the beam profile monitor 40 is disposed on the downstream side of the mass-separation electromagnet 17 in an ion beam travel direction, it is possible to measure the section shape and the current density distribution of the ion beam 1 having passed through the mass-separation electromagnet 17. The control unit 38 predicts a part of the ion beam 1 of which current density becomes relatively high after passing the mass-separation electromagnet 17 among the ion beam 1 received by the variable slit 30 on the basis of the measurement information obtained by the beam profile monitor 40. The control unit 38 removes a part of the ion beam 1 in advance by narrowing a slit width of the small slits 33 which are disposed at a position corresponding to the predicted part on the basis of the predicted result. For instance, when it is predicted that current density becomes relatively higher at a part around both sides in a width direction of the ion beam 1 close to the magnetic poles 18 than the center of the ion beam 1 having passed through the mass-separation electromagnet 17, as shown in FIG. 6, a part of the ion beam 1 is removed in advance by narrowing a slit width of the respective small slits 33 which are disposed at a position corresponding to both sides of the width direction of the ion beam 1. In this state, the current density distribution of the ion beam 1 having passed through the variable slit 30 and the mass-separation electromagnet 17 is again measured by the beam profile monitor 40. The control unit 38 determines whether the current density distribution is uniform. At a first measurement, when the predicted part of the ion beam 1 of which the current density becomes relatively high is still high, the respective slits 33 move in a direction where the slit width is further narrowed. On the contrary, when the predicted part of the ion beam 1 of which the current density becomes relative high is too low, the respective slits 33 move in a direction where the slit gap is widened. When the control unit 38 determines that the current density distribution is uniform after repeating such operations, the position adjustment control of the variable slit 30 ends. In this way, a feedback control of the respective small slits 33 of the variable slit 30 is performed by the beam profile monitor 40 and the control unit 38 so that a part of the ion beam 1 of which the current density becomes relatively high after passing the mass-separation electromagnet 17 is predicted and the respective small slits 33 is controlled to shield a part of the ion beam 1 by using the small slits 33 which are disposed at a position corresponding to the predicted part. Accordingly, it is possible to realize uniformity of the current density distribution of the ion beam 1 having passed through the mass-separation electromagnet 17 in terms of an automatic control. In the above-described embodiment, the movable wire collector 40A is configured as the beam profile monitor 40, but instead may be configured as a faraday cup array 40B shown in FIGS. 7 and 8. The faraday cup array 40B is disposed on the rear-surface side of the ion monitor 29. The faraday cup array 40B is configured such that a plurality of faraday cups is arranged in a width direction and a thickness direction of the ion beam 1. The plurality of faraday cups are provided in parallel at an area larger than the section shape of the ion beam 1. By using the faraday cup 40B with the above-described configuration, it is possible to measure the section shape and the current density distribution of the ion beam 1 upon receiving the ion beam 1. In addition, at the measurement performed by the faraday cup array 40B, the substrate slider 28 moves to a position not interrupting the ion beam 1 irradiated to the faraday cup array 40B. As shown in FIG. 8, the ion monitor 29 can escape up to a position indicated by a dashed line so as not to interrupt the ion beam 1 irradiated to the faraday cup array 40B at the measurement performed by the faraday cup array 40B. In the above-described embodiment, both the variable slit 30 and the separation slit 20 which can vary the shape of the gap are provided, but one of them may be provided instead. That is, only the separation slit 20 which can vary the shape of the gap may be provided without the variable slit 30. In this case, although it is not possible to realize uniformity of the current density of the ion beam 1, it is possible to reduce the current loss while ensuring the high mass-separation resolution. In addition, only the variable slit 30 may be provided without the separation slit 20 which can vary the shape of the gap. In this case, although it is not possible to reduce the current loss while ensuring the high-mass separation resolution, it is possible to realize uniformity of the current density of the ion beam 1. However, when the separation slit 20 which can vary the shape of the gap is not provided, it is necessary to provide, for instance, other separation slits shown in FIGS. 1A and 1B so as to select the desired type of ion. While preferred embodiments of the invention as described and illustrated above, it should be understood that these are exemplary of the invention and are not to be considered as limiting. The scope of the invention is illustrated in the appended claims and various modifications can be made within the meaning and scope equivalent to the description in the appended claims. |
|
06160867& | claims | 1. A mirror for reflecting X-rays, comprising: a substrate having a surface; and multiple alternating layers of a first material and a second material applied superposedly to the surface of the substrate to form a multi-layer structure on the substrate, the first material consisting essentially of a substance selected from a group consisting of Mo, Rh, Ru, Re, W, Ta, Ni, Cr, Al, and alloys of such substances, and the second material consisting essentially of silicon and a dopant selected from a group consisting of B, C, and P, the dopant being at a concentration sufficient to reduce net internal stress in the multi-layer structure compared to an otherwise similar multi-layer structure lacking the dopant in the second material. a substrate having a surface; and multiple alternating layers of a first material and a second material applied superposedly to the surface of the substrate to form a multi-layer structure on the substrate, the first material consisting essentially of a substance selected from a group consisting of Mo, Rh, Ru, Re, W, Ta, Ni, Cr, Al, and alloys of such substances, and the second material consisting essentially of silicon and a dopant selected from a group consisting of B, C, and P, the dopant being at a concentration of at least 1.times.10.sup.8 atoms/cm.sup.3 to reduce net internal stress in the multi-layer structure compared to an otherwise similar multi-layer structure lacking the dopant in the second material. a substrate having a surface; and multiple alternating layers of a first material and a second material applied superposedly to the surface of the substrate to form a multi-layer structure on the substrate, the first material consisting essentially of a substance selected from a group consisting of Mo, Rh, Ru, Re, W, Ta, Ni, Cr, Al, and alloys of such substances, and the second material consisting essentially of silicon and a dopant selected from a group consisting of B, C, and P, wherein the dopant is B at a concentration of at least 1.times.10.sup.18 atoms/cm.sup.3 that is sufficient to reduce net internal stress in the multi-layer structure compared to an otherwise similar multi-layer structure lacking the dopant in the second material. a substrate having a surface; and multiple alternating layers of a first material and a second material applied superposedly to the surface of the substrate to form a multi-layer structure on the substrate, the first material consisting essentially of a substance selected from a group consisting of Mo, Rh, Ru, Re, W, Ta, Ni, Cr, Al, and alloys of such substances, and the second material consisting essentially of silicon and a dopant selected from a group consisting of B, C, and P, the dopant being at a concentration sufficient to reduce net internal stress in the multi-layer structure compared to an otherwise similar multi-layer structure lacking the dopant in the second material, wherein the layer contacting the surface of the substrate is a layer of the second material. (a) providing a rigid substrate having a surface; (b) applying to the surface a laminar structure consisting of a layer of a first material and a layer of a second material, the first material consisting essentially of a substance selected from a group consisting of Mo, Rh, Ru, Re, W, Ta, Ni, Cr, Al, and alloys of such substances, and the second material consisting essentially of Si and a dopant selected from a group consisting of B, C, and P, the dopant being at a concentration of at least 0.001 atomic percent relative to the silicon; (c) superposedly applying at least one additional layer of the first material and of the second material in alternating order superposedly to the laminar structure formed in step (b) to form a multi-layer mirror structure. a substrate having a surface; and multiple alternating layers of a first material and a second material applied superposedly to the surface of the substrate to form a multi-layer structure on the substrate, the first material consisting essentially of a substance selected from a group consisting of Mo, Rh, Ru, Re, W, Ta, Ni, Cr, Al, and alloys of such substances, and the second material consisting essentially of silicon and a dopant selected from a group consisting of B, C, and P, the dopant being at a concentration sufficient to reduce surface warping compared to an otherwise similar multi-layer structure lacking the dopant in the second material. 2. A mirror for reflecting X-rays, comprising: 3. A mirror for reflecting X-rays, comprising: 4. The mirror of claim 1, wherein the substrate is glass. 5. The mirror of claim 1, comprising at least 50 layers of each of the first and second materials. 6. The mirror of claim 1, comprising 30 to 100 layers. 7. The mirror of claim 1, wherein the first material is Mo, and the second material is B-doped Si. 8. The mirror of claim 1, wherein the layer contacting the surface of the substrate is a layer of the first material. 9. A mirror for reflecting X-rays, comprising: 10. A method for making a mirror that is reflective to X-rays, the method comprising: 11. The method of claim 10, wherein, in step (b), a layer of the first material contacts the substrate surface. 12. The method of claim 10, wherein, in step (b), a layer of the second material contacts the substrate surface. 13. The method of claim 10, wherein the dopant in the second material is at a concentration of at least 1.times.10.sup.18 atoms/cm.sup.3. 14. The method of claim 13, wherein the dopant is B. 15. The method of claim 10, wherein the first material consists essentially of Mo, and the dopant is B. 16. The method of claim 10, wherein step (a) comprises providing a glass substrate, and providing the surface with a mirror-polish. 17. The method of claim 10, wherein step (c) comprises applying at least 50 layers of each of the first material and of the second material. 18. The method of claim 10, wherein a total of 30 to 100 layers is applied to the substrate. 19. The method of claim 10, wherein steps (b)-(c) are performed by sputtering. 20. A mirror manufactured according to the method of claim 10. 21. A mirror for reflecting X-rays, comprising: |
description | This application is a continuation of application Ser. No. 10/817,834 filed Apr. 6, 2004 now U.S. Pat. No. 6,885,001, which is a continuation of application Ser. No. 09/768,356 filed Jan. 25, 2001 now U.S. Pat. No. 6,787,772. The present invention relates to a scanning electron microscope that scans the surface of a specimen with an electron beam and forms a two-dimensional electron image representing the shape or composition of the surface of the specimen through the detection of secondary signals produced by the specimen. More particularly, the present invention relates to a scanning electron beam microscope suitable for forming electron beam images of a high resolution at a high throughput by rapidly moving an observation point to tens of test positions on a semiconductor wafer as a specimen. A scanning electron microscope (hereinafter abbreviated to “SEM”) accelerates electrons emitted by an electron source of a heating electron emission type or a field electron emission type, collimates the accelerated electrons in a fine electron beam, i.e., a primary electron beam using an electrostatic lens or a magnetic field lens, scans a specimen two-dimensionally with the primary electron beam, detects secondary electrons generated by the specimen irradiated with the primary electron beam or secondary signal electrons, i.e., reflected electrons, and forms a two-dimensional electron image by applying intensities of detection signals as brightness modulating inputs to a cathode-ray tube (abbreviated to “CRT”) that is scanned in synchronism with a scanning operation using the primary electron beam. Device miniaturization has progressively advanced in the semiconductor industry in recent years, and optical microscopes for inspection in semiconductor device fabricating processes and test processes have been replaced by SEMs. The SEM uses an electron beam for dimension measurement and testing electrical operations. When observing an insulating specimen, such as a wafer that is used in the semiconductor industry, is observed with a SEM, a low acceleration voltage of 1 kV or below must be used not to charge the insulating specimen. Generally, the resolution of a general SEM using a low acceleration voltage of 1 kV is about 10 nm. As the miniaturization of semiconductor devices advances, demand for SEMs capable of forming images in a high resolution by using a low acceleration voltage has increased. A retarding system and a boosting system were developed and proposed in, for example, Japanese Patent Laid-open No. Hei 9-171791 to meet such demand. Those previously proposed systems enable observation in a resolution of about 3 nm under optimum conditions for observation. When a SEM is used for the inspection of a semiconductor device during semiconductor device fabricating processes or a completed semiconductor device, capability of rapidly moving an observation point to tens of inspection positions on a semiconductor wafer is a prerequisite of the SEM for the improvement of the throughput of an inspection process. Therefore, a stage capable of rapid movement has been used. However, the positioning accuracy of the stage is on the order of several micrometers. Mechanical control of the position of the stage in an accuracy on the order of nanometers is economically infeasible and is practically difficult in respect of moving speed. Therefore, to position the stage in a high accuracy higher than several micrometers, there is adopted an image shifting system that shifts electrically the coordinates of the scanning center of a primary electron beam. In some cases, since the coordinates are shifted by a distance as long as several micrometers, the image shifting system employed in the conventional SEM deteriorates resolution when the distance of shift is great. According to the present invention it is an object of the present invention to provide a SEM capable of image shifting an image without causing significant deterioration of resolution. With the foregoing object in view, the present invention provides a SEM comprising: an electron source, an image shifting deflector system including two deflectors disposed respectively at upper and lower stages to shift an irradiation position of a primary electron beam emitted by the electron source on a specimen; and an objective that focuses the primary electron beam; wherein the objective has a lens gap opening toward the specimen, and the deflectors disposed at the lower stage on the side of the specimen forms a deflecting electric field in a region corresponding to an effective principal plane of the objective. FIG. 1 shows a SEM in a first embodiment according to the present invention. A cathode 4 emits electrons when a beam voltage 6 is applied across the cathode 4 and an emission control electrode 5. The electrons thus emitted are accelerated (decelerated in some cases) by the emission control electrode 5 and an anode 8 held at a ground voltage. An acceleration voltage for accelerating a primary electron beam 1 is equal to an electron gun acceleration voltage 7. The primary electron beam 1 accelerated by the anode 8 is gathered by a condenser lens 9. Angle of divergence of the primary electron beam 1 or beam current is determined by a diaphragm 11 disposed below the condenser lens 9. A knob 12 is operated for centering the diaphragm 11. The primary electron beam 1 having passed the diaphragm 11 is deflected by image shifting deflectors 20 and 30 having a scanning deflection function for image shifting, and is moved on a specimen 13 for two-dimensional scanning. The deflecting intensities of the deflectors 20 and 30 are adjusted so that the primary electron beam 1 travels straight through an objective 10. A deflection function for scanning and an image shift deflecting function are provided by simultaneously applying a scanning deflection component and an image shifting deflection component to the deflectors 20 and 30 by a deflection control power supply 40 to input the deflecting intensities of the deflectors 20 and 30. A focusing magnetic field created by the objective acts on the primary electron beam 1 so as to deflect the primary electron beam 1 in directions perpendicular to the direction of travel of the primary electron beam 1 to deflect the primary electron beam for image shifting so that the primary electron beam deviates greatly from the optical axis of the objective 10. Thus, the deflection of the primary electron beam 1 causes off-axis aberration. Such off-axis aberration can be suppressed by a deflector that deflects the primary electron beam 1 so as to cancel deflection caused by the objective 10. However, disposition of a deflector in the objective 10 is subjected to many physical restrictions. This SEM employs the objective 10 having a lens gap opening toward the specimen, i.e., an objective having a lower magnetic pole having an aperture greater than that of an upper magnetic pole and capable of creating a maximum focusing magnetic field in the vicinity of the specimen disposed below the objective. Thus, the effective principal plane of the objective is positioned on a level different from that of the objective or on a level that places only few physical restrictions to facilitate the disposition of an electrostatic deflecting electrode. The SEM shown in FIG. 1 has an optical system of a short overall length because only the deflector 20 needs to be disposed between the condenser lens 9 and the objective 10. The primary electron beam 1 is decelerated by a decelerating electric field created between the objective 10 and the specimen 13 by applying a negative retarding voltage 15 through a stage 14 to the specimen 13 and is collimated by the collimating action of the objective 10. In this embodiment, the upper deflector 20 is a magnetic deflector and the lower deflector 30 is an electrostatic deflector. The upper deflector 20 may be an electrostatic deflector. Similarly, the lower deflector 30 may be a magnetic deflector. However, since only a narrow space is available in the vicinity of the objective 10, it is proper to use an electrostatic deflector as the lower deflector 30. Image shifting deflecting intensity IIS given to the upper deflector 20 by the deflection control power supply 40 is expressed by the following expression. I IS = K 1 V acc LM sem where K1 is conversion coefficient for converting deflection sensitivity, MSEM is the magnification of the SEM, Vacc is acceleration voltage for accelerating the primary electron beam 1, L is the distance between the upper deflector 20 and the specimen 13. Image shifting deflecting intensity VIS given to the lower deflector 30 is expressed by the following expression.VIS=K2IIS where K2 is conversion coefficient for converting deflection sensitivity. The angle between the direction of a magnetic field created by the upper deflector 20, i.e., a magnetic deflector, and that of an electric field created by the lower deflector 30, i.e., an electrostatic deflector, is about 90°. This angle between the directions differs from 90° when a magnetic field is created above the objective 10. This angle can be previously determined by numerical simulation or experiments. Secondary signal electrons 2 are generated when the specimen 13 is irradiated with the primary electron beam 1. The secondary signal electrons 2 include secondary electrons and reflected electrons. The electric field created in a space between the objective 10 and the specimen 13 acts as an acceleration electric field on the secondary signal electrons 2. Therefore, the secondary signal electrons 2 are attracted to the electron beam passing aperture of the objective 10. The secondary signal electrons 2 travel upward being subjected to the focusing action of the magnetic field of the objective 10. The secondary signal electrons having high energy collide against a conversion electrode 16, whereby secondary electrons 3 are emitted. A positive high voltage of about 10 kv is applied to a scintillator 17. The scintillator 17 attracts (deflects) the secondary electrons 3 and emits light. A secondary electron detector, not shown, that detects secondary electrons guides the light emitted by the scintillator 17 by a light guide to a photomultiplier, the photomultiplier converts the light into a corresponding electric signal, the electric signal is amplified and the amplified electric signal is used for the brightness modulation of a CRT. The principle and advantages of the SEM in this embodiment will be specifically described with reference to FIGS. 2, 9 and 10. FIG. 9 shows a general SEM for semiconductor wafer inspection, and paths of secondary electrons. FIG. 9 shows an observation mode in which the specimen 13 is observed at a high magnification and image shifting is not used. In this observation mode, the primary electron beam 1 falls on the specimen 13 at a position very close to the optical axis and hence the high-energy accelerated secondary electrons 2 fall in regions near the optical axis on the conversion electrode 16. Since the conversion electrode 16 is provided with a central aperture through which the primary electron beam 1 passes, some secondary electrons 2a travel through the central aperture of the conversion electrode 16 and are not detected. Consequently, an image having irregular brightness is formed. FIG. 10 shows an observation mode in which the specimen 13 is observed at a high magnification and image shifting is used. Secondary electrons 2 emitted from a position to which an image is shifted pass through a retarding electric field, not shown, and the objective 10, and travel along a path slightly deviating from the optical axis and fall in a region not including the central aperture on the conversion electrode 16. Since the range of deflection of the primary electron beam 1 is limited by the central aperture of the conversion electrode 16, the central aperture of the conversion electrode 16 cannot be excessively reduced. The diameter of the central aperture of the conversion electrode 16 is, for example, 3 mm. Since the optical magnification of the objective 10 is, for example, 50×, an image shifting distance, for example, on the order of 60 μm is necessary to enable the secondary electrons fall in regions not including the central aperture on the conversion electrode 16. On the other hand, ordinary image shifting deteriorates resolution by off-axis aberration when the image shifting distance is greater than 10 μm. Therefore, it is difficult to observe an image of a high resolution when image shifting is executed. The SEM in this embodiment employs a multipole electrostatic deflector as the lower image shifting deflector and forms the electrostatic deflector on the effective principal plane of the objective to achieve the efficient detection of the secondary electrons without causing significant deterioration of resolution, even if an image shifting amount is great. In the SEM shown in FIG. 1, a magnetic lens is formed by the objective 10 and an electrostatic lens is formed by the retarding voltage 15 applied to the specimen 13 in the vicinity of the specimen 13. Although the magnetic and the electrostatic lens are shown separately in FIG. 2, actually, the magnetic and the electrostatic lens are superposed. FIG. 2A shows deflecting forces exerted by the magnetic and the electrostatic lens on the primary electrons traveling along an off-axis path. The deflecting force FB0 of the objective acts in a rotating direction and the deflecting force FE0 of the electrostatic lens acts in a radial direction. The deflecting force FB0 is always greater than the deflecting force FE0 (FB0>FE0). FIG. 2B shows the so-called moving objective that cancels deflecting forces by superposing lateral deflecting electric field FE1 and a magnetic field FB1 on the lens electric field and magnetic field. Since the deflecting forces are cancelled individually, i.e., FB0+FB1=0 and FE0+FE1=0, off-axis aberration is suppressed to the least extent. FIG. 2C shows the cancellation of deflecting force only by the deflecting electric field. Deflecting force acting on the primary electrons can be cancelled by: FB0+FE2=0 and FE0+FB1=0. Since the secondary electrons travel in the reverse direction, the deflecting force of the magnetic field is reversed. Generally, FB0+FE2=2×FE0 and FE0+FE1=0, and a comparatively large deflecting force remains. FIG. 2D shows the cancellation of the deflecting force only by superposition of the deflecting magnetic field. For the primary electrons, FB0+FB1=0 and FE0+FE1=0. For the secondary electrons, the deflecting force of the magnetic field is reversed because the secondary electrons travel in the reverse direction. Generally, FB0+FE2=0 and FE0+FB2=2×FE0, and a comparatively small deflecting force remains. As obvious from FIGS. 2A to 2D, the superposition of the deflecting electric field shown in FIG. 2C is advantageous to meet both the elimination of the off-axis aberration of the primary electrons and the deflection of the secondary electrons. When observing an image with the image shifted by a fixed distance on the basis of the foregoing principle by the SEM in this embodiment, the secondary electrons 2 are caused to travel along a path extending apart from the optical path so that most of the secondary electrons fall in a region not including the central aperture of the conversion electrode 16 on the conversion electrode 16, to suppress off-axis aberration due to image shifting and to improve secondary electron detecting efficiency. In some cases, image shifting deflection improves the secondary electron detecting efficiency in a SEM employing the retarding technique and it is desirable to set an observation point with awareness of such a fact. It is possible to prevent the secondary electrons from passing the central aperture of the conversion electrode 16 by disposing an energy filter 60 including a plurality of layers of meshes below the conversion electrode 16 with respect to the traveling direction of the primary electron beam, whereby energy discriminating ability is improved. In the SEM in this embodiment, a secondary electron detector, not shown, may be interposed between the energy filter 60 and the objective 10 to catch all the secondary electrons that collide against the meshes of the energy filter 60 and do not reach the conversion electrode 16. When there is not any retarding electric field or the retarding electric field is sufficiently small, only the reflected electrons pass the electron beam passing aperture of the objective 10. The reflected electrons have high energy. Positions at which the reflected electrons fall on the conversion electrode 16 are dependent on angle at which the electrons are reflected by the specimen 13 and energy of the reflected electrons. Therefore, information represented by the selected reflected electrons can be obtained in a high sensitivity by disposing an aperture filter 62 below the conversion electrode 16 with respect to the traveling direction of the primary electron beam. When the reflected electrons reflected in a substantially perpendicular direction are selected, an image of high contrast of a specimen having a specific atomic number can be observed in a high resolution. In the conventional SEM, the path of the reflected electrons and the path of the primary electrons overlap each other and hence the detection of the reflected electrons is difficult. Substantially the same effect can be expected by making only a part of the conversion electrode 16 emit secondary electrons instead of employing the aperture filter 62. In such a case, it is preferable to coat the conversion electrode 16 excluding a part of the same with carbon that emit secondary electrons at a low efficiency. FIG. 3 shows a SEM in a second embodiment according to the present invention. In the SEM in the first embodiment, the objective 10 cause slight off-axis aberration because deflecting force is exerted on the secondary electrons 2. The off-axis aberration is a significant problem that affects adversely to observation in a high resolution. In the third embodiment, a Wien filter 62 adjusted so as to cancel off-axis aberration caused by an objective 10 is disposed on the side of an electron source with respect to a conversion electrode 16 to avoid the problem attributable to off-axis aberration. FIG. 4 shows a SEM in a third embodiment according to the present invention. The SEM in the third embodiment is provided with, in addition to two scanning deflectors 18 and 19 of a general SEM disposed at two stages, image shifting deflectors 20 and 30 in accordance with the present invention. A primary electron beam 1 traveled through a diaphragm 11 is deflected for two-dimensional scanning on a specimen 13 by the scanning deflectors 18 and 19. A deflection control power supply 40 gives a deflecting intensity IIS corresponding to a shifting distance to the upper image shifting deflector 20 for image shifting and gives a deflecting intensity VIS adjusted so as to make a primary electron beam 1 travel straight through an objective 10 to the lower image shifting deflector 30. Thus, the image shifting deflectors 20 and 30 can be easily incorporated into the general SEM to improve image shifting function, resolution and accuracy of dimensional measurement. The image shifting deflectors 20 and 30 will be described with reference to FIGS. 4 and 5. The upper image shifting deflector 20 is the same in construction as a conventional scanning deflector. The upper image shifting deflector 20 has scanning coils 21 to 24 are cosine distributed winding coils to create a uniform deflecting magnetic field around the optical axis of the SEM. The four quadrant coils are disposed in a circle. Coil currents are regulated in proportion to the cosine of the angle φ between an electron beam deflecting direction and the position of the scanning coils to deflect the primary electron beam 1 in a desired direction. Usually, currents of the same absolute value and opposite directions are supplied to the opposite scanning coils 21 and 23, respectively. Therefore, currents can be supplied to both the scanning coils 21 and 23 from a single power supply by connecting the scanning coils 21 and 23 to the power supply in opposite ways of connection, respectively. Similarly, currents can be supplied to the opposite scanning coils 22 and 24 by a single power supply. The lower image shifting deflector 30 is an octupole electrostatic deflector. Since the lower image shifting deflector 30 is disposed in a narrow space between the objective 10 and the specimen 13, the lower image shifting deflector 30 is formed in the shape of a disk. Although the octupole electrostatic deflector can be constructed by assembling eight ⅛ electrode sectors, the octupole electrostatic deflector is formed by the following method to assemble the same in a high accuracy and to reduce assembling costs. An electron beam passing aperture is formed in an insulating disk of several millimeters in thickness. Insulating slits are formed in the insulating disk so as to extend radially from the electron beam passing aperture. Eight electrostatic deflecting electrodes 31 to 38 are formed by coating the front and the back surface of a part of the disk around the electron beam passing aperture and the side surfaces of the electron beam passing aperture and the insulating slits with a conductive material by a vapor deposition process or a plating process. Voltages to be applied to the electrodes 31 to 38 are regulated in proportion to the cosine of the angle θ between an electron beam deflecting direction and the position of the electrodes 31 to 38 to deflect an electron beam by a desired distance in a desired direction. An angular displacement Δφ corresponds to the angle of rotation of a primary electron beam caused by a lens magnetic field created in a space between the upper image shifting deflector 20 and the lower image shifting deflector 30. FIGS. 7 and 8 show lower image shifting deflectors 30 suitable for use in combination with an objective 10 having a principal plane on a level above the bottom surface of the objective 10, i.e., a level in the electron beam passing aperture of the objective 10. The lower image shifting deflector 30 shown in FIG. 7 has a funnel-shaped insulating base plate and the base plate is inserted from above the objective 10 in the electron beam passing aperture. A head part of the insulating base plate is divided into eight divisions and coated with a conductive material by the foregoing method. A shielding electrode 39 prevents the charging effect of an insulating part of the lower image shifting deflector 30 and the creation of a deflecting electric field in a region not affected by an objective magnetic field. The lower image shifting deflector 30 shown in FIG. 8 is inserted from below an objective 10 in an electron beam passing aperture formed in the objective 10. The insulating base plate of the lower image shifting deflector 30 has a flat, annular peripheral part and a cylindrical central part extending from a central portion of the peripheral part. The peripheral part and the central part of the base plate are divided into eight divisions, and coated with a conductive material by the foregoing method. In some cases, the cylindrical part is extended not only toward the objective 10 but also toward the specimen 13 according to the distribution of the objective magnetic field. A deflection control power supply 40 applies a voltage to the lower image shifting deflector 30 relative to a ground potential to deflect an electron beam. The surface electric field of the specimen 13 can be adjusted by off-setting a reference potential by a power supply 49, which is effective in charging and adjusting surface potential for the observation of an insulating specimen. The lower image shifting deflector 30 can be easily installed also when the SEM is provided with a height measuring device that measures the height of the specimen 13 by using a laser beam. A laser light source 51 projects a laser beam 52 obliquely to the specimen 13. The laser beam 52 reflected by the specimen 13 is detected by a position sensor 53. The position of the reflected laser beam 52 on the position sensor 53 varies according to the height of the specimen 13. The variation of the height of the specimen 13 is determined through the measurement of the variation of the position of the reflected laser beam 52 on the position sensor 53. The lower image shifting deflector 30, i.e., the octupole electrostatic deflector, can be easily disposed so that the laser beam 52 and the reflected laser beam 52 may pass the insulating slits of the lower image shifting deflector 30. In the SEM in this embodiment, the upper image shifting deflector deflects the electron beam off the optical axis taking the Lorentz force of the objective into consideration, and the lower image shifting deflector executes electrostatic deflection of the electron beam so that the axial deviation of the electron beam by the Lorentz force may be suppressed and the electron beam travels straight toward the specimen. Therefore, off-axis aberration due to a large angle of deflection of the electron beam can be suppressed and resolution can be improved. Since an electrostatic deflector is used as the lower image shifting deflector disposed between the lower magnetic pole of the objective of an open lower magnetic pole type and the specimen, the electron beam can be deflected without increasing the short focal length of the objective. The SEM in this embodiment reduces aberration by employing the objective having a short focal length and reduces off-axial aberration by controlling the angle of deflection for image shifting. FIG. 11 is a view of assistance in explaining a SEM in a fourth embodiment according to the present invention. FIG. 11 shows typically a deflection range 101 for image shifting. The SEM as shown in FIG. 1 is provided with a controller, not shown. The controller sets values of parameters including observation positions and magnification, and controls a mirror included in the SEM on the basis of the set values. A SEM for inspecting semiconductor wafers needs to observe a plurality of points on the surface of a semiconductor wafer. Recipe specifying conditions for the observation of the plurality of points are set beforehand or the recipe is set manually. A plurality of high-magnification observation regions 103 can be set in the deflection range 101 in which the electron beam is deflected by image shifting deflectors 20 and 30. As mentioned above, most secondary electrons from a central point 102 of the deflection range 101, i.e., a point corresponding to a primary electron beam 1, pass through the aperture of a conversion electrode 16, and an image of a specimen, having irregular brightness is formed. It is desirable to provide the SEM with a sequence that inhibits setting of a high-magnification observation region 103 at the center 102 of the deflection range 101. For example, when the SEM is provided with a sequence that sets a desired high-magnification observation region among low-magnification images, the foregoing problem can be prevented by making the setting of a high-magnification observation region 103 at the center 102 of the deflection range impossible or by generating a warning requesting moving the stage and resetting the high-magnification observation region 103. When the SEM is provided with recipe specifying operations for multiple-point observation, it is desirable to specify conditions for controlling the stage so that the high-magnification observation region 102 may not be located at the center of the deflection range, to generate a warning when conditions are set so as to locate the high-magnification observation region 102 at the center of the deflection region or to inhibit the setting of such conditions. The operator is able to carry out operations for setting the high-magnification region at a position other than the center of the deflection range 101 without depending on warnings or the like when a typical image of the deflection region 101 of the image shifting deflectors as shown in FIG. 11 is displayed on the screen of a display, not shown. The SEM in this embodiment is able to form an image of a high resolution and to measure dimensions in a high accuracy even if the distance of image shifting is great. In particular, in semiconductor device fabricating processes that process a wafer having a large area and provided with very minute circuit elements, the SEM is able to achieve precision inspection at a high throughput. |
|
summary | ||
summary | ||
abstract | Techniques for forming shallow junctions are disclosed. In one particular exemplary embodiment, the techniques may be realized as a method for forming shallow junctions. The method may comprise generating an ion beam comprising molecular ions based on one or more materials selected from a group consisting of: digermane (Ge2H6), germanium nitride (Ge3N4), germanium-fluorine compounds (GFn, wherein n=1, 2, or 3), and other germanium-containing compounds. The method may also comprise causing the ion beam to impact a semiconductor wafer. |
|
052992519 | claims | 1. An exposure apparatus comprising: a mask holder having means to move a mask held thereon; a target holder having means to move a target held thereon; an alignment system including at least two bases each being linearly movable along an axis parallel to the mask, wherein each base has an interference block and a front portion that is narrower than a rear portion of that base, and wherein each base carries an alignment sub-system or viewing an alignment mark on the mask to enable the mask holder and target holder to be steered to a proximal exposure position, characterized in that all axes intersect at one point and lie in one plane, each interference block has a blocking part which can be hit by another blocking part, a size of each blocking part is larger than a size of one of the narrower front portions corresponding to that blocking part, a shape of each blocking part is the same as the narrower front portion corresponding to that blocking part, and a direction of each blocking part is the same as one of the narrower front portions so that each base can engage with another base or another interference block to prevent collision of the alignment sub-systems. a light source; mask holding means for holding a mask; target holding means for holding a target in optical alignment with the light source and the mask; and an alignment system comprising a plurality of movable bases, wherein: 2. The exposure apparatus according to claim 1, wherein at least one of the interference blocks is displaceably mounted on one of the bases, a sensor is arranged to detect displacement of the interference blocks, and a means for stopping movement of the bases in response to the sensor is provided. 3. The exposure apparatus according to claim 2, wherein the sensor is arranged to detect displacement of at least one of the interference blocks in two directions. 4. The exposure apparatus according to claim 2, wherein the means for stopping movement of the bases allows at least one of the bases to move in a direction different than the direction which causes the sensor to be actuated. 5. The exposure apparatus according to any of the preceding claims, wherein each alignment sub-system is an optical assembly. 6. The exposure apparatus according to claim 5, wherein each optical assembly includes a prism. 7. The exposure apparatus according to claim 1, wherein movement of each base is detected by a sensing means. 8. The exposure apparatus according to claim 2, further comprising a limit sensor for detecting movement of at least one of the bases and for generating a movement signal, and means for receiving the signal from the limit sensor and generating an output signal to control the movement of the at least one base. 9. An exposure apparatus comprising: 10. The exposure apparatus of claim 9, wherein at least one of the interference blocks is rotatably mounted on one of the bases and the exposure apparatus comprises means for detecting displacement of each rotatable interference block and means for stopping movement of the bases in response to the detecting means. 11. The exposure apparatus according to claim 10, wherein each detecting means detects displacement of one of the rotatable interference blocks in a plurality of directions. 12. An exposure apparatus according to claim 9, wherein each alignment sub-system is an optical assembly. 13. An exposure apparatus according to claim 12, wherein each optical assembly includes a prism. |
claims | 1. An X-ray computed tomography apparatus comprising: an X-ray tube for irradiating an object with X-rays; a detector for detecting X-rays transmitted through the object; a noncontact type signal transmission device for transmitting a signal output from said detector; a unit for generating image data on the basis of the signal transmitted through said noncontact type signal transmission device; and a unit for displaying the image data, wherein said noncontact type signal transmission device comprises: a stationary portion; a rotating ring disposed inside said stationary portion; a plurality of light-emitting devices discretely arranged on an outer surface of said rotating ring; a plurality of light-receiving devices discretely arranged on an inner surface of said stationary portion; and a plurality of beam condensing devices arranged between said light-emitting devices and said light-receiving devices and having the function of condensing light in a direction parallel to a rotation axis of the rotating ring. |
|
abstract | A system and method for filling, dewatering and sealing high integrity containers for storing high level radioactive debris has a support structure for receiving a container and a movable hood supported over the support structure. The movable hood is movable between a filling/dewatering position, an intermediate position, and a sealing position. Fill and dewatering lines extend through the hood and have flexible lower portions with connectors for interfacing with the container to be filled. The flexible lower portions are movable into and out of engagement with respective connectors on the container when the hood is in the filling/dewatering position. A plurality of valves are provided to isolate the fill and dewatering lines to minimize release of radioactive debris during connector mating and demating operations. A straw extends through the hood for removing water from an upper volume of the container when the hood is in the intermediate position. A closing structure is supported by the hood for lowering a cover into engagement with the container and fastening the cover to the container when the hood is in the sealing position. A vent line is provided for purging gas from the hood. A vibrator is positioned within the support structure for engaging and vibrating the container to facilitate filling and dewatering operations. A scale is positioned between the container and the support structure for determining when the container is full. |
|
051805464 | description | DESCRIPTION OF THE PREFERRED EMBODIMENTS A power generation system 100 includes a reactor system 101, a turbine 104, a generator 105, and a fluid handling section 106, as shown in FIG. 1. Reactor system 101 includes a reactor vessel 102 and its internals, e.g., a core 108, a chimney 110, and a dryer 112. Vessel 102 has a cylindrical wall 114 and a semispherical top 116 and a semispherical bottom 118. Vessel 102 has a nominal water level 120 to which it is filled normally for operation. Reactor core 108 and chimney 110 are below nominal water level 120 so that they are primarily immersed in water; dryer 112 is above level 120 so it is primarily immersed in steam during reactor operation. A downcomer 122 extends between vessel wall 114 and chimney 110 and core 108. Twenty-four tubes 124 are arranged in a circular series within vessel 102, which arrangement is conveyed in FIG. 2. Each tube includes an entrance 126 within downcomer 122 and an exit 128 well above nominal water level 120 and downcomer 122, as shown in FIG. 1. Each tube defines a channel 130 therewithin for the escape of steam from downcomer 122 to the vessel space above nominal water level 120. Each tube 124 comprises a narrower upper section 132 and a wider lower section 134. Upper section 132 is narrow to minimally disturb fluid flow toward dryer 112. Lower section 134 is wider to provide disruption of the downward motion of fluid in downcomer 122 to enable steam to escape. In addition, the larger lower sections 134 provide wide sloped entrances 126 for capturing steam in the manner indicated by arrows 136. Steam exiting tubes 124 is indicated by arrows 138. Sections 132 and 134 are stainless steel and are fitted together with a conventional pipe joint. Tubes 124 are tack-welded to inner wall 114. Chimney 110 includes forty-five chimney sections constituting four groups, a central first group 201, a second group 202, a third group 203 and a peripheral fourth group 204, as indicated in FIG. 2. Most of the chimney sections have square cross-sections. Fourth group 204 includes some half-size sections. The half-size sections allow chimney 110 to conform to wall 114 of vessel 102. First group 201 includes a single section which is taller than the remaining forty-four sections, as indicated in FIG. 1. The height of group 201 defines a first group height or extension, which also defines the chimney height and the uppermost reach of downcomer 122. Second group 202 includes eight sections, radially outward and adjacent to the single section of first group 201. These eight second group sections share a common second group height less than the first group height but greater than the heights of the remaining more peripheral sections. Third group 203 includes sixteen sections. These third group sections are radially outward from and adjacent to second group 202 and share a common third group height which is less than the second group height. Fourth group 204 contains twenty sections, which are radially outward from and adjacent to third group 203. The sections of fourth group 204 share a common fourth group height less than the third group height. Since each group has a different height, chimney 110 is said to be staggered. As indicated in FIG. 1, the difference between the second group height and the first group height is less than the difference between the third group height and the second group height. Likewise, the difference between the third group height and the second group height is less than the difference between the fourth group height and the third group height. In other words, the stagger of chimney 110 becomes steeper away from its axis. Relative to an unstaggered chimney with the same height as group 201, staggered chimney 110 provides additional recirculation volume in downcomer 122 above outer chimney group 204. This additional volume at the top of downcomer 122 increases the time available for steam/water separation, reducing carryunder, and accommodates tubes 124, further reducing carryunder. Thus, staggered chimney configuration not only provides for reduced carryunder in its own right, but also makes the incorporation of release tubes 124 more favorable. Thus, there is a synergy between the use of staggered chimney 110 and tubes 124. Specific dimensions for the illustrated embodiment are approximately as follows. Upper sections 132 are about 10 cm in diameter, while lower sections 134 are about 20 cm in diameter. Each tube 124 is about 300 cm long. The chimney heights are 300 cm, 290 cm, 265 cm and 225 cm, respectively, for groups 201-204. The height differences between the first and second group is 10 cm, between the second and third group is 25 cm, and between the third and fourth group is 40 cm. This corresponds to a stagger which becomes progressively steeper toward the periphery. Square sections are 25 cm on each side and group 204 is 175 cm from side to opposing side. Vessel 102 is about 12 meters high and 2.8 meters in diameter. Core 108 is 190 cm high, the top 10 cm being inactive, and about 180 cm from side to opposing side. Core 108 has an octagonal cross section and its base is 2.4 meters above the center of vessel bottom 118. These dimensions correspond to those of the 60 megawatt reactor at Dodewaard, Holland. Reactor vessel 102 can be of carbon steel inside a stainless steel cladding, while chimney 110 can be of stainless steel. Generally, circulation within vessel 102 proceeds with water flowing up through core 108, which converts water to steam. The heated fluid flows up through chimney 110 and forces water above chimney 110 radially outward toward cylindrical wall 114. The water flows downward through downcomer 122. The water then flows below core 108, and upward again through core 108. Steam from chimney 110 proceeds upward past nominal water level 120, through dryer 112, out steam nozzle 142, and along steam line 144 to turbine 104. Turbine 104 is driven by the steam and, in turn, drives generator 105 to provide electricity. Steam and condensation from turbine 104 proceed along fluid path 146 to fluid handling section 106. Fluid handling section 106 performs a variety of conventional functions including collection of condensation, preheating of the return water, and pumping of return water along to feedwater line 148 feedwater sparger 150 in vessel 102. Feedwater sparger 150 is a toroid which includes a multitude of horizontally directed nozzles through which feedwater enters the recirculation fluid, quenching the carryunder. The returned water replenishes water from vessel 102 which has been converted to steam and output to turbine 104. In a reactor system with a conventional, unstaggered, chimney, water displaced by the output of more central sections quickly sweeps fluid exiting a peripheral chimney section into the downflow between the chimney and the vessel wall. For this reason, there is little time for steam from a peripheral section to escape the recirculating flow, resulting in significant carryunder. Of course, there is also less room for incorporation of release channels. In addition, an unstaggered chimney leaves little volume for flow separation for any of the sections. Thus, even more central sections contribute significant carryunder. As is apparent from FIG. 1, staggering provides greater volume for steam to separate from the recirculating water flow: all the space between the tops of groups 202-204 and the level defined by the top of central group 201 is added to the volume available for separation. Furthermore, the flows from the different groups are largely decoupled. Note that the flow from outermost group 204 can proceed upward a considerable distance before being swept radially outward by the combined flow of radially inward groups 201, 202, and 203. This extra upward clearance translates into critical separation time for peripheral group 204. The relatively steep step between the two most peripheral groups 203 and 204 accentuates this advantage. In addition, the staggering provides decoupling and additional separation time for second and third groups 202 and 203. Furthermore, the flow from central group 201 has additional separation time due to the greater total volume outside the chimney. In a complementary fashion, staggering reduces carryover. Since there is more height available between the top of group 204 and water level 120, there is more separation time available for water to separate from the steam flow toward top 116 of vessel 102. This applies to a lesser but significant extent, to the sections of intermediate groups 202 and 203. Further reduction of carryover can be accomplished by using a dryer which is elevation-staggered in a manner complementary to the chimney 110. Dryer 112 includes three annular elements 161, 162, and 163. Central dryer element 161 is disposed higher than intermediate dryer element 162, that, in turn is disposed higher than peripheral dryer element 163. This contrasts with a conventional arrangement in which dryer elements are arranged like a disk so that they are all at the same height within vessel 102. The illustrated staggered dryer 112 takes advantage of the otherwise wasted space defined by semispherical top 116. The advantage is most pronounced for central dryer element 161. Note that this dryer element 161 is the one most directly over central group 201, which is also the group provided the least carryover advantage by the staggering of chimney 110. In other words, while staggering chimney 110 does not add distance between the top of group 201 and water level 120, staggered dryer 112 does add distance between water level 120 and the dryer element most directly above group 201. The staggering of dryer 112 also provides benefits due to the higher position of intermediate dryer element 162. Peripheral dryer element 163 is at the height of a conventional dryer, but is most directly over the two peripheral groups 203 and 204, which have the least need for additional separation space above water level 120. Thus, staggered dryer 112 enhances the separation of water from the steam output and distributes this enhancement to provide separation where it is needed most. The novel chimney geometry also improves the distribution of heat transfer from reactor core 108. Being a conventional core, core 108 is generating more power in its center and less power toward its periphery. Optimal heat removal would require heat to be removed faster from the core center and more slowly from the core periphery. This occurs to some extent in a conventional natural circulation boiling water reactor due to the greater heat flux at the core center between core and water. However, this temperature differential effect is not sufficient to provide optimal heat transfer distribution through the core. The present configuration more closely approaches optimal heat transfer by forcing water faster through the core center. For example, since group 201 is higher than other sections, it supports a taller column of steam. The taller column of steam results in a greater pressure differential between the fluid through the core and chimney and the water in the downcomer. The greater pressure differential results in a faster fluid flow through central group 201 and the core center directly below. On the other hand, sections of peripheral group 204 support relatively short steam columns. This results in smaller pressure differentials and slower fluid flow through peripheral chimney sections and peripheral core regions below. Thus flow differences supplement the differences between density differentials among groups 201-204 to enhance the transfer of heat from core 108. Furthermore, reduced carryunder also enhances the ability of the recirculating water to remove heat from the core. Thus, the provision of channels 124, in conjunction with the stagger chimney configuration, reduces carryunder, yielding improved system efficiency. Reduced carryunder results in smaller core voids, and, thus, greater flow stability and greater margins for safety. These advantages are obtainable without additional pumps, control loops or other items which might add to system complexity or diminish the inherent safety of the system. The present invention provides a range of embodiments not described above. The release channel can be provided by a series of tubes, as in the preferred embodiment, or by a shroud or lining spaced from the vessel wall. The shroud can provide a single release channel or can be sectioned to provide multiple channels. The release structure can be welded or otherwise attached to the wall. Alternatively, the tubes can be mounted together on a frame which is in turn attached to the vessel wall. This later arrangement can provide more ready access to the vessel internals for maintenance. Different dimensions, materials, and power capabilities are provided for. It is not necessary that the reactor be a nuclear reactor or be used for generating electricity. The core can used fission, fusion, or other process for generating heat. Heat from the reactor can be used for some other purpose without an intermediate conversion in form. Coolants in addition to or other than water can be used. Steam or vapor used to transfer heat from a vessel can be recollected and returned to replenish fluid in the vessel. Alternatively, replenishment can be partially or completed effected by a separate fluid source. The invention can be practiced with or without a staggered dryer and with or without a staggered chimney. The reactor vessel can have different geometries, for example, the top and bottom need not be semispherical and the diameter of the vessel wall need not be constant over its height. These and other modifications to and variations upon the described embodiments are provided for by the present invention, the scope of which is limited only by the following claims. |
abstract | A radiation imaging apparatus is provided. The radiation imaging apparatus includes a radiation source configured to emit radiation from a first focal point, a plurality of radiation detecting elements disposed opposite to the radiation source and arranged in a channel direction, a plurality of collimator plates provided along the channel direction so as to separate the radiation detecting elements, the collimator plates including radiation absorption members at surfaces of at least one first collimator plate located on a first end side and at least one second collimator plate located on a second end side such that radiation shielding effects of the first and second collimator plates become substantially equivalent when the surfaces of the first and second collimator plates are located along a radial direction from a second focal point, and a data acquisition unit configured to acquire radiation projection data from the radiation detecting elements. |
|
summary | ||
052689425 | description | DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION As shown in FIG. 1, in a typical nuclear power generating facility 1 (only the pertinent parts are shown), a reactor building 23 contains a reactor vessel 2, which contains a core 3, which comprises numerous elements of nuclear fuel 4, usually in the form of fuel bundles. During power generating operations reactor vessel 2 is closed using top 5. Reactor vessel 2 is positioned within a reactor cavity 6, which is fluidly connected to a spent fuel pool (SFP) 7 during outages. In the facility embodiment shown, the SFP 7 is separated from the reactor cavity by a wall 8, having a closeable opening 9, closeable by a gate (not shown) or other means known in the art so as to isolate the SFP 7 from the reactor cavity 6. Since various embodiments of facilities 1 are possible, the SFP 7 and reactor cavity 6 will be jointly referred to as the "composite fuel pool" 10, which will refer to any point within either the SFP 7 or the reactor cavity 6. An example of an alternate embodiment of the composite fuel pool 10 is one wherein the SFP 7 and reactor cavity 6 are separated by a conduit (not shown) rather than a wall 8. The SFP 7 typically contains fuel racks 11, which support spent fuel bundles which are stored in the SFP 7. During power generating operations, top 5 is closed and primary fluid 12 (normally water) is contained within reactor vessel 2 at an operating level 13 above core 3. The core 3 heats primary fluid 12, generating steam which is used to generate electric power. The extensive piping and additional apparatus used for generating power is not relevant to the instant invention and is thus not shown. The reactor recirc system (RRS) 14 recirculates water within the reactor vessel 2, and is fluidly connected to the residual heat removal (RHR) system 15 during shutdown periods. In the facility embodiment shown in FIG. 1, the RRS 14 includes an "A" loop 16 and a "B" loop 17. Circulation is maintained by recirc pumps 18. Valves 19 provide isolation of the RRS 14 from the RHR system 15. Of course, many different configurations of piping and valves are possible, and vary from facility to facility. The facility 1 may be shut down for various reasons, including total or partial fuel replacement, decontamination of components, or for other reasons. Detailed shutdown procedures are required in order to maintain system safety. In order to remove fuel bundles 4 from the core 3, top 5 is removed and the level of primary fluid 12 is raised to a refueling level 20 within the composite fuel pool 10. Following this step the closeable opening 9 is in an open position, allowing primary fluid 12 to equalize refueling level 20 within both the SFP 7 and reactor cavity 6. Once refueling level 20 is stable, the fuel bundles 4 may be lifted from the core 3 and placed in fuel racks 11. However, the initial decay heat from the fuel bundles 4 must be removed during this procedure. Once the core 3 is shut down, decay heat continues to be generated by the fuel 4. The RHR system 15 is designed to provide heat exchange to cool the primary fluid 12, removing the tremendous initial decay heat generated upon system shutdown. As shown by flow arrows 21, the RHR system 15 cools primary fluid 12 and recirculates the cooled primary fluid 12 back to the reactor vessel 2. As stated above, the prior art method of cooling the primary fluid 12 requires operation of the RHR system 15 for a number of days until the initially large amount of decay heat is removed from the primary fluid 12. The amount of heat removed during RHR system operation can be on the order of 50,000,000 BTU/hr. The RHR system 15 was operated until the fuel bundles 4 were cooled to a point where they could be removed to the SFP 7, where the smaller capacity SFP cooling system 22 would continue to circulate primary fluid from the SFP 7 (see flow arrows 26) and remove the decay heat at a much smaller rate, for example 1,000,000 BTU/hr. The RHR system 15 and SFP cooling system 22 are permanently installed in the facility 1. Due to the permanent nature of the installation, as well as safety, redundancy, licensing and contamination problems, modification of the permanent cooling systems would be impractical and overly expensive. The temporary cooling system 30 provides immediate increased cooling capacity with no additional permanent connections to the facility 1. The invention 30 comprises a primary heat exchange system 31, which includes a primary heat exchange means 32 for transferring heat from primary fluid 12 to a secondary cooling fluid, a primary pump 33, a primary pump suction line 34, a primary pump discharge line 35 and a primary return line 36. Primary fluid 12 is circulated in primary heat exchange system 31, where heat is transferred to a secondary cooling fluid from a secondary heat exchange system 37. All heat exchange equipment, pumps and other components of the invention 30 may be mounted on skids 55 (see FIG. 3) and temporarily located within the facility 1. Due to severe space limitations within facilities 1, components of the invention 30 may be located in various places within a facility 1, as shown in FIG. 2. Due to radioactive particles circulating in the primary heat exchange system 31, it is preferable to locate the primary heat exchange system 31 within the containment of building 23. FIG. 2 shows a building 23 schematically (with walls removed for clarity), with the primary heat exchange system 31 located within the building 23 near a stairwell 24. Stairwell 24 provides an opening for primary pump suction line 34 and primary return line 36. Secondary heat exchange system 37 may be positioned at a point on the exterior of the building 23, such as a roof area 25. In this case, building penetrations 38 will need to be provided for secondary cooling fluid supply line 39 and secondary cooling fluid return line 40. Alternately, secondary heat exchange system 37 may also be positioned at a point on the interior of the building 23. A more detailed schematic of a preferred embodiment of the invention 30 is shown in FIG. 3. As can be seen, the system 30 is provided with some redundancy in order to assure adequate heat exchange capacity. Thus, two primary pumps 33, two primary heat exchangers 41, two secondary pumps 42 and two secondary heat exchange means 43 are provided. One or both of each of these components (if properly sized for the desired heat transfer rate) will adequately function in the system 30. The primary heat exchange means 32 preferably comprises a primary heat exchanger 41. It has been found that a plate-type heat exchanger (such as a Graham Manufacturing Company, Inc. Model No. UFX-51 plate heat exchanger) works well for this application, although other heat exchange means known in the art, such as chillers, may be used. Primary heat exchangers 41 each have a primary inlet 45, a primary outlet 46, a secondary inlet 47 and a secondary outlet 48. Primary inlets 45 are fluidly connected to outlet ends 49 of primary pump discharge line 35, and primary outlets 46 are fluidly connected to inlet ends 50 of primary return line 36. Secondary inlets 47 are fluidly connected to outlet ends 51 of secondary cooling fluid supply line 39, and secondary outlets 48 are fluidly connected to inlet ends 52 of secondary cooling fluid return line 40. For the purposes of this disclosure, the terms "fluidly connected" or "fluidly connectable" refer to the ability for fluid to flow from one element to another element. There may be numerous components, such as piping, valves, pumps, measuring devices, etc. interposed between such elements, which are not necessarily claimed as part of the invention 30 and which are simply part of the fluid connection or potential fluid connection. Primary pumps 33 each have an inlet 53 and an outlet 54. Primary pump suction line 34 has an inlet end 56 removably and fluidly connected to composite fuel pool 10. Both primary pump suction line 34 and primary return line 36 are shown connected to the SFP 7, but may also be connected anywhere in the composite fuel pool 10, depending upon the desired flow dynamics for the particular facility 1 in which the invention 30 is installed. For example primary pump suction line 34 could be connected to the reactor cavity 6 and primary return line 36 could be connected to the SFP 7. Outlet ends 57 of primary pump suction line 34 are fluidly connected to primary pump inlets 53. Inlet ends 58 of primary pump discharge line 35 are fluidly connected to primary pump outlets 54. Thus, primary pumps 33 draw primary fluid 12 from composite fuel pool 10, circulate it through primary heat exchanger 41 and return it through outlet end 59 of primary return line 36, which is removably and fluidly connected to composite fuel pool 10. The invention 30 may include an anti-siphon means 60 for preventing siphoning of primary fluid 12 from composite fuel pool 10 when primary fluid 12 falls below an undesirable level 62. Anti-siphon means 60 is connected to a portion of primary pump suction line 34 which is submersible in composite fuel pool 10, as shown in FIG. 6. Anti-siphon means 60 may take the form of one or more anti-siphon holes 61 in primary pump suction line 34, as shown in FIG. 6. It is also desirable to reduce turbulence from primary fluid 12 reentering composite fuel pool 10 through primary return line 36. This may be accomplished by providing a flow distribution means 63, connected to a portion of primary return line 36 which is submersible in composite fuel pool 10, for distributing return flow of primary fluid 12 to composite fuel pool 10. Flow distribution means 63 may comprise a plurality of flow distribution holes 64 provided in primary return line 36, as shown in FIG. 5. It has been found that one or more vertical rows of holes 64, facing away from wall 65 of composite fuel pool 10 will function adequately. Force from the exiting primary fluid 12 will maintain pipe support 68 in an abutted position against wall 65 for added stability. Of course flow through the end opening 66 of primary return line 36 should be restricted by an orifice plate 67 or other means known in the art in order to force return flow through flow distribution holes 64. The orifice in orifice plate 67 should be approximately the same size as holes 64. Primary fluid 12 normally contains particulate matter which accumulates in the core 3, composite fuel pool 10 and system piping. Since the particulate matter is exposed to the fuel 4, it becomes radioactive and will contaminate primary heat exchange means 32. Therefore, it is preferable that one or more particulate filters 69 be fluidly connected between composite fuel pool 10 and primary heat exchange means 32 (either in primary pump suction line 34 or primary pump discharge line 35). As shown in FIG. 3, it is preferable that particulate filters 69 be located in primary pump discharge line 35 between primary pumps 33 and primary heat exchange means 32. Particulate filters 69 may take any form known in the art, and preferably comprise remotely or semi-remotely removable filter cartridges, such as Filterite pleated polyethylene or cloth wound filter cartridges. An additional advantage to utilizing particulate filters 69 is the simultaneous filtering and resulting decontamination of SFP 7 and/or reactor cavity 6 during operation of the temporary cooling system 30, saving further time and resulting facility outage normally associated with separate and independent filtration operations. Similarly, it may also be preferable to conduct simultaneous cooling, filtration and demineralization of primary fluid 12. A demineralization means 70 is thus provided for removing undesirable minerals from primary fluid 12. Demineralization means 70 is fluidly connected between composite fuel pool 10 and primary heat exchange means 32 (either in primary pump suction line 34 or primary pump discharge line 35), preferably between particulate filters 69 and primary heat exchange means 32, as shown in FIG. 3. Demineralization means 70 may take any form known in the art, such as the ion exchange vessel 71 shown in FIG. 4. The vessel 71 is provided with a resin fill inlet 72, a process inlet pipe 73, a process outlet pipe 74, a sluice outlet pipe 75, inlet screen 76 and outlet screens 77. The vessel 71 is filled with ion exchange resin 78, such as Purolite ion exchange bead resin. Inlet pipe 73 and outlet pipe 74 are fluidly connected to the temporary cooling system 30 such that primary fluid 12 flows through inlet pipe 73 and inlet screen 76, then downward through resin 78 where it is demineralized, then out through outlet screens 77 and outlet pipe 74 and back to the temporary cooling system 30. Sluice outlet pipe 75 is used to remove spent resin 78. Any source of secondary cooling fluid 81 (such as water or freon) may be supplied to primary heat exchange means 32. As shown in FIG. 3, such a source may comprise a secondary heat exchange system 37. Secondary heat exchange system 37 includes secondary heat exchange means 43 for cooling secondary cooling fluid 81, which may comprise any suitable secondary heat exchangers 44, such as cooling towers. It was found that Baltimore Aircoil Company Series V cooling towers, Model VT1-N346-Q worked well in a test application. Circulation in secondary heat exchange system may be provided by secondary pumps 42, or other means, such as gravity. Secondary heat exchangers 44 are provided with secondary cooling fluid inlets 79, fluidly connected to outlet ends 82 of secondary cooling fluid return line 40, and secondary cooling fluid outlets 80, fluidly connected to inlet ends 83 of secondary cooling fluid supply line 39. Secondary pumps 42 may be fluidly connected in secondary cooling fluid supply line 39, as shown, or elsewhere in the circuit as necessary, depending upon the location and type of secondary heat exchange means 32 employed. As shown in FIG. 3, the substantial portion of secondary heat exchange system 37 may be located outside of containment walls 84. Therefore, it is desirable that potentially radioactive primary fluid 12 be prohibited from entering the secondary heat exchange system 37. A regulator means 85 is thus provided for maintaining an operating pressure of secondary cooling fluid 81 higher than the operating pressure of primary fluid 12. One embodiment of regulator means 85 is a backpressure valve 86, fluidly connected in secondary fluid return line 40 between primary heat exchange means 32 and secondary heat exchange means 43. Backpressure valve 86 may be set to maintain an upstream pressure greater than that of the primary heat exchange system 31 such that, if a leak occurs in primary heat exchanger 41, secondary fluid 81 will flow into primary heat exchange system 31, maintaining primary fluid 12 within the reactor building 23. Backpressure valve 86 may be of the type manufactured by the Ames Company, Model A820. Regulator means 85 may also include a system shutdown feature such as differential pressure transmitter 89 which will shut down and isolate both the primary and secondary heat exchange systems if the pressure in secondary heat exchange system 37 is not greater than the pressure in primary heat exchange system 31. Operation of the system 30 may be observed in FIGS. 1 and 3. Primary fluid circulation is shown by flow arrows 87, and secondary cooling fluid circulation is shown by flow arrows 88. Initially, top 5 of reactor vessel is removed and the level of primary fluid 12 is raised from operating level 13 to refueling level 20, at least partially filling reactor cavity 6 and/or SFP 7 with primary fluid 12. The temporary cooling system 30, which has been temporarily positioned in the facility 1 on skids 55, is then operated as a partial or full off-load of fuel bundles 4 takes place. Primary fluid 12 is circulated within primary heat exchange system 31, transferring heat from primary fluid 12 at a faster rate than that attainable by the SFP cooling system 22. Secondary cooling fluid 81 is circulated in secondary heat exchange system 37, removing the transferred heat from the secondary cooling fluid 81. During the cooling of primary fluid 12, particulate matter is filtered by particulate filters 69, and demineralization is accomplished by demineralization means 70. Circulation is maintained in order to maintain a desired temperature of primary fluid 12 during the outage. In a test application, primary fluid 12 was circulated at approximately 3,000 gallons per minute in primary heat exchange system 31, with primary heat exchangers 41 maintaining primary fluid 12 at a safe temperature during a full core off-load. The operation of the temporary cooling system 30 eliminated seventeen days of pre-cooling by the RHR system 15, saving millions of dollars in replacement power costs without the expense or complication of additional permanently installed equipment. Other embodiments of the invention will occur to those skilled in the art, and are intended to be included within the scope and spirit of the following claims. |
claims | 1. A multi-column electron beam exposure apparatus comprising:a plurality of column cells;a wafer stage including an electron-beam-property detecting unit for measuring an electron beam property; anda controller for measuring beam properties of electron beams used in all the column cells by using the electron-beam-property detecting unit, and for adjusting the electron beams of the respective column cells so that the properties of the electron beams used in the column cells may be approximately identical to one another. 2. The multi-column electron beam exposure apparatus according to claim 1, wherein the electron beam property is any of a beam position, a beam intensity, and a beam shape of the electron beam to be emitted. 3. The multi-column electron beam exposure apparatus according to claim 1, wherein the electron-beam-property detecting unit is any one of a chip for calibration with a reference mark formed thereon and a Faraday cup. 4. The multi-column electron beam exposure apparatus according to claim 1, whereinthe electron-beam-property detecting unit for measuring the electron beam property of a same kind is singly provided on an edge portion of the wafer stage, andusing one column cell among the plurality of column cells as a reference column cell, and using an electron beam of the reference column cell as a reference beam, the controller moves the electron-beam-property detecting unit to a predetermined position below each of all the column cells to measure the beam properties of the electron beams of the column cells, and adjusts the electron beam of each column cell other than the reference column cell so that a difference between the property of the electron beam used in the column cell and the property of the reference beam becomes less than a predetermined value. 5. The multi-column electron beam exposure apparatus according to claim 1, comprising:n electron-beam-property detecting units Mk (1≦k≦n) provided on an edge portion of the wafer stage for measuring the electron beam property of the same kind;n column cell groups Gk (1≦k≦n) each including a plurality of column cells; andat least one column cell common to the column cell group Gk and a column cell group Gk+1, whereinusing one column cell among the plurality of column cells as the reference column cell, and using the electron-beam-property detecting unit Ml, the controller measures a property of an electron beam used in each column cell within a column cell group G1 including the reference column cell, and adjusts a difference between the property of the electron beam used in each column cell and the beam property of the electron beam used in the reference column cell so that the difference becomes less than a predetermined value, andthe controller measures a beam property of the electron beam used in each column cell of the column cell group Gk+1(1 ≦k≦n−1) by using an electron-beam-property detecting unit Mk+1(1≦k≦n−1), and adjusts the beam property on the basis of the electron beam property of the common column cell. 6. The multi-column electron beam exposure apparatus according to claim 5, wherein the controller moves the electron-beam-property detecting units Mk to a predetermined position below each column cell of each of the column cell groups Gk, and measures the beam property. 7. The multi-column electron beam exposure apparatus according to claim 1, wherein the controller adjusts the electron beam property before an exposing process is performed on a wafer which is placed on the wafer stage. 8. The multi-column electron beam exposure apparatus according to claim 1, wherein the controller adjusts the electron beam property at a predetermined time during an exposing process on a specimen being placed on the wafer stage. 9. An exposure method performed by a multi-column electron beam exposure apparatus including a plurality of column cells, the method comprising the steps of:selecting a column cell serving as a reference among the plurality of column cells;measuring a beam property of a reference beam by using an electron-beam-property detecting unit for detecting an electron beam property, the reference beam being an electron beam used in the column cell serving as the reference;measuring a beam property of an electron beam of a column cell other than the reference column cell by using the electron-beam-property detecting unit;adjusting a difference between the beam property of the reference beam and the beam property of the electron beam other than the reference beam, to be within a predetermined value; andperforming an exposing process, using the electron beams of all the column cells, the electron beams having beam properties approximately identical to each other. 10. The multi-column electron beam exposure method according to claim 9, wherein the electron beam property is any of a beam position, a beam intensity, and a beam shape of the electron beam to be emitted. 11. The multi-column electron beam exposure method according to claim 9, wherein the electron-beam-property detecting unit is any one of a chip for calibration with a reference mark formed thereon and a Faraday cup. |
|
047568798 | summary | BACKGROUND OF THE INVENTION The present invention relates to nuclear reactors, particularly liquid metal-cooled fast neutron reactors. In such reactors, the core is mounted within a system of vertically axed vessels ensuring the confinement of the appropriate volume of metal, generally liquid sodium. This volume is surmounted by a neutral gas atmosphere and the system of vessels is closed by a slab, provided with passage orifices permitting access to the core within the vessel. These orifices are closed by rotary plugs. The smallest of the rotary plugs is itself provided with an opening closed by a plug for supporting the means making it possible to inspect and check the reactor core, as well as deflect the hot sodium jet leaving the core. These means and the structure maintaining the same form an assembly called the core cover. The latter is suspended on said plug, inclined in the smallest rotary plug, by a suspension structure and the assembly formed by these three structures, i.e. the plug, the suspension elements and the core cover is called "the core cover plug". The invention more particularly relates to such a core cover plug. To illustrate the prior art, a description will be given hereinafter with reference to FIG. 1 of a special embodiment of a nuclear reactor core cover plug as described in French Pat. No. 7,429,543 filed on Aug. 29th 1974 by the Commissariat a l'Energie Atomique and published under No. 2,289,031. In FIG. 1, reference numeral 1 designates a fast neutron nuclear reactor core, which is shown immersed in a liquid metal mass, particularly sodium, which ensures the coring of the reactor. Core 1 is mounted within an inner vessel 2, surrounded by a second, main vessel 3, whose upper part is sealed by a slab 9, which confines the liquid sodium, up to the level indicated at 4, which is surmounted by a covering neutral gas atmosphere 5, generally formed by argon. Vessel 3 is itself surrounded by another vessel, called the safety vessel 6, the system of said vessels with their common vertical axis being arranged within a concrete protection enclosure 7. The latter has a wide opening 8 in its upper part in which is mounted the sealing slab 9. The latter has a central opening 10 for fitting a system with two plugs 11, 12 which, by their mutual rotation, permit access to all points of the core 1. In addition, slab 9 has passages for the fitting of the equipment supported by it, such as pumps and exchangers necessary for the circulation of the sodium. One of each type is diagrammatically shown in FIG. 1, where reference numeral 13 designates a pump and 14 an exchanger. Finally, the core instrumentation is supported by an independent structure, the core cover plug 15, which is itself suspended on the small rotary plug 12. This core cover plug comprises a head plate 16 level with the small rotary plug 12. This plate supports a cylindrical tube or ferrule 17 which, on its lateral faces, has regularly spaced orifices 18. The ends of intermediate spacers 19, 20 bear on ferrule 17, whose lower part is closed by a thick plate constituting the heat shield 23. Within the ferrule 17 pass vertically the sleeve tubes 26 used for the passage of control rods or instrumentation. The construction of the hitherto known core cover plugs for liquid metal-cooled reactors suffer from a certain number of disadvantages. In particular, their great rigidity necessary to withstand earthquakes, is obtained by using very thick structures, which gives them a high thermal inertia. This makes it difficult to absorb the very high transient phenomena resulting from variations in the power conditions producing sudden temperature variations in the hot metal leaving the reactor core. SUMMARY OF THE INVENTION The present invention specifically relates to a core cover plug for a liquid metal-cooled nuclear reactor, whose design makes it possible to obtain, with thin walls, the rigidity necessary to be able to withstand earthquake shocks. This core cover plug has, as a result of the use of said thin walls, a minimum thermal inertia making it possible to accept transient operating conditions leading to significant variations in the temperature of the liquid metal directly leaving the core. This core cover plug of a liquid metal-cooled nuclear reactor comprising in per se known manner a system of vessels sealed by a slab provided with two rotary plugs, said core cover plug being suspended on the small rotary plug, is characterized in that it comprises a structure constituted in part by suspension elements fixed to the lower part of the small rotary plug, and in part by control rod sleeve elements, said two assemblies being joined, at least at a horizontal level, by vertical metal plates forming a honeycomb grid, and a conical deflecting metal plate, positioned directly above the core and fixed to certain sleeve elements by a connection permitting radial sliding. In a first constructional variant of the invention, the suspension elements are control rod sleeves. In a second variant of the invention, the suspension elements are sections having varied shapes, e.g. having a cross or square cross-section. According to another important feature of the invention, the deflecting plate of the nuclear reactor core cover plug according to the invention supports a group of sampling tubes making it possible to sample the liquid metal on leaving the core for locating possible sheath fractures and the position of thermocouples, said group of tubes being rigidified by two other truncated cone-shaped plates which also contribute with the actual deflecting plate to the deflection of the hot sodium jet leaving the core. The nuclear reactor core cover plug according to the invention thus provides a thin walled structure making it possible to withstand high thermal transient conditions and, as a result of its rigidity, to limit the reactions to earthquake shocks. |
abstract | A method for optimizing a binary mask pattern includes determining, by a processor, an evaluation value based on a comparison between a design pattern and a substrate pattern simulated based on the binary mask pattern. The method also includes, based on the evaluation value, using, by the processor, a gradient-based optimization method to generate a first adjusted binary mask pattern. The method also includes determining, by the processor, a first updated evaluation value based on a comparison between the design pattern and a first updated substrate pattern simulated based on the first adjusted binary mask pattern. The method also includes, based on the first updated evaluation value, using, by the processor, a product of a Hessian matrix and an arbitrary vector to generate a second adjusted binary mask pattern. The method also includes simulating, by the processor, a second updated substrate pattern based on the second adjusted binary mask pattern. |
|
summary | ||
summary | ||
abstract | The invention pertains to a direct write lithography system comprising: A converter comprising an array of light controllable electron sources, each field emitter being arranged for converting light into an electron beam, the field emitters having an element distance between each two adjacent field emitters, each field emitter having an activation area; A plurality of individually controllable light sources, each light source arranged for activating one field emitter; Controller means for controlling each light source individually; Focusing means for focusing each electron beam from the field emitters with a diameter smaller than the diameter of a light source on an object plane. |
|
052456412 | abstract | A spent fuel rack for storing fresh fuel assemblies, or spent fuel assemblies removed from a nuclear reactor, which includes a base plate having multiple cells of modular construction welded at their bottom ends to the plate. The cells are formed of L-shaped sections having walls which support neutron absorbing material, and the walls of one cell are common to the adjacent cells. The base plate includes openings primarily for receiving the bottom nozzle of a fuel assembly, but they further serve as access openings for apparatus used for leveling the base plate. There is also means for receiving and locking the engaging mechanism of lifting apparatus which means is wholly within the periphery of the base plate. |
abstract | An X-ray projection exposure apparatus includes a mask chuck, a wafer chuck, an X-ray illuminating system, and an X-ray projection system. The masks chuck holds a reflection X-ray mask having a mask pattern thereon. The wafer chuck holds a wafer onto which the mask pattern is transferred. The X-ray illuminating system illuminates the reflection X-ray mask, held by the mask chuck, with X-rays. The X-ray projection optical system projects the mask pattern of the reflection X-ray mask onto the wafer held by the wafer chuck with a predetermined magnification. The mask chuck includes a mechanism for generating static electricity for attracting and holding the reflection X-ray mask by an electrostatic force. The invention also includes a device manufacturing method using such an X-ray projection exposure apparatus to transfer a mask pattern onto the wafer using the X-ray projection exposure apparatus. |
|
description | This application claims priority to prior Japanese patent application JP 2004-347298, the disclosure of which is incorporated herein by reference. This invention relates to a deflecting method for scanning and a deflector for deflecting a charged particle beam such as an ion beam with scanning. This invention particularly relates to a deflecting method and a deflector suitable for deflecting a charged particle beam with a relatively large current or a charged particle beam with a relatively large diameter. The charged particle beam with the relatively large diameter represents, for example, a charged particle beam having a flattened cross-sectional shape in which its horizontal width is greater than its vertical width. Note that “horizontal” which will hereinafter be referred to represents one axis in a plane in a direction perpendicular to a center axis of a beam trajectory and does not necessarily represent a horizontal axis. Likewise, “vertical” represents one axis in the plane in the direction perpendicular to the center axis of the beam trajectory and does not necessarily represent a perpendicular or vertical axis, and specifically represents the axis that is perpendicular to the foregoing axis of the horizontal direction in the plane in the direction perpendicular to the center axis of the beam trajectory. This invention is suitable for application to an ion implantation method and an ion implantation system but is not limited thereto. Description will be briefly given about a structure of the ion implantation system. In this specification, an ion beam falls under the category of a charged particle beam and the charged particle beam may hereinafter be referred to simply as a “beam”. As is well known, in the ion implantation system, a beam is extracted from an ion source through an extraction electrode. The extracted beam is analyzed by a mass analysis electromagnet device and a mass analysis slit. As a result of the mass analysis, only a necessary ion species is selected. The selected ion is implanted into a substrate such as a silicon wafer. Normally, the ion implantation system is provided with a deflector for deflecting the beam in order to scan the surface of the substrate with the beam. Deflectors of this type include a magnetic deflector and an electrostatic (electrical field) deflector. Description will be briefly given about structures, merits and demerits of the magnetic deflector and the electrostatic deflector. The magnetic deflector comprises an electromagnet composed of at least two magnetic pole pieces confronting each other through a gap defined therebetween and a coil. A current supplied to the coil generates in the gap a magnetic field that deflects the beam. By changing the current supplied to the coil, the beam passing through the gap is magnetically deflected. The magnetic deflector has a merit of facilitating uniform generation and distribution of a magnetic field over a wide region as compared with the electrostatic deflector. However, the magnetic deflector has a demerit that a structure thereof tends to be large and complicated and further the power consumption thereof is large. In addition, the magnetic deflector also has a demerit that the magnetic field tends to leak and, as a scanning frequency increases, it becomes more difficult to generate the magnetic field. Moreover, in the magnetic deflector, there is an instant when a deflection angle of the beam becomes zero (i.e. the beam goes straight on) and, in this instant, the magnetic field disappears. While the magnetic field disappears, secondary electrons neutralizing the beam are dispersed so that a diameter of the beam increases. As a result, the beam diameter differs between when the deflection angle is zero and when the deflection angle is other than zero. On the other hand, the electrostatic deflector comprises at least two opposite electrodes confronting each other through a gap defined therebetween. A scanning voltage is applied across the two opposite electrodes. The scanning voltage generates in the gap an electrical field that deflects a beam passing through the gap. By changing the scanning voltage, the beam passing through the gap is electrostatically deflected (e.g. see JP-A-2003-513419). The electrostatic deflector has a merit that it can be more compact in structure and requires less power consumption as compared with the magnetic deflector. However, the electrostatic deflector has a demerit that a uniform electrical field is difficult to generate and the beam after deflection is inferior in quality as compared with that in the magnetic deflector. Incidentally, in the deflection of the beam, when a beam current is large or the beam has a flattened cross-sectional shape, i.e. a cross-sectional shape that is horizontally elongated, it is difficult for the conventional electrostatic deflector to cope with it and, therefore, improvement in performance of the deflector is essential. Specifically, when a beam having a horizontally elongated cross-sectional shape is deflected in its major-axis direction (horizontal-width direction), it is required that the beam be deflected at substantially the same deflection angle at any portions of the cross-section of the beam. Note that even if variation in deflection angle occurs in the deflection of the beam, it is assumed that no problem is raised when the variation is sufficiently small or can be easily corrected. It is an object of this invention to realize an electrostatic deflector that is practical and compact and that scans a large-diameter or large-current beam without defocus thereof. According to a first aspect of the invention, a beam deflector for scanning is provided. The beam deflector performs deflecting of a charged particle beam having a regular trajectory in a vacuum space to thereby periodically change the trajectory of the charged particle beam. The beam deflector comprises a pair of deflection electrodes disposed so as to confront each inner electrode surface having a symmetrical concave extending in a direction of a beam trajectory. In the beam deflector of the first aspect, it is preferable that a cross-sectional shape of the concave is a substantially circular-arc concave shape or a polygonal concave shape. In the beam deflector of the first aspect, the cross-sectional shape of the concave may change linearly or in steps along a center axis of the beam trajectory. In the beam deflector in the first aspect, it is preferable that inner electrode surfaces in the confronting direction of the pair of deflection electrodes are bent along maximum scan trajectories of a center axis of the beam trajectory so as to be substantially parallel to the maximum scan trajectories. In the beam deflector of the first aspect, it is preferable that the pair of deflection electrodes are applied with ac voltages having the same phase and reverse polarity, ac voltages in the form of triangular waves having the same phase and reverse polarity, or ac voltages approximate to triangular waves having the same phase and reverse polarity. In the beam deflector of the first aspect, the pair of deflection electrodes may be applied with ac voltages having the same values, the same phase, and reverse polarity. In the beam deflector of the first aspect, dc components may be superimposed on the ac voltages. In the beam deflector of the first aspect, each of the pair of deflection electrodes may be formed by a plurality of individual members that are divided in the direction of a center axis of the beam trajectory. According to a second aspect of the invention, an ion implantation system comprising the beam deflector for scanning according to the first aspect is provided. According to a third aspect of the invention, a beam deflecting method for scanning is provided. The beam deflecting method performs, by a beam deflector for scanning, deflecting of a charged particle beam having a regular trajectory in a vacuum space to thereby periodically change the trajectory of the charged particle beam. The beam deflecting method comprises the steps of preparing, as the beam deflector for scanning, a pair of deflection electrodes confronted each inner electrode surface having a symmetrical concave extending in a direction of a center axis of a beam trajectory, and applying a uniform electrical field generated by the pair of deflection electrodes to the charged particle beam passing through a space defined between the pair of deflection electrodes, thereby performing the deflection for scanning. In the beam deflecting method of the third aspect, it is preferable that the pair of deflection electrodes have shapes that form an electrical field so that an electrical field distribution in a beam horizontal-width direction becomes uniform at any positions in a beam advancing direction between the pair of deflection electrodes. According to a fourth aspect of the invention, a beam deflecting method for scanning is provided. The beam deflecting method performs, by beam deflector for scanning, deflecting of a charged particle beam having a regular trajectory in a vacuum space to thereby periodically change the trajectory of the charged particle beam. The beam deflecting method comprises the step of preparing, as the beam deflector for scanning, a pair of deflection electrodes confronted each inner electrode surface having a symmetrical concave extending in a direction of a center axis of a beam trajectory. The beam deflecting method further comprises the step of causing the charged particle beam having an oval cross-sectional shape in which a horizontal width of the oval beam parallel to a confronting direction of the pair of deflection electrodes is greater than a vertical width of the oval beam perpendicular to the confronting direction, and the oval beam being incident upon an inlet side of the pair of deflection electrodes of the beam deflector for scanning. The beam deflecting method still further comprises the step of applying a periodic deflection action for scanning in the confronting direction of the deflection electrodes. In the beam deflecting method of the fourth aspect, it is preferable that an electrical field generated by the pair of deflection electrodes is uniformly distributed so that the charged particle beam having the oval cross-sectional shape is deflected at substantially the same deflection angle at any portions with respect to a cross-section thereof. In the beam deflecting method of the fourth aspect, it is preferable that, in a space between the pair of deflection electrodes, a change in beam profile is made as small as possible and orderly with respect to the deflection angle. According to a fifth aspect of the invention a beam deflecting method for scanning is provided. The beam deflecting method performs deflecting of a charged particle beam having a regular trajectory in a vacuum space to thereby periodically change the trajectory of the charged particle beam. The beam deflecting method comprises the steps of deflecting the charged particle beam for scanning in one scanning direction by the use of a pair of deflection electrodes disposed so as to confront each inner electrode surface having a symmetrical concave extending in a direction of a center axis of a beam trajectory, and mechanically moving a substrate, implanted with the charged particle beam, in a direction perpendicular to the one scanning direction to thereby perform ion implantation. According to a sixth aspect of the invention, an ion implantation method using the beam deflecting method for scanning according to any one of the third to fifth aspects. According to a seventh aspect of the invention, a beam deflector for scanning performs deflecting of a charged particle beam having a regular trajectory in a vacuum space to thereby periodically change the trajectory of the charged particle beam. In the beam deflector of the seventh aspect comprises a pair of deflection electrodes disposed so as to confront each inner electrode surface. The each inner electrode surface has a symmetrical concave extending in a direction of a center axis of a beam trajectory. In order to be applied a uniform electrical field zone by the deflection electrodes to the charged particle beam, an inlet side of the pair of deflection electrodes having wide electrode distance between innermost-side ends of confronting portions, and the electrode distance are set much greater than a horizontal width of the incident charged particle beam. In the beam deflector of the seventh aspect, it is preferable that shield electrodes each having an opening for beam passing are disposed adjacent to the pair of deflection electrodes on upstream and downstream sides thereof, respectively. In the beam deflector of the seventh aspect, the shield electrodes disposed on each of the upstream and downstream sides may have plural electrodes, respectively. In the beam deflector of the seventh aspect, each of the shield electrodes may be independently applied with a fixed or variable voltage. In the beam deflector of the seventh aspect, the single shield electrode may be disposed on each of the upstream and downstream sides of the pair of deflection electrodes and each of the shield electrodes may be grounded. In the beam deflector of the seventh aspect, the two shield electrodes may be disposed on each of the upstream and downstream sides of the pair of deflection electrodes. In this case, one of the two shield electrodes on the upstream side, which is located closer to the pair of deflection electrodes, and one of the two shield electrodes on the downstream side, which is located closer to the pair of deflection electrodes, are applied with a dc voltage of about −1 kV to −2 kV so as to serve as electron suppression electrodes. The other of the two shield electrodes on the upstream side and the other of the two shield electrodes on the downstream side are grounded so as to serve as ground electrodes. In the beam deflector of the seventh aspect, it is preferable that each of the openings of the suppression and ground electrodes is formed into a rectangular shape with a large aspect ratio which is large in a direction of a horizontal beam width while one size larger than a vertical beam width in a direction of the vertical beam width so as to well suppress an electrical field. In the beam deflector of the seventh aspect, the suppression and ground electrodes cause the electrical field to be weak in the direction of the horizontal beam width and have no effect on the trajectory (deflection angle) of the charged particle beam. In the beam deflector of the seventh aspect, the opening of each of the shield electrodes on the upstream and downstream sides is configured such that a width thereof in a direction of a horizontal beam width is sufficiently greater than the horizontal beam width to thereby prevent the charged particle beam from passing near edges of the opening in the direction of the horizontal beam width. In the beam deflector of the seventh aspect, by determining a shape and size of each of the concave of the pair of deflection electrodes so that electrical fields in a direction perpendicular to a beam deflection plane near the shield electrodes and electrical fields in the direction perpendicular to the beam deflection plane within the beam deflector for scanning is canceled each other, consequently focus/defocus and trajectory declination of the charged particle beam in the direction perpendicular to the beam deflection plane before and after passing through the beam deflector is made small. In the beam deflector of the seventh aspect, by causing an electrical field in a direction perpendicular to a beam deflection plane at a center portion in the beam deflector for scanning to be slightly stronger than electrical fields in the other regions, consequently a beam profile after passing through the beam deflector for scanning is made excellent. In the beam deflector of the seventh aspect, each of the pair of deflection electrodes may be formed by a plurality of individual members that are divided in the direction of the center axis of the beam trajectory. According to an eighth aspect of the invention, an ion implantation system comprising the beam deflector for scanning according to the seventh aspect is provided. In the ion implantation system according to the second and the eighth aspects, the pair of deflection electrodes are disposed in a housing having openings for beam passing. The housing is configured to be freely putting on and taking off for a beam line in a midway of the beam line. In the ion implantation system according to the second and the eighth aspects, a rack is arranged in the midway of the beam line. A beam guide box having beam passing openings and being larger than the housing is mounted on the rack. The housing is movable along a rail disposed in the beam guide box so that the housing is allowed to be received into and taken out from the beam guide box. In the ion implantation system according to the second and the eighth aspects, the rail extends in a direction perpendicular to an extending direction of the beam line and a door for allowing the housing to be received into and taken out from the beam guide box is provided on one side of the beam guide box near one end of the rail. In the ion implantation system according to the second and the eighth aspects, the housing is provided with a plurality of terminals having a feedthrough structure for establishing connection between at least the pair of deflection electrodes and a power supply. In the ion implantation system according to the second and the eighth aspects, an outlet connected to an evacuator is provided in the housing. Referring to FIGS. 1A and 1B, description will be given about an embodiment wherein this invention is applied particularly to a single-wafer ion implantation system among those processing systems using charged particle beams. FIG. 1A is a plan view showing a schematic structure of the single-wafer ion implantation system, while FIG. 1B is a side view of FIG. 1A. In FIGS. 1A and 1B, ions generated in an ion source 11 are extracted through an extraction electrode (not illustrated) as an ion beam (hereinafter referred to as a “beam”). The extracted beam is analyzed by a mass analysis electromagnet device 12 so that only a necessary ion species is selected. The beam composed of the selected ion is shaped into a beam having a required cross-sectional shape by a beam shaper 13. The beam shaper 13 is formed by a Q (Quadrupole)-lens and so on. The beam having a regular trajectory and the shaped cross-section is deflected in a direction parallel to the sheet surface of FIG. 1A by a deflector 20 for scanning according to this invention. The deflector 20 has shield electrodes 25 and 26 disposed on the upstream and downstream sides thereof, respectively. The deflector 20 and the shield electrodes 25 and 26 will be described in detail later. The deflected beam is parallelized again by a P (Parallel)-lens 14 so as to be parallel to an axis of a deflection angle of 0 degree. In FIG. 1A, a scan range of the beam 10 by the deflector 20 is indicated by a thick black line and broken lines. The thick black line and the broken lines extending from the deflector 20 can be defined as the maximum scan trajectories, respectively. The beam from the P-lens 14 is sent to an azimuthal energy filter 16 through one or more acceleration/deceleration electrodes 15. The azimuthal energy filter 16 performs analysis about energy of the beam to thereby select only an ion species with a necessary energy. As shown in FIG. 1B, only the selected ion species is deflected slightly downward in the azimuthal energy filter 16. A semiconductor wafer 17 being a to-be-implanted object is irradiated by the beam composed of only the thus selected ion species. The beam that is not implanted to the semiconductor wafer 17 is incident on a beam stopper 18 so that energy thereof is consumed. Normally, the structure from the ion source 11 to a chamber (not illustrated) where the semiconductor wafer 17 is accommodated is called a beam line. A transportation path of the beam is all maintained in a high-vacuum state and sealed from the air. In FIG. 1A, two arrows shown adjacent to the semiconductor wafer 17 represent that the beam is deflected in directions of these arrows. In FIG. 1B, two arrows shown adjacent to the semiconductor wafer 17 represent that the semiconductor wafer 17 is reciprocated in directions of these arrows, i.e. mechanically moved. Specifically, assuming that the beam is reciprocatingly deflected in directions of one axis, the semiconductor wafer 17 is reciprocated in directions perpendicular to such directions of one-axis. FIG. 2 is a perspective view showing a basic structure of the deflector according to the embodiment of this invention. FIG. 3 is a diagram for showing a relationship among x-, y-, and z-axes which will be explained hereinbelow with respect to the deflector according to the embodiment of this invention. The deflector 20 comprises a pair of deflection electrodes 21 and 22 arranged so as to confront each other with the beam interposed therebetween. Note that the arrangement shown in FIG. 2 is only one example. That is, the arrangement of the deflection electrodes 21 and 22 is not limited to the illustrated manner in which the deflection electrodes 21 and 22 are disposed so as to confront each other in the horizontal direction, i.e. in the x-axis direction in this case. For example, the deflection electrodes 21 and 22 may be disposed so as to confront each other in the y-axis direction. The shield electrode 25 and the shield electrode 26 are disposed near the deflection electrodes 21 and 22 on their upstream and downstream sides, respectively. Note that the upstream and downstream shield electrodes 25 and 26 do not necessarily have the same shape. The deflection electrodes 21 and 22 are symmetrical in shape with respect to the z-axis and are disposed so that their inner electrode surfaces on the z-axis side become symmetrical with respect to the z-axis. On the surfaces of the deflection electrodes 21 and 22 on the z-axis side, concaves 21A and 22A each having a substantially circular-arc shape in cross-section are formed so as to each extend in the z-axis direction. As shown in FIG. 3, assuming that an initial beam advances in the z-axis direction and the deflection electrodes 21 and 22 are arranged symmetrically with respect to the y-z plane, the beam 10 is deflected in the z-x plane. The beam 10 has a flattened cross-sectional shape in which the width in the x-axis direction is greater than the width in the y-axis direction. Hereinafter, the width in the y-axis direction may be referred to as a “vertical width”, while the width in the x-axis direction may be referred to as a “horizontal width”. Further, the z-x plane may be referred to as a “beam deflection plane”. The shield electrodes 25 and 26 serve to prevent electrical fields generated by the deflection electrodes 21 and 22 from leaking to the beam trajectory outside the deflector 20. The shield electrodes 25 and 26 have openings 25A and 26A, respectively, and the beam passes through these openings 25A and 26A. FIG. 4A shows electric lines of force and electrical fields generated by conventional deflection electrodes 31 and 32 each having a planar surface on the z-axis side. On the other hand, FIG. 4B shows electric lines of force and electrical fields generated by the deflection electrodes 21 and 22 of this invention having on their surfaces on the z-axis side the concaves 21A and 22A each extending in the z-axis direction and each having the substantially circular-arc shape in cross-section. In FIG. 4B, let a shortest distance L between the confronting surfaces of the deflection electrodes 21 and 22 be defined as a distance between innermost-side ends of both electrode portions. It is assumed that, in each of FIGS. 4A and 4B, a negative voltage −V is applied to the deflection electrode on the right side in the figure and a positive voltage +V is applied to the deflection electrode on the left side in the figure. Further, in each of the figures, lines extending in a leftward/rightward direction represent electric lines of force, lines extending in an upward/downward direction represent equipotential lines, while thick-line arrows represent electrical fields. Hereinbelow, a comparison will be made between the deflection electrodes 31 and 32 of FIG. 4A (referred to as a “conventional type”) and the deflection electrodes 21 and 22 of FIG. 4B (referred to as an “invention type”). At first, x-axis direction electrical fields will be examined. In the conventional type, since the confronting surfaces on the beam side of the deflection electrodes 31 and 32 are planar in shape and the diameter (horizontal width) of the beam is relatively small, it is appropriate to consider that deflection electrical fields (x-axis direction electrical fields) of substantially the same strength are exerted on any cross-sectional portions of the beam. On the other hand, in the invention type, the concaves 21A and 22A are formed on the confronting surfaces on the z-axis side of the deflection electrodes 21 and 22. The concaves 21A and 22A are symmetrical in shape with respect to the z-axis. In this case, electric lines of force are collected near the z-axis and electrical field components in the x-axis direction become nearly uniform near the z-axis. As obvious from FIG. 4A, in the conventional type, electric lines of force largely expand in the y-axis direction so that the electrical field in the x-axis direction (deflection electrical field) becomes the weakest at x=0 while becomes stronger as going leftward or rightward. On the other hand, in the invention type, the directivity of electric lines of force around x=0 changes depending on a radius of each of the concaves 21A and 22A, a depth thereof, the distance L between the deflection electrodes 21 and 22, and so on. From the structural point of view, when the size of each of the concaves 21A and 22A is sufficiently large, the deflection electrical field becomes stronger as approaching x=0, while, as the contribution of the concaves 21A and 22A decreases, the deflection electrical field becomes weaker as approaching x=0. Practically, in order to deflect (bend) a beam having a flattened cross-sectional shape, i.e. having a large horizontal width, uniformly at the same angle, it is preferable that the deflection electrical field be somewhat strengthened at x=0. With respect to the shield electrodes 25 and 26 on the upstream and downstream sides of the deflection electrodes 21 and 22, the width in the x-axis (leftward/rightward) direction of each of the openings 25A and 26A is set sufficiently greater than the horizontal width of the beam so as to prevent the beam from passing near left and right edges of each of the openings 25A and 26A. This is because the electrical field is locally strengthened near the edges so that only a portion of the beam is irregularly bent. Referring now to FIG. 5, y-axis direction electrical fields will be examined. FIG. 5 is a diagram showing y-axis components of electrical fields near the opening of the shield electrode, herein, near the opening 25A of the upstream shield electrode 25. It may be considered that the same applies to the case of the downstream shield electrode 26. The electrical fields in the y-axis direction differ in a region near the shield electrode 25 and in a region sufficiently remote from the shield electrode 25. Accordingly, consideration is made about the electrical fields in the y-axis direction by dividing a region into one near the shield electrode 25 and the other region. Note that when there are a plurality of shield electrodes on each of the upstream and downstream sides of the deflection electrodes, selection is made of the shield electrode that is located closest to the deflection electrodes on each of the upstream and downstream sides thereof. i) Electrical Fields Inside the Deflector 20 Near Shield Electrode It is preferable that the opening 25A of the shield electrode 25 be formed as small as possible to thereby prevent the electrical fields from leaking to the outside of the deflector 20. Accordingly, a vertical width (y-axis direction width) of the opening 25A of the shield electrode 25 is set substantially equal to the vertical width of the beam. However, as shown in FIG. 5, under the influence of the deflection electrodes 21 and 22, relatively strong electrical fields are generated, although locally, at edges of the opening 25A of the shield electrode 25. Since the opening 25A is relatively narrow, any beam cannot avoid the electrical fields at the upper and lower edges of the opening 25A. The beam is directed from the front side toward the back side of the sheet of FIG. 5, wherein the upstream shield electrode 25 is disposed on the front side of the sheet of FIG. 5 and the pair of deflection electrodes 21 and 22 are disposed behind it. If the structure of the deflection electrodes and the distribution of the electrical fields are substantially symmetrical with respect to the y-axis, the electrical fields directed as shown in FIG. 5 are generated near the opening 25A of the upstream shield electrode 25 in an instant when the positive voltage +V is applied to the left deflection electrode 22 and the negative voltage −V is applied to the right deflection electrode 21. Such electrical fields at the opening 25A of the shield electrode 25 vertically defocus the beam when the beam passes therethrough in a region of x<0 (left side of z-axis), while focus the beam when the beam passes therethrough in a region of 0<x (right side of z-axis). This focus/defocus action is reversed across x=0 on the left and right sides thereof and the magnitude of this action increases as going away from x=0. Similar electrical fields are also generated at the opening 26A of the downstream shield electrode 26 disposed further behind in FIG. 5. The electrical fields at the opening of the shield electrode are strong only near the opening of the shield electrode and disappear in a region slightly away from it. This electrical field distribution is generated under the influence of potentials of the deflection electrodes 21 and 22, and the electrical fields generated by the deflection electrodes 21 and 22 are only extremely strong near those electrodes 21 and 22. Therefore, if slightly distanced from the deflection electrodes 21 and 22, the each directionalities of the electrical field distribution hardly changes even by changing the shape of each of the deflection electrodes 21 and 22. However, the strengths of the electrical fields change. That is, in a region slightly distanced from the deflection electrodes 21 and 22, the electrical fields of the same directionalities are constantly generated regardless of whether the deflection electrodes are of the conventional type or the invention type. ii) Y-Axis Direction (Vertical Direction) Electrical Fields in a Region Inside the Deflector 20 not Near Either of Upstream and Downstream Shield Electrodes In a region inside the deflector 20 and not near either of the upstream and downstream shield electrodes, the electrical fields generated by the deflection electrodes 21 and 22 become dominant. Vertical components of the deflection electrical fields are determined by the shape of each of the concaves 21A and 22A of the deflection electrodes 21 and 22. When the positive voltage +V is applied to the left deflection electrode and the negative voltage −V is applied to the right deflection electrode, the electrical field distribution becomes as shown in FIG. 6A or 6B depending on the presence/absence and shape of the concaves. According to the deflection electrodes 31 and 32 of the conventional type shown in FIG. 6A, electrical fields in the y-axis direction have the same directionality as that of the electrical fields at the opening of the shield electrode in the foregoing item i) to thereby amplify the focus/defocus of the beam in the y-axis direction. The deflection electrodes 21 and 22 of this invention shown in FIG. 6B are formed with the proper concaves 21A and 22A, respectively. In this case, as shown by arrows in FIG. 6C, electrical fields in the y-axis direction remote from the shield electrodes 25 and 26 have opposite directionalities of the electrical field in the y-axis direction near the openings of the shield electrodes in the foregoing item i). Those electrical fields in the vertical direction are much weaker as compared with the electrical fields near the openings of the shield electrodes but an acting distance range thereof is long, so that the effect of focusing and defocusing become substantially equal to each other in the overall deflector 20. By determining the shape and size of each of the concaves 21A and 22A of the deflection electrodes 21 and 22 of this invention so that the effect of the electrical fields in the vertical direction in the foregoing items i) and ii) have substantially the same magnitude to thereby cancel each other, the focus/defocus and trajectory declination of the beam in the vertical direction can be suppressed to a small level before and after passing through the deflector 20. Further, it has been confirmed that when the electrical field (particularly the electrical field in a direction perpendicular to the beam deflection plane) at the deflection electrode center portion (the center portion in the z-axis direction) becomes stronger than the electrical fields in the other regions (reverse mode is predominant), a beam profile after passing through the deflector 20 becomes excellent. Note that the size of each of the concaves 21A and 22A of the deflection electrodes 21 and 22 also affects the leftward/rightward (x-axis direction) beam deflection and thus is optimized by also taking it into account. As described above, the electrical fields having the directionalities achieved by the deflection electrodes of this invention can deflect the beam more uniformly as compared with the conventional type. Now, operation will be described. AC voltages approximate to, phase inverted each other triangular waves, or sawtooth waves, are applied to the two deflection electrodes 21 and 22. The shield electrodes 25 and 26 are provided on the upstream and downstream sides thereof, respectively, i.e. one shield electrode on each of the upstream and downstream sides. Each of the shield electrodes 25 and 26 is grounded. Instead of the ac voltages approximate to phase inverted each other triangular waves or sawtooth waves, use may be made of ac voltages having the same phase and reverse polarity, ac voltages in the form of triangular waves having the same phase and reverse polarity, or as voltages approximate to triangular waves having the same phase and reverse polarity. Alternatively, depending on necessity, use may be made of ac voltages, ac rectangular wave voltages, or ac sine wave voltages having the same values, the same phase, and reverse polarity. DC components may be superimposed on the ac voltages. The scanning frequency (sweep frequency) of the deflection electrodes is set to several tens of Hz to several hundreds of Hz or more and, if circumstances require, may be set to 1 KHz or more. Although the defocus state (gradient in emittance) of the beam passing through the deflector 20 somewhat changes depending on a deflection angle, the change in defocus state can be made relatively small and thus may be ignored depending on a purpose. In that case, the beam can be deflected only by the deflector of this invention without changing the defocus state of the beam. In FIG. 1, the beam shaper 13 formed by the Q-lens and so on is provided as a focusing element for forcibly removing the change in defocus state of the beam. The Q-lens may be of an electromagnet type using quadrupole magnets or an electrical field type using quadrupole electrodes. By operating this focusing element synchronously with the application voltage to the deflector 20, the change in defocus state of the beam can be suppressed to a sufficiently small level regardless of the deflection angle. Since the defocus state of the beam changes substantially in proportion to the deflection angle, it is appropriate that a current (in the case of the electromagnet type Q-lens) or a voltage (in the case of the electrical field type Q-lens) to the focusing element be set proportional to the deflection angle. When there are provided electrodes (P-lens 14 in FIG. 1) for reparallelizing the beam of which the defocus state has been changed by the deflector 20, the change in defocus state is corrected including such reparallelizing electrodes. The shape of each of the deflection electrodes is not limited to that shown in FIG. 2 and various changes may be made thereto. For example, the cross-sectional shape of the concave formed on each deflection electrode is not limited to the substantially circular-arc shape and may be a polygonal shape including a triangular shape, but is preferably as smooth as possible. Further, each concave may have a shape that changes following z-axis coordinates. Moreover, the surfaces of the concaves may be bent so as to be substantially parallel to the maximum scan trajectory (maximum scan angle range), respectively. For example, the surfaces of the two concaves of the two deflection electrodes may form a space therebetween having a shape that widens toward the downstream side. At any rate, the concave can be implemented by a groove. The concave may be implemented by a hollow cylindrical member with a hollow space defined by a cross-sectional shape of circle, polygonal, or the like, by half cutting along a center axis of the hollow cylindrical member. FIGS. 7 to 9 show examples of concaves of deflection electrodes modified on the basis of the foregoing points. FIG. 7 shows an example wherein two deflection electrodes 21 and 22 like those shown in FIG. 2 are disposed so that the distance therebetween increases toward the downstream side. This is based on the viewpoint that the deflection electrodes are not required to be parallel with respect to the z-axis (center axis of the beam trajectory), i.e. the center axis of each concave does not necessarily extend in the z-axis direction. However, it is desirable that the two deflection electrodes 21 and 22 be symmetrical with respect to the z-axis. FIG. 8 shows an example wherein although two deflection electrodes 21 and 22 are disposed in the same manner as in FIG. 2, the radius of the shape of each of concaves 21A-1 and 22A-1 formed on confronting surfaces on the z-axis side of the deflection electrodes 21 and 22, i.e. the radius of a circular-arc cross-sectional shape of each concave, increases toward the downstream side. This is based on the viewpoint that the cross-section of the concave of each deflection electrode as observed in the z-axis direction may be changed along with z-axis coordinates. However, it is desirable that the two deflection electrodes 21 and 22 be symmetrical with respect to the z-axis. FIG. 9 shows an example wherein each of concaves 21A-2 and 22A-2 formed on confronting surfaces on the z-axis side of two deflection electrodes 21 and 22 has a circular-arc cross-sectional shape in which the depth of the concave changes along with z-axis coordinates so as to be the shallowest at an intermediate portion in the z-axis direction. It is needless to say that, as described above, the cross-sectional shape of each concave may also be a polygonal shape including a triangular shape in any of the examples of FIGS. 7 to 9. Further, the cross-sectional shape of each concave may have a circular-arc portion at a deep portion (bottom portion) and an upper and a lower planar portion as shown in FIG. 10A, or the cross-sectional shape of each concave may have a planar portion at a deep portion (bottom portion) and an upper and a lower circular-arc portion as shown in FIG. 10B. Each of the deflection electrodes 21 and 22 may be integrally formed or may be integrally assembled from a plurality of individual members. FIG. 10C shows one example wherein each deflection electrode is formed by individual members. Each of deflection electrodes 21 and 22 is composed of three individual members divided in the z-axis direction. The individual members are in the form of semicylindrical members 21-1 (22-1), 21-2 (22-2), and 21-3 (22-3) each obtained by splitting a hollow cylindrical member longitudinally. Further, the semicylindrical members 21-2 (22-2) and 21-3 (22-3) are formed so as to provide a shape that expands toward the downstream side at two-step angles. At upper and lower portions of the semicylindrical members 21-1 (22-1), 21-2 (22-2), and 21-3 (22-3), there are provided base portions 21-5 (22-5), 21-6 (22-6), and 21-7 (22-7) (only the lower side is illustrated) for integrating those semicylindrical members. The base portions are integrated together by the use of joining members such as bolts. On the other hand, with respect to the shield electrode, it is preferable that the potential can be changed freely. In consideration of focus of the beam and so on, a plurality of shield electrodes may be provided on at least one of the upstream and downstream sides. Alternatively, it may be configured such that two shield electrodes are provided on each of the upstream and downstream sides, the electrode located closer to the deflection electrodes is applied with a dc voltage of about −1 kV to −2 kV so as to serve as a suppression electrode (electron suppression electrode), while the electrode located farther from the deflection electrodes is grounded so as to serve as a ground electrode. FIGS. 11 and 12 show examples of shield electrodes modified on the basis of the foregoing points. FIG. 11 shows an example wherein, instead of the shield electrodes each having the opening, two electrode plates 27-1 and 27-2 are arranged side by side with a distance defined therebetween so as to form a beam passing opening 27A and likewise two electrode plates 28-1 and 28-2 are arranged side by side with a distance defined therebetween so as to form a beam passing opening 28A. Naturally, the same voltage is applied to the electrode plates 27-1 and 27-2 and the same voltage is also applied to the electrode plates 28-1 and 28-2. FIG. 12 shows another embodiment wherein two shield electrodes 25-1 and 25-2 are disposed on the upstream side of the deflection electrodes 21 and 22 and likewise two shield electrodes 26-1 and 26-2 are disposed on the downstream side thereof. It is preferable that each of the shield electrodes can be independently applied with a voltage. As described above, the electrode located closer to the deflection electrodes may be applied with a dc voltage of about −1 kV to −2 kV so as to serve as a suppression electrode, while the electrode located farther from the deflection electrodes may be grounded so as to serve as a ground electrode. The sizes of openings 25-1A and 25-2A of the shield electrodes 25-1 and 25-2 are preferably equal to each other but may be different from each other and likewise the sizes of openings 26-1A and 26-2A of the shield electrodes 26-1 and 26-2 are preferably equal to each other but may be different from each other. Further, each opening may have a shape, other than the substantially rectangular shape, in which upper and lower edges of the opening are curved so that a center portion of the opening becomes narrower as compared with both end portions thereof. In this case, a vertical defocus/focus action against the beam can be adjusted to some degree. Referring now to FIGS. 13 to 16, description will be given about a mounting manner of the deflector according to this invention. FIG. 13 is a front cross-sectional view, as seen from the downstream side, of a structure wherein the deflector is detachably mounted midway in the beam line. FIG. 14 is a transverse sectional view, as seen from above, of the main part of the structure shown in FIG. 13. FIG. 15 is a perspective view showing a detachable structure for the deflector. FIG. 16 is a perspective view showing the state where the detachable structure for the deflector is on the way to detach the deflector. As shown in FIGS. 14 and 15, the pair of deflection electrodes 21 and 22 and the shield electrodes 25 and 26 mounted near the deflection electrodes 21 and 22 on the upstream and downstream sides thereof are accommodated and disposed within a housing 50. The housing 50 has an upstream wall and a downstream wall. The upstream wall of the housing 50 is formed, at its portion corresponding to the opening 25A of the shield electrode 25, with an upstream opening (not illustrated), while the downstream wall of the housing 50 is formed, at its portion corresponding to the opening 26A of the shield electrode 26, with a downstream opening 52A which is slightly larger than the opening 26A. Connection between the deflection electrodes and a power supply and connection between the shield electrodes and a power supply are realized by a feedthrough structure. Specifically, although not illustrated in FIGS. 15 and 16, the housing 50 has a lateral side where terminals 53 and 54 are provided for connecting the dc power supply to the shield electrodes 25 and 26. On the other hand, the housing 50 has a top side where there are provided terminals 55 and 56 for connecting the power supply to the deflection electrodes 21 and 22 and a terminal 57 for grounding. On two lateral sides, parallel to the center axis of the beam trajectory, of the housing 50 are provided grips 51 which are used for attaching, detaching, or carrying the housing 50. In FIG. 14, symbol 70A-3 denotes an outlet for evacuation carried out for increasing the f degree of vacuum within the deflector and the outlet 70A-3 is connected to an evacuator (not illustrated). As shown in FIG. 13, the housing 50 is slidably disposed in a beam guide box 70 fixedly mounted on a rack 60. The beam guide box 70 is sufficiently larger than the housing 50. At the bottom of the beam guide box 70, two guide rails 71 are disposed for allowing the housing 50 to be slidable therealong. Each guide rail 71 extends in a direction perpendicular to the center axis of the beam trajectory. The beam guide box 70 has a lateral side that can be opened and closed by a door 72 near one end of each guide rail 71. With this arrangement, the housing 50 can be easily taken out from the beam guide box 70 at the time of maintenance and checkout. In order to lock the housing 50 received in the beam guide box 70, locking mechanisms 73 are provided at the other ends of the guide rails 71. The beam guide box 70 has an upstream wall and a downstream wall that are formed, at their portions corresponding to the upstream opening and the downstream opening 52A of the housing 50, with openings 70A-1 and 70A-2, respectively. The opening 70A-1 does not need to be large because the incident beam trajectory hardly changes. On the other hand, the opening 70A-2 is required to be larger than the opening 52A because the outgoing beam is deflected. Lead wires (not illustrated) are connected to the terminals 53 to 57 but are detached when attaching or detaching the housing 50. At any rate, the housing 50 is configured that it is capable of freely putting on and taking off for the beam line in a midway thereof. On the other hand, when ions are implanted into a semiconductor wafer having a diameter of, for example, 300 mm by the use of a beam having a flattened cross-sectional shape in which its horizontal width is greater than its vertical width (i.e. having a large diameter) as shown in FIG. 3, the following points are required in the case of using the conventional deflector. The scan range is wide (e.g. scan angle: 13.5 degree). The distance L between the deflection electrodes is large (e.g. several hundreds of mm or more). The beam profile is not distorted even when the scan angle is large. However, it is practically impossible for the conventional deflector as shown in FIG. 4A to satisfy the foregoing points. On the other hand, by the use of the deflector according to this invention, it is possible to realize an ion implantation system that can deal with the beam as described above while satisfying the foregoing points. In the conventional deflector using the simple planar deflection electrodes, when a beam having a large diameter of several tens of mm or more is deflected, the profile of the beam largely and complicatedly changes depending on a change in deflection angle or a position between the deflection electrodes where the beam passes. On the other hand, in the deflector according to this invention, the deflection electrodes can be designed so that a change in profile of the beam is made as small as possible and orderly with respect to the deflection angle. In order to prevent leakage of electrical fields, the suppression electrode and the ground electrode are disposed on each of the upstream and downstream sides of the deflection electrodes. In this case, each of the openings of the suppression and ground electrodes is formed into the shape that is large in the horizontal-width direction of the beam while only slightly wider than the vertical width of the beam in the vertical-width direction of the beam so as to well suppress the electrical field, thereby having the rectangular shape with a large aspect ratio. With this arrangement, the suppression and ground electrodes cause the electrical field to be weak in the large-width direction and enable deflection scanning of a beam with a high current density of about 10 mA/cm2 without causing defocus thereof. Further, the size of the overall beam processing system can be the same as the conventional size by the use of the practical and compact deflector. Moreover, the operation attendant upon maintenance and checkout can be facilitated by allowing the deflector to be attachable and detachable with respect to the beam line. In view of the foregoing, the deflector according to this invention is suitable for the whole range of beam processing systems that deflect a beam having a relatively large diameter or a beam having a flattened shape, such as an oval shape, in cross-section. While the present invention has thus far been described in connection with the preferred embodiment thereof, it will readily be possible for those skilled in the art to put this invention into practice in various other manners. |
|
050248073 | description | DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT To understand the preferred embodiment, it is helpful to first refer to prior art FIGS. 1 and 2 where the numeral 10 generally designates a conventional fuel assembly. In FIG. 1, the prior art fuel assembly 10 includes an upper end fitting 12, a lower end fitting 14, spacer grids 16 supporting fuel rods 17, and a perimeter skirt portion 18 shown partially broken away in FIG. 1. In a conventional assembly, the region enclosed by the skirt would contain only the fuel rods. The numeral 20 indicates the location for a debris catching strainer grid constructed according to principles of the prior art (U.S. Pat. No. 4,781,884). Behind the skirt 18, within the non-end-cap-contacting compartments defined by the debris catching strainer grid 20 and at the ends of fuel rods 17, are solid fuel rod end caps 22. Each fuel rod end cap 22 is in a non-end-cap-contacting compartment of the prior art strainer grid 20. In FIG. 2 the perimeter skirt portion 18 and lower grid portion 16 is in cross-section to show how spring 23 and at least one arch 21 remain in position for capture of fuel rod 17, in spite of the "rod lift" caused by abnormal coolant flow in an amount equal to the length "x" of the "shoulder gap". The novel "spring detent spacer grid" of FIG. 3 is generally designated 20a and cooperates with circumferentially grooved end caps 22a with which it is in contact for "rod lift" preventing rod capture, for debris trapping and for debris retention below the active region or cladding of the fuel even with the coolant pumps off. The fuel assembly of FIG. 3 with "spring detent spacer grid" 20a is designated 10a, for convenience. Parts in fuel assembly 10a which are substantially the same as parts in prior art assembly 10 carry the same numbers in FIGS. 3 to 18 as they have in FIGS. 1 and 2. The new parts which are used to make up new fuel assembly 10a with the novel "spring detent spacer grid" 20a of the invention are given part numbers with letter subscripts. FIGS. 4 to 16 show the details of the strips utilized in making up the embodiment of the "spring detent spacer grid" 20a. The strips 24a are the top strips of the "eggcrate" grid assembly. Strips 26a are the bottom strips and strips 28a are the perimeter strips. As seen in FIGS. 4 to 7, the top strips 24a have leaves 30, opposite arch portions or bends 32 and extending in the same direction as the springs 34 which seat in tapered sided circumferential grooves 36 of end caps 22a to provide "rod lift" preventing rod capture. The bends or arch portions 32 cooperate with the springs 34 to laterally hold the fuel rods 17a, in known manner. Slots 38 facilitate the "eggcrate" assembly. As seen in FIGS. 8 to 11 the bottom strips 26a have leaves 40a and 40b vertically displaced on opposite sides of the strip but located such that they will be substantially symmetrically located relative to the intersection of strips 24a and 26a when assembled into a grid. Bends or arched portions 42 and springs 44 cooperate with end caps 22a and grooves 36 in the same manner as do portions 32 and springs 34. Slots accommodate the "eggcrate" assembly. The perimeter strip 28a illustrated in FIGS. 12 and is one typical type, but other designs are contemplated. The leaves 52 provide the arch function and the springs 54 engage the grooves 36 in end caps 22a. The perimeter strip 28a is straight without bends of the type at 32 and 42. FIGS. 17 and 18 show the relation of symmetry and the relative elevation of the features of the new "spring detent spacer grid". From these figures it is easy to see why debris is trapped and retained in the various tapered passageways the instant invention creates in the area just above the lower end fitting 14. |
claims | 1. An automatically self-calibrating magnifying measurement system, comprising:a) a calibration standard having a reference object with at least two landmark features of differing scales identifiable by pattern recognition at a plurality of magnifications, dimensions of which have been verified and digitally archived in association with a unique identification code for the calibration standard, the landmark features each being associated with a distinctive marking that can be read by pattern recognition to identify the different landmark features, the calibration standard also having a machine readable identification code marker configured to appear in a magnified digital image of the reference object, the identification code marker corresponding to the unique identification code for the calibration standard;b) a stage to position the calibration standard, and alternatively to position a sample;c) image acquiring means for acquiring magnified digital images of the reference object, and alternatively for acquiring a magnified digital image of the sample;d) a data storage module for storing information including the unique identification code for the calibration standard and the associated verified dimensions of the landmark features of the reference object;e) a control module configured to control the stage and the image acquiring means to obtain digital images of the reference object of the calibration standard at a plurality of magnifications, and alternatively to obtain a digital image of the sample; andf) a data processing module configured to:automatically read by pattern recognition at a plurality of magnifications the distinctive markings associated with the landmark features of the reference object of the calibration standard to identify the landmark features;automatically measure dimensions of the identified landmark features of the reference object of the calibration standard by pattern recognition at a plurality of magnifications;automatically read the identification code marker of the calibration standard by pattern recognition to obtain the unique identification code for the calibration standard, and to retrieve the verified dimensions of the landmark features of the reference object associated with the unique identification code for the calibration standard;automatically establish calibration parameters for a plurality of magnifications based on comparing the measured dimensions of the landmark features with the verified dimensions; andautomatically store the calibration parameters in the data storage module. 2. The automatically self-calibrating magnifying measurement system of claim 1 wherein the identification code marker comprises a bar code. 3. The automatically self-calibrating magnifying measurement system of claim 2 wherein the bar code is replicated at a plurality of different scales. 4. The automatically self-calibrating magnifying measurement system of claim 3 wherein the calibration standard also has the unique identification code marked on is in a form easily read by a human operator. 5. The automatically self-calibrating magnifying measurement system of claim 1 wherein landmark features of the reference object of the calibration standard comprises a plurality of similar figures of varying scale. 6. The automatically self-calibrating magnifying measurement system of claim 5 wherein each of the figures is distinguished with one of the distinctive markings read by the data processing module by pattern recognition. 7. The automatically self-calibrating magnifying measurement system of claim 6 wherein each of the figures is distinguished by a distinct number of sub-markings. 8. The automatically self-calibrating magnifying measurement system of claim 7 wherein the figures comprise a plurality of nesting rectangles. 9. The automatically self-calibrating magnifying measurement system of claim 1 further comprising a computer readable medium containing the unique identification code for the calibration standard and the associated verified dimensions of the landmark features of the reference object. 10. The automatically self-calibrating magnifying measurement system of claim 1, wherein the verified dimensions of the landmark features of the reference object are verified by an external calibration performed by an accredited organization. 11. The automatically self-calibrating magnifying measurement system of claim 1 wherein the data processing module is further configured to automatically validate the calibration parameters bymeasuring one or more attributes of a plurality of objects having attributes of known values by pattern recognition,comparing the measured values of the one or more attributes with the known values,wherein the system is validated when the measured values are within a predetermined range of the known values. 12. A calibration standard for use with an automatically self-calibrating magnifying measurement system that includes a data storage module for storing information including a unique identification code for the calibration standard and associated verified dimensions of landmark features of a reference object of the calibration standard, and a data processing module configured to automatically read at a plurality of magnifications distinctive markings associated with the landmark features of the reference object of the calibration to identify the different landmark features to measure dimensions of the landmark features of the reference object of the calibration standard, and to automatically read at a plurality of magnifications an identification code marker of the calibration standard, and to retrieve verified dimensions of the identified landmark features of the reference object associated with the unique identification code for the calibration standard, the calibration standard comprising:a reference object with at least two landmark features of different scales identifiable and measurable by pattern recognition at a plurality of magnifications, dimensions of which have been verified and digitally archived in association with a unique identification code for the calibration standard, the landmark features each being associated with a distinctive marking that can be read by pattern recognition to identify the different landmark features; anda machine readable identification code marker configured to appear in a magnified digital image of the reference object, the identification code marker being replicated at a plurality of different scales and corresponding to the unique identification code for the calibration standard; andwherein the identification code marker comprises a bar code. 13. The calibration standard of claim 12 wherein the calibration standard also has the unique identification code marked on it in a form easily read by a human operator. 14. The calibration standard of claim 13 wherein the reference object of the calibration standard comprises a plurality of similar figures of varying scale. 15. The calibration standard of claim 14 wherein each of the figures is distinguished with one of the distinctive markings read by the data processing module by pattern recognition. 16. The calibration standard of claim 15 wherein each of the figures is distinguished by a distinct number of sub-markings. 17. The calibration standard of claim 16 wherein the figures comprise a plurality of nesting rectangles. 18. The calibration standard of claim 12 further comprising a computer readable medium containing the unique identification code for the calibration standard and the associated verified dimensions of the landmark features of the reference object. 19. The automatically self-calibrating magnifying measurement system of claim 1 wherein the data processing module is further configured to measure one or more attributes of a sample by pattern recognition applying the calibration parameters. |
|
summary | ||
041586042 | abstract | Power generating plant which comprises a heat source, at least one main steam turbine and at least one main boiler heated by heat from the heat source and providing the steam to drive the turbine, comprises additionally at least one further steam turbine, smaller than the main turbine, and at least one further boiler, of lower capacity than the main boiler, and heated from the same heat source and providing steam for the further turbine.. Particularly advantageous in nuclear power stations, where the heat source is a nuclear reactor, the invention enables peak loads, above the normal continuous rating of the main generators driven by the main turbines, to be met by the further turbine(s) and one or more further generators driven thereby. This enables the main turbines to be freed from the thermal stresses of rapid load changes, which stresses are more easily accommodated by the smaller and thus more tolerant further turbine(s). Thus auxiliary diesel-driven or other independent power plant may be made partly or wholly unnecessary. Further, low-load running which would be inefficient if achieved by means of the main turbine(s), can be more efficiently effected by shutting them down and using the smaller further turbine(s) instead. These latter may also be used to provide independent power for servicing the generating plant during normal operation or during emergency or other shutdown, and in this latter case may also serve as a heat sink for the shut-down reactor. |
042343844 | abstract | Disclosed is a support structure consisting of several layers of prismatic graphite blocks arranged over each other. The layers are constructed as closed units without expansion gaps and the blocks of one layer are keyed together with the blocks of the adjacent layers. The upper layers are composed of a plurality of preferably hexagonal graphite blocks equipped with passages for the cooling gas, while the bottom layer is formed by a number of support structures, each consisting of several support segments fitted together preferably into a hexagonal cross section, with each support unit resting at its central section on a column head of a round column and carrying a limited number of the hexagonal graphite blocks and that cooling gas channels are provided at the locations of the bottom layer where three support units meet. |
claims | 1. An apparatus for manufacturing a radioisotope, the apparatus comprising:a container, the container comprising a portable neutron source and a solution that comprises a particular isotope; where the portable neutron source is surrounded by the solution; wherein the particular isotope comprises at least one of: copper phthalocyanine or copper salicylaldehyde o-phenylene diamine; andwherein the portable neutron source emits neutrons that react with the particular isotope, resulting in the transformation of the particular isotope into the radioisotope; wherein the portable neutron source is completely surrounded by both the particular isotope and a moderator; wherein the radioisotope is 64Cu. 2. The apparatus of claim 1, wherein the portable neutron source comprises at least one of: a plutonium-beryllium source, an americium-beryllium source, or a californium-252 source. 3. The apparatus of claim 1, wherein the particular isotope comprises at least one of:a compound,a bulk solid,a powdered solid,a liquid, ora gas. 4. The apparatus of claim 1, wherein the entire portable neutron source is surrounded by the solution. 5. The apparatus of claim 1, wherein the moderator is operative to reduce energy of neutrons of neutrons from the portable neutron source. 6. The apparatus of claim 5, wherein the solution acting as a moderator thermalizes the neutrons from the portable neutron source, the thermalized neutrons reacting with the particular isotope. 7. A medical patient examination facility comprising:an apparatus for manufacturing a radioisotope, the apparatus comprising:a container, the container comprising a portable neutron source and a solution that comprises a particular isotope; where the portable neutron source is completely surrounded by the solution and a moderator; wherein the particular isotope comprises at least one of: copper phthalocyanine or copper salicylaldehyde o-phenylene diamine; andwherein the portable neutron source emits neutrons that react with the particular isotope, resulting in the transformation of the particular isotope into the radioisotope, wherein the radioisotope is 64Cu. |
|
summary | ||
claims | 1. A method of removing tritium from tritiated water and binding said tritium into an insoluble tritiated polystyrene, comprising the steps of:reacting tritiated water with calcium carbide to produce a tritiated acetylene by-product;polymerizing said tritiated acetylene by-product with heat and a first catalyst to form a tritiated benzene by-product;reacting said tritiated benzene by-product with ethyl chloride and ferric chloride in the presence of an acid forming a tritiated ethyl benzene by-product;reacting said tritiated ethyl benzene by-product in the presence of steam and an iron oxide based second catalyst via catalytic dehydrogenation forming a tritiated styrene by-product;copolymerizing said tritiated styrene by-product with an effective amount of divinyl benzene cross-linking agent producing an insoluble tritiated polystyrene compound. 2. A tritiated polystyrene compound containing covalently bonded tritium produced in accordance with the method of claim 1. 3. A method of producing an insoluble tritiated polystyrene, consisting essentially of the steps of:reacting tritiated water with calcium carbide to produce a tritiated acetylene by-product;polymerizing said tritiated acetylene by-product with heat and a first catalyst to form a tritiated benzene by-product;reacting said tritiated benzene by-product with ethyl chloride and ferric chloride in the presence of an acid forming a tritiated ethyl benzene by-product;reacting said tritiated ethyl benzene by-product in the presence of steam and an iron oxide based second catalyst via catalytic dehydrogenation forming a tritiated styrene by-product;copolymerizing said tritiated styrene by-product with an effective amount of divinyl benzene cross-linking agent producing an insoluble tritiated polystyrene compound. 4. The method of claim 1,wherein said step of reacting said tritiated water with said calcium carbide also produces a tritiated calcium hydroxide and further comprising the step of calcinating said tritiated calcium hydroxide to remove tritiated water therefrom. 5. The method of claim 1, further comprising the step of copolymerizing said tritiated styrene by-product with a polybutadiene and an effective amount of divinylbenzene cross linking agent producing an insoluble tritiated polystyrene/polybutadiene graft copolymer compound containing covalently bonded tritium. 6. An insoluble tritiated polystyrene/polybutadiene graft copolymer compound containing covalently bonded tritium produced in accordance with the method of claim 5. 7. An insoluble tritiated polystyrene graft copolymer compound containing covalently bonded tritium and a monomer or a copolymer selected from the group consisting of a polybutadiene, an acrylonitrile butadiene styrene, an acrylonitrile, a maleic anhydride, and combinations thereof added during polymerization with an effective amount of a divinylbenzene cross linking agent produced in accordance with the method of claim 1. 8. The method of claim 1, wherein said step of reacting said tritiated water with said calcium carbide also produces a tritiated calcium hydroxide and further comprising the step of reacting said tritiated calcium hydroxide with a hydrochloric acid to yield a calcium chloride and tritiated water. 9. The method of claim 3, further comprising the step of copolymerizing said tritiated styrene by-product with a polybutadiene and an effective amount of divinylbenzene cross linking agent producing an insoluble tritiated polystyrene/polybutadiene graft copolymer compound containing covalently bonded tritium. 10. An insoluble tritiated polystyrene/polybutadiene graft copolymer compound containing covalently bonded tritium produced in accordance with the method of claim 9. 11. A method of incorporating tritium arising from tritiated water into a polystyrene consisting essentially of the steps of:reacting tritiated water with calcium carbide to produce a tritiated acetylene by-product;polymerizing said tritiated acetylene by-product producing a tritiated benzene;reacting said tritiated benzene with ethyl chloride and ferric chloride to form a tritiated ethyl benzene;converting said tritiated styrene to a tritiated styrene by catalytic dehydrogenation in the presence of steam and an iron oxide catalyst; andcopolymerizing said tritiated styrene with an effective amount of a divinylbenzene cross linking agent producing an insoluble tritiated polystyrene compound containing covalently bonded tritium. 12. The method of claim 11, further comprising the step of copolymerizing said tritiated styrene with a polybutadiene and an effective amount of divinylbenzene cross linking agent producing an insoluble tritiated polystyrene/polybutadiene graft copolymer compound containing covalently bonded tritium. 13. A method of incorporating tritium arising from tritiated water into a polystyrene comprising the steps of:reacting tritiated water with calcium carbide to produce a tritiated acetylene by-product;polymerizing said tritiated acetylene by-product producing a tritiated benzene;reacting said tritiated benzene with ethyl chloride and ferric chloride to form a tritiated ethyl benzene;converting said tritiated styrene to a tritiated styrene by catalytic dehydrogenation in the presence of steam and an iron oxide catalyst; andcopolymerizing said tritiated styrene with an effective amount of a divinylbenzene cross linking agent producing an insoluble tritiated polystyrene compound containing covalently bonded tritium. 14. A tritiated polystyrene compound containing covalently bonded tritium produced in accordance with the method of claim 13. 15. The method of claim 13,wherein said step of reacting said tritiated water with said calcium carbide also produces a tritiated calcium hydroxide and further comprising the step of calcinating said tritiated calcium hydroxide to remove tritiated water therefrom. 16. The method of claim 13, wherein said step of reacting said tritiated water with said calcium carbide also produces a tritiated calcium hydroxide and further comprising the step of reacting said tritiated calcium hydroxide with a hydrochloric acid to yield a calcium chloride and tritiated water. 17. The method of claim 13, further comprising the step of copolymerizing said tritiated styrene with a polybutadiene and an effective amount of divinylbenzene cross linking agent producing an insoluble tritiated polystyrene/polybutadiene graft copolymer compound containing covalently bonded tritium. 18. An insoluble tritiated polystyrene/polybutadiene graft copolymer compound containing covalently bonded tritium produced in accordance with the method of claim 17. |
|
054904188 | summary | BACKGROUND OF THE INVENTION The present invention relates to a device for measuring the force exerted by a spring of a supporting grid on a nuclear fuel rod passing through the grid. The fuel assemblies used in nuclear reactors that are cooled and moderated by water include support grids for supporting fuel rods and/or for holding them at the nodes of a regular array, generally a square array. The grid is often constituted by two sets of mutually crossed plates defining rod-receiving cells. Two facing walls in a given cell are organized so that one of them includes a rigid cell-engaging projections and the other includes a spring, often in the form of a hairpin, straddling a plate and intended to force the rod against the projections. The springs may be single, i.e. they may have a single resilient branch acting on one rod; or they may be double, i.e. they may have two branches each acting on a respective rod placed on a respective side of the plate carrying the spring. It is important for the springs to exert forces on the rods that do not depart too far from a set value. Various devices have already been proposed for measuring the force exerted by a spring that is single or double, for the purpose of verifying that the force exerted by each spring of a grid lies within a predetermined range of values prior to incorporating the grid in an assembly. For example, document EP-A-0 501 663 describes a device enabling the force exerted by a double spring to be measured; that device includes a gauge designed to be forced into a cell and including a feeler for transmitting the force exerted by a spring. The gauge is fixed to a centering peg which is designed to engage in the cell adjacent to that in which measurement is being performed and to retain the double spring therein. Forced insertion of the gauge and of the centering peg runs the risk of damaging the spring. Document DE-A-3 242 407 describes another measuring device having a gauge of a diameter that is substantially equal to that of a fuel rod. A bore is provided in the gauge transversely to its axis at a location that faces the thrust point of the spring when the gauge is pushed home. The bore contains a piston whose outside face carries a measuring element. To measure the force of a spring, the gauge is inserted and hydraulic pressure is exerted on the piston to bring it into a determined position such that the width of the gauge level with the spring thrust point is equal to the nominal diameter of a fuel rod. Given that the piston is hardly capable of projecting from the gauge, it is not possible to completely eliminate friction while the gauge is being inserted and removed. SUMMARY OF THE INVENTION It is an object of the invention to provide an improved device for measuring the force exerted by a grid spring on a fuel rod. It is a more specific object to reduce the friction forces exerted on the spring whose characteristics are to be measured. To this end, the invention there is provided a measurement device comprising: an elongate body connected by two flexible blades that are parallel to the long direction, to two respective beams designed to be inserted in a cell, at least one of the beams carrying a force sensor designed to be pressed against the spring; a unit slidable in the body along the body between a position in which it moves the beams apart while keeping them parallel to give them a spacing that corresponds to the nominal diameter of a fuel rod, and a position in which it allows the flexible blades to move the beams towards each other. Displacement means are provided for moving the unit at will between the two positions. The means for displacing the moving equipment may be manual; but they will generally be motor driven. In particular they may be actuated by a pressurized fluid. The movable unit may be of various different structures. In particular, it may comprise a connecting rod that is longitudinally displaceable by the displacement means and that is connected to the beams by arms in such a manner as to constitute a virtual deformable parallelogram that obliges the beams to remain parallel to themselves as they move apart or towards each other. In another embodiment, the movable unit carries at least two sets of ramps co-operating with thrust means provided on the beams and constituting cams. Whichever embodiment is adopted, the fact that the thrust surfaces of the beams remain parallel to themselves guarantees good contact between a force sensor carried by at least one of the beams and the spring whose force is to be measured. The device may be doubled up, i.e. it may have two sets of beams so as to make it possible to perform measurements on double springs. |
description | 1. Field of the Invention The embodiments herein generally relate to atomic force microscopy (AFM), and, more particularly, to methods of forming AFM probes for analyzing substrates. 2. Description of the Related Art Atomic Force Microscopy (AFM) is often used as a method of characterizing critical dimensions of width, height, profile, and surface chemistry for structures on a semiconductor substrate. In order to characterize the topography of trench features of silicon devices, it is desirable to fabricate AFM probe tips that have an angled feature near the active end of the probe tip. Conventionally, these probe tips are fabricated by etching silicon features with an angled structure or foot at one end of the silicon feature. FIG. 1 illustrates a conventional AFM probe apparatus. Generally, the AFM probe 1 comprises a probe arm 2 terminating with a tip 3. The probe tip 3 is then used to analyze the profile of the surface 5 of a substrate 4. A particular feature 6 on the surface 5 of the substrate 4 may have an undercut feature defined by inwardly sloping sidewalls 7. The topography of this feature 6 generally makes it difficult for the probe tip 3 to fully analyze all of the surface features of the substrate 4. Therefore, it remains desirable to develop additional methods of manufacturing AFM probe tips more reproducibly, and from other materials than silicon, which can be more durable and have a smaller dimension than conventional AFM probe tips, which can be used to analyze substrates with an angled topography, and which can be used for exploring the chemistry of the surfaces of substrate topography. In view of the foregoing, an embodiment herein provides a Y-shaped carbon nanotube atomic force microscope probe tip comprising a shaft portion; a pair of angled arms extending from a same end of the shaft portion, wherein the shaft portion and the pair of angled arms comprise a chemically modified carbon nanotube, and wherein the chemically modified carbon nanotube is modified with any of an amine, carboxyl, fluorine, and metallic component. Preferably, each of the pair of angled arms comprises a length of at least 200 nm and a diameter between 10 and 200 nm. Moreover, the chemically modified carbon nanotube is preferably adapted to allow differentiation between substrate materials to be probed. Additionally, the chemically modified carbon nanotube is preferably adapted to allow fluorine gas to flow through the chemically modified carbon nanotube onto a substrate to be characterized. Furthermore, the chemically modified carbon nanotube is preferably adapted to chemically react with a substrate surface to be characterized. Another embodiment provides a method of forming a Y-shaped carbon nanotube atomic force microscope probe tip, wherein the method comprises forming a shaft portion of the probe tip; extending a pair of angled arms from a same end of the shaft portion, wherein the shaft portion and the pair of angled arms comprise a carbon nanotube; and chemically modifying the carbon nanotube with any of an amine, carboxyl, fluorine, and metallic component. The method may further comprise configuring each of the pair of angled arms at a length of at least 200 nm; and configuring each of the pair of angled arms at a diameter between 10 and 200 nm. Moreover, the chemically modified carbon nanotube is preferably adapted to allow differentiation between substrate materials to be probed. Furthermore, the chemically modified carbon nanotube is preferably adapted to allow fluorine gas to flow through the chemically modified carbon nanotube onto a substrate to be characterized. Additionally, the chemically modified carbon nanotube is preferably adapted to chemically react with a substrate surface to be characterized. Another embodiment provides a method of performing atomic force microscopy, wherein the method comprises attaching a carbon nanotube to an atomic force microscope probe to form a probe tip, wherein the carbon nanotube is configured into a Y shape; chemically modifying the carbon nanotube probe tip with any of an amine, carboxyl, fluorine, and metallic component; and analyzing a surface of a substrate using the chemically modified Y-shaped carbon nanotube probe tip. The method may further comprise configuring the carbon nanotube probe tip with a shaft portion and a pair of angled arms extending from a same end of the shaft portion. Additionally, the method may further comprise configuring each of the pair of angled arms at a length of at least 200 nm. Moreover, the method may further comprise configuring each of the pair of angled arms at a diameter between 10 and 200 nm. Preferably, the chemically modified Y-shaped carbon nanotube is adapted to allow differentiation between substrate materials to be probed. Also, the chemically modified Y-shaped carbon nanotube is preferably adapted to allow fluorine gas to flow through the chemically modified carbon nanotube onto a substrate to be characterized. Furthermore, the chemically modified Y-shaped carbon nanotube is preferably adapted to chemically react with a substrate surface to be characterized. These and other aspects of the embodiments herein will be better appreciated and understood when considered in conjunction with the following description and the accompanying drawings. It should be understood, however, that the following description, while indicating preferred embodiments and numerous specific details thereof, is given by way of illustration and not of limitation. Many changes and modifications may be made within the scope of the embodiments herein without departing from the spirit thereof, and the embodiments include all such modifications. The embodiments herein and the various features and advantageous details thereof are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. It should be noted that the features illustrated in the drawings are not necessarily drawn to scale. Descriptions of well-known components and processing techniques are omitted so as to not unnecessarily obscure the embodiments herein. The examples used herein are intended merely to facilitate an understanding of ways in which the embodiments herein may be practiced and to further enable those of skill in the art to practice the embodiments herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein. As mentioned, there remains a need to develop additional methods of manufacturing AFM probe tips more reproducibly, and from other materials than silicon, which can be more durable and have a smaller dimension than conventional AFM probe tips, and which can be used to analyze substrates with an angled topography. The embodiments herein achieve this by providing an AFM probe tip formed of Y-shaped carbon nanotubes (CNT), which can be used for analyzing substrates with an angled topography. Referring now to the drawings, and more particularly to FIGS. 2(A) through 9(B), where similar reference characters denote corresponding features consistently throughout the figures, there are shown preferred embodiments herein. The embodiments herein provide a CNT structure that is more durable than conventional silicon tips used on AFM probes because the arms 13 of the CNT AFM probe tip 15 provided by the embodiments herein are mechanically flexible and are mechanically stronger than silicon. The embodiments herein utilize Y-shaped carbon nanotubes as the active probe tip 15 of an AFM probe 10 to allow for lateral reach for undercut profiles of an underlying substrate 22 to be analyzed. FIG. 2(A) illustrates a Y-shaped CNT AFM probe 10 in accordance with a first embodiment herein. The probe 10 comprises a probe arm 12 having a Y-shaped CNT tip 15 extending therefrom. The Y-shaped CNT tip 15, which is formed of carbon nanotubes, includes a generally straight shaft portion 11 and a pair of angled arms 13 extending from a confluence point 14 and joined to the shaft portion 11. FIG. 2(B) illustrates a probe 10 according to a second embodiment herein, which flips the Y-shaped CNT tip 15 such that the angled arms 13 are pointing towards the probe arm 12, whereby the probe arm 12 connects to the arms 13 or the confluence point 14 and the straight shaft portion 11 is pointing downward toward a substrate 24 to be analyzed. According to the embodiments herein, the Y-shaped carbon nanotubes can be grown by impregnating a magnesium oxide (MgO) support material with cobalt from solution. The supported catalyst is exposed to methane gas at an elevated temperature of approximately 800 to 1,000° C. to create the Y-shaped CNT as shown in FIG. 3. More specifically, as described in Li, W. Z. et al., “Straight carbon nanotube Y-junctions,” Appl. Phys. Lett. 79, 1879-1881 (2001), the complete disclosure of which, in its entirety, is herein incorporated by reference, the MgO supported Co catalysts may be prepared by dissolving 0.246 g of cobalt nitrate hexahydrate (Co(NO3)2-6H2O, 98%) in 40 mL ethyl alcohol first, and then immersing 2 grams of MgO powder (−325 mesh, 99%) in the solution by sonicating for approximately 50 minutes. After drying, the material is calcined at approximately 130° C. for approximately 14 hours. For carbon nanotube growth, the catalysts are first reduced at approximately 1000° C. for approximately 1 hour in flowing gases of H2 (40 sccm) with N2 (100 sccm) at a pressure of approximately 200 torr, then the N2 is replaced with CH4 (10 sccm) to start carbon nanotube growth. The growth normally lasts for approximately 1 hour. The arms 13 of the CNT tip 15 can be varied in length from approximately a few hundred (i.e., 200) nanometers to one micron or more. The diameter of the CNT can be varied from approximately 10 to 200 nm, depending on the specific gas pressure and temperature. The CNT tip 15 can be mounted on the AFM probe arm 12 in accordance with the process described in U.S. Pat. No. 6,800,865, the complete disclosure of which, in its entirety, is herein incorporated by reference, wherein an electric field is used to draw the CNT tip 15 to the probe arm 12, and then the CNT tip 15 is glued on the probe arm 12 by use of an E-beam curing process. Alternatively, the mounting can occur in accordance with the technique described in U.S. Pat. No. 6,755,956, the complete disclosure of which, in its entirety, is herein incorporated by reference, which provides that the growth of CNTs may occur directly onto the probe tip 15, so that the CNT tip 15 is attached to the probe arm 12 after growth. Also, the mounting may occur as described in U.S. Patent Application No. 2004/0009308, which describes forming a catalyst on the probe tip 15, using a focused ion beam (FIB) to shape the catalyst, and growing a Y shaped CNT on the probe tip 15 as an AFM probe. Thus, the CNT tip 15 can be mounted on the AFM probe arm 12 such that the arms 13 of the CNT tip 15 extend down toward the surface 25 of the substrate 24 to be characterized as illustrated in FIG. 2(A), allowing the arms 13 to extend underneath an over-hanging profile feature 26, and allowing the slope 27 of the profile to be measured. If desired, the CNT tip 15 can also be mounted on the probe arm 12 such that two of the arms 13 of the CNT Y-shaped tip 15 are bound to the probe arm 12, with a single CNT arm 11 extending toward the surface 25 of the substrate 24 to be characterized. The surfaces of the CNT Y-shaped tip 15 can also be modified with amine, carboxyl, fluorine, or metallic components, which can allow differentiation between substrate materials as illustrated in FIGS. 4 through 7. For example, copper typically binds strongly to amines; accordingly an amine-modified CNT can interact more strongly with a copper portion of the substrate than merely with a silicon or silicon oxide portion of the substrate. FIG. 4 illustrates a schematic diagram of the Y-shaped carbon nanotube AFM probe tip of FIG. 3 undergoing a chemical modification with an amine component and a fluorine component. The fluorination of a carbon nanotube is describe in Dai, L. et al., “Functionalized surfaces based on polymers and carbon nanotubes for some biomedical and optoelectronic applications,” Nanotechnology 14 No. 10, 1081-1097, October 2003, and U.S. Pat. Nos. 6,645,455 and 6,841,139, the complete disclosures of which, in their entireties, are herein incorporated by reference, and involves exposing the CNT tip 15 to gaseous fluorine at temperatures of approximately 250-350° C. The fluorinated CNT tip 15 can then be further modified with other reagents to introduce a variety of other functionalities, such as amino, hydroxyl, alkyl, thiol. Moreover, films can be deposited on the CNT tip 15 from an upstream plasma source, using source gases such as ammonia, ethylene diamine, acetic acid, ethyl acetate, methanol, methylamine, acetaldehyde, etc. The upstream plasma generates reactive species which deposit on the CNT tip 15 to create a functionalized surface. FIG. 5 illustrates a schematic diagram of the chemical interaction between the Y-shaped carbon nanotube AFM probe tip and the amine component of FIG. 4. Specifically, in FIG. 5, the CNT tip 15 has been modified with amine functionality. The amine includes polarized N—H bonds, which are suitable for creating hydrogen-bonding interactions with other polar chemical species, such as hydroxyl. In this case, as the CNT probe tip 15 is scanned across the surface 25 of the substrate 24, the hydrogen bonding between the amine functionality and the hydroxyl groups on the substrate surface 25 will cause a force to be applied to the CNT tip 15 and to the probe arm 12 (not shown in FIG. 5). A deflection in the probe arm 12 will result, giving a signal to the AFM tool (not shown) that a strong surface interaction is occurring. On the other hand, a fluorinated surface generally does not create an opportunity for such hydrogen bonding between the amine functionalized probe tip 12 and the fluorinated surface 25, so the CNT tip 15 will not interact strongly with the fluorinated surface 25 and the AFM tool (not shown) will not register a signal to the same extent. FIG. 6 illustrates an enlarged view of the chemical interaction illustrated in FIG. 5. More particularly, FIG. 6 shows the hydrogen bonding interaction between the aminated CNT tip 15 and the hydroxylated substrate surface 24 in more detail. Specifically, FIG. 6 depicts that the non-bonding electron pair which exists on nitrogen, and the two non-bonding pairs of electrons which exist on oxygen. The high electronegativity of nitrogen and oxygen cause them to draw electron density towards the nitrogen and oxygen atoms, while the bonded hydrogen atoms are consequently left with a lower level of electron density. As a result, the hydrogen atoms of these species tend to form an attraction, or a weak bond, to adjacent electron-rich areas, such as the non-bonding electron pairs on nitrogen or oxygen. While these hydrogen bonding interactions are generally weak relative to typical covalent bonds, in aggregate they can serve to create significant intermolecular interactions in the liquid or solid state. FIG. 7 illustrates an enlarged view of the chemical interaction between the Y-shaped carbon nanotube AFM probe tip and the fluorine component of FIG. 4. More particularly, FIG. 7 shows an absence of hydrogen bonding interaction between the fluorinated substrate surface 25 and the aminated CNT tip 15. There are three pairs of non-bonding electrons distributed around the fluorine atom, which are not shown in FIG. 7. The fluorine atom is more electronegative than either nitrogen or oxygen, and is less favored energetically to share these electrons with a proximal hydrogen atom, so the hydrogen bonding between and amine and a fluorinated substrate is relatively weak. Also, the fluorinated surface does not contain any hydrogen groups which might likewise form a hydrogen bond with the nitrogen of the amine functionality. As a result, a relatively weak interaction occurs between the fluorinated surface 25 of the substrate 24 and the aminated CNT tip 15. FIG. 8 illustrates a schematic diagram of a nano-etching process, whereby a flow of fluorine gas is pushed through the CNT probe tip 15 and onto a substrate 24, which allows for selective etching/modification of the surface 25 of the substrate 24. More particularly, FIG. 8 shows the fluorination of a silicon substrate by a fluorinated CNT. This type of chemistry is driven by a relatively weak and thermally reversible CNT bond to fluorine, while, in contrast, the silicon-fluorine bond is typically the strongest single bond. Furthermore, the silicon surface can be etched by the fluorinated CNT due to the volatility of SiF4, which readily allows the reacted silicon to be removed from the substrate surface 25. The fluorine on the CNT tip 15 can be re-generated by exposing the CNT tip 15 to fluorine gas in a separate chamber from the substrate 24. Or, alternatively, the CNT tip 15 can be attached to a manifold (not shown) on the cantilever arm, covered with a porous ceramic material, which allows fluorine gas to flow down through the nanotube to the substrate 24 below. FIG. 9(A) (with reference to FIGS. 2(A) through 8) is a flowchart illustrating a method of forming a Y-shaped carbon nanotube atomic force microscope probe tip 15 in accordance with an embodiment herein, wherein the method comprises forming (101) a shaft portion 11 of the probe tip 15; extending (103) a pair of angled arms 13 from a same end of the shaft portion 11, wherein the shaft portion 11 and the pair of angled arms 13 comprise a carbon nanotube (not shown); and chemically modifying (105) the carbon nanotube with any of an amine, carboxyl, fluorine, and metallic component. The method may further comprise configuring each of the pair of angled arms 13 at a length of at least 200 nm; and configuring each of the pair of angled arms 13 at a diameter between 10 and 200 nm. Moreover, the chemically modified carbon nanotube is preferably adapted to allow differentiation between substrate materials to be probed. Furthermore, the chemically modified carbon nanotube is preferably adapted to allow fluorine gas to flow through the chemically modified carbon nanotube onto a substrate 24 to be characterized. Additionally, the chemically modified carbon nanotube is preferably adapted to chemically react with a substrate surface 24 to be characterized. FIG. 9(B) (with reference to FIGS. 2(A) through 8) is a flowchart illustrating a method of performing atomic force microscopy in accordance with an embodiment herein, wherein the method comprises attaching (201) a carbon nanotube (not shown) to an atomic force microscope probe 10 to form a probe tip 15, wherein the carbon nanotube is configured into a Y shape; chemically modifying (203) the carbon nanotube probe tip 15 with any of an amine, carboxyl, fluorine, and metallic component; and analyzing (205) a surface 25 of a substrate 24 using the chemically modified Y-shaped carbon nanotube probe tip 15. The method may further comprise configuring the carbon nanotube probe tip 15 with a shaft portion 11 and a pair of angled arms 13 extending from a same end of the shaft portion 11. Additionally, the method may further comprise configuring each of the pair of angled arms 13 at a length of at least 200 nm. Moreover, the method may further comprise configuring each of the pair of angled arms 13 at a diameter between 10 and 200 nm. Preferably, the chemically modified Y-shaped carbon nanotube is adapted to allow differentiation between substrate materials to be probed. Also, the chemically modified Y-shaped carbon nanotube is preferably adapted to allow fluorine gas to flow through the chemically modified carbon nanotube onto a substrate 24 to be characterized. Furthermore, the chemically modified Y-shaped carbon nanotube is preferably adapted to chemically react with a substrate surface 25 to be characterized. The foregoing description of the specific embodiments will so fully reveal the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments can be practiced with modification within the spirit and scope of the appended claims. |
|
claims | 1. An indirect-drive method for laser driven energy research utilizing laser beams, comprising the steps of:providing a spherical outer plastic shell,providing an ablator layer inside said spherical outer plastic shell,providing a unit of deuterium-tritium fuel a layer inside said ablator layer,providing an inner volume of deuterium-tritium gas inside said layer of deuterium-tritium fuel,assembling a hohlraum around said spherical outer plastic shell containing said unit of deuterium-tritium fuel wherein said hohlram is in a position to the receive the laser beams and wherein said hohlram has an axis,shaping said hohlraum as single-turn solenoid,providing a narrow insulating slot in said single turn) solenoid hohlraum wherein said narrow insulating slot is parallel to said hohlraum axis,directing the laser beams onto said hohlraum, andemploying said hohlraum as a soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel. 2. The indirect-drive method for laser-driven energy research utilizing laser beams of claim 1 wherein said step of employing said hohlraum as soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel comprises employing said hohlraum as a soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel to compress said unit of deuterium-tritium fuel to greater than 10,000 T (100MG). 3. The indirect-drive method for laser-driven energy research utilizing laser beams of claim 1 wherein said step of employing said hohlraum as a soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel comprises employing said hohlraum as a soleniodal coil as a single-turn solenoid to produce a magnetic field directed to said unit of deuterium-tritium fuel. 4. The indirect-drive method for laser-driven energy research utilizing laser beams of claim 1 wherein said step of assembling a hohlraum containing said unit of deuterium-tritium fuel in a position to the receive the laser beams comprises assembling a cylindrical gold hohlraum containing said unit of deuterium-tritium fuel in a position to the receive the laser beams. 5. The indirect-drive method for laser-driven energy research utilizing laser beams of claim 1 wherein said step of providing a unit of deuterium-tritium fuel comprises providing a DT fuel capsule. 6. The indirect-drive method for laser-driven energy research utilizing laser beams of claim 1 wherein said step of providing a unit of deuterium-tritium fuel comprises providing a DT fuel capsule and wherein said step of assembling a hohlraum containing said unit of deuterium-tritium fuel in a position to the receive the laser beams comprises assembling a cylindrical gold hohlraum containing said DT fuel capsule in a position to the receive the laser beams. 7. An indirect-drive method fur laser-driven energy research utilizing laser beams from a first direction and laser beams from a second direction to increase the probability of achieving ignition, comprising the steps of:providing a spherical outer plastic shell,providing an ablator layer inside said spherical outer plastic shell,providing a unit of deuterium-tritium fuel as a layer inside said ablator layer,providing an inner volume of deuterium-tritium gas inside said layer of deuterium-tritium fuel,assembling a hohlraum around said spherical outer plastic shell containing said unit of deuterium-tritium fuel in a position to the receive beams from a first direction and the laser beams from a second direction wherein said hohlram has an axis,shaping said hohlraum as single-turn solenoid,providing a narrow insulating slot in said single-turn solenoid hohlraum wherein said narrow insulating slot is parallel to said hohlraum axis,filling said narrow insulating slot with a metal-oxide,directing the laser beams onto said hohlraum, andemploying said hohlraum as a soleniodal coil to axial seed a magnetic field on said unit of deuterium tritium fuel. 8. The indirect-drive method for laser-driven energy research utilizing laser beams from a first direction and laser beams from a second direction to increase the probability of achieving ignition of claim 7 wherein said step of employing said hohlraum as a soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel comprises employing said hohlraum as a soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel to compress said unit of deuterium-tritium fuel to greater than 10,000 T (100MG). 9. The indirect -drive method for laser-driven energy research utilizing laser beams from a first direction and laser beams from a second direction to increase the probability of achieving ignition of claim 7 wherein said step of employing said hohlraum as a soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel comprises employing said hohlraum as a soleniodal coil as a single-turn solenoid to produce a magnetic field directed to said unit of deuterium-tritium fuel. 10. The indirect-drive method for laser-driven energy research utilizing laser beams from a first direction and laser beams from a second direction to increase the probability of achieving ignition of claim 7 wherein said step of assembling hohlraum containing said unit of deuterium-tritium fuel in a position to the receive the laser beams from a first direction and the laser beams from a second direction comprises assembling a cylindrical gold hohlraum containing said unit of deuterium-tritium fuel in a position to the receive the laser beams from a first direction and the laser beams from a second direction. 11. The indirect-drive method for laser-driven energy research utilizing laser beams from a first direction and laser beams from a second direction to increase the probability of achieving ignition of claim 7 wherein said step of providing a unit of deuterium-tritium fuel comprises providing a DT fuel capsule. 12. The indirect-drive method for laser-driven energy research utilizing laser beams from a first direction and laser beams from a second direction to increase the probability of achieving ignition of claim 7 wherein said step of providing a unit of deuterium-tritium fuel comprises providing a DT fuel capsule and wherein said step of assembling a hohlraum containing said unit of deuterium-tritium fuel in a position to the receive the laser beams from a first direction and the laser beams from a second direction comprises assembling a cylindrical gold hohlraum containing said DT fuel capsule in a position to the receive the laser beams from a first direction and the laser beams from a second direction. 13. An indirect-drive method for laser-driven inertial confinement fusion research utilizing laser beams, comprising the steps of:providing a spherical outer plastic shell,providing an ablator layer inside said spherical outer plastic shell,providing a unit of deuterium-tritium fuel as a layer inside said ablator layer,providing an inner volume of deuterium-tritium gas inside said layer of deuterium-tritium fuel,assembling a hohlraum around said spherical outer plastic shell containing said unit of deuterium-tritium fuel wherein said hohlram is in a position to the receive the laser beams and wherein said hohlram has an axis,shaping said hohlraum as single-turn solenoid,providing a narrow insulating slot in said single-turn solenoid hohlraum wherein said narrow insulating slot is parallel to said hohlraum axis,directing the laser beams onto said hohlraum, andemploying said hohlraum as a soleniodal coil to produce a magnetic field directed to said unit of deuterium-tritium fuel. |
|
044906161 | claims | 1. A radiation shield adapted to be used in combination with an X-ray tube and a cephalometric X-ray head holder containing alignment ear rods comprising: a shield surface constructed of a material which is impervious to radiation, said surface adapted to be placed between the skull of the patient and the X-ray beam; and alignment means attached to said shield surface, said alignment means containing an aperture for cooperation with the alignment ear rods of the cephalometric head holder. a shield surface constructed of a material which is impervious to radiation, said surface adapted to be placed between the skull of the patient and the X-ray beam; alignment rods attached to the cephalometric head holder, and alignment means attached to said shield surface, said alignment means containing an aperture for cooperation with said alignment ear rods of the cephalometric head holder. 2. A radiation shield as claimed in claim 1 further including a means of stabilizing said shield against movement. 3. A radiation shield as claimed in claim 1 wherein said shield surface is planar. 4. A radiation shield as claimed in claim 1 wherein said shield surface contains a flap which can be elevated to expose the base of the skull. 5. A radiation shield as claimed in claims 2 or 3 wherein said shield surface contains a flap which can be elevated to expose the base of the skull. 6. A radiation shield adapted to be used in combination with a cephalometric X-ray head holder and X-ray tube comprising: 7. A radiation shield as claimed in claim 6 further including a means of stabilizing said shield against movement. 8. A radiation shield as claimed in claim 6 wherein said shield surface is planar. 9. A radiation shield as claimed in claim 6 wherein said shield surface contains a flap which can be elevated to expose the base of the skull. 10. A radiation shield as claimed in claims 7 or 8 wherein said shield surface contains a flap which can be elevated to expose the base of the skull. |
044926499 | claims | 1. A method of removing carbon dioxide from a gas stream by passing the gas stream through a packed bed of calcium hydroxide, wherein the bed is maintained at a temperature in the range 10.degree. C.-50.degree. C., and wherein the moisture content of the gas is controlled to a value corresponding to a relative humidity in the range 40%-100% at the bed temperature and such that the resultant conversion of calcium hydroxide is not less than 0.15, the conversion being defined by ##EQU2## where R is the gas flow rate, C is the carbon dioxide concentration upstream of the bed, T is the time required for the downstream concentration of carbon dioxide to reach 5% of the upstream concentration, and W is the weight of calcium hydroxide in the bed. C is the carbon dioxide concentration upstream of the bed, T is the time required for the downstream concentration of carbon dioxide to reach 5% of the upstream concentration, and W is the weight of calcium hydroxide in the bed. 2. A method according to claim 1, wherein the bed is maintained at a temperature in the range 20.degree. C.-30.degree. C., the moisture content of the gas stream corresponding to a relative humidity in the range 80%-100% at the bed temperature. 3. A method according to claim 1 or claim 2, wherein the initial moisture content of the gas stream corresponds to a relative humidity greater than 100% at the bed temperature, said control comprising dehumidifying the gas prior to passage through the bed. 4. A method according to claim 1 or claim 2, wherein the initial moisture content of the gas stream corresponds to a relative humidity less than the minimum of said relative humidity range at the bed temperature, said control comprising humidifying the gas stream prior to passage through the bed. 5. A method of removing carbon dioxide from a stream of industrial off-gas by passing the gas stream through a packed bed of calcium hydroxide maintained at a temperature in the range 10.degree. C.-50.degree. C., including the step of humidifying the gas stream to raise its moisture content to a value corresponding to a relative humidity in the range 40%-100% at the bed temperature and such that the resultant conversion of calcium hydroxide is not less than 0.15, the conversion being defined by ##EQU3## where R is the gas flow rate, 6. A method according to claim 5, wherein the bed is maintained at a temperature in the range 20.degree. C.-30.degree. C., the moisture content of the gas stream corresponding to a relative humidity in the range 80%-100% at the bed temperature. 7. A method of removing and immobilizing carbon dioxide from a gas stream including carbon dioxide containing radioactive carbon as a constituent, which comprises providing a gas filter comprising a packed bed of solid Ca(OH).sub.2 prepared by hydrating CaO and drying, crushing and packing the resultant hydroxide, contacting the gas stream with water to raise its moisture content to a value corresponding to a relative humidity in the range 80%-100% at the temperature of the bed, and flowing the humidified gas stream through the gas filter to effect conversion of the calcium hydroxide to calcium carbonate. 8. A method according to claim 7, wherein the temperature of the bed is in the range 20.degree. C.-30.degree. C. 9. A method according to claim 7, wherein the gas filter is formed by a column comprising a plurality of relatively flat, spaced apart beds of crushed solid calcium hydroxide, the column defining a gas flow path and the beds being arranged in series with respect to said flow path, the spacings between the beds modifying the gas flow to effect redistribution thereof between the filter stages. 10. A method according to claim 9, wherein the temperature of the bed is 20.degree. C.-30.degree. C. |
description | This application is based on and claims priority from Japanese Patent Application No. 2017-101371, filed on May 23, 2017, in the Japanese Patent Office, the disclosure of which is incorporated by reference herein its entirety. Apparatuses, devices, and articles of manufacture consistent with the present disclosure relate to a plasma source, and more particularly, to a plasma source operable to confine plasma generated in a chamber body. A plasma source is used for an ion source of a type which is configured to extract an ion beam from plasma generated in a plasma chamber using electrodes. A plasma source also includes one or more magnets, and the magnets may be, for example, of a permanent magnet type or an electromagnet type to confine plasma in the chamber. During operation of the plasma source, the plasma chamber has a high temperature, and along with the rise in temperature, the magnets tend to become demagnetized. It is an aspect to provide a plasma source with a permanent magnet arrangement capable of realizing both of a reduction in size of the plasma source and suppression of temperature rise in permanent magnets. According to an aspect of one or more exemplary embodiments, there is provided a plasma source comprising a chamber body inside which plasma is generated; a first mirror magnet and a second mirror magnet disposed around the chamber body at positions spaced apart from each other along a first direction; and a cusp magnet disposed around the chamber body at a position between the first and second mirror magnets in the first direction, wherein the first mirror magnet comprises a plurality of first permanent magnets which are arranged around the chamber body in a plane perpendicular to the first direction with a first space between adjacent ones of the first permanent magnets, each of the first permanent magnets having a first polarity, the second mirror magnet comprises a plurality of second permanent magnets which are arranged around the chamber body in the plane perpendicular to the first direction with a second space between adjacent ones of the second permanent magnets, each of the second permanent magnets having the first polarity; and the cusp magnet comprises a plurality of cusp permanent magnets which are arranged around the chamber body in the plane perpendicular to the first direction with a cusp space between adjacent ones of the cusp permanent magnets, the cusp permanent magnets having polarities that alternate around the chamber body between the first polarity and a second polarity that is different from the first polarity. According to another aspect of one or more exemplary embodiments, there is provided a plasma source comprising a chamber body inside which plasma is generated; a first mirror magnet, a second mirror magnet, and a cusp magnet provided around the chamber body and spaced apart in a axial direction thereof, each comprising a plurality of permanent magnets radially spaced apart from each other to form spaces between adjacent permanent magnets thereof; and a cooling medium flow passage provided in the spaces that passes a cooling medium for cooling the chamber body. Hereinafter, various exemplary embodiments of the present disclosure will be described with reference to the accompanying drawings. One of ordinary skill in the art should understand that the present disclosure is not limited to a specific exemplary embodiment described below and with reference to the drawings, but various modifications, equivalents, and/or alternatives of the exemplary embodiments of the present disclosure are included in the scope of the present disclosure. In the accompanying drawings, similar components are assigned similar reference numerals. As an example of a plasma source operable to confine plasma generated in a chamber defined by a chamber body, using a mirror magnet and a cusp magnet which are disposed around the chamber body, there has been known a microwave plasma source. The plasma source is of a type which is configured to extract an ion beam from plasma generated in a plasma chamber, using an anode electrode and an extraction electrode. Specifically, the plasma source includes a pair of mirror magnets disposed around a columnar chamber body defining the plasma chamber therein, at positions spaced apart from each other along an axial direction of the chamber (extraction direction of the ion beam); and a cusp magnet disposed around the chamber body at a position between the mirror magnets. With a view to minimizing the size of any part of the plasma source other than the electrodes for extracting an ion beam, it is advantageous if each of the magnets is composed of a permanent magnet, instead of an electromagnet. However, during operation of the plasma source, the plasma chamber has a high temperature, and, with a rise in temperature of each of the permanent magnets arranged around the chamber body, the permanent magnet tends to become demagnetized. Therefore, the plasma source includes a cooling means for suppressing temperature rise in the permanent magnets The related art makes no mention of a permanent magnet arrangement for satisfying both of a reduction in size of the plasma source and suppression of temperature rise in the permanent magnets. For example, to the extent that the related art such as JP 2000-173486A suggests a permanent magnet arrangement with a view to suppress temperature rise in the permanent magnets, such arrangements cause an increase in the dimensions of the chamber body, thereby leading to an increase in size of the plasma source. Exemplary embodiments described herein provide a plasma source capable of realizing both of a reduction in size of the plasma source and suppression of temperature rise in permanent magnets. According to one or more exemplary embodiments, a plasma source may comprise a chamber body inside which plasma is generated; a pair of mirror magnets disposed around the chamber body at positions spaced apart from each other along a first direction; and a cusp magnet disposed around the chamber body at a position between the pair of mirror magnets, wherein each of the mirror magnets comprises a plurality of permanent magnets which are arranged around the chamber body in a plane perpendicular to the first direction with a first space between adjacent ones thereof, in such a manner that the plurality of permanent magnets have a same chamber-side polarity, wherein the chamber-side polarity of the plurality of permanent magnets comprising one of the mirror magnets is different from the chamber-side polarity of the plurality of permanent magnets comprising the other mirror magnet; and the cusp magnet is comprised of a plurality of permanent magnets which are arranged around the chamber body in a plane perpendicular to the first direction with a second space between adjacent ones thereof, in such a manner that a chamber-side polarity of each of the plurality of permanent magnets and a chamber-side polarity of an adjacent one of the remaining permanent magnets are alternately varied. FIG. 1 is a schematic diagram depicting a plasma source 1 according to an exemplary embodiment. This plasma source 1 comprises a columnar chamber body 2 defining a chamber therein. A microwave is introduced from a waveguide 4 into the chamber through a dielectric window (not depicted) provided in a second end P2 of the chamber body 2. A pair of mirror magnets, including a first mirror magnet m1 and a second mirror magnet m2, are provided around the chamber body 2 at positions spaced apart from each other along the Z direction in the figures. Further, a cusp magnet c is provided around the chamber body 2 at a position between the first mirror magnet m1 and the second mirror magnet m2. In other words, looking in the Z direction from the second end P2, the magnets are arrangement in order of the first mirror magnet m1, the cusp magnet c, and the second mirror magnet m2. Plasma generated in the chamber of the chamber body 2 is confined based on a magnetic field formed in the chamber by the first and second mirror magnets m1, m2 and the cusp magnet c. The chamber body 2 has a first end P1 formed with an opening 3 for extracting therethrough ions or electrons from plasma in the chamber, in the form of a beam, by using a non-depicted electrode. Sectional views of the first mirror magnet m1, the cusp magnet c, and the second mirror magnet m2 taken along an X-Y plane are depicted in FIGS. 2A-2C. As depicted in FIGS. 2A and 2C, each of the first mirror magnet m1 and the second mirror magnet m2 comprises a plurality of permanent magnets P which are arranged along a circumferential direction of the chamber body 2 with a first space S and a second space S, respectively, between adjacent ones thereof, in such a manner that the plurality of permanent magnets P have the same polarity on the side of the chamber (chamber body 2), i.e., the same chamber-side polarity. In other words, the plurality of first permanent magnets P that make up the first mirror magnet m1 have the same polarity (e.g., S-N when looking outward from the center of the chamber in a radial direction) and have the first space S between adjacent ones of the permanent magnets P, and the plurality of second permanent magnets P that make up the second mirror magnet m2 have the same polarity (e.g., N-S when looking outward from the center of the chamber in a radial direction) and have the second space S between adjacent ones of the permanent magnets P. However, this is only an example, and the polarities may be reversed in some exemplary embodiments. In this state, the mirror magnet m1 and the mirror magnet m2 are arranged differently in terms of the chamber-side polarity. Specifically, the chamber-side polarity of the mirror magnet m1 is S-pole as depicted in FIG. 2A, whereas the chamber-side polarity of the mirror magnet m2 is N-pole as depicted in FIG. 2C. It should be noted that this polarity relationship may be reversed. That is, the chamber-side polarity of the mirror magnet m1 may be set to N-pole, and the chamber-side polarity of the mirror magnet m2 may be set to S-pole. As can be understood from FIG. 2B, the cusp magnet c also comprises a plurality of permanent magnets P which are arranged along the circumferential direction of the chamber body 2 with a cusp space S between adjacent ones thereof. Differently from the first mirror magnet m1 and the second mirror magnet m2, the permanent magnets P of the cusp magnet c are arranged such that chamber-side polarities thereof are alternately varied along the circumferential direction of the chamber body 2, as shown in FIG. 2B. The plurality of first permanent magnets P comprising the first mirror magnet and the plurality of second permanent magnets P comprising the second mirror magnet m2 and the plurality of permanent magnets P comprising the cusp magnets c are supported by a non-depicted yoke. The presence of the space S in each of the first mirror magnet m1, the second mirror magnet m2, and the cusp magnet c enables a cooling medium flow passage L to be disposed therein. An external dimension of the plasma source 1 is defined by an outer periphery of the permanent magnets P disposed around the chamber body 2. Thus, a configuration in which a cooling medium flow passage L is disposed in the inter-permanent magnet space S makes it possible to minimize an influence of the cooling medium flow passage L on the external dimension of the plasma source 1, and thus facilitate a reduction in size of the plasma source 1. Among the plurality of cooling medium flow passages L depicted in FIGS. 2A to 2C, each of the three cooling medium flow passages L indicated by the black circle is a flow passage through which a cooling medium flows from the second end P2 to the first end P1 of the chamber body 2. On the other hand, each of the three cooling medium flow passages L indicated by the white circle is a flow passage through which the cooling medium flows from the first end P1 to the second end P2 of the chamber body 2. For example, as the cooling medium, purified water may be used. However, it should be understood that this is only an example, and any other cooling medium that is capable of circulation through the cooling medium flow passages L may be used. Moreover, FIGS. 2A-2C show six cooling medium flow passages L. However, this is only an example, and the number of cooling medium flow passages L may be less than or more than six. Additionally, FIGS. 2A-2C show a cooling medium flow passage L in each space S between each adjacent two permanent magnets P of the first mirror magnet m1, second mirror magnet m2, and cusp magnet c. However, this is only an example, and in some exemplary embodiments, the cooling medium flow passage L may be provided in only a portion of the spaces S. As depicted in FIGS. 2A-2C, each of the plurality of inter-permanent magnet spaces S between adjacent ones of the six permanent magnets that comprise each of the first mirror magnet m1 and the second mirror magnet m2, and an associated one of the plurality of inter-permanent magnet spaces S between adjacent ones of the six permanent magnets comprising the cusp magnet c, may be aligned in the Z direction. In other words, the topmost inter-permanent magnet space S in each of FIGS. 2A-2C may be aligned in the Z direction, and the remaining inter-permanent magnet spaces S may similarly be aligned in the Z direction. In this case, the cooling medium flow passage L passing through each set of the Z-directionally aligned inter-permanent magnet spaces S in the magnets m1, m2, and c can be formed in a linear shape, so that the configuration of the cooling medium flow passage L is simplified. However, this linear shape is only an example, and the cooling medium flow passage L passing through the inter-permanent magnet spaces S does not necessarily need to have a linear shape, but may be somewhat bent, e.g., have one or more partially-bent portions, depending on the configuration. FIGS. 3A-3C show an example in which the first mirror magnet m1, the cusp magnet c, and the second mirror magnet m2 are configured such that the inter-permanent magnet spaces S are not aligned as in FIGS. 2A-2C and the cooling medium flow passage L includes partially-bent portions. In the case where the cooling medium flow passage L is bent, for example, the first mirror magnet m1, the cusp magnet c and the second mirror magnet m2 may have X-Y sections as depicted in FIGS. 3A, 3B and 3C, respectively. In the exemplary embodiment shown in FIGS. 3A-3C, each of the inter-permanent magnet spaces S between adjacent ones of the permanent magnets comprising each of the first mirror magnet m1 and the second mirror magnet m2 are aligned, but an associated one of the inter-permanent magnet spaces S between adjacent ones of the permanent magnets comprising the cusp magnet c are not aligned and are at different positions in the X-Y plane from the inter-permanent spaces S of the first mirror magnet m1 and the second mirror magnet m2, as shown in FIGS. 3A-3C. It should be noted that it is also possible for the first mirror magnet m1, the cusp magnet c and the second mirror magnet m2 to be arranged such that each of the inter-permanent magnet spaces S are formed at different positions in the X-Y plane, such that none of the inter-permanent magnet spaces S are aligned with each other. This arrangement however increases the number of partially-bent portions. Even in the permanent magnet arrangement depicted in FIGS. 3A-3C, the cooling medium flow passage L is provided in the inter-permanent magnet spaces S, so that it becomes possible to realize both of a reduction in size of the plasma source and suppression of temperature rise in permanent magnets, as with the arrangement shown in FIGS. 2A-2C. FIGS. 4A-4C depict a cooling passage in the plasma source of FIG. 1, according to an exemplary embodiment. FIGS. 4A-4C depict a configuration of a cooling passage comprising the cooling medium flow passages L in FIGS. 2A-2C. Specifically, FIG. 4A is a perspective view of the cooling passage formed in the chamber body 2. FIG. 4B depicts a ring-shaped cooling medium turnaround passage LC formed in the first end P1 of the chamber body 2 depicted in FIG. 4A. FIG. 4C depicts arc-shaped cooling medium inlet passage and an arc-shaped cooling medium outlet passage formed in the second end P2 of the chamber body 2 depicted in FIG. 4A. The cooling medium may be supplied to the second end P2 of the chamber body 2 in a direction (e.g., a +Z direction in the example shown in FIG. 4A) indicated by the arrowed line IN in FIG. 4A. The cooling medium supplied to the chamber body 2 divides and flows into three cooling medium inflow passages L indicated by the solid lines in FIG. 4A, and, after passing through the first and second spaces S in the first mirror magnet m1, the second mirror magnet m2, and the cusp magnet c, flows to the first end P1 of the chamber body 2. A ring-shaped cooling medium turnaround passage LC (thick line) is formed in the first end P1 of the chamber body 2. The above cooling medium inflow passages L indicated by the solid lines are connected to the ring-shaped cooling medium turnaround passage LC. Further, three cooling medium outflow passages L (broken lines) are connected to the ring-shaped cooling medium turnaround passage LC. The cooling medium outflow passages L (broken lines) are provided as a path by which the cooling medium flows from the first end P1 to the second end P2 of the chamber body 2. The cooling medium that has flowed back to the second end P2 through the cooling medium outflow passages L (broken lines) is discharged outside the chamber body 2 in a direction (e.g., a −Z direction in the example of FIG. 4A) indicated by the arrowed line OUT in FIG. 4A. In some exemplary embodiments, unlike the exemplary embodiment of FIGS. 4A-4C that show a ring-shaped cooling medium turnaround passage, each of the cooling medium inflow passages L (solid lines) may be directly connected to a respective one of the cooling medium outflow passages L (broken lines) via one of a plurality of (in this exemplary embodiment, three) cooling medium turnaround passages formed in the first end P1. In other words, the three cooling medium turnaround passages may be formed by providing the cooling medium turnaround passages as a plurality of arc-shapes, for example, by cutting the ring-shaped cooling medium turnaround passage LC into the arc-shapes. Alternatively, in some exemplary embodiments, the cooling medium turnaround passage may be provided as a plurality of linear (i.e., straight) passages such that the cooling medium turnaround passage is provided in a square-like shape. However, compared to the case where a cooling medium turnaround passage is formed in the first end P1 the chamber body 2 by cutting into arc-shaped cooling medium turnaround passages or by providing a plurality of linear passages in a square-like shape, the ring-shaped cooling medium turnaround passage LC that is shown in FIGS. 4A-4C may be more readily fabricated than the arc-shaped or linear cooling medium turnaround passages. It should be noted that the term “ring-shaped” does not necessarily denote a round shape, but may include a quadrangular or polygonal shape or the like. That is, the term “ring-shaped” herein denotes a closed loop-like shape. In the plasma source 1 according to the exemplary embodiments described above, supply of the cooling medium to the cooling medium inflow passages and discharge of the cooling medium from the cooling medium outflow passages are performed through the second end P2. Alternatively, the supply and discharge of the cooling medium may be performed through the first end P1. However, in the plasma source 1 according to the exemplary embodiments described above, the opening 3 is formed in the first end P1 to perform extraction of a beam such as an ion beam or release of ions or the like, through the opening 3. Thus, in the case where the supply and discharge of the cooling medium are performed through the first end P1, there is a disadvantage that the supply of the cooling medium to the cooling medium inflow passages and the discharge of the cooling medium from the cooling medium outflow passages may hinder the beam extraction or the like. Considering this disadvantage, even if the supply and discharge of the cooling medium may be performed without hindering the release of ions or electrons or the beam extraction, an area capable of performing the supply and discharge of the cooling medium is restricted by other factors such as electrodes arranged adjacent to the opening, etc. Therefore, the supply and discharge of the cooling medium through the second end P2 may provide a more simplified configuration of the plasma source. Although the above exemplary embodiments have been described based on an example in which the chamber body 2 has a columnar shape, the chamber body 2 may have any other suitable shape such as a rectangular parallelepiped shape, a cubic shape or a rectangular columnar shape. Although the above exemplary embodiments have been described based on an example in which a length direction of the chamber body 2 is defined as the Z direction, the chamber body 2 may be formed such that it has a Y-directional dimension greater than a Z-directional dimension. Although the above exemplary embodiments have been described based on an example in which a microwave is introduced into the chamber of the chamber body 2 using the waveguide 4, the plasma source may be configured to introduce any high-frequency wave other than a microwave. Further, the plasma source may comprise an antenna inserted into the chamber, in addition to the waveguide, wherein it may be configured to introduce a high-frequency wave into the chamber via the antenna. Although the above exemplary embodiments have been described based on an example in which one cooling medium flow passage L is disposed in each set of the Z-directionally aligned or associated inter-permanent magnet spaces S, two or more cooling medium flow passages L may be disposed in each set of the Z-directionally aligned or associated inter-permanent magnet spaces S. Although the above exemplary embodiments have been described based on an example in which the number of permanent magnets P comprising each of the first magnet m1, the second magnet m2, and the cusp magnet c is set to the same value (six, in the examples described above), this is only an example. The number of permanent magnets P needs not necessarily be set to the same value. For example, the first mirror magnet m1, the second mirror magnet m2, and the cusp magnet c may be comprised, respectively, of three sets of different numbers of permanent magnets P. That is, in some exemplary embodiments, for example, the first mirror magnet m1 may have 4 permanent magnets, the second mirror magnet m2 may have 6 permanent magnets and the cusp magnet may have 8 permanent magnets. Exemplary embodiments provide a plasma source comprising a chamber body inside which plasma is generated; a pair of mirror magnets disposed around the chamber body at positions spaced apart from each other along a first direction; and a cusp magnet disposed around the chamber body at a position between the pair of mirror magnets, wherein each of the mirror magnets is composed of a plurality of permanent magnets which are arranged around the chamber body in a plane perpendicular to the first direction with a first space between adjacent ones thereof, in such a manner that the plurality of permanent magnets have a same chamber-side polarity, wherein the chamber-side polarity of the plurality of permanent magnets composing one of the mirror magnets is different from the chamber-side polarity of the plurality of permanent magnets composing the other mirror magnet; and the cusp magnet is composed of a plurality of permanent magnets which are arranged around the chamber body in a plane perpendicular to the first direction with a second space between adjacent ones thereof, in such a manner that a chamber-side polarity of each of the plurality of permanent magnets and a chamber-side polarity of an adjacent one of the remaining permanent magnets are alternately varied. The plasma source may further comprise a cooling medium flow passage provided in the first space between adjacent ones of the plurality of permanent magnets composing each of the mirror magnet and the second space between adjacent ones of the plurality of permanent magnets composing the cusp magnets. The first space between adjacent ones of the plurality of permanent magnets composing each of the mirror magnets and the second space between adjacent ones of the plurality of permanent magnets composing the cusp magnet may be aligned in the first direction. Each of the first and second spaces may be formed plurally, wherein the cooling medium flow passage comprises a cooling medium inflow passage and a cooling medium outflow passage which are provided, respectively, in different spaces in each of a set of the plurality of first spaces and a set of the plurality of second spaces. The chamber body may have a first end formed with an opening for releasing therethrough ions or electrons from plasma generated inside the chamber body, wherein input and output of a cooling medium with respect to the cooling medium flow passage are performed through a second end of the chamber body located on the side opposite to the first end in the first direction. The first end of the chamber body may have a ring-shaped cooling medium turnaround passage to which one end of the cooling medium flow passage provided in the first and second spaces is connected. According to various exemplary embodiments disclosed here, a plasma source is provided with a permanent magnet arrangement that may realize a reduction in size of the plasma source while also suppressing temperature rise in the permanent magnets in the permanent magnet arrangement. While the present disclosure has been shown and described with reference to various exemplary embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present disclosure as defined by the appended claims and their equivalents. |
|
description | This application is a Continuation of U.S. patent application Ser. No. 13/607,329, filed Sep. 7, 2012, which is hereby incorporated by reference. The present invention relates to charged particle beam systems, more specifically to a system and method for laser beam alignment within charged particle beam systems. Charged particle beam systems are used in a variety of applications, including the manufacturing, repair, and inspection of miniature devices, such as integrated circuits, magnetic recording heads, and photolithography masks. Charged particle beams include ion beams and electron beams. Ions in a focused beam typically have sufficient momentum to micromachine by physically ejecting material from a surface. Because electrons are much lighter than ions, electron beams are typically limited to removing material by inducing a chemical reaction between an etchant vapor and the substrate. Both ion beams and electron beams can be used to image a surface at a greater magnification and higher resolution than can be achieved by the best optical microscopes. Since ion beams tend to damage sample surfaces even when used to image, ion beam columns are often combined with electron beam columns in dual beam systems. Such systems often include a scanning electron microscope (SEM) that can provide a high-resolution image with minimal damage to the target, and an ion beam system, such as a focused or shaped beam system, that can be used to alter workpieces and to form images. Dual beam systems including a liquid metal focused ion beam and an electron beam are well known. Focused ion beam milling in many instances are unacceptably slow for some micromachining applications. Other techniques, such as milling with a femtosecond laser can be used for faster material removal but the resolution of these techniques is lower than a typical LMIS FIB system. Lasers are typically capable of supplying energy to a substrate at a much higher rate than charged particle beams, and so lasers typically have much higher material removal rates (typically up to 7×106 μm3/s for a 1 kHz laser pulse repetition rate) than charged particle beams (typically 0.1 to 3.0 μm3/s for a Gallium FIB). Laser systems use several different mechanisms for micromachining, including laser ablation, in which energy supplied rapidly to a small volume causes atoms to be explosively expelled from the substrate. All such methods for rapid removal of material from a substrate using a laser beam will be collectively referred to herein as laser beam milling. The combination of a charged particle beam system with a laser beam system can demonstrate the advantages of both. For example, combining a high resolution LMIS FIB with a femtosecond laser allows the laser beam to be used for rapid material removal and the ion beam to be used for high precision micromachining in order to provide an extended range of milling applications within the same system. The combination of an electron beam system, either alone or in conjunction with a FIB, allows for nondestructive imaging of a sample. FIG. 1 shows a prior art dual beam system 100 having a combination charged particle beam column 101 and laser 104. Such a dual beam system is described in U.S. Pat. App. No. 2011/0248164 by Marcus Straw et al., for “Combination Laser and Charged Particle Beam System,” which is assigned to the assignee of the present application, and which is hereby incorporated by reference. U.S. Pat. App. No. 2011/0248164 is not admitted to be prior art by its inclusion in this Background section. As shown in the schematic drawing of FIG. 1, the laser beam 102 from laser 104 is focused by lens 106 located inside the vacuum chamber 108 into a converging laser beam 120. The laser beam 102 enters the chamber through a window 110. A single lens 106 or group of lenses (not shown) located adjacent to the charged particle beam 112 is used to focus the laser beam 120 such that it is either coincident and confocal with, or adjacent to, the charged particle beam 112 (produced by charged particle beam focusing column 101) as it impacts the sample 114 at location 116. Integrating a laser beam system with a charged particle beam system provides significant challenges. Problems may arise in spatially stabilizing the laser beam that is used in conjunction with a charged particle beam. The stability of the laser is determined by its ability to precisely maintain its direction as well as its initial position with the output aperture. The laser beam position may drift, however, over time with variations in temperature, mechanical vibrations inside the laser, and other environmental conditions. Periodic re-alignment of the laser beam is therefore required to compensate for the drift. Aligning a laser beam within a charged particle beam system is currently a very tedious and time consuming manual process and requires significant expertise. Automated beam positioning in laser beam systems is well known. See “Automatic beam alignment system for a pulsed infrared laser”, Review of Scientific Instruments 80, 013102 (2009). Past systems usually use a controller that receives signals from beam position detectors, and consequently issue commands for motorized optical elements (e.g., adjustable mirrors) in order to maintain proper alignment of the beam. Unfortunately, other than aligning the laser beam manually, there is currently no practical system that allows for the convenient alignment of the laser beam positioning in charge particle beam systems. The small sample chamber of a charged particle beam system makes it difficult to house components needed for beam alignment systems. What is needed is a method and apparatus for a convenient way to align a laser beam within a charged particle beam system without the need for performing the alignment manually. An object of the invention is to provide a method and apparatus to perform an alignment of a laser beam within a charged particle beam system that is done in conjunction with an electron beam or focused ion beam that provides coincident alignment with the system's eucentric point. According to a preferred embodiment of the present invention, a beam positioning system may be used to provide this type of alignment. Another object of the invention is to provide a system having a vacuum chamber, a workpiece support within the vacuum chamber, a charged particle beam system for generating a beam of charged particles, a laser beam system for generating a laser beam, and a laser beam alignment system for aligning the laser beam, wherein the laser beam alignment system has a laser beam position detector in the vacuum chamber. The system will have a second beam position detector outside the vacuum chamber and beam steering mirrors to make adjustments to the laser beam so that the laser beam is aligned to the eucentric point of a charged particle beam system. Another object of the invention is to provide a method of making adjustments to a laser beam comprising a charged particle beam source capable of generating a charged particle beam, providing a vacuum chamber, providing a laser beam source capable of generating a laser beam, providing a laser beam alignment system that allows the laser beam source to be aligned to the eucentric point of a charged particle beam system. Another object of the invention is to provide a method of using a laser system with a charge particle beam system, wherein the steps include generating a charged particle beam to be used on a workpiece, generating a laser beam to be used on the workpiece, wherein the laser beam is aligned eucentrically to the workpiece. The aligning process of the laser beam is performed using an alignment detector that is located within the vacuum chamber of the system, as well as an alignment detector that is located outside the detector. The foregoing has outlined rather broadly the features and technical advantages of the present invention in order that the detailed description of the invention that follows may be better understood. Additional features and advantages of the invention will be described hereinafter. It should be appreciated by those skilled in the art that the conception and specific embodiments disclosed may be readily utilized as a basis for modifying or designing other structures for carrying out the same purposes of the present invention. It should also be realized by those skilled in the art that such equivalent constructions do not depart from the spirit and scope of the invention as set forth in the appended claims. The accompanying drawings are not intended to be drawn to scale. In the drawings, each identical or nearly identical component that is illustrated in various figures is represented by a like numeral. For purposes of clarity, not every component may be labeled in every drawing. The incorporation of a laser beam system with a charged particle system involves difficulties with the amount of time and expertise required to align the laser beam. The common methods for aligning a laser beam inside a vacuum chamber are very tedious and time consuming manual processes. Embodiments of the present invention provide advantages over common methods of manually aligning a laser beam within a charged particle beam system. Some embodiments of the present invention provide a system for the alignment of a laser beam within a charged particle beam system using laser position sensors. FIG. 2 shows a schematic view of a laser beam alignment system 201 according to a preferred embodiment that is used in charged particle beam system. A laser beam source 205 generates a laser beam 204. Two fast steering mirrors 202, 203 are positioned to control the direction of the laser beam 204. Fast steering mirrors (FSM) have the ability to mechanically tilt the mirror in order to control the direction of the laser beam. FSMs are well known to those having skill in the art, and need not be described further herein. Other types of beam steering mirrors are well known in the art, including scanning mirrors. A galvanometer based scanning mirror can be used in place of FSMs and are also well known to those having skill in the art. Fast steering beam mirrors 202 and 203 are connected by lines 207 and 208 to fast steering mirror controllers 206 and 213. Voice coils, or devices that are galvanometers or act like galvanometers, are used in fast steering mirrors to use the electrical signals it receives from the controllers. Fast steering mirror controllers 206 and 213 control the fine pointing and tracking of the laser beams. Fast steering mirror 202 is coupled to the quad cell detector 210 via the controller 206. Quad cell detector 210 is located outside the chamber wall 209 of the charged particle beam system 201. Chamber wall 209 separates the vacuum chamber of the charged particle beam system 201 from the outside. As laser beam 204 reflects off of fast steering mirror 202 and 203, laser beam 204 is split with a beam sampler, or beam splitter 211, to form a second beam 223. Beam splitter 211 is a conventional beam splitter that separates the beam into two component beams. The power splitting between the two component beams is determined by the reflection and transmission coefficients of the beam splitter. Second beam 223 is directed to quad cell detector 210. Generally, second beam 223 is the weaker beam of the two split beams. Quad cell detector 210 and quad cell detector 215 can be conventional alignment detectors that are capable of detecting the alignment, or the position, of a laser beam source. A position sensitive detector (PSD) is another type of an alignment detector. A PSD can be generally a photoelectric device that converts an incident light, or laser beam, into continuous position data. In other words, a PSD can detect and record the position of incident light beams. A PSD can have various configurations, including a quadrant detector configuration or a dual axis lateral effect detectors. The purpose of these two types is to sense the position of the beam centroid in the X-Y plane orthogonal to the optical axis. In order to measure the X and Y position from the PSD, four electrodes are attached (not shown) to the detector and an algorithm then processes the four currents generated by photoabsorption. Quad cell detector 210 is generally fixed and provides the positional data of laser beam 204 to FSM controller 206. It then makes the adjustments in the fast steering mirror 202 so that the laser beam comes to an alignment point 220. Laser beam 204 enters the vacuum chamber via window 212 where the laser beam is focused using objective lens 214. Quad cell detector 215 is coupled to controller 213 and fast steering mirror 203. Quad cell detector 215 is located inside the chamber wall 209 within the vacuum chamber. Quad cell detector 215 works with the fast steering mirror controller 213 and fast steering mirror 203 to mechanically align the laser beam 204 to an alignment point 221. The in-chamber quad cell detector 215 is able to be positioned remotely with relatively good positional accuracy and high repeatability. Other types of alignment detectors can perform the detection of the laser alignment or position detection. A quad cell detector is generally a uniform disk with two gaps across its surface. It generates four signals from each quadrant of the disk. The laser beam is varied on the disk until the signal strength of each quadrant of the disk is equal. The in-chamber quad cell detector 215 is capable of being retracted or moved to clear the path for laser beam 204 with retractor 222. Retractor 222 can be controlled remotely from outside the vacuum chamber 360 and can be any mechanism that can move the quad cell detector 215 from its alignment position to a position away from laser beam pathway. The mechanism can be a lever that is manually adjusted in the X-Y-Z direction, or the mechanism can be an electronic component that can electronically adjust the quad cell detector 215 in the X-Y-Z direction. The mechanism must allow the retractor 222 to move the quad cell detector 215 in and out of the proper position accurately and repeatedly. The retractor 222 is aligned to the optical axis of the objective lens 214. In one embodiment of the invention, the objective lens 214 provides a hard stop for the quad cell detector 215 (not shown). It would include an electronically controlled actuator arm that slides the quad cell detector 215 in and out of the proper aligned position. FIG. 3 shows a system 300 according to a preferred embodiment of the present invention that combines a focused laser beam 216 (produced by a laser 306) for rapid material removal with a focused ion beam (FIB) 352 (produced by a FIB column 304) for further material processing and an electron beam 350 (produced by a SEM column 302) for monitoring the material removal process. A laser 306 directs a laser beam 308 towards a first steering mirror 202, which reflects the laser beam 308 to form a first reflected beam 312. First reflected beam 312 is directed towards a second steering mirror 203, which reflects the first reflected beam 312 to form a second reflected beam 322 which is directed through transparent window 212 in vacuum chamber 360. By “transparent” it is meant that the window is transparent to wavelengths of the particular type of laser being used. Steering mirrors 202 and 203 (or a similar reflecting elements) are used to adjust the position of the laser beam 216 on the sample 320. An objective lens 214 focuses the laser beam 322 (which may be substantially parallel) into a focused laser beam 216 with a focal point at or near to the surface of a sample 320. In some embodiments, laser beam 216 is preferably capable of being operated at a fluence greater than the ablation threshold of the material in sample 320 being machined. Preferred embodiments of the invention could use any type of laser, now existing or to be developed, that supplies sufficient fluence. A preferred laser provides a short, nanosecond to femtosecond, pulsed laser beam. Suitable lasers include, for example, a Ti:Sapphire oscillator or amplifier, a fiber-based laser, or an ytterbium- or chromium-doped thin disk laser. Other embodiments may use a laser having less fluence that reacts with the workpiece without ablation, such as thermally induced chemical desorption processes using a laser or the process of laser photochemistry. The current system allows for the manipulation of the fast steering mirrors 202 and 203 to be precisely controlled with the adjustments calculated by the reading of the quad cell detectors 210 and 215 so that the alignment of the laser beam can be made through the center of the objective lens 214 and ultimately, targeting the eucentric point of the target 320. Quad cell detector 214 is located as close to the output of the objective lens 214 as practically possible to provide better precision of the laser beam and to prevent damage to the detector induced by the focused laser beam. Sample 320 is typically positioned on a precision stage (not shown), which preferably can translate the sample in the X-Y plane, and more preferably can also translate the work piece in the Z-axis, as well as being able to tilt and rotate the sample for maximum flexibility in fabricating three-dimensional structures. System 300 optionally includes one or more charged particle beam columns, such as an electron beam column 302, an ion beam column 304, or both, which can be used for imaging the sample to monitor the laser ablation process, or for other processing (such as FIB-milling) or imaging tasks. Ion beam column 304 typically forms a beam of ions 352 which may be focused onto the sample surface 320 at or near the focal point of the laser beam 318. FIB column 304 may also be capable of scanning ion beam 352 on the substrate surface to perform imaging and/or FIB milling. System 300 may also include a gas injection 330 system for supplying a precursor gas that reacts with the substrate 320 in the presence of the electron beam 350 or focused ion beam 352. As is well-known in the prior art, the electron beam column 302 comprises an electron source (not shown) for producing electrons and electron-optical lenses (not shown) for forming a finely focused beam of electrons 350 which may be used for SEM imaging of the sample surface 320. The beam of electrons 350 can be positioned on, and can be scanned over, the surface of the sample 320 by means of a deflection coil or plates (not shown). Operation of the lenses and deflection coils is controlled by power supply and control unit (not shown). It is noted that the lenses and deflection unit may manipulate the electron beam through the use of electric fields, magnetic fields, or a combination thereof. Sample chamber 360 preferably includes one or more gas outlets for evacuating the sample chamber using a high vacuum and mechanical pumping system under the control of a vacuum controller (not shown). Sample chamber 360 also preferably includes one or more gas inlets through which gas can be introduced to the chamber at a desired pressure. FIG. 4 is a flowchart showing the steps of an algorithm for the alignment of the laser beam system 300 of FIG. 3 in accordance with one of the embodiments. Before the algorithm is begun, in step 401, the beam must be coarsely focused and aligned so that the laser beam is aligned to point 220. This step should be done with the system vented and the isolation table, if any, floated. Laser beam 204 is further positioned so that it passes through the laser injection port (LIP) window 214 and into the vacuum chamber 360. Adequate coarse focus will generally result in the formation of visible plasma when the vacuum chamber is open. The optical emission from the plasma will enable the user to roughly position the focus of the laser beam close to the eucentric point of the column (the LIP window 214 is capable of being manually translated in X, Y, and Z from outside the chamber). The LIP window 214 can be shifted in the X and Y directions, which positions the beam on the sample. The LIP window 214 can be moved in and out in the Z axis so that that focus of the beam can be directed to a desired location, e.g., so that the beam is aligned with the eucentric point of the system. After the manual coarse focus and positioning of the beam, the system 300 is pumped down and the electron beam turned on. Generally, the manual manipulation for coarse focusing will only need to be done the first time the laser is aligned with system 300. In step 402, quad cell 215 is moved to its pre-aligned position in the laser beam pathway. In step 403, the position of the laser beam 204 on the beam splitter 211 is monitored at quad cell detector 210. Beam position information from quad cell detector 210 is converted to a usable signal (via the fast steering mirror 202 and controller 206). In steps 404 and 411, controller 206 works with the voice coils of fast steering mirror 202, which provides the precision adjustments needed to steer the beam to be coincident with point 220. Steps 404 and 411 are performed repeatedly until the beam is aligned properly to point 220. Once the beam is aligned properly to point 220, in step 405, the position of the beam at the objective lens 214 is monitored by quad cell detector 215. As with quad cell detector 210, beam position information from quad cell detector 215 is converted to a voltage (via the fast steering mirror 203 and controller 213) that is applied to the voice coils of fast steering mirror 203. The adjustments made to fast steering mirror 203 with controller 213 is repeatedly, sequentially, and iteratively made until the beam is coincident with point 221 in step 407. If the beam is targeted properly on point 221, in step 408, the beam position is once again monitored at beam splitter 211 with quad cell detector 210. In step 409, the beam is monitored to be targeted on point 220. The whole process is repeated until the beam is aligned with both points 220 and 221. Once alignment of beam is made to be coincident with points 220 and 221, the beam enters LIP window 212. The location of the beam is checked on fast steering mirror 203. It is necessary to use fast steering mirror 203 to direct the beam so that it is centered on sample 320 because the fast steering mirror 203 is used to scan the beam on sample 320. If the beam is not centered on the fast steering mirror 203, the scan may not be linear across the scan field. Not having it centered may also limit the extent of the scan in one direction. In cases where fast steering mirror 203 is not centered on sample 320, the entire mirror assembly is moved in the X/Y directions in step 410 as needed to center the beam. In this process, the angle of the mirror is generally not changed. Once the laser beam is aligned to be coincident with the system's eucentric point, a retractor 222 is used to move quad cell detector 215 out of the beam path to allow the beam to be incident with the sample. In use, the laser beam is focused to the eucentric point of the charged particle system. The eucentric point is typically a prior known distance from the end of the electron column 302. The focus of electron beam 350 is adjusted such that the focus distance is the same as the eucentric point of the system and the workpiece height is adjusted until the sample comes into focus. A laser spot is then machined on the sample and compared to the system's eucentric point. If the laser spot is not positioned at the eucentric point, the LIP window 212 is manually adjusted until the correct position is achieved. The alignment procedure detailed above is repeated and the manual positioning of the laser spot is performed again. The whole process is iterated until the beam is aligned and positioned at the eucentric point and the electron beam 350 is aligned to the eucentric point. Once the alignment is set, LIP window 212 position is fixed. The invention described above has broad applicability and can provide many benefits as described and shown in the examples above. The embodiments will vary greatly depending upon the specific application, and not every embodiment will provide all of the benefits and meet all of the objectives that are achievable by the invention. For example, in a preferred embodiment TEM samples are created using a gallium liquid metal ion source to produce a beam of gallium ions focused to a sub-micrometer spot. Such focused ion beam systems are commercially available, for example, from FEI Company, the assignee of the present application. However, even though much of the previous description is directed toward the use of FIB milling, the milling beam used to process the desired TEM samples could comprise, for example, an electron beam, a laser beam, or a focused or shaped ion beam, for example, from a liquid metal ion source or a plasma ion source, or any other charged particle beam. Further, although much of the previous description is directed at semiconductor wafers, the invention could be applied to any suitable substrate or surface. Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made to the embodiments described herein without departing from the spirit and scope of the invention as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, composition of matter, means, methods and steps described in the specification. As one of ordinary skill in the art will readily appreciate from the disclosure of the present invention, processes, machines, manufacture, compositions of matter, means, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps. |
|
description | The present invention relates to a plant operation system for supporting the operation of a plant and a plant operation method of supporting the operation of a plant. An abnormality detection and diagnosis system which detects abnormality or an indication of abnormality in a facility such as a plant and diagnoses the facility is described in the related art (refer to, for example, PTL 1). This system is provided with a database unit storing information on a maintenance history of a plant or a facility and outputs a work instruction relating to necessary maintenance with respect to the occurred abnormality or abnormality indication by linking abnormality detection information detected by a sensor provided in the facility with the information on the maintenance history. [PTL 1] Japanese Unexamined Patent Application Publication No. 2012-137934 However, in the system of PTL 1, there is a case where even if the occurred abnormalities are different types of abnormalities, the abnormality detection information which is obtained is similar, and in this case, it is thought that it is difficult to output an appropriate work instruction for the occurred abnormality. Therefore, the present invention has an object to provide a plant operation system and a plant operation method in which it is possible to perform a diagnosis of abnormality of the plant and promptly provide a maintenance system with the result of the abnormality diagnosis. A plant operation system according to the present invention is a plant operation system for supporting operation of a plant, the system including: an operation monitoring system which monitors the operation of the plant and controls the operation of the plant; an abnormality indication monitoring system which monitors an indication of abnormality of the plant, based on an operation history of the plant which is monitored in the operation monitoring system; an abnormality diagnosis system which performs a diagnosis of abnormality of the plant, based on a result of the abnormality indication which is detected by the abnormality indication monitoring system; and a maintenance system which is used for performing maintenance and management of the plant, in which the operation monitoring system, the abnormality indication monitoring system, and the abnormality diagnosis system are connected to one another so as to be able to communicate from the operation monitoring system to the abnormality indication monitoring system and the abnormality diagnosis system, the abnormality diagnosis system and the maintenance system are connected to each other so as to be able to communicate with each other, and the abnormality diagnosis system provides the maintenance system with a result of the diagnosis of abnormality of the plant. Further, a plant operation method according to the present invention is a plant operation method of supporting operation of a plant, the method including: an operation monitoring step of monitoring the operation of the plant and controlling the operation of the plant; an abnormality indication monitoring step of monitoring an indication of abnormality of the plant, based on an operation history of the plant which is monitored in the operation monitoring step; an abnormality diagnosis step of performing a diagnosis of abnormality of the plant, based on a result of the abnormality indication which is detected in the abnormality indication monitoring step; and a maintenance step of performing maintenance and management of the plant, in which the result of the diagnosis of abnormality of the plant obtained in the abnormality diagnosis step is referred to in the maintenance step. According to this configuration, the maintenance system can instruct a maintenance worker to perform the maintenance and management of the plant based on the provided result of the abnormality diagnosis, or can provide the maintenance worker with information on the abnormality diagnosis. Further, it is preferable that the maintenance system has a maintenance terminal which acquires the result of the abnormality diagnosis from the abnormality diagnosis system, and a maintenance mobile terminal which can perform wireless communication with the maintenance terminal, and the maintenance terminal provides the result of the abnormality diagnosis toward the maintenance mobile terminal. According to this configuration, it is possible to provide the maintenance worker who carries the maintenance mobile terminal with the result of the abnormality diagnosis. Further, it is preferable that the maintenance terminal and the maintenance mobile terminal are provided in a building in which the plant is installed. According to this configuration, it is possible to enhance the security concerning the communication between the maintenance terminal and the maintenance mobile terminal. Hereinafter, an embodiment relating to the present invention will be described in detail based on the drawings. The present invention is not limited by this embodiment. Further, constituent elements which can be easily replaced by those skilled in the art or constituent elements which are substantially equal to the constituent elements are included in constituent elements in the following embodiment. Further, the constituent elements described below can be appropriately combined with each other, and in a case where there are a plurality of embodiments, it is also possible to combine the respective embodiments. FIG. 1 is a schematic configuration diagram relating to an atomic power plant operation system according to this embodiment. An atomic power plant operation system 100 is a system for supporting the operation of an atomic power plant. As shown in FIG. 1, the atomic power plant is, for example, an atomic power generation plant 110 having an atomic reactor, and the atomic power generation plant 110 is controlled so as to perform base load operation and provided in a site 115. The atomic power plant operation system 100 will be described with reference to FIG. 1. In this embodiment, the atomic power plant operation system 100 will be described as being applied to the atomic power generation plant 110 as a plant. However, there is no limitation to this configuration, and it may be applied to plants (for example, a chemical plant, a thermal power generation plant, or the like) other than the atomic power plant. As shown in FIG. 1, the atomic power plant operation system 100 is provided with an operation monitoring system 101, an abnormality indication monitoring system 102, an abnormality diagnosis system 103, a maintenance system 104, and an operation history database 105. Further, in the atomic power plant operation system 100, the respective systems 101, 102, 103, and 104 and the operation history database 105 are communicably connected to each other by a station bus 107 and a plurality of unit buses 108a, 108b, and 108c. The operation monitoring system 101 monitors and controls the operation of the atomic power generation plant 110. The operation monitoring system 101 is provided with a distributed control system (DCS) 121, a process control system (PCCS: Process Control Computer System) 122, and a gateway 123. The distributed control system 121 is configured to include a plurality of control devices which are connected so as to be able to control the atomic power generation plant 110 and in which a plurality of control functions are distributed. The distributed control system 121 is a system for controlling the operations of the respective devices such as pumps and valves (not shown) provided in the atomic power generation plant 110. The distributed control system 121 controls the operation of the atomic power generation plant 110 by controlling the operation of each device, based on a control signal from the process control system 122. Further, the distributed control system 121 is connected to a plurality of measuring instruments which are provided in the atomic power generation plant 110, acquires a plurality of measurement parameters which are respectively output from the plurality of measuring instruments, as plant operation data, and outputs the acquired plant operation data toward the process control system 122. The process control system 122 is connected to the distributed control system 121 through the unit bus 108a and provided in a central control room (MCR: Main Control Room) 131 distant from a building 133 in which the atomic power generation plant 110 is provided. The process control system 122 acquires the plant operation data which is input from the distributed control system 121, and outputs a control signal for controlling the operation of the atomic power generation plant 110 toward the distributed control system 121. Further, the process control system 122 outputs the plant operation data acquired from the distributed control system 121 toward the operation history database 105 through the gateway 123 and the station bus 107. The gateway 123 is provided between the process control system 122 and the station bus 107 and connected to each of the process control system 122 and the station bus 107. The gateway 123 allows output of the plant operation data from the process control system 122 while restricting input of data from another system to the process control system 122. The operation monitoring system 101 acquires the plant operation data from the atomic power generation plant 110 and monitors the acquired plant operation data. Further, the operation monitoring system 101 causes the atomic power generation plant 110 to perform base load operation such that a plurality of measurement parameters which are included in the acquired plant operation data reach a predefined target value. In this manner, the atomic power generation plant 110 performs the base load operation, and therefore, the target value becomes a steady-state value. The operation history database 105 is connected to the station bus 107 through the unit bus 108b and a gateway 124. That is, the gateway 124 is provided between the unit bus 108b and the station bus 107 and connected to each of the unit bus 108b and the station bus 107, and the operation history database 105 is connected to the unit bus 108b. The operation history database 105 is provided in an office 132 distant from the building 133 in which the atomic power generation plant 110 is provided. The operation history database 105 stores the history of the plant operation data by accumulating the plant operation data output from the distributed control system 121. The operation history database 105 can output the plant operation data in response to a request from the abnormality diagnosis system 103 and the maintenance system 104. The abnormality indication monitoring system 102 is connected to the unit bus 108b and can acquire the plant operation data output from the operation history database 105, through the unit bus 108b. Further, the abnormality indication monitoring system 102 can acquire the plant operation data output from the distributed control system 121 in real time. The abnormality indication monitoring system 102 compares a normal range which is set based on the past plant operation data stored in the operation history database 105 with the current plant operation data acquired in real time, and detects an abnormality indication of the atomic power generation plant 110 in a case where the plant operation data exceeds the normal range. Further, the abnormality indication monitoring system 102 is connected to the unit bus 108b and can output abnormality sign data, which is data relating to the detected abnormality indication, toward the abnormality diagnosis system 103. The abnormality diagnosis system 103 is connected to the unit bus 108b and can acquire the abnormality sign data output from the abnormality indication monitoring system 102, through the unit bus 108b. The abnormality diagnosis system 103 specifies a facility or a device which causes abnormality, among various facilities and various devices configuring the atomic power generation plant 110, based on the abnormality sign data. Further, the abnormality diagnosis system 103 is connected to the unit bus 108c and can output a diagnostic result relating to the specified facility or device, as maintenance data, toward the maintenance system 104. The maintenance system 104 is a system for maintaining and managing the atomic power generation plant 110. The maintenance system 104 acquires the maintenance data of the atomic power generation plant 110 diagnosed by the abnormality diagnosis system 103 and provides a maintenance worker with the acquired maintenance data or acquires and accumulates a maintenance inspection result which is obtained by inspection work or the like by the maintenance worker, as the maintenance data. The maintenance system 104 is provided with a maintenance database 135, a maintenance terminal 136, and a maintenance mobile terminal 137. The maintenance database 135 is provided in the office 132 and connected to the unit bus 108c. The maintenance database 135 outputs the maintenance data to the abnormality diagnosis system 103, accumulates the maintenance data which is input from the maintenance terminal 136 and the maintenance mobile terminal 137, or outputs the maintenance data acquired from the abnormality diagnosis system 103 to the maintenance terminal 136. The maintenance terminal 136 is provided in the building 133 which is a non-managed area where the atomic power generation plant 110 is provided, and is connected to the unit bus 108c. The maintenance terminal 136 provides the maintenance worker with the maintenance data acquired from the maintenance database 135 or outputs the maintenance data input by the maintenance worker to the maintenance database 135. The maintenance terminal 136 may be provided in the office 132. The maintenance mobile terminal 137 is carried by the maintenance worker and can perform wireless communication with the maintenance terminal 136. The maintenance inspection result which is obtained by inspection work, visual inspection, or the like by the maintenance worker is input as the maintenance data to the maintenance mobile terminal 137 by the maintenance worker. Further, the maintenance mobile terminal 137 outputs the input maintenance data toward the maintenance terminal 136 by wireless communication. At this time, the maintenance terminal 136 and the maintenance mobile terminal 137 are provided in the building 133, and the wireless communication between the maintenance terminal 136 and the maintenance mobile terminal 137 is performed in the building 133. In this manner, in the atomic power plant operation system 100, the respective systems 101, 102, 103, and 104 and the operation history database 105 are connected by the respective buses 107, 108a, 108b, and 108c, and therefore, it is possible to share various kinds of data obtained by the respective systems 101, 102, 103, and 104 and process the shared various kinds of data. Further, in the atomic power plant operation system 100, a large information terminal 141 is provided in a conference room 134 in the office 132, and the large information terminal 141 is connected to the unit bus 108b. In addition to the maintenance data accumulated in the maintenance system 104, the data acquired in each of the systems 101, 102, and 103 can be displayed on the large information terminal 141. Next, an abnormality diagnosis by the abnormality diagnosis system 103 will be described with reference to FIG. 2. The abnormality diagnosis system 103 is configured using hardware resources of a computer or the like, acquires the abnormality sign data which is output from the abnormality indication monitoring system 102, and performs a diagnosis of abnormality of the atomic power generation plant 110, based on the acquired abnormality sign data. Here, the abnormality sign data which is output from the abnormality indication monitoring system 102 will be described with reference to FIG. 2. FIG. 2 is an explanatory diagram showing a measurement parameter. In FIG. 2, the vertical axis is the value of the measurement parameter and the horizontal axis is time. The abnormality indication monitoring system 102 sets a normal range W that is a range in which the plant operation data normally changes, based on the past plant operation data stored in the operation history database 105, as described above. Further, the abnormality indication monitoring system 102 determines whether or not the current plant operation data which is acquired in real time changes in the normal range W. Here, the measurement parameter is divided into a normality determination area E1 which is in a normal state and an abnormality determination area E2 which is in an abnormal state, by a warning value K as a threshold value for determining the presence or absence of abnormality, and the normal range W is set in the normality determination area E1. For this reason, the abnormality indication monitoring system 102 detects whether or not there is a sign of abnormality in the atomic power generation plant 110 although the atomic power generation plant 110 is not in an abnormal state. In this manner, the measurement parameter in which a determination that there is an abnormality indication is made by the abnormality indication monitoring system 102 is a behavior before reaching the warning value K beyond the normal range W, and this measurement parameter is input to the abnormality diagnosis system 103 as the abnormality sign data. The abnormality diagnosis system 103 compares the acquired abnormality sign data with the previously stored abnormality model pattern and specifies an abnormality cause by using a Bayesian network as a statistical model. The abnormality model pattern is a pattern of the behavior of the measurement parameter which changes according to a cause of abnormality of the atomic power generation plant 110. A plurality of abnormality model patterns are provided according to various abnormality causes, and the abnormality cause and the probability of occurrence of the abnormality cause are associated with each of the abnormality model patterns. The abnormality model patterns corresponding to the measurement parameters will be described with reference to FIG. 3. FIG. 3 is an explanatory diagram showing the abnormality model patterns of the measurement parameters, and the abnormality causes corresponding to the abnormality model patterns. As shown in FIG. 3, for example, with regard to a measurement parameter A, two abnormality model patterns PA and PB are prepared. A plurality of abnormality causes CA1, CA2 are associated with the abnormality model pattern PA on one side, and a plurality of occurrence probabilities OA1, OA2 are respectively associated with the plurality of abnormality causes CA1, CA2. A plurality of abnormality causes CB1, CB2 are associated with the abnormality model pattern PB on the other side, and a plurality of occurrence probabilities OB1, OB2 are respectively associated with the plurality of abnormality causes CB1, CB2. The measurement parameter A in FIG. 3 is an example, and there are also a case where the abnormality model pattern is one and a case where the abnormality cause is one. The Bayesian network is a statistical model which is constructed based on a plurality of abnormality model patterns corresponding to the abnormality causes, and the probabilities of occurrence of the abnormality causes which are associated with the plurality of abnormality model patterns. An example of the Bayesian network will be described with reference to FIG. 4. FIG. 4 is an explanatory diagram of the Bayesian network. A Bayesian network M is a model for deriving the abnormality cause and the probability of occurrence of the abnormality cause from a plurality of measurement parameters in a case where there are a plurality of measurement parameters in which a determination that there is an abnormality indication is made. As shown in FIGS. 3 and 4, the abnormality causes CA1 to CA3 are associated with the abnormality model pattern PA, and similarly, the abnormality causes CB1 to CB3 and CC1 to CC3 are also associated with the abnormality model patterns PB and PC. Further, as the abnormality causes, there are abnormality causes α, β, and γ, and the abnormality causes α, β, and γ are associated with the abnormality causes CA1 to CA3, CB1 to CB3, and CC1 to CC3. Specifically, the abnormality cause CA1, the abnormality cause CB1, and the abnormality cause CC1 are associated with the abnormality cause α, and the probability of occurrence of the abnormality cause α takes into account the presence or absence and the probabilities of occurrence of the abnormality cause CA1, the abnormality cause CB1, and the abnormality cause CC1. The abnormality cause β and the abnormality cause γ are also as shown in FIG. 4. In a case of specifying the abnormality cause, the abnormality diagnosis system 103 first generates an abnormality sign pattern, based on the abnormality sign data. As described above, since the abnormality sign data is the measurement parameter which is a behavior before reaching the warning value K beyond the normal range W, the abnormality diagnosis system 103 generates a prediction model L (refer to FIG. 2) which predicts the progress of the measurement parameter by an extrapolation method, with respect to the measurement parameter. Further, the abnormality diagnosis system 103 generates a pattern of the behavior of the measurement parameter of the prediction model L as the abnormality sign pattern. Further, the abnormality diagnosis system 103 specifies the cause of abnormality of the atomic power generation plant 110 by making a determination of the match between the generated abnormality sign pattern and the abnormality model pattern. Specifically, the abnormality diagnosis system 103 determines whether or not the abnormality sign pattern of a predetermined measurement parameter matches any one of a plurality of abnormality model patterns corresponding to the predetermined measurement parameter. Then, the abnormality diagnosis system 103 specifies the abnormality cause corresponding to the abnormality model pattern determined to match, as the abnormality cause of the abnormality sign pattern, specifies the occurrence probability corresponding to the specified abnormality cause, and outputs the specified results as diagnosis results. At this time, in a case where there are a plurality of abnormality causes corresponding to the abnormality model pattern, the abnormality diagnosis system 103 specifies a plurality of abnormality causes and an occurrence probability corresponding to each of the abnormality causes by using the Bayesian network shown in FIG. 4. Then, the abnormality diagnosis system 103 outputs the diagnosis results as the maintenance data to the maintenance database 135. The maintenance system 104 outputs data relating to maintenance work which is associated with an abnormality cause from the maintenance terminal 136 to the maintenance mobile terminal 137 so as to perform maintenance and management of the specified abnormality cause by using the acquired maintenance data. In this way, the maintenance system 104 sends a work instruction to the maintenance worker and provides the maintenance worker with information on the abnormality cause. Further, the maintenance system 104 can provide the maintenance worker with instructions, procedures, work reports, or the like relating to the maintenance work. The maintenance worker carries the maintenance mobile terminal 137, executes the instructed maintenance work, and inputs information obtained by the maintenance work to the maintenance mobile terminal 137. As the information which is obtained by the maintenance work, for example, there are values of instruments which are provided in a device, and a state of the device, such as abnormal noise. The maintenance mobile terminal 137 inputs the input information to the maintenance database 135 through the maintenance terminal 136, as the maintenance data. Therefore, in addition to the diagnosis results of the abnormality diagnosis system 103, the information which is obtained by the maintenance work is also accumulated as the maintenance data in the maintenance database 135. Further, in the maintenance and management, the maintenance system 104 refers to the maintenance data that is the result of the abnormality diagnosis provided from the abnormality diagnosis system 103 and stored in the maintenance database 135. As described above, according to this embodiment, it is possible to detect an abnormality indication of the atomic power generation plant 110, based on the plant operation data that is the operation history of the atomic power generation plant 110, perform a diagnosis of abnormality of the atomic power generation plant 110, based on the result of the detected abnormality indication, and promptly provide the result of the abnormality diagnosis to the maintenance system 104. For this reason, the maintenance system 104 can instruct the maintenance worker to perform the maintenance and management of the atomic power generation plant 110 based on the provided result of the abnormality diagnosis, or provide the maintenance worker with information on the abnormality diagnosis. Further, according to this embodiment, it is possible to provide the maintenance worker who carries the maintenance mobile terminal 137 with the result of the abnormality diagnosis. Further, according to this embodiment, since the maintenance terminal 136 and the maintenance mobile terminal 137 are used in the building 133 of the atomic power generation plant 110, it is possible to enhance the security concerning the communication between the maintenance terminal 136 and the maintenance mobile terminal 137. 100: atomic power plant operation system 101: operation monitoring system 102: abnormality indication monitoring system 103: abnormality diagnosis system 104: maintenance system 105: operation history database 107: station bus 108a. 108b, 108c: unit bus 110: atomic power generation plant 115: site 121: distributed control system 122: process control system 123: gateway 124: gateway 131: central control room 132: office 133: building 134: conference room 135: maintenance database 136: maintenance terminal 137: maintenance mobile terminal 141: large information terminal W: normal range K: warning value E1: normality determination area E2: abnormality determination area M: Bayesian network |
|
abstract | An object of the present invention is to provide an inspection apparatus for inspecting weld zones in a reactor pressure vessel, the inspection apparatus comprising: an ultrasonic probe 6 for emitting an ultrasonic wave; a probe holding unit 60 for holding the ultrasonic probe 6 such that a ultrasonic wave transmitting surface of the ultrasonic probe 6 is kept in direct contact with or at a constant distance from the outer surface of the reactor pressure vessel 1; a pressing unit 50 for pressing the probe holding unit 60 parallel to a central axis of a control rod drive housing 8 against the reactor pressure vessel; and a rotator 40 for rotating the probe holding unit 60 and the pressing unit 50 about the central axis of the control rod drive housing 8. |
|
055531091 | description | BEST MODE FOR CARRYING OUT THE INVENTION Referring to FIGS. 2(a)) and 2(b), there is illustrated a closed pressure vessel 10 having a coolant, for example, water, within the vessel 10. Heating elements according to the present invention are disposed within vessel 10 in contact with the coolant. Such heating elements may comprise a single-ended heater rod 12, as in FIG. 2(a)), or a double-ended heater rod 14, as illustrated in FIG. 2(b). A single-ended heater rod exits the pressure vessel 10 only at one end, while the double-ended heater rod exits the pressure end at both the top and bottom ends of vessel 10. One or more of the heater rods embodying the two heater elements as described below may be disposed in the vessel 10. Referring now to FIG. 3, there is illustrated an example of a single-ended heater rod comprised of a double helix heating element. Heater rod 16 includes internal double helix heating elements 18 and 20 separated from an outer tubular metallic cladding 22 by suitable electrical insulation, typically boron nitride. The heating element can be fabricated from a uniform wall thickness tube using a numerically controlled machine tool. Thus, two continuous helices are generated with a width versus length variation which represents the desired power versus length relationship for each of the two length terms f.sub.1 (x) and f.sub.2 (x), as set forth in Equation (2). One end of each of the two helices is connected to ground and the other ends are coupled to two independently variable power supplies. Thus, the heater rod 16 may be connected to the independent power supply 24 having a controller 26 for varying the power output from supply 24 as a function of time. Similarly, power for the heater rod 16 is supplied independently from a separate power supply 28 having a separate controller 30 for varying the power output from supply 28 to the heater rod 16 as a different function of time than the controller 26. Referring now to FIG. 4, there is illustrated in cross-section a pair of coaxially and radially spaced heating elements forming a heater rod. The coaxial heater elements 32 and 34 are separated one from the other by electrically insulating material 36. It will be appreciated that more than two coaxially arranged heating elements can be provided to more accurately represent Equation (1) for a nuclear fuel rod. Also, the cladding may serve as the outer element 34 for the fuel rod simulator. These elements can be either solid or of a helical configuration. If the elements are solid, the axial power profile can be realized by either using tapered wall tubes of one material or uniform wall thickness tubes of more than one material with different coefficients of electrical resistivity. The ends of the two heating elements have a common ground and the other two ends are connected to electrically separate power supplies, similarly as in the embodiment of FIG. 3. With respect to double-ended heater rods as illustrated in FIG. 2, those rods exit the pressure vessel at both the top and bottom ends. Double-ended heater rods may be of the helix or coaxial type, or a combination of both types. With reference to FIG. 1(a)), there is graphically depicted the output of the two heater element FRS versus length, i.e., the length along the simulated fuel rod from its lower end to its upper end, at three different times. As will be appreciated, the power supplied to each heater rod element can be independently and continuously changed over time. Thus, by continuously changing the power supplied to the heating elements, with one element being weighted toward an initial steady state condition and the other weighted toward a transient condition, the total power developed is additive of the two heater elements at each location along the simulated nuclear rod and the change in the flux shape as a function of time of a nuclear transient condition can be simulated. Thus, while previously only the total bundle power output as a function of time was available, with the present invention, both the total bundle power output and the axial change in the flux shape of the simulated nuclear fuel bundle versus time can be approximated. A simplified example is given in FIGS. 1(a)) and 1(b). In FIG. 1(a)), the power output of two heater elements at time t=o is given s wherein heater element (1) is at 100% power and heater element (2) is at 0% power, giving an average relative power of about 1.75 for the four given axial locations (nodes). At time t=t.sub.1, the heater elements are both at 50% power thereby giving an average relative power of about 1.312 for the four given axial nodes. At time t=t.sub.2, the heater element (1) is at 0% power and heater element (2) is at 100% power, giving an average relative power of about 0.875 for the four axial nodes. In FIG. 1(b), the graph gives the total relative power variation for both heater elements with axial position and time. These values for the simplified representative example of FIGS. 1(a)) and 1(b)) may thus be tabulated as follows: ______________________________________ Tabular Values for FIG. 1 Relative Powers t = o t = t.sub.1 t = t.sub.2 Axial (Element #) (Element #) (Element #) Node (1) (2) (1) (2) (1 + 2) (1) (2) ______________________________________ 1 1 0 0.5 0.25 0.75 0 0.5 2 3 0 1.5 0.5 2.0 0 1.0 3 2 0 1.0 0.75 1.75 0 1.5 4 1 0 0.5 0.25 0.75 0 0.5 Average 1.75 0 0.875 0.4375 1.3125 0 0.875 Relative Power ______________________________________ Consequently, it will be seen that the independently controlled heater elements may approximate or simulate in power output and axial flux shape a nuclear fuel bundle as a function of time. While the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment, it is to be understood that the invention is not to be limited to the disclosed embodiment, but on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. |
abstract | The present invention includes a composition of LiF—ThF4—UF4—PuF3 for use as a fuel in a nuclear engine. |
|
summary | ||
summary | ||
summary | ||
abstract | A brachytherapy source delivery device includes a first tissue-piercing leg having proximal and distal ends, a second tissue-piercing leg having proximal and distal ends, wherein the proximal ends of the first and second tissue-piercing legs are joined at a span section in a first angular orientation with respect to each other, and a carrier element formed at, or attached to, the span section, the carrier element configured to support a radioactive brachytherapy source. The distal ends of the first and second legs can be curved inward toward each other to pierce a tissue when engaged toward each other into a closed position. The first and second tissue-piercing legs can be formed of a wire having a circular cross-sectional or non-circular cross-sectional shape. The carrier element can be tangentially attached to the span section. Each of the legs have a length that is greater than the length of the span section. |
|
claims | 1. A method for model-based scatter correction in a single photon emission computed tomography (SPECT) system, the method comprising:detecting, with a SPECT detector having a non-parallel-hole collimator, emissions from a patient;generating an image object from the emissions;forward projecting from the image object to a first data model in data space;forming a model-based scatter source from convolution of the image object with scatter kernels, the scatter kernels being kernels from a simulation of scatter with a parallel hole collimator normalized by sensitivity as a function of location measured for the non-parallel-hole collimator;determining a model of scatter from a vector map measured from the non-parallel-hole collimator and the model-based scatter source;combining the first data model with the model of scatter into a projection data model; anddisplaying a SPECT image of the patient as a function of the projection data model. 2. The method of claim 1 wherein detecting comprises detecting with the non-parallel-hole collimator being a multi-focal collimator with holes being more parallel along edges than inward from the center of the multi-focal collimator. 3. The method of claim 1 wherein generating the image object from the emissions, forward projecting, and combining are performed as part of iterative reconstruction, the displaying being of the SPECT image resulting from the iterative reconstruction. 4. The method of claim 1 wherein forward projecting comprises transforming the image object with a system matrix for the SPECT detector. 5. The method of claim 1 wherein forward projecting comprises forward projecting the image object for energies in a window about a photon energy of non-scatter ones of the emissions. 6. The method of claim 1 wherein forming comprises forming with the simulation being a Monte Carlo simulation. 7. The method of claim 1 wherein forming comprises forming with the sensitivity for the non-parallel-hole collimator being at a photon energy for non-scatter ones of the emissions. 8. The method of claim 1 wherein forming further comprises accounting for patient-specific characteristics in scatter with computed tomography data representing the patient. 9. The method of claim 1 wherein determining comprises convolving the vector map and the model-based scatter source with a point spread function. 10. The method of claim 1 wherein determining comprises ray tracing using the model-based scatter source and the vector map. 11. The method of claim 1 wherein determining comprises forward projecting the model-based scatter source. 12. The method of claim 1 wherein combining comprises estimating which of emissions of the first data model are without scatter and which of the emissions of the first data model are from scatter, and creating the projection data model from the emissions without scatter. 13. A single photon emission computed tomography (SPECT) system comprising:a non-parallel-hole collimator;a detector for detecting emissions from a patient, the detector adjacent to the non-parallel-hole collimator;a reconstruction processor configured to:generate an image object from the emissions,forward project from the image object to a first data model in data space,form a model-based scatter source from convolution of the image object with scatter kernels, the scatter kernels being kernels from a simulation of scatter with a parallel hole collimator normalized by sensitivity as a function of location measured for the non-parallel-hole collimator,determine a model of scatter from a vector map measured from the non-parallel-hole collimator and the model-based scatter source, andcombine the first data model with the model of scatter into a projection data model; anda display configured to display a SPECT image of the patient as a function of the projection data model. 14. The system of claim 13 wherein the non-parallel-hole collimator is a multi-focal collimator with holes being more parallel along edges than inward from the center of the multi-focal collimator. 15. The system of claim 13 wherein the non-parallel-hole collimator comprises angles of holes to form at least one of a plane, a fan beam, or a cone of response with spatial variance in orientation. |
|
abstract | The nuclear fuel assembly having nuclear fuel rods and a support skeleton having two nozzles, guide tubes interconnecting the nozzles, and spacer grids for holding the rods, the grids being secured to the guide tubes. The assembly further has at least one lattice reinforcing device for reinforcing the support skeleton. The reinforcing device is placed between two spacer grids and is secured to the guide tubes. The invention is applicable to fuel assemblies for pressurized water reactors. |
|
description | This application claims priority from Japanese Patent Application No. 2008-053031, filed on Mar. 4, 2008, the entire contents of which are hereby incorporated by reference. 1. Technical Field Devices and apparatuses consistent with the present disclosure relate to extreme ultraviolet radiation and, more particularly, to a connection device provided between an extreme ultraviolet radiation source and an extreme ultraviolet radiation receiving device. 2. Related Art FIG. 7 shows an example of a configuration of a related-art connection device between an extreme ultraviolet radiation source (hereinafter, referred to as an “EUV radiation source”) and a chamber containing an exposure tool. FIG. 7 is a cross-sectional view taken along an optical axis. The EUV radiation source has a chamber 10 as a discharge vessel. The chamber 10 of the EUV radiation source includes a first chamber 10a and a second chamber 10b. The first chamber 10a is provided with a discharge portion 1 for heating and exciting an EUV radiating species. The second chamber 10b is provided with an EUV collector mirror 2 for collecting EUV radiation. The EUV radiation is emitted from high temperature plasma generated from the EUV radiating species heated and excited by the discharge portion 1. The EUV collector mirror 2 collects the EUV radiation, and guides the EUV radiation from an EUV radiation output portion 4 of the second chamber 10b to an irradiation optical system including an exposure tool (not shown). The first chamber 10a is connected to exhaust unit 9c. The second chamber 10b is connected to a first gas supply unit 16a and a second gas supply unit 16b for supplying cleaning gas or the like and also is connected to a first gas exhaust unit 9a and a second gas exhaust unit 9b. The insides of the chambers 10a and 10b are depressurized by the gas exhaust units 9a, 9b, and 9c. In the discharge portion 1, a first discharge electrode 11 as a disk-shaped member made of metal and a second discharge electrode 12 as a disk-shaped member made of metal are disposed with an insulator 13 interposed therebetween. The center of the first discharge electrode 11 and the center of the second discharge electrode 12 are substantially on the same axis, and the first discharge electrode 11 and the second discharge electrode 12 are fixed at positions away from each other by a thickness of the insulator 13. A diameter of the second discharge electrode 12 is larger than that of the first discharge electrode 11. The thickness of the insulator 13, that is, a distance between the first discharge electrode 11 and the second discharge electrode 12 is about 1 mm to about 10 mm. A rotating shaft 6a of a motor 6 is attached to the second discharge electrode 12 such that the center of the first discharge electrode 11 and the center of the second discharge electrode 12 are substantially on the same rotating axis of the rotating shaft 6a. The rotating shaft 6a is introduced into the chamber 10 with, for example, a mechanical seal. The mechanical seal allows the rotating shaft 6a to rotate with the depressurized atmosphere kept in the chamber 10. A first wiper 12a and a second wiper 12b formed of, for example, carbon brush or the like are provided below the second discharge electrode 12. The second wiper 12b is electrically connected to the second discharge electrode 12. The first wiper 12a is electrically connected to the first discharge electrode 11 through a through hole 12c penetrating the second discharge electrode 12. Insulation breakdown does not occur between the first wiper 12a and the second discharge electrode 12. The first wiper 12a and the second wiper 12b are configured as electrical contact points keeping electrical connection while the first wiper 12a and the second wiper 12b are wiped, and are connected to a pulsed power supply 15. The pulsed power supply 15 supplies pulsed power between the rotating first discharge electrode 11 and second discharge electrode 12 through the first wiper 12a and the second wiper 12b. Peripheral portions of the first discharge electrode 11 and the second discharge electrode 12, which are the disk-shaped members made of metal, are tapered to produce a pointed edge. In other words, a diameter of the first discharge electrode 11 on a side facing the second discharge electrode 12 is slightly larger than a diameter of the first discharge electrode 11 on the opposite side from the second discharge electrode 12. Similarly, a diameter of the second discharge electrode 12 on a side facing the first discharge electrode 11 is slightly larger than a diameter of the second discharge electrode 12 on the opposite side from the first discharge electrode 11. When power is applied from the pulsed power supply 15 to the first discharge electrode 11 and the second discharge electrode 12 as described later, electrical discharge occurs between the tapered edge portions of the electrodes. When the electrical discharge occurs, temperature of the vicinity of the electrodes becomes high. Accordingly, the first discharge electrode 11 and the second discharge electrode 12 are made of high melting point metal such as tungsten, molybdenum, and tantalum. The insulator is made of, for example, silicon nitride, aluminum nitride, diamond, and the like. Solid tin (Sn) or solid lithium (Li) as a raw material for producing high temperature plasma is supplied to the discharge portion 1. The raw material is supplied from a raw material supply unit 14 to a groove portion 12d formed around the peripheral portion of the second discharge electrode 12. That is, the raw material is supplied into the groove portion 12d of the disk-shaped member that forms the second discharge electrode 12. The motor 6 rotates in only one direction, the rotating shaft 6a is rotated by the operation of the motor 6, and the first discharge electrode 11 and the second discharge electrode 12 connected to the rotating shaft 6a are rotated in one direction. Sn or Li supplied to the groove portion 12d of the second discharge electrode 12 is moved toward the EUV radiation outgoing side in the discharge portion 1 by the rotation of the second discharge electrode 12. The chamber 10 is provided with a laser irradiator 5 for irradiating laser onto the Sn or Li that is moved toward the EUV radiation outgoing side. The laser irradiator 5 may be formed of YAG laser, CO2 laser, or the like. The laser from the laser irradiator 5 is irradiated onto Sn or Li which is in the groove portion of the second discharge electrode 12 moved toward the EUV radiation outgoing side through a laser collecting means and a laser transmission window portion (not shown) in the chamber 10. As described above, the diameter of the second discharge electrode 12 is larger than that of the first discharge electrode 11. Accordingly, the laser passes by the side of the first discharge electrode 11 and is irradiated onto the groove portion 12d of the second discharge electrode 12. The EUV radiation from the discharge portion 1 is radiated as follows. The laser is irradiated from the laser irradiator 5 onto the Sn or Li in the groove portion 12d. The Sn or Li irradiated with the laser is evaporated between the first discharge electrode 11 and the second discharge electrode 12, and a part of the Sn or Li is ionized. Under such a condition, when the pulsed power supply 15 applies pulsed power, a voltage of which is about +20 kV to about −20 kV, between the first discharge electrode 11 and the second discharge electrode 12, an electrical discharge occurs between the tapered edge portions provided at the peripheral portions of the first discharge electrode 11 and the second discharge electrode 12. At this time, pulse-shaped high current flows at the partially ionized portion of Sn or Li evaporated between the first discharge electrode 11 and the second discharge electrode 12. A high temperature plasma P is formed, at the peripheral portion of the both electrodes, from the evaporated Sn or Li by Joule heating of the pinch effect, and EUV radiation having a wavelength of 13.5 nm radiates from the high temperature plasma P. As described above, since the pulsed power is applied between the first discharge electrode 11 and the second discharge electrode 12, the electrical discharge is a pulse discharge and the radiating EUV radiation is a pulse radiation having a pulse shape. The EUV radiation radiated from the discharge portion 1 is collected by an oblique-incidence type EUV collector mirror 2, and is guided, via the EUV radiation output portion 4 provided in the second chamber lob, to the irradiation optical system of the exposure tool (not shown) provided in a third chamber 10c. The EUV collector mirror 2 includes a plurality of, for example, rotating oval bodies having different diameters or paraboloid mirrors. The rotating center axes of the mirrors are overlapped with one another so that focal positions thereof substantially coincide with one another. The mirrors are configured to satisfactorily reflect EUV radiation having an oblique incident angle of about 0 to about 25 degrees by minutely coating a reflection side of a base material having a smooth surface formed of, for example, nickel (Ni) or the like, with a metal film such as ruthenium (Ru), molybdenum (Mo), or rhodium (Rh). A foil trap 3 is disposed between the discharge portion 1 and the EUV collector mirror 2 to prevent damage of the EUV collector mirror 2. The foil trap 3 catches debris such as metal powder generated by sputtering the first discharge electrode 11 and the second discharge electrode 12 which are in contact with the high temperature plasma, or debris caused by Sn or Li that is a radiating species, and thus allows only EUV radiation to pass. The foil trap 3 includes a plurality of plates (foil) and a ring-shaped supporter for supporting the plates. The plates are disposed in a diameter direction of a high temperature plasma generating area so as not to block the EUV radiation from the high temperature plasma. When the foil trap 3 is provided between the discharge portion 1 and the EUV collector mirror 2, pressure between the high temperature plasma P and the foil trap 3 increases and thus collision of debris increases. The debris reduces the kinetic energy by repeated collision. Accordingly, energy of the debris is reduced when the debris collides with the EUV collector mirror 2, and thus it is possible to reduce damage to the EUV collector mirror 2. As described above, the EUV radiation radiated from the high temperature plasma P generated in the EUV radiation source is collected by the EUV collector mirror 2, and is sent out via the EUV radiation output portion 4 of the second chamber 10b. The EUV radiation output portion 4 is connected to an EUV radiation output portion 7 provided in a housing of the exposure tool. That is, the EUV radiation collected from the EUV collector mirror 2 enters the exposure tool through the EUV radiation output portion 4 and the EUV radiation output portion 7. The exposure tool has an illumination optical system for application of the incident EUV radiation. The illumination optical system forms a shape of the EUV radiation incident from the EUV radiation output portion 7, and then irradiates a mask formed with a circuit pattern. The optical system in the exposure tool has no glass material allowing the EUV radiation to pass therethrough. Accordingly, a reflection optical system is employed instead of a transmission optical system such as a lens system, and the illumination optical system includes reflection type optical elements such as one or more reflection mirrors. The light reflected by the reflection type mask is reduced and projected onto a work (for example, a wafer coated with resist) by a projection optical system, and a reduced circuit pattern of the mask is formed on the work. Similarly to the illumination optical system, the projection optical system also employs a reflection optical system, and includes reflection type optical elements such as one or more reflection mirrors. The EUV radiation is absorbed by air, and thus components such as an illumination optical system of an exposure tool, a mask, a projection optical system, a work, and a work stage are installed in a vacuum. These components are installed in a housing of the exposure tool. Gas existing in the housing is exhausted by a gas exhaust unit, and an inside of the housing is kept at a low pressure. The EUV radiation receiving unit 7 provided in the housing of the exposure tool and the EUV radiation output portion 4 provided in the EUV radiation source are connected to each other through a connection device 20. The inside of the chamber (second chamber 10b) of the EUV radiation source and the inside of the housing (third chamber 10c) of the exposure tool have a structure capable of differential pumping by the gas exhaust units, respectively. In the EUV radiation source, various kinds of gas are used such as a gas for generating a high temperature plasma for radiating the EUV radiation, a gas for reducing the debris caused by the high temperature plasma or electrode materials, and a gas for cleaning an inner wall of the chamber or the collector mirror. For example, JP-T-2006-529057 describes that cleaning of debris may be performed with halogen gas. Meanwhile, the inside of the exposure tool connected to the EUV radiation source is kept in a high vacuum state to prevent attenuation of the EUV radiation. For this reason, it is advantageous to prevent movement of gas from the EUV radiation source to the exposure tool. For example, JP-A-2004-172626 describes a related art technique for forming a barrier using a gas lock in a lithography device in which an EUV radiation source and an exposure tool are connected each other. As described above, in the EUV radiation source for radiating the extreme ultraviolet radiation, the various kinds of gas are used. As such, the pressure of the EUV radiation source is set to about 1 Pa. Meanwhile, the inside of the exposure tool, which is connected to the EUV radiation source and to which the extreme ultraviolet radiation is introduced, is also kept in a high vacuum state (for example, about 10−5 Pa) to prevent attenuation of the EUV radiation. Accordingly, unnecessary gas is removed from the inside of the exposure tool by performing a degassing process. Thus, since the inner environments in the EUV radiation source and the exposure tool are different from each other, it is advantageous to prevent movement of gas from the EUV radiation source to the exposure tool on an interface between them. For example, a halogen gas used for cleaning is likely to decrease the characteristics of the optical components or to have an influence on a movement mechanism of the optical components. Accordingly, it is advantageous to prevent halogen gas from flowing into the exposure tool. As a general blocking method for preventing the movement of gas, a physical blocking means (e.g., a gate valve, a thin film filter) has been proposed in the related art. However, in the related art gate valve, there is a disadvantage in that a connection portion is covered with a lid. Accordingly, the related art gate valve cannot be used during an exposure operation, i.e., during the generation of EUV radiation. On the other hand, the related art thin film filter can be used during the exposure operation by selecting a material allowing the EUV radiation to pass therethrough. However, a pressure difference between the EUV radiation source and the exposure tool may be on the order of about 105 Pa. Accordingly, there is a disadvantage in that in a case where the thin film filter has a thickness capable of withstanding the pressure difference, permeability of the EUV radiation decreases. Accordingly, for example, as described in FIG. 7, the connection device 20 is provided in a differential pumping portion between the EUV radiation receiving portion 7 of the exposure tool and the EUV radiation output portion 4 of the second chamber 10b. In other words, the connection device 20 forms an interface between the EUV radiation source and the exposure tool. Gas is supplied from a third gas supply unit 20a to the connection device 20, and thus the movement of the gas on the interface between the EUV radiation source and the exposure tool is controlled. That is, as shown in FIG. 8, a gas for preventing the movement of gas between the EUV radiation source and the exposure tool (hereinafter “stop gas”) is supplied from the gas supply unit 20a to the connection device 20. The stop gas is allowed to flow in both directions toward the EUV radiation source and the exposure tool, and inflow of gas such as a cleaning gas from the EUV radiation source to the exposure tool is prevented. JP-A-2004-172626 describes a related art lithography device for coupling a first chamber and a second chamber using a gas lock. In this case, the gas of the gas lock forms a barrier separating the first chamber and the second chamber. FIG. 9 shows an example of the gas pressure of the related art connection device 20 in case of using differential pumping and a stop gas. In FIG. 9, a horizontal axis represents a distance from a stop gas inlet in a center-axis direction (i.e., an X-axis direction in FIG. 8), and the right side in the same figure represents the EUV radiation source side. A position of 0 in the horizontal axis is a center position of the stop gas inlet (in FIG. 9, the position of 0 is shown in the scale of the horizontal axis). A vertical axis represents a pressure (Pa). A graph A represents a pressure distribution of the stop gas supplied to a differential pumping portion, and a graph B represents a pressure distribution of a gas (e.g., cleaning gas) supplied to the EUV radiation source. As can be seen from FIG. 9, the gas on the EUV radiation source side does not flow into the exposure tool side by the operations of the differential pumping and the stop gas. However, while the related art connection device acts to prevent gas from flowing between the first chamber and the second chamber, the related art connection device has a few disadvantages. For example, when the stop gas is supplied to the differential pumping portion as described above, a high pressure layer is formed by the stop gas with respect to a passing direction of the EUV radiation. Accordingly, there is a disadvantage in that the EUV radiation does not easily pass through the high pressure layer (i.e., a permeability decreases). For example, as shown in FIG. 9, a thickness of a part where the pressure of the stop gas is 100 Pa with respect to the passing direction of the EUV radiation is about 9 mm. To reduce the thickness of the layer, it is conceivable to reduce a supply rate of the stop gas. However, if the supply rate of the stop gas is reduced to reduce the thickness, there is a disadvantage in that gas easily flows from the EUV radiation source into the exposure tool. As described above, in order to prevent the movement of gas, it is conceivable to use the related art gate valve or the related art thin film filter. However, the related art gate valve has a disadvantage in that the gate valve cannot be used during the EUV radiation generation. The related art film filter has a disadvantage in that the permeability of the EUV radiation decreases. Exemplary embodiments of the present invention address the above disadvantages and other disadvantages not described above. However, the present invention is not required to overcome the disadvantages described above, and thus, an exemplary embodiment of the present invention may not overcome any of the disadvantages described above. Illustrative aspects of the present invention provide a connection device for connecting an extreme ultraviolet radiation outgoing device and an extreme ultraviolet radiation receiving device, in which gas in the extreme ultraviolet radiation outgoing device can be prevented from flowing into the extreme ultraviolet radiation receiving device without using a gate valve or a thin film filter; a thickness of a high pressure part, which is formed by a stop gas, in a differential pumping portion with respect to a passing direction of EUV radiation can be reduced as small as possible; and a decrease in permeability of the EUV radiation caused by the stop gas can be prevented. According to one or more illustrative aspects of the present invention, there is provided a connection device for connecting a first depressurization vessel to a second depressurization vessel. The connection device comprises a communication hole comprising a first opening which is connected to the first depressurization vessel, and a second opening which is connected to the second depressurization vessel, the first opening and the second opening being, respectively, at opposite ends of the communication hole such that extreme ultraviolet radiation passes in a radiation direction from the first opening to the second opening; a gas inlet through which a gas flows into the communication hole in a direction perpendicular to the radiation direction of the extreme ultraviolet radiation; and a gas outlet which is opposed to the gas inlet such that the gas passes out the gas outlet. According to one or more illustrative aspects of the present invention, there is provided an exposure equipment comprising a first depressurization vessel that comprises a component for radiating extreme ultraviolet radiation and a first opening through which the extreme ultraviolet radiation passes; a second depressurization vessel that comprises a second opening for receiving the extreme ultraviolet radiation passed from the first depressurization vessel; and a connection device which connects the first depressurization vessel to the second depressurization vessel; a gas supply unit; and a gas exhaust unit. The connection device comprises a communication hole comprising two opening ends disposed on opposite sides, respectively, of the communication hole, wherein the first opening and the second opening are opposed to each other and are connected to respective ones of the two opening ends; a gas inlet through which a gas, which does not absorb the extreme ultraviolet radiation, flows in a direction perpendicular to a passing direction of the extreme ultraviolet radiation; and a first gas outlet which is provided at a position opposed to the gas inlet so as to remove the gas from the communication hole; at least one second gas outlet which is provided between the second depressurization vessel and the first gas outlet so as to remove the gas from the communication hole; and at least one third gas outlet which is provided between the first depressurization vessel and the first gas outlet so as to remove the gas from the communication hole. The gas supply unit is connected to the gas inlet so as to supply the gas to the connection device. The gas exhaust unit comprises a first gas exhaust unit connected to the first gas outlet so as to remove the gas; a second gas exhaust unit connected to one of the at least one second gas outlet so as to remove the gas; and a third gas exhaust unit connected to one of the at least one third gas outlet so as to remove the gas. Other aspects of the invention will be apparent from the following description, the drawings and the claims. Exemplary embodiments of the present invention will be now described with reference to the drawings. FIG. 1 is a diagram illustrating a configuration of an EUV radiation source that is an extreme ultraviolet radiation outgoing device, and an exposure tool (not shown) that is an extreme ultraviolet radiation receiving device, which are connected to each other through a connection device 30 according to an exemplary embodiment of the present invention. First and second chambers 10a and 10b constituting the EUV radiation source correspond to the first depressurization vessel, and a third chamber 10c containing the exposure tool corresponds to the second depressurization vessel. FIG. 1 shows a cross-sectional view taken along a plane through which an optical axis of the EUV radiation passes. The configuration of the EUV radiation source is the same as described in FIG. 7, and is briefly described hereinafter. A chamber 10 of the EUV radiation source includes a first chamber 10a and a second chamber 10b. The first chamber 10a is provided therein with a discharge portion 1 as a heating and exciting means for heating and exciting an EUV radiating species. The second chamber 10b is provided therein with an EUV collector mirror 2 for collecting EUV radiation emitted from high temperature plasma generated from the EUV radiating species heated and excited by the discharge portion 1. The first chamber 10a is connected to a exhaust unit 9c. The second chamber 10a is connected to a first gas supply unit 16a and a second gas supply unit 16b for supplying cleaning gas or the like and to a first gas exhaust unit 9a and a second gas exhaust unit 9b. The insides of the chambers 10a and 10b are depressurized by the gas exhaust units 9a, 9b, and 9c. As described above, the discharge portion 1 has a structure in which a first discharge electrode 11 is a disk-shaped member made of metal, and a second discharge electrode 12 is a disk-shaped member made of metal. The first discharge electrode 11 and the second discharge electrode 12 are disposed with an insulator 13 interposed therebetween. A rotating shaft 6a of a motor 6 is mounted on the second discharge electrode 12. A first wiper 12a and a second wiper 12b formed of, for example, carbon brush or the like are provided below the second discharge electrode 12. The second wiper 12b is electrically connected to the second discharge electrode 12. The first wiper 12a is electrically connected to the first discharge electrode 11 via a through hole 12c penetrating the second discharge electrode 12. The first wiper 12a and the second wiper 12b are connected to a pulsed power supply 15. When power is applied from the pulsed power supply 15 to the first discharge electrode 11 and the second discharge electrode 12, electrical discharge occurs between the edge-shaped portions of the both electrodes. Solid tin (Sn) or solid lithium (Li) as a raw material for high temperature plasma is supplied to the discharge portion 1, and the laser is irradiated from the laser irradiator 5 to Sn or Li. The Sn or Li irradiated with the laser is evaporated between the first discharge electrode 11 and the second discharge electrode 12, and a part of the Sn or Li is ionized. Under such a condition, when pulsed power is applied from the pulsed power supply 15 between the first discharge electrode 11 and the second discharge electrode 12, electrical discharge occurs between the tapered portions provided at the peripheral portions of the first discharge electrode 11 and the second discharge electrodes 12. At this time, a pulse-shaped high current flows at the partially ionized portion of Sn or Li evaporated between the first discharge electrode 11 and the second discharge electrode 12. Then, a high temperature plasma P is formed at the peripheral portion of the electrodes. The high temperature plasma P is formed from the evaporated Sn or Li by Joule heating of the pinch effect, and EUV radiation having a wavelength of 13.5 nm radiates from the high temperature plasma P. The EUV radiation radiated by the discharge portion 1 is incident to an oblique incidence type EUV collector mirror 2 through a foil trap 3, and is collected by the EUV collector mirror 2. The EUV radiation is guided from the EUV radiation output portion 4 provided in the second chamber 10b through the connection device 30 into the third chamber 10c. An EUV radiation receiving portion 7 provided in the housing (chamber 10c) of the exposure tool and the EUV radiation output portion 4 provided in the EUV radiation source are connected to each other through a connection device 30. The inside of the second chamber 10b of the EUV radiation source and the inside of the housing (third chamber 10c) of the exposure tool are capable of differential pumping by the respective gas exhaust units thereof. The connection device 30 is provided at a differential pumping portion between the EUV radiation output portion 4 and the EUV radiation receiving portion 7. The connection device 30 includes a communication hole 31, and the EUV radiation output portion 4 and the EUV radiation receiving portion 7 are opposed to each other and are connected to opening ends on both sides of the communication hole 31 of the connection device 30. The communication hole 31 is provided with a gas inlet 32 and a gas outlet 33 for exhausting the gas, which are opposed to each other. Stop gas which does not absorb extreme ultraviolet radiation is supplied from the third gas supply unit 30a to the gas inlet 32. The stop gas flows so as to intersect with the passing direction of the EUV radiation, and is forcedly exhausted from the gas outlet 33 by the gas exhaust unit 30b. That is, a gas curtain is formed by the gas inlet 32 and the gas outlet 33, and gas such as a cleaning gas is prevented from flowing from the EUV radiation source into the exposure tool. FIGS. 2A and 2B show an example of a configuration of the gas supply unit 30a and the gas exhaust unit 30b of the connection device 30, respectively. The gas inlet 32 is provided with a nozzle 32a, and the stop gas is ejected from the nozzle 32a. Hydrogen absorbing a little EUV radiation or a rare gas (e.g., He, Ne, Ar, Kr, etc.) having no reactivity may be used as the stop gas. The gas outlet 33 is provided with a diffuser 33a, and the diffuser 33a is opposed to the nozzle 32a on the gas supply unit 30a side. The stop gas ejected from the nozzle 32a is sucked into the diffuser 33a of the gas exhaust unit 30b and is exhausted. In the above description, the connection device 30 is provided with the third gas supply unit 30a and the third gas exhaust unit 30b. However, as shown with dotted lines in FIG. 1, a fourth gas exhaust unit 30c is provided on the exposure tool side. With such a configuration, the gas, which is not exhausted from the third gas exhaust unit 30b and goes toward the exposure tool, may be exhausted. In addition, a fifth gas exhaust unit 30d may be provided on the EUV radiation source side. With such a configuration, the gas, which is not exhausted from the third gas exhaust unit 30b and goes toward the EUV radiation source, may be exhausted. The gas outlets of the fourth gas exhaust unit 30c and the fifth gas exhaust unit 30d are provided, for example, in a ring shape along an inner periphery of the communication hole 31 of the connection device 30, and the gas is exhausted in a direction substantially perpendicular to the passing direction of the EUV radiation. FIGS. 3A to 3C are enlarged diagrams of the connection device 30 at the interface between the EUV radiation source and the exposure tool, and are diagrams illustrating gas flow when the connection device 30 constituting the differential pumping portion is provided with the third gas supply unit 30a and the third gas exhaust unit 30b and is additionally provided with the fourth gas exhaust unit 30c and the fifth gas exhaust unit 30d. As a first exemplary embodiment, FIG. 3A shows a state that the gas inlet 32 and the gas outlet 33 (third gas supply unit 30a and third gas exhaust unit 30b) are provided. As a second exemplary embodiment, FIG. 3B shows a state that the gas inlet 32 and the gas outlets 33 and 34 (third gas supply unit 30a, the third gas exhaust unit 30b and the fourth gas exhaust unit 30c) are provided. As a third exemplary embodiment, FIG. 3C shows a state that the gas inlet 32 and the gas outlets 33, 34, and 35 (the third gas supply unit 30a, the third gas exhaust unit 30b, the fourth gas exhaust unit 30c, and the fifth gas exhaust unit 30d) are provided. FIG. 3A shows the first exemplary embodiment. As shown in FIG. 3A, the gas outlet 33 for the stop gas is provided to be opposed to the gas inlet 32 for the stop gas. The stop gas introduced from the gas inlet 32 forms a gas curtain forcedly exhausted from the gas outlet 33. FIG. 4 shows a gas pressure distribution of the connection device of the first exemplary embodiment. FIG. 4 shows a pressure distribution on the center axis (X-axis direction in FIG. 2) of the communication hole 31 of the connection device in the gas supply unit 30a and the gas exhaust unit 30b shown in FIG. 2. The openings of the gas inlet 32 and the gas outlet 33 have a rectangular shape of about 5 mm by 5 mm. In FIG. 4, a horizontal axis represents a distance in the X-axis direction shown in FIG. 2 from the center of the stop gas inlet 32, and the right side in the same figure is the EUV radiation source side. A position of 0 in the horizontal axis is a center position of the stop gas inlet 32 (in FIG. 4, the position of 0 is shown in the scale of the horizontal axis). A vertical axis represents a pressure (Pa). A graph A represents a pressure distribution of the stop gas, and a graph B represents a pressure distribution of the gas (e.g., cleaning gas) supplied to the EUV radiation source. A thickness of a part where the pressure of the stop gas is 100 Pa with respect to the passing direction of the EUV radiation is about 7 mm. This thickness is smaller than the related-art thickness by about 2 mm. Absorption of radiation is determined by an absorption cross section area caused by gas concentration and a light path length, and is increased with an exponential function about the light path length. Accordingly, even when the thickness of the high pressure layer becomes slightly smaller, it is possible to improve permeability of the EUV radiation. The increase of pressure caused by the introduction of the stop gas in the connection device 30 is also reduced as compared with the increase of pressure in the related art. Accordingly, it is possible to reduce the increase of pressure of the exposure tool caused by the stop gas, which leads to a reduced burden of the gas exhaust unit of the EUV radiation source or the exposure tool. Thus, it is possible to prevent the size of the gas exhaust unit from increasing. FIG. 3B shows the second exemplary embodiment. In the second exemplary embodiment, a gas outlet 34 is added on the exposure tool side of the gas inlet 32 and the gas outlet 33 of the first exemplary embodiment, respectively, and the gas is exhausted by the fourth gas exhaust unit 30c. The stop gas is further prevented from flowing into the exposure tool by the gas outlet 34, thereby preventing the pressure of the exposure tool from increasing. In addition, the thickness of the high pressure part by the stop gas becomes smaller. FIG. 5 shows gas pressure distribution of the connection device of the second exemplary embodiment. Similarly to FIG. 4, FIG. 5 shows a pressure distribution on the X-axis in FIG. 2. A horizontal axis represents a distance in the X-axis direction shown in FIG. 2 from the center of the stop gas inlet 32, and a vertical axis represents a pressure (Pa). A graph A represents a pressure distribution of the stop gas, and a graph B represents a pressure distribution of the gas (e.g., cleaning gas) supplied to the EUV radiation source. As shown in FIG. 5, the pressure of the stop gas on the exposure tool side decreases as compared with the pressure on the EUV radiation source side, and a thickness of a part where the pressure of the stop gas is 100 Pa with respect to the passing direction of the EUV radiation is about 5 mm. The permeability of the EUV radiation is further improved. As described above, a hydrogen or rare gas is used as the stop gas. Such a gas includes a very small amount of water or carbon. When water or carbon is attached to the mirror of the exposure tool, reflectivity decreases. Accordingly, it is advantageous that stop gas does not flow into the exposure tool. In the second exemplary embodiment, the added gas exhaust unit 30c only exhausts gas in a small space of the differential pumping portion, and thus may have a small size, which does not cause a great increase of cost. FIG. 3C shows the third exemplary embodiment. In the third exemplary embodiment, a gas outlet 35 is added on the EUV radiation source side of the gas inlet 32 and the gas outlet 33 of the second exemplary embodiment, respectively, and the gas is exhausted by the fifth gas exhaust unit 30d. The stop gas is further prevented from flowing into the EUV radiation source by the gas outlet 35, thereby preventing the pressure of the EUV radiation source from increasing. FIG. 6 shows a gas pressure distribution of the connection device of the third exemplary embodiment. Similarly to FIG. 4, the pressure distribution on the X-axis in FIG. 2 is shown. A horizontal axis represents a distance in the X-axis direction shown in FIG. 2 from the center of the stop gas inlet 32, and a vertical axis represents a pressure (Pa). A graph A represents a pressure distribution of the stop gas, and a graph B represents a pressure distribution of the gas (e.g., cleaning gas) supplied to the EUV radiation source. Gas pressure of the differential pumping portion is shown. In FIG. 6, since the edges of both sides of the pressure of the stop gas become lower, it is possible to prevent the stop gas from flowing into the EUV radiation source as well as flowing into the exposure tool of the stop gas. For example, as compared with each point of 15 mm, which is one of edge points of the stop gas A, in the X-axis in FIGS. 5 and 6, it can be seen that pressure of the stop gas A in FIG. 6 is suppressed more than that in FIG. 5. Accordingly, a thickness of a part where the pressure of the stop gas is 100 Pa with respect to the passing direction of the EUV radiation becomes smaller than that of the second exemplary embodiment. According to the experimental results, when the thickness of the part where the pressure is 100 Pa with respect to the passing direction of the EUV radiation is about 6 mm or less, the permeability of the EUV radiation can be a desired value (e.g., 0.975) or more if the pressure of the stop gas is 300 Pa or less. In addition, in the first to third exemplary embodiments, a nozzle having a rectangular opening is used for the gas inlet 32 shown in FIG. 2. However, when a supersonic nozzle is used as the nozzle, the shape of the pressure distribution of the stop gas is further improved, thereby further reducing the widths of the edges on both sides of the pressure of stop gas. According to exemplary embodiments of the present invention, the communication hole for connecting the first depressurization vessel that sends out the extreme ultraviolet radiation and the second depressurization vessel that receives the extreme ultraviolet radiation is provided with the gas inlet and gas outlet for the stop gas to be opposed to each other, and the stop gas which does not absorb the extreme ultraviolet radiation is allowed to flow in a direction perpendicular to the passing direction of the extreme ultraviolet radiation, thereby forming the gas curtain. Accordingly, the gas in the first depressurization vessel is prevented from flowing into the second depressurization vessel. Since the stop gas is exhausted from the opposed gas outlet, the thickness of the high pressure layer formed by the stop gas becomes smaller. In addition, the stop gas does not flow into the first depressurization vessel or the second depressurization vessel, and thus it is possible to reduce the influence on pressure of both vessels. Since the concentration distribution of the stop gas is uniform, the permeability distribution of the EUV radiation is also uniform. Further, the second gas outlet for exhausting gas is provided on the second depressurization vessel side with respect to the gas inlet and the gas outlet, and thus it is possible to exhaust the gas going toward the second depressurization vessel without flowing into the gas outlet. The third gas outlet for exhausting gas is additionally provided on the first depressurization vessel side with respect to the gas inlet and the gas outlet, and thus it is possible to exhaust the gas going toward the first depressurization vessel without flowing into the gas outlet. Accordingly, the thickness of the high pressure layer formed at the communication hole by the stop gas with respect to the passing direction of the EUV radiation becomes smaller, and thus it is possible to prevent a decrease in permeability of the EUV radiation caused by the stop gas. In addition, it is possible to reduce the influence of the stop gas on the pressure of the first depressurization vessel and the second depressurization vessel as small as possible. According to one or more aspects of the present invention, an exposure equipment is provided. The exposure equipment includes a first depressurization vessel that has a component for radiating extreme ultraviolet radiation and a first opening for sending out the extreme ultraviolet radiation; a second depressurization vessel that has a second opening for receiving the extreme ultraviolet radiation sent from the first depressurization vessel; and a connection device configured to connect the first depressurization vessel to the second depressurization vessel, wherein the connection device includes a communication hole, wherein the first opening and the second opening are opposed to each other and are connected to opening ends on both sides of the communication hole; a gas inlet that flows gas, which does not absorb the extreme ultraviolet radiation, in a direction perpendicular to a passing direction of the extreme ultraviolet radiation; and a first gas outlet provided to be opposed to the gas inlet so as to exhaust the gas; at least one second gas outlet provided on the second depressurization vessel side with respect to the first gas outlet so as to exhaust the gas; and at least one third gas outlet provided on the first depressurization vessel side with respect to the first has outlet so as to exhaust the gas, a gas supply unit connected to the gas inlet so as to supply the gas to the connection device; and a gas exhaust unit comprising first gas exhaust unit connected to the first gas outlet so as to exhaust the gas; a second gas exhaust unit connected to one of the at least one second gas outlet so as to exhaust the gas; and a third gas exhaust unit connected to one of the at least one third gas outlet so as to exhaust the gas. While the present invention has been shown and described with reference to certain exemplary embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. It is aimed, therefore, to cover in the appended claim all such changes and modifications as fall within the true spirit and scope of the present invention. [FIG 1] 15: PULSED POWER SUPPLY 6: MOTOR 9a: FIRST GAS EXHAUST UNIT 9b: SECOND GAS EXHAUST UNIT 9c: RADIATION SOURCE GAS EXHAUST UNIT 14: RAW MATERIAL SUPPLY UNIT P: PLASMA 30d: FIFTH GAS EXHAUST UNIT 30b: THIRD GAS EXHAUST UNIT 30a: THIRD GAS SUPPLY UNIT 30c: FOURTH GAS EXHAUST UNIT 5: LASER IRRADIATOR 16a: FIRST GAS SUPPLY UNIT 16b: SECOND GAS SUPPLY UNIT [FIG. 2A] 30a: GAS SUPPLY UNIT #1: OPENING #2: GAS FLOW #3: GAS CURTAIN #4: DIFFERENTIAL PUMPING PORTION [FIG. 2B] 30b: THIRD GAS EXHAUST UNIT [FIG. 3A] #1: EXPOSURE TOOL #2: EXHAUST #3: GAS #4: DIFFERENTIAL PUMPING PORTION #5: X DIRECTION #6: EUV RADIATION SOURCE [FIG. 3B] #1: EXPOSURE TOOL #2: EXHAUST #3: GAS #4: DIFFERENTIAL PUMPING PORTION #5: X DIRECTION #6: EUV RADIATION SOURCE [FIG. 3C] #1: EXPOSURE TOOL #2: EXHAUST #3: GAS #4: DIFFERENTIAL PUMPING PORTION #5: X DIRECTION #6: EUV RADIATION SOURCE [FIG. 4] #1: STOP GAS PRESSURE (Pa) #2: STOP GAS A #3: CLEANING GAS B #4: EXPOSURE TOOL SIDE #5: EUV RADIATION SOURCE SIDE #6: CLEANING GAS PRESSURE (Pa) [FIG. 5] #1: STOP GAS PRESSURE (Pa) #2: STOP GAS A #3: CLEANING GAS B #4: EXPOSURE TOOL SIDE #5: EUV RADIATION SOURCE SIDE #6: CLEANING GAS PRESSURE (Pa) [FIG. 6] #1: STOP GAS PRESSURE (Pa) #2: STOP GAS A #3: CLEANING GAS B #4: EXPOSURE TOOL SIDE #5: EUV RADIATION SOURCE SIDE #6: CLEANING GAS PRESSURE (Pa) [FIG. 7] 15: PULSED POWER SUPPLY 6: MOTOR 9a: FIRST GAS EXHAUST UNIT 9b: SECOND GAS EXHAUST UNIT 9c: RADIATION SOURCE GAS EXHAUST UNIT 14: RAW MATERIAL SUPPLY UNIT P: PLASMA 20a: THIRD GAS SUPPLY UNIT 5: LASER IRRADIATOR 16a: FIRST GAS SUPPLY UNIT 16b: SECOND GAS SUPPLY UNIT [FIG. 8] #1: EXPOSURE TOOL #2: GAS #3: DIFFERENTIAL PUMPING PORTION #4: EUV RADIATION SOURCE #5: X DIRECTION [FIG. 9] #1: STOP GAS PRESSURE (Pa) #2: STOP GAS A #3: CLEANING GAS B #4: EXPOSURE TOOL SIDE #5: EUV RADIATION SOURCE SIDE #6: CLEANING GAS PRESSURE (Pa) |
|
description | Priority is claimed as a national stage application, under 35 U.S.C. § 371, to international application No. PCT/US2013/039743, filed May 6, 2013, which claims priority to U.S. provisional patent application Ser. No. 61/642,614, filed May 4, 2012, the disclosures of which are incorporated herein by reference in it their entirety. The field of the present invention relates to nuclear steam supply systems, and more particularly to a steam supply system for a small modular reactors. Pressurized water reactors (PWRs) for nuclear power generation facilities utilize both pumped and natural circulation of the primary coolant to both cool the reactor core and heat the secondary coolant to produce steam which may be working fluid for a Rankine power generation cycle. The existing natural circulation PWRs suffer from the drawback that the heat exchange equipment is integrated with and located within the reactor pressure vessel. Such an arrangement not only makes the heat exchange equipment difficult to repair and/or service, but also subjects the equipment to corrosive conditions and results in increased complexity and a potential increase in the number of penetrations into the reactor pressure vessel. In addition, locating the heat exchange equipment within the reactor pressure vessel creates problems with respect to radiation levels encountered for crews to repair the heat exchange equipment in proximity to the radioactively hot components of the reactor vessel. The general view has also been that the heat exchangers should be located in the reactor vessel to achieve natural circulation in those systems which may utilize this type of flow circulation. The reduction of vulnerabilities within nuclear power generation facilities is always an ongoing issue. For example, large pipes are seen as creating the potential for a “large break” Loss of Coolant Accident (LOCA) event, and thus it is desirable to remove large pipes where possible. A nuclear reactor vessel includes a shell and a head affixed to the upper end of the shell. The shell has an internal cavity with a central axis and an upper flange portion, wherein the internal cavity is configured to receive a reactor core. The head has a head flange portion, with the upper annular flange portion is coupled to the head annular flange portion, and the flanges are configured to minimize outward extension from the cavity while still providing desired leak protection at the interface between the shell and the head. In a first separate aspect of the present invention, the upper flange portion of the shell is annular and extends into the internal cavity, and the head flange portion of the head is also annular and extends outward from the internal cavity. In a second separate aspect of the present invention, a reactor core including nuclear fuel is disposed within the internal cavity of the nuclear reactor vessel, and a steam generating vessel including at least one heat exchanger section is fluidicly coupled to the reactor vessel. The upper flange portion of the shell extends into the internal cavity, and the head flange portion of the head extends outward from the internal cavity. In a third separate aspect of the present invention, a reactor core including nuclear fuel is disposed within the internal cavity of the nuclear reactor vessel, and a steam generating vessel including at least one heat exchanger section is fluidicly coupled to the reactor vessel. The upper flange portion of the shell extends into the internal cavity, and the head flange portion of the head extends outward from the internal cavity. An inner surface of the first head portion is disposed closer to the central axis than an inner surface of the first shell portion along respective parallel radial lines extending from the central axis. In a fourth separate aspect of the present invention, a method for generating steam utilizes the nuclear reactor vessel. The reactor vessel is capped with a head, and a reactor core is disposed within the reactor vessel. The upper flange portion extends into the internal cavity, and the head flange portion extends outward from the internal cavity. A liquid primary coolant is heated in the nuclear reactor core, and the heated primary coolant is discharged from a top portion of the reactor vessel into a steam generating vessel. The primary coolant is flowed through the reactor vessel and steam generating vessel in a closed circulation loop. In a fifth separate aspect of the present invention, one or more of the preceding separate aspects may be employed in combination. Advantages of the improvements will be apparent from the drawings and the description of the embodiments below. The description of illustrative embodiments according to principles of the present invention is intended to be read in connection with the accompanying drawings, which are to be considered part of the entire written description. In the description of embodiments of the invention disclosed herein, any reference to direction or orientation is merely intended for convenience of description and is not intended in any way to limit the scope of the present invention. Relative terms such as “lower,” “upper,” “horizontal,” “vertical,” “above,” “below,” “up,” “down,” “left,” “right,” “top” and “bottom” as well as derivatives thereof (e.g., “horizontally,” “downwardly,” “upwardly,” etc.) should be construed to refer to the orientation as then described or as shown in the drawing under discussion. These relative terms are for convenience of description only and do not require that the apparatus be constructed or operated in a particular orientation unless explicitly indicated as such. Terms such as “attached,” “affixed,” “connected,” “coupled,” “interconnected,” and similar refer to a relationship wherein structures are secured or attached to one another either directly or indirectly through intervening structures, as well as both movable or rigid attachments or relationships, unless expressly described otherwise. Moreover, the features and benefits of the invention are illustrated by reference to the preferred embodiments. Accordingly, the invention expressly should not be limited to such preferred embodiments illustrating some possible non-limiting combinations of features that may exist alone or in other combinations of features; the scope of the invention being defined by the claims appended hereto. Referring to FIGS. 1-6, a steam supply system for a nuclear pressurized water reactor (PWR) according to the present disclosure is shown. From the thermal-hydraulic standpoint, the system includes a steam generator assembly 100 generally including a reactor vessel 200 and a steam generating vessel 300 fluidly coupled to the reactor vessel. The steam generating vessel and reactor vessel are vertically elongated and separate components which hydraulically are closely coupled, but discrete vessels in themselves that are thermally isolated except for the exchange of primary loop coolant (i.e. reactor coolant) flowing between the vessels. As further described herein, the steam generating vessel 300 in one embodiment includes a preheater 320, main steam generator 330, and a superheater 350 which converts a fluid such as water flowing in a secondary coolant loop from a liquid entering the steam generating vessel 300 at an inlet 301 to superheated steam leaving the steam generating vessel at an outlet 302. The secondary coolant loop water may be a Rankine cycle fluid used to drive a turbine-generator set for producing electric power in some embodiments. The steam generating vessel 300 further includes a pressurizer 380 which maintains a predetermined pressure of the primary coolant fluid. The pressurizer is a pressure vessel mounted atop the steam generating vessel 300 and engineered to maintain a liquid/gas interface (i.e. primary coolant water/inert gas) that operates to enable control of the primary coolant pressure in the steam generator. In one embodiment, as shown, the pressurizer 380 may be mounted directly on top of the steam generating vessel 300 and forms an integral unitary structural part of the vessel to hydraulically close the vessel at the top end. The assemblage of the foregoing three heat exchangers and the pressurizer may be referred to as a “stack.” Referring to FIG. 1, the reactor vessel 200 and the steam generating vessel 300 are housed in a steam generator containment vessel 110. The containment vessel 110 may be formed of a suitable shop-fabricated steel comprised of a top 111, a bottom 112, and a cylindrical sidewall 113 extending therebetween. In some embodiments, portions of the containment vessel which are located above ground level may be made of ductile ribbed steel to help withstand aircraft impact. A missile shield 117 which is spaced above the top 111 of the containment vessel 110 may be provided as part of the containment vessel or a separate containment enclosure structure (not shown) which encloses the containment vessel 110. A horizontal partition wall 114 divides the containment vessel into an upper portion 114a and a lower portion 114b. The partition wall 114 defines a floor in the containment vessel. In one embodiment, a majority of the reactor vessel 200 may be disposed in the lower portion 114b and the steam generating vessel 300 may be disposed in the upper portion 114a as shown. In various embodiments, the containment vessel 110 may be mounted above ground, partially below ground, or completely below ground. In certain embodiments, the containment vessel 110 may be positioned so that at least part or all of the lower portion 114b that contains the nuclear fuel reactor core (e.g., a fuel cartridge 230) is located below ground level. In one embodiment, the entire reactor vessel 200 and a portion of the steam generating vessel 300 are located entirely below ground level for maximum security. The cylindrical shell or sidewall 113 of the containment vessel 110 may be horizontally split into an upper section and a lower section, which are joined together by a circumferential welded or bolted flanged joint 119 as shown in FIG. 1 to provide a demarcation for portions of the containment vessel which are located above and below ground level. In other embodiments, the upper and lower sections may be welded together without use of a flange. In one embodiment, for example without limitation, the containment vessel 110 may have a representative height of approximately 200 feet or more for a 160 MW (megawatt) modular nuclear electric generation facility. A non-limiting representative diameter for this power generation facility is about 45 feet. Any suitable height and diameter for the containment vessel may be provided depending on system component configuration and dimensions. The containment vessel 110 further includes a wet reactor well 115 defined in one embodiment by a cylindrical circumscribing walled enclosure 116 which is flooded with water to provide enhanced radiation shielding and a back-up reserve of readily accessible coolant for the reactor core. In one embodiment, the walled enclosure 116 may be formed of stainless steel cylindrical walls which extend circumferentially around the reactor vessel 200 as shown. Other suitable materials may be used to construct the enclosure 116. The wet reactor well 115 is disposed in the lower portion 114b of the containment vessel 110. The lower portion 114b may further include a flooded (i.e. water) used fuel pool 118 adjacent to the enclosure 116. In one embodiment, as shown in FIG. 1, both the used fuel pool 118 and the walled enclosure 116 are disposed below the horizontal partition wall 114 as shown in FIG. 1. In one embodiment, as shown in FIG. 1, the walled enclosure 116 may extend above the partition wall 114 and the inlet/outlet nozzle connection between the reactor and steam generating vessels may be made by a penetration through the walled enclosure. As further shown in FIG. 1, both the reactor vessel 200 and the steam generating vessel 300 preferably may be vertically oriented as shown to reduce the footprint and diameter of the containment vessel 110. The containment vessel 110 has a diameter large enough to house both the reactor vessel, steam generating vessel, and any other appurtenances. The containment vessel 110 preferably has a height large enough to completely house the reactor vessel and steam generating vessel to provide a fully contained steam generator with exception of the water and steam inlet and outlet penetrations for second coolant loop fluid flow associated with the Rankine cycle for driving the turbine-generator set for producing electric power. FIG. 2 shows the flow or circulation of primary coolant (e.g. water) in the primary coolant loop. In one embodiment, the primary coolant flow is gravity-driven relying on the change in temperature and corresponding density of the coolant as it is heated in the reactor vessel 200, and then cooled in the steam generating vessel 300 as heat is transferred to the secondary coolant loop of the Rankine cycle which drives the turbine-generator (T-G) set. The pressure head created by the changing different densities of the coolant (i.e. hot—lower density and cold—higher density) induces flow or circulation through the reactor vessel-steam generating vessel system as shown by the directional flow arrows. Advantage, the gravity-driven primary coolant circulation requires no coolant pumps or machinery thereby resulting in cost (capital, operating, and maintenance) savings, reduced system power consumption thereby increasing energy conversion efficiency of the PWR system, in addition to other advantages as described herein. The reactor vessel 200 may be similar to the reactor vessel with gravity-driven circulation system disclosed in commonly-owned U.S. patent application Ser. No. 13/577,163 filed Aug. 3, 2012, the disclosure of which is incorporated herein by reference in its entirety. Referring to FIGS. 3A and 3B, the reactor vessel 200 in one embodiment is an ASME code Section III, Class I thick-walled cylindrical pressure vessel includes a cylindrical sidewall shell 201, an integrally welded hemispherical bottom head 203 and, a removable hemispherical top head 202. The shell 201 primarily defines an internal cavity 208 configured for holding the reactor core, reactor shroud, and other appurtenances as described herein. In one embodiment, the upper extremity of the reactor vessel shell 201 is equipped with a tapered hub flange 204 (also known as “welding neck” flange in the art) which is bolted to a similar flange 205 welded to the top head 202. Commonly-owned PCT patent application No. PCT/US2013/0038289, filed Apr. 25, 2013, the disclosure of which is incorporated herein by reference in its entirety, discloses known prior-art for the design and coupling of the top head to the shell using two flanges. Each flange 204, 205 may be annular, so that each extends completely around the shell 201 and the head 202, respectively. Each flange may also be integrally formed as part of the shell 201 and the top head 202. The flange 204 extends into and toward the central axis 210 of the cavity 208, with the flange 204 forming at about the point where the sidewalls of the shell 201 begin to widen. In the case that the flange 204 is annular, it extends radially into the cavity around the entire cavity, and similarly, in the case that the flange 205 is annular, it extends radially outward from the cavity all around. As can be seen in the embodiment depicted, the inner sidewall surfaces 209 of the shell 201, excluding the flange 204, are defined by a first inner radius, measured from the central axis 210 of the cavity 208, and the inner sidewall surfaces 211 of the flange 204 are defined by a second inner radius, with the second inner radius being smaller than the first inner radius. The outward-extending head flange 205, which is formed at about the point where the sidewalls of the top head 202 begin to widen, has an inner surface 212 that may be at about the same distance from the central axis 210 as the inner sidewall surfaces 211 of the shell flange 204, as can be seen by line A. Thus, the inner surfaces 211, 212 of the two flanges 204, 205 have about the same radius from the central axis 210, and the inner surfaces 212 of the flange 205 have a smaller radius than the inner sidewall surfaces 209 of the shell 201. Also, the outer surfaces 213 of the hemispherical wall of the top head 202, at a point just above the flange 205, may be at about the same distance from, or even closer to, the central axis 210 as the inner sidewall surfaces 211 of the shell flange 204, as can be seen by line B. This results in the radius of the outer surfaces 213 having about the same radius from the central axis 210 as the inner sidewall surfaces 211, although the outer surfaces 213 could also have a radius less than that of the inner sidewall surfaces 211. So that the coupled flanges 204, 205 may each still serve as a “welding neck” flange, the outer surfaces 214, 215 of each flange may be at about the same distance from the central axis 210, as can be seen by line C. All distance and measurement comparisons between the shell 201 and the top head 210 are being made along parallel radial lines having the central axis 210 as a center. The top head 202 may be fastened to the shell 201 by coupling the flanges 204, 205 via a set of alloy bolts 216, which are pre-tensioned to establish a high integrity double gasket seal under all operation modes. The bolted connection of the top head 202 provides ready access to the reactor vessel internals such as the reactor core. The centerline, line D, of the bolts 216 may be at a distance greater than the internal surfaces 209 of the shell 201, but at a lesser distance than the outer surfaces 214 of the shell flange 204. Two concentric self-energizing gaskets 206 are placed in a pair of annular grooves 218, the grooves being formed in both flanges 204, 205, between the bolts 216 and the inner surfaces 211, 212, and compressed between the interfacing surfaces of two flanges 204, 205, when coupled together, to provide leak tightness of the reactor vessel 200 at the connection between the top head 202 and the shell 201. The leak tightness under operating conditions is assured by an axisymmetric heating of the flanged joint that is provided by the fluid flow arrangement of the primary coolant in the system, as further described herein. The top head 202 contains the vertical penetrations 207 for insertion of the control rods and further may serve as a base for mounting the associated control rod drives, both of which are not depicted but well known in the art without further elaboration. With continuing reference to FIG. 3A, the reactor vessel 200 includes a cylindrical reactor shroud 220 which contains the reactor core defined by a fuel cartridge 230. The reactor shroud 220 transversely divides the shell portion of the reactor vessel into two concentrically arranged spaces: (1) an outer annulus 221 defining an annular downcomer 222 for primary coolant entering the reactor vessel which is formed between the outer surface of the reactor shroud and the inner surface of the shell 201; and (2) a passageway 223 defining a riser column 224 for the primary coolant leaving the reactor vessel heated by fission in the reactor core. The reactor shroud 220 is elongated and extends in an axial direction along vertical axis VA1 of the reactor vessel which defines a height and includes an open bottom 225 and a closed top 226. In one embodiment, the top 226 may be closed by a top flow isolation plate 227 which directs primary coolant flowing up the riser column 224 to the steam generating vessel 300, as further described herein. In one embodiment, the bottom 225 of the reactor shroud 220 is vertically spaced apart by a distance from the bottom head 203 of the reactor vessel 200 and defines a bottom flow plenum 228. The bottom flow plenum 228 collects primary coolant from the annular downcomer 222 and directs the coolant flow into the inlet of the riser column 224 formed by the open bottom 225 of the reactor shroud 220 (see, e.g. FIG. 2). Both the fuel cartridge 230 and the reactor shroud 220 are supported by a core support structure (“CSS”), which in one embodiment includes a plurality of lateral support members 250 that span between and are attached to the reactor shroud and the shell 201 of the reactor vessel 200. A suitable number of supports members space both circumferentially and vertically apart are provided as needed to support the combined weight of the fuel cartridge 230 and the reactor shroud 220. In one embodiment, the bottom of the reactor shroud 220 is not attached to the reactor vessel 200 to allow the shroud to grow thermally in a vertical axial direction (i.e. parallel to vertical axis VA1) without undue constraint. The reactor shroud 220 is a double-walled cylinder in one embodiment which may be made of a corrosion resistant material, such as without limitation stainless steel. This double-wall construction of the reactor shroud 220 forms an insulated structure designed to retard the flow of heat across it and forms a smooth vertical riser column 224 for upward flow of the primary coolant (i.e. water) heated by the fission in the fuel cartridge 230 (“core”), which is preferably located at the bottom extremity of the shroud in one embodiment as shown in FIGS. 1-3. The vertical space above the fuel cartridge 230 in the reactor shroud 220 may also contain interconnected control rod segments along with a set of “non-segmental baffles” that serve to protect them from flow induced vibration during reactor operations. The reactor shroud 220 is laterally supported by the reactor vessel by support members 250 to prevent damage from mechanical vibrations that may induce failure from metal fatigue. The fuel cartridge 230 in one embodiment is a unitary autonomous structure containing upright fuel assemblies, and is situated in a region of the reactor vessel 200 that is spaced above the bottom head 203 so that a relatively deep plenum of water lies underneath the fuel cartridge. The fuel cartridge 230 is insulated by the reactor shroud 220 so that a majority of the heat generated by the fission reaction in the nuclear fuel core is used in heating the primary coolant flowing through the fuel cartridge and adjoining upper portions of the riser column 224. The fuel cartridge 230 is an open cylindrical structure including cylindrically shaped sidewalls 231, an open top 233, and an open bottom 234 to allow the primary coolant to flow upward completely through the cartridge (see directional flow arrows). In one embodiment, the sidewalls 231 may be formed by multiple arcuate segments of reflectors which are joined together by suitable means. The open interior of the fuel cartridge 230 is filled with a support grid 232 for holding the nuclear fuel rods and for insertion of control rods into the core to control the fission reaction as needed. Briefly, in operation, the hot reactor primary coolant exits the reactor vessel 200 through a low flow resistance outlet nozzle 270 to be cooled in the adjacent steam generating vessel 300, as shown in FIGS. 2 and 3. The cooled reactor primary coolant leaves the steam generating vessel 300 and enters the reactor vessel 200 through the inlet nozzle 271. The internal plumbing and arrangement in the reactor vessel directs the cooled reactor coolant down through to the annular downcomer 222. The height of the reactor vessel 200 is preferably selected to support an adequate level of turbulence in the recirculating reactor primary coolant by virtue of the density differences in the hot and cold water columns which is commonly known as the thermo-siphon action (density difference driven flow) actuated by gravity. In one embodiment, the circulation of the reactor primary coolant is driven by over 8 psi pressure generated by the thermo-siphon action, which has been determined to ensure (with adequate margin) a thoroughly turbulent flow and stable hydraulic performance. Referring to FIGS. 1 and 3, the top of the reactor vessel shell 201 is welded to a massive upper support forging which may be referred to as a reactor support flange 280. The support flange 280 supports the weight of the reactor vessel 200 and internal components above the wet reactor well 115. In one embodiment, the support flange is structurally stiffened and reinforced by a plurality of lugs 281 which are spaced circumferentially apart around the reactor vessel and welded to both the reactor vessel and flange, as shown. Support flange contacts and engages the horizontal partition wall 114, which transfers the dead weight of the reactor vessel 200 to the containment vessel 110. The reactor vessel's radial and axial thermal expansion (i.e. a majority of growth being primarily downwards from the horizontal partition wall 114) as the reactor heats up during operation is unconstrained. However, the portion of the containment vessel 110 which projects above the partition wall 114 is free to grow upwards in unison with the upwards growth of the steam generating vessel 30 to minimize axial differential expansion between the steam generating vessel and reactor vessel. Because the reactor vessel and steam generating vessel are configured and structured to thermally grow in height at substantially the same rate when heated, this arrangement helps minimize potential thermal expansions stress in the primary coolant fluid coupling 273 between the reactor vessel and steam generating vessel. The support flange 280 is spaced vertically downwards on the reactor vessel shell 201 by a distance from the top head 202 of the reactor vessel 200 sufficient to allow a fluid connection to be made to the steam generating vessel 300 which is above the partition wall 114, as shown in FIGS. 1 and 2. When the reactor vessel 200 is mounted inside the containment vessel 110, the top head 202 of the reactor vessel and the primary coolant fluid coupling 273 (collectively formed by combined the inlet-outlet flow nozzle 270/271 and the inlet-outlet flow nozzle 371/370 of the steam generating vessel 300, shown in FIG. 4) are located above the reactor well 115. This provides a location for connection to the steam generator headers and for the engineered safety systems (e.g. control rods, etc.) to deal with various postulated accident scenarios. A majority of the reactor vessel shell 201, however, may be disposed below the partition wall 114 and immersed in the wet reactor well 115 as shown in FIG. 1. The bottom region of the reactor vessel 200 is restrained by a lateral seismic restraint system 260 (shown schematically in FIG. 1) that spans the space between the reactor shell 201 and the reactor well 115 inside surface of the cylindrical enclosure 116 to withstand seismic events. The seismic restraint design is configured to allow for free axial (i.e. longitudinal along vertical axis VA1) and diametrical thermal expansion of the reactor vessel 200. The reactor well 115 is flooded during power operations to provide defense-in-depth against a (hypothetical, non-mechanistic) accident that is assumed to produce a rapid rise in the enthalpy of the reactor's contents. Because the reactor is designed to prevent loss of core water by leaks or breaks and the reactor well is flooded, burn-through of the reactor vessel by molten fuel (corium) is not likely. Referring to FIGS. 3A, 3B, and 4, the combined inlet-outlet flow nozzle 270/271 has two concentric hollow forgings including an outer inlet nozzle 270 and an inner outlet nozzle 271. Likewise, the inlet-outlet flow nozzle 370/371 is a forging. The outlet nozzle 271 has one end welded to the reactor shroud 220 (internal to the reactor vessel shell 201) and an opposite end welded to the inlet nozzle 371 of the steam generating vessel 300. The inlet nozzle 270 has one end welded to the reactor vessel shell 201 and an opposite end welded to the outlet nozzle 370 of the steam generating vessel 300. These weld joints may be butt welds. The flow isolation plate 227 helps ensure that the hot primary coolant water exiting the reactor vessel cannot flow back into the annulus 221. In the present embodiment, the outlet nozzle 271 of the reactor vessel and the inlet nozzle 371 of the steam generating vessel each have a smaller diameter than the inlet nozzle 270 of the reactor vessel and the outlet nozzle 270 of the steam generating vessel. The combined inlet-outlet flow nozzle 270/271 is located above the partition wall 114 of the containment vessel 110. The inlet nozzle 371 and the outlet nozzle 370 of the steam generating vessel 300 collectively define a mating concentrically arranged combined inlet/outlet nozzle 371/370 for the steam generating vessel. In order to avoid long loops of large piping in the reactor primary coolant system which creates the potential for a “large break” LOCA event, both the combined inlet-outlet flow nozzle 270/271 of the reactor vessel 200 and the combined inlet/outlet nozzle 371/370 for the steam generating vessel are intentionally very closely coupled to the shells of their respective vessels having a minimal radial projection beyond the shells. The design of the top of the reactor vessel, with the flanged connection between the head and the shell of the reactor vessel, helps to minimize this radial projection beyond the shell. This is accomplished by reducing the extent to which the flanges extend out from the shell, as compared to the prior art. In addition, cost advantages may be realized in having the inlet-outlet flow nozzle 270/271 shortened, in that different manufacturing techniques may be used to create the shorter inlet-outlet flow nozzle 270/271 as compared to if a longer flow nozzle is required. This permits the reactor vessel 200 to be directly coupled to the steam generating vessel 300 via the inlet/outlet nozzles as shown in FIGS. 1 and 2. As shown in FIG. 3A, the combined inlet-outlet flow nozzle 270/271 of the reactor vessel preferably protrudes radially beyond the shell 201 by a distance that is no more than the radial projection of the support flange 280. The total length of the inlet/outlet nozzle connection between the reactor vessel 200 and steam generating vessel 300 in certain embodiment is less than or equal to the diameter of the reactor vessel 200, and/or the steam generating vessel 300 to eliminate long runs of large coolant piping between the reactor and steam generating vessels. In one embodiment, the nozzle connections between the reactor vessel 200 and the steam generating vessel 300 is straight without any elbows or bends. While the invention has been described with respect to specific examples including presently preferred modes of carrying out the invention, those skilled in the art will appreciate that there are numerous variations and permutations of the above described systems and techniques. It is to be understood that other embodiments may be utilized and structural and functional modifications may be made without departing from the scope of the present invention. Thus, the spirit and scope of the invention should be construed broadly as set forth in the appended claims. |
|
summary | ||
abstract | In this X-ray phase imaging apparatus, at least one of a plurality of gratings is composed of a plurality of grating portions arranged along a third direction perpendicular to a first direction along which a subject or an imaging system is moved by a moving mechanism and a second direction along which an X-ray source, a detection unit, and a plurality of grating portions are arranged. The plurality of grating portions are arranged such that adjacent grating portions overlap each other when viewed in the first direction. |
|
claims | 1. An X-ray apparatus which is provided with an X-ray source ( 1 ) for producing X-rays ( 2 ), an X-ray detector ( 4 ) for detecting the X-rays, and a filter ( 12 ) which is arranged between the X-ray source and the X-ray detector and includes a plurality of tubular filter elements ( 13 ) for receiving an X-ray absorbing and electrically conductive liquid filling ( 22 ), first means ( 140 ) being provided for applying an electric voltage to individual filter elements ( 13 ), an X-ray absorptivity of the individual filter elements being adjustable by control of a quantity of X-ray absorbing liquid filling ( 22 ) present within the individual filter elements ( 13 ), characterized in that the filter ( 12 ) is also provided with a hydrostatic pressure control system ( 160 ) for controlling a hydrostatic pressure in the filter elements, measuring means being provided for measuring a physical quantity related to the height of a column of the X-ray absorbing liquid filling ( 224 ) within the filter elements, and with control means for controlling the hydrostatic pressure control system ( 160 ), the height of the column of the X-ray absorbing liquid filling ( 224 ) in an individual filter element being determined by the combination of the hydrostatic pressure and the electric voltage applied to the filter element. 2. A filter ( 12 ) for use in the X-ray apparatus claimed in claim 1 , wherein the measuring means are arranged to measure a reference electric voltage ( 300 , 301 ) in at least one reference filter element ( 135 ). claim 1 3. A filter ( 12 ) for use in the X-ray apparatus claimed in claim 1 , wherein a common liquid supply duct ( 220 , 221 ) is provided for all filter elements ( 13 ) and the measuring means are arranged to measure a hydrostatic pressure ( 131 ) in the common liquid supply duct ( 220 ). claim 1 4. A filter ( 12 ) for use in the X-ray apparatus as claimed in claim 1 , wherein the measuring means are provided with means for measuring an orientation (xcex2) of the filter as a whole relative to a vertical direction (g). claim 1 5. A filter ( 12 ) for use in the X-ray apparatus claimed in claim 1 , wherein a common liquid duct ( 220 , 221 ) is provided for all filter elements ( 13 ) and a liquid reservoir is provided for the supply of the X-ray absorbing liquid ( 224 ) via the common supply duct. claim 1 6. A filter ( 12 ) as claimed in claim 5 , wherein the liquid reservoir ( 150 , 150 xe2x80x2) includes tubular elements. claim 5 7. A filter ( 12 ) as claimed in claim 6 , wherein the tubular elements are filter elements ( 13 xe2x80x2, 13 xe2x80x3). claim 6 8. A filter ( 12 ) as claimed in claim 7 , wherein the first means are arranged to drain the liquid filling ( 22 ) from an internal volume of each filter element ( 13 ) to at least one corresponding filter element ( 13 xe2x80x2, 13 xe2x80x3) in the liquid reservoir ( 150 , 150 xe2x80x2). claim 7 9. A filter ( 12 ) for use in the X-ray apparatus as claimed in claim 1 , wherein the filter includes a number of sub-filters ( 212 , 213 , 214 , 215 ) that are hydraulically separated from one another. claim 1 |
|
062513095 | summary | BACKGROUND OF THE INVENTION The present invention relates to a method of manufacturing uranium dioxide fuel pellets. Particularly, this invention relates to a method of making U.sub.3 O.sub.8 single crystals and manufacturing large-grained uranium dioxide (UO.sub.2) fuel pellets through the use of a mixture comprising UO.sub.2 powder and U.sub.3 O.sub.8 single crystals. Uranium dioxide (UO.sub.2) fuel pellets have been manufactured using UO.sub.2 powder according to the following processes; homogenizing UO.sub.2 powder or mixing UO.sub.2 powder with other additives, pressing UO.sub.2 powder into green pellets, and sintering the green pellets at about 1700.degree. C. in a reducing gas atmosphere to produce UO.sub.2 pellets. The UO.sub.2 pellet has a cylindrical shape of about 8 mm diameter and 10 mm length, and it has a density of about 95% of theoretical density (TD) and a grain size of about 8 .mu.m. UO.sub.2 pellets are loaded into a zirconium-based tube, which is then seal-welded to fabricate a fuel rod. The defective UO.sub.2 pellets, which do not meet pellet specifications, are usually made in a small quantity during the process of pellet manufacture. Since defective UO.sub.2 pellets contain expensive enriched uranium, they are commonly recycled in the manufacture of new UO.sub.2 pellets according to the following method. Firstly, U.sub.3 O.sub.8 powder is made by heating defective UO.sub.2 pellets at around 450.degree. C. in air so as to oxidize UO.sub.2 to U.sub.3 O.sub.8, and the U.sub.3 O.sub.8 powder is then mixed with UO.sub.2 powder. Secondly, the mixture of UO.sub.2 and U.sub.3 O.sub.8 powder is pressed and sintered to produce UO.sub.2 pellets in the same way as the single UO.sub.2 powder. The U.sub.3 O.sub.8 powder is much less sinterable (capable of getting a high pellet density) than the UO.sub.2 powder, so that its content is generally limited within 15% by weight of the mixture of UO.sub.2 and U.sub.3 O.sub.8 powder. The art to improve the sinterability of U.sub.3 O.sub.8 powder has been disclosed in the literatures of U.S. Pat. No. 3,140,151 and U.S. Pat. No. 3,578,419. While a fuel rod is irradiated (burned) in a nuclear reactor, the fission gas such as xenon and krypton is generated in a fuel pellet and is released to the outside of the fuel pellet. The pressure in a fuel rod builds up increasingly with burnup. The fission gas released should be maintained as low as possible, for an excessive pressure gives rise to the failure of a fuel rod. In high burnup, the fission gas released may restrict the performance of a fuel rod. It has been known that a fuel pellet having a large grain provides a good performance since the amount of the fission gas released during irradiation decreases with increasing the grain size of a fuel pellet. It is a common sense that increasing sintering temperature and time makes a large-grained fuel pellet, but such a sintering method is not economical. Therefore, the art has been disclosed which provides a method of manufacturing large-grained UO.sub.2 pellets with the aid of sintering additives. According to the method of U. S. Pat. No. 4,869,867, UO.sub.2 fuel pellets having an average grain size of at least 20 .mu.m are produced by adding aluminosilicate to UO.sub.2 powder, pressing and sintering. A shortcoming of the prior art is that the sintering additive may have an adverse effect on the other properties of the UO.sub.2 fuel pellet. For example, the sintering additive may degrade thermal properties such as thermal conductivity and melting point. On the other hand, the art has been known which provides a method of manufacturing a large-grained UO.sub.2 pellet with no sintering additive added. U.S. Pat. No. 4,578,229 disclosed a method of sintering UO.sub.2 green pellets at a temperature range of 1000.degree. C. to 1400.degree. C. in an oxidizing gas such as carbon dioxide and reducing the sintered pellet at that temperature range in a reducing gas. The prior art has a problem in that a special sintering furnace is needed in which an oxidizing gas and a reducing gas can be used separately. SUMMARY OF THE INVENTION The above disadvantages of the prior arts are overcome by the present invention. A principal object of this invention is to provide a method of manufacturing large-grained UO.sub.2 fuel pellets in a reducing gas atmosphere with the aid of U.sub.3 O.sub.8 single crystals. With the foregoing object and other objects in view, there is provided in accordance with the invention a method of manufacturing large-grained UO.sub.2 pellets, comprising annealing U.sub.3 O.sub.8 powder at temperatures of 1000.degree. C. to 1500.degree. C. in order to produce U.sub.3 O.sub.8 polycrystalline aggregates having a large crystal size; dividing the U.sub.3 O.sub.8 polycrystalline aggregate into its constituent U.sub.3 O.sub.8 single crystals; forming a mixture of UO.sub.2 powder and the U.sub.3 O.sub.8 single crystals; making granules of the mixture; pressing the granules into green pellets; and sintering the green pellets at temperatures above 1600.degree. C. in a reducing gas atmosphere to produce large-grained UO.sub.2 pellets. The method according to the invention is characterized in that the U.sub.3 O.sub.8 powder is produced preferably by heating defective UO.sub.2 pellets at temperatures of 300.degree. C. to 800.degree. C. in an oxidizing gas to oxidize UO.sub.2 to U.sub.3 O.sub.8. The method according to the invention is characterized in that the mixture includes 1% to 15% by weight of the U.sub.3 O.sub.8 single crystals. An advantage of the present invention is that a large-grained UO.sub.2 pellet is produced in a reducing gas atmosphere without adding any sintering additives. Another advantage is that defective UO.sub.2 pellets can be reused in producing large-grained UO.sub.2 pellets, so fuel fabrication cost is saved. |
053944461 | abstract | A gauge for ensuring that the uncoupling rod of a control rod drive is properly inserted in the center hole of the spud and not in one of the outer lobes, i.e., spud flow holes, which communicate with the center hole. The uncoupling rod is inserted in the spud. Then the gauge is placed on top of the spud with a centering ring protruding into the spud. The uncoupling rod is correctly installed if it is free to slide inside the gauge and the spud. The gauge is also provided with a ring to protect the spud during transfer of the control rod drive. |
claims | 1. A scanning device for providing a radiation scan to an article, the scanning device comprising:a housing having a entrance port and an exit port and enclosing a radiation analysis unit;a transport system for moving the article from the entrance port, through the housing and to the exit port; anda radiation attenuation system supported at one of the entrance port and the exit port, the radiation attenuation system including at least one substantially rigid panel rotatable relative to the housing and a counter balance coupled to the panel to at least partially offset the weight of the panel. 2. The scanning device of claim 1, wherein the at least one panel comprises a plurality of panels arranged in a lateral direction relative to each other. 3. The scanning device of claim 2, wherein the plurality of panels are formed of stainless steel. 4. The scanning device of claim 2, wherein a gap slight gap separates adjacent panels in the lateral direction. 5. The scanning device of claim 2, wherein adjacent panels are substantially abutting each other. 6. The scanning device of claim 2, wherein the radiation attenuation system further includes a mounting device coupled between the counter balance and the panel. 7. The scanning device of claim 6, wherein the mounting device defines an aperture configured to receive a pivot shaft about which the panel is configured to rotate. 8. The scanning device of claim 7, wherein the pivot shaft is coupled to the housing. 9. The scanning device of claim 7, wherein the pivot shaft is a circular rod that defines an axis of rotation of the panel. 10. The scanning device of claim 7, wherein the mounting device is in the form of a bracket configured to engage the pivot shaft in at least two positions that are offset from each other. 11. The scanning device of claim 10, wherein the bracket is configured to directly engage the pivot shaft. 12. The scanning device of claim 7, further comprising a stop mechanism for restricting the rotation of the panels, the stop mechanism being substantially parallel to the pivot shaft. 13. The scanning device of claim 12, wherein stop mechanism restricts the panels from rotating downward toward the transport system. 14. The scanning device of claim 1, wherein transport system is a conveyor system having a conveyor belt and at least one roller. 15. The scanning device of claim 1, wherein the article being scanned is a food product. 16. The scanning device of claim 15, wherein the food product is a meat and the radiation analysis unit is configured to measure the percentage of fat within the meat. 17. The scanning device of claim 1, wherein the weight of the counter balance is substantially the same as the weight of the panel. 18. A radiation attenuation system for use with a scanning device, the radiation attenuation system comprising:a support structure;a mounting device rotatably supported at the support structure;a substantially rigid panel formed of a radiation attenuation material and coupled to a first portion of the mounting device, the panel being configured to move between a retracted position and an extended position; anda counter balance coupled to a second portion of the mounting device,wherein the counter balance has a weight configured to assist in moving the panel between the retracted position and the extended position. 19. The radiation attenuation system of claim 18, further comprising a stop mechanism configured to restrict the rotation of the panel in a downward direction. 20. A method of attenuating radiation within a scanning device, the method comprising:coupling a support structure to at least one of an entrance port of the scanning device and a exit port of the scanning device, the support structure including a pivot shaft extending in a lateral direction;rotatably supporting a plurality of mounting devices on the pivot shaft;coupling a rigid panel formed of a radiation attenuation material to a first portion of each mounting; andcoupling a counter balance to a second portion of each mounting device opposite the panel. |
|
summary | ||
044217153 | abstract | The baffle maintenance apparatus comprises a peening apparatus mounted on a movable carriage for reducing the width of a gap between two adjacent baffle plates in a nuclear reactor. The peening apparatus comprises an hydraulic hammer mounted on a pivotable plate that is capable of being positioned in proper relationship to the baffle plate for reducing the gap therebetween. The baffle maintenance apparatus may also comprise a gauging mechanism mounted on the carriage for determining the width of the gap between the baffle plates. |
summary | ||
summary | ||
052767256 | description | DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring first to FIG. 3, which is a graph showing a distribution of synchrotron orbital radiation beam energy with respect to wavelength, the axis of the abscissa denotes the wavelengths and the axis of ordinate depicts the relative value of the energy. It is seen from FIG. 3 that in the synchrotron orbital radiation beam a light of wavelength within the visible region or a region adjacent thereto, has an energy which is about 1/100 of the maximum energy. In a first embodiment which will be described below, light in the visible region or a region adjacent thereto (within a range of about 3800-9000 angstroms), contained in the synchrotron orbital radiation beam, is used to execute the axis alignment of an exposure beam (SOR beam) and a pattern transferring exposure station of an exposure system. FIG. 1 is a side view schematically and diagrammatically showing a major part of an exposure system according to the first embodiment of the present invention. Denoted in this Figure at 1 is a pattern transferring exposure station of an exposure system (X-ray exposure apparatus); at 2 is first driving means by which the pattern transferring exposure station 1 can be translated in X-axis and Y-axis directions as viewed in the drawing and also can be rotationally moved in each of Wx and Wy directions about the X and Y axes, respectively. Denoted at 3 is a radiation beam (exposure beam) emanating from an electron orbital device (SOR) 23 and including an X-ray beam 5; at 4 is a mirror effective to transform the radiation beam 3 into an X-ray flux 5 having surface expansion, the transformation being made by, for example, oscillating the mirror itself; at 6 and 7 are a mask (in this example, which may be a dummy mask) and a wafer, respectively, which are placed in the pattern transferring exposure station 1; and at 8 is an axis adjusting optical system. The axis adjusting optical system 8 comprises members denoted at 9-16 supported as a unit in a predetermined relationship. The optical system 8 can be translated in X' and Y' directions and also can be rotationally moved in Wx' and Wy' directions, by second driving means 17. Denoted at 9 is an X-ray cut filter made of a non-brown glass for example, that is operable to intercept a radiation beam component in the X-ray region but to transmit only the light in the visible region or a region adjacent thereto; at 10 is a light blocking plate having an aperture of a circular shape or cross shape, for example; at 11 and 12 are first and second beam splitters; at 13 is a corner cube; at 14 is an autocollimator; at 15 is a telescope; and at 16 is a TV camera. Those elements denoted at 11, 13 and 14 cooperate to provide a first observation optical system, while those elements denoted at 12, 15 and 16 cooperate to provide a second observation optical system. With respect to the center of the aperture of the light blocking plate 10 and to the first and second beam splitters 11 and 12, the first and second observation systems have their optical axes placed in a coaxial relationship. Denoted at 18 and 18' are signal processors, each being adapted to process a signal from the autocollimator 14 or the TV camera 16, and to transmit a resultant signal to an associated controller 19 or 19'. The controllers 19 and 19' are operable in response to the outputs from the signal processors 18 and 18', respectively, to produce control signals for actuating the first and second driving means 2 and 17. Denoted at 20 is a reference surface provided, in this example, on a reflective member, for the axis alignment purpose. For example, the reference surface comprises an optical reflection flat surface having an alignment mark of a cross shape formed at the center thereof. The reflective member 6 may have a size and a shape the same as those of a mask or a wafer used for production of microcircuits. In this illustrated example, the reflective member is disposed at the position 6 in place of such a mask. Two coordinate systems as illustrated are determined so that the direction perpendicular to a reference plane, for setting the pattern transferring exposure station 1 of the exposure system, is depicted by Y; the direction of incidence of the X-ray flux 5 is depicted by Z; the direction parallel to the radiation beam 3 is depicted by Z' and the direction perpendicular to the radiation beam 3 is depicted by Y'. The operation for the axis adjustment to be made in the X-ray exposure system structured as described above, will be explained below. It is to be noted here that upon the axis adjustment, a mask stage or a wafer stage, which is included in the pattern transferring exposure station 1 and to which the reflective member 6 having the axis adjusting reference surface 20 is mounted, is disposed at such position and angle which are preset as a reference for the exposure, and that the mirror 4 is of the type that the radiation beam is diverged by oscillation thereof, is fixed at such angle which is the center of its maximum oscillation range. The mask stage, to which a reflective member having a reference surface 20 for the axis adjustment may be mounted, may be made to be only rotationally movable in a Wz direction (a rotational direction about the Z axis), with a result of coincidence of the center of the mask stage and the center of the exposure area. For this axis adjustment, first the axis of the exposure beam and the axis of the axis adjusting optical system 8 are brought into alignment by using the first observation optical system. Initially, the second driving means 17 operates to translate the axis adjusting optical system 8 in the X'-Y' plane through a predetermined distance to displace the same to a position traversing the radiation beam 3 and, thereafter, the radiation beam 3 is projected thereupon. The distance through which the axis adjusting optical system 8 is moved is set, while taking into account the retracted position of the optical system 8 itself and the position of the axis of the radiation beam 3 (having been designed), so that the center of the aperture stop of the light blocking plate 10 in the axis adjusting optical system 8 is located, after the movement of the optical system 8, just on or close to the axis of the radiation beam 3. While not shown in FIG. 1, the position of the pattern transferring exposure station 1 and the position of the axis adjusting optical system 8 are monitored by using suitable means such as a laser interferometer, for example, the results of such monitoring being fed back to the a controller. As the radiation beam 3 is projected on the axis adjusting optical system 8, the light component of the radiation beam 3 in the X-ray wavelength region is intercepted by the X-ray cut filter 9, and only the light in the visible region or in a region close thereto, passing in close proximity to the axis OX, is allowed to pass therethrough, and is then reduced to a minute diameter by means of the aperture of the light blocking plate 10. Thereafter, it passes through the second beam splitter 12 and enters into the first beam splitter 11. A portion of the light incident on the first beam splitter 11 is deflected by a first reflection surface and impinges on the corner cube 13. According to the characteristics of the corner cube 13, the inputted light emanates from the corner cube 13 along its oncoming path. Then, the light enters the first beam splitter again, and after passing therethrough, it is received by the autocollimator 14. Thus, as illustrated in FIG. 2, the light component in the visible region or a region adjacent thereto, contained in the radiation beam 3, appears within the view field of the autocollimator 14 in the form of a spot 21 having a shape as determined by the aperture of the light blocking plate 10. At this time, the projection of light by the autocollimator 14 itself is inhibited. Then, the second driving means 17 operates to move the axis adjusting optical system 8 so that the spot 21 comes to the center OC of the view field of the autocollimator 14 (i.e. the center of a cursor 22 or, alternatively, it may be a blade means having a minute aperture which represents the center position of the view field of the autocollimator). As is well known in the art, an autocollimator comprises a projection optical system for projecting an index, such as a cursor, upon a surface of the subject of measurement, and a re-imaging optical system for re-imaging an image projected on the subject of measurement through the projection optical system. The projection optical system and the re-imaging optical system have their optical axes placed in a coaxial relationship. Thus, the present embodiment uses such a common axis of the autocollimator as an optical axis OA of the autocollimator. When the above coincidence is accomplished, the axis OX of the radiation beam 3 and the axis OA of the autocollimator 14 are brought into a coaxial or a substantially coaxial relationship. More specifically, in this occasion, the signal processor 18 is used to process the information as obtained from the autocollimator to detect the position of the spot 21 upon the cursor 22 of the autocollimator. In accordance with a detected value, the controller 19 actuates the driving means 17 so that the spot position comes to the center OC. Subsequently, the second observation optical system is used additionally, to accomplish the axis alignment between the axis adjusting optical system 8 and the pattern transferring exposure station 1. Initially, by using the telescope 15 and the TV camera 16 and through the second beam splitter 12, a mark (of a cross shape, for example) which is provided at the center of the reference surface 20 is observed. Then, by using the first driving means 2, the pattern transferring exposure station 1 is displaced in X and Y directions so that the center of the mark becomes coincident with the center of a spot on the reference surface 20, which is seen at the middle of the picture plane (the spot being provided by a portion of the radiation beam 3 in the visible region or adjacent thereto, having been transmitted through the second beam splitter 12). At this time, the mark on the reference surface is illuminated by means of an unshown illumination source. The control of the driving means 2 at this time is executed by the controller 19'. More specifically, the signal processor 18' operates to process the information as obtained by the TV camera 16 to detect the positions of the mark and the spot on the reference surface 20, in response to which the controller 19' controls the driving means 2. When the cursor 22 (FIG. 2) of cross shape is projected upon the reference surface 20 through a second reflection surface of the first beam splitter 11, with the illumination by the light from the autocollimator any inclination of a normal to the reference surface 20 (i.e. the axis of the pattern transferring exposure station 1) with respect to the axis of the exposure beam can be detected, on the basis of any deviation between the cursor 22 and a reflection image within the view field of the autocollimator 14 by the reference surface 20. Thus, the pattern transferring exposure station 1 is moved rotationally in the Wx and Wy directions by the first driving means 2, so as to remove the inclination. More specifically, in this occasion, the information as obtained from the autocollimator is processed by the signal processor 18, whereby any deviation between the reflection image and the cursor 22 is detected. In response to a detected value, the controller 19 controls the driving means 2. If, by this adjustment, the spot on the reference surface 20 shifts from the center of the mark provided on the reference surface 20, the pattern transferring exposure station 1 is displaced in the X and Y directions in the manner described hereinbefore and, similarly, the inclination of the reference surface 20 is adjusted by the rotational movement in the Wx and Wy directions. By repeating the above-described adjustment to accomplish the axis adjustment between the pattern transferring exposure station 1 and the axis adjusting optical system 8, finally the axis OX of the exposure beam and the axis OM of the pattern transferring exposure station 1 can be aligned with each other. After the adjustment is completed, the axis adjusting optical system 8 is retracted to a position not intercepting the radiation beam 3, whereby the exposure system becomes ready for the exposure. An X-ray beam has an angle of divergence of 1 milliradian and, therefore, a mechanical precision not greater than 0.1 milliradian may be required. However, an autocollimator can provide a precision not greater than 1 second (5 microradians), and thus is sufficient. In the present embodiment, the axis adjusting optical system 8 is disposed between the radiation beam source 23 and the mirror 4. However, it may be disposed between the mirror 4 and the pattern transferring exposure station 1. Light blocking plate 10 usable in the present invention will be explained in greater detail. FIG. 4 is a top plan view of such a light blocking plate 10. As shown, it is provided with an aperture 23 whose diameter is set sufficiently small, as compared with the diameter or size of the radiation beam 3. The light blocking plate 10 can function to restrict or reduce the diameter of the radiation beam, and this provides various advantages which will be explained in conjunction with FIG. 5. Denoted in FIG. 5 at 24 and 25 are different radiation beams projected on the light blocking plate 10 in different directions. Reference numerals 26 and 27 denote the portions of the radiation beams 24 and 25 which pass through the light blocking plate 10. Denoted at 28 is a light receiving sensor which may comprise a linear image sensor, for example. Reference numerals 29 and 30 depict the positions on the sensor 28 at which the axes 26 and 27 intersect with the sensor 28. The sensor 28 and the light blocking plate 10 are made integrally with each other. In operation, the radiation beams 24 and 25 are restricted and reduced to sufficiently small diameters, by the light blocking plate 10, and are received by the sensor 28. The direction of projection of each radiation beam 24 or 25 upon or with respect to the light blocking plate 10 and the sensor 28 can be detected on the basis of the position of incidence thereof upon the sensor 28. If such light blocking plate 10 is not used, it is necessary to use a large sensor having a wide light receiving surface, which is larger than the cross-sectional area of the radiation beams 24 and 25, in order to detect the direction of projection of these beams. This is a disadvantage since the structure becomes bulky and expensive. While the invention has been described with reference to the structures disclosed herein, it is not confined to the details set forth and this application is intended to cover such modifications or changes as may come within the purposes of the improvements or the scope of the following claims. |
abstract | The invention is an imaging apparatus comprising a detector device (12) for determining points of incidence of photons and having an impact surface (13), and an aperture (16) suitable for projecting the photons to the detector device (12) having an inlet surface (17) and an outlet surface facing the impact surface (13), and comprising pinholes (18′, 18″, 22) connecting the inlet surface (17) and the outlet surface. The pinholes (18′, 18″, 22) comprise one or more central pinholes (18′, 22) and one or more peripheral pinholes (18″), and at least one central pinhole (18′, 22) and at least one peripheral pinhole (18″) are formed with focal opening (20′, 20″, 23) depth or focal opening (20′, 20″, 23) sizes different from each other. Furthermore, the invention is an aperture for the imaging apparatus and a method of manufacturing an aperture of an imaging apparatus. |
|
abstract | Exemplary embodiments provide a method for laying out an integrated circuit (“IC”) design and the IC design layout. In one embodiment, the IC design layout can include a first feature placed on a first intersecting point of a grid. The placed first feature can define a local grid area. The local grid area can further include a plurality of local intersecting points having an outer perimeter spaced from any outermost local intersecting point in a spacing ranging from a length of a grid side to a length of a grid diagonal of a grid unit. A second feature can either be restrictively placed on any local intersecting point of the local grid area, or be randomly placed on any location outside the outer perimeter of the local grid area. |
|
abstract | An apparatus and method are provided which are designed to structurally replace welds that attach a riser brace assembly to a jet pump riser pipe. The riser brace assembly may include an upper clamp assembly, a lower clamp assembly, and a plurality of mechanical fasteners to provide clamping forces to the upper clamp assembly and the lower clamp assembly. The upper clamp assembly and the lower clamp assembly sandwich a riser brace support, wherein the riser brace support is provided with at least one through-hole to accommodate the plurality of mechanical fasteners. |
|
abstract | Compliance with administrative limits on cumulative exposure of control rod groups in the reactor core, is monitored by computing the incremental effective exposure for each group commensurate with core power, for each time increment at which each group is within the position range where an administrative limit is imposed. The increments of effective exposures for each group are accumulated, and the accumulated effective exposure for each group is compared with the administrative limit to each group. This comparison is then displayed to the reactor operator, preferably using either a xe2x80x9crolling wheelxe2x80x9d or xe2x80x9csliding barxe2x80x9d format. |
|
description | This application claims priority from Korean Patent Application No. 10-2007-0014896 filed on Feb. 13, 2007 in the Korean Intellectual Property Office, the contents of which are herein incorporated by reference in their entirety. 1. Technical Field The present disclosure is directed to a mask set, and more particularly, to a mask set for in-situ synthesizing probes of a microarray, a method of fabricating the mask set, and a method of fabricating the microarray using the mask set. 2. Description of the Related Art Advances in the genome project have revealed genome nucleotide sequences of various organisms. Accordingly, there is a growing interest in microarrays. Microarrays are widely used for gene expression profiling, genotyping, detection of mutations and polymorphisms, such as single nucleotide polymorphisms (SNPs), analysis of proteins and peptides, screening of potential medicine, development and production of new medicine, and the like. A microarray includes a plurality of probes fixed to a substrate. The probes may be directly fixed to the substrate by spotting or in-situ synthesized using photolithography and then fixed to the substrate. In particular, in-situ synthesis using photolithography is recently drawing attention because it facilitates mass production of microarrays. A plurality of masks are used for the in-situ synthesis of probes. Each mask includes light-transmitting regions and light-blocking regions. In addition, each mask is allocated any one of a plurality of, e.g., four, probe monomers. If there are four probe monomers, a maximum of four separate masks are required to complete a monomer layer of a probe. If a probe is composed of 25 monomer layers, a maximum of 100 separate masks would be required. The light-transmitting regions of each mask respectively correspond to probe cells where monomers are to be synthesized. Therefore, the pattern of each mask varies according to the sequence of target probes that are to be synthesized in each probe cell. That is, while light-transmitting regions may occupy an average of, for example, 25% of an entire mask, their proportion in each mask may be far smaller than the average according to the probe sequence of each probe cell. In the extreme case, some masks may have light-transmitting regions which occupy less than 1% thereof. If a proportion of the light-transmitting regions in some masks is excessively small, it is challenging to perform precise patterning during mask fabrication. For example, since the light-transmitting regions are either partially open or closed, light-transmitting regions of a desired size and/or shape cannot be secured. This situation aggravates as microarrays become more integrated. Embodiments of the present invention provide a mask set with a controlled proportion of light-transmitting regions. Embodiments of the present invention also provide a mask layout determination system controlling the proportion of light-transmitting regions of a mask layout. Embodiments of the present invention also provide a mask layout determination method which controls a proportion of light-transmitting regions of a mask layout. Embodiments of the present invention also provide a method of fabricating a mask set using each mask layout with a controlled proportion of light-transmitting regions. Embodiments of the present invention also provide a method of fabricating a microarray using the mask set. However, the features of the embodiments of the present invention are not restricted to the one set forth herein. The above and other features will become more apparent to one of daily skill in the art to which embodiments of the present invention pertain by referencing a detailed description of the present invention given below. According to an aspect of the present invention, there is provided a mask set including a plurality of masks performing in-situ synthesis on probes of a microarray, wherein each mask includes light-transmitting regions and light-blocking regions, and a proportion of the light-transmitting regions in each mask is equal to or greater than about 5% of a total proportion of the light-transmitting and light-blocking regions in each mask. According to another aspect of the present invention, there is provided a mask layout determination system including a pattern determination unit for allocating light-transmitting regions and light-blocking regions to each of a plurality of mask layouts which perform in-situ synthesis on probes of a microarray; a selection unit for selecting any one of the mask layouts; a comparison unit for comparing a proportion of the light-transmitting regions in a selected mask layout with a minimum light-transmitting proportion; and a pattern change unit for exchanging a light-blocking region of the selected mask layout with a light-transmitting region of an unselected mask layout if the proportion of the light-transmitting regions in the selected mask layout is smaller than the minimum light-transmitting proportion. According to another aspect of the present invention, there is provided a mask layout determination method including allocating light-transmitting regions and light-blocking regions to each of a plurality of mask layouts which perform in-situ synthesis on probes of a microarray; and exchanging a light-blocking region of a mask layout with a light-transmitting region of another mask layout wherein a proportion of the light-transmitting regions in each mask layout is equal to or greater than a minimum light-transmitting proportion. According to another aspect of the present invention, there is provided a method of fabricating a mask set. The method includes allocating light-transmitting regions and light-blocking regions to each of a plurality of mask layouts which perform in-situ synthesis on probes of a microarray; exchanging a light-blocking region of a mask layout with a light-transmitting region of another mask layout wherein a proportion of the light-transmitting regions in each mask layout is equal to or greater than a minimum light-transmitting proportion; and fabricating a plurality of masks using the mask layouts which include each mask layout whose light-blocking region is exchanged with a light-transmitting region. According to another aspect of the present invention, there is provided a method of fabricating a microarray. The method includes providing a substrate comprising an array of a plurality of probe cells and having a surface protected by a photolabile protecting group; and performing in-situ synthesis on probes of a microarray using a mask set which comprises a plurality of masks, each comprising light-transmitting regions and light-blocking regions, wherein a proportion of the light-transmitting regions is equal to or greater than about 5% of a total proportion of the light-transmitting and light-blocking regions. Embodiments of the present invention will now be described more fully with reference to the accompanying drawings, in which exemplary embodiments of the invention are shown. The invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Like reference numerals in the drawings denote like elements, and thus their description will be omitted. Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings. FIG. 1 is a perspective view of a microarray 100 fabricated according to an embodiment of the present invention. FIG. 2 is a cross-sectional view of the microarray 100 taken along a line II-II′ of FIG. 1. Referring to FIGS. 1 and 2, the microarray 100 includes a substrate 110 and a plurality of probes 140. The probes 140 are coupled onto the substrate 110. The microarray 100 may further include a fixing layer 120 and/or a linker 130 between the probes 140 and the substrate 110. The fixing layer 120 and/or the linker 130 couples the probes 140 to the substrate 110. The substrate 110 may be, for example, a flexible or rigid substrate. An example of a flexible substrate includes a membrane or plastic film such as nylon and nitrocellulose. Examples of a rigid substrate include a silicon substrate and a transparent glass substrate formed of soda lime glass. In the case of the silicon substrate or the transparent glass substrate, non-specific binding rarely occurs during hybridization. In addition, various thin-film fabrication processes and a photolithography process, which are well established and applied to the process of fabricating semiconductor devices or liquid crystal display (LCD) panels, can also be applied to fabricate the silicon substrate or the transparent glass substrate. The probes 140 may be, for example, oligomer probes. An oligomer is a polymer composed of two or more covalently bonded monomers, and its molecular weight may be approximately 1,000 or less. The oligomer may include approximately 2 through 500 monomers. More specifically, the oligomer may include approximately 5 through 30 monomers. However, the oligomer, which is mentioned in the present invention, is not limited to the above figures, and it encompasses everything that can be called ‘oligomer’ in the art. Each monomer of an oligomer probe may be, for example, a nucleoside, a nucleotide, an amino acid, or a peptide. Each of the nucleosides and nucleotides may include a methylated purine or pyrimidine and an acylated purine or pyrimidine as well as the well-known purine and pyrimidine bases. Examples of the purine and pyrimidine bases may include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). In addition, each of the nucleosides and nucleotides may include ribose and deoxyribose sugar, but also modified sugar obtained by replacing one or more hydroxyl groups with halogen atoms or aliphatic families or by being bonded to functional groups such as ether and amine. The amino acid may be an L-, D-, or nonchiral amino acid found in nature, a modified amino acid, or an amino acid analog. The peptide is a compound created by an amino bond between a carboxyl group of an amino acid and an amino group of another amino acid. Therefore, each of the oligomer probes 140 may be formed of two or more nucleocides, nucleotides, amino acids, or peptides. Each of the probes 140 may be formed by in-situ synthesis of probe monomers. The in-situ synthesis of the probe monomers may be performed using a mask set which includes a plurality of masks. The masks and the mask set will be described in detail later. The fixing layer 120 interposed between the substrate 110 and the probes 140 couples the probes 140 to the substratel 10. The fixing layer 120 may be formed of a substantially stable material under a hybridization analysis condition, that is, a material which is not hydrolyzed when contacting phosphate of pH 6-9 or a TRIS buffer. For example, the fixing layer 120 may be formed of a silicon oxide film such as a plasma-enhanced tetraethyl orthosilicate (PE-TEOS) film, a high density plasma (HDP) oxide film, a P—SiH4 oxide film or a thermal oxide film, a silicate such as a hafnium silicate or a zirconium silicate, a metal oxynitride film such as a silicon oxynitride film, a hafnium oxynitride (HfON) film or a zirconium oxynitride film, a metal oxide film such as a titanium oxide film, a tantalum oxide film, an aluminum oxide film, a hafnium oxide film, a zirconium oxide film or an indium tin oxide (ITO) film, metal such as polyimide, polyamine, gold, silver, copper or palladium, or a polymer such as polystyrene, a polyacrylic acid or polyvinyl. The linker 130 may optionally be interposed between the fixing layer 120 and the probes 140. The linker 130 couples the probes 140 to the fixing layer 120. Therefore, the linker 130 may be formed of a material including a functional group which can be coupled to the fixing layer 120 and a functional group which can be coupled to the probes 140. Furthermore, the linker 130 may provide a spatial margin for hybridization. To this end, the length of the linker 130 may be, but is not limited to, about 6 through 50 atoms. The microarray 100 configured as described above includes a plurality of probe cells. For illustrative purposes, an exemplary, non-limiting microarray includes first through twelfth probe cells P1-P12. It is to be understood that microarrays according to other embodiments can be configured with a different number of probe cells. Each of the first through twelfth probe cells P1-P12 is a segment to which the probes 140 are coupled. Therefore, it may be understood that the first through twelfth probe cells P1-P12 include the probes 140 and an object to which the probes 140 are coupled. As described above, the object to which the probes 140 are coupled may be the substrate 110, the fixing layer 120, and/or the linker 130. Therefore, it can be understood that anything referred to as a probe cell includes the object and at least one of the substrate 110, the fixing layer 120, and the linker 130. The first through twelfth probe cells P1-P12 can be distinguished from one another by the sequence of the probes 140 coupled to the fixing layer 120 and/or by physical patterns of the fixing layer 120. More specifically, probes included in the same probe cell have substantially the same probe sequence. On the other hand, probes included in different probe cells have different probe sequences. Referring to FIG. 2, all probes PROBE 5 included in the fifth probe cell P5 have the same probe sequence. The same applies to probes PROBE 6, PROBE 7, and PROBE 8. However, when it comes to the relationship between the probes PROBE5, PROBE 6, PROBE 7 and PROBE 8, the probes PROBE5, PROBE 6, PROBE 7 and PROBE 8 have different probe sequences since they are included in different probe cells, i.e., the fifth through eighth probe cells P5-P8, respectively. That is, the fifth probe cell P5 including the probes PROBE 5, the sixth probe cell P6 including the probes PROBE 6, the seventh probe cell P7 including the probes PROBE 7, and the eighth probe cell P8 including the probes PROBE 8 sequentially arranged from the left in FIG. 2 may be distinguished from one another by their probe sequences. Similarly, the same applies to the first through fourth probe cells P1-P4 and the ninth through twelfth probe cells P9-P12. Another standard for distinguishing the first through twelfth probe cells P1-P12 is a physical pattern. That is, the first through twelfth probe cells P1-P12 may be physically patterned, and an isolation region (not shown) may be interposed between them. As illustrated in FIG. 1, the first through twelfth probe cells P1-P12 may be patterns arranged in rows and columns and have substantially the same size and shape. Hereinafter, a mask used for the in-situ synthesis of the probes 140 in the microarray 100 will be described. FIG. 3 is a plan view of a mask 201 according to an embodiment of the present invention. FIG. 4 is a cross-sectional view of the mask 201 taken along a line IV-IV′ of FIG. 3. Referring to FIG. 3, the mask 201 may be divided into a plurality of segments respectively corresponding to probe cells in a microarray. Each segment is occupied by any one of a light-transmitting region TR and a light-blocking region BR. The total number of light-transmitting regions TR and light-blocking regions BR in the mask 201 is equal to the number of corresponding probe cells regardless of whether the above regions are adjacent to one another. Therefore, in FIG. 3, there are two light-transmitting regions TR and ten light-blocking regions BR. A cross-sectional structure of the mask 201 will now be described with reference to FIG. 4. The mask 201 includes a base 220 formed of transparent glass, a light-blocking pattern layer 230 partially formed on the base 220 and formed of an opaque material such as chrome, and a reflection preventive pattern layer 240, for example, formed of chrome oxide. The light-transmitting and light-blocking regions TR and BR of the mask 201 are determined according to whether the light-blocking pattern layer 230 is formed. That is, a region where the light-blocking region 230 is formed is a light-blocking region BR, and a region where the light-blocking region 230 is not formed is a light-transmitting regions TR since the transparent base 220 is exposed. A method of fabricating the mask 201 will now be described with reference to FIGS. 5A through 5C. FIGS. 5A through 5C are cross-sectional views for explaining the method of fabricating the mask 201 illustrated in FIG. 4. Referring to FIG. 5A, a stack is provided of a light-blocking layer 230a, a reflection preventive layer 240a, and a photoresist film 250a sequentially formed on the base 220. The photoresist film 250a is selectively exposed as indicated by reference numeral 400. Here, a region (hereinafter, referred to as an exposure region) of the photoresist film 250a, which is to be exposed, may be selected based on a mask layout which is prepared in advance. Referring to FIG. 5B, the selected exposure region of the photoresist film 250a is removed in a photolithography process. Consequently, a photoresist pattern 250 exposing the reflection preventive layer 240a is formed. Referring to FIG. 5C, the exposed reflection preventive layer 240a and the light-blocking layer 230a beneath the exposed reflection preventive layer 240a are etched. Consequently, the reflection preventive pattern layer 240 and the light-blocking pattern layer 230 are formed, and the substrate 220 thereunder is exposed. The exposed reflection preventive layer 240a and the light-blocking layer 230a may be anisotropically etched. Next, if the photoresist pattern 250 is removed, the mask 201 illustrated in FIG. 4 can be completed. A region where the reflection preventive layer 240a and the light-blocking layer 230a therebeneath are removed is the light-transmitting region TR. In the above fabrication process, the selective exposure process 400 of the photoresist film 250a is performed using, for example, electronic beams. In the selective exposure process 400, if the size of the selected exposure region is much smaller than the size of the mask 201, it becomes challenging to perform accurate patterning. For example, when various masks are fabricated using electronic beams having the same dose, if an exposure region is excessively small, it cannot be exposed to a desired exposure dose. In addition, in a developing process, an excessively small exposure region hinders precise development. Consequently, the reliability of mask patterns, i.e., the light-transmitting and light-blocking regions TR and BR, is reduced. Therefore, the light-transmitting regions TR may account for an appropriate proportion of the mask patterns fabricated. For example, a proportion of the light-transmitting regions in the mask patterns may be greater than a minimum light-transmitting proportion. The minimum light-transmitting proportion may vary according to the size of a light-transmitting region TR. The size of a light-transmitting region TR is proportional to the size of a probe cell. For example, if each probe cell is a square having a side of about 10 μm or greater and thus an area of 100 μm2 or greater, a proportion (the sum of the sizes of light-transmitting regions if there are a plurality of light-transmitting regions) of the light-transmitting regions TR in the mask 201 may be equal to or greater than approximately 5% of a total proportion (the sum of the sizes of all light-transmitting and light-blocking regions) of the light-transmitting and light-blocking regions TR and BR in the mask 201. However, if the size of each probe cell is smaller than about 100 μm2, the minimum light-transmitting proportion is greater than the above figure. For example, if the size of each probe cell is about 1 through 100 μm2, the proportion of the light-transmitting regions TR in the mask 201 may be equal to or greater than approximately 7.5% of the total proportion of the light-transmitting and light-blocking regions TR and BR in the mask 201. If the size of each probe cell is about 0.01 through 1 μm2, the proportion of the light-transmitting regions TR in the mask 201 may be equal to or greater than approximately 10% of the total proportion of the light-transmitting and light-blocking regions TR and BR in the mask 201. In FIG. 3, two of 12 segments of the mask 201 are occupied by the light-transmitting regions TR. If the size of each light-transmitting region TR is equal to that of each light-blocking region BR, the proportion of the light-transmitting regions TR in the mask 201 is approximately 16.7%, that is, more than 10%, of the total proportion of the light-transmitting regions TR and the light-blocking regions BR in the mask 201. Therefore, the mask 201 illustrated in FIG. 3 can be applied when the size of each probe cell is about 0.01 μm2 or greater. FIG. 6 is a plan view of a mask 202 according to another embodiment of the present invention. Unlike the mask 201 illustrated in FIG. 3, the mask 202 illustrated in FIG. 6 allocates one of its twelve segments to a light-transmitting region TR. Therefore, a proportion of the light-transmitting region TR of the mask 202 illustrated in FIG. 6 is approximately 8.3% of a total proportion of the light-transmitting region TR and light-blocking regions BR in the mask 202. It is not impossible to use the mask 202 to fabricate probes of a microarray in which the size of each probe cell is about 0.01 through 1 μm2. However, the mask 202 may be used to fabricate probes of a microarray in which the size of each probe cell is about 1 μm2 or greater to enhance the reliability of the in-situ synthesis of the probes. If the size of each probe cell that is to be synthesized may be within the range of about 0.01 through 1 μm2 and if it is challenging to change the size, the design pattern of the mask 202 illustrated in FIG. 6 can be changed using a mask layout determination method according to an embodiment of the present invention, which will be described later, in a mask layout process performed before a mask fabrication process. Hence, the mask 202 may be fabricated to have the changed design pattern and provided accordingly. FIG. 7 is a perspective view of a mask set 21 0 according to an embodiment of the present invention. The mask set 210 includes a plurality of masks fabricated according to the above-mentioned embodiments of the present invention. Referring to FIG. 7, an exemplary, non-limiting mask set 210 according to an embodiment of the invention includes 12 masks M1-M12. Each of the masks M1-M12 is used for at least one lithography process to synthesize probes of a microarray. Therefore, the mask set 210 illustrated in FIG. 7 may be used for a total of at least 12 lithography processes to synthesize probes of a microarray. It is to be understood, however, that this mask set is illustrative, and mask sets according to other embodiments of the invention can have a different number of masks. Each lithography process is performed to synthesize a probe monomer. Therefore, each of the masks M1-M12 can be allocated to any one of a plurality of probe monomers that are to be synthesized. For example, if a monomer that is to be synthesized is a nucleotide phosphoamidite monomer having any one of adenine (A), guanine (G), thymine (T), and cytosine (C) as a base, each of the masks M1-M12 is allocated to the nucleotide phosphoamidite monomer having any one of adenine (A), guanine (G), thymine (T), and cytosine (C) as a base. Each of the masks M1-M12 that comprise the mask set 210 satisfies the conditions of the masks according to the embodiments of the present invention. Therefore, if the mask set 210 is used to synthesize probes of a microarray having probe cells, the size of each probe cell being about 100 μm2 or greater, the proportion of light-transmitting regions TR in each of the masks M1-M12 may be more than approximately 5% of the total proportion of the light-transmitting and light-blocking regions TR and BR in each of the masks M1-M12. Similarly, if the size of each probe cell is about 1 through 100 μm2, the light-transmitting regions TR may occupy more than approximately 7.5% of each of the masks M1-M12. If the size of each probe cell is about 0.01 through 1 μm2, the light-transmitting regions TR may occupy more than approximately 10% of each of the masks M1-M12. Hereinafter, a method of fabricating a mask set according to an embodiment of the invention will be described. In the following embodiment, for convenience, it is assumed that the size of each probe cell in a microarray for probes to be synthesized is about 0.01 through 1 μm2 and that the proportion of light-transmitting regions in each mask is equal to or greater than approximately 10% of the total proportion of the light-transmitting and light-blocking regions in each mask. However, it is to be understood that methods according to other embodiments of the invention are not limited to probe cells of this size. FIG. 8 is a flowchart illustrating a method of fabricating a mask set according to an embodiment of the present invention. Referring to FIG. 8, a plurality of mask layouts are determined (operation S11). Here, the mask layout includes an arrangement plan of mask patterns and mask pattern data which are required to fabricate a mask. That is, the mask layout may be provided as a drawing or as a data sheet. In addition, the mask layout may be provided as a way in which the mask pattern data is stored in a computer. As assumed above, all masks that are to be fabricated according to the present embodiment aim to have light-transmitting regions TR occupying more than approximately 10% of the total proportion of the light-transmitting and light-blocking regions TR and BR. Accordingly, a plurality of mask layouts are determined to correspond to the aimed masks. Next, a plurality of masks are fabricated according to the determined mask layouts (operation S12). The masks may be fabricated according to the determined mask layouts and using a method substantially identical to the method of fabricating a mask described above with reference to FIGS. 5A through 5C. The operation of determining the mask layouts will now be described in more detail. The mask layouts may be determined using a mask layout determination system. FIG. 9 is a block diagram of a mask layout determination system 300 according to an embodiment of the present invention. Referring to FIG. 9, the mask layout determination system 300 includes a pattern determination unit 310, a selection unit 320, a comparison unit 330, and a pattern change unit 340. The pattern determination unit 310 receives probe sequence data of a microarray, generates a plurality of mask layouts, which are applied to performing in-situ synthesis on probes of the microarray using the received probe sequence data, and allocates light-transmitting regions TR and light-blocking regions BR to each mask layout. The selection unit 320 receives data on each mask layout to which the light-transmitting regions TR and the light-blocking regions BR were allocated from the pattern determination unit 310 and selects any one of the mask layouts. The comparison unit 330 compares a proportion of the light-transmitting regions TR in the mask layout selected by the selection unit 320 with a minimum light-transmitting proportion. If the proportion of the light-transmitting regions TR in the selected mask layout is equal to or greater than the minimum light-transmitting proportion, the comparison unit 330 transmits the comparison result to the selection unit 320. Then, the selection unit 320 selects another mask layout. If the proportion of the light-transmitting regions TR in the selected mask layout is smaller than the minimum light-transmitting proportion, the comparison unit 330 transmits the comparison result to the pattern change unit 340. The pattern change unit 340 exchanges light-blocking regions BR of the selected mask layout, which includes the light-transmitting regions TR occupying a smaller proportion of the selected mask layout than the minimum light-transmitting proportion, with light-transmitting regions TR of another unselected mask layout, thereby increasing the number of light-transmitting regions TR included in the selected mask layout. Then, the pattern change unit 340 transmits the exchange result to the comparison unit 330. The comparison unit 330 compares the proportion of the increased number of light-transmitting regions TR in the selected mask layout with the minimum light-transmitting proportion. Optionally, the mask layout determination system 300 may further include an examination unit 350. If the comparison unit 330 determines that the proportion of the light-transmitting regions TR in each mask layout is equal to or greater than the minimum light-transmitting proportion, the examination unit 350 simulates probe synthesis using the mask layouts and examines whether the sequence of the simulation-synthesized probes is substantially identical to the probe sequence data (a desired probe sequence) initially provided by the pattern determination unit 310. FIG. 10 is a flowchart illustrating a mask layout determination method according to an embodiment of the present invention. Referring to FIG. 10, light-transmitting regions TR and light-blocking regions BR are allocated to a plurality of mask layouts (operation S21). Specifically, any one of monomers that are to be synthesized can be allocated to each of the mask layouts, and the sequence of the mask layouts to which any one of monomers is allocated is determined. Next, each mask layout is divided into a plurality of segments respectively corresponding to a plurality of probe cells. Then, the light-transmitting regions TR and the light-blocking regions BR are allocated to each segment. Next, it is determined whether a desired probe sequence is synthesized in each probe cell (operation S22). If the desired probe sequence is not synthesized, the light-transmitting regions TR and the light-blocking regions BR are allocated again to each mask layout. If the desired probe sequence is synthesized after operations S21 and S22 are repeated, it is determined whether a proportion of the light-transmitting regions TR in each mask layout is equal to or greater than a minimum light-transmitting proportion (operation S23). If the proportion of the light-transmitting regions TR in any one of the mask layouts is smaller than the minimum light-transmitting proportion, light-blocking regions BR of the selected mask layout are exchanged with light-transmitting regions TR of another mask layout (operation S24). In this case, the light-transmitting and light-blocking regions TR and BR, which are exchanged with each other, may correspond to the same probe cell. In addition, the same monomers may be allocated to the selected mask layout and another mask layout, light-transmitting regions TR of which are to be exchanged with light-blocking regions BR of the selected mask layout. Although the light-blocking regions BR are exchanged with the light-transmitting regions TR, the same probe sequence may be synthesized in the corresponding probe cell. Probe monomers are synthesized when they correspond to a light-transmitting region TR of a mask layout which corresponds to a probe cell. In this case, the monomers that are to be synthesized may be monomers allocated to a mask layout including the light-transmitting region TR that corresponds to the probe cell. Consequently, a probe sequence synthesized in the probe cell is substantially identical to the sequence of monomers allocated to the light-transmitting region TR that corresponds to the probe cell. Therefore, if the sequence of the monomers allocated to the light-transmitting region TR that corresponds to the probe cell is compared before and after the exchange, it can be identified whether substantially the same probe sequence is synthesized before and after the exchange. After the light-blocking and light-transmitting regions BR and TR are exchanged between the mask layouts, it is determined again whether the proportion of the light-transmitting regions TR in the selected mask layout is equal to or greater than the minimum light-transmitting proportion (operation S23). If the proportion of the light-transmitting regions TR in the selected mask layout is still smaller than the minimum light-transmitting proportion, the light-blocking and light-transmitting regions BR and TR are exchanged again (operation S24). Operations S23 and S24 are repeated until the proportion of the light-transmitting regions TR in each mask layout is equal to or greater than the minimum light-transmitting proportion. Consequently, the proportion of the light-transmitting regions TR in each mask layout becomes equal to or greater than the minimum light-transmitting proportion. Optionally, it is examined whether the desired probe sequence is synthesized using the mask layouts which have exchanged the light-transmitting and/or light-blocking regions TR and BR (operation S25). This examination is designed to enhance the reliability of the mask layouts with the changed patterns. If any one pattern in a plurality of mask layouts is flawed, when probes are synthesized using the mask layouts, a flawed probe sequence may be synthesized, which results in a flaw in the entire microarray. Therefore, it is desirable to perform a probe synthesis simulation test as a last operation. FIGS. 11 through 14 are perspective views for explaining operations of changing patterns of mask layouts according to an embodiment of the present invention. Operations S23 and S24 will now be described in more detail with reference to FIGS. 11 through 14. The present embodiment is based on the following non-limiting assumptions: that is, a microarray where probes are to be synthesized includes 12 probe cells; the size of each probe cell is within the range of about 0.01 through 1 μm2, and a minimum light-transmitting proportion of each mask is about 10% of the proportion of light-transmitting and light-blocking regions TR and BR in each mask; and the sequence of monomers to be synthesized in each probe cell is as shown in Table 1. TABLE 1Probe cellP1P2P3P4P5P6Probe sequenceATTCACTAAGTCCTCTGTCTAAAGProbe cellP7P8P9P10P11P12Probe sequenceCTGATGTTGTAGACGTCGCGTAGT (In Table 1, P1-P12 indicate first through twelfth probe cells. In addition, A, C, G and T respectively indicate monomers that are to be synthesized). As described above with reference to FIG. 10, the patterns and arrangement of a plurality of mask layouts are determined to synthesize the above probe sequences. A detailed description will be made with reference to Table 2 and FIG. 11. TABLE 2ProbeProbeML1ML2ML3ML4ML5ML6ML7ML8ML9ML10ML11ML12CellSequenceACGTACGTACGTP1ATTCATTCP2ACTAACTAP3AGTCAGTCP4CTCTCTCTP5GTCTGTCTP6AAAGAAAGP7CTGACTGAP8TGTTTGTTP9ATAGGTAGP10ACGTACGTP11CGCGCGCGP12TAGTTAGTNumber5551044552111of lighttransmittingregions Referring to Table 2 and FIG. 11, a plurality of, i.e., first through twelfth mask layouts ML1-ML12 are prepared and sequentially arranged. The embodiment of Table is exemplary and non-limiting, and it is to be understood that microarrays according to other embodiments can use a different number of mask layouts and a different number of probe cells. Then, monomers A, C, G and T that are to be synthesized are sequentially and alternately allocated to each of the first through twelfth mask layouts ML1-ML12. In addition, each of the first through twelfth mask layouts ML1-ML12 is divided into a plurality of segments respectively corresponding to first through twelve probe cells P1-P12. Then, monomers to be synthesized in a segment corresponding to each of the first through twelfth probe cells P1-P12 in each of the first through twelfth mask layouts ML1-ML12 are checked according to the target probe sequence of each of the first through twelfth probe cells P1-P12. Then, the light-transmitting regions TR are allocated to the segments. In addition, the light-blocking regions BR are allocated to all remaining segments except the light-transmitting regions TR of each of the first through twelfth mask layouts ML1-ML12. Then, mask layouts to which the light-transmitting regions TR are not allocated are removed, thereby determining the final number of mask layouts. The final number of mask layouts may be determined to be a minimum applicable number. To change the patterns of the first through twelfth mask layouts ML1-ML12, a mask layout, in which light-transmitting regions proportion is smaller than a minimum light-transmitting proportion, is selected. In Table 2, mask layouts in which the light-transmitting regions TR account for less than 10%, i.e., the minimum light-transmitting proportion, are the tenth through twelfth mask layouts ML10-ML12. That is, each of the tenth through twelfth mask layouts ML10-ML12 has only one light-transmitting region TR. Accordingly one of the tenth through twelfth mask layouts ML10-ML12 is selected. For example, the twelfth mask layout ML12, which is the last one of the tenth through twelfth mask layouts ML10-ML12, is selected. Next, light-blocking regions BR of the selected twelfth mask layout ML12 are exchanged with light-transmitting regions TR of another mask layout, that is, one of the first through eleventh mask layouts ML1-ML11. To maintain the probe synthesis sequence, an equal number of light-transmitting regions TR to the number of light-blocking regions BR, which correspond to the same probe cell, may be exchanged. In Table 2, an example satisfying the above condition may be to move any one of A, G, C, and T in a row direction to a blank column. In addition, mask layouts, which will exchange the light-transmitting and light-blocking regions TR and BR with the selected twelfth mask layout ML12, may be mask layouts which have been allocated the same monomer as the synthesis target monomer allocated to the twelfth mask layout ML12, here monomer T. That is, the fourth mask layout ML4 and the eighth mask layout ML8 to which the synthesis target monomer T is allocated are candidate mask layouts. A light-transmitting region TR, which can be exchanged without changing the probe sequence, is a light-transmitting region TR corresponding to fourth, fifth, and twelfth probe cells P4, P5, and P12 of the eighth mask layout ML8. Therefore, one of the light-transmitting regions TR corresponding to the fourth, fifth, and twelfth probe cells P4, P5, and P12 of the eighth mask layout ML8 is exchanged with a corresponding light-blocking region BR of the twelfth mask layout ML12. Table 3 below shows an example in which the light-transmitting region TR corresponding to the fourth probe cell P4 of the eighth mask layout ML8 is exchanged with the light-blocking region BR corresponding to the fourth probe cell P4 of the selected twelfth mask layout ML12. This example is also illustrated in FIG. 12. TABLE 3ProbeProbeML1ML2ML3ML4ML5ML6ML7ML8ML9ML10ML11ML12CellSequenceACGTACGTACGTP1ATTCATTCP2ACTAACTAP3AGTCAGTCP4CTCTCTCTP5GTCTGTCTP6AAAGAAAGP7CTGACTGAP8TGTTTGTTP9GTAGGTAGP10ACGTACGTP11CGCGCGCGP12TAGTTAGTNumber5551044542112of lighttransmittingregions It is determined whether the proportion of the light-transmitting region TR in the selected mask layout is equal to or greater than the minimum light-transmitting proportion. If the proportion of the light-transmitting region TR is still smaller than the minimum light-transmitting proportion even after the exchange of the light-transmitting and light-blocking regions TR and BR, any one of light-transmitting regions TR corresponding to the fifth and twelfth probe cells P5 and P12 of the eighth mask layout ML8 is exchanged with the light-blocking regions BR corresponding to the same probe cells, i.e., the fifth and twelfth probe cells P5 and P12 of the twelfth mask layout ML12. However, referring to Table 3 and FIG. 12, since the number of light-transmitting regions TR of the twelfth mask layout ML12 has been increased to two, the proportion of the light-transmitting regions TR is already equal to or greater than the minimum light-transmitting proportion. If the proportion of the light-transmitting regions TR is greater than the minimum light-transmitting proportion as described above, the pattern change of the selected mask layout is stopped, and a next mask layout is selected. For example, the eleventh mask layout ML11 immediately before the twelfth mask layout ML12 is selected. Referring to Table 3 and FIG. 12, light-blocking regions BR of the selected eleventh mask layout ML11 are exchanged with light-transmitting regions TR of another mask layout using the same method used to change the pattern of the twelfth mask layout ML12. In this case, it is desirable to exclude the twelfth mask layout ML12, whose pattern has already been changed, from candidate mask layouts. Therefore, the first through tenth mask layouts ML1-ML10 can be candidate mask layouts. Of the first through tenth mask layouts ML1-ML10, mask layouts having been allocated the same monomer as a synthesis target monomer allocated to the eleventh mask layout ML11, which is monomer G, are determined to be final candidate layouts. Therefore, the third mask layout ML3 and the seventh mask layout ML7 to which the synthesis target monomer G is allocated are final candidate mask layouts. A light-transmitting region TR, which can be exchanged without changing the probe sequence, is a light-transmitting region TR corresponding to the ninth and eleventh probe cells P9 and P11 of the seventh mask layout ML7. For example, a light-transmitting region TR corresponding to the ninth probe cell P9 of the seventh mask layout ML7 is exchanged with a light-blocking region BR corresponding to the ninth probe cell P9 of the eleventh mask layout ML11. The result is shown in Table 4 and FIG. 13. TABLE 4ProbeProbeML1ML2ML3ML4ML5ML6ML7ML8ML9ML10ML11ML12CellSequenceACGTACGTACGTP1ATTCATTCP2ACTAACTAP3AGTCAGTCP4CTCTCTCTP5GTCTGTCTP6AAAGAAAGP7CTGACTGAP8TGTTTGTTP9GTAGGTAGP10ACGTACGTP11CGCGCGCGP12TAGTTAGTNumber5551044442122of lighttransmittingregions Referring to Table 4 and FIG. 13, after the light-transmitting and light-blocking regions TR and BR are exchanged, the number of light-transmitting regions TR of the eleventh mask layout ML11 is increased to two. Consequently, the proportion of the light-transmitting region TR of the eleventh mask layout ML11 becomes equal to or greater than the minimum light-transmitting proportion. Accordingly, a next mask layout is selected. Here, the remaining mask layout is the tenth mask layout ML10. If the same method is used for the tenth mask layout ML10, a light-transmitting region TR corresponding to the third probe cell P3 of the sixth mask layout ML6 is a target light-transmitting region to be exchanged. If the light-transmitting region TR corresponding to the third probe cell P3 of the sixth mask layout ML6 is exchanged with the light-blocking region BR corresponding to the third probe cell P3 of the tenth mask layout ML10, the mask layout as shown in Table 5 and FIG. 14 is determined. TABLE 5ProbeProbeML1ML2ML3ML4ML5ML6ML7ML8ML9ML10ML11ML12CellSequenceACGTACGTACGTP1ATTCATTCP2ACTAACTAP3AGTCAGTCP4CTCTCTCTP5GTCTGTCTP6AAAGAAAGP7CTGACTGAP8TGTTTGTTP9GTAGGTAGP10ACGTACGTP11CGCGCGCGP12TAGTTAGTNumber5551043442222of lighttransmittingregions Referring to Table 5 and FIG. 14, as a result of changing the patterns, the proportion of the light-transmitting regions TR in each of the first through twelfth mask layouts ML1-ML12 is equal to or greater than the minimum light-transmitting proportion. Therefore, the operations of changing patterns are terminated, and the final patterns of the first through twelfth mask layouts ML1-ML12 are determined. Since the proportion of the light-transmitting regions TR in each of the first through twelfth mask layouts ML1-ML12 determined as described above is equal to or greater than the minimum light-transmitting proportion, if a plurality of masks are fabricated using the first through twelfth mask layouts ML1-ML12, the reliability of mask patterns that are formed can be enhanced even if an electronic beam exposure of the same dose is used. A method of fabricating a microarray using a mask set according to an embodiment of the invention which includes a plurality of masks as described above will now be described. FIGS. 15 through 21 are perspective views for explaining a method of fabricating a microarray according to an embodiment of the present invention. For illustrative purposes, it is assumed that a mask set used in the embodiment illustrated in FIGS. 15 through 21 has been fabricated using mask layouts determined with reference to Table 5 and FIG. 14 and that it is the mask set illustrated in FIG. 7. Referring to FIG. 15, a substrate 110 which includes an array of first through twelfth probe cells P1-P12, and whose surface is protected by a photolabile protecting group 150 is provided. In FIG, 15, the photolabile protecting group 150 is connected to a linker 130 which is coupled to the substrate 110, thereby protecting the surface of the substrate 110. A fixing layer is not illustrated in FIG. 15 for clarity. Referring to FIG. 16, the probe cells on the substrate 110 are exposed using a first mask M1 of a mask set 210. Consequently, the first through third probe cells P1-P3, the sixth probe cell P6, and the tenth probe cell P10 corresponding light-transmitting regions TR of the first mask M1 are exposed as indicated by reference numeral 401. Referring to FIG. 17, as a result of the exposure, the photolabile protecting group 150 connected to the linker 130 in each of the first through third probe cells P1-P3, the sixth probe cell P6, and the tenth probe cell P10 is resolved, and a functional group of the linker 130 is exposed. Referring to FIG. 18, a monomer A (141) connected to the photolabile protecting group 150 is provided on the resultant structure of FIG. 17. The monomer A (141) connected to the photolabile protecting group 150 is coupled to the linker 130 in each of the first through third probe cells P1-P3, the sixth probe cell P6, and the tenth probe cell P10. Since the fourth probe cell P4, the fifth probe cell P5, and the seventh through twelfth probe cells P7-P12 are protected by the photolabile protecting group 150, the monomer A (141) connected to the photolabile protecting group 150 is not connected thereto. Consequently, while the monomer A (141) is synthesized in each of the first through third probe cells P1-P3, the sixth probe cell P6, and the tenth probe cell P10, since it is connected to the photolabile protecting group 150, the surface of the synthesized substrate 110 is protected again by the photolabile protecting group 150 as illustrated in FIG. 15. Referring to FIG. 19, the probe cells on the substrate 110 illustrated in FIG. 18 are exposed using a second mask M2 of the mask set 210. Consequently, the second probe cell P2, the seventh probe cell P7, the tenth probe cell P10, and the eleventh probe cell P11 corresponding light-transmitting regions TR of the second mask M2 are exposed as indicated by reference numeral 401. Referring to FIG. 20, as a result of the exposure, the photolabile protecting group 150 connected to the linker 130 or the monomer A (141) in each of the second probe cell P2, the seventh probe cell P7, the tenth probe cell P10, and the eleventh probe cell P11 is resolved, and a functional group of the linker 130 or the monomer A (141) is exposed. Referring to FIG. 21, a monomer C (142) connected to the photolabile protecting group 150 is provided in the resultant structure of FIG. 20. The monomer C (142) connected to the photolabile protecting group 150 is coupled to the linker 130 or the monomer A (141), whose functional group is exposed, in each of the second probe cell P2, the seventh probe cell P7, the tenth probe cell P10, and the eleventh probe cell P11. Since the first probe cell P1, the third probe cell P3, the fourth through sixth probe cells P4-P6, the eighth probe cell P8, the ninth probe cell P9, and the twelfth probe cell P12 are protected by the photolabile protecting group 150, the monomer C (142) connected to the photolabile protecting group 150 is not connected thereto. Consequently, while the monomer C (142) is synthesized in each of the second probe cell P2, the seventh probe cell P7, the tenth probe cell P10, and the eleventh probe cell P11, since it is connected to the photolabile protecting group 150, the surface of the synthesized substrate 110 is protected again by the photolabile protecting group 150 as illustrated in FIG. 15. If the in-situ synthesis is repeated on the third through twelfth masks M3-M12 using the method described above, a microarray including the first through twelfth probe cells P1-P12 whose respective probe sequences are as shown in Table 5 can be fabricated. According to a mask layout determination method according to the present invention, a proportion of light-transmitting regions in each of a plurality of mask layouts can be controlled to be equal to or greater than a minimum light-transmitting proportion without changing the sequence of probes that are to be synthesized. Therefore, the pattern reliability of a mask set that is fabricated can be enhanced. While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims. The exemplary embodiments should be considered in descriptive sense only and not for purposes of limitation. |
|
050323482 | description | DESCRIPTION OF INVENTION The invention is a stowage rack for nuclear fuel elements, for storage or preferably dry transport, comprising a plurality of adjacent prismatic cells which are parallel and very long, said cells being designed to receive said fuel elements and forming a unit which must fulfil mechanical strength, thermal conductivity and neutron absorption functions, characterised in that, for the purpose of construction the rack from known, reliable materials which will fulfil the mechanical strength and thermal conductivity functions, and providing at least the neutron absorbing function separately, the walls of the cells are made up of a neat intersecting stack of elongated structural members of the profile type, of constant cross-section and made of common material, disposed in successive layers perpendicular to the axis of the cells, and that said walls control criticality, either due to their thickness and due to neutrophage rods arranged inside said walls parallel or perpendicular to the axis of the cells, or through having the structural members of common material with mechanical strength and/or thermal conductivity functions alternating in the stack with structural members of neutrophage material fulfilling the neutron absorbing function; the stack being such that the rack fulfils all the required functions. Thus the rack according to the invention is used for packing nuclear fuel elements under conditions requiring the presence of a neutron absorber, allowing for their geometry and their composition. A stowage rack of this type may be used either for storing fuel elements in a pool or preferably dry, or more preferably for transporting them under dry conditions. In this rack it is placed in a sheathed container before or after the fuel elements have been loaded. If the elements transported have been irradiated, the container both provides biological and mechanical protection and dissipates heat. The stowage rack acts as a neutron absorber and is the sole means of transferring the heat given off by the irradiated fuel elements to the sheathed container. The rack also has an essential mechanical strength function, particularly in avoiding possible crushing of the elements in the event of an accident, and in supporting the load of packed elements during horizontal transportation. Such a rack may equally be self supporting. All that is required is to reinforce it by any appropriate means and to fit it with handling devices, a base and possibly a cover. The rack according to the invention is made up of a plurality of adjacent prismatic cells, They may have any cross-section and are generally all identical. They have common walls, which are thick enough (in the transverse direction to the cell axis) to carry out the mechanical strength and thermal conductivity functions and, where appropriate, to contain the neutrophage rods, as will be explained later. The structural members chosen to form the neat stack are elongated with a cross-section of substantially constant profile; they are preferably sections of the normal type, with a preferably angular cross-section of simple shapes such as L, U, T, I, H, crosses, tubes or solid bars of square or rectangular section, flat strips and the like. Pairs of elongated thin flat strips may equally be used as structural members. Their long surfaces are arranged parallel with each other and parallel with the axis of the cells, and the space thus defined between the strips must be sufficient to insert the neutrophage rods, parallel or perpendicular to the cell axis. The structural members may equally be elongated extruded flat bars of rectangular section, with aligned tubular receptacles formed inside them to receive the neutrophage rods. All these different types of structural elements may be used either alone or in combination. They are generally straight but may also be evenly bent, with the edges of the bent portions arranged parallel with each other and perpendicular to the plane containing the resultant broken line. The stack is formed parallel with the axis of the cells to be obtained, with the length of the structural members directly perpendicular to the cell axis. The structural members are stacked in successive layers or rows, so that they are in a well-defined general direction in each layer or row, the directions cutting across each other from one layer to another. The number of directions is usually the same as the number of walls required, but this is not essential: two or three directions may, for example, be used for cells or hexagonal section. Structural members extending in the same direction and located in different layers are stacked, aligned, parallel with the axis of the cells, to form the cell walls. They must be long enough for one and the same member to serve a plurality of cells. To obtain a vertical, square mesh cellular rack, for example, a first layer is formed by arranging the structural members in a horizontal plane, parallel with a direction A and spaced by a distance corresponding to the cell mesh; then by forming a second horizontal layer on the first through arranging the structural members in the same way but in a direction B perpendicular to the direction A. Thus a square mesh cellular structure can be obtained by alternating the layers in directions A and B and ensuring that stacked members extending in the same direction are vertically aligned. Similarly cells of hexagonal mesh can be obtained by crossing over the layers of structural members in two or preferably three directions, forming angles of 60.degree. between them. The members must first have been bent evenly at 120.degree., to form a broken line in which each segment has the dimension of one side of the cell. This kind of stack, illustrated in FIG. 5, will be described in greater detail later. The structural members in the different layers or rows are rigidly connected by any known joining means such as pins, bolts, welds, flat bar, staples, angle irons, rivets, tie rods, punched plates etc., so as to maintain the cohesion and rigidity of the stack forming the cellular structure. As a complementary measure the compactness of the stack may be increased, while still maintaining its cohesion and rigidity, if the structural members are provided with positioning notches or incisions cooperating with one another, as in certain bottle cases or in the construction of mountain huts where the walls are assembled by this nesting process. If this is done the walls need not contain any cut outs. Neutrophage rods are preferably placed within the actual walls of the cells, extending in the desired direction, i.e. parallel or perpendicular to the cell axis. If necessary appropriate holes first have to be made in the structural members. Thus if a stack of profiled members other than flat strips is used, e.g. `H` shaped or `U` shaped members, holes are drilled in the sole plates or cores of the sections which are perpendicular to the cells' axis, and the neutrophage rods will then be parallel with that axis. Similarly, if the structural members used are extruded flat bars, which are crossed over and nested by means of incisions, and which are of rectangular cross-section and adequate thickness, tubular receptacles can be formed in the extruding direction to receive the neutrophage rods, e.g. by means of a bridge type die. The structural members may also be reinforced locally, e.g. by extra thick portions judiciously arranged, particularly near the zones which have been drilled to receive the neutrophage rods. If on the other hand the cell walls are formed by a stack of structural members comprising pairs of thin flat strips, with their surfaces parallel to each other and to the cell axis, then the neutrophage rods will be inserted directly into the space defined by the parallel surfaces of the bars facing one another, as illustrated in FIG. 4. The neutrophage rods may be arranged perpendicular to the axis of the cells; in this case they will improve the other functions (mechanical strength and heat transfer). The structural members forming the cell walls must a least fulfil the mechanical strength and heat transfer functions. For this purpose they can be made from a choice of materials fulfilling both functions, for example steels (normal, stainless or special), aluminium, copper or magnesium or alloys thereof, and generally any metals or materials which will form sections with the required mechanical and thermal properties. Materials which only fulfil one function may equally be used; for example, layers of structural members made of materials with high mechanical strength such as steel may be alternated with others with good heat conductivity such as copper. In some special cases structural members of neutrophage material may be inserted in the stack forming the cellular rack. Thus the members of neutrophage material may be stacked alternately with those providing the mechanical strength and heat transfer. This alteration may take place either from one layer to another or within the same layer or there may be a combination of both. It is compulsory for the neutrophage material used in the invention to contain at least one neutrophage element such as B, Gd, Hf, Cd, In, Li, etc. The material is made up of that element itself or one of its compounds, used as such or combined with a different material to give a composite. These other materials may be: metals or metal alloys such as Al, Cu or their alloys, charged with boron or another neutrophage element, PA1 the various types of fritted products (including fritting by extrusion through a die) containing boron or alternative material, e.g. B.sub.4 C.Al or B.sub.4 C.Cu PA1 ceramics or glasses containing boron or alternative material. These various composites are generally used in rod form with or without a sheath. The rods may equally be obtained by extruding billets of alloy or cermet obtained by known processes, including those of the spray deposition type. However, it is an advantage to use any material which is readily available on the market, particularly wire made of boron-aluminium master alloy, containing 2.5 or 3.5% of boron. This is easily available as it is used in other applications which consume large quantities of this kind of product (e.g. aluminium refining). The neutrophage rods cover at least part of the length or width of the cell walls, according to the direction in which they are installed, and may cover them all. The installation density of the bars is adapted to requirements. A neutrophage bar may be made up of a succession of component bars of reduced length. To illustrate the invention FIGS. 1 to 7 give different examples of stacks using various types of simple sections. FIG. 1 shows a stack formed to create a stowage rack with cells of rectangular or square cross-section; the stack is made up of structural members 1 and 2, which are `U` shaped sections but could equally well be solid bars or hollow tubes of the same cross-section. The members 1 are all arranged in the same direction; so in one layer they are parallel and separated by a distance equal to the size of the cells 3. The members 2 in the adjacent layers are also parallel with one another but perpendicular to the members 1 and separated by a distance equal to the cell mesh in that direction. Holes 4 have been drilled in the horizontal sole plates, enabling neutrophage rods 5 to be inserted in the wall of the cell 3 parallel with its axis. In this case the cell walls contain cut-outs. The parts are assembled by tie rods 6 located at the intersection of the structural members 1 and 2. They are made of a material with good mechanical strength, for example stainless steel; the assembly can be made rigid by end plates (not shown) containing cut outs as in the drawing of the cells. FIG. 2 shows the detail of an assembly of structural members 1 and 2, which are `H` sections, using notches 7. With this type of assembly it is not necessary to have cut outs in the cell walls. The neutrophage wires 5 are arranged parallel with the cell axis in two rows within the walls of the said cell. FIG. 3 shows a portion of a vertical stack of structural members 1-1a-1b in one direction. The structural members are flat sections of rectangular cross-section with tubular receptacles 4 arranged inside them. The receptacles 4 are designed to receive the neutrophage rods 5, which in this case are perpendicular to the axis of the cells. Notches 7 enable the member 1 to be connected rigidly to the member perpendicular to it (not shown). FIG. 4 is an assembly where the structural members are pairs 1 and 2 made up of two parallel flat bars. The pairs 1 and 2 are arranged in orthogonal directions and rigidly connected by means of notches 7. They form the walls of the cell 3. The neutrophage rods 5 are inserted in the actual walls parallel with the axis of the cell and with minimum diametric clearance, to avoid the risk of misalignment of the rods within the wall. FIG. 5 represents a rack with hexagonal cells 3. It is formed by a stack of structural members 1-2-8. These are evenly bent `U` sections (or any other shaped sections) in the form of a broken line extending in three directions 1-2-8. The directions are staggered at 60.degree., so that each cell wall is open over one-third of its height. The rack structure is completed as before by neutron absorber rods 5 and tie rods 6 inserted in the holes 4. The neutron absorber 5 may either be continuous, as are rods 11, or a series of abutting shorter rods 12. FIG. 6 shows a stowage rack according to the invention, comprising an intersecting stack of sections in the form of flat strips. FIG. 7 shows an enlarged view of a portion of the rack of FIG. 6. Strips 1, comprising intersecting, perpendicular strips 1a and 1b with mechanical strength and heat transfer functions, alternate with strips 5 of boron alloy, which absorb neutrons and contribute to the heat transfer. The strips 1 may of course contain openings and/or be replaced by any sections of the same thickness as the strips 5. The use of standard materials for the invention has the advantage of facilitating construction of the stowage racks, lowering their cost and facilitating their homologation. In racks where the neutrophage rods are metallic and perpendicular to the axis of the cells these rods have the further advantage of improving heat transfer. |
summary | ||
abstract | An electron beam sterilization device (1) for thin-walled containers (C) is fitted with an input (40) or output unit (60) provided with a swivelling body to bring a set of containers (C) from the outside environment into the sterilization chamber or vice versa, avoiding radioactive emissions from the sterilization chamber. |
|
description | The present invention relates to a gantry for particle therapy. In proton therapy and ion therapy often use is made of a gantry to direct the incident beam from the most optimal angle towards the target (usually a tumor) in the patient. A gantry is a beam transport system (usually comprising magnets) mounted on a mechanical structure that can rotate around the patient who is positioned—often lying but in some cases also sitting on a dedicated treatment table/chair located—at the treatment position. Usually, the rotation range of the gantry is a bit more than 360 degrees, but in some gantries also a bit more than only 180 degrees is used to save space and allow accessing the treatment table/chair at any time during the treatment. Examples for typical rotatable gantries used for proton therapy are disclosed in the European Patent Application 15 194 795.9 and in the International Patent Application WO 2013/149945 A1. The rotatable gantries deliver the dose to be deposited into a cancerous tumor volume at pencil beam resolution for various gantry-orientations which enable a precise dose accumulation in this tumor volume coincidently preventing healthy tissue in the surrounding of the tumor volume from damage due to the beam stopping effect which materializes in the so-called Bragg Peak. Nevertheless, these gantries of the form of a C-arm require a considerable space to allow its rotation of a system that involves the weight of ten of tons. At each gantry angle a very accurate positioning of the beam delivery components (in particular the sweeper magnets and the last beam bending magnet(s)) is needed in order to obtain the desired beam characteristics, like the beam energy and beam position and beam direction. It is therefore the objective of the present invention to provide a system that replaces the current rotatable gantries for particle beam therapy and that provides a significantly simpler set-up and allowing at least the flexibility in beam delivery known from the prior art gantries. Compared to the currently used rotatable gantries the advantages of the present invention shall also provide a lower weight of the system and a smaller space needed. This objective is achieved according to the present invention by a system for particle beam therapy, comprising as seen in the flow direction of the particle beam: a) an adjustable gantry for the beam delivery to a target volume, said gantry comprising: a1) a beam coupling section for the incoming particle beam; said incoming particle beam being oriented substantially horizontally thereby defining a horizontal plane; a2) a first beam bending section comprising a number of beam deflection and/or focusing magnets; said first bending section either bending the beam with an adjustable angle into the vertical plane, or with 90 degrees in the horizontal plane, but with the mechanical possibility to rotate with an adjustable angle along the axis of the incoming particle beam; a3) a beam transport section receiving the particle beam leaving the first beam bending section and guiding the particle beam to a second beam bending section; a4) the second beam bending section comprising a number of beam deflection magnets and/or beam focusing magnets; a5) a beam nozzle comprising a window for the exit of the particle beam; and b) a patient table/chair being rotatable and/or shiftable in the horizontal plane or in a plane being parallel to the horizontal plane and optionally being adjustable vertically,wherein: c) the gantry is supported by a tilting mechanism allowing the gantry to be tilted vertically by an angle Φ1 with respect to the horizontal plane, Φ1ε[−90°; +90°], wherein the gantry comprises a pivot being disposed in the region of the beam coupling section; and d) a rotation mechanism being disposed in a way that the second beam bending section and the beam nozzle being rotatable by an angle Φ2, Φ2ε[−180°; +180°] around a direction given by the angle Φ1. The advantages of this system layout are a reduction of the treatment room footprint with respect to that of a conventional gantry according to the prior art and a very simple mechanical construction to move second beam bending section up and down. Further, it is possible to mount a degrader and/or a beam scanning system in the beam transport section between the first beam bending section and the second beam bending section whereas the scanning system may be mounted in the nozzle downstream of the second beam bending section. Furthermore, compared with conventional gantries two rotational axes allow additional freedom in the choice of how a treatment angle is constructed and how the eventual misalignments can be corrected. With respect to a geometrical set-up of the system that can be easily implemented and/or maintained, i.e. for quality control, the following basic settings can be chosen: a) maximum of Φ1 and Φ2=0° lead to a particle beam pointing from the vertical direction downwards to the patient table/chair; b) minimum of Φ1 and Φ2=180° lead to a particle beam pointing from the vertical direction upwards to the patient table/chair; c) Φ1=0° and Φ2=90° lead to a particle beam pointing in the horizontal direction from one side to the patient table/chair; and d) Φ1=0° and Φ2=90° and a rotation of the patient table/chair of 180° in the horizontal plane lead to a particle beam pointing in the horizontal direction from the other side to the patient table/chair. These settings allow to “play” with the beam orientation according to the needs and demands of the therapy plan and to get back easily to one of the position according to the basic settings a) to d). The settings therefore allow an extension of the range of Φ2 into [180°; +180°] The tilting angle of Φ2 can preferably range from 0° to +180°, so that the isocenter and the patient table/chair are always at the same side of the gantry. In this way, the footprint of the gantry is minimized. In order to realize a mechanical set-up that can be controlled in a non-complicated way, the tilting mechanism may comprise a telescope arm or a lifting mechanism based on one or two chains along the lifting arm. Further, the beam transport section may comprise a telescope section, too. This enables the operator during the tilting to maintain the position in terms of the point (isocenter of the system) of the beam passing through the horizontal plane. Herein, it is suitable when the beam transport section can be adjustable in length in order to compensate the change in the horizontal component of the gantry due to the tilting. In this way, the isocenter will be located on a straight line, perpendicular to the direction of the beam after the first bending section. At some installations it might not be possible to deliver the particle beam right in the direction required for the first and/or second bending section. It is therefore helpful when the first beam bending section may comprise a set of magnets that also deflect in the horizontal plane. The first bending section itself can also rotate mechanically over an axis that coincides with the incoming beam direction. The combination of the 90 degrees deflection due to the magnetic fields in the first bending section and the mechanical rotation of the first beam bending section defines the gantry's first angle Φ1. Therefore, the first beam bending section is capable to bend the beam not only in the direction given by the first angle Φ1 but also into a further direction, i.e. within the horizontal plane in which the beam is delivered after its generation, i.e. in a cyclotron. In a preferred embodiment the system may additionally comprise a beam spreading system to spread the beam in the lateral direction, which is perpendicular to the direction of the beam leaving the second bending section. The beam spreading system can comprise a scattering system that increases the beam diameter and/or a system of fast deflection magnets that scan the beam in the transversal direction. The beam spreading system can be collated before (upstream of) or behind (downstream of) the second bending section. Preferred embodiments of the present invention are hereinafter described in more detail with reference to the attached drawings which depict in: FIG. 1 schematically shows a first system 2 for particle beam therapy delivery. The system 2 comprises for an incoming particle beam 4 a beam coupling section 6 being following by a first bending section 8. In the present example, a gantry 10 is supported by a tilting mechanism 24 allowing the gantry 10 to be tilted vertically (along the z-axis) by an first angle Φ1, Φ1ε[−90°; +90°], wherein the gantry 10 comprises the bearing (pivot) 7 being disposed at the entrance of the beam coupling section 6 in order to enable a declination of the complete gantry 10 in the z-direction. The first bending section 8 bends the particle beam 4, such as a proton beam or an ion beam, in the vertical yz plane with an angle Φ1. Further, a second bending section 18 and a beam nozzle 20 can be rotated by a rotation mechanism 26 being disposed in a way that the second beam bending section 18 and the beam nozzle 20 being rotatable by an angle Φ2, Φ2ε[−180°; +180°] around a direction given by the angle Φ1, but preferably Φ2ε[0°; +180°], to limit the footprint of the gantry. In addition, a beam transport section 16 connecting the first beam bending section 8 to the second bending section 18 can be telescopically adjustable with respect to the length of this beam transport section 16 and allows a variation in length of approximately 0.5 m. In the shown example, the second beam bending section 18 bends the beam by a fixed angle in the range of 90-135 degrees. This second bending section 18 is rotatable along an axis that approximately equals the direction given by Φ1 of the unscanned (or central) beam entering the second beam bending section 18. This rotation angle Φ2 covers at least 180 degrees, between 0 degr. (aiming the beam downwards) and +180 degr (aiming upwards). The appropriate value for Φ2 is a function of Φ1. The combination of Φ1 and Φ2 determines the incident angle of the beam direction at the patient. The following three main incident direction can be established: When Φ1 is maximal (+) and Φ2=0°, the particle beam 4 points from the vertical direction down to the patient (see FIG. 3(a)). When Φ1 is minimal (−) and Φ2=180°, the particle beam 4 points in the vertical direction upwards to the patient (see FIG. 3(b)). When Φ1=0° and Φ2=90°, the particle beam 4 points in the horizontal direction to the patient (see FIGS. 4 (a) and (b)). In all orientations small deviations can be added to Φ1 and Φ2 by small bending magnets (steering magnets) for fine tuning the incident angle at the patient. A nozzle 20 at the exit of the second bending section 18 can comprise equipment to verify the applied dose and the beam characteristics. A patient table 22 is part of a positioning system that can shift and rotate the patient position in the horizontal plane. The range of this adjustment must be large enough to compensate the motion of the isocenter as a function of Φ1 and Φ2. In order to have a common understanding on the direction, the following definitions are applied: The horizontal plane is the plane at the height of the particle beam 4 exiting the second beam bending section 18, when Φ1 is at 0°. This is usually equal to the level of the incoming particle beam 4 at the coupling section 6. The treatment angle is the angle of the particle beam at the isocenter with respect to the patient orientation and it is determined by a combination of the Φ1 and Φ2 and the orientation of the patient table/chair 22. The isocenter is the location where the beam coming out of the nozzle 20 is crossing the horizontal plane. Typically, Φ2 is determined by the value of Φ1 but can be chosen differently in case of exceptional treatment angles or treatment target locations. The components from the beam transport section 16 until and including the second beam bending section 18 are mounted such that these are always aligned in a mechanical stable or corrected position. The isocenter position is not fixed in space and moves along a curve in the horizontal plane as a function of Φ1. The shape of this curve depends on whether use is made of the option to have an adjustable (telescopable) length of the beam transfer section 16 which is located between the first beam bending section 10 and the second beam bending section 18. In that case, the length of this beam transport section 16 is a function of Φ1. This option enables that the isocenter position moves along a straight line in the horizontal plane. This is advantageous for daily checks and in connection to imaging devices that verify the patients positioning with respect to the gantry. However, with appropriate tools for these checks, a curved trajectory of the isocenter position as a function of Φ1 and Φ2 is also possible. The second beam bending section 18 can be designed such that it rotates over a Φ2 range of >360 degrees or >180 degrees. The 180 degrees version has major advantages, such as a smaller treatment room, less moving range of the patient table 22 and easier rotation construction. This is the version shown in the figures. Possible advantages of here proposed mechanical layout are: a reduction of the treatment room footprint with respect to that of a conventional gantry; very simple mechanical construction to move the second beam bending section 18 up and down; it is possible to mount a degrader and/or scanning system (sweeper magnets) in the beam transfer section 16 between the first bending section 8 and the second beam bending section 18 or the beam scanning system can be mounted in the nozzle 20 of the second beam bending section 18; Compared with conventional gantries the two rotational axes allow one additional degree of freedom in the choice of how a treatment angle is constructed. In a preferred embodiment, the system 2 may additionally comprise a beam spreading system 30 to spread the beam in the lateral direction, which is perpendicular to the direction of the beam leaving the second bending section 18. The beam spreading system 30 can comprise a scattering system 32 that increases the beam diameter and/or a system of fast deflection magnets 34 that scan the beam in the transversal direction. The beam spreading system 30 can be collated before 36 (upstream of) or behind 38 (downstream of) the second bending section 18. FIG. 2 schematically shows a system 2′ for a therapy using the particle beam 4 that is slightly amended as compared to the system 2. Presently, the particle beam 4 which is generated in a linear accelerator and/or a cyclotron and/or a synchrotron is delivered horizontally along the x-direction to a particle beam gantry—in the following referred to as gantry 10′. Said gantry 10′ comprises a coupling section 6. At this coupling section 6, the gantry 10 can be rotated over an angle Φ1 along the x-axis by a rotation bearing 7′. Beside this rotation bearing 7′, the coupling section 6 provides beam focusing (collimators) and beam control/diagnosis equipment (not shown in detail) before the particle beam 4 enters into a first bending section 8′. Usually, this first bending section 8′ comprises a number of dipole and/or quadrupole magnets 12, 14 which are controlled to bend the particle beam 4 by its magnetic fields into a desired direction. In the present example, the first beam bending section 8′ bends the particle beam 4 from the x-direction into the y-direction, so over an angle of 90 degrees in the horizontal plane, if the first bending section 8′ is not rotated. The first beam bending section 8′ is followed by the beam transport section 16 receiving the particle beam 4 leaving the first beam bending section 8′ and guiding the particle beam 4 to a second beam bending section 18. The beam transport section 16 may comprise further equipment for the beam diagnosis and sweeper magnets as for example known from the WO 2013/149945 A1. The second beam bending section 18 comprises a number of beam deflection magnets and/or beam focusing magnets in order to deliver the particle beam 4 via the beam nozzle 20 comprising a window for the exit of the particle beam 4 out of the gantry 10′ to the patient table 22. The patient table 22 could also comprise a patient chair allowing a patient to be treated in upright position. The patient table/chair 22 is rotatable and/or shiftable in the horizontal plane (given here by the x-and y-axis). Optionally, the patient table/chair may be adjustable vertically, too. In the present example, the gantry 10′ is supported by the tilting mechanism 24 allowing the gantry 10′ to be tilted vertically (along the z-axis, in the yz-plane) by a first angle Φ1, Φ1ε[−90°; +90°], wherein the gantry 10′ comprises the rotation bearing (pivot) 7′ being disposed at the entrance of the beam coupling section 6 in order to enable a rotation of the complete gantry 10′ along the x-axis. Further, the second bending section 18 and the beam nozzle 20 can be rotated by the rotation mechanism 26 being disposed in a way that the second beam bending section 18 and the beam nozzle 20 being rotatable by an angle Φ2, Φ2ε[−180°; +180°], but preferably Φ2ε[0°; +180°] in order to limit the footprint of the gantry 10′) around a direction given by the angle Φ1. Typically, the range of the first angle Φ1 depends on the design of the system 2′. For the system 2′, the range of the first angle Φ1 can typically be between approximately −40° and +40°. After the first bending section 8′ the out-coming beam 4 is aimed into the Φ1-direction with respect to the horizontal plane: downwards when Φ1<0 and upwards when Φ1>0. Due to the bending in the horizontal plane, the first bending section 8′ can be designed such that it can also serve as an energy selection system. |
|
claims | 1. A method of manufacturing a pelletized nuclear ceramic fuel, including preparation of uranium dioxide moulding powder with or without an addition of concentrated uranium oxide, pressing the moulding powder into pressed pellets and sintering the pressed pellets in a reducing atmosphere, wherein uranium dioxide powder is utilized as a raw material for the preparation of the uranium dioxide moulding powder, the uranium dioxide powder having a proportion of oxygen to uranium equal to: 2.37±0.04, and the uranium dioxide powder being preliminarily obtained by heating a ceramic grade uranium dioxide powder in air. |
|
description | This application is a continuation of prior filed application Ser. No. 13/834,772 filed Mar. 15, 2013, which is incorporated herein by reference in its entirety. The present invention relates to the field of radiation therapy, and more particularly, to an aperture assembly for a radiation therapy apparatus, and related methods. Proton therapy uses a beam of protons to irradiate diseased tissue, most often in the treatment of cancer. The chief advantage of proton therapy is the ability to more precisely localize the radiation dosage when compared with other types of external beam radiotherapy. During treatment, a particle accelerator is used to target the diseased tissue with a beam of protons. Due to their relatively large mass, protons have little lateral side scatter in the tissue. The beam does not broaden much, stays focused on the shape of the diseased tissue and delivers low-dose side-effects to surrounding tissue. All protons of a given energy have a certain range, with very few protons penetrating beyond this range. The dose delivered to the tissue is maximum just over the last few millimeters of the particle's range, which is called the Bragg peak. A radiation aperture body (i.e., aperture) and a radiation filter (i.e., a range compensator) are beam modifying devices that control the shape and penetration of protons during treatment of a patient. These devices are typically connected to an output of a radiation source of a radiation therapy apparatus. The radiation aperture body is typically brass and can be up to several inches thick, and has a shaped opening therein to control the radiation dosing profile. The radiation filter is three-dimensionally shaped to direct the protons to the desired target area on the patient to ensure that the target receives the correct radiation dose, while the healthy tissue surrounding the target receives substantially less radiation. Careful registration or indexing of the radiation filter and the radiation aperture body ensures that the patient has the proper exposure in the target area, such that the proton's energy is released within the target area. A typical radiation therapy apparatus does not fully expose the radiation aperture body to the protons. Consequently, there is a border region around the perimeter of the radiation aperture body which is not exposed to the protons. As noted above, the radiation aperture body is typically brass and can be up to several inches thick. Brass is a fairly expensive material compared to other high density materials, and the excess brass in the border region adds to the cost of the radiation aperture body. One approach to reduce the cost of the radiation aperture body is to replace a portion of the brass border region with a non-brass frame that carries the radiation aperture body, as disclosed in U.S. published patent application no. 2011/0127443. The frame and the radiation aperture body are dimensioned so that the radiation aperture body is still not fully exposed to the protons, but since the volume of the radiation aperture body is reduced, less brass is needed resulting in a cost savings. Nonetheless, there is still a need to further reduce the cost of a radiation aperture body. In view of the foregoing background, it is therefore an object of the present invention to provide a radiation therapy apparatus with a low cost radiation aperture body. This and other objects, features, and advantages in accordance with the present invention are provided by a radiation therapy apparatus comprising a housing, a radiation source carried by the housing, and at least one aperture assembly carried by the housing. The aperture assembly may comprise a radiation aperture body, an aperture holder and a cover. A radiation filter may also be carried by the housing. The radiation source may generate protons, for example. More particularly, the radiation aperture body may have a shaped opening therein to control a radiation dosing profile. The aperture holder may have an aperture-receiving passageway therein receiving the radiation aperture body, and a recessed end. The cover may be received within the recessed end of the aperture holder, and retains the radiation aperture body within the aperture holder. The cover may have an opening aligned with the shaped opening in the radiation aperture body. The aperture holder and cover may advantageously be formed out of a different material from the radiation aperture body. For example, the radiation aperture body may be formed out of brass, whereas the aperture holder and cover may each be formed out of stainless steel or other high density material other than brass. Since the volume of the radiation aperture body has been significantly reduced, significantly less brass may be needed resulting in an even greater cost savings. The radiation source may include a radiation output having a first diameter, and the opening in the cover may have a second diameter less than the first diameter. This results in the radiation aperture body being fully exposed to the radiation. To prevent unwanted radiation from passing through an interface between the radiation aperture body and the aperture holder and cover, the radiation aperture body may comprise a frusto-conical first portion, and the aperture receiving passageway may have a corresponding shape to the frusto-conical first portion. Similarly, the radiation aperture body may comprise a frusto-conical second portion, and the opening of the cover may have a corresponding shape to the frusto-conical second portion. The recessed end of the aperture holder and the cover may also define a threaded joint therebetween. The radiation aperture body may comprise at least one alignment edge extending outwards therefrom, and the aperture-receiving passageway may further include at least one recess receiving the at least one alignment edge. Another aspect of the present invention is directed to an aperture assembly for radiation therapy, as described above. Yet another aspect of the present invention is directed to a method for making an aperture assembly for radiation therapy. The method may comprise forming a radiation aperture body having a shaped opening therein to control a radiation dosing profile. An aperture holder having a disk shape, an aperture-receiving passageway therein to receive the radiation aperture body, and a recessed end is formed. The method may further comprise forming a cover received within the recessed end of the aperture holder, with the cover to retain the radiation aperture body within the aperture holder, and with the cover having an opening aligned with the shaped opening in the radiation aperture body. The present invention will now be described more fully hereinafter with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. Like numbers refer to like elements throughout. Referring initially to FIG. 1, a radiation therapy apparatus 10 includes a housing 12, a radiation source 14 carried by the housing, at least one aperture assembly 20 carried by the housing, and a radiation filter 18 carried by the housing. In the illustrated embodiment, three aperture assemblies 20 are stacked on top of one another. If the penetration energy of the radiation is low, then only one aperture assembly 20 may be sufficient to block radiation from healthy tissue within the patient. However, if the penetration energy of the radiation is high, then multiple aperture assemblies 20 may be combined to provide a total thickness necessary to block radiation from healthy tissue within the patient. Even though a single aperture assembly 20 having the same combined thickness could be used, the weight would make it difficult to handle. The radiation filter 18 is also known as a range compensator and filters the radiation. Filter is broadly used to include controlling the intensity or range of the radiation depending on modality, as readily understood by those skilled in the art. The radiation filter 18 is specifically designed for the patient. The radiation filter 18 may be machined from a solid piece of material, and is mounted directly in the path of the radiation beam, as disclosed in U.S. Pat. No. 6,980,871. This patent is assigned to the current assignee of the present invention, and is incorporated herein by reference in its entirety. The unique three-dimensional geometry of each radiation filter 18 provides the conformal radiation dose distributions required by the patient. The illustrated radiation source 14 is configured to generate protons. The radiation source 14 includes a particle accelerator, either a synchrotron or a cyclotron, to accelerate the protons to variable energies into a beam transport line. A synchrotron contains a ring of magnets that constrains the protons so that they travel in a set path inside a high vacuum chamber. During each revolution of travel through the chamber, the protons gain an increment of energy from the radio frequency power. After many cycles, the protons reach the energy required by the specific treatment planning system and are extracted from the ring of magnets into the beam transport line, which directs the protons to the aperture assemblies 20. Even though the illustrated radiation source 14 is a proton radiation source, the aperture assembly 20 is readily applicable to other types of radiation sources, such as electrons or photons, as readily appreciated by those skilled in the art. The aperture assembly 20 will now be discussed in greater detail. Each aperture assembly 20 includes a radiation aperture body 30, an aperture holder 40 and a cover 50, as illustrated by the exploded view in FIG. 2 and the cross-sectional view in FIG. 3. The radiation aperture body 30 may also be referred to as an aperture. The radiation aperture body 30 has a shaped opening 32 therein specific to the patient to control a radiation dosing profile of the protons. The radiation aperture body 30 is typically made out of brass, for example. As an alternative to brass, other high density materials capable of blocking protons may be used. The aperture holder 40 has an aperture-receiving passageway 42 therein receiving the radiation aperture body 30, and has a recessed end 44. The cover 50 is received within the recessed end 44 of the aperture holder 40 and retains the radiation aperture body 30 within the aperture holder. The illustrated aperture holder 40 has a disk shape. The shape of the aperture holder 40 is not limited to a disk shape. Instead, the shape is based upon the profile of the radiation output or snout of the radiation source 14. In other embodiments, the aperture holder 40 may have a rectangular shape, for example. The cover 50 has an opening 52 aligned with the shaped opening 32 in the radiation aperture body 30. Aligned in this instance means that the opening 52 is not overlapping or blocking the shaped opening 32 in the radiation aperture body 30. The aperture holder 40 and cover 50 are typically made out of a non-brass material, such as stainless steel, for example. As an alternative to stainless steel, other high density materials capable of blocking protons may be used. As a result of the aperture holder 40 and the cover 50, the volume of the radiation aperture body 30 has been significantly reduced. Since the aperture holder 40 and the cover 50 are reusable, significantly less brass is needed, a greater cost savings may be achieved. As discussed in the background section, prior art radiation aperture bodies were not fully exposed to the protons. In other words, the outside diameter of the radiation aperture body exceeded the diameter of the radiation output. This ensured that there were no interfaces being exposed to the protons that would allow the protons to penetrate through and onto the patient receiving treatment. In sharp contrast, the radiation aperture body 30 is fully exposed to the protons. In other words, the radiation source 14 includes a radiation output having a first diameter d1, and the opening 52 in the cover 50 has a second diameter d2 less than the first diameter, as illustrated in FIG. 3. This notably causes the interface 57 between the radiation aperture body 30 and cover 50, as well as the interface 55 between the radiation aperture body 30 and the aperture holder 40, to be fully exposed. To prevent unwanted radiation from passing through the interfaces 57, 55 between the radiation aperture body 30 and the aperture holder 40 and cover 50, the radiation aperture body has a frusto-conical first portion 36, and the aperture receiving passageway 42 has a corresponding shape to the frusto-conical first portion. Similarly, the radiation aperture body 30 has a frusto-conical second portion 38, and the opening 52 of the cover 50 may have a corresponding shape to the frusto-conical second portion. As a result of the frusto-conical portions 36, 38 of the radiation aperture body 30, the interfaces 57, 55 are angled. This advantageously reduces any chance of unwanted protons making their way to the patient, as compared to vertical interfaces, by increasing the relative angle between the radiation particles and the interfaces 57, 55. The frusto-conical portion 36 also allows the radiation aperture body 30 to be press fit into the aperture holder 40, ensuring unwanted radiation does not pass through the interface 55. Similarly, the frusto-conical portion 38 also allows the cover 50 to be press fit onto the radiation aperture body 30, ensuring unwanted radiation does not pass through the interface 57. In other embodiments, the radiation aperture body 30 may include only one frusto-conical portion 36 or 38. The other non-frusto-conical portion may be configured so that one of the interfaces 57 or 55 is at a vertical angle with respect to an upper surface of the aperture holder 40. Another area of concern for radiation leakage is at the interface 45 between the aperture holder 40 and the cover 50. To address this concern, the recessed end 44 of the aperture holder 40 and the cover 50 define a threaded joint therebetween. In other words, the recessed end 44 and the cover 50 are threaded for engaging one another to define the threaded joint. The interface 45 may also be angled. To place the radiation aperture body 30 in a desired orientation, the radiation aperture body includes at least one alignment edge 37 extending outwards therefrom, as illustrated in FIG. 2. The aperture-receiving passageway 42 include at least one recess 41 receiving the at least one alignment edge, as illustrated in FIG. 4. In the illustrated embodiment, there are three alignment edges 37 and three corresponding recesses 41. The alignment edges 37 and recesses 41 prevent spinning of the radiation aperture body 30 once placed in the aperture-receiving passageway 42. Referring now to the flowchart 100 in FIG. 5, another aspect is directed to a method for making an aperture assembly 20 for radiation therapy. The method comprises, from the start (Block 102), forming a radiation aperture body 30 at Block 104 having a shaped opening 32 therein to control a radiation dosing profile. An aperture holder 40 is formed at Block 106 having a disk shape, an aperture-receiving passageway 42 therein to receive the radiation aperture body 30, and having a recessed end 44. The method further comprises forming a cover 50 at Block 108 that is received within the recessed end 44 of the aperture holder 40. The cover 50 retains the radiation aperture body 30 within the aperture holder 40. The cover 50 has an opening 52 aligned with the shaped opening 32 in the radiation aperture body 30. The method ends at Block 110. Many modifications and other embodiments of the invention will come to the mind of one skilled in the art having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is understood that the invention is not to be limited to the specific embodiments disclosed, and that modifications and embodiments are intended to be included within the scope of the appended claims. |
|
description | The present application: (i) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jun. 27, 2013 of U.S. provisional application Ser. No. 61/840,428; (ii) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jan. 8, 2014 of U.S. provisional application Ser. No. 61/925,114; (iii) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jan. 8, 2014 of U.S. provisional application Ser. No. 61/925,131; (iv) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jan. 8, 2014 of U.S. provisional application Ser. No. 61/925,122; (v) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jan. 8, 2014 of U.S. provisional application Ser. No. 61/925,148; (vi) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jan. 8, 2014 of U.S. provisional application Ser. No. 61/925,142; (vii) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jul. 1, 2013 of U.S. provisional application Ser. No. 61/841,834; (viii) claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Jul. 4, 2013 of U.S. provisional application Ser. No. 61/843,015; (ix) is a continuation-in-part of U.S. patent application Ser. No. 14/205,339 filed Mar. 11, 2014, which claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of Mar. 11, 2013 of U.S. provisional application Ser. No. 61/776,592, which is a continuation-in-part of U.S. application Ser. No. 12/850,633, filed Aug. 5, 2010, which is a continuation-in-part of U.S. application Ser. No. 12/783,550, filed May 19, 2010, which claims, under 35 U.S.C. § 119(e)(1), the benefit of the filing date of May 19, 2009 of U.S. provisional application Ser. No. 61/179,625, the entire disclosure of each of which are incorporated herein by reference. The present inventions relate to methods, apparatuses, devices, and systems for creating, controlling, conducting, and optimizing fusion activities of nuclei. In particular, the present inventions relate to, among other things, fusion activities for energy production, propulsion, formation of material, and generation of directed energetic beams and particles. The present inventions further relate to such activities that cover a spectrum of reactions from aneutronic, fusion reactions that produce essentially no neutrons, to neutronic, fusion reactions that produce substantial numbers of neutrons. As used herein, unless expressly stated otherwise, the term fusion should be given its broadest possible meaning, and would include interactions and reactions between two or more nuclei whereby one or more new or different nuclei are formed, as well as subsequently induced or derivative reactions and energy generation associated therewith. As used herein, unless expressly stated otherwise, the terms formation, formation of material, and similar terms should be given their broadest possible meaning, and would include transmutation, and the modification or creation of a nucleus or nuclei, such as, for example, nuclides, and isotopes having value in medical, imaging, testing, and other useful applications. As used herein, unless expressly stated otherwise, the term light element means an element or ion with atomic mass of 62 or less. As used herein, unless expressly stated otherwise, the term physical confinement, physical containment, and similar such terms mean the use of a physical structure that passively confines the fusion reaction as opposed to the use of directed energy, including shockwaves or electromagnetic fields to confine the fusion reaction, or interaction, should include confinement by directed energy such as EM fields, such as coming from lasers as an example. As used herein, unless expressly stated otherwise, the term strongly ionized plasma means a plasma whereby the ratio of ions to neutrals is at least about 1:1. As used herein, unless expressly stated otherwise, the term weakly ionized plasma means a plasma whereby the ratio of ions to neutrals is less than about 1:100. The terms plasma, ionized material, and similar such terms includes all degrees and ratios of ionization. As used herein, unless expressly stated otherwise, the term neutrals means atoms, molecules or clusters with no net charge. For 60 years the science and technology communities have been striving to achieve controlled and economically viable fusion. The commonly held belief in the art is that another 25-50 years of research remain before fusion is a viable option for power generation—“As the old joke has it, fusion is the power of the future—and always will be” (“Next ITERation?”, Sep. 3, 2011, The Economist). Further, until the present inventions, it was believed that a paradigm existed in that achieving fusion of reactants was unobtainable without incredibly high temperatures for even the most likely reactants and even higher temperatures for other reactants. As a consequence, it was further believed that there was no reason to construct, or investigate the composition of, a nuclear fusion reactor with lower temperature reactant confinement. Prior to the present inventions it was believed that the art in controlled fusion reactions taught that temperatures in excess of 150,000,000 degrees Centigrade were required to achieve favorable gross energy balance in a controlled fusion reactor. Gross energy balance, Q, is defined as: Q = E fusion E in ,where Efusion is the total energy released by fusion reactions and Ein is the energy used to create the reactions. The Joint European Torus, JET, claims to have achieved Q≈0.7 and the US National Ignition Facility recently claims to have achieved a Q>1 (ignoring the very substantial energy losses of its lasers). The condition of Q=1, referred to as “breakeven,” indicates that the amount of energy released by fusion reactions is equal to the amount of energy input. In practice, a reactor used to produce electricity should exhibit a Q value significantly greater than 1 to be commercially viable, since only a portion of the fusion energy can be converted to a useful form. Conventional thinking holds that only strongly ionized plasmas, are necessary to achieve Q>1. These conditions limit the particle densities and energy confinement times that can be achieved in a fusion reactor. Thus, the art has looked to the Lawson criterion as the benchmark for controlled fusion reactions—a benchmark, it is believed, that no one has yet achieved when accounting for all energy inputs. The art's pursuit of the Lawson criterion, or substantially similar paradigms, has led to fusion devices and systems that are large, complex, difficult to manage, expensive, and economically unviable. A common formulation of the Lawson criterion is as follows: N τ E * > 3 ( 1 - η in η out ) H η in η out 〈 σ v 〉 ab ( H ) Q ab 4 ( 1 + δ ab ) - ( 1 - η in η out ) A br H All of the parameters that go into the Lawson criterion will not be discussed here. But in essence, the criterion requires that the product of the particle density (N) and the energy confinement time (τE*) be greater than a number dependent on, among other parameters, reaction temperature (H) and the reactivity σvab, which is the average of the product of the reaction cross section and relative velocity of the reactants. In practice, this industry-standard paradigm suggests that temperatures in excess of 150,000,000 degrees Centigrade are required to achieve positive energy balance using a D-T fusion reaction. For proton—boron fusion, as one example, the criterion suggests that the product of density and confinement time must be yet substantially higher. An aspect of the Lawson criterion is based on the premise that thermal energy must be continually added to the plasma to replace lost energy to maintain the plasma temperature and to keep it fully or highly ionized. In particular, a major source of energy loss in conventional fusion systems is radiation due to electron bremsstrahlung and cyclotron motion as mobile electrons interact with ions in the hot plasma. The Lawson criterion was not formulated for fusion methods that essentially eliminate electron radiation loss considerations by avoiding the use of hot, heavily ionized plasmas with highly mobile electrons. Because the conventional thinking holds that high temperatures and strongly ionized plasma are required, it was further believed in the art that inexpensive physical containment of the reaction was impossible. Accordingly, methods being pursued in the art are directed to complex and expensive schemes to contain the reaction, such as those used in magnetic confinement systems (e.g., the ITER tokamak) and in inertial confinement systems (e.g., NIF laser). In fact, at least one source in the prior art expressly acknowledges the believed impossibility of containing a fusion reaction with a physical structure: “The simplest and most obvious method with which to provide confinement of a plasma is by a direct-contact with material walls, but is impossible for two fundamental reasons: the wall would cool the plasma and most wall materials would melt. We recall that the fusion plasma here requires a temperature of ˜108 K while metals generally melt at a temperature below 5000 K.” (“Principles of Fusion Energy,” A. A. Harms et. al.) It should be pointed out that current fusion schemes using D-T fuels which produce radioactive materials. Robots are required to operate such systems. The present inventions break the prior art paradigms by, among other things, increasing the reactant density, essentially eliminating electron radiation losses, and combinations of these, by avoiding the use of a strongly ionized plasma, modifying the Coulomb barrier and thus increasing the reaction cross section, extending the interaction region of fusion reactants from a point to a large surface area, and using physical confinement to contain the fusion reaction. Such approaches make Lawson's criterion inapposite. The importance and value of achieving economically viable controlled fusion has long been recognized and sought after in the art. Controlled fusion may have applications in energy production, propulsion, material creation, material formation, the production of useful isotopes, generation of directed energetic beams and particles, and many other key fields and applications. In the energy production area, controlled fusion has been envisioned to provide a solution to global energy and environmental challenges, including supply, distribution, cost, and adverse effects from using hydrocarbon or other alternative fuel sources. Accordingly, there has been a long-standing and unfulfilled need for a controlled fusion reaction, and the clean energy and other benefits and beneficial uses that are associated with such a reaction. The present methods, devices and systems for conducting fusion reactions solve these and other problems, deficiencies, and inadequacies associated with prior attempts to create a viable controlled fusion system. Further, the present inventions avoid the risks associated with conventional fission power generation. Moreover, available aneutronic embodiments of controlled fusion avoid the potential issues associated with managing neutrons produced in other fusion reactions. Thus, the present inventions, among other things, solve these needs by providing the articles of manufacture, devices and processes taught, disclosed and claimed herein. In an embodiment of the present inventions there is provided a device that uses high-speed rotation of material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. These devices rotate materials at hundreds of thousands or millions of revolutions per second (RPS), creating forces, effects and conditions that facilitate the fusion reaction. The fusion reaction takes place near the outer region of this rotating material, generally further away from the center of rotation and more toward where the material is fastest moving in km/sec. The recovery or utilization of the fusion products, which includes created materials, modified materials and energy can then be more readily utilized, because these products are similarly near the outer side of this rotating material. In an embodiment of the present inventions there is provided a device that uses high-speed rotation of material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. These devices rotate materials at hundreds of thousands or millions of revolutions per second (RPS), creating forces, effects and conditions that facilitate the fusion reaction. The fusion reaction takes place in a region removed from the axial center of the rotating mass, preferably where the material is fastest-moving. The recovery or utilization of the fusion products, which includes created materials, modified materials and energy can then be more readily utilized, because these products are similarly near the outer side of this rotating material. Additionally, in an embodiment of the present inventions there is provided a method that uses high-speed rotation of material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. These methods rotate materials at hundreds of thousands or millions of revolutions per second (RPS), creating forces, effects and conditions that facilitate the fusion reaction. The fusion reaction takes place in a region removed from the axial center of the rotating mass, preferably where the material is fastest-moving. The recovery or utilization of the fusion products, which includes created materials, modified materials and energy can then be more readily utilized, because these products are similarly near the outer side of this rotating material. In a further embodiment of the present inventions there is provided a method that uses high-speed rotation of material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. This method rotates materials at hundreds of thousands or millions of revolutions per second (RPS), creating forces, effects and conditions that facilitate the fusion reaction. The fusion reaction takes place near the outer side of this rotating material, generally further away from the center of rotation and more toward where the material is fastest moving in km/sec. The recovery or utilization of the fusion products, which includes created materials, modified materials and energy can then be more readily utilized, because these products are similarly near the outer side of this rotating material. In yet another embodiment of the present inventions there is provided a fusion device that utilizes an ionized material spinning at very high rates of speed. This device establishes conditions where the rotating material is forced into a second material, which is stationary, or for all practical purposes moving so slowly or in an opposite direction that it is effectively stationary with respect to the rotating material, wherein these two materials are brought together in a fusion reaction, whereby one or more of high energy particles, radiation, or new elements (or materials) are produced. Yet still further, in an embodiment of the present inventions there is provided a fusion method using ionized material spinning at very high rates of speed. This method forces the rotating material into a second material, which is stationary, or for all practical purposes moving so slowly or that is moving in the opposite direction that it is effectively stationary with respect to the rotating material, and brings these two material together in a fusion reaction, whereby one or more of high energy particles, radiation, or new elements (or materials) are produced. Further, the ionized material may be introduced to the device as pre-ionized. Additionally, in an embodiment of the present inventions there is provided a device requiring no internal mechanical rotation devices that creates and uses high-speed rotation of material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. These devices rotate materials at hundreds of thousands or millions of revolutions per second (RPS), without the use of any mechanical device or rotating device components, creating forces, effects and conditions that facilitate the fusion reaction. The fusion reaction takes place near a region generally further away from the center of rotation and more toward where the material is fastest moving in km/sec. The fusion products, which include created materials, modified materials, and energy, can then be more readily recovered or utilized because these products are similarly near the outer region of this rotating material. Moreover, in an embodiment of the present inventions there is provided a device requiring no internal mechanical rotation devices that creates and uses high-speed rotation of material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. These devices rotate materials at many thousands and potentially millions of revolutions per second (RPS), without the use of any mechanical device or rotating device components, creating forces, effects and conditions that facilitate the fusion reaction, by using reactors with small dimensions. The fusion reaction takes place near a region generally further away from the center of rotation and more toward where the material is fastest moving in km/sec. The fusion products, which include created materials, modified materials, and energy, can then be more readily recovered or utilized because these products are similarly near the outer region of this rotating material. In a further embodiment of the present inventions there is provided a method that uses non-mechanical high-speed rotation of a material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. This method rotates by non-mechanical means, materials at hundreds of thousands or millions of revolutions per second (RPS), creating forces, effects and conditions that facilitate the fusion reaction. The fusion reaction takes place near the outer side of this rotating material, general further away from the center of rotation and more toward where the material is fastest moving in km/sec. The recovery or utilization of the fusion products, which includes created materials, modified materials and energy can then be more readily utilized, because these products are similarly near the outer side of this rotating material. Moreover, in an embodiment of the present inventions there is provided a method requiring no internal mechanical rotation devices that creates and uses high-speed rotation of material to produce conditions for performing fusion reactions and utilizing the energy and materials created by those reactions. These methods rotate materials at hundreds of thousands or millions of revolutions per second (RPS), without the use of any mechanical device or rotating device components, creating forces, effects and conditions that facilitate the fusion reaction, by using reactors with small dimensions. The fusion reaction takes place near a region generally further away from the center of rotation and more toward where the material is fastest moving in km/sec. The fusion products, which include created materials, modified materials, and energy, can then be more readily recovered or utilized because these products are similarly near the outer region of this rotating material. In yet another embodiment of the present inventions there is provided a fusion device that utilizes an ionized material spinning at very high rates of speed. This device does not require mechanical rotating components. This device establishes conditions where the rotating material is forced into a second material, which is stationary, or for all practical purposes moving so slowly or in an opposite direction that it is effectively stationary with respect to the rotating material, wherein these two materials are brought together in a fusion reaction, whereby high energy particles are produced. Moreover, in an embodiment of the present inventions there is provided a fusion method using ionized material spinning at very high rates of speed without the need for mechanically rotating components. This method forces the rotating material into a second material, which is stationary, or for all practical purposes moving so slowly or that is moving in the opposite direction that it is effectively stationary with respect to the rotating material, and brings these two material together in a fusion reaction, whereby high energy particles are produced. In further embodiments of the above inventions, one or more of the following may also be present: the high energy particles may be alpha particles; energy may also be produced; at least about 1 nW (nanowatts) to about 1 mW (milliwatts) of energy may also be produced; at least about 10 W of energy may also be produced; about 10 kW (kilowatts) of energy may also be produced; about 1 MW (megawatt) of energy may also be produced; about 100 MW of energy may also be produced; about 1 GW (gigawatt) may also be produced; the high energy particles may be used to create electricity; at least about 1 mW of electricity may be produced; at least about 10 W of electricity may be produced; at least about 1 MW of electricity may be produced; at least about 100 MW of electricity may be produced; at least about 1 GW of electricity may be produced; energy may be produced which is then used to create electricity; the high energy particles are alpha particles and energy is produced; and, the high energy particles have an energy of at least about 2 MeV; and the high energy particles have an energy of at least about 1 MeV. In still further embodiments of the present inventions there are provided a fusion reaction device and method having, one or more of the following: the device or method may be configured and operated to achieve a predetermined energy balance of the fusion reaction; configured and operated to achieve a predetermined rate of the fusion reaction; configured and operated to achieve a predetermined reactant density; configured and operated to achieve a predetermined fusion reaction cross section; configured and operated to facilitate expansive confinement of the fusion reaction, whereby the fusion reaction is forced to the outer areas of the fusion chamber rather than the inner areas of that chamber; and configured and operated to achieve increased probability of reaction through a longer confinement time. Additionally, in embodiments of the present inventions there are provided a fusion reaction device and method having one or more of the following: the device or method may be configured and operated to provide for expansive confinement to create sustained functioning fusion reactions and fusion reaction devices from a microscale, e.g., less than a few millimeters in size, to a few meters, to commercial power generation scale; the scaling of fusion reactor size geometrically to determine reaction rate; and the scaling of fusion reactor size geometrically to determine energy balance. Still further in embodiments of the present inventions there is provided a fusion reactor configuration for enabling nuclear fusion reactions for use in an application; the reactor incorporating a first reactant and a second reactant; the first reactant having a first density; the second reactant having a second density; a means for expansive confinement; and a means to modify the cross section of reaction, the reactor is capable of producing predetermined products. Yet further, in embodiments of the present inventions there is provided a fusion reactor configuration for enabling nuclear fusion reactions for use in an application, the reactor incorporating a first reactant and a second reactant; the first reactant having a first density on the order of about 1013 particles/cm3 to on the order of about 1023 particles/cm3, greater than about 1024 particles/cm3, greater than about 1025 particles/cm3; the second reactant having a second density of about 1013 particles/cm3 to on the order of about 1023 particles/cm3, greater than about 1024 particles/cm3, greater than about 1025 particles/cm3; a predetermined source of potential in addition and beyond the Coulomb potential; wherein these potentials interact with and/or combine with the Coulomb potential barrier. Furthermore, in embodiments of the present inventions there is provided a system configuration incorporating a reactor with a first reactant and a second reactant; the first reactant having a first density of about 1013 particles/cm3 to on the order of about 1023 particles/cm3, greater than about 1024 particles/cm3, greater than about 1025 particles/cm3; the second reactant having a second density of about 1013 particles/cm3 to on the order of about 1023 particles/cm3, greater than about 1024 particles/cm3, greater than about 1025 particles/cm3; a means for expansive confinement; and a means to modify the cross section of reaction, the reactor is capable of producing predetermined products. The system having an energy conversion system; a component to provide power to the reactor; a component to control the reactor. Further, in embodiments of the present inventions there is provided a system configuration incorporating a material rotating at high rates, wherein this rotation results in a pressure change in the system. This pressure change may induce a vacuum or flow of material. Still further, embodiments of the present inventions are provided in the claims, drawings and specification of this application. In general, the present inventions relate to methods, apparatuses, devices, and systems for creating, measuring, controlling, conducting, and optimizing fusion activities of nuclei. In particular, the present inventions relate to, among other things, fusion activities for energy production, propulsion, formation of material, and generation of directed energetic beams and particles. The present inventions further relate to such activities that cover a spectrum of reactions, from aneutronic fusion reactions that produce essentially no neutrons, to neutronic fusion reactions that produce substantial amounts of neutrons. Generally, the present methods, apparatuses, and systems utilize the high speed rotation of particles to provide for controlled fusion reactions in controlled environments, and preferably without the need for magnetic or high-energy containment fields. Further, embodiments of the present invention create or modify quantum and other effects to provide for or enhance the fusion reaction. In general, the controlled fusion devices utilize rotating particles at a high rate of speed. This may be done in a variety of ways. For example, an axial magnetic field can be created in a cylindrical chamber, and a radial plasma current can be induced by applying a voltage across a central discharge rod and a concentric electrode. The perpendicular electric field and magnetic field create a Lorentz force along the axis perpendicular to both the electric and magnetic fields, in this case in the azimuthal direction. The electric field and magnetic field may further be at an angle that differs from the perpendicular, such that perpendicular components, to a lesser or greater extent, are present in sufficient strength to create a sufficiently strong azimuthal Lorentz force. This azimuthal force acts on ions, which in turn couple with neutrals such that particles in the annular space between the central discharge rod and outer electrode are made to move at high rotational velocity. The lack of any moving mechanical parts means that there is little limitation to the speed at which rotation can occur, thus providing rotation rates in excess of 100,000 RPS. Turning to FIG. 1, there is provided schematic diagram of an embodiment of a fusion device of the present inventions. The controlled fusion device 100 has a first working material 101 and a second working material 110 associated with it. The controlled fusion device 100 has a rotation chamber 103 having rotation chamber wall 105 and a cavity 108, and a controlled pressure area 104. Operationally associated with the rotation chamber 103 is a rotation source 102 and a plasma creation device 106. The devices 102 and 106 may be the same, may be different, and may be operationally associated in combinations and variations of these. Within the cavity 108 there is a fusion surface 109. The first working material 101 is any material or combination of substances that is capable of being formed into a plasma, and more preferably a weakly ionized plasma. For example, the first working material can be hydrogen, deuterium, tritium, helium, argon, neon, xenon, nitrogen, oxygen, in general gaseous materials, vaporized solids or other solids, or liquids. It may be a combination of an ionizable background material and a material which is intended to be directly involved in the fusion reaction. The ionizable background material may also be involved in the fusion reaction. For example, argon gas (as a background material) may be combined with vaporized boron. In one embodiment, the first material could be hydrogen. The second working material 110 can be the same as the first working material 101, it may be combined with the first working material, or it may be different. In general, the second working material and the first working material should be selected to provide for a predetermined and optimized fusion reaction. Thus, for example, the combination of these materials may seek to, among other things, create an aneutronic fusion reaction, provide for high particle density, result in a high energy output, provide for good electron emission, provide for use of materials which both have positive or both have negative magnetic moments, and combinations and variations of these and other factors. Preferably, the material should be selected to provide for an aneutronic fusion reaction. Preferably, the second working material is a solid. In one embodiment, the second material could be boron or a boron compound such as boron nitride or lanthanum hexaboride. Preferably, the first and second materials for some embodiments of the controlled fusion device may be: hydrogen-1 and boron-11, hydrogen-1 and lithium-6, hydrogen-1 and lithium-7, deuterium and helium-3, deuterium and lithium-6, helium-3 and lithium-6, helium-3 and helium-3, hydrogen-1 and nitrogen-15, deuterium and deuterium, deuterium and tritium, or tritium and tritium. It may be advantageous to use molecular compounds that are good electron emitters, for example boron nitride or lanthanum hexaboride. The first or second working material may also be a matrix or composite of different materials, each of which may provide an advantage for the fusion reaction, e.g., one is a good electron emitter and one is the compound containing the fusion reactant. A further consideration in determining the first and second working materials is the avoidance of potentially added cost and difficulties in handling materials that may be potentially dangerous, self-pyrolizing, or have other heightened health, safety or cost concerns. The rotational source 102 or device for providing rotation to the plasma, and preferably weakly ionized plasma, may include superconducting magnets, permanent magnets, electromagnets, radiofrequency sources, microwave sources, electric field sources, electrodes, lasers, ion guns, and combinations and variations of these and other types of devices. The plasma creation device 106 may include radiofrequency sources, microwave sources, lasers, electric field sources, electrodes, spark gap, and ion guns, and combinations and variations of these and other types of devices. In some embodiments, the rotational device 102 and the plasma creation device 106 may be combined. For example, a superconducting magnet creating a magnetic field between about 0.5 and about 2 Teslas or greater, and a set of electrodes with a voltage difference of between about 2 kV (kilovolts) and 3 kV or greater will both create a plasma and cause the said plasma to rotate; another example is plasma being created by electromagnetic waves at the resonant frequencies of ions and electrons in a magnetic field, and being caused to rotate by the same electromagnetic waves and magnetic field. The rotation chamber 103 forms or defines the cavity 108 that contains the plasma, and preferably the weakly ionized plasma. Associated with the cavity are the rotational device 102 and the plasma creation device 106. In this manner, these devices 102, 106, create a plasma and cause the plasma to rotate within the chamber at high revolutions, e.g., at least about 1,000 revolutions per second (RPS), at least about 5,000 RPS, at least about 50,000 RPS, at least about 100,000 RPS, at least about 300,000 RPS, or greater, and from about 100,000 to about 300,000 RPS. The rotation chamber 103 may be made from metals, ceramics, plastics, composites, and combinations and variations of these and other types of materials. The rotation chamber can provide a controlled pressure area 104 or it may itself be contained in or be part of the controlled pressure area 104. The rotation chamber provides a controlled environment and preferably surfaces that, among other things, direct or contain the rotation of the plasma. The rotation chamber may also include or be an electrode. The rotation chamber 103 has a wall 105 or structures that provide physical barriers to the rotating plasma, as well as, in some embodiments, a physical barrier to contain or control the atmosphere and pressures. The rotation chamber wall 105 can define, in whole or in part, a cavity 108. The cavity 108 forms a volume or defines a region, where the plasma rotates and the fusion reaction may also take place. A fusion surface 109 is provided in the device 100. In dealing with nuclear distances and areas where the fusion reaction takes place, relative or common terms of distance may not completely apply. Thus, as used herein, when it is provided that the fusion reaction occurs at, near, or adjacent to a surface or region, these terms are to be used in their broadest possible sense, and would include the reaction taking place in that general region, or being bounded by or otherwise physically contained by that surface. In the device 100, preferably the fusion reaction takes place in whole or in part adjacent to the fusion surface 109. The fusion surface may form in whole or in part the rotation chamber 103, the controlled pressure area 104, the cavity 108, and combinations and variations of these. The fusion surface 109 may also be contained within some or all of these structures, provided however that the fusion surface is located within the controlled pressure area 104. The fusion surface may be solid, a screen, nanoparticles, a gel, a matrix, coatings and platings generally, micro and nano structured surfaces, and for example may be formed from copper, stainless steel, silver, metal platings, ceramics, composites, plastics, metals, metalloids, organics, oxides, glass, polymeric materials, alloys, graphite, and combinations and variations of these and other materials. Moreover, the fusion surface 109 may include or be the second working material. Turning to FIG. 2, there is shown a perspective cross-sectional view of an embodiment of a controlled fusion device 200. The controlled fusion device 200 has a superconducting magnet 201 which provides a magnetic field from about 0.5 to 2 Teslas. Within the magnet 201, and thus within the magnetic field created by the magnet, are an outer electrode 204, and an inner electrode 202. The inner electrode has insulation 203. Located on the inner surface 208 of the outer electrode 204 is a first boron plate 205 and a second boron plate 206. A working gas inlet line 207 is located within the inner electrode 204 and within the magnet 201. The outer electrode 204 is in the shape of a tube having an inner diameter of 16 centimeters (cm). The outer electrode 204 is made from copper. An uninsulated or exposed section 209 of the inner electrode 202 is located axially across from the boron plates 205 and 206. Although not shown in the figure, the inner and outer electrodes are contained within a controlled pressure environment. The inner electrode and the uninsulated section 209 has an diameter of 4 cm. Thus the inner and outer electrodes are electrically associated with a power source and circuit shown in FIG. 4A, and thus there is provided a voltage across the two electrodes. Preferably, in this embodiment the boron plates are made from boron nitride or lanthanum hexaboride both of which are excellent electron emitters. It should be understood that this embodiment may be configured such that the components and their respective positions may be modified or changed. For example, multiple inner electrodes may be used, different configurations for the outer electrode may be used, more or fewer boron plates may be used, a continuous ring of boron may be used, or other configurations of the boron may be used, the location and position of the working gas inlet line 207 may be changed and multiple working gas inlet lines 207 may be used. The distance between the inner surface of the outer electrode 204 and the exposed outer section of the inner electrode 209 is approximately 6 cm. It is in this region that an electric current is flowed through the working gas to create a plasma, and preferably a weakly ionized plasma. The concentration and type of the working gas, the pressure of the working gas, the distance between the electrodes, and other factors are evaluated in determining the voltage and current used to create the plasma. Moreover, the voltage and current used to impart the Lorentz force to create the rotation of the plasma is based upon the magnetic field and other factors. Thus, in this embodiment, the distance between the electrodes may be less than a centimeter, may be less than 2 cm, may be from about 2 cm to about 50 cm, may be from about 5 cm to about 20 cm, and may be greater than a meter. In determining this distance, consideration should be given to the detrimental effect that increased distance has on electrical power requirements to form the plasma and to create sufficient Lorentz forces to induce sufficient rotation to allow fusion to take place. In using smaller distances, consideration should also be given to avoiding the creation of boundary layer effects, which may adversely affect the ability of the Lorentz forces to impart sufficient rotation to give rise to fusion. The magnetic field may be from about 0.5 Tesla to about 20 Teslas, from about 2 Teslas to about 5 Teslas, and may be greater or lower depending upon the plasma current such that sufficient rotation is imparted. The hydrogen gas is preferably at approximately 3 torr, but may be from about 0.5 torr to about 12 torr, from about 1 torr to about 7 torr, and preferably 2 torr or greater. Further, and more preferably, the pressure of the hydrogen should be as large as is possible without adversely affecting or inhibiting the plasma creation. The axial length of the electrodes, and more particularly the axial length of the uninsulated section of the inner electrode, may be less than a centimeter, and can be substantially longer than a centimeter, provided that the voltage across the electrodes is sufficiently high to induce a sufficient amount of rotation in the region where fusion is intended to take place. Further, this embodiment may be used with other first working materials and other second working materials. Generally, the device of the embodiment of FIG. 2 can be operated by providing the magnetic field of between about 0.5 Tesla and about 2 Teslas; purging the device of all atmosphere; and after purging, filling the device with hydrogen to about 3 torr. Applying a voltage of about 1.4 kV through a current-limiting resistor to the inner electrode creates a plasma current of about 10 to 50 A, which imparts, due to the Lorentz force created by the magnetic field and current, a rotation of about 1,000 RPS. Preferably, this initial rotation in devices of the embodiment of the type of FIG. 2, enhances the ability to achieve rotational speeds sufficient to cause fusion. After the initial rotation is established, a pulse of about 400 V to 1 kV between the outer and inner electrodes creates a plasma current of about 2 to 5 kA, and imparts a rotation of at least about 100,000 RPS. The rotation of the plasma is maintained for about 10 milliseconds. During this rotation of the plasma, alpha particles are created by a fusion reaction between a proton and a boron-11 nucleus. It is believed that the average kinetic energy of the protons is approximately 500 eV (electron-volts). The cumulative energy imparted to the three alpha particles produced by each fusion reaction is thought to be approximately 8.68 MeV. In addition to a single pulse operation, the embodiment of FIG. 2 may be operated with one, two, or more serially spaced pulses. The serially spaced pulses may be staggered or overlapping. Further, a CW (continuous wave) voltage may be applied for periods of greater duration than the pulses. These approaches may thus provide substantially longer periods of fusion activity than the observed 10 milliseconds, where the creation of alpha particles and associated energy production can take place. Also, secondary nuclear reactions between energetic alpha particles and other materials may take place, adding additional energy to the system. For example, alpha particles produced by a primary reaction between hydrogen-1 and boron-11 may react with carbon in the wall of the controlled fusion device, creating oxygen and releasing additional energy. Thus, the fusion product itself may become a working material, e.g., a third working material. Turning to FIGS. 2A through 2E, there are shown perspective cross-sectional views of the embodiment of FIG. 2 taken along line A-A. As described subsequently, these figures illustrate the various electric fields, magnetic fields, and operating parameters of the embodiment of FIG. 2, resulting in the creation of the fusion reaction and fusion products, e.g., alpha particles and related energy generation. Turning to FIG. 2A, the magnetic field lines are shown by arrows (B). These magnetic field lines, created by magnet 201, are shown passing through the annular space 222 between the inner 202 and outer 204 electrodes. Hydrogen gas is filling this annular space 222. As shown in this figure, because the voltage has not been applied across the electrodes 202 and 204, no rotation has taken place. A power source 220, and water cooling lines 221a, 221b are also shown. Turning to FIG. 2B, the electric field is created and is illustrated by the plus symbols on the inner electrode 202 and the arrows (E) extending radially outward from inner electrode 202 to the outer electrode 204. From this figure it can be seen that the electric field lines (E) are normal to the magnetic field lines (B). Preferably, the voltage is initially applied at a lower level to create weak ionization and slow initial rotation. Turning to FIG. 2C, there is shown the creation of the weakly ionized plasma, which initially occurs at the application of the low power CW voltage. Thus, the electric field has ionized some hydrogen to create a weakly-ionized plasma (e.g., 1 ion for about every 100,000 neutrals). The presence of these ions allows current to flow, illustrated by the jagged lightning bolt-like lines (I) extending radially outward. The weakness of the plasma allows it to remain stable. Proceeding then to FIG. 2D, the high power pulse has been applied across the electrodes, creating an azimuthal Lorentz force, shown by arrows (F), acting upon the ions in the weakly ionized plasma. The flow of the plasma current in both FIGS. 2C and 2D is illustrated by the jagged lightning bolt-like lines (I) extending radially outward. The direction of the Lorentz force (F) on the ions of the weakly ionized plasma is perpendicular to both the magnetic field (B) and electric field (E) (as shown by the tangential arrows in FIG. 2D), and induces a rotation in the direction of forces (F) and the circular arrows (R) shown in FIG. 2E. Thus, the rotation of the ions in the weakly ionized plasma causes the neutrals (e.g., the non-ionized hydrogen) to rotate. It is believed that this rotation is caused by collisions between the ions and the neutrals. Thus the embodiment of FIG. 2 enables the acceleration of a substantial number of neutral particles by only a very few ions to an energy level sufficient for the fusion reaction. For example, if using hydrogen the ratio of ions to neutrals may be from about 1:1,000 to about 1:120,000, from about 1:50,000 to about 1:100,000, from about 1:100,000 to about 1:180,000, 1 to at least about 1, 1 to at least about 10, 1 to at least about 100, 1 to at least about 1,000, 1 to at least about 10,000, 1 to at least about 50,000, 1 to at least about 80,000, 1 to at least about 100,000, 1 to at least about 180,000. Thus, turning to FIG. 2E, there is illustrated in a conceptual manner the fusion reaction taking place along a fusion surface 208 which in this embodiment is the inner surface 208 of outer electrode 204. It is presently believed that in the embodiment of FIG. 2, the vast majority of the fusion reactions take place adjacent to the fusion surface. The fusion reaction is illustrated by the starburst-like graphics around the boron particles that are believed to have migrated from the boron plates 205 and 206. FIG. 4A depicts an embodiment of a control apparatus and discharge circuit that is part of a controlled fusion device, such as that depicted in FIG. 2. A system control block 401 allows an operator to manage and control one or more elements operatively interconnected with the controlled fusion device. The system control block 401 may include a computer. Alternatively, it may include manual switches or any other types of control interfaces known in the art. Communication pathways, e.g., control and data signal transmission and receipt and the like are as shown by dashed lines in the figure. The control apparatus includes a continuous wave (CW) discharge circuit 407 and a pulsed discharge circuit 406. The CW discharge circuit 407 is made up of a DC power supply 402 configured to deliver a voltage of between 1.4 and 2.0 kV, although other voltages are also possible. (data and control communication pathway is shown by dashed line 402a.) The DC power supply 402 has a bank of fuses 421 and a Variac 408 associated with it. The DC power supply 402 is operatively connected to electrodes in the controlled fusion device through an impedance of approximately 5 Ohms in order to apply continuous voltage across the plasma load 403. As discussed above with reference to FIG. 2, the CW voltage may pre-ionize the plasma and initiate rotation of the plasma. In operation, the CW discharge circuit 407 provides a current of approximately 10 to 50 Amps through the plasma. The CW discharge circuit 407 also has a high voltage probes 413a, 413b connected to, e.g., in data communication with, an oscilloscope, a 0.1 Ohm 1% resistance device 412, a 5 Ohm resistance device 411, a 30 Amp Fuse 410, and a 36 A 3 kV isolation diode 409. A crowbar diode 420 bridges the CW discharge circuit 407 and the pulsed discharge circuit 406. The pulsed discharge circuit 406 is made up of a capacitor bank 404 which is charged to between 1.5 and 4 kV. In some embodiments, the capacitor bank 404 has a capacitance of 3.6 mF, although other capacitance values may be used. When the system control block closes the gate drive switch 405 (e.g., via control and data pathway 405a), the capacitor bank 404 is discharged through the plasma, creating a current (shown by arrow 421) of between 3 kA and 50 kA for approximately 10 to 15 milliseconds. This current pulse 421 induces rapid rotation of the plasma, up to about 100,000 RPS, which induces fusion. Other variations of a control apparatus and discharge circuit are also possible and would also fall within the scope and spirit of the present invention. The pulsed discharge circuit 406 also has a voltage source 418, from 1.5 kV to 4 kV, a 100 Ohm resistance device 417, a 16 micron hertz device 416, a 0.3 Ohm resistance device 415, and a current monitor 414 having a 10 As saturation (in control and data communication via pathway 414a). The system also has a control and data communications pathway 420 that is associated with the gas (puff) inlet valve (not shown), and a fast video camera 419 having data and communications pathway 419a. As the voltage is applied and the degree of ionization increases, the current flows more readily, thus resulting in a perceived drop in the required voltage. Thus, as a result, sequencing or use of various sources of voltage may be employed, a low voltage CW source may be used to create initial start-up rotation, a high voltage may be used to form the requisite degree of ionization and high speed rotation (e.g., about at least 100,000 RPS), and then a lower voltage may be used for maintaining the degree of ionization and speed of rotation to conduct fusion reactions over an extended period of time. To enhance the overall efficiency of the system, it is preferred that for each type of voltage needed, the most efficient source of voltage be used. Thus, sequencing the power inputs such that as the conductivity increases inside the fusion region, the voltage input is reduced to track such increases. This in turn lowers the required power input, thereby increasing the overall gain of this fusion device. Turning to FIG. 3, there is shown a perspective cross-sectional view of an embodiment of a controlled fusion device 300. The controlled fusion device 300 has a superconducting magnet 307. Within the magnet 307, and thus within the magnetic field created by the magnet, are a controlled pressure chamber 306, an outer electrode 304, and an inner electrode 302. The inner electrode has insulation 303. Located on the inner surface 312 of the outer electrode 304 is a member 305a, having the second working material, and a second member 305b, having a second working material. A working gas inlet line 301 is located within the inner electrode 304 and within the magnet 307. The outer electrode 304 is in the shape of a tube having an inner diameter of 16 centimeters (cm), and is made from copper. The wall 313 of the outer electrode 304 is about 2 cm in thickness. The inner electrode 302 is made from copper, and has an expanded, and uninsulated outer surface 311. The distance between the outer surface 311 of the inner electrode 302 and the inner surface 312 of the outer electrode 304 is shown by double arrow 310, and is about 3.5 cm. The members 305a, 305b are located axially across from the inner electrode's 302 outer surface 311. A fusion chamber 308 is at least partially positioned within the magnetic field of the magnet 307. A fusion surface 309 is associated with the controlled pressure chamber 306. The inner and the outer electrodes are electrically associated with a power source and circuit, for example of the type shown in FIG. 4B (which is described in further detail below in the specification), and thus there is provided a voltage across the two electrodes 304, 302. Preferably, in this embodiment the first working material, is a working gas, and in particular hydrogen, and the second working material is boron nitride or lanthanum hexaboride. In the region between the outer surface 311 of the electrode 302 and the inner surface 312, the electric current is flowed through the first working material to create preferably a weakly ionized plasma. In operation, the fusion reaction takes place in the fusion cavity 308, and preferably adjacent the fusion surface 309. It should be understood that this embodiment may be configured such that the components and their respective positions may be modified or changed. For example, multiple inner electrodes may be used, different configurations for the outer electrode may be used, more or fewer second working material members may be used, and a continuous ring may be used. The location and position of the working gas inlet line, the fusion chamber, the fusion surface and other components, as well, may be varied. FIG. 4B depicts another embodiment of a system control and discharge circuit which may be used in conjunction with the system described with reference to FIG. 3. The system control and discharge circuit includes a CW discharge circuit 457 and a pulsed discharge circuit 456. The CW discharge circuit 457 includes a DC power supply 452 configured to supply 1.44 kV through an impedance of between 6 and 18 Ohms across the plasma 453. However, other voltage levels and impedance values may be used. The DC power supply 452 is configured to supply on the order of 10 Amps across the plasma in order to pre-ionize the plasma and initiate rotation. The DC power supply 452 has a bank of fuses 471 and a transformer 458. The CW discharge circuit 457 also has a high voltage probes 463 in communication (via pathway 463a) with an oscilloscope (not shown), a 6-18 Ohm resistance device 461, a 30 Amp fuse 460, an isolation diode 459 (e.g., at 36 A, 3 kV). The pulsed discharge circuit 456 includes a capacitor bank 454 with a capacitance of 5.6 mF, although other capacitance values are also possible. The capacitor bank is charged to approximately 3 kV, from power voltage source 468 (3 kV, 5 A). When the system control block 451 closes the pulse control switch 455, a current pulse of 3 to 30 kA (arrow 480) is applied to the plasma, inducing rapid rotation, which gives rise to fusion events. The pulsed discharge circuit 456 also has a 100 Ohm resistance device 467, a relay 474, and a 10 As saturation current monitor 485, and pathway 485a. The control system and discharge circuit of the embodiment of FIG. 4B, has a controller 451 (which can be one or more controllers, PLCs, computers, processor-memory combinations, and variations and combinations of these). The controller 451 is in communication via a communication and data network having various communication pathways, illustrated as dashed lines. Thus, pathway 469a places a fast video camera 469 in communication with the controller 451, pathway 452a is associated with the DC power supply, pathway 470 is associated with the gas puff valve, pathway 472 is associated with a thermocouple, pathway 473 is associated with other monitoring equipment, e.g., additional oscilloscopes, pathway 491a is associated with an optical fiber monochromator 491, pathway 468a is associated with the voltage supply 468, and pathway 455a is associated with the pulse control 455. Generally, the term “about” is meant to encompass a variance or range of ±10%, the experimental or instrument error associated with obtaining the stated value, and preferably the larger of these. Embodiments of the present inventions may utilize quantum, electrostatic, mechanical, or other effects including, among other things, large E-fields, high electron densities, ponderomotive forces, modification or change of the Coulomb barrier, modification or change of the reaction cross section, space charge or electron shielding effects, the use of neutrals, ion-neutral coupling, nuclear magnetic moment interaction, spin polarization, magnetic dipole-dipole interaction, high particle density materials, compression forces associated with centrifugal forces or ponderomotive forces, phase transitions of hydrogen, positive feedback mechanisms, and modification and variations of these and other effects. All references in this specification to modifying, changing, lowering, reducing or eliminating the barrier include means by which the Coulomb barrier is offset by, or its effect is reduced by, the presence of one or more other features (e.g., high electron densities) even though the Coulomb barrier itself (independent of such features) remains unchanged. It is noted that there is no requirement to provide or address the theory underlying the novel and groundbreaking fusion methods, devices and systems that are the subject of the present inventions. Nevertheless, these theories are provided to further advance the art in this important area. The theories put forth in this specification, unless expressly stated otherwise, in no way limit, restrict or narrow the scope of protection to be afforded the claimed inventions. These theories many not be required or practiced to utilize the present inventions. It is further understood that the present inventions may lead to new, and heretofore unknown theories to explain the fusion methods, devices and system of the present inventions, and such later developed theories shall not serve to diminish or limit the scope of protection afforded the claimed inventions. Modification or Change of the Coulomb barrier In order to fuse, two nuclei must come into contact; however, nuclei are very small (on the order of 10−15 m), and because they are positively charged, they are electrostatically repulsed by one another. Turning to FIG. 5A to 5C there are shown are shown examples of an explanation of the affects of an embodiment of the present inventions, through the illustrative use of a potential energy curve of a two particle system. The potential energy curve of a two particle system 501 in which a first nucleus 502 is approaching a second nucleus is illustrated in FIG. 5A. On the horizontal axis 506, x is the distance between the two nuclei. Energy of the system is shown on the y-axis 505. The system potential 501 is near zero when the first nucleus is located far away from the second nucleus, and increases as the first nucleus approaches the second nucleus. The system potential 501 is the sum of the repulsive (positive) Coulomb potential and the attractive (negative) strong nuclear force potential. Once the two nuclei are very close, at distance xn apart (where xn is approximately equal to the sum of the radii of the two fusing nuclei), the system potential 501 becomes negative due to the effect of the strong nuclear force. Thus, the term “Coulomb barrier” is used to describe the difficulty of bringing the two nuclei into contact, either by getting through or getting above the potential curve shown in FIG. 5A. FIG. 5A labels the kinetic energy of the two-nucleus system, “ϵ,” as expressed by:ϵ=1/2mrv2 where v=v1-v2, v1 and v2 are the velocities of the two nuclei, and mr is the reduced mass of the system, given by: m r = m 1 m 2 m 1 + m 2 where m1 and m2 are the masses of the two nuclei. Classical mechanics holds that, when the nuclei are approaching one another, ϵ must be greater than the height of the Coulomb barrier for the nuclei to come into contact. However, quantum mechanics allows for “tunneling” through a potential barrier, xT, thus making fusion reactions possible when ϵ is below this threshold. However, the magnitude of the barrier still presents an impediment to tunneling, xT such that reactions with larger Coulomb barriers (e.g., higher, wider, or both) are generally less likely to occur than those with smaller barriers. Thus, under classical mechanics energies in area 503 should not overcome the Coulomb barrier. Embodiments of the present invention may lower or reduce the Coulomb barrier by creating, modifying, or utilizing effects that have negative (attractive) potentials. Such a negative potential is illustrated in FIG. 5B. In this figure, a negative potential 507 is shown, and the additive effect of the negative potential 507 and the initial system potential 501 creates a new, resultant system potential 504. This new resultant systems potential 507 has a distance x1 where the potential starts out as negative, has a substantially lower Coulomb barrier, and the distance xT for tunneling reduced and closer to the distance where attraction takes over xn. Thus, for example, embodiments of the present invention may lower or reduce the Coulomb barrier through the use of effects such as: centrifugal effects; space charge or electron shielding effects; the use of neutrals; ion-neutral coupling; or nuclear magnetic moment interaction, spin polarization, or dipole-dipole interaction effects; and combinations and variations of these and other effects. FIG. 5C illustrates the resultant system potential 504 that arises from combining the initial system potential 503 with a centrifugal potential 508, an electron shielding potential 509, and a nuclear magnetic moment interaction potential 510. Each of these alone and in combination reduces the Coulomb barrier, (making it lower, less thick, and both) which makes it easier for the nuclei to tunnel through or overcome the potential barrier, thus increasing the probability that the fusion reaction will take place. Centrifugal Potential When a material rotates within a confined space, the confining walls provide a counterforce (centripetal force) to the force created by the rotating materials (centrifugal force). These countering forces compress the rotating materials against other materials in the area adjacent the confining walls. This compression gives rise to a negative centrifugal potential. A centrifugal potential effectively creates an attractive force towards the confining wall, and this force gets stronger as materials approach the confining wall. Embodiments of the present invention may generate a strong centrifugal potential by inducing rapid rotation of particles within a confined space, causing particles to accelerate toward the outer wall of the confinement structure. In one embodiment of the present inventions, rotation of the plasma produces a centrifugal acceleration of 109 g, although this value can be made higher or lower by changing system parameters (for example, by changing the radius of curvature of the device, or by changing the azimuthal velocity of reactants). This centrifugal acceleration is analogous to gravity, but the effective force is directed radially outward, as opposed to radially inward in the case of gravity. Thus, at the localized fusion reaction site, i.e., between one nucleus and another, forces equivalent to pressures in the hundreds of millions, and even billions of psi may be present. One advantage of the use of centrifugal acceleration is that the material is compressed adjacent to a surface, rather than compressed toward a point. It is believed this provides a larger region where reactants are in close contact and fusion can take place, increasing the probability and rate of fusion. Thus, there is further provided readily and easily accessible means to extract the energy created from the fusion reaction for use. The effect of the centrifugal potential 506 is illustrated in FIG. 5C. Electron Shielding An advantage of using weakly ionized plasma is that the reactants largely comprise neutral atoms. The electrons interposed between the nuclei shield the repulsive Coulomb force between the positively charged nuclei. This phenomenon affects the Coulomb repulsion and may reduce the Coulomb barrier. In addition, using reactants that are highly efficient electron emitters introduces a cloud of electrons, a negative space charge, between the positively charged reactants, which further enhances this shielding effect. In an embodiment of the present invention, the second working material is selected to comprise lanthanum hexaboride, which has one of the highest electron emissivities of any known compound. It is believed that electrons emitted by the lanthanum hexaboride working material remain in the vicinity of the boron, and provide an electron shielding effect which reduces the Coulomb barrier and enhances the fusion reaction rate. In another embodiment the second working material comprises boron nitride, which is also an efficient electron emitter, and has a similar effect. The effect of the electron shielding potential 507 is illustrated in FIG. 5C. In a further embodiment, there is present in the system a material with a geometry or surface profile that creates non-uniform electric fields. Thus, by way of example, a lanthanum hexaboride surface with a dendritic profile may be desirable to generate localized electron shielding for fusion. Nuclear Magnetic Moment Interactions Many nuclei have an intrinsic “spin,” a form of angular momentum, which is associated with their own small magnetic field. The magnetic field lines form as though one end of the nucleus were a magnetic north pole, and the other end were a magnetic south pole, leading the nucleus to be referred to as a “magnetic dipole,” and the strength and orientation of the dipole described by the “nuclear magnetic moment.” Nuclear magnetic moments play a role in quantum tunneling. Specifically, when the magnetic moments of two nuclei are parallel, an attractive force between the two nuclei is created. As a result, the total potential barrier between two nuclei with parallel magnetic moments is lowered, and a tunneling event is more likely to occur. The reverse is true when two nuclei have antiparallel magnetic moments, the potential barrier is increased, and tunneling is less likely to occur. When the magnetic moment of a particular type of nucleus is positive, the nucleus tends to align its magnetic moment in the direction of an applied magnetic field. Conversely, when the moment is negative, the nucleus tends to align antiparallel to an applied field. Most nuclei, including most nuclei which are of interest as potential fusion reactants, have positive magnetic moments (p, D, T, 6Li, 7Li, and 11B all have positive moments; 3He, and 15N have negative moments). In an embodiment of a controlled fusion device a magnetic field may be provided that aligns the magnetic moments in approximately the same direction at every point within the device where a magnetic field is present. This results in a reduction of the total potential energy barrier between nuclei when the first and second working materials have nuclear magnetic moments which are either both positive or both negative. It is believed that this leads to an increased rate of tunneling and a greater occurrence of fusion reactions. The effect of the nuclear magnetic moment interaction potential 508 is illustrated in FIG. 5C. This effect may also be referred to as spin polarization or magnetic dipole-dipole interaction. In addition, the gyration of a nucleus about a magnetic field line also contributes to determining the total angular momentum of the nucleus. So when the cyclotron motion of the nucleus produces additional angular momentum in the same direction as the polarization of the nuclear magnetic moment, the Coulomb barrier is further reduced. Modification or Change of the Reaction Cross Section The probability of a fusion reaction between a pair of nuclei is expressed by the reaction cross section, “σ.” The cross section is typically measured in experiments as a function of ϵ by bombarding a stationary target of nuclei with a beam of nuclei. The cross section is normally defined such that: σ = B I where B is the number of reactions per unit time per target nucleus, and I is the number of incident particles per unit time per unit target area. When cross section is defined and measured in this way, each fusion reaction will have a certain, specific cross section at a particular ϵ for a given system. The fusion reaction rate per unit volume in a particular reactor is normally described by: R = n 1 n 2 1 + δ 12 〈 σ v 〉 Here δ12=1 if the first nucleus and the second nucleus are the same type of nuclei (e.g., deuterium is being fused with deuterium) and δ12=0 otherwise, and σv is the “averaged reactivity” of the system, defined as:σv=∫0∞σ(v)vf(v)dv where f(v) is the distribution function of the relative velocities, normalized in such a way that ∫0∞f(v)dv=1. When the second nucleus is at rest, σv=σv; however, the preceding definition accounts for situations in which the second nucleus moves, and each pair of interacting nuclei may have a different relative velocity v. The rate of fusion energy release is then given by: dW dt = REwhere W is the total fusion energy per unit volume released and E is the energy released by a single reaction (E=8.68 MeV in the case of p-11B fusion). The probability of the two nuclei coming into contact through a quantum tunneling event is described by the tunneling barrier transparency, “T,” such that a higher value of T corresponds to greater likelihood of tunneling. Since tunneling is the primary mechanism by which fusion occurs, cross section is proportional to T (σ ∝ T). T is approximated by: T ≈ e - ϵ G ϵ where e is Euler's number, and ϵG is the modified energy of the Coulomb barrier. When the two nuclei are a distance x≥xT apart, ϵG is described by:ϵG ∝ ∫xnxTq1φ(x)dx Here, q1 is the charge of the first nucleus, φ(x) is the potential expressed as a function of x, and xT is the classical turning point at which φ(xT)=ϵ. As a result of these relationships, a higher value of φ (e.g., larger Coulomb barrier) will tend to translate into higher ϵG, which in turn will tend to lead to lower T, lower σ, lower R, and, when E>0, lower dW dtfor any specific system. Thus, systems in which φ is high will tend to experience fewer fusion events and lower fusion energy release rates, and systems in which φ is low will tend to experience more fusion events and higher fusion energy release rates. As discussed above, reducing the Coulomb barrier is equivalent to reducing φ, and embodiments of the present invention may employ these techniques to generally increase the cross section, σ; this also increases the fusion reaction rate.High Particle Density An embodiment of the present invention makes use of the electromagnetic force, requiring the presence of charged particles. However, instead of creating a strongly ionized plasma, we create a weakly ionized plasma, and then rely upon the ions to drive neutrals through the principle of ion-neutral coupling. This approach does not give rise to plasma instabilities, and so particle density (n1 and n2) can be many orders of magnitude higher than with a strongly ionized plasma. In an embodiment of the present invention, particle density is at least 1017/cm3 throughout the entire volume of the device. Further, the compression induced by the centrifugal potential leads to an increased density of particles in the region in which fusion events are expected to be concentrated, leading to densities of about 1018/cm3 in the region of the device where fusion reactions are concentrated. In addition, an embodiment of the present invention uses boron compounds in a solid form, which have a particle density on the order of 1023/cm3. Thus, in the region where fusion reactions are thought to be concentrated, the present invention achieves particle densities in a physical container many orders of magnitude greater than other methods known in the art (for example, it is believed that tokamak reactors have not achieved sustained particle densities greater than about 1014/cm3). An advantage of the present inventions is that they effectively suppress radiation losses due to electron bremsstrahlung. Conventional fusion reactors such as tokamaks employ hot, highly ionized plasma. Electron-ion interactions, resulting in bremsstrahlung and cyclotron radiation, are a significant source of energy loss and is one of the reasons such systems have not been able to satisfy the Lawson criterion. However, the high-density, lightly ionized, and colder plasma employed in embodiments of the present inventions suppresses electron mobility and greatly reduces radiative losses. Phase Transition of Hydrogen Under High Pressures Hydrogen atoms under high pressure compression can become liquid or solid metals, depending on the compressional forces and their states of rotation. In either the liquid or solid states, the density is many orders of magnitude higher than that in the gaseous state. The total reaction rate will be correspondingly higher according to the product of the particle densities of the two reactants. In addition, metallic hydrogen becomes highly conductive or even a superconductor with zero resistance. This increases the overall conductivity of the entire system, lowering the resistive loss and the input energy required. Thus, the overall efficiency of such a system is greater, making it easier to attain a large Q factor and the corresponding energy gain. Thus, it is presently theorized that as higher rotational speeds of the neutrals, such as, for example, hydrogen neutrals, are attained, these neutrals will become, or behave, in a manner like a liquid, solid, or superconductor. This form of the working material takes part in the fusion reaction, and is presently believed to be primarily located at the outer reaches of the fusion reaction chamber or zone nearer to the wall. The presence of this form of working material may greatly enhance the overall efficiency of the system. Positive Feedback The present invention may generate particles during operation. In some cases these particles may provide benefit to the device's function. In embodiments utilizing ionized particles, the creation of ionizing radiation may further enhance additional fusion by increasing, modifying, maintaining, or improving the ionization or rotational movement of a working material or plasma. Thus, by way of example, an apparatus using a weakly ionized plasma and a rotation mechanism wherein the first working material is hydrogen, and the second working material is boron, may generate alpha particles. These particles may ionize additional hydrogen, and may impart to them rotational energy. Thus, this synergistic effect of fusion products creating additional ions may have the effect of increasing rotational energy without the need for additional energy from an external source. Further, to prevent this feature from leading to a runaway reaction, the system temperature and the feed of hydrogen are constantly monitored, and the feed of hydrogen can be adjusted accordingly to modify the number of neutrals present, and thus control the rate of reaction. Diagnostics that monitor oscillations in current and voltages, which may be in-situ, and may be of micro or nano scales, may be placed inside the controlled fusion device, may communicate wirelessly to the data-control center through Wi-Fi channels. This arrangement allows for the direct monitoring and management of conditions within the fusion reaction zone. This will result in an efficient design of the fusion system. Further diagnostics and monitoring systems and techniques, such as temperature, spectroscopy, laser diagnostics, temperature monitoring, particle detectors, video, and others known to the art may be utilized to establish a control and monitoring system for a fusion reactor and power generation system. The following examples are provided to illustrate various embodiments of controlled fusion methods, devices and systems of the present inventions. These examples are for illustrative purposes, and should not be viewed as, and do not otherwise limit, the scope of the present inventions. A controlled fusion device of the general type shown in the embodiment of FIG. 3, was operated to provide a controlled fusion reaction that produced high-energy alpha particles and helium. The first working material in the device is hydrogen. The second working material in the device is boron that is introduced into the device through boron nitride targets, e.g., plates, on the inner walls of the outer electrode, and a lanthanum hexaboride target, e.g., disc, that is inserted into the reaction chamber by way of a rod. The magnet provides a magnetic field of 0.5 Tesla to the internal components of the controlled fusion device. The controlled pressure chamber is purged. After purging, the controlled pressure chamber and fusion cavity are filled with hydrogen gas to about 3 torr and at ambient temperature. A voltage of about 1.4 kV is applied through a current-limiting resistor to the inner electrode, creating a plasma current of about 25 A, which imparts, due to the Lorentz force created by the magnetic field and current, an initial or preliminary rotation believed to be about 800 to 2,000 RPS. The electrodes and apparatus are designed such that the electric field produced is substantially in a desired part of the apparatus, and minimizes arcing to the undesirable surfaces. After the initial rotation is established, a pulse of about 400 V to 1 kV between the outer and inner electrodes creates a plasma current of up to about 43 kA, which creates a weakly ionized plasma having a ratio of ions to neutrals believed to be about 1:100,000; and which imparts a rotation to the weakly ionized plasma (ions and neutrals) of at least about 100,000 RPS. The rotation of the weakly ionized plasma is maintained for about 10 milliseconds. During this rotation of the weakly ionized plasma, alpha particles are created by a fusion reaction between a proton and a boron-11 nucleus. Additionally, during this reaction helium appeared when none was present before commencing the rotation. It is believed that the average kinetic energy of these protons is approximately 500 eV (electron-volts). The cumulative energy imparted to the three alpha particles produced by each fusion reaction is thought to be approximately 8.68 MeV. The presence of helium in the fusion chamber was shown in part by a still image captured by a high-speed video camera of the interior of the chamber of the embodiment of the device. A boron target was placed in the chamber and a supply of hydrogen gas was introduced into the chamber. The still image was obtained by applying an optical filter centered at 587.5 nanometers, which is a wavelength in the strong emission spectrum of helium when excited by high energy particles. The captured image is provided in FIG. 6. This image was captured at t=10.74 ms after initiating a high voltage pulse in the discharge rod, e.g., inner electrode, in the chamber, thereby stimulating hydrogen-boron interaction in the chamber. The presence of helium in the chamber as shown by FIG. 6 demonstrates that a plasma of ions and neutrals is created by the hydrogen gas, which is caused to rotate within the cylindrical chamber by the electric and magnetic fields at acceleration levels sufficient to cause fusion between particles in the plasma and the Boron target in the chamber, in accordance with the equation H+11B→3 4He+++8.7 MeV. Thus, FIG. 6 shows helium neutrals created as a result of hydrogen-boron interactions. The creation of high-energy alpha particles was also shown by the presence of micro-etching on the inner surfaces of the device components, which for example is shown in the photograph of FIG. 7. Further, the creation of high-energy alpha particles was evidenced by the observed impacts on and ultimate destruction of a foil detector 801 located near to the fusion chamber 802. The foil detector 801 is made up of two sheets of aluminum foil, the first having a thickness of 1.2 μm, and the second having a thickness of 0.8 μm. The energy required to penetrate or significantly deform these foils with a single particle is at least about 2 MeV. FIGS. 8A to 8F are a series of photographs of the foil detector 801 over an 8.25 millisecond time period showing the detector before any detectable impact (FIG. 8A) through various impacts during the fusion reaction (FIGS. 8B through 8D) through destruction (FIG. 8E) and being completely gone from its frame (FIG. 8F). The direction of broken pieces of aluminum foil is downward and toward the rotating hydrogen, consistent with the rotation of the hydrogen atoms in the central generation region. The method and device of Example 1 is operated at a sufficient magnetic field and voltage to provide at least about 250 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 25 MW of electricity. Ten devices of the type of Example 1 are operated together to provide in combination to provide at least about 2,500 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 250 MW of electricity. Fewer or more of these devices may be combined to provide greater thermal energy, to provide backup units should one go offline, which assembly can be associated with heat conversion devices known to those in the art. The method and device of Example 1 is operated at a sufficient magnetic field and voltage to provide at least about 10,000 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 1,000 MW of electricity. The method and device of Example 1 is operated at a sufficient magnetic field and voltage to provide at least about 5 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 500 kW of electricity. One or more of the devices of Example 1 may be combined to provide greater thermal energy, to provide backup units should one go offline, which assembly can be associated with heat conversion devices known to those in the art. The method and device of Example 1 is operated at a sufficient magnetic field and voltage to provide at least about 0.1 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 10 kW of electricity. One or more of the devices of Example 1 may be combined to provide greater thermal energy, to provide backup units should one go offline, which assembly can be associated with heat conversion devices known to those in the art. The operation of the device along the lines of Example 1 was repeated over 400 times. Each time the evidence of the creation of helium and high energy alpha particles was observed. An embodiment of a controlled fusion device generally of the type of the embodiment shown in FIG. 3, has a rare earth magnet. An embodiment of a controlled fusion device is of the general type of the embodiment shown in FIG. 3, has an electromagnet. An embodiment of a controlled fusion device is shown in FIGS. 9A and 9B, with FIG. 9A being an axial cross sectional view and FIG. 9B being a transverse cross sectional view. This embodiment has an outer electrode 901 and a concentric inner electrode 903, with localized axial magnetic fields 904 generated within the annular space between the two electrodes 901, 903. The magnetic fields are generated by current-carrying coils 902 placed axially adjacent to either side of the region 905 in which rotation is to be incited, and operated such that the magnetic field generated by each pair of coils 902 is oriented in the same axial direction (e.g., arrow B). Thus, in this embodiment, the magnetic fields generated by the coil pairs extends parallel to the central axis in the region of interest between the two electrodes, inducing rotation of the plasma. This embodiment may have advantages for large-scale applications, such as large-scale electrical power generation units. The method and device of Example 4 is operated at a sufficient magnetic field and voltage to provide at least about 250 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 25 MW of electricity. Ten devices of the type of Example 4 are operated together to provide in combination to provide at least about 2,500 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 250 MW of electricity. Fewer or more of these devices may be combined to provide greater thermal energy, to provide backup units should one go offline, which assembly can be associated with heat conversion devices known to those in the art. The method and device of Example 4 is operated at a sufficient magnetic field and voltage to provide at least about 10,000 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 1,000 MW of electricity. The method and device of Example 4 is operated at a sufficient magnetic field and voltage to provide at least about 5 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 500 kW of electricity. One or more of the devices of Example 4 may be combined to provide greater thermal energy, to provide backup units should one go offline, which assembly can be associated with heat conversion devices known to those in the art. The method and device of Example 4 is operated at a sufficient magnetic field and voltage to provide at least about 0.1 MMBtu/hour of thermal energy. This thermal energy is converted by apparatus known to those of skill in the power and electrical generation arts, such as heat exchangers, steam turbines, and electrical generators, to provide at least about 10 kW of electricity. One or more of the devices of Example 4 may be combined to provide greater thermal energy, to provide backup units should one go offline, which assembly can be associated with heat conversion devices known to those in the art. In an embodiment of a controlled fusion device, as shown in FIG. 10, material is accelerated azimuthally by means of using electrodes e.g., 1001 to generate localized electric fields, e.g., 1002 within the annular space 1003 in which the material is rotating. The electric fields are oscillated to accelerate the material in the intended direction (much as a Maglev train is propelled by oscillating magnetic fields in the track). Inner electrodes (inner surface of annular space 1003) are mounted on support 1005 and outer electrodes (outer surface of annular space 1003) are on support 1004. Some ions are present in the rotating material, because neutral atoms will not experience direct force as a result of electric fields, but a relatively small number of ions are sufficient to drive neutrals through the principle of ion-neutral coupling. This system does not require an axial static magnetic field. A controlled fusion device of the general type shown in the embodiment of FIG. 3, is operated to provide a controlled fusion reaction that produced high-energy alpha particles and helium. The first working material in the device is hydrogen. The second working material in the device is lithium. The magnet provides a magnetic field of 0.5 Tesla to the internal components of the controlled fusion device. The controlled pressure chamber is purged. After purging, the controlled pressure chamber and fusion cavity are filled with hydrogen gas to about 3 torr and at ambient temperature. A voltage of about 1.4 kV is applied through a current-limiting resistor to the inner electrode, creating a plasma current of about 25 A, which imparts, due to the Lorentz force created by the magnetic field and current, an initial or preliminary rotation believed to be about 800 to 2,000 RPS. After the initial rotation is established, a pulse of about 400 V to 1 kV between the outer and inner electrodes creates a plasma current of up to about 43 kA, which creates a weakly ionized plasma having a ratio of ions to neutrals believed to be about 1:100,000; and which imparts a rotation to the weakly ionized plasma (ions and neutrals) of at least about 100,000 RPS. The rotation of the weakly ionized plasma is maintained for about 10 milliseconds, wherein fusion reactions take place. In an embodiment of a controlled fusion device, the second working material consists of multiple materials in solid form, as shown in FIG. 11. One material, elemental boron 1101, is arranged in a composite structure with a second material, barium oxide 1102. Elemental boron is selected to provide a source of boron necessary for the reaction of hydrogen-1 and boron-11 (the first working material is hydrogen). It is desirable for the second working material to be an efficient electron emitter in order to create a strong electron shielding effect, which lowers the Coulomb barrier and increases the rate of fusion. Elemental boron is a less efficient electron emitter; barium oxide is an efficient electron emitter. In this manner, the composite has a synergistic effect of combining the benefits or greater benefits of each material. By constructing the second working material to include both a fusion reactant and an efficient electron emitter, a strong electron shielding effect is created. Further, in addition to a layered structure as shown in FIG. 11, it is contemplated that other arrangements of differing materials to obtain this synergistic benefit may be used, including for example microstructures, nanoparticles, matrices, and mixtures. In an embodiment of a controlled fusion device, an ion cyclotron resonance device which utilizes the ponderomotive force to amplify the nuclear magnetic moment potential is associated with the controlled fusion device. The ion cyclotron resonance device includes a microwave source producing electromagnetic radiation at a frequency of 2.45 gigahertz (GHz). The magnetic field present in the controlled fusion device is tuned such that, at the point where the microwave source is introduced, the cyclotron frequency of an electron matches the frequency of the microwave source. This excites the electrons in the controlled fusion device, increasing their radius of gyration about the magnetic field lines. A second frequency is layered on top of the 2.45 GHz microwave signal to create amplitude modulation, phase modulation, or both. This causes the excited electrons to become more and less excited at the second frequency. The second frequency is selected such that it matches the ion cyclotron frequency of hydrogen-1 ions present in the first working material in the region of the controlled fusion device where rotation is being induced. Cyclotron frequency is given by: f c = qB 2 π m where q is absolute value of the charge of the particle or ion, B is magnetic field strength, and m is the mass of the particle or ion. Since q is equal for an electron and a hydrogen-1 ion but m is several orders of magnitude greater for a hydrogen-1 ion, at a given value of B hydrogen-1 has a cyclotron frequency that is several orders of magnitude less than an electron's cyclotron frequency. In the embodiment, the cyclotron frequency of the hydrogen-1 ions in the region of the controlled fusion device where rotation is being induced is believed to be approximately 7.6 megahertz (MHz). The electrons are used to transfer this second frequency to the hydrogen-1, causing them to become excited, and increasing their radius of gyration about the magnetic field lines. As a result, the total angular momentum of the hydrogen-1 is increased. The direction of gyration of hydrogen-1 ions and atoms tends to be aligned, and so the nuclear magnetic moment potential is amplified. In FIG. 12, there is shown a perspective cross-sectional view of an embodiment of a controlled fusion device 1200. The embodiment is similar to the embodiment depicted in FIG. 2, with the notable exception that the inner electrode 1202, outer electrode 1203, controlled pressure chamber 1205, and magnet 1206 are in the shape of tori, as opposed to cylinders. These tori can be open or closed. A working gas inlet line 1201 is inserted through the magnet 1206 and controlled pressure chamber 1205, and into the annular space between the inner electrode 1202 and the outer electrode 1203. A fusion chamber 1207 is positioned within the magnetic field of the magnet 1206. A fusion surface 1208 is associated with the controlled pressure chamber 1205. In an embodiment of a controlled fusion device, the controlled fusion device is used for formation of material. The formation is accomplished by transmutation, whereby hydrogen-1 and lithium-6 undergo a fusion reaction to create helium-3 and helium-4. Helium-3 is a highly valuable isotope used for neutron detection, medical imaging, and cryogenics. In the embodiment, hydrogen is the first working material, and lithium fluoride, whereby the lithium is enriched in lithium-6, i.e., contains a higher proportion of lithium-6 than natural abundance, is the second working material. The controlled fusion device is operated, and gas is subsequently removed from the controlled pressure chamber. The gas contains helium-3, and can be subsequently separated to obtain high-purity helium-3 suitable for use. In an embodiment of a controlled fusion device, the controlled fusion device is similar to the embodiment depicted in FIG. 2. A difference is that a modification is made to enhance the emission of electrons by the boron plates, which is explained below, thus strengthening the electron shielding effect. A magnified view of a portion of the outer electrode 1301 and a boron plate 1302 is shown in FIG. 13. In the embodiment, a heating coil 1303 is added to the section of the outer electrode 1301 directly opposite the boron plate 1302. The boron plate 1302 is composed of lanthanum hexaboride, which is an excellent emitter of electrons when heated. The heating coil 1303 is activated immediately prior to and during incitement of rotation in the controlled fusion device, causing heat to be transferred through the outer electrode 1301 to the boron plate 1302. The heating of the boron plate 1302 induces the emission of electrons, and causes the resulting electron cloud to be denser than it otherwise would without the use of the heating coil 1303. This in turn increases the electron shielding effect, which reduces the Coulomb barrier and increases the rate of fusion. In an embodiment of a controlled fusion device, the controlled fusion device is similar to the embodiment depicted in FIG. 2. A difference is that a modification is made to enhance the electron shielding effect, which is explained below. A microscopic view of the inner surface 208 of the outer electrode 1401 is shown in FIG. 14. Carbon nanotubes 1402, which are efficient electron emitters, are adhered to the outer electrode 1401. During operation of the device, the presence of thermal energy, electromagnetic radiation, high energy particles, or electric fields induce emission of electrons by the carbon nanotubes 1402. Because the inner surface 208 of the outer electrode 1401 is the fusion surface, the electron emission is localized to the area where fusion is anticipated to be concentrated. This is ideal for creating or enhancing the electron shielding effect, which in turn lowers the Coulomb barrier and increases the rate of fusion. In an embodiment of a controlled fusion device, the controlled fusion device is similar to the embodiment depicted in FIG. 3. In this embodiment the first working material is helium-3 gas (instead of hydrogen gas in the preferred embodiment of FIG. 3), and the second working material is composed of deuterium oxide, a liquid commonly called “heavy water.” The boron plates 305a and 305b are not necessary, and the heavy water is located along the inner surface 312 of the outer electrode 304. During operation of the device, rotation causes the heavy water to form a ring across the entire inner surface 312 of the outer electrode 304. Fusion reactions between the helium-3 in the first working material and the deuterium in the second working material result in a release of energy, which can be subsequently captured and used for electricity generation, heating, or other useful purposes. In an embodiment of a controlled fusion device, a method of reducing the Coulomb potential, and increasing the cross section of a fusion reaction includes the introduction, modification, enhancement, or control of a negative electrical potential; including means of generating and controlling electrons present in the working volume of a controlled fusion system. A controlled fusion device utilizing this method and effects is provided in the schematic diagram of FIG. 16. In this device, the controlled fusion device 1600 has a first working material 1602 and a second working material 1604 associated with it. The controlled fusion device 1600 has a chamber 1601 having a wall 1606 and cavity 1605. Associated with the chamber 1601 is an electron emitting material 1603. Additionally associated with the device is a source of energy 1607 to induce electron emission from material 1603. The electron emitting material 1603 may include boron nitride, lanthanum hexaboride, or other efficient electron emitters. The emitting material 1603 may be a compound, matrix, coating, bulk material, or of other construction. The source of energy 1607 may include, but is not limited to including, photons, ions, accelerated particles, electric fields, magnetic fields, heat, radiation, resistive heating etc. Thus, by way of example, a source of accelerated particles may be associated with the controlled fusion device 1600 wherein the particles are in part, or wholly, directed towards the electron emitter 1603. Further, by way of additional example, a source of photons may be associated with the controlled fusion device 1600 wherein the photons are in part, or wholly, directed towards the electron emitter 1603. In an embodiment of a controlled fusion device, ions may not be required. Thus, in this embodiment the controlled fusion device is preferably ion-free, although its benefits may still be obtained with the presence of some ions. Thus, a controlled fusion device utilizing photon pressure as the rotation source is shown in FIG. 15. The controlled fusion device 1500 has a first working material 1503 and a second working material 1502 associated with it. The controlled fusion device 1500 has a rotation chamber 1501 having a rotation chamber wall 1505 and cavity 1506. Associated with the rotation chamber 1501 is a source of photons 1504. In this example, photons from source 1504 impinge the first working material 1503. The interaction of the photons with the material imparts a force to the working material 1503. This force can be substantively directed in a predetermined direction. This “photon pressure” can be used to accelerate the first working material 1503 substantially azimuthally to induce rotation of the kind desirable for controlled fusion. The photon source 1504 can be a single source, a multitude of sources, or a multiply-directed energy from a single source. For example, an array of sources can be provided to induce rotation by placing the sources along the radius of the device 1501 with photons directed tangentially to a predefined working material path. The rotation induced by photon pressure will create an expansive pressure to the device wall 1505 and between the first working material 1503 and the second working material 1502, which can also be the same material. This pressure can induce or assist in the creation of a fusion event. Additionally, the photons in the system can provide a space charge emission of working material 1502, or an electron emitter associated with the fusion device 1500. Further, other embodiments in which rotation is induced for controlled fusion without reliance or without substantial reliance on the presence of ions are contemplated. In an embodiment of a controlled fusion device, the Coulomb potential may allow for quantum tunneling through the barrier. This tunneling probability is typically understood to be a function of the relative energy of the nuclei, where the higher the energy the higher the probability of tunneling. However, Coulomb potentials of a certain “shape” may allow for enhanced tunneling at relatively lower energies by a condition described as resonance. FIG. 17 depicts the resonance condition. 1701 is the incoming nucleus wavefunction, 1702 is the Coulomb potential of the system, 1703 is the decaying wavefunction or an evanescent wave of 1701, and 1704 is the portion of the wavefunction present past the Coulomb barrier. Because the shape of the Coulomb barrier 1702 and the energy of 1701 changes the shape of 1703, the decaying portion of the wavefunction, the shape of 1704 is influenced by both the Coulomb barrier and the energy of the system. At certain energies for a specific Coulomb barrier and a nuclear potential, the wavefunction may experience a resonant condition such that its “shape” allows for optimum transmission through the Coulomb barrier 1702. This condition may occur at less energy than would otherwise be required to achieve a given probability of tunneling. This resonance condition modifies the cross section of the reaction as depicted in FIG. 18. 1801 is the cross section of the reaction as a function of energy without the resonance condition. 1802 is a resonant peak which can be seen to increase the cross section of the reaction at certain energies in the center-of-mass reference frame. Thus, for example, the aforementioned methods and devices can be used to control the Coulomb potential as well as the energy of the reaction system to achieve, control, modify, or induce a resonant condition of tunneling. In an embodiment of a controlled fusion device, a variety of geometries and orientations may be utilized. By way of example, FIG. 19 depicts a micro-reactor 1900 which operates on the principles described herein. In this embodiment the rotation source is electromagnetic and operates based on a resonance. This device includes a reaction chamber 1901, a chamber wall 1902, a first working material 1903, a second working material 1904, and a cavity 1905. The geometry of this cavity and chamber is important to this embodiment, and will at present, by way of example, be described by a characteristic dimension L 1906. Electromagnetic radiation has a wavelength associated with it. There can be set up a source of electromagnetic radiation 1907 whereby the wavelength and characteristic dimension 1906 are selected to have a specific relationship. The result of this selection criteria can be a resonating wave present in the cavity 1904. Specifically, this wave may rotate azimuthally such that, when interacting with charged particles present as part of, or in addition to, a working material, one or more working materials are accelerated substantially azimuthally. This embodiment allows for reactor dimensions of significant variation, including, but not limited to, reactors smaller than previously envisioned in the art on the scale of centimeters of characteristic length. In some embodiments the source of electromagnetic radiation may be a microwave generator. In some embodiments, there may be a plurality of sources. In some embodiments multiple resonant frequencies may be established within a given cavity. Further, there are envisioned embodiments where the resonant frequency is adjusted during operation, or tuned, so as to induce optimum fusion conditions. In an embodiment of a controlled fusion device, the controlled fusion device is similar to the embodiment depicted in FIG. 3. Thus, as illustrated in FIG. 20 a laser 2001 is added and connected to an optical fiber 2002 which is run through insulation 2003 surrounding the inner electrode 2004. The optical fiber 2002 is terminated at a point 2005 near a plate 2006a. The end of the fiber 2002 is oriented such that the light coming out of it is directed toward the plate 2006a. The plate 2006a includes a photoemissive compound. When the laser 2001 is turned on, the light incident on the plate 2006a causes it to emit electrons, and causes the resulting electron cloud to be denser than it otherwise would without the use of the laser 2001. This in turn increases the electron shielding effect, which reduces the Coulomb barrier and increases the rate of fusion. The device has a second plate 2006b with a flue material, a gas puff inlet 2010 an outer electrode 2007, and a pressure control vessel 2008, and a magnet 2009. A second fiber and beam launch can also be used to direct the laser beam to the plate 2006b. In an embodiment of a controlled fusion device, the controlled fusion device is similar to the embodiment depicted in FIG. 3. Thus, as illustrated in FIG. 21, the boron plates 305a and 305b are preferably removed, and are replaced by two wires 2101 and 2102 run axially through the controlled fusion device into the annular space between the inner electrode 2103 and the outer electrode 2104, with boron coatings 2105 and 2106 covering the wires 2101 and 2102 in the axial section of the controlled fusion device where the inner electrode is uninsulated 2107. Since the boron coatings 2105 and 2106 are located some distance radially inward from the inner surface 2108 of the outer electrode 2104, fusion reactions will tend to be concentrated in a region located more radially inward than in the embodiment depicted in FIG. 3. This may be advantageous, because the energy of particles may be greater in the vicinity of the boron coatings 2105 and 2106 than along the inner surface 2108 of the outer electrode 2104, where the growth of a boundary layer may dampen particle velocities. Higher particle energies tend to correspond to higher rates of tunneling, leading to elevated rates of fusion. The embodiment has a controlled pressure housing 2112, and a magnet 2113. Turning to FIG. 22, there is provided a schematic of a controlled fusion device and energy utilization assembly. This configuration 2200 has a fusion device 2200 having a DC-AC power supply 2205, an a gas input line 2204, a power cable 2206, a discharge rod 2202, which has an insulation covering 2203. The discharge rod 2202 extends into the fusion device beyond the insulation covering 2203 and into the gas rotation area 2220. Within the gas rotation area 2220 are the Boron targets 2217, 2219, and a Boron target 2218, mechanically associated with a control arm 2210. The fusion device has an outer electrode 2201, and a magnet 2216. In this embodiment the energy utilization assembly 2260 is located inside the fusion device pressure control structure, and just outside of the outer electrode 2201, and directly adjacent to the gas rotation area 2220. The fusion device also has a camera 2209, a vacuum pump 2207 and valve 2208. A sample and analysis assembly is also provided with this embodiment. This assembly has a valve 2211, an analysis chamber 2212, a pump 2213, a valve 2214 and an RGA (residual gas analyzer) 2215. The analysis chamber may have a pressure of 10−5 torr. In this embodiment, the energy utilization assembly can be a heat exchanger that utilizes a working fluid such as water, high pressure water, liquid sodium, steam, or other heat exchanging media known to the art. The heat exchanger may be channels positioned on the inner surface of the outer electrode, within the walls of the outer electrode, or along the outer surface of the outer electrode, including for example jackets, coils, counter-current mechanisms. Additionally, the working fluid may be a charged fluid, or have a charge associated with it, which facilitates the utilization of the magnetic and electric fields present within the device to provide motive forces to the working fluid to enhance heat exchanging efficiencies. Further, this embodiment, as well as the embodiments of the other examples and figures set forth in this specification generally, and preferably, may have a control circuit which may, in whole or in part, be operated by a system of controllers and computers, and which may have remote access as well. Thus, for example, the control system may be a distributed control network, a control network, or other types of control systems known to those of skill in the art for controlling large plants and facilities, and individual apparatus, as well as combinations and variations of these. Further, this control system in a more preferred embodiment may be integrated with, or otherwise associated with, an enterprise data system, such as, for example, SAP. The control system may control any and all parameters of the fusion reaction, the heat energy gathering or utilization processes, and conversion to electrical or other useful forms of energy. Preferably, the control system maintains a predetermined and preselected balance between heat generation and heat extraction. Thus, for example, to maintain this predetermined and preselected balance, the control system may modulate the electrical pulses, e.g., lengthening or shortening the time period between each pulse, changing the voltage applied to create the plasma, changing the magnetic field, for example, with an adjustable magnet in conjunction with a superconducting magnet, and changing the density of the reactants. This embodiment may also have similar types of heat exchanging apparatus associated with the inner electrode. It should further be understood that these various heat exchanging and capturing systems may be utilized with other embodiments of the controlled fusion devices, in addition to those using electrical discharge to create a plasma. Turning to FIG. 23, there is provided a schematic of a controlled fusion device and direct energy conversion assembly. This configuration 2300 has a fusion device 2300 having a DC-AC power supply 2305, an a gas input line 2304, a power cable 2306, a discharge rod 2302, which has an insulation covering 2303. The discharge rod 2302 extends into the fusion device beyond the insulation covering 2303 and into the gas rotation area 2320. Within the gas rotation area 2320 are the Boron targets 2317, 2319, and a Boron target 2318, mechanically associated with a control arm 2310. The fusion device has an outer electrode 2301, and a magnet 2316. In this embodiment the energy utilization assembly, e.g., a direct energy conversion assembly 2350, is located inside the fusion device pressure control structure, and just outside of the outer electrode 2301, and away from (down stream from) the gas rotation area 2320. The fusion device also has a camera 2309, a vacuum pump 2307 and valve 2308. A sample and analysis assembly is also provided with this embodiment. This assembly has a valve 2311, an analysis chamber 2312, a pump 2313, a valve 2314 and an RGA (residual gas analyzer) 2315. The analysis chamber may have a pressure of 10−5 torr. In this embodiment, the direct energy conversion assembly may include a metallic or other electron-motive material: in the shape of a plate, rod, cylinder, sectional components of a cylinder, and the like; electrically-conductive coils that are positioned adjacent the likely path of charged high-energy particles created by the fusion reaction, so that a current may be directly induced as the charged particles are collected. Further, although not shown in the Figure, such devices may also be located at the axial end of the fusion reaction region or chamber. For example, in embodiments utilizing the fusion reaction that creates alpha particles, the alpha particles lose energy by ionizing materials in the direct energy conversion assembly, producing free electrons that carry electrical current. In other embodiments, charged particles may be directed into a beam by use of electric or magnetic fields, or a combination of both, producing a direct current. In another embodiment of a controlled fusion device, a direct energy conversion assembly includes an array of semiconductor PN junctions. The PN junctions create a depletion layer that creates regions having an electric field gradient. Charged particles, such as alphas created in a fusion reaction, or electromagnetic radiation, or both, interact with the semiconductor material, producing electron-hole pairs in the vicinity of the electric field gradient. As the electrons and ions are accelerated toward the edges of the depletion layer, a current is created. In another embodiment of a controlled fusion device, a direct energy conversion assembly includes an assembly for utilizing high-energy charged particles to generate an electric current. For example, using the alpha particles generated via the hydrogen-boron reaction discussed above, the alpha particles may be directed from the fusion reaction region to a region having a first plate and a second plate separated by a readily ionizable material. Thus, in this manner, as the directed alpha particles pass through this readily ionizable material, electrons and positive ions are created. The electrons migrate to the first plate, the positive ions migrate to the second plate, creating a potential that then results in the flow of a current when the plates are electrically connected. For example, the first plate may be made from a low work function material such as magnesium, and the second plate may be made from a high work function material such as gold, and the readily ionizable material may be argon gas. Further, the ionizable material may be in the form of a gel, thus simplifying the need to contain the ionizing material in the direct energy conversion region. Additionally, the first plate, second plate, and readily ionizable material may be combined into a solid multi-layered semiconductor structure capable of surviving the alpha impacts and generating a potential between layers within that multi-layered structure. In an additional embodiment, the controlled fusion device may have its axis in a vertical or essentially vertical position with the opening having the alphas exiting therefrom, pointing downwardly toward a container having a gel or a liquid which serves as the ionizable material. In this manner, containment of the readily ionizable material may be accomplished without the need for any membrane or other member that permits the transmission of alpha particle while having the readily ionizable material adjacent or in the low pressure containment area of controlled fusion device. FIG. 24A shows a controlled fusion device 2400 comprising a source of radiation 2401, a first working material 2404, a radiation target 2403, a second working material 2402, and a cavity 2405. The radiation 2401 impinges on the radiation target 2403 generating the first working material 2404. The radiation may be a laser, ion beam, pulsed radiation source, and more. The radiation target may be a metallic foil, a polymer, and more. The first working material may be protons, ions, or other desirable reactants and materials. The first working material is made to move in the direction of the second working material 2402. The energy of the first working material may be greater than 1 eV, greater than 100 eV, greater than 1 keV, greater than 100 keV, greater than 1 MeV, or greater than 10 MeV. FIG. 24B shows the controlled fusion device of FIG. 24A, to which a third working material is added. The controlled fusion device 2400 has a source of radiation 2401, a first working material 2404, a radiation target 2403, a second working material 2402, a cavity 2405, and a third working material 2406. The radiation 2401 impinges on the radiation target 2403 generating a first working material 2404. The radiation may be a laser, ion beam, pulsed radiation source, and more. The radiation target may be a metallic foil, a polymer, and more. The first working material may be protons, ions, or other desirable reactants and materials. The first working material is made to move in the direction of the third working material 2406. The motion of the first working material is coupled to the third working material which is made to move in the direction of the second working material 2402. The energy of the first working material may be greater than 1 eV, greater than 100 eV, greater than 1 keV, greater than 100 keV, greater than 1 MeV, or greater than 10 MeV. In an embodiment of a controlled fusion device, the controlled fusion device is of the general type depicted in FIG. 3. Thus, a plurality of boron structures positioned on the wires may form a shell of boron shell of boron compounds between the inner electrode and the outer electrode. Embodiments of the present controlled fusion devices can be relatively compact and small. This enables to placement of these devices in many applications where size is an issue. It also permits several of these smaller devices to be utilized together to provide the requisite amount of power needed. These devices can essentially be small and compact, for example, about the size of a small refrigerator, a bag of golf clubs, a suitcase, a few feet by a few feet, one square foot or less, e.g., the size of a large can of coffee. Thus, turning to FIG. 25 there is shown a perspective view of an embodiment of a tabletop controlled fusion device 2500. The device 2500 is mounted on a table 2501 (2 feet by 2 feet). The device 2500 has two magnet holders 2503, 2502 at the axial ends of the device. Each magnet holder holds a magnet 2509, 2508. Between the magnet holder 2503, 2502 there is an assembly to contain the rotating gas, this assembly has two outer cover flanges 2512, 2511 that are attached to the axial ends of a housing 2510. The housing 2510 and flanges 2512, 2511 form the cavity 2506 where the gases rotate. The inner surface 2507 of housing 2510 is the surface where the fusion process primarily takes places. The housing 2510 also serves as the outer electrode. The inner electrode 2504 has a discharge head 2505. Additionally, mounts 2524 and 2517 hold the assembly. Each mount has a bottom arm 2524a, 2517a, and a top caps 2524b, 2517b, respectively. Gas inlet line 2515 has opening 2515a and gas outlet 2516 has an outlet opening (not shown). Cooling water circulation lines, inlet 2514, outlet 2513 are provided so that water can be circulated around housing 2510. FIG. 25B is a cross section of the embodiment of FIG. 25, and FIG. 25C is an exploded view showing the components of the embodiment of FIG. 25. The device of example 24 is fueled with fusion materials to provided for aneutronic fusion, and is used to power an electric automobile. The embodiment of FIG. 25, is made larger than the device of FIG. 24, and is fueled to provide for neutronic fusion and the generation of neutrons. The device is used in a medical device to provide for a controlled and targeted beam of neutrons for the treatment of medical conditions. The embodiment of FIG. 25, is made smaller, having an outer diameter of less about 6 inches, and is fueled to provide for neutronic fusion and the generation of neutrons. The device is incorporated in to an oil and gas exploration (e.g., drilling for oil) down hole logging and measuring tool (often referred to as LWD, MWD, and LMWD). The generated neutrons from the device are used for analytical purpose to evaluate the nature of the formation associated with a borehole. The low amount (zero in some embodiments) of power that is required for the generation of neutrons with the device provides substantial benefits especially when measuring or logging very deep (or long) boreholes, e.g., over 10,000 feet, by not requiring the substantial power losses in the transmission of electricity down hole to have to be overcome. In the embodiment of this example a microwave source is used to help start the rotation of the gases (weakly ionized gases). In this manner the microwave source requires less power than the use of a current to initially get the rotation of the gases starting, and thus, the use of the microwave generator provide for a better, e.g., more efficient, energy balance. Thus, turning to FIG. 26 there is shown a perspective view of an embodiment of a tabletop controlled fusion device 2600. The device 2600 is mounted on a table 2601 (1 feet by 2 feet). The device 2600 has two magnet holders 2603, 2602 at the axial ends of the device. Each magnet holder holds a magnet 2609, 2608. Between the magnet holder 2603, 2602 there is an assembly to contain the rotating gas, this assembly has two outer cover flanges 2612, 2611. Flange 2612 is attached to the axial end of housing 2610. Flanged microwave delivery assembly 2650 is attached to the other end of housing 2610, and flange 2611 is attached to the assembly 2650. The microwave source 2651 is attached to assembly 2650. The housing 2510, the assembly 2652, and flanges 2612, 2611 form the cavity where the gases rotate. The inner surface of housing 2610 is the surface where the fusion process primarily takes places. The housing 2610 also serves as the outer electrode. The inner electrode 2604 has a discharge head. Additionally, mounts 2624 and 2617 hold the assembly. Each mount has a bottom arm 2624a, 2617a, and a top caps 2624b, 2617b, respectively. Gas inlet line 2615 has opening 2615a and gas outlet 2616 has an outlet opening (not shown). Cooling water circulation lines, inlet 2614, outlet 2613 are provided so that water can be circulated around housing 2610. A device of the general type shown in FIG. 3 was used to conduct fusion interactions. FIG. 27 shows the current and voltage that is applied to the device to rotate the gases. Thus, line 2702 shows the voltage across the electrode over time in ms. Line 2701 shows the pulse current in amps over time. The two lines show the relationship of CW voltage and current during the pulse. Point (A) on the graph of FIG. 27 corresponds to FIG. 27A, point (B) on the graph of FIG. 27 corresponds to FIG. 27B, point (C) on the graph of FIG. 27 corresponds to FIG. 27C, point (D) on the graph of FIG. 27 corresponds to FIG. 27D, point (E) on the graph of FIG. 27 corresponds to FIG. 27E, and point (F) on the graph of FIG. 27 corresponds to FIG. 27F. FIGS. 27A to 27F are schematic representations of photographs that were taken within the rotating gas cavity of the fusion device. FIG. 27A shows that no reaction is taking place, the weakly ionized gas is spinning by the applied voltage and the pulse is only beginning to be applied. FIG. 27B shows that fusion products are beginning to be formed, and as the pulse increases through points C and D the fusion reaction products are additionally increased. As the pulse stopped, e.g., current lowered, points E and F, the fusion reaction and production of fusion products continues. A device of the general type shown in FIG. 3 was used to conduct fusion interactions. FIG. 28 is a graphic representation of He I neutrals emission 2801 observed using a filter centered at 587.5 nm (±2.5 nm FWHW), at time 10.7 ms. shows the current and voltage that is applied to the device to rotate the gases. A device of the general type shown in FIG. 3 was used to conduct fusion interactions. FIG. 29 is a graphic representation of He I neutrals emission observed using a filter centered at 587.5 nm (±2.5 nm FWHW), at time 10.7 ms. The fusion products and weakly ionized gases 2901 have been calculated at 2.52×106 m/s, fusion products and weakly ionized gases 2902 have been calculated at 1.63×106 m/s, fusion products and weakly ionized gases 2903 have been calculated at 1.15×106 m/s, and fusion products and weakly ionized gases 2904 have been calculated at 9.95×105 m/s. FIGS. 30 and 31 show the intensity of He emissions with and without boron targets. The efficacy and utility of energy storage and generation devices are often discussed in terms of specific energy and specific power. It is highly desirable to have a simultaneous high specific energy and high specific power. It may also be desirable to have a predetermined specific energy and specific power. Specific energy is typically measured in J/kg, or J/L (volumetric) while specific power is typically measured in W/kg or W/L. These values indicate the total energy production, and the energy production rate, for a system of a given size. Typical values seen for specific energy vary from 10−8 J/kg for supercapacitors to 108 J/kg (106 J/L) for compressed hydrogen. Typical values of specific power vary from 1 W/kg to 104 W/kg. However, prior to the present invention, specific energies and powers (or the combination therein) above certain levels have been untenable. Further, while, for example, a rocket engine may have a relatively high specific power, it cannot be scaled to smaller or larger sizes with ease. Thus, it is here envisioned that a controlled fusion device is capable of producing specific powers and specific energies according to the following table. SpecificSpecificSpecificSpecificExampleEnergy (J/kg)Energy (J/L)Power (W/kg)Power (W/L)A106103102102B10141015108106C108109105103D1010107106104 In this embodiment the spinning of the weakly ionized plasma in the device can be obtained by wave particle trapping. In general, a circular electromagnetic wave is induced in the device, near to, and preferably, directly adjacent the inner wall. The ionized particles couple to this circular wave, and move around the device, brining the neutral particles with them. In this manner the high speed spinning of the weakly ionized plasma in the device can be accomplished without the need for a magnetic filed. Thus, using want is theorized to be the underlying principles of nonlinear-wave-particle trapping and ion-neutral coupling in a three-component plasma system consisting of positive ions, negative ions, and neutral molecules (neutrals) the requisite conditions can be obtained for a fusion interaction of the particles. The resulting collective phenomena are much richer and more diverse than the sum of their parts. Typically unstable ions are kept stable, oppositely charged particles are kept separate in wave potential troughs, and very high overall density is attained without limitations by space charges. Collisions between neutrals and ions allow the control of a high-density medium by electromagnetic fields. These phenomena apply to both gasses and liquids. Waves are manifestations of the collective motion of particles and possess energy and momentum. As particles, wave packets can be excited and pointed in a preferred direction. The use of waves with negative and positive ions has not been thoroughly investigated, especially in the regime where ions and neutral molecules coexist in various concentrations. A traveling electric wave with precisely aligned phase velocity can accelerate positive ions, negative ions, and neutrals to high speeds. Over 1.5 seconds, or 9×106 periods, using a 100V 6 MHz electric wave, the neutrals accelerate to more than 9000 meters per second. It is important to note that, while the velocity of the negative and positive ions each appear to have high negative values in areas, these areas correspond to the lowest densities of these ions. Similarly, the areas with the highest positive velocities of negative ions, positive ions, and neutrals correlate to the areas with the highest particle densities. As such, the net momentum of negative ions, positive ions, and neutrals are each in the forward direction. These simulations demonstrate that, based upon accepted theory, neutrals can be accelerated by an electric wave when coupled with ions, negative and positive ions are kept separate when coupled with neutrals, and that potential wells and troughs can be used to accelerate alternating groups of negative and positive ions. The examples above are meant to be a sample of the possibility space. Additionally, it should be understood that the boundary at which the specific energy or specific power is calculated may vary according to the type of system. The various embodiments of energy utilization assemblies and direct energy conversion assemblies may be used individually or collectively on or in association with various controlled fusion devices. Thus, for example, to increase the overall energy conversion efficiency of the device, and to protect components of the device from thermal damage, direct energy conversion assemblies may have energy utilization assemblies associated with them. Similarly, energy utilization assemblies may have, preferably on their surfaces, direct energy conversion assemblies. In this manner, and preferably, all usable surfaces and areas where heat transfer or capture of high-energy particles in the controlled fusion device may be utilized. The various embodiments of devices, methods and systems set forth in this specification may be used for various operations, other energy production, including the formation of materials. Additionally, these embodiments, for example, may be used with systems and operations that may be developed in the future; and with existing systems and operations that may be modified, in-part, based on the teachings of this specification. Further, the various embodiments set forth in this specification may be used with each other, in whole or in part, and in different and various combinations. Thus, for example, the configurations provided in the various embodiments of this specification may be used with each other; and the scope of protection afforded the present inventions should not be limited to a particular embodiment, configuration or arrangement that is set forth in a particular embodiment, example, or in an embodiment in a particular Figure. The invention may be embodied in other forms than those specifically disclosed herein without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. |
|
description | This application is a divisional of U.S. patent application Ser. No. 11/045,748 filed Jan. 28, 2005 which claims priority under 35 U.S.C. §119 to Japanese Patent Application No. 2004-019681 filed on Jan. 28, 2004. The content of the applications are incorporated herein by reference, in their entirety. 1. Field of the Invention The present invention relates to an electron beam irradiation apparatus and electron beam irradiation method for irradiating electron beams and to an apparatus for and a method of manufacturing a disc-shaped object. 2. Description of the Prior Art Optical discs such as a CD (Compact Disc), a DVD (Digital versatile Disc), and the like have hitherto been utilized as optical information recording mediums. Over the recent years, however, there has been a progress of developing a blue semiconductor laser of which an oscillation wavelength is on the order of 400 nm. The development of a next generation high-density optical disc such as a high-density DVD, and the like capable of recording with a higher density than the general DVD, is conducted by use of this type of blue semiconductor laser. FIG. 13 shows an example of a prior art layer structure of this type of next generation high-density optical disc. This high-density optical disc is structured such that a recording layer 91 for recording information, a light transmitting layer 92 that transmits laser beams for recording and reproducing so that the laser beams get incident on the recording layer 91 and a protection layer 93 taking contact with a member on the side of an optical pickup into consideration, are stacked in this sequence on a substrate 90 composed of a resin material such as polycarbonate. The light transmitting layer 92 and the protection layer 93 are, when formed, irradiated with ultraviolet rays after being coated for curing. When especially the protection layer, etc. is formed of a material such as silicon compound, fluorine compound, etc. that exhibit radial polymerization double-bond, however, there might be a case in which a characteristic as the protection layer, etc. deteriorates unless a reaction initiator is added thereto in such a case, and the protection layer is hard to be cured by the irradiation of the ultraviolet rays, with the result that the protection layer having a sufficient quality can not be formed (refer to Japanese Patent Laid-Open Application Publication No.4-019839, Japanese Patent Laid-Open Application Publication No.11-162015, Japanese Patent Laid-Open Application Publication No.7-292470, Japanese Patent Laid-Open Application Publication No.2000-64042). For solving the problems inherent in the prior arts given above, the present inventors cooperating with other inventors proposed an electron beam irradiation apparatus and an electron beam irradiation method in Japanese Patent Application No.2002-274120, which are capable of efficiently irradiating electron beams, of which an acceleration voltage is on the order of 20 kV through 100 kV while rotating a disc substrate, exhibiting consequently greater energy than the ultraviolet rays have, and of easily curing the protection layer, etc. such as a lubricating layer, etc. that is hard to be cured by the irradiation of the ultraviolet rays. In this case, a plurality of electron beam irradiation tubes are disposed for irradiating uniformly the whole disc substrate with the electron beams. If the electron beam irradiation apparatus involves using the plurality of electron beam irradiation tubes, the apparatus increases both in weight and in size, an equipment cost rises because of the electron beam irradiation tube being comparatively expensive, and a running cost increases with a rise in amounts of consumption of an N2 gas for cooling and of electric power. A manufacturing cost increases due to these factors. It is an object of the present invention to provide an electron beam irradiation apparatus and an electron beam irradiation method that are capable of easily curing a material that is hard to be cured by irradiation of ultraviolet rays and of reducing the number of electron beam irradiation tubes to be used. It is another object of the present invention to provide an apparatus for and a method of manufacturing a disc-shaped object that are capable of forming a layer having functionability on the disc-shaped object efficiently and at a low cost by use of a material that is hard to be cured by the irradiation of the ultraviolet rays. An electron beam irradiation apparatus according to an embodiment comprises a rotary driving unit for rotationally driving an irradiation target object, a shield container for rotatably accommodating the irradiation target object, and an electron beam irradiation unit provided in the shield container so that the surface of the irradiation target object is irradiated with electron beams, wherein the electron beam irradiation unit and the irradiation target object are relatively moved when the electron beam irradiation unit irradiates the surface of the irradiation target object with the electron beams during a rotation of the irradiation target object. Herein, the relative movement described above does not imply a rotation of the irradiation target object. According to this electron beam irradiation apparatus, the surface of the non-rotating irradiation target object is irradiated with the electron beams, and it is therefore possible to efficiently irradiate the surface of the irradiation target object with the electron beams having greater energy than ultraviolet rays have. Hence, for example, it is feasible to cure a layer having functionability and using a material that is hard to be cured by the irradiation of the ultraviolet rays, and the electron beam irradiation unit can be constructed of, for instance, fewer electron beam irradiation tubes because of making the relative movements of the electron beam irradiation unit and the irradiation target object when performing such irradiation of the electron beams, thus enabling the number of electron beam irradiation tubes to be reduced. Herein, the term “functionability” implies lubricity, anti-static property, anti-fouling property, hardness, abrasion resistance, and so on. The following discussion will be made by exemplifying the lubricity. The electron beam irradiation apparatus can be constructed so that a width of the electron beam irradiation unit in a direction orthogonal to a rotating direction of the irradiation target object within a rotating plane of the irradiation target object, is smaller than a maximum distance from the center of rotation within the rotating plane of the irradiation target object. Namely, when the irradiation target surface of the irradiation target object takes a disc-like shape, even if the width of the electron beam irradiation unit in the direction orthogonal to the rotating direction of the irradiation target object within the rotating plane of the irradiation target object, is smaller than a radius of the irradiation target object, substantially the entire surface of the irradiation target object can be irradiated with the electron beams owing to the relative movements described above. Further, when the irradiation target surface of the irradiation target object takes a non-disc-like shape such as a polygonal shape, etc., even if the width of the electron beam irradiation unit in the aforementioned direction is smaller than a maximum distance (which is a maximum radius of a circle defined by a rotation within the rotating plane) from the center of the rotation within the rotating plane of the irradiation target object, substantially the entire surface of the irradiation target object can be irradiated with the electron beams owing to the aforementioned relative movements. Moreover, the electron beam irradiation apparatus can be constructed so that a rotating speed of the irradiation target object is changed corresponding to a position of the irradiation by the electron beam irradiation unit over the irradiation target object. In this case, the rotating speed of the irradiation target object is decreased when the electron beam irradiation unit irradiates an outer periphery side of the irradiation target object with the electron beams and is increased when irradiating an inner periphery side with the electron beams, whereby an electron beam absorbed dose of the irradiation target object can be set fixed irrespective of the position of the irradiation target object. Note that in this case, the electron beam irradiation apparatus can be constructed so as to move the irradiation target object with respect to the electron beam irradiation unit and may also be constructed so as to move the electron beam irradiation unit with respect to the irradiation target object. Furthermore, both of the electron beam irradiation unit and the irradiation target object may be moved relatively. Further, the electron beam irradiation apparatus can be constructed so that a moving velocity of the electron beam irradiation unit is changed corresponding to the position of the irradiation by the electron beam irradiation unit over the irradiation target object. For example, in the case of moving the electron beam irradiation unit with respect to the irradiation target object, the moving velocity of the electron beam irradiation unit is decreased when the electron beam irradiation unit irradiates the outer periphery side of the irradiation target object with the electron beams and is increased when irradiating the inner periphery side with the electron beams, whereby the electron beam absorbed dose of the irradiation target object can be set fixed irrespective of the position of the irradiation target object. The electron beam irradiation unit can be constructed of an irradiation window of a single electron beam irradiation tube. Note that the irradiation target object preferably takes the disc-like shape and is irradiated with the electron beams in a way that moves an irradiation target area on the irradiation target object sequentially in the radial direction of the irradiation target object through the relative movements of the electron beam irradiation unit and the irradiation target object, whereby an irradiation required area on the irradiation target object can be irradiated with the electron beams. An electron beam irradiation method according to the present embodiment comprises the steps of rotationally driving an irradiation target object accommodated in a shield container that can be said air-tight, and making relative movements of the electron beam irradiation unit and the irradiation target object when the electron beam irradiation unit irradiates the surface of the on-rotating irradiation target object with the electron beams. According to this electron beam irradiation method, the surface of the on-rotating irradiation target object is irradiated with the electron beams, and therefore the surface of the irradiation target object can be efficiently irradiated with the electron beams having the greater energy than the ultraviolet rays have. Hence, for example, it is feasible to easily cure a lubricating layer exhibiting, etc. made of a material that is hard to be cured by the irradiation of the ultraviolet rays, and at the same time the electron beam irradiation unit can be constructed of a less number of electron beam irradiation tubes because of making the relative movements of the electron beam irradiation unit and the irradiation target object when performing such irradiation of the electron beams, thus enabling the number of electron beam irradiation tubes to be reduced. In the electron beam irradiation method, it is preferable that a rotating speed of the irradiation target object is changed corresponding to a position of the irradiation by the electron beam irradiation unit over the irradiation target object. In this case, the rotating speed of the irradiation target object is decreased when the electron beam irradiation unit irradiates an outer periphery side of the irradiation target object with the electron beams and is increased when irradiating an inner periphery side with the electron beams, whereby an electron beam absorbed dose of the irradiation target object can be set fixed irrespective of the position of the irradiation target object. Moreover, it is preferable that a moving velocity of the electron beam irradiation unit is changed corresponding to the position of the irradiation by the electron beam irradiation unit over the irradiation target object. In this case, the moving velocity of the electron beam irradiation unit is decreased when the electron beam irradiation unit irradiates the outer periphery side of the irradiation target object with the electron beams and is increased when irradiating the inner periphery side with the electron beams, whereby the electron beam absorbed dose of the irradiation target object can be set fixed irrespective of the position of the irradiation target object. An apparatus for manufacturing a disc-shaped object according to the present embodiment comprises the aforementioned electron beam irradiation apparatus, wherein the disc-shaped object serving as the irradiation target object is formed with a layer having functionability, which is cured by the irradiation of the electron beams. According to this disc-shaped object manufacturing apparatus, the on-rotating disc-shaped object is irradiated with the electron beams, and it is therefore possible to efficiently irradiate the disc-shaped object with the electron beams having the greater energy than the ultraviolet rays have. Hence, the lubricating layer, etc. made of the material that is hard to be cured by the irradiation of the ultraviolet rays can be easily cured and efficiently formed on the disc-shaped object. Further, the electron beam irradiation unit can be constructed of a less number of electron beam irradiation tubes because of making the relative movements of the electron beam irradiation unit and the disc-shaped object when performing such irradiation of the electron beams, thus enabling the number of electron beam irradiation tubes to be reduced. Then, the equipment cost and the running cost can be reduced, and the lubricating layer, etc. can be formed at a low cost. A method of manufacturing a disc-shaped object according to the present embodiment involves using the aforementioned electron beam irradiation apparatus or the aforementioned electron beam irradiation method, wherein the disc-shaped object serving as the irradiation target object is formed with a layer having functionability, which is cured by the irradiation of the electron beams. According to this disc-shaped object manufacturing method, the on-rotating disc-shaped object is irradiated with the electron beams, and it is therefore possible to efficiently irradiate the disc-shaped object with the electron beams having the greater energy than the ultraviolet rays have. Hence, the lubricating layer, etc. made of the material that is hard to be cured by the irradiation of the ultraviolet rays can be easily cured and efficiently formed on the disc-shaped object. Further, the electron beam irradiation unit can be constructed of a less number of electron beam irradiation tubes because of making the relative movements of the electron beam irradiation unit and the disc-shaped object when performing such irradiation of the electron beams, thus enabling the number of electron beam irradiation tubes to be reduced. Then, the equipment cost and the running cost can be reduced, and the lubricating layer, etc. can be formed at a low cost. Another apparatus for manufacturing a disc-shaped object according to the present embodiment comprises an electron beam irradiation apparatus including a first rotational unit provided in an openable/closable shield container and accommodating a disc-shaped object rotationally driven, and an electron beam irradiation unit for irradiating the surface of the on-rotating disc-shaped object with electron beams, a chamber including a second rotational unit capable of accommodating the disc-shaped object and an exchange chamber that is air-tight and openable/closable independently of the shield container, and a rotational unit for exchanging the first and second rotational units with each other by rotating the first rotational unit in the shield container and the second rotational unit in the exchange chamber, wherein the electron beam irradiation unit and the disc-shaped object are relatively moved when irradiating the on-rotating disc-shaped object with the electron beams. According to this disc-shaped object manufacturing apparatus, the on-rotating disc-shaped object is irradiated with the electron beams, and it is therefore possible to efficiently irradiate the disc-shaped object with the electron beams having the greater energy than the ultraviolet rays have. Hence, for example, the lubricating layer, etc. made of the material that is hard to be cured by the irradiation of the ultraviolet rays can be easily cured. Further, the two pieces of first and second rotational units are exchanged with each other by rotating the first rotational unit and the second rotational unit, thus ejecting the post-irradiation disc-shaped object and simultaneously supplying the pre-irradiation disc-shaped object. The two disc-shaped objects can be efficiently exchanged, thereby improving the productivity. At the same time, the electron beam irradiation unit can be constructed of a less number of electron beam irradiation tubes because of making the relative movements of the electron beam irradiation unit and the disc-shaped object when performing the irradiation of the electron beams, thus enabling the number of electron beam irradiation tubes to be reduced. Then, the equipment cost and the running cost can be reduced, and the lubricating layer, etc. can be formed at a low cost. The disc-shaped object manufacturing apparatus can be constructed so that a width of the electron beam irradiation unit in a direction orthogonal to a rotating direction of the irradiation target object within a rotating plane of the disc-shaped object, is smaller than a radius of the disc-shaped object. Moreover, in the disc-shaped object manufacturing apparatus, it is preferable that a rotating speed of the disc-shaped object is changed corresponding to a position of the irradiation by the electron beam irradiation unit over the disc-shaped object. In this case, the first rotational unit and the second rotational unit are so constructed as to be capable of revolving, and the first rotational unit irradiates the surface of the on-rotating disc-shaped object with the electron beams from the electron beam irradiation unit, whereby the disc-shaped object can be moved with respect to the electron beam irradiation unit. Moreover, the rotating speed of the disc-shaped object is decreased when the electron beam irradiation unit irradiates an outer periphery side of the disc-shaped object with the electron beams and is increased when irradiating an inner periphery side with the electron beams, whereby the electron beam absorbed dose of the disc-shaped object can be set fixed irrespective of the position of the disc-shaped object. Further, it is preferable that a moving velocity of the electron beam irradiation unit is changed corresponding to the position of the irradiation by the electron beam irradiation unit over the disc-shaped object. In this case, the moving velocity of the electron beam irradiation unit is decreased when the electron beam irradiation unit irradiates the outer periphery side of the disc-shaped object with the electron beams and is increased when irradiating the inner periphery side with the electron beams, whereby the electron beam absorbed dose of the disc-shaped object can be set fixed irrespective of the position of the disc-shaped object. Moreover, the electron beam irradiation unit can be constructed of an irradiation window of a single electron beam irradiation tube. A best mode for carrying out the present invention will hereinafter be described with reference to the drawings. Namely, an electron beam irradiation apparatus according to a first embodiment, and an apparatus for manufacturing a disc-shaped medium according to a second embodiment and a third embodiment will be explained with reference to the drawings. The electron beam irradiation apparatus in the first embodiment is constructed to irradiate a disc-shaped irradiation target object with electron beams while moving a single electron beam irradiation tube. FIG. 1 is a side view schematically showing the electron beam irradiation apparatus in the first embodiment. FIG. 2 is a plan view of the principal portions of the electron beam irradiation apparatus in FIG. 1. FIG. 3 is a block diagram showing a control system of the electron beam irradiation apparatus in FIG. 1. FIG. 4 is a flowchart showing an operation of the electron beam irradiation apparatus in FIGS. 1 through 3. FIG. 5 is a graph schematically showing a relation between a radius-directional position of an electron beam irradiation tube 11a and a moving velocity of the electron beam irradiation tube 11a of the electron beam irradiation apparatus in FIGS. 1 through 3. FIG. 17 is a plan view showing a positional relation in plane between the on-rotating disc-shaped irradiation target object and the electron beam irradiation tube in the electron beam irradiation apparatus in FIGS. 1 and 2. As illustrated in FIG. 1, an electron beam irradiation apparatus 1 includes a shield container 10 that accommodates a disc-shaped irradiation target object 2 rotatably and is composed of stainless steel in order to shield the electron beams (to confine the electron beams to the inside), a motor 17 for rotationally driving the irradiation target object 2 held by engaging a central hole of the irradiation target object 2 with an engaging member 4 through a rotary shaft 3, the electron beam irradiation tube 11a that emits the electron beams under a low-acceleration voltage, an electron beam irradiating portion 11c, constructed of an irradiation window of the electron beam irradiation tube 11a, from which to irradiate the irradiation target object 2 with the electron beams, a power source 12 for applying a voltage to the electron beam irradiation tube 11a, and a temperature measuring device 13 for measuring an ambient temperature to the electron beam irradiation tube 11a by use of a temperature sensor 24 disposed in the vicinity of the electron beam irradiation tube 11a. The electron beam irradiation apparatus 1 further includes an oxygen concentration meter 16 for measuring an oxygen concentration of oxygen in an airtight closed space within the shield container 10, a vacuumizing device 18 for evacuating and thus depressurizing an interior of the shield container 10 via a valve 19, a nitrogen gas source 14 that supplies a nitrogen gas for replacing the interior of the shield container 10 with a nitrogen gas atmosphere, and a gas flow rate control valve 15 capable of controlling a gas flow rate of the nitrogen gas in a such a flow that the nitrogen gas is supplied from the nitrogen gas source 14, introduced via a gas introduction port 25, passes through in the vicinity of the irradiation window 11c and is discharged from a gas discharge port 26. Further, the gas discharge port 26 is provided with a valve (unillustrated). As shown in FIGS. 1 and 2, the electron beam irradiation apparatus 1 is equipped with a moving mechanism 20 for moving the electron beam irradiation tube 11a in a radial direction R of the irradiation target object 2, and with an irradiation tube container 11b disposed in a upper part of the shield container 10 and accommodating the electron beam irradiation tube 11a inwardly. The electron beam irradiation tube 11a irradiates the electron beams of which an acceleration voltage is on the order of 20 kV through 100 kV from the elongated irradiation window (i.e., the electron beam irradiating portion 11c) disposed along the radial direction R of the irradiation target object 2 in FIGS. 1, 2 and 17. The irradiation window (the electron beam irradiating portion) 11c of the electron beam irradiation tube 11a has a width d along the radial direction R that is smaller than a radius r (a distance from a rotational center 2a up to an outer periphery) of the disc-shaped irradiation target object 2 in FIG. 17. As shown in FIG. 2, an upper surface of the shield container 10 within the irradiation tube container 11b is formed with an elongated aperture 23 in and along which the electron beam irradiation tube 11a is disposed and movable. The irradiation tube container 11b is, as in the case of the shield container 10, composed of the stainless steel so that the electron beams do not leak out of the aperture 23, thus shielding the electron beams. The moving mechanism 20 includes a servo motor 21 disposed on the upper surface of the shield container 10 outwardly of the irradiation tube container 11b, and a ball slide shaft 22 connected to the electron beam irradiation tube 11a within the irradiation tube container 11b and rotationally driven by the servo motor 21. The servo motor 21 can rectilinearly move the electron beam irradiation tube 11a along the aperture 23 by rotationally driving the ball slide shaft 22, and can adjust the moving velocity of the electron beam irradiation tube 11a by controlling the number of revolutions of the servo motor 21. The moving mechanism 20 moves the electron beam irradiation tube 11a in the radial direction R, thereby enabling the irradiation of the electron beams over substantially the entire surface of the irradiation target object 2 by use of the electron beam irradiation tube 11a having the irradiation window 11c of which the width d is smaller than the radius r of the irradiation target object 2 in FIG. 17. The electron beam irradiation tube 11a, when the voltage is applied to this tube 11a from the power source 12, irradiates part of an area of the on-rotating irradiation target object 2 with the electron beams of which the acceleration voltage is on the order of 20 kV through 100 kV via the irradiation window 11c. In this case, however, a control unit 30 in FIG. 3 keeps constant the rotating speed of the irradiation target object 2, and controls the servo motor 21 of the moving mechanism 20, as shown in FIG. 5, so as to decrease the moving velocity of the electron beam irradiation tube 11a when the electron beam irradiation tube 11a irradiates an outer peripheral side of the irradiation target object 2 with the electron beams and so as to increase the moving velocity of the electron beam irradiation tube 11a when irradiating an inner peripheral side with the electron beams. With this control thus effected, an electron beam absorbed dose of the irradiation target object 2 can be fixed irrespective of the radius-directional position of the irradiation target object 2. The thus-constructed electron beam irradiation apparatus 1 in FIGS. 1 and 2, irradiates the electron beams in a way that controls the whole as shown in FIG. 3 by the control unit 30. Respective steps S01 through S11 of the operation of the electron beam irradiation apparatus 1 will be described with reference to FIG. 4. Under the control of the control unit 30, to begin with, after closing the valve at the gas discharge port 26, the vacuumizing device 18 operates to depressurize the interior of the shield container 10 (S01), then the valve 19 is closed, and the nitrogen gas is introduced into the shield container 10 via a gas flow rate control valve 15 from the nitrogen gas source 14 (S02). The interior of the shield container 10 can be thereby easily replaced with a nitrogen atmosphere. Then, the oxygen concentration meter 16 detects a decrease down to a predetermined oxygen concentration in the interior of the shield container 10 (S03), and the irradiation target object 2 is rotated at a predetermined rotating speed by driving the motor 17 (S04). On the other hand, the voltage is applied to the electron beam irradiation tube 11a from the power source 12 (S05), thereby generating the electron beams (S06). At this time, the electron beam irradiation tube 11a is positioned by far more outwards than the outermost periphery of the irradiation target object 2 as depicted by the solid lines in FIGS. 1 and 2. Next, the ball slide shaft 22 is rotated by driving the servo motor 21, whereby the electron beam irradiation tube 11a is moved towards the inner periphery side in the radial direction R up to a position indicated by a broken line in FIGS. 1 and 2 from the position depicted by the solid lines in FIGS. 1 and 2 (S07). In the meantime, the surface of the on-rotating irradiation target object 2 is irradiated with the electron beams emitted from the irradiation window 11c of the electron beam irradiation tube 11a (S08). During the thus-effected irradiation of the electron beams, the electron beam irradiation tube 11a is moved towards the innermost periphery side from the outer periphery side of the irradiation target object 2, and the moving velocity thereof in the radial direction R is so controlled as to change from a low velocity to a high velocity as shown in FIG. 5. Therefore, the electron beam absorbed dose of the on-rotating irradiation target object 2 can be fixed regardless of the radius-directional position of the irradiation target object 2. Then, when the electron beam irradiation tube 11a is moved to the vicinity of the rotational center of the irradiation target object 2 in alignment with the position of an edge portion 11d extending so as to provide an eaved-cover above the engaging member 4 from the irradiation tube container 11b, the electron beam irradiation tube 11a stops moving, and simultaneously the irradiation of the electron beams from the electron beam irradiation tube 11a is stopped (S09). Further, during the emission of the electron beams from the electron beam irradiation tube 11a, the nitrogen gas from the nitrogen gas source 14 flows through the vicinity of the irradiation window 11c via the gas introduction portion 25 and further flows into the gas discharge portion 26 (S10), thereby making it possible to cool off the irradiation window 11c that rises in its temperature when emitting the electron beams. Moreover, a temperature ambient to the irradiation window 11c is measured by a temperature sensor 24 and by a temperature measuring device 13, and a flow rate of the nitrogen gas is controlled based on this measured temperature by the gas flow rate control valve 15 (S11). The temperature ambient to the irradiation window 11c can be controlled to be equal to or lower than a fixed temperature. As described above, according to the electron beam irradiation apparatus in FIGS. 1 through 4, the surface of the on-rotating irradiation target object 2 is irradiated with the electron beams, thereby enabling highly efficient irradiation of the electron beams exhibiting greater energy than the ultraviolet rays have. It is therefore feasible to facilitate curing of a lubricating layer, etc. made of a material that is hard to be cured by the irradiation of, for example, the ultraviolet rays. When irradiating the electron beams, the electron beam irradiation tube 11a is moved along above the on-rotating irradiation target object 2, and hence the single electron beam irradiation tube 11a can irradiate substantially the entire surface of the irradiation target object 2 with the electron beams. The apparatus can be constructed of a less number of electron beam irradiation tubes 11a than by the prior art, whereby the number of electron beam irradiation tubes 11a can be reduced. Accordingly, there suffices one single electron beam irradiation tube 11a that is expensive, and therefore the equipment cost can be restrained by increasing neither a weight nor a size of the apparatus. At the same time, the running cost can be restrained without increasing amounts of consumption of N2 gas for cooling and of the electric power. Further, the surface of the irradiation target object 2 is irradiated with the electron beams of which the acceleration voltage is as low as 20 kV through 100 kV, whereby the electron beam energy can be highly efficiently applied across the object surface over a thin range, e.g., over the lubricating layer. It is therefore possible to prevent deterioration of a substrate, etc. without exerting influence of the electron beams upon the substrate, etc. existing thereunder. Moreover, the irradiation of the electron beams is conducted after reducing the oxygen concentration in the interior of the shield container 10 down to the predetermined level, so that an inhibition of radical reaction caused by oxygen in the vicinity of the surface of the irradiation target object 2 irradiated with the electron beams is hard to occur, thereby making it possible to ensure preferable hardening reaction in the lubricating layer, etc. Note that in the discussion given above, the electron beam irradiation tube 11a is moved toward the inner periphery from the outer periphery of the irradiation target object 2 and may also be moved toward the outer periphery from the inner periphery of the irradiation target object 2. Moreover, the electron beam irradiation tube 11a may also be reciprocated such as the outer periphery→the inner periphery→the output periphery of the irradiation target object 2 or the inner periphery→the outer periphery→the inner periphery thereof. Next, an apparatus for manufacturing the disc-shaped medium according to a second embodiment will be described. FIGS. 6 through 10 are side views of the manufacturing apparatus, explaining respective processes for forming a layer (a lubricating layer) exhibiting lubricity on the disc-shaped medium according to the second embodiment. As shown in FIGS. 6 through 10, a disc-shaped medium manufacturing apparatus (which will hereinafter be simply termed a [manufacturing apparatus]) 50 has an airtight closable chamber 51 accommodating the electron beam irradiation apparatus 1 that emits the electron beams of which the acceleration voltage is as low as 20 kV through 100 kV and irradiates the surface of a disc-shaped medium 49 with the electron beams, an exchange chamber 52 for loading the pre-irradiation disc-shaped medium 49 into the electron beam irradiation apparatus 1 and receiving a post-irradiation disc-shaped medium 49a from the electron beam irradiation apparatus 1, and a rotational (turn) unit 54 that rotates about a rotary shaft 53 in order to exchange the pre-irradiation disc-shaped medium with the post-irradiation disc-shaped medium. As shown in FIGS. 6 through 10, the manufacturing apparatus 50 further includes a disc carrying device 60 for carrying the disc-shaped medium in a way that loads the pre-irradiation disc-shaped medium into the exchange chamber 52 and ejects the post-irradiation disc-shaped medium. The electron irradiation apparatus 1 is constructed substantially in the same way as in FIGS. 1 through 3, and hence a different point from the configuration in FIGS. 1 through 3 will be explained. To be specific, FIG. 6 shows a variation of the shield container 10 in FIG. 1, wherein this shield container 10 is divided into a rotational (turn) tray unit 10a, provided on a lower side as viewed in FIG. 6, that is configured in a tray-like shape so as to rotatably accommodate the disc-shaped medium 49, and an upper-side fixed unit 10b provided with an irradiation tube container 11b, a moving mechanism 20, etc. The rotational tray unit 10a serving as a first rotational unit is movable to the side f the exchange chamber 52 in a way that moves up and down and turns with the aid of the rotational unit 54 with respect to the fixed unit 10b. As illustrated in FIG. 6, an abutting face 10c of the rotational tray unit 10a and an abutting face 10c′ of the fixed unit 10b are provided with shield members 55 for shielding the electron beams so that the electron beams do not leak out. FIG. 11 is an enlarged sectional view showing the shield member 55. As shown in FIG. 11, the abutting face 10c of the rotational tray unit 10a has a protruded portion 55a formed along the entire periphery thereof, and the abutting face 10c′ of the fixed unit 10b has a recessed portion 55b formed along the entire periphery thereof, wherein the protruded portion 55a can be fitted in the recessed portion 55b. Further, a bottom of the recessed portion 55b configuring the shield member 55 is further formed with a cavity 55c, and an O-ring 56a is accommodated in the cavity 55c, thus forming an airtight closed portion 56. When the abutting face 10c and the abutting face 10c′ abut on each other, the protruded portion 55a slightly enters the cavity 55c from through the recessed portion 55b and presses the O-ring 56a in the cavity 55c in the airtight closed portion 56. Thus, the rotational tray unit 10a abuts on the fixed unit 10b, thereby making it possible to enhance airtightness in an airtight closed space 10d formed inside owing to the airtight closed portion 56 and to provide preferable shield property of the electron beams. Note that the rotational tray unit 10a (52a) is, when moved downward for exchanging as shown in FIG. 10, descended down to a position in FIG. 11 so as not to butt against the fixed unit 10b. Further, in the shield portion 55 in FIG. 11, the O-ring 56a in the airtight closed portion 56 is positioned much closer to the bottom within the cavity 55c from the recessed portion 55b and is not therefore irradiated with the electron beams directly, whereby the O-ring 56a can be prevented from being deteriorated. As illustrated in FIG. 6, the exchange chamber 52 includes a rotational tray unit 52a serving as a second rotational unit that is moved up and down and rotated by the rotational unit 54 and is thus moved to the side of the electron beam irradiation apparatus 1, wherein this rotational tray unit 52a is exchangeable with the rotational tray unit 10a and configured in the tray shape. The exchange chamber 52 further includes a carry rotational tray unit 52b that receives the pre-irradiation disc-shaped medium and ejects the post-irradiation disc-shaped medium to the outside by use of the disc carrying device 60. The chamber 51 has an edge portion 51a and a connecting portion 51b that configure part of the exchange chamber 52. The edge portion 51a and the connecting portion 51b are interposed serving as abutting faces between the rotational tray unit 52a and the carry rotational tray unit 52b of the exchange chamber 52, whereby an airtight closed space 52c is formed within the exchange chamber 52 and at the same time the carry rotational tray unit 52b configures part of the chamber 51. Moreover, airtight closed portions 57 each using an O-ring are provided on an abutting face between the edge portion 51a and the carry rotational tray unit 52b and on an abutting face between the connecting portion 51b and the carry rotational tray unit 52b. Further, the same shield portions 55 and the same airtight closed portions 56 as those in FIG. 10 are respectively provided on the abutting face between the edge portion 51a and the rotational tray unit 52a and on the abutting face between the connecting portion 51b and the rotational tray unit 52a. The chamber 51 connects to the fixed unit 10b on the side of the edge portion of the electron beam irradiation apparatus 1, the connecting portion 51b connects to the fixed unit 10b in the vicinity of a central portion, and the carry rotational tray unit 52b is air-tightly closed by the edge portion 51a and by the connecting portion 51b, thereby becoming air-tightly closable on the whole. Moreover, the chamber 51, the carry rotational tray unit 52b (62), the rotational tray unit 10a, the fixed unit 10b, etc., are made of iron and steel, stainless steel and so on, thereby shielding the electron beams to prevent the electron beams from leaking to the outside. The nitrogen gas can be introduced into the chamber 51 via a nitrogen gas introduction port 58, and the airtight closed space 52c within the exchange chamber 52 can be depressurized by a vacuumizing device 59. As shown in FIG. 10, in a state where the whole chamber 51 is air-tightly closed, the rotational unit 54 moves together with the rotational tray units 10a, 50a downward as viewed in FIG. 10, and the airtight closed spaces 10d, 52c are opened. This case indicates a state in which the interior of exchange chamber is replaced with the nitrogen gas, and hence the interior of the chamber 51 does not affect the nitrogen gas atmosphere in the airtight closed space 10d of the electron beam irradiation apparatus 1. Moreover, the nitrogen gas can be introduced into the exchange chamber 52 via a nitrogen gas introduction port 59b. Further, the nitrogen gas in the chamber 51 can be discharged from a gas discharge port 58a. As shown in FIG. 6, the disc carrying device 60 includes another carry rotational tray unit 62 exchangeable with the carry rotational tray unit 52b configuring the exchange chamber 52, and a rotational unit (rotational plate) 64 that rotates the carry rotational tray units 52b, 62 through a rotary shaft 63. Each of the carry rotational tray units 52b, 62 has an adsorbing member 61 for vacuum-adsorbing the disc-shaped medium 49 in the vicinity of the periphery of a central hole of the disc-shaped medium 49. The rotational unit 64 makes the up-and-down and rotational movements and thus carries the disc-shaped medium between the exchange chamber 52 and an external disc transferring/receiving unit 70. The disc-shaped medium 49 supplied from the disc transferring/receiving unit 70 to the exchange chamber 52 is formed on its surface with a light transmitting layer containing a resinous material and a lubricating layer composed of a lubricant thereon by use of an external spin coat device. A material for forming this type of light transmitting layer is not particularly limited on condition that it is an active energy ray curing compound. It is, however, preferable that this material contains at least one reactive group selected from within a (meta) acryloyl group, a vinyl group and a mercapto group. For others, the aforementioned material may contain a known photo-polymerization initiator. Further, for example, a silicon compound and a fluorine compound each exhibiting radical polymerization property are given as materials for forming the lubricating layer. The materials are not, however, limited to those aforementioned. Those lubricating layer forming materials are generally hard to be cured by ultraviolet rays in the case of containing no photo-polymerization initiator but can be instantaneously cured by the electron beams. Next, an operation of the manufacturing apparatus 50 described above will be explained with reference to flowcharts in FIGS. 6 through 10 and 12 in a way that divides the operation into the irradiation of the electron beams upon the disc-shaped medium and the ejecting/supplying of the disc-shaped medium. As shown in FIG. 12, to begin with, the whole chamber 51 is air-tightly closed as illustrated in FIG. 10, and the rotary shaft 53 and the rotational unit 54 moves downward as viewed in FIG. 10 together with the rotational tray units 10a, 52a. Then, after the airtight closed spaces 10d, 52c have been opened, the nitrogen gas is introduced into the chamber 51 via the nitrogen gas introduction port 58, thereby replacing the interior thereof with the nitrogen gas atmosphere (S21). At this time, the replacement with the nitrogen gas can be performed while measuring a concentration of oxygen in the chamber 51 by the oxygen concentration meter 16. Next, when the rotary shaft 53 and the rotational unit 54 move upward as viewed in the Figure together with the rotational tray units 10a, 52a, as shown in FIG. 6, the airtight closed spaces 10d, 52c are formed. Then, in the electron beam irradiation apparatus 1, the disc-shaped medium 49 is rotated by the motor 17 within the airtight closed space 10d (S22), the electron beam irradiation tube 11a is controlled to emit a predetermined amount of electron beams (S23), and the nitrogen gas flows through the vicinity of the irradiation window 11c toward the gas discharge port 26 from the gas introduction port 25. Next, the electron beam irradiation tube 11a starts moving by operating the moving mechanism 20 and is moved toward the inner periphery from the outer periphery of the disc-shaped medium 49 (S24), and simultaneously the surface, formed with the lubricating layer on the light transmitting layer, of the on-rotating disc-shaped medium 49 is irradiated with the electron beams (S25). At this time, the electron beam irradiation tube 11a is moved in a way that changes the moving velocity of the movement in the radial direction R (FIGS. 2 and 17) to a high velocity from a low velocity as the electron beam irradiation tube 11a moves from the outermost periphery to the innermost periphery of the disc-shaped medium 49 as shown in FIG. 5, then substantially the entire surface of the disc-shaped medium 49 is irradiated with the electron beams, and thereafter the movement and the irradiation of the electron beam irradiation tube 11a are stopped (S26). This enables acquisition of the disc-shaped medium 49a including the lubricating layer fixed onto the surface of the light transmitting layer of the disc-shaped medium 49. This is considered such that the vicinity of the surface of the light transmitting layer is cured, and at the same time the reactive group of the lubricant is bound (cured) with reactive groups of the surface of the light transmitting layer and of other lubricant. In a state where the airtight closed space 52c is formed within the exchange chamber 52 as shown in FIG. 6, the airtight closed space 52c in the exchange chamber 52 accommodating the post-irradiation disc-shaped medium 49a inside is opened to the atmospheric air through an opening valve 59c and an opening port 59d as shown in FIG. 7 (S30). Then, the disc carrying device 60 moves the adsorbing member 61 provided on the side of the carry rotational tray unit 52b downward as viewed in FIG. 7 by lowering the rotary shaft 63 and an adsorbing arm 64a of the rotational unit 64, whereby the adsorbing member 61 adsorbs the disc-shaped medium 49a (S31). Almost simultaneously with this, the adsorbing member 61 on the side of another carry rotational tray unit 62 adsorbs the pre-irradiation disc-shaped medium 49 formed with the lubricating layer on its surface, which is accommodated in the external disc transferring/receiving unit 70 (S32). Next, as illustrated in FIG. 8, the disc carrying device 60 raises the disc-shaped medium 49a by lifting up the adsorbing arm 64a, and simultaneously moves the rotary shaft 63 and the rotational unit 64 upward as viewed in FIG. 8. Then, the rotational unit 64 rotates about the rotary shaft 63, whereby the carry rotational tray units 52b and 62 are replaced in their positions with each other (S33). Next, as shown in FIG. 9, the disc carrying device 60 moves the rotary shaft 63 and the rotational unit 64 downward as viewed in FIG. 8, thereby setting the disc-shaped medium 49a into the rotational tray unit 52a of the exchange chamber 52 (S34). On the other hand, the disc-shaped medium 49a is transferred to the disc transferring/receiving unit 70 (S35), and the respective adsorbing members 61 stop adsorbing the disc-shaped mediums 49, 49a and move upward as viewed in FIG. 9. The disc-shaped medium 49a is ejected to the outside from the disc transferring/receiving unit 70 (S36). Then, the airtight closed space 52c, which is formed again in the manner described above, within the exchange chamber 52 is depressurized by the vacuumizing device 59, and the nitrogen gas is introduced via the nitrogen gas introduction port 59b, wherein the replacement of the nitrogen gas is conducted beforehand (S37). In the way described above, the disc-shaped medium 49a after being irradiated with the electron beams can be carried up to the disc transferring/receiving unit 70 from the exchange chamber 52, and the same time the disc-shaped medium 49 before being irradiated with the electron beams can be carried up to the exchange chamber 52 from the disc transferring/receiving unit 70. Thus, the disc-shaped mediums 49, 49a can be exchanged by the single rotational operation of each of the rotary shaft 63 and the rotational unit 64. Further, the exchange between the disc-shaped mediums 49, 49a can be efficiently executed during the irradiation of the electron beams by the electron beam irradiation apparatus 1 because of the airtight closed spaces 10d, 52c being independent of each other as shown in FIGS. 7 and 8. Next, an exchanging operation of the disc-shaped medium between the exchange chamber 52 and the electron beam irradiation apparatus 1 will be explained. To be specific, as illustrated in FIG. 9, the rotational tray unit 52a of the exchange chamber 52 accommodates the pre-irradiation disc-shaped medium 49. In the electron beam irradiation apparatus 1, the rotation by the motor 17 is stopped (S38), the disc-shaped medium 49a that has finished being irradiated with the electron beams is housed in the rotational tray unit 10a, and, in this state, the rotary shaft 53 and the rotational unit 54 move downward as viewed in FIG. 9, whereby the rotational tray units 52a, 10a move downward to open the airtight closed spaces 52c, 10d. Note that the interior of the airtight closed space 52c has been replaced with the nitrogen gas atmosphere at that time, and hence there is no influence on other portions within the chamber 51. Next, as shown in FIG. 10, the rotational unit 54 rotates about the rotary shaft 53 within the chamber 51, thereby exchanging the rotational tray units 52a, 10a in their positions with each other (S39). With this operation, the pre-irradiation disc-shaped medium 49 housed in the rotational tray unit 52a is moved into the electron beam irradiation apparatus 1 (S40), and, almost simultaneously with this, the disc-shaped medium 49a housed in the rotational tray unit 10a is moved into the exchange chamber 52 (S41). In the way explained above, the disc-shaped mediums 49, 49a can be exchanged with each other between the exchange chamber 52 and the electron beam irradiation apparatus 1 by performing one rotational operation of each of the rotary shaft 53 and the rotational unit 54. Then, the rotary shaft 53 and the rotational unit 54 move upward as viewed in the Figure in order to move upward the rotational tray units 52a, 10a, whereby the airtight closed spaces 52c, 10d are again formed as shown in FIG. 6. Then, in the electron beam irradiation apparatus 1 the operation returns to step S22 described above, and in the exchange chamber 52 the operation goes back to step S30, thus enabling the same operations to be repeated. Note that the rotary shaft 3 of the motor 17 is contrived to, when the rotary shaft 53 and the rotational unit 54 rotate, retreat downward from the rotational unit 54 and from the rotational tray unit 10a, thus permitting the rotational unit 54 to rotate. As explained above, according to the manufacturing apparatus 50 in FIGS. 5 through 9, the disc-shaped medium 49 of which the surface is formed with the lubricating layer, etc. is rotated, and the on-rotating disc-shaped medium is irradiated with the electron beams whose acceleration voltage is as low as 20 kV through 100 kV. It is therefore possible to irradiate instantaneously the disc-shaped medium at a high efficiency with the electron beams exhibiting the greater energy than the ultraviolet rays have. This enables both of facilitation of curing and fixing the lubricating layer, etc. that is hard to be cured by the irradiation of the ultraviolet rays and the instantaneous formation of the lubricating layer, etc. As a result of improving the productivity for forming the lubricating layer, etc., this improvement can contribute to enhance the productivity of the disc-shaped medium. Moreover, the single electron beam irradiation tube 11a is capable of irradiating the electron beams substantially over the entire surface of the disc-shaped medium 49, and consequently the number of electron beam irradiation tubes can be reduced. There suffices one single electron beam irradiation tube that is expensive, and therefore the equipment cost can be restrained by increasing neither the weight nor the size of the apparatus. At the same time, the running cost can be restrained without increasing amounts of consumption of N2 gas for cooling and of the electric power, and the cost for manufacturing the disc-shaped medium 49 can be decreased. Further, the electron beam irradiation tube 11a is moved in a way that changes the moving velocity thereof to the high velocity from the low velocity as the electron beam irradiation tube 11a moves from the outermost periphery to the innermost periphery of the disc-shaped medium 49, thereby irradiating substantially the entire surface of the disc-shaped medium 49 with the electron beams. It is therefore feasible to keep constant the electron beam absorbed dose of the disc-shaped medium 49 irrespective of the radius-directional position of the disc-shaped medium 49 and also to easily uniformly cure the lubricating layer, etc. Still further, in the interior of the chamber 51 and in the disc carrying device 60, the two pieces of rotational tray units are exchanged with each other by the single rotational operation of each rotational tray unit in synchronization between one rotational tray unit and the other rotational tray unit, thereby ejecting the post-irradiation disc-shaped medium 49a and supplying the pre-irradiation disc-shaped medium 49. The disc-shaped mediums 49, 49a can be thus efficiently exchanged with each other, and hence the productivity is improved. Yet further, because of using the electron beams of which the acceleration voltage is as low as 20 Kv through 100 kV, the electron beam energy is efficiently applied to the lubricating layer, etc. existing over the thin range from the surface, and the electron beams do not affect the substrate existing thereunder. For example, the electron beam irradiation tube 11a, configuring the electron beam irradiation unit 11 of the electron beam irradiation apparatus 1, for irradiating the electron beams having the low acceleration voltage, is available on the market as offered by Ushio Electric Co., Ltd. The electron beam irradiation tube 11a is capable of efficiently applying the electron beam energy to the lubricating layer/resin layer, etc. within a depthwise range that is on the order of 10 μm through 20 μm from the surface under the condition that the acceleration voltage is 50 kV, and a tube current is 0.6 mA per piece, and is capable of efficiently curing the layer instantaneously in less than 1 sec. For instance, the electron beam irradiation tube 11a can simultaneously cure not only a lubricating layer 93 on the optical disc as shown in FIG. 13 but also even a portion, contiguous to the lubricating layer 93, of a light transmitting layer 92. Besides, for example, since the electron beams do not reach a substrate 90 existing under the lubricating layer 93 on the optical disc as illustrated in FIG. 13, and hence no damage is exerted on the substrate 90 composed of a resin material such as polycarbonate, etc., and there occurs none of adverse influence such as discoloration, deformation, deterioration and so forth. Note that a silicon thin film having a thickness of approximately 3 μm is preferable for a window material that composes the irradiation window 11c of the electron beam irradiation tube 11a, wherein the electron beams accelerated by a voltage equal to or lower than 100 kV, which can not be captured (taken out) by the conventional irradiation window, can be captured by the irradiation window 11c. The disc-shaped medium manufacturing apparatus will be described by way of a third embodiment. The disc-shaped medium manufacturing apparatus in FIGS. 6 through 11 according to the second embodiment discussed above is constructed to irradiate the electron beams while moving the single electron beam irradiation tube with respect to the disc-shaped medium. A construction in the third embodiment is, however, such that the disc-shaped medium is moved close to and away from the single electron beam irradiation tube. The discussion is therefore concentrated on different portions from the second embodiment, wherein the same components as those in the second embodiment are marked with the same numerals and symbols, and their explanations are omitted. FIG. 14 is a side view showing the same processes, as those in FIG. 6, of the manufacturing apparatus, for forming the lubricating layer, etc. on the disc-shaped medium in the third embodiment. FIG. 15 is a plan view of principal portions of the manufacturing apparatus in FIG. 14. FIG. 16 is a diagram schematically showing a relation between a radius-directional position of the electron beam irradiation tube 11a in FIGS. 11 and 15 with respect to the disc-shaped medium and a rotating speed of the disc-shaped medium. As shown in FIG. 14, in the manufacturing apparatus according to the third embodiment, the electron beam irradiation unit 11 includes the electron beam irradiation tube 11a fixedly disposed in an upper position in the vicinity of the center of the disc-shaped medium 49 within the irradiation tube container 11b. Further, the rotational tray unit 52a and the rotational tray unit 10b are independently rotationally controlled in order to exchange the rotational tray units 52a, 10a in their positions within the chamber 51. The rotational tray unit 52a is rotated (auto-rotation) by a motor 17a different from the motor 17 for the rotational tray unit 10a. Moreover, the rotational tray unit 10a is revolved through a rotary shaft 53a by a motor 81. The rotational tray unit 52a is revolved by a motor 82 through a rotary shaft 53b disposed concentrically with the rotary shaft 53a. As shown in FIGS. 14 and 15, the rotational tray unit 10a is, when the disc-shaped medium 49 is irradiated with the electron beams from the electron beam irradiation tube 11a, controlled so that the disc-shaped medium 49 is, while being rotated by the motor 17, moved by the motor 81 from an electron beam irradiation start position 91 up to an electron beam irradiation end position 92 along a revolution trajectory S (indicated by a one-dotted chain line in FIG. 15) taking a circular shape in a revolving direction k about the rotary shaft 53a at a fixed revolution speed. Further, the rotational tray unit 52a located in an exchange position 93 in FIG. 15 is likewise so controlled as to be moved in the revolving direction k along the revolution trajectory S in order to be exchanged with the rotational tray unit 10a, and then moved to the electron beam irradiation start position 91 in FIG. 15, wherein next other disc-shaped medium held by the rotational tray unit 52a is to be irradiated with the electron beams. As shown in FIG. 16, when the electron beam irradiation tube 11a irradiates the electron beams over the inner peripheral side of the disc-shaped medium 49 in the electron beam irradiation start position 91 in FIG. 15, the rotating speed of the disc-shaped medium 49 by the motor 17 is increased, the disc-shaped medium 49 is moved while revolving toward the electron beam irradiation end position 92 in FIG. 15, and the electron beam irradiation tube 11a irradiates the electron beams over the outer peripheral side of the medium 49. At this time, the electron beam absorbed dose of the disc-shaped medium 49 can be set fixed irrespective of the radius-directional position of the disc-shaped medium 49 by controlling the rotating speed of the motor 17 so that the rotating speed of the disc-shaped medium 49 gradually decreases. As discussed above, in the case of performing a relative movement between the electron beam irradiation tube 11a and the disc-shaped medium 49 by making the revolving movement of the disc-shaped medium 49, a rotating speed (speed of rotation) t of the disc-shaped medium 49 and a radius-directional position r of the electron beam irradiation tube 11a from the rotational center, are so controlled as to establish the following relational formula (1).t∝1/r (1) According to the manufacturing apparatus in FIGS. 14 through 16, the disc-shaped medium 49 formed with the lubricating layer, etc. on its surface is rotated, this on-rotating disc-shaped medium is irradiated with the electron beams of which the acceleration voltage is as low as 20 kV through 100 kV. It is therefore possible to irradiate instantaneously the disc-shaped medium at the high efficiency with the electron beams exhibiting the greater energy than the ultraviolet rays have. This enables both of facilitation of curing and fixing the lubricating layer, etc. that is hard to be cured by the irradiation of the ultraviolet rays and the instantaneous formation of the lubricating layer, etc. As a result of improving the productivity for forming the lubricating layer, etc., this improvement can contribute to enhance the productivity of the disc-shaped medium. Moreover, the single electron beam irradiation tube 11a is capable of irradiating the electron beams substantially over the entire surface of the disc-shaped medium 49, and consequently the number of electron beam irradiation tubes can be reduced. There suffices one single electron beam irradiation tube that is expensive, and therefore the equipment cost can be restrained by increasing neither the weight nor the size of the apparatus. At the same time, the running cost can be restrained without increasing amounts of consumption of N2 gas for cooling and of the electric power, and the cost for manufacturing the disc-shaped medium 49 can be decreased. Further, when the irradiating position of the electron beam irradiation tube 11a shifts from the innermost periphery to the outermost periphery of the disc-shaped medium 49 while the disc-shaped medium 49 revolves as illustrated in FIG. 15, the disc-shaped medium is rotated (auto-rotation) in a way that changes the speed thereof to the low speed from the high speed toward the outermost periphery from the innermost periphery of the disc-shaped medium 49, thereby irradiating substantially the entire surface of the disc-shaped medium 49 with the electron beams. It is therefore feasible to keep constant the electron beam absorbed dose of the disc-shaped medium 49 irrespective of the radius-directional position of the disc-shaped medium 49 and also to easily uniformly cure the lubricating layer, etc. Still further, similarly in FIGS. 6 through 10, in the interior of the chamber 51 and in the disc carrying device 60, the two pieces of rotational tray units are exchanged with each other by the single rotational operation of each rotational tray unit in synchronization between one rotational tray unit and the other rotational tray unit, thereby enabling the ejection of the post-irradiation disc-shaped medium 49 and the supply of the pre-irradiation disc-shaped medium 49. The disc-shaped mediums 49 can be thus efficiently exchanged with each other, and hence the productivity is improved. It should be noted that throughout the present specification, the term “rotational” implies not a simple consecutive rotation of the irradiation target object, i.e., the disc-shaped medium in one direction (or in the direction opposite thereto) as in the rotation but a turn in a way that changes its position so as to turn by a predetermined amount in one direction or in the opposite direction and then stop. Further, the term “radial direction” of the disc-shaped medium connotes the directions extending radially from the rotational center of the irradiation target object, i.e., the disc-shaped medium, and includes the directions extending to the outer periphery of the irradiation target object, i.e., the disc-shaped medium from points eccentric from the rotational center of the irradiation target object, i.e., the disc-shaped medium. As discussed above, the present invention has been described by way of the embodiments but is not limited to those embodiments, and a variety of modifications can be made within the range of the technical ideas of the present invention. For example, in the apparatus for manufacturing the disc-shaped medium according to the present embodiment, the exemplification is that the light transmitting layer and the lubricating layer that are composed of the aforementioned materials are formed by curing in the vicinity of the surface of the disc-shaped medium such as an optical disc, etc., however, the present invention is not limited to this construction and may also be, as a matter of course, applied to the curing of a resin layer, etc. other than the lubricating layer. For instance, the present invention may be applied to forming, in FIG. 13, only the light transmitting layer 92 under the lubricating layer 93, wherein the layer can be instantaneously cured. This is efficient and can contribute to the improvement of the productivity. Moreover, a variety of disc shapes may be taken for the irradiation target object that can be irradiated with the electron beams by the electron beam irradiation apparatus 1. Further, the disc-shaped medium such as the optical disc, etc. has been exemplified as the disc-shaped object that can be manufactured by the manufacturing apparatus in FIGS. 6 and 14, however, the present invention can be, as a matter of course, applied to a case of forming a variety of resin layers on the disc-shaped object other than the medium. Still further, the moving velocity of the electron beam irradiation tube 11a by the moving mechanism 20 in FIGS. 1, 2 and 6 through 10 is set fixed, and the rotating speed of the motor 17 is controlled to decrease the rotating speed of the irradiation target object 2 by use of the motor 17 when the electron beam irradiation tube 11a irradiates the electron beams over the outer periphery side of the irradiation target object 2 and to increase the rotating speed of the irradiation target object 2 when irradiating the electron beams over the inner periphery side thereof. Namely, the number of revolutions of the motor 17 is so controlled for establishing the aforementioned relational formula (1) as to gradually decrease from the outermost periphery toward the innermost periphery in accordance with the radius-direction position of the electron beam irradiation tube 11a along the ball side shaft 22, whereby the electron beam absorbed dose of the irradiation target object 2 can be set fixed regardless of the radius-directional position of the irradiation target object 2. Further, both of the moving velocity of the electron beam irradiation tube 11a and the rotating speed of the irradiation target object 2 may also be controlled. Moreover, in FIGS. 14 and 15, the revolution speed in the revolving direction k along the revolution trajectory S of the disc-shaped medium 49 is set fixed and may also be so controlled as to increase when the irradiation position of the electron beam irradiation tube 11a is on the side of the innermost periphery and to decrease when on the side of the outermost periphery. At this time, the rotating (auto-rotation) speed of the disc-shaped medium 49 can be set fixed and may also be set variable. Through these control operations, the electron beam absorbed dose of the irradiation target object 2 can be set fixed irrespective of the radius-directional position of the irradiation target object 2. Moreover, in the electron beam irradiation apparatus in FIG. 1 and in the manufacturing apparatus in FIGS. 6 and 14, it is preferable that the tube voltage, etc. of the electron beam irradiation tube be determined in consideration of the layer thickness on the electron beam irradiation target surface. Furthermore, there may be provided a plurality of electron beam irradiation tubes corresponding to sizes and dimensions of the irradiation target object 2 and of the irradiation target surface of the disc-shaped medium 49. Furthermore, the gas to be replaced with the atmospheres within the chamber and within the electron beam irradiation apparatus is not limited to the nitrogen gas, wherein an inert gas such as an argon gas, a helium gas, etc. is available, and a mixture gas of these two or more types of gases is also available. |
|
description | This application claims benefit of: U.S. provisional patent application No. 61/055,395 filed May 22, 2008; U.S. provisional patent application No. 61/137,574 filed Aug. 1, 2008; U.S. provisional patent application No. 61/192,245 filed Sep. 17, 2008; U.S. provisional patent application No. 61/055,409 filed May 22, 2008; U.S. provisional patent application No. 61/203,308 filed Dec. 22, 2008; U.S. provisional patent application No. 61/188,407 filed Aug. 11, 2008; U.S. provisional patent application No. 61/209,529 filed Mar. 9, 2009; U.S. provisional patent application No. 61/188,406 filed Aug. 11, 2008; U.S. provisional patent application No. 61/189,815 filed Aug. 25, 2008; U.S. provisional patent application No. 61/208,182 filed Feb. 23, 2009; U.S. provisional patent application No. 61/201,731 filed Dec. 15, 2008; U.S. provisional patent application No. 61/208,971 filed Mar. 3, 2009; U.S. provisional patent application No. 61/205,362 filed Jan. 21, 2009; U.S. provisional patent application No. 61/134,717 filed Jul. 14, 2008; U.S. provisional patent application No. 61/134,707 filed Jul. 14, 2008; U.S. provisional patent application No. 61/201,732 filed Dec. 15, 2008; U.S. provisional patent application No. 61/198,509 filed Nov. 7, 2008; U.S. provisional patent application No. 61/134,718 filed Jul. 14, 2008; U.S. provisional patent application No. 61/190,613 filed Sep. 2, 2008; U.S. provisional patent application No. 61/191,043 filed Sep. 8, 2008; U.S. provisional patent application No. 61/192,237 filed Sep. 17, 2008; U.S. provisional patent application No. 61/201,728 filed Dec. 15, 2008; U.S. provisional patent application No. 61/190,546 filed Sep. 2, 2008; U.S. provisional patent application No. 61/189,017 filed Aug. 15, 2008; U.S. provisional patent application No. 61/198,248 filed Nov. 5, 2008; U.S. provisional patent application No. 61/198,508 filed Nov. 7, 2008; U.S. provisional patent application No. 61/197,971 filed Nov. 3, 2008; U.S. provisional patent application No. 61/199,405 filed Nov. 17, 2008; U.S. provisional patent application No. 61/199,403 filed Nov. 17, 2008; and U.S. provisional patent application No. 61/199,404 filed Nov. 17, 2008, all of which are incorporated herein in their entirety by this reference thereto. 1. Field of the Invention This invention relates generally to treatment of solid cancers. More particularly, the invention relates to a method and apparatus used in conjunction with radiation treatment of cancerous tumors. 2. Discussion of the Prior Art Cancer A tumor is an abnormal mass of tissue. Tumors are either benign or malignant. A benign tumor grows locally, but does not spread to other parts of the body. Benign tumors cause problems because of their spread, as they press and displace normal tissues. Benign tumors are dangerous in confined places such as the skull. A malignant tumor is capable of invading other regions of the body. Metastasis is cancer spreading by invading normal tissue and spreading to distant tissues. Cancer Treatment Several forms of radiation therapy exist for cancer treatment including: brachytherapy, traditional electromagnetic X-ray therapy, and proton therapy. Each are further described, infra. Brachytherapy is radiation therapy using radioactive sources implanted inside the body. In this treatment, an oncologist implants radioactive material directly into the tumor or very close to it. Radioactive sources are also placed within body cavities, such as the uterine cervix. The second form of traditional cancer treatment using electromagnetic radiation includes treatment using X-rays and gamma rays. An X-ray is high-energy, ionizing, electromagnetic radiation that is used at low doses to diagnose disease or at high doses to treat cancer. An X-ray or Röntgen ray is a form of electromagnetic radiation with a wavelength in the range of 10 to 0.01 nanometers (nm), corresponding to frequencies in the range of 30 PHz to 30 EHz. X-rays are longer than gamma rays and shorter than ultraviolet rays. X-rays are primarily used for diagnostic radiography. X-rays are a form of ionizing radiation and as such can be dangerous. Gamma rays are also a form of electromagnetic radiation and are at frequencies produced by sub-atomic particle interactions, such as electron-positron annihilation or radioactive decay. In the electromagnetic spectrum, gamma rays are generally characterized as electromagnetic radiation having the highest frequency, as having highest energy, and having the shortest wavelength, such as below about 10 picometers. Gamma rays consist of high energy photons with energies above about 100 keV. X-rays are commonly used to treat cancerous tumors. However, X-rays are not optimal for treatment of cancerous tissue as X-rays deposit their highest does of radiation near the surface of the targeted tissue and delivery exponentially less radiation as they penetrate into the tissue. This results in large amounts of radiation being delivered outside of the tumor. Gamma rays have similar limitations. The third form of cancer treatment uses protons. Proton therapy systems typically include: a beam generator, an accelerator, and a beam transport system to move the resulting accelerated protons to a plurality of treatment rooms where the protons are delivered to a tumor in a patient's body. Proton therapy works by aiming energetic ionizing particles, such as protons accelerated with a particle accelerator, onto a target tumor. These particles damage the DNA of cells, ultimately causing their death. Cancerous cells, because of their high rate of division and their reduced ability to repair damaged DNA, are particularly vulnerable to attack on their DNA. Due to their relatively enormous size, protons scatter less easily in the tissue and there is very little lateral dispersion. Hence, the proton beam stays focused on the tumor shape without much lateral damage to surrounding tissue. All protons of a given energy have a certain range, defined by the Bragg peak, and the dosage delivery to tissue ratio is maximum over just the last few millimeters of the particle's range. The penetration depth depends on the energy of the particles, which is directly related to the speed to which the particles were accelerated by the proton accelerator. The speed of the proton is adjustable to the maximum rating of the accelerator. It is therefore possible to focus the cell damage due to the proton beam at the very depth in the tissues where the tumor is situated. Tissues situated before the Bragg peak receive some reduced dose and tissues situated after the peak receive none. Synchrotrons Patents related to the current invention are summarized here. Proton Beam Therapy System F. Cole, et. al. of Loma Linda University Medical Center “Multi-Station Proton Beam Therapy System”, U.S. Pat. No. 4,870,287 (Sep. 26, 1989) describe a proton beam therapy system for selectively generating and transporting proton beams from a single proton source and accelerator to a selected treatment room of a plurality of patient treatment rooms. Transport/Scanning Control K. Matsuda, et. al. “Particle Beam Irradiation Apparatus, Treatment Planning Unit, and Particle Beam Irradiation Method”, U.S. Pat. No. 7,227,161 (Jun. 5, 2007); K. Matsuda, et. al. “Particle Beam Irradiation Treatment Planning Unit, and Particle Beam Irradiation Method”, U.S. Pat. No. 7,122,8110 (Oct. 17, 2006); and K. Matsuda, et. al. “Particle Beam Irradiation Apparatus, Treatment Planning Unit, and Particle Beam Irradiation Method” (Sep. 5, 2006) describe a particle beam irradiation apparatus have a scanning controller that stops output of an ion beam, changes irradiation position via control of scanning electromagnets, and reinitiates treatment based on treatment planning information. T. Norimine, et. al. “Particle Therapy System Apparatus”, U.S. Pat. No. 7,060,997 (Jun. 13, 2006); T. Norimine, et. al. “Particle Therapy System Apparatus”, U.S. Pat. No. 6,936,832 (Aug. 30, 2005); and T. Norimine, et. al. “Particle Therapy System Apparatus”, U.S. Pat. No. 6,774,383 (Aug. 10, 2004) each describe a particle therapy system having a first steering magnet and a second steering magnet disposed in a charged particle beam path after a synchrotron that are controlled by first and second beam position monitors. K. Moriyama, et. al. “Particle Beam Therapy System”, U.S. Pat. No. 7,012,267 (Mar. 14, 2006) describe a manual input to a ready signal indicating preparations are completed for transport of the ion beam to a patient. H. Harada, et. al. “Irradiation Apparatus and Irradiation Method”, U.S. Pat. No. 6,984,835 (Jan. 10, 2006) describe an irradiation method having a large irradiation filed capable of uniform dose distribution, without strengthening performance of an irradiation field device, using a position controller having overlapping area formed by a plurality of irradiations using a multileaf collimator. The system provides flat and uniform dose distribution over an entire surface of a target. H. Akiyama, et. al. “Charged Particle Beam Irradiation Equipment Having Scanning Electromagnet Power Supplies”, U.S. Pat. No. 6,903,351 (Jun. 7, 2005); H. Akiyama, et. al. “Charged Particle Beam Irradiation Equipment Having Scanning Electromagnet Power Supplies”, U.S. Pat. No. 6,900,436 (May 31, 2005); and H. Akiyama, et. al. “Charged Particle Beam Irradiation Equipment Having Scanning Electromagnet Power Supplies”, U.S. Pat. No. 6,881,970 (Apr. 19, 2005) all describe a power supply for applying a voltage to a scanning electromagnet for deflecting a charged particle beam and a second power supply without a pulsating component to control the scanning electromagnet more precisely allowing for uniform irradiation of the irradiation object. K. Amemiya, et. al. “Accelerator System and Medical Accelerator Facility”, U.S. Pat. No. 6,800,866 (Oct. 5, 2004) describe an accelerator system having a wide ion beam control current range capable of operating with low power consumption and having a long maintenance interval. A. Dolinskii, et. al. “Gantry with an Ion-Optical System”, U.S. Pat. No. 6,476,403 (Nov. 5, 2002) describe a gantry for an ion-optical system comprising an ion source and three bending magnets for deflecting an ion beam about an axis of rotation. A plurality of quadrupoles are also provided along the beam path to create a fully achromatic beam transport and an ion beam with difference emittances in the horizontal and vertical planes. Further, two scanning magnets are provided between the second and third bending magnets to direct the beam. H. Akiyama, et. al. “Charged Particle Beam Irradiation Apparatus”, U.S. Pat. No. 6,218,675 (Apr. 17, 2001) describe a charged particle beam irradiation apparatus for irradiating a target with a charged particle beam that include a plurality of scanning electromagnets and a quadrupole electromagnet between two of the plurality of scanning electromagnets. K. Matsuda, et. al. “Charged Particle Beam Irradiation System and Method Thereof”, U.S. Pat. No. 6,087,672 (Jul. 11, 2000) describe a charged particle beam irradiation system having a ridge filter with shielding elements to shield a part of the charged particle beam in an area corresponding to a thin region in said target. P. Young, et. al. “Raster Scan Control System for a Charged-Particle Beam”, U.S. Pat. No. 5,017,789 (May 21, 1991) describe a raster scan control system for use with a charged-particle beam delivery system that includes a nozzle through which a charged particle beam passes. The nozzle includes a programmable raster generator and both fast and slow sweep scan electromagnets that cooperate to generate a sweeping magnetic field that steers the beam along a desired raster scan pattern at a target. Beam Shape Control M. Yanagisawa, et. al. “Particle Beam Irradiation System and Method of Adjusting Irradiation Field Forming Apparatus”, U.S. Pat. No. 7,154,107 (Dec. 26, 2006) and M. Yanagisawa, et. al. “Particle Beam Irradiation System and Method of Adjusting Irradiation Field Forming Apparatus”, U.S. Pat. No. 7,049,613 (May 23, 2006) describe a particle therapy system having a scattering compensator and a range modulation wheel. Movement of the scattering compensator and the range modulation wheel adjusts a size of the ion beam and scattering intensity resulting in penumbra control and a more uniform dose distribution to a diseased body part. T. Haberer, et. al. “Device and Method for Adapting the Size of an Ion Beam Spot in the Domain of Tumor Irradiation”, U.S. Pat. No. 6,859,741 (Feb. 22, 2005) describe a method and apparatus for adapting the size of an ion beam in tumor irradiation. Quadrupole magnets determining the size of the ion beam spot are arranged directly in front of raster scanning magnets determining the size of the ion beam spot. The apparatus contains a control loop for obtaining current correction values to further control the ion beam spot size. K. Matsuda, et. al. “Charged Particle Irradiation Apparatus and an Operating Method Thereof”, U.S. Pat. No. 5,986,274 (Nov. 16, 1999) describe a charged particle irradiation apparatus capable of decreasing a lateral dose falloff at boundaries of an irradiation field of a charged particle beam using controlling magnet fields of quadrupole electromagnets and deflection electromagnets to control the center of the charged particle beam passing through the center of a scatterer irrespective of direction and intensity of a magnetic field generated by scanning electromagnets. K. Hiramoto, et. al. “Charged Particle Beam Apparatus and Method for Operating the Same”, U.S. Pat. No. 5,969,367 (Oct. 19, 1999) describe a charged particle beam apparatus where a the charged particle beam is enlarged by a scatterer resulting in a Gaussian distribution that allows overlapping of irradiation doses applied to varying spot positions. M. Moyers, et. al. “Charged Particle Beam Scattering System”, U.S. Pat. No. 5,440,133 (Aug. 8, 1995) describe a radiation treatment apparatus for producing a particle beam and a scattering foil for changing the diameter of the charged particle beam. C. Nunan “Multileaf Collimator for Radiotherapy Machines”, U.S. Pat. No. 4,868,844 (Sep. 19, 1989) describes a radiation therapy machine having a multileaf collimator formed of a plurality of heavy metal leaf bars movable to form a rectangular irradiation field. R. Maughan, et. al. “Variable Radiation Collimator”, U.S. Pat. No. 4,754,147 (Jun. 28, 1988) describe a variable collimator for shaping a cross-section of a radiation beam that relies on rods, which are positioned around a beam axis. The rods are shaped by a shaping member cut to a shape of an area of a patient go be irradiated. Beam Energy/Intensity M. Yanagisawa, et. al. “Charged Particle Therapy System, Range Modulation Wheel Device, and Method of Installing Range Modulation Wheel Device”, U.S. Pat. No. 7,355,189 (Apr. 8, 2008) and Yanagisawa, et. al. “Charged Particle Therapy System, Range Modulation Wheel Device, and Method of Installing Range Modulation Wheel Device”, U.S. Pat. No. 7,053,389 (May 30, 2008) both describe a particle therapy system having a range modulation wheel. The ion beam passes through the range modulation wheel resulting in a plurality of energy levels corresponding to a plurality of stepped thicknesses of the range modulation wheel. M. Yanagisawa, et. al. “Particle Beam Irradiation System and Method of Adjusting Irradiation Apparatus”, U.S. Pat. No. 7,297,967 (Nov. 20, 2007); M. Yanagisawa, et. al. “Particle Beam Irradiation System and Method of Adjusting Irradiation Apparatus”, U.S. Pat. No. 7,071,479 (Jul. 4, 2006); M. Yanagisawa, et. al. “Particle Beam Irradiation System and Method of Adjusting Irradiation Apparatus”, U.S. Pat. No. 7,026,636 (Apr. 11, 2006); and M. Yanagisawa, et. al. “Particle Beam Irradiation System and Method of Adjusting Irradiation Apparatus”, U.S. Pat. No. 6,777,700 (Aug. 17, 2004) all describe a scattering device, a range adjustment device, and a peak spreading device. The scattering device and range adjustment device are combined together and are moved along a beam axis. The spreading device is independently moved along the axis to adjust the degree of ion beam scattering. Combined, the devise increases the degree of uniformity of radiation dose distribution to a diseased tissue. A. Sliski, et. al. “Programmable Particle Scatterer for Radiation Therapy Beam Formation”, U.S. Pat. No. 7,208,748 (Apr. 24, 2007) describe a programmable pathlength of a fluid disposed into a particle beam to modulate scattering angle and beam range in a predetermined manner. The charged particle beam scatterer/range modulator comprises a fluid reservoir having opposing walls in a particle beam path and a drive to adjust the distance between the walls of the fluid reservoir under control of a programmable controller to create a predetermined spread out Bragg peak at a predetermined depth in a tissue. The beam scattering and modulation is continuously and dynamically adjusted during treatment of a tumor to deposit a dose in a targeted predetermined three dimensional volume. M. Tadokoro, et. al. “Particle Therapy System”, U.S. Pat. No. 7,247,869 (Jul. 24, 2007) and U.S. Pat. No. 7,154,108 (Dec. 26, 2006) each describe a particle therapy system capable of measuring energy of a charged particle beam during irradiation during use. The system includes a beam passage between a pair of collimators, an energy detector mounted, and a signal processing unit. G. Kraft, et. al. “Ion Beam Scanner System and Operating Method”, U.S. Pat. No. 6,891,177 (May 10, 2005) describe an ion beam scanning system having a mechanical alignment system for the target volume to be scanned and allowing for depth modulation of the ion beam by means of a linear motor and transverse displacement of energy absorption means resulting in depth-staggered scanning of volume elements of a target volume. G. Hartmann, et. al. “Method for Operating an Ion Beam Therapy System by Monitoring the Distribution of the Radiation Dose”, U.S. Pat. No. 6,736,831 (May 18, 2004) describe a method for operation of an ion beam therapy system having a grid scanner and irradiates and scans an area surrounding an isocentre. Both the depth dose distribution and the transverse dose distribution of the grid scanner device at various positions in the region of the isocentre are measured and evaluated. Y. Jongen “Method for Treating a Target Volume with a Particle Beam and Device Implementing Same”, U.S. Pat. No. 6,717,162 (Apr. 6, 2004) describes a method of producing from a particle beam a narrow spot directed towards a target volume, characterized in that the spot sweeping speed and particle beam intensity are simultaneously varied. G. Kraft, et. al. “Device for Irradiating a Tumor Tissue”, U.S. Pat. No. 6,710,362 (Mar. 23, 2004) describe a method and apparatus of irradiating a tumor tissue, where the apparatus has an electromagnetically driven ion-braking device in the proton beam path for depth-wise adaptation of the proton beam that adjusts both the ion beam direction and ion beam range. K. Matsuda, et. al. “Charged Particle Beam Irradiation Apparatus”, U.S. Pat. No. 6,617,598 (Sep. 9, 2003) describe a charged particle beam irradiation apparatus that increased the width in a depth direction of a Bragg peak by passing the Bragg peak through an enlarging device containing three ion beam components having different energies produced according to the difference between passed positions of each of the filter elements. H. Stelzer, et. al. “Ionization Chamber for Ion Beams and Method for Monitoring the Intensity of an Ion Beam”, U.S. Pat. No. 6,437,513 (Aug. 20, 2002) describe an ionization chamber for ion beams and a method of monitoring the intensity of an ion therapy beam. The ionization chamber includes a chamber housing, a beam inlet window, a beam outlet window, a beam outlet window, and a chamber volume filled with counting gas. H. Akiyama, et. al. “Charged-Particle Beam Irradiation Method and System”, U.S. Pat. No. 6,433,349 (Aug. 13, 2002) and H. Akiyama, et. al. “Charged-Particle Beam Irradiation Method and System”, U.S. Pat. No. 6,265,837 (Jul. 24, 2001) both describe a charged particle beam irradiation system that includes a changer for changing energy of the particle and an intensity controller for controlling an intensity of the charged-particle beam. Y. Pu “Charged Particle Beam Irradiation Apparatus and Method of Irradiation with Charged Particle Beam”, U.S. Pat. No. 6,034,377 (Mar. 7, 2000) describes a charged particle beam irradiation apparatus having an energy degrader comprising: (1) a cylindrical member having a length; and (2) a distribution of wall thickness in a circumferential direction around an axis of rotation, where thickness of the wall determines energy degradation of the irradiation beam. Dosage K. Matsuda, et. al. “Particle Beam Irradiation System”, U.S. Pat. No. 7,372,053 (Nov. 27, 2007) describe a particle beam irradiation system ensuring a more uniform dose distribution at an irradiation object through use of a stop signal, which stops the output of the ion beam from the irradiation device. H. Sakamoto, et. al. “Radiation Treatment Plan Making System and Method”, U.S. Pat. No. 7,054,801 (May 30, 2006) describe a radiation exposure system that divides an exposure region into a plurality of exposure regions and uses a radiation simulation to plan radiation treatment conditions to obtain flat radiation exposure to the desired region. G. Hartmann, et. al. “Method For Verifying the Calculated Radiation Dose of an Ion Beam Therapy System”, U.S. Pat. No. 6,799,068 (Sep. 28, 2004) describe a method for the verification of the calculated dose of an ion beam therapy system that comprises a phantom and a discrepancy between the calculated radiation dose and the phantom. H. Brand, et. al. “Method for Monitoring the Irradiation Control of an Ion Beam Therapy System”, U.S. Pat. No. 6,614,038 (Sep. 2, 2003) describe a method of checking a calculated irradiation control unit of an ion beam therapy system, where scan data sets, control computer parameters, measuring sensor parameters, and desired current values of scanner magnets are permanently stored. T. Kan, et. al. “Water Phantom Type Dose Distribution Determining Apparatus”, U.S. Pat. No. 6,207,952 (Mar. 27, 2001) describe a water phantom type dose distribution apparatus that includes a closed water tank, filled with water to the brim, having an inserted sensor that is used to determine an actual dose distribution of radiation prior to radiation therapy. Starting/Stopping Irradiation K. Hiramoto, et. al. “Charged Particle Beam Apparatus and Method for Operating the Same”, U.S. Pat. No. 6,316,776 (Nov. 13, 2001) describe a charged particle beam apparatus where a charged particle beam is positioned, started, stopped, and repositioned repetitively. Residual particles are used in the accelerator without supplying new particles if sufficient charge is available. K. Matsuda, et. al. “Method and Apparatus for Controlling Circular Accelerator”, U.S. Pat. No. 6,462,490 (Oct. 8, 2002) describe a control method and apparatus for a circular accelerator for adjusting timing of emitted charged particles. The clock pulse is suspended after delivery of a charged particle stream and is resumed on the basis of state of an object to be irradiated. Movable Patient N. Rigney, et. al. “Patient Alignment System with External Measurement and Object Coordination for Radiation Therapy System”, U.S. Pat. No. 7,199,382 (Apr. 3, 2007) describe a patient alignment system for a radiation therapy system that includes multiple external measurement devices that obtain position measurements of movable components of the radiation therapy system. The alignment system uses the external measurements to provide corrective positioning feedback to more precisely register the patient to the radiation beam. Y. Muramatsu, et. al. “Medical Particle Irradiation Apparatus”, U.S. Pat. No. 7,030,396 (Apr. 18, 2006); Y. Muramatsu, et. al. “Medical Particle Irradiation Apparatus”, U.S. Pat. No. 6,903,356 (Jun. 7, 2005); and Y. Muramatsu, et. al. “Medical Particle Irradiation Apparatus”, U.S. Pat. No. 6,803,591 (Oct. 12, 2004) all describe a medical particle irradiation apparatus having a rotating gantry, an annular frame located within the gantry such that is can rotate relative to the rotating gantry, an anti-correlation mechanism to keep the frame from rotating with the gantry, and a flexible moving floor engaged with the frame is such a manner to move freely with a substantially level bottom while the gantry rotates. H. Nonaka, et. al. “Rotating Radiation Chamber for Radiation Therapy”, U.S. Pat. No. 5,993,373 (Nov. 30, 1999) describe a horizontal movable floor composed of a series of multiple plates that are connected in a free and flexible manner, where the movable floor is moved in synchrony with rotation of a radiation beam irradiation section. Respiration K. Matsuda “Radioactive Beam Irradiation Method and Apparatus Taking Movement of the Irradiation Area Into Consideration”, U.S. Pat. No. 5,538,494 (Jul. 23, 1996) describes a method and apparatus that enables irradiation even in the case of a diseased part changing position due to physical activity, such as breathing and heart beat. Initially, a position change of a diseased body part and physical activity of the patient are measured concurrently and a relationship therebetween is defined as a function. Radiation therapy is performed in accordance to the function. Patient Positioning Y. Nagamine, et. al. “Patient Positioning Device and Patient Positioning Method”, U.S. Pat. Nos. 7,212,609 and 7,212,608 (May 1, 2007) describe a patient positioning system that compares a comparison area of a reference X-ray image and a current X-ray image of a current patient location using pattern matching. D. Miller, et. al. “Modular Patient Support System”, U.S. Pat. No. 7,173,265 (Feb. 6, 2007) describe a radiation treatment system having a patient support system that includes a modularly expandable patient pod and at least one immobilization device, such as a moldable foam cradle. K. Kato, et. al. “Multi-Leaf Collimator and Medical System Including Accelerator”, U.S. Pat. No. 6,931,100 (Aug. 16, 2005); K. Kato, et. al. “Multi-Leaf Collimator and Medical System Including Accelerator”, U.S. Pat. No. 6,823,045 (Nov. 23, 2004); K. Kato, et. al. “Multi-Leaf Collimator and Medical System Including Accelerator”, U.S. Pat. No. 6,819,743 (Nov. 16, 2004); and K. Kato, et. al. “Multi-Leaf Collimator and Medical System Including Accelerator”, U.S. Pat. No. 6,792,078 (Sep. 14, 2004) all describe a system of leaf plates used to shorten positioning time of a patient for irradiation therapy. Motor driving force is transmitted to a plurality of leaf plates at the same time through a pinion gear. The system also uses upper and lower air cylinders and upper and lower guides to position a patient. Imaging P. Adamee, et. al. “Charged Particle Beam Apparatus and Method for Operating the Same”, U.S. Pat. No. 7,274,018 (Sep. 25, 2007) and P. Adamee, et. al. “Charged Particle Beam Apparatus and Method for Operating the Same”, U.S. Pat. No. 7,045,781 (May 16, 2006) describe a charged particle beam apparatus configured for serial and/or parallel imaging of an object. K. Hiramoto, et. al. “Ion Beam Therapy System and its Couch Positioning System”, U.S. Pat. No. 7,193,2270 (Mar. 20, 2007) describe a ion beam therapy system having an X-ray imaging system moving in conjunction with a rotating gantry. C. Maurer, et. al. “Apparatus and Method for Registration of Images to Physical Space Using a Weighted Combination of Points and Surfaces”, U.S. Pat. No. 6,560,354 (May 6, 2003) described a process of X-ray computed tomography registered to physical measurements taken on the patient's body, where different body parts are given different weights. Weights are used in an iterative registration process to determine a rigid body transformation process, where the transformation function is used to assist surgical or stereotactic procedures. M. Blair, et. al. “Proton Beam Digital Imaging System”, U.S. Pat. No. 5,825,845 (Oct. 20, 1998) describe a proton beam digital imaging system having an X-ray source that is movable into the treatment beam line that can produce an X-ray beam through a region of the body. By comparison of the relative positions of the center of the beam in the patient orientation image and the isocentre in the master prescription image with respect to selected monuments, the amount and direction of movement of the patient to make the best beam center correspond to the target isocentre is determined. S. Nishihara, et. al. “Therapeutic Apparatus”, U.S. Pat. No. 5,039,867 (Aug. 13, 1991) describe a method and apparatus for positioning a therapeutic beam in which a first distance is determined on the basis of a first image, a second distance is determined on the basis of a second image, and the patient is moved to a therapy beam irradiation position on the basis of the first and second distances. Problem There exists in the art of particle beam therapy of cancerous tumors a need for positioning and verification of proper positioning of a patient immediately prior to and/or concurrently with particle beam therapy irradiation to ensure targeted and controlled delivery of energy to the cancerous tumor with minimization of damage to surrounding healthy tissue. There further exists a need for maintaining position of a patient throughout proton beam therapy treatment once positioning and verification of positioning of a patient is achieved. The invention comprises a semi-vertical patient positioning and/or immobilization method and apparatus used in conjunction with charged particle beam radiation therapy of cancerous tumors. The invention comprises a semi-vertical patient positioning and/or immobilization method and apparatus used in conjunction with charged particle beam radiation therapy of cancerous tumors. Accurate and precise delivery of protons to a tumor in body tissue is critical in charged particle beam therapy. Complicating accurate and precise deliver is natural movement of the body. Movement of the body occurs on multiple levels, including: (1) general patient movement, such as walking; (2) standing, sitting, or lying position variation; and (3) relative movement of internal body parts, such as organs. All of these movements change with time. Hence, a method of determining position of elements of the body at and/or in close proximity in time to the charged particle therapy is needed, such as after the body is positioned relative to a charged particle beam. Herein, an X-ray positioning and/or verification method and apparatus used in conjunction with charged particle therapy is described. Further, a system for maintaining position of a patient throughout proton beam therapy treatment once positioning and verification of positioning of a patient is achieved is described. The system controls movement of a patient during charged particle beam therapy, such as cancerous tumor treatment using proton beam therapy. A patient is positioned in a semi-vertical position in a proton beam therapy system. Patient positioning constraints are used to maintain the patient in a treatment position, including one or more of: a seat support, a back support, a head support, an arm support, a knee support, and a foot support. One or more of the positioning constraints are movable and/or under computer control for rapid positioning and/or immobilization of the patient. The system preferably uses an X-ray beam that lies in substantially the same path as a charged particle beam path of a particle beam cancer therapy system to align the subject just prior to proton beam therapy and/or to verify patient positioning during proton beam therapy. Since, the X-ray path is essentially the charged particle beam path, the generated X-ray image is usable for fine tuning body alignment relative to the charged particle beam path, is used to control the charged particle beam path to accurately and precisely target the tumor, and/or is used in system verification and validation. Charged Particle Beam Therapy Throughout this document, a charged particle beam therapy system, such as a proton beam, hydrogen ion beam, or carbon ion beam, is described. Herein, the charged particle beam therapy system is described using a proton beam. However, the aspects taught and described in terms of a proton beam are not intended to be limiting to that of a proton beam and are illustrative of a charged particle beam system. Any charged particle beam system is equally applicable to the techniques described herein. Referring now to FIG. 1, a charged particle beam system 100 is illustrated. A charged particle beam, preferably comprises a number of subsystems including any of: a main controller 110; an injection system 120; a synchrotron 130 that typically includes: (1) an accelerator system 132 and (2) an extraction system 134; a targeting/delivery system 140; a patient interface module 150; a display system 160; and/or an imaging system 170. An exemplary method of use of the charged particle beam system 100 is provided. The main controller 110 controls one or more of the subsystems to accurately and precisely deliver protons to a patient. For example, the main controller 110 obtains an image, such as a portion of a body and/or of a tumor, from the imaging system 170. The main controller 110 also obtains position and/or timing information from the patient interface module 150. The main controller 110 then optionally controls the injection system 120 to inject a proton into a synchrotron 130. The synchrotron typically contains at least an accelerator system 132 and extraction system 134. The main controller preferably controls the proton beam within the accelerator system, such as by controlling speed, trajectory, and timing of the proton beam. The main controller then controls extraction of a proton beam from the accelerator through the extraction system 134. For example, the controller controls timing, energy, and intensity of the extracted beam. The controller 110 also preferably controls targeting of the proton beam through the targeting/delivery system 140 to the patient interface module 150. One or more components of the patient interface module 150 are preferably controlled by the main controller 110; Further, display elements of the display system 160 are preferably controlled via the main controller 110; Displays are typically provided to one or more operators and/or to one or more patients. In one embodiment, the main controller 110 times the delivery of the proton beam from all systems, such that protons are delivered in an optimal therapeutic manner to the patient. Herein, the main controller 110 refers to a single system controlling the charged particle beam system 100, to a single controller controlling a plurality of subsystems controlling the charged particle beam system 100, or to a plurality of individual controllers controlling one or more sub-systems of the charged particle beam system 100. Synchrotron Herein, the term synchrotron is used to refer to a system maintaining the charged particle beam in a circulating path; however, cyclotrons are alternatively used, albeit with their inherent limitations of energy, intensity, and extraction control. Further, the charged particle beam is referred to herein as circulating along a circulating path about a central point of the synchrotron. The circulating path is alternatively referred to as an orbiting path; however, the orbiting path does not refer a perfect circle or ellipse, rather it refers to cycling of the protons around a central region. Referring now to FIG. 2, an illustrative exemplary embodiment of one version of the charged particle beam system 100 is provided. In the illustrated embodiment, a charged particle beam source 210 generates protons. The protons are delivered into a vacuum tube that runs into, through, and out of the synchrotron. The generated protons are delivered along an initial path 220. Focusing magnets 230, such as quadrupole magnets or injection quadrupole magnets, are used to focus the proton beam path. A quadrupole magnet is a focusing magnet. An injector bending magnet 232 bends the proton beam toward the plane of the synchrotron 130. The focused protons having an initial energy are introduced into an injector magnet 240, which is preferably an injection Lamberson magnet. Typically, the initial beam path 262 is along an axis off of, such as above, a circulating plane of the synchrotron 130. The injector bending magnet 232 and injector magnet 240 combine to move the protons into the synchrotron 130. Circulating magnets or main bending magnets 250 are used to turn the protons along a circulating beam path 260. The circulating magnets 250 bend the original beam path 220 into a circulating beam path 260. In this example, the circulating magnets 250 are represented as four sets of four magnets to maintain the circulating beam path 260 into a stable circulating beam path. A plurality of main bending magnets make up a turning section of the synchrotron. In the illustrated exemplary embodiment, four main bending magnets make up a turning section turning the proton beam about ninety degrees. Optionally, any number of magnets or sets of magnets are optionally used to move the protons around a single orbit in the circulation process. The protons pass through an accelerator 270. The accelerator accelerates the protons in the beam path 260. As the protons are accelerated, the fields applied by the magnets are increased. Particularly, the speed of the protons achieved by the accelerator 270 are synchronized with magnetic fields of the circulating magnets 250 to maintain stable circulation of the protons about a central point or region 280 of the synchrotron. At separate points in time the accelerator 270/circulating magnet 250 combination is used to accelerate and/or decelerate the circulating protons. An extraction system 290 is used in combination with a deflector 300 to remove protons from their circulating path 260 within the synchrotron 190. One example of a deflector component is a Lamberson magnet. Typically the deflector moves the protons from the circulating plane to an axis off of the circulating plane, such as above the circulating plane. Extracted protons are preferably directed and/or focused using an extraction bending magnet 237 and extraction focusing magnets 235, such as quadrupole magnets along a transport path into the scanning/targeting/delivery system 160. Two components of a targeting system 160 typically include a first axis control 162, such as a vertical control, and a second axis control 164, such as a horizontal control. Protons are delivered with control to the patient interface module 170 and to a tumor of a patient. Preferably no quadrupoles are used in or around the circulating path of the synchrotron. Proton Beam Extraction Generally, protons are extracted from the synchrotron by slowing the protons. As described, supra, the protons were initially accelerated in a circulating path, which is maintained with a plurality of turning magnets. The circulating path is referred to herein as an original central beamline. The protons repeatedly cycle around a central point in the synchrotron. The proton path traverses through an RF cavity system. To initiate extraction, an RF field is applied across a first blade and a second blade, in the RF cavity system. The first blade and second blade are referred to herein as a first pair of blades. In the proton extraction process, a radio-frequency (RF) voltage is applied across the first pair of blades, where the first blade of the first pair of blades is on one side of the circulating proton beam path and the second blade of the first pair of blades is on an opposite side of the circulating proton beam path. The applied RF field applies energy to the circulating charged-particle beam. The applied RF field alters the orbiting or circulating beam path slightly of the protons from the original central beamline to an altered circulating beam path. Upon a second pass of the protons through the RF cavity system, the RF field further moves the protons off of the original proton beamline. For example, if the original beamline is considered as a circular path, then the altered beamline is slightly elliptical. The applied RF field is timed to apply outward or inward movement to a given band of protons circulating in the synchrotron accelerator. Each orbit of the protons is slightly more off axis compared to the original circulating beam path. Successive passes of the protons through the RF cavity system are forced further and further from the original central beamline by altering the direction and/or intensity of the RF field with each successive pass of the proton beam through the RF field. The RF voltage is frequency modulated at a frequency about equal to the period of one proton cycling around the synchrotron for one revolution or at a frequency than is an integral multiplier of the period of one proton cycling about the synchrotron. The applied RF frequency modulated voltage excites a betatron oscillation. For example, the oscillation is a sine wave motion of the protons. The process of timing the RF field to a given proton beam within the RF cavity system is repeated thousands of times with each successive pass of the protons being moved approximately one micrometer further off of the original central beamline. For clarity, the effect of the approximately changing beam paths with each successive path of a given band of protons through the RF field is illustrated as the altered beam path. With a sufficient sine wave betatron amplitude, the altered circulating beam path touches a material, such as a foil or a sheet of foil. The foil is preferably a lightweight material, such as beryllium, a lithium hydride, a carbon sheet, or a material of low nuclear charge. A material of low nuclear charge is a material composed of atoms consisting essentially of atoms having six or fewer protons. The foil is preferably about 10 to 150 microns thick, is more preferably 30 to 100 microns thick, and is still more preferably 40-60 microns thick. In one example, the foil is beryllium with a thickness of about 50 microns. When the protons traverse through the foil, energy of the protons is lost and the speed of the protons is reduced. Typically, a current is also generated, described infra. Protons moving at a slower speed travel in the synchrotron with a reduced radius of curvature compared to either the original central beamline or the altered circulating path. The reduced radius of curvature path is also referred to herein as a path having a smaller diameter of trajectory or a path having protons with reduced energy. The reduced radius of curvature is typically about two millimeters less than a radius of curvature of the last pass of the protons along the altered proton beam path. The thickness of the material 1230 is optionally adjusted to create a change in the radius of curvature, such as about ½, 1, 2, 3, or 4 mm less than the last pass of the protons or original radius of curvature. Protons moving with the smaller radius of curvature travel between a second pair of blades. In one case, the second pair of blades is physically distinct and/or are separated from the first pair of blades. In a second case, one of the first pair of blades is also a member of the second pair of blades. For example, the second pair of blades is the second blade and a third blade in the RF cavity system. A high voltage DC signal, such as about 1 to 5 kV, is then applied across the second pair of blades, which directs the protons out of the synchrotron through a deflector, such as a Lamberson magnet, into a transport path. Control of acceleration of the charged particle beam path in the synchrotron with the accelerator and/or applied fields of the turning magnets in combination with the above described extraction system allows for control of the intensity of the extracted proton beam, where intensity is a proton flux per unit time or the number of protons extracted as a function of time. For example, when a current is measured beyond a threshold, the RF field modulation in the RF cavity system is terminated or reinitiated to establish a subsequent cycle of proton beam extraction. This process is repeated to yield many cycles of proton beam extraction from the synchrotron accelerator. Because the extraction system does not depend on any change any change in magnetic field properties, it allows the synchrotron to continue to operate in acceleration or deceleration mode during the extraction process. Stated differently, the extraction process does not interfere with synchrotron. In stark contrast, traditional extraction systems introduce a new magnetic field, such as via a hexapole, during the extraction process. More particularly, traditional synchrotrons have a magnet, such as a hexapole magnet, that is off during an acceleration stage. During the extraction phase, the hexapole magnetic field is introduced to the circulating path of the synchrotron. The introduction of the magnetic field necessitates two distinct modes, an acceleration mode and an extraction mode, which are mutually exclusive in time. In one example, the charged particle irradiation includes a synchrotron having: a center, straight sections, and turning sections. The charged particle beam path runs about the center, through the straight sections, and through said turning sections, where each of the turning sections comprises a plurality of bending magnets. Preferably, the circulation beam path comprises a length of less than sixty meters, and the number of straight sections equals the number of turning sections. Imaging System Herein, an X-ray system is used to illustrate an imaging system. Timing An X-ray is preferably collected either (1) just before or (2) concurrently with treating a subject with proton therapy for a couple of reasons. First, movement of the body, described supra, changes the local position of the tumor in the body. If the subject has an X-ray taken and is then bodily moved to a proton treatment room, accurate alignment of the proton beam to the tumor is problematic. Alignment of the proton beam to the tumor using one or more X-rays is best performed at the time of proton delivery or in the seconds or minutes immediately prior to proton delivery and after the patient is placed into a therapeutic body position, which is typically a fixed position. Second, the X-ray taken after positioning the patient is used for verification of proton beam alignment to a targeted position, such as a tumor and/or internal organ position. Positioning An X-ray is preferably taken just before treating the subject to aid in patient positioning. For positioning purposes, an X-ray of a large body area is not needed. In one embodiment, an X-ray of only a local area is collected. When collecting an X-ray, the X-ray has an X-ray path. The proton beam has a proton beam path. Overlaying the X-ray path with the proton beam path is one method of aligning the proton beam to the tumor. However, this method involves putting the X-ray equipment into the proton beam path, taking the X-ray, and then moving the X-ray equipment out of the beam path. This process takes time. The elapsed time while the X-ray equipment moves has a couple of detrimental effects. First, during the time required to move the X-ray equipment, the body moves. The resulting movement decreases precision and accuracy of subsequent proton beam alignment to the tumor. Second, the time require to move the X-ray equipment is time that the proton beam therapy system is not in use, which decreases the total efficiency of the proton beam therapy system. Referring now to FIG. 3, in one embodiment, an X-ray is generated close to, but not in, the proton beam path. A proton beam therapy system and an X-ray system combination 300 is illustrated in FIG. 3. The proton beam therapy system has a proton beam 260 in a transport system after the deflector 292 of the synchrotron 130. The proton beam is directed by the targeting/delivery system 140 to a tumor 320 of a patient 330. The X-ray system 305 includes an electron beam source 340 generating an electron beam 350. The electron beam is directed to an X-ray generation source 360, such as a piece of tungsten. Preferably, the tungsten X-ray source is located about 1, 2, 3, 5, 10, or 20 millimeters from the proton beam path 260. When the electron beam 350 hits the tungsten, X-rays are generated in all directions. X-rays are blocked with a port 362 and are selected for an X-ray beam path 370. The X-ray beam path 370 and proton beam path 260 run substantially in parallel to the tumor 320. The distance between the X-ray beam path 370 and proton beam path diminishes to near zero and/or the X-ray beam path 370 and proton beam path 269 overlap by the time they reach the tumor 320. Simple geometry shows this to be the case given the long distance, of at least a meter, between the tungsten and the tumor 320. The distance is illustrated as a gap 380 in FIG. 3. The X-rays are detected at an X-ray detector 390, which is used to form an image of the tumor 320 and/or position of the patient 330. As a whole, the system generates an X-ray beam that lies in substantially the same path as the proton therapy beam. The X-ray beam is generated by striking a tungsten or equivalent material with an electron beam. The X-ray generation source is located proximate to the proton beam path. Geometry of the incident electrons, geometry of the X-ray generation material, and geometry of the X-ray beam blocker 262 yield an X-ray beam that runs either in substantially in parallel with the proton beam or results in an X-ray beam path that starts proximate the proton beam path an expands to cover and transmit through a tumor cross-sectional area to strike an X-ray detector array or film allowing imaging of the tumor from a direction and alignment of the proton therapy beam. The X-ray image is then used to control the charged particle beam path to accurately and precisely target the tumor, and/or is used in system verification and validation. Vertical Patient Positioning/Immobilization In this section an x-, y-, and z-axes coordinate system and rotation axis is used to describe the orientation of the patient relative to the proton beam. The z-axis represent travel of the proton beam, such as the depth of the proton beam into the patient. When looking at the patient down the z-axis of travel of the proton beam, the x-axis refers to moving left or right across the patient and the y-axis refers to movement up or down the patient. The y-axis is aligned with gravity. A first rotation axis is rotation of the patient about the y-axis and is referred to herein as a rotation axis or y-axis of rotation. In one example, an X-ray generation source is located within about forty millimeters of the charged particle beam path, where the X-ray source maintains a single static position: (1) during use of the X-ray source and (2) during tumor treatment with the charged particles. In this example, the X-ray generation source is a tungsten anode and X-rays emitted from the X-ray source run substantially in parallel with the charged particle beam path. Preferably, use of said X-ray generation source occurs within thirty seconds of subsequent use of the charged particle irradiation system. In another example, the charged particle irradiation system includes horizontal position control of the charged particles, vertical position control of the charged particles, and an X-ray input signal, where the X-ray input signal includes a signal generated by an X-ray source proximate the charged particle beam path. Preferably, the X-ray input signal is used in: setting position of the horizontal position and setting position of the vertical position of the charged particle beam path. Referring now to FIG. 4, a semi-vertical patient positioning and/or immobilization system 400 is described. The patient positioning and/or immobilization system 400 controls movement of the patient during proton beam therapy. The patient is positioned in a semi-vertical position in a proton beam therapy system. As illustrated, the patient is reclining at an angle alpha, α, about 45 degrees off of the y-axis as defined by an axis running from head to foot of the patient. More generally, the patient is optionally completely standing in a vertical position of zero degrees off the of y-axis or is in a semi-vertical position alpha that is reclined about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or 55 degrees off of the y-axis. In one example, the patient positioning system includes an upper body support, where the upper body support includes a semi-upright patient support surface. Preferably, the charged particle irradiation system includes a charged particle beam path and the charged particle beam path passes within about six inches of the semi-upright patient support surface. Still referring to FIG. 4, patient positioning constraints 415 are used to maintain the patient in a treatment position, including one or more of: a seat support 420, a back support 430, a head support 440, an arm support 450, a knee support 460, and a foot support 470. The constraints are optionally and independently rigid or semi-rigid. Examples of semi-rigid material include a high or low density foam or a visco-elastic foam. For example the foot support 470 is preferably rigid and the back support 430 is preferably semi-rigid, such as a high density foam material. One or more of the positioning constraints 415 are movable and/or under computer control for rapid positioning and/or immobilization of the patient. For example, the seat support 420 is adjustable along a seat adjustment axis 422, which is preferably the y-axis; the back support 430 is adjustable along a back support axis 432, which is preferably dominated by z-axis movement with a y-axis element; the head support 440 is adjustable along a head support axis 442, which is preferably dominated by z-axis movement with a y-axis element; the arm support 450 is adjustable along an arm support axis, which is preferably dominated by z-axis movement with a y-axis element; the knee support 460 is adjustable along a knee support axis 462, which is preferably dominated by y-axis movement with a z-axis element; and the foot support 470 is adjustable along a foot support axis, which is preferably dominated by y-axis movement with a z-axis element. In one example, the patient positioning system reduces movement freedom of the tumor in terms of any of: horizontal movement, vertical movement, movement in parallel to said charged particle beam path above a portion of said patient positioning system, yaw, pitch, and roll. Still referring to FIG. 4, the patient is preferably positioned on a patient positioning unit 410, which optionally includes a bottom unit 412 and a top unit 414. Preferably, some of the patient positioning constraints 415 are fixed to and supported by the patient positioning unit 410. For instance, some of the patient positioning constraints 415 are fixed to and supported by the bottom unit 412 and some of the patient positioning constraints 415 are fixed to and supported by the top unit 414. Additionally, preferably the patient positioning unit 410 is adjustable along the y-axis 416 to allow vertical positioning of the patient relative to the proton therapy beam 260. Additionally, preferably the patient positioning unit 410 is rotatable about a rotation axis 417, such as about the y-axis, to allow rotational control and positioning of the patient relative to the proton beam path 260. The rotation of the positioning unit is illustrated about the rotation axis 417 at three distinct times, t1, t2, and t3. Still referring to FIG. 4, an optional camera 480 is illustrated. The camera views the subject 330 creating an video image. The image is provided to one or more operators of the charged particle beam system and allows the operators one safety mechanism for determining if the subject has moved or desires to terminate the proton therapy treatment procedure. Based on the video image, the operators may suspend or terminate the proton therapy procedure. Still referring to FIG. 4, an optional video display 490 is provided to the patient. The video display optionally presents to the patient any of: operator instructions, system instructions, status of treatment, or entertainment. Breath control is optionally performed by using the video display 490. As the patient breathes, internal and external structures of the body move in both absolute terms and in relative terms. For example, the outside of the chest cavity and internal organs both have absolute moves with a breath. In addition, the relative position of an internal organ relative to another body component, such as an outer region of the body, a bone, support structure, or another organ, moves with each breath. Hence, for more accurate and precise tumor targeting, the proton beam is preferably delivered at point a in time where the position of the internal structure or tumor is well defined, such as at the bottom of each breath. The video display 490 is used to help coordinate the proton beam delivery with the patient's breathing cycle. For example, the video display 490 optionally displays to the patient a command, such as a hold breath statement, a breath statement, a countdown indicating when a breadth will next need to be held, or a countdown until breathing may resume. Referring now to FIG. 5, an example of the back support 430 is further described. Referring to FIG. 5, an example of a perspective orientation of the back support 430 is illustrated. The back support is preferably curved to support the patient's back and to wrap onto the sides of the patient's torso. The back support preferably has two semi-rigid portions, a left side 510 and right side 520. Further, the back support 430 has a top end 530 and a bottom end 540. A first distance 550 between the top ends 530 of the left side 510 and right side 520 is preferably adjustable to fit the upper portion of the patient's back. A second distance 560 between the bottom ends 540 of the left side 510 and right side 520 is preferably independently adjustable to fit the lower portion of the patient's back. Referring now to FIG. 6, an example of the knee support 460 is further described. The knee support preferably has a left knee support 610 and a right knee support 620 that are optionally connected or individually movable. Both the left and right knee supports 610, 620 are preferably curved to fit standard sized knees 332. The left knee support 610 is optionally adjustable along a left knee support axis 612 and the right knee support 620 is optionally adjustable along a right knee support axis 622. Alternatively, the left and right knee supports 610, 620 are connected and movable along the knee support axis 462. Both the left and right knee supports 610, 620, like the other patient positioning constraints 415, are preferably made of a semi-rigid material, such as a low or high density foam, having an optional covering, such as a plastic or leather. Referring now to FIG. 7, an example of the head support 440 is further described. The head support 440 is preferably curved to fit a standard or child sized head 336. The head support 440 is optionally adjustable along a head support axis 442. Further, the head supports 440, like the other patient positioning constraints 415, is preferably made of a semi-rigid material, such as a low or high density foam, and has an optional covering, such as a plastic or leather. Still referring to FIG. 7, an example of the arm support 450 is further described. The arm support preferably has a left hand grip 710 and a right hand grip 720 used for aligning the upper body of the patient 330 through the action of the patient 330 gripping the left and right hand grips 710, 720 with the patient's hands 334. The left and right hand grips 710, 720 are preferably connected to the arm support 450 that supports the mass of the patient's arms. The left and right hand grips 710, 720 are preferably constructed using a semi-rigid material. The left and right hand grips 710, 720 are optionally molded to the patient's hands to aid in alignment. Positioning System Computer Control One or more of the patient positioning unit 410 components and/or one of more of the patient positioning constraints 415 are preferably under computer control, where the computer control positioning devices, such as via a series of motors and drives, to reproducibly position the patient. For example, the patient is initially positioned and constrained by the patient positioning constraints 415. The position of each of the patient positioning constraints 415 is recorded and saved by the main controller 110, by a sub-controller or the main controller 110, or by a separate computer controller. Then, medical devices are used to locate the tumor 320 in the patient 330 while the patient is in the orientation of final treatment. The imaging system 170 includes one or more of: MRI's, X-rays, CT's, proton beam tomography, and the like. Time optionally passes at this point where images from the imaging system 170 are analyzed and a proton therapy treatment plan is devised. The patient may exit the constraint system during this time period, which may be minutes, hours, or days. Upon return of the patient to the patient positioning unit 410, the computer can return the patient positioning constraints 415 to the recorded positions. This system allows for rapid repositioning of the patient to the position used during imaging and development of the treatment plan, which minimizes setup time of patient positioning and maximizes time that the charged particle beam system 100 is used for cancer treatment Proton Beam Therapy Synchronization with Breathing In another embodiment, delivery of a proton beam dosage is synchronized with a breathing pattern of a subject. When a subject, also referred to herein as a patient, is breathing many portions of the body move with each breath. For example, when a subject breathes the lungs move as do relative positions of organs within the body, such as the stomach, kidneys, liver, chest muscles, skin, heart, and lungs. Generally, most or all parts of the torso move with each breath. Indeed, the inventors have recognized that in addition to motion of the torso with each breath, various motion also exists in the head and limbs with each breath. Motion is to be considered in delivery of a proton dose to the body as the protons are preferentially delivered to the tumor and not to surrounding tissue. Motion thus results in an ambiguity in where the tumor resides relative to the beam path. To partially overcome this concern, protons are preferentially delivered at the same point in a breathing cycle. Initially a rhythmic pattern of breathing of a subject is determined. The cycle is observed or measured. For example, a proton beam operator can observe when a subject is breathing or is between breaths and can time the delivery of the protons to a given period of each breath. Alternatively, the subject is told to inhale, exhale, and/or hold their breath and the protons are delivered during the commanded time period. Preferably, one or more sensors are used to determine the breathing cycle of the individual. For example, a breath monitoring sensor senses air flow by or through the mouth or nose. Another optional sensor is a chest motion sensor attached or affixed to a torso of the subject. Once the rhythmic pattern of the subject's breathing is determined, a signal is optionally delivered to the subject to more precisely control the breathing frequency. For example, a display screen is placed in front of the subject directing the subject when to hold their breath and when to breath. Typically, a breathing control module uses input from one or more of the breathing sensors. For example, the input is used to determine when the next breath exhale is to complete. At the bottom of the breath, the control module displays a hold breath signal to the subject, such as on a monitor, via an oral signal, digitized and automatically generated voice command, or via a visual control signal. Preferably, a display monitor is positioned in front of the subject and the display monitor displays at least breathing commands to the subject. Typically, the subject is directed to hold their breath for a short period of time, such as about one-half, one, two, or three seconds. The period of time the subject is asked to hold their breath is less than about ten seconds as the period of time the breath is held is synchronized to the delivery time of the proton beam to the tumor, which is about one-half, one, two, or three seconds. While delivery of the protons at the bottom of the breath is preferred, protons are optionally delivered at any point in the breathing cycle, such as upon full inhalation. Delivery at the top of the breath or when the patient is directed to inhale deeply and hold their breath by the breathing control module is optionally performed as at the top of the breath the chest cavity is largest and for some tumors the distance between the tumor and surrounding tissue is maximized or the surrounding tissue is rarefied as a result of the increased volume. Hence, protons hitting surrounding tissue is minimized. Optionally, the display screen tells the subject when they are about to be asked to hold their breath, such as with a 3, 2, 1, second countdown so that the subject is aware of the task they are about to be asked to perform. A proton delivery control algorithm is used to synchronize delivery of the protons to the tumor within a given period of each breath, such as at the bottom of a breath when the subject is holding their breath. The proton delivery control algorithm is preferably integrated with the breathing control module. Thus, the proton delivery control algorithm knows when the subject is breathing, where in the breath cycle the subject is, and/or when the subject is holding their breath. The proton delivery control algorithm controls when protons are injected and/or inflected into the synchrotron, when an RF signal is applied to induce an oscillation, as described supra, and when a DC voltage is applied to extract protons from the synchrotron, as described supra. Typically, the proton delivery control algorithm initiates proton inflection and subsequent RF induced oscillation before the subject is directed to hold their breath or before the identified period of the breathing cycle selected for a proton delivery time. In this manner, the proton delivery control algorithm can deliver protons at a selected period of the breathing cycle by simultaneously or near simultaneously delivering the high DC voltage to the second pair of plates, described supra, that results in extraction of the protons from the synchrotron and subsequent delivery to the subject at the selected time point. Since the period of acceleration of protons in the synchrotron is constant, the proton delivery control algorithm is used to set an AC RF signal that matches the breathing cycle or directed breathing cycle of the subject. In yet another example, the patient is held on the rotatable platform, where the rotatable platform holds at least a portion of the patient positioning system. The patient is preferably rotated on the rotatable platform and the charged particles are delivered to the tumor of the patient from a synchrotron of the charged particle system during or interspersed with the step of rotating the patient. Optionally, a respiration signal is generated with a respiration sensor, where the respiration signal corresponds to a breathing cycle of the patient and delivery of the charged particles to the tumor is timed to a set point in said breathing cycle using the respiration signal. Preferably, the charged particles are independently controlled in terms of: a horizontal position of the charged particles and a vertical position of the charged particles. Preferably, the patient is rotated to at least ten rotation positions of the rotatable platform during charged particle therapy where the rotatable platform rotates through at least one hundred eighty degrees and preferably through three hundred sixty degrees during an irradiation period of the patient. Although the invention has been described herein with reference to certain preferred embodiments, one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the spirit and scope of the present invention. Accordingly, the invention should only be limited by the Claims included below. |
|
summary | ||
abstract | Efficiency of installation work of equipment such as an ECCS pump is enhanced. In an installation method of equipment, a pit can unit in which an upper side frame, a pit can, various reinforcing steels including vertical reinforcing bars reinforcing the above from a periphery, and an anchor plate supporting mechanism are integrated is manufactured in advance, and the pit can unit is placed on an MMR via a lower side frame. Further, an anchor bolt unit is disposed on the anchor plate supporting mechanism after primary concrete is deposited, a relative positional relationship of respective foundation bolts relative to the pit can is corrected by using a template, and secondary concrete is deposited under the state in which the positional relationship is corrected. After that, the ECCS pump is carried into the pit can, and an installation of the ECCS pump is completed by fixing the carried ECCS pump through the respective foundation bolts of which bottom sides are embedded. |
|
053717686 | abstract | In a boiling water nuclear reactor fuel bundle, the use of a shortened ferrule spacer in combination with overlying swirl vanes is set forth. In the preferred embodiment, the shortened ferrule spacer is placed under any swirl vanes and has an individual ferrule surrounding each fuel rod at the elevation of the spacer. Each ferrule is given both minimum side wall thickness in the range of 0.020 inches or less as well as reduced height in the order of 0.9 inch or less. The reduced height and thickness of the ferrule spacer is required to maintain pressure drop within acceptable limits and still tends to augment the required liquid film for steam generation over the fuel rod lengths downstream (that is immediately above) the spacer. At the same time, the swirl vane structure is placed immediately above the ferrule spacer overlying the so-called subchannel region of the ferrule spacer between the fuel rods. |
abstract | Neutron shielding for the central column of a tokamak nuclear fusion reactor. The neutron shielding comprises an electrically conductive neutron absorbing material. The neutron shielding is arranged such that the electrically conductive neutron absorbing material forms a solenoid for the initiation of plasma within the tokamak. |
|
claims | 1. An inspection apparatus for inspecting weld zones in a reactor pressure vessel, the inspection apparatus inspecting a weld zone of a control rod drive housing and an area in proximity to the weld zone, the control rod drive housing being placed from the bottom of the reactor pressure vessel to an inside thereof, said inspection apparatus comprising:a probe configured to emit an ultrasonic wave toward the weld zones;means for positioning the inspection apparatus to more than one control rod drive housing that is adjacent to the inspection apparatus;a probe holding unit configured to hold the probe such that an ultrasonic wave transmitting surface of the probe is kept in direct contact with or at a constant distance from an outer surface of the reactor pressure vessel;a pressing unit having a spring configured to press the probe holding unit along a central axis of the control rod drive housing against the reactor pressure vessel; anda rotator configured to rotate the probe holding unit and the pressing unit around the central axis of the control rod drive housing. 2. The inspection apparatus according to claim 1, wherein:the means for positioning the inspection apparatus includes an arm and a positioning pad. 3. The inspection apparatus according to claim 1, wherein:the means for positioning the inspection apparatus includes an ultrasonic-wave or laser range configured for measuring each distance from one or more adjacent control rod drive housings to the inspection apparatus to compute the current position of the inspection apparatus. 4. A method for inspecting weld zones in a reactor pressure vessel, including inspecting a weld zone of a control rod drive housing and an area in proximity to the weld zone, the control rod drive housing being placed from the bottom of the reactor pressure vessel to an inside thereof, said method comprising the steps of:mounting an ultrasonic probe onto a probe holding unit of an inspection apparatus which comprises the probe holding unit configured to hold the ultrasonic probe such that an ultrasonic wave transmitting surface of the ultrasonic probe is kept in direct contact with or at a constant distance from an outer surface of the reactor pressure vessel, a pressing unit having a spring configured to press the probe holding unit along a central axis of the control rod drive housing against the reactor pressure vessel, a rotator configured to rotate the probe holding unit and the pressing unit around the central axis of the control rod drive housing, and an elevator configured to move up and down the ultrasonic probe, the probe holding unit, the pressing unit, and the rotator along the control rod drive housing;setting a focus position of the ultrasonic probe;mounting the inspection apparatus to the control rod drive housing;pressing the ultrasonic probe against the reactor pressure vessel using the elevator so that the spring of the pressing unit against the reactor pressure vessel is brought into its most contracted state;rotating, by the rotator, the ultrasonic probe around the control rod drive housing to a position at which inspection is to be performed;performing the inspection;lowering the ultrasonic probe to a lower portion of the reactor pressure vessel using the elevator after completion of the inspection; andremoving the inspection apparatus from the control rod drive housing. |
|
abstract | An unirradiated nuclear fuel assembly component transport system that includes a clamshell-type inner liner that opens either along its axial dimension or from the top to load and unload the fuel assembly being transported. The exterior dimensions of the liner conform to a generic overpack tubular container that protects the liner from impact loads and fires. |
|
claims | 1. A deflection device for X-ray differential phase-contrast imaging, comprising:a deflection structure comprising a parabolic phase profile,the deflection structure comprising:a first plurality of first areas adapted to change a phase, or an amplitude, or both, of X-ray radiation; anda second plurality of second areas that are transparent to the X-ray radiation,the first and second areas being arranged periodically such that, in the cross section, the deflection structure is provided with a profile arranged such that projections exist in the first areas, and recesses exist in the second areas, adjacent projections forming respective side surfaces partly enclosing the respective recess arranged therebetween,wherein the side surfaces of each respective recess has a varying distance across the depth of the recess, andwherein each projection comprises at least two steps between a lower part of the projection and an upper part of the projection. 2. The deflection device according to claim 1, wherein an intensity profile is reproduced at a distance of less than 1/16 of a Talbot distance. 3. The deflection device according to claim 1, wherein the profile of the deflection structure is provided with a discretized shape. 4. The deflection device according to claim 1, wherein the first areas are provided with a plurality of projection shapes; wherein the different projection shapes are arranged in a repetitive order. 5. The deflection device according to claim 1, wherein the profile of the deflection structure is provided as a plurality of curved profile segments, and the segments are generated by wrapping back curve segments by π or an integer multiple of π. 6. A detector arrangement of an X-ray system, the detector arrangement configured to generate phase-contrast images of an object, the detector arrangement comprising:a phase grating;an analyzer grating; anda detector comprising a sensor adapted to record intensity variations of X-ray radiation, wherein the phase grating is provided as the deflection device according to claim 1. 7. An X-ray image acquisition device configured to generate phase-contrast images of an object, the X-ray acquisition device comprising:an X-ray source configured to generate X-ray radiation;a phase grating;an analyzer grating; anda detector, wherein the X-ray image acquisition device is adapted to provide an X-ray beam with sufficient coherence that interference exists at a location of the analyzer grating, the phase grating, the analyzer grating and the detector being provided as the detector arrangement according to claim 6. 8. The X-ray image acquisition device according to claim 7, comprising:a source grating comprising a source grating pitch, and adapted to split the X-ray radiation of the X-ray source generating the at least partly coherent X-ray radiation, andwherein a ratio of the source grating pitch to an analyzer grating pitch is equal to a ratio of a distance between the source grating and the phase grating to a distance between the phase grating and the analyzer grating. 9. An X-ray imaging system for differential phase contrast imaging, comprising:the X-ray image acquisition device according to claim 7, and configured to generate phase-contrast images;a processor adapted to control the X-ray source and phase-stepping of the analyzer grating and/or the phase grating; andan interface adapted to provide detected raw image data to the processor. 10. A method for differential phase contrast imaging, the method comprising:applying at least partly coherent X-ray radiation to an object of interest;applying the X-ray radiation passing the object to a phase grating recombining the splitted beams in an analyzer plane;applying the recombined beams to an analyzer grating arranged in the analyzer plane;recording raw image data with a sensor while transversely stepping an analyzer grating or a phase grating with multiple steps with a step size of at most p/(n*k); andwherein p is a pitch of the analyzer grating or the phase grating, n is a reciprocal of a duty cycle of the analyzer grating, and k is larger than 1, and the phase grating in is the deflection device according to claim 1. 11. A non-transitory computer readable medium comprising instructions stored thereon, executable on a processor, to cause the processor to control the deflection device according to claim 1. 12. The deflection device according to claim 1, wherein the parabolic phase profile does not comprise sharp-edges, or stepped portions, in the first plurality of first areas between the second plurality of second areas. 13. An absorption device for X-ray differential phase-contrast imaging, comprising:an absorption structure, comprising:a first plurality of first absorption areas that are opaque to X-rays; anda second plurality of second absorption areas that are transparent to X-rays, the first absorption areas and second absorption areas being arranged periodically such that, in the cross section, the absorption structure is provided with an absorption profile such the first absorption areas comprise absorption projections that partly enclosing the second absorption areas therebetween, said second absorption areas comprising X-ray transparent fillings, wherein the transparent fillings each comprises a wider cross section than a width of the absorption projections. 14. The absorption device according to claim 13, wherein the absorption device is an analyzer grating. 15. The absorption device according to claim 13, wherein, over one pitch, a ratio of the cross-sectional area of first absorption areas to the cross sectional area of the second absorption areas is less than 1:1. 16. The absorption device according to claim 15, wherein, over one pitch, the ratio of the cross-sectional area of the first absorption areas to the cross sectional area of the second absorption areas is 1:8. 17. The absorption device according to claim 14, wherein a duty cycle of the analyzer grating is less than 50%. 18. The absorption device according to claim 17, wherein the duty cycle of the analyzer grating is less than 20%. 19. A deflection device for X-ray differential phase-contrast imaging, comprising:a deflection structure, comprising a plurality of periods,the deflection structure comprising:a first plurality of first areas adapted to change a phase, or an amplitude, or both, of X-ray radiation; anda second plurality of second areas that are transparent to the X ray radiation the first and second areas being arranged periodically such that, in the cross section,the deflection structure is provided with a profile arranged such that projections exist in the first areas, and recesses exist in the second areas, adjacent projections forming respective side surfaces partly enclosing the respective recess arranged therebetween,wherein the side surfaces of each respective recess has a varying distance across the depth of the recess, andwherein at least one period of the periodically arranged first and second area is configured to allow the deflection structure to function, at least as per a shape of the deflection structure, as a micro-lense structure for focusing the X-ray radiation such that, at a distance from the micro-lens structure, at least one intensity maximum is obtained. 20. The deflection device according to claim 19, wherein the profile of the deflection structure is provided with a discretized shape. 21. The deflection device according to claim 19, wherein the first areas are provided with a plurality of projection shapes; wherein the different projection shapes are arranged in a repetitive order. 22. The deflection device according to claim 19, wherein the profile of the deflection structure is provided as a plurality of curved profile segments, and the plurality of curved profile segments are generated by wrapping back curve segments by π or an integer multiple of π. 23. The deflection device according to claim 19, wherein an intensity profile is reproduced at a distance of less than 1/16 of a Talbot distance. 24. The deflection device according to claim 19, wherein the parabolic phase profile does not comprise sharp-edges, or stepped portions, in the first plurality of first areas between the second plurality of second areas. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.