text
stringlengths 1.55k
332k
| label
class label 9
classes |
|---|---|
a drill string 20 shown in fig1 includes a drill pipe 22 supported and operated from above ground , a measurement while drilling ( mwd ) package 24 contained within an enlarged lower section 26 of the drill pipe and a drill bit 28 . drilling mud , a fluid used to remove cuttings and stabilize down - hole pressure , is circulated as shown by the arrows along the drill pipe 22 , over and through the mwd package 24 , through nozzles in the drill bit 28 and back along the annular space between the drill pipe and the bore hole . feed and return lines 32 and 34 , respectively , connect the drill pipe with a pump 36 and a mud pit 38 where cuttings are separated out of the fluid . the mwd package 24 contains instrumentation 39 to sense physical parameters around the drill head , a signal processing package 40 to convert sensor output to electrical impulses , a power supply 42 and a vortex chamber fluid pulser 44 to convert the electrical impulses into pressure waves , detected on the surface by a pressure transducer 45 in the wall of feed line 32 . the vortex chamber mud pulser 44 , fig2 and 3 , has an actuator module 46 and a valve module 48 . the actuator module is smaller in diameter than the drill pipe , allowing drilling mud to flow between the module and the pipe . the actuator module converts electrical impulses received from the signal processing package into movement of a control rod 50 extending into the valve module . a pair of coaxial opposed solenoids 52 and 54 are housed in the actuator module . the plungers of the two solenoids ( not shown ) are connected to a linkage arm 56 pivotably fixed on one end to the actuator module housing 58 by a first pin 60 and pivotably connected on the opposite end by a second pin 62 to the rigid control rod 50 extending through a passage 66 in the housing 84 of valve module 48 . energization of the first solenoid urges linkage 56 and control rod 50 a short distance ( on the order of 0 . 20 inches ) toward the valve module 48 into an extended position ; alternate energization of the second solenoid returns the linkage and rod toward the actuator module 46 into a retracted position . the actuator module 46 is filled with hydraulic fluid 68 surrounding the solenoids . a diaphragm assembly 70 is attached to the external surface of the actuator module housing and communicates with the hydraulic fluid 68 through an orifice 72 . a pressure compensation diaphragm 74 expandably seals the fluid in the actuator module , allowing pressure to be equalized across the walls of the housing and compensating for changes in the internal volume of the actuator module due to movement of the plungers , linkage and control rod , expansion from solenoid heating and changes in ambient pressure . a flexible rubber bellows 76 sealingly surrounds the control rod between the actuator module and the valve module . alternative configurations and assemblies , for instance , piezo - electric stacks , bi - morph materials and state changing fluids , may be used to translate the electrical impulses from the signal processor into mechanical movement of the control arm . the valve module 48 is sized to fit tightly in the drill pipe and has a circumferential groove 78 machined into the outer surface to seat an o - ring 80 used to provide a seal between the upper inlet portion 82 of the valve module housing 84 and the lower outlet portion 86 . an inlet duct 88 having an axis along the axis of the drill pipe 22 is located on the upper portion of the valve module and communicates with the radial wall of an annular chamber 90 . annular chamber 90 has an axis of revolution lying normal to the axis of the drill pipe 22 . two outlet ducts 92 and 94 are coaxial with the annular axis of revolution and communicate with the vortex chamber through an open cylindrical chamber 96 , coaxial with outlet ducts and extending radially to the annular vortex chamber . the axial outlet ducts 92 and 94 can be machined to an efficient nozzle shape or to threadingly receive commercially available drill bit nozzles . the control rod 50 linking the actuator module 46 to the valve module 48 extends through passage 66 into the annular chamber 90 in a direction parallel to the axis of the drill pipe . passage 66 and control rod 50 are offset from but adjacent the radial inlet duct 88 , perpendicular to the axis of revolution of annular chamber 90 and centered thereto . a perpendicular tab 102 is attached to the free end of control rod 50 and extends in each direction a distance less than half the width of annular chamber 90 forming a &# 34 ; t &# 34 ; junction with the control rod . a groove or slot 104 is machined into the interior wall of the annular chamber 90 and sized to accept tab 102 in a recessed position flush with the contour of the chamber wall when control rod 50 is in the retracted position . when control rod 50 is in the extended position , tab 102 is displaced into the vortex chamber by a distance corresponding to the distance control rod 50 is urged by linkage 56 . the composite geometry of the annular chamber 90 , the axial outlet ducts 92 and 94 , the cylindrical chamber 96 , passage 66 and slot 104 form a vortex chamber 105 , shown in fig4 having geometric symmetry on either side of the plane passing through the axes of inlet duct 88 and outlet ducts 92 and 94 . the valve module housing 84 is tapered on opposite sides at 93 and 95 in the vicinity of the two axial outlet ducts 92 and 94 , respectively , to permit free flow between the housing and the drill pipe of drilling mud passing through the vortex chamber 105 . a downwardly converging flow guide 106 can be used to channel the annular flow of drilling mud past the actuator module 46 into inlet duct 88 of the valve module 48 . the symmetry of the vortex chamber 105 greatly simplifies fabrication of the valve module . each identical half of the chamber , as shown in fig4 is machined from a piece of solid stock , the two halves are assembled together into a unit , and the unit is turned on a lathe to achieve the required diameter and to cut o - ring groove 78 . tapered sections 93 and 95 are then milled into the sides of the unit . the two halves are disassembled , the retractable control rod 50 and tab 102 assembly is positioned and the halves are reassembled to each other by bolts , brazing or other means . these simple fabrication techniques are generally well suited to modern numerical control machine shop practice . in use , the vortex chamber mud pulser 44 is positioned in the drill pipe 22 near the instrumentation 39 , signal processor 40 and power supply 42 . electrical impulses are fed from the signal processor to the actuator module 46 in sequences containing data encoded into binary form and applied alternately to a first and second coaxial solenoid 52 and 54 to magnetically move the plunger and , through linkage 56 , to selectively extend and retract a control rod 50 alternatively toward and away from the valve module 48 . the mass and travel distance of the control rod and tab are small ; consequently less actuator power is required and system response time is faster than in typical mechanical systems . moreover , the simplicity of movement and minimal inertia of the control rod and tab assures a rugged shock - resistant device well suited to the down - hole environment . drilling mud propelled down the drill pipe by pump 36 passes around the actuator module and into inlet duct 88 in the valve module 48 . passage of mud around the valve module is prevented by o - ring 80 sealingly compressed between the valve module and the drill pipe . the mud flows through the inlet into the vortex chamber 105 . when the control rod 50 is in the retracted position , tab 102 is recessed in groove 104 and does not interfere with the flow of the drilling mud . undisturbed flow encircles the vortex chamber 105 in a relatively symmetric pattern resulting in radial flow into the axial outlet ducts 92 and 94 as shown in fig5 and 6 , with a plane of essentially zero flow formed midway between the two outlet ducts along the vortex chamber plane of symmetry . in prior art single outlet devices this plane is formed by a back plate and is subjected to high pressure and wear . here the pressure is equalized as the fluid is free to flow symmetrically in both directions . when control rod 50 is extended in response to an electrical impulse sent to the actuator module 48 from the signal processor 40 , tab 102 is projected into the vortex chamber 105 and the chamber ceases to have symmetry about the axis of the radial inlet duct 88 . the obstruction produced by tab 102 initiates a vortical flow pattern , shown by the arrows in fig7 and 8 , following the chamber walls away from the disturbance and producing a &# 34 ; free &# 34 ; vortex . in a &# 34 ; free &# 34 ; vortex the angular momentum of the fluid is conserved and the angular velocity of the fluid increases as the flow swirls toward the centrally located outlet ducts 92 and 94 . the increasing velocity produces a large pressure gradient between the slower moving and higher pressure flow near the chamber walls and the faster moving and lower pressure flow approaching the outlets . the magnitude of the throttling effect of the gradient is determined by the geometry of the chamber . the vortex increases the tangential velocity of the flow , reduces the static pressure normally driving the fluid through the outlets and produces a rapid reduction in flow rate , known as a &# 34 ; water hammer &# 34 ;. the sudden flow restriction produces a pressure pulse propagating through the fluid at the speed of sound . a similar pulse is initiated by the withdrawal of tab 102 from the chamber as the flow returns to an unperturbed radial flow pattern with an attendant rapid increase in flow rate . pressure pulses thus generated travel up the drilling mud and are sensed by a pressure transducer 45 in feed line 32 on the surface where the data encoded in the sequences or patterns of pressure pulses are interpreted . in view of the foregoing , it is apparent that the present invention makes available a mud pulser capable of viably telemetering down - hole sensor signals to operators located at the surface . the ability to produce a high signal rate from a rugged , reliable and inexpensive pulser has not been heretofore possible in the prior art . inasmuch as the present invention is subject to many variations , modifications and changes in detail , it is intended that all subject matter discussed above or shown in the accompanying drawings be interpreted as illustrative only and not be taken in a limiting sense .
| 8General tagging of new or cross-sectional technology
|
this invention relates to a soybean cultivar designated 11939 - 40 which was developed by single plant selection from another soybean cultivar , 11939 , which was disclosed and claimed in u . s . ser . no . 10 / 108 , 326 . soybean cultivar 11939 - 40 differs from its “ mother ” cultivar , 11939 , in more than one important characteristic , as described below . a single plant selection from soybean cultivar 11939 ( developed as described in detail in u . s . ser . no . 10 / 108 , 326 ) was made in a winter nursery in south america and grown in a progeny row at gilbert , ia in plot omr9667 - 34 in 2000 . seed gathered from this progeny row was used for agronomic and yield trial evaluations in subsequent seasons , and named 11939 - 40 on jul . 30 , 2001 . this new soybean cultivar was characterized for important morphological , agronomic and performance qualities in evaluation trials , greenhouse studies , and disease nurseries . soybean cultivar 11939 - 40 has uniformity and stability of its morphological and other characteristics . the variety description information ( table i ) provides a summary of characteristics of soybean cultivar 11939 - 40 plant characteristics . as used herein , “ a soybean plant having the physiological and morphological characteristics of soybean cultivar 11939 - 40 ” is a plant having the characteristics set forth in table 1 . soybean cultivar 11939 - 40 differs from cultivar 11939 in that 11939 - 40 breeds true for pure purple flower color . the soybean cultivar 11939 - 40 does not differ significantly from 11939 in important agronomic characteristics such as lodging resistance and plant height ( table 2 ). in table 3 , the yield and maturity date of soybean cultivars 11939 - 40 and 11939 are compared . as can be seen in table 3 , the soybean cultivar 11939 - 40 was found to mature one day later than soybean cultivar 11939 in three years of replicated , comparative studies . therefore , 11939 - 40 is characterized as a maturity group ii soybean cultivar with a relative maturity of 2 . 3 , whereas 11939 is a maturity group ii soybean cultivar with a relative maturity of 2 . 1 ( table 1 ). as can be seen in table 3 , a statistically significant difference ( as quantified by a paired t test at a p = 0 . 10 level of probability ) exists in yield between soybean cultivar 11939 - 40 and cultivar 11939 . soybean cultivar 11939 - 40 has a nearly 1 . 5 bu / ac improved yield over that of cultivar 11939 . the present invention contemplates using the 11939 - 40 soybean plant , or part thereof , or a soybean plant having the physiological and morphological characteristics of the 11939 - 40 soybean plant , as a source of breeding material for developing a soybean plant in a soybean breeding program using plant breeding techniques . plant breeding techniques useful in the developing soybean plants include , but are not limited to , single seed descent , modified single seed descent , recurrent selection , reselection , mass selection , bulk selection , backcrossing , pedigree breeding , mutation breeding , restriction fragment length polymorphism enhanced selection , genetic marker enhanced selection , and transformation . plant breeding techniques are known to the art and have been described in the literature . for example , see u . s . pat . no . 6 , 143 , 954 , which , along with the references cited therein , is incorporated by reference herein . as used herein , the term “ plant ” includes plant cells , plant protoplasts , plant cell tissue cultures from which soybean plants can be regenerated , plant calli , plant clumps , and plant cells that are intact in plants or parts thereof . “ plant part ” includes , but is not limited to , embryos , pollen , ovules , seeds , flowers , pods , leaves , roots , root tips , anthers , and the like . one may obtain soybean plants according to the present invention by directly by growing the seed of 11939 - 40 or by any other means . a soybean plant having all of the physiological and morphological characteristics of 11939 - 40 can be obtained by any suitable means , including , but not limited to , regenerating plants or plant parts from tissue culture or cuttings . the scope of the present invention is not limited by the method by which the plant is obtained . seed from soybean cultivar 11939 - 40 , disclosed above and recited in the appended claims , was deposited with the american type culture collection ( atcc ), 10801 university boulevard , manassas , virginia 20110 on ______ , 2004 . the present invention is not limited to the exemplified embodiments , but is intended to encompass all such modifications and variations as come within the scope of the following claims .
| 0Human Necessities
|
disclosed is a system and method for facilitating check writing . generally speaking , the system and method can be used to access a network - based ( e . g ., web - based ) imaging service that enables the user to identify the imaging data to be used to generate checks . once the data has been identified , it can be stored by the service and , if desired , one or more hard copy documents ( i . e ., checks ) can be generated . to facilitate description of the inventive system and method , example systems are discussed with reference to the figures . although these systems are described in detail , it will be appreciated that they are provided for purposes of illustration only and that various modifications are feasible without departing from the inventive concept . after the description of the example systems , examples of operation of the systems are provided to explain the manners in which check generation can be facilitated . [ 0015 ] fig1 is a schematic representation of the general operation of the invention . as shown in this figure , an imaging client 100 communicates with one or more imaging sources 102 and one or more imaging destinations 104 , which can in some arrangements comprise the same device and / or service . the imaging source ( s ) 102 represent any of a wide variety of devices / services that can be accessed by the imaging client 100 and used to input data that will be used to create a document , such as a check . once the imaging data have been input , the imaging client 100 can identify data from the imaging source ( s ) 102 that are to be used by the imaging destination ( s ) 104 for printing , as well as the arrangement of the data within the printed document . the image destination ( s ) 104 can then print the document ( s ) according to the client &# 39 ; s selections . [ 0016 ] fig2 illustrates an example system 200 with which the invention can be implemented . as indicated in this figure , the example system 200 generally comprises a computing device 202 , a printing device 204 , and one or more network servers 206 , each of which can be connected to a network 208 . as indicated in fig2 the computing device 202 can be arranged as a personal computer ( pc ). more broadly , however , the computing device 202 can comprise substantially any device that can be used to communicate via the network 208 and , therefore , access and / or be accessed by check writing services made available over the network . by way of example , the computing device 202 can alternatively comprise a notebook computer , macintosh computer , handheld computer such as a personal digital assistant or mobile telephone , smart card , etc . the printing device 204 comprises any device that is capable of generating hardcopy documents in the form of a check . although the term “ printing device ” is used herein , it is to be understood that the disclosure is not limited to any particular type of device that provides this functionality . accordingly , the term is intended to include any appliance or printing device ( e . g ., printer , photocopier , facsimile machine , multifunction peripheral ( mfp ), etc .) that either inherently provides this functionality or which provides it when a suitable accessory is used in conjunction therewith . the one or more network servers 206 typically comprise computing devices similar in configuration to the computing device 202 , but which normally possess greater resources in terms of processing power , memory , and / or storage space . as will be apparent from the discussions provided below , the network servers 206 are typically used with the internet ( public or private ) and , therefore , typically comprise web servers . although the use of internet networking protocols ( e . g ., transmission control protocol ( tcp ) and / or internet protocol ( ip )) may mean that web protocols ( e . g ., hypertext transfer protocol ( http )) will be used , it will be recognized by those skilled in the art that http is just one of many protocols capable of being used on internet networks . the network 208 normally comprises one or more sub - networks that are communicatively coupled to each other . by way of example , these networks can include one or more local area networks ( lans ) and / or wide area networks ( wans ) that comprise a set of networks that forms part of the internet . in addition to the network connections shown in fig2 one or more of the computing device 202 and servers 206 can be directly connected to the printing device 204 ( not shown ). direct connection between the computing device 202 and the printing device 204 may be likely where the printing device is used in a home or small office environment in which the user does not have access to a network . direct connection between a network server 206 and the printing device 204 may be likely where the server functions as a print server controlled by a check writing service . as noted above , other system arrangements are possible for implementation of the invention . for instance , the system can be arranged as one or more of the example systems identified in u . s . patent application ser . no . ______ , entitled “ system and method for charging for printing services rendered ,” by shell simpson , ward foster , and kris livingston and bearing attorney docket no . 10008256 - 1 , the disclosure of which is hereby incorporated by reference into the present disclosure . in such a case , the data to be printed ( i . e ., imaging data ) can be accessed by imaging destinations ( e . g ., printing services ) in an , at least partially , automated manner . [ 0020 ] fig3 is a schematic view illustrating an example architecture for the printing device 204 identified in fig2 . as indicated in fig3 the printing device 204 can generally comprise a processing device 300 , memory 302 , hard copy generation hardware 304 , one or more user interface devices 306 , one or more input / output ( i / o ) devices 308 , and one or more network interface devices 310 , each of which is connected to a local interface 312 that normally comprises one or more internal and / or external buses . the processing device 300 is adapted to execute commands stored in memory 302 and can comprise a general - purpose processor , a microprocessor , one or more application - specific integrated circuits ( asics ), a plurality of suitably configured digital logic gates , and other well known electrical configurations comprised of discrete elements both individually and in various combinations to coordinate the overall operation of the printing device 204 . the memory 204 can include any one of a combination of volatile memory elements ( e . g ., random access memory ( ram , such as dram , sram , etc .)) and nonvolatile memory elements ( e . g ., rom , hard drive , tape , cdrom , etc .). the hard copy generation hardware 304 comprises the components with which the printing device 204 can generate hard copy documents and , more particularly , with which the device can generate checks . for example , the hard copy generation hardware 304 can comprise a print engine that is possible of many different configurations . the one or more user interface devices 306 , where provided , comprise those components with which the user can interact with the printing device 204 . by way of example , the user interface devices 306 comprise one or more function keys and / or buttons with which the operation of the device 204 can be controlled , and a display , such as a liquid crystal display ( lcd ), with which information can be visually communicated to the user and , where the display comprises a touch - sensitive screen , commands can be entered . with further reference to fig3 the one or more i / o devices 308 are adapted to facilitate communications of the printing device 204 with another device and may therefore include one or more serial , parallel , small computer system interface ( scsi ), universal serial bus ( usb ), ieee 1394 ( e . g ., firewire ™), and / or personal area network ( pan ) components . the network interface devices 310 comprise the various components used to transmit and / or receive data over a network 208 . by way of example , the network interface devices 310 include a device that can communicate both inputs and outputs , for instance , a modulator / demodulator ( e . g ., modem ), wireless ( e . g ., radio frequency ( rf )) transceiver , a telephonic interface , a bridge , a router , network card , etc . the memory 302 typically comprises an operating system 314 . in addition , where the printing device 204 is adapted to support a service that facilitates check writing , the memory 204 typically includes an embedded network server 316 . the operating system 314 controls the execution of other software and / or firmware and provides scheduling , input - output control , file and data management , memory management , and communication control and related services . the embedded network server 316 comprises software and / or firmware that is used to serve information to the network 208 . where the network comprises the internet ( public or private ), the embedded network server 316 may function as an embedded web server . as indicated in fig3 the embedded network server 316 , where provided , comprises a check writing service 318 that , as is discussed in greater detail below , can be used to facilitate the check writing process . the operation of the network server 316 and the check writing service 318 when acting in this capacity is described below with reference to fig4 - 5 b . although the check writing service 318 has been identified as being supported by the printing device 204 , persons having ordinary skill in the art will appreciate that this service could , alternatively , be provided by another device , for instance one or more of the network servers 206 . as will be apparent from the discussions that follow , however , the location of the check writing service 318 is not critical to the operation of the inventive system and method . various software and / or firmware has been described herein . it is to be understood that this software and / or firmware can be stored on any computer - readable medium for use by or in connection with any computer - related system or method . in the context of this document , a computer - readable medium denotes an electronic , magnetic , optical , or other physical device or means that can contain or store a computer program for use by or in connection with a computer - related system or method . these programs can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . in the context of this document , a “ computer - readable medium ” can be any means that can store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer - readable medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a nonexhaustive list ) of the computer - readable medium include an electrical connection having one or more wires , a portable computer diskette , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom , eeprom , or flash memory ), an optical fiber , and a portable compact disc read - only memory ( cdrom ). note that the computer - readable medium can even be paper or another suitable medium upon which a program is printed , as the program can be electronically captured , via for instance optical scanning of the paper or other medium , then compiled , interpreted or otherwise processed in a suitable manner if necessary , and then stored in a computer memory . an example system having been described above , operation of the system will now be discussed . in the discussions that follow , flow diagrams are provided . it is to be understood that any process steps or blocks in these flow diagrams represent modules , segments , or portions of code that include one or more executable instructions for implementing specific logical functions or steps in the process . it will be appreciated that , although particular example process steps are described , alternative implementations are feasible . moreover , steps may be executed out of order from that shown or discussed , including substantially concurrently or in reverse order , depending on the functionality involved . [ 0028 ] fig4 provides a general overview of the manner in which a user can use the example system 200 , or another appropriate system , to facilitate check writing . beginning with block 400 , the check writing service 318 is accessed . typically , this access is gained via the network 208 . for instance , where the check writing service 318 executes on the printing device 204 , the user can access the service by directing an appropriate browser to the address ( e . g ., uniform resource locator ( url )) of the service . after the check writing service 318 has been accessed , the user can identify the data that are to be printed on the check that will be generated , as indicated in block 402 . this information typically includes at least a payee name and a payment amount . once the data has been entered by the user , the check writing service 318 can store the data , as indicated in block 404 . at this point , the user can print the data , as indicated in block 406 , by issuing a print command to the check writing service 318 . as noted above , the data are typically printed on preprinted check media that are contained within the printing device 204 . referring now to fig5 a - 5 b , a more detailed example of the operation of the system 200 will be provided . more particularly , an example of operation of the check writing service 318 is provided . beginning with block 500 of fig5 a , the user browses to the check writing service 318 using an appropriate network browser ( e . g ., web browser ) that executes on the user computing device 202 . typically , this service 318 comprises a web site that is accessed via the internet ( and / or intranet ). to provide for security , this communication , and those that follow , can be accessed through a secure sockets layer ( ssl ) or through use of another security scheme . as noted above , the check writing service 318 can , for example , be executed upon the printing device 204 . once the check writing service 318 is accessed , the service downloads content to the user browser , as indicated in block 502 . this content normally includes various text and / or graphics that are displayed to the user to facilitate interfacing between the user and the service 318 . this content can , optionally , include one or more applications ( e . g ., applets ) that perform certain functions to aid the check writing service 318 and , thereby , facilitate check generation . after the check writing service 318 has been accessed , the user can be prompted to verify his or her authorization to use the check writing service , as indicated in block 504 . by way of example , the user can be prompted to enter a user name and password . notably , if the user already logged on to the computing device 202 that is being used to access the check writing service 318 , the above - noted verification procedure may be unnecessary . assuming the user to be authorized and therefore capable of establishing his or her authorization , the check writing service 318 can confirm the user authorization , as indicated in block 506 . at this point , the check writing service 318 can prompt the user to identify the data to be printed , as indicated in block 508 . typically , this prompting is effected with an interface ( e . g ., graphical user interface ( gui )) in the form of one or more web pages that are presented to the user with the user browser . for example , the check writing service 318 can prompt the user to manually enter the data or identify the location of the data . the latter option may be particularly attractive where the user wishes to print several different checks using data from one or more databases . for instance , where the data for several different insurance claimants resides in one or more such databases , the user can identify the location ( s ) of the database ( s ) such that the data can be uploaded to the check writing service 318 . these databases can , for instance , reside on the user computing device 202 ( e . g ., on a hard disk ) and may comprise one or more files associated with a given user application ( e . g ., peachtree ™ quicken ™, etc .). if this option is selected , one or more applications ( e . g ., applets or possibly signed applets which are allowed extensive access to the capabilities of the client system ) that were downloaded to the user browser as content can form part of an upload mechanism that is used to perform the upload operation . for instance , the applications can generate a pop - up dialogue box or further web page with which the user can provide one or more file names from which the data is to be retrieved . where the user does not know of the correct filename ( s ), the applications can , for instance , be used to scan the user &# 39 ; s computing device hard disk so that the user may browse through the contents of the hard disk to locate the appropriate file ( s ). where the databases comprise remote databases , the user can provide an address ( e . g ., url ) of the databases to be accessed so that the check writing service 318 can retrieve the data . again , this information can be provided with a dialogue box or further web page that is presented to the user . by way of example , the database ( s ) can include one or more internet - accessible database management systems ( e . g ., oracle , sybase , etc .) that the user may presently use to store the data to be printed . in such a circumstance , the user may further be prompted to provide additional information that identifies the print data . for example , the user may be prompted to provide a structured query language ( sql ) query to identify which data ( e . g ., records ) are to be accessed by the check writing service 318 , and any other details that may be pertinent to identifying and accessing the data ( e . g ., the credentials needed to access the database , the network address of the database , the name of the database , etc .). irrespective of the manner in which the data to be printed is identified , the data identification can be received by the check writing service 318 , as indicated in block 510 . at this point , the various data to be printed can be stored by the service 318 , as indicated in block 512 . where the service 318 is supported by the printing device 204 , ( i . e ., embedded within the device ), the data can be stored within memory 302 ( e . g ., an internal hard disk ) of the device . where the service 318 is not supported by the printing device 204 , or where the device lacks the storage resources to store the data in memory 302 , the data can be stored in another appropriate storage location that is accessible by the service . with reference to fig5 b and decision element 514 , it can then be determined whether checks are to be printed . if the checks are not to be printed , flow for the session is terminated and the user may return to the service 318 at a later time to print the checks , if desired . if , however , the user does wish for checks to be printed , the check writing service 318 facilitates this printing , as indicated in block 516 , by , for example , sending a print job comprising the data and its arrangement to the hard copy generation hardware 304 . as noted above , there is nearly always potential for fraud when printing checks . to cite one example way in which fraud can be perpetrated , an unscrupulous user can simulate a jam of the printing device 204 in an attempt to access the preprinted blank checks that the device contains . to prevent such activity or , to at least more quickly identify the perpetrator , the check writing service 318 can be configured to detect when a jam condition is registered . this detection is possible in that the check writing service 318 is closely linked with the printing device 204 ( e . g ., stored in the printing device ). assuming the service 318 to be configured to provide such functionality , flow continues to decision element 518 at which it is determined whether a jam occurs . this determination can be made affirmatively by the check writing service 318 through various detection means , or can be made with reference to a notification that is delivered to the service from another device component . regardless , if no jam occurs during the printing of the check ( s ), flow continues to block 528 described below . if , on the other hand , a jam does occur , flow continues to block 520 at which the jam occurrence is recorded along with information about who sent the print job , when the jam occurred , etc . this information can be recorded within the printing device 204 ( e . g ., within an internal hard disk ) or in another location accessible via the network 208 . in addition , it can be determined , at decision element 522 , whether to alert a responsible party as to the jam condition . in that checks are being printed , such a jam condition is an inherently suspect condition . for this reason , it may be desirable to provide an immediate notification to the responsible party who may , for instance , hold a managerial position . if no alert is to be transmitted , flow continues to decision element 526 described below . if the alert is to be transmitted , however , it is transmitted to the responsible party , as indicated in block 524 . this alert can comprise , for instance , an email message , a text message that is sent to a portable device ( e . g ., pda , mobile telephone ) of the responsible party , a page that is sent to a pager of the responsible party , combinations thereof , etc . accordingly , the responsible party can immediately be made aware of the situation and , if on the premises , immediately investigate the situation personally . with reference to decision element 526 , if the jam is not fixed , flow for the printing session is terminated until such time when the device 204 is again operational . once the jam is fixed , however , the check writing service 318 logs information about the completed check printing session , as indicated in block 528 , such as when the print job was initiated , who initiated the print job , who the listed payee ( s ) is / are , the amount of the check ( s ), etc . by way of example , this information can be stored within memory ( e . g ., internal hard disk ) of the printing device 204 or another designated location that is accessible via the network 208 . at this point , the printing session can be memorialized as indicated in block 530 . this memorialization can take many different forms . by way of example , the check writing service 318 can generate a receipt that can , for instance , be printed along with the printed check so that the user ( i . e ., sender ) can obtain a record of the printing of the check . this record can include some or all of the information that was logged by the check writing service 318 as noted above with reference to block 528 . this printed receipt can then be provided to the payee of the check ( e . g ., insurance claimant ). alternatively , an electronic receipt can be generated for the user and stored in a designated location that is accessible over the network 208 for later retrieval and / or inspection . for instance , the electronic receipt can be stored in a personal imaging repository of the user in the manner described in u . s . patent application ser . no . ______ , identified above ( attorney docket no . 10008256 - 1 ). operating in the manner described above , the system and method can be used to simplify check writing in that the check writing service can be managed from a single control point as opposed to being distributed over several different computing devices . moreover , as noted above , fraud can be prevented and / or quickly discovered with greater ease . although the jam scenario has been discussed in detail , it is to be understood that the same antifraud measures described above can be used for any other type of occurrence that may be deemed suspicious ( i . e ., susceptible to fraudulent activity ) that may arise . while particular embodiments of the invention have been disclosed in detail in the foregoing description and drawings for purposes of example , it will be understood by those skilled in the art that variations and modifications thereof can be made without departing from the scope of the invention as set forth in the following claims .
| 6Physics
|
in an aspect , any biomass may be employed in connection with the processes and reactor ( s ) described herein . for example , the biomass may contain one or more wood ( s ), grass ( es ), and / or any lignocellulosic - containing material . in an effort to overcome the deficiencies of the prior art ( e . g ., the use of immersion and / or soaking ), it may be desirable to improve the efficiency of sugar extraction while reducing the downstream drying and evaporation needs by reducing the liquid in the biomass pretreatment reactor vessel . this reduced liquid environment may be accomplished by using dry conditions with little or no free liquid . but the absence of liquid can cause a unique set of difficulties . in an aspect of the present invention , a reactor design may alleviate the difficulties . in a dry processing reactor , the reactor vessel generally contains two parts : an upper part and a lower part . the upper part of the vessel is a pressurized section where biomass enters and is heated using steam or other gaseous product ( such as ammonia ). the wall ( s ) of the upper portion may be made from carbon steel or stainless steel or another appropriate material . the ultimate pressure of the vessel is dependent on the heating medium . if steam is used the pressure of the vessel at the desired temperature will be about 5 to 25 bar , but if ammonia is used as the heating medium the operating pressure of the vessel could be up to 60 bar at the desired operating temperature . it may be possible to use combinations of steam and ammonia and / or other heating medium ( s ) in certain embodiments of the present invention . the lower part of the vessel may be a bottom discharge section where the internal pressure exerted on the biomass material is different from the external pressure of the cavity in which the discharge device is located . to facilitate a proper mass flow , this reactor discharge device could be similar to a diamondback ® chip bin shape , as described in u . s . pat . no . 5 , 500 , 083 ( which is incorporated herein by reference ), or other one dimensional convergence with side relief , or even other geometric shapes that would allow for smooth discharge of the biomass material without the need for a vibratory or rotary discharge devices . in an aspect , the present invention relies on the geometry of the vessel , rather than external forces ( e . g ., vibration and / or rotation ) to move the biomass . the geometry of the discharge may be important to proper operation of the vessel so deflection of the discharge device walls must be prevented . deflection can be prevented by either constructing the discharge portion with very heavy material or providing for the equalization of pressure inside and outside of the discharge region of the vessel . in order to equalize the pressure , a pressure envelop around the discharge device region of the vessel may exist , thereby reducing the distortion of the discharge device material . the pressure envelop may minimize the differential pressure between the outside and the inside of the discharge devices . this pressure envelope may allow the walls of the discharge device ( which may be corrosion resistant material ) to be as thin as possible because the walls of the pressure envelop ( made of a less costly material such as carbon steel ) can withstand the reactor pressure . the corrosion resistant material may be stainless steel , titanium , zirconium , and / or any other corrosion resistant material . if the pressure envelope is omitted , the metal plates or pieces used in construction of the discharge device become difficult to form and support resulting in a more costly device , especially because they must prevent deflection of and damage to the discharge device . in an aspect , the reactor vessel with the pressure envelope thus advantageously reduces the amount of costly material necessary . gas ( possibly steam ) may be used to heat and pressurize the biomass material in the upper vessel section ( i . e ., where the thermochemical reactions may be primarily occurring ). to equalize the pressure between the reactor vessel and the envelop surrounding the discharge device , the two sections may be connected by a pressure equalization pipe . gas in the reactor vessel upper section could then fill and pressurize the envelop surrounding the discharge device thereby equalizing the pressure between the inside and outside of the discharge device . if roughly equalized , the gas in the reactor vessel and the cavity surrounding the discharge device would be at approximately the same pressure , but not have the same function . the gas to the cavity surrounding the discharge device would not be needed to heat the biomass in the discharge device , but merely to maintain pressure . the gas to the upper part of the reactor vessel would be used to heat the biomass as well as maintain the pressure in the vessel . if condensate of the heating medium is allowed to collect in the pressure envelop , it is possible that there will be a hydrostatic pressure difference between the inside of the discharge device and the cavity ( external of the discharge device ). to prevent this hydrostatic pressure difference from becoming excessive in the region of the discharge device , it is possible to locate an overflow device in the cavity to maintain a liquid level in the cavity area of the discharge device . in addition to allowing for equalization of the pressure inside and outside of the discharge section , the cavity — because it may be at or near the temperature of the upper section of the reactor — may be available to supply heat to the reactor contents in an upset condition , such as the loss of gas to the upper section of the reactor . in such a case the heat of the cavity area may become a temporary process heat source to allow for the safe and controlled deactivation of the process reactor . for instance , maintaining a liquid level of the condensate in the pressure envelope ( e . g ., the cavity ) may also provide a heat source in the event that the heating medium is lost temporarily . if the reactor is slowly deactivated , a rapid and dangerous loss of heat and pressure can be avoided thereby minimizing the danger to operators and equipment . fig1 a and 1b schematically illustrates a reactor in accordance with an embodiment of the present invention . fig1 a and 1b show different views of the same vessel , with like numerals identifying like parts . vessel 100 is largely defined by outside walls 190 that create a cavity which may be divided into upper portion 110 and the lower portion 120 . biomass material ( e . g ., lignocellulosic material ) is fed to the top 102 of vessel 100 . the biomass may be gravity fed and / or mechanically fed , e . g ., via a screw conveyor and / or a conveyor belt . upon entering vessel 100 , the biomass material enters upper portion 110 , where ammonia and / or steam pressurizes the reactor without adding excess amounts of liquid . that is , it is preferable that a slurry is not created by the addition of liquid . process chemicals ( e . g ., acids that may assist in the hydrolysis reactions ) may have been added to the biomass before it enters the vessel . examples of these acids may include sulfuric , hydrochloric , hydrofluoric , and / or phosphoric acid . organic acids like acetic acid , formic acid could also be used . process inlet nozzles 140 also permit the addition of process chemicals ( e . g ., acids that may assist in the hydrolysis reactions ). examples of these acids may include sulfuric , hydrochloric , hydrofluoric , and / or phosphoric acid . in an aspect , there may be little to no free liquid in the reactor treatment vessel . that is , the biomass may have little or no excess liquid , because the liquid may be absorbed into the cellulosic material . lower portion 120 may be shaped to facilitate transfer of the biomass without external agitation or rotation , e . g ., via a diamondback ® chip bin shape , as described in u . s . pat . no . 5 , 500 , 083 . lower portion 120 may be made from corrosion resistant material ( e . g ., stainless steel , titanium , zirconium , ceramic coating ( like a brick lining ), a polytetrafluoroethylene lining , or combinations thereof , etc . ), and a pressure envelope 130 exists between lower portion 120 and wall 190 . as illustrated , the pressure envelope 130 exists between wall 122 of lower portion 120 and wall 132 of vessel 100 . biomass exits the vessel 100 via bottom portion 104 . to facilitate unplugging and reduce clogging , nozzles 150 , 160 , and 170 are provided . furthermore , equalization line 180 may equalize pressure between upper portion 110 ( via connection 182 ) and pressure envelope 130 ( via connection 184 ). pressurization nozzles 186 are provided to facilitate control of the pressure of upper portion 110 and / or pressure envelope 130 . in an aspect , pressure envelope 130 permits less material ( for example corrosive resistant or other appropriate material ) to form the walls of lower portion 120 . although illustrated and described in connection with a continuous process , the reactor vessel may be used in a batch process . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .
| 3Textiles; Paper
|
the present invention generally relates to a packer cup for sealing a wellbore . the packer cup will be described herein in relation to pipe that is used in the wellbore . it is to be understood , however , that the packer cup may also be used with other downhole tools , such as a whipstock seal , or a debris barrier , without departing from principles of the present invention . further , the packer cup may be used in a cased wellbore or within an open - hole wellbore . to better understand the novelty of the packer cup of the present invention and the methods of use thereof , reference is hereafter made to the accompanying drawings . fig1 is a view of a packer cup 100 disposed in a wellbore 40 . the packer cup 100 is used to isolate a defect 70 in the wellbore 40 . the packer cup 100 is attached to a workstring 20 . as shown in fig1 , a casing 10 is disposed in the wellbore 40 . the casing 10 may be cemented in the wellbore 40 using cement 30 and may include multiple sections of casings coupled together to form the casing 10 . located along the length of the casing 10 is the defect 70 , such as a leaking connection or a fracture in the wall of the casing 10 . the defect 70 may permit the loss of a fluid , such as a liquid or a gas , into the surrounding earthen formation or permit the introduction of unwanted fluids into the casing 10 of the wellbore 40 . as a result , dangerous pressure fluctuations may occur during the formation or completion of the wellbore 40 . to isolate the defect 70 , one or more packer cups 100 are used . as shown in fig1 , two packer cups 100 are used to isolate a first portion 185 a of the wellbore 40 from a second portion 185 b of the wellbore 40 . the first portion 185 a has a pressure p1 that is greater than a pressure p2 in the second portion 185 b of the wellbore 40 . generally , the opening of the packer cup 100 is facing the portion of the wellbore having the higher pressure ( as shown ). as will be described herein , the pressure ( e . g ., pressure p1 ) adjacent the packer cup 100 will be used to set the packer cup 100 in the wellbore 40 . as shown in fig1 , the workstring 20 is not centered in the casing 10 . in other words , a longitudinal axis of the workstring 20 is offset from a longitudinal axis of the casing 10 . as a result , distance 130 is greater than distance 135 . generally , a workstring in a horizontal wellbore may sag , which causes the packer cup 100 to be off - center in the casing 10 . the conventional packer cup may not be able to create a seal with the casing when the conventional packer cup is off - center in the casing . however , the packer cup 100 of the present invention is configured to create a seal with the casing , even if the packer cup 100 is off - center , or if the packer cup 100 is placed within an eccentric casing ( or wellbore ). fig2 and 2a illustrate a view of the packer cup 100 in a run - in position . as shown , the packer cup 100 includes a base 105 with a lip 110 and seal segments 160 , 170 , 180 . the seal segments 160 , 170 , 180 are interconnected together . in one embodiment , the seal segments 160 , 170 , 180 are separate pieces ( and / or material ) that are attached together by bonding , glue or another attachment method . in another embodiment , the seal segments 160 , 170 , 180 are formed from a single piece . in either case , the seal segments 160 , 170 , 180 are designed to engage and create a seal with the casing 10 upon activation of the packer cup 100 . the packer cup 100 in fig2 shows three seal segments , however , two or more seal segments may be used in the packer cup 100 without departing from principles of the present invention . the seal segments 160 , 170 , 180 are connected to the base 110 . as shown , a portion of the seal segment 160 is disposed under the lip 110 . the base 105 is configured to be attached to the workstring 20 by a connection member 115 , such as threads , key and groove arrangement or any other type of connection member . a seal member ( not shown ) may be placed between the base 105 and the workstring 30 to create a seal therebetween . as also shown , an annulus 175 is defined between an outer surface of the workstring 20 and an inner surface of the seal segments 160 , 170 , 180 . the seal segments 160 , 170 , 180 are configured to seal an annulus between the workstring 20 and the casing 10 . the seal segments 160 , 170 , 180 are configured to move between a retracted shape ( fig2 ) and an expanded shape ( fig4 ). each seal segment 160 , 170 , 180 is an annular member that is made of a flexible material , such as elastomer or plastic . in the embodiment shown , each seal segment 160 , 170 , 180 has a different outer diameter ( od ). the od of seal segment 160 & lt ; the od of seal segment 170 & lt ; the od of seal segment 180 . as shown , a gap 140 is formed between seal segment 160 and the casing 10 , and a smaller gap 190 is formed between seal segment 170 and the casing 10 . additionally , a gap 195 is formed between the lip 110 and the casing 10 . the packer cup 100 is off - center in the casing 10 . as shown in fig2 , the upper portions 160 a , 170 a of the seal segments 160 , 170 are not in contact with the casing 10 , while the lower portions 160 b , 170 b , 180 b of the seal segments 160 , 170 , 180 are in contact with the casing 10 . additionally , the upper portion 110 a of the lip 110 is not in contact with the casing 10 , while the lower portion 1108 of the lip 110 is in contact with the casing 10 . fig2 a is a sectional view along line 2 a - 2 a in fig2 . as shown , the gap 140 is formed between seal segment 160 and the casing 10 , because the workstring 20 is offset relative to the casing 10 ( distance 130 & gt ; distance 135 ) and the od of seal segment 160 . as also shown , the thickness of the upper portion 160 a of seal segment 160 and the lower portion 1608 of seal segment 160 have substantially the same thickness in the run - in position . fig3 and 3a illustrate a view of the packer cup 100 in an intermediate expanded position . after the packer cup 100 is positioned within the casing 10 , pressure p1 activates the packer cup 100 in order to isolate a portion of the wellbore . more specifically , the pressure p1 enters an opening 120 of the packer cup 100 and moves into the annulus 175 , which causes the seal segments 160 , 170 , 180 to expand radially outward toward the casing 10 . the seal segments 160 , 170 , 180 are made from a flexible material , and since pressure p1 is greater than p2 , the seal segments 160 , 170 , 180 are urged radially outward . in comparing fig3 ( intermediate expanded position ) and fig2 ( run - in position ), it can be seen that the upper portions of the seal segments 160 a , 170 a , 180 a are in contact with the casing 10 , which results in the gaps 140 and 190 being substantially closed . it can also be seen that the lower portions of the seal segments 160 b , 170 b , 180 b have more surface area in contact with the casing 10 in the intermediate expanded position . it can be further seen that the gap 195 between the upper lip 110 a and the casing 10 is still present in the intermediate expanded position . fig3 a is a sectional view along line 3 a - 3 a in fig3 . as shown , the gap 140 formed between seal segment 160 and the casing 10 has been closed due to the activation of the packer cup 100 . it is to be noted that the workstring 20 remains offset relative to the casing 10 ( distance 130 & gt ; distance 135 ). fig4 and 4a illustrate a view of the packer cup 100 in an expanded position . the packer cup 100 has been expanded by the pressure p1 in the annulus 175 . in comparing fig4 ( expanded position ) and fig3 ( intermediate expanded position ), it can be seen that the upper portions of the seal segments 160 a , 170 a , 180 a and the lower portions of the seal segments 160 b , 170 b , 180 b have more surface area in contact with the casing 10 . it can also be seen that the gap 195 between the upper lip 110 a and the casing 10 has been closed , and the upper lip 110 a and the lower lip 1108 are in contact with casing 10 . in one embodiment , the lip 110 may act as a barrier to the flow of the material of the seal segments 160 , 170 , 180 . in this manner , the lip 110 in the packer cup 100 may act as an anti - extrusion device or an extrusion barrier . in another embodiment , the lip 110 may act as an anchor portion that secures the packer cup 100 in the casing 10 . fig4 a is a sectional view along line 4 a - 4 a in fig4 . as shown , the gap 140 formed between seal segment 160 and the casing 10 is closed due to the activation of the packer cup 100 . as also shown , the thickness of the upper portion 160 a of seal segment 160 is smaller than the thickness of the lower portion 160 b of seal segment 160 , because the upper portion 160 a was radially expanded further relative to the centerline of the packer cup 100 than the lower portion 160 b , due to the packer cup 100 being off - center in the casing 10 . in this manner , the packer cup 100 is capable of sealing an annulus between the casing 10 and the string 20 , even with the packer cup 100 being off - center in the casing 10 . fig5 illustrates a view of a packer cup 200 . for convenience , the components in the packer cup 200 that are similar to the components in the packer cup 100 will be labeled with the same number indicator . the packer cup 200 includes seal segments 210 , 220 , 230 and the base 105 . the seal segments 210 , 220 , 230 are interconnected together . the seal segments 210 , 220 , 230 may be separate pieces ( and / or material ) that are attached together , or the seal segments 210 , 220 , 230 may be formed from a single piece . in either case , the seal segments 210 , 220 , 230 are designed to engage and create a seal with the casing ( not shown ) upon activation of the packer cup 200 . each seal segment 210 , 220 , 230 may have a different outer diameter ( od ). for instance , the od of seal segment 210 may be less than the od of seal segment 220 , which may be less than the od of seal segment 230 . further , each seal segment 210 , 220 , 230 may have a different longitudinal length . for instance , the length of seal segment 220 may be shorter than the length of seal segment 230 , which may be shorter than the length of seal segment 210 . additionally , the thickness of the seal segments 210 , 220 , 230 may be different . each characteristic ( e . g ., diameter , length , thickness , number of seal segments ) of the seal segment 210 , 220 , 230 may be selected based upon the application in the wellbore . fig6 illustrates a view of a packer cup 250 . for convenience , the components in the packer cup 250 that are similar to the components in the packer cup 100 will be labeled with the same number indicator . the packer cup 250 includes seal segments 260 , 270 , 280 and the base 105 . the seal segments 260 , 270 , 280 are interconnected together . in one embodiment , the seal segments 260 , 270 , 280 may be made from different material , such as a rubber material having a different durometer . the seal segments 260 , 270 , 280 may be attached together to form a single unit of seal segments . in another embodiment , the seal segments 260 , 270 , 280 may be made from the same material and attached together or formed from a single piece . similar to the other packer cups set forth herein , the seal segments 260 , 270 , 280 are designed to engage and create a seal with the casing ( not shown ) upon activation of the packer cup 250 . in the embodiment shown in fig6 , each seal segment 260 , 270 , 280 has several different diameters . for example , each seal segment 260 , 270 , 280 has a first diameter 255 , a second diameter 265 , a third diameter 275 , and a fourth diameter 285 . the alternating large diameter sections and small diameter sections create a redundancy that allows the packer cup 250 to create a seal with the casing ( or wellbore ), even if the packer cup 250 is off - center , or if the packer cup 250 is placed within an eccentric casing ( or wellbore ). further , each seal segment 260 , 270 , 280 may have the same or different longitudinal length . additionally , each seal segment 260 , 270 , 280 may have the same or different thickness . each characteristic ( e . g ., diameter , length , thickness , number of seal segments ) of the seal segment 260 , 270 , 280 may be selected based upon the application in the wellbore . fig7 and 7a illustrate a view of the packer cup 300 in a run - in position . for convenience , the components in the packer cup 300 that are similar to the components in the packer cup 100 will be labeled with the same number indicator . as shown , the packer cup 300 includes seal segments 360 , 370 , 380 , which are attached to the base 105 . the seal segments 360 , 370 , 380 are interconnected together to form a single unit . in one embodiment , the seal segments 360 , 370 , 380 are separate pieces ( and / or material ) that are attached together by bonding , glue or another attachment method . in another embodiment , the seal segments 360 , 370 , 380 are formed from a single piece . the seal segments 360 , 370 , 380 are designed to engage and create a seal with the casing 10 upon activation of the packer cup 300 . even though the packer cup 300 is illustrated with three seal segments , the packer cup 300 may include two or more seal segments without departing from principles of the present invention . an annulus 375 is defined between an outer surface of the workstring 20 and an inner surface of the seal segments 360 , 370 , 380 . the seal segments 360 , 370 , 380 are configured to create a seal between the workstring 20 and the casing 10 . the seal segments 360 , 370 , 380 are configured to move between a retracted shape ( fig7 ) and an expanded shape ( fig9 ). each seal segment 360 , 370 , 380 is an annular member that is made of a flexible material , such that the seal segments 360 , 370 , 380 deform upon application of a pressure . in the embodiment shown , each seal segment 360 , 370 , 380 has substantially the same outer diameter ( od ). the packer cup 100 is substantially centered in the casing 10 . in other words , distance 330 is substantially equal to distance 335 . as shown fig7 , upper portions 360 a , 370 a , 380 a of the seal segments 360 , 370 , 380 and the lower portions 360 b , 370 b , 380 b of the seal segments 360 , 370 , 380 are in contact with the casing 10 . additionally , the upper portion 110 a and lower portion 1108 of the lip 110 are not in contact with the casing 10 . fig7 a is a sectional view along line 7 a - 7 a in fig7 . as shown , the entire section of seal segment 360 is engaged with the casing 10 because the workstring 20 is substantially centered in the casing 10 ( distance 330 is substantially equal to distance 335 ) and the od of seal segment 360 . as also shown , the upper portion 360 a of seal segment 360 and the lower portion 360 b of seal segment 360 have substantially the same thickness in the run - in position . fig8 and 8a illustrate a view of the packer cup 300 in an intermediate expanded position . after the packer cup 300 is positioned within the casing 10 , pressure p1 activates the packer cup 300 in order to isolate a portion of the wellbore . more specifically , the pressure p1 enters an opening 320 of the packer cup 330 and moves into the annulus 375 , which causes the seal segments 360 , 370 , 380 to expand radially outward toward the casing 10 . the seal segments 360 , 370 , 380 are made from a flexible material , and since pressure p1 is greater than pressure p2 , the seal segments 360 , 370 , 380 are urged radially outward . in comparing fig8 ( intermediate expanded position ) and fig7 ( run - in position ), it can be seen that the upper portions 360 a , 370 a , 380 a and the lower portions 360 b , 370 b , 380 b of the seal segments have been expanded radially outward into further contact with the surrounding casing 10 . it can be further seen that the gap 395 between the lips 110 a , 1108 and the casing 10 is still present in the intermediate expanded position . fig8 a is a sectional view along line 8 a - 8 a in fig8 . as shown , the workstring 20 remains substantially centered relative to the casing 10 ( distance 330 is substantially equal to distance 335 ). as also shown , the upper portion 360 a of seal segment 360 and the lower portion 360 b of seal segment 360 have substantially the same thickness in the intermediate expanded position . fig9 and 9a illustrate a view of the packer cup 300 in an expanded position . the packer cup 300 has been expanded by the pressure p1 in the annulus 375 . in comparing fig9 ( expanded position ) and fig8 ( intermediate expanded position ), it can be seen that the upper portions 360 a , 370 a , 380 a and the lower portions 360 b , 370 b , 380 b of the seal segments have more surface area in contact with the casing 10 . it can also be seen that the gap 195 has been closed , and the upper lip 110 a and the lower lip 1108 are in contact with casing 10 . in one embodiment , the lip 110 may act as a barrier to the flow of the material of the seal segments 360 , 370 , 380 . in this manner , the lip 110 in the packer cup 300 may act as an anti - extrusion device or an extrusion barrier . in another embodiment , the lip 110 may also act as an anchor portion that secures the packer cup 300 in the casing 10 . fig9 a is a sectional view along line 9 a - 9 a in fig9 . as shown , the thickness of the upper portion 360 a of seal segment 360 is substantially equal to the thickness of the lower portion 360 b of seal segment 360 because the portions 360 a , 360 b were radially expanded the same amount due to the packer cup 300 being centered in the casing 10 . in this manner , the packer cup 300 is capable of sealing an annulus between the casing 10 and the string 20 when the packer cup 300 is centered in the casing 10 . fig1 illustrates a view of a packer cup 400 . for convenience , the components in the packer cup 400 that are similar to the components in the packer cup 100 will be labeled with the same number indicator . the packer cup 400 includes seal segments 410 , 420 , 430 and the base 105 . the seal segments 410 , 420 , 430 are interconnected together . the seal segments 410 , 420 , 430 are designed to engage and create a seal with the casing ( not shown ) upon activation of the packer cup 400 . as shown , the seal segments 420 , 430 have the same thickness , and the seal segment 410 has a different thickness . additionally , the seal segments 420 , 430 have the same outer diameter , and seal segment 410 has a smaller outer diameter . each characteristic ( e . g ., diameter , length , thickness , number of seal segments ) of the seal segment 410 , 420 , 430 may be selected based upon the application in the wellbore . fig1 illustrates a view of a packer cup 450 . for convenience , the components in the packer cup 450 that are similar to the components in the packer cup 100 will be labeled with the same number indicator . the packer cup 450 includes seal segments 460 , 470 , 480 and the base 105 . the seal segments 460 , 470 , 480 are interconnected together . as shown , a first protrusion 465 is formed between seal segments 460 , 470 , and a second protrusion 475 is formed between seal segments 470 , 480 . the protrusions 465 , 470 are formed when the packer cup 450 is being pulled up in the casing , or in the direction of the seal segments 460 , 470 , 480 . the protrusions 465 , 470 are formed as the shoulders of the seal segments 460 , 470 , 480 move toward each other due to the movement within the casing , and the seal segments 460 , 470 , 480 may contact each other . the protrusions 465 , 470 provide additional stability to the seal segments 460 , 470 , 480 as the packer cup 450 is moved relative to the casing . the seal segments 460 , 470 , 480 are designed to engage and create a seal with the casing ( not shown ) upon activation of the packer cup 450 . as shown , the seal segments 420 , 430 have the same thickness , and the seal segment 410 has a different thickness . each characteristic ( e . g ., diameter , length , thickness , number of seal segments ) of the seal segment 460 , 470 , 480 may be selected based upon the application in the wellbore . fig1 illustrates a view of a packer cup 500 in an eccentric wellbore 80 . the packer cup 500 includes a seal segment 510 attached to the base 105 . although the packer cup 500 in fig1 shows one seal segment 510 , the packer cup 500 includes at least two seal segments . similar to the seal segments described herein , the seal segment 510 is configured to move from a first shape to a second expanded shape to create a seal with the eccentric wellbore 80 . the seal segment 510 in fig1 is shown in the second expanded shape . the portions of the seal segment 510 expand in different amounts along an inner circumference of the eccentric wellbore 80 . for instance , a first portion 515 of the seal segment 510 expanded a larger amount than a second portion 520 , and a third portion 530 expanded further than a fourth portion 525 , in order to engage the eccentric wellbore 80 . in this manner , the seal segment 510 of the packer cup 500 is configured to conform to the inner circumference of the eccentric wellbore 80 in the second expanded shape . fig1 illustrates a view of a packer cup 550 in an eccentric wellbore 90 . the packer cup 550 includes a seal segment 560 attached to the base 105 . the packer cup 550 includes at least two seal segments . similar to the seal segments described herein , the seal segment 560 is configured to move from a first shape to a second expanded shape to create a seal with the eccentric wellbore 90 . the seal segment 560 in fig1 is shown in the second expanded shape . in order to engage the eccentric wellbore 90 , a first portion 565 of the seal segment 560 has expanded further than a second portion 570 . in this manner , the seal segment 560 of the packer cup 550 is configured to conform to the inner circumference of the eccentric wellbore 90 in the second expanded shape . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .
| 4Fixed Constructions
|
the process of this invention is used for the homopolymerization and copolymerization of trioxane . suitable monomers which can be used with trioxane in the copolymerization reaction are cyclic ethers and cyclic acetals having 2 or more adjacent carbon atoms and , in particular , from 3 to 9 ring members . examples of such monomers are ethylene oxide , 1 , 2 - propylene oxide , trimethylene oxide , butadiene oxide , 1 , 3 - dioxolane , 1 , 4 - butane diol formal , diethylene glycol formal , o - xylene glycol formal , thiodiglycol formal and 1 , 3 - oxythiolane . these monomers are copolymerized with trioxane in the amounts of about 0 . 1 to 15 weight percent and , preferably , from about 0 . 5 to about 5 weight percent based on the total weight of monomers . the molecular weight of the polymers can be controlled by means of regulators conventionally employed in trioxane polymerization reactions . suitable regulators are acetals or formals of monohydric alcohols , the alcohols themselves , or small amounts of water . the preferred regulator is methylal . the regulators are used in the amount of about 10 to about 1000 ppm and , preferably , from about 100 to about 500 ppm based on the total weight of monomers . the catalyst used in this invention is boron trifluoride gas which is mixed with nitrogen gas before being introduced into the reactor containing the monomers . the boron trifluoride gas is used in the amount of about 20 to about 200 ppm and , preferably , about 40 to about 120 ppm based on the weight of monomer . the boron trifluoride gas is blended with nitrogen gas in the volume ratios of about 1 : 5 to about 1 : 40 boron trifluoride to nitrogen and preferably about 1 : 10 to about 1 : 30 parts . the monomers and regulators if used can be premixed and then introduced into the polymerization reactor or may be introduced separately . the trioxane is introduced in molten form . the polymerization reactor can be an extruder , a kneader , a stirred kettle , a gear pump , or a flow tube with or without a static mixing element . it should be possible to heat or cool the reactor and also to impose a temperature profile on it . the reaction can be conducted isothermally or adiabatically since the relatively low enthalpy of polymerization does not give rise to any problems with regard to the supply and removal of heat . suitable reactors are described in u . s . pat . nos . 2 , 505 , 125 , 3 , 630 , 689 , 4 , 105 , 637 and 4 , 115 , 369 which are hereby incorporated by reference . in accordance with this invention , the trioxane in molten form is introduced into the reactor along with comonomers and chain regulators if used . the boron trifluoride gas is blended with nitrogen gas before being introduced into the reactor . the gaseous mixture is then added through a small jet or pin opening under such pressure that the gas blend is injected into the monomer mixture . the jet or pin openings will vary from about 0 . 01 to about 0 . 2 inch in diameter and preferably from about 0 . 05 to about 0 . 1 inch . the gaseous catalyst mixture is added to the reactor under a pressure , measured as back pressure , of at least 10 psi . the polymerization reaction is carried out at a temperature above the melting point of the trioxane and under the boiling point of the trioxane . the temperature will vary from about 160 ° f . to about 230 ° f . and , preferably , will vary from about 200 ° f . to 220 ° f . the reaction is conducted in the reactor for a time sufficient to obtain a conversion of monomer to polymer of about 40 to about 70 weight percent and , preferably , about 50 to about 60 weight percent . the residence time in the reactor will vary from about 1 minute to about 20 minutes and , preferably , from about 2 minutes to about 10 minutes . when the extent of polymerization is completed , the reactor contents are ground to a mean particle size of about 0 . 5 to about 1 . 5 millimeters . the polymerization reaction is then stopped by introducing the grind into a quench tank which contains water and a base , e . g ., triethylamine . the unreacted trioxane is then recovered for recycle and the polymer is stabilized by removal of end groups using well known stabilization procedures such as those described in u . s . pat . nos . 4 , 087 , 411 , 4 , 301 , 273 and 4 , 342 , 680 which are hereby incorporated by reference . by the use of this invention , the efficiency of the catalyst is improved , the conversion of monomers to polymer is increased and the amount of catalyst can be reduced . the amount of catalyst can be reduced to as much as 50 percent while still obtaining conversions equivalent to those obtain using up to twice as much boron trifluoride without nitrogen . the polymeric product obtained by this process shows improvements in extractable formaldehyde , color and k d values which values are a measure of the degradation rate of the composition when molded , i . e ., the average weight loss per minute at 230 ° c . the following examples describe the invention in more detail . parts and percentages are parts and percentages by weight unless otherwise designated . trioxane was added to a kokneader manufactured by baker perkins inc . at a feed rate of 4 , 260 parts per hour . the monomer feed also contained 1 . 84 weight percent ethylene oxide based on the weight of trioxane and 401 ppm methylal based on the weight of trioxane . boron trifluoride gas mixed with gaseous nitrogen in a volume ratio of 1 : 10 was introduced into the reactor through a 0 . 093 inch diameter tube mounted concentrically to the monomer feed nozzle . the tube was set so that it discharged catalyst about one - fourth inch from the surface of the reactor screw . the boron trifluoride catalyst was introduced at a rate of 31 . 1 ppm based on the weight of trioxane . as the reactants progressed through the reactor , the temperature varied from about 205 ° f . to about 221 ° f . with the temperature at the end of the reaction being 198 ° f . the residence time in the reactor was about 10 minutes . the polymeric product was then ground to a mean particle size of about 1 millimeter and the reaction was quenched in a quench tank containing water and triethylamine . the polymer was then stabilized in a melt hydrolysis process as described in u . s . pat . no . 3 , 318 , 848 and 3 , 418 , 280 . the percent conversion of trioxane to oxymethylene polymer was 58 . 7 percent . this reaction was conducted in a honda polymerization reactor . trioxane was introduced at a feed rate of 4 , 260 parts per hour with ethylene oxide at a weight percent of 1 . 80 based on the weight of trioxane and methylal at a rate of 274 ppm based on the weight of trioxane . the boron trifluoride catalyst blended with nitrogen in a volume ratio of 1 : 10 was introduced at a feed rate of 65 . 7 ppm based on the weight of trioxane . the boron trifluoride / nitrogen mixture was introduced into the reactor through a 0 . 055 inch diameter tube positioned so that it discharged catalyst just at the nozzle of the monomer feed pipe . the temperature during the reaction varied from 207 ° f . to 215 ° f . with the exit temperature being 198 ° f . after grinding , quenching and stabilizing reactions , the polymer was recovered with a conversion of 58 . 7 percent . reaction conditions and percent conversion for a number of reactions are shown in table i for the baker , perkins reactor and in table ii for the honda reactor . physical properties of plastic molds made from the product of those reactions listed in tables i are shown in table iii . vicat temperature is a measure of the heat distortion of the polymer . &# 34 ; b &# 34 ; color is the color measured on a hunter colormeter . the lower the number the less yellow in the sample . mxb color is the shift in &# 34 ; b &# 34 ; color after the sample is melted and molded . the lower numbers indicate less color shift . the ethylene oxide distribution in the polymeric products is listed in table iv . ethylene oxide can copolymerize with trioxane to form one oxyethylene unit between two oxymethylene units . such units are referred to in table v as mono (%). ethylene oxide can also polymerize with itself as well as with the trioxane to form two or more oxyethylene units between two oxymethylene units . the polymeric forms are referred to in table v as di (%) and tri (%). table i______________________________________reaction conditionsexample 1 3 5 control a______________________________________trioxane feedrate 4260 3757 3244 4260 ( part / hr ) ethylene oxide 1 . 84 1 . 82 1 . 65 1 . 76feedrate ( wt %) methylal feed - 401 381 403 371rate ( ppm ) bf . sub . 3 : n . sub . 2 vol 1 : 10 1 : 30 1 : 10 -- bf . sub . 3 feedrate ( ppm ) 31 . 1 29 . 3 20 . 7 41 . 9 % conversion 58 . 7 54 . 4 52 . 5 53 . 9______________________________________ table ii______________________________________reaction conditionsexample 2 4 6 control b______________________________________trioxane feedrate 4260 2662 3346 4260 ( part / hr ) ethylene oxide 1 . 80 1 . 86 1 . 71 1 . 72feedrate ( wt %) methylal feed - 274 286 304 291rate ( ppm ) bf . sub . 3 : n . sub . 2 vol 1 : 10 1 : 30 1 : 30 -- bf . sub . 3 feedrate ( ppm ) 65 . 7 63 . 8 52 . 5 65 . 8 % conversion 58 . 7 54 . 4 52 . 5 53 . 9______________________________________ table iii______________________________________physical propertiesexample 1 3 5 control a______________________________________k . sub . d 0 . 015 0 . 016 0 . 016 0 . 017extractable 0 . 082 0 . 077 0 . 066 0 . 066hchovicat temp 158 . 9 158 . 9 158 . 3 159 . 1 ° c . b color 1 . 67 1 . 86 2 . 29 1 . 93mxb color 15 . 7 13 . 3 6 . 8 19 . 9tensile 8527 . 5 8515 8462 8435strength ( psi ) elongation at 64 . 5 61 . 7 69 . 0 80break (%) flex strength 12106 11934 12027 11979 ( psi ) flex modulus 0 . 362 0 . 361 0 . 363 0 . 361 ( psi × 10 . sup . 6 ) izod 1 . 37 1 . 37 1 . 44 1 . 48 ( ft lbs / in ) ______________________________________ table iv______________________________________ethylene oxide distributionexample 1 5 control a______________________________________ethylene oxide in 1 . 82 1 . 68 1 . 77feed ( wt %) ethylene oxide in 2 . 19 2 . 14 2 . 42polymer ( wt %) as mono (%) 55 . 9 52 . 1 46 . 7as di (%) 33 . 1 35 . 7 38 . 0as tri (%) 11 . 0 12 . 3 15 . 3______________________________________ the principles , preferred embodiments and modes of operation of the present invention have been described in the foregoing specification . the invention which is intended to be protected herein , however , is not to be construed as limited to the particular forms disclosed , since these are to be regarded as illustrating rather than restrictive . variations and changes may be made by those skilled in the art without departing from the spirit of the invention .
| 2Chemistry; Metallurgy
|
reference will now be made in detail to preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . referring to fig5 the image pick - up unit according to the first embodiment of the present invention comprises a thin transmission mirror 51 slanted at a given angle with respect to the angle of the incident light . the transmission mirror reflects incident light that forms a two - dimensional image at the given angle and simultaneously transmits the incident light at its incident angle . a condenser such as a piano convex lens 52 condenses the two - dimensional image reflected by the thin transmission mirror 51 into a one - dimensional image . a converter such as a line ccd 53 , located where the output signal from condenser 52 is condensed into the one - dimensional component , converts the one - dimensional image component into electrical signals . in the first embodiment of the present invention , as shown in fig6 there are two image component pick - up units , 60 and 65 . a horizontal component pick - up unit 60 , made up of a horizontal thin transmission mirror 61 , a horizontal condenser 62 , and a horizontal converter 63 , receives a two - dimensional image and outputs one - dimensional horizontal component data . a vertical component pick - up unit 65 , made up of a vertical thin transmission mirror 66 , a vertical condenser 67 , and a vertical converter 68 , receives a two - dimensional image and outputs one - dimensional vertical component data . together the horizontal component pick - up 60 and the vertical component pick - up form a horizontal / vertical image pick - up unit . there is an orientation difference of 90 ° between the horizontal component pick - up unit 60 and the vertical component pick - up unit 65 . except for their orientation , the horizontal and vertical component pick - up units 60 and 65 are the same in their constitutions and functions as those of the image component pick - up unit 50 of fig5 . in other words , the functions of the horizontal transmission mirror 61 and the vertical transmission mirror 66 are the same as those of the transmission mirror 51 of fig5 except for their orientation ; the functions of the horizontal condenser 62 and the vertical condenser 67 are the same as those of the condenser 52 of fig5 except for their orientation ; and the functions of the horizontal converter 63 and the vertical converter 68 are the same as those of the converter 53 of fig5 except for their orientation . referring to fig6 the operations of the image component pick - up units 60 and 65 for detecting a motion vector according to the first embodiment of the present invention will now be described . incident light from a camera lens forms a two - dimensional image that is simultaneously reflected at given horizontal and vertical angles and transmitted by the horizontal and vertical transmission mirrors 61 and 66 , respectively . the images reflected from the horizontal and vertical transmission mirrors 61 and 66 , respectively , are condensed into horizontal and vertical one - dimensional components by the horizontal and vertical plano convex lenses 62 and 67 , respectively . the condensed horizontal and vertical components are converted to electrical signals by the horizontal and vertical line ccds 63 and 68 , respectively . the electrical signals from the horizontal and vertical line ccds 63 and 68 , respectively , are input to circuits for detecting a motion vector . referring to fig7 the image pick - up unit according to the second embodiment of the present invention comprises a curved thin transmission mirror 71 having a curved portion on its surface which simultaneously transmits incident light and reflects the incident light at a range of angles that focuses the two - dimensional image into a one - dimensional component . a line ccd 72 , located where the reflected light is condensed into the one - dimensional component , converts the one - dimensional component into electrical signals . in the second embodiment of the present invention , as shown in fig8 there are two component pick - up units 80 and 85 . a horizontal component pick - up unit 80 is made up of a horizontal curved thin transmission mirror 81 and a horizontal converter 82 . a vertical component pick - up unit 85 is made up of a vertical curved thin transmission mirror 86 and a vertical converter 87 . together the horizontal component pick - up 80 and the vertical component pick - up 85 form a horizontal / vertical image pick - up unit . referring to fig8 the operations of the image component pick - up units 80 and 85 for detecting a motion vector according to the second embodiment of the present invention will now be described . the horizontal and vertical curved thin transmission mirrors 81 and 86 , simultaneously reflect and focus incident light from a camera lens that constitutes a two - dimensional image . the horizontal and vertical components are produced by the horizontal and vertical curved transmission mirrors 81 and 86 , respectively , and are converted to electrical signals by horizontal and vertical line ccds 82 and 87 , respectively . the electrical signals output from the horizontal and vertical line ccds 82 and 87 are input to circuits for detecting a motion vector . as mentioned above , the flat thin transmission mirror is used in the component pick - up units 60 and 65 of the first embodiment of the present invention , and the curved thin transmission mirror is used in the component pick - up units 80 and 85 of the second embodiment of the present invention . other flat and curved transmission reflectors can be substituted for the mirrors presented here without departing from the principles of the present invention . also , other linear pick - up units and signal converters can be substituted without departing from such principles . fig9 is a block diagram which shows a third embodiment of a motion correction device wherein an image correction system including a motion vector detector utilizes the component pick - ups of the present invention for a camcorder . as shown in fig9 an image correction system uses a motion vector detector 90 including a vertical component pick - up unit 901 and a horizontal component pick - up unit 906 . the system includes a solid state pick - up device , such as a ccd imager 91 , which picks up incident light passing through an optical system to form an input image , and scans the image electronically to convert the image into system electrical signals . a system a / d converter 92 converts an analog signal output from the solid state pick - up device 91 into a system digital signal . a camera signal processing unit 93 converts a signal output from the system a / d converter into a color and brightness signal . the motion vector detector 90 receives the same image that is input to the solid state pick - up device 91 through horizontal and vertical image component pick - up units 901 and 906 , respectively , and detects a motion vector caused by unstable hands . a memory control unit 94 receives a motion vector output from the motion vector detector 90 to control the position of pixels in a color and brightness signal . a field memory 95 holds a field unit ( or a frame unit ) of image color / brightness data and , according to image correction control by the memory control unit 94 , outputs a stabilized image signal . a system d / a converter 96 converts a corrected color / brightness digital image signal output from the field memory 95 into an analog image signal to be output and recorded . fig1 is a block diagram which shows a fourth embodiment of a motion correction device for a camcorder using a motion vector detector . the motion vector detector can utilize the component pick - ups of the present invention or conventional component pick - ups . as shown in fig1 , the motion correction device of the fourth embodiment comprises a motion vector detector 90 which receives horizontal and vertical image components from component pick - up units 901 and 906 , respectively . a solid state pickup control unit , such as a ccd control unit 104 , receives a motion vector output from the motion vector detector 90 to control the position of pixels in the analog output of the solid state pick - up device 101 . the solid state pick - up device 101 receives the same incident light through an optical system that is input to the motion vector detector 90 as a two - dimensional image , and according to a control signal output from the solid state pick - up control unit 104 , converts the corrected image into system electrical signals . a system a / d converter 102 converts an analog signal output from the solid state pick - up device 101 into a system digital signal . a camera signal processing unit 103 converts the system digital signal output from the system a / d converter into a color and brightness signal . a system d / a converter 106 converts a digital image colorlbrightness signal into an analog image signal to be output and recorded . in both the embodiments of the motion correction device depicted in fig9 and fig1 the motion vector detector has a vertical motion component detector and a horizontal motion component detector . in the vertical motion component detector , a vertical component pick - up unit 901 simultaneously transmits and reflects incident light that forms the two dimensional image , vertically condenses the reflected image to provide the vertical component of the image , and converts the vertical component into electrical signals . a vertical a / d converter 902 converts the analog signal output from the vertical component pick - up unit 901 into a vertical digital signal . a vertical delay register 903 holds the vertical digital signal output from the vertical a / d converter 902 for a time during which pixels corresponding to half of a searching distance ( s in equation 1 ) are processed , then outputs the signal . a vertical line memory 904 holds the vertical digital signal output from the vertical delay register 903 . a vertical covariance arithmetic unit 905 receives the vertical digital signal output from the vertical a / d converter 902 and the delayed vertical digital signal from the vertical line memory 904 , and calculates covariance values between the two signals to output a vertical displacement signal which is the vertical component of the motion vector . in the horizontal motion component detector , a horizontal component pick - up unit 906 simultaneously transmits and reflects incident light that forms the two dimensional image , horizontally condenses the reflected image to provide the horizontal component of the image , and converts the horizontal component into electrical signals . a horizontal a / d converter 907 converts the analog signal output from the horizontal component pick - up unit 906 into a horizontal digital signal . a horizontal delay register 908 holds the horizontal digital signal output from the horizontal a / d converter 907 for a time during which pixels corresponding to half of a searching distance are processed , then outputs the signal . a horizontal line memory 909 holds the horizontal digital signal output from the horizontal delay register 908 . a horizontal covariance arithmetic unit 910 receives the horizontal digital signal output from the horizontal a / d converter 907 and the delayed horizontal digital signal from the horizontal line memory 909 , and calculates covariance values between the two signals to output a horizontal displacement signal which is the horizontal component of the motion vector . in the preferred embodiments , the vertical component pick - up unit 901 of the motion vector detector 90 in fig9 and fig1 uses the vertical component pick - up unit 65 in fig6 and the vertical component pick - up unit 85 in fig8 respectively . the horizontal component pick - up unit 906 of the motion vector detector 90 in fig9 and fig1 uses the horizontal component pick - up unit 60 in fig6 and the horizontal component pick - up unit 80 in fig8 respectively . assuming that an input image is picked up in both the horizontal line ccd 63 or 82 and the vertical line ccd 68 or 87 , and that the number of registers of the horizontal line ccd 63 or 82 is m , and the number of registers of the vertical line ccd 68 or 87 is n , the component results still can be represented by equations ( 2 ) and ( 3 ), above . here the variable a is a reflection coefficient for light incident upon the flat transmission mirrors 61 and 66 or the curved transmission mirrors 81 and 86 . a one - dimensional image , which has been linearly condensed , is converted into electrical signals in the horizontal and vertical line ccds 63 and 82 or 68 and 87 , respectively , and is input to circuit 902 or 907 , respectively , for detecting motion vectors . as shown in fig9 one - dimensional image components p h and p v output from the horizontal and vertical component pick - up units 906 and 901 , respectively , are converted into digital signals through the horizontal and vertical a / d converters 907 and 902 . further , in the horizontal and vertical covariance arithmetic units 910 and 905 , through an equation such as equation ( 1 ), the covariance calculation is carried out between one - dimensional image components of the preceding field from the horizontal and vertical line memories 909 and 904 , and digital image signals from the horizontal and vertical a / d converters 907 and 902 . a location which results in the minimum covariance value among the calculated covariance values is presumed to be the optimum displacement of the image . further , the memory control unit 94 , after receiving horizontal and vertical components of the motion vector from the motion vector detector 90 , sends a signal for correcting the image to the field memory 95 which holds an unstable color / brightness image . an incident image input to the system solid state pick - up device such as a ccd imager 91 is converted to system electrical signals which go through the a / d converter 92 . the resulting system digital signals go through the camera signal processing unit 93 , which outputs color / brightness signals which are stored in the field memory 95 . the initial locations of pixels of the image in the field memory 95 are changed under the control of the memory control unit 94 . the field memory 95 then outputs a corrected image . the corrected image output from the field memory 95 goes through the system d / a converter 96 to be converted into an analog signal , which will be recorded in a videocassette recorder or output as an image . the same image that is input to the system solid state pick - up 91 is input to the horizontal and vertical component pick - up units 906 and 901 , which process the input image independently of each other and simultaneously . as shown in fig1 , a system solid state pick - up device 101 , a system a / d converter , a camera signal processing unit 103 , and a d / a converter 106 of the fourth embodiment are similar in their constitutions and functions as those of the third embodiment of fig9 . the motion vector detector 90 , after receiving the same image that is input to the system solid state pick - up device 101 as mentioned above , can independently detect a motion vector . thus , as soon as an image is picked up in the system solid state pick - up device 101 , a solid state pick - up control unit such as a ccd control unit 104 , after receiving a motion vector output from the motion vector detector 90 , can directly control the image in the system solid state pick - up device 101 to output a corrected image . accordingly , the field memory 95 of fig9 is not required in this case . as described above , in the process of correcting an unstable image caused by unsteady hands , the preferred embodiments of the present invention provide a small - sized and simple construction of a motion correction device for images in camcorders since one - dimensional image component data , which are necessary for image correction , are simply obtained through the flat or curved thin transmission mirrors . having described and illustrated above the principles of the present invention in the preferred embodiments , it should be apparent to those skilled in the art that the invention can be modified in arrangement and detail without departing from the technical spirit and scope of the present invention as defined by the appended claims and their equivalents .
| 7Electricity
|
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . referring now to fig4 , a transmitter 120 includes transmitter circuits 122 ( such as those depicted in fig3 a and 3b ), a power amplifier 124 , and an antenna 126 . a power amplifier protection circuit 130 monitors a voltage output of the power amplifier 124 . the power amplifier protection circuit 130 shuts down the power amplifier 124 when the output voltage exceeds a predetermined voltage value to prevent damage to the power amplifier 124 . for example , the power amplifier protection circuit 130 prevents damage that may occur when a user or an object touches the antenna 126 , alters the impedance of the antenna , and causes a voltage increase . referring now to fig5 , the power amplifier protection circuit 130 is illustrated in further detail . the power amplifier protection circuit 130 includes a sensing circuit 140 that senses an output of the power amplifier 124 . an output of the sensing circuit 140 is input to a comparator 144 . a reference signal generator 146 generates a reference signal . an output of the reference signal generator 146 is also input to the comparator 144 . when the output of the sensing circuit 140 exceeds an output of the reference signal generator 146 , the comparator 144 changes state and turns off the power amplifier 124 . referring now to fig6 , a first exemplary implementation of the power amplifier protection circuit 130 - 1 is illustrated . the power amplifier protection circuit 130 - 1 communicates with an output stage 150 of a power amplifier . the output stage 150 is typically coupled by capacitors 154 and 156 to other transmitter circuits . a negative input inn is coupled to a gate of a first transistor 158 . a positive input in p is coupled to a gate of a second transistor 160 . a first inductor 164 is connected between a voltage source v dd and a drain of the first transistor 158 . a second inductor 166 is connected between the voltage source v dd and a drain of the second transistor 160 . the sources of the transistors 158 and 160 are coupled to a common potential such as ground . positive and negative outputs v outp and v outn , which drive the antenna , are taken between the inductors 164 and 166 and the drains of the transistors 158 and 160 . in fig7 , the output stage of the differential power amplifier is typically coupled through an output transformer , which performs differential to single - ended conversion . the power amplifier protection circuit 130 - 1 includes first and second transistors 180 and 182 having drains connected to the gate of the transistors 158 and 160 , respectively . gates of the transistors 180 and 182 are connected to an output of a comparator 186 . a first input of the comparator 186 is connected to a reference signal v th . the outputs v outp and v outn of the output stage 150 are connected to sources of transistors 190 and 192 . gates of the transistors 190 and 192 are connected to v bias . drains of the transistors 190 and 192 are connected together , to a current source 194 , and to a second input of the comparator 186 . in use , the voltage v bias is set above the normal operating voltage of the transistors 158 and 160 . transistors 190 and 192 are off under normal operating conditions with proper signal voltage at the drains of transistors 158 and 160 . since neither transistors 190 and 192 are conducting , current source 194 will pull the second input of the comparator 186 towards ground potential . when the operating voltage exceeds v bias , the transistors 190 and 192 begin conducting . the non - inverting input exceeds the threshold voltage of the comparator 186 and the comparator 186 changes state . the comparator 186 biases the gates of the transistors 180 and 182 , which begin conducting . the inputs to the output stage 150 of the power amplifier are shorted to ground and the power amplifier is turned off . when the operating voltage falls below the v bias , the transistors 190 and 192 stop conducting and the comparator 186 changes state . the comparator 186 turns off the transistors 180 and 182 and normal operation of the power amplifier can be resumed if the effective impedance of the antenna returns to nominal range . referring now to fig8 , a second exemplary implementation of the power amplifier protection circuit is illustrated at 130 - 2 . the transistors 180 and 182 are replaced by a transistor 200 . the transistor 200 shorts the gates of the transistors 158 and 160 when the comparator 186 changes state when the second signal exceeds the reference signal . this will suppress the ac signals applied to the pa and reduce signal swing at pa outputs , which prevents transistor breakdown or overstress . in the exemplary implementations in fig6 and 8 , cmos technology is employed . transistors 158 , 160 , 180 , 182 and 200 are implemented using n - channel cmos transistors . transistors 190 and 192 have been implemented using p - channel cmos transistors . skilled artisans will appreciate that the present invention has application to other transistor technologies having low breakdown voltages and that these other transistor technologies may be employed without departing from the scope of the present invention . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular examples thereof , the true scope of the invention should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , the specification and the following claims .
| 7Electricity
|
an exemplary embodiment of the present invention will now be described with reference to fig1 - 5 . referring to fig1 , illustrated therein is a schematic block diagram of a personal knowledge - based connection system 10 according to the present invention . the system is referred to as a personal knowledge - based system because it provides a connection between a user &# 39 ; s ( or layperson &# 39 ; s ) location 12 and that of a specific provider 16 . examples of a specific provider are circuit city , home depot , ace hardware or any entity that provides consumer goods . alternatively , the knowledge - based connection and information transfer system of the present invention can be implemented as a kiosk ( or other stand - alone location ) within a specific provider . this differs from the market broker knowledge - based system that will be described in greater detail with respect to fig3 - 5 . as shown , the personal - based connection system 10 includes a user location 12 , which is connected to a specific provider through a communication link 15 . in the embodiment illustrated in fig1 , the communication link 15 is provided by the internet . however , it will be appreciated by those of ordinary skill in the art that the communication link can also be performed over a local area network ( lan ), a wide area network ( wan ), or any suitable land - line and / or wireless network . sensor 14 , such as , for example , temperature sensors , humidity sensors , light sensors or any other suitable ( wireless or wire - line ) sensing device may be used to detect the user &# 39 ; s environment and transmit information related thereto to the provider 16 . a camera , preferably a digital camera having wireless transmission capabilities 30 , equipped with an illuminating mechanism ( e . g ., a light ) 31 may be used to provide a visual image of the user &# 39 ; s environment ( or problem to resolve ) within the user location 12 and transmit such visual image to the provider 16 over the communication link 15 . a wireless microphone 32 or appropriate transceiver may be used to provide verbal information transfer between the user and the expert , either alone , or simultaneously with the visual image of the user environment over the communication link 15 . in an exemplary embodiment , the voice and / or image information is transmitted to the communication link 15 through a suitable application 13 that is running within or about location 12 . in this fashion , the user is able to move about the particular location 12 , and is not restricted to any specific or otherwise limited area . the provider 16 includes an expertise manager 18 , which in an exemplary embodiment may act as a searchable database utilizing a processor 19 and a memory 19 , which maintains a directory of available experts ( e 1 , e 2 , e 3 ) 20 - 24 , respectively , that are available to receive the information regarding the user environment and provide advice on how to resolve any user issues or other troubleshooting problems . the expertise manager 18 may be equipped with a voice recognition engine for converting the user &# 39 ; s oral requests and / or questions into a digital format that is more suited for transmission over the communication link 15 . the expertise manager 18 may also be equipped with a second ( i . e ., text - to - speech ) engine for providing a means for the experts to communicate directly with the user . it will be appreciated and recognized by those of ordinary skill in the art that the voice recognition engine and / or the text - to - speech engine can be part of application 13 maintained at the user location 12 . in the embodiment of fig1 , the experts 20 - 24 are associated with the provider 16 of the service . thus , using an electronics store as an example , each of the experts 20 - 24 are employees or contractors of the electronic store provider . however , it should be noted that the employees are not limited to reside within a particular location . for example , experts 20 and 22 may reside in one location , while expert 24 resides in another location . accordingly , if expert 24 is the most appropriate individual to answer the user request , expert 24 will be connected to and communicate with the user . the operation of the system illustrated in fig1 will now be described with reference to fig2 . fig2 is a flowchart illustrating the operating steps performed by the knowledge - based connection system shown in fig1 . the process begins at step 100 with the user or layperson connecting to the provider 16 by orally requesting assistance for a particular problem . the request is received by the voice recognition engine of the expertise manager 18 through communication link 15 , as shown in fig1 . next , the expertise manager 18 requests the layperson to communicate the general nature of the problem and the parameters of the problem ( e . g ., context within which the problem exists ). such information is received in step 102 . the process then moves to step 104 . in step 104 , the expertise manager 18 searches the database of provider employees and contractors and provides the layperson with a list of available experts 20 - 24 ( shown in fig1 ), based on the information provided by the user via the text - to - speech engine . the layperson then reviews the list and selects one of the available experts to be connected to . the process then proceeds to step 105 . in step 105 , a determination is made as to whether the selected expert is available for a consultation . if the selected expert is not available , the process moves back to step 104 where the expertise manager 18 requests the layperson to make another selection . on the other hand , if the selected expert is available , the process moves to step 106 . in step 106 , the layperson &# 39 ; s request and operating environment is transferred to the expert for review . while connected to the expert , the layperson can discuss the problem with the expert , provide the expert with a real - time image of the problem context by transmitting the image through the use of a wireless camera or a simultaneous transmission of both image and voice information . alternately , the layperson can be connected to the expert through a direct communication link 17 . the session can be terminated by either the layperson or the expert once the layperson &# 39 ; s questions have been satisfactorily answered or the issues adequately resolved . the aforementioned provider - based system can be implemented as a fee - based system or a free system depending on the interests or objectives of the provider . if the provider - based system is to be implemented as a fee - based system , the expertise manager 18 may include time - monitoring functionality , which monitors the amount of time the user is connected to the expert , and bills the user for such time , or the user may be billed on a fixed - fee basis . with either billing method , the user will be queried to provide the expertise manager 18 with a method of payment . such payment methods can include credit card information , debit card information , billing address information , store account information , or any other suitable proprietary or nonproprietary payment method . by using the provider - based system of the present invention , the user saves money by not having to pay for an in - home visit . additionally , the time spent resolving an issue may also be tremendously reduced by the user not having to wait for an expert to travel to the user location to troubleshoot and resolve the problem . also , the user may be empowered to undertake other projects and return to the particular provider 16 for the components to complete such projects , based on the satisfactory use of the knowledge - based connection system of the present invention . fig3 is a schematic block diagram of a knowledge - based connection system 10 according to an alternate embodiment of the present invention . the connection system 10 is referred to as a market broker or participant - based system because it provides for a connection between a user ( at a particular remote location ) 12 and one of a plurality of experts 44 - 48 that are independent from each other . this differs from the personal knowledge - based system illustrated in fig1 , in that , the experts that the user or layperson are connected to , are not affiliated with the same entity . as illustrated in fig3 , the connection system 30 includes a market broker manager 40 , operative to provide a real - time connection between the user or layperson , at a remote location 12 , and one of a plurality of experts 44 - 48 , based on the layperson &# 39 ; s particular situation , and a metering block 42 operative to , for example , monitor the amount of time the layperson spends connected to a particular one of the plurality of experts . the experts may be present at locations remote from one another , or they may be present in the same location ( as illustrated by the dashed outline ). in addition to monitoring connection time , the metering block 42 may also be configured to calculate any charges as part of a fee - based service , and receive and process payment information such as , for example , credit card information , debit card information , or any proprietary payment information . other services or processes that may be performed by the metering block 42 include searching , providing security over the information transferred or payment information , and / or providing quality assurance benefits to the user . it should also be noted that connecting to an expert may be provided as a free service by a host . the market broker manager 40 will now be described with reference to fig4 . as illustrated in fig4 , the market broker manager 40 includes a personal services manager 42 who is operative to receive an oral description of the problem the user ( e . g ., the layperson ) is trying to resolve and / or real - time video illustrating the problem the user is trying to resolve and providing a link between the user and an appropriate expert 60 on - line 62 based on the received information . a speech engine 44 is coupled to the personal services manager 42 , and is operative to perform speech recognition such that the speech engine converts the voice and any corresponding oral commands of the user into appropriate digital signals for further use and transmission by the personal services manager 42 . in an exemplary embodiment , speech recognition is performed by an engine such as ibm viavoice . the speech engine 44 also performs text - to - speech synthesis , where digital signals are converted into audible sounds ( e . g ., words ) that the user can understand . in the embodiment , the text - to - speech synthesis is performed by the at & amp ; t natural voices engine . however , any suitable text - to - speech engine can be used without deviating from the spirit and scope of the present invention . a web services api 46 couples a uddi registry 48 to the personal services manager 42 . the uddi registry 48 , in one embodiment , is configured as a database that maintains a searchable list of experts in myriad fields . the expert list includes information relating to each of the experts maintained in the uddi registry including , for example , the connection capabilities of the expert , the location of the expert , an indication of whether the expert is available for consultation , the technical blueprints ( or t - models ), which explain how , programmatically , to bind and invoke an expert service and any fees charged by the expert , to name just a few . it will be appreciated by one of ordinary skill in the art that the aforementioned list of expert information is not exhaustive and any appropriate information relating to the experts that falls within the may be maintained in the personal services manager and falls within the spirit and scope of the present invention . in addition , the experts may be business or commercial entities , as well as individual persons . if the selected expert is a business entity , such entity may , for example , implement a connection system similar to that described with reference to fig1 and 2 in order to connect the use with an individual expert who can answer an user question . searching of the uddi registry 48 is performed , for example , using the xml / soap - based query patterns and protocols , as specified in the uddi 2 . 0 api specification . a user database 45 is also coupled to the personal services manager 42 and is operative to store user preferences relating to , for example , the maximum amount of fees to be paid for advice or services , preferred location and experience level of experts , billing information and any technical information pertinent to the environment of the user . although , the speech engine 44 , user database 45 , api 46 and uddi registry 48 are described as being separate components , it will be appreciated by one of ordinary skill in the art that the aforementioned components can be integrated within the personal services manager 42 , and such a configuration is contemplated by and falls within the spirit and scope of the invention . for example , the market broker manager 40 illustrated in fig4 can be implemented as a processor 41 connected to and operating according to instructions that are maintained within a memory 41 . also , it should be noted and appreciated that the expertise manager 18 can be implemented in similar fashion to the personal services manger 42 described above . referring back to fig3 , the user location 12 is connected to the market broker manager 40 via communication link 15 . in the embodiment illustrated in fig3 , the communication link 15 is provided by the internet . however , it will be appreciated by those of ordinary skill in the art that the communication link 15 can also be provided by a local area network ( lan ), a wide area network ( wan ), or appropriate land - line and wireless networks . the user location 12 also includes sensors 14 , which may also include , temperature sensors , humidity sensors or a digital camera 30 equipped with a lighting element that is adapted to wirelessly transmit video images over the communication link . a wireless microphone ( not shown ) or any other means for transmitting voice data over the communication link 15 may also be coupled to or provided within the user location . market broker system operation of the present invention will now be described with reference to fig5 . referring now to fig5 , the method begins at step 200 with the user or layperson connecting to the market broker manager and providing an oral request for expert assistance . in this step , the oral query ( e . g ., “ i need help connecting a phone jack to the wall ”) is received by the viavoice engine and converted into digital signals for use by the personal services manager 42 . the process then proceeds to step 202 . in step 202 , a keyword determination ( e . g ., “ phone ” “ jack ” and “ connection ”) is generated by the personal services manger 42 , based on the oral request , and the keyword ( s ) from the request are provided to the user for modification or confirmation by the text - to - speech engine . next , in step 203 , a determination is made as to whether a modification to any determined keywords is necessary . if a modification is necessary , or the layperson wants to modify the request , the process moves back to step 202 where the layperson modifies the request and the modified request is received by the personal services manager . on the other hand , if modifications are not necessary , the process moves to step 204 . in step 204 , the personal services manager 42 generates an xml / soap query pattern based on the keywords and searches the uddi registry 48 for at least one expert that meets the layperson requirements in step 205 . if no match is found , the process moves back to step 202 , where the personal service manager 42 requests the layperson for a new query ( e . g ., “ your query resulted in no matches , please make another request ”) via the text - to - speech engine . after the new query is received , the keyword ( s ) are modified and a new search is conducted . if a match is found in step 205 , the process moves to step 206 . in step 206 , the personal services manager 42 provides the layperson with a list of expert matches ( e . g ., “ john smith , smith electric ,” “ home depot ,” “ alexander jones ”), along with any contact and t - model information , through the text - to - speech engine and waits for the layperson to select an expert in step 207 . once a selection is made ( e . g ., “ john smith ”) and the t - model information between the layperson location 12 and the expert matches , the voice and video information , if any , of the layperson environment ( e . g ., the outlet where the phone jack is to be connected ) is simultaneously transmitted to the selected expert via communication link 15 in step 208 . in this manner , the expert is provided with a real - time image of the phone jack and where it is to be connected and can provide the layperson with step - by - step instructions on how to connect the phone jack with the actual layperson environment as the model . if the t - model information between the layperson location 12 and the expert does not match , the layperson will be alerted of the mismatch and be asked to enter a new selection ( e . g ., “ connection not possible at this time , please make another selection ”). in fee - based embodiments , the metering block 42 requests the user or layperson to enter the method of payment ( e . g ., credit card , debit card , etc .) and then keeps track of the amount of time the user is connected to the expert and calculates a bill based on the connection time . alternately , in fixed - fee based services , the user is charged once connection is made to the expert . in step 208 , the personal services manager determines whether the session has been terminated . if the session is complete , the process moves to step 210 where the connection between the layperson and the expert is terminated ( e . g ., “ connection to john smith terminated ”). the above detailed description of the present invention and the examples described therein have been provided for the purposes of illustration and description . although an exemplary embodiment of the present invention has been described in detail herein with reference to the accompanying drawings , it is to be understood that the present invention is not limited to the precise embodiments disclosed , and that various changes and modifications to the invention are possible , in light of the above teaching . accordingly , the scope of the present invention is to be defined by the claims appended hereto .
| 7Electricity
|
referring to fig1 the imprinting press and cooking device 10 are preferably supported by an open frame 13 . the frame 13 consists of a rectangular enclosure having protective cross members 14 to add strength and protection for the working components . frame 13 is supported by adjustable legs 16 . frame 13 has a bottom deck 87 and a middle deck 83 . bottom deck 87 can be formed by a flat plate welded between the bottom cross members 14 . support box 31 is mounted to deck 87 . support box 31 is a rectangular enclosure mounted in the center of deck 87 to house and protect ring gear 35 , right angle gear 33 , support bottom bearing 28 and top bearing 25 , which will be more fully described below . bottom bearing 28 and top bearing 25 support center post 22 , which in turn supports upper and lower circular cooking plates 19 and 20 . bottom bearing 28 also forms a thrust surface to support the weight of center post 22 , ring gear 35 and upper and lower circular cooking plates 19 and 20 . center post 22 is mounted in bottom bearing 28 and proceeds upward from top bearing 25 through hole 86 in deck 83 and then expands to a larger diameter , forming support post 23 . support post 23 is welded to the bottom of lower circular cooking plate 20 , coaxial with lower circular cooking plate 20 and center post 22 . support post 24 is positioned on top of and coaxial with lower circular cooking plate 20 and welded in place . support post 24 , in turn , is coaxially positioned below upper circular cooking plate 19 and welded in place . the cooking plates 19 and 20 are free to rotate in the top bearing 25 and bottom bearing 28 . during operation , they are driven by ring gear 35 which is engaged by right angle drive gear 33 . right angle drive gear 33 is connected to low speed gear box 41 , which is in turn driven by a high speed electric motor 38 . during operation , motor 38 , through gear box 41 right angle drive gear 33 and ring gear 35 turns the cooking plates 19 and 20 at approximately three revolutions per minute . however , this speed can be varied in alternate embodiments to raise or lower the rotational speed of the cooking plates and consequently , the potential output of cooked bread products produced by the machine . on top of circular cooking plate 19 , scraper 42 is radially positioned and held in place by frame 13 . scraper 42 is comprised of an angular bar 43 , formed with a slight curve . angular bar 43 holds flexible scraper 44 downward against upper circular cooking plate 19 . angular scraping bar 43 is rigidly bolted to frame 13 . a second scraper 48 including angular bar 49 and flexible scraper 51 is radially positioned on top of lower cooking plate 20 . scraper 48 is rigidly held in place by frame 13 . air slide 45 is held directly adjacent upper circular cooking plate 19 and scraper 42 by channel duct 46 . channel duct 46 is bolted in place on frame 13 between top cross members 14 . referring briefly to fig4 it can be seen that air slide 45 is preferably comprised of three pieces of curved stainless steel . top plate 90 has multiple perforations 91 for the passage of high pressure air . top plate 90 is spot welded to spacer 93 . spacer 93 is preferably a &# 34 ; u &# 34 ; shaped piece of stainless steel cured to match top plate 90 . bottom plate 96 is cured to match top plate 90 and is also spot welded to spacer 93 . the result is a thin flat duct having one open end at the top . other methods of forming a duct are well known in the art and will serve well here ; they will not be disclosed . channel duct 46 is formed with a thin rectangular hole ( not shown ) which matches the open end formed between top plate 90 and bottom plate 96 . top plate 90 , spacer 93 and bottom plate 96 are all sealed to this thin rectangular hole in channel duct 46 . channel duct 46 also connects to reduction coupling 19 which is , in turn , connected to transmission duct 47 . a second hole in channel duct 46 matching that in reduction coupling 99 allows air to flow from transmission duct 47 through reduction coupling 99 into channel duct 46 and in turn , into the space in between top plate 90 and bottom plate 96 and outward through perforations 91 . the ends of channel duct 46 are sealed . returning to fig1 transmission duct 47 can been seen to be connected to high speed impeller 50 . in operation , high speed impeller 50 supplies high pressure air through duct 47 to be expelled through perforations 91 . thus , a tortilla scraped off of the upper cooking plate will slide down the air slide , supported on a thin cushion of pressured air . other sources of air pressure can be used here as well . in the top corner of frame 13 , a flat press plate 53 is positioned and bolted in place . flat press plate 53 is hinged to support frame 56 . a coil spring 57 is spot welded to support frame 56 and flat press plate 23 to aid in lifting support frame 56 , as will be further described below . support frame 56 is preferably constructed of right angle channel forming an open frame to support imprinting plate 62 . imprinting plate 62 is supported by pins 65 which are pivotally connected to support frame 56 . referring briefly to fig3 a , 3b , 3c and 3d , the details of the imprinting press can be seen . referring to fig3 a , a handle 59 can be seen bolted to the top of support frame 56 . this handle is grasped by the user and pulled downward to press and imprint a tortilla . both flat press plate 53 and imprinting plate 62 are heated . this heating is accomplished through electrical heating elements 105 and 108 which are bolted in place in direct contact with the back of flat plate 53 and imprinting plate 62 . in the preferred embodiment , each heating element is rated at 2000 watts ; however , other wattages may be implemented with successful results in other embodiments . other heat sources , such as gas burners or inductive elements , may also be used with varying degrees of success . heating elements 108 and 105 are directly connected to a thermostatic control , shown in fig1 at 117 . thermostat 117 is , in turn , connected to a source of electrical power in the preferred embodiment is 220 v a . c . the details of these connections and of thermostatic control are well known in the art and will not be discussed further . imprinting plate 62 is preferably shaped in the form of a flat octagon . a circular shape is inscribed in the octagon leaving each corner of the octagon raised . the corners form standoffs 114 , which press directly against flat plate 53 when the imprinting press is closed . standoffs 114 are preferably 0 . 020 &# 34 ; thick . the standoffs form the maximum thickness of the tortilla or other bread product to be pressed by controlling the distance between the imprinting plate 62 and the flat press plate 53 when the imprinting press is enclosed . other standoff thicknesses can be used , depending on the desired thickness of the flat bread product . design 111 are shown inscribed into imprinting plate 62 . in the preferred embodiment , the design is engraved into imprinting plate 62 to a depth of approximately 0 . 020 &# 34 ; . other depths can be used to vary the results and designs obtained . in other embodiments , design 111 can be embossed onto printing plate 62 . in the preferred embodiment , imprinting plate 62 also includes a removable icon 112 . imprinting plate 62 is formed with a round hole 115 in its center . icon 112 is a removable plate which is fitted exactly within hole 115 and held in place by flathead screws 113 . additional designs 111 are engraved or embossed into icon 112 and appear on the tortilla surface . the advantage of removable icon 112 is that it can be changed for each restaurant or festive events to custom label the tortillas or other bread products . referring to fig3 b , the operation of the imprinting press can be seen . fig3 b shows the imprinting press open and the position of imprinting plate 62 . frame 56 is held open by coil spring 57 . imprinting plate 62 is held at an angle by support frame 56 and pins 65 . as seen in fig3 c , as the imprinting press is closed , the top of imprinting plate 62 contacts flat press plate 53 first . as the imprinting press is further closed , the imprinting plate 62 rotates downward toward flat press plate 53 pivoting and sliding at its front corner down toward the unpressed dough product . when fully closed , the imprinting press comes to rest as shown in fig3 d . the advantage of the pivotal connection of imprinting plate 62 to support frame 56 is that as the imprinting press is being closed , the tortilla dough is pressed evenly from front to back forming a nearly perfect disk shape . when pressure is released from handle 59 , coil spring 57 returns frame 56 to its open position . slide plate 54 is connected to press plate 53 and aids in sliding pressed bread products from flat press plate 53 onto upper cooking plate 19 . as shown in fig1 upper circular cooking plate 19 and lower circular cooking plate 20 are heated . in the preferred embodiment , the cooking plates are heated through gas burners which can best be seen in fig2 . fig2 shows support piping 68 which is connected to the exterior frame 13 . support piping 68 extends inward underneath cooking plates 19 and 20 . the support piping terminates in a round burner 71 under each cooking plate . gas valves 80 are provided . in the preferred embodiment , these are electrically controlled solenoid valves which are operated from a stop switch shown in fig1 . stop switch 120 also controls the operation of impeller 50 and motor 38 . in operation , when the stop switch is turned on , gas supply is allowed to flow to burner 71 and motor 38 is activated as is impeller 50 . when the stop switch is turned off , impeller 50 and motor 38 are both turned off and gas valves 77 and 80 are closed , stopping the flow of gas to burners 71 . the electrical connections between the valves , motor , impeller and stop switch are well known and will not be further described . in operation , the cooking unit is turned on via stop switch 120 and the imprinting press is set to a desired temperature through thermostat 117 . after being allowed to warm up a short period of time , a ball of tortilla dough is place roughly in the center of flat press plate 53 . handle 59 on support frame 56 is grasped and pulled downward bringing imprinting plate 62 toward flat press plate 53 . as the imprinting plate is closed , the tortilla dough is pressed out into a circular disk to a thickness set by standoff 114 . as it is being pressed , the tortilla dough flows upward into engraved design 111 forming an embossed label on the flat tortilla . since both the imprinting plate 62 and the flat press plate 53 are heated , the tortilla dough does not stick to them . after pressing , the imprinting plate is raised via handle 59 and coil spring 57 revealing the pressed tortilla . the pressed tortilla is then slid down slide plate 54 , either manually , or by the force of gravity , and onto upper circular cooking plate 19 . upper circular cooking plate 19 is rotating and the pressed tortilla rotates and cooks , around the outer periphery of the cooking plate . when the tortilla reaches scraper 42 , it contacts the tortilla and forces it off of cooking plate 19 and onto air slide 45 . air slide 45 then directs the tortilla downward toward lower cooking plate 20 . the tortilla then cooks on its opposite on lower cooking plate 20 rotating a full revolution toward scraper 48 . after cooking , the imprinted design is fixed in the tortilla . scraper 48 then forces the now cooked tortilla of cooking plate 20 where it falls and comes to rest on deck 83 . it can then be removed and used in food preparation . fig5 shows a schematic diagram of a second embodiment of the device . in this embodiment , the circular cooking plates 19 and 20 are replaced by flat belts 130 and 139 . the belts are supported by pulleys 133 and positioned one above the other as shown . the direction of travel of each belt in this alternate embodiment is shown as 142 and 145 . heating elements 136 are provided under the top surfaces of belts 130 and 139 to complete cooking of the tortilla . radiative , convective , conductive or inductive heating elements may all be used in alternate embodiments . the mechanical elements necessary to support the belts , and cause pulleys 133 to rotate , therefore moving belts is well know in the art and will not be described here . air slide 45 is also provided at the end of belt 130 to aid in moving and flipping the flat bread product from belt 130 to belt 139 . in operation of this embodiment , the tortilla is pressed by forcing imprinting plate 62 downward against flat press plate 53 . after pressing and imprinting the tortilla , imprinting plate 62 is raised and the now pressed tortilla is slid down slide plate 54 and onto moving belt 130 . heating elements 136 provide heat to cook the first side of the tortilla as it travels along belt 130 . when reaching the end of belt 130 , the tortilla falls off and is flipped by air slide 45 downward and onto belt 139 . heating elements 136 complete cooking of the second side of the tortilla as it travels the length of belt 139 . at the end of belt 139 , the tortilla has completed cooking whereupon it is ready to be used in food preparation . the previous discussion discloses the most marketable embodiments of the present invention . however , there are alternative ways of accomplishing similar results . for example , the imprinting plate has been described as pressing a form into the uncooked dough . but , a surface image could be seared onto the dough with a flat imprinting plate if heating elements on the opposite side of the plate were formed in the shape of the image . in other words , the surface temperature of the imprinting plate would be higher immediately opposite the heating elements . thus , these higher temperature zones could be formed to match the name of a restaurant . when the plates were brought together , the tortilla dough would be flattened and partially seared , spelling out the name of that restaurant . the partially cooked tortilla would still be removed and then fully cooked . thus , the term imprinting should be interpreted to include branding such as described in this alternative . in another embodiment , the tortilla could be fully cooked before having the image or word seared onto its surface . up to this point , the imprinting was done before the tortilla was cooked . conceivably , an imprinting station could be placed at the end of the process . while the preferred embodiment of the invention has been described , it is not intended to limit the invention to the particular form set forth , but is intended to cover such alternatives , modifications , and equivalents as may be included in the spirit and scope of the invention as defined by the appended claims .
| 0Human Necessities
|
the embodiments discussed herein are merely illustrative of specific manners in which to make and use the invention and are not to be interpreted as limiting the scope of the instant invention . referring to the above listed drawings in detail : the preferred embodiment of the apparatus and the method for making same utilizes 37 hexagon hubs ( fig2 ), 6 pentagon hubs ( fig1 ), 13 half - hexagon hubs ( fig3 ), and 6 entry hubs . the 6 entry hubs include 2 entry midway ts ( fig4 ), 2 entry tops ( fig5 & amp ; fig6 ), and 2 entry bottoms ( fig7 & amp ; fig8 ). the hubs are produced with cylindrical and notched jigs ( fig1 & amp ; fig2 ). the jigs ( fig1 & amp ; fig2 ) used to fashion the hubs are cylinders 2 inches high by 3 . 125 inches in diameter with 5 ( for pentagon hubs ) or 6 ( for hexagon hubs ) 0 . 5 inch by 0 . 5 inch notches ( 1901 & amp ; 2001 ) fashioned at equidistant intervals around the cylinder edge . ( notches are cut at 72 degree intervals for pentagon hubs and 60 degree intervals for hexagon hubs .) placing the jigs on a flat surface with notched ends up will provide the proper inclination to achieve a 10 degree pronation of 8 inch long # 4 rebar inserts with ends touching at the center to form a hub . placing the 8 inch long # 4 rebar inserts in the notched locations around the top of the jig with ends touching will set the inserts at the proper angles for strut orientation . the 37 hexagon hubs ( fig2 ) are created by placing 6 - 8 inch long # 4 rebar inserts ( 201 ) into a jig for hexagon hubs , described above , and welding the ends of the rebar inserts together in the center of the jig . 6 - 2 inch locking bars ( 202 ) are welded between the rebar inserts near the center of the hub . the 6 pentagon hubs ( fig1 ) are created by placing 5 - 8 inch long # 4 rebar inserts ( 101 ) into a jig for pentagon hubs , described above , and welding the ends of the rebar inserts together in the center of the jig . 5 - 3 inch locking bars ( 102 ) are welded between the rebar inserts near the center of the hub . the 13 half - hexagons ( fig3 ) are created by placing 4 - 8 inch long # 4 rebar inserts ( 301 ) into 4 adjacent notches in a jig for hexagon hubs , described above , and welding the ends of the rebar inserts together in the center of the jig . 3 - 2 inch locking bars ( 302 ) are welded between the rebar inserts near the center of the hub . the 2 entry midway ts ( fig4 ) are created by welding an 8 inch long # 4 rebar insert ( 402 ) at the center point of a 16 inch long section of # 4 rebar ( 401 ) at a 90 degree angle . the 2 mirrored entry tops ( fig5 & amp ; fig6 ) are created by placing 5 - 8 inch long # 4 rebar inserts ( 501 & amp ; 601 ) into a jig for hexagon hubs , described above , and welding the ends of the rebar inserts together in the center of the jig . 4 - 2 inch locking bars ( 502 & amp ; 602 ) are welded between the rebar inserts near the center of the hub . a 6 th 8 inch long # 4 rebar insert ( 503 & amp ; 603 ) is welded into the hub creating a 90 degree angle in relation to the left adjacent insert and 30 degree angle in relation to the right adjacent insert . for the mirrored entry top , a 6 th 8 inch long # 4 rebar insert is welded into the hub creating a 90 degree angle in relation to the right adjacent insert and 30 degree angle in relation to the left adjacent insert . the 2 mirrored entry bottoms ( fig7 & amp ; fig8 ) are created by placing 2 - 8 inch long # 4 rebar inserts ( 701 & amp ; 801 ) into 2 adjacent notches in a jig for hexagon hubs , described above , and welding the ends of the rebar inserts together in the center of the jig . 1 - 2 inch locking bar ( 702 & amp ; 802 ) is welded between the rebar inserts near the center of the hub . a 3 rd 8 inch long # 4 rebar insert ( 703 & amp ; 803 ) is welded into the hub creating a 270 degree angle in relation to the left adjacent insert and 30 degree angle in relation to the right adjacent insert . for the mirrored entry bottom , a 3 rd 8 inch long # 4 rebar insert is welded into the hub creating a 30 degree angle in relation to the right adjacent insert and 270 degree angle in relation to the left adjacent insert . the preferred embodiment of the apparatus and the method for making same utilizes 30 “ a struts ” ( fig9 ), 54 “ b struts ” ( fig1 ), 74 “ c struts ” ( fig1 ), 4 “ entry struts ” ( fig1 ), and 2 “ entry midway struts ” ( fig1 ). the struts may be created with wood , rebar , bamboo , pvc pipe , or any other appropriate available material . the preferred embodiment described herein utilizes bamboo . the 30 “ a struts ” ( fig9 ) are each created with a 37 inch length of bamboo ( 901 ) approximately 2 inches in diameter . the bamboo is notched across each end ( 902 ) 0 . 5 inches wide by 0 . 75 inches deep and in alignment . a 0 . 125 inch hole ( 903 ) is drilled through the strut 7 inches from each end for 2 - 28 inch lengths of wire ( 14 . 5 gauge steel wire or an equivalent ) that will tie off to the hubs . 2 - 24 inch lengths of wire ( 904 ) ( 14 . 5 gauge steel wire or an equivalent ) are wrapped three times around each strut at points approximately 1 inch from each notch . the 54 “ b struts ” ( fig1 ) are each created with a 42 inch length of bamboo ( 1001 ) approximately 2 inches in diameter . the bamboo is notched across each end ( 1002 ) 0 . 5 inches wide by 0 . 75 inches deep and in alignment . a 0 . 125 inch hole ( 1003 ) is drilled through the strut 7 inches from each end for 2 - 28 inch lengths of wire ( 14 . 5 gauge steel wire or an equivalent ) that will tie off to the hubs . 2 - 24 inch lengths of wire ( 1004 ) ( 14 . 5 gauge steel wire or an equivalent ) are wrapped three times around each strut at points approximately 1 inch from each notch . the 74 “ c struts ” ( fig1 ) are each created with a 43 . 5 inch length of bamboo ( 1101 ) approximately 2 inches in diameter . the bamboo is notched across each end ( 1102 ) 0 . 5 inches wide by 0 . 75 inches deep and in alignment . a 0 . 125 inch hole ( 1103 ) is drilled through the strut 7 inches from each end for 2 - 28 inch lengths of wire ( 14 . 5 gauge steel wire or an equivalent ) that will tie off to the hubs . 2 - 24 inch lengths of wire ( 1104 ) ( 14 . 5 gauge steel wire or an equivalent ) are wrapped three times around each strut at points approximately 1 inch from each notch . the 4 “ entry struts ” ( fig1 ) are each created with a 37 inch length of bamboo ( 1201 ) approximately 2 inches in diameter . the bamboo is notched across one end ( 1202 ) 0 . 5 inches wide by 0 . 75 inches deep and in alignment . a 0 . 125 inch hole ( 1203 ) is drilled through the strut 7 inches from each end for 2 - 28 inch lengths of wire ( 14 . 5 gauge steel wire or an equivalent ) that will tie off to the hubs . 2 - 24 inch lengths of wire ( 1204 ) ( 14 . 5 gauge steel wire or an equivalent ) are wrapped three times around each strut at points approximately 2 inches from each end . the 2 “ entry midway struts ” ( fig1 ) are each created with a 22 inch length of bamboo ( 1301 ) approximately 2 inches in diameter . the bamboo is notched across one end ( 1302 ) 0 . 5 inches wide by 0 . 75 inches deep and in alignment . a 0 . 125 inch hole ( 1303 ) is drilled through the strut 7 inches from each end for 2 - 28 inch lengths of wire ( 14 . 5 gauge steel wire or an equivalent ) that will tie off to the hubs . 2 - 24 inch lengths of wire ( 1304 ) ( 14 . 5 gauge steel wire or an equivalent ) are wrapped three times around each strut at points approximately 2 inches from each end . the preferred embodiment of the apparatus and the method for making same utilizes 6 “ pentagon forms ” ( fig1 ), 37 “ hexagon forms ” ( fig1 ), and 13 “ half - hexagon forms ” ( fig1 ). the forms may be created with wood , cardboard , oriented strand board , particleboard , or any other appropriate available material . the preferred embodiment described herein utilizes oriented strand board (“ osb ”). the pentagon forms ( fig1 ) each necessitate one 12 inch by 12 inch osb square to form an inner pentagon ( 1401 ), one 16 inch by 17 inch osb rectangle to form an outer pentagon ( 1402 ), five 3 . 5 inch by 7 inch hourglass shaped flaps ( 1403 ), one piece of 50 inch length string , fifteen pieces of 5 inch length tape ( 1404 ), five 1 inch screws , and three pieces of 29 inch wire ( 14 . 5 gauge steel wire or an equivalent ). the osb squares are cut into pentagons as shown in fig1 ; the five 3 . 5 inch by 7 inch hourglass shaped flaps are cut as shown in fig1 . one 1 inch screw is screwed into the center of each flap ( 1405 ) approximately 0 . 75 inches from the outside edge as shown in fig1 . the inside edges of the flaps ( edge opposite screw ) are connected to the corresponding edges of the inner pentagon via the tape pieces described above — one piece of tape for the top side of the combination and one piece of tape for the bottom side of the combination as shown in fig1 . one end of the string described above is tied to one screw head . the osb may be sealed to prevent water penetration . the outer pentagon ( 1402 ) may contain groves ( 1406 ). the hexagon forms ( fig1 ) each necessitate one 10 inch by 9 inch osb rectangle to form an inner hexagon ( 1501 ), one 12 inch by 14 inch osb rectangle to form an outer hexagon ( 1502 ), six 3 . 5 inch by 5 . 25 inch hourglass shaped flaps ( 1503 ), one piece of 48 inch length string , eighteen pieces of 5 . 25 inch length tape ( 1504 ), six 1 inch screws , and three pieces of 26 inch wire ( 14 . 5 gauge steel wire or an equivalent ). the osb squares are cut into hexagons as shown in fig1 ; the six 3 . 5 inch by 5 . 25 inch hourglass shaped flaps are cut as shown in fig1 . one 1 inch screw is screwed into the center of each flap ( 1505 ) approximately 0 . 75 inches from the outside edge as shown in fig1 . the inside edges of the flaps ( edge opposite screw ) are connected to the corresponding edges of the inner hexagon via the tape pieces described above — one piece of tape for the top side of the combination and one piece of tape for the bottom side of the combination as shown in fig1 . one end of the string described above is tied to one screw head . the osb may be sealed to prevent water penetration . the outer hexagon ( 1502 ) may contain groves ( 1506 ). the half - hexagon forms ( fig1 ) each necessitate one 10 inch by 4 . 5 inch osb rectangle to form an inner half - hexagon ( 1601 ), one 6 inch by 14 inch osb rectangle to form an outer half - hexagon ( 1602 ), three 3 . 5 inch by 5 . 25 inch hourglass shaped flaps ( 1603 ), one piece of 24 inch length string , nine pieces of 5 . 25 inch length tape ( 1604 ), three 1 inch screws , and three pieces of 26 inch wire ( 14 . 5 gauge steel wire or an equivalent ). the osb squares are cut into half - hexagons as shown in fig1 ; the three 3 . 5 inch by 5 . 25 inch hourglass shaped flaps are cut as shown in fig1 . one 1 inch screw is screwed into the center of each flap approximately 0 . 75 inches from the outside edge as shown in fig1 . the inside edges of the flaps ( edge opposite screw ) are connected to the corresponding edges of the inner hexagon via the tape pieces described above — one piece of tape for the top side of the combination and one piece of tape for the bottom side of the combination as shown in fig1 . one end of the string described above is tied to one screw head . the osb may be sealed to prevent water penetration . the outer half - hexagon ( 1602 ) may contain groves ( 1606 ). 2 nd step : fill the end of one a strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining four a struts . 4 th step : use a mallet to drive the prepared a struts onto the pentagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 6 th step : use a mallet to drive the hexagon hubs into the a struts protruding from the prepared pentagon hubs . lock the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub . guide the wires through the spaces on opposing sides of the hub and twist the wires tight enough to prevent the strut from separating from the hub . 8 th step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining four b struts . 9 th step : use a mallet to drive the b struts , onto the adjacent inserts and pins of the hexagon hubs , next to the a struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . a pentagon is now formed out of the a and b struts . 11 th step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine c struts . 12 th step : use a mallet to drive the c struts onto the adjacent inserts and pins of the hexagon hubs , next to the b struts , onto the ends of the pentagon &# 39 ; s apexes ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 14 th step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining four b struts . 15 th step : use a mallet to drive the b struts , onto the remaining inserts and pins ; locking the strut notches into the hub pins , of the hexagon hubs . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 17 th step : use a mallet and drive one hexagon hub , into the b strut ; locking the strut notches into the hub pin . use the wires on the struts to secure the strut to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 19 th step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine a struts . 20 th step : use a mallet and drive one c strut into the insert and pins of the hexagon hub that is adjacent to the b strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 21 st step : use a mallet and drive one hexagon hub into the adjacent c , c , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 22 nd step : use a mallet and drive one c strut into the horizontal insert and pins of the hexagon hub that is adjacent to the c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 23 rd step : use a mallet and drive one hexagon hub into the b strut and c strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 24 th step : use a mallet and drive one c strut into the insert and pins of the hexagon hub that is adjacent to the b strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 25 th step : use a mallet and drive one hexagon hub into the adjacent c , c , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 26 th step : use a mallet and drive one c strut into the horizontal insert and pins of the hexagon hub that is adjacent to the c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 27 th step : repeat steps 23 through 26 three times . this will bring you to the hexagon hub , where you will attach the end of the c strut into the insert and pins of the hexagon hub , that is adjacent to the b strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 29 th step : fill the end of one a strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining four a struts . 30 th step : use a mallet and drive the a struts , onto the ends of the hexagon hubs , which are opposite to or across from , the b struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 32 nd step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine b struts . 33 rd step : use a mallet and drive the b struts onto the remaining inserts and pins , of the hexagon hub , adjacent to the a struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 35 th step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine c struts . 36 th step : use a mallet and drive the c struts , onto the remaining inserts and pins of the hexagon hubs ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 38 th step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining four b struts . 40 th step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine c struts . 41 st step : collect 1 right entry top hub and locate the orientation of the door . 42 nd step : insert the right hand side entry top hub , into the ends of one b strut and one c strut . use a mallet and drive the upper door opening hub into the b strut and c strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 43 rd step : use a mallet and drive one b strut , onto the insert of the entry top hub , that is adjacent to the c strut . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 45 th step : insert the left hand side entry top hub into the ends of the two b struts and one c strut , that are opposite of the right hand side entry top hub . use a mallet and drive the upper door opening hub into the b struts and c strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 46 th step : use a mallet and drive one a strut , into the left hand side insert and pins of the entry top hub , that is adjacent to the b strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 48 th step : use a mallet and drive one pentagon hub into the ends of the two a struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 49 th step : use a mallet and drive one a strut , onto the upper left hand side insert and pins of the pentagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 51 st step : use a mallet and drive the inserts and pins of the hexagon hub into the a , b , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 52 nd step : use a mallet and drive one b strut , onto the insert and pins of the hexagon hub , that is adjacent to the c strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 53 rd step : use a mallet and drive the inserts and pins of one hexagon hub into the b , b , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 54 th step : use a mallet and drive one a strut , onto the upper left hand side insert and pins of the hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 55 th step : use a mallet and drive one pentagon hub into the ends of the two a struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 56 th step : use a mallet and drive one a strut , onto the upper left hand side insert and pins of the pentagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 58 th step : insert the a strut onto the insert and pins of the right entry top hub , which is adjacent to the b strut . 60 th step : fill the end of one a strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine a struts . 61 st step : use a mallet and drive the a struts onto the insert and pins of the pentagon hubs ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 63 rd step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine b struts . 64 th step : use a mallet and drive the b struts onto the insert and pins of the hexagon hubs , that are adjacent to the pentagon hubs ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 66 th step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining seven c struts . 67 th step : use a mallet and drive the c struts , onto the remaining inserts and pins of the hexagon hubs ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 69 th step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining four b struts . 71 st step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining seven c struts . 73 rd step : start at the left of the door opening , use a mallet and drive one hexagon hub into the a and b struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 74 th step : use a mallet and drive one b strut into the horizontal insert and pins of the hexagon hub , that is adjacent to the a strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 75 th step : use a mallet and drive one hexagon hub into the ends of the b , a , and b struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 76 th step : use a mallet and drive one c strut into the horizontal insert and pins of the hexagon hub , that is adjacent to the b strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 77 th step : use a mallet and drive one hexagon hub into the ends of the c , c , and c , struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 78 th step : use a mallet and drive one c strut into the horizontal insert and pins of the hexagon hub , that is adjacent to the c strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 79 th step : use a mallet and drive one hexagon hub into the ends of the a , b , & amp ; c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 80 th step : use a mallet and drive one b strut into the horizontal insert and pins of the hexagon hub , that is adjacent to the a strut ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 81 st step : repeat steps 76 through 81 three times . this will bring you to the right hand side of the doorway . 83 rd step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine b struts . 84 th step : use a mallet and drive the b struts , onto the inserts and pins of the hexagon hubs , that are on the opposite side of the a struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 86 th step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining seventeen c struts . 87 th step : use a mallet and drive the c struts , onto the remaining inserts and pins of the hexagon hubs ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 89 th step : fill the end of one c strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining nine c struts . 91 st step : fill the end of one b strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining three b struts . 93 rd step : use one half - hexagon hub . place it horizontally under the c struts , to the left of the door opening . use a mallet and drive the top two inserts and pins into the c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 94 th step : use a mallet and drive one c strut it into the right insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 95 th step : use a mallet and drive one c strut into the left insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 96 th step : use a mallet and drive one half - hexagon hub into the c , b , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 97 th step : use a mallet and drive one b strut into the left insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 98 th step : use a mallet and drive one half - hexagon hub into the b , c , and b struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 99 th step : use a mallet and drive one c strut into the left horizontal insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 100 th step : use one half - hexagon hub . place it horizontally under the c struts . use a mallet and drive it into the inserts and pins of the c , c , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 101 st step : use a mallet and drive one c strut into the left insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 102 nd step : use a mallet and drive one half - hexagon hub into the c , b , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 103 rd step : use a mallet and drive one b strut into the left insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 104 th step : use a mallet and drive one half - hexagon hub into the b , c , and b struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 105 th step : use a mallet and drive one c strut into the left insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 106 th step : repeat steps 98 through 103 three times . this will take you to the right hand side of the door . 107 th step : use one half - hexagon hub . place it horizontally under the c struts . use a mallet and drive it into the inserts and pins of the c , c , and c struts ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 108 th step : use a mallet and drive one c strut into the left insert and pins of the half - hexagon hub ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 110 th step : fill the end of one entry strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining three entry struts . 112 th step : fill the end of one entry midway strut with the fine mix of cement up to the strut &# 39 ; s notch . cover and secure the end to keep the cement from running out . flip the strut over and fill the other end of the strut with the mix of fine cement up to the strut &# 39 ; s notch and secure and cover . repeat this step with the remaining entry midway strut . 115 th step : using a mallet , drive two entry struts onto the inserts of the entry top hubs ; locking the strut notches into the hub pins . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 116 th step : using a mallet , drive two entry midway struts onto the inserts and pins of the adjacent hexagon hubs , on each side of the doorway . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 117 th step : using a mallet , drive two entry midway “ t ” hubs into the entry top struts and the entry midway struts . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . the remaining insert should be pointing downward . 118 th step : using a mallet drive the remaining two entry struts into the inserts of the entry midway “ t ” hubs . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . 119 th step : using a mallet , drive the two entry bottom hubs into the c , b , and entry struts . use the wires on the struts to secure the struts to the hub , by guiding the wires through the spaces on opposing sides of the hub and twisting the wires tight enough to prevent the strut from separating from the hub . after the frame is assembled and the concrete in the struts has cured for three days , the forms and concrete are ready to be installed over the hub connections . 1 ) place a pentagon or a hexagon form under the center of the corresponding metal hub . 2 ) fold the flaps around the struts . 3 ) take the string over the struts and wrap around the screw on each flap securing the form to the framework . 4 ) when the form is in the horizontal position , secure the flaps and fill concrete from the top . 5 ) when the form is in the vertical position , leave the top flap untied for inserting concrete . 6 ) for vertical forms , place the outer part of the form with the notched side facing outward against the ends of the flaps of the attached form . 7 ) secure wire around the strut below the notch in the outer part of the form . 8 ) pull the wire across the notch in the form and secure the wire on an opposing strut below the end of the notch . 9 ) repeat step 8 by running the wires through the axes of the hub until all of the axes are secure . 10 ) tighten the wires to bend the outer form into to the shape of an apex shape . 11 ) draw the surface of the outer form to the ends of the flaps of the inner form . 12 ) pour concrete mix in the upper opening of the form filling the form to the top . 13 ) vibrate form to remove any voids in the pour to make a good cast . 14 ) after the concrete has set , snip the wires and remove the outer parts of the forms . 15 ) untie the strings of the inner form , open up the flaps and remove the inner part of the form . check for voids in the casting and repair as needed . coverings may be utilized as shown in fig1 , fig1 , fig2 , and fig2 . an “ aab panel ” ( 1701 ) is formed of osb panel , or any other suitable material , and cut to cover a triangular aperture created by two “ a struts ” ( fig9 ) and one “ b strut ” ( fig1 ). bracing rods ( 1702 ) may be affixed to the “ aab panel ” via wire or string and bracing rod holes ( 1703 ). the “ aab panel ” may be affixed to the two “ a struts ” and one “ b strut ” via wire or string and “ aab panel ” holes ( 1704 ). a “ ccb panel ” ( 1801 ) is formed of osb panel , or any other suitable material , and cut to cover a triangular aperture created by two “ c struts ” ( fig1 ) and one “ b strut ” ( fig1 ). bracing rods ( 1802 ) may be affixed to the “ ccb panel ” via wire or string and bracing rod holes ( 1803 ). the “ ccb panel ” may be affixed to the two “ c struts ” and one “ b strut ” via wire or string and “ ccb panel ” holes ( 1804 ). 1 st step : place the aab panel on the struts that form a pentagon in the middle of the dome . locate the aab struts that correspond to the sides of the panel . 2 nd step : place the aab panel on the triangle formed by the a struts and b strut with the 1 ″ bamboo braces resting on the 2 ″ bamboo struts . 3 rd step : wrap the panel lashing wires ( attached to the panel ) around the struts and twist until panel is drawn tight against the cement hubs and 1 ″ panel braces . 4 th step : lock the next aab panel into the mounted aab panel by placing the a side over hanging 1 ″ bamboo braces under the existing panel &# 39 ; s a side and sliding the edges together . line up the points of the angle &# 39 ; s a side . lash the panel into place drawing the panel tight against the struts and hubs . 5 th step : continue locking and securing aab panels into place until the last triangle in the pentagon is to be put in place . 6 th step : lock the next aab panel into the mounted aab panel by placing the a side over hanging 1 ″ bamboo braces under the existing panel &# 39 ; s a side and sliding the edges together . line up the points of the angle &# 39 ; s a side . use a mallet to help drive the 1 ″ bamboo braces back and forth until the panel is locked into place on both sides of the panel . lash the panel into place drawing the panel tight against the struts and hubs . 7 th step : place a ccb panel up against an aab panel with the b sides lined up with each other . place the ccb panel on the triangle formed by the c struts and b strut with the 1 ″ bamboo braces resting on the 2 ″ bamboo struts . lock the ccb panel into the mounted aab panel by placing the b side over hanging 1 ″ bamboo braces under the existing panel &# 39 ; s b side and sliding the edges together . line up the points of the angle &# 39 ; s b side . push the panel into place drawing the panel tight against the struts and hubs with the lashing wires . 8 th step : lock the next ccb panel into the mounted ccb panel by placing the c side over hanging 1 ″ bamboo braces under the existing panel &# 39 ; s c side and sliding the edges together . line up the points of the angle &# 39 ; s c side . use a mallet to help drive the 1 ″ bamboo braces back and forth until the panel is locked into place on both sides of the panel . lash the panel into place drawing the panel tight against the struts and hubs . 9 th step : continue locking the panels together , lining up a to a sides , b to b sides and c to c sides until the dome is covered . while the invention has been described with a certain degree of particularity , it is to be noted that modifications may be made in the details of the invention &# 39 ; s construction and the arrangement of its components without departing from the spirit and scope of this disclosure . it is understood that the invention is not limited to the embodiments set forth herein for the purposes of exemplification .
| 4Fixed Constructions
|
the following detailed description will describe a cpt frequency standard employing a rotatable circular polarizer to control the intensity of circularly - polarized light incident on the atomic resonance cell , and will finally disclose experimental results using a circular polarizer in this fashion in the cpt frequency standard . using a circular polarizer to control the intensity of circularly - polarized light : fig2 fig2 shows at 201 how a circular polarizer 202 may be used to control the intensity of circularly - polarized light . circular polarizer 202 is made in the usual fashion : a linear polarizer 203 is combined with a quarter wave retarder 205 such that there is a fixed relationship between the axis of polarization 209 and the fast axis 208 of the quarter wave retarder . the linear polarizer and quarter wave retarder may be made of any materials which polarize light in the required fashions . a preferred relationship between the axis of polarization 209 and fast axis 208 is 45 °, but any relationship which results in circularly - polarized light may be used . the light 206 that is input to circular polarizer 202 is itself linearly polarized . its plane of polarization is shown at 207 . linearly polarized light 206 may be produced by a laser or by passing light through another linear polarizer . the light that is output from circular polarizer 202 is a beam of circularly polarized light 213 . the intensity of circularly polarized beam 213 may be varied by rotating circular polarizer 202 as shown at 211 . arrangement 201 may be used in any situation in which circularly - polarized light of a controlled intensity is required . an example of such a situation is cpt frequency standard 101 of fig1 , in which the circularly polarized light required for resonance cell 111 is produced by quarter - wave retarder 109 from the linearly - polarized light produced by laser 103 when light that is already linearly polarized passes through a linear polarizer , the amount of light that passes through the linear polarizer is a function of the angle θ between the axis of polarization of the linearly polarized light and the axis of polarization of the linear polarizer . as θ ranges between 0 °, that is , where the axis of polarization 209 of the linear polarizer is the same as the plane of polarization 207 of the linearly polarized light , and 90 °, that is , where axis of polarization is perpendicular to the plane of polarization , the amount of light that passes through ranges from nearly all to nearly none . when linearly - polarized light is passed through a linear polarizer , the electric field of the emerging linearly - polarized light is oriented along the axis of polarization of the linear polarizing medium . the linear polarizer thus serves to rotate the plane of polarization of the incident linearly - polarized light . because the relationship between axis of polarization 209 of linear polarizer 203 and fast axis 208 of quarter wave retarder 205 is fixed , the behavior of circular polarizer 202 is unaffected by rotation 211 of circular polarizer 202 . because the amount of light that passes through linear polarizer 203 is a function of the angle θ , the amount of circularly polarized light 213 produced by circular polarizer 202 is also a function of θ . consequently , the intensity of the circularly - polarized light which leaves quarter - wave retarder 205 may be adjusted by rotating circular polarizer 202 about beam 206 . the two elements of circular polarizer 202 , linear polarizer 203 and quarter - wave retarder 205 , may be made of any materials which suit the particular application and may be coupled to each other by any technique which maintains a fixed relationship between the axis of polarization of linear polarizer 203 and the fast axis of quarter - wave retarder 205 . circular polarizer 202 may be rotated about beam of linearly - polarized light 206 using any mechanism which permits circular polarizer 202 to be rotated sufficiently to provide the desired range of attenuation . for many applications it will be important that circular polarizer 202 be locked at the point at which the desired attenuation is achieved ; this can be done using mechanisms such as set screws , clamps , or a worm gear that interacts with teeth around the circumference of circular polarizer 202 . a cpt frequency standard which incorporates technique 201 : fig3 and 4 fig3 shows a cpt frequency standard 301 which incorporates technique 201 . as may be seen from fig3 , the only difference between cpt frequency standard 301 and cpt frequency standard 101 is that attenuator 107 and quarter - wave retarder 109 have been replaced by circular polarizer 202 . because circular polarizer 202 may be rotated around laser light beam 105 to adjust the intensity of the circularly - polarized light reaching resonance cell 111 , there is no need to add and remove attenuators or to separately adjust the quarter - wave retarder . cpt frequency standard 101 uses photodetector 113 to measure the amount of laser light which passes through resonance cell 111 , and when cpt frequency standard 301 is being calibrated , photodetector 113 can be used to determine the degree to which circular polarizer 202 is attenuating laser light 105 . in frequency standard 301 , as in any other system which provides feedback 117 concerning the amount of light that is passing through circular polarizer 202 , the light intensity can be made automatically controlled : a rotator 303 such as a servomotor can be added to rotate the circular polarizer 202 and the rotator can be controlled by rotator control signal 305 , which control processor 121 can derive from feedback signal 117 . the elements 303 and 305 required to make the attenuation self - adjusting are shown in dotted lines in fig3 . it should be noted here that embodiments of cpt frequency standard 301 are possible in which beam of light 105 is not linearly polarized ; in that case , a fixed linear polarizer would be placed in the path of beam 105 ahead of circular polarizer 202 in order to produce the linearly polarized light required by technique 201 . fig5 shows a presently - preferred embodiment 501 of circular polarizer 202 . linear polarizer 505 is a color pol ® polarizer made by codixx ag , barleben , germany ; quarter - wave retarder 507 is an optigrafix ™ quarter - wave retarder made by grafix ® plastics , cleveland , ohio , usa . linear polarizer 505 and quarter - wave retarder 507 are held in the proper relationship to each other by linear polarizer holder 503 and quarter - wave retarder holder 509 , which are in turn held together by pins 511 . when circular polarizer 501 is installed in frequency standard 301 , it is held in a mount by friction . the edge of quarter - wave retarder 507 has holes 510 which permit a tool to engage circular polarizer 501 and rotate circular polarizer 501 . the effect of the rotation on the intensity of the light reaching resonance cell 111 can be determined from the output of photodetector 113 , and when the light has the proper intensity , circular polarizer 501 may be locked in that position either by increasing the friction between the mount and circular polarizer 501 or by gluing circular polarizer 501 to the mount . fig4 is a plot showing the effectiveness of technique 201 with circular polarizer 501 . curve 403 shows how the power of the light which passes through circular polarizer 501 varies as the circular polarizer is rotated through 360 °; the optical power ranges from a maximum of 100 % through a minimum of about 5 %. curve 405 shows how the degree of circular polarization varies during the rotation . the degree of circular polarization ranges from a maximum of 87 % to a minimum of about 70 %; however , it remains between about 85 % and 87 % for most of the range of optical power . technique 201 thus provides a large range of attenuation over which the degree of attenuation has little effect on the degree of circular polarization . the foregoing detailed description has disclosed to those skilled in the relevant technologies how to control the intensity of circularly - polarized light using the technique and has further disclosed the best mode presently known to the inventors of using the technique and of making a device that employs the technique . it will be immediately apparent to those skilled in the relevant technologies that as long as the circular polarizer is applied to linearly polarized light , the circular polarizer can be of any size and be made using any available techniques . similarly , any available technique can be used for rotating the circular polarizer . it will further be immediately apparent that the technique may be used not only in cpt atomic frequency standards , but in any device that requires adjustment of the intensity of circularly - polarized light . for all of the foregoing reasons , the detailed description is to be regarded as being in all respects exemplary and not restrictive , and the breadth of the invention disclosed here in is to be determined not from the detailed description , but rather from the claims as interpreted with the full breadth permitted by the patent laws .
| 6Physics
|
the compositions of the present invention are useful for providing improved and / or longer lasting anti - inflammatory action from topically applied hydrocortisone compositions . the compositions may be topically applied to skin exhibiting symptoms of inflammation . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs . whenever used , any percentage is weight by weight ( w / w ) unless otherwise indicated . as used herein , “ topically applying ” means directly laying on , applying to or spreading on outer skin , e . g ., by use of the hands or an applicator such as a wipe , puff , roller , or spray . as used herein , “ cosmetically - acceptable ” means that the product ( s ), compound ( s ), or composition ( s ) which the term describes are suitable for use in contact with tissues ( e . g ., the skin or hair ) without undue toxicity , incompatibility , instability , irritation , allergic response , and the like . this term is not intended to limit the compound / product / composition to which it describes for use solely as a cosmetic ( e . g ., the ingredient / product may be used as a pharmaceutical ). as used herein , “ topical carrier ” means one or more compatible solid or liquid diluents that are suitable for topical administration of an active ingredient to the skin of a mammal . examples of topical carriers include , but are not limited to , water , waxes , oils , emollients , emulsifiers , thickening agents , gelling agents , and mixtures thereof . as used herein , “ safe and effective amount ” means an amount of product ( s ), compound ( s ), or composition ( s ) sufficient to induce an anti - acne , or pre - emergent pimple effect , but low enough to avoid serious side effects . compositions of the present invention include hydrocortisone . the amount of hydrocortisone is typically within the amount approved in the united states of america &# 39 ; s over - the - counter monograph , and may vary from about 0 . 1 % to about 1 %, for example from about 0 . 5 % to about 1 %, or from about 0 . 75 % to about 1 %, by weight , based on the total weight of the composition . the compositions of the present invention further include avenanthramides . avenanthramdes are organic molecules that can be made synthetically or extracted from oat plants . avenanthramides belong to a group of hydroxycinnamic acid derivatives . the most abundant avenanthramides found in oat plants are 5 - hydroxyanthranilic acid derivatives of hydroxycinnamic acid . they contain coumaric , caffeic , or ferulic acid moieties . the amount of avenanthramides in the compositions of the present invention is based on the total amount of all avenanthramides obtained through the extraction of the oat plant . the compositions of the present invention contain from about 0 . 05 ppm to about 100 ppm avenanthramides , for example from about 0 . 5 ppm to about 50 ppm , or from about 1 ppm to about 10 ppm , avenanthramides . the compositions of the present invention may further include an alkanolamine . the alkanolamine may be selected from the group consisting of ethylaminoethanol , methylaminoethanol , dimethylaminoethanolamine , isopropanolamine , triethanolamine , isopropanoldimethylamine , ethylethanolamine , 2 - butanolamine , choline and serine . when an alkanolamine is utilized , dimethylaminoethanolamine is preferred . the amount of alkanolamine may vary from about 0 . 01 % to about 10 %, for example from about 0 . 1 % to about 5 %, or from about 0 . 25 % to about 1 %, by weight , based on the total weight of the composition . the compositions of the present invention may further include additional natural extracts . suitable natural extracts include , but are not limited to , chamomile , panthenol , feverfew , olive leaf , soy and the like . the amount of natural extract may vary , but when utilized typically ranges from about 0 . 01 percent by weight to about 5 percent , by weight , based on the total weight of the composition . the compositions of the present invention are provided in formulations suitable for topical application to skin . the composition may comprise the hydrocortisone product , the avenanthramides , and a cosmetically - acceptable topical carrier . the cosmetically - acceptable topical carrier may comprise from about 50 % to about 99 . 99 %, by weight , of the composition , or from about 80 % to about 95 %, by weight , of the composition . the compositions may be made into a wide variety of product types that include , but are not limited to , solid and liquid compositions such as lotions , creams , gels , sticks , sprays , shaving creams , ointments , cleansing liquid washes and solid bars , shampoos , pastes , powders , mousses , shaving creams , and wipes . these product types may comprise multiple types of cosmetically acceptable topical carriers including , but not limited to , solutions , emulsions ( e . g ., microemulsions and nanoemulsions ), gels , solids and liposomes . the following are non - limitative examples of such carriers . other carriers can be formulated by those of ordinary skill in the art . the topical compositions useful in the present invention can be formulated as solutions . solutions typically include an aqueous solvent ( e . g ., from about 50 % to about 99 . 99 %, or from about 90 % to about 99 %, of a cosmetically acceptable aqueous solvent . topical compositions useful in the subject invention may be formulated as a solution comprising an emollient . such compositions preferably contain from about 2 % to about 50 % of an emollient ( s ). as used herein , “ emollients ” refer to materials used for the prevention or relief of dryness , as well as for the protection of the skin . a wide variety of suitable emollients are known and may be used herein . see international cosmetic ingredient dictionary and handbook , eds . wenninger and mcewen , pp . 1656 - 61 , 1626 , and 1654 - 55 ( the cosmetic , toiletry , and fragrance assoc ., washington , d . c ., 7 th edition , 1997 ) ( hereinafter “ inci handbook ”) contains numerous examples of suitable materials . a lotion can be made from such a solution . lotions typically comprise from about 1 % to about 20 %, or from about 5 % to about 10 %, of an emollient ( s ) and from about 50 % to about 90 %, or from about 60 % to about 80 %, of water . another type of product that may be formulated from a solution is a cream . a cream typically comprises from about 5 % to about 50 %, or from about 10 % to about 20 %, of an emollient ( s ) and from about 45 % to about 85 %, or from about 50 % to about 75 %, of water . yet another type of product that may be formulated from a solution is an ointment . an ointment may comprise a simple base of animal or vegetable oils or semi - solid hydrocarbons . an ointment may comprise from about 2 % to about 10 % of an emollient ( s ) plus from about 0 . 1 % to about 2 % of a thickening agent ( s ). a more complete disclosure of thickening agents or viscosity increasing agents useful herein can be found in the inci handbook pp . 1693 - 1697 . the topical compositions useful in the present invention may be formulated as emulsions . if the carrier is an emulsion , from about 1 % to about 10 %, or from about 2 % to about 5 %, of the carrier comprises an emulsifier ( s ). emulsifiers may be nonionic , anionic or cationic . suitable emulsifiers are disclosed in , for example , inci handbook , pp . 1673 - 1686 . lotions and creams can be formulated as emulsions . typically such lotions comprise from 0 . 5 % to about 5 % of an emulsifier ( s ). such creams would typically comprise from about 1 % to about 20 %, or from about 5 % to about 10 %, of an emollient ( s ); from about 20 % to about 80 %, or from 30 % to about 70 %, of water ; and from about 1 % to about 10 %, or from about 2 % to about 5 %, of an emulsifier ( s ). single emulsion skin care preparations , such as lotions and creams , of the oil - in - water type and water - in - oil type are well - known in the cosmetic art and are useful in the subject invention . multiphase emulsion compositions , such as the water - in - oil - in - water type are also useful in the subject invention . in general , such single or multiphase emulsions contain water , emollients , and emulsifiers as essential ingredients . the topical compositions of this invention can also be formulated as a gel ( e . g ., an aqueous gel using a suitable gelling agent ( s )). suitable gelling agents for aqueous gels include , but are not limited to , natural gums , acrylic acid and acrylate polymers and copolymers , and cellulose derivatives ( e . g ., hydroxymethyl cellulose and hydroxypropyl cellulose ). suitable gelling agents for oils ( such as mineral oil ) include , but are not limited to , hydrogenated butylene / ethylene / styrene copolymer and hydrogenated ethylene / propylene / styrene copolymer . such gels typically comprise between about 0 . 1 % and 5 %, by weight , of such gelling agents . the topical compositions of the present invention can also be formulated into a solid formulation ( e . g ., a wax - based stick , soap bar composition , powder , or a wipe containing powder ). the topical compositions useful in the subject invention may contain , in addition to the aforementioned components , a wide variety of additional oil - soluble materials and / or water - soluble materials conventionally used in compositions for use on skin , hair , and nails , at concentrations recognized by those skilled in the art . the topical compositions may be applied one or more times a day , preferably twice a day . the amount used will vary with the age and physical condition of the end user , the duration of the treatment , the specific compound , product , or composition employed , the particular cosmetically - acceptable carrier utilized , and like factors . examples of the present invention are described below . the invention should not be construed to be limited to the details thereof . compositions of the present invention were prepared by combining the materials listed in table 1 and mixing the materials until homogenous . the compositions prepared in example 1 were tested for reduction / inhibition of redness of skin by the following method . the human volar forearms of test subjects were pre - treated with topical application of a placebo or the formulations of example 1 for 30 minutes prior to testing . a chemical minimal erythema dose (“ med ”) was established for each test subject using doses of methyl nicotinate from 1 to 5 mm . the dose resulting in a med for each test subject was used in the pre - treated sites . redness was induced by topical application of aqueous methyl nicotinate using 25 mm hilltop chambers for 30 seconds . redness was assessed at 30 minutes after application of methyl nicotinate using diffuse reflectance spectroscopy (“ drs ”) and calculating the ratio of oxyhemoglobin to deoxyhemoglobin . drs results were analyzed using t - test with significance for all tests set at p & lt ; 0 . 05 . the results of compositions of the present invention compared to sample 3 , 1 % hydrocortisone with no avenanthramides , are shown in table 2 as percent reduction in redness . as the data indicates , compositions of the present invention provided increased inhibition of skin erythema compared to compositions comprising only hydrocortisone as the active ingredient . surprisingly , it was found that compositions containing lower amounts of avenanthramides provided significantly better results when compared to compositions comprising twice the amount of avenanthramides . twenty - nine panelists were selected for a test to demonstrate the efficacy of hydrocortisone creams of the present invention ( sample 2 ) over time . four rectangles were marked on the inner volar forearm of each panelist , with placement of the outer edge of the 1 st square beginning approximately one - half inch from the elbow crease . markings were then placed on the skin with non - smearable ink on the inside corners of the rectangular box . samples 2 and 3 , containing 1 % hydrocortisone , were applied in a uniform thin line in the approximate center on the rectangle , beginning from the top to the bottom ( 32 ul / rectangle ). each product was then carefully rubbed into the rectangle area only , with a circular motion , for approximately 10 seconds . after the indicated time following product application , sebutape ® strips were applied to the appropriate skin locations . with gloved hands , the strips were removed from the sheet with forceps and applied to the center of the skin rectangle , pressed firmly , and removed 1 minute later with forceps . the tapes were then placed skin - side - down in appropriately labeled vials . finally , 500 μl of cell growth media rpmi 1640 was added to each vial and the vials placed in a − 80 ° c . freezer until time of il - 2 assay the vials were thawed on ice and then sonicated on ice for 15 minutes . jurkat cells were plated onto 96 - well round bottom plates at 100 , 000 cells / well in 100 μl . cells were then stimulated for il - 2 production with the addition of 50 μl mixture of phorbol myristate acetate (“ pma ”, 200 ng / ml ) and phytohemagglutinin (“ pha ”, 16 μg / ml ). designated sample wells were then treated with 50 μl of media from sample vials after vortexing them for 10 seconds . each sample was used to treat 2 wells . to the wells designated for stimulation only , 50 μl of rpmi cellular growth media + 10 % fetal bovine serum (“ fbs ”) growth media was added . plates were incubated overnight for approximately 16 hours @ 37 ° c . and 5 % co 2 . after incubation , the supernatants were removed and transferred to low - binding 96 - well plates . the supernatants were diluted 1 : 5 in rmpi growth media and assayed for il - 2 concentration using the upstate kit according to the manufacturers protocol and analyzed on a luminex 100 multi - analyte detector ( luminex corp , austin , tex .). values from the luminex were correlated to actual il - 2 concentration values using a standard curve from known il - 2 concentrations included on the plate . the average concentration in the stimulated wells was determined as the normal il - 2 release . the calculated concentrations in treated wells were used to calculate a percent inhibition of this normal value . each plate contained a set of stimulated wells and this calculation was made separately for each plate . panelist results were compiled to compare results of each product at each time point . paired student &# 39 ; s t - tests were performed to evaluate the significance of differences between groups with significance levels in all tests set at values & lt ; 0 . 05 . the results are shown in table 3 as percent reduction in il - 2 release . the results demonstrate that the hydrocortisone cream of sample 2 has a significantly greater efficacy than a hydrocortisone cream without avenanthramides and resulted in a longer efficacy compared to a hydrocortisone cream without avenanthramides . this data supports the efficacy of the hydrocortisone creams tested over these time periods . it is understood that while the invention has been described in conjunction with the detailed description thereof , that the foregoing description is intended to illustrate and not limit the scope of the invention , which is defined by the scope of the appended claims . other aspects , advantages , and modifications are within the claims .
| 0Human Necessities
|
the household washing machine 1 shown in fig1 is positioned on a pedestal 2 and connected therewith in a manner to be described . the structure of such a washing machine is sufficiently known from european patent specification ep 0 , 943 , 721 a1 and is , therefore , neither shown nor described in any detail . its housing is manufactured as a frame structure , the frame including , among other components , a sheet metal bottom panel . in the context of the invention , it is only the manufacture of this sheet metal bottom panel 3 which is important and which shown in detail in fig4 . initially , it is severed by a punching or clicking operation as one piece from a coil of sheet metal ( not shown ) and provided with the required cut - outs 4 and openings 5 . thereafter , recesses 6 and protrusions 7 are formed in a multiple step stamping operation by a stamping process by one or more stamping tools . in this manner , a circumferential margin 8 is formed in the sheet metal bottom panel 3 . in addition , stamped nuts 9 for the reception of machine feet 10 ( see fig1 and 2 ) are formed during this process . for manufacturing the pedestal 2 shown as a single component in fig2 and 3 a sheet metal bottom panel 3 . 1 is used which is subjected to a similar shaping process as the sheet metal bottom panel 3 of the washing machine 1 . since it need not be quite as stable or sturdy as the bottom panel of the washing machine 1 the bottom panel 3 . 1 may be made of thinner sheet metal . a unitary body 11 constitutes a further component of the pedestal 2 . it constitutes the two side walls 12 and a supporting surface 13 for the washing machine 1 . this component , too , is initially cut by punching from a coil of sheet metal and provided with a pattern of openings the function of which will be described hereinafter . thereafter , the side walls 12 are folded , and a marginal strip 14 , 15 is folded down from the front as well as rear of the supporting surface 13 . in their overlapping area 16 , these marginal strips are joined by clinch connections 17 . the body 11 is connected to the bottom panel 3 . 1 by blind rivets 18 . thereafter , a flat panel ( not shown ) is screwed to the rear of the body 11 to close it . the marginal strips 14 of the side walls 12 are bent inwardly by a further chamfering operation . in this manner , they form abutments 19 for threadedly connecting two lateral sheet metal fastening panels 20 which in turn are each provided with a telescoping rail 21 . the rails 21 serve to receive a drawer 22 shown in fig1 in its inserted state and in fig2 in its withdrawn state . the structure of such a drawer 22 is generally known and is not , therefore , described here in any detail . it is to be mentioned , however , that the front panel 23 of the drawer 22 is dimensioned such that is it completely covers the front side of the pedestal 2 . in its front section , the telescoping rail 21 is fastened to the chamfer 19 of the pedestal as well ass to the fastening panel 20 . to this end , both components are provided with consecutively positioned bores of which fig3 only shows bore 24 at the chamfer 19 . the added fastening of the telescoping rail 21 at the pedestal 2 provides for a defined alignment of the front panel 23 relative to the edges of the pedestal 2 . for erecting the system , feet 10 usually screwed into the bottom panel 3 of the washing machine 1 are removed therefrom and threaded into the stamped nuts in the bottom panel 3 . 1 of the pedestal 2 . threaded pins ( not shown ) are screwed into the stamped nuts 9 in the bottom panel 3 of the washing machine 1 . thereafter , the washing machine 1 is aligned relative to the support surface 13 such that the threaded pins protrude into corresponding bores 25 in the surface 13 . to connect the washing machine 1 to the pedestal 2 each threaded pin is secured by a nut screwed onto the pin in the interior of the pedestal 2 . the numerous bores 25 are provided for the accommodation of various types of machines .
| 3Textiles; Paper
|
in this invention , laser ablation is used to deposit metal lines on substrates by the ablation of a metal film from a donor plate , in a dry process that does not require a vacuum . the metal film is contained in a channel of the donor plate . the channel may restrict the area of metal deposition on a substrate . in addition , an electric field may be applied across the donor plate being ablated and the substrate onto which the metal lines are deposited to drive the ablated metal ions toward the deposition location and to electrostatically bond the metal ions to the surface of the substrate . fig1 illustrates an exemplary laser metal deposition apparatus according to the present invention . laser 1 is a harmonically doubled solid state q - switched nd : ylf or nd : yag laser , available from continuum inc ., in santa clara , calif . laser beam 13 from laser 1 is expanded by telescope 2 into expanded beam 14 . expanded beam 14 shines on dichroic mirror 3 which directs expanded beam 14 into objective lens 4 . focusing mechanism 7 is used to adjust the focus of the beam 17 provided by the objective lens 4 . objective lens 4 focuses the expanded beam 14 to a diffraction limit spot on sample 5 . an optional power supply 12 may be used to create an electric field across the sample 5 . in the exemplary embodiment shown in fig1 illuminator 11 provides light that is deflected by mirror 9 onto dichroic mirror 3 . illuminator 11 is used as a white light source to illuminate sample 5 so the process and location of the focused spot can be monitored . a suitable illuminator is available from edmund scientific company in barrington , n . j . also , in the exemplary embodiment , ccd camera 10 is used to image and monitor the process location . the image is fed to computer 8 which computes subsequent process locations based on a programmed path . any state of the art video camera is suitable for this purpose . when repairing metal lines , the image from the ccd camera 10 may also be used to identify the location of defects in metal lines to repair . sample 5 is supported on stage 6 . stage 6 is equipped with x - y motion controls 15 that are controlled by computer 8 . suitable motion controls and computer are available from new england affiliated technologies in lawrence , mass ., and comprise , for example , an xy - 8080 precision stage , a pcx2 controller , and a 202m microstepping drive , with the controller interfaced to a 486 ibm pc or compatible . computer 8 also controls the power of laser 1 . by adjusting the position of stage 6 and the power of laser 1 , computer 8 enables the deposition of specific patterns on sample 5 . fig2 illustrates a sample 5 according to the present invention . the sample 5 includes a donor plate 21 and a deposition substrate 23 . the donor plate 21 includes a donor substrate 32 , a donor surface 22 , a channel 24 , and a metallic material 26 coating the channel 24 . fig3 a - 3c illustrate a method of forming the donor plate 21 . as shown in fig3 a , at least one channel 24 is formed in a donor substrate 32 having a donor surface 22 . the donor substrate 32 is preferably glass . the channels 24 may be formed by etching the channels 24 into the donor substrate 32 . as shown in fig3 b , a metallic material 26 is deposited upon the donor surface 22 of the donor substrate 32 and in the channels 24 . the metallic material 26 may be deposited using sputtering , e - beam deposition or chemical vapor deposition ( cvd ), for example . preferably , the metallic material 26 is copper , gold or silver . as shown in fig3 c , the metallic material 26 is then removed from the donor surface 22 of the donor substrate 32 while retained in the channels 24 . the metallic material 26 may be removed from the donor surface 22 by chemical - mechanical polishing ( cmp ), for example . as shown in fig2 the deposition substrate 23 has a deposition surface 27 upon which a metal line is to be deposited . the deposition substrate 23 is disposed so the deposition surface 27 is adjacent the donor surface 22 of the donor plate 21 . in the exemplary embodiment , the deposition substrate 23 is glass . the focused beam 17 passes through donor substrate 32 of the donor plate 21 and impinges on the metal coating 26 in the channel 24 . the contact of focused beam 17 with the metal coating 26 results in ablation of the metal coating 26 . during ablation , metal ions 25 accelerate away from the metal coating 26 . as metal ions 25 accelerate away from the donor plate 21 the metal ions 25 contact the deposition substrate 23 . the metal ions 25 accelerate away from the donor plate 21 due to the laser ablation - generated acoustic shock waves . in the embodiment illustrated in fig2 laser ablation is used to repair a gap 29 in a metal line 28 . the teachings of this invention may also be applied to forming a metal line on the deposition substrate 23 when a metal line is not present on the deposition substrate 23 . after ablation of the metal coating 26 , variations in the thickness of the deposited metal line may be adjusted . for example , as shown in fig4 a , when a metal coating 26 is ablated to repair a metal line 28 , the thickness of the resulting metal line is not uniform . the deposited metal 44 causes the resulting metal line to be thicker where the original metal line 28 was thicker before ablation . the non - uniformities of the resulting metal line may then be reduced to provide a metal line as shown in fig4 b . non - uniformities in thickness may be removed by methods known to those skilled in the art such as by using a laser or by chemical - mechanical polishing ( cmp ). the spacing 18 between the donor plate 21 and the deposition substrate 23 may be adjusted to vary the feature size ( width ) of the resulting metal lines on deposition substrate 23 . as the spacing 18 increases , the feature size of the deposited metal lines increases . in one exemplary embodiment as shown in fig5 the spacing is minimal and the donor plate 21 is disposed upon the deposition substrate 23 such that the donor surface 22 is in contact with the deposition surface 27 . thus , the cavity 24 mechanically restricts the deposition of the metal ions 25 onto the deposition substrate 23 . fig6 illustrates a donor plate 21 according to the present invention during laser ablation of the metallic material 26 from the channel 24 . in fig6 the channel 24 restricts the deposition of metal droplets and mist 42 to the area defined by the channel 24 . a method of aligning the donor substrate 21 and the deposition substrate 23 is described with reference to fig7 a - 7c . a pattern of lines , as shown in fig7 a , may be formed upon each of the donor plate 21 and the deposition substrate 23 . the patterns of lines may be displayed by the image from the ccd camera 10 . when the patterns of lines on the donor substrate 21 and the deposition substrate 23 are in alignment , a pattern of lines as in fig7 a will be visible . when the donor substrate 21 and the deposition substrate 23 are misaligned , a moire pattern as shown in fig7 b and 7c will be visible . the lines 62 in the moire pattern indicate the extent of misalignment . thus , the pattern in fig7 c has a single line 62 and is closer to alignment than the pattern in fig7 b which has three lines 62 . as shown in fig2 in an exemplary embodiment , an electric field may be applied between the donor plate 21 and the deposition substrate 23 using power supply 12 . power supply 12 has a positive electrode 30 attached to the metallic material 26 . a negative electrode 31 is connected to deposition substrate 23 . preferably , the voltages applied across the electrodes 30 , 31 are at least 300 volts . when using an electric field , the metal ions 25 are driven toward the deposition plate 23 by an electrostatic force due to the electric field in addition to the laser ablation - generated acoustic shock waves . the electric field applied across donor plate 21 and deposition substrate 23 also assists the bonding of metal ions 25 to deposition substrate 23 . because of the contact of the negative electrode with deposition substrate 23 , the positive ions such as sodium ions in deposition substrate 23 migrate away from the deposition surface 27 toward the negative electrode 31 . this leaves behind negative ions such as oxygen in the deposition substrate 23 . these negative ions electrostatically bond with the positive metal ions that contact the deposition surface 27 . a permanent chemical seal due to a thin metal oxide layer is formed after the electric field is removed . conducting metal lines can thus be formed on deposition surface 27 of the deposition substrate 23 from metal ions 25 . as shown in fig2 a hot plate 20 may be used to augment the migration of positive ions within deposition substrate 23 to the negative electrode 31 and thus enhance the bonding of metal ions 25 to the deposition surface 27 of the deposition substrate 23 . the heat increases the diffusion and allows for greater mobility of the ions in the deposition substrate 23 . by adjusting stage controls 15 and the power of laser 1 , computer 8 enables movement of stage 6 , and hence sample 5 , under beam 17 . this allows metal line patterns to be written on sample 5 . alternatively , the beam 17 can be moved with a scanner and a scanning lens with the sample 5 held stationary under the beam 17 . this invention is not limited to the method of positioning the sample 5 with respect to the beam 17 as described above . other positioning methods and apparatus are known to those skilled in the art such as that described by laplante et al . in u . s . pat . no . 5 , 168 , 454 , incorporated herein by reference for its teachings on laser assisted machining . the thickness of metal material 26 in a channel 24 may be varied in order to change the thickness of the metal lines deposited onto the deposition substrate 23 . a thicker coating of metallic material 26 in the channel 24 allows more metal ions 25 to be ablated . this produces a thicker metal line . fig8 illustrates exemplary variations of a donor plate . the depth 72 of a cavity 24 , the width of a cavity 74 , the distance between cavities 76 , and the thickness 78 of the metallic material 26 in a cavity 24 can be varied . in addition , the sidewalls 79 of a cavity 24 are not necessarily perpendicular to the deposition surface 27 . the above variations may be adjusted for achieving the desired width , thickness , and uniformity of a deposited metal line . although this invention has been described with reference to a particular embodiment , it is not intended to be limited thereto . rather , the scope of the invention is intended to be interpreted according to the scope of the appended claims .
| 7Electricity
|
fig1 shows a molded transparent plastic sphere 1 mounted on a molded opaque plastic base 2 which possesses three integral feet 3 , only one of which is shown . at the bottom of the sphere is a silvered platform 4 having at its center asilvered holographic photograph 5 . the photograph shown in fig1 is an eight point compass star but any circularly symmetric hologram or picture will do as the picture serves in a decorative function . at the center of the compass star in fig1 is located a half - silvered mirror film 6 which functions as a port for the entrance of light into thebase of the toy and onto a photodiode positioned just under the half - silvered mirrored film . fig2 shows the same view of the crystal ball toy as fig1 but with a portion of the base cut away . it is seen that a circuit board 7 is locatedunder the platform 4 . mounted on the circuit board 7 is shown a main component of this circuit , a texas instruments tsp50c41 speech synthesizerchip 10 or its equivalent . also shown mounted on the circuit board 7 are two of the resistors 11 and 12 that are part of this circuit . below the circuit board 7 are shown two of the four 1 . 5 v batteries 8 that power this circuit . the batteries 8 are hooked together in series and to the circuit board by insulated wire 14 . the batteries 8 are physically held in place by standard 1 . 5 v battery holders 13 arranged quadrangularlyaround the circuit board 7 which is circular . the battery holders 13 , in turn are mounted on a floor 15 of the base . alsomounted to the base floor 15 is an electrical speaker 9 . the floor 15 is made of masonite and has holes drilled through it to allow sound emission from the speaker 9 . fig3 shows a schematic diagram for the optoelectronic circuit of this talking crystal ball toy . the circuit is powered by four 1 . 5 v aa batteries 8 . ground is indicated by the standard symbol 31 . the photodiode16 functions as a photosensor switch for the circuit . the photodiode 16 is normally in an illuminated state thereby causing a 2n3906 ( pnp type ) transistor 17 to be saturated , thereby causing a 47k ohmresistor 18 to have a high voltage . this keeps the dp30 terminal of a texasintruments tsp50c41 speech synthesizer chip 10 in a high voltage state . thenormally illuminated condition also causes the init terminal of the chip tohave a high voltage and the dp10 terminal of the chip to have a low voltagebecause of a in4148 diode 20 . upon interruption of light to photodiode 16 , the transistor 17 is turned off , causing the resistor 18 to go to ground . this in turn pulls the init terminal voltage low . the first time the init circuit goes low causes the dp10 terminal to go high . at this time the internal microprocessor of the chip 10 is running , but no speech has resulted . no speech will result until the incident light is again interrupted . the second light interruption must take place within approximately three seconds or the internal microprocessor will again shutdown and require a double pass initiation . if the incident light is interrupted within the three second period , then terminal dp30 is caused to go low the second time , which initiates the internal speech synthesis program and hardware to emit at random one of twenty four pre - recorded verbal responses that have been digitally stored in the chip 10 . at the termination of the verbal response via a speaker 9 , the dp10 terminal automatically returns to a low state , and the process has to be repeated in order to initiate a second verbal response . the tsp50c41 chip is programmed to randomly select just one verbal phrase each time the speech synthesizer facility is initiated . normally the arrayof responses are all pre - programmed on the tsp50c41 chip 10 . however , this circuit allows an option to put additional messages on an optional external program 27 utilizing a texas instruments 60c20 rom chip 28 , or its equivalent . the rom chip 28 can be programmed in a foreign language , for example japanese . when it is desired to use the optional responses from the rom chip 28 in lieu of the on - board responses from the main chip 10 , then the dp31 terminal on the main chip must be changed from a grounded connection 25 to a plus connection 26 , as shown in the optional switch circuit 24 . the speed at which the voice response of the chip 10 is synthesized is controlled by the frequency of an external oscillator at terminals 32 and 33 comprised of a 3 . 07 mhz crystal 21 and two 33 pf capacitors 22 and 23 . the external oscillator frequency affects the tonal quality of the voice response . the tsp50c41 chip 10 shown in fig3 has enough audio output power through terminals 34 and 35 to drive directly a 50 ohm speaker 9 . if more power isdesired , an optional amplifier 29 can be installed , and the 50 ohm speaker changed to an 8 ohm speaker . for the 50 ohm speaker , a 1 uf capacitor 30 is connected across the speaker leads . the power source for this circuit , four 1 . 5 v batteries in series , gives a nominal voltage range of between 4 to 6 volts dc for a nominal voltage of 5 volts as depicted in fig3 . in the present embodiment of this invention , the voice responses which are digitally recorded in the tsp50c41 chip are as follows : the circuit in fig3 is shown to also contain a 0 . 22 uf capacitor 19 and an in4148 diode 20 . resistor 11 has a value of 100 k ohms and resistor 12 has a value of 10 k ohms . the terminal pins of the texas instruments tsp50c41 chip 10 possess the following functions . the init pin initializes input . when this pin is low , the chip is initialized and goes into a low power mode . vss is a ground pin . the irt pin is a ready for data output . the dp10 , dp30 , dp31 , and dp20 through dp27 pins are data bus points . the irt goes high as data in the data register of the chp 10 is read on the data bus dp pins . vco is the positive voltage pin . the various functions of the texas instruments 60c20 rom chip be found in data manuals for such component . the photosensor in the circuit disclosed in fig3 is comprised of an arrayof four amorphous silicon photovoltaic cells of about 2 . 4 v total output inseries in which the array of photovoltaic cells is acting as a photodiode . in an unilluminated condition , a silicon cell does not conduct electric current , whereas in an illuminated condition , a photovoltaic cell does conduct current but only in one direction . thus , when an independent voltage is applied across a photovoltaic cell , the photovoltaic cell becomes a photodiode . in fig3 the photovoltaic cell acts as a photodiode light switch . the transistor in fig3 functions as a voltage - change switch . together the photovoltaic cell - photodiode and the transistor function as a light activated voltage switch . the texas instruments tsp50c41 chip 10 is a 64k bit speech synthesis computer integrated on a single chip . the texas instruments tsp60c20 rom is a 256k bit read - only - memory capable of approximately 100 total voice responses and can digitally store foreign language or alternate / additionalenglish voice responses .
| 0Human Necessities
|
reference will now be made to fig1 , which is a simplified schematic diagram of a bunch sheet depository 10 according to one embodiment of the present invention . the depository 10 is operable to receive bunches of banknotes and / or cheques from a customer . the depository 10 includes a chassis 12 onto which various parts are mounted . the depository 10 further comprises : a bunch deposit slot 14 into which a bunch of sheets 16 can be deposited ; a bunch loader 22 ; a picker 24 aligned with the bunch loader 22 for removing individual sheets from the bunch ( or stack ) of sheets 16 ; a sheet validator 26 ; an escrow 28 for temporarily holding validated sheets until a customer confirms that he / she wants to complete the transaction ; a storage compartment 30 ; a communications circuit board 32 for communicating with a self - service terminal ( not shown ) into which the depository 10 may be installed ; and an onboard controller 34 for controlling the operation of the depository 10 . the depository 10 includes a plurality of sheet transport sections , only some of which will be described herein . an upper sheet transport section 40 is located above the bunch loader 22 and adjacent the picker 24 . a lower sheet transport section 42 is located beneath the bunch loader 22 and near the bunch deposit slot 14 . the bunch loader 22 is used to transport deposited banknotes from the bunch deposit slot 14 to the picker 24 . there are two different routes that can be taken by a sheet that is inserted into the depository 10 . the first route is shown by arrow 46 and involves the sheet being picked from the bunch of sheets 16 , transported to the picker 24 , moved past the validator 26 to be identified and validated , placed in the escrow 28 , and from the escrow 28 transported into the storage compartment 30 . the second route is shown by arrow 48 and involves the sheet being picked from the bunch of sheets 16 , transported to the picker 24 , moved past the validator 26 to be identified and validated , placed in the escrow 28 , and from the escrow 28 returned to the customer via the lower sheet transporter 42 . as is known in the art , whether a sheet is stored ( that is , follows the first route 46 in this embodiment ) or returned to the customer ( that is , the second route 48 in this embodiment ) depends on a number of factors , such as : whether the sheet is recognised , whether the sheet is validated , whether the customer cancels or confirms the transaction , and the like . reference will now be made to fig2 to 4 , which illustrate the bunch loader 22 in more detail . the bunch loader 22 comprises : a pair of link arms 50 ; a pressure plate 52 ; and an actuator 54 . to aid clarity , not all reference numerals will be shown in all of the drawings . each link arm 50 defines a pivot 60 , in the form of a hub that is mounted on a link arm pivot shaft 62 . the link arm pivot shaft 62 operates as a drive shaft , as will be described below . each link arm 50 also includes an upper resilient member 66 and a lower resilient member 68 mounted opposite each other with a gap therebetween . the resilient members 66 , 68 are in the form of coil springs . each link arm 50 defines a central area 70 ( the gap between the upper and lower coil springs 66 , 68 ) through which the actuator 54 protrudes . each coil spring 66 , 68 is mounted to the link arm 50 at a fixed end 72 , 74 respectively , and is coupled to a cam follower 76 , 78 respectively , near the centre of the central area 70 ( between the opposing fixed ends 72 , 74 ). thus , the upper coil spring 66 is coupled to the upper cam follower 76 , and the lower coil spring 68 is coupled to the lower cam follower 78 . the actuator 54 comprises a rotating shaft 80 on which are mounted two cams 82 , 84 , one cam 82 , 84 for each link arm 50 . each cam ( for example , cam 82 ) is aligned with the respective cam followers 76 , 78 of the associated link arm 50 . the cams 82 , 84 are generally teardrop - shaped and are aligned in registration on the shaft 80 , so that as the shaft 80 rotates , the cams 82 , 84 both engage with the upper cam follower 76 to compress the upper coil spring 66 , and then both disengage from the upper cam follower 76 to allow the upper coil spring 66 to relax to its quiescent state . further rotation of the shaft 80 causes both of the cams 82 , 84 to engage with the lower cam follower 78 to compress the lower coil spring 68 , and then disengage from the lower cam follower 78 to allow the lower coil spring 68 to relax to its quiescent state . the bunch loader 22 also includes a transport arrangement 90 powered by the drive shaft 62 . the transport arrangement 90 co - operates with both the upper sheet transport section 40 and the lower sheet transport section 42 . the transport arrangement 90 comprises : a chassis 91 including shafts and wheels ( not individually labelled in the drawings ), a pair of belts 92 mounted to the chassis 91 , a single thinner belt 94 also mounted on the chassis 91 , and a pivot shaft 95 about which both the link arms 50 and the chassis 91 can pivot . the three belts 92 , 94 all protrude through the pressure plate 52 ( best shown by fig2 ) for transporting the bunch of sheets 16 to the picker 24 . the pair of belts 92 also extend beneath the pressure plate 52 ( best shown by fig3 ) to provide a transport section that co - operates with the lower sheet transport section 42 . each link arm 50 is also pivotably coupled to the pressure plate 52 by an urging portion 96 . the urging portion 96 defines a hub 97 mounted on the pivot shaft 95 of the transport arrangement 90 . the pressure plate 52 is also mounted on the pivot shaft 95 . as the urging portion 96 moves upwards , the transport arrangement 90 and the pressure plate 52 move upwards ; as the urging portion 96 moves downwards , the transport arrangement 90 and the pressure plate 52 move downwards . as will be explained in more detail below , rotation of the actuator shaft 80 can be used to pivot the urging portion 96 upwards to cause the pressure plate 52 and the transport arrangement 90 to rise . further rotation of the actuator shaft 80 can be used to pivot the urging portion 96 downwards to cause the pressure plate 52 and the transport arrangement 90 to fall . a flap 98 is coupled to an end of the pressure plate 52 near to the bunch deposit slot 14 . this flap 98 allows a bunch 16 of sheets to be transported over the sheet return path ( route 48 ) when the bunch 16 of sheets is being inserted ; but it can also be deflected by a bunch of sheets being transported to the bunch deposit slot 14 in the event that one or more sheets have to be returned to the customer . reference will now be made to fig5 to 12 , which illustrate the bunch loader 22 , the upper sheet transport section 40 , and the lower sheet transport section 42 in more detail . again , for clarity , not all reference numerals are shown on these drawings . fig5 to 7 illustrate the bunch loader 22 driven to an upper position , which is used when the bunch 16 of sheets is inserted into the depository 10 ; and fig8 to 10 illustrate the bunch loader 22 driven to a lower position , which is used when a bunch of sheets is being returned to a customer . referring first to fig5 to 7 , the upper sheet transport section 40 comprises : a pair of transport belts 100 for moving an inserted bunch 16 towards the picker 24 . the picker 24 includes a pick belt 102 having a high friction surface for picking the topmost sheet from the bunch 16 . although not illustrated in fig5 to 7 , the picker 24 also includes a retard belt 104 ( fig1 and 12 ) that moves in the opposite direction to the pick belt 102 to reduce the possibility of picking multiple sheets at a time . the picker 24 also includes a registration edge 106 ( fig1 and 12 ) against which the bunch 16 of sheets is driven prior to ( and optionally during ) the pick operation . such retard belts 104 are well known to those of skill in the art . the lower sheet transport section 42 comprises a pair of belts 110 that cooperate with the pair of belts 92 in the transport arrangement 90 . the controller 34 is responsible for energising all of the transport sections within the depository 10 , rotating the actuator shaft 80 , energising the picker 24 , and all other electrical and electro - mechanical operations of the depository 10 . as shown in fig5 to 7 and 11 , when a bunch 16 of sheets ( such as banknotes ) is inserted into the bunch deposit slot 14 , the controller 34 detects this and energises the transport arrangement 90 and the upper sheet transport section 40 to draw the bunch 16 into the depository 10 . the controller 34 also energises the actuator 54 and rotates the actuator shaft 80 until the cams 82 , 84 impart maximum displacement to the upper cam followers 76 . in this position , the lower cam followers 78 are not displaced . displacement of the upper cam followers 76 causes both of the upper coil springs 66 to be compressed . this , in turn , causes both of the link arms 50 to pivot about pivot 60 so that the urging portion 96 of each rises . when the urging portions 96 rise , the pressure plate 52 also rises . this has the effect of compressing the bunch 16 , which ensures that banknotes within the bunch 16 are not splayed during transport . since the pressure plate 52 is pivotably coupled to the urging portion 96 , the pressure plate 52 remains parallel to the bunch 16 as the pressure plate 52 rises . once the bunch 16 reaches the picker 24 , the picker 24 removes banknotes one at a time . each banknote that is removed enables the pressure plate 52 to rise a little . this allows the upper coil springs 66 to expand ( that is , to relax ), which reduces the pressure that the upper coil springs 66 apply to the remaining banknotes in the bunch 16 . fig1 illustrates the bunch 16 at the picker 24 . fig7 illustrates the pressure plate 52 urged against the upper sheet transport section 40 . once all of the banknotes in the bunch 16 have been picked , the controller 34 de - activates the actuator 54 by rotating the actuator shaft 80 until the cams 82 , 84 cease to displace the upper cam followers 76 . this allows the pressure plate 52 to fall back to its normal position because the link arms 50 are equally biased by the upper and lower coil springs 66 , 68 . it should be noted that in fig1 and 12 one of the link arms 50 has been removed for clarity . when the depository 10 is to return one or more sheets to a customer , then the controller 34 actuates the bunch loader 22 as illustrated in fig8 to 10 and 12 . the controller 34 energises transport sections ( not shown in detail ) within the depository 10 to transport the bunch 16 of sheets towards the lower transport section 42 . the controller 34 also energises the actuator 54 and rotates the actuator shaft 80 until the cams 82 , 84 impart maximum displacement to the lower cam followers 78 . in this position , the upper cam followers 76 are not displaced . displacement of the lower cam followers 78 causes both of the lower coil springs 68 to be compressed . this , in turn , causes both of the link arms 50 to pivot about pivot 60 so that the urging portion 96 of each moves downwards . when the urging portions 96 move down , the pressure plate 52 also moves down ( best seen in fig1 ). this has the effect of compressing the bunch 16 between ( i ) the pair of belts 92 on the transport arrangement 90 and ( ii ) the pair of belts 110 on the lower transport section 42 . this ensures that banknotes within the bunch 16 are not splayed during transport towards the bunch deposit slot 14 . as the bunch 16 approaches the bunch deposit slot 14 , the bunch deflects the flap 98 upwards and then partially exits the bunch deposit slot 14 for the customer to retrieve . once the bunch 16 has been removed by the customer , the controller 34 de - activates the actuator 54 by rotating the actuator shaft 80 until the cams 82 , 84 cease to displace the lower cam followers 78 . this allows the pressure plate 52 to fall back to its normal position because the link arms 50 are equally biased by the upper and lower coil springs 66 , 68 . it should now be appreciated that this embodiment has the advantage that a bunch of sheets can be transported and the sheets individually picked , while a pressure plate automatically applies an appropriate pressure to the bunch depending on the size of the bunch . because a yoke link arm is used in the above embodiment ( that is , a link arm having a pair of springs mounted thereto ), the same mechanism can be used for drawing sheets into the depository and transporting sheets out of the depository . various modifications may be made to the above described embodiment within the scope of the invention , for example , in other embodiments , a different resilient member may be used , such as a leaf spring . in other embodiments , only a single link arm , or more than two link arms , may be used . in other embodiments , each link arm may only include a single resilient member rather than a pair of opposed resilient members . in other embodiments , the resilient members may be extended rather than compressed to pivot the link arms . in other embodiments , the actuator may comprise a linkage rather than a shaft and cams . in other embodiments , different transport sections may be used than those described . transport sections may use different sheet drive mechanisms than those described above . the steps of the methods described herein may be carried out in any suitable order , or simultaneously where appropriate . the terms “ comprising ”, “ including ”, “ incorporating ”, and “ having ” are used herein to recite an open - ended list of one or more elements or steps , not a closed list . when such terms are used , those elements or steps recited in the list are not exclusive of other elements or steps that may be added to the list . unless otherwise indicated by the context , the terms “ a ” and “ an ” are used herein to denote at least one of the elements , integers , steps , features , operations , or components mentioned thereafter , but do not exclude additional elements , integers , steps , features , operations , or components .
| 1Performing Operations; Transporting
|
as illustrated in fig1 a fine grained ore concentrate is provided at 10 together with additives such as slag forming agents . there also be may be included potentially auxiliary fuel such as coal dust . the mixture of materials is continuously supplied from a supply bunker 11 via a metering device 12 into a pressure line 13 . the line 13 is pressurized by a compressor 14 which provides for the pneumatic conveying of the suspension of solids through the pressure line 13 . air or oxygen enriched gas can be employed as conveying gas for the pneumatic conveying of the fine grained solids . the suspension of solids flows as indicated by the arrowed 15 , and this suspension with carrier gas is insufflated from above into a melting cyclone 17 through an upper wall 18 thereof via a nozzle 16 . the insufflation occurs at an exit speed in the range of 3 . 5 m ./ sec . through approximately 8 m ./ sec . a burner 19 is positioned to laterally direct a flame into the melting cyclone 17 which is positioned vertically . the burner 19 is supplied with fuel 20 , such as coal dust , and with primary air and potentially secondary air or oxygen enriched gas . the burner has a flame jet and the exit speed of the fuel at 21 of the burner orifice is in the order of 150 m ./ sec . the overhead nozzle provides a stream 22 of solids and the nozzle 16 is located so that the stream of solid particles is insufflated directly from above into the hottest zone of the burner flame jet 21 . the solid particles will penetrate into the burner jet . the stream 22 of solid particles impacts the burner jet at a specific location at which the burner jet is at its hottest point . this is a location where the burner jet has already transversed at least one - third of its overall tangent path relative to the wall of the melting cyclone , and this is illustrated generally by the location of burners 19a , 19b , 19c and 19d in fig2 through 4 . the solid particles 22 introduced from above into the melting cyclone are completely melted with instantaneous heating to high temperatures in the hottest part of the burner flame . the temperatures at that point will be on the order of 1600 ° c . and melting will occur in fractions of a second while the particles are still in flight or in an eddy condition as illustrated by the line 23 . these are interdependent of the atmosphere to be controlled via the partial oxygen pressure in the melting cyclone and the particles are subjected to a chemical reaction . at the underside of the melting cyclone 17 , low dust exhaust gas is withdrawn at the arrowed line 24 separately from the molten particles which migrate helically downwardly as indicated by the arrowed line 25 being as a melt film on the inside wall of the melting cyclone . with reference to fig2 a plurality of ore injecting nozzles 16a , 16b , 16c and 16d may be provided . fig2 illustrates four such nozzles which are circumferentially distributed over the top of the cyclone for the insufflation of fine grained solids material . the location of the insufflation nozzles is interdependent with the location of the burners 19a through 19d which are circumferentially spaced over the circumference of the cyclone . in addition to being circumferentially spaced , the burner jets 16a through 16d can be located at different vertical levels . as illustrated by fig3 which illustrates one level , burners 19a and 19c are positioned 180 ° apart . as illustrated in fig4 burner jets 19b and 19d are located at a lower location on the wall of the cyclone . the burner jets are each positioned relative to the insufflation particle nozzles so that a particle nozzle is positioned for each burner to direct the insufflation flow of particulate material and gas into the hottest point of a burner . the burner jets are positioned and angled so that the burner flame emerging from the jets extend into the cyclone tangent to the cyclone wall . this , of course , enhances the operation of the cyclone and while the burner flames carry the molten particulate material onto the cyclone wall , the material is molten by the time it reaches the wall so that abrasive engagement is avoided . ______________________________________concentrate mix 10______________________________________23 - 24 wt . -- % cu21 - 22 wt . -- % fe26 - 28 wt . -- % s14 - 19 wt . -- % ( sio . sub . 2 + al . sub . 2 o . sub . 3 + cao ) 2 - 3 wt . -- % zn0 . 5 - 1 wt . -- % pb0 . 5 - 1 st . -- % as______________________________________ melting results achieved in a trial system , particulars referred to 1 , 000 kg concentrate mix : oxygen through the burner 19 ( 95 % o 2 purity ): 307 - 334 nm 3 / t concentrate mix solids carrier agent or , respectively , reaction air : 206 - 300 nm 3 / t concentrate mix fuel through the burner 19 ( ch 4 ): 92 nm 3 / t concentrate mix heat losses of the melting cyclone 17 : 15 through 25 % of the introduced heat ratio of dust in the exhaust gas 24 : 21 through 27 kg / t (≈ 2 . 1 through 2 . 7 %) oxygen content in the exhaust gas 24 : 0 . 3 through 2 . 8 volume % copper content of the settled crude copper phase : 59 through 65 wt . % copper content of the settled slag phase : 0 . 7 through 1 . 0 wt . % in the foregoing example , the crude copper phase was separated from the slag phase without further after - treatment in a settling hearth arranged after the melting cyclone . comparatively low copper content of the settled slag phase , despite the presence of the comparatively high copper content of the settled crude copper phase is unexpected . the magnetite content of the slag phase lay between 5 % through 7 % by weight . thus , it will be seen that there have been provided an improved apparatus and method for the treatment of fine grained solids in a melting cyclone which meets the objectives and advantages above set forth and provides improved economy and efficiency , and longer cyclone wear than with arrangements heretofore available .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
hereinafter , exemplary embodiments are described in detail with reference to the accompanying drawings . for reference , in explaining the exemplary embodiments , detailed descriptions of constructions or processes known in the art may be omitted to avoid obscuring the subject matter of the exemplary embodiments . fig2 is a diagram illustrating an example in which a bidirectional remote controller according to an exemplary embodiment controls a display device . as illustrated in fig2 , a bidirectional remote controller 220 according to an exemplary embodiment performs bidirectional communication with a display device 210 . also , the display device 210 may transmit an osd menu screen for control of the display device to the bidirectional remote controller 220 , and the bidirectional remote controller 220 may transmit a control command for displaying an active window that corresponds to a menu screen selected by a user or a control command for executing a function that corresponds to the menu screen selected by the user to the display device 210 . accordingly , an osd menu screen for controlling screen brightness , contrast , and the like is displayed on the bidirectional remote controller . fig3 is a brief block diagram of a bidirectional remote controller according to an exemplary embodiment illustrated in fig2 . as illustrated in fig3 , the bidirectional remote controller 220 includes a reception unit 221 , a display unit 223 , a function execution unit 225 , a transmission unit 227 , and a user command input unit 229 . the reception unit 221 receives the menu screen for controlling the display device 210 from the display device 210 . in an exemplary embodiment , the reception unit 221 may receive the menu screen in an xml data format from the display device 210 . here , the xml data format represents a method for describing schema using an xml ( extensible markup language ) grammar , and is an xml application for defining metadata schema . in an exemplary embodiment , the menu screen may include at least one of an osd menu screen and an e - manual screen of the display device . here , the osd menu screen may be a screen for setting a screen or sound of the display device . in other words , through the menu screen , the osd , manual , and the like of the display device 210 that is a main video appliance can be received . for example , the osd may be an osd menu screen for setting a screen or sound of the display device or an e - manual that is a user guide for the display device . accordingly , the bidirectional remote controller according to an exemplary embodiment can directly receive the osd screen for controlling the display device , and can set the screen or sound desired by the user . the display unit 223 of the bidirectional remote controller 220 outputs the menu screen received by the reception unit 221 from the display device 210 . here , the bidirectional remote controller 220 may be a remote controller that includes a touch screen or a display unit . in other words , since the bidirectional remote controller 220 according to an exemplary embodiment receives the osd screen or the like from the display device 210 and displays the osd screen on the bidirectional remote controller 220 , the bidirectional remote controller 220 should include a display unit such as a touch screen . also , in an exemplary embodiment , the display unit 223 of the bidirectional remote controller 220 may install a program in the bidirectional remote controller 220 for configuring the menu screen received by the reception unit 221 in the xml data format . accordingly , it is necessary to install the osd screen received from the display device 210 in the bidirectional remote controller 220 in order to control the display device . if at least one menu is selected from the menu screen , the function execution unit 225 generates at least one of the control command for displaying an active window that corresponds to the selected menu and the control command for executing a function that corresponds to the selected menu on the display device . in other words , if the user selects any one of the osd menu screen or e - manual screen received from the display device 210 , the function execution unit 225 generates the control command that executes the function that corresponds to the selected item . the transmission unit 227 transmits the control command generated by the function execution unit 225 to the display device 210 . in an exemplary embodiment , the transmission unit 227 can transmit the control command for immediately displaying the active window to the display device 210 in the case where any one of the menu screens displayed on the bidirectional remote controller 220 is selected by the user . in other words , if the user selects any one of diverse menu items on the remote controller , the transmission unit of the bidirectional remote controller according to an exemplary embodiment transmits the control command for immediately displaying the active window that corresponds to the selected menu item on the display device 210 to the display device 210 . accordingly , the user can perform all settings for the screen or sound on the bidirectional remote controller 220 without the necessity of operating the osd menu screen on the display device 210 . here , the active window that corresponds to the selected menu screen may have its inherent id , and the control command for displaying the active window that corresponds to the selected menu screen may include the inherent id . in other words , in order to immediately display the active window that corresponds to the menu screen selected on the bidirectional remote controller 220 on the display device 210 , the inherent id such as an index id is given to each active window that corresponds to the menu screen selected on the bidirectional remote controller 220 , and if the inherent id that displays the active window is included in the control command , the display device 210 immediately displays the active window that corresponds to the inherent id transmitted from the bidirectional remote controller 220 . in an exemplary embodiment , if a plurality of menus are selected , the transmission unit 227 may transmit the control commands that correspond to the plurality of menus individually or collectively . in other words , the transmission unit 227 may individually transmit the control command according to the menu selected by the user in the function execution unit whenever the control command is generated , or may collectively transmit the control command to the display device after all settings are completed . here , the control command may include a control command for storing the data input by the bidirectional remote controller 220 in the display device 210 . in other words , the control command may include not only the control command according to the menu screen for controlling the display device 210 through the remote controller but also the control command for storing the user input data , such as characters input through the remote controller or setting data changed by the bidirectional remote controller 220 , in the display device 210 . the user command input unit 229 receives the user input from the user . that is , the function execution unit 225 receives the user input for executing a function that corresponds to the menu selected by the user . in an exemplary embodiment , the transmission unit 227 may transmit the data that corresponds to the user input received by the user command input unit 229 to the display device 210 . for example , the character input data input through the user command input unit can be transmitted to the display device 210 . also , in an exemplary embodiment , the bidirectional remote controller 220 can perform not only the function of a remote controller for one display device but also the function of an integrated remote controller for a plurality of display devices . accordingly , the bidirectional remote controller 220 according to diverse exemplary embodiments can immediately transmit the settings desired by the user to the display device 210 for storage as the user watches the setting and operation explanation of the display device on the remote controller in the case of using contents such as an e - manual or the like . also , it is possible to freely operate the osd menu screen on the screen without discriminating the osd menu screens displayed on the display device . also , in the case of setting navigation of the osd menu screen using the bidirectional remote controller 220 , the user &# 39 ; s input of touch , instruction , character input , and the like , can be freely performed . hereinafter , a method for controlling a bidirectional remote controller 220 according to an exemplary embodiment will be described . in the following description , explanation that overlaps the above - described explanation of the bidirectional remote controller according to an embodiment of the invention will be omitted . fig4 is a flowchart illustrating a method for controlling a bidirectional remote controller according to an embodiment of the invention . first , the bidirectional remote controller 220 receives a menu screen from the display device 210 and displays the menu screen ( s 410 ). here , the bidirectional remote controller 220 may be a remote controller that includes a touch screen remote controller or a display unit . in other words , since the bidirectional remote controller 220 according to an exemplary embodiment receives the osd screen or the like from the display device 210 and displays the osd screen on the bidirectional remote controller 220 , it should include a display unit such as a touch screen . in an exemplary embodiment , the menu screen may include at least one of an osd menu screen and an e - manual screen of the display device 210 . here , the osd menu screen may be a screen for setting a screen or sound of the display device . in other words , through the menu screen , the osd , manual , and the like , of the display device 210 that is a main video appliance can be received from the display device 210 . for example , the osd may be an osd menu screen for setting a screen or sound of the display device 210 or an e - manual that is a user guide for the display device 210 . accordingly , the bidirectional remote controller 220 according to an exemplary embodiment can directly receive the osd screen for controlling the display device 210 , and can set the screen or sound desired by the user . in an exemplary embodiment , the menu screen may be received in an xml data format from the display device 210 . here , receiving the menu screen from the display device 210 and displaying the menu screen on the bidirectional remote controller 220 may include installing a program for configuring the menu screen received in the xml data format in the bidirectional remote controller 220 . this is because an installation program for displaying the osd screen received from the display device is required in order to receive the osd screen for controlling the display device 210 in the bidirectional remote controller 220 and to control the display device 210 accordingly . next , a menu is selected from the menu screen displayed in operation s 410 ( s 430 ). according to the method for controlling a bidirectional remote controller 220 according to an exemplary embodiment , a user selects any one of the osd menu screen and e - manual received from the display device 210 . last , at least one of a control command for displaying an active window that corresponds to the menu screen selected in operation s 430 and a control command for executing a function that corresponds to the selected menu on the display device 210 is transmitted to the display device 210 ( s 450 ). here , the method for controlling a bidirectional remote controller 220 according to an exemplary embodiment may further include receiving a user input from the user and transmitting data that corresponds to the user input to the display device 210 . in an exemplary embodiment , the control command for displaying the active window that corresponds to the selected menu screen on the display device 210 may be a control command for immediately displaying the active window in the case where any one menu is selected by the user from the menu screens displayed on the bidirectional remote controller 220 . in other words , if the user selects any one of diverse menu items on the bidirectional remote controller 220 , the control command for immediately displaying the active window that corresponds to the selected menu item on the display device 210 is transmitted to the display device 210 . accordingly , the user can perform all settings for the screen or sound on the bidirectional remote controller 220 without the necessity of operating the osd menu screen on the display device 210 . here , the active window that corresponds to the selected menu screen may have its inherent id , and the control command for displaying the active window that corresponds to the selected menu screen may include the inherent id . therefore , in order to immediately display the active window that corresponds to the menu screen selected on the bidirectional remote controller 220 on the display device 210 , the inherent id such as an index id is given to each active window that corresponds to the menu screen selected on the bidirectional remote controller 220 , and if the inherent id that displays the active window is included in the control command , the display device 210 immediately displays the active window that corresponds to the inherent id transmitted from the bidirectional remote controller . 220 in an exemplary embodiment , if a plurality of menus are selected , operation s 450 may transmit the control commands individually or collectively . in other words , the control command according to the menu selected by the user may be individually transmitted whenever the control command is generated , or may be collectively transmitted to the display device 210 after all settings are completed . here , the control command may include a control command for storing the data input by the remote controller in the display device . in other words , the control command may include not only the control command according to the menu screen for controlling the display device 210 through the bidirectional remote controller 220 but also the control command for storing the user input data , such as characters input through the remote controller or setting data changed by the bidirectional remote controller 220 , in the display device 210 . accordingly , the method for controlling a bidirectional remote controller 220 according to diverse exemplary embodiments can immediately transmit the settings desired by the user to the display device 210 for storage as the user watches the setting and operation explanation of the display device 210 on the remote controller in the case of using contents such as an e - manual or the like . also , it is possible to freely operate the osd menu screen on the screen without discriminating the osd menu screens displayed on the display device 210 . also , in the case of setting navigation of the osd menu screen using the bidirectional remote controller 220 , the user &# 39 ; s input of touch , instruction , character input , and the like , can be freely performed . while the inventive concept has been shown and described with reference to certain exemplary embodiments thereof , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the inventive concept , as defined by the appended claims .
| 7Electricity
|
fig1 illustrates a first embodiment of the gasifier in accordance with the present invention . while this embodiment comprises a preferred embodiment in which the biomass fuel is fed into the top of a vertically oriented chamber and the fuel descends into the chamber as it is burned , the invention is not so limited . those skilled in the art will appreciate that it is within the skill in the art to configure the chamber in other ways . for example , the biomass fuel can be fed into the bottom of a vertically oriented chamber and moved upward during burning . in another embodiment , the chamber can be configured horizontally or at some angle , such that the biomass is fed into one end of the chamber and moved to the other end . a spindle assembly 10 is located within an insulated chamber 12 , preferably along the central vertical axis of chamber 12 . the chamber 12 must withstand temperatures in excess of 2000 ° f ., and thus its walls must be constructed of a suitable material capable of withstanding these high temperatures as well as providing thermal insulation , such as ceramic , lined with insulation , and surrounded by a steel shell . input auger 16 , or other suitable feeding device , is used to feed biomass fuel into the top of chamber 12 , typically from a suitably designed hopper and in such a manner as to minimize air leakage into the chamber with the fuel . the spindle assembly 10 is suspended from the top or cover of chamber 12 in such a manner as to be able to rotate about a vertical axis . in the first embodiment , the spindle 10 is suspended from the center of the chamber so as to be equally spaced from the walls of the chamber 12 . a second embodiment will be described below in association with fig3 . spindle 10 comprises an inner tube 56 , which is preferably fixed in position , such as by clamp 58 , and unable to rotate . spindle tube 64 circumscribes inner tube 56 and rotates about a vertical axis . in the preferred embodiment , spindle tube 64 is in communication with gear 68 , which is connected via a gear assembly to a motor ( not shown ). air jacket tube 20 preferably surrounds spindle tube 64 in such a manner as to allow the flow of air to occur in the space between the two tubes . preferably , this flow of air is supplied under pressure by primary air blower 22 . air damper 24 can be optionally used to control the flow of air entering the air jacket pipe 20 . air damper 24 also can be used to prevent admission of air into the pipe when the gasifier is inactive . optionally , air can be drawn through the air nozzles 18 into the gasifier chamber by maintaining the chamber at a lower pressure than the outside air . in either case , air that is pushed through the air jacket pipe 20 is forced through the air nozzles 18 into the gasifier chamber 12 . in the preferred embodiment , a circular grate 26 is affixed above air nozzles 18 and rotates with the spindle tube 64 . optionally , stirring fingers 28 which extend outwardly from the air jacket pipe 20 can also be included . located below the air nozzles 18 is a rotating hearth 30 , preferably constructed of refractory ceramic , or other high temperature resistant material . the rotating grate 26 , hearth 30 and fingers 28 increase the lateral mixing of the fuel material , and facilitate the downward flow of fuel , while also promoting flame penetration of the fuel above the hearth 30 and between the hearth and gasifier walls . all of these components are attached to the spindle tube 64 , causing them to rotate in unison . below the ceramic hearth 30 lies the gas collector 14 . the gas produced by the gasifier is captured by the collector 14 and transferred out of the gasifier through gas tube 56 . gas tube 56 is prevented from rotating by its attachment to the top of the gasifier via clamp 58 . fig2 illustrates the preferred embodiment of the gas collector 14 . the collector comprises an internal frame 54 , which is attached , such as by locating pins , to inner tube 56 , and therefore unable to rotate . at the base of the internal frame 54 is a ceramic heat shield 66 . fixed rings 50 and rotating rings 52 are placed about internal frame 54 in an alternating pattern . the rings are preferably produced from heat resistant steel alloy and fit over the internal frame . fixed rings 50 have one or more , preferably two , internal protrusions 50 a , each of which is configured to fit between adjacent supports of internal frame 54 , thereby fixing them with respect to the internal frame . rotating rings 52 do not have the above - mentioned protrusions and therefore are free to rotate relative to internal frame 54 . natural imperfections in the manufacturing process create sufficient gaps between adjacent rings to allow gas to flow between them . the capacity of the gas collector can be varied by a number of techniques ; an increase in the number of rings used causes an increased number of gaps through which gas can flow . similarly , an increase in the radius of the rings also increases the area through which the gas can flow . the rings may be deformed or machined to have slightly rippled upper and lower surfaces , that , being identical for all rings , cause the rings to move slightly toward and away from adjacent rings as they turn relative to adjacent rings . atop the uppermost ring , which is preferably a fixed ring 50 , is situated a hub 62 . hub 62 preferably has upward facing protrusions , which interlock with corresponding lower side indentations on the ceramic hearth 30 and has locating pins or other means to ensure its rotation with spindle tube 64 . this interlocking mechanism , or any other similar interconnection , allows the hub 62 , to move in concert with the ceramic hearth 30 and spindle tube 64 . auger 60 is attached to hub 62 , as by welding , and circumscribes the stack of rings . in the preferred embodiment , the auger 60 is attached to all rotating rings 52 by welding , but not attached to fixed rings 50 . in this way , the rotation of spindle tube 64 causes the rotation of the ceramic hearth 30 , the hub 62 , the auger 60 , and the rotating rings 52 . turning back to fig1 , a second combustion zone within the lower portion of chamber 12 includes nozzles 32 for the injection of air or oxygen into said combustion zone . in the preferred embodiment , air is injected by blower 38 , controlled by damper 42 , which , when the gasifier is inactive , may entirely prevent air leakage via nozzles 32 into chamber 12 . optionally , nozzles 34 reinject gases produced in the first combustion zone , principally co 2 , h 2 o , and tars , into the second combustion zone , near the bottom of gasifier chamber 12 . such reinjection may be caused by a blower 40 and controlled by a damper 44 , or by varying the blower speed . ash auger 36 is located at the bottom of chamber 12 , which is preferably conical in shape to require the ash to accumulate near the auger . auger 36 enables ash and other noncombustible residues to be removed from chamber 12 to an ash receiver suitably designed to prevent air leakage into chamber 12 . having described the physical components of the present invention , the operation of the gasifier will now be described . referring to fig1 , biomass is fed into the gasifier via the rotation of input auger 16 . the drive motor of the input auger 16 ( not shown ) is equipped with a means of detecting that the gasifier chamber 12 is full of biomass fuel . in practice this may be performed by a variety of mechanisms such as electrical or mechanical detection of the torque applied to the feed auger , or by a separate paddle wheel type sensor . as the biomass enters the chamber 12 , the rotary action of fingers 28 and circular grate 26 serve to mix the biomass and ensure even penetration into the biomass of the flame originating at nozzles 18 . air nozzles 18 provide the combustion air necessary for the biomass to burn . air is preferably blown into the space between air jacket pipe 20 and spindle tube 64 by primary air blower 22 . damper 24 controls the flow of air entering the air jacket pipe 20 . alternatively , air can enter the gasifier by maintaining a negative pressure differential between the inside of the gasifier and the outside environment . the region of chamber 12 located in the vicinity of circular grate 26 , circular hearth 30 and air nozzles 18 comprises combustion zone i , where solid fuel is carbonized by vaporization and combustion of substantially all of its volatile combustible constituents . the combustion process is initiated by manually igniting the raw biomass , such as by the use of a blowtorch , or an automatic ignition device . once ignited , the combustion of the biomass becomes a continuous , self - sustaining process , where the injection of air and additional biomass are all that is needed to maintain combustion . spindle assembly 10 is rotated continuously or intermittently during operation of the gasifier , but at a low speed , to ensure mixing and flow of the material , but so as to avoid unnecessary breakage of the fuel and charcoal particles . as additional fuel is added and carbonized within combustion zone i , this newly carbonized fuel descends deeper into the chamber 12 . the rotation of the auger 60 ensures that the carbonized fuel continues to descend , despite the movement of gas toward the gas collector surface and the consequent migration of small char particles toward the gas collector surface . the close proximity of the surface of the gas collector to the walls of the gasifier chamber 12 , which chamber is square in its plan view or otherwise designed to prevent rotation of the charcoal particles with the spindle assembly , assists in forcing the char particles to descend toward combustion zone ii . the bottom of the gasifier chamber 12 , denoted as combustion zone ii , is thereby maintained full of char particles , despite the upward flow of gas from combustion zone ii toward the gas collector . in a preferred embodiment of the gasifier , the outside diameter of the gas collector is approximately ten inches , while the distance between opposite walls of chamber 12 is eighteen inches , creating a distance of four inches between the gas collector surface and the nearest surfaces of the chamber 12 . the downward movement of charcoal particles in proximity to the gas collector is responsible for preventing the problem of charcoal bed choking or densification mentioned previously . this problem is caused by the rapid migration of small char and ash particles with the flow of gas toward the gas collector . these small particles remain mobile and continue to flow with the gas until their path is obstructed by somewhat larger particles , having void spaces slightly too small to allow further migration of these particles . in this way the charcoal bed acts like a filter , trapping particles that would otherwise reach the gas collector surface , the smallest of which would pass between the gas collector rings and enter the product gas . a stationery charcoal bed would necessarily and quickly clog with these smaller particles , as occurs in fixed bed gasifiers of conventional design . in the present invention , the clogging , densification , or aggregation of the charcoal bed is counteracted by the continuous or intermittent transport of the charcoal bed toward combustion zone ii . in practice a very high rate of combustible gas production may be maintained by this method with a suction of less than 2 . 5 ″ water column ( 0 . 1 psi ). actively transporting the char downward also helps ensure that channels do not develop through which oxygen or noncombustible gases can travel to the gas collector surface . channeling is the formation of passages through the char bed by erosion , which allow unreacted combustion gas , such as carbon dioxide , water vapor and hydrocarbons , to bypass the char bed and pass directly into the gas collector . channeling occurs in conventional fixed bed gasifiers when the openings in the gas collector or grate are large enough to allow the passage of both intermediate size and small char particles out of the charcoal bed . when the charcoal bed is vibrated or otherwise disturbed , these particles may discharge from a portion of the char bed especially when the gas suction is strong . the present invention prevents channeling by utilizing very small gasflow passages in the gas collector surface , these being the gaps between adjacent rings . in addition gas suction across the char bed is very weak because of the continuous renewal of the char bed due to its downward displacement . newly produced char from combustion zone i , containing relatively large particles , presents relatively little resistance to the flow of gas , and continuously or intermittently replaces the partially densified bed as it is moved toward combustion zone ii . since the area surrounding the gas collector contains mostly carbonized fuel , it reacts with the hot gases , such as carbon dioxide and water vapor , that are produced in combustion zone i , located above the gas collector , and combustion zone ii , located below the gas collector . this endothermic reaction yields carbon monoxide and hydrogen gas . the region of chamber 12 below combustion zone i and above combustion zone ii ( which is described below ) comprises the reduction zone , which is also a region wherein the temperatures are lower than in either of the combustion zones surrounding it . because the zone of the gasifier surrounding the gas collector is not fed with air and is involved in endothermic reactions , its temperature is lower than that of combustion zone i , or combustion zone ii , which is located in the lower portion of the chamber 12 . to protect the gas collector from the extreme temperatures both above and below it , ceramic materials are used in the production of the hearth 30 and the heat shield 66 . the gas collector itself may be made from relatively less temperature resistant material , such as high temperature corrosion resistant alloy steel . the gas temperature exiting the gasifier typically has a temperature of 800 to 1000 degrees fahrenheit . as the carbonized fuel passes below the gas collector , it enters combustion zone ii , where air or oxygen is injected , using blower 38 , into chamber 12 through nozzles 32 . as in the case of combustion zone i , the flow of air or oxygen can be controlled by damper or valve 42 , and can be completely stopped when the gasifier is inactive . this injection of air allows for the complete combustion of the char particles that have been transported down by the auger 60 . this process will typically yield carbon dioxide and completely consumed fuel , in the form of ash . the second combustion zone produces much of the energy required for the conversion of noncombustible carbon dioxide gas to combustible carbon monoxide gas as the gas travels upward through the charcoal bed and is captured by the gas collector . the reduction of carbon dioxide to carbon monoxide is accompanied by the oxidation of carbon in the charcoal to carbon monoxide , which consumes a portion of the charcoal before it reaches combustion zone ii . the nozzles 32 are configured to consume charcoal as completely as possible , allowing only noncombustible ash to reach the ash auger 36 . auger 36 is rotated intermittently or continuously in response to excess air pressure encountered by air blower 38 . excess air pressure indicates a buildup of ash interfering with the injection of air into combustion zone ii . summarizing the operation of the gasifier , combustion zone i uses air to convert fresh biomass into carbon dioxide , water vapor and carbonized fuel . this partially burned fuel is moved downward through the chamber by the rotation of the auger 60 . as the hot carbon dioxide and water vapor move away from combustion zone i , they continue to react with the partially burned fuel , yielding carbon monoxide and hydrogen gas , which are captured by the gas collector 14 . the rotation of the auger 60 also continues to push this carbonized fuel downward . the unique configuration of the gas collector , in conjunction with the rotary action of the auger , serve to continuously clean the surface of the gas collector to prevent aggregation . as the remaining carbonized fuel reaches the lower portion of the chamber 12 , it enters combustion zone ii . in this zone , air is injected into the chamber and the carbonized fuel is completely combusted to yield hot carbon dioxide and ash . hot carbon dioxide travels through the carbonized fuel up toward the gas collector . while traveling , it reacts with the fuel to create carbon monoxide , which is captured by the gas collector . thus , the gas collector is capable of capturing gases produced in both combustion zone i and combustion zone ii after reaction with the reduction zone . the efficiency of the described gasifier can be further enhanced by the re - circulation of exhaust gases from combustion zone i . in this embodiment , gases are drawn from the top of chamber 12 by the action of exhaust gas blower 40 and injected into combustion zone ii via nozzles 34 . these exhaust gases , including steam , carbon dioxide , tars and other hydrocarbons , are injected to reduce their presence in the product gas and to control the relative temperatures of combustion zone i and combustion zone ii . the quantity of gas recirculated may be controlled by damper or valve 42 or by varying the speed of blower 38 . the re - circulation of the exhaust gases serves several purposes . pulling a high gas flow through the recirculation loop decreases the downward flow of combustion gas from combustion zone i toward the reduction zone and the gas collector . since zone i has lower temperatures than zone ii , these combustion gases are less likely to be converted to combustible gas than if they originated from zone ii . recirculation also increases the upward penetration of the flame from combustion zone i into the raw fuel located above combustion zone i , thereby increasing the rate of fuel to char conversion . at very high rates of gas recirculation , much of the heat required for fuel pyrolysis or fuel to char conversion , may come from the upward flow of a portion of the hot gases from combustion zone ii and the reduction zone . at lower rates of gas recirculation , water vapor is withdrawn from the top of gasifier chamber 12 fast enough to prevent condensation of water in the newly added biomass fuel , which would otherwise hinder combustion in zone i . such water vapor may be partially or wholly dissociated into hydrogen gas and oxygen where the oxygen combines with carbon under high temperatures in combustion zone ii . the gas that enters the gas collector travels up inner tube 56 . this tube is preferably in communication with gas cleaning equipment and a gas suction blower , where the blower delivers gas to the end use application at a rate equal to the rate of gas consumption , thereby minimizing or obviating the storage of the low caloric value gas produced . ideally , the gas suction blower is regulated to maintain a slightly negative pressure inside the gasifier , relative to air pressure . this eliminates the possibility of combustible and lethal gas leakage into the surrounding environment . fig3 illustrates a second embodiment of the gasifier of the present invention . in this embodiment , a plurality of spindle assemblies 10 is used in conjunction with a single insulated chamber . fig3 shows a top view of the chamber 12 , with several spindle assemblies 10 . these spindle assemblies are mounted to the top of the chamber , as described in reference to fig1 . in the first embodiment , the gas collector is surrounded by the walls of gasifier chamber 12 , which are square in plan or otherwise configured to inhibit rotation of the char with the spindle assembly . in the embodiment of fig3 , there is no chamber wall around many of the augers . however , the use of multiple augers having the same pitch direction and same direction of rotation such that proximate points on adjacent augers are moving in opposition yields the same result . referring to fig3 , a configuration of nine augers is shown . auger 300 , like all other augers rotates in a counterclockwise direction . when viewed in relation to its immediate neighboring auger 301 , it can be seen that augers 300 and 301 are moving in opposite directions at the point where these augers are the closest together . this opposite movement creates a powerful downward tractive force on the charcoal surrounding these augers . the same phenomenon exists with respect to auger 300 and its other neighboring augers 302 , 303 and 304 . similarly , this exists between each pair of neighboring augers . thus , each auger is surrounded by either a chamber wall 330 , or an opposing auger . this embodiment ensures a uniform downward motion of charcoal surrounding the gas collectors , and allows the production of large amounts of combustible gas due to the large combined surface area of multiple gas collectors . the fixed gas pipes leading from the multiple spindles of such multi - spindle gasifiers may be manifolded together such that the gas may be drawn from multiple gas collectors by a single blower . the combustible gas may be then used in a number of ways ; it can be burned to produce heat , it can be used to power internal combustion engines or turbines , or it can be used as feedstock for chemical production .
| 2Chemistry; Metallurgy
|
fig1 depicts a present - art monitoring system for the ecg . the patient 101 is shown supine on bed 104 or analogous surface for repose or transport . outside and beyond the perimeter 104 of the bed , dashed lines 107 demarcate the outer boundary or perimeter of the infectious zone , which is beyond the patient &# 39 ; s reach . electronic monitor console 110 is shown outside the infectious zone , although it is frequently positioned at the patient &# 39 ; s bedside and within reach of the patient , hence within the infectious zone . present - art practice generally locates the monitor console according to physical constraints of the available space and operator convenience , without attention to issues of contamination by the patient . trunk cable 112 is shown connected to the console by connector 113 at its proximal end , and possesses a connector or yoke 114 at its distal end . three conductive wires 117 comprise the serial cable shown herein , but more elaborate serial cables contain additional electrical wires to enable multiple ecg leads ( waveforms ). each conductive wire comprising the serial cable terminates at its distal end in a conductive electrode 121 which is conductively coupled to the skin surface . other types of conductive couplings may be used , not shown , such as subcutaneous or intravascular . the proximal end of the serial cable connects to the yoke 114 of the trunk cable , such connection shown herein by pin connectors 116 , though other types of connectors may be employed . the present - art system configuration shown in fig1 makes evident the ease of frequent contamination of the trunk cable and its yoke connector by the patient , bedclothes , and other personal sundries residing with the patient . the serial cable is generally disposable . fig2 depicts a present - art monitoring system for body temperature , showing the patient 201 , the perimeter 204 of the bed , and the outer boundary or perimeter 207 of the infectious zone . electronic monitor console 210 is shown outside the infectious zone and engages input connector 213 on the proximal end of the trunk cable 212 . the distal end of the trunk cable possesses connector 214 which couples to connector 216 on the proximal end of serial cable 217 , possessing the requisite number of conductors to convey the signal representing body temperature . the distal end of the serial cable connects to the temperature sensor 222 , such as thermistor or thermocouple , shown in the axilla of the patient . fig2 , in a manner analogous to fig1 , shows the consistent contamination of the trunk cable by the patient and his intimate physical environment . fig3 depicts a present - art monitoring system for non - invasive blood pressure measurement , showing the patient 301 , the perimeter of the bed 304 , and the perimeter 307 of the infectious zone . electronic monitor console 310 is shown outside the infectious zone and receives pneumatic input connector 313 on the proximal end of the pneumatic trunk cable 312 ( tubular trunk line ). the distal end of the tubular pneumatic trunk line possesses connector 314 , which couples pneumatically to connector 316 on the proximal end of the pneumatic serial cable 317 , the serial tubular line to inflatable blood - pressure cuff 323 . the electronic console contains an air pump to inflate the cuff , a valve to gradually bleed air from the cuff after adequate inflation , a pressure sensor to measure air pressure within the tubular lines and cuff , and algorithms for controlling the operation of the system and for computing blood pressure from the pulsating pressure fluctuations which occur during deflation of the pressurized cuff . this method is well - known to those skilled in the art , and further details are not herein provided . while disposable blood pressure cuffs are now available , but not always employed , their serial pneumatic line 317 is always short , and connector 316 lies within the infectious zone , as does its mating connector 314 ; the pneumatic trunk cable 312 extending to the monitor console 310 is extensively within the bed and infectious zone . fig4 depicts the first configuration applied to ecg monitoring , showing the patient 401 , the perimeter 404 of the bed , and the perimeter 407 of the infectious zone . electronic monitor console 410 is located outside the infectious zone , and receives connector 413 from the proximal end of trunk cable 426 . trunk cable 426 lies entirely outside the infectious zone , as does the connector or yoke 414 at its distal end . thus , the trunk cable is not subject to direct contamination by the patient or his intimate environment . pin connectors 416 , affixed to the proximal end of serial cable 418 , also lie outside the infectious zone , but serial cable 418 enters the infectious zone and extends to the patient , where ecg electrodes 421 at the distal ends of the serial cable &# 39 ; s wires are conductively coupled to the patient . compared to present art as shown in fig1 , the configuration as drawn in fig4 shows the trunk cable to be shorter and the disposable serial cable to be longer than present art . fig5 depicts the first configuration applied to monitoring of temperature , showing patient 501 , the perimeter 504 of the bed , and the perimeter 507 of the infectious zone . electronic monitor console 510 is located outside the infectious zone , and receives connector 513 from the proximal end of trunk cable 526 . trunk cable 526 lies entirely outside the infectious zone , as do connector 513 at its proximal end and connector 514 at its distal end . thus , the trunk cable is not subject to direct contamination by the patient or his intimate environment . connector 516 at the proximal end of serial cable 518 also lies outside the infectious zone , but serial cable 518 enters the infectious zone and extends to the patient , where temperature sensor 522 at the distal end resides in the patient &# 39 ; s axilla . compared to present art as drawn in fig2 , the configuration as drawn in fig5 shows the trunk cable to be shorter and the disposable serial cable to be longer than present art . fig6 depicts the first configuration applied to monitoring of blood pressure , showing patient 601 , the perimeter 604 of the bed , and the perimeter 607 of the infectious zone . electronic monitor console 610 is located outside the infectious zone , and receives connector 613 from the proximal end of pneumatic trunk cable 626 . trunk cable 626 lies entirely outside the infectious zone , as does pneumatic connector 614 at its distal end . thus , pneumatic trunk cable 626 is not subject to direct contamination by the patient or his intimate environment . pneumatic connector 616 at the proximal end of serial pneumatic cable 618 also lies outside the infectious zone ; serial pneumatic cable 618 enters the infectious zone and extends to the patient , where blood - pressure cuff 623 at the distal end is wrapped around the patient &# 39 ; s arm . compared to present art as drawn in fig3 , the configuration as drawn in fig6 shows the pneumatic trunk cable to be shorter and the disposable serial pneumatic cable to be longer than present art . fig7 depicts the second configuration applied to ecg monitoring , showing patient 701 , the perimeter 704 of the bed , and the perimeter 707 of the infectious zone . electronic monitor console 710 is located outside the infectious zone , and receives connector 713 from the proximal end of trunk cable 726 . trunk cable 726 lies entirely outside the infectious zone 707 , as does yoke connector 714 at its distal end . thus , trunk cable 726 is not subject to direct contamination by the patient or his intimate environment . pin connectors 715 are affixed to the proximal end of an intermediate cable 733 , and also lie outside the infectious zone , while intermediate cable 733 enters the infectious zone and extends to the proximal end of the serial cable 717 . pin - receptive connectors 734 at the distal end of the intermediate cable mate with pin connectors 716 at the proximal end of the serial cable . the distal ends of wires comprising the serial cable terminate in conductive electrodes 721 which are conductively coupled to the patient . in this second configuration , both the serial cable and the intermediate cable are disposable . this permits use of serial cables as presently manufactured , which are not sufficiently long to reliably extend outside the infectious zone , while the intermediate cable of simple structure and inexpensive serves as an extension line for the serial cable and reaches outside the infectious zone to the yoke connector 714 of the trunk cable 726 . essentially , serial cable 717 linked to intermediate cable 733 replaces serial cable 418 of fig4 . fig8 depicts the second configuration applied to monitoring of temperature , showing patient 801 , the perimeter 804 of the bed , and the perimeter 807 of the infectious zone . electronic monitor console 810 is located outside the infectious zone , and receives connector 813 from the proximal end of trunk cable 826 . trunk cable 826 lies entirely outside the infectious zone 807 , as does connector 814 at its distal end . thus , trunk cable 826 and its connectors are not subject to direct contamination by the patient or his intimate environment . mating connector 815 is affixed to the proximal end of an intermediate cable 833 , and also lies outside the infectious zone , while intermediate cable 833 enters the infectious zone and extends to the proximal end of the serial cable 817 . at the distal end of intermediate cable 833 , receptive connector 834 mates with connector 816 at the proximal end of serial cable 817 . the distal end of serial cable 817 connects to the temperature sensor , which is shown nestled in the patient &# 39 ; s axilla . in this second configuration for temperature monitoring , both serial cable 817 and intermediate cable 833 are disposable . essentially , serial cable 817 linked to intermediate cable 833 replaces serial cable 518 of fig5 . fig9 depicts the second configuration applied to monitoring of blood pressure , showing patient 901 , the perimeter 904 of the bed , and the perimeter 907 of the infectious zone . electronic monitor console 910 is located outside the infectious zone , and receives pneumatic connector 913 from the proximal end of pneumatic trunk cable 926 . trunk cable 926 lies entirely outside the infectious zone 907 , as does pneumatic connector 914 at its distal end . thus , pneumatic trunk cable 926 and its connectors are not subject to direct contamination by the patient or his intimate environment . mating connector 915 is affixed to the proximal end of an intermediate pneumatic cable 933 , and also lies outside the infectious zone , while intermediate pneumatic cable 933 enters the infectious zone and extends to the proximal end of the serial cable 917 . at the distal end of intermediate pneumatic cable 933 , receptive pneumatic connector 934 mates with pneumatic connector 916 at the proximal end of serial pneumatic cable 917 . the distal end of pneumatic serial cable 917 connects to the blood pressure cuff 923 , which is wrapped around the patient &# 39 ; s arm . in this second configuration for monitoring of blood pressure , both serial pneumatic cable 917 and intermediate pneumatic cable 933 are disposable . essentially , serial pneumatic cable 917 linked to intermediate pneumatic cable 933 replaces serial pneumatic cable 618 of fig6 . present - day disposable blood - pressure cuffs generally possess a short length of pneumatic cable ( tubing ) permanently affixed thereto , which would serve as the serial pneumatic cable 917 of the present fig9 . fig1 a - 10b depicts sheaths primarily used for encasing the trunk cable of the monitoring system , and could also be used for the other cables as well . fig1 a is a longitudinal section along the central axis showing an configuration having a pleated sheath with end - partitions . the pleated sheath 1080 is generally shown , with radially - oriented pleats 1081 , end - partition 1082 possessing apertures 1083 a and 1083 b through both of which the cable is inserted , and then one end - partition is slidably drawn along the entire length of the cable . at the trunk cable &# 39 ; s proximal end the connector protrudes slightly to enable connection to the monitor console ; at the distal end the trunk cable may protrude sufficiently to allow connection of the serial cable , and the region of such connection may then be inserted inside the sheath so that the trunk cable at its distal end is fully protected by the sheath . as previously described , the distal end of the trunk cable and its mating to the proximal end of the serial cable , or the proximal end of the intermediate cable in the second configuration , are always maintained outside of the infectious zone , and this is maintained during disposition of the sheath around and over said cables . fig1 b is a longitudinal section along the central axis of another configuration depicting a sheath with a compact telescopic form , which may be drawn along the entire length of the trunk cable and connections made as described above for a pleated sheath . the telescopic sheath 1090 is generally shown , with overlying folds 1091 , end - partition 1092 possessing apertures 1093 a and 1093 b . the apertures 1083 and 1093 , if true voids in the material of the end - partition , are smaller than the diameter of the cable so that the end - partition snugly surrounds the cable and seals it from the external environment . alternatively , the aperture may be replaced by a slit which is parted to insert the cable . end - partitions 1082 and 1092 are advantageously elastic or compliant materials to perform the function of a seal around the cable . if the material comprising the end - partition is sponge - like , it may be impregnated with an antimicrobial , which would be wiped along the cable during insertion as the end - partition is drawn along the entire length of the cable . the sheath material may be made of any number of elastomeric materials , and may or may not incorporate an anti - microbial agent . alternatively , the anti - microbial agent may be applied to the inner and / or outer surfaces of the sheath material . while the two configurations of a sheath depicted herein show the sheath material in a folded manner in order to reduce the space needed to package the component , an alternative means of collapsing the sheath may be to simply bundle or bunch the material together . other configurations for the sheath ( not shown ) may consist of other means for enclosing each end of the sheath to capture it against the cable or the connector . in one configuration an adhesive material may be applied to the end of the sheath , which is then compressed against the cable or connector . alternatively , the ends may be made with an elastic band or other cinching means which can cinch down against the cable or the connector . yet other configurations of the sheath may provide sufficient material to allow the sheath to extend over multiple cables of the monitoring system . in this configuration the sheath would extend into the infectious zone . it may also be made of sufficient length to reach from the monitor to the patient along the entire length of multiple cables . while preferred configurations have been described with particularity and with reference to the drawings , modifications and variations of the foregoing will be apparent to those of skill in the art utilizing the techniques disclosed herein . it is , therefore , to be understood that such configurations are illustrative and not limiting on the scope of the present application and that the application encompasses such modifications and variations . 2 . the system wherein said serial cable proximal end connects to a wireless transmitter and said trunk cable distal end connects to a wireless receiver . the system wherein said serial cable proximal end connects to a wireless transmitter and a wireless receiver is connected to said monitor . the system wherein said wireless receiver is contained within said monitor &# 39 ; s enclosure . the system wherein said intermediate cable proximal end connects to a wireless transmitter and said trunk cable distal end connects to a wireless receiver . the system wherein said intermediate cable proximal end connects to a wireless transmitter and a wireless receiver is connected to said monitor .
| 0Human Necessities
|
fig1 shows an illustrative network for use with a range of embodiments of the present invention . there , first and second pluralities of telephone stations 101 - 1 through 5 - 101 - m and 181 - 1 through 181 - n are shown connected to respective central offices 102 and 155 . these central offices are , in turn , connected to representative toll switches 110 and 140 to permit normal voice calling between telephone stations in respective pluralities of telephone stations . central offices 102 and 155 are also shown connected to representative signal transfer points ( stps ) 115 and 137 , which stps are , in turn , shown interconnected through a signaling network of stps also comprising stps 135 , and 145 . these stps and their interconnection are typical of signaling system 7 ( ss7 ) signaling networks well known in the telecommunications arts . the illustrative network of fig1 also includes additional toll switches 190 and 198 . in appropriate circumstances , some or all of the toll switches shown in fig1 may be operated by a local exchange carrier ( lec ), an interexchange carrier ( ixc ), or another entity . while each of the switches are shown interconnecting with stps in fig1 , it will be understood that , in particular cases , some switches may not themselves include ss7 capabilities , and so are connected to the ss7 network through another ss7 - enabled switch . also shown interconnected with the standard voice network arrangement described so far with reference to fig1 are illustrative network services platforms 125 and 126 , shown as including respective processors 131 and 127 , as well as respective database systems 129 and 128 . these latter service platforms are illustrative of so - called intelligent network platforms that include service control points , scps , ( or network control points , ncps ), known in the art . for example , network platforms include the well known 8xx ( toll - free calling ) and calling card platforms . in typical fashion , platforms such as illustrative platforms 125 and 126 in fig1 receive queries , commands or other information and illustratively provide routing , authentication and other control information . in the illustrative network embodiment shown in fig1 , platform 126 advantageously serves as an scp configured to provide calling card validation functionality . thus platform 126 is arranged to receive calling card queries from network switches through one or more of the stps shown in fig1 , and to provide authentication ( or not ) for the received account information and personal identification number ( pin ) or other identification appropriate to the circumstances . further descriptions of telephone networks of the type shown generally in fig1 may be found in the literature , including , e . g ., intelligent networks , by jan thorner , artech house , norwood , mass ., 1994 , and signaling system 7 , by t . russell , mcgraw - hill , new york , 1995 . the network of fig1 also shows first and second pluralities of computers , workstations or computer terminal devices ( collectively , “ computers ”) appearing as 105 - 1 through 105 - p , and 182 - 1 through 182 - q . these computers may be desktop or portable computers , or may be terminals connected through a centralized computer , all to provide users with keyboard and other input facilities ( such as a mouse or other pointing device ) and display facilities well known in the art . in typical operation , these computers are arranged to communicate over the pstn or other telephone network using standard modems , and to connect to one or more internet service providers ( isps ) through portions of such telephone networks for access to the internet ( shown as the “ cloud ” 195 in fig1 ), including chat and messaging facilities of the internet . hardware in computers 105 - i and 182 - j will typically include a sound card , such as the well - known soundblaster sound cards or those available form voyetra turtle beach , inc ., for , among other things , converting speech inputs from a microphone into digitized speech signals and for converting received digitized speech signals into analog speech signals for driving a loudspeaker or earphones . in some cases this sound card functionality is built into a computer motherboard , or may be provided in an external device used with the computer . software executing in computers 105 - i and 182 - j will typically include an internet “ browser ,” such as are available from microsoft corporation or netscape corporation , among others , for interacting with internet facilities . in some cases , such browser software may be augmented by add - on or plug - in software for introducing or upgrading messaging and / or chat software . in one illustrative case , both user ( client ) and server software ( executing at an isp access server , or related network server ) will be based on well - known chat components such as mirc client and server software by mirc co . ltd , which is available on the internet . further information about well - known chat software and procedures is available from the undernet user committee web site . of particular note is network working group request for comments : 1459 , by j . oikarinen and d . reed , may , 1993 , available at the undernet web site . this latter document presents a version of the internet relay chat ( irc ) protocol that has provided important bases for current chat implementations . other particular client / server implementations of various chat functionalities include several quirc chat software modules and those available from activerse , inc . client software is also available as components of browser software and from isps such as at & amp ; t worldnet and america online for interacting over chat and messaging facilities . in illustrative operation of the network of fig1 for internet connections , a user at one of the computers , such as 105 - 1 in the network of fig1 will gain access to an isp access server , such as server 191 in fig1 , through a dial - up connection by way of central office 102 and toll switch 190 . in some cases , the isp access server will connect directly to a central office , such as 102 in fig1 , and in other cases , additional toll or other switches will be used to connect the user at computer 105 - 1 to an isp server such as 191 in fig1 . once connected to access server 191 , the user at computer 105 - 1 , and other users at other computers such as computers 105 - i and 182 - j shown in fig1 , will typically login in well known fashion and begin interacting with internet facilities . among the activities pursued by users are the aforementioned chat facilities . for example , terminal 105 - 1 and 182 - 1 may be connected through respective isp access servers 191 and 196 ( which servers may be under the control of the same isp , or independently controlled ) to chat server 193 over the internet . the chat server may , of course , actually be one of the access servers , or an isp server connected in a distributed network with the access server — or the chat server may be independent of either or both of the isps . it will be appreciated that connections between computers such as 105 - i or 182 - j are typically to central offices such as 102 and 155 over normal dial - up subscriber telephone lines , e . g ., from a user &# 39 ; s home or office . while many homes and offices are supplied with more than one subscriber line , many locations , especially homes , have only a single active subscriber line entering the premises . in other cases where more than one subscriber line may be present , the user of a computer such as 105 - 1 may only be allowed to use one subscriber line for all of his / her communications . for example , in a two - line household , one line may be reserved for business or other dedicated purpose of one member of the household . thus , all internet connections and voice conversations by other members of the household normally must be pursued using the remaining line . accordingly , when a user at a location with only a single available line is active in an internet session , e . g ., to a chat room , the line is unavailable to originate or receive normal telephone calls using a telephone such as 101 - 1 . in other cases , of course , a computer such as 105 - 1 and a telephone station set such as 101 - 1 may have separate subscriber lines and may be active simultaneously without conflict . one application of the teachings of the incorporated desimone application ser . no . 09 / 111 , 672 , permits a first user engaged in a text chat session to contact a “ call broker ” to obtain a so - called “ participant authorization code ” ( pac ) and a session identifier , which information is then supplied to one or more other chat participants . the first user will typically provide payment information and a callback telephone number . when one or more of the other chat participants contacts the call broker and supplies the session and pac information ( typically provided in the chat or messaging context by the first user ), along with respective callback telephone numbers , the call broker seeks to establish a telephone connection between the chat participants electing to take part , usually including the first user . using this approach , the anonymity of the telephone call participants is maintained , as it typically is in the text chat session . of course , if one or more of the would - be participants in the telephone call has but a single available subscriber line at the user location , then an attempt by the call broker to complete a telephone call to the callback number over the pstn will normally not be successful if the user at that location continues to be active in the internet text chat session or other computer calling activity . this problem is addressed in u . s . pat . no . 5 , 805 , 587 , issued on sep . 8 , 1998 to j . h . norris and t . l . russell and assigned to the assignee of the present invention . in one aspect , the last - cited patent ( hereinafter , the &# 39 ; 587 patent ) describes sending of a message to a user who is online to an isp or other server . the message provides information regarding a telephone call directed to the subscriber line currently being used for the online call . a user is typically presented with a range of options , including terminating the computer call in favor of receiving the incoming voice call on a telephone set . the &# 39 ; 587 patent is hereby incorporated by reference in the present application as if set forth in its entirety herein . the present detailed description will now treat extensions and enhancements of prior voice chat arrangements described above . in one aspect , we describe modification to the network of fig1 as presented above , and further describe alternative modes of operation of such a modified network . the term “ voice - over - ip ” ( voip ) has come to reflect a variety of network elements , techniques and technologies , all contributing , in one way or another , to the transmission of a voice call in accordance with the internet protocol ( ip ) over at least a part of its path between one or more voice callers and one or more other voice call participants . thus , a voice telephone call in digital form is segmented in well - known ways into packets for transmission in the same form as for other ip sessions , such as for text information over computer connections to chat rooms . these voice information packets may be routed to a voice chat server , which often operates in a “ layer ” above the normal text chat — as noted above . in other cases , voice packets may be delivered to a voip “ gateway ” where , after suitable authentication and collection of billing or account data , they are delivered through the internet or other ip network for ultimate delivery to one or more call participants . vop gateways and associated network elements are available from many suppliers . for example , efusion , inc ., lucent technologies , inc and vocaltec communications market such voip gateways and related products to enable interconnections between the public switched telephone network and data networks ( including the internet ). the internet engineering task force ( ietf ), the inow industry consortium and other standards bodies are considering various proposals for enabling internet telephony applications . other aspects of voip are described , e . g ., in delivering voice over ip networks , by d . minoli and e . minoli , john wiley & amp ; sons , 1998 . in an illustrative application of voip arising from text chat sessions , an efusion ip telephony gateway is used to interact with internet - enabled client software ( including , e . g ., internet call assistant — ica — software ) at a host computer , such as user computer 105 - 1 in fig1 . the voip client software at user computer 105 - 1 is typically provided as a plug - in to the browser software otherwise operating at that computer when online . this client voip software will illustratively provide for a login at the exemplary efusion voip gateway , e . g ., 192 in fig1 , each time the user at computer 105 - 1 gains access to the internet through illustrative isp 191 in fig1 . among other things , the voip login ( which typically is effected automatically by the plug - in software , without overt action by the user ) provides gateway 192 with information that user 105 - 1 is online to the internet and can receive incoming ip packets from the gateway when required . for present illustrative purposes , it suffices to treat text chat sessions as existing between chat clients at user computers such as 105 - 1 and 182 - 1 through respective isp access servers such as 191 and 196 to a chat server 193 in fig1 . as will be understood by those skilled in the art , the actual chat server function may be provided at the isp access server ( or networked in a distributed isp network to a related isp chat server ), or by another entity providing the chat function on the internet . also included in the network of fig1 is a call broker 199 of the type described generally in the above - cited incorporated desimone patent application . in particular , call broker 199 receives requests from a first internet user ( hereinafter the “ host ”) and , after performing authentication and account operations , provides the above described session and pac code information to the host . upon appropriate further access by those possessing session and pac information ( hereinafter , the “ participants ”), and upon receipt of callback numbers for the participants , call broker 199 seeks to complete telephone calls to those participants at their respective callback numbers . alternative modes of operation of such a call broker in the context of the network of fig1 will be described in the sequel . an additional network element shown in fig1 is network adjunct processor 133 interposed between pstn elements ( stp 145 , toll switch 198 ) and call broker 199 . nap 133 advantageously provides bridging of calls setup by call broker 199 and typically acts in response to control signals from call broker 199 . more particularly , as shown in fig2 , call broker 199 receives requests over input 201 to set up calls from users participating in chat rooms and elsewhere in internet or other data network sessions . call broker processor 205 , operating under control of a program stored in memory 210 , and responding to input requests through internet protocol ( ip ) interface 225 , sends queries ( typically over ss7 signaling links 216 , via ss7 facilities unit 215 ) to a validation server such as card server platform 126 in fig1 . in some embodiments , it proves useful to provide for local account validation at call broker 199 . thus , call broker 199 is shown in fig2 as including a validation database 218 for interacting with processor 205 in accordance with well known validation processes . signaling information exchanged ( via ss7 links 216 or otherwise ) will typically be employed to perform call rating and billing operations , as is known in the art . other particular account validation , and particular call rating and billing arrangements , will be employed by those skilled in the art as circumstances may suggest . upon receipt of authorization from validation server 126 ( or other validation source ), call broker 199 sets up voice links as will be described below . network adjunct processor ( nap ) 133 receives control information on path 230 from the call setup facilities of call broker 199 and hands off originations from call broker 199 to the pstn . these call originations from call broker 199 pass through nap 133 , illustratively via voice trunks 240 and 270 . also shown passing by way of nap 133 are ss7 links 263 to the pstn , which links are used by call setup unit 220 and processor 205 in call broker 215 in establishing connections to the parties to a desired voice call . in particular , answer signaling information indicating that a called party answers a voice call setup by call broker 199 is used to pass control information over path 230 to bridge processor 260 in nap 133 as shown in fig2 . when calls to two or more parties to a desired voice call have answered the calls setup by call broker 199 ( and therefore are available for bridging ), nap provides the selective bridging of calls passing from call broker 199 to the pstn . as shown in fig2 , nap 133 includes bridge 250 . in performing its interaction with call broker 199 , nap advantageously performs such network functions as collecting dtmf digits , playing tones and prompts and selectively muting a call leg . thus , using the facilities of fig1 and 2 voice calls are completed between users present in a text chat room while preserving host and other participant anonymity . call broker 199 may be implemented as a special purpose platform or may be realized as a well - known pbx with standard ss7 and ip interface facilities . many so - called unpbx systems , or generally programmable switches , will likewise find application in this context . for a description of such unpbx systems , reference may be had to computer telephony , may , 1997 , pp . 20 - 97 . nap 133 may likewise be implemented using a special purpose bridging platform , or using well known pbx ( or unpbx ) or other programmable switches . while call broker 199 and nap 133 may provide separate functionality in separate physical systems , it will prove advantageous in many applications to combine the data , signaling and pstn interfaces and the described switching and call control functionality in a single unit with combined or coordinated processing and memory . call setup and bridging functions are individually well known and are readily combined in a single unit such as a pbx or unpbx . fig3 is a flow - sequence diagram illustrating operations at and between elements of the network of fig1 in processing voice calls in cooperation with ongoing ( text ) chat operations . for purposes of simplicity of presentation , a description of the operations shown in fig3 will proceed primarily in terms of voice calling between a first ( originating ) user (“ the host ”) and a second network user , the “ participant .” this mode of operation is conveniently referred to as a one - to - one voice call . it will be recognized , however , that the operations to be described can be applied in a context of plural participants , i . e ., a one - to - many voice call scenario , or voice chat “ conference call . pstn 300 is used in fig3 to represent the telephone network switches , including central offices , stps and standard telephone network platforms such as calling card scp 126 . network adjunct processor 133 and call broker 199 are platforms of the type shown in fig2 for performing the functions and steps to be described in the following elaboration of processing in accordance with fig3 . a typical operating sequence in accordance with fig3 will now be followed in order of the numbered steps shown there . in particular , an illustrative sequence begins ( step 0 ) with host computer 105 - 1 logging onto the voip gateway 192 , using , e . g ., the above - noted efusion voip functionality in host computer 105 - 1 cooperating with gateway 192 ( or 197 ). since this log - on process typically occurs each time the user logs onto the internet , it is accompanied by the busying of the available subscriber phone line . this log - in process between illustrative computer 105 - 1 and voip system 192 typically includes an exchange of messages whereby the computer 105 - 1 sends a login id / password and its current ip address ; gateway 192 compares the login id / password to previously - provisioned information stored in tables at gateway 192 and returns a confirmation message if the comparison yields a match . with log - on to the voip gateway established , an existing ( or a newly entered ) text chat illustratively gives rise to a desire on the part of the host user to establish a voice telephone call with one ( or more ) participants . toward this end , the host 105 - i sends a request ( step 1 ) to the call broker 199 seeking to create a voice call by way of the chat session , and including billing or account information — typically calling card ( or pre - paid card ) account and pin information . assuming the call is to be billed to a calling card for which the host is an authorized user , the calling card information is compared with existing account information ( step 1 a ) to validate the card information . in some cases it will prove convenient to provide validation services locally with respect to the call broker , and in other circumstances use of a network database such as calling card validation server ( scp ) 126 shown in fig1 . when call broker 199 receives validation of the account information ( e . g ., from scp 126 or from local data base 126 ), the call broker ( step 2 ) returns session id information to the host 105 - 1 . using the construct of the incorporated desimone patent application , the information returned to host 105 - 1 will include not only a session id but also a pac code . the host 105 - 1 passes ( step 3 ) the session id and other necessary information ( e . g ., pac code , where applicable ) to the desired voice call participant ( illustratively , the user at computer 182 - 1 ). such notification will typically be by way of a private message ( e . g ., a direct message in the text chat session ) to the desired participant . a notified text chat participant receiving the voice call session information from the host and desiring to participate in the voice call then sends ( step 3 a ) the session id ( and pac , as appropriate ) to the call broker 199 along with a callback number . the call broker then places a call to the host at the assigned voip gateway number supplied by the host at step 1 ; the call is processed through the nap ( step 4 b ) and is sent through the pstn 300 to the illustrative voip gateway 192 associated with computer 105 - 1 ( step 4 c ). identification of the ip address of the host ( illustratively 105 - 1 ) by call broker 199 is conveniently accomplished by using the callback number provided by the host when contacting the call broker . thus , as part of the service subscription by users such as the user at computer 105 - 1 , a callback number is provided to vop gateway 192 which is conveniently used as a key into account records for the subscribing user . the callback number supplied by the host upon requesting the current voice call session from call broker 199 is then used to identify the online status of the destination voip link , as well as the corresponding ip address . the voip gateway 192 then rings the internet telephone at the host computer ( step 5 a ) and , upon answer by the internet telephone ( step 5 b ), answers the call from call broker 199 by way of pstn 300 and nap 133 ( step 6 ). having the call connected from the host , the call broker then dials the participant ( step 7 ) at the callback number provided by the participant . unlike the call placed by the call broker to the host ( step 4 ), the call to the participant is advantageously placed over the pstn ( by way of the nap ) directly to the participant &# 39 ; s telephone , here assumedly telephone 181 - 1 . when the participant answers ( step 8 ) at telephone 181 - 1 the call is extended through the pstn to the nap . upon receipt of the answer by both the host and the participant , the nap advantageously bridges the call . it will be appreciated that the use of voip gateway in communication with host 105 - 1 avoids the need for two subscriber lines at the host location . when one of the host or participant terminates the call , the termination is signaled to the nap , which then terminates the bridge and sends accounting information to the call broker , if not already present at the latter . if more than one participant has been bridged on to a voice call using the above - described steps , then departure of each participant will be detected at the nap and accumulating billing concluded for the departing participant &# 39 ; s voice link . the accumulated total for each link will then be added to the total billing for the host . in some cases , all voice call links ( and billing for these links ) will be terminated upon departure of the host from the bridged call . while the foregoing description has proceeded in terms of a voice call including a voip call link to the host , and a normal pstn link to one or more participants , nothing in the present invention prevents a participant other than the host from being linked to the voice conversation over a voip link , nor for the host to be connected to the voice call via the pstn instead of one or more other participants . in appropriate cases , both the host and all participants can be connected over voip links using the above - described process . the call broker can advantageously incorporate call setup optimization techniques , based , e . g ., on the location of the callback numbers and congestion and available bandwidth for voip calls to determine which links progress over the pstn and which links employ voip processing . a second subscriber line at participants &# 39 ; locations can also be avoided in accordance with another illustrative embodiment of the present invention . this approach may be used , for example , when a call is placed by call broker 199 through nap 310 to a would - be participant in a voice call ( as described above ), and that user has no available subscriber line . this unavailability will typically occur because a subscriber line at that location continues to be used for a text chat session or other data application using computer 182 - 1 . recall that in seeking to participate in the voice call the user at computer 182 - 1 supplies call broker 199 with a callback number . thus , by providing the number of the line that the computer 182 - 1 is connected to , the would - be participant is seeking to have the voice call completed through computer 182 - 1 , if at all , in the same fashion as was described for the host . in accordance with the present alternative embodiment , the attempted call by nap 310 illustratively employs the call notification technique of u . s . pat . no . 5 , 805 , 587 ( hereinafter &# 39 ; 587 patent ). in particular , the attempted call to the subscriber line that is busy with a data connection by computer 182 - 1 through its isp access server 196 is advantageously forwarded in accordance with the teachings of the &# 39 ; 587 patent to the isp access server 196 ( sometimes referred to as internet access server or ias ). using the incorporated teachings of the &# 39 ; 587 patent , a message is sent to the computer 182 - 1 by the isp access server informing the user at computer 182 - 1 of the arrival of a voice message and presenting a number of alternatives for handling the call . ( in many cases it will be unnecessary to present a full range of alternatives because the user at computer 182 - 1 has very recently indicated an interest in taking part in a voice call .) in the general case , one alternative is to continue to use the computer for the text chat or other data connections and to also receive the voice call as converted to streaming audio or an internet voice call . an illustrative arrangement given in the &# 39 ; 587 patent describes the use of vocaltec software for performing the required packetizing , depacketizing and related functions used in communicating the voice call to a computer such as 182 - 1 in fig1 . while the above - described embodiments are couched in terms of ip protocol messages and the internet , those skilled in the art will recognize that other particular data communications protocols may be used for communicating digitized voice signals . likewise , the characteristics of the internet and other networks continue to evolve . chat techniques are not uniquely associated with the internet , nor the ip protocol . while many of the aspects of the pstn described above involve use of the ss7 signaling protocol , other particular signaling techniques may be used in appropriate circumstances . for example , the well - known isdn signaling protocols can be used for many applications of the present invention . the functionalities of the nap described in illustrative embodiments above may , of course , be combined with those of the call broker , or one may be used as an adjunct to the other or to another network element , such as a pbx or pstn switch . while validation of host charging information was couched in terms of calling card processing in the above descriptions of illustrative embodiments , it will be understood by those skilled in the art that prepaid calling card account identification and pin validation may be employed as well . likewise , the online status of a desired voice call participant , and therefore the availability of at least one subscriber line to receive a pstn voice call , as well as the current ip address of such an online would - be voice call participant , may be maintained in a network database system represented by isp scp 125 in fig1 . scp 125 is seen to include isp database 129 and isp service processor 131 , each generally of the form used for other pstn network services . additional information stored at scp 125 will include , in appropriate cases , alternative subscriber lines , ip addresses or other termination possibilities , such as voice message recording devices , call forwarding locations and the like . the isp scp 125 may serve more than one isp , but typically relies on login and logoff information supplied by participating isps over ss7 links ( shown in fig1 ) or ip or other data messages ( not shown ). information stored in isp scp 125 may be used to supplement information stored at call broker 199 or voip gateways 192 , 197 or at other internet nodes . though only a single call broker 199 is shown in the representative network of fig1 , it should be understood that many such call brokers can be included . moreover , these plural call brokers may be networked and may serve as proxies for other call brokers as is known in standard internet practice . in networks including plural call brokers session information forwarded to desired voice call participants will include information identifying the appropriate call broker ( s ). though the voice call links established by call broker 199 in the above - described illustrative embodiments were all links to existing text chat participants , in appropriate circumstances the host ( or other authorizing participant ) may request that call broker set up links to other voice call participants . in such cases , call broker 199 may cause voice links to be established to one or more non - chat - participant lines , either through pstn links or through voip links .
| 7Electricity
|
fig1 shows a flow chart of a display method for a vehicle . in a step 101 , a vehicle position is determined . according to a step 103 , vehicle surroundings data are then retrieved from a database corresponding to the determined vehicle position . this therefore means in particular that a corresponding request is posed or transmitted to the database , whereupon it transmits or makes available the corresponding vehicle surroundings data . according to a step 105 , the vehicle surroundings are furthermore detected . in particular , detecting the vehicle surroundings includes recording video images or video data streams of the vehicle surroundings . in a step 107 , a vehicle surroundings view is then displayed which is based on the retrieved vehicle surroundings data and the detected vehicle surroundings . this therefore means in particular that the displayed vehicle surroundings view includes both a view corresponding to the detected vehicle surroundings and a vehicle surroundings view corresponding to the vehicle surroundings data . fig2 shows a display system 201 for a vehicle ( not shown ). display system 201 includes a position determination device 203 for determining a vehicle position . furthermore , a retriever 205 is provided which is able to retrieve vehicle surroundings data from a database corresponding to the determined vehicle position . this therefore means in particular that retriever 205 poses a corresponding request to the database , whereupon the database transmits the corresponding vehicle surroundings data to retriever 205 . display system 201 furthermore includes a detection device 207 for detecting the vehicle surroundings . the detection device in particular includes one or multiple video cameras . furthermore , a display device 209 is provided which may display a vehicle surroundings view which is based on the retrieved vehicle surroundings data and the detected vehicle surroundings . due to the fact that in addition to a view corresponding to the detected vehicle surroundings , a view corresponding to the vehicle surroundings data from the database is displayed , it is possible to provide the driver with a precise and reliable vehicle surroundings view , even if the detection device is not able to completely detect the vehicle surroundings or if the detection device malfunctions . this means , for example , that the video camera of the detection device may fail , for example , but the driver may still be provided with a vehicle surroundings view . fig3 shows another display system 301 which is essentially designed similarly to display system 201 in fig2 . detection device 207 of display system 301 according to fig3 also includes a video camera 303 which may record a video of the vehicle surroundings . multiple video cameras may preferably also be provided . fig4 shows a driver assistance system 401 for a vehicle including a display system 403 . display system 403 may , for example , be display system 201 or 301 according to fig2 or fig3 , respectively . this therefore means in particular that the corresponding data , such as the display data , may be made available to driver assistance system 401 , so that driver assistance system 401 may be operated or controlled as a function of these data . this therefore means in particular that the video data of a video camera may , for example , be made available to driver assistance system 401 , so that it makes a decision based on these video data as to whether it carries out an intervention into a drive system , a braking system and / or a steering system . fig5 shows a vehicle 501 including a display system 201 according to fig2 . in another specific embodiment ( not shown ), it may be provided that vehicle 501 may also include display system 301 or driver assistance system 401 according to fig3 or fig4 , respectively . moreover , an external database 503 is provided . this therefore means in particular that external database 503 is situated outside of vehicle 501 . retriever 205 poses a corresponding request to external database 503 , in which the vehicle surroundings data are stored , with regard to the vehicle surroundings data at the vehicle position determined with the aid of position determination device 203 . the requested vehicle surroundings data are then transmitted from external database 503 to retriever 205 . moreover , another vehicle 505 is also provided which may in particular detect its corresponding vehicle surroundings , the corresponding other vehicle surroundings data then being transmitted also to display system 201 , so that the other vehicle surroundings of other vehicle 505 may also be displayed with the aid of display device 209 . it may be preferably provided that the display data corresponding to the displayed vehicle surroundings view may be made available to external database 503 and / or other vehicle 505 . other vehicles may preferably also be provided , a corresponding communication between the individual vehicles taking place in a similar manner . fig6 shows a vehicle surroundings view 601 as it may be displayed , for example , with the aid of display device 209 . a vehicle 603 is schematically centrally illustrated . a vehicle surroundings area around vehicle 603 is identified in this case with the aid of a circle having reference numeral 605 . vehicle surroundings area 605 may preferably also be identified with the aid of different geometric shapes , e . g ., with the aid of a square or a triangle . vehicle surroundings area 605 has multiple subareas 607 , 609 , 611 , and 613 . subarea 607 shows , for example , a corresponding partial view of the vehicle surroundings which is based on the sensors of a video camera of vehicle 603 . subarea 609 shows , for example , a corresponding partial view of the vehicle surroundings which is based on the sensors of a video camera of another vehicle which is not shown here . subarea 611 shows , for example , a corresponding partial view of the vehicle surroundings which is based on the sensors of a video camera of an infrastructure . subarea 613 shows , for example , a corresponding virtual partial view of the vehicle surroundings which is based on the data of a digital map of a navigation system . thus , a vehicle surroundings view may be preferably composed of multiple partial views , each of which is based on data from different sensors , in particular radar sensors and / or ultrasonic sensors and / or lidar sensors , or from systems such as a navigation system and / or a driver assistance system . preferably , one or multiple subarea ( s ) may also be provided for which there is no data available for a corresponding partial view . such subareas are then in particular identified as such , in particular with the aid of white , black , or differently colored spots .
| 6Physics
|
a many core system is a term used herein to refer to a system such as that depicted in fig1 . as in the figure , a many core system may include a plurality of processor cores such as cores 150 and 180 . the term core as used herein may refer , for example , to a single processor of a multiprocessor system , or to a processor core of a multicore processor . in general , the system has a set of busses such as the bus 160 that interconnects the cores and a memory 165 with devices on the bus such as a trusted platform module ( tpm ) 155 , a network interface 190 , and other devices 162 . these devices may include for example , storage , input and output devices . as shown in the system depicted , the cores may form the basis of several logical machines presenting an abstraction of processor and memory , such as logical machines 1 - 3 , at 105 , 115 , and 120 . each logical machine provides a logical view of a processor 130 and memory 135 to programs executing on the logical machine . in some instances such as with logical machine 1 at 105 , a core such as the core 150 and a segment of the system memory 170 may be directly mapped 140 to the logical machine 105 much as in a single processor system . in other instances , logical machines may actually be virtual machines such as the machines 115 and 120 , that may in turn execute via a virtual machine monitor ( vmm ) that itself executes directly on a core such as the core at 180 . the vmm may then partition the memory available to its core 180 into segments 175 and 185 allocated to the virtual logical machines 115 and 120 respectively . general purpose logical machines of a many core system such as 105 , 115 and 120 may also be referred to as ( logical ) address spaces of the system , because each logical machine defines an address space within which a logical memory and a register set of a processor may be referenced . special purpose logical machines may also be provided , for example the trusted platform module ( tpm ) of the many core system 125 may be provided as a logical tpm by directly mapping 145 a hardware tpm 155 . similarly , other devices including i / o devices , may be provided as logical devices . in other instances , services associated with a tpm may be provided as a logical machine supported in hardware by a general purpose core . a many core system may connect to a network with a network interface device 190 such as a wireless network adapter or a wired network adapter as is known . in many cases , the logical machines of the system may map their internal logical representations of the adapter to the same network interface 190 . thus , when a many core system such as the one depicted in fig1 connects to a network , the interface 190 is shared by multiple logical machines . as should be evident to the artisan , a practically unlimited set of variations of the many core system depicted in the figure is possible . in particular , the number of cores , and the mapping from cores to logical machines may be varied ; in some embodiment systems , there may be no virtual machines present , while in others all the logical machines may be virtual . a tpm may not be present in some systems , while multiple tpms may be provided in others . a system may participate in multiple networks with multiple network interfaces in some embodiments . many other variations are possible . in fig2 , an embodiment in which a many core system 200 is connected to a network with network access control ( nac ) is depicted . the system 200 may include several logical machines or logical address spaces as explained previously . in this example , the system includes logical machines that are trusted platform modules ( tpms ) which may serve as roots of trust for storage and reporting ( rts - rtr ), 255 and 265 , a machine for system management ( 235 ), and other machines 275 and 280 . as before , these machines may themselves be implemented directly on hardware cores of system 200 , or as virtual machines that run on a virtual machine monitor . in some embodiments a dedicated machine , packet redirector 210 may be used to redirect data packets within the system at the data link level . internal data links 245 such as data channel 1 , data channel 2 , and data channel 3 interconnect the logical machines of the system internally . the depicted system connects to a network using an interface 215 over a physical channel which may be a wired , optical , radio frequency or other datalink as is known in the art . the policy enforcement point ( pep ) 220 is the entry point of the network and enforces network access control policy as determined by the pdp 225 such as a radius server . the pep routes the connection request in this embodiment to the pdp , which may provision a data channel between system 200 and the network . the pdp in this embodiment may also provide a context for each of the logical machines of the system to interact with the network on a logical data channel with its own identity and security credentials . in order to provision this data channel and the logical channels to the logical machines of system 200 , in this embodiment , an internal process such as random selection is used within the system 200 to select one of the logical machines of the system 205 to act as a host machine . the host machine does not have to be a trusted processor either from the point of view of the pdp or from the point of view of the other machines of the system , but serves as a relaying intermediary between the network and the system 200 . once a host machine is selected , a negotiation between the logical machines of system 200 and the pdp sets up logical control channels such as 290 and 295 to provision the logical data channels between the network and the logical machines of the system . the host machine has the added responsibility of preventing man - in - the - middle redirection of messages provided by the other machines and tunneled through the host &# 39 ; s connection . at least one technique for preventing such redirection is to generate a hash of all the messages provided by the other cores in a hash that is then used to establish session keys for the host tunnel . protection of the “ inner ” logical machines from host tampering may be performed by each machine negotiating session keys directly with the pdp . the session keys may be used to protect provisioning messages from tampering by the untrusted host machine . once the pdp is sufficiently satisfied regarding authentication / status of the inner machines and host machine , the host generates a pre - master key ( pmk ) derived from the hash of “ inner ” messages as described above and supplies it to the network interface ( nic ) where session keys for the data channel may be generated ( e . g . using a 4 - way key exchange or similar protocol ). along with the “ inner ” method material , the pmk key derivation may also include the identity of the many core system . once the pmk key ( and , other keys , including for example , session keys ) are derived , they will be securely stored in a tpm which is accessible to all machines of the many core system . each machine presents appropriate credentials to retrieve , update , and delete these session keys and other security associations . fig3 represents the flow of processing in one embodiment when a many core system boots and connects to a nac network . at boot , the system internally determines a machine to serve as host and a machine to serve as packet redirector , 310 . in one embodiment , the host machine may be selected at random . the machine selected to serve as host opens an encrypted nac session with the pdp of the network , using the pmk and receiving a nonce from the pdp that will be used for the rest of the session , 315 . the host then notifies all the remaining machines in the many core system that a nac session is pending , and forwards the nonce from the pdp to each machine , 320 . each machine then prepares a posture report which indicates its status for a pdp determination of its access privileges . this report is signed by a tpm for the machine and a measurement of the report may be stored in the tpm . the machine also generates its own nonce at 330 . the signed reports and both the pdp and machine nonces from the machines are then relayed to the pdp by the host at 335 . on receiving each report and nonces , the pdp authenticates it at 340 . details of the authentication process are depicted in block 340 a . as depicted in block 340 a , to authenticate a machine from the many core system , the pdp first verifies its own nonce returned with the report at 355 . it then checks that the report signature is valid at 360 . finally , it determines if the machine &# 39 ; s posture is acceptable , at 370 . if all three of these conditions are met , the pdp authenticates that machine , otherwise , authentication fails . after authentication is complete , at 345 , the pdp assigns each machine a trust level and a privilege using a session key for encryption . the final assignment is then forwarded to the packet redirector and policy enforcement point ( pep ) for enforcement . once the signature and nonce with the assignment are validated , 385 , each machine may operate according to its assigned privilege and trust level , 395 . if validation fails at this stage for a machine , the pep and packet redirector operate according to default privilege assignments for an unprivileged machine , 380 . as should be understood by one in the art , the above embodiment represents only one processing flow by which a many core system may be authenticated to a nac network . in some embodiments , not all machines in the many core network may need network access . in others , some of the processing steps may be omitted ; and others added , for example , all machines in the many core system may use a single posture . the various names and acronyms used are for ease of exposition , in general many other terms may be used . for example , a pdp may be referred to as an ras - aaa server ; a pep may be termed a gateway or firewall , and similarly each machine in the many core system may have a specific term . as before , the machines may themselves be physically segregated cores and address spaces or may be virtual machines . not all embodiments may have virtual machines or multicore processors . many other variations are possible . the packet redirector in some embodiments may also be responsible for directing packets between the different logical machines of the many core system . in some embodiments , an a - priori set of filtering rules may control the operation of the packet redirector ; in others , the packet redirector may be configured by the pdp . in a stand alone mode , a many core system may also in some instances serve as a multi - layer secure system with the packet redirector serving as a security kernel for cores operating at different privileges or trust levels . in the preceding description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the described embodiments , however , one skilled in the art will appreciate that many other embodiments may be practiced without these specific details . some portions of the detailed description above are presented in terms of algorithms and symbolic representations of operations on data bits within a processor - based system . these algorithmic descriptions and representations are the means used by those skilled in the art to most effectively convey the substance of their work to others in the art . the operations are those requiring physical manipulations of physical quantities . these quantities may take the form of electrical , magnetic , optical or other physical signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the description , terms such as “ executing ” or “ processing ” or “ computing ” or “ calculating ” or “ determining ” or the like , may refer to the action and processes of a processor - based system , or similar electronic computing device , that manipulates and transforms data represented as physical quantities within the processor - based system &# 39 ; s storage into other data similarly represented or other such information storage , transmission or display devices . in the description of the embodiments , reference may be made to accompanying drawings . in the drawings , like numerals describe substantially similar components throughout the several views . other embodiments may be utilized and structural , logical , and electrical changes may be made . moreover , it is to be understood that the various embodiments , although different , are not necessarily mutually exclusive . for example , a particular feature , structure , or characteristic described in one embodiment may be included within other embodiments . further , a design of an embodiment that is implemented in a processor may go through various stages , from creation to simulation to fabrication . data representing a design may represent the design in a number of manners . first , as is useful in simulations , the hardware may be represented using a hardware description language or another functional description language . additionally , a circuit level model with logic and / or transistor gates may be produced at some stages of the design process . furthermore , most designs , at some stage , reach a level of data representing the physical placement of various devices in the hardware model . in the case where conventional semiconductor fabrication techniques are used , data representing a hardware model may be the data specifying the presence or absence of various features on different mask layers for masks used to produce the integrated circuit . in any representation of the design , the data may be stored in any form of a machine - readable medium . an optical or electrical wave modulated or otherwise generated to transmit such information , a memory , or a magnetic or optical storage such as a disc may be the machine readable medium . any of these mediums may “ carry ” or “ indicate ” the design or software information . when an electrical carrier wave indicating or carrying the code or design is transmitted , to the extent that copying , buffering , or re - transmission of the electrical signal is performed , a new copy is made . thus , a communication provider or a network provider may make copies of an article ( a carrier wave ) that constitute or represent an embodiment . embodiments may be provided as a program product that may include a machine - readable medium having stored thereon data which when accessed by a machine may cause the machine to perform a process according to the claimed subject matter . the machine - readable medium may include , but is not limited to , floppy diskettes , optical disks , dvd - rom disks , dvd - ram disks , dvd - rw disks , dvd + rw disks , cd - r disks , cd - rw disks , cd - rom disks , and magneto - optical disks , roms , rams , eproms , eeproms , magnet or optical cards , flash memory , or other type of media / machine - readable medium suitable for storing electronic instructions . moreover , embodiments may also be downloaded as a program product , wherein the program may be transferred from a remote data source to a requesting device by way of data signals embodied in a carrier wave or other propagation medium via a communication link ( e . g ., a modem or network connection ). many of the methods are described in their most basic form but steps can be added to or deleted from any of the methods and information can be added or subtracted from any of the described messages without departing from the basic scope of the claimed subject matter . it will be apparent to those skilled in the art that many further modifications and adaptations can be made . the particular embodiments are not provided to limit the claimed subject matter but to illustrate it . the scope of the claimed subject matter is not to be determined by the specific examples provided above but only by the claims below .
| 7Electricity
|
it should be understood at the outset that although an exemplary implementation of one embodiment of the present disclosure is illustrated below , the present system may be implemented using any number of techniques , whether currently known or in existence . the present disclosure should in no way be limited to the exemplary implementations , drawings , and techniques illustrated below , including the exemplary design and implementation illustrated and described herein . the preferred embodiments of the present invention disclose a method and related system for customizing a report summarizing the status of a plurality of business process objects ( hereinafter , “ orders ”) within a business workflow . the preferred embodiments enable a user to quickly customize the report by editing data in data store tables , thereby changing how data is summarized for the report . order processing is generally coordinated between several systems by a central workflow manager . generally , a central workflow manager acts as a central clearinghouse to coordinate messages between numerous individual systems . the workflow manager is linked with each system by one or more “ channels ,” which are communications pathways for delivering queued event - based messages between the workflow manager and each system , as well as between different processes within the workflow manager . typically , the workflow manager places an event into a channel , where the event remains until it is retrieved by the target system . the event may have an expiration period , so that it is not enacted if it is not retrieved before a deadline , or may alternately be a guaranteed delivery event , which does not expire . after retrieving and acting on an event , a system may insert another event designated for the workflow manager into a return channel . once the event is retrieved by the workflow manager , the workflow manager may recognize that a certain task has been performed . the workflow manager then addresses the next task in the workflow by placing a subsequent event designated for the next targeted system . events may pass to or from the workflow manager , depending on the system for which they are targeted . essentially , the workflow manager follows a set procedure for notifying various systems of tasks to be performed , receiving confirmation that the events reached their destinations , and following up with subsequent tasks . the workflow manager may process hundreds of thousands of orders per month , each order being sequenced through possibly hundreds of distinct tasks , stages , or states . turning now to fig1 , a block diagram of a system 10 suitable for implementing the present embodiments is depicted . a workflow manager 12 includes one or more servers that receive and send out event - based messages or “ events ,” to communicate between internal processes and a multitude of linked systems . events are associated with transitions of a customer order from one workflow state to another , marking the progress of the order through the workflow . in the setup shown in fig1 , a task such as entering a new order may be performed by a first system 14 . an event may then be placed into a first channel 16 on the workflow manager 12 . the event may remain in the first channel 16 for a period of time until it is retrieved by the workflow manager 12 or it expires . the workflow manager 12 is also in communication with a second system 18 using a second channel 20 and with a third system 22 using a third channel 22 . it will be understood that arrows 16 , 20 , and 24 represent channels and not necessarily physical connections . in the preferred embodiment , the workflow manager 12 is a vitria workflow manager . the workflow manager 12 , the first system 14 , the second system 18 , and the third system 22 each may execute on a general purpose computer system . general purpose computer systems will be discussed in greater detail hereinafter . the event in the channel 16 is typically retrieved by the workflow manager 12 , which then recognizes that a certain task has been performed and that a subsequent action ( e . g ., product shipping ) needs to be taken . assuming that the second system 18 handles tasks associated with product shipping , an event might be placed into channel 20 , where it is retrieved by the second system 18 . this event may trigger an action at the second system 18 , such as a product shipping procedure . the second system 18 may then recognize that it must confirm completion of this action in order for the next step in the workflow to take place , and consequently places a subsequent event , such as “ shipped today ,” into the second channel 20 . once retrieved by the workflow manager 12 , a follow - up event , such as “ order completed ,” may then be placed into the third channel 24 by the workflow manager 12 . the third system 22 may then retrieve the follow - up event and perform an associated task ( e . g ., billing ). as the workflow manager 12 processes events and manages tasks it deposits order state information into a tracking data store 26 . the data in the tracking data store 26 tracks the state and condition of the numerous orders in the system 10 in real - time or near real - time in the present embodiment . a reporting data store 28 is in communication with the tracking data store 26 . the reporting data store 28 is periodically refreshed with copies of the information on the orders and stores this information indefinitely . the reporting data store 28 supports analyzing order histories , analyzing processing trends , and generating reports based on the state information deposited into the reporting data store 28 . a user interface ( ui ) 30 provides control inputs to the reporting data store 28 to cause reports to be generated . the ui 30 also displays the report information . the reporting data store 28 and the ui 30 collectively form a customizable workflow reporter 32 . in the preferred embodiment , the tracking data store 26 and the reporting data store 28 are mocha data stores . the tracking data store 26 and the reporting data store 28 each may execute on a general purpose computer system . the reporting data store 28 may sync with tracking data store 26 for example every 24 hours . the reporting data store 28 has pusql and other stored procedures which may be initiated or triggered , for example , by tasks such as identifying changed records for orders between the reporting and tracking data stores 28 and 26 , respectively ; deleting all matching records from the reporting data store 28 ; and adding new order milestone information including old orders along with new orders . turning now to fig2 , a block diagram provides internal details of the reporting data store 28 . the data received from the tracking data store 26 is stored in a data warehouse 50 . this data is preprocessed and placed into a plurality of datamarts 52 — a first datamart 52 a , a second datamart 52 b , and a third datamart 52 c . the datamarts 52 contain preprocessed data amenable to retrieval by the user interface 30 for display . preprocessing procedures may form a component of each datamart 52 or may be separate components within the reporting data store 28 . preprocessing procedures may also be components external to the reporting data store 28 and may interwork with the reporting data store 28 to provide preprocessed information to the datamarts 52 . a scenario preprocessor 54 for generating data to the first datamart 52 a is depicted as separate from the first datamart 52 a , but other configurations may be employed in alternate embodiments . the scenario preprocessor 54 , for example , in another embodiment may be a component of the first datamart 52 a . in another embodiment , the scenario preprocessor 54 may be a component external to the reporting data store 28 and may interwork with the reporting data store 28 to provide preprocessed information to the first datamart 52 a . the scenario preprocessor 54 includes a milestone definition data store table ( mddt ) 56 , a scenario definition data store table ( sddt ) 58 , one or more milestone mapping procedures 60 , and a scenario preprocessor user interface ( ui ) 62 . the mddt 56 comprises a plurality of entries , records , or rows each of which contains the definition of a milestone . the milestone is the abstract representation of one or more job states or stages . the milestone may organize a plurality of job states or stages into a unity which is more meaningful to an analyst or operator than the uncollected plurality of job states or stages . the definition or details of the milestone may include a milestone name , a from - state identification , and a to - state identification . the milestone is considered to subsume within it all the consecutive states between the from - state and the to - state as well as the from - state and the to - state . for example , suppose a job comprises 100 consecutively ordered states or stages named state 1 , state 2 , through state 100 . suppose a milestone c has a from - state identification of state 20 and a to - state identification of state 23 . then , the milestone c subsumes within it state 20 , state 21 , state 22 , and state 23 . any job processing instance which is in state 20 , state 21 , state 22 , or state 23 is said to be in the milestone c . turning now to fig3 , an exemplary ordered group of job or business process states 80 is shown comprising state s 1 through state s 1000 . some jobs or business processes , for example an order , may comprise either more or fewer job states than the 1000 depicted here . turning now to fig4 , an exemplary mddt 56 is depicted . the mddt 56 is shown to comprise four entries , records , or rows each of which define a milestone 82 — a first milestone 82 a , a second milestone 82 b , a third milestone 82 c , and a fourth milestone 82 d . the first milestone 82 a comprises states s 1 through s 3 . the second milestone 82 b comprises states s 4 through s 7 . the third milestone 82 c comprises states s 8 through s 11 . the fourth milestone 82 d comprises states s 12 through s 1000 . thus , this exemplary job or business process has 1000 distinct stages or states and may be simplified or abstracted to comprise four milestones . the first milestone 82 a , for example , may be named “ initialization .” the second milestone 82 b , for example , may be named “ processing .” the third milestone 82 c , for example , may be named “ analysis .” the fourth milestone 82 d , for example , may be named “ formatting and output .” the milestones 82 need not be stored in order in the mddt 56 . two different milestones 82 defined in separate entries , records , or rows of the mddt 56 may share the same definition . two milestones 82 defined in separate entries , records , or rows of the mddt 56 may have overlapping definitions . for example , a fifth milestone 82 e may be defined by the entry “ ms 5 , s 5 , s 25 ” and a sixth milestone 82 f may be defined by the entry “ ms 6 , s 9 , s 55 ”, where the ordered triple within quotes correspond to the milestone name , the from - state , and the to - state respectively . in this example , the fifth milestone 82 e overlaps the definition of the second milestone 82 b , the third milestone 82 c , the fourth milestone 82 d , and the sixth milestone 82 f . in this example , the sixth milestone 82 f overlaps the definition of the third milestone 82 c , the fourth milestone 82 d , and the fifth milestone 82 e . the milestones 82 may be redefined simply by changing the mddt 56 , such as by executing structured query language ( sql ) commands , or by other means well known to those skilled in the art , to update the reporting data store 28 . similarly , new milestones 82 may be defined by adding new entries , records , or rows to the mddt 56 , such as by executing sql commands in the reporting data store 28 . returning briefly to fig2 , the sddt 58 comprises a plurality of entries , records , or rows each of which contains a milestone identification , a scenario identification , and a scenario element sequence number . by identifying all of the entries in the sddt 58 which share a common scenario identification , a set of milestones associated with the identified scenario is defined . by ordering these milestones according to the scenario element sequence number , a scenario 92 is defined . the scenario 92 may define a preferred view of the job for displaying a report with the user interface 30 . turning now to fig5 , an exemplary sddt 58 a is depicted . the sddt 58 a comprises nine entries , records , or rows — a first sddt record 90 a , a second sddt record 90 b , a third sddt record 90 c , a fourth sddt record 90 d , a fifth sddt record 90 e , a sixth sddt record 90 f , a seventh sddt record 90 g , an eighth sddt record 90 h , and a ninth sddt record 90 i . the sddt records 90 a , 90 b , 90 c , and 90 d define a first scenario 92 a . note that the order of the milestones 82 which comprise the first scenario 92 a is determined by the sequence number designated in the corresponding sddt records 90 . the sddt records 90 e , 90 f , 90 g , 90 h , and 90 i define a second scenario 92 b . note that the order of the milestones 82 which comprise the second scenario 92 b is determined by the sequence number designated in the corresponding sddt records 90 . note that the second milestone 82 b is a constituent of both the first scenario 92 a and the second scenario 92 b , and hence there are two entries , records , or rows in the sddt 58 a identifying the second milestone 82 b — the second sddt record 90 b and the eighth sddt record 90 h . the scenarios 92 may be redefined simply by changing the sddt 58 a , such as by executing structured query language ( sql ) commands to update the reporting data store 28 . similarly , new scenarios 92 may be defined by adding new entries , records , or rows to the sddt 58 a , such as by executing sql commands , or by other means well known to those skilled in the art , in the reporting data store 28 . referring also to fig3 and fig4 it will be understood by those skilled in the art , that given the ordered set of job states 80 , the mddt 56 and the sddt 58 a can be edited to construct any series scenario 92 providing the full range of abstraction , from highest level to lowest level of abstraction . furthermore , any scenario 92 whose milestones are arranged in sequence , e . g ., in series , can be defined without changing code , by modifying the mddt 56 and the sddt 58 a , for example by executing sql commands in the reporting data store 28 . providing for scenarios 92 which include parallel or concurrent scenario segments is discussed hereinafter . returning briefly to fig2 , the milestone mapping procedure 60 aggregates information on jobs or orders based on the definitions of milestones in the mddt 56 . for example , the milestone mapping procedure 60 may determine the number of orders in state s 1 , state s 2 , and s 3 — the three states comprising the first milestone 82 a — and sum these numbers to represent the number of orders in the first milestone 82 a . the milestone mapping procedure 60 also performs a roll - up of information contained in the several states associated with each milestone on an order - by - order basis . for example , the milestone mapping procedure 60 may determine that an exemplary order was in state s 1 from time t 1 to time t 2 , in state s 2 from time t 2 to time t 3 , and in state s 3 from time t 3 to time t 4 . the roll - up of this information will capture that the exemplary order was in the first milestone ms 1 from time t 1 to time t 4 . the milestone mapping procedure 60 processes or executes on a periodic basis . in the preferred embodiment , the milestone mapping procedure 60 processes or executes once per day , but in another embodiment a different execution period may be defined . in one embodiment it may be possible for the scenario preprocessing ui 62 to invoke an aperiodic execution of the milestone mapping procedure 60 , for example after editing the mddt 56 . the results of the milestone mapping procedure 60 are stored in the first datamart 52 a . any earlier changes to the mddt 56 become visible to the customizable workflow reporter 32 after the milestone mapping procedure 60 executes . turning now to fig6 , an alternate embodiment of the sddt 58 b is depicted . the sddt 58 b may be distinguished from the sddt 58 a by the addition of a sname field 150 . the sname 150 field may be employed to create branching scenario paths , providing for parallel or concurrent scenario segments . the sname 150 field provides for an additional dimension of naming , thereby to provide branching scenario paths . entries in the sddt 58 b having different sname 150 values are associated with different parallel or concurrent scenario segments . the milestones 82 which comprise a parallel or concurrent scenario segment share a common sname 150 value and are ordered relative to one another according to the sequence number . turning to fig7 , a scenario 92 c is depicted that is defined in the exemplary sddt 58 b data table shown in fig6 . ms 10 , ms 11 , ms 13 , and ms 15 are depicted as parallel or concurrent milestones 82 because they share the same sequence number but have different sname 150 values . ms 12 is depicted as serial with ms 11 because it shares the same sname 150 value with ms 11 . ms 12 is depicted as following ms 11 because the sequence number of ms 12 is greater than the sequence number of ms 11 . similarly , ms 14 is depicted as serial with ms 13 because it shares the same sname with ms 13 . ms 14 is depicted as following ms 13 because the sequence number of ms 14 is greater than the sequence number of ms 13 . in this embodiment , the addition of the sname 150 field supports the definition of complex , multi - branch scenarios 92 . as described above , the scenarios 92 may be redefined or new scenarios 92 defined simply by executing sql commands in the reporting data store 28 . turning now to fig8 , a report screen 200 which may display on the ui 30 is shown . the scenario 92 is selected using input box 201 . a milestone selector box 202 permits selection of all milestones 82 which form part of the selected scenario or selection of specific milestones 82 from those which form part of the selected scenario . the selected milestones 82 are displayed , as boxes , according to sname 150 and sequence number as shown in fig6 , in the report frame 204 . each milestone 82 box displays a count of orders which are in the states associated with that milestone 82 by the mddt 56 . for example , five orders are shown to be processing in milestone 82 z , “ sims2complete - processed .” an analyst may quickly determine how processing of the scenario 92 is proceeding by examining the report screen 200 . more importantly , if a particular set of defined scenarios 92 does not provide the view of the order processing needed by an analyst , an additional scenario 92 can be generated by defining appropriate milestones 82 in the mddt 56 and defining the desired scenario 92 in the sddt 58 . drill - down views , for example a view which exposes finer details of order processes , are readily created by first defining milestones 82 which provide the level of fine detail desired and then defining the scenario 92 which sequences these milestones 82 in the desired order and structure . the definition of milestones 82 using the mddt 56 , the processing of the milestones 82 by the milestone mapping procedures 60 , the definition of the scenarios 92 using the sddt 58 , and the report screen 200 , in cooperation with the rest of the system 10 , are operable using the customizable workflow reporter 32 provided by the present disclosure . the customizable workflow reporter 32 is easily modifiable which enables improved workflow analysis . the customizable workflow reporter 32 may be used to identify bottlenecks in a workflow and allocate resources to remove the bottleneck , such as deploy additional server systems to process messages and reduce message queue latency for orders . the system 10 described above may be implemented on any general - purpose computer with sufficient processing power , memory resources , and network throughput capability to handle the necessary workload placed upon it . fig9 illustrates a typical , general - purpose computer system suitable for implementing one or more embodiments disclosed herein . the computer system 380 includes a processor 382 ( which may be referred to as a central processor unit or cpu ) that is in communication with memory devices including secondary storage 384 , read only memory ( rom ) 386 , random access memory ( ram ) 388 , input / output ( i / o ) 390 devices , and network connectivity devices 392 . the processor may be implemented as one or more cpu chips . the secondary storage 384 is typically comprised of one or more disk drives or tape drives and is used for non - volatile storage of data and as an over - flow data storage device if ram 388 is not large enough to hold all working data . secondary storage 384 may be used to store programs which are loaded into ram 388 when such programs are selected for execution . the rom 386 is used to store instructions and perhaps data which are read during program execution . rom 386 is a non - volatile memory device which typically has a small memory capacity relative to the larger memory capacity of secondary storage . the ram 388 is used to store volatile data and perhaps to store instructions . access to both rom 386 and ram 388 is typically faster than to secondary storage 384 . i / o 390 devices may include printers , video monitors , liquid crystal displays ( lcds ), touch screen displays , keyboards , keypads , switches , dials , mice , track balls , voice recognizers , card readers , paper tape readers , or other well - known input devices . the network connectivity devices 392 may take the form of modems , modem banks , ethernet cards , token ring cards , fiber distributed data interface ( fddi ) cards , and other well - known network devices . these network connectivity 392 devices may enable the processor 382 to communicate with an internet or one or more intranets . with such a network connection , it is contemplated that the processor 382 might receive information from the network , or might output information to the network in the course of performing the above - described method steps . such information , which is often represented as a sequence of instructions to be executed using processor 382 , may be received from and outputted to the network , for example , in the form of a computer data signal embodied in a carrier wave . the processor 382 executes instructions , codes , computer programs , scripts which it accesses from hard disk , floppy disk , optical disk ( these various disk based systems may all be considered secondary storage 384 ), rom 386 , ram 388 , or the network connectivity devices 392 . while several embodiments have been provided in the present disclosure , it should be understood that the disclosed systems and methods may be embodied in many other specific forms without departing from the spirit or scope of the present disclosure . the present examples are to be considered as illustrative and not restrictive , and the intention is not to be limited to the details given herein , but may be modified within the scope of the appended claims along with their full scope of equivalents . for example , the various elements or components may be combined or integrated in another system or certain features may be omitted , or not implemented . also , techniques , systems , subsystems and methods described and illustrated in the various embodiments as discreet or separate may be combined or integrated with other systems , modules , techniques , or methods without departing from the scope of the present disclosure . other items shown as directly coupled or communicating with each other may be coupled through some interface or device , such that the items may no longer be considered directly coupled to each but may still be indirectly coupled and in communication with one another . other examples of changes , substitutions , and alterations are ascertainable by one skilled in the art and could be made without departing from the spirit and scope disclosed herein .
| 6Physics
|
fig3 - 5 show a mounting bracket 100 constructed according to one embodiment of the present invention . a mounting bracket 100 according to the present invention can take a variety of shapes . for example , the mounting bracket may be elongated , such as in the manner shown in fig3 - 7 , or it may comprises a broader plate , as is shown in fig8 - 10 . each mounting bracket 100 of the present invention comprises a mounting contact portion 102 and one or more side portions 104 . the side portions 104 , in a particular embodiment of the invention , are substantially perpendicular to the mounting contact portion 102 . in other embodiments , it is also possible for the side portions 104 to be at a non - perpendicular angle to the mounting contact portion 102 . in one embodiment of the invention , the mounting contact portion 102 and the pair of side portions 104 are formed as a single piece of material , such as aluminum or steel . in other embodiments , it is also possible for the contact portion 102 and the side portions 104 to be formed as separate components which are later coupled together . the mounting contact portion 102 includes a plurality of mounting slots 106 formed therein . the mounting slots 106 are used to couple the mounting bracket 100 to a flat panel display ( not shown ) in one embodiment of the invention . alternatively , the mounting slots 106 may be used to couple the mounting bracket 100 to a wall or other surface in a different embodiment of the invention . as shown in fig3 - 4 , the mounting bracket 100 includes an upper hook 108 and a lower guiding portion 110 on each side portion 104 , which together define a receiving region 112 for first and second retaining portions 14 and 16 ( shown in fig6 a and 6b ). it should be noted that the first and second retaining portions 14 and 16 can comprise separate bars , or they can simply constitutes different portions of the same component . the upper hook 108 defines an upper indentation 118 for receiving the first retaining portion 14 . the upper hook 108 is formed on each of the side portions 104 at substantially the same position . each upper hook 108 and / or guiding portion 110 may be formed as one piece with the rest of the mounting bracket 100 or , alternatively , each upper hook 108 and / or guiding portion 110 may comprise a separate component which is coupled to the mounting bracket 100 in the appropriate position . the guiding portion 110 , which is positioned below the upper hook 108 in one embodiment of the invention , includes a longitudinal surface 120 . the longitudinal surface 120 may comprise the same type of material as the rest of the mounting bracket 100 and may be welded to the pair of side portions 104 or fastened in other conventionally - known manners . the guiding portion 110 may also terminate at a slight indentation 111 sized for receiving a retaining portion , as is discussed below . both the upper hook 108 and the guiding portion 110 are spaced apart from each other at a distance such that the first and second retaining portions 14 and 16 of the type shown in fig1 , 2 , 6 ( a ), 6 ( b ) and 7 can fit therebetween . more particularly , when properly mated , the first retaining portion 14 fits snugly within the upper hook 108 , while the second retaining portion 16 rests on the guiding portion 110 . according to one embodiment of the present invention , for each side portion 104 , the upper hook 108 includes one or more upper ramping surfaces 122 on the outside thereof . each upper ramping surface 122 is formed as part of the side portions 104 in one particular embodiment of the invention . in an alternative embodiment of the invention , the upper ramping surface 122 is formed as one or more separate component , which are then coupled to the mounting bracket 100 at a desired location . in the embodiment shown in fig3 - 7 , the upper ramping surface 122 includes a gradual but noticeable curve as it approaches a lower profile , recessed portion 124 of the side portion 104 . however , it should also be noted that each upper ramping surface 122 can possess various levels of curvature , or it could have no curvature at all . similarly and according to one embodiment of the present invention , for each side portion 104 , one or more lower ramping surfaces 126 are positioned immediately below the guiding portion 110 . each lower ramping surface 126 is formed as part of the side portions 104 in one particular embodiment of the invention . in an alternative embodiment of the invention , each upper ramping surface 126 is formed as one or more separate component , which are then coupled to the mounting bracket 100 at a desired location . in the embodiment shown in fig3 - 7 , each lower ramping surface 126 includes a gradual but noticeable curve as it approaches the lower profile , recessed portion 124 of the side portion 104 . however , it should also be noted that each lower ramping surface 126 can possess various levels of curvature , or each lower ramping surface 126 could have no curvature at all . according to the present invention , each upper ramping surface 122 and each lower ramping surface 126 are angled such that , if a mount is incorrectly aligned either the first retaining portion 14 will contact an upper ramping surface 122 or the second retaining portion 16 will contact a lower ramping surface 126 . fig6 ( a ) and 6 ( b ) show two such scenarios where misalignment occurs . in fig6 ( b ), the flat panel display and mounting bracket 100 or brackets are positioned too low relative to the mount . in this scenario , the receiving region 112 accepts the first retaining portion 14 therein . however , as the flat panel television or other device moves toward the mount , the second retaining portion 16 comes into direct contact with the lower ramping surfaces 126 . as a result of this contact , the flat panel television cannot be oriented substantially upright relative to the floor , and the lower ramping surfaces 126 will cause the mounting bracket 100 or brackets ( and the attached flat panel television ) to slide along the lower ramping surface 126 . therefore , the installer is provided with a clear indication that the flat panel television or other device is not correctly positioned for mounting . because the installer &# 39 ; s view of the mount and the mounting bracket 100 or brackets is blocked by the flat panel display , this feature provides the installer with valuable information which otherwise may not be available to him or her . it should be noted that the term “ ramping surface ” as discussed herein should not be interpreted as requiring that the surface in question be angled by any specified amount relative to other components . instead , this term should be understood as only requiring some form of offset that would inform a user of a misalignment as discussed herein . fig6 ( a ) shows the scenario where the flat panel display and mounting bracket 100 or brackets are positioned too high relative to the mount . in this scenario , the receiving region 112 accepts the second retaining portion 16 therein . however , as the flat panel television or other device moves toward the mount , the first retaining portion 14 comes into direct contact with the upper ramping surfaces 122 . as a result of this contact , the flat panel television cannot be oriented substantially upright relative to the floor , and the upper ramping surface 122 will cause the mounting bracket 100 or brackets ( and the attached flat panel television ) to slide along the upper ramping surfaces 122 . therefore , the installer once again is provided with a clear indication that the flat panel television or other device is not correctly positioned for mounting . fig7 is a perspective view of a representative mounting system 200 where two mounting brackets constructed according to the present invention are correctly attached to the first and second retaining portions 14 and 16 . in the mounting system of fig7 , two mounting brackets 100 are used and are configured to cooperatively support a flat panel television or display . however , it is also possible to use fewer or more mounting brackets 100 depending upon the size of the flat panel television being supported . it is additionally possible for the mounting brackets 100 to support devices other than flat panel televisions as necessary or desired . still further , it is also possible for the mounting brackets 100 to be secured to a wall , while the remainder of the mounting system 200 is secured to the back of a device . it is also possible for the mounting bracket 100 or brackets comprise intermediate interface members which do not directly attach to the back of the device . for example , the mounting bracket 100 or brackets can attached to another interface member , which in turn couples direct to the back of a device . in the mounting system 200 of fig7 , the mounting brackets 100 have correctly accepted the first and second retaining portions 14 and 16 . the first and second retaining portions 14 and 16 are operatively connected to each other via a plurality of retaining portion plates 202 . in the embodiment shown in fig7 , two of the retaining portion plates 202 are rotatably connected to a base plate 204 via a plurality of rolling pins 206 . however , it should be noted that other components , such as gliders ( not shown ), may also be used to effectuate this connection . furthermore , it is also possible for this connection to be fixed and not capable of any rotation at all . the base plate 204 can be coupled to a wall mounting plate ( not shown ) for securement to a wall or other mounting surface ( not shown ). alternatively , the base plate 204 can be directly secured to the wall or other mounting surface . fig8 shows a mounting bracket 300 constructed in accordance with a second embodiment of the present invention . the mounting bracket 300 of fig8 is similar to the mounting bracket 100 of fig3 - 7 . however , the mounting bracket 300 of fig8 includes a substantially larger mounting contact portion 102 than that shown in fig3 - 7 . additionally , it should be noted that the upper and lower ramping surfaces 122 and 126 are substantially straight in nature and include no substantial curvature . fig9 shows a mounting bracket 400 constructed in accordance with a third embodiment of the present invention . unlike the embodiments shown in fig3 - 8 , the mounting bracket 400 of fig9 does not include any side portions whatsoever . instead , the upper and lower ramping surfaces 122 and 126 are formed directly out of the top and bottom of the mounting contact portion 102 . it should be noted that the upper and lower ramping surfaces 122 and 126 can also be formed from separate components which are then coupled to the mounting contact portion 102 . fig1 shows a mounting system 500 constructed according to still another embodiment of the present invention . the mounting system 500 of fig1 includes a screen mounting plate 502 that is used to couple a display unit 504 to an interface assembly 506 . the interface assembly 506 includes upper ramps 122 and lower ramps 126 as discussed above , and is also configured to attach to a wall plate 508 which attaches to a wall ( not shown ). in this embodiment , retaining portions 510 are formed from the wall plate 508 . fig1 shows another mounting system 600 comprising a similar embodiment of the present invention . the foregoing description of embodiments of the present invention have been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the present invention to the precise form disclosed , and modifications and variations are possible in light of the above teachings or may be acquired from practice of the present invention . for example , all of the individual items which together make up a mounting bracket 100 may be formed from a single piece of material , or they can be formed as different components which are subsequent coupled to each other using conventional processes . it is also possible for various components to be rotated by ninety degrees , i . e ., so that the side portions 104 are located on the top and bottom of the mounting bracket 100 , for example . the embodiments were chosen and described in order to explain the principles of the present invention and its practical application to enable one skilled in the art to utilize the present invention in various embodiments and with various modifications as are suited to the particular use contemplated .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
the apparatus for transporting a passenger shown in the figures includes a generally rectangular frame 10 defining two side rails 101 , 102 , a front cross member 103 and a rear cross member 104 . the frame includes a rear back rest 105 against which the seated rider reclines . a seat 11 formed for example of fabric sheets applied over the frame tubes is provided on the frame 10 for at least one passenger ; a generally horizontal front axle 12 is connected to the front cross member by a platform 121 fastened to the front rail 103 by a mounting 122 and fixed against side to side and front to rear tilting . the front axle includes a pivot coupling 123 for rotation of the axle relative to the platform 121 about a vertical steering axis . generally symmetrically there is provided a horizontal rear axle 13 which is connected to the rear cross member 104 by a platform 131 fastened to the rear rail 104 by mounting brackets 105 and fixed against side to side and front to rear tilting . the rear axle includes a pivot coupling 133 for rotation of the axle relative to the platform 131 about a vertical steering axis . the platforms provide a downwardly facing surface against which the axle slides as it rotates . two transversely spaced front support members in the form of skis 15 , 16 are attached to the axles 12 , 13 for movement therewith and for supporting the axles for movement across a support surface such as the ground , snow , ice or water . the axles 12 and 13 provide steering movement of the skis 15 , 16 operated by a pair of steering levers 17 , 18 each on a respective side of the frame for operation by the passenger in forward and rearward movement of the steering lever . each lever has a steering link 171 , 181 extending from the lever to the front axle for causing steering movement of the front axle relative to the frame . the levers are mounted at respective sides of the frame and pivotal at the frame about an axis 182 parallel to the axles . a first diagonally extending flexible connecting link or brace 19 extends from a right hand end 125 of the front axle to a left hand end 135 of the rear axle and a second diagonally extending flexible connecting link 20 extends from a left hand end 126 of the front axle to a right hand end 136 of the rear axle so that operation of the levers causes the front skis to turn in one direction while the rear skisturn in the opposite direction . the front axle includes a first single coupling 123 allowing steering movement of the front axle 12 relative to the frame in a wagon steering mode as shown in fig9 and includes two second couplings 127 , 128 allowing individual steering movements of the support members relative to the front axle in a vehicle steering mode as shown in fig8 . symmetrically the rear axle includes a first single coupling 133 allowing steering movement of the rear axle relative to the frame in a wagon steering mode and includes two second couplings 137 , 138 allowing individual steering movements of the support members relative to the rear axle in a vehicle steering mode . each of the skis of the front axle is mounted on a support link 30 , 31 which is connected to the front axle 12 by one of the second couplings and the steering link 171 extends from the lever 17 to the support link 30 and symmetrically the steering link 181 extends from the lever 18 to the support link 31 . there is provided an arrangement for selecting either the first single coupling or the two second couplings to change the steering modes . this comprises inserting a locking pin 21 , 22 at the support link 30 and removing a locking pin at the axle 12 and wherein the selection of the vehicle steering mode is obtained by removing a locking pin at the support link 30 and inserting a locking pin 25 at the axle . the rear axle operates symmetrically with pins 26 , 27 , 28 . when skis are used as shown in fig3 d and 3e , each of the skis includes a longitudinally extending blade 151 , 16 therein extending along a central line of a concave under surface 152 of the ski . the skis are replaceable so that a selection can be made between wheels and a float assembly ( fig8 ). in fig8 , each float assembly comprises a tube 50 arranged horizontally under the respective axle with a guide fin 51 longitudinally of the respective float assembly for guiding movement over water longitudinally . each of the float assemblies 50 includes outwardly extending paddle members 52 each arranged to paddle rearwardly on the surface when moved rearwardly such that rotational steering movements of the floats 50 cause alternate paddling actions of the paddle members to propel the frame forwardly over the surface . that is the paddle members 52 are arranged to paddle against the surface in the rearward direction and to side over the surface a forward direction as shown at 53 . as shown in fig3 c , the link 30 is generally l - shaped with a leg 301 to which the ski is attached and a leg 302 to which the steering link 171 is attached . in addition a connecting link 303 extends across between the link 30 and the link 31 on the opposite side for maintaining a common steering angle between the skis . referring now to fig3 a , 3b and 3c , the operation of the device is as follows : these two plates ( front and rear ) attach to a snap on sled frame as shown on fig2 and 4 . once the plates are attached to the sled frame the front plate will pivot sideways to give the sled a smooth ride and the rear plate is rigid , this will stabilize the sled . the skis , pontoon type skis and the tube attach to piece number iv - 6 . these attachments will enable the devices to move up and down to further give the sled a smoother ride . by simply moving one bolt ( 2 or 3 ) in each plate you have two types of steering . two axle automobile type steering see fig1 and 2 two axle wagon type steering is shown in fig4 and 5 . one can add on propulsion adaptor adaptors systems to this steering design as shown in fig4 a and 5a whereupon the propulsion system is activated by just pumping the steering handles . to get only front steering just remove the two cables . to stabilize the rear plate holes 1 , 2 and 3 must have bolt in them . a brake 60 is provided and comprises a blade 61 for engaging the ground or snow cover in the centre between the skis and a handle 62 operable by the seated passenger at one side or both sides of the frame and pulled into a retracted position by a spring 63 . the length of the arm carrying the blade is extendible to allow the operator to select a required length in respect of the surface over which the vehicle is travelling . the rear platform 131 includes a rear panel 13 r extending behind the rear axle between the rear skis for a second passenger to stand on . due to the sled &# 39 ; s unique steering and propulsion mechanism system , when the rider moves the handle the other handle moves simultaneously in the other direction setting off a chain of events that makes the sled turn in a circular motion . the front control board 121 is connected to the front axle 12 . they pivot each other because they are connected to the bolt and nut 123 . the pivoting axle 12 is connected to the pivoting arm which is connected to the frame 10 . the pivoting arm enables the platform 121 to pivot two different ways sideways and up and down . the rear platform 131 is connected to the rear pivoting board and pivots relative to each other by means of the ( a ) bolt and nut . the rear platform pivots up and down unless otherwise locked when connected to the frame 10 . the steering handles 17 , 18 are connected to the frame and connection pipe which is connected to the steering arm 171 which is connected to the unit control pipe 303 and the criss - cross control cables 19 , 20 . all five sled snap - on adapters function on the same operating principles to steer and propel the sled . to propel the sled forward , one must pump the handles by pushing them forward and backward . this handle pumping action will enable paddles 60 shown in fig4 a and 6a to push the sled forward , while simultaneously moving the other paddles in the forward motion and they in turn will move the sled forward . the paddles hinge at the top 61 so that when pushed rearwardly by the steering handles they are fixed with the steering and the rear movement pushes the vehicle forwards . on the return stroke the paddles pivot rearwardly and therefore feather relative to the surface on which the vehicle is carried so as to provide no rear propulsion . the paddles 60 are blades when used in water or snow and can be spiked when used on ground or ice . since various modifications can be made in my invention as herein above described , and many apparently widely different embodiments of same made within the spirit and scope of the claims without department from the scope , it is intended that all matter contained in the accompanying specification shall be interpreted as illustrative only and not in a limiting sense .
| 1Performing Operations; Transporting
|
reference will now be made in detail to the various embodiments of the present disclosure , examples of which are illustrated in the accompanying drawings . while described in conjunction with these embodiments , it will be understood that they are not intended to limit the disclosure to these embodiments . on the contrary , the disclosure is intended to cover alternatives , modifications and equivalents , which may be included within the spirit and scope of the disclosure as defined by the appended claims . furthermore , in the following detailed description of the present disclosure , numerous specific details are set forth in order to provide a thorough understanding of the present disclosure . however , it will be understood that the present disclosure may be practiced without these specific details . in other instances , well - known methods , procedures , components , and circuits have not been described in detail so as not to unnecessarily obscure aspects of the present disclosure . specific embodiments of the invention will now be described in detail with reference to the accompanying figures . like elements in the various figures are denoted by like reference numerals for consistency . in the following detailed description of embodiments of the invention , numerous specific details are set forth in order to provide a more thorough understanding of the invention . however , it will be apparent to one of ordinary skill in the art that the invention can be practiced without these specific details . in other instances , well - known features have not been described in detail to avoid unnecessarily complicating the description . in the following embodiments , an embodiment is described for an approach to modular solar panel installation and removal that provides quick and efficient removal while maintaining stability and security during operation . as depicted in fig1 , an exemplary system 100 is depicted for coupling a plurality of rectangular solar collecting panels , in accordance with various embodiments of the claimed subject matter . in one or more embodiments , the plurality of panels ( e . g ., panels 101 , 103 , and 105 ) may include solar panels , each being implemented as one or more solar cells . composition of the solar cells may vary according to various implementation , and may include ( but are not limited to ): crystalline - silicon solar cells , thin - film solar cells , amorphous - silicon solar cells , or a combination of two or more compositions , for example . the panels may be electrical solar panels in one embodiment . in one or more embodiments , the solar panels ( 101 , 103 , 105 ) may be mounted to a roof , other relatively flat surface , or open structures such as a carport or ground - mounted array . mounting may be performed by affixing portions of a panel ( e . g ., a panel frame ) to mounting points 107 . the mounting points 107 may be implemented as hinges or other vertical outcroppings and configured to be fastened to a mounting system installed ( typically with a flashing ) into the roof . in one embodiment , mounting points 107 may be positioned to correspond to the location of rafters or other secured points in a building or establishment . as shown in fig1 , the perimeter of each panel includes one or more channels 111 . these channels can , in various embodiments , be implemented as grooves along entire ( or substantial portions of ) lengths of the exterior surface of the panel &# 39 ; s frame , allowing for the free movement and positioning of elements within the channels . the channels may themselves be disposed along any of a side , top , or bottom surface of the frame , or a combination of surfaces . in one or more embodiments , panel splices 109 may be freely positioned along the channels on opposite sides of two or more adjacent panels , to provide rigidity , panel alignment , and a grounding path between panels . according to further embodiments , a separate channel or groove may be used to position the mounting point 107 at the designed location . as depicted in fig1 , three solar panels ( 101 , 103 , 105 ) are arranged in series according to a horizontal configuration . such a configuration is purely exemplary , and it is to be understood that embodiments of the claimed subject matter are well suited to varying configurations and orientations . panels may be configured in arrays in one ( a row of panels ) or two ( a grid of panels ) dimensions , for example . as depicted in fig2 , an exemplary configuration 200 of a panel splice and frame is depicted , in accordance with various embodiments of the claimed subject matter . fig2 depicts a cross - section of a panel 201 . the panel 201 includes a frame 202 . as depicted , the frame includes a first channel 203 , and a second channel 205 . as shown in fig2 , the first channel 203 may be used as a connection channel , and used to allow panel splices 209 to move along the channel into position to mechanically couple the panel to an adjacent panel , and / or out of position in order to decouple a pair of adjacent panels , for example . the second channel may be used to position a mounting point ( e . g ., mounting point 107 of fig1 ). according to further embodiments , the second channel can also be used to secure , or allow the movement and / or passage of various channel accessories . these channel accessories may include , for example , a series of cable clips fastening a plurality of cables together ; an extra splice to reinforce or support a coupling of two adjacent panels ; an electrical box , solar optimizer , micro inverter attachment , safety device , or performance enhancement device used during the process to convert absorbed solar energy into electricity , etc . as depicted in fig2 , panel splice 209 is shaped as a ridged bar . panel splice 209 may be composed of metal , or any other high density and / or rigid composition capable of supporting the weight of two adjacent solar panels . while depicted as a ridged bar in fig2 , panel splice 209 may be variously shaped , according to different embodiments . for example , panel splice 209 may also be shaped as a plate , rod , slider , beam , bolt , or other composition with a substantially straight profile . in alternate embodiments , the panel splice 209 may be shaped with a ( slight ) arched profile , such that the top of the arch crests at a location between two adjacent panels , and increasing the support provided by the splice 209 . in still further embodiments , the splice 209 may be shaped as any number of polyhedrons , not specifically limited to cylinders ( rods ). for example , embodiments may be well suited for implementations that impart a trapezoidal polyhedron shape to the panel splice 209 . also as depicted in fig2 , panel splice 209 may be fastened at a position in the channel and the frame using a fastening mechanism 207 . fastening the panel splice 209 to the frame may be performed by adjusting a fastening mechanism 207 in an aperture through the panel splice 209 . the fastening mechanism 207 may be implemented in a variety of manners , including , but not limited to : a bolt ; a cam , a screw ; an interference fit fastener ; a threaded fastener ; a tapered threaded fastener ; a cone - threaded fastener ; a ball - tipped fastener ; a spring - loaded fastener ; a pin ; and a tapered spring fastener ; or any other device that may be inserted through an aperture in the splice 209 and adjusted until movement of the splice is substantially prevented . in one or more embodiments , the panel splice 209 may include multiple apertures , either implemented as complete through - holes , or raised ridges ( or depressions ) that correspond to similar structures or protrusions on one or more surfaces of the channel that assists in the guidance of the panel splice 209 into proper positioning . alternately , a spring pin in the splice 209 and a corresponding pin hole in the interior surface of the channel can be implemented and used as an indication when the splice 209 is properly positioned . in further embodiments , the spring pin , when positioned within the pin hole also is configured to secure the splice in place . while fig2 depicts a fastening device 207 being inserted through an aperture in a side surface of the splice 209 , according to alternate embodiments , the aperture for fastening the splice 209 may be located on a top surface , and fastening the aperture to the frame or a spacer component ( described below ) may be performed from a position above the panel 201 and splice 209 . fig3 depicts an exemplary configuration 300 of a panel 301 with a pair of panel splices ( splices 309 , 311 ), in accordance with various embodiments of the claimed subject matter . panel 301 is depicted with an encircling frame 303 that includes two channels , channels 305 , 307 . each channel is fitted to secure the movement of corresponding panel splices 309 , 311 . as shown in fig3 , a first panel splice 309 is operable to travel the length of the top channel 305 , along the interior of the channel 305 . a second panel splice 311 is operable to travel the length of the bottom channel 307 , with a surface on an exterior of the channel 307 ( and frame 303 itself ). a dual splice system may be used to provide additional load - bearing support or rigidity , for example . in one or more embodiments , one or more of the splices may also be equipped with one or more friction - reducing elements , so as to allow smoother movement along a channel . the friction - reducing element may be one of several possible implementations that include , but are not limited to : a surface finish ; a surface coating ; a surface plating ; a plurality of surface grooves to reduce contact with channel surfaces ; a plurality of other raised elements ( e . g ., bumps ); embossing ; encasing in a low - friction polymer ; adhesion to a low - friction tape , etc . fig4 a - 4 c depict cross - sections of varying exemplary panel frames , in accordance with various embodiments of the claimed subject matter . fig4 a depicts a cross - section of an exemplary panel frame 401 a with three channels ( 403 a , 405 a , 407 a ). fig4 b depicts a cross - section of an exemplary panel frame 401 b with two channels ( 403 b , 405 b ). fig4 c depicts a cross - section of an exemplary panel frame 401 c with one channel ( 403 c ), in accordance with various embodiments of the claimed subject matter . as described above with respect to fig1 - 3 , one or more of the channels in each frame ( 401 a , 401 b , 401 c ) may be used to transport , or position , one or more module splices to a location between two adjacent panels to provide structure , support , and a grounding path . remaining , unoccupied channels may be used for various purposes as described herein . as depicted in fig5 , a cross - section 500 of an exemplary panel frame 501 and panel splice 509 is depicted with a shelf configuration 511 , in accordance with various embodiments of the claimed subject matter . as shown in fig5 , the panel frame consists of three channels , one closed channel 503 , and two exterior facing open channels 505 , 507 . a panel splice 509 , depicted in fig5 to include a shelf 511 may be inserted — at a corner of the panel frame 501 , for example — into the lower channel 507 . subsequently , the panel splice 509 may be moved along the channel 507 until a portion of the panel splice 509 extends at least partially into a corresponding channel 507 in an immediately adjacent panel . in this manner , a portion of the panel splice 509 may protrude into channels 507 for both panels , with the panel splice 509 bridging a space between the panels . the portion protruding into each channel 507 may then be affixed to each panel ( via each respective frame , for example ) thereby aligning the panels , and providing rigidity and support to the panel array . a shelf 511 as depicted in fig5 may be able to provide additional support and rigidity to the structure by preventing a slight dip or any other misalignment between adjacent panels . fig6 a and 6 b depict cross - sections ( 600 a , 600 b ) of an exemplary panel frame 601 and panel splice 609 . each of fig6 a and 6 b depict panel frames 601 in a three channel configuration , including a closed back channel 605 , a lower , open front channel 603 , and an upper open front channel ( occupied by the splice 609 ). in one or more embodiments , one or more channels of a panel frame 601 may be equipped with securing features to allow the secure movement of a panel splice 609 along the channel . these features may include , for example a bolstered edge ( 613 ) that corresponds to a dovetail feature 615 of the panel splice 609 . such a configuration secures the splice within the channel while still allowing free movement along the channel . fig6 a depicts an adjustable fastening mechanism 611 a at a less secured position . fig6 b depicts the adjustable fastening mechanism 611 b at a more secured position . while the claimed subject matter is well suited to other embodiments , the fastening mechanisms 611 a and 611 b are depicted in fig6 a and 6 b as bolts that are inserted through apertures in side surfaces of both the panel splice 609 and a wall in the back channel 605 . fastening the splice 609 into a current position may thus be performed by inserting the fastening mechanism into an initial position ( e . g ., 611 a ) and tightening the fastening mechanism to secure the splice 609 into place at a final position ( e . g ., 611 b ). while fig6 a depicts a side - oriented fastening embodiment , the apertures may also ( or instead ) be positioned on top surfaces of the panel splice 609 and frame 601 a , 601 b , such that the fastening device may be inserted through the apertures in the top surfaces and secured also from the top . removal of top - fastened splices may be performed in these embodiments also from a position above the panels , thereby providing greater access to fastening mechanisms of installed panels arranged in tightly spaced , two - dimensional arrays . fig7 depicts an exemplary illustration 700 of a plurality of panels ( 701 ), each panel having an encircling frame ( 703 ), in accordance with various embodiments of the claimed subject matter . the panels 701 may be mechanically coupled to each other with panel splices 709 positioned along channels in the top and bottom edges of the frames 703 surrounding the perimeters of the panels 701 , as described above . as depicted in fig7 , each panel 701 includes a pair of integrated electrical connection interfaces . in one or more embodiments , the electrical connection interfaces may include a reception interface 705 configured to mechanically and electrically couple ( via a plurality of pins , for example ) with a connection interface 707 . in one or more embodiments , coupling a reception interface 705 of a panel ( e . g ., 701 ) with the connection interface 707 of a neighboring panel ( e . g ., 703 ) establishes an electrical path between the panels , e . g ., to conduct the flow of electricity along the configuration of panels . as depicted in fig7 , each electrical connection interface may be positioned to protrude from a side surface of a panel frame , and such that the reception interface of a panel is on an opposite side surface of the connection interface . in this manner , the reception interface of a panel is always aligned to couple with a connection interface of a neighboring panel , and vice versa . by having an integrated electrical connection interface in the panels themselves , conventional approaches that require sub - surface wiring underneath the panel can be avoided , such that removal of panels may be performed more easily , with greater access to the electrical path , and with less risk of exposing or damaging wiring during removal procedures . the electrical connection may be disengaged by decoupling the reception interface 705 from the connection interface 707 . in one or more embodiments , disengagement of the electrical connection interfaces may be performed using a release feature 711 . the release feature may , in some embodiments , be implemented to include a mechanical release of one or more engagement features used to couple the electrical connection interfaces together . the engagement features may , in some instances , be implemented as : a spring action element ; a clasping element ; a latch element ; a twist element ; and / or a cam element , each of which , when the mechanical release is activated , releases the engagement between the connection interface 707 and the reception interface 705 . in one or more embodiments , the release feature 711 may be activated by hand ( e . g ., toggling a button or lever ). in further embodiments , the release feature 711 may be activated with a general or specialized tool . fig8 depicts an exemplary illustration 800 of a plurality of coupled panels ( 801 ), each panel having an encircling frame ( 803 ), in accordance with various embodiments of the claimed subject matter . as depicted in fig8 , the panels 801 correspond to the panels 701 described above with respect to fig7 . the panels 801 are depicted in a coupled state , whereby a pair of panel splices 809 are positioned in channels along the top and bottom edges of the frames 803 , and affixed to the frame . as depicted in fig8 , a roughly equivalent proportion of each splice may extend into a channel of each panel . the splices may be affixed to the frames via fastening mechanisms along the top and / or side surfaces , as variously described herein . in one or more embodiments , spacer components 805 may be placed between panels , in order to provide a clearance between the pair of adjacent panels 801 and to allow access to a release feature 811 of an electrical connection 807 . in one or more embodiments , the spacer components 805 may be implemented to include a channel , aligned with the one or more channels of the panel frames 803 , and configured to allow a panel splice 809 to travel through the spacer channel . in other words , the spacer channel may act as a channel bridge in the space between the panels . particular implementations of the spacer components 805 can vary widely across embodiments . these implementations may include , but are not limited to : a clamp ; a washer ; a bolt ; a shelf ; a full or partial cross - section of a frame ; or any such component configured to align against an exterior ( outwardly facing ) surface of a frame 803 of a panel 801 and to provide a clearance between two adjacent panels 801 . in one or more embodiments , the panel splices 809 may be fastened to a desired position through the spacer components 805 . for example , a fastening mechanism ( such as fastening mechanism 611 a , 611 b described above with respect to fig6 a and 6 b ) may be fastened to the panel splice 809 through an aperture in the top or side surface of the spacer component 805 . in alternate embodiments , tightening of the fastening mechanism may be performed through an aperture in the panel splice 809 , with the fastening mechanism gaining access to contact the panel splice 809 through an aperture in the top or side surface of the spacer component 805 . according to such embodiments , the fastening mechanism may or may not itself be fastened to the spacer component 805 . fig9 depicts an exemplary illustration 900 during the removal of a middle panel of a sequence of three panels ( 901 a , 901 b , 901 c ), in accordance with various embodiments of the claimed subject matter . as depicted in fig9 , each panel has an encircling frame ( 903 ). as depicted in fig9 , the panels 901 a , 901 b , 901 c correspond to the panels 701 and 801 described above with respect to fig7 and 8 . as shown in fig9 , panel 901 b may be removed by unfastening the panel splices 909 and moving ( sliding ) the panel splices 909 out of the channels in the frame 903 of the target panel 901 b . unfastening the panel splices 909 may be performed by removing or deactivating a fastening mechanism used to affix the panel splice 909 to a frame 903 and / or a spacer component 913 . for example , a bolt may be loosened through an aperture in either the side or top surface of a panel splice 909 and at least one of a frame 903 and a spacer 913 the panel splice 909 is affixed to . in one or more embodiments , the panel splices 909 may be moved further into the channels of the adjacent panels 901 a , 901 c , such that an entirety or a substantial portion of each panel splice 909 is in the neighboring panels , with little to no portion of the splice remaining in the panel 901 b to be removed . in one or more embodiments , the panel splices 909 may be moved through the spacer components 913 with sufficient clearance as to allow the removal of the spacer components 913 from between the panels . in still further embodiments , a spacer component 913 may be removed ( e . g ., by removing a top - oriented fastening mechanism ) without disturbing the placement of the panels on either side of the spacer component 913 . fig1 depicts a flowchart of an exemplary process 1000 for coupling a plurality of panels . steps 1001 - 1011 describe exemplary steps comprising the process 1000 in accordance with the various embodiments herein described . at step 1001 , a panel is affixed to a mounting system . affixing the panel to a mount may be performed by , for example , fastening a mounting point against a frame of the panel , and to the mounting system itself . according to various embodiments , the mounting point may be configured to freely travel a length of a side of the frame of the panel within a first channel or groove in the frame until a desired position is reached . the mounting point may then be fastened against the frame to secure the panel to the mounting system . at step 1003 , a second panel is positioned next to the panel affixed to the mounting system . the second panel may be positioned linearly in a serial alignment with respect to the first panel , as part of a one or two dimensional array of panels , for example . once positioned , a spacer is positioned between the two panels ( step 1005 ). in one embodiment , the spacer is positioned to align with the exterior surface of the frames of the adjacent panels along the edge of one side of the frames . a panel splice is then inserted into a second channel of one of the panels at step 1007 . according to alternate embodiments , the panel splice may be inserted into a second channel of the first panel prior to the positioning of the second panel at step 1003 . once the panel splice is inserted into a second channel in the frame of either the first or second panel , the panel splice can be moved along the second channel of one or both panel frames and the spacer at step 1009 until a target position is reached . in one embodiment , the target position is achieved when the panel splice extends into the second channel of both panel frames in substantially equivalent proportion . in further embodiments , bumps , spring - pins or other guiding elements ( with corresponding apertures , grooves ) may be used to guide the panel splice into proper positioning , indicate the splice is in the correct position , and further secure the splice in place . once the target position of the splice is achieved , the splice can be fastened at step 1011 , e . g ., via a fastening mechanism through a side and / or top surface of the splice , whereby the splice is affixed into its present position and to the spacer , at least one of the pair of adjacent panels , or any combination thereof . steps 1005 to 1011 are then repeated for an opposite edge of the pair of adjacent panels , whereby a second spacer is inserted between the panels , a second splice is inserted , positioned , and fastened into a target position . in further embodiments , each panel may further include an electrical connection interface that is configured to electrically and physically couple when a pair of adjacent panels are positioned and aligned . in one embodiment , positioning the splice at the target position ( e . g ., step 1009 ) aligns the panels , and may position the electrical connection interfaces of each panel to automatically couple . in further embodiments , the alignment of the panels provided by the splice also prevents terminals ( e . g ., pins ) of the interface from being damaged . once splices on both opposite edges are fastened into position , and the electrical connection interfaces between the pair of panels is engaged , installation is completed for that pair of panels . a next panel in the series can be installed , adjacent to the second panel , by performing steps 1003 to 1011 for the panel , and for each subsequent panel in the series . fig1 depicts a flowchart of an exemplary process for removing a panel between a plurality of adjacent panels , in accordance with various embodiments of the claimed subject matter . steps 1101 - 1011 describe exemplary steps comprising the process 1000 in accordance with the various embodiments herein described . at step 1101 , panel splices are unfastened for a target panel between a pair of panels , with a panel being located on either side of the target panel . panel splices may be unfastened by loosening ( and / or removing ) a fastening mechanism affixing the splices to the frame of target panel and each of the two neighboring panels . at step 1103 , the splices along a top edge of the panels are moved in a channel along the frames of each of the target panel and the two neighboring panels such that no ( substantial ) portion of any splice remains in the channels of the target panel . this may be performed by , for example , shifting the splice so that an entirety or substantial majority of the splice extends into the channels of the neighboring panels , and away from the channel of the target panel . movement of the splices is repeated at step 1105 for the splices in the channels along the bottom edge of the panels . once the splices are completely disengaged from the target panel along both the top and bottom edge , electrical connectors coupling the target panel to electrical connectors in each of its neighboring panels are also disengaged at step 1107 . disengaging the electrical connectors may be performed , for example , by activating a release element in the electrical connector that automatically releases , or allows a manual separation of the electrical interfaces coupled together to form the electrical connection . at step 1109 , the target panel is unfastened from the mounting system ( if necessary ), by detaching or unfastening the target panel from a mounting point . thereafter , the target panel is no longer attached to either of the adjacent panels mechanically or electrically , and any attachment to the mounting system is removed as well . finally , the target panel may be removed at step 1111 . although the subject matter has been described in language specific to structural features and / or methodological acts , it is to be understood that the subject matter defined in the appended claims is not necessarily limited to the specific features or acts described above . rather , the specific features and acts described above are disclosed as example forms of implementing the claims .
| 7Electricity
|
fig1 illustrates a front isometric view of an interconnect cassette 300 configured to be mated with a separate and discrete sensor bezel 302 according to an embodiment of the present invention . the interconnect cassette 300 includes a housing 304 defined by side walls 306 , a top surface 308 , a base 310 , a rear wall 312 and a jack interface 314 . the jack interface 314 includes a plurality of receptacle jacks 370 and sensor strip pin receptacles 316 positioned to the side of the receptacle jacks 370 . the receptacle jacks 370 each have a channel 386 along one side thereof and are configured to receive plugs 18 ( as shown in fig2 ) on patch cords 10 . fig2 illustrates a side sectional view of a portion of a patch cord 10 formed according to an embodiment of the present invention . the patch cord 10 includes an insulated cable 14 and a plug 18 retained in a boot 22 . the cable 14 extends to a first network component ( not shown ) that , by way of example only , may be a server , interconnect module or another interconnect cassette 300 . the cable 14 contains several signal wires ( not shown ) that may , by way of example only , be shielded or unshielded and made of fiber optics or copper . a probe wire 26 extends from the cable 14 to a sensor probe 30 . the sensor probe 30 may be positioned generally parallel to a longitudinal axis of the plug 18 . the sensor probe 30 has a probe head 98 extending outward from the boot 22 . a flexible prong 38 extends from a front end 42 of the plug 18 rearward at an acute angle with respect to a bottom surface 36 of the plug 18 and is configured to retain the plug 18 within the interconnect cassette 300 . referring again to fig1 the receptacle jacks 370 are arranged in two rows ( a and b ) each having six receptacle jacks 370 . rows a and b of receptacles jacks 370 are stacked . optionally , the jack interface 314 may have more or less than two rows of receptacle jacks 370 . further , more or less than six receptacle jacks 370 may be included within each row . additionally , the sensor strip pin receptacles 316 may be positioned above or below the rows a and b of receptacle jacks 370 depending on the location of the sensor strip pins 342 on the sensor bezel 302 . the interconnect cassette 300 may be connected to a network connection component such as a patch panel , a wall mounted box , a floor box , or any number of other network connection structures ( not shown ). mounting features , such as fastener holes 343 , are provided in the jack interface 314 to allow the interconnect cassette 300 to be mounted into a rack unit ( not shown ) or other such organizational and support structure . the interconnect cassette 300 connects the receptacle jacks 370 to corresponding wires , a printed circuit board , a flexible circuit , a lead frame , or the like within the housing of the interconnect cassette 300 as opposed to directly connecting each receptacle jack 370 to a corresponding structure within another network connection . the wires electrically connected to the receptacle jacks 370 may be bundled inside the interconnect cassette 300 and electrically connected to a signal input / output ( i / o ) interface 320 ( as shown below with respect to fig3 and 4 ). the signal i / o interface 320 may then be connected to a cable or other connection route ( such as cable 311 ), which in turn is electrically connected to a network component or connection 313 , such as a patch panel . because the wires from the receptacle jacks 370 are bundled within the interconnect cassette 300 and subsequently routed to corresponding features in the signal i / o interface 320 within the interconnect cassette 300 , there is no need to route numerous cables and wires from the interconnect cassette 300 to the network component 313 . rather , a single cable , such as cable 311 , may house a plurality of wires and connect the interconnect cassette 300 to the network connection 313 . optionally , the receptacle jacks 370 may be electrically connected to a flexible or printed circuit board ( not shown ) within the interconnect cassette 300 that is , in turn , electrically connected to a signal input / output interface 318 located at the front or rear of the interconnect cassette 300 . the sensor bezel 302 includes a frame 324 defined by horizontal frame members 326 formed integrally with vertical frame members 328 . the frame 324 includes a front face 330 , a cassette interface surface 332 and a column of strip pins 342 located on one of the vertical frame members 328 . portions of the cassette interface surface 332 ( for example , the edges of the cassette interface surface 332 ) may be beveled , notched or ribbed such that the cassette interface surface 332 engages corresponding structures in the jack interface 314 to allow the sensor bezel 302 to be snapably , latchably , removably , or otherwise securably retained by the jack interface 314 of the interconnect cassette 300 . optionally , the sensor bezel 302 may be securably retained by the interconnect cassette 300 without the use of glue or other such adhesives . the strip pins 342 extend outwardly from the cassette interface surface 332 and may optionally be formed on one of the horizontal frame members 326 ( as a row ) or on the other vertical frame member 328 . also , optionally , strip pins 342 may be positioned on more than one of the vertical and horizontal frame member 328 and 326 ( so long as they correspond to strip pin receptacles formed within the interconnect cassette 300 ). a sensor strip 334 , attached to each vertical frame member , spans longitudinally across the sensor bezel 302 in a parallel relationship with the horizontal frame members 326 . the sensor bezel 302 may be molded with , stamped onto , or otherwise integrally formed with the frame 324 . alternatively , the horizontal frame members 328 may include slots configured to receive and retain support tabs formed as terminal ends of the sensor strip 334 . that is , the sensor strip 334 may be removable from the frame 324 . two open jack cavities 336 are defined between the horizontal frame members 326 and the sensor strip 334 and are configured to allow plugs 18 to pass therethrough . the jack cavities 336 allow plugs 18 of the patch cords 10 to mate with the receptacle jacks 370 as described below . as shown in fig1 the sensor strip 334 is a flexible circuit having conducting pads or sensor contacts 340 , as commonly used as a connection sensor with interconnect modules ( such as interconnect module 600 shown in fig5 ). the sensor contacts 340 are electrically connected to corresponding strip pins 342 extending outwardly from the cassette interface surface 332 . the sensor contacts 340 may be electrically connected to the corresponding strip pins through traces ( an exemplary trace , which is under the surface of the sensor strip 334 and vertical member 326 , is shown by line 341 ) that may be formed within or on the sensor strip 334 and the frame 324 . the sensor bezel 302 is received and retained by the interconnect cassette 300 . the interconnect cassette 300 includes features that allow the strip assembly 302 to snapably , latchably or otherwise securably mount to the jack interface 314 of the interconnect cassette 300 . the sensor bezel 302 is mounted to the interconnect cassette 300 without the use of glue or other such adhesives . the sensor bezel 302 may be quickly and efficiently mounted to ( and removed from ) the interconnect cassette 300 through snapable , latchable or other such matable engagement between the jack interface 314 and the cassette interface surface 332 . also , the strip pins 342 may be securably retained by the strip pin receptacles 316 so that the strip assembly 302 is securably positioned on the jack interface 314 of the interconnect cassette 300 . as the sensor bezel 302 is mounted to the jack interface 314 in the direction of the dashed lines , the strip pins 342 are received and retained by the strip pin receptacles 316 . the strip pins 342 are then electrically connected to contacts ( not shown ) within the strip pin receptacles 316 , which are in turn electrically connected to a sensor input / output ( i / o ) interface 318 or insulated displacement contact ( idc ) assembly 322 ( as discussed below with respect to fig3 and 4 ) through internal traces , wires , or the like . the sensor i / o interface 318 or idc assembly 322 may then be in electrical communication with a sensing component 317 within or discrete from the network component 313 through a cable 315 or other such electrical path . when the sensor bezel 302 is securably mounted to , and consequently in operative connection with , the interconnect cassette 300 , the receptacle jacks 370 may receive the plugs 18 of the patch cords 10 such that the flexible prongs 38 are retained in the channels 386 and biased toward the bottom surface 36 of the plugs 18 . the resistance of the flexible prongs 38 against the channels 386 retains the plugs 18 within the receptacle jacks 370 . optionally , the flexible prongs 38 may include a latch feature that joins a corresponding latch feature in the channel 386 . when the plugs 18 are fully received in the receptacle jacks 370 , the probe heads 98 contact and electrically engage corresponding sensor contacts 340 . when the plugs 18 are inserted into corresponding receptacle jacks 370 , the sensor probes 30 align with and engage corresponding sensor contacts 340 on the sensor strip 334 , thereby enabling sensor signals to pass in either direction between the plug 18 and interconnect cassette 300 . optionally , instead of a pin and socket configuration , the sensor bezel 302 may be compressibly connected to the interconnect cassette 300 . for example , instead of the pins 342 and the receptacles 316 , the sensor bezel 302 may include an array of insulators and conductors . the insulators may be longer or higher than the conductors . when the array is sandwiched between the sensor bezel 302 and interconnect cassette 300 , however , the insulators may be compressed to the length or height of the conductors . when the sensor strip 334 is operatively connected to the interconnect cassette 300 , a pin or other such element , such as the sensor probe 30 , on the plug 18 or patch cord 10 contacts the sensor strip 334 if the plug 18 is fully mated into a corresponding receptacle jack 370 . in particular , the sensor probe 30 of the plug 18 contacts a sensor contact 340 when the plug is fully mated into the receptacle jack 370 . upon full mating of the plug 18 into the receptacle jack 370 , an electrical circuit is formed between the plug 18 and the sensor contact 340 by virtue of the sensor probe 30 contacting the sensor contact 340 . the sensing component 317 detects this electrical circuit as a connection between the plug 18 and its corresponding receptacle jack 370 . if , however , the plug 18 becomes dislodged from its corresponding receptacle jack 370 , the sensor probe 30 no longer contacts the sensor contact 340 . thus , the electrical circuit is broken and the sensing component 317 senses that a connection is not present between the plug 318 and its corresponding receptacle jack 370 . the information regarding connections is relayed to a processing unit ( not shown ), which in turn may display connection information to an operator or overseer . fig3 illustrates a rear isometric view of an interconnect cassette 300 according to an embodiment of the present invention . the rear wall 312 of the interconnect cassette 300 includes a sensor input / output ( i / o ) interface 318 and a signal input / output ( i / o ) interface 320 . the sensor i / o interface 318 electrically connects to the strip pin receptacles 316 through electrical traces , cables , wires , circuit boards or the like . similarly , the signal i / o interface 320 electrically connects to the receptacle jacks 370 through electrical traces , cables , wires , circuit boards or the like . thus , the interconnect cassette 300 may connect to a patch panel , or other network connection structure , such as network component 313 , through an electrical cable , such as cable 311 , that bundles a plurality of signal wires and connects them to an i / o interface on the network component 313 . similarly , sensor information is relayed to a sensing component 317 through a cable 315 that connects the sensor i / o interface 318 to an interface on the sensing component 317 . fig4 illustrates a rear isometric view of an interconnect cassette 300 according to an alternative embodiment of the present invention . instead of the sensor i / o interface shown in fig9 the interconnect cassette 300 may include an idc assembly 322 that may communicate with a corresponding assembly of a sensing component 317 . united states patent application entitled “ receptacle and plug interconnect module with integral sensor contacts ,” filed jun . 18 , 2002 , attorney docket 17862us1 ( mhm no . 13761us01 ), listing pepe et al . as inventors (“ the pepe application ”), discloses a connector assembly having sensor contacts integrally formed with a housing of the connector assembly . the pepe application is incorporated by reference herein in its entirety . the pepe application discloses an interconnect module having a plurality of sensor contacts integrally formed thereon . the sensor strip 334 shown above with respect to fig1 may include the sensor contacts shown in the pepe application , instead of the flexible strip 338 . each contact sensor , or conducting pad of the contact sensor , is electrically connected to the strip pins 342 by way of traces 341 or similar electrical paths . in an alternative embodiment of the present invention , the sensor strip 334 and the sensor i / o interface 318 or the idc assembly 322 may be connected together by a printed circuit board that extends through the housing 304 of the interconnect cassette 300 . the printed circuit board has electronic traces that extend along the length thereof and that are connected to the sensor strip receptacles 316 . the printed circuit board may include signal conditioning circuits , an identification id code unique to each receptacle jack 370 , and / or processing components that analyze and identify the type of plug inserted . the interconnect cassette 300 and separate sensor bezel 302 confer several benefits . first , the interconnect cassette 300 utilizes individual sensor contacts 340 positioned proximate each receptacle jack 370 . the sensor contacts 340 are retained individually within the front face of the sensor bezel 302 and are connected to the sensor pins 316 through traces 341 , or the like . thus , the sensor contacts 340 directly connect to the sensor probes of the plugs 18 . the sensor contacts 340 are separate and discrete from one another thereby allowing easy removal and replacement of the plugs 18 from the receptacle jacks 370 without disconnecting other plugs 18 from receptacle jacks 370 that are not being replaced / removed . that is , only the sensor strip 334 needs to be removed , while the sensor bezel 302 and the plugs remain in place . also , if sensor contacts 34 - are faulty , only the sensor bezel 302 needs to be replaced ( as opposed to the entire interconnect cassette 300 ). further , the sensor strip 334 of the sensor bezel 302 may be removable so that only the sensor strip 334 or individual sensor contacts 340 needs to be replaced . finally , the sensor contacts eliminate the need for fixed lengths of cable and multiple connectors to connect sensor pads to the sensor wires , thus saving time and space . embodiments of the present invention may be used with various applications including modular jacks . for example , the present invention may be used to electrically or fiber optically connect components . while the invention has been described with reference to certain embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from its scope . therefore , it is intended that the invention not be limited to the particular embodiment disclosed , but that the invention will include all embodiments falling within the scope of the appended claims .
| 7Electricity
|
most electronic devices within an image related system include a semiconductor image sensor functioning as an image capturing device as shown . the image sensor can be a ccd or a cmos image sensor . most image and video compression algorithms , like jpeg and mpeg have been developed in late 1980s &# 39 ; or early 1990s &# 39 ;. the cmos image sensor technology was not mature then . the ccd sensor has inheriting higher image quality than the cmos image sensor and has been used in applications requires image quality like scanner , high - ended digital camera or camcorder or surveillance system or the video recording system . an image sensor is to capture the image by measuring the amount of red photons , green photons and blue photons by either using ccd , a charge coupled device or a cmos image sensor array . an image sensor cell comprising of no matter a ccd or a cmos image sensor , can capture only one color by each cell as shown in fig1 by applying one of the three color filters 17 on top of the sensor cell . each pixel of a cmos active - pixel image sensor contains not only the photo - detector element , a photo diode 16 or a photo gate but also active transistor circuitry , or said an amplifier for readout of the pixel signal . the bigger the pixel , the more light it can collect . thus , big - pixel sensors work best under low - light conditions . for the same number of pixels , bigger pixels result in a bigger chip , which means higher cost . for allowing only a selected color photons to punch the predetermined location of an image sensor die , a specific color filter pattern or sequence of filters can be designed . the bayer cfa pattern coming out of one row of rgrgrgrg . . . followed by the next row of gbgbgbgb . . . was invented long ago at kodak and is a repeating 2 × 2 arrangement 12 , 13 , 14 , 15 has been widely adopted . another prior art of the image capturing with a semiconductor image sensor is shown in fig2 has been granted a u . s . pat . no . 5 , 965 , 875 . this figure is an example of p - type substrate 27 with three well layers which used to form photo diode with capability of capturing and storing variable colors . these three wells include n - well 26 on p - substrate for capturing red photons , p - well 25 on the n - well which captures green photons and another n - well 24 on the p - well which captures the blue photons . the three wells form three vertical photo diodes and represent three color capturing devices with each having corresponding color filters , blue color filter 21 , green color filter 22 and red color filter 23 on top of it . drawbacks of the u . s . pat . no . 5 , 965 , 875 include : complex and expensive semiconductor process of additional three wells which require more masks and more process layers . relatively larger image sensor cell size per pixel : since it implements three color filters on top of a cell , the area size is larger than conventional ones . even the quality has sharply improved compared to conventional one color per pixel , the cost of implementation and cell size still have room to improve . fig3 depicts the semiconductor image sensor 31 which can be made of ccd 33 or cmos 32 materials . a cmos image sensor array is formed like a memory array with each location of row or column can be randomly accessed . and each image sensor cell can capture one color 34 , 35 can provide an amplified image information . the ccd image sensor is different the cmos sensor . the colors captured sensor cells 37 , 39 . . . can be transferred seriously to the next cell till the end of row / column by two non - overlapping clocks 36 , 38 . as shown in fig4 , the present invention of the method and device of the efficient image capturing improves the drawbacks of prior arts including quality enhancement of capturing 3 colors per image sensor cell simple semiconductor process small sensor cell size : achieving low cost multiple color filters 43 , 44 , 45 are designed and can be placed on top or all image sensor cells 41 , 42 . . . . only one selected color filter is placed on top if the image sensor at the scheduled time . for example , red , green and blue are designed to be the selected three color filters . in the application of the color image scanner as an example , firstly , the red filter 48 is placed on top of the image sensor to let only the red light penetrate through the red color filter and hit the image sensor array , the photo diodes 47 , then , the image sensor circuit reads out the red color information . in the second scheduled time slot , the green filter 49 is placed on top of the image sensor to let only the green light penetrate through the green color filter and hit the image sensor array , the photo diodes 47 , afterward , the image sensor circuit reads out the green color information . in the third scheduled time slot , the blue filter 46 is placed on top of the image sensor to let only the blue light penetrate through the blue color filter and hit the image sensor array , the photo diodes 47 , afterward , the image sensor circuit reads out the blue color information . by applying three color filters in scheduled time and placing on top of image sensor as above mechanism , each image sensor cell can hence capture three color components in seriously scheduled timing . fig5 illustrates the structure of the image sensor for this invention of the efficient image capturing , which can be a ccd sensor or a cmos sensor . the photo diode 52 , the image sensing element , is formed on top of the semiconductor substrate 51 . an opaque layer 53 is formed on top of the area between two photo diodes to block light penetrating to the substrate . for attracting more lights , the micro - lens 54 is formed above the substrate by a predetermined distance 55 which is proportional to the area of the sensing photo diode . placing a selected color filter to be placed on top of the image sensor at a scheduled time can be replaced by another method of applying color filter made of thin film material which is turning on and off electrically as shown in fig6 . the image sensing photo diode 62 is formed on top of the semiconductor substrate 61 . the electrically on - off controlled thin film color filters 63 , 64 , 65 are placed on upper layers of the image sensor and been isolated by insulation layers 66 . the insulation material can be glass or plastic with good polarization effect to avoid reducing the energy of light . in some applications , like digital camera , video camcorder requiring high speed of changing the color filters , an accurate timing controller 67 is designed for turning on and off the thin film color filters in a precisely determined timing . fig7 shows the timing and corresponding procedures of this invention of the efficient image capturing . each image capturing procedure is divided into three phases of red phase 71 , green phase 72 and blue phase 73 . each phase of a selected color capturing and processing includes a couple of procedures of placing color filter , readout color signal , digitization and image processing and reset . the 1 st procedure is placing color filter 74 letting the selected color of light shoot to the image sensor , the readout sensor information which conducts the photo diode to a source follower circuit with amplification and place the output to a column node . the readout signal will be converted to digital format by an analog - to - digital - converter , adc for image processing including gamma correction , white balance , auto exposure . . . . when all procedures are done , a reset signal turns on the transistor to discharge all charges stored in the photo diodes . fig8 depicts the readout circuitry of the sense amplifier . a photo diode 81 captures the photons and forms positive voltage conducts to the gate of the source follower device 83 which amplifies the photo signal . the output of the source follower connects to the row select device 84 of each column 85 and the output voltage on the column will be converted to digital signal by an adc , analog - to - digital - converter for further image processing . the present invention of the efficient image capturing enhances the image quality by capturing multiple colors , for example said red , green and blue in each image sensor cell be placing the corresponding color filter on top of the image sensor in a scheduled time . it will be apparent to those skills in the art that various modifications and variations can be made to the structure of the present invention without departing from the scope or the spirit of the invention . in the view of the foregoing , it is intended that the present invention cover modifications and variations of this invention provided they fall within the scope of the following claims and their equivalents .
| 7Electricity
|
a pullout guide 1 comprises a guide rail 2 , which is fixable on a side grating in , for example , an oven , a side wall of an oven , or on a furniture body . a middle rail 3 is mounted so it is movable via roller bodies 6 on the guide rail 2 . the middle rail 3 is used to mount a slide rail 4 . at least two , or , for example , three runways 9 for roller bodies 6 are on the guide rail 2 and the slide rail 4 for mounting the rails 2 , 3 , and 4 . the roller bodies 6 are held as a unit in a roller body cage 7 . furthermore , a total of at least four runways , or , for example , eight runways 8 for roller bodies 6 are on the middle rail 3 . at least two runways 8 are assigned to the guide rail 2 and at least two runways 8 are assigned to the slide rail 4 , respectively . two clamps 5 are fixed on the guide rail 2 for fastening the pullout guide 1 on , for example , a side grating of an oven . other fasteners or fastening points can also be provided on the guide rail 2 . the pullout guide 1 is provided on the externally accessible region , that is , on the outer side of the guide rail 2 and the slide rail 4 , with , for example , a ptfe - containing coating , or polytetrafluoroethylene - containing coating . a frontal stop 10 , which is fastened on the slide rail 4 , is also coated on its externally accessible regions with a ptfe - containing coating , for example . a holding pin 11 is also equipped with a ptfe - containing coating , for example . the clamps 5 are also equipped with a ptfe - containing coating , for example . the inner side of the slide rail 4 and the guide rail 2 , on which the runways 9 for the roller bodies 6 are implemented , does not have a coating . the middle rail 3 , which is arranged completely in the inner region of the pullout guide 1 when the slide rail 4 is arranged in the retracted position , also has no coating , at least in the region of the runways 8 . the runways 8 can thus be formed by the material of the rails 2 , 3 , and 4 . the runways 8 and 9 are typically produced from a bent steel sheet . easy cleaning is made possible on the outer side by , for example , a ptfe - containing coating on the rails 2 and 4 on the outer side . the pullout guide 1 can thus be used in an oven , a high running quality being achieved over a long service life . an upper pullout having three rails 2 , 3 , and 4 is shown in fig1 to 3 . an embodiment having at least three rails as a complete pullout is within the scope of the present disclosure . it is also to implement the pullout guide as a partial pullout having only two rails , without the middle rail 3 , or having more than three rails . in addition to the ptfe - containing coating , the pullout guide can also have a peek - containing coating , a pfa , or perfluoroalkoxy - containing coating , and / or an inorganic - organic hybrid - polymer - containing coating . the pullout guide shown in fig1 to 3 is first assembled to form a unit , according to a method of the present disclosure . both the assembly method of the present disclosure and also the coating method can be completely automated . fig4 and 5 show the sequence of a first method , according to the present disclosure , for producing a pullout guide 1 in the form of a complete pullout . the shaping or provision of a plurality of components identified with numerical descriptions 2 - 11 , is performed in a first step 101 . this is performed , for example , by stamping and bending a metal strip . this is followed by a step 102 , in which a treatment of the surface is performed by abrasive blasting to set a surface roughness . this setting can be specified by specifying one or more fixed parameters . these parameters can , for example , be the pressure at which the blasting medium leaves a corresponding blasting nozzle and / or the distance of the blasting nozzle from the surface to be treated . the blasting medium is not dry snow or ice . an abrasive treatment , among others , such as , for example , abrasive blasting , in contrast to smoothing , results in the increase of the surface roughness . thus , the average and the maximum roughness depths in relation to an untreated surface , an overall roughened surface texture is provided and , for example , protruding corners and burrs are eroded simultaneously . the roughening of the surface improves the adhesion of the coating subsequently to be applied . the coating can “ claw ” into the provided surface structure . an intimate connection results between the surface and the coating , and the risk is therefore reduced that components or elements of the coating will detach from the surface . the coating becomes more resistant in relation to mechanical attacks , for example , by scrubbing pads or sharp objects . in step 103 , cleaning is performed by removing the blasting medium from the surface , for example , from the rails 2 - 4 . this may be performed by suctioning or blowing off the blasting medium . in accordance with embodiments of the present disclosure , the pullout guide can also be flushed using a cleaning fluid . in step 104 , assembly of the individual components , with numerical designations 2 - 11 , to form the pullout guide 1 is performed . the individual components 2 - 11 are plugged together and subsequently limited in their movement path by introducing notches or embossments into the rails 2 - 4 . subsequently , the surface is freed of production residues in a further cleaning step in step 105 . this can , for example , be performed by a cleaning fluid . the cleaning in this step is , for example , not performed by abrasive cleaning methods , so as not to cause a change of the surface roughness after step 102 . the non - abrasive cleaning methods include , among others , non - abrasive blasting methods , ultrasonic cleaning , plasma cleaning , laser cleaning , steam cleaning , and chemical cleaning . for example , step 105 can be carried out in an alkaline cleaning medium under ultrasonic action . furthermore , one or more flushing steps using demineralized water can follow , until a neutral ph value has resulted . it is within the scope of the present disclosure that the cleaning of the surface in step 105 can be followed by drying of the pullout guide 1 in step 106 . a first decision stage a can control whether or not drying is necessary as a function of the cleaning method . following the cleaning according to step 105 or the drying according to step 106 , the coating of the pullout guide 1 is at least sectionally performed in step 107 . any high - temperature - resistant plastic comes into consideration , for example , mixtures containing pfa , peek , and / or ptfe . these solutions can be dispersed in a fluid , for example , water , and subsequently applied to the surface of the pullout guide 1 by lacquering or spraying . it is within the scope of the present disclosure that an inorganic - organic hybrid polymer can be applied at least partially to the surface of the pullout guide 1 in a sol - gel method . it is within the scope of the present disclosure that other modes of application can also be used , depending on the type of the applied plastics . thus , for example , mixtures containing peek and pfa can be applied in a spraying method , for example , by plastic flame spraying . the coating is followed in step 108 by drying of the applied coating , in which the fluid vaporizes and only the dispersed plastic particles remain on the surface of the pullout guide 1 . depending on the type of the applied coating and the application method , burning - in of the coating material into the surface of the pullout guide can be performed in a step 109 . the burning - in is carried out at 250 - 500 ° c . the burning - in time lasts a few minutes up to several hours depending on the temperature . for example , residual moisture is removed and a homogeneous polymer layer is implemented during the burning in . following the burning in , lubrication or application of lubricant to the pullout guide 1 is performed in step 110 . the lubricant , like the applied coating composition , has to be high - temperature - resistant up to a temperature of at least 250 ° c . for the use of the pullout guide 1 in the field of ovens . furthermore , the lubricant must be approved for the field of food . it is within the scope of the present disclosure that step 110 , for example , the application of lubricant , can also follow directly after the drying in step 108 . it is within the scope of the present disclosure that tempering can also be performed in step 111 following the drying in step 108 . the tempering may , for example , be performed at a temperature above 200 ° c . tempering according to step 111 may , for example , be performed if an inorganic - organic hybrid polymer is provided as the coating . tempering could be performed , for example , by slow heating to the target temperature over 3 to 7 hours . the target temperature of , for example , 500 ° c . is maintained over 30 to 120 min . slow cooling to ambient temperature is then performed . the tempering can be carried out in a first tempering step 111 a in a nitrogen atmosphere , the coating additionally being compacted . the anti - adhesive effect of the coated surface can advantageously be improved by the tempering step in an oxygen - poor , nitrogen - rich atmosphere . such a surface is additionally more elastic and can absorb impacts on the pullout guide 1 . it is within the scope of the present disclosure that tempering can be performed in an air atmosphere with a mass proportion of approximately 20 - 25 % o 2 in the air , in a second tempering step 111 b , the coating being at least partially oxidized , whereby greater hardness and scratch resistance is produced , for example , in an inorganic - organic hybrid polymer coating . this scratch resistance can within the scope of the present disclosure , be increased , in that a third tempering step 111 c is performed in oxygen - rich atmosphere and having an o 2 mass proportion greater than 25 % in the air , for example , at approximately 650 - 750 ° c . the treatment of the coated component after the drying in step 108 can be controlled . a second decision stage b can be provided for this purpose , which regulates a step sequence directly after the drying . thus , steps 109 , 110 , and 111 a - c can directly follow step 108 . it is within the scope of the present disclosure that the second decision stage b can be automated , it being decided at least on the basis of one measurement parameter after the drying according to step 108 whether burning - in or a tempering step is necessary . the layer thickness , the hardness , and / or an interfacial tension can , for example , be ascertained as actual values and compared to predefined target values . if the actual values correspond to the target values , the coated pullout guide 1 can , for example , be provided with lubricant directly in step 110 and subsequently can be packaged . otherwise , for example , with inorganic - organic hybrid polymers , tempering can be performed by one or more tempering steps 111 a - c or , in the case of peek , pfa , and ptfe , burning - in can , for example , be performed according to step 109 . the step sequence can be set by a third and a fourth decision stage c and d in such a manner that the oxygen supply and / or the temperature are increased step - by - step or continuously . that is so that the tempering is initially performed in oxygen - poor , nitrogen - rich atmosphere at approximately 500 ° c . over multiple hours and is subsequently performed in oxygen - rich atmosphere and / or at 700 ° c . over 10 - 30 min . it is within the scope of the present disclosure that the third and fourth decision stages c and d can also be automated and can be performed by determination of at least one actual value and comparison to a target value , for example , the hardness , the layer thickness , or the interfacial tension . the transition from at least one oxygen - poor , nitrogen - rich tempering step 111 a to one of at least two oxygen - rich tempering steps 111 b , 111 c or step 110 of lubricating the pullout guide is subsequently regulated . in addition , the decision stages b - d can also regulate the duration of each tempering step . subsequently , a quality control of pullout guide 1 is performed in a further step 112 . it is within the scope of the present disclosure that parameters can be ascertained during the quality control , which can be used to control the tempering and burning - in steps , for example , the temperature , the duration , and the oxygen content during the burning - in or tempering of the coating of the pullout guide 1 . fig6 and 7 show an embodiment of a method sequence , which differs from the preceding embodiment essentially in that the treatment of the surface to set the surface roughness according to step 102 is performed with the pullout guide 1 in the assembled state . after step 101 , that is , the provision or shaping of the components 2 - 11 , the assembly of the pullout guide 1 is performed in step 104 . since the setting of the surface roughness may , for example , be performed using sandblasting , isolated surfaces of the pullout guide 1 are initially masked after the assembly . during masking according to step 113 , a protective layer is applied against the abrasive treatment , for example , over the runways 8 and 9 of the pullout guide 1 . this protective layer can have a wax - like consistency , for example , which at least damps the velocity of the blasting medium before it strikes the runways 8 , 9 or entirely prevents the striking , so that erosion of material from the surface of the runways 8 , 9 is no longer possible . this is followed by step 102 , that is , the setting of the surface roughness , roughening of the surface being performed by abrasive blasting using a blasting medium . step 103 relates to the removal of the blasting medium from the surface and can advantageously be combined with step 105 , a further cleaning step for removing production residues . this is followed by optional step 106 , the drying of the pullout guide 1 . the pullout guide 1 is now provided with a coating in step 107 and subsequently processed further similarly to the method described in fig4 and 5 . fig8 and 9 describes an alternative method according to the present disclosure , in particular for the pre - treatment of the surface of the pullout guide 1 before coating step 107 . the shaping of the individual components 2 - 11 of the pullout guide 1 , the assembly of the pullout guide 1 , and finally the cleaning of the pullout guide 1 are initially performed similarly to fig6 and 7 in the method sequence of steps 101 , 104 , 105 . this method sequence may be already carried out completely automatically for uncoated pullout guides 1 . in accordance with the present disclosure , an optional drying according to step 106 of the pullout guide 1 can be performed following the cleaning . after the cleaning according to step 105 or the drying according to step 106 , the coating of the pullout guide 1 with a porous basecoat is performed in a step 114 . this basecoat increases the surface roughness . while material - removing or abrasive methods were described in fig4 - 7 , a material application is performed in the preparation for the coating , before step 107 , in this embodiment of a method in accordance with the present disclosure . the porous basecoat acts as a type of adhesion promoter between the actual coating , which is subsequently applied , and the typically metallic surface of the fitting 1 . for example , with fluoropolymers , such a porous basecoat has proven to be advantageous and improves the adhesion of ptfe , for example . the basecoat can advantageously be implemented as a hard coating , so that in addition to increasing the surface roughness of the fitting 1 , it also ensures an increase of the scratch resistance . for example , silicon carbide or silicon nitride are suitable as porous hard material coatings . they form a suitable basecoat for a coating using an inorganic - organic hybrid polymer , since the inorganic - organic hybrid polymer is based on a silicon - oxygen framework . after the application of the basecoat according to step 114 , a cleaning step 115 of the surface of the pullout guide 1 is optionally performed . this can , for example , be performed by a cleaning fluid . if this is the case , a step 116 of drying the surface can , within the scope of the present disclosure , follow cleaning step 115 . a sixth decision stage f connected downstream from cleaning step 115 ascertains the residual moisture of the surface and , subsequently thereto , supplies the pullout guide 1 either to a drying facility or directly to a further coating facility , which applies the actual coating to the surface of the pullout guide 1 in step 107 . as needed , cleaning step 115 can be performed or coating 107 can be performed directly . a fifth decision stage e regulates which of the two method steps is to be carried out after the application of the basecoat , that is , after step 114 . further method steps 108 - 112 , which can be carried out similarly to the embodiment in fig4 and 5 , follow the coating of the pullout guide 1 in step 107 . within the scope of the present disclosure , as an alternative to the method described in fig8 and 9 , a surface roughness can also be preset by abrasive treatment before the application of a basecoat in step 114 . this advantageously increases the adhesion of the basecoat . according to another embodiment of the present disclosure , a measurement of the surface roughness is performed after the surface treatment according to step 102 and / or 114 . if the surface roughness proves to be inadequate , the method step of surface treatment , for example , the abrasive blasting , is to be repeated . this measurement of the surface roughness can , for example , be performed in the continuous production method by a laser measurement . fig1 and 11 show an embodiment of a method sequence in accordance with the present disclosure which essentially differs from the preceding embodiment , explained on the basis of fig4 , in that instead of the roughening of the surface by abrasive blasting , processing of the surface by brushes 117 is performed . larger irregularities of the surface are eroded and a surface having a maximum roughness depth of , for example , less than 7 μm being able to be produced . the method step of cleaning is required during the treatment of the surface due to the surface treatment by brushing . in contrast to the case of sandblasting , no foreign materials or residues , for example , blasting medium , remain on the surface . additional wet - chemical cleaning of the surface can , for example , be performed in addition to the brushing . through the surface treatment , for example , by brushing , the adhesion of the coating on the surface is improved in relation to an untreated surface of the same material . the brushing 117 may , for example , be performed by processing by rotating brushes from three sides , for example , by metal brushes whose contact pressure on the surface is individually settable . the shape of the brushes may , for example , be concave , in order to also reach corner regions of a rail profile , for example . furthermore , however , no stamping is performed in step 101 , the shaping , so that an endless profile results , which is isolated in a later processing step ( not shown ) before the assembly 104 of the components 2 - 11 to form the pullout guide 1 . the brushing is carried out using a brushing machine , in which one or more brushing stations are arranged . a total of three brushes , for example , may be used per brushing station . the brushing is , for example , performed on the outer surfaces of the rails 2 , 3 , 4 of a pullout guide 1 , that is , on the surfaces which are perceived by the observer of a respective rail 2 , 3 , 4 in the case of a pullout guide 1 in the retracted state . an endless profile is guided in the feed direction through the brushing station . two brushes stand opposite to one another in a brush assembly of the brushing station and allow the surface processing from diametrically opposite lateral external surfaces of the endless profile . for example , the brushes each execute a linear movement toward the endless profile . a third brush for processing an upper side of the endless profile executes a second linear movement , for example , perpendicular to the plane of the first linear movements and the feed direction . the brushes are arranged on a shared linear carriage , which has a defined travel path . the movement of the linear carriage is performed , for example , via a servomotor , the contact pressure of each individual brush being individually settable . multiple brush assemblies can also be arranged on one linear carriage . the speed of the brushes is settable via frequency rectifiers to implement a uniform profile on all sides of the endless profile . the brushes are each operated by a separate drive . at least “ matte gloss ” according to din 67530 is ensured on the surface by the brushing 117 . during the brushing , the profile is freed of longitudinal grooves , which can already be present in the starting material and are only removable with difficulty using means known from the prior art . it is within the scope of the present disclosure that , as an alternative , the surface is cleaned by treatment with ultrasound 118 , a liquid medium being applied to the surface of the components 2 - 11 and subsequently ultrasonic waves are transmitted to the liquid medium by an ultrasound generator with the aid of a sonotrode . these ultrasonic waves result in the formation and implosion of gas bubbles because of cavity effects in the liquid medium , whereby adhering contaminants are eroded from the surface of the component . in an embodiment of the present disclosure that includes cleaning by brushes , the feed velocity of the profile or the component is at least twice the feed velocity of the brushes . a high gloss without brushing and at least matte gloss with brushing can , within the scope of the present disclosure , be achieved on the surface by the treatment using ultrasound 118 . the treatment using ultrasound 118 and the brushing 117 are performed in a an embodiment of the present disclosure on an endless profile . the isolation of the endless profile to form components of a pullout guide 1 ( not shown ) being performed subsequently to the treatment using ultrasound 118 . such an embodiment is advantageous , since it is easily possible to guide an endless profile in a manufacturing facility in the production process . the cleaning process in the ultrasound station can be controlled by ascertaining the profile brilliance . this is performed by regulating the feed velocity of the profile and the vibration amplitudes . the degree of soiling , a further criterion for the quality of the cleaning method , can subsequently be determined by a wiping test . a soft cloth is rubbed over the profile surface and the degree of soiling is determined visually . in embodiments of the present disclosure , the cloth does not have any perceptible soiling . improved corrosion resistance , for example , surface corrosion resistance , in relation to untreated profiles was proven by a 96 hour salt spray test . an evaluation was performed after 16 hours , 24 hours , 72 hours , and 96 hours . since the components used in the assembly of the components 2 - 11 to form the pullout guide 1 are already precleaned , for example , high - gloss components , additional cleaning 105 , as shown in fig1 and 13 , is also possible within the scope of the present disclosure . according to decision stage g , alternatively to the cleaning 105 and the optional drying 106 , immediate coating 107 can also be performed , for example , if , during the assembly or the isolation ( not shown ) of the components 2 - 11 , no chips or other contaminants are found on the surfaces of the components 2 - 11 . the metallic gloss of the profile is , advantageously , maintained in the case of a transparent coating . different ways of processing for components 2 - 11 of a pullout guide 1 are shown in fig1 and 15 . the rails of a pullout guide 1 , that is , the slide rail 4 , guide rail 2 , and optionally , rail 2 being a metal rail , pass through a surface treatment in the form of brushing and ultrasonic cleaning to at least sectionally generate , high - gloss surfaces . in further components of the pullout guide 1 , for example , a stop 10 , a clamp 5 , and / or a roller body 6 , after the shaping 119 , roughening of the surface is performed by abrasive blasting 120 using a blasting medium . after the assembly of the pullout guide 1 , remaining contaminants on the surface and the runways 8 , 9 of the pullout guide 1 are established in the decision stage g and , if they are present , a cleaning 105 is carried out , which is optionally followed by drying 106 . if the surface and the runways 8 , 9 of the pullout guide 1 are free of contaminants , a coating step 107 and a following method sequence , similar to fig4 , are performed . fig1 and 17 show a method sequence of the present disclosure in which the surfaces of rails of a pullout guide are processed after the shaping 101 either by brushing 117 or by abrasive blasting 102 . in a decision step h , in an embodiment of the method sequence , the surface roughness is measured and subsequently a method of surface processing is determined as a function of the degree of the measured surface roughness . following the brushing 117 or the abrasive blasting 102 , a high - gloss surface free of grease , oil , or other deposits is provided by an ultrasonic cleaning 118 . it is within the scope of the present disclosure that in an alternative embodiment , the rails of the pullout guide 1 are isolated directly after the shaping 101 and assembled together with further components by assembly 104 to form the pullout guide 1 . further components of the pullout guide 1 are surface treated similarly to fig1 by abrasive blasting 120 and assembled to form the pullout guide 1 in step 104 . the method sequence following is similar to the embodiment of fig4 . the method shown in fig1 and 19 differs from the method in fig1 and 17 essentially in that instead of the treatment of the surface using ultrasound 118 , or the cleaning by cavity effects , respectively , cleaning by plasma irradiation 121 is provided . in another embodiment according to the present disclosure , the rails 2 - 4 of the pullout guide 1 , for example , the guide rail 2 and the slide rail 4 and optionally the middle rail 3 , at least sectionally have a brushed surface before the coating . the texture of the surface has a main orientation direction , in the longitudinal direction of the rails 2 , 3 , 4 , and includes a plurality of grooves having low penetration depth of , for example , less than 7 μm in the surface , which have individual orientation directions . the mean value of the individual orientation directions or the direction vectors of the grooves specifies the main orientation direction of the texture or the surface structure . the pullout guide 1 is matte gloss . the scatter of the mean roughness value of the metallic surface after the brushing is decreased in relation to an unbrushed surface . the scatter of the mean roughness value of the metallic surface is , for example , less than half of the scatter of an unbrushed surface . the scatter of the mean roughness value is an index of whether a surface having homogeneous roughness is provided or whether a surface has irregularities . an uneven surface can have channels and tension cracks of a maximum roughness depth of greater than 7 μm , for example . the brushed surface extends at least over the entire outer surface of the respective rail , that is , the surface which is visible to the end user in the case of a pullout guide 1 in the installed state . in addition to the measurement of the mean roughness value ra , an ascertainment of the average roughness depth rz and the maximum roughness depth rmax can also be performed , in order to obtain more detailed specifications on the roughness of the surface . metal sheets made of stainless steel , which have been subjected to an abrasive treatment of the surface to set a surface roughness , and an untreated metal sheet made of stainless steel are compared hereafter . the maximum roughness depth and the average roughness depth for the roughened metal sheet and the untreated metal sheet were ascertained . in the present embodiment , the abrasive treatment is performed by a brushing procedure . the metallic surface of the fitting 1 is guided past a brushing station . the brushing station has brushes which are equipped with special grinding bristles . bristles impregnated with abrasive medium as a trimming material for brushes for finish processing are designated as grinding bristles . the bristle material can include nylon , for example . silicon carbide , aluminum oxide , chromium oxide , diamond , and / or zirconium may , for example , be used as the abrasive medium . the grinding effect results through the hard and sharp tips of the grinding material which is enclosed in the brush material , for example , nylon . during the processing of workpieces , a specific quantity of the abrasive medium is always released by the wear of the brush material . the parameters 80 , 120 , 240 , and 2000 therefore correspond to the grain size of the grinding bristles of the respective brush trimming with which the surface of a fitting 1 has been roughened by abrasive treatment . the designation “ series ” identifies the surface roughness of an untreated fitting . the designation “ ultrasound ” reflects the measured values of the maximum roughness depth and average roughness depth as parameters of the surface roughness of a surface of a fitting 1 cleaned using ultrasound . the measurement was carried out in the case of the 120 grain size , the series , and the ultrasound measured values on three fittings respectively , a triple measurement having been performed on each of the three different fittings . a total of nine measurements were thus carried out per measured value . a total of six measurements were carried out on the same fitting in the case of the 80 , 240 , and 2000 grain sizes . the measured values in the following table were measured using stainless steel of the alloy 1 . 4301 ( wnr . 1 . 4301 ( x5crni18 - 10 ), aisi 304 ( v2a )). the measured values in the following table were measured employing stainless steel of the alloy 1 . 4016 ( wnr . 1 . 4016 ( x6cr17 ), aisi 430 ). it can be seen , on the basis of the measured values , that roughening of the surface has occurred as a result of the abrasive treatment , by brushing here . the measurement of the surface roughness was performed using a hommel tester t1000 . in an embodiment of the present disclosure , the average roughness depth rz of the fitting after the abrasive treatment of the surface is greater than 1 . 85 or , for example , greater than 2 . 0 or , for example , greater than 2 . 7 the mean value of the average roughness depth rz of the fitting from at least six measurements is , for example , 3 . 0 - 4 . 0 μm . the mean value of the maximum roughness depth rmax of the fitting from at least six measurements is , for example , greater than 3 . 3 μm , or , may be greater than 3 . 5 μm . the mean value of the maximum roughness depth rmax from at least six measurements is , for example , 3 . 8 - 5 . 2 μm . in spite of the increased measured values of the average roughness depth and the maximum roughness depth in relation to the surface of an untreated fitting , the mean roughness value is , for example , between 0 . 3 - 0 . 49 μm . a uniformly roughened surface may therefore be concluded with simultaneously increased roughness depth . in an embodiment according to the present disclosure , the surface after the abrasive treatment therefore has a mean roughness value ra of less than 2 μm , or , for example , less than 0 . 8 μm , or , for example , less than 0 . 5 μm . in another embodiment according to the present disclosure , the outer surfaces of the pullout guide 1 have a high - gloss surface . this is achieved by a treatment using ultrasound 118 . the mean brilliance of the metallic surface is , with a 60 ° geometry , greater than 150 , or may be , for example , greater than 200 , and is carried out based on din 67530 using a measuring device refo 60 from hach - lange . the following table describes the improved gloss behavior of the fitting 1 due to the cleaning of the surface of the fitting to be coated , which causes an improvement of the appearance of the fitting 1 and simultaneously provides a larger surface for applying the coating . the mean value shown in the table is the ascertained brilliance of the surfaces before and after cleaning by ultrasound . the measurement of the brilliance was performed using an refo 60 portable 60 ° angle reflectometer , the measured gloss units being specified according to din 67530 . in an embodiment according to the present disclosure , a metallic surface after the step of cleaning the surface to be coated according to a method disclosed herein has a brilliance of at least 120 , or , for example , at least 140 , or , for example , at least 190 . cleaning of the surface is , for example , performed in a non - thermal cleaning method in accordance with the present disclosure . the surface roughness specified in the context of the embodiments of the present disclosure relates to the mean roughness value ra , or μm , according to din 4768 . the mean roughness value ra is the arithmetic mean value of the absolute values of the distances y of the roughness profile from the center line within a measuring section . the roughness measurement is performed using electrical stylus instruments according to din 4772 . the measurement conditions are established according to din 4768 t1 for the measurement of the mean roughness value ra . the measurement was performed transversely to the texture of the surface . the distance of two parallels to a center line , which contact the measured actual profile at the highest point and at the lowest point within an individual measuring section , is designated as the individual roughness depth zi . the average roughness depth rz , in μm , is the arithmetic mean of the individual roughness steps zi of five equidistant adjoining individual measuring sections . the maximum roughness depth rmax , in μm , is the greatest value of five individual roughness depths z 1 to z 5 . to monitor the nucleation process and the corrosion behavior , the electrochemical noise is tracked by electrochemical measuring apparatus . stainless steels are enclosed by a protective passive layer of only approximately 1 - 20 nm thickness , which can also partially regenerate itself in the event of damage . this layer is typically thinner than the wavelength of visible light , so that it is not perceptible using typical optical microscopes . the formation , damage , and regeneration of the passive layer is dependent on the corrosive medium , the metal , and the design . the design is determined by the surface roughness , the type of joining , structurally related gaps , and the overall structure . the influence of the corrosive medium is determined by the concentration of , for example , corrosion - promoting agents , such as chloride ions , the temperature , and the flow velocity of the corrosive medium . corrosion can occur on stainless steels in the event of the deviation of parameters , for example , the local oxygen concentration , the extent of possible nuclei on the surface , and the achievement of a critical temperature range . damage to the passive layer by tension cracks and corrosion of the surface can possibly also occur as a result of the shaping . dissolving processes and layer formation processes of the passive layer oppose one another . as a result , the passive layer is not a constant - thickness cover layer , but rather is subject to a dynamic equilibrium . if a liquid medium is subsequently deposited on a metal surface , metal ions go into solution . the remaining electron excess and the potential change are detectable . corrosion always forms in energetically preferred regions , for example , local contaminants or flaws in the layer , such as scratches or upon the processing of pressed - in foreign bodies . these locally delimited regions are typically only briefly available , so that the passive layer can form again . in some cases , however , gap corrosion or progressing hole corrosion occurs . the nuclei and corrosion regions are perceived as a result of the potential changes as a varying signal sequence , the so - called electrochemical noise . causes of electrochemical noise on passive metals are the activation and repassivation processes of the passive layer or the variations thus induced of the charge at the phase interface metal passive layer / electrolyte , respectively . these charge variations can be measured as current or potential noise depending on the experimental setup . however , this method is used in the present embodiments for the quality control of the surface composition after the cleaning of the pullout guide 1 by brushing , treatment using ultrasound , and / or treatment using plasma , in order to ensure the quality of the cleaning and the presence of a nucleus - free passive layer . damage to the surface , as is necessary in other control methods , does not have to be performed in the present embodiments . in addition , ultrasmall nuclei which are barely visually perceptible can be detected and the corresponding cleaning method can be optimized to reduce the number of these nuclei . the occurrence of an increased concentration of compounds having chloride ions on the surface , for example , by salt water spray and the like , is also detectable in this manner . a mean brilliance indicates the extent to which light is reflected upon incidence on the fitting 1 . the brilliance is divided in the case of metallic surfaces into high gloss , medium gloss , and matte gloss and is defined based on din 67530 . the brilliance is measured for different geometries , for example , 20 °, 60 °, and 85 °. the determination of the brilliance is a standardized measuring method according to din 67530 . the measurements were carried out based on din 67530 . although the present disclosure has been described and illustrated in detail , it is to be clearly understood that this is done by way of illustration and example only and is not to be taken by way of limitation . the scope of the present disclosure is to be limited only by the terms of the appended claims .
| 0Human Necessities
|
the invention is described hereinafter with reference to fig1 and 2 . charging the digester with wood chips and evacuating the digester starts the kraft cook . the chips can be packed with steam or be pre - steamed , before the digester is essentially filled with impregnation liquor a from the impregnation liquor tank 5 , soaking and heating the chips . wood chip charging and impregnation liquor charging preferably overlap . an overflow , point a 1 , to black liquor tank 4 , point ab , is carried out in order to remove air and first front of diluted liquor . after closing the flow a 1 , the digester is pressurized and impregnation is completed . during impregnation , a relatively low temperature is preferred , since a higher impregnation temperature will consume residual alkali too fast , resulting in higher rejects , non - uniform cooking and lower pulp quality . preferably , the temperature of this impregnation step is below 100 ° c . in practice , temperatures of from about 20 ° c . to 100 ° c . can be utilized . in the next stage , the wood chips are further treated with hotter liquors before actual cooking . the temperature of the hotter liquors is between 120 to 180 ° c . in fig1 , a method is described where hot black liquor b from hot black liquor tank 1 is pumped into the digester . black liquor from tank 1 is at constant temperature , dry solids content and residual alkali content which makes it easy to maintain conformity from cook to cook . this is important because the hot black liquor has a major chemical effect on the wood and controls the selectivity and cooking kinetics in the main cooking stage with white liquor . the cooler black liquor a 2 , displaced by hot black liquor , is conducted to black liquor tank 4 , point ab , discharging to an evaporation plant for recovery of cooking liquor or to the initial part of the terminal displacement , point e , to terminally treat the calcium dissolved in the impregnation stage . pumping hot white liquor c from tank 3 into the digester continues the cooking sequence . hot white liquor is usually diluted with hot black liquor in order to dilute the very high alkali concentration of the white liquor . after white liquor charge , a smaller amount of hot black liquor charge is pumped in order to flush lines into the digester . the liquor d 2 , displaced by hot liquor above about the atmospheric boiling point , is conducted to hot black liquor tank 2 . after the filling procedure described above , the digester temperature is close to the final cooking temperature . the final cooking temperature can be between about 140 ° c . to 180 ° c . depending on the wood raw material and produced quality . the final heating - up is carried out using direct or indirect steam heating and digester re - circulation . during cooking , optional additional fresh cooking liquor , c , from tank 3 can be added to even out the alkali profile . spent liquor , b 2 , is then removed from the digester to tank 1 or tank 2 . after the desired cooking time when delignification has proceeded to the desired reaction degree , the spent liquor is ready to be displaced with wash filtrate f . initially , liquor e can be used to thermally treat calcium dissolved in the impregnation stage . in the final displacement , the first portion b 1 of the hot black liquor corresponds , together with b 2 , to the total of the volumes b required in the filling stages . the second portion d 1 of displaced black liquor , which is diluted by the used displacement liquor but is still above its atmospheric boiling point , is conducted to the hot black liquor tank 2 , point d . after completed final displacement , the digester contents are discharged for further processing of the pulp . the above cooking sequence may then be repeated . the equipment for the cooking process also includes the tank farm where fresh liquors and spent liquors are stored and heat is recovered . the hot black liquor tank 2 provides cooled evaporation black liquor to the recovery cycle and impregnation black liquor to tank 5 , transferring its heat to white liquor and water by means of heat exchange . the vapor , liquors and gases from digester venting are conducted to the hot black liquor tank 2 and the gases are further conducted to turpentine condensers and recovery of strong odor gases . tank 2 separates liquor coming with digester venting . the hot black liquor tank 1 is provided with heating and circulation piping below the liquor surface . hot black liquor tank 2 is not equipped with any heating or circulation . according to prior art liquor - displacement batch cooking , the pressurized accumulators , e . g . tank 1 and 2 , are constantly held at a significant overpressure , which cause the volatile and non - condensable gases to dissolve into the black liquors . consequently , the turpentine yield is low and process disturbances can occur because the produced pulp and spent liquors contain volatile turpentine compounds , as well as undesired non - condensable gases . fig2 shows tank arrangments according to the prior art , for handling liquors displaced from the digester . in fig2 a ), a tank 23 to which conduit 20 transfers spent liquor from the digester to the tank 23 below the liquor - gas interface 24 . valve 25 controls the pressure ( p ) in tank 23 and flow of gas through conduit 22 . conduit 22 transmits the gases to the next stage , e . g . the turpentine recovery . the arrangement of fig2 a ) is a typical for tank 2 shown in fig1 . tank 23 is always held at overpressure compared to the temperature of liquor fed through conduit 20 by addition of fresh steam , vapor and gases from other tanks or digesters operating at higher pressure . thus , the liquor conducted to the next stage is essentially at the same temperature as feeding liquor as no or little expansion ( vaporization ) occurs in a tank held at overpressure ( when not taking into account other exothermic or endothermic reactions ). in fig2 b ), a tank 33 is shown , to which a line 30 from the digester is connected . conduit 30 transfers spent liquor from the digester to the tank 33 below the liquor - gas interface 34 . spent liquor is circulated through heat exchanger 36 by way of pump 37 and conduit 35 to adjust the temperature of the liquor and to ensure uniform temperature of the liquor transferred to the next cooking stage through conduit 31 . valve 38 controls the pressure ( p ) in tank 33 . conduit 32 transmits the gases to the next stage , e . g . to the turpentine recovery or to another tank . the arrangement of fig2 b ) is typical for tank 1 in a liquor displacement system according to fig1 . tank 33 is always held at a pressure above the pressure corresponding to the boiling temperature of liquor fed through conduit 30 and compared to the temperature of the liquor in tank 33 after temperature adjustment in heat exchanger 36 . overpressure can be provided by addition of steam to the gas space ( g ) of tank 33 . in fig2 c ), a tank 43 is shown , to which a line 40 from the digester is connected . conduit 40 transfers spent liquor from the digester to the tank 43 above the liquor - gas interface 44 . valve 45 controls the pressure ( p ) in tank 43 . conduit 42 transmits the gases and steam to the next stage , e . g . steam to the pre - steaming vessel , heating device or to another tank . tank 43 is a typical arrangement for flash tanks in continuous digesters systems for recovering energy and turpentine . in tank 43 , the pressure is reduced , steam is produced for e . g . pre - steaming or other heating and the temperature of the liquor led through conduit 41 is clearly below the temperature of the liquor fed to the tank through conduit 40 . the expansion is normally over 20 ° c . to efficiently produce steam , which is normally used to heat the chips before cooking . then , a lot of turpentine condenses onto the chips and the turpentine recovery efficiency is low . the method of the invention comprises in a liquor displacement batch system of digester degassing and expansion of at least one of the hot black liquors stored in tanks and conduction of the released vapor in the expansion to the turpentine recovery . “ saturation pressure ” in this context refers to the pressure corresponding to the boiling point of a given liquor . according to the invention , the pressure in at least one of the tanks is kept at or near the saturation pressure of the black liquor . in an expansion zone , vapors are released from the black liquor stored in the relevant tank by adjusting the pressure to or below the saturation pressure of the black liquor brought to the expansion zone . preferably , the pressure is reduced by at the most 1 bar below the saturation pressure of the black liquor brought to the expansion zone . the expansion zone can be located inside the tank or outside the tank . the pressure adjustment corresponds to a temperature difference of about 1 ° c . to about 5 ° c . when comparing the temperature of liquor supplied to the expansion zone and liquor conducted from the expansion zone . thereby , turpentine and volatile compounds and non - condensable gases can be removed from the system to improve operation of the plant and increase turpentine recovery without essentially affecting energy recovery . in a system according to the invention , venting of the liquor - displacement batch digester occurs by venting the digester during the temperature adjustment and cooking phase under liquor circulation . preferably , the top liquor circulation conduit is arranged above the surface of the liquor - vapor interface in the top of the digester or into a vessel above the surface of a liquor - vapor interface outside the top of the digester during the temperature adjustment and cooking phase under liquor circulation to improve flashing . pressure control is used to control venting from the digester at a pressure greater than or at about the saturation pressure of the liquor brought to the liquor - vapor interface . preferably , the pressure is kept at about the saturation pressure of the liquor brought to the liquor - vapor interface . there are two alternatives for processing the gases leaving the digester during the cooking stage of liquor - displacement batch digesters . the gases are either conducted to a hot black liquor tank , where liquor drops are removed , and the gases are from there conducted to turpentine condensers and to the recovery of strong odor gases ; or , the digester is directly degassed to the turpentine recovery facilities , which then include liquor separator , condensers and decanter . the former alternative is feasible when the pressure drop from the digester to the accumulator tank is above about 3 . 5 bar . the latter alternative is feasible when the pressure difference between the digester and the accumulator having the lowest pressure is below about 3 . 5 bar . in the former alternative , the accumulator works as a liquor and is equipped with drop separator equipment , and no separate liquor and drop separator would be required in turpentine recovery . in a batch cooking method according to the invention , at least one of the hot black liquors displaced from the digester is expanded in addition to the digester venting because of reasons set forth above . fig3 shows tank arrangements for spent liquor displaced from the digester according to the invention . fig3 a ) shows a tank 53 to which a line 50 is connected from the digester . spent liquor from the digester is fed into tank 53 above the liquor - gas interface 54 through conduit 55 . valve 57 controls the pressure ( p 53 ) in tank 53 . according to the invention , the valve is preferably of the orifice plate type . conduit 52 transmits the gases to the next stage , e . g . the turpentine recovery . according to the invention , tank 53 is an arrangement for tank 2 shown in fig1 . tank 53 is held at a pressure ( p 53 ), which causes expansion and causes a temperature difference of about 1 ° c . to about 5 ° c . when comparing liquor inlet , 50 , and outlet , 51 , and excluding possible reaction energy . thereby , turpentine and volatile organic compounds and non - condensable gases are efficiently removed from the liquor . in addition , the embodiment requires a pump for pumping out the liquor from hot black liquor tank 2 through heat exchangers to tank 5 or evaporation plant . the advantage thereof is that a higher degree of expansion and depressurizing can be used in tank 2 and according to arrangements shown in fig3 . the expansion can also take place in a special vessel outside the relevant tank before conducting the liquors to the next process stages . the turpentine and other volatile gases are released from the black liquor by reducing the pressure , preferably by at the most 1 bar . fig3 b ) shows such an example , a tank 63 to which a line 60 is connected from the digester . conduit 60 transfers spent liquor from the digester to the tank 63 below the liquor - gas interface 64 through conduit 60 . valve 69 a ) controls the overpressure ( p 63 ) in tank 63 . conduit 62 transmits gases and vapor to the next stage , e . g . the turpentine recovery and further odor gas treatment when the overpressure is adjusted . conduit 61 feeds an expansion vessel 67 with liquor . tank 63 is held at a pressure ( p 63 ), which causes expansion in tank 67 , which is kept at a lower pressure ( p 67 ) and this causes , according to the invention , a temperature difference of about 1 ° c . to about 5 ° c . when comparing liquor inlet , 61 , and outlet , 65 . conduit 66 conducts the released vapor and gases to the next process stage , preferably turpentine recovery . when the expansion zone is located inside the tank and the tank is provided with liquor circulation , the circulation return loop is , according to the invention , connected to the upper part of the tank above the liquid surface in order to increase the liquid - gas interface . before any significant use of the liquor in the next batch , expansion takes place . heating and pressure control provide the expansion driving force . heating is required to adjust the temperature of the hot black liquor for use in the next batch . fig3 c ) and d ) shows examples how this can be arranged . according to the invention , heating the liquor to about 1 to about 5 ° c . above the boiling temperature at the expansion pressure and depressurizing accordingly expands the black liquor , whereby vapor is produced . the vapor released in the expansion zone is conducted to the turpentine recovery facilities . arrangements according to fig3 c ) and d ) are suitable for tank 1 of fig1 in a liquor displacement batch system . the method can also comprise circulation of the contents in tank 2 of fig1 to the upper part of the tank above the liquor level . in the arrangement according to fig3 c ), heating is applied in heat exchanger 76 to create a higher temperature in the liquor brought through conduit 77 to the expansion zone in the gas space of tank 73 , where a pressure reduction is carried out corresponding to a temperature difference of about 1 ° c . to about 5 ° c . when comparing temperature of liquor in conduit 77 and 71 . in the arrangement according to fig3 d ), liquor is pumped from tank 83 through heat exchanger 88 to a separate expansion vessel 92 , the pressure of which is regulated by valve 94 b . flash steam is carried off through conduit 91 , and liquor is returned to the bulk of liquid in tank 83 via conduit 90 . the pressure difference between conduits 89 and 90 corresponds to a temperature difference of about 1 ° c . to about 5 ° c . according to an embodiment of the invention , a tank with heating device has a mixing - reducing barrier separating two groups of tank connections : on the one hand the liquor inlet to the tank and the liquor inlet to the line conducting liquor to the heating device , and on the other hand the line or lines distributing liquor or flash steam back into the tank , and the tank outlet . the gas space is common for both sides . the mixing - reducing barrier may be a wall with holes or a wall with pipes connecting both sides of the wall to adjust liquor levels . this equipment will ensure uniform properties and low turpentine content of the liquor distributed to the next stage . fig3 c ) shows a barrier w separating the liquor inlet 70 to the tank 73 and a line 75 conducting the liquor to the heating device 76 from the line 77 distributing the liquor back into the tank 73 to ensure uniform properties of liquor led through 71 to the next stage . also , fig3 d ) shows a barrier w separating the liquor inlet 80 to the tank 83 and a line 85 conducting the liquor to the heating device 88 from the line 90 distributing the liquor back into the tank 83 to ensure uniform properties of liquor led through 81 to the next stage . according to the invention , a system which fits continuous cooking uses an expansion of about 1 ° c . to about 5 ° c . for spent liquor led from the digester in an arrangement analogous to that of fig2 c ). these systems will efficiently remove turpentine and other gases through conduit 45 with minimum loss of energy . thereby , the energy efficiency of the continuous digester system is not affected . the liquor conducted through conduit 41 is further depressurized in flash tanks following tank 43 . a clear difference of the invention compared to prior art flashing ( in e . g . continuous cooking ) is that the temperature difference and pressure drop in flashing according to the present invention are significantly lower . typical pressure drops in primary flash tanks of continuous digesters are over about 2 - 3 bar , corresponding to a temperature difference of over about 25 - 30 ° c . in prior art flashing of spent liquors in cooking systems , the main target is energy saving by using the resulting flash steam to heat the charged chip material . we have surprisingly found that only a low degree of expansion is needed to release turpentine from the spent liquor . the advantage of using a lower degree of expansion is , that less energy is lost to turpentine recovery and lower condensate amounts are produced . this fits the heat recovery principle of liquor displacement batch cooking systems , where hot black liquor is recovered at the end of cooking and its energy is reused , 1 ) as a direct heating medium to be pumped into the digester during a subsequent batch , and 2 ) to heat white liquor by means of heat exchangers . this also fits continuous cooking to increase the amount of turpentine recovered and improve operation of the digester and washing without essentially affecting the energy economy of the plant . thus , the primary flashing in a continuous system according to the invention would use a low depressurizing temperature drop . a secondary flashing with a larger temperature drop may then be carried out on the once flashed liquor , for the purpose of heat recovery . in an industrial liquor displacement batch cooking plant , softwood chips were cooked . the liquors from tank 1 and tank 2 shown in fig1 were expanded using a laboratory expansion tank connected to the process . the turpentine balance over the expansion tank was calculated . table 1 shows the results . table 1 . results of flashing liquors in tank 1 and 2 at various depressurizing degrees expressed as temperature difference . δt of 0 ° c . represent prior art with applied overpressure in the expansion tank . for the tank 1 results , the turpentine concentration was considerably reduced , when the liquor was depressurized by 0 . 2 bar and the temperature decreased by 1 ° c . a temperature difference of 5 ° c . decreased the turpentine content even more . for the liquor in tank 2 , an expansion using a temperature difference of 1 ° c . also showed significant reduction . the surprising results of the example clearly show that there is no need to use an expansion corresponding to a 20 - 30 ° c . temperature drop and corresponding pressure drop in order to remove turpentine from black liquor as the loss of energy is then much higher .
| 3Textiles; Paper
|
the various aspects of the invention are further described with reference to the accompanying drawings , a few of which have already been briefly referred to . in the drawings : fig2 schematically illustrates a pulse analysing system in accordance with the invention ; fig9 a , 9b , 10a and 10b show the results of use of the system of fig8 ; fig1 shows methods for analysing two - dimensional images using one - dimensional datasieves ; fig1 illustrates use of a matched datasieve for image processing ; fig1 a and 15b shows the combination of two image decomposition systems ; and for convenience , the different aspects of the invention are described firstly with respect to basic datasieve operation , including noise reduction and pulse analysis , and secondly with respect to pattern recognition . data compression and linear / non - linear switching are also incorporated in the description and , finally , implementations of the fast datasieve circuits are described . fig1 previously described shows a known weighted median filter circuit hitherto employed with larger window size , for achieving noise reduction . referring to fig2 there is depicted a video camera 100 supplying an analogue signal 102 through a buffer amplifier 104 and an a / d converter 106 to a datasieve 108 . the datasieve comprises a succession of ordinal value filters of integrally increasing value , providing m bandpass outputs 110 , one from each stage . whilst the a / d converter is preferable , it is not essential , as the datasieve 108 could operate on an analogue signal . the datasieve 108 effectively comprises a pulse width discriminator of m stages , the output of each stage being subtracted from its input to produce a bandpass output which contains pulses of width unique to that stage . thus , the datasieve decomposes the input signal into component pulses according to their widths . the m outputs are taken to a pulse selector 112 , which selects a predetermined subset of the pulses arising at its multiple inputs and adds them together to produce an output 114 containing only data pulses determined by the selection . the signal 114 is passed through a d / a converter 116 to a video monitor 118 , which displays an image synthesised by the pulse selector and so contains only those features of the input signal selected by the pulse selector 112 . on the right hand side of fig2 part of the original image 120 is shown , white lines highlighting the two scan lines which produce the analogue signal shown at 102 . below this , the scan lines are shown at 122 broken down into a set of constituent pulses of different widths . amplitude is shown by intensity , pulse width is plotted logarithmically along the vertical axis and the horizontal axis represents time . the output 114 more specifically shows the result of selecting the patterns of pulses which represent the eyes of the subject in the image 120 and recombining to form an amplitude modulated video signal . the unwanted ( non - eye ) signals are substantially attenuated . the circuit diagram of fig3 exemplifies the system of fig2 whilst fig4 illustrates a practical realisation of the circuit . in these two figures , reference 130 denotes an ordinal value 1 filter , reference 132 an ordinal value 2 filter and reference 134 an ordinal value 3 filter . ordinal value 3 filter may be a median filter or some other rank filter ( the ma 7190 is , for example , able to find any rank ), or some combination of rank filters . filters of ordinal value 4 , 5 et seq follow , but are not depicted . box 131 represents a &# 34 ; twos compliment &# 34 ; circuit . box 137 represents a &# 34 ; twos compliment and negate &# 34 ; circuit . adders 136 , 138 etc . provide outputs to the pulse selector , full details not shown . in the practical circuit of fig4 pins 8 and 9 of each filter 130 , 132 etc . connect to a central bus . for filter 130 , the window is set to 3 and the rank to 2 ; for filter 132 the window is set to 5 and the rank to 3 . fig5 to 7 show a modified system in analogous manner , applied to the output 140 of a photomultiplier 142 . however , in this embodiment , pulse selection and adding is effected within the datasieve 144 , which constitutes a pulse width discriminator with m stages directly providing an output 146 without any , or at least with many fewer , short term pulses or impulses which are unwanted in the final output 148 produced by signal analyser 150 . the photomultiplier 142 is shown providing an output 140 obtained by monitoring the fluorescence of a flow cytometer . this output 140 clearly comprises a basic wanted signal which can be represented as a series of pulses longer than m samples , together with random uncorrelated noise signals of short duration . the cleaned output at 148 is equally clear . typically , this output contains only pulses of duration greater than 20 data samples . in more detail , fig5 shows photomultiplier monitoring , e . g . fluorescence of cells in a flow cytometer at 142 . the output signal 140 represents an underlying ( wanted ) signal that can be represented as a sequence of pulses longer than n samples , and ( unwanted ) random uncorrelated noise that is represented as pulses shorter than n samples in duration . reference 141 denotes a buffer amplifier , and 143 an analogue to digital converter ( most but not all datasieve and pulse selectors will work with digital data ). the datasieve pulse width discriminator 144 has a total of n stages , the output 148 of which represents the underlying ( wanted ) signal without any ( or many fewer ) short term pulses or impulses . the signal analyser 150 further analyses the underlying ( wanted ) signal that has been cleaned by the datasieve . ii ) the wanted signal 148 . it consists of all pulses of greater duration than 5 samples . the shorter pulses ( unwanted noise ) have been severely attenuated , and the edge location , sharpness and pulse widths are better preserved by the datasieve . iv ) the inferior result of filtering through a linear gaussian filter bank . it does not discriminate pulses very well despite being the optimal f . i . r . filter for localising frequency and scale . it is again to be noted that the illustrated a / d converter 143 is not essential . the circuit diagram of fig6 and the practical realisation of fig7 will be clear without detailed description , by analogy with the description of fig2 and 4 . in this case , however , the required output is provided by the output of the final filter of the datasieve . pulse selection is effectively incorporated within the datasieve . in another aspect , the present invention concerns a pattern recognition system that depends upon an alternative , general purpose , multiscale decomposition , namely the datasieve . it is used as item 200 in fig7 and is designed specifically to yield multiscale primitives that are suitable for pattern recognition . the design commences thresholding operations at the initial decomposition stage . thus , the datasieve 200 is appropriate for isolating and locating the position of objects with sharp edges arising from non - linear events , because there is an intrinsic binding between the scale of objects and their edges . a typical example is the image due to one object partially occluding another . it can represent structural information in a way that is independent of spatial frequency , has different uncertainty trade - offs , and can be used for scale , position and contrast independent pattern recognition . fig8 shows the outline of a typical image analysis system . the decomposition by scale of the signal 202 is conventionally performed through a linear process device . however , in accordance with this invention , the datasieve structure 200 is used . the two are pin compatible and so standard edge finding 204 , classification 206 and thresholding 208 , 210 processing of the intermediate signal primitives 212 can be performed . however , the present invention also concerns unconventional approaches to steps 204 to 210 that the datasieve enables . it is important to note that these non - linear ordinal filters are neither commutative nor associative and so different arrangements of sub - filters yield different overall results . this difference from linear filters is fundamental for it means that different arrangements ( structures ) of filters are functionally distinct . the cascade structure introduced by the datasieve in which ordinal filters of increasing window width are serially coupled together produces a distinctive and useful result . it is important to emphasise that it is the cascade structure of a series of increasing scale ordinal or rank filters that is important , not the particular ordinal filter used at each stage in the series . this arrangement has advantages over alternatives , because it is found that successive stages of a median ( or other combination of rank ) filter cascade eliminate the distortions introduced by a single long filter . this is a problem encountered when using , for example , pairs of long median filters required to discriminate a van from a bush , in u . s . pat . no . 4 , 603 , 430 . the datasieve exploits the well - known property of ordinal ( i . e . rank order ) filters of simplifying signals whilst preserving edges ( see for example u . s . pat . nos . 4 , 441 , 165 , 4 , 439 , 840 , 4 , 506 , 974 ). this characteristic has been recognised since the introduction of the closely related binary morphological filters in the 1950s although it was not until the mid - 1980s that these filters were extended to grey scales by using sequences of max and min operations . in the late 1970s a separate line of research developed around median filters , but recently the two approaches have converged with the development of stack filter theory , umbrae and finally the datasieve . the systems described herein represent pattern recognition based on the primitives obtained from the datasieve . the information in the primitives derived from the datasieve has been termed the granularity , granules or rects . it is found that the granularity can be used directly to simplify signals and to recognise patterns in both one and two dimensions . the advantages of doing this are illustrated in fig1 a , which clearly shows that the right eyes can be located in the test image and the remainder of the images rejected . the figure shows the result of applying the datasieve to the signal granules 200 ( fig8 ) obtained from the image in fig9 a . as in the case of linear processing ( fig9 b ) the mask is derived from the eye at the centre . the improved result achieved by use of the datasieve ( fig1 a ) is clearly better than the result obtained by linear processing ( fig9 b ). in another application of the method , a means of recognising elements of an image that are visually important is produced . this may be used for image compression . the properties of granules are exploited to form an information reduced image as illustrated in fig1 b . this shows the output from a lowpass 2d datasieve ( circular mask , order 10 , i . e . from the tenth stage of the datasieve ) to which only the largest 10 % of granules obtained from the first 9 stages have been added . the middle region of the image is to be compared with the middle of fig9 a . adding 100 % of granules would result in a perfect reconstruction . with regard to one dimensional recognition at single scale using a matched datasieve , the granularity ( signal primitives obtained by datasieving ) of a one - dimensional ( 1d ) target signal can be used to design a circuit , based on a datasieve , that discriminates a target from background signals . it is called a matched datasieve . the method requires the signature of the target in terms of its granularity ; in other words the target is datasieved to obtain its granularity . in the 1d case each granule is described by three parameters : its position x , its amplitude a , and its scale or mesh m . one of the granules , usually the first , is then designated to be the reference granule and its value of x is subtracted from each x . as a result all x parameters become offsets relative to the reference granule . in one implementation of the matched sieve the process of obtaining the target parameters takes place before designing the matched sieve itself . in another implementation the target parameters are refined , using standard adaptive filter methods that incorporate an error measure and negative feedback . the parameters are then used to design or configure a datasieve matched to the target . this is achieved by a granule ( in 1d a pulse ) selector that only passes those patterns of granules the parameters of which match the target parameters within controlled limits . the role of the granules selector in a 1d matched sieve is shown in fig1 . fig1 shows at ( i ) part of original image , wherein white lines highlight the two scan lines used for the worked example . this is then sampled using a video camera 220 generating an analogue line scanned image ( ii ). a buffer amplifier 222 feeds an analogue to digital converter 224 ( most but not all datasieve and pulse selectors will work with digital data ), and the digitised signal is then datasieved at 226 to a total of m stages . the output of each stage is subtracted from its input to produce bandpass output that contains granules of scale unique to that stage , i . e . it decomposes the input signal to component granules according to their widths and two dimensional geometry . the parallel outputs are then passed to a granule selector 228 which selects a subset of those granules arriving at its inputs and adds them together to produce an output . the result ( iii ) shows the result of selecting patterns of granules that represent the eyes and recombining to form an amplitude modulated video signal . unwanted ( non - eye ) information is substantially reduced and is then passed through a digital to analogue converter 230 ( if 226 and 228 are operating on digitised data ) and displayed on a video monitor 232 that displays an image that has been synthesised by the pulse selector and so contains only those features of the input that match the pattern of pulses selected by selector 228 . reference 234 indicates that the datasieve 226 provides m bandpass outputs , one for each stage , to the selector 228 . this selector ( delivering different order granule signals 236 ) in a learn mode , stores granules ( g - target ) and subsequently at 238 match mode ands g - target and incoming granules ( g - image ) to provide outputs only if g - target is exceeded . also in accordance with the present invention , fig1 serves to illustrate three improved methods for obtaining two - dimensional ( 2d ) image primitives using 1d datasieves . in one implementation , at each stage of a datasieve the output of the previous stage 250 is scanned at several angles a and the several sequences of samples ordinal filtered with a window appropriate to the stage in the datasieve . the several resulting images are then either ored together at 252 or anded together at 254 to form the output image at that stage 256 . in another implementation the image at each stage 250 is first scanned at one angle a , and the sequence of samples ordinal filtered with a window appropriate to the stage in the datasieve . then the resulting image is re - scanned at another angle a 2 and the sequence of samples ordinal filtered again with a window appropriate to the stage in the datasieve . in other words the operations are carried out in series as indicated at 258 . this is repeated for all angles and the final output image 256 is the output of that stage . a more general case of pattern recognition using a matched sieve would handle multidimensional signals , for example , images . fig1 shows how this can be achieved and fig1 shows a circuit to implement it . in stage 260 ( fig1 ) the image 262 ( shown as the image at the bottom of the pile of object 263 ) is decomposed to a series of images of increasing scale . this is effected using a datasieve . the next step is to take the difference between pairs at increasing scale . the difference images contain scale and geometric information associated with objects in the image , which is the granularity , g . the difference images are shown with scale increasing g 1 image , g 2 image , g 3 image . . . the granularity of the object is also shown at each scale . the next step 264 is to decompose the target ( shown as an image 265 at the bottom ) to a series of images of increasing scale . this is performed the same way as with the image . differences are taken to form g 1 target , g 2 target , g 3 target . . . and all parameters of non - zero values are stored in g target . in the case of 2d images , the result is a 3d mask . one of the granules in the mask becomes the reference and all offsets x are made relative to the reference granule . in a similar manner all m and offsets x are scaled according to the parameter m of the reference granule . in the final step 266 , the target mask is passed through an image box in the x , y , z planes ( 2d images have three planes , 1d have two planes namely x position and scale z ), scaling as appropriate . at each position , the target x , y , z is scaled according to the value z of the reference element . then every element in the target box is anded with the associated element in the image box to increment a counter representing the numbers that are non - zero at each z ( order ). if more than the threshold number of elements are non - zero , then a function of each matching element is outputted to the associated output granularity , g - output , and the elements of g - outputs are added at each x , y position to form the output image . an example of result from such a matched datasieve is shown in fig1 left panel . fig1 shows a circuit for a matched datasieve . the signal at position x , y of , for example , an image is input 300 ( which corresponds to the input 226 in fig1 ) and three possible outputs are available . output 302 is a lowpass datasieved result , output 304 is a measure of the quality of match at the particular point in the input and output 306 is the value of the matched sieve output at position x , y . output 306 corresponds to the input to the 230 in fig1 . 308 is a standard datasieve , typically using a circular mask and median filter at each stage , as previously described . it comprises three main elements at each stage . 310 is the ordinal filter , and 312 is a delay line to compensate for the delay introduced by 310 . 314 is an adder that finds the difference between the input 300 to 310 and its output . there are m difference signals 316 , one corresponding to each scale or level in the datasieve . one or more may be combined together . the circuit comprising 318 , 320 , 322 , 324 provides a means of determining and storing the parameters of the target . when item 326 is set , the signal 316 is routed to set of buffers 324 where the granule values are stored whenever 326 is cleared . signal 338 is a granularity image of the target ( as seen in 264 in fig1 ). the set of buffers 320 represent a delay line with as many elements as is necessary to encompass the target . it will be a two - dimensional array if the target is an image . the parameters of some but not all the granules is stored in 324 , selection being made by the thresholding devices 322 . elements 320 , 322 , 324 together represent an example of a perceptron . the outputs from 324 are used to gate outputs from another set of threshold devices 330 . elements 332 and 330 are similar to 320 , 322 in that they store a spatial sequence of samples , the values of which are thresholded to remove unwanted small granules . signal 334 is a granularity image as seen in 260 in fig1 . 336 is a buffer that is enabled by signal 338 . it is this step that selects the set of granules in the image according to the target pattern stored in 324 . in order to determine the quality of match at the particular scale m on the output from 308 , the outputs of 336 are summed at 340 and the result thresholded at 342 either locally at a particular scale m or collectively over all m . if the signal exceeds the threshold , a gating signal 344 is used to gate the outputs 346 by enabling buffer 348 . the selected granules 350 at each x , y , m are then summed at 352 and the intensity at that position is output 306 . an alternative output at each x , y is a measure of the total match at that point and this is obtained by summing at 344 for all m scales . an element of the full circuit is illustrated but it is understood that similar circuits exist for handling each stage of the datasieve . it is also understood that a steering circuit exists for applying the scaled parameters 354 , 356 to each of the scales m . in order to recognise objects that are a mirror image of the target , means of switching the order of output 328 is provided . if all elements of buffer 336 are enabled ( so ignoring the target ) and the selection based on 344 is also ignored , the device becomes a means of selecting component granules according to their amplitude by means of the threshold devices 330 . the result , when combined with a lowpass signal , is a simplified representation of the original signal . for example , fig1 b , shows an image of lenna that has been simplified in this manner . the key property of datasieves that distinguishes decomposition by this route , as opposed to conventional methods , is the way sharp edged objects are not spread to many scales . the less the information is spread , the fewer target parameters need to be stored . conversely , conventional linear signal processing methods do not spread smoothly contrasted objects to many spatial channels . it is , therefore , desirable to use whichever decomposition , linear or datasieve , that yields the least spread of information over different scales to form a hybrid filter . the advantages of switching between non - linear and linear methods , although not with respect to a datasieve , has been published , e . g . &# 34 ; the scheme is based on a combination of linear and non - linear filters and a decision structure . the decision structure is designed in such a way that it switches between the linear and non - linear filters depending on the presence of a signal component which could give rise to serious aliasing artefacts . in this way , filtering with the elimination of both blurring and aliasing is achieved .&# 34 ; ( also see fig3 in the paper by defee , i ., soininen , r ., and neuvo , y . &# 34 ; detail - preserving filters with improved lowpass characteristics &# 34 ;, signal processing , elsevier , pp 1157 - 1160 ( 1992 )). however , this prior proposal does not make use of granularity . instead , an ad hoc method is employed for identifying outliers , which results in unreliable , pixel by pixel , switching . a more reliable method is identified below . a measure of the spread of information over the different scales can be obtained by finding the variance ( power ) of output 346 ( fig1 ) over all the m . fig1 ( a ) shows a circuit which compares two signals input at 401 and selects the appropriate datasieve , or linear matched filter , depending on the result . item 400 produces a datasieve decomposition in terms of granularity . item 402 produces a linear decomposition in terms of spatial wavelength related parameters . these outputs , which may be equivalent to outputs 304 and 306 in fig1 , are connected to items 404 , 406 respectively . the inputs to 408 represent the variance ( power ) associated with the distribution of granularities ( wavelengths ) associated with outputs 350 in fig1 and the equivalent measure from the linear decomposition . 408 then either gates 400 to the output 410 using 404 or respectively gates 402 to the output using 406 . it is also possible for a signal to contain both smooth contrasted and sharp edged objects , in which case selectivity of a system can be improved by combining the linear and non - linear decompositions . fig1 ( b ) shows a suitable circuit . a datasieve non - linear decomposition is performed by 420 and a linear decomposition by 422 . in this case these steps may include an element of matching . the outputs , for example , might be such as fig9 b and fig1 a . component 424 then either ands the two results or ors them together to produce output 426 . a fast datasieve employing run length coding is now described with reference to fig1 to 18 . the principle of operation of a fast one - dimensional datasieve is now described by means of a pseudo - code program for one - dimensional decomposition . it should be understood that faster hardware implementations are described later . 1 ) a ) runlength code the data as a series of triples ( vectors ) r =( v , n , s ), where v is the value of the run , n is the number of samples within the run and the flag s signifies whether the run is part of a monotone or extrema let i be the index into the current run - length : if ( v i - 1 & lt ; v i & lt ; v i + 1 ) then s i = 1 monotonic upwards if ( v i - 1 & gt ; v i & gt ; v i + 1 ) then s i = 2 monotonic downwards if ( v i - 1 & lt ; v i & gt ; v i + 1 ) then s 1 =- 1 maximum extremum , hill top if ( v i - 1 & gt ; v i & lt ; v i + 1 ) then s i =- 2 minimum extremum , valley floor also , record the smallest value of n , when s i & lt ; 0 , as min n . 2 ) set the mesh of the current stage in the datasieve to min -- n , i . e . let m = min -- n if ( s i & gt ; 0 or n & gt ; m ) copy to output else if ( median or root median ) filter the data m values before to m values after the extremum , a total 2m + 1 samples . whenever the root median filter is being implemented , there is no need to use a conventional sort . it is enough to choose the largest of v i - 1 and v i + 1 when s i =- 1 or the smallest of v i - 1 and v i + 1 when s i =- 2 . else if ( alpha or beta filter ) either filter the hill - tops , to implement a min followed by a max . operation , or the valley - floors , to implement a max followed by a min operation . to perform a min followed by max , choose the largest of v i - 1 and v i + 1 when s =- 1 and to perform a max followed by min choose the smallest of v i - 1 and v i + 1 when s i =- 2 . 4 ) if ( min -- n & gt ; maximum mesh required or min -- n & gt ;= n the number of samples ) then finish else if ( min -- n = m ) go to 3 ( this will not happen at the root of median or when applying an alpha or beta datasieve ) a hardware implementation is shown in fig1 to 18 and is described in detail , later . in the case of two - dimensional or multi - dimensional signals , the values of the flag s have to be extended to indicate two - dimensional monotones and the presence or not of discontinuities in the signal in more than one direction . however , the technique of flagging regions for which no computation is required so restricting the amount of processing that has to be carried out , remains equally applicable . a 2d datasieve algorithm is now described can reduce the circuit complexity significantly . it takes the form of a simple two dimensional square filter that exploits the property of the datasieve method that results in the signal , for example a two dimensional image , becoming simpler as it passes through the stages in the datasieve . 1 ) transfer image horizontal scan line by line to buffer h and again vertical scan line by line to v , they are indexed using j and i respectively . runlength code the rows of h and volumns of v and transfer the result to buffer rh and rv respectively , these buffers are indexed using rj and ri . 2 ) load buffer hs at each position ri according to the following rules if ( rh ri - 1 & lt ; rh ri & lt ; rh ri + 1 ) then hs ri = 1 monotonic upwards else if ( rh ri - 1 & gt ; rh ri & gt ; rh ri + 1 ) then hs ri = 2 monotonic downwards 3 ) runlength code the flags vs and hs to form rvs and rhs respectively . 4 ) starting at the top left position in the image , i , j but allowing for the window and that other than at the first stage of the datasieve , j will have been incremented . 5 ) let variable top be the range of indexes that access the top row of the image elements within the window centered at position i , j . likewise let variable left be the range of indexes that access the left column of the image elements within the window centered at position i , j . 6 ) let the minimum i in rh indexed by left , for which elements of rh are the same and for which elements of rv indexed by top at each position i are all the same , be i -- mina let the minimum i in rhs indexed by left , for which element of rhs are the same and for which elements of rvs indexed by top at each position are all the same and the image within the window is monotone in all other directions , be i -- minb if ( i -- min & gt ; current position i and neither rv nor rh start runs at this position ) then for i = i to i -- min transfer the input elements of v and h to the equivalent output buffers 8 ) if i has reached the end of the line increment to the next line by incrementing j and go to 5 . 9 ) if i and j have reached the end of the image and datasieve has not finished , then increase the size of the window and go to 1 . the result is that although later stages of the datasieve , have large windows the signal contains large regions that are either flat or monotone in 2d ( because of the datasieve circuits ). hence the proposed circuit will be faster since only the top and left edges of the window proportional to m ) have to be processed complexity proportional to scale m in contrast to the standard approach in which all elements in the window have to be considered separately ( complexity proportional to m squared ). the approach is not confined to square filters or to rectangular lattice images . one possible hardware implementation is of the one dimensional circuit shown in fig1 to 18 . fig1 shows the outline of the fast datasieve circuit . in this example , the input signal is assumed to be runlength coded . the runlength coded signal 500 is applied to a combined gate and buffer 502 . this contains an input buffer and a computation buffer . the combined gate and buffer 502 is connected through a control bus 504 to a controller 506 . the controller instructs 502 to transfer a new run or sequence of runs from the input buffer to the computation buffer . the content of the computation buffer is then transferred to the rank operator unit 510 . this performs a single stage of smoothing using scale parameter m = 1 . the result 512 is passed to an output gate 514 . the routing of the signal achieved by 514 depends on the type of datasieve being implemented . if it is an alpha or beta datasieve then each stage of the fast datasieve performs two rank filtering steps , either a minimum then maximum or a max then min . consequently , signal 516 is either routed to a filtering step of the appropriate type before being passed to the next stage for which m = 2 , or it is recycled through 502 and reprocessed with the alternate operation before being passed to the next stage . if the datasieve to be implemented is based on root medians the output of 514 is either routed to sufficient further stages of 510 to assure that the minimum extremum runlength is greater than m samples long , or is recycled back to 502 whereupon the segment of signal is repeatedly processed until the minimum extremum runlength condition is met . the control system 504 , 506 provides overall supervision of the circuitry . this is assured in a finite number of iterations . during these sieving operations 502 buffers the input signal . the overall output of the datasieve stage 516 is finally passed to the next datasieve stage for which m = 2 . an alternative , bandpass , output 518 is provided by a circuit 520 which , when necessary , expands the runlength coded input 500 and the output signal 516 , and takes the difference . it is not essential for the signal to be or remain runlength coded . indeed there may be advantages in implementing the whole circuit as an analogue filter , using buffers created from analogue sample and holds . using this approach it is possible to produce either a finite segment length fast datasieve transform ( alternatively known as the fast sieve transform ), which operates on a single block of data , or a continuous , one sample in - one sample out sieve that could be analogue in and analogue out . it should be noted that in one dimension alpha and beta filters can be implemented directly using a predictable number of rank order operators because the output of each stage is idempotent in one pass . in the case of a root median a number of passes are required to find the root . however , this does not lead to a large increase in the number of rank operations at 510 required for a given sieve . this is because multiple passes at a given m are only required if there is an oscillation of scale m and an oscillation at one scale necessarily reduces the number of oscillations at other scales . in one example of a circuit that takes advantage of this , there are a number of stages each such as indicated in fig1 . each stage median filters the signal with an m that is dictated by the minimum runlength present in the signal at the output of the previous stage . consequently , if a median filtering operation at scale m does not increase the minimum runlength present in the signal , so the next stage repeats the median filtering operation at the same scale . this is repeated until the desired m is reached . it is found that the maximum number of stages required is finite and workable . fig1 shows a circuit 530 for finding the extrema . the input 532 is assumed to be runlength coded , although it need not be . let the number of samples in a run be n and the amplitude of the run be v and the runlength structures , or positions on a stack , or the sequences that form runs , be indexed by i as indicated at 534 . segments of the signal that are part of an increasing monotone , i . e . v i - 1 & lt ; v i & lt ; v i + 1 , are detected by the comparators 536 and the and gate 538 and are signalled by 540 becoming logically true . likewise those segments that are part of a decreasing monotone , i . e . v i - 1 & gt ; v i & gt ; v i + 1 , are detected by the comparators 536 and the nor gate 542 and are signalled by 544 becoming logically true . extrema , i . e . maxima or hill tops v i - 1 & lt ; v i & gt ; v i + 1 , and minima or valley bottoms , v i - 1 & gt ; v i & lt ; v i + 1 , are detected by the comparators 536 and the eor gate 546 and are signalled by 548 becoming logically true . ( in the case of alpha or beta filters it is necessary to distinguish hill tops from valley bottoms , and this can be achieved by further simple logic gates .) fig1 shows the rank filtering step 550 of a fast datasieve . the input 552 is assumed to be runlength coded . local extrema , the hill tops and valley floors are flagged using the circuit 554 ( detailed in fig1 ). the output of 554 , namely 556 , is used to control a gate 558 . the gate 558 either routes 552 or 560 to the buffer output 562 . 558 routes 552 to 562 whenever the 552 is monotonic or the extremum has a run of greater than m samples . otherwise it routes 560 to buffer 562 . when it routes 560 to 562 it also controls the addressing of buffers 564 and 562 such that 560 is correctly positioned in the output buffer and the correct output 566 is selected . circuits 534 and 536 from fig1 are also shown in fig1 .
| 7Electricity
|
the method of the present invention may be used with standard mri apparatus if such apparatus has control capabilities where parameters of the radio frequency ( rf ) pulse train and gradient may be easily varied . referring to fig1 a simplified block diagram of an mri device is illustrated . the mri device includes a main magnet 10 which provides a magnetic field b 0 that generates a steady magnetic field realizing a polarization of the nuclei of the protons of the specimen or subject for which an image is desired . within magnet 10 there is a cavity or space in which the specimen or human to be examined is placed . the apparatus also includes a gradient system for producing spatial linear field gradients . these gradient fields are generally established by a set of three orthogonal direct current coils 11 , 12 and 13 , which generate the three principal gradients g y , g x , and g z . these coils are driven by gradient generator 14 , which in turn is controlled by a controller 16 which communicates with the host computer 20 . typical gradients used in mri image processing are the well known slice select , readout , and phase encoding gradients . typical mri systems also generally include a radio frequency ( rf ) coil 17 which generates a radio frequency field in the specimen being analyzed and senses a free induction decay or spin echo signal which is generated after termination of the radio frequency pulse . rf pulse unit 18 excites rf coil 17 . the signal processor 19 receives the small microvoltage level spin echo signals which are reconstructed by computer 20 to form an image . the image is digitized and stored in the memory section of computer 20 for later display on display unit 21 . protons with their magnetic axis aligned in the transverse plane are termed “ saturated ,” as will be discussed below . if the imaging step is conducted with a magnetic axis of a proton already in the transverse plane , then due to the subsequent gradient crushing or dephasing , the magnetic axes will be aligned orthogonally to the slice plane ( along the z axis ) which produces no signal , thereby resulting in a perceptible void in the image . referring to fig2 a and 2b , the present invention uses a sinc function to modulate the rf pulses 200 from generator 18 in a manner which yields relatively uniform rectangular magnetization profile tags 202 . as will be set forth below , the present invention allows for control of both the width of the tags and the separation of the tags . a first order approximation of the presaturated magnetization profile produced by an rf pulse train in the presence of a constant gradient g x is the fourier transform of the rf pulse train waveform . assume the width of individual rf pulses is infinitesimal , the sinc modulated rf pulse train can be written as : rf ( t ) = sinc ( π t δ t 1 ) × comb ( t , δ t 2 ) [ 1 ] sinc ( π t δ t 1 ) is the sinc function with the first zero crossing at δt 1 and comb ( t , δt 2 ) is the comb function of spacing δt 2 . thus the spatial modulation of magnetization can be approximated as : m sat ( x ) = rect ( γ g x δ t 1 x ) ⊗ comb ( x , 1 γ g x δ t 2 ) [ 2 ] which provides rectangular tags of width 1 /( γg x δt 1 ) and separation 1 /( γg x δt 2 ). as is evident from this equation , both the tag width and separation are influenced by the gradient g x . thus , in addition to influencing the tag line properties with the characteristics of the sinc function and comb function , the magnitude of the gradient can also be used to define these properties . [ 0041 ] fig2 a , 2b , 3 a , 3 b and 4 a , 4 b illustrate examples of sinc modulated rf pulse trains and corresponding saturated magnetization profiles of varying tag width to separation ratios , i . e ., 1 : 2 , 1 : 4 and 1 : 8 , respectively . the ratio of tag width to tag separation is controlled by controlling the ratio of δt 2 to δt 1 . this approach can also be extended to 2d and 3d tagging without causing signal loss in untagged areas . while expressed above as an ideal comb function , in practical implementations , the width of individual rf pulses is finite . this finite width may cause undesirable shading across the image in the presence of the constant gradient g x . assuming the duration of individual rectangular rf pulses is δt 3 , the sinc modulated rf pulse train can be expressed as : rf ( t ) = ( sinc ( π t δ t 1 ) × comb ( t , δ t 2 ) ) ⊗ rect ( t δ t 3 ) [ 3 ] m sat ( x ) = ( rect ( γ g x δ t 1 x ) ⊗ comb ( x , 1 γ g x δ t 2 ) ) × sinc ( π x γ g x δ t 3 ) . [ 4 ] thus the shading is characterized by a sinc modulation , sinc ( πxγg x δt 3 ). this shading can be visible and detrimental when tagging a large field of view with very small tag separation . reducing the duration of individual rf pulses , δt 3 , can overcome this problem . however , doing so may impose high rf peak power requirements in some applications , such as human cardiac studies . to address the problem of shading in a manner which does not put undo limitations on the peak power requirements of the rf generator , it has been discovered that the constant gradient g x can be replaced by gradient segments between rf pulses without affecting the saturation profile as long as the gradient segment integral ( i . e ., the phase accumulation ) between adjacent rf pulses is preserved . fig6 a and 6b illustrate , by way of timing diagrams , a first example where gradient segments are active only between the rf pulses of the sinc modulated rf waveform . [ 0046 ] fig5 is a simplified flowchart describing the generation of the waveforms depicted in the timing diagrams of fig6 a and 6b . as described above , the present invention provides for the selection of both tag width and separation by controlling parameters of the gradient , the sinc modulation function and the rf pulses of the comb function being modulated . in step 505 , the desired tag width is set by adjusting the lobe width of the sinc function ( δt 1 ). as is evident in equation 2 , set forth above , both tag width and separation are also simultaneously affected by the gradient , g x . the tag separation can be adjusted by altering gradient and the time between rf pulses in the comb function ( δt 2 ), as illustrated in step 510 . while the gradient alters both the tag width and separation , it effects each of these parameters simultaneously . the tag width and separation are altered independently of each other by varying the sinc function and comb function as described above . prior to activation of the first rf pulse , the gradient , g x , is turned off ( step 515 ) and the rf pulse is then applied ( step 520 ). at the end of the rf pulse , the gradient gx is again turned on ( step 525 ). this process is completed for each pulse in the sinc modulated rf pulse train . if there are additional pulses in the pulse train to be applied ( step 530 ), the process idles with the gradient active until the start time of the next rf pulse ( step 540 ). if there are no more pulses in the pulse train , then the process advances to conventional mri image acquisition ( step 535 ). the gradient , g x , is then deactivated ( step 545 ) and the next rf pulse , whose amplitude and duration are determined by the sinc and comb function parameters , is applied ( step 550 ). at the end of the pulse , the process returns , in a loop , to step 525 . [ 0048 ] fig7 a and 7b are timing diagrams which illustrate an equivalent example to that depicted in fig6 . as compared to the example in fig6 a , in the case of fig7 a , the amplitude of the individual rf pulses is reduced , but the duty cycle of such pulses have been extended to preserve the power of each pulse and maintain an equivalent resulting spatial magnetization tag . this alteration permits the use of longer pulse duration to reduce peak power requirement , and allows equalized rf pulse amplitudes to minimize the total pulse train duration , reducing delays to the initialization of imaging after the qrs complex trigger . this modification of the rf pulse could occur , for example , in steps 505 and / or 510 of the method depicted in fig5 . [ 0049 ] fig8 a and 8b illustrate a further equivalent timing relationship to that illustrated in fig6 . in fig8 a , the amplitude of each of the rf pulse segments is now constant rather than varying in accordance with the sinc modulation . however , the duty cycle of the rf pulses , which was previously constant , is now varied to provide the sinc modulation of the rf signal . the gradient pulses illustrated in fig8 b are now pulse width modulated as well to correspond to the varying duty cycle of the rf signal . note that sinc modulated rf pulse trains can be further iteratively optimized by simulating the bloch equation numerically . the present methods are generally incorporated into conventional mri apparatus by way of programming the host computer 20 and / or controller 16 in order to generate the desired waveforms from the rf pulse generator 18 and gradient generator 14 . the software is generally written in any number of conventional programming languages and can be stored and transported on conventional computer readable media , such as magnetic storage disks ( floppy diskettes , hard disks and the like ), optical disks ( cd - roms ) and the like . the present invention has been implemented using a bruker avance 400wb spectrometer ( bruker nmr , inc ., billerica , mass .) with an 89 mm vertical bore magnet of 9 . 4 t ( oxford instruments ltd ., uk ) using a 30 - mm - i . d . quadrature rf probe and a shielded gradient system up to 100 g / cm . the sinc modulated rf pulse trains in conjunction with a constant gradient illustrated in fig2 a , 2b , 3 a , 3 b , and 4 a , 4 b , were implemented for both a phantom and an in vivo animal study . the rf pulse trains were 6 ms long and modulated by a 3 - lobe sinc function . the duration of individual rf pulses was 20 μs , 40 μs and 80 μs using waveforms illustrated in fig2 a , 3a and 4 a , respectively . the dante tagging method , consisting of an rf pulse train of uniform amplitude and constant gradient , was also implemented for comparison . to achieve a tag width to separation ratio equivalent to that in fig2 b for comparison ( 1 : 4 ), the number of rf pulses in dante pulse train was chosen to be four ( 4 ). in all experiments , the rf transmitter attenuation was calibrated for the tagging rf pulse train to produce a 90 ° flip angle . the tagging sequence was followed by a 1 . 5 ms crusher gradient . for the phantom study , a 20 mm tube of water doped with copper sulfate was used . images were obtained by rf pulse train tagging followed by a 2d gradient echo ( ge ) encoding with the following sequence parameters : fov = 22 mm , acquisition matrix = 256 × 256 , slice thickness = 2 mm , tr / te = 300 / 3 ms , flip angle = 30 °, number of averages = 1 . the rf pulse trains in fig2 a , 3a , and 4 a were employed to demonstrate various spatial modulation of magnetization . the in vivo mouse heart study was performed using a normal wild - type adult mouse ( c57bl / 6 , 25 g ). during the imaging experiment the mouse was anesthetized with isoflurane gas ( 1 . 5 vol . % at 2 l / min air flow ) via a nose cone . the ecg was recorded from the front limbs using subcutaneous silver electrodes . during imaging heart rate was approximately 500 beats per minute . imaging was performed with an ecg - gated fast 2d ge sequence using tr / te = 110 / 1 . 8 ms , fov = 26 mm , acquisition matrix = 168 × 168 , slice thickness = 1 . 5 mm , flip angle = 20 °, number of averages = 8 . the total acquisition time was approximately 2 . 5 min . the tagging waveform in fig2 b was employed . there was a 3 ms delay between the end of the tagging sequence and the start of the ge imaging sequence , i . e ., slice selective rf excitation . delay between the qrs complex trigger and the start of the ge sequence was approximately 10 ms , therefore , images were acquired during ventricular systole . [ 0056 ] fig9 a , 9b and 9 c are images which illustrate the results from the phantom study employing the waveforms of fig2 a , 3a and 4 a , respectively . as predicted , tags with sharp edges were obtained with sinc modulated rf pulse trains . fig9 a , 9b and 9 c demonstrate the flexibility to alter the ratio of tag width to tag separation , which cannot be easily provided by the dante and spamm techniques . fig1 is an image acquired using the prior art dante method during the phantom study . the improvement of tag contrast over the conventional dante tagging technique is apparent . fig1 and 12 illustrate 1d tagging of a wild - type mouse heart by the sinc modulated rf pulse train of the present invention and the conventional dante technique , respectively . the nominal tag width and separation were 0 . 16 mm and 0 . 65 mm , respectively . the sharper - edged tagging by the sinc modulated rf train is apparent in the myocardium and the entire field of view of fig9 a . [ 0057 ] fig9 d illustrates an extension of the present invention into two dimensional tag lines . the tag lines are added in a direction orthogonal to the initial tag lines , thereby forming a grid , by following the same procedure described above for g x with either the g y or g x gradients . although the present invention has been described in connection with specific exemplary embodiments , it should be understood that various changes , substitutions and alterations can be made to the disclosed embodiments without departing from the spirit and scope of the invention as set forth in the appended claims .
| 6Physics
|
the prior art approach to thin a substrate such as a multidie semiconductor wafer 10 , from an initial mean thickness 18 of , e . g ., about 28 mm to a final mean thickness 22 of about , e . g ., 4 mm is illustrated in fig1 , 2 , 3 , 4 and 4 a . the bare back side surface 14 is typically rough , as shown by the exaggerated “ peaks ” 24 and “ valleys ” 26 which define the topography of the surface in fig1 . the roughness may be measured in terms of a maximum amplitude 38 between the deepest valley 26 and the highest peak 24 . the final mean thickness 22 of semiconductor wafer 10 is shown as the distance between an active surface 12 and a final back side surface 20 . it is very desirable that the back side surface 14 be as uniformly planar and smooth as possible to enable accurate and uniform severance or singulation of individual semiconductor dice cut from the semiconductor wafer 10 , to maintain the structural integrity of the resulting dice and to maintain uniform thickness dimensions thereof for packaging . various methods are used conventionally for bulk thinning by so - called “ backgrinding ” of a multidie semiconductor wafer 10 , including mechanical methods of grinding , etching with a dry or wet chemical ( or even a vapor ), and combinations thereof . one currently preferred method is to initially use one of a mechanical , i . e ., abrasive polishing , cmp , or grinding process , followed by a wet chemical etch or a dry chemical etch . as shown in fig2 , the etching of a bare substrate ( semiconductor wafer 10 ) surface such as a rough wafer back side surface 14 , reduces the topographic maximum amplitude 38 but does not planarize the etched surface 30 to a high degree due to the isotropic nature of the etch chemistry . an isotropic etchant 28 may be considered as attacking all exposed surfaces of the peaks and valleys 24 , 26 at substantially the same rate in a direction normal to the particular surface location . fig3 depicts a movable element 32 which is moved in a lateral direction 33 , such as through rotation . the movable element 32 , which may be structured as a pad , carries abrasive materials 36 exposed beyond the pad surface and which impinge laterally with force against nonhorizontal back side surface 14 , i . e ., as directed lateral forces 34 . a similar effect results from use of a diamond grinding wheel . the directed lateral forces 34 tend to break the peaks 24 along various crystalline cleavage planes with a resulting , significant degree of nonuniformity in the surface topography , although the amplitude will be reduced . the production of high - asperity particles from the grinding process will also be significant , leading to nonuniform solids removal . as shown in fig4 , when the back side surface 14 of a semiconductor wafer 10 has been ground to a desired final mean thickness 22 , the surface nevertheless remains undesirably rough . the valleys 26 may extend into the semiconductor wafer 10 to produce weakness therein , or even cracking or fracture . this is especially critical in very thin wafers , e . g ., 2 – 4 mm final mean thickness 22 , which are also subject to warpage . thus , in the prior art , conventional methods may lead to failure of semiconductor dice 16 ( see fig4 a ) at the time of or following singulation from the semiconductor wafer 10 , i . e ., by cutting along streets 46 . turning now to fig5 through 10 , exemplary embodiments of methods of the invention are illustrated for thinning and planarizing a substrate , such as a semiconductor wafer 10 back side surface 14 . the semiconductor wafer 10 may comprise a wafer of silicon , gallium arsenide , germanium or indium phosphide , by way of example only . in fig5 , a semiconductor wafer 10 is shown with an active surface 12 and rough back side surface 14 . a planarizing material 40 has been deposited as an overlying layer on the original nonplanar back side surface 14 and is shown as filling in the valleys 26 and covering the peaks 24 of the surface . in other words , the layer of planarizing material 40 substantially covers all features of the topography and , desirably , covers the entire back side surface 14 . the layer of planarizing material 40 is formed and cured to have a substantially planar exposed surface 42 , and is shown with a mean thickness 44 . the layer of planarizing material 40 and a substantial portion of the underlying substrate ( semiconductor wafer 10 ) are to be removed , thinning the substrate to a final back side surface 20 which is substantially planarized . the layer of planarizing material 40 penetrates the rough surface of back side surface 14 and is very adherent thereto . the planarizing material may be desirably chosen to meet the following criteria : ( a ) it is easily applied to a surface of the substrate on which thinning is to be initiated ; ( b ) when hardened , it exhibits a solids removal rate similar to that exhibited by the underlying substrate material , e . g ., semiconductor material , when subjected to the same material removal technique ; and ( c ) when hardened , it forms a substantially planar , exposed surface . materials which may be used to form the layer of planarizing material 40 of the above - listed criteria include various polymers which are in the classes of epoxies and acrylics and , more particularly , thermal ( thermoset ) or ultraviolet light ( uv ) linkable polymers and two - part epoxy formulations . other general classes of coating which are contemplated as usable in this invention include silicones , urethanes , and siloxanes , without limitation thereto . a number of photoresists will etch at substantially the same rate as silicon materials , such as , for example , silicon dioxide . as disclosed below , it may be desirable to oxidize back side surface 14 , forming silicon dioxide in the case of a silicon wafer , prior to application of the planarizing material 40 . of course , the etch rates for planarizing material 40 may be matched empirically to that of the material of the wafer for each selected etchant . the application of a layer of planarizing material 40 to a substrate back side surface 14 may be by a variety of methods . in one method for example , a flowable polymeric material ( liquid or particulate solid ) maybe applied to a back side surface 14 by screen - coating or stencil - coating . if a liquid material is used , spin - coating is also effective . the polymeric material may then be cured to a hardened state by application of heat or , in some instances , by a selected wavelength of radiation . in another variation , an epoxy material can be cured to a so - called “ b ” stage of tackiness , at which it is still flowable . the epoxy material may then be applied to the back side surface 14 and reheated to complete the cure , bond to the surface and harden . it is contemplated that a layer of epoxy material may be applied to a backing sheet carrying a release layer , cured to a “ b ” stage and applied to the back side surface 14 . the backing may then be stripped off , and the epoxy cure and hardening completed . other application methods which may be used include cvd and pecvd , in which the planarizing material is applied as a vapor . these depositon methods are well known in the art . in a deposition method of newer development , the parylene process ™ may be used . in this method , an organic dimer is heated to form monomers and then applied at a lower temperature to a back side surface 14 where it deposits as a planarizing material 40 . a dimer such as di - para - xylene may be used . another deposition method which may be used comprises the formation of a tape or film element of partially polymerized material . the tape or film may then be applied to the back side surface 14 , heated to flow , bond to the surface , level and planarize , and finally cooled to a solid state . fig6 shows the substrate ( semiconductor wafer 10 ) of fig5 following exemplary thinning by wet or dry chemical etching by isotropic etchant 28 to produce an etched surface 30 near the original back side surface 14 . unlike the rough original back side surface 14 , the etched surface 30 is substantially planar and includes etched portions of the planarizing material 40 . the exposure to isotropic etchant 28 may be continued until the desired final back side surface 20 , i . e ., final mean thickness 22 , is reached . inasmuch as the planar exposed surface 42 initially exposed to the isoctropic etchant 28 is substantially planar , the attained final back side surface 20 will also be substantially planar . while dry etching , for example , reactive ion etching ( also termed “ plasma etching ”), may be used to thin a substrate , it is currently preferred that wet etching be employed . suitable etchants for a silicon substrate include , without limitation , 100 % koh , koh mixed with deionized water , koh mixed with isopropyl alcohol , a mixture of hf , hno 3 and ch 3 cooh formulated , for example as so - called “ 95 % poly etch ,” comprising 50 % nitric acid , 2 . 5 % acetic acid and 0 . 74 % hydrofluoric acid , by volume . however , a mechanical or chemical - mechanical material removal process may be used to thin the back side surface 14 . as shown in fig7 , a movable element 32 with attached abrasive materials 36 may be used to grind a substrate ( semiconductor wafer 10 ) to ( or nearly to ) a desired final mean thickness 22 . the movable element 32 may be moved in a lateral direction or lateral directions 33 parallel to the desired final back side surface 20 to remove substrate material until surfaces 14 and 20 merge . the acts of the methods of the present invention may be conducted in differing orders . as shown in fig8 with respect to one exemplary embodiment , a substrate is provided in act 50 with a bare , thinnable back side surface 14 . the term “ bare ” denotes that electronic or other components are not present on the back side surface 14 . a layer of planarizing material 40 is then applied , as discussed above , in act 52 . following hardening in act 54 , one or more thinning and planarizing acts 58 may be used to thin and complete planarization . the thinning and planarization acts 58 may be of any of the previously mentioned techniques . as shown in fig9 with respect to another exemplary embodiment , the method of fig8 may be modified to include an initial thinning act 56 for bulk removal of substrate material prior to deposition of a planarizing material in act 52 . fig1 illustrates another exemplary embodiment of a method of the present invention . in this embodiment , the thinnable back side surface 14 is first subjected to an oxidation act 60 . when the substrate is silicon , for example , the back side surface 14 may be oxidized to silicon dioxide . polymers such as are used as planarizing materials in this invention are , in general , much more adherent to the oxide than to silicon itself . however , it should be noted that , in general , the initially rough back side surface 14 may enhance adhesion of such a polymer thereto and render preoxidation in act 60 unnecessary . as practiced by those of ordinary skill in the art , the material removal process from a substrate such as a semiconductor wafer is typically practiced while the active surface of the wafer is protected from possible mechanical damage and reagent and debris contamination , for example , by the prior application of so - called “ backgrind tape ” as known in the art . further , the manner in which a substrate such as a wafer is fixed for material removal therefrom is also well known . accordingly , no further description of the acts preliminary to the material removal processes described herein , including mounting of the wafer or other substrate , is provided . although the foregoing description contains many specifics , these should not be construed as limiting the scope of the present invention , but merely as providing illustrations of some of the presently preferred embodiments . similarly , other embodiments of the invention may be devised which do not depart from the spirit or scope of the present invention . moreover , features from different embodiments of the invention may be employed in combination . the scope of the invention is , therefore , indicated and limited only by the appended claims and their legal equivalents , rather than by the foregoing description . all additions , deletions , and modifications to the invention , as disclosed herein , which fall within the meaning and scope of the claims are to be embraced thereby .
| 7Electricity
|
for a better and more thorough understanding of the present invention , it will be shown embodied in a refrigerator having both refrigerator and freezer sections for purposes of illustration . it should be understood , however , that the invention is not limited to use solely in refrigerators but other appliances , particularly those that include x compartments and x - 1 sensors . that is to say , if the unit has two compartments , there will only be one sensor , etc . the present invention is primarily based on the utilization of software algorithms for use in the described system . referring initially to fig1 and 5 , compensation for proper freezer temperature is handled in the following way . a single sensor 108 utilized within the refrigerator section 101 , while none are included in the freezer 102 . for three on - off cycles , the measurement period ( of the compressor ) times of each refrigerator cycle are measured . external temperature is known from the comparison to reference times which were recorded previously . for the next two cycles of operation known as the adjust period , the microcontroller will force the compressor on and off according to the reference times in that external temperature of the freezer unit . microcontroller 601 will then repeat these periods . the microcontroller 601 as shown in fig5 will force the compressor on and off according to reference times and the external temperature of the freezer . the microcontroller 601 then repeats these periods . the forced adjust period based on freezer times is alternated with the measurement period which is based on refrigerator temperature . referring now to fig5 temperature sensor 108 placed inside the refrigerator section , in section 101 and seen in fig1 operates the refrigerator internal cold producing device , such as compressor 107 as seen in fig1 which turns on and off so the inside of the refrigerator is regulated at an average established temperature . a microcontroller 601 , or some similar measuring device , measures the time it takes for the sensor temperature of sensor 108 to rise and fall . since the information stored in the microcontroller consists of times of internal operation which correlate to various external temperatures of the refrigerator , the evaporator section , as may be seen in fig1 is balanced between section 105 and refrigerator section 101 and evaporator section 106 and freezer compartment 102 . this arrangement insures that the refrigerator normally will be operated at 6 ° c . with the freezer being operated at - 10 ° c . in a room temperature of 25 ° c . as may be seen by referring to fig3 the refrigerator is initially place in a room having a temperature of 15 ° c . at this time , the inside of the refrigerator is set to operate at the 6 ° c . temperature and the desired freezer temperature at - 10 ° c . the microcontroller 601 will measure on ( t2 ) three times as shown in fig2 averaging them to twenty minutes as shown in the table portion of fig3 . from the stored reference times , the outside temperature is 15 ° c . because the evaporator is balanced for 25 ° c . external temperatures , the freezer will be warmer than - 10 ° c . so the microcontroller will start an adjust period ( tadjust 1 , as shown in fig3 ) for two cycles when it forces the compressor on for a period of 29 minutes . this will then make the freezer section - 10 ° c . in a 15 ° c . room and the refrigerator portion will be a little colder than needed . the microcontroller 601 will then start another adjustment period ( tm 2 ) and adjust accordingly ( tadjust 2 ) as shown in fig3 . accordingly , the performance of the freezer is substantially improved due to the adjust period and known edge of the external temperature . when the room temperature with the same refrigerator is changed to 31 ° c ., as shown in the table portion of fig3 the microcontroller will measure 3 on times with an average time being 68 minutes ( shown as tm 1 in fig3 ). from the stored reference times , the outside temperature is determined to be 31 ° c . thus , the microcontroller will start an adjust period ( again see tadjust 1 column . fig3 ) for two cycles when it will force the compressor on for a total of 77 minutes . this will make the freezer portion - 10 ° c . in the 31 ° c . room . this time the microcontroller will start another measurement period ( tm 2 ) and adjust accordingly ( tadjust 2 ) as shown in fig3 . as noted above , during the adjust period the microcontroller could also make the temperature compensation in the refrigerator compartment , energy efficiency improvements as well as temperature changes to other compartments which are also in the same room as the refrigerator . it is also possible in the alternative for the microcontroller to utilize the adjust period as the next measurement period . referring now to the software flow chart of fig4 it will be seen that at the start of the system operation , or in response to external interference , such as a door opening or power interruption , it is very important to allow the system to operate until the compartment is stabilized . the system is considered stabilized when the compartment temperature has reached its cut - out temperature at the current setting . the cut - out temperature normally is the low temperature of a setting at which the compressor will turn off . stability of the compartment temperature is necessary to insure accuracy of ambient temperature detection . once the compartment temperature is stabilized , compressor on and off times are measured during each compressor cycle . compressor on and off times will be calculated for a fixed length of time or a fixed number of compressor cycles to determine average time . average compressor on and off time is then compared to a known average on and off time of a setting to decide if there is a change in the ambient temperature . if the average compressor off time is increasing , then the ambient is regarded as falling , while the average compressor on time is increasing it is then determined that the ambient temperature is regarded as rising . these known average on and off times of the settings are values based on experimentation and testing . each ambient range will have a distinct average on and off time for every setting to compare . change in the compressor on time will be more noticeable at higher ambient temperatures and change in compressor off times will be more noticeable at lower ambient temperatures . utilizing compressor on and off times when making the comparison will maximize accuracy of the ambient detection . when the program detects a change within a certain ambient range , the setting will be modified to the adaptive settings . the adaptive settings will have a different cut - in and cut - out temperature which will optimize the system performance for that ambient range . the cut - in temperature is the high temperature setpoint of a setting at which the compressor will turn on . referring now to fig4 it may be seen that after the temperature is stabilized , the average compressor on and off times after a fixed number of cycles or hours are calculated , and after which calculation of the compressor on and off times difference takes place , decisions are made as to whether the off time is increasing or decreasing , should it not be increasing , another decision is made as to whether the on time difference is increasing . in the first case , if the ambient temperature is failing by virtue of the calculation of the off and on time difference , it is referred to number of decisions within selected ambient ranges , known as ranges a , b , c and d , as well as no change , decisions are made , and then if the decision is made that it is within a particular range , or that it is not within the normal ambient temperature range , another decision is made as to whether the current temperature setting is within the modified ambient range as to one of a , b , c , d or normal ambient range . if the answer is &# 34 ; no &# 34 ;, appropriate changes are made to bring the current temperature setting within the selected ambient range , or should it be &# 34 ; yes &# 34 ;, the main program would be returned and repeated from point a as shown on the software flow chart . while but a single embodiment of the present invention has been shown , it will be obvious to those skilled in the art that numerous modifications may be made without departing from the spirit of the present invention , which shall be limited only by the scope of the claims appended hereto .
| 8General tagging of new or cross-sectional technology
|
a mail sorting system of the invention uses a sorting machine which is a transport with multiple sorting pockets . the transport includes cameras capable of surveying the entire mail piece or other item capable of being conveyed down the transport . the transport in the case of mail pieces is preferably a pinch belt conveyor wherein the mail pieces are held on opposite sides by a pair of belts as they are transported . however , other types of known mail sorting machines could be used . the pinch belt leads past a series of diverter gates at which the mail piece can be diverted to a bin to one side of the conveyor path . typical dbcs and mlocr machines operate in the manner . prior to use of the system , an operator has put in a database all information pertinent to any job ( the “ input profile ”) that may be run on the equipment . this information can include , but is not limited to : mailer identity , postage applied ( if known ), endorsements , indicia , symbols and other patterns . location of the information on the mail piece is also indicated . each input is marked as “ critical ” or “ non - critical ” by the system or the operator according to a pre - determined standard . this designation will subsequently be used to accept the mail piece if information is correct and complete , or reject it if its information cannot be verified . as an alternative to operator input , a few sample mail pieces may be scanned , and the scanned mail piece information extracted and stored in the database with the customer id assigned to the information and used for reference . the database may also contain sort schemes that an equipment operator can preselect prior to starting processing . mail identifiers may be created as follows . a sample mail piece is first imaged , and the captured image is used to extract mail piece features . fig1 illustrates a typical mail piece 10 with features such as permit imprint 11 , address 12 , return address 13 , endorsement 14 , postnet bar code 15 , automarking 16 , manifest keyline information 17 and planet bar code 8 , which contains an assigned id number associated with the mailer . keyline information 17 is a series of text / digits that uniquely identify a mailer and job , along with mail piece characteristics such as mail weight . such mailings also commonly have advertisement text and special patterns / graphics characteristic of each mailer . while the address 12 will vary on each mail piece , other items will remain the same for all mail within the same job , for example , the return address 13 . logo 9 and any other distinct graphic objects can be located anywhere on the mail pieces other than at locations reserved for essential features as described above . the input file can be created manually by a video operator , who reviews the mail piece image on screen and identifies regions of interest such as 18 , containing the address , and 19 containing the return address . the decoded text in roi 19 may be designated a critical parameter in that all mail pieces from the job associated with that profile are expected to have that return address . the permit number will likewise be considered a critical parameter . what is considered critical by the system analyzing a mail piece image will vary depending on the program logic the system employs to make the decision . the input process may be based on a few mail pieces that are representative of all the mail pieces in a job . the reverse side of the mail piece may contain information of interest and is preferably characterized in the same manner as the front side . the goal of the input process is to create a “ profile ” of features by which a specific mailers &# 39 ; mail pieces can be recognized as they pass through the sorting system , preferably without need for either a special symbol identifying the mailer or use of markers such as divider cards to indicate a change in mailer during a sorting run . region of interest ( roi ) features extraction and matching software has been developed and tested in real time to find and characterize features of the mail piece from the mail piece image . delivery address blocks , return address blocks , stamps and permit blocks , meter mark , logo , etc . were found and characterized . the return address block , delivery address blocks and the permit blocks , etc . were submitted for ocr processing . the geometrical information of each object and the results of this ocr processing were used to match the current mail piece to a predetermined template . the result of template matching can be used to determine the customer id for the mail pieces being processed . if some fields match but not all , operator intervention may be required . it may occur that multiple jobs are received from the same mailer at the same time where the mail pieces are identical in appearance and layout , and it is possible or desirable to commingle them in order to obtain a higher overall postal discount . in such a case , the mail piece may include a special symbol or number 20 put on by the mailer that distinguishes mail from one job for that mailer from another . a different symbol or number 20 is used for each successive job for that mailer . referring to fig2 , once the input of mailer profile data is completed ( step 30 ), the machine operator places mail pieces on the transport ( step 32 ), such as by loading them onto a conventional pickoff feeder , without any requirement to input information such as mailer id , etc . mail pieces can be randomly selected or of mixed origin , since each will be uniquely identified by the input parameters or by a mail piece unique id . the transport carries each mail piece past a digital camera to lift an image ( step 34 ). if this image has a unique id ( decision 36 ), the information is stored , such as on hard disk storage ( step 38 ) where it may be retrieved later . if no unique id is determined , the system assigns one ( step 40 ), applies the id to the mail piece ( step 42 ), and the information is stored in the disk storage . the id number assigned may be either unique to each mail piece , or just unique to that mailer , with all mail pieces for that mailer receiving the same id number . the same id number could have both attributes , e . g ., the first six digits or characters identify the mailer , and the remaining digits or characters uniquely identify the mail piece . an “ id number ” for this purpose refers to any combination of numbers , letters , or other symbols sufficient for identification purposes . all data from the image lift is resolved and compared with the input profile ( step 44 ), and confirmation is made assuring that all data marked critical is available ( decision 46 ) so that the mailer can be reliably determined . any missing critical data undergoes an algorithm matching process ( step 48 ) to determine if the system can identify missing data . if successful ( decision 50 ), the mail piece is approved for further processing . if not , the mail piece is sorted to a special reject bin for offline processing ( step 52 ). if the mailer can be determined , then counters are incremented for number of mail pieces to that zip code , number of mail pieces sent by that mailer , number of mail pieces sent by that mailer in that zip code and any other desired information , such as the number of mail pieces of that mailer in the current job . this information is stored in memory and / or saved to disk for preparation of manifests or other reports . if a postnet bar code exists ( decision 54 ), the system compares the applied bar code to the resolved address ( step 58 ) and determines whether a match exists ( decision 60 ). if there is not a match , the mail piece is rejected for offline processing ( step 62 ). the resolved address is also compared with a national forwarding database ( step 64 ) to determine if forwarding is required ( decision 66 ). one such forwarding database having improved capabilities as compared to the ncoa database is described in sipe et al . u . s . patent application 20040093222 , published may 13 , 2004 , the contents of which are incorporated by reference herein . if forwarding is needed and the machine has forwarding capability , then if the mail piece is first class mail ( decision 68 ), it will apply the forwarding bar code ( step 70 ), and reject other types of mail for offline processing ( step 72 ). machines without forwarding capability will all reject pieces requiring forwarding . if no postnet bar code exists and the machine is equipped to print a postnet code determined from the resolved address , the postnet code is printed ( step 56 ) and then the check for forwarding is carried out . if the machine does not have the capability of applying a determined bar code , the mail piece is instead rejected . alternatively , the piece could be sorted to its destination using the delivery point assigned by the ocr process . once all the above is accomplished , the mail piece postnet bar code is matched against a predetermined sort scheme , and a proper sort is effected ( step 74 ). the sort scheme may assign the mail piece to a final sort (“ quick kill ”), or send it into a location where a secondary sort is required . upon determination of the proper sort , correct postage is determined ( step 76 ) and sent to the database holding all other pertinent information on the mail piece , including the postage applied if there is pre - applied postage ( meter , stamps , etc .) ( step 78 ). if the mail piece requires a secondary sort ( decision 80 ), the process is accomplished in the same manner as an initial sort by again feeding the mail piece to the transport that has an operator - preset sort scheme . the mail piece is identified by its profile or unique number in step 36 , and again proper sorting is accomplished . proper postage may now have changed , and the information is corrected in the database in steps 76 , 78 . all other parameters should not have changed . after all sorting , primary and secondary , is completed , data in the database , including an image of the mail piece , is now available for completing all required usps forms ( step 82 ) for mass mailings . all information is retained , including postage applied , postage owed , value added rebates , number of mail pieces , number assigned to each sort level and each destination . by accessing the unique id for any given mail piece , an exact profile of the information can be obtained . this data is available for verification purposes and archived for subsequent retrieval should audit at later date be required . the algorithm matching process of step 48 can be done by deduction based on other data . for example , the return address is unreadable from the image lift for some reason , but upon considering other factors such as permit number , endorsements and their location , and the like , the program logic narrows the possibilities down to only one matching mailer and job . for a similar process relating to missing address information , see commonly - owned u . s . provisional application ser . no . 60 / 530 , 879 , filed dec . 18 , 2003 , the contents of which are incorporated by reference herein . the system can be programmed with limited error tolerance if desired . for example , if a mis - scan of one or two letters in the return address occurs , a computer may return a mismatch initially but then override the mismatch based on the high correspondence of all the other letters in the address . the database created in the foregoing example contains an exact profile of each mailing by mailer . information such as number of pieces , rejects , incorrect addresses , postage required vs . postage applied , distribution by zip code and other information can be easily extracted and verified as well as information on each mail piece . with this information , automatic invoices can be prepared . this also allows a presorter to reward mailers with error free mail and penalize with additional fees those whose mailing lists contain errors . in a variation according to the invention , secondary processing can be used in an attempt to selectively sort rejects by mailer . when a mail piece is rejected in steps 52 or 62 due to an inadequate address or because the postnet code does not match the resolved address , the system will normally know the associated mailer from the profiling procedure , and can direct the mail piece to a mailer - specific reject bin that receives all rejects for that mailer . if the system does not know the mailer , it can then attempt to determine which mailer the unsortable mail piece belongs to . this can be done in a number of ways , such as by means of the special mailer job id symbol 20 , planet bar code 8 , and possibly logo 9 , by matching an assigned mail piece id number with the associated mailer , or by using process of elimination program logic in conjunction with known elements of address and other information resulting from the imaging step to determine the mailer . in the case of a complete misread where no information is available about a mail piece , the system can sort the rejected mail piece based on information concerning the immediately preceding and / or following mail pieces . if the system detects a series of mail pieces belonging to a single mailer on this basis , it can assign the mail piece to the reject bin associated with that mailer . the number of mail pieces following the rejected one that will be considered as part of a possible series is limited to those which can be imaged and processed before the rejected mail piece has traveled from the imaging camera to the gates for the reject bins . it may be advantageous to assign the bins requiring the longest travel from the imaging system as reject bins to permit more time for processing and increase the number of following mail pieces that can be considered as part of a series . predetermined criteria based on the desired confidence level are used to determine if the rejected mail piece is part of a series belonging to a particular mailer . for example , if the system detects that three mail pieces immediately following and preceding the reject all belong to the same mailer , it then assigns the reject to the reject bin for that mailer . the image of the rejected mail piece may then be reviewed in an offline processing operation similar to manual video coding used by the usps . in an alternative embodiment of the invention , the steps 36 , 40 and 42 wherein an id number is determined and printed on each mail piece are omitted . this version of the invention is appropriate where , due to machine configuration , there is insufficient time between imaging and sorting to perform advanced processing . in such a case , processing of the mail piece image in step 34 proceeds along two parallel tracks . the first track only includes operations needed to make the sorting decision in a manner known in the art . the second track , which may be performed by a secondary processor , uses the information from the image to determine which mailer the mail piece belongs to , and performs any other computations that do no need to be completed before making the sorting decision , e . g ., the number of mail pieces assigned to each zip code which is maintained in order to do the final postage calculation . in this manner , secondary processing can lag behind the primary sorting processing without adversely affecting operation . as discussed above in connection with reject processing , the system may also rely on series information in making decisions , recognizing that in a great many cases a long series of almost identical mail pieces will be imaged . thus , if the image information does not provide enough critical data to identify the mailer , the system may look to the mail pieces preceding and / or following that mail piece . if a series of mail pieces immediately before and after the mail piece that can &# 39 ; t be resolved all belong to the same mailer , the probability is high that the unresolved mail piece also belongs to that mailer , and may be identified accordingly . storage of the image on a permanent storage medium such as a hard drive in step 38 makes it possible to investigate and determine what went wrong with the mail piece later on , with a change in the assigned job number if the system &# 39 ; s determination proves to be incorrect . series information can also be used for process control purposes . if more than a predetermined number of unreadable pieces pass by the imaging camera , the sorting system is preferably programmed to shut down so that the operator can investigate for a potential machine problem . in the case of multiple jobs received from the same mailer at the same time where the mail pieces are identical in appearance and layout , there are several possible approaches . first , the human operator can manually interrupt a run in this situation and enter a new job code , overriding the existing one , much as currently practiced for all jobs . second , if the system is provided with the data , e . g . tables linking zip codes to the corresponding job number for that mailer , then the system can automatically determine the correct job code from the recipient address . third , by pre - arrangement , the mailer can used the special symbol ( indicia ) or mark 20 as noted to distinguish one job from another , and the verification of the mark is added to the list of critical features . according to a further aspect of the invention , it is not essential to reject all mail pieces for which a mailer cannot be determined . where there are a large number of mail pieces in a batch that do not match a mailer profile , it is likely that they all originate from a single mailer that for some reason was not profiled , or for which the profile was not recognizable by the system . in such a situation , the system can assign a pseudo - mailer id to the unidentified mail pieces and sort them according to zip code , rather than to a reject bin . the mailer for these mail pieces can then be determined later in an offline process using the saved data for each mail piece , including the images of the mail piece . it will be understood that the foregoing description is of preferred exemplary embodiments of the invention , and that the invention is not limited to the specific forms shown . items other than mail pieces such as flat and large pieces could be identified by the process of the invention . modifications may be made in without departing from the scope of the invention as expressed in the appended claims .
| 6Physics
|
several commercial systems exist to help users search through large collections in order to retrieve those data that the user wishes to find . this is straightforward for certain types of data , e . g ., searching for sales figures that meet certain criteria . however , searches for people , objects , or activities in large video archives are fraught with difficulties . achieving good performance on clearly - specified searches , e . g ., a search for all red cars in an archive , depends on the system &# 39 ; s having good recognition performance on video , which is often beyond the state of the art . achieving similar performance on more vaguely - specified , example - based searches introduces the additional difficulty of properly understanding the user &# 39 ; s intent . if the example given by the user contains several objects , this raises the question as whether the intent is to find other instances of either object , both , or instances with a similar relationship between the two . in order to resolve these issues , there may be many approaches in the realm of content - based image / video retrieval that employ user feedback to clarify user intent and help improve the recognition performance of the system . in many cases , possibly the simplest ( and therefore easiest to provide ) form of user feedback involves presenting the user with samples from the archive and asking that the user provide a positive / negative label for each , indicating whether or not they are accepted as correct . in order to have the system perform well , given relatively sparse input from the user , there are two fundamental questions that should be answered . a first question is which samples from the archive , if labeled by the user , enable the system to improve its performance the most . this question may be referred to as the active learning issue . a second question is , given a set of sparse labels , as provided by the user , how this information can be propagated to other , unlabeled , samples in the archive . this question may be referred to as the label propagation issue . the present approach may address both the active learning and label propagation issues by employing a memory of user provided labels of the archive data . one may assume simple positive / negative labeling of samples , and further concentrate on example - based queries . for example - based queries , as mentioned previously , one of the difficulties is to determine from the input the user &# 39 ; s intended search category . due to uncertainty in this determination , it is not necessarily possible to assign a definitive , high - level label to archive data based on a user &# 39 ; s feedback . for instance , one cannot necessarily assume that an archive sample is a red vehicle simply because the user has assigned it a positive label relative to an example video containing a red vehicle . the user may have intended to retrieve red objects more broadly , and the positively - labeled sample may be an image of an apple . because of the uncertainty inherent in example - based searching , one may design the system to store only low - level information based on user feedback . here , one may retain a set of equivalence classes in the archive , where each equivalence class contains samples that were given the same label by the user with respect to a particular query . these equivalence classes may provide natural answers to both the active learning and label propagation issues . for each query on which a user will provide feedback , one may generate two equivalence classes . one class may contain the set of samples that are positively labeled by the user , and another class may contain the negatively - labeled samples . in subsequent queries , these equivalence classes may be used to solve the active learning issue . elements chosen from each of the positively - labeled equivalence classes may provide much information when the elements are labeled in new queries . thus , these elements get a high priority for labeling . if such an element is positively labeled in the new query , that positive label may be propagated to all other elements from its equivalence class and a negative label may be assigned to all elements of the corresponding negative equivalence class . if , on the other hand , the chosen element may be negatively labeled with respect to the new query , then the negative label can be propagated to the other elements of its equivalence class but no label can be assigned to the elements of the corresponding negative class . because of the difference between the two cases outlined , one may say that there is more information gained from getting a positive label on elements of positive equivalence classes . for this reason , when the system is able to get fewer labels from the user , the active learning approach will attempt to find elements of positive equivalence classes that are the best matches to the ongoing query , in order to improve the chances of getting the more valuable true ( i . e ., accurate ) label . in addition , the sizes of the equivalence classes may also be taken into consideration , as it is more valuable when a label can be propagated to a larger set . fig1 is a diagram of a query refinement system 11 . a query may be entered by a user 16 in an initial search module 12 . the system may be illustrated with a specific example as a query ; however , other kinds of items may be applied to the system . the medium for the present example may be video clips . a query at input 14 may be a search for all red cars in the archive at module 12 . an output may be input on line 19 to a feedback selection module 13 . a form of user feedback at feedback selection module 13 may involve presenting the user 16 at an output 15 with examples from the archive and be vested to provide a positive or negative label at input 17 for each example from the archive , indicating whether or not they are accepted as correct . a simple “ positive ” or “ negative ” labeling of the samples may be used relative to each example of a video clip . an output of the initial search module 12 may be entered at line 18 to a query refinement module 21 . an output from query refinement module 21 may be fed back along a line 22 to feedback selection 13 . another output from query refinement module 21 may be fed along a line 23 to formulate a final result set module 24 . an output 25 may return video clips from formulate find result set module 24 to a user 16 . fig2 is a diagram of a system 31 which may be an extension of system 11 of fig1 . a query may be entered at input 14 of an initial search module 12 . the query may be , for example , a search for all red cars in an archive 20 connected via line 43 to module 12 . an output of search matches may be input on a line 19 to a feedback selection module 13 . an output on line 26 may include representative matches of search results from module 13 with requests asking for a positive or negative label for each match or representative match of search results from module 12 . the requests may be fed into a database 27 along line 26 from module 13 . requests from database 27 may be provided to user 16 on a line 15 . the requests to the user 16 may be associated or labeled with query labels which go to a query n ( qn ) database 29 via a line 17 by user 16 . the labels may indicate for the matches or representative matches in accordance with requests from line 15 as to whether the respective match is correct or not , which may be indicated with a simple label of “ positive ” or “ negative ”. these labels may be placed in the qn database 29 . the labels may be provided to a memory 32 along a line 33 from database 29 . information in memory 32 may be provided to feedback selection module 13 via line 44 . the labels may be provided from label database 29 to a label propagation module 36 along a line 35 . the matches or search results from search module 12 may go to the label propagation module 36 along line 28 . information from memory 32 may go to a label propagation module 36 via line 34 . the propagation results , including found labels , of the labels from label propagation module 36 may go a query refinement module 38 via a line 37 . query refinements , including generation of a final result set , may proceed from module 38 to feedback selection module 13 for an iterative process along a line 39 , and to a formulate result set module 42 along a line 41 . a process of requests , labeling and label propagation may again cycle from module 13 through query refinement 38 , including intermediate actions , to provide better query results as more information is fed into system 31 by user 16 . better label information may consequently be provided to memory 32 along line 33 from label database 29 . with query refinement information from module 38 along line 41 to module 42 , module 42 may cull out some of the items , and provide or return selected video clips on line 25 to user 16 . the video clip results may be saved in an off - system file by user 16 . if the user 16 decides to use one or more of the return video clips in a new query , then the selection of video clips may improve as the system 31 usage continues with better query and label information being made more accurate as inputs on lines 14 and 17 , respectively . or user 16 may begin the process of system 31 with an entirely new query on line 14 . fig3 shows the various symbols which may represent the various positive and negative results of the video clips discussed herein . fig4 shows a time table with various searches done in response to a digging inquiry . in response , there may be an initial search with the query being an example video of people digging . the video may have other items in it such as cars driving by . the search may result in 60 video clip results . a request to a user may go out requesting the user to rate the results as positive or negative . the user may rate 20 results as positive and 40 results as negative . these ratings are associated with the results as labels which may be members of equivalence classes . another query , i . e ., a video clip , may be entered which is labeled as carrying . the query may return 70 video clip results . the user , for instance , may rate 25 results as positive and 45 results as negative . the labels associated with the results may be provided to the database 29 by the user . the 20 results of the digging rated as positive and the 40 results rated as negative may regarded as a positive equivalence class and a negative equivalence class , respectively . queries may be regarded as q 1 ( digging ), q 2 ( carrying ) and so on to qn ( digging ). each set of results may be regarded as having a time range and bounding boxes . in fig4 , symbols 61 and 62 represent the positive and negative results , respectively , of the search for video 51 . symbols 63 and 64 represent the positive and negative results , respectively , of the search for video 52 . symbols 69 and 71 represent the positive and negative results , respectively , of the search for video 56 . fig5 shows a set of contents that might be in memory 32 . in a similar sense , like the information shown in fig4 , there may be a q 1 video 51 , q 2 video 52 , q 3 video 53 , and so on through q ( n − 1 ) video 55 . a qn video 56 would be the video currently being processed in system 31 , as indicated in fig4 . the information in video clips 51 , 52 , 53 . . . 55 may include the video , the positive results , the negative results , and other related information . the circles may be coded such as to represent color , according to fig3 , and to distinguish them from other circles . symbols 65 and 66 represent the positive and negative results , respectively , of the search for video 53 . symbols 67 and 68 represent the positive and negative results , respectively , of the search for video 55 . fig6 is a diagram of various positive and negative results . in this figure , the results of an inquiry may be noted in area 71 . for instance , positive results 61 appear in an area 72 and are from the q 1 digging query 51 . numerous positive results 61 emanate from a central appearing positive result 61 as indicated by arrowed lines 75 . some negative results 62 appear outside of area 72 . one result 62 appears in are 74 . another result 62 appears in no sub - area . the emanation of some of the negative results from the digging query 51 is indicated by arrowed lines 76 . one may note a negative result 62 proximate to a result 63 appears in area 73 with an emanation of positive results 63 , as indicated by arrowed lines 77 , for a carrying query 52 . however , these results 63 may be negative relative to the digging query and have features which are similar to the negative results 62 of digging query 51 as indicated by result 62 emanated by an arrow 76 from area 72 to area 73 . the following is a recap of the present approach and system . the approach may be for querying with user input , with obtaining a query from a user , searching an archive for matches to the query , requesting the user to label the matches or elements from memory as positive if they resemble the query , requesting the user to label the matches or elements from memory as negative if they do not resemble the query , storing the matches and elements with labels in a memory , and selecting matches and elements using labels and the memory to formulate a result set . this approach may also have a selection by the user of a match and / or element from the result set as a new query and a searching the archive for matches relative to the new query . further , there may be a propagation of labels of matches , an obtaining a refined query from matches of propagated labels , a requesting the user to label some of the matches and / or elements from the memory as positive and regarded as refined matches and elements if they resemble the refined query , a requesting the user to label the refined matches or elements as negative if they do not resemble the refined query , storing the refined matches and elements with labels in a memory and selecting refined matches and elements labeled as positive for a result set . the approach additionally may have a selection of a refined match or element from the result set as a new query and a searching the archive for matches to the new query . a query may be a video clip and a match or element may be a video clip . a query system may have a search mechanism for searching for elements in an archive that match a query from a user , a requester which asks the user to label at least some of the search / memory elements positive or negative if an element corresponds to the query or does not correspond to the query , respectively , a memory which receives from the user and stores the elements having positive and / or negative labels , and a selecting elements having labels from the memory to formulate a result set . the user may select an element from the result set or from the memory to be a new query , and the search mechanism may search for elements in the archive that match the new query . the system may have a label propagator for propagating the labels of the elements having positive and / or negative labels and at times for finding new elements with corresponding labels , a query refiner for providing a match set of elements from the propagating of the labels of the elements , and a selector that chooses elements of the match set and a memory , for the user to label . the requestor may ask the user to label chosen elements as positive or negative if each one corresponds to the refined query or does not correspond to the refined query , respectively . the memory may receive from the user and store refined results having positive and / or negative labels , and the formulator may select certain refined results for a result set . the user may select a refined result from the result set as a new query . the search mechanism may search for results in the archive , which match the new query . a result or element may be a video clip and a query may be a video clip . an approach may have a providing a query from a user , a performing a search in an archive to obtain results in response to the query , a providing the results to the user to indicate whether one or more results are responsive or not responsive to the query with a positive or negative label , respectively , a selecting at least one result with a positive label , an entering the at least one result with a positive label as an additional query in the archive to obtain another set of results in response to the additional query , a providing the other set of results to the user to indicate whether one or more results is responsive or not responsive to the additional query with a positive or negative label , respectively , and formulating a final result set which compromises results from the other set of results . the results with a negative label may be propagated to results of a corresponding negative equivalence class . results with labels may be stored in a memory . the results with labels stored in the memory may provide information when the results are labeled in new queries . the results of the positive equivalence classes may be the best matches to ongoing queries to improve chances for getting a positive label . a result with a negative label may be assigned to results of a corresponding negative equivalence class . a query may be a video clip , and a result may be a video clip . labels may be propagated to other unlabeled items in the archive . the approach may have a memory of user - provided labels of the archive data for additional queries , feedback selection of results , and / or label propagation . in the present specification , some of the matter may be of a hypothetical or prophetic nature although stated in another manner or tense . although the present system has been described with respect to at least one illustrative example , many variations and modifications will become apparent to those skilled in the art upon reading the specification . it is therefore the intention that the appended claims be interpreted as broadly as possible in view of the prior art to include all such variations and modifications .
| 6Physics
|
the following examples further specifically define the present invention . parts and percentages are by weight unless otherwise indicated . the examples are intended to illustrate various preferred embodiments of the process of this invention . all of the following examples are carried out in an apparatus of the general type illustrated in fig1 a and 1b with the imaging suspension being coated on the conductive surface of a nesa glass electrode connected in series with a switch , a potential source and a conductive center of a blocking electrode . the roller is about 21 / 2 inches in diameter and is moved across the plate surface at about 4 cm ./ second in the dark charge injecting step . the conductive electrode employed is roughly a 4 inch square section of nesa glass and is exposed with an unfiltered white light intensity of about 200 microwatts / sq . cm . as measured on the uncoated nesa glass surface . unless otherwise indicated about 7 percent by weight of the indicated pigments in each example is suspended in sohio odorless solvent 3440 to form the imaging suspension . exposure is made with a 3200 ° k lamp through a transparent photographic original . the dark charge injecting layer has a thickness on the blocking electrode in the range of about 0 . 05 to about 0 . 1 micron unless otherwise stated . an imaging suspension is prepared by adding alphaphthalocyanine to the imaging liquid and coating the suspension onto the surface of a nesa glass electrode . while being exposed imagewise , a blocking electrode is rolled over the suspension with each electrode being connected to a 2 , 000 volt power supply , the nesa electrode having a positive polarity with respect to the blocking electrode . the blocking material on the roller comprises a 2 mil thick tedlar film . a positive image having low density is found on the nesa electrode while a low quality negative image having high background is found on the blocking layer . a dark charge injecting material , bonadur red b pigment is suspended in sohio 3440 at a concentration of about 4 percent . the suspension is painted onto a tedlar film similar to that of example i with a small brush . upon drying , the procedure of example i is repeated with the exception that the tedlar film coated with bonadur red b pigment is employed as the blocking layer on the roller electrode and the imagewise exposure is omitted . the coated blocking layer is replaced by an uncoated tedlar film . the roller electrode is again caused to travel across the imaging layer while the layer is being exposed to light with 2 , 000 volts applied between the electrodes exposure step . a very high density positive image is found on the nesa electrode while an exceptionally high quality negative image is found on the blocking layer . the maximum density of the positive image is found to be 1 . 8 as compared to the maximum density of 1 . 1 found in the image of example i . the procedure of example i is repeated with the exception that yellow pigment , n - 2 &# 34 ;- pyridyl - 8 , 13 - dioxodinaphtho -( 2 , 1 - b ; 2 &# 39 ;, 3 - d )- furan - 6 - carboxamide ) is employed in the imaging suspension . the image produced exhibits a very low maximum density ( blue reflection density less than 0 . 05 ) while the negative image on the blocking layer indicates high background . the procedure of example iii is repeated with the exception a dark charge injecting material is employed on the blocking layer which is 1 -[ 1 - naphthyl azo ]- 2 - naphthol and the imagewise exposure step is omitted . this material is evaporated and condensed onto a tedlar film similar to that employed in examples i and ii . after passing the roller electrode over the imaging suspension , the coated blocking layer is replaced with a clean 2 mil thick tedlar film . the applied voltage on the electrodes is again adjusted to 2 , 000 volts and the roller electrode again passed over the dark charged imaging layer while the imaging layer is exposed to light . a positive image is formed on the nesa and a negative image is formed on the blocking layer . the optical density of the image on the conducting electrode is 1 . 2 ( blue reflection ). upon inspection of a negative image on the blocking layer there were found no pigment particles in areas corresponding to maximum density or dark areas of the positive image . a thin layer of evaporated metal free alpha phthalocyanine is placed on the blocking electrode roller of the imaging apparatus . an imaging suspension is prepared by combining a yellow pigment of example iii whth sohio odorless solvent 3440 and placing it on a nesa glass electrode . with 2 , 000 volts potential applied , while in the dark , the blocking electrode having the dark charge injecting material coated thereon is rolled over the imaging suspension on the nesa glass plate . a clean blocking electrode is then passed over the dark charged imaging layer while the layer is exposed to light . a dense high quality yellow positive image is found on the nesa electrode while a high quality negative image is found on the blocking electrode . as shown in example ii , bonadur red b is a strong dark charge injector . as shown in table i the dark charge injection ability of the material is affected by the addition of a polymer to the material . an imaging suspension is prepared by combining equal amounts of bonadur red b having polymer added as described in table i with the yellow pigment of example iii . a multicolor original image is employed in the imaging process and the images are found to have poor color separation and low density . the procedure of example vi is repeated with the exception that 1 -[ 1 - naphthyl azo ]- 2 - naphthol is condensed on the blocking layer to a thickness of about 0 . 1 microns and the exposure step is omitted . a clean , uncoated block layer replaces the coated layer and the applied voltage adjusted to 2 , 000 volts . the roller electrode with the clean blocking layer is passed over the dark charged layer while the layer is exposed to light . good color separation and high density is achieved . a trimix imaging suspension is prepared by combining equal amount of polymer added bonadur red b of example vi , the yellow pigment of example iii and metal free alpha phthalocyanine , which has had polymer added as with the bonadur red b pigment . a full color transparency is employed in the imaging system resulting in the production of low density full color images on the electrodes having poor color separation . the procedure of example viii is repeated with the exception that a thin layer of 1 -[ 1 - naphthyl azo ]- 2 - naphthol is condensed on the blocking electrode and the imagewise exposure step is omitted . the coated blocking layer is replaced with a clean tedlar film and the voltage applied to the electrodes adjusted to 2 , 000 volts . full color optical positive and negative images are provided on the electrodes which are characterized by high density and good color separation . the procedure of example viii is repeated with the exception that bonadur red b pigment , without polymer addition , is added to the trimix in the amount of about 10 percent by weight of the trimix pigments . also , the amount of magenta pigment in the trimix is reduced slightly . upon application of the electric field most of the bonadur red b pigment without polymer migrates to the blocking electrode thus forming a dark charge injecting layer on the blocking layer . upon exposure an image is formed on the conductive electrode which has high density and good color balance . the procedure of example ix is repeated with the exception that a full color negative transparency is employed as an original . upon completion of the imaging procedure a high quality full color positive of the original is found on the blocking electrode and a negative of the original is found on the conductive electrode . the following table ii lists other examples of dark charge injecting materials employed in the above - described photoelectrophoretic imaging process employing an imaging suspension containing the specified pigments . table ii__________________________________________________________________________ dark charge imaging suspensionexample injecting material pigments__________________________________________________________________________xii indofast yellow tones ( available from harmon color co .) bonadur red b , metal free alpha phthal - ocyanine , yellow pig - ment of example iiixiii naphtho [ 2 , 3 - d ] furo -[ 3 , 2 - f ] quinoline - 8 , 13 - dione &# 34 ; xiv rhodamine b ( ionic dye ) &# 34 ; xv benzo -[ b ]- naphtho -[ 2 , 3 - d ] furan - 6 , 11 - dione &# 34 ; xvi same yellow pigment of example iiixvii rhodamine b ( ionic dye ) &# 34 ; xviii indofast yellow toner &# 34 ; xix 1 -[ p - nitrophenyl azo ]- 2 - naphthol &# 34 ; xx hexadecyl amine &# 34 ; xxi hexadecyl amine hydrochloride &# 34 ; xxii hexadecyl trimethyl ammonium chloride &# 34 ; xxiii p - nitrophenol &# 34 ; xxiv hexadecyl alcohol &# 34 ; xxv p - dimethylaminoazobenzene &# 34 ; xxvi erythrosine yellowish c . sub . 20 h . sub . 8 i . sub . 2 na . sub . 2 o . sub . 5 &# 34 ; xxvii potassium iodide &# 34 ; xxviii lithium bromide &# 34 ; xxix lithium chloride &# 34 ; xxx ferrous chloride &# 34 ; xxxi dodecylethylmethylsulfonium chloride &# 34 ; xxxii hexadecyltrimethylammonium chloride &# 34 ; xxxiii polyvinylbenzyl trimethyl ammonium &# 34 ; xxxiv alkyl aryl sulfonate ( atlas g3300 ) ( available from atlas chemical co .) &# 34 ; xxxv n - cetyl - nethyl morpholinium ethosulfate ( atlas g263 ) &# 34 ; xxxvi dodecylphenol ethylene oxide adduct ( monsanto sterox df ) available from monsanto co . yellow pig - ment of ex - ample iiixxxvii dodecyl phenol &# 34 ; xxxviii arginine &# 34 ; xxxix 8 - hydroxy quinoline &# 34 ; xl benzotriazole &# 34 ; ixl carbon black &# 34 ; viiil cobalt neodecanoate &# 34 ; __________________________________________________________________________ although specific components and proportions have been stated in the above description of preferred embodiments of the invention , other typical materials as listed above if suitable may be used with similar results . in addition , other materials may be added to the mixture to synergize , enhance or otherwise modify the properties of the imaging layer . for example , various dyes , spectral sensitizers such as lewis acids may be added to the several layers . other modifications and ramifications of the present invention will occur to those skilled in the art upon a reading of the present disclosure . these are intended to be included within the scope of this invention .
| 6Physics
|
as used in this specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . thus , for example , the term “ a member ” is intended to mean a single member or a combination of members , and “ a material ” is intended to mean one or more materials , or a combination thereof . furthermore , the words “ proximal ” and “ distal ” refer to directions closer to and away from , respectively , an operator ( e . g ., surgeon , physician , nurse , technician , etc .) who would insert the medical device into the patient , with the tip - end ( i . e ., distal end ) of the device inserted inside a patient &# 39 ; s body first . thus , for example , the device end first inserted inside the patient &# 39 ; s body would be the distal end of the device , while the device end last to enter the patient &# 39 ; s body would be the proximal end of the device . as used in this specification and the appended claims , the terms “ up ”, “ upper ”, “ top ”, “ down ”, “ lower ”, “ bottom ”, “ front ”, “ back ”, “ rear ”, “ left ”, “ right ”, “ side ”, “ inner ”, “ middle ” and “ center ”, and similar terms , refer to portions of or positions in or on the implant when the implant is oriented in its implanted position , such as shown in fig1 . as used in this specification and the appended claims , the term “ axial plane ” when used in connection with particular relationships between various parts of the implant means a plane that divides the implant into upper and lower parts . as used in this specification and the appended claims , the term “ coronal plane ” when used in connection with particular relationships between various parts of the implant means a plane that divides the implant into front and back parts . as used in this specification and the appended claims , the term “ sagittal plane ” when used in connection with particular relationships between various parts of the implant means a plane that divides the implant into left and right parts . as used in this specification and the appended claims , the term “ body ” when used in connection with the location where the device of this invention is to be placed , or to teach or practice implantation methods for the device , means a mammalian body . for example , a body can be a patient &# 39 ; s body , or a cadaver , or a portion of a patient &# 39 ; s body or a portion of a cadaver . a “ body ” may also refer to a model of a mammalian body for teaching or training purposes . as used in this specification and the appended claims , the term “ parallel ” describes a relationship , given normal manufacturing or measurement or similar tolerances , between two geometric constructions ( e . g ., two lines , two planes , a line and a plane , two curved surfaces , a line and a curved surface or the like ) in which the two geometric constructions are substantially non - intersecting as they extend substantially to infinity . for example , as used herein , a line is said to be parallel to a curved surface when the line and the curved surface do not intersect as they extend to infinity . similarly , when a planar surface ( i . e ., a two - dimensional surface ) is said to be parallel to a line , every point along the line is spaced apart from the nearest portion of the surface by a substantially equal distance . thus , two geometric constructions are described herein as being “ parallel ” or “ substantially parallel ” to each other when they are nominally parallel to each other , such as for example , when they are parallel to each other within a tolerance . such tolerances can include , for example , manufacturing tolerances , measurement tolerances or the like . as used in this specification and the appended claims , the terms “ normal ”, “ perpendicular ” and “ orthogonal ” describe a relationship between two geometric constructions ( e . g ., two lines , two planes , a line and a plane , two curved surfaces , a line and a curved surface or the like ) in which the two geometric constructions intersect at an angle of approximately 90 degrees within at least one plane . for example , as used herein , a line is said to be normal , perpendicular or orthogonal to a curved surface when the line and the curved surface intersect at an angle of approximately 90 degrees within a plane . thus two geometric constructions are described herein as being “ normal ”, “ perpendicular ”, “ orthogonal ” or “ substantially normal ”, “ substantially perpendicular ”, “ substantially orthogonal ” to each other when they are nominally 90 degrees to each other , such as for example , when they are 90 degrees to each other within a tolerance . such tolerances can include , for example , manufacturing tolerances , measurement tolerances or the like . a spinal implant 100 for spinal fusion that attaches to adjacent spinous processes to fixate the corresponding vertebrae relative to the other is described herein . implant 100 may include two fixation plates 10 , 20 , a brace 30 and a locking element 40 . plates 10 , 20 are adapted to be disposed on respective lateral sides of the adjacent superior and inferior spinous processes . projections 15 may extend from the inner surfaces of plates 10 , 20 and are adapted to engage or “ bite into ” the surfaces of the spinous processes to fix plates 10 , 20 with respect to the spinous processes . brace 30 may be fixed to plate 10 and is adapted to extend through at least plate 20 with distal plate 20 adapted to be moveable proximally with respect to brace 30 . brace 30 may be hollow and may define a lumen 31 extending therethrough that defines a first diameter . locking element 40 is adapted to be disposed within lumen 31 . both proximal plate 10 and distal plate 20 may have a generally curved configuration that extends along a curving longitudinal axis . it is to be understood however that plates 10 , 20 may be generally rectangular with a straight longitudinal axis or may have an offset configuration where the upper and lower portions of the longitudinal axis are offset from each other . projections , or teeth , 15 extend inwardly away from the longitudinal axis of the plate on which they are located and toward the spinous process . as mentioned above , projections 15 are adapted to engage or “ bite into ” the surfaces of the spinous processes to fix plates 10 , 20 with respect to the spinous processes . each plate 10 , 20 defines an opening 11 , 21 , respectively , therein along a medial portion . opening 21 in distal plate 20 should have a diameter large enough to allow distal plate 20 to slide proximally along brace 30 . opening 11 in proximal plate 10 should have a diameter large enough to allow the proximal rod 42 of locking element 40 to slide proximally past proximal plate 10 . as shown in fig6 , plates 10 , 20 may be substantially mirror images of each other . brace 30 may have a generally tubular configuration defining lumen 31 therein . brace 30 may be fixed to either plate 10 , 20 . as shown in fig1 - 5 , brace 30 may be fixed along its proximal end to proximal plate 10 using any suitable means such as welding , brazing , adhesive or mechanical engagement . distal plate 20 may define an opening 21 to allow brace 30 to extend through plate 20 and thus slide along brace 30 and vary the distance between proximal plate 10 and distal plate 20 . the axis of brace 30 is generally transverse to the longitudinal axes of plates 10 , 20 . proximal plate 10 may also define an opening 11 to allow proximal rod 42 to extend proximally through plate 10 . as shown , in fig6 , brace 30 ′ need not be fixed to plate 10 ′. instead , plate 10 ′ may define an opening 11 ′ having a diameter to allow brace 30 ′ to extend through plate 10 ′. a proximal flange 35 may be located at the proximal end of brace 30 ′ to prevent plate 10 from moving proximally off of brace 30 ′. as mention above , the diameter of the proximal portion of brace 30 ′ and the diameter of opening 11 ′ may be matched to provide an interference fit therebetween . locking element 40 includes an enlarged distal knob 41 and a proximal rod 42 attached to distal knob 41 . the maximum diameter of enlarged distal knob 41 is chosen so that it is greater than the diameter of lumen 31 . although knob 41 is shown in the figs . as having a generally circular cross - section , it is to be understood that other configurations could be used for knob 41 . however , it is desirable that the proximal portion of knob 41 have a tapered proximal configuration that increases in diameter in the distal direction . this taper facilitates proximal movement of locking element 40 with respect to brace 30 . locking element 40 is disposed within lumen 31 of brace 30 so that knob 41 is initially located beyond the distal end of brace 30 and the proximal end of rod 42 extends proximally beyond the proximal end of brace 30 and plate 10 . see , e . g . fig4 . when locking element 40 is pulled proximally , the tapered portion of knob 41 engages the distal end of brace 30 and forces the distal portion of brace 30 to deform so it increases in diameter such that the enlarged diameter is greater than the diameter of opening 21 in distal plate 20 . this increase in diameter for the distal portion of brace 30 prevents plate 20 from being moved distally off of brace 30 and thus locks plate 20 to brace 30 and plate 10 . in addition , since the increased diameter of the distal portion of brace 30 caused by knob 41 is larger than the diameter of opening 21 , proximal movement of knob 41 forces plate 20 to move proximally . continued proximal movement of locking element 40 moves plates 10 , 20 together so that projections 15 of each plate 10 , 20 engage and “ bite into ” the spinous processes and lock implant 100 to the spinous processes . once plates 10 , 20 are fixed to the adjacent spinous processes , rod 42 may then be removed from knob 41 so that there is nothing that extends proximally beyond plate 10 . see fig5 . rod 42 or a proximal portion of rod 42 can be removed from locking element 40 by any number of mechanisms . for example , the compressive force between plates 10 , 20 that is necessary to ensure that plates 10 , 20 can be compressed so that projections 15 “ bite into ” the spinous processes can be determined . once this force is determined , the cross - sectional area of a segment of rod 42 can be locally decreased so that it fractures after the desired compressive force has been reached . this cross - sectional area can be computed based on the mechanical properties chosen for knob 41 and rod 42 of locking element 40 . alternatively , a mechanical connection , such as a thread located along the distal end of rod 42 and a tapped hole formed in knob 41 , may be used . in such an embodiment , the user would be able to manually disengage rod 42 from knob 41 after plates 10 , 20 have been fixed to the spinous processes . also , a cutting device may be used to cut off a proximal portion of rod 42 . a method of implanting the spinal implant may include the following steps . after access to the desired spinal motion segment is obtained , proximal plate 10 is located adjacent to the proximal lateral sides of adjacent superior and inferior spinous processes . where brace 30 is fixed to plate 20 , proper placement of plate 10 ensures that brace 30 extends in the interspinous space through the sagittal plane . where brace 30 ′ is not fixed to plate 10 ′, the distal end of brace 30 ′ may be inserted through opening 11 ′ in plate 10 ′, after plate 10 ′ is properly located adjacent the proximal lateral sides of the adjacent spinous processes , and moved distally through the interspinous space until flange 35 abuts the proximal medial face of plate 10 ′ around opening 11 ′. with proximal plate 10 and brace 30 properly located with respect to the spinal segment , the distal end of brace 30 should extend past the distal lateral sides of the adjacent spinous processes . distal plate 20 may then be placed over the distal end of brace 30 so that plate 20 is placed adjacent to the distal lateral sides of the adjacent superior and inferior spinous processes . locking mechanism 40 may then be placed into lumen 31 through brace 30 such that the proximal end of rod 42 is first inserted into the distal end of brace 30 and moved proximally through brace 30 until knob 41 abuts the distal opening of brace 30 . rod 42 may continue to be pulled from the proximal side of brace 30 so knob 41 enlarges the distal portion of brace 30 and locks plate 20 onto brace 30 and with respect to plate 10 . continued proximal movement of locking mechanism 40 forces knob 41 further into the distal portion of brace 30 , enlarging this portion of brace 30 and forcing distal plate 20 to move proximally into engagement with the distal lateral faces of the adjacent superior and inferior spinous processes . once the surgeon is satisfied with the placement of implant 100 , rod 42 may be cut or broken off of knob 41 . for example , knob 41 may be connected to rod 42 by a frangible connection that may be broken by specific manipulation of rod 42 . if desired , the distal portion of brace 30 extending beyond the distal face of distal plate 20 can be removed to minimize the space occupied by implant 100 . however , it is contemplated that only a minor length of the distal portion of brace 30 will extend beyond the distal face of distal plate 20 after plates 10 , 20 have been compressed into engagement with the spinous processes . thus it may be unnecessary to remove any portion of the distal portion of brace 30 . implant 100 may be formed of suitable biocompatible materials . for example , plates 10 , 20 may be formed from stainless steel , titanium and its alloys , polymers such as peek , carbon fiber and the like . a softer , more ductile material , such as 316 stainless steel , may be used for brace 30 . this material would allow brace 30 to deform without fracture and would not require an extremely high force to deform . a harder material , such as a cobalt chrome alloy , may be used for locking element 40 . the various materials used for the parts of implant 100 may be considered in combination with the geometry of the various parts to obtain a customized force / implantation profile to facilitate implantation by the surgeon and achieve an optimized function . while various embodiments of the spinous process fusion device are described herein , it should be understood that they have been presented by way of example only , and not limitation . many modifications and variations will be apparent to the practitioner skilled in the art . the foregoing description of the spinous process fusion device is not intended to be exhaustive or to limit the scope of the invention . it is intended that the scope of the invention be defined by the following claims and their equivalents .
| 0Human Necessities
|
the device shown in fig1 and 2 possesses a rotor 1 driven by a motor not shown in any detail here which rotor can be set into rotary motion in rotating direction a in accordance with fig2 . on this rotor , in horizontal alignment , are fitted two compacting tools 2 , 4 which in each case are movable in relation to one another . the compacting tools 2 , 4 are designed in the form of an inner punch 4 and an outer punch 2 which dip into a corresponding borehole of a template 3 . on the circumference of the rotor 1 in the present embodiment , are located four compacting tool pairs which interact with the corresponding templates . on a central axle a of the rotor 1 there is additionally positioned a material filling funnel 5 which rotates together with the rotor 1 . as the rotor i rotates , the outer compacting tool 2 , the outer punch , is moved over an outer guide curve 12 ( fig2 ) in a horizontal plane relative to the rotor 1 . equally , the second compacting tool 4 , the inner punch , is moved over a guide curve 11 in the horizontal plane of the rotor as the rotor 1 rotates . in this way , the compacting tools 2 and 4 take on a different position to one another in dependence on the angle position of the rotor 1 due to the corresponding guide curves . this is made clear by means of the representation in accordance with fig2 . in position i , the two compacting tools are at a large distance from one another . here , the tabletting material is filled in and dosed . in position ii , the compacting tools 2 and 4 are moved closer to one another . here the tabletting material is increasingly compressed . to apply the required compacting force , two pressure rollers 6 and 8 are positioned opposite each other here . in this position , the pre - compacting of the tablet or compact is performed within template 3 . in position iii , the compacting tools 2 and 4 are moved even closer together so that the tabletting material is compressed even further . here the final compacting pressure to form the tablet is achieved . the final compacting pressure is applied by the pressure roller 6 and the pressure roller 7 ( fig2 ). finally , the compacting tools are moved by the curve control in such a way that the finished tablet or compact is ejected from the template . this ejection position is marked by iv in fig2 . the pressure rollers 6 , 7 and 8 are designed to be movable . the pressure roller 6 positioned in the central area of the rotor 1 is located eccentrically to the axle a of the rotor 1 here and is adjustable in its eccentricity . the pressure rollers 7 and 8 are each adjustable in their distance to the rotor 1 . thanks to this adjustability , the compacting forces to form the tablet or compact can be varied . basically , the pressure rollers 6 , 7 and 8 serve , as described above , to generate the required compacting forces and to transfer these to the compacting tools . in this process , at each passage of the compacting tool pair 2 , 4 between the pressure rollers 6 and 8 and 6 and 7 associated therewith in each case , a packing of the template contents takes place . the filling means 5 in the embodiment shown here is designed as a filling funnel with a convex design , with the funnel shape being obtained by a cone located in the interior of the filling funnel . funnel - like tapering channels 9 are formed between the filling funnel 5 and corresponding filling apertures 10 in the templates 3 . due to the centrifugal forces which apply to the tabletting material particles located in the tapering ends as a result of the rotation of the filling funnel , a safe transport and so filling of the templates 3 is ensured at position i . in fig3 to 5 , different working positions of the compacting tools 2 and 4 in relation to each other are shown in each case . in fig3 the phase of template filling is shown . this representation corresponds to position i in fig2 . in fig4 the compression of the tabletting material is shown . this phase 2 corresponds to positions ii and iii of fig2 . finally , fig5 shows the ejecting of the finished tablet t . phase 3 corresponds to position iv in fig2 . it becomes clear here that the finished tablet t can fall down due to gravity through a corresponding slot 13 into a collecting box not shown in any detail here .
| 0Human Necessities
|
compound 1 , also known as dimethyl ( 2s , 2 ′ s )- 1 , 1 ′ 4 -( 2s , 2 ′ s )- 2 , 2 ′-( 4 , 4 ′ 4 -( 2s , 5s )- 1 -( 4 - tert - butylphenyl ) pyrrolidine - 2 , 5 - diyl ) bis ( 4 , 1 - phenylene )) bis ( azanediyl ) bis ( oxomethylene ) bis ( pyrrolidine - 2 , 1 - diyl )) bis ( 3 - methyl - 1 - oxobutane - 2 , 1 - diyl ) dicarbamate , is described in u . s . patent application publication no . 2010 / 0317568 , the entire content of which is incorporated herein by reference . compound 1 was found to have an ec 50 value of less than 20 pm against many clinically relevant hcv genotypes , such as hcv genotype 1a , 1b , 2a , 2b , 3a , 4a , and 5a , and an ec 50 value of less than 0 . 5 nm against hcv genotype 6a . the present invention features the use of compound 1 or a pharmaceutically acceptable salt thereof to treat hcv as described hereinabove . in any method or use described herein , compound 1 or a pharmaceutically acceptable salt thereof can be formulated in a suitable liquid or solid dosage form . preferably , compound 1 or the salt thereof is formulated in a solid composition comprising compound 1 ( or a pharmaceutically acceptable salt thereof ) in amorphous form , a pharmaceutically acceptable hydrophilic polymer , and optionally a pharmaceutically acceptable surfactant . a non - limiting way to form an amorphous form of compound 1 ( or a pharmaceutically acceptable salt thereof ) is through the formation of solid dispersions with a polymeric carrier . as used herein , the term “ solid dispersion ” defines a system in a solid state ( as opposed to a liquid or gaseous state ) comprising at least two components , wherein one component is dispersed throughout the other component or components . for example , an active ingredient or a combination of active ingredients can be dispersed in a matrix comprised of a pharmaceutically acceptable hydrophilic polymer ( s ) and a pharmaceutically acceptable surfactant ( s ). the term “ solid dispersion ” encompasses systems having small particles of one phase dispersed in another phase . these particles are often of less than 400 μm in size , such as less than 100 , 10 , or 1 μm in size . when a solid dispersion of the components is such that the system is chemically and physically uniform or homogenous throughout or consists of one phase ( as defined in thermodynamics ), such a solid dispersion is called a “ solid solution .” a glassy solution is a solid solution in which a solute is dissolved in a glassy solvent . any method described herein can employ a solid composition which comprises ( 1 ) compound 1 ( or a pharmaceutically acceptable salt thereof ) in amorphous form , ( 2 ) a pharmaceutically acceptable hydrophilic polymer , and ( 3 ) a pharmaceutically acceptable surfactant . compound 1 ( or the salt thereof ) and the polymer preferably are formulated in a solid dispersion . the surfactant may also be formulated in the same solid dispersion ; or the surfactant can be separately combined or mixed with the solid dispersion . the hydrophilic polymer can , for example and without limitation , have a t g of at least 50 ° c ., more preferably at least 60 ° c ., and highly preferably at least 80 ° c . including , but not limited to from , 80 ° c . to 180 ° c ., or from 100 ° c . to 150 ° c . preferably , the hydrophilic polymer is water - soluble . non - limiting examples of suitable hydrophilic polymers include , but are not limited to , homopolymers or copolymers of n - vinyl lactams , such as homopolymers or copolymers of n - vinyl pyrrolidone ( e . g ., polyvinylpyrrolidone ( pvp ), or copolymers of n - vinyl pyrrolidone and vinyl acetate or vinyl propionate ); cellulose esters or cellulose ethers , such as alkylcelluloses ( e . g ., methylcellulose or ethylcellulose ), hydroxyalkylcelluloses ( e . g ., hydroxypropylcellulose ), hydroxyalkylalkylcelluloses ( e . g ., hydroxypropylmethylcellulose ), and cellulose phthalates or succinates ( e . g ., cellulose acetate phthalate and hydroxypropylmethylcellulose phthalate , hydroxypropylmethylcellulose succinate , or hydroxypropylmethylcellulose acetate succinate ); high molecular polyalkylene oxides , such as polyethylene oxide , polypropylene oxide , and copolymers of ethylene oxide and propylene oxide ; polyacrylates or polymethacrylates , such as methacrylic acid / ethyl acrylate copolymers , methacrylic acid / methyl methacrylate copolymers , butyl methacrylate / 2 - dimethylaminoethyl methacrylate copolymers , poly ( hydroxyalkyl acrylates ), and poly ( hydroxyalkyl methacrylates ); polyacrylamides ; vinyl acetate polymers , such as copolymers of vinyl acetate and crotonic acid , and partially hydrolyzed polyvinyl acetate ( also referred to as partially saponified “ polyvinyl alcohol ”); polyvinyl alcohol ; oligo - or polysaccharides , such as carrageenans , galactomannans , and xanthan gum ; polyhydroxyalkylacrylates ; polyhydroxyalkyl - methacrylates ; copolymers of methyl methacrylate and acrylic acid ; polyethylene glycols ( pegs ); or any mixture thereof . non - limiting examples of preferred hydrophilic polymers include polyvinylpyrrolidone ( pvp ) k17 , pvp k25 , pvp k30 , pvp k90 , hydroxypropyl methylcellulose ( hpmc ) e3 , hpmc e5 , hpmc e6 , hpmc e15 , hpmc k3 , hpmc a4 , hpmc a15 , hpmc acetate succinate ( as ) lf , hpmc as mf , hpmc as hf , hpmc as lg , hpmc as mg , hpmc as hg , hpmc phthalate ( p ) 50 , hpmc p 55 , ethocel 4 , ethocel 7 , ethocel 10 , ethocel 14 , ethocel 20 , copovidone ( vinylpyrrolidone - vinyl acetate copolymer 60 / 40 ), polyvinyl acetate , methacrylate / methacrylic acid copolymer ( eudragit ) l100 - 55 , eudragit l100 , eudragit s100 , polyethylene glycol ( peg ) 400 , peg 600 , peg 1450 , peg 3350 , peg 4000 , peg 6000 , peg 8000 , poloxamer 124 , poloxamer 188 , poloxamer 237 , poloxamer 338 , and poloxamer 407 . of these , homopolymers or copolymers of n - vinyl pyrrolidone , such as copolymers of n - vinyl pyrrolidone and vinyl acetate , are preferred . a non - limiting example of a preferred polymer is a copolymer of 60 % by weight of n - vinyl pyrrolidone and 40 % by weight of vinyl acetate . other preferred polymers include , without limitation , hydroxypropyl methylcellulose ( hpmc , also known as hypromellose in usp ), such as hydroxypropyl methylcellulose grade e5 ( hpmc - e5 ); and hydroxypropyl methylcellulose acetate succinate ( hpmc - as ). the pharmaceutically acceptable surfactant employed can be a non - ionic surfactant . preferably , the surfactant has an hlb value of from 2 - 20 . a solid composition employed in the invention can also include a mixture of pharmaceutically acceptable surfactants , with at least one surfactant having an hlb value of at least 10 and at least another surfactant having an hlb value of below 10 . non - limiting examples of suitable pharmaceutically acceptable surfactants include polyoxyethylene castor oil derivates , e . g . polyoxyethyleneglycerol triricinoleate or polyoxyl 35 castor oil ( cremophor ® el ; basf corp .) or polyoxyethyleneglycerol oxystearate such as polyethyleneglycol 40 hydrogenated castor oil ( cremophor ® rh 40 , also known as polyoxyl 40 hydrogenated castor oil or macrogolglycerol hydroxystearate ) or polyethylenglycol 60 hydrogenated castor oil ( cremophor ® rh 60 ); or a mono fatty acid ester of polyoxyethylene sorbitan , such as a mono fatty acid ester of polyoxyethylene ( 20 ) sorbitan , e . g . polyoxyethylene ( 20 ) sorbitan monooleate ( tween ® 80 ), polyoxyethylene ( 20 ) sorbitan monostearate ( tween ® 60 ), polyoxyethylene ( 20 ) sorbitan monopalmitate ( tween ® 40 ), or polyoxyethylene ( 20 ) sorbitan monolaurate ( tween ® 20 ). other non - limiting examples of suitable surfactants include polyoxyethylene alkyl ethers , e . g . polyoxyethylene ( 3 ) lauryl ether , polyoxyethylene ( 5 ) cetyl ether , polyoxyethylene ( 2 ) stearyl ether , polyoxyethylene ( 5 ) stearyl ether ; polyoxyethylene alkylaryl ethers , e . g . polyoxyethylene ( 2 ) nonylphenyl ether , polyoxyethylene ( 3 ) nonylphenyl ether , polyoxyethylene ( 4 ) nonylphenyl ether , polyoxyethylene ( 3 ) octylphenyl ether ; polyethylene glycol fatty acid esters , e . g . peg - 200 monolaurate , peg - 200 dilaurate , peg - 300 dilaurate , peg - 400 dilaurate , peg - 300 distearate , peg - 300 dioleate ; alkylene glycol fatty acid mono esters , e . g . propylene glycol monolaurate ( lauroglycol ®); sucrose fatty acid esters , e . g . sucrose monostearate , sucrose distearate , sucrose monolaurate , sucrose dilaurate ; sorbitan fatty acid mono esters such as sorbitan mono laurate ( span ® 20 ), sorbitan monooleate , sorbitan monopalnitate ( span ® 40 ), or sorbitan stearate . other suitable surfactants include , but are not limited to , block copolymers of ethylene oxide and propylene oxide , also known as polyoxyethylene polyoxypropylene block copolymers or polyoxyethylene polypropyleneglycol , such as poloxamer ® 124 , poloxamer ® 188 , poloxamer ® 237 , poloxamer ® 388 , or poloxamer ® 407 ( basf wyandotte corp .). as described above , a mixture of surfactants can be used in a solid composition employed in the invention . non - limiting examples of preferred surfactants include polysorbate 20 , polysorbate 40 , polysorbate 60 , polysorbate 80 , cremophor rh 40 , cremophor el , gelucire 44 / 14 , gelucire 50 / 13 , d - alpha - tocopheryl polyethylene glycol 1000 succinate ( vitamin e tpgs ), propylene glycol laurate , sodium lauryl sulfate , and sorbitan monolaurate . the solid dispersion employed in this invention preferably is a solid solution , and more preferably a glassy solution . in one embodiment , a solid composition employed in the invention comprises an amorphous solid dispersion or solid solution which includes compound 1 ( or a pharmaceutically acceptable salt thereof ) and a pharmaceutically acceptable hydrophilic polymer . the solid composition also includes a pharmaceutically acceptable surfactant which preferably is formulated in the amorphous solid dispersion or solid solution . the hydrophilic polymer can be selected , for example , from the group consisting of homopolymer of n - vinyl lactam , copolymer of n - vinyl lactam , cellulose ester , cellulose ether , polyalkylene oxide , polyacrylate , polymethacrylate , polyacrylamide , polyvinyl alcohol , vinyl acetate polymer , oligosaccharide , and polysaccharide . as a non - limiting example , the hydrophilic polymer is selected from the group consisting of homopolymer of n - vinyl pyrrolidone , copolymer of n - vinyl pyrrolidone , copolymer of n - vinyl pyrrolidone and vinyl acetate , copolymer of n - vinyl pyrrolidone and vinyl propionate , polyvinylpyrrolidone , methylcellulose , ethylcellulose , hydroxyalkylcelluloses , hydroxypropylcellulose , hydroxyalkylalkylcellulose , hydroxypropylmethylcellulose , cellulose phthalate , cellulose succinate , cellulose acetate phthalate , hydroxypropylmethylcellulose phthalate , hydroxypropylmethylcellulose succinate , hydroxypropylmethylcellulose acetate succinate , polyethylene oxide , polypropylene oxide , copolymer of ethylene oxide and propylene oxide , methacrylic acid / ethyl acrylate copolymer , methacrylic acid / methyl methacrylate copolymer , butyl methacrylate / 2 - dimethylaminoethyl methacrylate copolymer , poly ( hydroxyalkyl acrylate ), poly ( hydroxyalkyl methacrylate ), copolymer of vinyl acetate and crotonic acid , partially hydrolyzed polyvinyl acetate , carrageenan , galactomannan , and xanthan gum . preferably , the hydrophilic polymer is selected from polyvinylpyrrolidone ( pvp ) k17 , pvp k25 , pvp k30 , pvp k90 , hydroxypropyl methylcellulose ( hpmc ) e3 , hpmc e5 , hpmc e6 , hpmc e15 , hpmc k3 , hpmc a4 , hpmc a15 , hpmc acetate succinate ( as ) lf , hpmc as mf , hpmc as hf , hpmc as lg , hpmc as mg , hpmc as hg , hpmc phthalate ( p ) 50 , hpmc p 55 , ethocel 4 , ethocel 7 , ethocel 10 , ethocel 14 , ethocel 20 , copovidone ( vinylpyrrolidone - vinyl acetate copolymer 60 / 40 ), polyvinyl acetate , methacrylate / methacrylic acid copolymer ( eudragit ) l100 - 55 , eudragit l100 , eudragit s100 , polyethylene glycol ( peg ) 400 , peg 600 , peg 1450 , peg 3350 , peg 4000 , peg 6000 , peg 8000 , poloxamer 124 , poloxamer 188 , poloxamer 237 , poloxamer 338 , or poloxamer 407 . more preferably , the hydrophilic polymer is selected from homopolymers of vinylpyrrolidone ( e . g ., pvp with fikentscher k values of from 12 to 100 , or pvp with fikentscher k values of from 17 to 30 ), or copolymers of 30 to 70 % by weight of n - vinylpyrrolidone ( vp ) and 70 to 30 % by weight of vinyl acetate ( va ) ( e . g ., a copolymer of 60 % by weight vp and 40 % by weight va ). the surfactant can be selected , for example , from the group consisting of polyoxyethyleneglycerol triricinoleate or polyoxyl 35 castor oil ( cremophor ® el ; basf corp .) or polyoxyethyleneglycerol oxystearate , mono fatty acid ester of polyoxyethylene sorbitan , polyoxyethylene alkyl ether , polyoxyethylene alkylaryl ether , polyethylene glycol fatty acid ester , alkylene glycol fatty acid mono ester , sucrose fatty acid ester , and sorbitan fatty acid mono ester . as a non - limited example , the surfactant is selected from the group consisting of polyethylenglycol 40 hydrogenated castor oil ( cremophor ® rh 40 , also known as polyoxyl 40 hydrogenated castor oil or macrogolglycerol hydroxystearate ), polyethylenglycol 60 hydrogenated castor oil ( cremophor ® rh 60 ), a mono fatty acid ester of polyoxyethylene ( 20 ) sorbitan ( e . g . polyoxyethylene ( 20 ) sorbitan monooleate ( tween ® 80 ), polyoxyethylene ( 20 ) sorbitan monostearate ( tween ® 60 ), polyoxyethylene ( 20 ) sorbitan monopalmitate ( tween ® 40 ), or polyoxyethylene ( 20 ) sorbitan monolaurate ( tween ® 20 )), polyoxyethylene ( 3 ) lauryl ether , polyoxyethylene ( 5 ) cetyl ether , polyoxyethylene ( 2 ) stearyl ether , polyoxyethylene ( 5 ) stearyl ether , polyoxyethylene ( 2 ) nonylphenyl ether , polyoxyethylene ( 3 ) nonylphenyl ether , polyoxyethylene ( 4 ) nonylphenyl ether , polyoxyethylene ( 3 ) octylphenyl ether , peg - 200 monolaurate , peg - 200 dilaurate , peg - 300 dilaurate , peg - 400 dilaurate , peg - 300 distearate , peg - 300 dioleate , propylene glycol monolaurate , sucrose monostearate , sucrose distearate , sucrose monolaurate , sucrose dilaurate , sorbitan monolaurate , sorbitan monooleate , sorbitan monopalnitate , and sorbitan stearate . preferably , the surfactant is selected from polysorbate 20 , polysorbate 40 , polysorbate 60 , polysorbate 80 , cremophor rh 40 , cremophor el , gelucire 44 / 14 , gelucire 50 / 13 , d - alpha - tocopheryl polyethylene glycol 1000 succinate ( vitamin e tpgs ), propylene glycol laurate , sodium lauryl sulfate , or sorbitan monolaurate . more preferably , the surfactant is selected from sorbitan monolaurate or d - alpha - tocopheryl polyethylene glycol 1000 succinate . a solid dispersion employed in the invention preferably comprises or consists of a single - phase ( defined in thermodynamics ) in which compound 1 , or a combination of compound 1 and another anti - hcv agent , is molecularly dispersed in a matrix containing the pharmaceutically acceptable hydrophilic polymer ( s ). in such cases , thermal analysis of the solid dispersion using differential scanning calorimetry ( dsc ) typically shows only one single t g , and the solid dispersion does not contain any detectable crystalline compound 1 as measured by x - ray powder diffraction spectroscopy . a solid composition employed in the invention can be prepared by a variety of techniques such as , without limitation , melt - extrusion , spray - drying , co - precipitation , freeze drying , or other solvent evaporation techniques , with melt - extrusion and spray - drying being preferred . the melt - extrusion process typically comprises the steps of preparing a melt which includes the active ingredient ( s ), the hydrophilic polymer ( s ) and preferably the surfactant ( s ), and then cooling the melt until it solidifies . “ melting ” means a transition into a liquid or rubbery state in which it is possible for one component to get embedded , preferably homogeneously embedded , in the other component or components . in many cases , the polymer component ( s ) will melt and the other components including the active ingredient ( s ) and surfactant ( s ) will dissolve in the melt thereby forming a solution . melting usually involves heating above the softening point of the polymer ( s ). the preparation of the melt can take place in a variety of ways . the mixing of the components can take place before , during or after the formation of the melt . for example , the components can be mixed first and then melted or be simultaneously mixed and melted . the melt can also be homogenized in order to disperse the active ingredient ( s ) efficiently . in addition , it may be convenient first to melt the polymer ( s ) and then to mix in and homogenize the active ingredient ( s ). in one example , all materials except surfactant ( s ) are blended and fed into an extruder , while the surfactant ( s ) is molten externally and pumped in during extrusion . to start a melt - extrusion process , the active ingredient ( s ) ( e . g ., compound 1 , or a combination of compound 1 and at least another anti - hcv agent ) can be employed in their solid forms , such as their respective crystalline forms . the active ingredient ( s ) can also be employed as a solution or dispersion in a suitable liquid solvent such as alcohols , aliphatic hydrocarbons , esters or , in some cases , liquid carbon dioxide . the solvent can be removed , e . g . evaporated , upon preparation of the melt . various additives can also be included in the melt , for example , flow regulators ( e . g ., colloidal silica ), binders , lubricants , fillers , disintegrants , plasticizers , colorants , or stabilizers ( e . g ., antioxidants , light stabilizers , radical scavengers , and stabilizers against microbial attack ). the melting and / or mixing can take place in an apparatus customary for this purpose . particularly suitable ones are extruders or kneaders . suitable extruders include single screw extruders , intermeshing screw extruders or multiscrew extruders , preferably twin screw extruders , which can be corotating or counterrotating and , optionally , be equipped with kneading disks . it will be appreciated that the working temperatures will be determined by the kind of extruder or the kind of configuration within the extruder that is used . part of the energy needed to melt , mix and dissolve the components in the extruder can be provided by heating elements . however , the friction and shearing of the material in the extruder may also provide a substantial amount of energy to the mixture and aid in the formation of a homogeneous melt of the components . the melt can range from thin to pasty to viscous . shaping of the extrudate can be conveniently carried out by a calender with two counter - rotating rollers with mutually matching depressions on their surface . the extrudate can be cooled and allow to solidify . the extrudate can also be cut into pieces , either before ( hot - cut ) or after solidification ( cold - cut ). the solidified extrusion product can be further milled , ground or otherwise reduced to granules . the solidified extrudate , as well as each granule produced , comprises a solid dispersion , preferably a solid solution , of the active ingredient ( s ) in a matrix comprised of the hydrophilic polymer ( s ) and optionally the pharmaceutically acceptable surfactant ( s ). where the granules do not contain any surfactant , a pharmaceutically acceptable surfactant described above can be added to and blended with the granules . the extrusion product can also be blended with other active ingredient ( s ) and / or additive ( s ) before being milled or ground to granules . the granules can be further processed into suitable solid oral dosage forms . the approach of solvent evaporation , via spray - drying , provides the advantage of allowing for processability at lower temperatures , if needed , and allows for other modifications to the process in order to further improve powder properties . the spray - dried powder can then be formulated further , if needed , and final drug product is flexible with regards to whether capsule , tablet or any other solid dosage form is desired . exemplary spray - drying processes and spray - drying equipment are described in k . masters , s pray d rying h andbook ( halstead press , new york , 4 th ed ., 1985 ). non - limiting examples of spray - drying devices that are suitable for the present invention include spray dryers manufactured by niro inc . or gea process engineering inc ., buchi labortechnik ag , and spray drying systems , inc . a spray - drying process generally involves breaking up a liquid mixture into small droplets and rapidly removing solvent from the droplets in a container ( spray drying apparatus ) where there is a strong driving force for evaporation of solvent from the droplets . atomization techniques include , for example , two - fluid or pressure nozzles , or rotary atomizers . the strong driving force for solvent evaporation can be provided , for example , by maintaining the partial pressure of solvent in the spray drying apparatus well below the vapor pressure of the solvent at the temperatures of the drying droplets . this may be accomplished by either ( 1 ) maintaining the pressure in the spray drying apparatus at a partial vacuum ; ( 2 ) mixing the liquid droplets with a warm drying gas ( e . g ., heated nitrogen ); or ( 3 ) both . the temperature and flow rate of the drying gas , as well as the spray dryer design , can be selected so that the droplets are dry enough by the time they reach the wall of the apparatus . this help to ensure that the dried droplets are essentially solid and can form a fine powder and do not stick to the apparatus wall . the spray - dried product can be collected by removing the material manually , pneumatically , mechanically or by other suitable means . the actual length of time to achieve the preferred level of dryness depends on the size of the droplets , the formulation , and spray dryer operation . following the solidification , the solid powder may stay in the spray drying chamber for additional time ( e . g ., 5 - 60 seconds ) to further evaporate solvent from the solid powder . the final solvent content in the solid dispersion as it exits the dryer is preferably at a sufficiently low level so as to improve the stability of the final product . for instance , the residual solvent content of the spray - dried powder can be less than 2 % by weight . highly preferably , the residual solvent content is within the limits set forth in the international conference on harmonization ( ich ) guidelines . in addition , it may be useful to subject the spray - dried composition to further drying to lower the residual solvent to even lower levels . methods to further lower solvent levels include , but are not limited to , fluid bed drying , infra - red drying , tumble drying , vacuum drying , and combinations of these and other processes . like the solid extrudate described above , the spray dried product contains a solid dispersion , preferably a solid solution , of the active ingredient ( s ) in a matrix comprised of the hydrophilic polymer ( s ) and optionally the pharmaceutically acceptable surfactant ( s ). where the spray dried product does not contain any surfactant , a pharmaceutically acceptable surfactant described above can be added to and blended with the spray - dried product before further processing . before feeding into a spray dryer , the active ingredient ( s ) ( e . g ., compound 1 , or a combination of compound 1 and at least another anti - hcv agent ), the hydrophilic polymer ( s ), as well as other optional active ingredients or excipients such as the pharmaceutically acceptable surfactant ( s ), can be dissolved in a solvent . suitable solvents include , but are not limited to , alkanols ( e . g ., methanol , ethanol , 1 - propanol , 2 - propanol or mixtures thereof ), acetone , acetone / water , alkanol / water mixtures ( e . g ., ethanol / water mixtures ), or combinations thereof . the solution can also be preheated before being fed into the spray dryer . the solid dispersion produced by melt - extrusion , spray - drying or other techniques can be prepared into any suitable solid oral dosage forms . in one embodiment , the solid dispersion prepared by melt - extrusion , spray - drying or other techniques can be compressed into tablets . the solid dispersion can be either directly compressed , or milled or ground to granules or powders before compression . compression can be done in a tablet press , such as in a steel die between two moving punches . when a solid composition of the present invention comprises compound 1 and another anti - hcv agent , it is possible to separately prepare solid dispersions of each individual active ingredient and then blend the optionally milled or ground solid dispersions before compacting . compound 1 and other active ingredient ( s ) can also be prepared in the same solid dispersion , optionally milled and / or blended with other additives , and then compressed into tablets . at least one additive selected from flow regulators , binders , lubricants , fillers , disintegrants , or plasticizers may be used in compressing the solid dispersion . these additives can be mixed with ground or milled solid dispersion before compacting . various other additives may also be used in preparing a solid composition of the present invention , for example dyes such as azo dyes , organic or inorganic pigments such as aluminium oxide or titanium dioxide , or dyes of natural origin ; stabilizers such as antioxidants , light stabilizers , radical scavengers , stabilizers against microbial attack . in any aspect , embodiment and example described herein , compound 1 ( or a pharmaceutically acceptable salt thereof ) can be administered to an hcv patient in combination with another anti - hcv agent . preferably , such a treatment does not include the use of interferon throughout the treatment regimen . the treatment regimen can last , for example and without limitation , 24 , 23 , 22 , 21 , 20 , 19 , 18 , 17 , 16 , 15 , 14 , 13 , 12 , 11 , 10 , 9 or 8 weeks . preferably , the treatment regimen last , for example and without limitation , 12 weeks . the treatment regimen may also last less than 12 weeks , such as 11 , 10 , 9 or 8 weeks . suitable anti - hcv agents that can be combined with compound 1 ( or a pharmaceutically acceptable salt thereof ) include , but are not limited to , hcv polymerase inhibitors ( e . g ., nucleoside polymerase inhibitors or non - nucleoside polymerase inhibitors ), hcv protease inhibitors , hcv helicase inhibitors , other hcv ns5a inhibitors , hcv entry inhibitors , cyclophilin inhibitors , cd81 inhibitors , internal ribosome entry site inhibitors , or any combination thereof . for instance , said another anti - hcv agent can be an hcv polymerase inhibitor . for another instance , said another anti - hcv agent can be an hcv protease inhibitor . said another anti - hcv agent can also include two or more hcv inhibitors . for instance , said another anti - hcv agent can be a combination of an hcv polymerase inhibitor and an hcv protease inhibitor . for another instance , said another anti - hcv agent can be a combination of two different hcv protease inhibitors . for another instance , said another anti - hcv agent can be a combination of two different hcv polymerase inhibitors ( e . g ., one is a nucleoside or nucleotide polymerase inhibitor and the other is a non - nucleoside polymerase inhibitor ; or both are nucleoside or nucleotide polymerase inhibitors ; or both are non - nucleoside polymerase inhibitor ). in yet another example , said another anti - hcv agent can be a combination of another hcv ns5a inhibitor and an hcv polymerase inhibitor . in yet another example , said another anti - hcv agent can be a combination of another hcv ns5a inhibitor and an hcv protease inhibitor . in still another example , said another anti - hcv agent can be a combination of two other hcv ns5a inhibitors . specific examples of anti - hcv agents that are suitable for combination with compound 1 ( or a pharmaceutically acceptable salt thereof ) in any aspect , embodiment or example described herein include , but are not limited to , psi - 7977 ( pharmasset / gilead ), psi - 7851 ( pharmasset / gilead ), psi - 938 ( pharmasset / gilead ), pf - 00868554 , ana - 598 , idx184 , idx102 , idx375 , gs - 9190 , vch - 759 , vch - 916 , mk - 3281 , bcx - 4678 , mk - 3281 , vby708 , ana598 , gl59728 , gl60667 , bms - 790052 , bms - 791325 , bms - 650032 , bms - 824393 , gs - 9132 , ach - 1095 , ap - h005 , a - 831 ( arrow therapeutics ), a - 689 ( arrow therapeutics ), inx08189 ( inhibitex ), azd2836 , telaprevir , boceprevir , itmn - 191 ( intermune / roche ), bi - 201335 , vby - 376 , vx - 500 ( vertex ), phx - b , ach - 1625 , idx136 , idx316 , vx - 813 ( vertex ), sch 900518 ( schering - plough ), tmc - 435 ( tibotec ), itmn - 191 ( intermune , roche ), mk - 7009 ( merck ), idx - pi ( novartis ), bi - 201335 ( boehringer ingelheim ), r7128 ( roche ), mk - 3281 ( merck ), mk - 0608 ( merck ), pf - 868554 ( pfizer ), pf - 4878691 ( pfizer ), idx - 184 ( novartis ), idx - 375 , ppi - 461 ( presidio ), bilb - 1941 ( boehringer ingelheim ), gs - 9190 ( gilead ), bms - 790052 ( bms ), cts - 1027 ( conatus ), gs - 9620 ( gilead ), pf - 4878691 ( pfizer ), ro5303253 ( roche ), als - 2200 ( alios biopharma / vertex ), als - 2158 ( alios biopharma / vertex ), gsk62336805 ( glaxosmithkline ), or any combinations thereof . non - limiting examples of hcv protease inhibitors that are suitable for combination with compound 1 ( or a pharmaceutically acceptable salt thereof ) in any aspect , embodiment or example described herein include ach - 1095 ( achillion ), ach - 1625 ( achillion ), ach - 2684 ( achillion ), avl - 181 ( avila ), avl - 192 ( avila ), bi - 201335 ( boehringer ingelheim ), bms - 650032 ( bms ), boceprevir , danoprevir , gs - 9132 ( gilead ), gs - 9256 ( gilead ), gs - 9451 ( gilead ), idx - 136 ( idenix ), idx - 316 ( idenix ), idx - 320 ( idenix ), mk - 5172 ( merck ), narlaprevir , phx - 1766 ( phenomix ), telaprevir , tmc - 435 ( tibotec ), vaniprevir , vby708 ( virobay ), vx - 500 ( vertex ), vx - 813 ( vertex ), vx - 985 ( vertex ), or any combination thereof . non - limiting examples of hcv polymerase inhibitors that are suitable for combination with compound 1 ( or a pharmaceutically acceptable salt thereof ) in any aspect , embodiment or example described herein include ana - 598 ( anadys ), bi - 207127 ( boehringer ingelheim ), bilb - 1941 ( boehringer ingelheim ), bms - 791325 ( bms ), filibuvir , gl59728 ( glaxo ), gl60667 ( glaxo ), gs - 9669 ( gilead ), idx - 375 ( idenix ), mk - 3281 ( merck ), tegobuvir , tmc - 647055 ( tibotec ), vch - 759 ( vertex & amp ; virachem ), vch - 916 ( virachem ), vx - 222 ( vch - 222 ) ( vertex & amp ; virachem ), vx - 759 ( vertex ), gs - 6620 ( gilead ), idx - 102 ( idenix ), idx - 184 ( idenix ), inx - 189 ( inhibitex ), mk - 0608 ( merck ), psi - 7977 ( pharmasset / gilead ), psi - 938 ( pharmasset / gilead ), rg7128 ( roche ), tmc64912 ( medivir ), gsk625433 ( glaxosmithkline ), bcx - 4678 ( biocryst ), als - 2200 ( alios biopharma / vertex ), als - 2158 ( alios biopharma / vertex ), or any combination thereof . a polymerase inhibitor may be a nucleotide polymerase inhibitor , such as gs - 6620 ( gilead ), idx - 102 ( idenix ), idx - 184 ( idenix ), inx - 189 ( inhibitex ), mk - 0608 ( merck ), psi - 7977 ( pharmasset / gilead ), psi - 938 ( pharmasset / gilead ), rg7128 ( roche ), tmc64912 ( medivir ), als - 2200 ( alios biopharma / vertex ), als - 2158 ( alios biopharma / vertex ), or any combination therefore . a polymerase inhibitor may also be a non - nucleoside polymerase inhibitor , such as ana - 598 ( anadys ), bi - 207127 ( boehringer ingelheim ), bilb - 1941 ( boehringer ingelheim ), bms - 791325 ( bms ), filibuvir , gl59728 ( glaxo ), gl60667 ( glaxo ), gs - 9669 ( gilead ), idx - 375 ( idenix ), mk - 3281 ( merck ), tegobuvir , tmc - 647055 ( tibotec ), vch - 759 ( vertex & amp ; virachem ), vch - 916 ( virachem ), vx - 222 ( vch - 222 ) ( vertex & amp ; virachem ), vx - 759 ( vertex ), or any combination thereof . non - limiting examples of ns5a inhibitors that are suitable for combination with compound 1 ( or a pharmaceutically acceptable salt thereof ) in any aspect , embodiment or example described herein include gsk62336805 ( glaxosmithkline ), ach - 2928 ( achillion ), ach - 3102 ( achillion ), azd2836 ( astra - zeneca ), azd7295 ( astra - zeneca ), bms - 790052 ( bms ), bms - 824393 ( bms ), edp - 239 ( enanta / novartis ), gs - 5885 ( gilead ), idx - 719 ( idenix ), mk - 8742 ( merck ), ppi - 1301 ( presidio ), ppi - 461 ( presidio ), or any combination thereof . non - limiting examples of cyclophilin inhibitors that are suitable for combination with compound 1 ( or a pharmaceutically acceptable salt thereof ) in any aspect , embodiment or example described herein include alisporovir ( novartis & amp ; debiopharm ), nm - 811 ( novartis ), scy - 635 ( scynexis ), or any combination thereof . non - limiting examples of hcv entry inhibitors that are suitable for combination with compound 1 ( or a pharmaceutically acceptable salt thereof ) in any aspect , embodiment or example described herein include itx - 4520 ( itherx ), itx - 5061 ( itherx ), or a combination thereof . in any aspect , embodiment or example described herein , compound 1 ( or a pharmaceutically acceptable salt thereof ) can be administered , for example and without limitation , concurrently with said anther anti - hcv agent . compound 1 ( or a pharmaceutically acceptable salt thereof ) can also be administered , for example and without limitation , sequentially with said another anti - hcv agent . for instance , compound 1 ( or a pharmaceutically acceptable salt thereof ) can be administered immediately before or after the administration of said another anti - hcv agent . the frequency of administration may be the same or different . for example , compound 1 ( or a pharmaceutically acceptable salt thereof ) and said another anti - hcv agent can be administered once daily . for another example , compound 1 ( or a pharmaceutically acceptable salt thereof ) can be administered once daily , and said another anti - hcv agent can be administered twice daily . in any aspect , embodiment or example described herein , compound 1 ( or a pharmaceutically acceptable salt thereof ) can be co - formulated with said another anti - hcv agent in a single dosage form . non - limiting examples of suitable dosage forms include liquid or solid dosage forms . preferably , the dosage form is a solid dosage form . more preferably , the dosage form is a solid dosage form in which compound 1 ( or a pharmaceutically acceptable salt thereof ) is in amorphous form , or highly preferably molecularly dispersed in a matrix which comprises a pharmaceutically acceptable water - soluble polymer and a pharmaceutically acceptable surfactant . said another anti - hcv agent can also be in amorphous form , or molecularly dispersed in the same matrix or a different matrix which comprises a pharmaceutically acceptable water - soluble polymer and a pharmaceutically acceptable surfactant . said another anti - hcv agent can also be formulated in different form ( s ) ( e . g ., in a crystalline form ). as a non - limiting alternative , compound 1 ( or a pharmaceutically acceptable salt thereof ) and said another anti - hcv agent can be formulated in different dosage forms . for instance , compound 1 ( or a pharmaceutically acceptable salt thereof ) and said another anti - hcv agent can be formulated in different respective solid dosage forms . in any aspect , embodiment or example described herein , compound 1 or a pharmaceutically acceptable salt thereof may be administered in a suitable amount such as , for example , in doses of from about 0 . 1 mg / kg to about 200 mg / kg body weight , or from about 0 . 25 mg / kg to about 100 mg / kg , or from about 0 . 3 mg / kg to about 30 mg / kg . as another non - limiting example , compound 1 ( or a pharmaceutically acceptable salt thereof ) may be administered in a total daily dose amount of from about 5 mg to about 300 mg , or from about 25 mg to about 200 mg , or from about 25 mg to about 50 mg or an amount there between . single dose compositions may contain such amounts or submultiples thereof to make up the daily dose . it will be understood , however , that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed , the age , body weight , general health , sex , diet , time of administration , route of administration , rate of excretion , drug combination , and the severity of the disease undergoing therapy . it will also be understood that the total daily dosage of the compounds and compositions to be administered will be decided by the attending physician within the scope of sound medical judgment . the following table lists non - limiting examples of a combination of compound 1 ( or a pharmaceutically acceptable salt thereof ) and another anti - hcv agent that can be used in any aspect , embodiment or example described herein . for each treatment , compound 1 ( or a pharmaceutically acceptable salt thereof ) and said another anti - hcv agent can be administered daily to an hcv patient . each treatment can be interferon - free . administration of ribavirin can be included in each regimen . however , the present invention contemplates that each treatment regimen can be both interferon - and ribavirin - free . in addition , interferon and / or ribavirin can be included in each treatment regimen if needed . each treatment regimen may also optionally comprise administering one or more other anti - hcv agents to the patient . the duration of each treatment regimen may last , for example and without limitation , 8 - 48 weeks , depending on the patient &# 39 ; s response . in any given regimen described in table 1 , the drugs can be , for example and without limitation , co - formulated in a single solid dosage form . for instance , all drugs used in a regimen can be co - formulated in amorphous forms or molecularly dispersed in a matrix comprising a pharmaceutically acceptable water - soluble polymer and optionally a pharmaceutically acceptable surfactant ; for another instance , compound 1 is formulated in amorphous form or molecularly dispersed in a matrix comprising a pharmaceutically acceptable water - soluble polymer and optionally a pharmaceutically acceptable surfactant , and the other drug is in crystalline form ( s ) and combined with amorphous compound 1 in a single solid dosage form . for yet another instance , compound 1 is formulated in a different dosage form than that of the other drug . replicon cell lines used for evaluating the inhibitory activities of compound 1 can be prepared according to the following protocol . two genotype 1 stable subgenomic replicon cell lines can be used for compound characterization in cell culture : one derived from genotype 1a - h77 and the other derived from genotype 1b - con1 . the replicon constructs can be bicistronic subgenomic replicons . the genotype 1a replicon construct contains ns3 - ns5b coding region derived from the h77 strain of hcv ( 1a - h77 ). the replicon also has a firefly luciferase reporter and a neomycin phosphotransferase ( neo ) selectable marker . these two coding regions , separated by the fmdv 2a protease , comprise the first cistron of the bicistronic replicon construct , with the second cistron containing the ns3 - ns5b coding region with addition of adaptive mutations e 1202g , k1691r , k2040r , and s2204i . the 1b - con1 replicon construct is identical to the 1a - h77 replicon , except that the hcv 5 ′ utr , 3 ′ utr , and ns3 - ns5b coding region are derived from the 1b - con1 strain , and the adaptive mutations are k1609e , k1846t , and y3005c . in addition , the 1b - con1 replicon construct contains a poliovirus ires between the hcv ires and the luciferase gene . replicon cell lines can be maintained in dulbecco &# 39 ; s modified eagles medium ( dmem ) containing 10 % ( v / v ) fetal bovine serum ( fbs ), 100 iu / ml penicillin , 100 mg / ml streptomycin ( invitrogen ), and 200 mg / ml g418 ( invitrogen ). it should be understood that the above - described embodiments and the following examples are given by way of illustration , not limitation . various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the present description . antiviral activity of compound 1 against hcv replicons containing ns5a genes obtained from genotype 2 , 3 , 4 , 5 or 6 hcv infected humans in order to assess the ability of compound 1 to inhibit ns5a from non - genotype 1 hcv , a number of stable subgenomic 1b - con1 replicon cell lines containing a portion of ns5a from genotype 2a , 2b , 3a , 4a , 5a or 6a hcv were created . this replicon construct contains a noti restriction site upstream of ns5a , and a blpi restriction site just after ns5a amino acid 214 . viral rna from infected subjects was isolated according to middleton et al ., j v irol m ethods 145 : 137 - 145 ( 2007 ) and tripathi et al ., a ntiviral r es 73 : 40 - 49 ( 2007 ). rt - pcr was conducted on the rna to generate a dna fragment encoding ns5a amino acids 1 - 214 . the pcr fragment incorporated noti and blpi compatible ends , and this fragment was ligated into a plasmid containing the 1b - con1 replicon . stable cell lines were generated by introducing these constructs into huh - 7 cells . the inhibitory effect of compound 1 on hcv replication was determined by measuring activity of the luciferase reporter gene . briefly , replicon - containing cells were seeded into 96 - well plates at a density of 5000 cells per well in 100 μl dmem containing 5 % fbs . the following day , compounds were diluted in dimethyl sulfoxide ( dmso ) to generate a 200 × stock in a series of eight half - log dilutions . the dilution series was then further diluted 100 - fold in the medium containing 5 % fbs . medium with the inhibitor was added to the overnight cell culture plates already containing 100 μl of dmem with 5 % fbs . in assays measuring inhibitory activity in the presence of human plasma , the medium from the overnight cell culture plates was replaced with dmem containing 40 % human plasma and 5 % fbs . the cells were incubated for three days in the tissue culture incubators after which time 30 μl of passive lysis buffer ( promega ) was added to each well , and then the plates were incubated for 15 minutes with rocking to lyse the cells . luciferin solution ( 50 μl , promega ) was added to each well , and luciferase activity was measured with a victor ii luminometer ( perkin - elmer ). the percent inhibition of hcv rna replication was calculated for each compound concentration and the ec 50 value was calculated using nonlinear regression curve fitting to the 4 - parameter logistic equation and graphpad prism 4 software ( halfman , m ethods e nzymol 74 pt c : 481 - 497 ( 1981 )). the antiviral effects of compound 1 were determined in stable replicon cells by measuring the reduction of firefly luciferase . in order to estimate the effect of plasma proteins on the antiviral activity , the compound was tested in the presence of 5 % fbs . the results in table 2 demonstrate that compound 1 has excellent potency against genotype 1a and 1b replicons , with mean ec 50 values that range between 5 and 14 pm in the presence of 5 % fbs . the antiviral activity of compound 1 in the presence of 5 % fbs . compound 1 also has excellent potency against replicons containing ns5a from genotype 2 , 3 , 4 and 5 . its activity against genotype 6a is also provided . an hcv shuttle vector cassette was used for assessing the phenotype of ns5a genes derived from individuals infected with genotype 1a and 1b hcv . the vector contains the 5 ′ utr , 3 ′ utr , and nonstructural genes ns3 - ns5b from 1b strain con1 , with adaptive mutations k1609e , k1846t , and y3005c . noti and clai restriction sites were introduced flanking the ns5a gene , without changing any amino acids or the insertion of additional amino acids . a poliovirus ires was inserted between the hcv 5 ′ utr and the firefly luciferase reporter gene as described by lohmann et al . j v irol 77 : 3007 - 3019 ( 2003 ). in order to assess the ability of compound 1 to inhibit ns5a from non - genotype 1 hcv , a number of stable subgenomic 1b - con1 replicon cell lines containing a portion of ns5a from genotype 2a , 2b , 3a , 4a , 5a or 6a hcv were created . this replicon construct contains a noti restriction site upstream of ns5a , and a blpi restriction site just after ns5a amino acid 214 . viral rna from infected subjects was isolated according to middleton et al ., j v irol m ethods 145 : 137 - 145 ( 2007 ) and tripathi et al ., a ntiviral r es 73 : 40 - 49 ( 2007 ). rt - pcr was conducted on the rna to generate a dna fragment encoding ns5a amino acids 1 - 214 . the pcr fragment incorporated noti and blpi compatible ends , and this fragment was ligated into a plasmid containing the 1b - con1 replicon . hcv rna was isolated from the serum of hcv infected subjects and processed through the shuttle vector system as described in middleton et al ., j v irol m ethods 145 : 137 - 145 ( 2007 ). briefly , viral rna was isolated from 140 to 280 μl of serum from hcv infected subjects using the qiaamp viral rna isolation kit ( qiagen ), according to the supplier &# 39 ; s instructions . an rt - pcr protocol was conducted on the rna to generate a dna fragment encoding the ns5a gene with noti and clai / blpi compatible ends . this fragment was ligated into a plasmid containing the shuttle vector , and then the ligated plasmid was transfected into competent e . coli cells . after overnight growth in liquid culture , the plasmid dna from the entire population was isolated , purified and then linearized by digestion with scai . the transcriptaid t7 high yield transcription kit ( fermentas ) was used to transcribe the hcv subgenomic rna . the hcv subgenomic rna containing the ns5a gene from the clinical sample was transfected via electroporation into a huh - 7 derived cell line as described except that 3 × 10 6 cells were electroporated with 15 μg of template rna and the 96 well plate was seeded with 7 . 5 × 10 3 cells per well ( middleton et al ., j v irol m ethods 145 : 137 - 145 ( 2007 ). four hours post - transfection , the wells from one plate were harvested for luciferase measurement . this plate provides a measure of the amount of translatable input rna , and therefore transfection efficiency . to the wells of the remaining plates , a 3 - fold dilution series of test compounds was added in dmso ( 0 . 5 % dmso final concentration ), and plates were incubated at 37 ° c ., 5 % co 2 in a humidified incubator for 4 days . after this period , the media was removed and the plates were washed with 100 μl phosphate - buffered saline per well . for the luciferase assay , 30 μl of passive lysis buffer ( promega ) was added to each well , and then the plates were incubated for 15 minutes with rocking to lyse the cells . luciferin solution ( 50 μl , promega ) was added to each well , and luciferase activity was measured with a victor ii luminometer ( perkin - elmer ). the ec 50 values for compound 1 were calculated using nonlinear regression cure fitting of the inhibition data to the 4 - parameter logistic equation and graphpad prism 4 software ( halfman , m ethods e nzymol , 74 pt c : 481 - 497 ( 1981 )). given the genetic diversity of hcv and the degree of polymorphisms within the n - terminal region of ns5a , a panel of genotypes 1 , 2 , 3 and 4 clinical isolates without previous exposure to investigative small molecule antiviral agents were evaluated . mean ec 50 values of 0 . 66 pm and 1 . 0 pm were calculated for the 11 genotype 1a and 11 1b clinical isolates , respectively ( table 3 ). of the 2a sequences available in genbank , only 11 % of the samples contain leucine at position 31 of ns5a , and this includes the 2a - jfh1 strain . the 7 samples tested in this panel contained methionine at position 31 , and compound 1 retained its activity against this panel with a mean ec 50 of 3 . 8 pm ( table 4 ). in genotype 2b , there is 50 % variability at position 31 of ns5a with the amino acid variant being leucine or methionine . of the 14 genotype 2b samples included in the panel , 6 samples contained m31 and 1 sample contained l28f variant . compound 1 retained its activity against 13 / 14 samples with an ec 50 of 1 . 1 pm , there was a 75 - fold loss in activity against the sample containing l28f variant ( table 5 ). thirteen genotype 3a samples were evaluated , and the mean ec 50 against 12 of the samples was 4 . 5 pm . the ec 50 against one of the genotype 3a sample was 55 pm most likely due to the presence of the a30k variant ( table 6 ). nine genotype 4a samples were evaluated , two of the samples had met at position 28 ; however , this did not affect the activity of compound 1 and a mean ec 50 of 0 . 23 pm was obtained ( table 7 ). of the genotype 6a samples available in genebank , there is a 50 % variability at position 28 with the amino acid variant being leucine or phenylalanine . only one genotype 6a sample was available with the l28 variant . in order to better represent genotype 6a isolates , l28f mutation was introduced into the population . the ec 50 of compound 1 was 42 pm and 68 pm against the l28 versus f28 variant of genotype 6a ( table 8 ). in summary , compound 1 retained its activity against a panel of genotypes 1a , 1b , 2a , 2b , 3a , 4a and 6a samples , despite polymorphisms at ns5a amino acid positions 28 , 30 , 31 , 58 and 93 . the foregoing description of the present invention provides illustration and description , but is not intended to be exhaustive or to limit the invention to the precise one disclosed . modifications and variations are possible in light of the above teachings or may be acquired from practice of the invention . thus , it is noted that the scope of the invention is defined by the claims and their equivalents .
| 0Human Necessities
|
fig1 is a schematic illustration of a vehicle 10 that incorporates example vehicle interior functions , which include memory settings electronically controlled by one embodiment of the method of the present invention . the memory settings are controlled based upon a monitored occupant characteristic , for example , a weight classification or a biomass . initially , when a first driver 12 is seated in a vehicle seat 14 , the first driver 12 manually adjusts a variety of vehicle interior functions to his / her desired positions . the desired positions are subsequently stored as a first set of memory settings in a feature control system 16 and associated with the first driver 12 within the feature control system 16 . a weight classification and / or a biomass of the first driver 12 is measured contemporaneously with the first driver 12 setting the first set of memory settings by a sensing system 18 . the weight classification is indicative of an overall weight of the first driver 12 as measured by , for example , a strain gage arrangement included in the sensing system 18 , which is imbedded in the vehicle seat 14 . when the first driver 12 sits on the vehicle seat 14 , the overall weight of the first driver 12 induces a strain that is representative of the overall weight of the first driver 12 . the measured overall weight is then transmitted to the feature control system 16 where it is stored in relationship to the first set of memory settings . the biomass is indicative of a wet weight of the first driver 12 . the wet weight is measured by traditional means , for example , a bio - sensor included in the sensing system 18 . the bio - sensor measures not only the overall weight of the first driver 12 but also measures the amount of the overall weight that is water . measuring the portion of weight of an occupant that is water allows the system to differentiate between , for example , a 100 - pound occupant and a 50 - pound child in a 50 - pound child seat . the biomass , i . e ., the wet weight , of the 100 - pound occupant would be greater than the biomass , i . e . the wet weight , of the 50 - pound child in the 50 - pound child seat . the sensing system 18 transmits the measured weight classification and / or the biomass of the first driver 12 to the feature control system 16 . the weight classification and / or biomass of the first driver 12 are stored in the feature control system 16 , where they are associated with the first set of memory settings and the first driver 12 . further , this process can be conducted for any number of drivers . that is , each individual driver can create a unique set of memory settings associated with himself / herself . a weight classification and / or biomass of each individual driver is measured and associated with the unique set of memory settings , and stored in the feature control system 16 . subsequently , when a driver enters the vehicle 10 , the sensing system 18 will measure the weight classification and / or the biomass of the driver and transmit the measured weight classification and / or biomass to the feature control system 16 . the feature control system 16 then associates the measured weight classification and / or biomass with the respective driver and the set of memory settings previously stored by that driver as indicated by the measured weight classification and / or biomass . the feature control system 16 then transmits signals to the various interior features controlled by the memory settings to electronically adjust the various interior features to their pre - determined desired positions . for example , when the first driver 12 enters the vehicle 10 and sits in the vehicle seat 14 , the sensing system 18 measures the weight classification and / or biomass associated with the first driver 12 , and transmits the weight classification and / or biomass associated with the first driver 12 to the feature control system 16 . the feature control system 16 associates the transmitted weight classification and / or biomass of the first driver 12 with the first set of memory settings , and then transmits signals to the various interior features controlled by the memory settings to electronically adjust the various interior features to their pre - determined desired positions . the set of memory settings transmitted to the various interior features by the feature control system 16 depends on the weight classification and / or biomass received by the feature control system 16 from the sensing system 18 . as this is determined when the driver sits in the seat , this entire process is conducted passively , i . e ., does not require any active input from the driver . in the illustrated embodiment , the sensing system 18 is located in the vehicle seat 14 and the example vehicle interior functions , which include electronically controlled memory settings , may include but are not limited to positioning of the vehicle seat 14 , vehicle pedals 22 , and / or steering column 24 . the entire vehicle seat 14 is moveable forward and rearward in vehicle 10 as illustrated by arrow a and upward and downward in vehicle 10 as illustrated by arrow b . a back portion 26 of the vehicle seat 20 is moveable from an upright sitting position c 1 to a reclined position c 2 as illustrated by arrow c . the vehicle pedals 22 are moveable away from and toward the first driver 12 in vehicle 10 as illustrated by arrow d . fig2 is a schematic illustration of a vehicle 10 that incorporates example vehicle interior functions , which include memory settings that are electronically controlled by another embodiment of the method of the present invention based upon a user identification device . in the illustrated embodiment , the memory settings are initially set as discussed above in fig1 , but are passively controlled by a user identification device 30 , for example , a key fob or a personal electronic device carried by the occupant . when the driver 12 comes within a pre - defined distance of the vehicle 10 , the user identification device 30 transmits a signal to a receiver 32 associated with the vehicle 10 . the receiver 32 communicates the signal to the feature control system 16 , which transmits signals to the various interior features controlled by the memory settings to adjust the various interior features to their pre - determined desired positions as discussed previously in fig1 . as such , the vehicle interior functions associated with the memory settings are passively controlled based upon the signal received from the user identification device 30 . fig3 is a schematic illustration of a vehicle 10 that incorporates example vehicle interior functions that are selectively overridden according to yet another embodiment of the method of the present invention . the example vehicle interior functions that are selectively overridden include but are not limited to an express up / down feature associated with a window and / or a child safety latch . these example vehicle interior functions are electronically controlled by a feature control system 16 . when the vehicle 10 is equipped with the express up / down feature , each window so equipped will automatically travel to a full - up condition or a full - down position with one touch of a window control instead of requiring the window control to be held down through the entire window travel . as such , if a child occupant 40 is located in a seat next to a window equipped with this feature , there is a risk that the child occupant 40 will activate the feature in an undesirable manner . according to the present invention , based upon the passive weight classification and / or biomass sensing strategies discussed above in fig1 , when a sensing system 18 a senses that a child occupant 40 is located in a seat 20 a , the sensing system 18 a transmits a signal to the feature control system 16 identifying the location of the child occupant 40 . the feature control system 16 then transmits a signal that selectively overrides the express up / down feature associated with a window proximate to the child &# 39 ; s seat 20 a . as such , this process is conducted passively based upon a sensed weight classification and / or biomass . the vehicle 10 may be equipped with a child safety latch feature . typically , this feature is manually activated by a driver 42 of the vehicle 10 either via an electronic switch on the driver &# 39 ; s door or via a mechanical switch located on an inside edge of the child &# 39 ; s door . when activated , this feature prevents the child occupant 40 from opening a vehicle door proximate to the child &# 39 ; s seat 20 a from the inside of the vehicle 10 by electronically disabling an interior latch release mechanism . in the event that the driver 42 forgets to activate this feature , when the sensing system 18 a senses that a child occupant 40 is located in a seat 20 a based upon the weight classification and / or biomass sensing strategies discussed above , the sensing system 18 a transmits a signal to the feature control system 16 identifying the location of the child occupant 40 . the feature control system 16 then transmits a signal that selectively overrides the interior latch release mechanism associated with a door proximate to the child &# 39 ; s seat 20 a to ensure that the child safety latch feature associated with that door in engaged preventing the child occupant 40 from opening the vehicle door from inside the vehicle 10 . this process is conducted passively based upon a sensed weight classification and / or biomass . fig4 a is a top view schematic illustration of a vehicle that incorporates yet another vehicle interior function selectively restricted according to another embodiment of the method of the present invention . in this example , the interior function that is selectively restricted includes but is not limited to an electrically controlled power - folding seat 52 . when a vehicle 10 is equipped with the electrically controlled power - folding seat 52 , typically a back portion 52 a of the electrically controlled power - folding seat 52 has the ability to travel from a full - up position e 1 to a full - down position e 2 as illustrated by arrow e . however , if a first occupant 54 , seated in a seat h , attempts to actuate his seat to the full - down position e 2 and a second occupant 56 is seated in a seat i , allowing the back portion 52 a to actuate to the full - down position e 2 may produce an undesirable result . as such , according to the present invention , based upon the passive weight classification and / or biomass sensing strategies discussed above in fig1 , when a sensing system 50 , 50 a senses that a vehicle seat immediately behind a vehicle seat is occupied , for example , seat i which is immediately behind seat h , or seat g , which is immediately behind seat f , as shown in fig4 b , the sensing system 50 , 50 a transmits a signal to a feature control system 16 indicating that the seat i is occupied . the feature control system 16 then transmits a signal selectively restricting the travel of the back portion 52 a of the seat h such that the back portion 52 a will not be allowed to travel to the full - down position e 2 . this process is conducted passively based upon the sensed weight classification and / or biomass . fig5 is a flow chart that schematically illustrates yet another embodiment of the method of the present invention . known vehicles have the ability to electronically sense when a vehicle is parked and locked . by incorporating the passive weight classification and / or biomass sensing strategies above in fig1 , the vehicle can also determine if the vehicle is occupied when the vehicle is parked and locked and / or if the vehicle becomes occupied subsequent to the vehicle being parked and locked . if the vehicle is occupied when the vehicle is initially parked and locked , and this occupation continues , the vehicle will monitor an interior function and regulate that interior function after the vehicle is parked and locked . for example , if a child and / or a pet are left in the vehicle , and the vehicle is parked and locked , the vehicle will monitor an interior temperature of the vehicle and regulate the interior temperature of the vehicle to a pre - set level to prevent overheating of the child and / or pet . in addition , when the vehicle remains occupied after being initially parked and locked , the vehicle will provide notification that the vehicle is still occupied . this notification can be provided to the driver , for example , via an electronic signal sent by a feature control system within the vehicle to a personal electronic device carried by the driver , such as a key fob , a pager or a cell phone , or the notification can be provided to a dispatch center . the notification can also be via an audible alarm installed in the vehicle itself . in one example , referring back to fig1 , the feature control system 16 controls all electronic features associated with a vehicle 10 . as such , the feature control system 16 can determine when the vehicle 10 is parked and locked . once the feature control system 16 determines that the vehicle 10 is parked and locked , weight classification and / or biomass measurements are taken via a sensing system 18 . based on these measurements , the sensing system determines whether or not the vehicle 10 is occupied . when the sensing system 18 determines that a vehicle seat 14 is occupied based upon weight classification and / or biomass , as discussed above in fig1 , and the vehicle 10 is parked and locked , the feature control system 16 generates a signal to provide electronic notification to the driver or initiates the audible alarm . while the illustration shows only one vehicle seat 14 and one sensing system 18 imbedded in the vehicle seat 14 , it is to be appreciated that the vehicle 10 may include multiple vehicle seats 14 , which further include multiple sensing systems 18 , all of which transmit information to the feature control system 16 . conversely , if the sensing system 18 determines that the vehicle 10 is unoccupied when the vehicle 10 is parked and locked , but becomes occupied while remaining parked and / or locked , the feature control system 16 will also generate a signal to provide electronic notification to the driver that the vehicle has become occupied . for example , if the vehicle 10 is parked and locked in a store parking lot while the driver goes into shop and someone breaks into the vehicle 10 while the driver is in the store , the driver will be notified of the occupation . this can minimize theft and damage to the vehicle and its contents . again , this notification can be provided to the driver via a personal electronic device , for example , a key fob , pager or cell phone . this notification can also be provided to a dispatch center , or via an audible alarm as discussed above . although a preferred embodiment of this invention has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this invention . for that reason , the following claims should be studied to determine the true scope and content of this invention .
| 1Performing Operations; Transporting
|
as mentioned , the typical modeling of data can be overly time consuming and labor intensive . the present invention addresses these issues by making a streamlined and more efficient modeling process which can be completed in a single pass . to provide context , one example of an existing modeling process is illustrated in fig1 in flow chart form . more specifically , the modeling process 20 begins with an input data step 22 wherein the appropriate information is loaded into the modeler . next , the data is “ cleaned ” in step 24 to deal with any foreseen irregularities or uniqueness in the data . next , a transformed step 26 is completed which simply transforms data into a format more useable by the modeling process . next , statistical software 28 is applied . the statistical software 28 performs the actual step of modeling , by a computing coefficients and analyzing variable contributions to the model . as is well understood by those skilled in the art , the modeling step contemplated utilizes the provided data to produce a completed model . this completed model is created using well understood statistical techniques which are applied to the provided data . following the application of the statistical software step 28 , an analysis step 30 is carried out to determine the accuracy / value of the resulting model . this step simply questions whether the resulting model is “ good ”, or whether problems are inherent . if problems do exist , the modeling process loops to a fix problem step 32 which identifies the potential source of problems , and removes any offending variable or problem coefficient . at this point , because the offending variable or coefficient has now been removed , the process then loops back to the statistical software application 28 and is required to recalculate the model . as can be anticipated , this new model is slightly different from the previous one due to the elimination of the offending variables , etc . at this point , the process will again move to the results analysis step to determine whether the “ refit ” model is valid or appropriate . as can be anticipated , the “ fix problems ” loop can continue for an undefined number of times , until a feasible model is created . once the analysis step determines that the most recent model is acceptable , the process then moves to the production step 34 . at this point appropriate documents and a code is prepared / produced to subsequently implement the necessary process in other situations . more specifically , the documents and code which are prepared to relate to the development of servable code which can be used to analyze additional data sets and apply the recently created model . as illustrated in fig1 , the inherent complication with this modeling process involves the analysis and fixing loop , which can involve many potential steps . naturally , it is most efficient for fix problem 32 to make relatively small adjustments . this allows for changes to deal with the particular problems without compromising the efficiency of the model . this necessarily increases the number of iterations however , thus increasing the overall number of steps . again , to achieve each of these repeated steps requires time and processing power . referring now to fig2 , a schematic illustration is shown illustrating one embodiment of the modeling system . as illustrated , a number of data sources , 42 , 44 and 46 are shown , each accessible by statistical modeler 48 . statistical modeler 48 provides an output model to a production system 50 for further use . as can be anticipated , production system 50 could take many forms and make use of the data model for many different purposes . production system 50 also has access to first data source 42 , second data source 44 and third data source 46 . production system 50 typically produces its output in many different forms , which may include reports , response to inquiries , data bases , etc . referring now to fig3 , a flowchart is shown which illustrates one embodiment of the modeling process of the present invention . more specifically , one pass modeling process 60 is illustrated , which begins with a data collection step 62 . once received , the data is then cleaned in cleaning step 64 . next , transformations are accomplished in transform step 66 , so that the data can be appropriately processed . following these preliminary steps , the present process moves to the modeling step 70 . this will be further described below . modeling step 70 inherently produces a reliable / useable model in a single modeling step , thus avoiding the possibilities for unnecessary loops or iterations throughout the process . next , documents and appropriate code are produced in documents step 72 . upon the completion of documents and code , the modeling step is then completed , at which time the code may be provided to further systems for their potential use . for example , the code may b used by other systems to apply the model to different sets of data , thus providing a predictive tool which provides valuable insight . referring now fig4 , a more detailed flowchart is provided , outlining the steps involved in fit model step 70 shown in fig3 . fit model step 70 begins by first computing applicable coefficients for the model , at step 82 . next , the coefficients and existing “ draft ” model is analyzed to determine if any offending variables are utilized . if offending variables are identified , these offending components are then removed at removal step 86 . the modeling system can then regenerate appropriate coefficients at computation step 82 . at this point in the overall modeling process , the “ recomputation ” of coefficients is easily achieved , since the complete model has not yet been formed . outlined in more detail below are specific examples of potentially offending variables which are typically involved in offending variable analysis step 84 . referring again to the process of fig4 , if no offending variables are identified , the process moves to variable contribution analysis 88 to determine if any variables exist which are contributing negligible affects to the overall model . since the affects of any identified models are relatively small , they can easily be removed at this point . this removal is achieved at the remove least contributing variable step 90 . following the removal at step 90 of the least contributing variables , the coefficients can again be easily recomputed at coefficient computation step 82 . following the computation of these coefficients , the offending variable analysis 84 and variable contribution analysis 88 can then be completed to determine whether all variables are making contributions appropriate for the desired model . at this point , the model is output at completion step 92 for use by subsequent systems . referring again to fig3 , the completed model is provided by completion step 92 for use by code generation step 72 . in this process , appropriate documentation and code is produced for the recently generated model . again , the documentation and code is usable by subsequent systems for various purposes depending on the nature of the model . the code produced is fully servable , thus capable of easy implementation in appropriate applications . one advantage of the process outlined in fig3 and 4 is the ability to produce models utilizing very little human interaction . typically , the analysis and adjustment steps of prior modeling systems have been carried out by human interaction . while this does allow for subjective judgment regarding the use of particular coefficient values and the appropriate inclusion of various variables , it is time consuming and often involved . in many instances , an individual modeler ( human being ) will be required to review and evaluate multiple models during a period of time . since each model is unique , this requires a complete understanding of the model being analyzed and the necessary adjustments . once adjusted , a new model must then be created based upon the adjustments made . conversely , the system and process outlined in fig2 - 4 above can be carried out in an entirely automated fashion . that is , the computer is capable of determining if the variables are appropriate for inclusion in the model , while it is being created . consequently , this totally eliminates the involvement of human operators , and the necessary time required for the manual evaluation steps previously carried out . further , the process of the present invention will eliminate the level of discretion previously allowed in modeling tasks . as mentioned above , certain types of variables are classified as offending variables in the method of the present invention . initially , any variables exhibiting multicolinearity are identified at this fairly preliminary step in the modeling process , and removed from the model . consequently , the system proactively anticipates and deals with any potential for multicolinearity to negatively influence the model . additional offending variables may be those exhibiting serious outlier influence ( i . e ., those with considerable stray data points ). another possibility of an anticipated offending variable is one having unexpected sign reversals , thus creating non - uniform data sets . in addition to the above - mentioned offending variables , the least contributing variable analysis can be achieved by performing various tasks . for example , t - tests can be utilized . further , a wald test , likelihood ratio test , or score test could also be utilized to identify these variables . as is illustrated below , the modeling process of the present invention can be achieved utilizing a single pass process . the actual process of fitting the model does have loops within that specific process , but these are self - contained in the model formation step . consequently , a completed model is not produced until offending variable analysis , and least contributing variable analysis is completed . at this point , the model is formed . because the model forming process deals with these potential error sources , subsequent model analysis is unnecessary and not utilized . the resulting process provides a much more efficient modeling technique , which can more quickly carried out and which reduces the amount of human intervention .
| 6Physics
|
referring now to the drawings , the novel collar cuff pressing machine 10 of the invention includes a lower buck assembly 12 mounted on a horizontal table 14 of the frame of the machine . buck assembly 12 includes a center elongated arched collar pressing buck member 16 and cuff pressing arched buck members 18 and 20 at opposite ends of the collar pressing buck 16 . bucks 16 , 18 and 20 are provided with suitable padding just as in conventional machines . a pressing head assembly 22 is supported on an arm 24 which is pivotally mounted at 26 to frame 14 for movement between an open position shown in fig1 and a closed pressing position in which it engages against the collar and cuffs of a shirt laying on bucks 16 , 18 and 20 . pressing head assembly 22 includes contoured pressing surfaces 30 , 32 and 34 which conform to the shape of bucks 16 , 18 and 20 , respectively so as to perform the pressing operation as described . buck assembly 12 and head assembly 22 are steam heated in the usual fashion and the machine as described to this point is essentially the same as the assignee &# 39 ; s prior commercial alc8 machine and thus no further detailed description of those elements is necessary . buck assembly 12 also includes smaller auxiliary pleat pressing bucks 40 and 42 which are rigidly mounted on a support frame and extend forwardly from and are in alignment with the inner pressing surfaces 44 and 46 of bucks 18 and 20 , respectively . bucks 40 and 42 are padded in the same manner as bucks 18 and 20 . pressing head assembly 22 includes a pair of pneumatically operated auxiliary pleat pressing heads 50 and 52 mounted on the front face of head assembly 22 and extending forwardly from and in general alignment with the inner portions 54 and 56 of pressing surfaces 32 and 34 , respectively , so as to be in operative pleat pressing relationship with auxiliary bucks 40 and 42 , respectively , when head assembly 22 is closed on buck assembly 12 . heads 50 and 52 are reciprocated from a normally retracted non - pressing position to an extended pressing position by non - rotating double - acting air cylinders 60 and 62 independently of the operating system for the main head assembly 22 . the auxiliary pleat pressing bucks 40 and 42 and heads 50 and 52 are steam heated in the same manner as the main bucks 16 , 18 and 20 and main head pressing surfaces 30 , 32 and 34 . the novel pressing machine 10 of the invention operates as follows . with the pressing head assembly 22 in the open position as shown in fig1 a long sleeve shirt is loaded on the machine , first by placing the collar of the shirt on buck 16 with the inside of the shirt facing up . next the cuff of the right sleeve of the shirt is placed on buck 18 with the outside of the cuff facing up . the cuff of the left sleeve of the shirt is similarly placed on buck 20 with the outside of the cuff facing up with the cuffs positioned so that the pleats on the shirt sleeves just above the cuffs will be lying on auxiliary bucks 40 and 42 . the operator then presses the main start buttons of the machine to move head assembly 22 down towards buck assembly 12 so that the pressing head surfaces 30 , 32 and 34 press the collar and cuffs against bucks 16 , 18 and 20 , respectively . the head 22 is then locked into this pressing position . the auxiliary heads 50 and 52 will be facing the pleated portions of the shirt sleeves supported on bucks 40 and 42 , but the heads are still held in a retracted position by air cylinders 60 and 62 as illustrated in fig1 and 4 , spaced approximately ¼ inch or so from the pleated portion . thus , an operator has the opportunity to dress the sleeves , that , is align the pleats as desired simply by pulling on the shirt sleeves . since the cuffs themselves are already being held in place by closure of the main heads on the main bucks , the sleeves will not pull away from the machine and the operator has both hands available for dressing those sleeves . when the operator is satisfied with the dressed look of the sleeve on buck 40 , a common foot - operated air pedal is actuated to energize air cylinders 60 and 62 to extend the pleat pressing heads 50 and 52 into pressing engagement with the pleats on bucks 40 and 42 . steam is then supplied to main bucks 16 , 18 and 20 , main head surfaces 30 , 32 and 34 , auxiliary bucks 40 , 42 , and auxiliary heads 50 , 52 . when the pressing operation is completed , air cylinders 60 and 62 are actuated in a reverse direction to retract auxiliary heads 50 and 52 and the main head assembly 22 is opened . the shirt is then removed form the machine with the collar , cuffs and pleated area of the sleeves having been pressed in the same pressing operation . this saves substantial time in that the hand ironing operation of the pleats , normally required by conventional machines , has been eliminated . in addition , if the operator does not want to press the pleats , the pneumatic system for operating the air cylinders 60 and 62 can be disabled and the machine and be used in the more traditional fashion . from the description hereinabove , it is apparent that the invention accomplishes the objectives noted initially and provides advantages over prior conventional machines such as the alc8 machine and over systems such as that illustrated in u . s . pat . no . 5 , 675 , 918 . first of all the main head and buck assemblies of the machine are essentially the same as those used in prior conventional machines such as the alc8 machine and require little modification therefrom . the provision of the separate pleat pressing head and buck assemblies and their separate operations , enable the operator to properly dress the shirt sleeves , that is , align the pleats , while the cuffs themselves are being held in place between the main heads and bucks . the operator may use one or both hands to dress the shirt sleeves by pulling on the sleeves without being concerned about pulling the cuffs away from the machine . further , if for some reason the operator does not want to press the pleats , the auxiliary pleat pressing heads need not be activated and the machine can be used in its conventional fashion . if desired , machine 10 may be modified in several respects . for example , air cylinders 60 and 62 may be of the single acting type and spring loaded to hold heads 50 and 52 in a normally retracted position . also , each of the cylinders 60 and 62 may be actuated by its own separate foot pedal . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .
| 3Textiles; Paper
|
fig1 shows the energy conversion apparatus 10 of the present invention , connected to a section of a conventional pipe 100 for conveying fluid such as pressurized drinking water . pipe 100 defines a hollow inner volume 110 , through which a fluid ( not shown ) such as drinking water , air , sewage , or petroleum may be conveyed by gravity or by pumping means . pipe 100 includes an inner surface 101 facing inner volume 110 and an outer surface 102 . the fluid flows generally in the direction of pipe 100 &# 39 ; s longitudinal axis l . pipe 100 may be of indeterminate length , but is typically composed of pipe segments 115 that are two to ten times as long as their diameter . a pipe segment 115 is typically made from concrete or cast iron , but other materials are suitable . the inner diameter of pipe segment 115 is preferably greater than 12 inches but may be as much as several feet . the elements of energy conversion apparatus 10 are usually attached to an individual pipe segment 115 . if many pipe segments 115 are connected end - to - end to create a long pipe 100 , the elements of energy conversion apparatus 10 of individual pipe segments 115 are also connected together to create a larger apparatus 10 . energy conversion apparatus 10 may be operated attached to a single pipe segment 115 , although the electrical output naturally increases in proportion to the number of pipe segments 115 connected together . fig2 is a sectional view , cut away and with vertical axis exaggerated for clarity , of apparatus 10 and pipe 100 of fig1 taken along line 2 - 2 . apparatus 10 includes pipe liner 11 attached to pipe inner surface 101 . pipe liner 11 typically includes at least one pair of electricity - producing layers , such as carbon fiber layers 12 ; and an isolator ( dielectric ) layer 13 between each pair of carbon fiber layers 12 . isolator layer 13 separates carbon fiber layers 12 both physically and electrically . layers 12 , 13 are preferably attached to inner surface 101 and to each other with suitable adhesive ( not shown ), typically an epoxy resin or a cementitious material such as grout or cement that is not degraded by the fluid conveyed by pipe 100 . the adhesive typically penetrates the entire thickness of the carbon fiber layer and forms a matrix around the fibers . it has been reported ( mingquing sun , et al ., cement and concrete research ) that carbon fiber embedded in cementitious material polarizes and creates electricity in response to deformation . testing of the present invention has borne this out . apparatus 10 further includes collection means 20 for collecting and conducting the electricity produced by pipe liner 11 . collection means 20 typically includes collection conductors 21 attached to pipe liner 11 and an output cable 22 that connects collection conductors 21 to some device 50 for receiving the produced electricity . various types of collection conductors 21 for energy - harvesting installations are known in the art and include conductive fibers embedded in a matrix or woven into a layer and , as illustrated herein , a layer of conductive sheet material 14 such as thin metal foil . in the preferred embodiment illustrated , one pair of carbon fiber layers 12 are sandwiched between two conductor layers 14 . as shown in fig2 , the outermost layers of liner 11 are two insulator layers 15 that insulate liner 11 electrically and protect it from mechanical damage . in a preferred embodiment , insulator layer 15 and conductor layer 14 are combined in a single sheet of metallized mylar or the equivalent . conductor layer 14 is the metallized face of the mylar and insulator layer 15 is the mylar base . next , a first carbon fiber layer 12 is attached over first conductor layer 14 by suitable adhesive means ( not shown ) such as grout or cement . carbon fiber layer 12 may consist of a woven or knitted sheet of carbon fiber fabric or it may be created in situ by laying carbon fiber yarns closely together , typically in a helical pattern . either method of lining pipe 100 may be done manually ( in the case of a pipe 100 large enough for a person to enter ) or by a machine that travels through pipe 100 either under its own power or by being drawn by a cable . methods of lining a pipe are well known in the art . if a second , or more , carbon fiber layers 12 are to be installed , an isolator layer 13 is attached over first carbon fiber layer 12 . isolator layer 13 is composed of a suitable material such as non - metallized mylar , teflon , porcelain , mica , or similar non - conductive material . isolator layer 13 could be sprayed in place , or could be a separate film or panel that is attached over first carbon layer 12 . isolator layer 13 is attached by a suitable adhesive such as cementitious material or polymeric resin . the choice of insulator material is determined by cost , durability , compatibility with the other materials , and degree of stiffness desired . electricity that is produced by carbon fiber layers 12 is collected by conductor layers 14 a , b . collection means 20 may be wires embedded alongside conductor layers 14 , wires soldered or otherwise attached to conductor layers 14 , or similar means as is known in the art . collection conductors 21 lead the electrical current to output cables 22 and then to a device 50 that uses , stores , or modifies the electrical current . output cables 22 are shown in fig2 as connected to both carbon layers 12 of the pair to form a simple circuit with a device 50 that receives the generated electricity for conversion to dc current or for other use or modification . typically , the electrical current is brought outside of pipe 100 by the passage of output cables 22 through one or more apertures 112 provided in pipe 100 or pipe segment 115 .
| 7Electricity
|
an apparatus is disclosed for measuring the stiffness modulus over time of an aggregate column constructed by tamping the column with a vertically reciprocating driving force . the deflection at the top of the column is measured in real time during construction , and dynamic deflection measurements are processed using a computer program that filters the data to provide a smoothed modulus curve . the system includes a processing system to process data as described hereafter and a sensing system . the system of the invention can use micro - electro - mechanical - systems (“ mems ”) technology to determine the position of a tamper during construction . as is well known , mems is the integration of mechanical elements , sensors , actuators , and electronics on a silicon substrate through microfacrication . as shown in fig1 a , separately positioned sensors 12 determine the position of a tamper and its hammer 51 during construction , and show a data processor 14 , having a display or other like device like a printer , located in an operator &# 39 ; s cockpit of a tamping apparatus 10 of the invention . while fig1 a generally illustrates exemplary positioning of sensors 12 and data processor 14 , it will be appreciated that the positioning of the sensors 12 will be determined by the type of sensors system employed . thus , for example , if a system such as that commercially available under the name trimble gcs is employed , the manufacturer of such systems will direct the location of the sensors . in the case of the device 10 shown in fig1 b , in an exemplary embodiment , a pitch and roll sensor may be installed near the base of the boom . the sensor may be oriented with the longitudinal axis parallel to the boom centerline . a boom angle sensor may be installed on a side face of the boom 63 and oriented with the longitudinal axis parallel to line 39 from the boom / body pivot point 17 to the boom / stick pivot point 19 . a stick angle sensor may be installed on a side face of stick 61 and oriented with the longitudinal axis parallel to line 45 from the boom / stick pivot 19 to the boom / hammer pivot 23 . if a system available under the name trimble gcs600 is used , the sensors are connected to the data processor 14 in accordance with the specifications for such a system . in accordance with fig1 b , a hammer 51 applies dynamic energy to a column being constructed . the dynamic energy results in high frequency vibration of the system during tamping . mems sensors which may be employed , detect the exact position of stick 61 and boom 63 of the tamping apparatus 10 at a high frequency to track dynamic response of the system , and describe the machine orientation . as is explained hereafter with reference to the figures , the hammer 51 position is plotted over time during compaction of a single lift . three phenomena are observed , i . e ., 1 ) the hammer 51 moves downward during tamping , 2 ) there is variability in position of the hammer 51 during tamping and the variability is caused by the vibrations caused by the hammer 51 during tamping , and 3 ) the overall rate of downward deflection reduces with time . a vertically reciprocating driving force is induced by a hydraulically powered tamper attached to the hammer 51 of an excavator and tamping apparatus 10 as shown in fig1 b . in an exemplary embodiment , the following dimensions of the tamping apparatus 10 components shown in fig1 b , are measured and known : 1 . the length of the machine ( lm ) 11 is the horizontal distance from the boom / body pivot point 17 to the point of body rotation 31 . 2 . the height of the machine ( hm ) 13 is the vertical distance from the boom / body pivot point 17 to the bottom of the machine tracks ( ground ) 27 . 3 . the length of the boom ( bl ) 15 is the distance from the boom / body pivot point 17 to the boom / stick pivot point 19 . 4 . the length of the stick ( sl ) 21 is the distance from the boom / stick pivot point 19 to the stick / hammer pivot point 23 . 5 . the boom / body angle ( gamma — γ ) 25 is the angle formed by the bottom of the machine tracks ( ground ) 27 and the line 29 between the point of body rotation 31 and boom / body pivot point 17 . 6 . the distance of the machine ( dm ) 33 is the distance from the point of body rotation 31 to the boom / body pivot point 17 . the tamping apparatus 10 may use mems technology employed in an angle sensing system using gauges , for example , such as one commercially available under the name trimble gcs600 system , assembled on components of the tamping apparatus 10 in a conventional manner , to measure machine orientation angles in real time . the angles are measured relative to the horizon with respect to tamping apparatus 10 in which the following measurements are used : 1 . the boom angle ( alpha — α ) 35 is the angle between the horizon line 37 and the line 39 between the boom / body pivot point 17 and the boom / stick pivot point 19 . 2 . the stick angle ( beta — β ) 41 is the angle between the second horizon line 43 and the line 45 between the boom / stick pivot point 19 and the stick / hammer pivot point 23 . 3 . the longitudinal slope ( ls ) 47 is the angle between the horizon and the longitudinal axis of the machine body . 4 . the cross slope ( cs ) is the angle between the horizon and the transverse axis of the tamping apparatus 10 body ( not shown in fig1 b ). vibrations resulting from the operation of the hammer 51 of the tamping apparatus 10 for compaction influence the sensors on the tamping apparatus 10 which are used to measure the angles , and result in variations in angle measurements . the angle measurements are processed to account for this induced variation by applying a filtering algorithm to produce filtered angle measurements . the filter can use a parks - mcclellan equiripple algorithm that makes use of the remez exchange algorithm to produce an optimal linear phase filter approximating a desired frequency response , in a manner apparent to those of ordinary skill based on the disclosure herein . smooth deflection plots are generated as disclosed herein through the algorithm which allows for interpretation of the data . the filter is generated using the remez ( n , f , a , w ) command in matlab , wherein : n + 1 = number of filter taps . f = frequency band edges as fractions of the nyquist frequency . a = desired frequency response values at the band edges . w = weights to be applied to the pass and stop bands . in an exemplary embodiment , the filter employed is a 35 point filter generated by : remez ( 34 , [ 0 0 . 01 0 . 1 1 ], [ 1 1 0 0 ], [ 1 . 3 ]), as is illustrated in fig3 . the resulting filter is scaled so that the direct current (“ dc ”) response is exactly 1 by : 1 . 0 . 007125044906646 2 . 0 . 005943054100178 3 . 0 . 008199587605973 4 . 0 . 010822522399877 5 . 0 . 013794983660447 6 . 0 . 017073009490180 7 . 0 . 020603266578722 8 . 0 . 024304546620220 9 . 0 . 028097813618765 10 . 0 . 031881797182137 11 . 0 . 035555749201273 12 . 0 . 039019795063257 13 . 0 . 042150954045455 14 . 0 . 044871906212448 15 . 0 . 047082607397000 16 . 0 . 048719345391338 17 . 0 . 049721660761634 18 . 0 . 050064711528905 19 . 0 . 049721660761634 20 . 0 . 048719345391338 21 . 0 . 047082607397000 22 . 0 . 044871906212448 23 . 0 . 042150954045455 24 . 0 . 039019795063257 25 . 0 . 035555749201273 26 . 0 . 031881797182137 27 . 0 . 028097813618765 28 . 0 . 024304546620220 29 . 0 . 020603266578722 30 . 0 . 017073009490180 31 . 0 . 013794983660447 32 . 0 . 010822522399877 33 . 0 . 008199587605973 34 . 0 . 005943054100178 35 . 0 . 007125044906646 the filter response is plotted on a linear scale in fig4 and on a logarithmic scale in fig5 . as also shown in the figures , examples of the raw angles and the filtered response angles are shown in fig6 and 7 for boom angle alpha and stick angle beta , respectively . the filtered response of the four measured angles ( α , β , cs , and ls ) and the known machine dimensions are used in real time to calculate the height of the stick / hammer pivot point ( hs ) 53 . as shown in fig1 b , the value of hs 53 at any point in time is the sum of the height of the machine ( vm ) 55 and the vertical distance ( dv ) 57 between the boom / body pivot point 17 and the stick / hammer pivot point 23 . referring to fig1 b , the following calculations apply : vm =√{ square root over ( lm 2 + hm 2 )}* sin ( ls + γ ) at the start of the column lift compaction process , the apparatus 10 includes a system that measures the angles at the aforedescribed locations , determines the filtered response of each angle , and calculates the initial height of stick ( hs 0 ). during the compaction process , the apparatus calculates the height of the stick at time t ( hs t ), preferably , approximately nine times per second . the calculated hs t is further filtered based on a 27 point moving average and used to calculate the time modulus ( m t ), as shown in fig8 . the time modulus is inverse of the slope of the filtered hs versus time curve . the effect of the data filters is to reduce the variability of the calculated hs t values sufficiently to provide calculated m t values that are meaningful . fig9 shows the effect of filtering the angle measurements on the calculated hs values , while the effect of filtering the hs values is shown in fig1 . the effect of the data filters on the calculated m t values is shown in fig1 . the hs versus time curve is highly variable when hs is calculated using the raw angle measurements , referencing fig9 , and the magnitude of the slope of the curve is large . the time modulus ( m t ) is the inverse of the slope of the hs versus time curve , and thus the values of m t calculated when no filtering is applied are consistently small and difficult to interpret . values of m t calculated using filtered angles and filtered hs values represent the underlying phenomenon and is therefore meaningful as a real - time measure of column lift stiffness . accordingly , once deflection is reduced to a predetermined amount ( a smaller amount ) as determined from the calculations , compaction can cease and a new lift added as appropriate . referring to the prior description , the use of commercially available systems for excavators such as the trimble gcs 600 system for measuring elevation is possible . in addition , other components which can be used include , for example , one available under the name , panasonic toughbook u1 pc , and customized data filtering and recording software as is evident to those of ordinary skill from the prior description . as will be appreciated , in practice , the invention involves the measurement of angles of the tamping apparatus stick and boom 61 and 63 , and resolving of the respective angles to obtain the tamper elevation . elevation is typically measured approximately ten ( 10 ) times per second and recorded in a raw data form . the software algorithm previously described is used to filter the data ( that accounts or corrects for tamper vibration , etc .) as shown in the attached figures . the generated curves are analogous to stiffness of the lift and when the slope of the curves reach a certain pre - defined angled , it is determined that the target modulus has been reached . for example , as shown in fig8 , the time modulus at a tamping time at 14 seconds is 2 . 7 seconds / inch . at a tamping time of 17 seconds , the time modulus value increases to 7 . 1 seconds / inch . if the target threshold time modulus of 7 seconds / inch is established for the design , the lift would need to be tamped approximately 17 seconds to reach the modulus criterion . in various operating and project site environments , the typical process will involve the testing of a load column to get the target base point for that particular site . this site specific data is then used on production columns throughout the construction process . the modulus testing process is performed during construction of each lift and provides the quality control necessary to confirm that each column meets design standards . the invention also includes the use of standardized data recording hardware , and a pressure switch on a hydraulic line , to start / stop the data recording , identification of a lift quality metric , providing a hammer operating status indicator , and the use of a hammer plumbness sensor . a pier quality metric may also be identified from a combination of each lift quality metric . the foregoing detailed description of embodiments refers to the accompanying drawings , which illustrate specific embodiments of the invention . other embodiments having different structures and operations do not depart from the scope of the present invention . the term “ the invention ” or the like is used with reference to certain specific examples of the many alternative aspects or embodiments of the applicants &# 39 ; invention set forth in this specification , and neither its use nor its absence is intended to limit the scope of the applicants &# 39 ; invention or the scope of the claims . this specification is divided into sections for the convenience of the reader only . headings should not be construed as limiting of the scope of the invention . it will be understood that various details of the present invention may be changed without departing from the scope of the present invention . furthermore , the foregoing description is for the purpose of illustration only , and not for the purpose of limitation .
| 4Fixed Constructions
|
methods and apparatuses for semi - planar avalanche photodetectors ( apds ) are disclosed . in the following description numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be apparent , however , to one having ordinary skill in the art that the specific detail need not be employed to practice the present invention . in other instances , well - known materials or methods have not been described in detail in order to avoid obscuring the present invention . reference throughout this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , appearances of the phrases “ in one embodiment ” or “ in an embodiment ” in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures or characteristics may be combined in any suitable manner in one or more embodiments . in addition , it is appreciated that the figures provided herewith are for explanation purposes to persons ordinarily skilled in the art and that the drawings are not necessarily drawn to scale . moreover , it is appreciated that the specific example doping concentrations , thicknesses and materials or the like that are described in this disclosure are provided for explanation purposes and that other doping concentrations , thicknesses and materials or the like may also be utilized in accordance with the teachings of the present invention . fig1 is a diagram illustrating generally a cross - section view of a system 102 including a semi - planar avalanche photodetector ( apd ) 101 according to an example of the present invention . in the illustrated example , light or an optical beam 123 is directed from an optical source 139 to apd 101 . depending on the specific application , optical beam 123 may originate from or may be reflected from optical source 139 . in one example , optical beam 123 may optionally be directed or focused from optical source 139 directly to apd 101 or may be directed through an optical element 137 to apd 101 . it is appreciated that one or more apds 101 may be used in a variety of applications and configurations . for instance , depending on the specific application , it is appreciated that apd 101 may be employed individually to for example detect a signal encoded in lower power optical beam 123 in telecommunications . in another example , apd 101 may be one of a plurality of apds arranged in an array or grid to sense images or the like . for example , an array apd &# 39 ; s arranged in a grid may function to sense images , similar to a complementary metal oxide semiconductor ( cmos ) sensor array or the like . in one example , optical element 137 may include a lens or other type of refractive or diffractive optical element such that an image is directed or focused on array of apds 101 with illumination including optical beam 123 . optical beam 123 may include visible light , infrared light and / or a combination of wavelengths across the visible through infrared spectrum or the like . in the illustrated example , apd 101 is functionally a combination of a photodiode that converts optical signal into electrical signal and an amplifier that multiplies the detected signal with gain . as shown , apd 101 includes a mesa structure 103 including a first type of semiconductor material 111 proximate to and separated from a planar region 105 including a second type of semiconductor material 113 . as shown in the example , mesa structure 103 includes an absorption region and planar region 105 includes a separate multiplication region 109 . in the illustrated example , the first type of semiconductor material includes an intrinsic germanium region 125 and the second type of semiconductor material includes a p doped silicon region 115 adjoining an n doped silicon region 117 as shown . in the example , an external bias voltage v + 135 may be applied to the apd 101 through a contact 121 coupled to the planar region 105 and a contact 122 coupled to mesa structure 103 . in one example , contact 122 is coupled to the mesa structure 103 at a p doped region of the first type of semiconductor material 127 and contact 121 is coupled to the planar region 105 at an n + doped region of the second type of semiconductor material 119 , which help improve the ohmic contact of contacts 121 and 122 to the apd 101 in accordance with the teachings of the present invention . in the example shown in fig1 , it is noted that the n + doped region 119 is illustrated to be a region confined or centered underneath the mesa structure 103 . as will be illustrated in another example shown fig2 , it is appreciated that the n + doped region can also be a uniform layer throughout the planar region 105 . for instance , in such an example , the n + doped region 119 could be a highly n + doped silicon substrate layer defined in the planar region 105 in accordance with the teachings of the present invention . referring back to the example illustrated in fig1 , it is noted that the first type of semiconductor material is shown as germanium . it is appreciated that in another example , the first type of semiconductor material may include ingaas or another suitable type of material in accordance with the teachings of the present invention . in the example shown in fig1 , apd 101 includes two regions in terms of electric field strength — one is in absorption region 107 of mesa structure 103 , in which a low electric field is created with the application of the external bias voltage v + 135 to apd 101 . the other electric field region is in the multiplication region 109 of the planar region 105 , in which a high electric field is created at the pn junction interface between the p doped silicon region 115 and the n doped silicon region 117 in accordance with the teachings of the present invention . in operation , free charge carriers or electron - hole pairs are initially photo - generated in the absorption region 107 in mesa structure 103 by the incident photons of optical beam 123 if the photon energy is equal to or higher than the band gap energy of the semiconductor material ( e . g . germanium or ingaas ) inside low electric field absorption region 107 . these photo - generated charge carriers are illustrated in fig1 as holes 131 and electrons 133 . with the application of the external bias voltage v + 135 to apd 101 resulting in the low electric field in mesa structure 103 , the holes 131 are accelerated towards contact 122 coupled to the mesa structure 103 while the electrons 133 are accelerated towards contact 121 out from the mesa structure 103 into the planar region 105 in accordance with the teachings of the present invention . it is noted that the speed performance of apd 101 is improved by having mesa structure 103 localize the low electric field in the absorption region 107 in accordance with the teachings of the present invention . electrons 133 are separated from holes 131 as they injected as a result of the low electric field in the absorption region 107 into the high electric field in multiplication region 109 as a result of the pn junction interface between the p and n doped silicon region 115 and 117 . impact ionization occurs as electrons 133 gain enough kinetic energy and collide with other electrons in the semiconductor material in multiplication region 109 resulting in at least a fraction of the electrons 133 becoming part of a photocurrent . a chain of such impact ionizations leads to carrier multiplication in accordance with the teachings of the present invention . avalanche multiplication continues to occur until the electrons 133 move out of the active area of the apd 101 to contact 121 . therefore , with the low electric field absorption region 107 part of the apd 101 included in a mesa structure 103 and with the high electric field multiplication region 109 included in a planar region 105 as shown , a “ semi - planar ” apd 101 is realized in accordance with the teachings of the present invention . in other words , with the combination of a planar structure for planar region 105 for the silicon portion of apd 101 , and a mesa structure 103 for the germanium portion of apd 101 , a semi - planar apd 101 is realized . in the illustrated example , with the combination of a planar structure of the silicon portion and a mesa structure for the germanium or ingaas portion of apd 101 , benefits of having both planar and mesa structures may be realized in accordance with the teachings of the present invention . for example , by having the planar region 105 for the silicon , apd 101 has low dark current , increased reliability and uniform avalanche gain in accordance with the teachings of the present invention . in addition , by having the mesa structure 103 for the germanium or ingaas , apd 101 has high speed and low crosstalk between any neighboring pixels in arrays of apds since the low electric field is confined in the mesa structure 103 in accordance with the teachings of the present invention . in addition , with a semi - planar apd 101 , where one material , such as silicon , is included in the multiplication region 109 and another material , such as germanium or ingaas , is included in the absorption region 107 allows different processing and design techniques that can be optimized for each specific region and / or material in accordance with the teachings of the present invention . for instance , in one example , germanium may be epitaxially grown using selective growth germanium on tope of the silicon of planar region 105 . mesa structure 103 can then be etched with the etching being stopped at the silicon of planar region 105 . by etching the mesa structure 103 and stopping the etching at the silicon , a mesa structure 103 including the absorption region 107 is provided while maintaining planar region 105 with a multiplication region 109 including silicon in accordance with the teachings of the present invention . thus , in the specific example illustrated in fig1 , a germanium on silicon , or ge — si , apd 101 is illustrated where the germanium mesa structure 103 includes the absorption region 107 , which has low electric field ; while silicon is in the multiplication agent in which high electric field is concentrated under the central p doped region 115 . in one example , due to the curvature of the central p doped region 115 , the high electric field peaks along the edge of the center p doped region 115 . fig1 also illustrates an optional guard ring structure 129 that may included in apd 101 , which in the example is shown as a floating guard ring having a p doped silicon region disposed in the silicon of planar region 105 . fig2 is another diagram illustrating an example of a tilt view of the cross - section of the semi - planar apd 101 shown in fig1 with mesa structure 103 having absorption region 107 disposed over planar region 105 having multiplication region 109 in accordance with the teachings of the present invention . in the example illustrated in fig2 , it is noted that the n + doped region 119 is a uniform highly doped silicon layer throughout the planar region 105 , as mentioned previously . as shown the example illustrated in fig2 , guard ring structure 129 is a floating guard ring including p doped silicon disposed in the silicon of planar region 105 surrounding the mesa structure 103 in accordance with the teachings of the present invention . thus , in the example , the guard ring structure 129 is at or proximate to the interface between the absorption region 107 and the multiplication region 109 of apd 101 in accordance with the teachings with the present invention . in the illustrated example , guard ring structure 129 provides the structure to help reduce or prevent premature breakdown in the multiplication region 109 at the device periphery . in one example , guard ring structure 129 may be included using ion implantation , diffusion or another suitable technique . it is appreciated that a “ sandwiched ” guard ring structure as illustrated is made possible the semi - planar structure of the apd 101 as such a structure would not be possible with a mesa only device . in addition , it is noted that by having multiplication region 109 in a planar region 105 , sensitivity to side walls passivation , which can cause undesired leakage current due to the high electric field in the multiplication region 109 is eliminated in accordance with the teachings of the present invention . the above description of illustrated embodiments of the invention , including what is described in the abstract , is not intended to be exhaustive or to be limitation to the precise forms disclosed . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes , various equivalent refinements and modifications are possible , as those skilled in the relevant art will recognize . indeed , it is appreciated that any specific wavelengths , dimensions , materials , times , voltages , power range values , etc ., are provided for explanation purposes and that other values may also be employed in other embodiments in accordance with the teachings of the present invention . these modifications can be made to embodiments of the invention in light of the above detailed description . the terms used in the following claims should not be construed to limit the invention to the specific embodiments disclosed in the specification and the claims . rather , the scope is to be determined entirely by the following claims , which are to be construed in accordance with established doctrines of claim interpretation .
| 8General tagging of new or cross-sectional technology
|
this invention relates to compositions of a drug with a water soluble polymer which has been treated with a wetting sufficient amount of a wetting agent selected from anionic and cationic surfactants . in preferred embodiments the composition is a solid , usually a powder , which is then compounded into suitable solid dosage forms for oral administration . griseofulvin is a known antibiotic which has been found useful in the treatment of certain fungus diseases of plants , man and animals . griseofulvin as discussed in the background of this invention is also known as a poorly soluble or water soluble drug , which in vivo provides a low order of bioavailability when administered orally . thus the composition of the instant invention is particularly useful for griseofulvin and drugs of a similar nature such as certain steroids and antibiotics which due to their low aqueous solubility and / or high melting point are poorly absorbed . illustrative of such drugs are medrogestone ; progesterone ; estradiol ; 10 , 11 - dihydro - 5h - dibenzo [ a , d ] cycloheptene - 5 - carboxamide ; 5h - dibenzo [ a , d ] cycloheptene - 5 - carboxamide and the like . the compositions of this invention , as will soon be appreciated , further permit the formulation of solid dosage forms which may contain high concentrations of the particular drug , such as griseofulvin , with no concomitant loss of bioavailability usually associated with such high concentrations . these compositions thus allow the preparation of elegant solid dosage forms . the compositions of this invention are also resistant to agglomeration of the drug particles or the tendency of the drug in storage to produce undesirable crystal formation which adversely affects bioavailability of the drug . polymers useful in this invention include water soluble polymers which are nontoxic and pharmacologically acceptable , particularly for oral administration . illustrative of polymers , found suitable in this invention include polyvinylpyrrolidone , hydroxypropyl methyl cellulose , hydroxypropyl cellulose , methyl cellulose , block co - polymers of ethylene oxide and propylene oxide , and polyethylene glycol . generally these polymers are commercially available over a broad range of average molecular weights . for example , polyvinylpyrrolidone ( pvp ) is a well known product produced commercially as a series of products having mean molecular weights ranging from about 10 , 000 to 700 , 000 . prepared by reppe &# 39 ; s process : 1 , 4 - butanediol obtained in the reppe butadiene synthesis is dehydrogenated over copper at 200 ° forming γ - butyrolactone ; reaction with ammonia yields pyrrolidone . subsequent treatment with acetylene gives the vinyl pyrrolidone monomer . polymerization is carried out by heating in the presence of h 2 o 2 and nh 3 . debell et al ., german plastics practice ( springfield , 1946 ); hecth , weese , munch . med . wochenschr . 1 943 , 11 ; weese , naturforschung & amp ; medizin 62 , 224 ( wiesbaden 1948 ), and the corresp vol . of fiat review of german science . monographs : general aniline and film corp ., pvp ( new york , 1951 ); w . reppe , polyvinylpyrrolidon ( monographie zu &# 34 ; angewandte chemie &# 34 ; no . 66 , weinheim / bergstr ., 1954 ). generally available commercial grades have average molecular weights in the range of 10 , 000 to 360 , 000 , for example , general aniline and film corporation ( gaf ) markets at least four viscosity grades available as k - 15 , k - 30 , k - 60 , and k - 90 which have average molecular weights of about 10 , 000 , 40 , 000 , 160 , 000 and 360 , 000 , respectively . the k - values are derived from viscosity measurements and calculated according to fikentscher &# 39 ; s formula ( kline , g . m ., modern plastics 137 no . 1945 ). similar commercial products are available from basf - wyandotte . selection of a particular polymer with its characteristic molecular weight will in part depend on its ability to form suitable dosage forms with the particular drug . thus , in preparing solid dosages , whether in powder , tablet or capsule units , the composition of this invention should be readily grindable or pulverizable , or in the form of free - flowing powders . a second consideration in the selection of a particular polymer derives from the limitations inherent in the use of specific equipment with polymers of increasingly higher viscosity . for example in forming the drug - polymer solution or mixture , complete dissolution or mixing could be inhibited utilizing blenders , mixer or the like , which are inadequate by reason of low shear or proper baffles to form a uniform and homogeneous drug - polymer solution or mixture . depending on the process employed for forming of the drug - polymer mixture , another consideration in the selection of a particular polymer is that the polymer be mutually soluble in solvents for the particular drug . the wetting agents found most suitable for the present invention are those selected from anionic or cationic surfactants . in addition , to those cited in the summary of this disclosure , other suitable surfactants of the anionic variety are illustrated by sodium stearate , potassium stearate , sodium oleate and the like . the compositions of this invention are prepared in a step by step process . in the first step , a mixture or solution of the drug witht the water soluble polymer is formed . the mixture can be formed in a solvent or solvent mixture which is a mutual solvent for both the drug and the polymer . alternatively , the drug - polymer , solvent mixture can , at this stage , be coated onto lactose . where the drug and the polymer are not subject to degradation at elevated temperatures , the drug - polymer mixture may also be formed by melt mixing . any volatile solvent in which the drug is soluble is suitable for forming the drug - polymer mixture . for griseofulvin , suitable solvents would include methylene chloride , methylene chloride - ethanol , chloroform , acetone , methyl ethyl ketone and combinations thereof . the most suitable polymer for forming the melt mixture with a drug such as griseofulvin is hydroxypropyl cellulose . after the drug - polymer mixture or solution has been formed in a solvent it is dried by spray - drying , flash evaporation or air drying . commercially , spray - drying is most practical since the dried mixture is already in powder form . in the case of the melt mixture drying the drug - polymer mixture is defined as cooling . the melt - mix product is then ground or milled into powder form in preparation for the next step ; grinding or milling may also be necessary for dried solvent formed mixtures . the powdered drug - polymer mixture is then treated with a wetting sufficient amount of a primarily aqueous wetting solution containing a wetting agent selected from anionic and cationic surfactants . this wetting treatment is accomplished by forming a slurry , wet granulation or paste mixture of the powdered drug - polymer with the wetting solution . the wetting solution treatment can be achieved with small incremental additions of the wetting solution or a larger single - shot treatment . the wetting solution treatment apparently fulfills two roles : crystallization of any amorphous regions into ultramicrosize crystals , and the breakup of clusters of such crystals so that they disperse spontaneously when exposed to water . also , the role of the primarily aqueous solution for the wetting agent treatment is to distribute the wetting agent to surfaces of the drug , whether or not the drug is amorphous or crystalline . when the employment of more than one polymer is desired , separate drug - polymer mixtures for each polymer are usually prepared which are then initimately blended with each either in dry form prior to or after the wetting solution treatment . the treated mixture is then dried as earlier described and , if necessary , it is milled , screened or ground prior to formulating into suitable dosage forms with pharmaceutically acceptable excipients . it will be again appreciated by those skilled in the art that while the invention is illustrated with particularly water insoluble drugs , the composition and method of this invention is also applicable to more soluble drugs in need of enhanced bioavailability . in such instances a broader range of solvents and polymers including the natural gums may be employed to form the drug - polymer mixture . the concentrations of drug found useful in the drug - polymer mixture of this invention range from the lowest therapeutically effective amount of the drug up to about 90 to 95 % of the drug . thus , in griseofulvin - polymer mixtures , the concentration of griseofulvin ranges from about 0 . 1 % by weight to about 90 - 95 % by weight . in order to form pharmaceutically elegant dosage forms for high dose drugs , the concentration of the drug should be at least 50 % by weight of the drug - polymer mixture . in especially preferred embodiments the concentration of drug in the drug polymer mixture will range from about 50 % to about 80 % by weight . the required concentration for the wetting agent ( or surfactant ) in the primarily aqueous wetting solution is a wetting sufficient amount . this amount further depends on whether incremental or single - shot wetting treatments are employed and on whether a slurry or paste treatment is contemplated . generally , small incremental treatments will require less wetting agent than a larger single shot treatment and a paste treatment will require more wetting agent than a slurry . in any case , it has been found that satisfactory results are obtained when the amount of wetting agent comprises from about 0 . 025 % to about 2 . 0 % by weight of the dried drug polymer mixture and preferrably from about 0 . 1 % or 0 . 2 % to about 1 . 0 % by weight . while higher concentrations of the wetting agent may be satisfactorily employed , no additional advantages in terms of dissolution and / or bioavailability are obtained . it has also been found that when a griseofulvin - polymer , melt mixture has been wetted and crystallized from an aqueous sorbitol solution , enhanced dissolution rates was obtained , however the rate of dissolution was still less that those mixtures treated with a wetting agent . the rate of dissolution of the powdered materials was determined by one of three methods . all three methods gave equivalent results and only the results of method 1 outlined below are used herein unless otherwised noted . method ( 1 ) a sample containing 20 mg of griseofulvin was dissolved into 1 liter of a 0 . 02 % polysorbate 80 aqueous solution at 37 ° c . the solution was monitored by a flow cell in a spectrophotometer set at 295 nm . method ( 2 ) a sample containing 500 mg griseofulvin was dissolved in 10 liters of 0 . 15 % sodium lauryl sulfate in water at 37 ° c . method ( 3 ) a sample containing 125 mg griseofulvin was dissolved in 24 liters of water at 37 ° c . for examples 2 - 5 the wetting agent solution employed was as follows : 2 . 5 g of sodium lauryl sulfate ( sls ) were dissolved into 500 ml of a mixture of 100 ml of water and 400 ml of ethyl alcohol or 0 . 25 g of sodium lauryl sulfate were dissolved into 50 ml of a mixture of 10 ml of water and 40 ml of ethyl alcohol . this example describes the preparation of ultramicrocrystalline griseofulvin . the method consists of flash evaporation of a solution containing 10 g of griseofulvin and 10 g of polyvinylpyrrolidone ( povidone ® k - 30 , u . s . p .- from gaf corp .) dissolved in 200 ml of methylene chloride . the evaporation was done on a rotating evaporator at 35 °- 45 ° c . in a closed system ( vacuum ). about 4 - 5 ml of the solution to be evaporated was placed in a 100 ml round bottom flask , then placed on the evaporator . upon evaporation of solvent , the material was deposited onto the wall of the flask . the dried material was found to be amorphous by x - ray diffraction . next , this amorphous material was treated with the sls solution . to 2 g of powder , 0 . 125 ml of the solution was added with constant mixing and the solvent was allowed to dry . this was repeated six more times until a total of 0 . 875 ml of solution had been added . microscopic observation and dissolution data showed that ultramicrocrystalline griseofulvin was formed by this method and has a much faster dissolution rate into water at 37 ° c ., than microsized griseofulvin or untreated amorphous material table 1______________________________________ dissolution profile of griseofulvin into water at 37 ° c . thedissolved griseofulvin , unless otherwise specified , is expressedin mg / liter over an elapsed time period in minutes . sample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 11 . 2 11 . 7 11 . 9 12 . 0 12 . 2 12 . 52 2 . 5 3 . 8 4 . 8 6 . 5 8 . 7 9 . 83 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - flash evaporated griseofulvin : pvp ( 50 % griseofulvin ) treated with sls solution . 2flash evaporated griseofulvin : pvp ( 50 % 3 - microsized griseofulvin table 1 -- this example describes the preparation of ultramicrocrystalline griseofulvin by coating a solution of griseofulvin and polyvinylpyrrolidone onto lactose then treating the powder with a solution of sodium lauryl sulfate . a solution was prepared by dissolving 1 g of griseofulvin and 1 g of polyvinylpyrrolidone into 8 ml of methylene chloride . all this solution was coated successively in 1 ml portions onto 2 g of lactose and allowed to dry . the material formed by this method was crystalline by x - ray diffraction . next 1 ml of the sls solution was added to the 4 g of powder and allowed to dry . microscopic observation and dissolution data showed that the griseofulvin formed by this method was ultramicrocrystalline and had a much faster dissolution rate into water at 37 ° c ., than microsized griseofulvin . table 2______________________________________sample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 10 . 8 11 . 6 11 . 8 11 . 9 12 . 0 12 . 02 7 . 0 8 . 7 9 . 7 10 . 5 11 . 5 11 . 53 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - griseofulvin : pvp ( 50 : 50 ) coated onto lactose and treated with sls solution . 2griseofulvin : pvp ( 50 : 50 ) coated onto lactose . 3microsized griseofulvin this example describes the preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone then treating with powder with a solution of sodium lauryl sulfate . a solution of 50 g of griseofulvin and 50 g of polyvinylpyrrolidone dissolved in 2 liters of methylene chloride was spray dried at room temperature . a mixture of 1 ml of the sls solution and 2 g of the powder was dried . microscopic observation and dissolution data showed the griseofulvin formed by this method to be ultramicrocrystalline and has a much faster dissolution rate into water at 37 ° c . than microsized griseofulvin . table 3______________________________________sample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 10 . 5 10 . 7 10 . 8 11 . 0 11 . 0 11 . 02 3 . 2 4 . 4 5 . 6 8 . 1 9 . 9 10 . 43 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - spray dried griseofulvin : pvp ( 1 : 1 ) treated with sls solution . 2spray dried griseofulvin : pvp ( 1 : 1 ) 3 - microsized griseofulvin this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at room temperature . to 2 g of the powder , 3 / 4 ml of the sls solution was added in six 0 . 125 ml increments and dried between additions . microscopic observation and dissolution data showed that the griseofulvin formed by this method was ultramicrocrystalline and had a much faster dissolution rate into water at 37 ° c . than microsized griseofulvin . table 4______________________________________sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . 15 min . ______________________________________1 10 . 0 10 . 9 11 . 5 12 . 0 12 . 5 12 . 7 -- 2 2 . 5 3 . 9 4 . 9 6 . 5 9 . 0 10 . 4 -- 3 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2 -- 4 1 . 9 3 . 5 4 . 6 6 . 3 8 . 6 -- 9 . 75 1 . 8 3 . 0 4 . 0 5 . 8 8 . 1 -- 9 . 36 1 . 9 3 . 1 4 . 3 6 . 0 8 . 6 -- 9 . 7______________________________________ 1 - spray dried griseofulvin : pvp ( 70 : 30 ) treated with sls solution . 2spray dried griseofulvin : pvp ( 70 : 30 ). 3microsized griseofulvin 4 - spray - dried griseofulvin : pvp treated with the nonionic polysorbate 80 . griseofulvin : pvp : nonionic ( 69 . 7 : 29 . 7 : 0 . 5 ) 5spray dried griseofulvin : pvp treated with the nonionic block copolymer of ethylene oxide and propylene oxide ( pluronic ® f77 ) griseofulvin : pvp : nonionic ( 69 . 7 : 29 . 7 : 0 . 5 ) 6spray dried griseofulvin : pvp treated with the nonionic isooctyl phenoxy polyethoxy ethanol . griseofulvin pvp : nonionic ( 69 . 7 : 29 . 7 : 0 . 5 ) table 5______________________________________dissolution profilesample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 10 . 0 10 . 9 11 . 5 12 . 0 12 . 5 12 . 72 6 . 9 8 . 7 9 . 7 10 . 4 11 . 3 -- 3 6 . 0 7 . 0 7 . 3 7 . 7 8 . 0 -- 4 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - spray dried griseofulvin : pvp ( 70 : 30 ) treated 2 - dorsey laboratories &# 39 ; grispeg ( trademark ) for griseofulvin composition i peg 6000 . 3schering laboratories &# 39 ; fulvicin p / g ( trademark ) for griseofulvin composition in peg 6000 . 4microsized griseofulvin . in the samples evaluated in tables 6 - 8 , the following further describes their preparation . two grades of hydroxypropyl cellulose were used , klucel ® ef and klucel ® lf ( hercules ), the former preferred for its lower viscosity . coarse griseofulvin , spray dried lactose , sorbitol , and sodium lauryl sulfate were the other ingredients . the solvents were methylene chloride and absolute ethanol , u . s . p . grade . crystallinity of griseofulvin preparations were judged by visual microscopic observation under crossed polarizers , or by x - ray diffraction assay . a glass melting tube immersed in a hot oil bath was used to melt together various amounts of griseofulvin and klucel . after complete melting and mixing , the liquid mixture was rapidly chilled under a cold water tap , while rotating the tube horizontally so as to distribute the liquid over the inside walls . after solidification , the tube was further cooled in a dry ice bath , which fractured the product and allowed its removal from the glass tube . the chunky product was ground to a powder in a micromill . typically , an amount of powdered melt mixture was intimately mixed with an equal weight of an aqueous solution containing , by weight , about 22 % sorbitol and 13 % ethanol . this was vigorously mixed and worked with a spatula , until the doughy mixture acquired the consistency of a smooth cream or paste . the paste was allowed to dry , and the dry chunky product was ground in a mortar . solution for spray drying were prepared by dissolving griseofulvin and klucel in a mixture of methylene chloride and ethanol . an anhydro laboratory spray dryer no . 3 was used , and the solution was spray dried at room temperature . typically , a weight of spray dried powder ( whether amorphous or crystalline ) was intimately mixed with about 0 . 9 weight of a 1 . 5 % aqueous solution of sodium lauryl sulfate . the solution could also contain ethanol and sorbitol or lactose , but this was found to be unnecessary . the doughy mixture was vigorously mixed and worked with a spatula , until it became a smooth paste . then , about 0 . 25 weight of lactose was added , and mixed until again smooth . the paste was spread and dried at around 85 ° c . the elevated temperature coagulated the wet paste into granules , which could be stirred and mixed at times during drying , to diminish caking . the dry product was milled and passed through a 60 or 80 mesh screen . the product contained about 1 % sodium lauryl sulfate . treatment of spray dried mixtures with sodium lauryl sulfate solution , without pasting about 2 . 0 g of spray dried griseofulvin - klucel ® mixture was placed in a mortar , then treated successively with six 0 . 125 ml portions of a wetting solution , allowing enough drying between portions to prevent the powder from becoming pasty . the wetting solution contained 5 mg / ml sodium lauryl sulfate in a mixture of 4 parts ethanol - 1 part water , by volume . the final granular powder contained about 0 . 2 % sodium lauryl sulfate . crystallization of spray dried powders with sodium lauryl sulfate solution on a 1 kg scale were achieved in a hobart mixer , equipped with a small bowl and a pastry blade . lactose was added to the paste , then the mixture was spread on trays and dried at 85 ° c . the chunky , partially caked product was milled and screened . ______________________________________ spray dried mixtures of griseofulvin & amp ; hydroxypropyl cellulose ( klucel )® composition of solutionsolids griseofulvin solventcontent content volume ( g / l of (% of ratio crystallinitysolvent ) solids ) ( mecl . sub . 2 / etoh ) of product______________________________________100 50 7 / 1 mostly amorphous 50 75 9 / 1 amorphous167 75 8 . 6 / 1 crystalline200 80 7 / 1 crystalline______________________________________ table 6______________________________________dissolution profile . sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 15 min . 20 min . ______________________________________1 4 . 1 8 . 0 9 . 2 10 . 8 12 . 6 13 . 4 13 . 72 1 . 5 2 . 7 3 . 4 4 . 7 7 . 0 8 . 4 9 . 23 0 . 5 1 . 0 1 . 3 2 . 0 3 . 2 4 . 2 5 . 0______________________________________ 1 - melt mixture of griseofulvin ( 75 %) klucel ® ( 25 %), crystallized with sorbitol solution 2 - micronized griseofulvin 3 - melt mixture of griseofulvin ( 83 %) klucel ® ( 17 %), amorphous . table 7______________________________________sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 15 min . 20 min . ______________________________________1 2 . 0 3 . 6 4 . 7 6 . 5 9 . 8 11 . 4 12 . 82 2 . 0 3 . 6 4 . 7 6 . 5 9 . 2 10 . 5 11 . 83 1 . 5 2 . 7 3 . 4 4 . 7 7 . 0 8 . 4 9 . 24 0 . 8 1 . 5 2 . 0 2 . 8 4 . 7 5 . 8 6 . 5______________________________________ 1 - spray dried griseofulvin ( 75 %) klucel ® ( 25 %) mixture , amorphous . 2 - spray dried griseofulvin ( 50 %) klucel ® ( 50 %) mixture , mostly amorphous . 3 - micronized griseofulvin . 4spray dried griseofulvin ( 80 %) klucel ® ( 20 %) mixture crystalline . table 8______________________________________sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 15 min . 20 min . ______________________________________1 6 . 2 11 . 1 11 . 5 12 . 0 12 . 5 12 . 7 12 . 82 6 . 2 10 . 2 11 . 0 11 . 6 12 . 1 12 . 2 12 . 33 1 . 5 2 . 7 3 . 4 4 . 7 7 . 0 8 . 4 9 . 2______________________________________ 1 - spray dried mixture of griseofulvin : pvp ( 70 : 30 ), treated with sls solution ./ 2 spray dried mixture of griseofulvin : klucel ® ( 75 : 35 ), crystallized with sodium lauryl sulfate solution . 3micronized griseofulvin this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and hydroxypropyl methyl cellulose and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 40 g of hydroxypropyl methylcellulose 80 g of griseofulvin and 200 ml of methanol dissolved into 2 liters of methylene chloride was spray dried at r . t . the dried material was found to be amorphous by x - ray diffraction . to 4 g of the powder , 4 ml of a solution containing 1 . 5 g sodium lauryl sulfate dissolved into 100 ml of h 2 o was mixed in , and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method and has a much faster dissolution rate into water at 37 ° c ., then microsized griseofulvin or untreated amorphous material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and methylcellulose and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 40 g of methylcellulose ( 15 cps ) and 120 g of griseofulvin , and 200 ml of methanol dissolved into 2 liters of methylene chloride was spray dried at r . t . the dried material was found to be partly amorphous and partly crystalline by x - ray diffraction . to 4 g of the powder , 4 ml of a 1 . 5 % sodium lauryl sulfate solution was added and mixed in . the mixture then was dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and poly ( oxypropylene ) poly ( oxyethylene ) block copolymer ( pluronic ® f77 basf wyandotte corp .) and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 100 g of the block copolymer and 100 g griseofulvin dissolved into 2 liters of methylene chloride was spray dried at rt , to 4 g of the powder , 2 ml of a 1 . 5 % sodium lauryl sulfate was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyethylene glycol and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 100 g of griseofulvin and 100 g of polyethylene glycol 6000 dissolved into methylene chloride was spray dried . to 4 g of the powder , 2 ml of a 1 . 5 % sodium lauryl sulfate solution was added , mixed and dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution containing griseofulvin and hydroxypropyl methylcellulose and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 40 g of hydroxypropyl methylcellulose , 160 g of griseofulvin and 100 ml of ethanol dissolved into 2 liters of methylene chloride was spray dried . to 2 g of powder , 0 . 125 ml of sodium lauryl sulfate wetting solution ( see above example no . 7 ) was added with constant mixing and the solvent was allowed to dry . this was repeated five more times until a total of 0 . 750 ml of solution had been added . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of benzalkonium chloride . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 1 % aqueous solution of benzalkonium chloride was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of sodium laurate . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 2 % aqueous solution of sodium laurate was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of dioctyl sodium sulfosuccinate . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 1 % aqueous solution of dioctyl sodium sulfosuccinate was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ulramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of bis ( 2 - hydroxyethyl ) oleylamine . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 2 % aqueous solution of bis ( 2 - hydroxyethyl ) oleylamine was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . table 9__________________________________________________________________________the results of dissolution studies on the samples prepared by examples7 - 15are listed below . the unit of expression for this table is percent ofsaturation achievedin time expressed in minutes . wt . % wet - gris - poly - ting eoful - percent of saturation - time min . polymer wetting agent mer agent vin 1 2 3 4 5 10 15 20 25__________________________________________________________________________none - griseoful - none none none 100 % 14 . 8 22 . 3 30 . 3 36 . 8 42 . 6 64 . 5 76 . 1 83 . 1 86 . 5vin microsizedpolyvinyl - sodium lauryl 49 . 9 0 . 2 49 . 9 92 . 9 99 . 2 100 . 6 101 . 3 101 . 9pyrrolidone sulfatepolyvinyl - sodium lauryl 29 . 9 0 . 2 69 . 9 91 . 6 97 . 0 98 . 8 99 . 4 99 . 6 100 . 0pyrrolidone sulfatepolyvinyl - sodium lauryl 9 . 9 0 . 2 89 . 9 60 . 7 70 . 0 89 . 0 83 . 9 85 . 8 91 . 6 93 . 5 94 . 8 95 . 6pyrrolidone sulfatepolyvinyl - benzalkonium 29 . 8 0 . 5 69 . 7 75 . 7 87 . 2 92 . 6 95 . 3 97 . 0 99 . 3 100pyrrolidone chloridepolyvinyl - dioctyl sodium 29 . 8 0 . 5 69 . 7 86 . 5 92 . 9 95 . 5 96 . 8 97 . 4 98 . 3 99 . 8pyrrolidone sulfosaccinatepolyvinyl - sodium laurate 29 . 7 1 . 0 69 . 3 53 . 5 65 . 2 72 . 3 77 . 4 81 . 9 90 . 3 94 . 8pyrrolidonepolyvinyl - bis ( 2 - hydroxy - 29 . 7 1 . 0 69 . 3 74 . 2 83 . 9 88 . 6 91 . 6 93 . 2 97 . 4 100 . 00 100 . 6pyrrolidone ethyl ) oleyl aminehydroxypropyl sodium lauryl 24 . 9 0 . 2 74 . 9 85 . 4 93 . 2 96 . 7 98 . 3 99 . 3 101 . 9cellulose sulfatehydroxypropyl sodium lauryl 19 . 9 0 . 2 79 . 9 61 . 9 71 . 6 77 . 4 81 . 5 84 . 5 94 . 2 99 . 4 101 . 9 109 . 0cellulose sulfatehydroxypropyl sodium lauryl 32 . 8 1 . 5 65 . 8 36 . 8 49 . 0 57 . 4 69 . 8 67 . 7 88 . 4 101 . 3 108 . 4 112 . 9methyl cellulose sulfatepolyethylene sodium lauryl 49 . 6 0 . 7 99 . 6 71 . 2 83 . 2 89 . 6 92 . 9 94 . 5 98 . 3 99 . 4 99 . 6glycol sulfatepolyoxyethylene sodium lauryl 44 . 6 0 . 7 49 . 6 43 . 2 56 . 7 63 . 8 68 . 6 72 . 3 81 . 3 85 . 4 87 . 7 89 . 0polyoxypropylene sulfatecopolymer__________________________________________________________________________ * saturation 11 . 6 mg liter . the relative bioavailability of the composition of this invention with two different polymer mixtures and that of one marketed ultramicrosize griseofulvin dosage form was studied in humans . the urinary excretion of the major griseofulvin metabolite 6 - desmethyl griseofulvin ( 6 - dmg ) was determined for all three dosage forms following the administration of 250 mg of griseofulvin ( in the form of 125 mg tablets ) to 15 healthy adult volunteers divided into three groups using a crossover experimental design . the total tablet weight for each of the 125 mg dosages was 350 mg . the compositions of the invention were represented by spray dried griseofulvin mixtures with either polyvinylpyrrolidone or hydroxypropyl cellulose both treated with sls . the marketed product evaluated was schering &# 39 ; s fulvicin ® p / g which is perceived as providing maximum bioavailability or absorption following oral administration . the results indicated that there were no statistically significant differences between the 3 dosage forms evaluated . the cumulative mean for all groups expressed in mg of either free or total 6 - dmg found in the urine for each of the three dosages was as follows : ______________________________________ gris - hydroxypropyl marketed gris - pvp cellulose product free total free total free total______________________________________0 - 24 hours 48 : 6 75 . 8 50 . 3 81 . 1 48 . 9 76 . 724 - 48 hours 19 . 1 30 . 0 20 . 7 33 . 3 19 . 5 37 . 10 - 48 hours 68 . 7 105 . 8 71 . 0 114 . 4 68 . 4 113 . 8______________________________________ in a second bioavailability study conducted with 4 healthy adult volunteers , dosage forms containing 500 mg of micronized griseofulvin were administered in the form of a single tablet or 2 capsules each containing 250 mg of micronized griseofulvin . since griseofulvin is not a dose dependent drug , twice the amount of the 6 - dmg metabolite should be excreted over that of a 250 mg dosage of griseofulvin . ______________________________________ 500mg griseofulvin 500mg griseofulvin tablet as 2 × 250mg capsules free total free total______________________________________0 - 24 hours 34 . 4 35 . 5 38 . 0 54 . 724 - 48 hours 63 . 5 104 . 2 64 . 4 102 . 80 - 48 hours 97 . 9 157 . 9 102 . 4 157 . 5______________________________________ typical direct compression tablet formulations may be prepared as follows for 125 mg dosage forms having a final tablet weight of 350 mg . ______________________________________a . 1 . griseofulvin at 59 . 5 % in mixture with hydroxypropyl cellulose , sls treated 210 . 0 g2 . microcrystalline cellulose 87 . 0 g3 . lactose , edible 32 . 0 g4 . sodium starch glycolate 17 . 5 g5 . magnesium stearate u . s . p . 3 . 5 g theoretical tablet weight 350 mg . b . 1 . griseofulvin at 67 . 5 % in pvp mixture treated with sls 185 . 0 g2 . microcrystalline cellulose 87 . 0 g3 . lactose , edible 67 . 0 g4 . sodium starch glycolate 17 . 5 g5 . magnesium stearate 3 . 5 g theoretical tablet weight 350 g______________________________________ in both a and b , ingredients 1 - 4 were blended together until uniform , passed through a screen , blended with ingredient 5 and compressed at the correct tablet weight . the dissolution profile for the compressed tablets demonstrated further that there was no significant difference in dissolution for the formulated tablet as compared with the unformulated powdered material .
| 0Human Necessities
|
with reference to fig1 , a monitoring device 10 , according to a preferred embodiment of the invention , is placed in position to commence analysis over the wound 11 . the device has to be placed close enough to the target wound to ensure clear high resolution imagery is available and also to maximize the effectiveness of other wound analysis components in the device . in this example the wound 11 is on a patient &# 39 ; s right forearm . fig2 shows a viewfinder / display screen 20 at the rear of the monitoring device 10 , with the device positioned to give the operator a clear image of the wound 11 . the viewfinder / display screen 20 is used to verify that the wound 11 is in the frame of the view finder / display screen 20 and can be easily captured and analyzed by the device 10 . a sensor 30 located in the device 10 as shown in fig3 , is designed to measure the distance 31 from the wound 11 thereby establishing a base line distance parameter upon which other variables can be calculated such as changes in surface contours and topography . this sensor 30 is also used to provide three dimensional imaging of the wound 11 detecting swelling and providing an assessment of the wound &# 39 ; s 11 relative size . fig4 shows a reference grid 40 being visually projected by a laser source projector 41 onto the arm 42 . this reference grid 40 can be visually seen and measured by the device 10 . the grid can be used to determine if the laser source projector 41 , and hence the device 10 , is at a different angle or distance from the subject wound 11 to that of the previous , base line analysis session . the reference grid system provides for repeatability of sensing and image recording between the first base line recording session and subsequent recording sessions . the size of this reference grid 40 combined with the measurement of distance 31 between the device 10 and wound 11 as described above and shown in fig3 , allows for an accurate calculation of variables such as distance and angle of the device 10 relative to the wound 11 , and eliminates erroneous diagnosis due to a difference between measurements taken at various times during the treatment process . the laser source projector 41 could additionally be configured to act as a cauterizing laser source . by this means small pockets of infection on some wounds could be cauterized as part of a sensing and image recording session . fig5 shows a thermal imaging temperature sensor 50 of device 10 , measuring the ambient temperature 51 of the environment in which monitoring of the wound 11 takes place . this is used to establish a baseline for other measurements which rely on temperature readings related to the wound and surrounding body surface . at the same time an optical sensor 52 measures the light level and hue of the environment , allowing these variables to be taken into account when diagnosing skin discoloration in and around the wound 11 . device 10 may further incorporate a self - adjusting flash 60 as shown in fig6 , which utilizes the light level measurement taken as described above and shown in fig5 to ensure an optimal and consistent light balance for color evaluation across all data collected relative to a single wound . fig7 shows a first set of images 70 being displayed after capture . the device 10 displays the results on the view finder / display screen 20 and saves the image - set together with a patient identifier , time , date , distance and ambient temperature as measured . this grouped information is used collectively to compare with results from other sessions of grouped data taken at other times and used to analyse what is happening to the wound . fig8 shows how wound colours 80 are recorded in the set of images and displayed on the view finder / display screen 20 . one example of how wound colour is used in wound management is to determine the progress of a bruise where discolouration is clearly a sign of the progress or decay of the wound . fig9 illustrates a thermal image 90 of the wound being displayed on the screen 20 . wound temperatures are measured by the sensor 50 as described above and shown in fig5 . the measured temperatures are recorded in an image set . small variations in temperature in the wound 11 are recorded and help in the assessment of many wound conditions including , but not limited to , signs of tissue death , known in the art as necrosis , and infection . fig1 shows an example of how the set of images 100 can be compiled and presented on the view finder / display screen 20 as a semi transparent layer 100 on top of real - time imagery 101 of the wound 11 and can be analyzed by the device . fig1 shows the analysis and compiled images 110 being displayed on the view finder / display screen 20 as a semi transparent layer which then allows the operator to make clinical treatment decisions based on the comparison of the previous data and image set with the current condition of the wound 11 . as shown in fig1 , when subsequent images are taken at later dates for diagnosis of the healing progress , the device 10 can be used to monitor this progress . the device retrieves data from the previous patient assessment , displaying this on the semi transparent layer on view finder / display screen 20 . the same distance and aspect from the wound are achieved using the saved distance measurement and projected grid as described above and shown in fig1 to 4 . the user is guided by a semi - transparent version of the previous images 120 to adjust the position of the device over the wound 11 . when the grid 40 in the saved image 120 is aligned with the marker shown in current diagnosis 123 , the steps described above and shown in fig5 to 10 are repeated for a comparative diagnosis . fig1 shows that the device has analyzed changes in color , temperature and relative size of the wound 11 . analytical data is then displayed 130 , 131 on the screen 20 to assist the operator . in this example , analysis 132 has determined that the wound is smaller and that the surface temperature of the wound has reduced and deduced that the chance of infection is unlikely . all data is saved with patient identification for records , analysis and ongoing treatment . the system of the invention provides the ability to monitor and record wounds over time . it also enables systematic multi - sensing assessment of a wound , supporting the early detection of pathologies to improve patient outcomes . it is anticipated that the frequency of use will depend on the pathology of individual patients , with some wounds requiring monitoring every shift ( 8 hrs ) in a hospital setting . the following sets out a method of use in a typical wound monitoring process . the user &# 39 ; s id is input . the patient &# 39 ; s id and the location of the wound or wounds are input . each wound has a record specific to it . time and date are appended to the record automatically . the user positions the device over the wound to be measured , recorded and analysed . by using the screen as reference , the user ensures that the wound is in - frame . the device measures the distance from the wound and projects a grid onto the wound . the device focuses and records a visual image in 3d and a thermal image . the images are stored separately , and can be viewed individually or as composite . a combination of image collection setting and distance from the wound can be used to calculate the surface area of the wound . if thermal readings or colour analysis suggest the likelihood of infection , the device signifies the risk . the user &# 39 ; s id is input . the patients id and the location of the wound or wounds are selected from a list . time and date are appended to the record automatically . the user positions the device over the wound to be measured , recorded and analysed . previous image and live input from the screen , and ; previous measurement of distance of the device from specific locations on the patient &# 39 ; s body , using the projected grid and the patient as reference the user ensures that the device is positioned similarly to the initial image capture . this creates a series of images to enable slight corrections within the device cpu , such that an accurate comparison of wound size , colour and temperature is possible . changes in wound size , colour and / or temperature may signal the likelihood of pathologies or healing . initially , the device will alert the user to these changes . in time , clinical trials and ongoing analysis will inform a diagnostic capability in the device . changes will also be aligned to treatment records enabling improvements in wound care more broadly . high definition , high sensitivity thermal analysis will also enable the detection of early - stage infection and early treatment thereby ameliorating or preventing progress of the wound to a serious and / or chronic infection . with reference to fig1 there is illustrated in block diagram form the main components and their interconnection of a data acquisition device 150 suited to implement the system described above . in this instance the data acquisition device 150 includes a digital processor and display 151 in communication with a memory 154 which stores data corresponding to patient details , treatment history , comparative analysis , wound location and wound condition ( monitored progressively and repeatedly over time at predetermined time intervals ). a number of primary sensing components are also in communication with the processor and display 151 including a range finder 152 which acquires and transmits data corresponding to distance to a target location ( in this instance a wound ). again , distance data is sent at predetermined intervals on a repeated basis thereby to build a time referenced profile of conditions at the target site . a suitable range finder device particularly suited to wound data acquisition at close range ( that is under 1 m in range but at high resolution ) as contemplated in embodiments described above . also in communication with the processor and display 151 is laser pattern generator 153 which , in the preferred instances described above , projects a grid pattern onto the target site at the range determined by the rangefinder 152 . in a preferred form the grid is a rectilinear array of squares having sides having lengths in the range 0 to 5 mm depending on specific application thereby to provide a clear point of reference for an observer . the range finder 152 and laser pattern generator 153 collectively provide data feeds to processor and display 151 as what may be broadly described as targeting data including distance of the data acquisition device 150 from its target site and the relative location of the target site , in this instance a wound , in three - dimensional space . also in communication with the processor and display 151 is thermal imaging device 155 . this device fundamentally records heat signature at the target site at the designated range on a repeated basis at predetermined intervals . in a preferred form the thermal imaging device comprises a heat sensor with a macro lens which permits focus onto the target site and acquisition of thermal imaging data in the under 1 m range including more preferably the 0 to 20 cm range . also in communication with the processor and display 151 is 3 - d imaging device 156 which records colour data and size data at the target site with reference to the data provided by the targeting elements 152 , 153 . again these recordings are made at predetermined intervals on a repeated basis thereby to provide time sequence data and as a consequence change data ( first derivative ). the thermal imaging device 155 and 3 - d imaging device 156 comprise diagnostic elements which provide data relating to size , colour , heat signature and change in size , colour and heat signature which processor 151 references against the targeting element data from rangefinder 152 and laser pattern generator 153 thereby to build a time referenced profile of data concerning the target site , in this instance of the wound . with reference to fig1 there is illustrated a flow chart sequence 200 which can be programmed into the processor and display 151 of fig1 whereby initial data capture 203 includes patient identification , operator identification , wound location and time and date data for providing core reference date for a capture sequence . this data is input into processor 151 ( see fig1 ) either via a touch sensitive display or other keypad input . data is then progressively acquired from the devices described with reference to fig1 including targeting coordinates 204 and detailed diagnostic data 205 . this data acquisition enables a reference framework 201 to be built by processor 151 in the form of record identity 206 , image repeatability ( particularly with reference to the grid pattern provided by the laser ) 207 and diagnostic element data 208 . the sequence is repeated 202 as a series of subsequent data captures 202 at predetermined intervals on a repeated basis . in a preferred form the intervals are equal . in an alternative form the intervals may not be equal but extrapolation algorithms may then be used to normalise the data for example so as to map it to what would be expected for equal time interval data acquisition . thus , at predetermined intervals , the data captures repeat the patient id acquisition 209 , the targeting coordinates data 210 and the 3 - d image and related detailed data 211 thereby to present a relative wound condition summary 212 over time . in the first preferred embodiment described above all the components for analysis are in the one device . an alternative embodiment could have these components separated but connected to one central data processing unit . for example multiple analysis devices of the same type could be used at different times but the results could be coordinated to achieve the same synchronized diagnosis . in the first preferred embodiment described above all the measurements required for diagnosis are taken in one session . in alternative embodiments measurements could be taken continuously or at intervals of any length . in the first preferred embodiment described above images are taken at high definition quality commonly used in digital cameras . an alternative embodiment could use much higher resolution , allowing diagnosis even up to microscopic levels . in the first preferred embodiment described above the projected reference marker shown in fig4 is a grid . in an alternative embodiment a different size or shape projection than that used in the drawings could be used with the intent of being able to determine changes in size and angle . the first preferred embodiment described above uses changes in color , heat , size and contour of the wound to make an analysis . an alternative embodiment could use just three of these to perform an analysis . the first preferred embodiment described above is a single , purpose designed module that can be cleaned to minimize infection risk . an alternative embodiment could see the functionality separated out into separate modules . while this may be harder to sanitize it may also deliver advantages in terms of ease of replacement with component failure . the first preferred embodiment described above takes temperature measurements and three dimensional images simultaneously , allowing multiple evaluations to be conducted to enable an accurate clinical appraisal . an alternative embodiment could collect measurements from approximately the same time , using multiple devices and still deliver relatively usable analysis . the above describes only some embodiments of the present invention and modifications , obvious to those skilled in the art , can be made thereto without departing from the scope and spirit of the present invention .
| 0Human Necessities
|
fig1 depicts a suture anchor 10 according to the present invention . it comprises in gross an inner body 12 having a distal end 14 and proximal end 16 and a cannulated outer body 18 having a distal end 20 , proximal end 22 and a cannulation 24 therethrough . towards the outer body proximal end 22 the cannulation 24 bears internal threads 26 which decrease in internal diameter at the proximal end 22 . on its exterior surface 28 the outer body 18 bears barb shaped annular flanges 30 to assist in bone fixation . the inner body 12 has an annular flange 32 at its distal end 14 with a groove 34 therethrough passing over the distal end 14 . at its proximal end 16 the inner body 12 has exterior threads 36 which mate with the inner body threads 26 . a pair of radially extending projections 38 extend from the inner body 12 toward the outer body 18 at its distal end 20 . the tolerance between the projections 38 and the outer body 18 should be close enough to prevent suture 39 from passing therebetween . a tool receiving recess 40 on the inner body proximal end 16 mates with a driver head 42 ( such as for instance a hex driver ) on a distal end of a driver 44 . just proximal thereof on the driver 44 are threads 46 which mate with the threads 26 on the outer body 18 . the threads 46 have a reduced major diameter at a proximal portion 48 which in its starting configuration as shown in fig1 sits adjacent the decreased internal diameter of the outer body thread 26 at their proximal end 22 . the driver 44 operates within a tube 50 having a distal end 52 abutting the outer body proximal end 22 with distally projecting tangs 53 extending into slots 54 in the outer body proximal end . this interface assists in maintaining the position of the anchor 10 as it is employed , by resisting both rotation and proximal withdrawal thereof . turning also now to fig2 , two or more of the stress relief slots 54 extend axially into the outer body 18 from its proximal end 22 . this allows the proximal end to be made from somewhat brittle materials yet still be able to expand outwardly radially to provide fixation . both the inner body 12 and outer body 18 are preferably formed of a bioabsorbable material such as biocryl rapide available from depuy mitek , inc . of raynham , mass . biocryl rapide is a bioabsorbable polymer formed of homogenous blend of tricalcium phosphate ( tcp ) and polylactic / polyglycolic acid ( plga ). other suitable materials include without limitation peek , pla , titanium , stainless steel , metals , polymers and other biocompatible materials . turning also now to fig3 to 7 , use of the suture anchor 10 will be described . the anchor 10 is sterile and packaged in bacteria proof packaging ( not shown ) pre - loaded onto the driver 44 and pre - loaded with a suture capture device 56 comprising an elongated filament 58 having a suture capture loop 60 at one end . one example is the chia percpasser available from depuy mitek , inc . of raynham , mass . the loop 60 in fig3 is shown adjacent the anchor 10 for ease of display but in practice sufficient length of the filament 58 would extend from the anchor 10 to allow suture 39 to be pulled out of a cannula ( not shown ) through which the procedure is being endoscopically performed . the suture 39 would be loaded into the suture capture loop 60 exterior of the patient and the cannula . a tab 62 may be placed on an opposite end of the filament 58 . ( this is also shown adjacent the anchor 10 for ease of display but would more conveniently be positioned outside of the cannula .) when the tab is pulled the loop 60 with the suture 39 captured therein is drawn down between the inner body 12 and outer body 18 pulling the suture 39 with it . the path of the suture 39 after passing between the inner body 12 and outer body 18 goes through the groove 34 to assist in sliding . additional sutures can also be employed , such as additional suture loops in the suture capture loop 60 or addition suture loops each with their own suture capture device . the anchor 10 with the suture 39 therein is now inserted into a pre - drilled hole 64 in a bone 66 to which a piece of soft tissue 68 is to be attached as shown in fig4 . the anchor 10 is positioned in the hole 64 such that the suture passes into the anchor 10 at one of the stress relief slots 54 . the suture 39 is shown looped through the soft tissue 68 but other arrangements are possible such as extending from another anchor ( not shown and typically of a different configuration than anchor 10 ) which is positioned in the bone 66 below the soft tissue 68 and up through the soft tissue 68 to the anchor 10 , such as in a dual row rotator cuff repair . also , the path from the soft tissue 68 through the anchor 10 could be reversed . free ends 70 of the suture 39 are drawn through the anchor 10 to position the soft tissue 68 and properly tension the suture 39 ( see fig5 ). the tube 50 of the driver 44 holds the anchor 10 down and prevents rotation of the outer body 18 while the driver 44 is rotated to rotate the inner body 18 ( see fig6 ). as the threads 46 of the driver 44 pass through the reduced inner diameter proximal portion 22 of the outer body 18 it causes it to expand outwardly radially to engage the bone 66 and reduces the stress on the inner body 18 . preferably , the relaxed condition of the outer body 18 is slightly expanded radially and as it is inserted into the hole 64 it is compressed slightly inwardly ; the expansion by the threads 46 move it back to its relaxed configuration thus reducing internal stress . as the rotation continues the threads 36 of the inner body move into the reduced inner diameter proximal portion 22 to keep the outer body proximal end 22 radially expanded . the projections 38 on the inner body 12 cause the suture 39 to wrap around the inner body 12 . the suture 39 feeds in from the free ends 70 , not from the soft tissue 68 so that the position of the soft tissue 68 and the tension on the suture 39 between the anchor 10 and the soft tissue 68 remains substantially unchanged as the inner body 12 is rotated . after sufficient rotation the driver 44 is disengaged from the anchor 10 and removed leaving the suture 39 locked to the anchor 10 by virtue of its being wrapped around the inner body 12 and the outer body proximal end 22 is expanded outwardly into the bone 66 to lock the anchor 10 thereto ( see fig7 and 8 ). tests have shown three to five turns providing good locking of the suture 39 . fig9 and 10 illustrate a further preferred embodiment of the invention which is essentially similar to that depicted in fig1 and 2 . like parts are denoted with like numerals with the addition of a prime symbol (′). it comprises a suture anchor 10 ′ having an inner body 12 ′ and cannulated outer body 18 ′ having a short internal thread 24 ′. the inner body 12 ′ has an annular flange 32 ′ at its distal end 14 ′ with a groove 34 ′. it also carries radially extending projections 38 ′. fig9 especially more clearly illustrates how a driver receiving tube 50 ′ abuts a proximal end 22 ′ of the outer body 18 ′ with distally projecting tangs 53 ′ extending into stress relief slots 54 ′. a loop of suture 39 ′ has free ends which pass into the outer body 18 ′ from its proximal end 22 ′, preferably through one of the stress relief slots 54 ′, passes down between the inner body 12 ′ and outer body 18 ′ and between the projections 38 ′, out of the outer body 18 ′ through its distal end 20 ′, through the groove 34 ′ on the inner body 12 ′ at its distal end 14 ′ and then back into the outer body 18 ′ between it and the inner body 12 ′ and also again between the projections 38 ″ and finally exit through the opposing stress relief slot 54 ′. this embodiment is used similarly to the previous one . however , the groove 34 ′ assists in wrapping the suture 39 ′ around the inner body 12 ′ and one could even dispense with the projections 38 ′ due to the wrapping action provided by the groove 34 ′. various modifications and alterations of this invention will be apparent to those skilled in the art without departing from the scope and spirit of this invention . it should be understood that the invention is not limited to the embodiments disclosed herein , and that the claims should be interpreted as broadly as the prior art allows .
| 0Human Necessities
|
the present invention relates to toy guns in general and more particularly to those that utilize a spring - driven plunger and compressed air to project paper , confetti , fiber , or fluid . for decades toy guns with different functions have been popular with both children and adults . air guns powered by a spring and compressed air are among the most common types of toy guns . among the projectiles available are balls , darts , missiles , disks , arrows , and water . many prior inventions involve toy guns driven by a spring and possibly compressed air as well . most projectiles in these cases consist of relatively rigid materials such as metal , glass , plastic , or foam , and all tend to remain an integrated unit after being launched and during flight . when fluid is projected , it is in the form of relatively continuous flows . each of the following toy guns is in the form of a “ gun .” u . s . pat . no . 183 , 124 ( butterweck ) discloses a toy gun which ejects a spherical projectile from the barrel utilizing a contracted spring as the sole source of power . its trigger is designed to catch on a piston in the barrel . u . s . pat . no . 1 , 339 , 949 ( egts ) discloses a double - barreled toy gun which launches a small spherical projectile from the first barrel , using an extended spring in the second barrel as the power source . u . s . pat . no . 1 , 488 , 995 ( mccollom ) also discloses a double - barreled toy gun , which compresses air by the movement of a spring and a plunger in the two barrels , discharging a missile - shaped projectile . its trigger catches on the middle portion of a spring to hold the gun in a state ready for firing . u . s . pat . no . 1 , 575 , 644 ( schmidt ) discloses a toy gun with a trigger as its source of power , utilizing both a spring and compressed air as agents . when the trigger is pressed , the power is transferred through a series of mechanisms to contract a spring within the barrel . when the trigger is released , the potential energy of the spring ejects the projectile . u . s . pat . no . 2 , 321 , 077 ( gora et al ) discloses a toy gun within whose barrel is a spring that is compressed by the tail of a dart . the contracted spring is held by a trigger , the release of which ejects the projectile . u . s . pat . no . 2 , 630 , 108 ( white ) discloses a toy gun that projects ping - pong balls utilizing the potential energy of a contracted spring and compressed air as an agent . u . s . pat . no . 2 , 652 , 822 ( griffith ) discloses a toy gun , with a rod and a spring , which projects a ping - pong ball like projectile by utilizing the energy produced by dragging the rod and compressing the spring . u . s . pat . no . 2 , 725 , 869 ( barber ) discloses a long gun , which uses a plunger to generate compressed air and to eject a ball - shaped projectile . the following projectors are in the form of a long cylinder and use a spring or compressed air to generate power for the projection . u . s . pat . no . 1 , 556 , 846 ( kovacs ) discloses a launching tube containing a rod that is drawn to contract a spring . u . s . pat . no . 2 , 600 , 883 ( king ) discloses an apparatus in which a rod is drawn to contract a spring , which once released , is able to fire balls . u . s . pat . no . 4 , 335 , 701 ( bozich ) discloses a projector that ejects a baseball , utilizing a spring as the power source and a long rod as an agent for transmitting the power . u . s . pat . no . 5 , 058 , 561 ( starr ) discloses a launching tube , which manually ejects cylindrical projectiles such as empty beverage cans using compressed air as an agent . the following two patents emphasize the visual effects of projectiles in dark surroundings . u . s . pat . no . 5 , 415 , 151 ( fusi ) involves a bullet - shaped phosphor - containing projectile that creates clear visual effects in darkness . the invention discloses a round capsule containing a phosphor - containing fluid . however , the purpose of the art is to keep the projectile visible in flight and to leave a luminous mark on targets the projectile strikes . as such , the projectile remains integrated in flight until it reaches the target . u . s . pat . no . 6 , 048 , 280 ( palmer / palmer ) discloses a toy gun that projects a dart using as an agent compressed air generated by a drawn rod and a released spring . the gun contains a flash lamp to create the fluorescent effects of the propelled projectile . the above - mentioned launching devices have at least one of the following features , which differentiate them from the present invention : 1 ) the appearance of a “ gun ,” 2 ) horizontal “ shooting ” as the primary function , 3 ) rigid projectiles such as balls , darts , beverage cans , and special bullets that stay integrated during flight , 4 ) a target for shooting . projectiles in all above - mentioned devices remain integrated after being ejected . having one or more of these characteristics renders past inventions unsuitable for usage at large social gatherings . the present invention is entirely dissimilar from above - mentioned apparatuses . the device is to be used for leisure . the primary function of the present invention is to project and disseminate soft and non - integrated materials contained in a cartridge , generally vertically and without aiming at a target . additionally , the outside surface of the present invention can be covered with fluorescent materials for decorative purposes . a flag may also be attached to the upper section of the launching tube . these and other features could be appropriate at sporting or music events , wedding ceremonies , holiday celebrations , parties , or other large social gatherings . in consideration of disadvantages of known types of toy gun devices , whose primary purposes are to horizontally project various hard projectiles that remain integrated after being ejected , the present invention is a new type of projecting device , which may be held in the hand and may project , usually vertically , soft projectiles such as paper disks , confetti , or fluid . the general purpose of the present invention is to provide a new , simply constructed device that “ projects ” for visual pleasure but does not “ shoot .” none of these advantages and new features have been shown or suggested in the prior art projecting devices . for this purpose , the present invention consists of two sections of a launching tube , a plunger , a spring , a trigger , and a cartridge , which will be described with all details later . a primary object of the present invention is to provide a projecting device capable of launching , usually vertically , soft projectiles such as paper disks , confetti , or fluid for visual pleasure . another object is to provide a cartridge with a variety of possible contents , including but not limited to paper disks , confetti , and fluid , which may be treated with fluorescent materials in order to create pleasant visual effects in the dark . letters or words could also be printed on paper disks . the disks could also display messages such as fortunes . alternatively , they could show numbers and be used for drawing lots . to create a cheerful atmosphere , the substances being projected may also be scented . a further object is to provide a projecting device not in the form of a “ gun ” but that of a long stick , the cross section of which may be circular , triangular , rectangular , or any other shape . the advantage of a stick - like structure is that additional adaptations are possible . for instance , the device may be used as a flagpole . another object is to provide a simply - constructed and inexpensive projecting device . the simplicity of the structure makes this device affordable and easy to use . still another object is to provide a light - weight , simply - operated , and easy - to - carry projecting device able to be held in one hand . a further object is to provide a projecting device for repeated use . an additional object is to provide a projecting device at a much larger scale , with the same structure as formerly described , in order to meet various demands on different occasions . another object is to provide a horizontal complex of projecting devices , with combined or separate triggers in order to eject projectiles from more than one device simultaneously . [ 0025 ] fig3 is a sectional view of the present invention where the upper section of the launching tube is folded to the side and the cartridge is being loaded . [ 0026 ] fig4 is a perspective view of the present invention after the projection . [ 0027 ] fig5 is an enlarged perspective view of the trigger shown in fig4 . [ 0028 ] fig6 is a perspective view of the plunger shown in fig2 - 3 . [ 0029 ] fig7 is an exploded view of the cartridge and its contents after they are expelled from the launching tube . fig1 - 4 show the present invention 10 completely . as shown in fig2 the present projecting device 10 consists of a lower section 11 of the launching tube , an upper section 12 of the launching tube , a plunger 13 , a spring 14 , a cartridge 15 , a pulling string 16 , a trigger 17 , a v - shaped pivot component 18 , and a hook 19 . as shown in fig1 - 4 , the lower section 11 and the upper section 12 of the launching tube have the same diameter . the two sections are connected with a v - shaped pivot component and a hook . as shown in fig1 , and 4 , the lower section 11 and the upper section 12 are in rectilinear state immediately before , during and after the launching of the projectile . as shown in fig3 before the user inserts the cartridge 15 and pulls back on the string 16 , the upper section 12 folds to the side , forming with the lower section 11 a “ 7 ” shape . then , the user loads a cartridge 15 into the upper section 12 . as shown in fig2 - 3 , within the lower section 11 are the plunger 13 , the spring 15 , and the string 16 . a long screw 22 is installed near the end of the lower section 11 . the trigger 17 is installed on the outside surface of the lower section 11 . as shown in fig2 the top of the lower section 11 has a inner collar flange 31 designed to keep the plunger 13 within the lower section 11 as the plunger 13 moves upward , driven by the released spring 14 . thus , the diameter of the plunger 13 should be slightly smaller than the lower section of the launching tube 11 so that the plunger 13 can smoothly slide and reciprocate within the tube . as shown in fig6 the plunger 13 has a main body 32 which may move smoothly within the lower section 11 . the plunger 13 also has a top portion 33 , the diameter of which is smaller than that of the main body 32 . when the plunger 13 is released , the top portion 33 directly hits the bottom of the cartridge 15 . the lower portion 34 of the plunger 13 also has a diameter much smaller than that of the main body 32 so that the lower portion 34 can be inserted into the spring 14 . the string 16 goes through a loop 30 found on the bottom of the lower portion 34 . as shown in fig2 , and 6 , the upper end of the spring 14 surrounds the lower portion 34 of the plunger 13 . a screw 22 keeps the rear end of the spring 14 from being pressured out of the lower section 11 of the tube when the string 16 is pulled . as shown in fig1 - 4 , the string 16 , connected to the plunger 13 by the loop 30 , is used to pull the plunger 13 downwards . fig3 shows the user pulling on the string 16 . near its lower end the string 16 is knotted 21 in order to prevent the lower end of the string 16 from receding into the tube . when the spring 14 releases and the string 16 is moving upwards , the screw 22 stops the string 16 at the knot 21 , and the rear end of the string 16 remains outside of the launching tube . as shown in fig1 - 4 and in particular detail in fig5 a trigger 17 is installed on the outside surface of the lower section 11 of the launching tube , on the same side as the hook 19 . the upper end of the trigger 17 digs into a gap 23 in the surface of the launching tube . when the string 16 is pulled backwards , the front of the trigger 17 , affected by a leaf spring 26 , enters into the launching tube and blocks the upward motion of the spring 14 by stopping the upper end of the plunger 13 and allowing the projecting device 10 to enter a ready - to - launch state . the trigger 17 is connected and fixed to a support base 24 by a long screw 25 . the leaf spring 26 is installed between the trigger 17 and the support base 24 in order for the front of the trigger 17 to automatically be pushed into the launching tube and block the upper end of the plunger 13 while it is pulled downwards . as shown in fig1 - 4 , the v - shaped pivot component 18 includes a triangular flange 27 at the top of the lower section 11 and a triangular flange 28 on the bottom of the upper section 12 . as shown in fig2 the front of the hawk - beak hook 19 locks the flange 29 at the top of the lower section 11 , which is in rectilinear state with the upper section 12 . as shown in fig3 the user must forcibly fold the upper section 12 to the side , disconnecting the hawk - beak hook 19 from the flange 29 , in order to load the cartridge 15 into the open end of the upper section 12 . at this time , the lower section 11 and the upper section 12 of the launching tube are connected by the pivot 18 . as shown in fig2 , and 7 , the user must insert the cartridge 15 into the open end of the upper section 12 of the launching tube before the projection . as shown in fig7 the cartridge 15 consists of a container 50 holding paper disks 51 , an adhesive piece of paper 52 for sealing the front end of the cartridge 15 , and a piece of cardboard 53 for blocking the rear end of the cartridge 15 . the container 50 has a rear end with an extended ridge outside 54 and inside 56 . the dashed line 55 shows the conjunction at which the wall of the container 50 connects to the ring that gives it an outer 54 and inner ridge 56 . lucky phrases and numbers for drawing lots may be printed on the paper disks 51 , or fluorescent materials may be added to create pleasing visual effects in the dark . the adhesive piece of paper 52 is sticky on the edges in order to keep all contents within the container 50 . the solidity of the adhesive paper 52 should be such that the contents may leave the container 50 freely once compressed air hits the bottom of the cartridge 15 . if the contents of the cartridge 15 are paper disks 51 or confetti , a piece of cardboard 53 is used on the bottom of the cartridge 15 . if the content is a fluid , waterproof plastic adhesive tape should be used on the bottom of the cartridge 15 in order to keep the fluid within the container 50 without leaking . the solidity of the waterproof plastic should be such that allows the expulsion of the fluid when compressed air hits the bottom of the cartridge 15 . as shown in fig2 the lower section 11 and the upper section 12 of the launching tube , the plunger 13 , and the trigger 17 may use pvc as the raw material for injection processing . the plunger 13 is a hollow cylinder . the leaf spring 26 is u - shaped , with resilience to become straight . as shown in fig3 the user folds the upper section 12 of the launching tube to the side , disconnecting the hawk - beak hook 19 from flange 29 , allowing the upper section 11 and the lower section 12 of the launching tube to change from a rectilinear state to a “ 7 ” shape , connected by the v - shaped pivot 18 . the user then inserts the cartridge 15 into the upper section 12 in direction a until the outside ridge 54 of the cartridge 15 is closely pressed to the bottom of the upper section 12 of the launching tube . then , as in fig3 the user pulls the string 16 in direction b to contract the spring 14 into a ready - to - launch state , where the front end of the trigger 17 , affected by the resilience of the leaf spring 26 , digs into a gap 23 in the launching tube , blocking the plunger 13 . the user then restores the upper section 12 to a rectilinear state with the lower section 11 , allowing the entire projecting device 10 to enter a state fully ready for projection . as shown in fig1 when the user presses the trigger 17 in direction a , the plunger 12 , pushed by the spring 14 , moves upwards inside the launching tube in direction b . compressed air in the launching tube propels the paper disks 51 or other contents into flight from the launching tube . although the above description of the present invention includes illustrations and detailed explanations , it does not limit the present invention within the illustrations and descriptions . some changes and modifications may take place within the scope of the present invention without modifying its basic principles .
| 0Human Necessities
|
hereinafter , a power supply system for an electric vehicle according to an embodiment of the present invention will be described with reference to fig1 and 2 . fig1 is a diagram illustrating the configuration of a power supply system for an electric vehicle according to embodiment 1 of the present invention . fig2 is a block diagram illustrating the configuration of the power supply system for an electric vehicle . in fig2 , a solid arrow represents the flow of signals and a dotted arrow represents the flow of power . as shown in fig1 , the power supply system for an electric vehicle according to an embodiment of the present invention includes power supply apparatus 2 installed in a road and electric vehicle 3 supplied with power from power supply apparatus 2 . more specifically , electric vehicle 3 is charged with power supplied from power supply apparatus 2 through the use of power receiving apparatus 4 . electric vehicle 3 in embodiment 1 of the present invention is a vehicle obtaining a thrust by electricity and includes an electric motor that generates , with power , a driving force transmitted to wheels . the electric motor is driven with power of power storage section 42 ( see fig2 ). the power stored in the power storage section 42 is supplied from the outside of electric vehicle 3 . examples of electric vehicle 3 in the present invention include an ev ( electric vehicle ) that is driven using only an electric motor and a plug - in hybrid vehicle that is driven using an engine and an electric motor and that enables power storage section 42 to be supplied with power from a power supply outside electric vehicle 3 . detailed configurations of power supply apparatus 2 and power receiving apparatus 4 will be described below . power supply apparatus 2 includes power supply section 21 that supplies power to power receiving section 41 of electric vehicle 3 in a non - contact manner , vehicle detecting section 22 that detects the entrance of electric vehicle 3 to a predetermined range on a road , power supply - side communication section 23 that communicates with electric vehicle 3 , and power supply - side control section 24 that controls sections of power supply apparatus 2 . electric vehicle 3 can be charged in a non - contact manner by stopping in a predetermined range ( hereinafter , referred to as “ chargeable area b ”) on road surface a in fig1 . fig1 shows an example where electric vehicle 3 a is going to enter chargeable area b and electric vehicle 3 b stops in the vicinity of electric vehicle 3 a . when electric vehicle 3 a enters chargeable area b , power supply apparatus 2 sets up a communication with electric vehicle 3 a and supplies power to electric vehicle 3 a . at this time , it is necessary for power supply apparatus 2 to control a communication not to be set up with electric vehicle 3 b stopping in the vicinity thereof . the sections of power supply apparatus 2 will be described in detail below . power supply section 21 generates power and supplies the generated power to electric vehicle 3 in a non - contact manner . it is preferable that power supply section 21 be installed in the vicinity of the road surface of a road . power supply section 21 includes a power supply coil and a coil driving circuit that drives the power supply coil . the coil driving circuit drives the power supply coil by applying a pulse of a predetermined frequency to the power supply coil . the predetermined frequency ( chopper frequency ) of the pulse is controlled by power supply - side control section 24 . a magnetic field proportional to the current is generated in the power supply coil using the pulse as excitation current . an electromotive force is generated in the power receiving coil of power receiving section 41 by the magnetic field , and power is supplied from power supply section 21 to power receiving section 41 . here , it is assumed that the magnitude of power supplied from power supply section 21 when electric vehicle 3 enters chargeable area b is defined as first power value pa and the magnitude of power supplied from power supply section 21 after a communication between power supply apparatus 2 and electric vehicle 3 is set up is defined as second power value pb . first power value pa is such power as to have no influence on a human body . here , the “ such power as to have no influence on a human body ” means such a small magnitude of power to have no influence on animals or the like present around power supply section 21 . second power value pb means a magnitude which is larger than first power value pa and which enables power receiving section 41 to charge power storage section 42 . for example , first power value pa is about several w to several tens w , and second power value pb is about several kw to several tens kw . vehicle detecting section 22 is a sensor used to determine whether electric vehicle 3 enters chargeable area b . vehicle detecting section 22 transmits the determination result on whether electric vehicle 3 enters chargeable area b to power supply - side control section 24 . vehicle detecting section 22 includes , for example , an infrared sensor that detects whether an object is present within a predetermined distance . a plurality of the infrared sensors are disposed at facing positions on the boundary of chargeable area b . vehicle detecting section 22 determines that electric vehicle 3 enters chargeable area b , when all the infrared sensors detect an object . in another example of vehicle detecting section 22 , an imaging camera imaging a vehicle may be installed around the road and may detect that electric vehicle 3 enters or leaves chargeable area b by the use of an image captured with the imaging camera . power supply - side communication section 23 wirelessly communicates with vehicle - side communication section 43 of electric vehicle 3 to be described later . power supply - side communication section 23 is controlled by power supply - side control section 24 . power supply - side communication section 23 includes an antenna receiving rf waves and a modulation and demodulation section modulating or demodulating a received signal . power supply - side communication section 23 is always supplied with power . it is preferable that power supply - side communication section 23 be installed around a surface of a road . in the present invention , the communication method is not particularly limited , but a communication method of performing a short - distance communication of which the communication distance is several meters can be preferably used . this is because power supply - side communication section 23 needs only to be able to communicate with vehicle - side communication section 43 of electric vehicle 3 ( electric vehicle 3 entering chargeable area b ) to be supplied with power from power supply section 21 , and needs to prevent a communication with electric vehicle 3 b stopping in the vicinity of electric vehicle 3 a to be supplied with power , for example , as shown in fig1 . examples of the communication method applicable to the present invention include zigbee ( registered trademark ), wireless lan , and communications using specified low power bands . power supply - side control section 24 controls power supply section 21 on the basis of the detection result from vehicle detecting section 22 and information received by power supply - side communication section 23 . specifically , when vehicle detecting section 22 detects that electric vehicle 3 enters chargeable area b , power supply - side control section 24 sets the magnitude of power to be supplied from power supply section 21 to first power value pa . power supply - side control section 24 then causes power supply - side communication section 23 to transmit and receive data in order to set up a communication between power supply - side communication section 23 and vehicle - side communication section 43 . when the communication is set up , power supply - side control section 24 sets the magnitude of power to be supplied from power supply section 21 to second power value pb . details of the control performed by power supply - side control section 24 will be described later . power receiving apparatus 4 includes power receiving section 41 that receives power supplied from power supply section 21 of power supply apparatus 2 , power storage section 42 that stores power received by power receiving section 41 , vehicle - side communication section 43 that communicates with power supply - side communication section 23 , and vehicle - side control section 44 that controls power receiving section 41 and vehicle - side communication section 43 . the sections of power receiving apparatus 4 will be described in detail below . power receiving section 41 is installed on the bottom surface of the vehicle body of electric vehicle 3 and includes a power receiving coil and a rectifier circuit . it is preferable that power receiving section 41 is installed on the bottom surface of electric vehicle 3 facing the road . the surface of the power receiving coil is covered with a synthetic resin or the like . the power receiving coil is a coil formed , for example , in a coplanar shape and can receive power from power supply section 21 through electromagnetic induction . the power received through electromagnetic induction is input to the rectifier circuit , is converted into dc current therein , and is output to power storage section 42 . power storage section 42 stores power received by power receiving section 41 . a secondary battery ( such as a nickel - hydrogen secondary battery or a lithium ion secondary battery ) having a high energy density or a capacitor having large capacity is used as power storage section 42 . the power stored in power storage section 42 serves as a power source for driving the wheels of electric vehicle 3 and is used to operate an electric motor . the power stored in power storage section 42 is used as power for operating accessories such as a car navigation apparatus and a car audio apparatus , electrical components such as power windows , an etc ( registered trademark ), and an ecu ( electronic control unit ), and the like , in addition to the electric motor . vehicle - side communication section 43 wirelessly communicates with power supply - side communication section 23 of power supply apparatus 2 . vehicle - side communication section 43 is controlled by vehicle - side control section 44 . vehicle - side communication section 43 includes an antenna for receiving rf waves and a modulation and demodulation section for modulating or demodulating a received signal . it is preferable that vehicle - side communication section 43 be installed on the bottom surface of electric vehicle 3 facing the road . accordingly , the antenna is preferably a planar antenna not protruding from the bottom surface of electric vehicle 3 . in the present invention , the communication method is not particularly limited , but a communication method of performing a short - distance communication of which the communication distance is about several meters can be preferably used . vehicle - side communication section 43 is started up on the basis of power received by power receiving section 41 . specifically , vehicle - side communication section 43 is started when power of first power value pa or more is supplied from power supply section 21 to power receiving section 41 , and operates with the power output from power receiving section 41 . after being started up , vehicle - side communication section 43 performs a process of setting up a communication with power supply - side communication section 23 . vehicle - side communication section 43 operates with power received by power receiving section 41 until the communication is set up , and operates with power of power storage section 42 after the communication is set up . vehicle - side communication section 43 is in a communication standby state after the communication is set up . since vehicle - side communication section 43 operates with power received by power receiving section 41 until the communication is set up , it is possible to start the communication without using the power of power storage section 42 . vehicle - side control section 44 controls vehicle - side communication section 43 and power receiving section 41 of power receiving apparatus 4 . specifically , vehicle - side control section 44 controls power receiving section 41 to prepare reception of power and causes vehicle - side communication section 43 to transmit and receive data so as to set up a communication between power supply - side communication section 23 and vehicle - side communication section 43 . details of the control performed by vehicle - side control section 44 will be described later . vehicle - side control section 44 and power supply - side control section 24 include a cpu , a rom , and a ram . the cpu performs various operations , outputting of control signals , and the like by executing a program stored in the rom . the cpu uses the ram as a work area during execution of the program . the processing operations of the power supply system for an electric vehicle having the above - mentioned configuration will be described below with reference to fig3 to fig5 . fig3 is a diagram illustrating the operation of the power supply apparatus . fig4 is a diagram illustrating the operation of the power receiving apparatus . fig5 is a diagram illustrating a communication setup process . first , the operation of the power supply apparatus will be described with reference to fig3 . in “ start ” of fig3 , power supply section 21 does not supply power . power supply - side control section 24 first determines whether electric vehicle 3 enters chargeable area b on the basis of the detection result from vehicle detecting section 22 ( s 10 ). when electric vehicle 3 does not enter chargeable area b ( no in s 10 ), power supply - side control section 24 performs the process of s 10 again . when electric vehicle 3 enters chargeable area b ( yes in s 10 ), power supply - side control section 24 controls power supply section 21 so that power supply section 21 supplies power of first power value pa ( s 11 ). power supply - side communication section 23 performs a process of setting up a communication with vehicle - side communication section 43 of electric vehicle 3 entering chargeable area b ( s 12 ). details of this process will be described later . after the communication is set up in s 12 , power supply - side control section 24 controls power supply section 21 so that power supply section 21 supplies power of second power value pb ( s 13 ). when power supply section 21 supplies power of second power value pb in s 13 , electric vehicle 3 starts receiving power . after the supply of power is started in s 13 , power supply - side control section 24 determines whether electric vehicle 3 leaves chargeable area b ( s 14 ). when the electric vehicle leaves chargeable area b ( yes in s 14 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). this process is performed regardless of whether the charging of electric vehicle 3 is ended . this is because when electric vehicle 3 is being charged but electric vehicle 3 moves for a certain reason , power supply section 21 supplying power of second power value pb is exposed , which is dangerous . when electric vehicle 3 does not leave chargeable area b ( no in s 14 ), power supply - side control section 24 determines whether power supply - side communication section 23 receives a power supply stop signal from vehicle - side communication section 43 ( s 15 ). when the power supply stop signal is received ( yes in s 15 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). on the other hand , when the power supply stop signal is not received ( no in s 15 ), power supply - side control section 24 performs the process of s 14 again . when the process of s 16 is ended , the same state as “ start ” of fig3 is obtained . the operation of power receiving apparatus 4 will be described below with reference to fig4 . first , vehicle - side control section 44 prepares power receiving section 41 to receive power of first power value pa ( s 20 ). this preparation is a process for enabling power receiving section 41 to receive power . this preparation is started , for example , when the speed of a vehicle becomes lower than or equal to a predetermined speed . this is because the charging operation when a vehicle travels at a high speed cannot be normally considered . when the process of s 20 is ended , vehicle - side control section 44 determines whether vehicle - side communication section 43 is started up ( s 21 ). vehicle - side communication section 43 is started up when power receiving section 41 receives power of first power value pa . when vehicle - side communication section 43 is not started up ( no in s 21 ), vehicle - side control section 44 repeatedly performs the process of s 21 . after power receiving section 41 receives power of first power value pa to start up vehicle - side communication section 43 ( yes in s 21 ), vehicle - side communication section 43 performs a process of setting up a communication with power supply - side communication section 23 of power supply apparatus 2 ( s 22 ). details of this process will be described later . when power receiving section 41 receives power of first power value pa in s 21 and s 22 , vehicle - side communication section 43 operates with power output from power receiving section 41 . after the communication is set up in s 22 , vehicle - side control section 44 prepares power receiving section 41 to receive power of second power value pb ( s 23 ). this preparation includes , for example , a process of turning on a relay ( not shown ) connecting power receiving section 41 and power storage section 42 . after the communication is set up in s 22 , vehicle - side control section 44 switches the power source for vehicle - side communication section 43 so that vehicle - side communication section 43 operates with power supplied from power storage section 42 as a power source . this is because after the communication is set up once , it is preferable that the power source be switched to power storage section 42 which can stably supply power , to stabilize the communication . when the process of s 23 is ended , power receiving section 41 starts receiving power from power supply section 21 . vehicle - side control section 44 determines whether power storage section 42 is fully charged during the reception of power ( s 24 ). when it is determined that power storage section 42 is not fully charged ( no in s 24 ), vehicle - side control section 44 performs the process of s 24 again after a predetermined time passes , in order for power receiving section 41 to consecutively receive power . when it is determined that power storage section 42 is fully charged ( yes in s 24 ), vehicle - side control section 44 causes vehicle - side communication section 43 to transmit a power supply stop signal ( s 25 ). the power supply stop signal is a signal used for causing power supply section 2 to stop the supply of power of second power value pb from power supply section 21 . when the charging is continuously performed even after power storage section 42 is fully charged , overcharging occurs to cause overheating of power storage section 42 and degradation in lifetime . therefore , the supply of power is stopped by the use of the power supply stop signal . after transmitting the power supply stop signal , vehicle - side control section 44 performs a power reception ending process . here , the power reception ending process includes , for example , a process of turning off a relay ( not shown ) connecting power receiving section 41 and power storage section 42 . the communication setup process will be described below with reference to fig5 . the left flowchart in fig5 represents the power supply - side process ( s 12 ) and the right flowchart represents the vehicle - side process ( s 22 ). after vehicle - side communication section 43 is started up in s 21 , vehicle - side control section 44 generates a random number ( s 221 ). then , vehicle - side control section 44 generates predetermined time ttest and predetermined power value ptest on the basis of the random number ( s 222 ). predetermined time ttest and predetermined power value ptest are values to be set for power supply apparatus 2 . vehicle - side control section 44 determines that the communication with power supply apparatus 2 is set up when power supply section 21 provides power of predetermined power value ptest after predetermined time ttest passes . here , predetermined time ttest is a time of about several seconds . when this time is excessively long , it takes a lot of time to start the supply of power . on the other hand , when this time is excessively short , power supply apparatus 2 cannot respond . predetermined power value ptest is a value greater than first power value pa and smaller than second power value pb and is about several w to several tens kw . when power value ptest is excessively great , the periphery of power supply section 21 is affected . when the power value is excessively small , vehicle - side communication section 43 cannot be started up . for example , when it is assumed that vehicle - side control section 44 generates a random number of 8 bits ( 0 to 255 ) in s 221 , vehicle - side control section 44 can divide the above - mentioned preferable ranges of predetermined time ttest and predetermined power value ptest into 256 equal parts and select a numerical value corresponding to the generated random number . it is assumed that multiple power supply apparatuses 2 are installed in parallel and electric vehicles 3 stops on respective power supply apparatuses 2 and are charged . then , when predetermined time ttest and predetermined power value ptest of neighboring vehicles are set to the same value , the correspondence between power supply apparatuses 2 and electric vehicles 3 may be erroneously determined . by using the random number , it is possible to actively avoid the state where predetermined time ttest and predetermined power value ptest of neighboring vehicles have the same values . vehicle - side control section 44 then generates a request signal including predetermined time ttest and predetermined power value ptest and causes vehicle - side communication section 43 to transmit the request signal ( s 223 ). the request signal transmitted from vehicle - side communication section 43 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether power supply - side communication section 23 receives the request signal within predetermined time tlimit after power supply section 21 starts the supply of power of first power value pa in s 11 ( s 121 ). predetermined time tlimit is , for example , about several seconds . when the request signal is not received within predetermined time tlimit ( no in s 121 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). when it is considered that a vehicle passes through chargeable area b after the supply of power of first power value pa is started , the subsequent supply of power of first power value pa causes power waste . therefore , when a response is not received within a predetermined time , it is preferable to determine that there is no power supply target and stop the supply of power . when the request signal is received within predetermined time tlimit ( yes in s 121 ), power supply - side control section 24 controls power supply section 21 on the basis of predetermined time ttest and predetermined power value ptest included in the request signal . specifically , after predetermined time ttest passes from when power supply - side communication section 23 receives the request signal , the power supplied from power supply section 21 is controlled to be predetermined power value ptest ( s 122 ). vehicle - side control section 44 determines whether the power received by power receiving section 41 is predetermined power value ptest after predetermined time ttest passes from when transmitting the request signal ( s 224 ). when the power is not power value ptest ( no in s 224 ), vehicle - side control section 44 determines that a communication with power supply apparatus 2 is not set up , and returns the process flow to start of fig4 . on the other hand , when the power is predetermined power value ptest ( yes in s 224 ), vehicle - side control section 44 determines that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up , and performs a control for causing vehicle - side communication section 43 to transmit a power supply start signal ( s 225 ). then , vehicle - side control section 44 performs the process of s 23 . the power supply start signal transmitted from vehicle - side communication section 43 in s 225 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether the power supply start signal is received within predetermined time tlimit after the supply of power in s 122 is started ( s 123 ). when the power supply start signal is not received within predetermined time tlimit ( no in s 123 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). on the other hand , when the power supply start signal is received within predetermined time tlimit ( yes in s 123 ), power supply - side control section 24 determines that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is setup up , and performs a control for causing power supply section 21 to supply power of second power value pb in the process of s 13 . the reason of determining whether the power supply start signal is received within predetermined time tlimit is the same as described in s 121 . when the request signal is received within predetermined time tlimit in s 121 ( yes in s 121 ), power supply - side control section 24 may determine that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up . in this case , the calculation of predetermined power value ptest in s 222 and the transmission of predetermined power value ptest in s 223 become unnecessary . power supply - side control section 24 performs a control such that power supplied from power supply section 21 becomes second power value pb after predetermined time ttest passes from when the request signal is received in s 122 . when the supplied power is second power value pb in s 224 , vehicle - side control section 44 determines that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up . the processes of s 225 and s 123 are unnecessary . a variation in power value supplied from power supply section 21 will be described below with reference to fig6 . fig6 is a timing diagram in embodiment 1 of the present invention . time t 0 represents the “ start ” state of fig3 , and the power value supplied from power supply section 21 is zero at this time . time t 1 represents a state where a vehicle enters chargeable area b ( yes in s 10 ), and the magnitude of the power supplied from power supply section 21 is first power value pa . since the magnitude of the power supplied from power supply section 21 is first power value pa , vehicle - side communication section 43 is started up ( yes in s 21 ) and vehicle - side communication section 43 transmits a request signal ( s 223 ). when power supply - side communication section 23 receives the request signal within predetermined time tlimit after a vehicle enters chargeable area b at time t 2 ( s 121 ), power supply - side control section 24 controls power supply section 21 so that the supplied power is set to predetermined power value ptest included in the request signal at the time point where predetermined time ttest included in the request signal passes from t 2 to t 3 ( s 122 ). when it is confirmed that the supplied power is set to predetermined power value ptest at the time point where predetermined time ttest passes after the transmission of the request signal at time t 3 ( yes in s 224 ), vehicle - side control section 44 transmits a power supply start signal ( s 225 ). power supply - side control section 24 controls power supply section 21 so that the supplied power is set to second power value pb from t 3 to t 4 ( s 123 ). when the vehicle leaves chargeable area b ( yes in s 14 ), or when power storage section 42 is fully charged , power supply - side control section 24 causes power supply section 21 to stop the supply of power ( after t 4 ). in this way , in the power supply system according to this embodiment , power supply - side control section 24 performs a control for causing power supply section 21 to supply power of first power value pa when vehicle detecting section 22 detects that electric vehicle 3 enters chargeable area b . in this state , when it is determined that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up , the system performs a control for causing power supply section 21 to supply power of second power value pb . accordingly , it is possible to accurately associate electric vehicle 3 supplied with power from power supply apparatus 2 , with electric vehicle 3 communicating with power supply apparatus 2 . additionally , since vehicle - side communication section 43 of electric vehicle 3 is started up on the basis of first power value pa smaller than second power value pb for supplying power to electric vehicle 3 , it is possible to improve safety without discharging high power to the periphery of power supply section 21 of power supply apparatus 2 . it has been stated in this embodiment that vehicle - side communication section 43 is operated with the power supplied to power receiving section 41 until a communication is set up and is operated with the power of power storage section 42 after the communication is set up . however , the present invention is not limited to this example , but vehicle - side communication section 43 may be always operated with power supplied from power storage section 42 as a power source . at this time , vehicle - side communication section 43 is started up with a signal indicating reception of power of first power value pa or larger output from power receiving section 41 as a trigger . accordingly , since vehicle - side communication section 43 can be always in a communication standby state , it is possible to shorten the time until a communication is started , compared with the case where vehicle - side communication section 43 is started up with power supplied from power receiving section 41 . it has been stated in this embodiment that in s 223 , vehicle - side control section 44 generates a request signal including predetermined time ttest and predetermined power value ptest generated in s 222 and causes vehicle - side communication section 43 to transmit the generated request signal . however , the present invention is not limited to this example , but only any one of predetermined time ttest and predetermined power value ptest may be transmitted . when only predetermined time ttest is transmitted , the processes of s 122 and s 224 of fig5 can be performed without any change by causing power supply apparatus 2 and power receiving apparatus 4 to share a predetermined value of predetermined power value ptest . when only predetermined power value ptest is transmitted , power supply - side control section 24 controls power supply section 21 on the basis of predetermined power value ptest included in the request signal just after receiving the request signal . vehicle - side control section 44 determines whether the power received by power receiving section 41 is predetermined power value ptest in s 224 , just after transmitting the request signal . it is preferable that power receiving section 41 and vehicle - side communication section 43 be installed on the bottom surface of electric vehicle 3 facing the road , and power supply section 21 and power supply - side communication section 23 be installed in the vicinity of the road surface of the road . accordingly , only by locating electric vehicle 3 on the road surface in which power supply section 21 and power supply - side communication section 23 are installed , vehicle - side communication section 43 can be easily started up . since electric vehicle 3 serves as a shielding member , it is possible to prevent a communication with a different electric vehicle . hereinafter , a power supply system for an electric vehicle according to embodiment 2 of the present invention will be described with reference to fig7 . fig7 is a diagram illustrating a communication setup process in embodiment 2 of the present invention . in fig7 , the same steps as described with reference to fig5 in embodiment 1 will be referenced by the same reference numerals and description thereof will not be repeated . embodiment 2 is different from embodiment 1 , in that it is determined whether a communication is set up on the basis of chopper frequency ftest instead of power value ptest in embodiment 1 . the chopper frequency is an on - off cycle of current when ac current is generated from a dc power source by repeating on - off of current . vehicle - side control section 44 can acquire chopper frequency ftest by measuring the output of power receiving section 41 through the use of a dedicated measuring circuit . as shown in fig7 , vehicle - side control section 44 calculates time ttest and chopper frequency ftest on the basis of a random number ( s 216 ) subsequently to s 211 as described above , and causes vehicle - side communication section 43 to transmit a request signal including time ttest and chopper frequency ftest ( s 217 ). power supply - side control section 24 performs a control for causing power supply section 21 to supply power so as to achieve chopper frequency ftest after time ttest passes , in response to the request signal received by power supply - side communication section 23 ( s 124 ). vehicle - side control section 44 determines whether the power received by power receiving section 41 in time ttest after the transmission of the request signal has chopper frequency ftest ( s 218 ). when it is determined that the power has chopper frequency ftest ( yes in s 218 ), vehicle - side control section 44 determines that a communication is set up and causes vehicle - side communication section 43 to transmit a power supply start signal ( s 215 ). as described above , the power supply system according to this embodiment determines whether a communication is set up on the basis of chopper frequency ftest . when power value ptest is measured as described in embodiment 1 , the absolute value of power is measured and an error may therefore be included in the power due to attenuation dependent on the distance . on the other hand , the measured value of chopper frequency ftest does not depend on the distance but is constant . accordingly , it is possible to reduce the measurement error in comparison with the case where power value ptest is used , by using chopper frequency ftest . it has been stated in this embodiment that vehicle - side control section 44 generates the request signal including predetermined time ttest and chopper frequency ftest generated in s 216 and causes vehicle - side communication section 43 to transmit the generated request signal in s 217 . however , the present invention is not limited to this example , but only any one of predetermined time ttest and chopper frequency ftest may be transmitted . when only predetermined time ttest is transmitted , the processes of s 124 and s 218 of fig7 can be performed without any change by causing power supply apparatus 2 and power receiving apparatus 4 to share a predetermined value of chopper frequency ftest . when only chopper frequency ftest is transmitted , power supply - side control section 24 controls power supply section 21 on the basis of chopper frequency ftest included in the request signal just after receiving the request signal . vehicle - side control section 44 determines whether the power received by power receiving section 41 has chopper frequency ftest in s 218 , just after transmitting the request signal . hereinafter , a power supply system for an electric vehicle according to embodiment 3 of the present invention will be described with reference to fig8 . fig8 is a block diagram illustrating the configuration of the power supply system for an electric vehicle according to embodiment 3 of the present invention . in fig8 , solid arrows represent the flow of signals and dotted arrows represent the flow of power . in fig8 , the same elements as described with reference to fig2 in embodiment 1 will be referenced by the same reference numerals and description thereof will not be repeated . it has been stated in embodiment 1 that vehicle - side communication section 43 is operated with power received by power receiving section 41 until a communication is set up between vehicle - side communication section 43 and power supply - side communication section 23 , and is operated with power stored in power storage section 42 as a power source after the communication is set up . on the contrary , in embodiment 3 , vehicle - side communication section 43 is always operated with power received by power receiving section 41 as a power source . accordingly , in fig8 , the supply of power from power storage section 42 to vehicle - side communication section 43 in fig2 is deleted . in embodiment 1 , vehicle - side communication section 43 is operated with power of power storage section 42 after a communication is set up . this means that the power which is first received by power receiving section 41 and then stored in power storage section 42 is used . when power is once stored in power storage section 42 and the power is used , loss is necessarily caused in the power . in embodiment 3 , since power is directly supplied from power receiving section 41 to vehicle - side communication section 43 without storing the power in power storage section 42 after a communication is set up , it is possible to operate vehicle - side communication section 43 with small power loss . in embodiment 4 , an example where multiple power supply apparatuses supply power of first power values pa different from one another will be described . hereinafter , a power supply system for an electric vehicle according to embodiment 4 of the present invention will be described with reference to fig9 and fig1 . fig9 is a diagram illustrating the configuration of the power supply system for an electric vehicle according to embodiment 4 of the present invention . fig1 is a diagram illustrating a communication setup process in embodiment 4 of the present invention . the configurations of power supply apparatus 2 and power receiving apparatus 4 in this embodiment are the same as described with reference to fig2 in embodiment 1 . in fig9 , three power supply apparatuses 2 a , 2 b , and 2 c are shown . power supply section 21 a of power supply apparatus 2 a supplies power of first power value pa 1 to electric vehicle 3 a when electric vehicle 3 a enters chargeable area b 1 . power supply section 21 b of power supply apparatus 2 b supplies power of first power value pa 2 to electric vehicle 3 b when electric vehicle 3 b enters chargeable area b 2 . power supply section 21 c of power supply apparatus 2 c supplies power of first power value pa 3 to electric vehicle 3 c when electric vehicle 3 c enters chargeable area b 3 . first power values pa 1 , pa 2 , and pa 3 are about several w to several tens w and are different from each other . the communication setup process will be described below with reference to fig1 . the left flowchart in fig1 represents a power supply - side process ( s 12 ) and the right flowchart represents a vehicle - side process ( s 22 ). after vehicle - side communication section 43 is started up in s 21 , vehicle - side control section 44 generates a request signal including the power value received by power receiving section 41 and a vehicle identification number and causes vehicle - side communication section 43 to transmit the generated request signal ( s 41 ). the request signal transmitted from vehicle - side communication section 43 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether the power value included in the request signal is substantially equal to first power value pa supplied from power supply section 21 in s 11 ( s 31 ). the term “ substantially equal ” means that the power value included in the request signal belongs to a predetermined range including first power value pa . when the power value included in the request signal is not equal to first power value pa supplied from power supply section 21 ( no in s 31 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). this is because it is thought in this case that electric vehicle 3 supplied with power from power supply apparatus 2 is not matched with electric vehicle 3 communicating with power supply apparatus 2 . when the power value included in the request signal is substantially equal to first power value pa supplied from power supply section 21 ( yes in s 31 ), power supply - side control section 24 generates a response signal including the vehicle identification number included in the request signal and causes power supply - side communication section 23 to transmit the generated response signal ( s 32 ). in this case , it is thought that the electric vehicle supplied with power from the power supply apparatus is matched with the electric vehicle communicating with the power supply apparatus . vehicle - side control section 44 determines whether vehicle - side communication section 43 receives the response signal including its own vehicle identification number before predetermined time ttest passes from when transmitting the request signal ( s 42 ). when the response signal is not received ( no in s 42 ), vehicle - side control section 44 determines that a communication with power supply apparatus 2 is not set up and returns the flow of processes to start of fig4 . when the response signal is received ( yes in s 42 ), vehicle - side control section 44 determines that a communication is set up between power supply - side communication section 23 and vehicle - side communication section 43 , and performs a control for causing vehicle - side communication section 43 to transmit a power supply start signal ( s 43 ). then , vehicle - side control section 44 performs the process of s 23 . the power supply start signal transmitted from vehicle - side communication section 43 in s 43 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether the power supply start signal is received within predetermined time tlimit after the supply of power in s 11 is started ( s 33 ). when the power supply start signal is not received within predetermined time tlimit ( no in s 33 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). when the power supply start signal is received within predetermined time tlimit ( yes in s 33 ), power supply - side control section 24 determines that a communication is set up between power supply - side communication section 23 and vehicle - side communication section 43 , moves the flow of processes to s 13 , and performs a control for causing power supply section 21 to supply power of second power value pb . as described above , in the power supply system according to this embodiment , power supply - side control section 24 performs a control for causing power supply section 21 to supply power of first power value pa when vehicle detecting section 22 detects that electric vehicle 3 enters chargeable area b . at this time , power supply sections 21 a , 21 b , and 21 c supply power of first power values pa ( pa 1 , pa 2 , and pa 3 ) different from each other . in this state , when determining that a communication is set up between power supply - side communication section 23 and vehicle - side communication section 43 , power supply - side control section 24 performs a control for causing power supply section 21 to supply power of second power value pb . accordingly , it is possible to accurately associate electric vehicle 3 supplied with power from power supply apparatus 2 , with electric vehicle 3 communicating with power supply apparatus 2 . in this embodiment , first power values pa ( pa 1 , pa 2 , and pa 3 ) may be fixedly assigned to power supply apparatuses 2 ( 2 a , 2 b , and 2 c ), respectively , or may be assigned to power supply apparatuses 2 ( 2 a , 2 b , and 2 c ) in patterns determined depending on the time for supplying power , respectively . the patterns of first power values pa differ depending on power supply apparatuses 2 . in this case , vehicle - side control section 44 generates a request signal including the pattern of first power value pa received by power receiving section 41 instead of generating the request signal including the power value received by power receiving section 41 in s 41 . when the pattern of first power value pa included in the request signal is substantially equal to the pattern of first power value pa supplied from power supply section 21 of power supply apparatus 2 in s 32 , power supply - side control section 24 generates a response signal including the vehicle identification number included in the request signal and causes power supply - side communication section 23 to transmit the generated response signal . first power values pa ( pa 1 , pa 2 , and pa 3 ) may vary in power receiving section 41 due to positional mismatch between power supply section 21 and power receiving section 41 . by causing the first power value pa to temporally vary in patterns different depending on power supply apparatuses 2 , it is possible to accurately associate therewith electric vehicle 3 communicating with power supply apparatus 2 with temporal variation of the power value , even when variation occurs in the absolute value of first power value pa received by power receiving section 41 . the disclosure of japanese patent application no . 2010 - 223759 , filed on oct . 1 , 2010 , including the specification , drawings and abstract , is incorporated herein by reference in its entirety . the present invention can be suitably used for a power supply system for an electric vehicle that supplies power from a power supply apparatus to an electric vehicle in a non - contact manner , and an electric vehicle and a power supply apparatus that are used for the system .
| 7Electricity
|
according to the present invention , it is important to add other metal to a platinum catalyst . in general , it is said that , in an alloy catalyst , the characteristics of component metal elements are developed depending on a composition of the alloy . the other metal is added to platinum in an amount of from 0 . 01 to 500 % by weight , preferably from 0 . 1 to 300 % by weight , based on the weight of platinum , to make the most of the features of platinum . although the concentration of an alloy which is held on a support can vary in the wide range of from 0 . 05 to 5 % by weight based on the weight of the support , the concentration of from 0 . 5 to 2 % by weight can be recommended . suitable supports used in the present invention include activated carbon , alumina , zirconia , titania , etc . while a particle size of the support gives less effect on the reaction , it is preferably in the range of from 0 . 1 to 100 mm . in the reduction of 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifluoroethane , the ratio of hydrogen to the starting material can vary in a wide range . usually a stoichiometric amount of hydrogen is used to remove a halogen atom . however , hydrogen may be used in much more than the stoichiometric amounts , for example , in an amount of 4 moles or more per one mole of the starting materials . the reaction is carried out at or above atmospheric pressure . the reaction temperature is in the range of from 0 ° to 450 ° c ., preferably from 50 ° to 300 ° c . it is appropriate to carry out the reaction in a gas phase or a liquid phase . in the case of the gas phase reaction , the contact time is usually from 0 . 1 to 300 sec , particularly from 1 to 30 sec . the present invention will be illustrated by means of examples hereinafter . to a platinum catalyst containing 0 . 5 % by weight of the platinum held on activated carbon , an aqueous solution of cucl 2 which amount corresponds to 1 % by weight of the activated carbon was added , followed by the dropwise addition of 0 . 2 ml of formalin . the resulting mixture was aged at a temperature of 50 ° c . for 5 hours . then water in it was distilled off under a reduced pressure and the residue was dried at 100 ° c . for a day . 18 cc of the catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 22 cc / min . and 44 cc / min ., respectively . the reaction temperature was 110 ° c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 0 . 1 % by weight of silver on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using agno 3 and the reaction was carried out . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 0 . 1 % by weight of tellurium on a platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using tecl 2 and hydrogen chloride , and the reaction was carried out . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 0 . 1 % by weight of gold on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using aucl 3 and the reaction was carried out . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of zinc on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using zncl 2 . 16 . 5 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length , and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 12 cc / min . and 44 cc / min ., respectively . the reaction temperature was 110 ° c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of chromium on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using cr ( no 3 ) 3 . 9h 2 o . 16 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length , and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 32 . 8 cc / min . and 65 . 8 cc / min ., respectively . the reaction temperature was 130 ° c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of thallium on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using tlcl 3 . 13 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 18 . 4 cc / min and 36 . 7 cc / min , respectively . the reaction temperature was 130 ° c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of molybdenum on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using ( nh 4 ) 6 mo 7 o 24 . 4h 2 o . 14 . 5 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifluoroethane which had been previously vaporized and hydrogen gas were introduced to the tube at rates of 33 . 2 cc / min . and 66 . 3 cc / min ., respectively . the reaction temperature was 200 ° c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . table 1______________________________________example no . conversion of 113a (%) selectivity of 123 (%) ______________________________________1 94 912 97 963 87 864 93 905 55 936 86 857 42 928 50 96______________________________________
| 2Chemistry; Metallurgy
|
in the description that follows , like components are marked throughout the specification and drawings with the same reference numerals , respectively . the drawing figures are not necessarily to scale . certain features of the invention may be shown exaggerated in scale or in somewhat schematic form and some details of conventional elements may not be shown in the interest of clarity and conciseness . referring now to fig1 , floating platform 10 is positioned above a field of subsea wellheads 14 . floating platform 10 is secured on location by mooring system 11 that allows the platform to be positioned at any location within watch circle 13 . attached to some of subsea wellheads 14 are subsea trees 16 . also seen on bottom 15 is distribution control and monitoring station 22 , which is coupled to subsea trees 16 by flying leads 24 . floating platform 10 is connected to subsea trees 16 through risers 12 . floating platform 10 performs distribution control and monitoring functions for subsea trees 16 through umbilicals 26 that terminate in subsea umbilical termination ( sut ) assemblies including an electrical and hydraulic subsea umbilical termination assembly 18 and a chemical subsea umbilical termination assembly 20 . the subsea umbilical termination assemblies 18 and 20 are connected to distribution control and monitoring station 22 through flying leads 28 and 30 , respectively . referring now to fig2 , an electro - hydraulic multiplex control system for controlling subsea trees 16 from floating platform 10 ( fig1 ) is seen . topside primary control station 200 , hydraulic power unit 202 , master control station 203 , blowout preventer control system 205 , and injection unit 206 are all disposed on floating platform 10 . topside primary control station ( pcs ) 200 communicates to master control station 203 through communications link 200 a . master control station 203 includes an electrical power unit ( epu ) and an uninterruptible power supply ( ups ). master control station 203 and hydraulic power unit ( hpu ) 202 are coupled to electrical - hydraulic umbilical line 26 that terminates on sea floor 15 in electrical - hydraulic umbilical termination assembly 18 , which is connected to distribution , control , and monitoring ( dcm ) station 22 through electrical - hydraulic flying lead 30 . electrical - hydraulic flying lead 30 provides electric control signals and pressurized hydraulic fluid to dcm station 22 , which comprises subsea distribution unit 22 d and control unit 22 e that includes control modules 22 c and hydraulic accumulator package 22 a . a variety of subsea control modules 22 c and accumulator packages 22 a that are alternative embodiments of the invention will occur to those of skill in the art without need for further description . control unit 22 e is connected to subsea tree 16 by electrical flying lead 24 e that carries electrical signals between the control unit and the subsea tree . distribution unit 22 d is connected to subsea tree 16 by hydraulic control flying lead 24 h that provides hydraulic communication between the distribution unit and the subsea tree . chemical injection unit 206 is connected through chemical umbilical 26 c to chemical injection umbilical termination assembly 20 on bottom 15 . chemical injection umbilical termination assembly 20 is connected to subsea distribution unit 22 d by chemical flying lead 28 . chemical injection is provided to subsea tree 16 by flying lead 24 c . also seen in fig2 is a bop ( blowout preventer ) control system 205 that resides on floating platform 10 and is connected to electrical - hydraulic umbilical 26 . various bop control systems 205 will occur to those of skill in the art , as will various chemical injection units 206 , all of which are example embodiments of the invention and require no further explanation . likewise , flying leads 28 , 30 , 24 c , 24 e , and 24 h , will be understood by those with skill in the art without further elaboration , and installation of such flying leads between the termination assemblies 18 and 20 , and subsea distribution unit 22 , will also be understood by those of skill in the arts to be accomplished in various example embodiments of the invention by using a remote operated vehicle ( rov — not shown ). likewise , the connections of flying leads 24 c , 24 e , and 24 h , between subsea distribution unit 22 and subsea tree 16 are accomplished in various example embodiments of the invention through the use of an rov . referring now to fig3 , an alternative embodiment is seen in which topside pcs 200 is connected to hydraulic power unit 202 , well control panel 204 , and chemical injection unit 206 . hydraulic power unit 202 and chemical injection unit 206 are also connected to well control panel 204 . thus , well control panel 204 controls , from floating platform 10 , subsea trees 16 on bottom 15 . such control is accomplished through electrical umbilical 26 e and hydraulic umbilical 26 h . electrical umbilical 26 e is connected to electrical subsea umbilical termination assembly 18 e and control unit 22 e , as shown . likewise , hydraulic umbilical 26 h is connected to distribution unit 22 d . well control panel 204 communicates with chemical injection unit 206 , which is connected to chemical injection umbilical 26 c for umbilical communication with chemical injection umbilical termination assembly 20 . the subsea distribution unit 22 is connected to the chemical injection umbilical termination assembly 20 via chemical injection flying lead 28 . subsea distribution unit 22 d provides hydraulic communication to subsea tree 16 through hydraulic flying lead 24 h and chemical injection communication to subsea tree 16 through flying lead 24 c . control 22 e provides electrical communication to subsea tree 16 through flying lead 24 e . although not shown in fig2 and 3 , it will be understood by those of skill in the art that multiple wells 16 are controlled , as seen in fig1 , through a single set of distribution control and monitoring components . thus , the need for a single umbilical to each subsea tree 16 is eliminated and multiple wells are controlled , monitored , or have fluids distributed to them through single umbilicals 26 e , 26 h , and 26 c . at the same time , simplified risers 12 ( fig1 ) connect in a substantially vertical manner to subsea trees 16 , allowing for insertion and removal of various tools useful in drilling , production , and work - over . such insertion and removal of tools is not possible in systems in which production occurs through conduits that communicate to a central distribution control or monitoring station on the sea - floor , due to the acute angle between the well bore and the fluid conduit . referring now to fig4 , still another embodiment of well control is seen in which direct control to each well is accomplished . in the fig4 embodiment , pcs 200 communicates with chemical injection unit 206 , hydraulic power unit 202 , and well control panel 204 . in the illustrated embodiment , a single umbilical 26 is used for all electrical , hydraulic , and chemical injection functions and is separate from riser 12 . riser 12 and umbilical 26 are connected directly to subsea trees 16 , as shown . referring now to fig5 , a system and method of installation of an umbilical 26 with riser 12 to a tree 16 is seen . tree connector 500 and guide sleeve 502 are mounted on deck 510 of floating platform 10 ( fig1 ). umbilical 26 comprises a flexible , reel - held conduit that is supported by turndown sheave 520 and spooled on reel 504 . umbilical 26 is fed from reel 504 through turndown sheave 520 , guide sleeve 502 , and tree connector 500 . from tree connector 500 , umbilical 26 is fed through the keel 525 of floating platform 10 at guide sleeve 504 . through the use of an rov , umbilical 26 is connected to subsea tree 16 . referring now to fig6 , a more detailed view of a direct control of subsea trees 16 is seen . umbilical 26 ( hydraulic or electro - hydraulic in an alternative embodiment ) is supported by umbilical tensioner 600 . umbilical 26 is attached to hose reel 612 and control / hydraulic unit 614 as will be understood by those of skill in the art . umbilical 26 passes through umbilical tensioner 600 and tree connector 500 to which surface tree 604 is attached . a flow line 606 is connected to the top of surface tree 604 and supported by flow line tensioner 608 . flow line 606 terminates in topside equipment 610 as well be understood by those of skill in the arts . referring now to fig7 , a more detailed view of a well in a drilling mode being controlled by multiplex systems of the type seen in fig2 and 3 is illustrated . a pressure control device , such as surface blowout preventer 700 , is connected to a drilling or work - over riser 710 that is , in turn , connected to a subsea blowout preventer 720 through tieback connector 722 . subsea blowout preventer 720 is mounted on wellhead 14 by tree connector 726 . surface blowout preventer 700 is mounted on floating platform 10 ( fig1 ) that can be positioned directly above wellhead 14 by moving the platform within its watch circle by the adjustment of the platform &# 39 ; s mooring system . subsea blowout preventer 720 has various controls , as are known to those of skill in the art , which are coupled to subsea distribution unit 22 by flying leads 24 . subsea distribution unit 22 includes subsea control module 22 c and subsea accumulator package 22 a . in various embodiments , subsea accumulator package 22 a includes a high - pressure accumulator , a low - pressure accumulator , and a “ return ” pressure accumulator . subsea distribution unit 22 is mounted on subsea distribution unit docking platform 728 and is connected to floating platform 10 ( fig1 ) via umbilicals 26 ( as described in reference to fig2 and 3 ). referring now to fig8 , the well of fig7 is shown in a production mode being controlled by the same multiplex system . a pressure control device , such as surface tree 800 , is connected to tubing riser 12 , which is connected to riser connecter 812 and subsea tree 16 as is understood by those of skill in the art . subsea tree 16 includes master valves 816 and annulus valves 818 for access and control of the annulus between tubing 820 of wellhead 14 and the other components of the wellhead . control and instrumentation junction plate 825 , which serves as a connector for subsea flying lead 24 . referring now to fig9 , an example embodiment is shown with the well in a work - over configuration . a pressure control device , such as surface blowout preventer or tree 900 , resides on floating platform 10 ( fig1 ), and work - over riser 910 is connected to tie - back connector 922 . subsea blowout preventer 720 is connected to subsea tree 16 via tree connector 726 and subsea flying lead umbilical 24 is connected to control and instrumentation junction plate 825 and subsea distribution unit 22 . as in the drilling mode of fig7 , floating platform 10 ( fig1 ) that can be positioned directly above wellhead 14 by moving the platform within its watch circle by the adjustment of the platform &# 39 ; s mooring system . while a specialized subsea distribution unit 22 is useful in some embodiments for production , and a specialized subsea distribution unit 22 is useful in other example embodiments for drilling or work - over configurations , the examples seen in fig7 - 9 show a common type of subsea distribution unit 22 having similar components . this allows for efficiencies in that the control and distribution functions for drilling , work - over , and production , are provided in one unit on the sea floor that can interface with a variety of equipment , such as risers 710 , 810 , and 910 , subsurface blowout preventer 720 , and subsea tree 16 . likewise , subsea flying lead umbilical 24 may include all control lines for all three operational modes or any combination of two modes . examples of the controls provided in various embodiments include : bop control , connector lock / unlock , tree control , dssv control , chemical injection , annulus monitoring , instrumentation communication , and others . referring now to fig1 , an example embodiment of the subsea tree with an exterior production master valve is seen , in which riser connector 1000 attaches to subsea tree 1002 that includes sea plug 1004 . master valves 1006 a and 1006 b control access on either side of sea plug 1004 . annulus access valves 1010 a , 1010 b , and 1010 c control access to the subsea tree annulus on each side of sea plug 1004 . in various operational situations , pressure in an annulus can increase to an unacceptable level . in such cases , it is desirable both to monitor the annulus ( e . g ., through annulus valves 1010 a - c ), and / or to provide fluids ( e . g ., drilling mud or cement ) into the annulus through valves 1010 a - c . likewise , should the annulus line attach to annulus access valve 1010 a be insufficient to carry the desired fluid into the annulus ( for example , in embodiments in which the annulus line is sized merely for monitoring ), then master valves 1006 a and 1006 b are manipulated such that a fluid ( e . g ., cement ) is pumped down through a riser ( connected to riser connecter 1000 ) and into annulus access passage 1011 . annulus access valves 1010 a - c are manipulated such that the fluid then passes through annulus access passage 1012 into annulus 1020 . from the illustrated embodiment , and the above description , it will be understood by those of skill in the art how various other annulus control and access operations are performed through manipulation of master valves 1006 a and b and annulus access valves 1010 a - c . referring now to fig1 , an alternative embodiment of a subsea tree is seen in which the valves are integral with a spool piece . rather than have master valves 1006 a and 1006 b controlling flow line access passage 1030 master valves 1106 a and 1106 b control the flow line 1101 directly . referring now to fig1 , still a further alternative embodiment is seen in which a subsea tree with a vertical annulus and production string is illustrated . flow line 1201 is controlled by production master valves 1206 a and 1206 b housed within subsea tree 1202 . also within subsea tree 1202 is cross - over valve 1250 which controls flow and a cross - over access passage 1252 that , in turn , controls communication between annulus access passage 1254 and flow line 1201 . annulus master valve 1256 is provided an annulus access passage 1254 for providing access to annulus 1020 . referring now to fig1 , a hydraulic accumulator package is seen in which accumulator 1301 and accumulator 1302 are in connection with hydraulic supply line 1304 and hydraulic return line 1306 through hydraulic control valve 1308 ( located on the bottom ). accumulators 1301 and 1302 are also in communication with another hydraulic control valve 1310 , which is located on the topside . as seen , 1308 and 1310 are two - position , single - throw valves . other valves will occur to those of ordinary skill in the art as alternative examples . supply pressure source 1312 is connected through valve 1310 to accumulator 1301 and through valve 1308 to hydraulic supply line 1304 , which is connected to the various well - control systems described above . the use of subsea accumulators as illustrated provides for multiple efficiencies in the hydraulic operations . referring now to fig1 , an example of dcm station 22 from fig1 is seen . dcm station 22 comprises hydraulic connectors 1401 , electrical connectors 1403 , accumulator bank 1405 , subsea control modules 1406 , electro - hydraulic umbilical connector 1407 , and injection umbilical connectors 1409 a - b . hydraulic connectors 1401 and electrical connectors 1403 provide termination connection points for a plurality of hydraulic and electric flying leads that are connected to individual wellheads . accumulator bank 1405 includes a plurality of hydraulic accumulators that store a predetermined volume of hydraulic fluid at a selected pressure . there may be fewer accumulators than there are connectors for flying leads because not all wells will require hydraulic circuit control with significant accumulators at the same time . subsea control modules 1406 house the various electrical circuits and control systems that connect to electrical connectors 1403 . an electrical - hydraulic umbilical connection 1407 connects to an electro - hydraulic flying lead that provides electrical signal and hydraulic communication with a floating platform . likewise , injection connectors 1409 a and 1409 b are provided for the connections needed for the chemical injection flying leads . thus , dcm station 22 , through control modules 1406 and the multiplexers and valve - selectable manifolds disposed within the station , provides electrical and fluid communication between a plurality of distributed wells and a single floating installation so as to control equipment disposed on the wellheads as well as fluid injection capabilities . the above description is given by way of example only and not intended to limit the scope of the invention as claimed . other examples will occur to those of skill in the art , which are within the scope of the invention .
| 4Fixed Constructions
|
the improvements to capacitance diaphragms are disclosed herein with respect to exemplary embodiments of a system and a method . the embodiments are disclosed for illustration of the system and the method and are not limiting except as defined in the appended claims . although the following description is directed to a particular embodiment of a capacitance diaphragm gauge , it should be understood that the disclosed system and method can be applied to other embodiments of capacitance diaphragm gauges . fig1 illustrates a front perspective view of an exemplary capacitance diaphragm gauge ( cdg ) 100 , which is installable into a pneumatic system ( not shown ) to measure the pressure within the system . in particular , the cdg is used to measure very low pressures resulting from evacuation of the pneumatic system . fig2 illustrates a rear perspective view of the cdg of fig1 which is rotated 180 ° from the view in fig1 . fig3 illustrates a cross - sectional view of the cdg taken along the line 3 - 3 in fig1 . in the illustrated embodiment , the cdg 100 comprises a hollow , generally cylindrical body structure 110 , which extends between a first end surface 112 ( fig1 ) and a second end surface 114 ( fig2 ). a first cylindrical tube 120 extends from the first end surface . the first cylindrical tube provides pneumatic access to a first inner cavity 122 ( fig3 ) of the cdg . the first cylindrical tube is connectable to the pneumatic system ( not shown ) to allow the pressure of the system to be applied to the first inner cavity . as shown in fig2 , a diaphragm 130 within the cylindrical body structure 110 separates the first inner cavity 122 from a second inner cavity 132 . the diaphragm is sealed around its peripheral edges with respect to an inner surface 134 of the cylindrical body structure so that the first inner cavity is pneumatically isolated from the second inner cavity by the diaphragm . the diaphragm is also electrically connected to the cylindrical body structure , which is electrically connected to a ground reference , as discussed below . in certain embodiments , the diaphragm 130 comprises inconel ® alloy 750 or another suitable material . in certain embodiments , the diaphragm has a thickness that can range from approximately 0 . 001 inch ( 0 . 025 mm ) to approximately 0 . 015 inch ( 0 . 38 mm ). the first inner cavity 122 also includes a baffle 136 that is positioned between the diaphragm and the first cylindrical tube 120 . the baffle reduces the deposition of contaminants onto the surface of the diaphragm that faces the first inner cavity . an electrode assembly 140 is positioned within the second inner cavity 132 between the diaphragm 130 and the second end surface 114 . the electrode assembly comprises a mounting structure 142 , which is secured to the inner surface 134 of the cylindrical body structure 110 . the mounting structure of the electrode assembly is not sealed around the peripheral edges . accordingly , both sides of the electrode assembly are at the same pressure within the second inner cavity . at least one electrode 144 is mounted on one side of the electrode assembly mounting structure . in particular , the electrode is mounted on the side of the mounting structure that faces the diaphragm . the electrode is electrically connected through the mounting structure . a conductor 146 extends from the mounting structure to a port 150 that extends through the second end surface 114 of the cylindrical body structure 110 . the port 150 includes a second cylindrical tube 152 that extends outwardly from the second end surface . the conductor extends beyond the end of the second cylindrical tube . the conductor extends through a plug 154 that hermetically seals the second cylindrical tube around the conductor . although described herein with respect to one electrode on the electrode assembly , one skilled in the art will appreciate that the electrode assembly may include more than one electrode . see , for example , u . s . pat . no . 4 , 823 , 603 to ferran et al ., which discloses two concentric fixed electrodes . u . s . pat . no . 4 , 823 , 603 is incorporated herein by reference . in the illustrated embodiment , a central portion 160 of the second end surface 114 extends outwardly to form an extended cavity portion 162 of the second inner cavity 132 . the extended portion of the second inner cavity houses a getter 164 . the getter functions in a conventional manner to remove small amounts of gas that may be released by the inner surface of the second inner cavity . a third cylindrical tube 170 extends from the second end surface 114 of the cylindrical body structure 110 . initially , the entire length of the third cylindrical tube is uniformly cylindrical . the third cylindrical tube is connected to a vacuum evacuation system ( not shown ) to evacuate the gases from the second inner cavity 132 to create a desired low pressure within the second inner cavity . after the evacuation process is completed , an end portion 172 of the third cylindrical tube is crimped as shown in fig1 to seal the second inner cavity to maintain the evacuated condition of the second inner cavity . as illustrated in the cross - sectional view of fig3 , the diaphragm 130 is a thin metallic plate that separates the first inner cavity 122 from the second inner cavity 132 . as discussed above , the second inner cavity is evacuated so that the absolute pressure within the second inner cavity is very low ( e . g ., approximately 10 − 9 torr ). the pressure within the first inner cavity is determined by the pressure px of the system ( not shown ) to which the first cylindrical tube 120 is connected . when the pressure within the first inner cavity is substantially equal to the pressure within the second inner cavity , the diaphragm will not be deflected and will maintain the substantially flat shape shown by the solid cross - hatched profile ( labeled as 130 in fig3 ). if the pressure px on the system side of the diaphragm ( i . e ., the pressure in the first inner cavity ) exceeds the pressure in the second inner cavity , the center of the diaphragm will be deflected toward the second inner cavity and the diaphragm will bow into the second inner cavity as illustrated by a first dashed cross - hatched profile 130 ′ in fig3 . if the pressure px on the system side of the diaphragm is less than the pressure in the second inner cavity , the center of the diaphragm will be deflected toward to the first inner cavity and the diaphragm will bow into the first inner cavity as illustrated by a second dashed cross - hatched profile 130 ″ in fig3 . in each case , the amount of the deflection will be determined by the pressure differential between the first and second inner cavities . the amount of deflection is also determined in part by the material properties of the diaphragm ( e . g ., the stiffness of the diaphragm ). as is well known in the art , the diaphragm 130 forms a first , movable plate of a variable capacitor . the electrode 144 on the electrode support structure 142 forms a second , fixed plate of the variable capacitor . when the diaphragm 130 is in the undeflected initial state , the capacitance of the variable capacitor has a first ( initial ) value determined by the initial distance between the diaphragm and the electrode . when the pressure px increases , the diaphragm is deflected toward the second inner cavity and thus toward the fixed electrode as illustrated by the first dashed cross - hatched profile 130 ′. the deflection reduces the distance between the diaphragm and the electrode , which increases the capacitance of the variable capacitor . when the pressure px decreases , the diaphragm is deflected toward the first inner cavity and thus away from the fixed electrode as illustrated by the second dashed cross - hatched profile 130 ″. the deflection increases the distance between the diaphragm and the electrode , which decreases the capacitance of the variable capacitor . as discussed below , the capacitance is monitored and the increases and decreases in capacitance are used to determine corresponding increases and decreases in the system pressure px . the cdg is initially calibrated by monitoring the changes in capacitance as a plurality of known values of the pressure px are applied to the cdg . fig4 illustrates a simplified exemplary system 200 for monitoring the capacitance of the variable capacitor formed by the diaphragm 130 and the fixed electrode 144 of fig3 . the system comprises a first capacitor 210 and a second capacitor 212 . the first capacitor comprises the variable capacitor formed by the diaphragm and the fixed electrode . accordingly , a first electrode ( the diaphragm ) of the first capacitor is identified with the reference number 130 , and a second electrode ( the fixed electrode ) of the first capacitor is identified with the reference number 144 . the second capacitor is a conventional fixed capacitor . the second capacitor has a first electrode 214 and a second electrode 216 . the first electrode 130 of the first capacitor 210 and the first electrode 214 of the second capacitor 212 are connected to a ground reference 218 . the second electrode 144 of the first capacitor is connected to a first terminal 224 of a center - tapped output ( secondary ) winding 222 of a transformer 220 . the second electrode 216 of the second capacitor is connected to a second terminal 226 of the output winding of the transformer . a center - tap terminal 228 of the output winding of the transformer provides a signal output on a line 230 . in the illustrated embodiment , the first electrode ( diaphragm ) 130 of the first ( variable ) capacitor 210 is mechanically and electrically connected to the cylindrical body structure 110 . the cylindrical body structure is electrically connected to the ground reference 218 when installed in the system having the pressure to be measured , thus providing the electrical connection of the diaphragm to the ground reference . the second electrode 144 of the first ( variable ) capacitor is connected to the second terminal of the transformer via the conductor 146 of fig3 . in the illustrated embodiment , the capacitance of the second capacitor 212 is fixed . the capacitance of the second ( fixed ) capacitor is selected to be approximately equal to the initial capacitance between the diaphragm 130 and the fixed electrode 144 ( e . g ., the initial capacitance of the first ( variable ) capacitor 210 ) when the system pressure px in the first inner cavity 122 is approximately equal to the pressure in the second inner cavity 132 as discussed above with respect to fig3 . the transformer 220 has an input ( primary ) winding 240 having a first terminal 242 and a second terminal 244 . the first terminal is connected to the ground reference 218 . the second terminal is connected to a high frequency signal source 246 operating , for example , at a frequency of approximately 50 kilohertz as represented by an ac waveform 248 . the electrical conductor 230 connects the center tap 228 of the output winding 222 of the transformer 220 to an input 254 of an ac pressure measuring circuit 250 via an ac coupling capacitor 252 . the ac pressure measuring circuit provides an output signal ( output ) on an output signal line 256 . in the illustrated embodiment , the ac pressure measuring circuit 250 comprises an amplifier 260 and a demodulator 262 . the signal on the center tap 228 of the output winding 222 of the transformer 220 is applied to an input 270 of the amplifier via the ac coupling capacitor 252 . the amplifier preferably has a very high input impedance so that substantially zero current flows into the input of the amplifier . an output 272 of the amplifier provides an amplified output signal to an input 274 of the demodulator . an output 276 of the demodulator provides the output signal on the output signal line 256 . the output signal is responsive to the variations in the capacitance of the first ( variable ) capacitor 210 . accordingly , the output signal varies in response to changes in the system pressure px . the signal generated by the high frequency signal source 246 is applied to the input ( primary ) winding 240 of the transformer 220 . the applied signal is coupled to the secondary winding 222 and induces a high frequency voltage across the secondary winding . the induced voltage is applied across the series connection of the first ( variable ) capacitor 210 and the second ( fixed ) capacitor 212 . the voltage across each capacitor is inversely proportional to the respective capacitance of the capacitor . since the capacitance of the second ( fixed ) capacitor is substantially constant , the voltage across the first ( variable ) capacitor varies in accordance with the deflection of the diaphragm 130 caused by differential pressure across the diaphragm between the first inner cavity 122 and the second inner cavity 132 of the cdg 100 . because one electrode of each of each capacitor is electrically connected to the ground reference 218 , a difference in the voltages across the two capacitors appears as a voltage differential across the output winding between the first input terminal 224 and the second input terminal 226 of the output winding of the transformer . the voltage differential across the output winding 222 of the transformer 220 causes a voltage to appear on the center tap 228 of the output winding that is referenced to the ground reference 218 and that is proportional to the differences in the capacitance between the first ( variable ) capacitor 210 and the second ( fixed ) capacitor 212 . the voltage on the center tap 228 of the output winding 222 of the transformer 220 is applied via the conductor 230 and the ac coupling capacitor 252 to the input 270 of the amplifier 260 . the amplifier amplifies the center tap voltage and provides the amplified signal as an output signal on the output 272 . the output signal from the amplifier is a time - varying signal at the frequency of the signal source 246 with an amplitude that is proportional to the difference in capacitance of the first ( variable ) capacitor 210 , which varies in response to changes in the pressure differential across the diaphragm 130 . accordingly , the amplitude of the time - varying signal output of the amplifier changes in response to changes in the pressure differential across the diaphragm . the time - varying signal generated by the amplifier 260 is demodulated by the demodulator 262 in a conventional manner to provide the output signal on the output signal line 256 having a dc voltage level corresponding to the pressure differential across the diaphragm 130 . the ac pressure measuring circuit is calibrated to equate the variations in the ac voltage to the absolute pressure ( px ) applied to the diaphragm . in one embodiment , the demodulator comprises a synchronous demodulator known to the art . fig5 illustrates an improved pressure monitoring system 400 that includes circuitry that operates to compensate for the effects of differing ambient atmospheric pressures on the measured output signal from the cdg 100 . the improved measurement system of fig5 includes elements that are described above with respect to the system illustrated in fig4 . accordingly , like elements are identified with reference numbers corresponding to the reference numbers in fig4 . the elements of the improved pressure monitoring system in fig5 up to and including the ac pressure measuring circuit 250 are similar to the corresponding components in the previously described pressure monitoring system 200 of fig4 and are not described again in detail . in addition to the elements described above in fig4 , the improved pressure monitoring system of fig5 includes an analog - to - digital ( nd ) converter 410 . an input 412 of the a / d converter receives an analog value that represents the measured absolute pressure from the ac pressure measuring circuit . the a / d converter generates a digital value on an output 414 . the digital value also represents the measured absolute pressure , which may differ from the actual absolute pressure ( px ) because of the effects of the ambient atmospheric pressure on the accuracy of the cdg 100 . the digital value on the output 414 of the a / d converter 410 is provided to a first input 422 of a digital processing system 420 . the digital processing system has a second input 424 , and generates a calibrated absolute pressure signal on an output 426 . in one embodiment , the digital processing system 420 comprises a microcontroller . in other embodiments , the digital processing system comprises an application specific integrated circuit ( asic ) configured to perform the function described below . in the illustrated embodiment , the digital processing system may also control the operation of the a / d converter 410 to determine when the a / d converter samples the analog signal and generates the digital value . it should be understood that the a / d converter may be incorporated into the digital processing system . in such embodiments , the analog output from the ac pressure measuring system 250 is provided to an analog input port of the digital processing system . the second input 424 of the digital processing system 420 is connected to receive an output signal from an independent atmospheric pressure sensor 430 via a set of signal lines 432 . as illustrated in fig6 , the independent atmospheric pressure sensor is mounted in a common enclosure 440 that further encloses the cdg 100 such the independent atmospheric pressure sensor is subjected to the ambient atmospheric pressure that surrounds the body of the cdg . accordingly , the output of the independent atmospheric pressure sensor is a signal that represents the ambient atmospheric pressure . the independent atmospheric pressure sensor is “ independent ” because it is not affected by the absolute pressure ( px ) applied to the input of the cdg . it should be understood that the common enclosure may be a system enclosure into which the cdg is installed at a user site or the enclosure may be an enclosure into which the cdg is installed when the cdg is manufactured . in fig6 , the independent atmospheric pressure sensor is shown as being attached to the body of the cdg ; however , the independent atmospheric pressure sensor may be installed elsewhere in the common enclosure as long as the atmospheric pressure sensor is subjected to the same pressure as the cdg . the output of the independent atmospheric pressure sensor 430 may be an analog signal that represents the ambient atmospheric pressure or a digital signal that represents the ambient atmospheric pressure . in the former case , the digital processing system 420 includes an analog interface and performs integral analog - to - digital ( a / d ) conversion to convert the analog signal to a digital value . in the illustrated embodiment shown in fig5 , the independent atmospheric pressure sensor produces a digital value that represents the ambient atmospheric pressure . atmospheric pressure sensors are available from many sources . one such atmospheric sensor is a mpl115a1 miniature spi digital barometer from freescale semiconductor , inc ., that provides the digital value on a serial peripheral interface ( spi ) port , which is described in appendix a , filed herewith . the atmospheric sensor may also be a mpl115a2 miniature i 2 c digital barometer from freescale semiconductor , inc ., that provides the digital value on an inter - integrated circuit ( i 2 c ) port , which is described in appendix b , filed herewith . the contents of appendix a and appendix b are incorporated by reference herein . the spi port and the i 2 c port are both standard serial interface ports , and the sensor is selected , for example , in accordance with the type of port available on the digital processing system . fig5 illustrates an embodiment that includes the mpl115a2 i 2 c digital barometer integrated circuit . for this circuit , the serial interface includes three signal lines 432 comprising a serial clock ( scl ) line , a serial data ( sda ) line and a reset ( rst ) line . power , ground and other interconnection lines to and from the integrated circuit are not shown in fig5 and 6 . the operation of the i 2 c interface is well known . one device ( e . g ., the digital processing system ) operates as a master device to control data transfers between the devices . a second device ( e . g ., the atmospheric sensor ) operates as a slave device and sends data to the master device in response to commands from the master device . other pressure sensors 430 from other sources and with other interface ports may also be used . for example , a pressure sensor that continuously provides an analog or digital value to the second input of the digital processing system may also be used such that the control signals from the digital processing system to the pressure sensor may not be needed . the digital processing system 420 processes the raw digital data from the independent atmospheric pressure sensor 430 to generate an absolute value for the ambient atmospheric pressure surrounding the cdg 100 . in particular , as described in more detail in the technical data sheets for the mpl115a1 and the mpl115a2 available from freescale semiconductor , inc ., and included herewith as appendix a and appendix b , respectively , the digital processing system first accesses the atmospheric pressure sensor to input a plurality of constants that are stored in the atmospheric pressure sensor when the pressure sensor is manufactured and initially calibrated . the constants are unique for each particular sensor . the digital processing system then accesses the atmospheric pressure sensor to access a first set of data that represents the pressure sensed by the atmospheric pressure sensor and to access a second set of data that represents the temperature of the atmospheric pressure sensor . the digital processing system then performs a compensation algorithm ( described below ) specified in the technical data sheets to determine the actual ( compensated ) atmospheric pressure . it should be understood that other pressure sensors from other manufacturers may provide a digital output signal or an analog output signal that represents the actual absolute pressure . when such sensors are used , the digital processing system does not have to perform the compensation algorithm specified for the pressure sensors from freescale semiconductor , inc . the digital processing system 420 is responsive to the digital signal from the atmospheric pressure sensor 430 to generate a pressure correction factor to apply to the digital output from the a / d converter 410 . the pressure correction factor represents the effect of the ambient atmospheric pressure on the absolute pressure readings caused by the absolute input pressure ( px ). in one embodiment of the digital processing system , the effects of the ambient atmospheric pressure are stored in a lookup table 450 as pressure calibration factors . the calibration factors are indexed within the lookup table by the values of the ambient atmospheric pressure . in this embodiment , the digital processing system uses the digital value from the atmospheric pressure sensor to access the lookup table to select the calibration factor corresponding to the atmospheric pressure . the digital processing system applies the calibration factor as a correction to the measured pressure represented by the output of the a / d converter . in another embodiment , the digital processing system applies the digital value from the atmospheric pressure sensor as an input to a calibration equation that calculates the effect of the measured ambient atmospheric pressure on the measured absolute pressure ( px ). the output of the equation is a calibration factor that the digital processing system applies as a correction to the measured absolute pressure to offset the effect of the ambient atmospheric pressure . the corrected absolute pressure is provided to the user as an output from the digital processing circuit . the values for the lookup table for the first embodiment or the coefficients for the calibration equation in the second embodiment are determined during a calibration procedure that is performed on the cdg 100 by applying varying ambient atmospheric pressures to the body 110 of the cdg while maintaining the absolute input pressure ( px ) applied to the input of the cdg ( first cylindrical tube 120 in fig6 ) at a known value . as the ambient atmospheric pressure is varied , the effects of the changes in atmospheric pressure on the measured values of the absolute pressure are monitored . in particular , the difference between the known absolute pressure and the measured absolute pressure are determined for each applied value of atmospheric pressure . in the first embodiment , the differences are stored as entries in the lookup table 450 using the values of the atmospheric pressure as the indices for the stored values . in the second embodiment , the effects on the measured values determined during the calibration process are used to generate a calibration equation . the calibration equation is generated by applying curve - fitting or other known techniques to the data points to produce an equation that defines the pressure differences ( calibration factors ) as a function of the atmospheric pressure values . the operation of the improved pressure monitoring system 400 of fig5 is illustrated by a flowchart 500 in fig7 , which is implemented in the digital processing system 420 of fig5 . the steps of the flow chart may be executed periodically or continuously in accordance with the requirements of the system . as discussed above , the digital processing system may be a microcontroller ( or microprocessor ), in which case , some or all of the steps of the flow chart are implemented as software instructions . the digital processing system may also be an application specific integrated circuit ( asic ), in which case , some or all of the steps are implemented by logic circuits . it should be understood that the steps may also be implemented by a combination of hardware circuits and software instructions . the flow chart 500 in fig7 begins with a step 510 in which the analog output of the ac pressure measuring circuit 250 is converted to a digital input value by the a / d converter 410 . in a step 512 , the digital value from the a / d converter is received by the digital processing system 420 and is stored as a measured cdg pressure value . as discussed above , in certain embodiments where the a / d converter is part of the digital processing system , the digital processing system receives the analog value directly from the ac pressure measuring circuit and converts the analog value to a digital value within the digital processing system . the digital processing system 420 also generates appropriate command signals to the atmospheric pressure sensor 430 via the i 2 c reset ( rst ), clock ( scl ) and data ( sda ) lines 432 to cause the atmospheric pressure sensor to send data to the input 424 of the digital processing system . for the embodiment wherein the atmospheric pressure sensor is implemented by the mpl115a2 miniature i 2 c digital barometer from freescale semiconductor , inc ., or the mpl115a1 spi miniature digital barometer from freescale semiconductor , inc ., the digital processing system accesses the atmospheric pressure sensor at least one time to receive and store the coefficients that are used to convert the raw digital data from the atmospheric pressure sensor to compensated ( actual ) pressure . the first step for accessing the data from the atmospheric pressure sensor is thus shown as a decision step 520 in which the digital processing system determines whether the coefficients have already been stored . if the coefficients are not already stored , the digital processing system performs a step 522 in which it executes commands to cause the atmospheric pressure sensor to transfer the coefficient data and then performs a step 524 in which the digital processing system stores the coefficient data . the digital processing system then proceeds to a step 530 . if the coefficients are already stored , the digital processing system proceeds to the step 530 directly from the decision step 520 . in the step 530 , the digital processing system 420 generates the appropriate command signals on the i 2 c lines 432 to cause the atmospheric pressure sensor 430 to generate data representing the measured ambient temperature and pressure surrounding the cdg 100 . in a step 532 , the digital processing system stores the temperature and pressure data as uncompensated data . in a step 534 , the digital processing system converts the uncompensated temperature and pressure data to compensated pressure data , which is stored as a compensated atmospheric pressure value . for example , the technical data sheet from freescale semiconductor , inc ., for the illustrated atmospheric pressure sensor defines the following compensation equation : p comp = a 0 +( b 1 +( c 12 × t adc ))× p adc )+( b 2 × t adc ) a 0 is a pressure offset coefficient ; b 1 is pressure sensitivity coefficient ; b 2 is a temperature coefficient of offset ; c 12 is a temperature coefficient of sensitivity ; p adc is the pressure value from the pressure sensor ; and t adc is the temperature value from the pressure sensor . other pressure sensors may be used that provide an output that is already compensated for pressure and temperature . when such pressure sensors are used , the step 534 is not required . in a step 540 , the digital processing system 420 generates a pressure differential value ( calibration factor ) that represents the effect of the atmospheric pressure on the pressure measured by the cdg 100 . the pressure differential value may be obtained from a lookup table that is indexed by the compensated atmospheric pressure value stored in the step 534 . for example , during a calibration process , the lookup table may be populated by pressure differential values that are determined by applying a fixed absolute input pressure ( px ) to the input of the cdg and by varying the ambient atmospheric pressure while monitoring the digital values representing the output of the ac pressure measuring circuit 250 . the pressure differential values correspond to the differences between the monitored digital values and the measured digital values at each value of the variable ambient atmospheric pressure . if the pressure differential value differs significantly with changes in temperature , the measured temperature value from the ambient atmospheric pressure sensor may also be provided as a second index to the lookup table so that the pressure differential value is a selected by a combination of the measured ambient atmospheric pressure and the measured temperature . as an alternative to a lookup table , the pressure differential value may also be determined by a calculation wherein the compensated ambient atmospheric pressure value is an input variable to an equation that is generated to represent the relationship between the value of the ambient atmospheric pressure and the pressure differential values . the generation of a parametric equation to represent the relationship between the compensated ambient atmospheric pressure value and the pressure differential values ( calibration factors ). the generation of such equations using curve fitting and other techniques is well known in the art . as with the lookup table embodiment , the equation can be generated with the compensated ambient atmospheric pressure as the only input variable and can also be generated with the measured temperature from the pressure sensor as a second input variable . in a step 542 , the digital processing system 420 applies the pressure differential value from the lookup table or from the calculation to the measured cdg absolute pressure value stored in the step 512 to increase or decrease the measured cdg absolute pressure value to generate a calibrated cdg absolute pressure value . the calibrated cdg absolute pressure value corresponds to the actual absolute pressure ( px ) applied to the cdg 100 via the first cylindrical tube 120 in fig6 . the digital processing system outputs the calibrated actual pressure value to the user ( e . g ., the surrounding system for which the pressure is being measured ) via the output 426 . after calculating and outputting the actual pressure value , the digital processing system 420 returns to the step 510 to again input the analog input signal and to repeat the foregoing steps . the steps may be repeated continuously or the steps may be repeated on a periodic basis by having the digital processing system wait for a predetermined duration before inputting the analog input signal . the waiting is represented by an optional delay step 550 ; however , it should be understood that the digital processing system may be controlled by a timer set at a particular repetition rate ( e . g ., once per second , once per millisecond , or the like ) that awakens the digital processing system or that generates an interrupt to trigger the digital processing system to exit from a wait state . the control of the timing of periodic measurement processes is well known in the art and can be accomplished in many ways . as various changes could be made in the above constructions without departing from the scope of the invention , it is intended that all the matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense .
| 6Physics
|
with reference to fig1 , an embodiment of a laryngoscope handle 100 for a laryngoscope 110 will be described . in the embodiment shown , an illumination device in the form of a fiber optic laryngoscope blade 120 is connected to the laryngoscope handle 100 . the laryngoscope blade 120 ( e . g ., curved macintosh blade , straight miller / robertshaw blade , or other type of blade ) carries fiber optics ( e . g ., fiber optic light tube ) 130 . the fiber optic light tube 130 is optically coupled to a connection section 140 , where the laryngoscope blade 120 connects to the laryngoscope handle 100 . in alternative embodiments , other types of illumination devices other than a laryngoscope blade 120 are used and other illumination sources other than a laryngoscope handle 100 are used . in this embodiment , the laryngoscope handle 100 has a curved , ergonomic laryngoscope handle body with a series of finger grip indents 150 on an inner surface 160 . the laryngoscope handle 100 has a connection section 170 at an upper end 180 of an upper portion 190 with connection mechanism 200 for mechanically and optically coupling the connection section 140 of the laryngoscope blade 120 and the connection section 170 of the laryngoscope handle 100 . the connection mechanism 200 may include a switch therein ( e . g ., an electrically conductive ball contact in connection portion ( s ) 140 and / or 170 that contact each other to close circuit ) that is automatically operated when the connection sections 140 , 170 are connected for actuating an illumination source system 190 discussed below . for example , the illumination source system 190 is automatically placed in communication with one or more power sources 250 when the laryngoscope blade 120 is assembled or clicked together with the upper part of the laryngoscope handle 100 , and are automatically turned off when the laryngoscope blade 120 is released or disassembled from the upper part of the laryngoscope handle 100 for storage when not in use , for example when the laryngoscope blade 120 is unlocked / unlatched from the upper part of the laryngoscope handle 100 . alternatively or additionally , the laryngoscope handle 100 may include a manual switch for turning the illumination source system 190 on , off , and / or otherwise controlling the illumination source system 190 ( e . g ., switching to at least one of an “ off ” condition , an “ on ” condition in which both uv and white light is emitted , a uv light only condition , and a white light only condition ). adjacent to the connection section is an illumination source system 190 . the illumination source system 190 includes one or more white light illumination sources 200 , preferably one or more white light led ( s ). in alternative embodiments , the one or more white light illumination sources 200 include , but are not limited to , a white halogen light and / or a white incandescent light . the illumination source system 190 also includes one or more ultra violet ( uv ) light illumination sources 210 , preferably one or more uv led ( s ). the one or more uv light illumination sources 210 emit long wave uva radiation and little visible light . the one or more uv light illumination sources 210 emit electromagnetic radiation that is in the soft , near ultraviolet range . the one or more uv light illumination sources 210 prompt the visible effects of fluorescence and phosphorescence with respect to the patient &# 39 ; s vocal cords and the glottis , which is the space between the vocal cords , during laryngoscopy . in one embodiment , the one or more uv light illumination sources 210 emit electromagnetic radiation including a wavelength in the range of 315 to 400 nm , without emitting substantial electromagnetic radiation including a wavelength outside of the range of 300 to 450 nm . in another embodiment , the one or more uv light illumination sources 210 emit electromagnetic radiation including a wavelength of 385 - 395 nm . the illumination source system 190 may include a chamber 220 with mirrored wall ( s ) 230 . the chamber 220 may be cone - shaped or have another configuration to enhance the reflection and emission of light from the illumination source system 190 . the illumination sources 200 , 210 may be connected to a printed circuit board ( pcb ) 240 , which is electrically coupled to and powered by one or more power sources 250 ( e . g ., one or more rechargeable batteries , one or more disposable batteries , one or more dry cell batteries such as one or more lithium ion batteries ). an exemplary method of performing a medical procedure , and , in particular , an endotracheal intubation using the laryngoscope handle 100 and laryngoscope blade 120 of the laryngoscope is described below . the illumination source system 190 of the laryngoscope handle 100 is actuated ( e . g ., when the laryngoscope 110 is clicked together / assembled ). this causes the one or more white light illumination sources 200 and the one or more uv light illumination sources 210 in the laryngoscope handle 100 to emit , respectively , white and uv light , which are mixed in the chamber 220 of the handle 100 , resulting in a mixed , combination of white and uv light , which is transmitted to the fiber optic light tube 130 . at a distal end of the fiber optic light tube 130 , the combination of white and uv light is emitted distally from a distal end portion of the laryngoscope blade 120 . the laryngoscope blade 120 is inserted into a patient &# 39 ; s mouth and behind the patient &# 39 ; s tongue and mandible . by gripping the handle 100 with one &# 39 ; s hand , the tongue and mandible are lifted for viewing the vocal cords adjacent the larynx and to aid in the insertion of an endotracheal tube past the vocal cords . the black light of the combination black and uv light emitted from the fiber optic light tube 130 prompts the visible effects of fluorescence and phosphorescence with respect to the patient &# 39 ; s vocal cords and the glottis , making the patient &# 39 ; s vocal cords at the glottis visible either directly by the eyes of the medical provider or via a scope of the endotracheal tube ( or via an electronic display ). the black light causes vocal cords or vocal folds to naturally fluoresce , clearly identifying pathway to the trachea . the white light in combination with uv light provides general illumination ( e . g ., of the interior of the mouth and back of the patient &# 39 ; s throat ). this brightness of the white light is bright enough to provide general illumination ( e . g ., of the interior of the mouth and back of the patient &# 39 ; s throat ) while not being so bright as to overtake the effects of the uv light . the mixed uv and white light combination lighting produces “ near - 3d optimization of viewing area , causing airway structures to stand out via precision - shadowing effect . the uv and white light wavelength mix dramatically improves discrimination of tissues , field of view , reduces glare and creates better depth perception in the airway . the endotracheal tube is inserted into the patient &# 39 ; s mouth , between the patient &# 39 ; s visible vocal cords into the larynx , and then into the trachea of the patient in a usual manner . a stylet of the endotracheal tube may be used to shape the scope / endotracheal tube to the individual anatomy / pathology of the patient . in an embodiment of the laryngoscope handle 100 including a manual switch / controller , the respective light sources 200 , 210 may be individually / selectively actuated or deactivated ( e . g ., to cause only uv light to be emitted , only white light to be emitted , no light to be emitted , and / or a mixed , combined uv and white light to be emitted ) so that optimal viewing of the vocal cords occurs . the medical provider may prefer to use the uv light condition and / or the white light condition , depending on external lighting conditions , the individual anatomy / pathology of the patient , the patient &# 39 ; s condition , and other factors . in an alternative exemplary method , which is described in u . s . patent application u . s . patent application no . 13 / 328 , 499 , which is incorporated by reference herein , the laryngoscope 110 is used to assist in removal of an obstruction or foreign object from a patient &# 39 ; s trachea . the above figures may depict exemplary configurations for the invention , which is done to aid in understanding the features and functionality that can be included in the invention . the invention is not restricted to the illustrated architectures or configurations , but can be implemented using a variety of alternative architectures and configurations . additionally , although the invention is described above in terms of various exemplary embodiments and implementations , it should be understood that the various features and functionality described in one or more of the individual embodiments with which they are described , but instead can be applied , alone or in some combination , to one or more of the other embodiments of the invention , whether or not such embodiments are described and whether or not such features are presented as being a part of a described embodiment . thus the breadth and scope of the present invention , especially in the following claims , should not be limited by any of the above - described exemplary embodiments . terms and phrases used in this document , and variations thereof , unless otherwise expressly stated , should be construed as open ended as opposed to limiting . as examples of the foregoing : the term “ including ” should be read as meaning “ including , without limitation ” or the like ; the term “ example ” is used to provide exemplary instances of the item in discussion , not an exhaustive or limiting list thereof ; and adjectives such as “ conventional ,” “ traditional ,” “ standard ,” “ known ” and terms of similar meaning should not be construed as limiting the item described to a given time period or to an item available as of a given time , but instead should be read to encompass conventional , traditional , normal , or standard technologies that may be available or known now or at any time in the future . likewise , a group of items linked with the conjunction “ and ” should not be read as requiring that each and every one of those items e present in the grouping , but rather should be read as “ and / or ” unless expressly stated otherwise . similarly , a group of items linked with the conjunction “ or ” should not be read as requiring mutual exclusivity among that group , but rather should also be read as “ and / or ” unless expressly stated otherwise . furthermore , although items , elements or components of the disclosure may be described or claimed in the singular , the plural is contemplated to be within the scope thereof unless limitation to the singular is explicitly stated . the presence of broadening words and phrases such as “ one or more ,” “ at least ,” “ but not limited to ” or other like phrases in some instances shall not be read to mean that the narrower case is intended or required in instances where such broadening phrases may be absent .
| 0Human Necessities
|
compounds of the invention , including salts thereof , can be prepared using known organic synthesis techniques and can be synthesized according to any of numerous possible synthetic routes . the reactions for preparing compounds of the invention can be carried out in suitable solvents , which can be readily selected by one of skill in the art of organic synthesis . suitable solvents can be substantially non - reactive with the starting materials ( reactants ), the intermediates , or products at the temperatures at which the reactions are carried out , e . g ., temperatures that can range from the solvent &# 39 ; s freezing temperature to the solvent &# 39 ; s boiling temperature . a given reaction can be carried out in one solvent or a mixture of more than one solvent . depending on the particular reaction step , suitable solvents for a particular reaction step can be selected by the skilled artisan . preparation of compounds of the invention can involve the protection and deprotection of various chemical groups . the need for protection and deprotection , and the selection of appropriate protecting groups , can be readily determined by one skilled in the art . the chemistry of protecting groups can be found , for example , in t . w . greene and p . g . m . wuts , protective groups in organic synthesis , 3 rd ed ., wiley & amp ; sons , inc ., new york ( 1999 ), which is incorporated herein by reference in its entirety . reactions can be monitored according to any suitable method known in the art . for example , product formation can be monitored by spectroscopic means , such as nuclear magnetic resonance spectroscopy ( e . g ., 1 h or 13 c ), infrared spectroscopy , spectrophotometry ( e . g ., uv - visible ), mass spectrometry , or by chromatographic methods such as high - performance liquid chromatography ( hplc ) or thin layer chromatography ( tlc ). compounds of formula i and intermediates thereof may be prepared according to the following reaction schemes and accompanying discussion . unless otherwise indicated , r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , r 10 , r 10b , r 11 , r 11a , t 1 , t 2 , t 3 , t 4 , q 1 , and x 1 , and structural formula i in the reaction schemes and discussion that follow are as defined above . in general , the compounds of this invention may be made by processes which include processes analogous to those known in the chemical arts , particularly in light of the description provided herein . certain processes for the manufacture of the compounds of this invention and intermediates thereof are provided as further features of the invention and are illustrated by the following reaction schemes . other processes are described in the experimental section . the schemes and examples provided herein ( including the corresponding description ) are for illustration only , and not intended to limit the scope of the present invention . scheme 1 refers to preparation of compounds of formula 1 - 5 ( i . e ., compounds of formula i wherein l 1 is o ). referring to scheme 1 , compounds of formula 1 - 1 [ where lg 1 is a suitable leaving group such as halo ( e . g ., f , cl or br )] and 1 - 2 [ wherein z 1 can be , e . g ., halogen ( e . g ., br or i ) or trifluoromethanesulfonate ( triflate )] are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 1 - 3 can be prepared by coupling a compound of formula 1 - 1 with a compound of formula 1 - 2 under suitable conditions . the coupling can be accomplished , for example , by heating a mixture of a compound of formula 1 - 1 with a compound of formula 1 - 2 in the presence of a base , such as cs 2 co 3 , in an appropriate solvent , such as dimethyl sulfoxide ( dmso ). alternatively , a metal - catalyzed ( such as using a palladium or copper catalyst ) coupling may be employed to accomplish the aforesaid coupling . in this variant of the coupling , a mixture of a compound of formula 1 - 1 and a compound of formula 1 - 2 can be heated in the presence of a base ( such as cs 2 co 3 ), a metal catalyst [ such as a palladium catalyst , e . g ., pd ( oac ) 2 ], and a ligand [ such as 1 , 1 ′- binaphthalene - 2 , 2 ′- diylbis ( diphenylphosphane ) ( binap )] in an appropriate solvent , such as 1 , 4 - dioxane . a compound of formula 1 - 3 can subsequently be reacted with a compound of formula q 1 - z 2 [ wherein z 2 can be br ; b ( oh ) 2 ; b ( or ) 2 wherein each r is independently h or c 1 - 6 alkyl , or wherein the two ( or ) groups , together with the b atom to which they are attached , form a 5 - to 10 - membered heterocycloalkyl optionally substituted with one or more c 1 - 6 alkyl ; a trialkyltin moiety ; or the like ] by a metal - catalyzed ( such as using a palladium catalyst ) coupling reaction to obtain a compound of formula i . compounds of formula q 1 - z 2 are commercially available or can be made by methods described herein or by methods analogous to those described in the chemical art . alternatively , a compound of formula 1 - 3 can be converted to a compound of formula 1 - 4 ( wherein z 2 is defined as above ). for example , a compound of formula 1 - 3 ( wherein z 1 is halogen such as br or i ) can be converted to a compound of formula 1 - 4 [ wherein z 2 is b ( oh ) 2 ; b ( or ) 2 wherein each r is independently h or c 1 - 6 alkyl , or wherein the two ( or ) groups , together with the b atom to which they are attached , form a 5 - to 10 - membered heterocycloalkyl or heteroaryl optionally substituted with one or more c 1 - 6 alkyl ] by methods described herein or other methods well known to those skilled in the art . in this example , this reaction can be accomplished , for example , by reacting a compound of formula 1 - 3 ( wherein z 1 is halogen such as br ) with 4 , 4 , 4 ′, 4 ′, 5 , 5 , 5 ′, 5 ′- octamethyl - 2 , 2 ′- bi - 1 , 3 , 2 - dioxaborolane , a suitable base ( such as potassium acetate ), and a palladium catalyst { such as [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii )} in a suitable solvent such as 1 , 4 - dioxane . in another example , a compound of formula 1 - 3 ( wherein z 1 is halogen such as br ) can be converted to a compound of formula 1 - 4 ( wherein z 2 is a trialkyltin moiety ) by alternate methods described herein or other methods well known to those skilled in the art . in this example , this reaction can be accomplished , for example , by reacting a compound of formula 1 - 3 ( wherein z 1 is halogen such as br ) with a hexaalkyldistannane ( such as hexamethyldistannane ) in the presence of a palladium catalyst [ such as tetrakis ( triphenylphosphine ) palladium ( 0 )] in a suitable solvent such as 1 , 4 - dioxane . a compound of formula 1 - 4 can then be reacted with a compound of formula q 1 - z 1 ( wherein z 1 is defined as above ) by a metal - catalyzed ( such as using a palladium catalyst ) coupling reaction to obtain a compound of formula i . compounds of formula q 1 - z 1 are commercially available or can be made by methods described herein or by methods analogous to those described in the chemical art . the type of reaction employed depends on the selection of z 1 and z 2 . for example , when z 1 is halogen or triflate and the q 1 - z 2 reagent is a boronic acid or boronic ester , a suzuki reaction may be used [ a . suzuki , j . organomet . chem . 1999 , 576 , 147 - 168 ; n . miyaura and a . suzuki , chem . rev . 1995 , 95 , 2457 - 2483 ; a . f . littke et al ., j . am . chem . soc . 2000 , 122 , 4020 - 4028 ]. in some specific embodiments , an aromatic iodide , bromide , or triflate of formula 1 - 3 is combined with an aryl or heteroaryl boronic acid or boronic ester of formula q 1 - z 2 and a suitable base , such as potassium phosphate , in a suitable organic solvent such as tetrahydrofuran ( thf ). a palladium catalyst is added , such as s - phos precatalyst { also known as chloro ( 2 - dicyclohexylphosphino - 2 ′, 6 ′- dimethoxy - 1 , 1 ′- biphenyl )[ 2 -( 2 - aminoethylphenyl )] palladium ( ii )- tert - butyl methyl ether adduct }, and the reaction mixture is heated . alternatively , when z 1 is halogen or triflate and z 2 is trialkyltin , a stille coupling may be employed [ v . farina et al ., organic reactions 1997 , 50 , 1 - 652 ]. more specifically , a compound of formula 1 - 3 ( wherein z 1 is br , i , or triflate ) may be combined with a compound of formula q 1 - z 2 ( wherein the q 1 - z 2 compound is a q 1 - stannane compound ) in the presence of a palladium catalyst , such as dichlorobis ( triphenylphosphine ) palladium ( ii ), in a suitable organic solvent such as toluene , and the reaction may be heated . where z 1 is br , i , or triflate and z 2 is br or i , a negishi coupling may be used [ e . erdik , tetrahedron 1992 , 48 , 9577 - 9648 ]. more specifically , a compound of formula 1 - 3 ( wherein z 1 is br , i , or triflate ) may be transmetallated by treatment with 1 to 1 . 1 equivalents of an alkyllithium reagent followed by a solution of 1 . 2 to 1 . 4 equivalents of zinc chloride in an appropriate solvent such as thf at a temperature ranging from − 80 ° c . to − 65 ° c . after warming to a temperature between 10 ° c . and 30 ° c ., the reaction mixture may be treated with a compound of formula q 1 - z 2 ( wherein z 2 is br or i ), and heated at 50 ° c . to 70 ° c . with addition of a catalyst such as tetrakis ( triphenylphosphine ) palladium ( 0 ). the reaction may be carried out for times ranging from 1 to 24 hours to yield the compound of formula 1 - 5 . similar to the chemical transformations described in scheme 1 , compounds of formula i can be prepared starting from compounds of formula 1 ′- 3 according to scheme 1 ′ scheme 2 also refers to preparation of compounds of formula 1 - 5 . referring to scheme 2 , compounds of formula 1 - 5 may be prepared utilizing analogous chemical transformations to those described in scheme 1 , but with a different ordering of steps . compounds of formula 2 - 1 [ wherein pg 1 is a suitable protecting group such as methyl , benzyl , tetrahydropyranyl ( thp ), or tert - butyldimethyl ( tbs )] are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 2 - 1 can be converted to a compound of formula 2 - 2 either directly or after conversion to a compound of formula 2 - 3 using methods analogous to those described in scheme 1 . a compound of formula 2 - 2 may then be deprotected , using appropriate conditions depending on the selection of the pg 1 group , to obtain a compound of formula 2 - 4 , which in turn can be coupled with a compound of formula 1 - 1 in scheme 1 to afford a compound of formula 1 - 5 . the coupling conditions employed may be analogous to those described for the preparation of a compound of formula 1 - 3 in scheme 1 . scheme 3 refers to a preparation of a compound of formula 3 - 5 wherein a 1 is a moiety of formula a 1a or a suitable protecting group pg 2 . ( e . g ., methyl , benzyl , thp , or tbs ). referring to scheme 3 , compounds of formula 3 - 1 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 3 - 2 can be prepared by reacting an arylketone of formula 3 - 1 with an alkyl nitrite ( e . g ., isoamyl nitrite ) in the presence of an acid ( such as hydrochloric acid ). the resulting oxime of formula 3 - 2 can be converted to the diketone of formula 3 - 3 upon treatment with formaldehyde ( or its equivalent such as metaformaldehyde or polyformaldehyde ) in the presence of an acid ( such as an aqueous hydrochloric acid solution ). diketones of formula 3 - 3 can be reacted with glycinamide or a salt thereof ( such as an acetic acid salt ) in the presence of a base such as sodium hydroxide to obtain pyrazinones of formula 3 - 4 . alkylation of the pyrazinone nitrogen to obtain a compound of formula 3 - 5 can be achieved by treatment of a compound of formula 3 - 4 with a base [ such as lithium diisopropylamide ( lda ), lithium bis ( trimethylsilyl ) amide ( lhmds ), and the like ] and a compound of the formula r 11a — z 3 [ wherein z 3 is an acceptable leaving group such as cl , br , i , methanesulfonate ( mesylate ), and the like and wherein r 11a is for example c 1 - 3 alkyl ( e . g ., methyl )]. suitable reaction solvents typically can be selected from polar aprotic solvents such as n , n - dimethylformamide ( dmf ), 1 , 4 - dioxane , or thf . alternatively , a compound of formula 3 - 5 may be prepared as in scheme 4 wherein l 1 is o , nh , n ( c 1 - 4 alkyl ) and n ( c 3 - 6 cycloalkyl ). referring to scheme 4 , compounds of formula 4 - 1 and 4 - 2 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 4 - 3 can be prepared by coupling a compound of formula 4 - 1 with a compound of formula 4 - 2 . the aforesaid coupling may be accomplished by reacting a compound of formula 4 - 1 with a compound of formula 4 - 2 in the presence of a suitable base ( such as potassium carbonate ), a suitable catalyst [ such as tetrakis ( triphenylphosphine ) palladium ( 0 )], and a suitable solvent ( such as ethanol ). a compound of formula 4 - 3 can be reacted with maleic anhydride and hydrogen peroxide in a solvent ( such as dichloromethane ) to provide a compound of formula 4 - 4 , which may contain a mixture of n - oxide regioisomers . a compound of formula 4 - 5 can be prepared from a compound of formula 4 - 4 by heating with acetic anhydride ; the initial product can be saponified using a base ( such as naoh ) in a suitable polar solvent ( such as water or methanol ). a compound of formula 3 - 5 can be prepared from a compound of formula 4 - 5 by reaction with a suitable base ( such as lda , lhmds and the like ), lithium bromide , and a compound of the formula r 11a — z 3 ( wherein z 3 is an acceptable leaving group such as cl , br , i , mesylate , and the like ). suitable reaction solvents typically can be selected from polar aprotic solvents ( such as dmf , 1 , 4 - dioxane , or thf ). scheme 5 refers to a preparation of a compound of formula 5 - 5 wherein l 1 is o , nh , n ( c 1 - 4 alkyl ) and n ( c 3 - 6 cycloalkyl ) and a 1 is a moiety of formula a 1a or a pg 2 ( such as a benzyl group ). referring to scheme 5 , compounds of formula 5 - 1 and 5 - 2 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 5 - 3 can be prepared by coupling a compound of formula 5 - 1 with an enol trifluoromethanesulfonate of formula 5 - 2 . the aforesaid coupling may be accomplished by reacting a compound of formula 5 - 1 with a trifluoromethanesulfonate of formula 5 - 2 in the presence of a suitable base ( such as potassium carbonate or sodium carbonate ), a suitable catalyst [ such as palladium ( ii ) acetate ], optionally a suitable ligand ( such as tricyclohexylphosphine ), and optionally a suitable phase - transfer catalyst such as tetrabutylammonium chloride . suitable reaction solvents typically can be selected from polar aprotic solvents such as 1 , 4 - dioxane or thf . a compound of formula 5 - 3 can be reacted with 1 to 5 equivalents of a suitable base [ such as 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu )] under an oxygen atmosphere to obtain a compound of formula 5 - 4 . suitable reaction solvents typically can be selected from polar aprotic solvents such as dmf , 1 , 4 - dioxane , or thf . a compound of formula 5 - 5 can be obtained by reacting a compound of formula 5 - 4 with hydrazine in a suitable solvent such as 1 - butanol . scheme 6 refers to a preparation of a compound of formula 6 - 5 . referring to scheme 6 , a compound of formula 6 - 1 can be prepared as described in scheme 5 , wherein pg 2 is a suitable protecting group ( such as benzyl ). a compound of formula 6 - 1 can be converted to a suitably protected compound of formula 6 - 2 using methods described herein or other methods well known to those skilled in the art , wherein pg 3 is a suitable protecting group ( such as thp ) that can be removed under orthogonal reaction conditions to pg 2 . a compound of formula 6 - 3 can be prepared by selective removal of pg 2 under suitable deprotection conditions depending on the selection of pg 2 . for example , when pg 2 is a benzyl group , it can be removed by treatment with palladium ( 10 % on carbon ) under hydrogenation condition in a suitable solvent , such as methanol and ethyl acetate . using the aforementioned reaction conditions described in scheme 1 , a compound of formula 6 - 3 can be coupled with a reagent of formula 1 - 1 to yield a compound of formula 6 - 4 . a compound of formula 6 - 5 can be obtained by removing pg 3 under suitable deprotection conditions depending on the selection of pg 3 . for example , when pg 3 is thp , it can be removed under acidic conditions , such as hydrogen chloride in a suitable solvent , such as dichloromethane . scheme 7 refers to a preparation of a compound of formula 7 - 5 [ wherein r 10 is , for example , c 1 - 3 alkyl ( e . g ., methyl ); r 10b is , for example , h or c 1 - 3 alkyl ( e . g ., methyl ); and pg 4 is a suitable protecting group [ e . g ., 2 -( trimethylsilyl ) ethoxymethyl ( sem ), tert - butoxycarbonyl ( boc ), or benzyloxymethyl acetal ( bom )]. referring to scheme 7 , compounds of formula 2 - 3 and 7 - 1 are commercially available or can be prepared by methods described herein or other methods well known to those skilled in the art . a compound of formula 7 - 2 can be prepared by coupling a compound of formula 2 - 3 with a compound of formula 7 - 1 , in the presence of a suitable base ( such as potassium carbonate ) and a suitable catalyst { such as [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii )}. a compound of formula 7 - 3 can be prepared by selective removal of pg 2 under suitable de - protection conditions depending on the selection of pg 2 . for example , when pg 2 is a benzyl group , it can be removed by treatment with palladium ( 10 % on carbon ) under hydrogenation condition in a suitable solvent , such as methanol and ethyl acetate . using the aforementioned reaction conditions described in scheme 1 , a compound of formula 7 - 3 can be coupled with a reagent of formula 1 - 1 to yield a compound of formula 7 - 4 . alternatively , a compound of formula 7 - 4 can be prepared from intermediate 1 - 4 , following the coupling conditions described in scheme 1 . a compound of formula 7 - 5 can then be obtained from a compound of formula 7 - 4 by removing pg 4 under suitable deprotection conditions that are known to those skilled in the art . scheme 8 refers to a preparation of a compound of formula 8 - 1 [ wherein r 10 is , for example , c 1 - 3 alkyl ( e . g ., methyl ); r 10b is , for example , h or c 1 - 3 alkyl ( e . g ., methyl )]. referring to scheme 8 , compounds of formula 8 - 1 can be prepared by treating a compound of formula 7 - 5 with a suitable thianation reagent , such as lawesson &# 39 ; s reagent [ 2 , 4 - bis ( 4 - methoxyphenyl )- 1 , 3 , 2 , 4 - dithiadiphosphetane - 2 , 4 - dithione ] or phosphorus pentasulfide , in a suitable solvent such as toluene . scheme 9 refers to preparation of compounds of formula 9 - 5 and 9 - 6 . referring to scheme 9 , compounds of formula 9 - 1 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 9 - 1 can be converted to a compound of formula 9 - 2 either directly or after conversion to a compound of formula 9 - 3 using methods analogous to those described in scheme 1 . the nitro group of a compound of formula 9 - 2 can then be converted to an amine via hydrogenation in the presence of a suitable catalyst , such as palladium ( 10 % on carbon ), to yield a compound of formula 9 - 4 . a compound of formula 9 - 4 can then be coupled with a compound of formula 1 - 1 in scheme 1 to afford a compound of formula 9 - 5 . the coupling conditions employed may be analogous to those described for the preparation of a compound of formula 1 - 3 in scheme 1 . a compound of formula 9 - 6 can be prepared via n - alkylation of a compound of formula 9 - 5 using a reagent of y — z 3 , wherein y is c 1 - 4 alkyl , or c 3 - 6 cycloalkyl , and z 3 is an acceptable leaving group such as cl , br , i , mesylate , and the like . scheme 10 refers to preparation of compounds of formula 10 - 4 . referring to scheme 10 , a compound of formula 10 - 1 can be prepared via triflation of a compound of formula 2 - 4 ( scheme 2 ) using a suitable reagent such as trifluoromethanesulfonic anhydride in the presence of a suitable base such as triethylamine . a compound of formula 10 - 1 can be converted to a compound of formula 10 - 2 by coupling with potassium thioacetate , in the presence of a suitable metal catalyst , such as tris ( dibenzylideneacetone ) dipalladium ( 0 ), and a suitable ligand , such as ( r )-(−)- 1 -[( sp )- 2 -( dicyclohexylphosphino ) ferrocenyl ] ethyldi - tert - butylphosphine , in a suitable solvent , such as toluene . a compound of formula 10 - 2 can then be hydrolyzed to obtain a compound of formula 10 - 3 , which in turn can be coupled with a compound of formula 1 - 1 in scheme 1 to afford a compound of formula 10 - 4 . the coupling conditions employed may be analogous to those described for the preparation of a compound of formula 1 - 3 in scheme 1 . a compound of formula 10 - 4 may then be deprotected , using appropriate conditions depending on the selection of the pg 1 group , to obtain a compound of formula i . additional starting materials and intermediates useful for making the compounds of the present invention can be obtained from chemical vendors such as sigma - aldrich or can be made according to methods described in the chemical art . those skilled in the art can recognize that in all of the schemes described herein , if there are functional ( reactive ) groups present on a part of the compound structure such as a substituent group , for example r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , r 10 , r 10b , r 11 , r 11a , t 1 , t 2 , t 3 , t 4 , q 1 , and x 1 etc ., further modification can be made if appropriate and / or desired , using methods well known to those skilled in the art . for example , a — cn group can be hydrolyzed to afford an amide group ; a carboxylic acid can be converted to an amide ; a carboxylic acid can be converted to an ester , which in turn can be reduced to an alcohol , which in turn can be further modified . for another example , an oh group can be converted into a better leaving group such as a methanesulfonate , which in turn is suitable for nucleophilic substitution , such as by a cyanide ion ( cn − ). for another example , an — s — can be oxidized to — s (═ o )— and / or — s (═ o ) 2 —. for yet another example , an unsaturated bond such as c ═ c or c ≡ c can be reduced to a saturated bond by hydrogenation . in some embodiments , a primary amine or a secondary amine moiety ( present on a substituent group such as r 3 , r 4 , r 9 , r 10 , etc .) can be converted to an amide , sulfonamide , urea , or thiourea moiety by reacting it with an appropriate reagent such as an acid chloride , a sulfonyl chloride , an isocyanate , or a thioisocyanate compound . one skilled in the art will recognize further such modifications . thus , a compound of formula i having a substituent that contains a functional group can be converted to another compound of formula i having a different substituent group . similarly , those skilled in the art can also recognize that in all of the schemes described herein , if there are functional ( reactive ) groups present on a substituent group such as r 3 , r 4 , r 9 , r 10 , etc ., these functional groups can be protected / deprotected in the course of the synthetic scheme described here , if appropriate and / or desired . for example , an oh group can be protected by a benzyl , methyl , or acetyl group , which can be deprotected and converted back to the oh group in a later stage of the synthetic process . for another example , an nh 2 group can be protected by a benzyloxycarbonyl ( cbz ) or boc group ; conversion back to the nh 2 group can be carried out at a later stage of the synthetic process via deprotection . as used herein , the term “ reacting ” ( or “ reaction ” or “ reacted ”) refers to the bringing together of designated chemical reactants such that a chemical transformation takes place generating a compound different from any initially introduced into the system . reactions can take place in the presence or absence of solvent . compounds of formula i may exist as stereoisomers , such as atropisomers , racemates , enantiomers , or diastereomers . conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate using , for example , chiral high pressure liquid chromatography ( hplc ). alternatively , the racemate ( or a racemic precursor ) may be reacted with a suitable optically active compound , for example , an alcohol , or , in the case where the compound contains an acidic or basic moiety , an acid or base such as tartaric acid or 1 - phenylethylamine . the resulting diastereomeric mixture may be separated by chromatography and / or fractional crystallization and one or both of the diastereoisomers converted to the corresponding pure enantiomer ( s ) by means well known to one skilled in the art . chiral compounds of formula i ( and chiral precursors thereof ) may be obtained in enantiomerically enriched form using chromatography , typically hplc , on an asymmetric resin with a mobile phase consisting of a hydrocarbon , typically heptane or hexane , containing from 0 % to 50 % 2 - propanol , typically from 2 % to 20 %, and from 0 % to 5 % of an alkylamine , typically 0 . 1 % diethylamine . concentration of the eluate affords the enriched mixture . stereoisomeric conglomerates may be separated by conventional techniques known to those skilled in the art . see , e . g ., stereochemistry of organic compounds by e . l . eliel and s . h . wilen ( wiley , new york , 1994 ), the disclosure of which is incorporated herein by reference in its entirety . suitable stereoselective techniques are well - known to those of ordinary skill in the art . where a compound of formula i contains an alkenyl or alkenylene ( alkylidene ) group , geometric cis / trans ( or z / e ) isomers are possible . cis / trans isomers may be separated by conventional techniques well known to those skilled in the art , for example , chromatography and fractional crystallization . salts of the present invention can be prepared according to methods known to those of skill in the art . the compounds of formula i that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids . although such salts must be pharmaceutically acceptable for administration to animals , it is often desirable in practice to initially isolate the compound of the present invention from the reaction mixture as a pharmaceutically unacceptable salt and then simply convert the latter back to the free base compound by treatment with an alkaline reagent and subsequently convert the latter free base to a pharmaceutically acceptable acid addition salt . the acid addition salts of the basic compounds of this invention can be prepared by treating the basic compound with a substantially equivalent amount of the selected mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent , such as methanol or ethanol . upon evaporation of the solvent , the desired solid salt is obtained . the desired acid salt can also be precipitated from a solution of the free base in an organic solvent by adding an appropriate mineral or organic acid to the solution . if the inventive compound is a base , the desired pharmaceutically acceptable salt may be prepared by any suitable method available in the art , for example , treatment of the free base with an inorganic acid , such as hydrochloric acid , hydrobromic acid , sulfuric acid , nitric acid , phosphoric acid and the like , or with an organic acid , such as acetic acid , maleic acid , succinic acid , mandelic acid , fumaric acid , malonic acid , pyruvic acid , oxalic acid , glycolic acid , salicylic acid , isonicotinic acid , lactic acid , pantothenic acid , bitartric acid , ascorbic acid , 2 , 5 - dihydroxybenzoic acid , gluconic acid , saccharic acid , formic acid , methanesulfonic acid , ethanesulfonic acid , benzenesulfonic acid , p - toluenesulfonic acid , and pamoic [ i . e ., 4 , 4 ′- methanediylbis ( 3 - hydroxynaphthalene - 2 - carboxylic acid )] acid , a pyranosidyl acid , such as glucuronic acid or galacturonic acid , an alpha - hydroxy acid , such as citric acid or tartaric acid , an amino acid , such as aspartic acid or glutamic acid , an aromatic acid , such as benzoic acid or cinnamic acid , a sulfonic acid , such as ethanesulfonic acid , or the like . those compounds of formula i that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations . examples of such salts include the alkali metal or alkaline earth metal salts , and particularly the sodium and potassium salts . these salts are all prepared by conventional techniques . the chemical bases which are used as reagents to prepare the pharmaceutically acceptable base salts of this invention are those which form non - toxic base salts with the acidic compounds of formula i . these salts may be prepared by any suitable method , for example , treatment of the free acid with an inorganic or organic base , such as an amine ( primary , secondary or tertiary ), an alkali metal hydroxide or alkaline earth metal hydroxide , or the like . these salts can also be prepared by treating the corresponding acidic compounds with an aqueous solution containing the desired pharmacologically acceptable cations , and then evaporating the resulting solution to dryness , for example under reduced pressure . alternatively , they may also be prepared by mixing lower alkanolic solutions of the acidic compounds and the desired alkali metal alkoxide together , and then evaporating the resulting solution to dryness in the same manner as before . in either case , stoichiometric quantities of reagents are , for example , employed in order to ensure completeness of reaction and maximum yields of the desired final product . pharmaceutically acceptable salts of compounds of formula i ( including compounds of formula ia or ib ) may be prepared by one or more of three methods : ( i ) by reacting the compound of formula i with the desired acid or base ; ( ii ) by removing an acid - or base - labile protecting group from a suitable precursor of the compound of formula i or by ring - opening a suitable cyclic precursor , for example , a lactone or lactam , using the desired acid or base ; or ( iii ) by converting one salt of the compound of formula i to another by reaction with an appropriate acid or base or by means of a suitable ion exchange column . all three reactions are typically carried out in solution . the resulting salt may precipitate out and be collected by filtration or may be recovered by evaporation of the solvent . the degree of ionization in the resulting salt may vary from completely ionized to almost non - ionized . polymorphs can be prepared according to techniques well - known to those skilled in the art , for example , by crystallization . when any racemate crystallizes , crystals of two different types are possible . the first type is the racemic compound ( true racemate ) referred to above wherein one homogeneous form of crystal is produced containing both enantiomers in equimolar amounts . the second type is the racemic mixture or conglomerate wherein two forms of crystal are produced in equimolar amounts each comprising a single enantiomer . while both of the crystal forms present in a racemic mixture may have almost identical physical properties , they may have different physical properties compared to the true racemate . racemic mixtures may be separated by conventional techniques known to those skilled in the art — see , for example , stereochemistry of organic compounds by e . l . eliel and s . h . wilen ( wiley , new york , 1994 ). the invention also includes isotopically labeled compounds of formula i wherein one or more atoms is replaced by an atom having the same atomic number , but an atomic mass or mass number different from the atomic mass or mass number usually found in nature . isotopically labeled compounds of formula i ( or pharmaceutically acceptable salts thereof or n - oxides thereof ) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein , using an appropriate isotopically labeled reagent in place of the non - labeled reagent otherwise employed . prodrugs in accordance with the invention can , for example , be produced by replacing appropriate functionalities present in the compounds of formula i with certain moieties known to those skilled in the art as ‘ pro - moieties ’ as described , for example , in design of prodrugs by h . bundgaard ( elsevier , 1985 ). the compounds of formula i should be assessed for their biopharmaceutical properties , such as solubility and solution stability ( across ph ), permeability , etc ., in order to select the most appropriate dosage form and route of administration for treatment of the proposed indication . compounds of the invention intended for pharmaceutical use may be administered as crystalline or amorphous products . they may be obtained , for example , as solid plugs , powders , or films by methods such as precipitation , crystallization , freeze drying , spray drying , or evaporative drying . microwave or radio frequency drying may be used for this purpose . they may be administered alone or in combination with one or more other compounds of the invention or in combination with one or more other drugs ( or as any combination thereof ). generally , they will be administered as a formulation in association with one or more pharmaceutically acceptable excipients . the term “ excipient ” is used herein to describe any ingredient other than the compound ( s ) of the invention . the choice of excipient will to a large extent depend on factors such as the particular mode of administration , the effect of the excipient on solubility and stability , and the nature of the dosage form . pharmaceutical compositions suitable for the delivery of compounds of the present invention ( or pharmaceutically acceptable salts thereof ) and methods for their preparation will be readily apparent to those skilled in the art . such compositions and methods for their preparation may be found , for example , in remington &# 39 ; s pharmaceutical sciences , 19th edition ( mack publishing company , 1995 ). the compounds of the invention ( including pharmaceutically acceptable salts thereof and n - oxides thereof ) may be administered orally . oral administration may involve swallowing , so that the compound enters the gastrointestinal tract , and / or buccal , lingual , or sublingual administration by which the compound enters the blood stream directly from the mouth . formulations suitable for oral administration include solid , semi - solid and liquid systems such as tablets ; soft or hard capsules containing multi - or nano - particulates , liquids , or powders ; lozenges ( including liquid - filled ); chews ; gels ; fast dispersing dosage forms ; films ; ovules ; sprays ; and buccal / mucoadhesive patches . liquid formulations include suspensions , solutions , syrups and elixirs . such formulations may be employed as fillers in soft or hard capsules ( made , for example , from gelatin or hydroxypropyl methyl cellulose ) and typically comprise a carrier , for example , water , ethanol , polyethylene glycol , propylene glycol , methyl cellulose , or a suitable oil , and one or more emulsifying agents and / or suspending agents . liquid formulations may also be prepared by the reconstitution of a solid , for example , from a sachet . the compounds of the invention may also be used in fast - dissolving , fast - disintegrating dosage forms such as those described by liang and chen , expert opinion in therapeutic patents 2001 , 11 , 981 - 986 . for tablet dosage forms , depending on dose , the drug may make up from 1 weight % to 80 weight % of the dosage form , more typically from 5 weight % to 60 weight % of the dosage form . in addition to the drug , tablets generally contain a disintegrant . examples of disintegrants include sodium starch glycolate , sodium carboxymethyl cellulose , calcium carboxymethyl cellulose , croscarmellose sodium , crospovidone , polyvinylpyrrolidone , methyl cellulose , microcrystalline cellulose , lower alkyl - substituted hydroxypropyl cellulose , starch , pregelatinized starch and sodium alginate . generally , the disintegrant will comprise from 1 weight % to 25 weight %, for example , from 5 weight % to 20 weight % of the dosage form . binders are generally used to impart cohesive qualities to a tablet formulation . suitable binders include microcrystalline cellulose , gelatin , sugars , polyethylene glycol , natural and synthetic gums , polyvinylpyrrolidone , pregelatinized starch , hydroxypropyl cellulose and hydroxypropyl methylcellulose . tablets may also contain diluents , such as lactose ( monohydrate , spray - dried monohydrate , anhydrous and the like ), mannitol , xylitol , dextrose , sucrose , sorbitol , microcrystalline cellulose , starch and dibasic calcium phosphate dihydrate . tablets may also optionally comprise surface active agents , such as sodium lauryl sulfate and polysorbate 80 , and glidants such as silicon dioxide and talc . when present , surface active agents may comprise from 0 . 2 weight % to 5 weight % of the tablet , and glidants may comprise from 0 . 2 weight % to 1 weight % of the tablet . tablets also generally contain lubricants such as magnesium stearate , calcium stearate , zinc stearate , sodium stearyl fumarate , and mixtures of magnesium stearate with sodium lauryl sulfate . lubricants generally comprise from 0 . 25 weight % to 10 weight %, for example , from 0 . 5 weight % to 3 weight % of the tablet . other possible ingredients include anti - oxidants , colorants , flavoring agents , preservatives and taste - masking agents . exemplary tablets contain up to about 80 % drug , from about 10 weight % to about 90 weight % binder , from about 0 weight % to about 85 weight % diluent , from about 2 weight % to about 10 weight % disintegrant , and from about 0 . 25 weight % to about 10 weight % lubricant . tablet blends may be compressed directly or by roller to form tablets . tablet blends or portions of blends may alternatively be wet -, dry -, or melt - granulated , melt - congealed , or extruded before tabletting . the final formulation may comprise one or more layers and may be coated or uncoated ; it may even be encapsulated . the formulation of tablets is discussed in pharmaceutical dosage forms : tablets , vol . 1 , by h . lieberman and l . lachman ( marcel dekker , new york , 1980 ). consumable oral films for human or veterinary use are typically pliable water - soluble or water - swellable thin film dosage forms which may be rapidly dissolving or mucoadhesive and typically comprise a compound of formula i , a film - forming polymer , a binder , a solvent , a humectant , a plasticizer , a stabilizer or emulsifier , a viscosity - modifying agent and a solvent . some components of the formulation may perform more than one function . the compound of formula i ( or pharmaceutically acceptable salts thereof or n - oxides thereof ) may be water - soluble or insoluble . a water - soluble compound typically comprises from 1 weight % to 80 weight %, more typically from 20 weight % to 50 weight %, of the solutes . less soluble compounds may comprise a smaller proportion of the composition , typically up to 30 weight % of the solutes . alternatively , the compound of formula i may be in the form of multiparticulate beads . the film - forming polymer may be selected from natural polysaccharides , proteins , or synthetic hydrocolloids and is typically present in the range 0 . 01 to 99 weight %, more typically in the range 30 to 80 weight %. other possible ingredients include anti - oxidants , colorants , flavorings and flavor enhancers , preservatives , salivary stimulating agents , cooling agents , co - solvents ( including oils ), emollients , bulking agents , anti - foaming agents , surfactants and taste - masking agents . films in accordance with the invention are typically prepared by evaporative drying of thin aqueous films coated onto a peelable backing support or paper . this may be done in a drying oven or tunnel , typically a combined coater dryer , or by freeze - drying or vacuuming . solid formulations for oral administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . suitable modified release formulations for the purposes of the invention are described in u . s . pat . no . 6 , 106 , 864 . details of other suitable release technologies such as high energy dispersions and osmotic and coated particles are to be found in verma et al ., pharmaceutical technology on - line , 25 ( 2 ), 1 - 14 ( 2001 ). the use of chewing gum to achieve controlled release is described in wo 00 / 35298 . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may also be administered directly into the blood stream , into muscle , or into an internal organ . suitable means for parenteral administration include intravenous , intraarterial , intraperitoneal , intrathecal , intraventricular , intraurethral , intrasternal , intracranial , intramuscular , intrasynovial and subcutaneous . suitable devices for parenteral administration include needle ( including microneedle ) injectors , needle - free injectors and infusion techniques . parenteral formulations are typically aqueous solutions which may contain excipients such as salts , carbohydrates and buffering agents ( for example to a ph of from 3 to 9 ), but , for some applications , they may be more suitably formulated as a sterile non - aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile , pyrogen - free water . the preparation of parenteral formulations under sterile conditions , for example , by lyophilization , may readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art . the solubility of compounds of formula i ( including pharmaceutically acceptable salts thereof ) used in the preparation of parenteral solutions may be increased by the use of appropriate formulation techniques , such as the incorporation of solubility - enhancing agents . formulations for parenteral administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . thus compounds of the invention may be formulated as a suspension or as a solid , semi - solid , or thixotropic liquid for administration as an implanted depot providing modified release of the active compound . examples of such formulations include drug - coated stents and semi - solids and suspensions comprising drug - loaded poly ( dl - lactic - coglycolic acid ) ( plga ) microspheres . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may also be administered topically , ( intra ) dermally , or transdermally to the skin or mucosa . typical formulations for this purpose include gels , hydrogels , lotions , solutions , creams , ointments , dusting powders , dressings , foams , films , skin patches , wafers , implants , sponges , fibers , bandages and microemulsions . liposomes may also be used . typical carriers include alcohol , water , mineral oil , liquid petrolatum , white petrolatum , glycerin , polyethylene glycol and propylene glycol . penetration enhancers may be incorporated . see e . g ., finnin and morgan , j . pharm . sci . 1999 , 88 , 955 - 958 . other means of topical administration include delivery by electroporation , iontophoresis , phonophoresis , sonophoresis and microneedle or needle - free ( e . g ., powderject ™, bioject ™, etc .) injection . formulations for topical administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) can also be administered intranasally or by inhalation , typically in the form of a dry powder ( either alone ; as a mixture , for example , in a dry blend with lactose ; or as a mixed component particle , for example , mixed with phospholipids , such as phosphatidylcholine ) from a dry powder inhaler , as an aerosol spray from a pressurized container , pump , spray , atomizer ( for example an atomizer using electrohydrodynamics to produce a fine mist ), or nebulizer , with or without the use of a suitable propellant , such as 1 , 1 , 1 , 2 - tetrafluoroethane or 1 , 1 , 1 , 2 , 3 , 3 , 3 - heptafluoropropane , or as nasal drops . for intranasal use , the powder may comprise a bioadhesive agent , for example , chitosan or cyclodextrin . the pressurized container , pump , spray , atomizer , or nebulizer contains a solution or suspension of the compound ( s ) of the invention comprising , for example , ethanol , aqueous ethanol , or a suitable alternative agent for dispersing , solubilizing , or extending release of the active , a propellant ( s ) as solvent and an optional surfactant , such as sorbitan trioleate , oleic acid , or an oligolactic acid . prior to use in a dry powder or suspension formulation , the drug product is micronized to a size suitable for delivery by inhalation ( typically less than 5 microns ). this may be achieved by any appropriate comminuting method , such as spiral jet milling , fluid bed jet milling , supercritical fluid processing to form nanoparticles , high pressure homogenization , or spray drying . capsules ( made , for example , from gelatin or hydroxypropyl methyl cellulose ), blisters and cartridges for use in an inhaler or insufflator may be formulated to contain a powder mix of the compound of the invention , a suitable powder base such as lactose or starch and a performance modifier such as l - leucine , mannitol , or magnesium stearate . the lactose may be anhydrous or in the form of the monohydrate . other suitable excipients include dextran , glucose , maltose , sorbitol , xylitol , fructose , sucrose and trehalose . a suitable solution formulation for use in an atomizer using electrohydrodynamics to produce a fine mist may contain from 1 μg to 20 mg of the compound of the invention per actuation and the actuation volume may vary from 1 μl to 100 μl . a typical formulation may comprise a compound of formula i or a pharmaceutically acceptable salt thereof , propylene glycol , sterile water , ethanol and sodium chloride . alternative solvents which may be used instead of propylene glycol include glycerol and polyethylene glycol . suitable flavors , such as menthol and levomenthol , or sweeteners , such as saccharin or saccharin sodium , may be added to those formulations of the invention intended for inhaled / intranasal administration . formulations for inhaled / intranasal administration may be formulated to be immediate and / or modified release using , for example , pgla . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . in the case of dry powder inhalers and aerosols , the dosage unit is determined by means of a valve which delivers a metered amount . units in accordance with the invention are typically arranged to administer a metered dose or “ puff ” containing from 0 . 01 to 100 mg of the compound of formula i . the overall daily dose will typically be in the range 1 μg to 200 mg , which may be administered in a single dose or , more usually , as divided doses throughout the day . the compounds of the invention may be administered rectally or vaginally , for example , in the form of a suppository , pessary , or enema . cocoa butter is a traditional suppository base , but various alternatives may be used as appropriate . formulations for rectal / vaginal administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may also be administered directly to the eye or ear , typically in the form of drops of a micronized suspension or solution in isotonic , ph - adjusted , sterile saline . other formulations suitable for ocular and aural administration include ointments , gels , biodegradable ( e . g ., absorbable gel sponges , collagen ) and non - biodegradable ( e . g ., silicone ) implants , wafers , lenses and particulate or vesicular systems , such as niosomes or liposomes . a polymer such as crossed - linked polyacrylic acid , polyvinylalcohol , hyaluronic acid , a cellulosic polymer , for example , hydroxypropyl methyl cellulose , hydroxyethyl cellulose , or methyl cellulose , or a heteropolysaccharide polymer , for example , gelan gum , may be incorporated together with a preservative , such as benzalkonium chloride . such formulations may also be delivered by iontophoresis . formulations for ocular / aural administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted , or programmed release . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may be combined with soluble macromolecular entities , such as cyclodextrin and suitable derivatives thereof or polyethylene glycol - containing polymers , in order to improve their solubility , dissolution rate , taste - masking , bioavailability and / or stability for use in any of the aforementioned modes of administration . drug - cyclodextrin complexes , for example , are found to be generally useful for most dosage forms and administration routes . both inclusion and non - inclusion complexes may be used . as an alternative to direct complexation with the drug , the cyclodextrin may be used as an auxiliary additive , i . e ., as a carrier , diluent , or solubilizer . most commonly used for these purposes are alpha -, beta - and gamma - cyclodextrins , examples of which may be found in international patent applications nos . wo 91 / 11172 , wo 94 / 02518 and wo 98 / 55148 . since the present invention has an aspect that relates to the treatment of the disease / conditions described herein with a combination of active ingredients which may be administered separately , the invention also relates to combining separate pharmaceutical compositions in kit form . the kit comprises two separate pharmaceutical compositions : a compound of formula i a prodrug thereof or a salt of such compound or prodrug and a second compound as described above . the kit comprises means for containing the separate compositions such as a container , a divided bottle or a divided foil packet . typically the kit comprises directions for the administration of the separate components . the kit form is particularly advantageous when the separate components are for example administered in different dosage forms ( e . g ., oral and parenteral ), are administered at different dosage intervals , or when titration of the individual components of the combination is desired by the prescribing physician . an example of such a kit is a so - called blister pack . blister packs are well known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms ( tablets , capsules , and the like ). blister packs generally consist of a sheet of relatively stiff material covered with a foil of a transparent plastic material . during the packaging process recesses are formed in the plastic foil . the recesses have the size and shape of the tablets or capsules to be packed . next , the tablets or capsules are placed in the recesses and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed . as a result , the tablets or capsules are sealed in the recesses between the plastic foil and the sheet . in some embodiments , the strength of the sheet is such that the tablets or capsules can be removed from the blister pack by manually applying pressure on the recesses whereby an opening is formed in the sheet at the place of the recess . the tablet or capsule can then be removed via said opening . it may be desirable to provide a memory aid on the kit , e . g ., in the form of numbers next to the tablets or capsules whereby the numbers correspond with the days of the regimen which the tablets or capsules so specified should be ingested . another example of such a memory aid is a calendar printed on the card , e . g ., as follows “ first week , monday , tuesday , etc . . . . second week , monday , tuesday , . . . ” etc . other variations of memory aids will be readily apparent . a “ daily dose ” can be a single tablet or capsule or several pills or capsules to be taken on a given day . also , a daily dose of formula i compound can consist of one tablet or capsule while a daily dose of the second compound can consist of several tablets or capsules and vice versa . the memory aid should reflect this . in another specific embodiment of the invention , a dispenser designed to dispense the daily doses one at a time in the order of their intended use is provided . for example , the dispenser is equipped with a memory aid , so as to further facilitate compliance with the regimen . an example of such a memory aid is a mechanical counter which indicates the number of daily doses that has been dispensed . another example of such a memory aid is a battery - powered micro - chip memory coupled with a liquid crystal readout , or audible reminder signal which , for example , reads out the date that the last daily dose has been taken and / or reminds one when the next dose is to be taken . the invention will be described in greater detail by way of specific examples . the following examples are offered for illustrative purposes , and are not intended to limit the invention in any manner . those of skill in the art will readily recognize a variety of non - critical parameters that can be changed or modified to yield essentially the same results . additional compounds within the scope of this invention may be prepared using the methods illustrated in these examples , either alone or in combination with techniques generally known in the art . in the following examples and preparations , “ dmso ” means dimethyl sulfoxide , “ n ” where referring to concentration means normal , “ m ” means molar , “ ml ” means milliliter , “ mmol ” means millimoles , “ μmol ” means micromoles , “ eq .” means equivalent , “° c .” means degrees celsius , “ mhz ” means megahertz , “ hplc ” means high - performance liquid chromatography . experiments were generally carried out under inert atmosphere ( nitrogen or argon ), particularly in cases where oxygen - or moisture - sensitive reagents or intermediates were employed . commercial solvents and reagents were generally used without further purification . anhydrous solvents were employed where appropriate , generally acroseal ® products from acros organics or drisolv ® products from emd chemicals . in other cases , commercial solvents were passed through columns packed with 4 å molecular sieves , until the following qc standards for water were attained : a ) & lt ; 100 ppm for dichloromethane , toluene , n , n - dimethylformamide and tetrahydrofuran ; b ) & lt ; 180 ppm for methanol , ethanol , 1 , 4 - dioxane and diisopropylamine . for very sensitive reactions , solvents were further treated with metallic sodium , calcium hydride or molecular sieves , and distilled just prior to use . products were generally dried under vacuum before being carried on to further reactions or submitted for biological testing . mass spectrometry data is reported from either liquid chromatography - mass spectrometry ( lcms ), atmospheric pressure chemical ionization ( apci ) or gas chromatography - mass spectrometry ( gcms ) instrumentation . chemical shifts for nuclear magnetic resonance ( nmr ) data are expressed in parts per million ( ppm , δ ) referenced to residual peaks from the deuterated solvents employed . in some examples , chiral separations were carried out to separate atropisomers ( or atropenantiomers ) of certain compounds of the invention . in some examples , the optical rotation of an atropisomer was measured using a polarimeter . according to its observed rotation data ( or its specific rotation data ), an atropisomer ( or atropenantiomer ) with a clockwise rotation was designated as the (+)- atropisomer [ or the (+) atropenantiomer ] and an atropisomer ( or atropenantiomer ) with a counter - clockwise rotation was designated as the (−)- atropisomer [ or the (−) atropenantiomer ]. reactions proceeding through detectable intermediates were generally followed by lcms , and allowed to proceed to full conversion prior to addition of subsequent reagents . for syntheses referencing procedures in other examples or methods , reaction conditions ( reaction time and temperature ) may vary . in general , reactions were followed by thin - layer chromatography or mass spectrometry , and subjected to work - up when appropriate . purifications may vary between experiments : in general , solvents and the solvent ratios used for eluents / gradients were chosen to provide appropriate r f s or retention times . a solution of sodium methoxide in methanol ( 4 . 4 m , 27 ml , 119 mmol ) was added to a solution of ethyl 2 - cyanopropanoate ( 95 %, 13 . 2 ml , 99 . 6 mmol ) and 1 - methylurea ( 98 %, 8 . 26 g , 109 mmol ) in methanol ( 75 ml ), and the reaction mixture was heated at reflux for 18 hours , then cooled to room temperature . after removal of solvent in vacuo , the residue was repeatedly evaporated under reduced pressure with acetonitrile ( 3 × 50 ml ), then partitioned between acetonitrile ( 100 ml ) and water ( 100 ml ). aqueous 6 m hydrochloric acid was slowly added until the ph had reached approximately 2 ; the resulting mixture was stirred for 1 hour . the precipitate was collected via filtration and washed with tert - butyl methyl ether , affording the product as a white solid . yield : 15 . 2 g , 79 . 3 mmol , 80 %. lcms m / z 156 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 10 . 38 ( br s , 1h ), 6 . 39 ( s , 2h ), 3 . 22 ( s , 3h ), 1 . 67 ( s , 3h ). a 1 : 1 mixture of acetonitrile and water ( 120 ml ) was added to a mixture of c1 ( 9 . 50 g , 49 . 6 mmol ), sodium nitrite ( 5 . 24 g , 76 mmol ), and copper ( ii ) bromide ( 22 . 4 g , 100 mmol ) { caution : bubbling and slight exotherm }, and the reaction mixture was allowed to stir at room temperature for 66 hours . addition of aqueous sulfuric acid ( 1 n , 200 ml ) and ethyl acetate ( 100 ml ) provided a precipitate , which was collected via filtration and washed with water and ethyl acetate to afford the product as a light yellow solid ( 7 . 70 g ). the organic layer of the filtrate was concentrated to a smaller volume , during which additional precipitate formed ; this was isolated via filtration and washed with 1 : 1 ethyl acetate / heptane to provide additional product ( 0 . 4 g ). total yield : 8 . 1 g , 37 mmol , 75 %. gcms m / z 218 , 220 [ m + ]. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 11 . 58 ( br s , 1h ), 3 . 45 ( s , 3h ), 1 . 93 ( s , 3h ). to a mixture of c2 ( 21 . 9 g , 99 . 8 mmol ) and 2 -( trimethylsilyl ) ethoxymethyl chloride ( 20 g , 120 mmol ) in acetonitrile ( 400 ml ) was added 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 18 . 3 g , 120 mmol ), and the reaction mixture was stirred at 60 ° c . for 18 hours . additional 2 -( trimethylsilyl ) ethoxymethyl chloride ( 5 g , 30 mmol ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 4 . 6 g , 30 mmol ) were added , and stirring was continued at 60 ° c . for 18 hours . after the mixture had been concentrated in vacuo , the residue was diluted with water ( 500 ml ) and extracted with ethyl acetate ( 3 × 300 ml ). the combined organic layers were concentrated ; purification using chromatography on silica gel ( gradient : 20 % to 50 % ethyl acetate in petroleum ether ) afforded the product as a colorless oil . yield : 22 . 5 g , 64 . 4 mmol , 64 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 5 . 41 ( s , 2h ), 3 . 61 - 3 . 72 ( m , 5h ), 2 . 13 ( s , 3h ), 0 . 93 - 1 . 02 ( m , 2h ), 0 . 00 ( s , 9h ). to a mixture of c3 ( 10 g , 29 mmol ), [ 4 -( benzyloxy )- 2 - methylphenyl ] boronic acid ( 10 . 4 g , 43 . 0 mmol ) and cesium carbonate ( 28 g , 86 mmol ) in 1 , 4 - dioxane ( 400 ml ) was added [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ) ( 2 . 2 g , 3 . 0 mmol ). the reaction mixture was heated at reflux for 4 hours , then filtered . the filtrate was concentrated , and the residue was purified by silica gel chromatography ( gradient : 10 % to 20 % ethyl acetate in petroleum ether ) to provide the product as a light yellow solid . yield : 10 g , 21 mmol , 72 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 34 - 7 . 49 ( m , 5h ), 7 . 00 ( d , half of ab quartet , j = 8 . 3 hz , 1h ), 6 . 91 - 6 . 97 ( m , 2h ), 5 . 50 ( ab quartet , j ab = 9 . 2 hz , δv ab = 4 . 1 hz , 2h ), 5 . 10 ( s , 2h ), 3 . 73 - 3 . 79 ( m , 2h ), 3 . 03 ( s , 3h ), 2 . 15 ( s , 3h ), 1 . 65 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). a mixture of c4 ( 10 g , 21 mmol ) and palladium hydroxide ( 2 g , dry ) in methanol ( 300 ml ) was stirred at room temperature for 24 hours under 40 psi of hydrogen . after filtration of the reaction mixture , the filtrate was concentrated to provide the product as a light yellow solid . yield : 8 . 0 g , 21 mmol , 100 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 6 . 92 ( d , half of ab quartet , j = 8 . 2 hz , 1h ), 6 . 81 - 6 . 87 ( m , 2h ), 5 . 52 ( ab quartet , j ab = 9 . 5 hz , δv ab = 2 . 7 hz , 2h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 03 ( s , 3h ), 2 . 11 ( s , 3h ), 1 . 65 ( s , 3h ), 0 . 99 - 1 . 05 ( m , 2h ), 0 . 01 ( s , 9h ). to a mixture of 2 - chloro - 3 - iodopyridine ( 2 . 39 g , 9 . 98 mmol ), cyclopropylboronic acid ( 860 mg , 10 mmol ) and potassium carbonate ( 4 . 14 g , 30 . 0 mmol ) in 1 , 4 - dioxane ( 50 ml ) was added tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 1 . 16 g , 1 . 00 mmol ). the reaction mixture was stirred at 120 ° c . for 4 hours , then diluted with ethyl acetate ( 50 ml ) and filtered . the filtrate was concentrated and the residue was purified by silica gel chromatography ( gradient : 10 % to 30 % ethyl acetate in petroleum ether ) to afford the product as a colorless oil . yield : 1 g , 6 mmol , 60 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 20 ( dd , j = 4 . 7 , 1 . 8 hz , 1h ), 7 . 24 - 7 . 28 ( m , 1h ), 7 . 14 ( br dd , j = 7 . 6 , 4 . 8 hz , 1h ), 2 . 12 - 2 . 21 ( m , 1h ), 1 . 04 - 1 . 11 ( m , 2h ), 0 . 67 - 0 . 72 ( m , 2h ). palladium ( ii ) acetate ( 61 mg , 0 . 27 mmol ) and di - tert - butyl [ 3 , 4 , 5 , 6 - tetramethyl - 2 ′, 4 ′, 6 - tri ( propan - 2 - yl ) biphenyl - 2 - yl ] phosphane ( 130 mg , 0 . 27 mmol ) were added to a mixture of c6 ( 615 mg , 4 . 00 mmol ), c5 ( 1 . 0 g , 2 . 6 mmol ) and cesium carbonate ( 2 . 6 g , 8 . 0 mmol ) in 1 , 4 - dioxane ( 25 ml ). the reaction mixture was stirred at 120 ° c . under microwave irradiation for 5 hours , then diluted with ethyl acetate ( 50 ml ) and filtered . after removal of solvents in vacuo , the residue was purified via silica gel chromatography ( gradient : 0 % to 25 % ethyl acetate in petroleum ether ) to provide the product as a yellow gum . yield : 900 mg , 1 . 8 mmol , 69 %. lcms m / z 494 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 02 ( dd , j = 4 . 8 , 1 . 8 hz , 1h ), 7 . 30 ( dd , j = 7 . 4 , 1 . 8 hz , 1h ), 7 . 11 - 7 . 14 ( m , 1h ), 7 . 08 - 7 . 10 ( m , 2h ), 7 . 01 ( dd , j = 7 . 5 , 4 . 8 hz , 1h ), 5 . 51 ( ab quartet , j ab = 9 . 3 hz , δv ab = 3 . 8 hz , 2h ), 3 . 74 - 3 . 80 ( m , 2h ), 3 . 08 ( s , 3h ), 2 . 18 ( s , 3h ), 2 . 16 - 2 . 24 ( m , 1h ), 1 . 70 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 4h ), 0 . 74 - 0 . 79 ( m , 2h ), 0 . 03 ( s , 9h ). trifluoroacetic acid ( 1 . 5 ml ) was added to a solution of c7 ( 875 mg , 1 . 77 mmol ) in dichloromethane ( 8 ml ). the reaction mixture was stirred at room temperature for 2 hours and concentrated in vacuo ; the residue was dissolved in methanol ( 10 ml ), treated with potassium carbonate ( 1 . 22 g , 8 . 83 mmol ) and stirred at room temperature for 18 hours . after removal of solids via filtration , the filtrate was concentrated under reduced pressure and partitioned between ethyl acetate and water . the aqueous layer was extracted three times with ethyl acetate , and the combined organic layers were washed sequentially with water and with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 100 % ethyl acetate in heptane ) afforded a mixture of 1 and 2 , which was separated via reversed phase chiral chromatography ( column : chiral technologies , chiralpak ia ; gradient : heptane in ethanol ). the first - eluting atropenantiomer , obtained as a solid that exhibited a positive (+) rotation , was designated as example 1 . yield : 210 mg , 0 . 578 mmol , 33 %. the second - eluting atropenantiomer , also obtained as a solid but with a negative (−) rotation , was designated as example 2 . yield : 190 mg , 0 . 523 mmol , 30 %. 1 : lcms m / z 364 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 7 . 94 ( br d , j = 5 hz , 1h ), 7 . 48 ( br d , j = 7 . 6 hz , 1h ), 7 . 22 ( d , j = 8 . 2 hz , 1h ), 7 . 03 - 7 . 14 ( m , 3h ), 3 . 04 ( s , 3h ), 2 . 20 ( s , 3h ), 2 . 15 - 2 . 23 ( m , 1h ), 1 . 63 ( s , 3h ), 0 . 99 - 1 . 06 ( m , 2h ), 0 . 75 - 0 . 82 ( m , 2h ). 2 : lcms m / z 364 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 7 . 94 ( dd , j = 4 . 8 , 1 . 7 hz , 1h ), 7 . 48 ( dd , j = 7 . 5 , 1 . 8 hz , 1h ), 7 . 22 ( d , j = 8 . 3 hz , 1h ), 7 . 09 - 7 . 14 ( m , 2h ), 7 . 06 ( dd , j = 8 . 4 , 2 . 3 hz , 1h ), 3 . 04 ( s , 3h ), 2 . 20 ( s , 3h ), 2 . 15 - 2 . 23 ( m , 1h ), 1 . 63 ( s , 3h ), 0 . 99 - 1 . 06 ( m , 2h ), 0 . 75 - 0 . 82 ( m , 2h ). cesium carbonate ( 476 mg , 1 . 46 mmol ) was added to a mixture of 3 - chloro - 2 , 5 - difluoropyridine ( 97 %, 150 mg , 0 . 97 mmol ) and c5 ( 366 mg , 0 . 972 mmol ) in dimethyl sulfoxide ( 5 ml ), and the reaction mixture was stirred at 80 ° c . for 6 hours . water was added , and the mixture was extracted three times with ethyl acetate ; the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 10 % to 40 % ethyl acetate in heptane ) provided the product as a sticky solid . yield : 414 mg , 0 . 818 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 96 ( d , j = 2 . 7 hz , 1h ), 7 . 64 ( dd , j = 7 . 1 , 2 . 7 hz , 1h ), 7 . 09 - 7 . 15 ( m , 3h ), 5 . 51 ( ab quartet , j ab = 9 . 3 hz , δv ab = 3 . 4 hz , 2h ), 3 . 74 - 3 . 80 ( m , 2h ), 3 . 07 ( s , 3h ), 2 . 19 ( s , 3h ), 1 . 69 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). trifluoroacetic acid ( 812 μl , 10 . 9 mmol ) was added to a solution of c8 ( 187 mg , 0 . 370 mmol ) in dichloromethane ( 3 . 0 ml ), and the reaction mixture was stirred at room temperature for 1 hour . solvents were removed in vacuo , and the residue was taken up in tetrahydrofuran ( 4 . 5 ml ) and treated with concentrated aqueous ammonium hydroxide ( 9 ml ). after 4 hours , the reaction mixture was concentrated under reduced pressure , combined with the crude product from an identical reaction carried out on c8 ( 200 mg , 0 . 395 mmol ), and purified via chromatography on silica gel ( gradient : 20 % to 40 % ethyl acetate in heptane ), to provide the racemic product as a white solid . yield : 219 mg , 0 . 583 mmol , 76 %. this was separated into its atropenantiomers via chiral chromatography ( column : phenomenex lux cellulose - 1 ; gradient : 50 % to 100 % ethanol in heptane ). the first - eluting atropenantiomer , which was obtained as a white solid , exhibited a negative (−) rotation and was designated as example 3 . yield : 25 mg , 66 μmol , 9 %. the second - eluting atropenantiomer was also a white solid , but exhibited a positive (+) rotation ; this was designated as example 4 . yield : 62 mg , 160 μmol , 21 %. 3 : lcms m / z 376 . 1 , 378 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 35 ( br s , 1h ), 7 . 97 ( d , j = 2 . 7 hz , 1h ), 7 . 64 ( dd , j = 7 . 1 , 2 . 8 hz , 1h ), 7 . 11 - 7 . 16 ( m , 3h ), 3 . 04 ( s , 3h ), 2 . 20 ( s , 3h ), 1 . 67 ( s , 3h ). 4 : lcms m / z 376 . 2 , 378 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 46 ( br s , 1h ), 7 . 97 ( d , j = 2 . 7 hz , 1h ), 7 . 64 ( dd , j = 7 . 1 , 2 . 7 hz , 1h ), 7 . 12 - 7 . 16 ( m , 3h ), 3 . 04 ( s , 3h ), 2 . 20 ( br s , 3h ), 1 . 67 ( s , 3h ). sodium hydride ( 1 . 84 g , 76 . 7 mmol ) was added in portions to a solution of 1 - ethylurea ( 5 . 7 g , 65 mmol ) and ethyl 2 - cyanopropanoate ( 7 . 5 g , 59 mmol ) in methanol ( 60 ml ) that had been cooled to 0 to 5 ° c . the reaction mixture was stirred for 18 hours and then was concentrated in vacuo . acetonitrile ( 200 ml ) was added , and the mixture was again concentrated to dryness . the residue was diluted with a mixture of acetonitrile ( 100 ml ) and water ( 30 ml ); 12 m aqueous hydrochloric acid was added drop - wise until the ph was approximately 1 - 2 . after the mixture had been stirred for 1 hour , the precipitate was collected via filtration and washed with tert - butyl methyl ether , affording the product as a white solid . yield : 8 . 15 g , 48 . 2 mmol , 82 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 3 . 84 ( q , j = 6 . 9 hz , 2h ), 1 . 66 ( s , 3h ), 1 . 07 ( t , j = 7 . 0 hz , 3h ). to a solution of c9 ( 6 . 2 g , 36 . 6 mmol ) in a 1 : 1 mixture of acetonitrile and water ( 70 ml ) were added sodium nitrite ( 3 . 8 g , 55 mmol ) and copper ( ii ) bromide ( 16 . 4 g , 73 . 4 mmol ), and the reaction mixture was stirred for 18 hours at room temperature . a mixture of 1 n aqueous sulfuric acid ( 100 ml ) and ethyl acetate ( 50 ml ) was added , and stirring was continued for 1 hour , at which time the organic layer was separated , and the aqueous layer was extracted with dichloromethane ( 2 × 100 ml ). the combined organic layers were concentrated in vacuo ; silica gel chromatography ( gradient : 0 % to 50 % ethyl acetate in petroleum ether ) provided the product as a green solid . yield : 5 . 0 g , 21 mmol , 57 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 87 ( br s , 1h ), 4 . 21 ( q , j = 7 . 0 hz , 2h ), 2 . 11 ( s , 3h ), 1 . 32 ( t , j = 7 . 0 hz , 3h ). compound c10 was converted to the product using the method described for synthesis of c3 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 1 . 28 g , 3 . 52 mmol , 17 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 5 . 41 ( s , 2h ), 4 . 24 ( q , j = 7 . 1 hz , 2h ), 3 . 65 - 3 . 72 ( m , 2h ), 2 . 13 ( s , 3h ), 1 . 31 ( t , j = 7 . 1 hz , 3h ), 0 . 94 - 1 . 01 ( m , 2h ), 0 . 00 ( s , 9h ). compound c11 was converted to the product using the method described for synthesis of c4 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 1 . 09 g , 2 . 27 mmol , 78 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 34 - 7 . 49 ( m , 5h ), 7 . 05 ( d , j = 8 . 2 hz , 1h ), 6 . 91 - 6 . 97 ( m , 2h ), 5 . 50 ( s , 2h ), 5 . 10 ( s , 2h ), 3 . 79 - 3 . 89 ( m , 1h ), 3 . 74 - 3 . 80 ( m , 2h ), 3 . 23 - 3 . 34 ( m , 1h ), 2 . 15 ( s , 3h ), 1 . 62 ( s , 3h ), 1 . 00 - 1 . 07 ( m , 5h ), 0 . 03 ( s , 9h ). the product , obtained as a gray solid , was synthesized from c12 using the method described for synthesis of c5 in examples 1 and 2 . yield : 800 mg , 2 . 05 mmol , 90 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 6 . 99 ( d , j = 8 . 2 hz , 1h ), 6 . 79 - 6 . 85 ( m , 2h ), 5 . 51 ( s , 2h ), 3 . 79 - 3 . 89 ( m , 1h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 24 - 3 . 34 ( m , 1h ), 2 . 12 ( s , 3h ), 1 . 62 ( s , 3h ), 0 . 99 - 1 . 06 ( m , 5h ), 0 . 02 ( s , 9h ). cesium carbonate ( 127 mg , 0 . 390 mmol ) and c13 ( 50 mg , 0 . 13 mmol ) were added to a solution of 2 , 3 - dichloropyridine ( 38 mg , 0 . 26 mmol ) in dimethyl sulfoxide ( 3 ml ), and the reaction mixture was heated at 80 ° c . for 18 hours . after removal of solids via filtration , the filtrate was partitioned between ethyl acetate ( 20 ml ) and water ( 20 ml ), and the aqueous layer was extracted with ethyl acetate ( 2 × 20 ml ). the combined organic layers were concentrated in vacuo and the residue was purified by preparative thin - layer chromatography on silica gel ( eluent : 3 : 1 petroleum ether / ethyl acetate ) to afford the product as a yellow gum . yield : 31 mg , 62 μmol , 48 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 08 ( dd , j = 4 . 7 , 1 . 4 hz , 1h ), 7 . 81 ( dd , j = 7 . 7 , 1 . 4 hz , 1h ), 7 . 11 - 7 . 19 ( m , 3h ), 7 . 05 ( dd , j = 7 . 6 , 4 . 9 hz , 1h ), 5 . 50 ( s , 2h ), 3 . 81 - 3 . 93 ( m , 1h ), 3 . 72 - 3 . 80 ( m , 2h ), 3 . 25 - 3 . 37 ( m , 1h ), 2 . 19 ( s , 3h ), 1 . 65 ( s , 3h ), 0 . 98 - 1 . 10 ( m , 5h ), 0 . 02 ( s , 9h ). compound c14 ( 31 mg , 62 μmol ) was treated with trifluoroacetic acid ( 3 ml ), and the reaction mixture was stirred at room temperature for 1 hour . removal of solvent in vacuo provided the product ( 24 . 8 mg ), which was used for the next step without further purification . to a solution of c15 ( from the previous step , 24 . 8 mg , ≦ 62 μmol ) in methanol ( 5 ml ) was added potassium carbonate ( 83 mg , 0 . 60 mmol ), and the reaction mixture was stirred at room temperature for 1 hour . after removal of solids via filtration , the filtrate was concentrated and the residue was purified by preparative thin - layer chromatography on silica gel ( eluent : 20 : 1 dichloromethane / methanol ) to afford the product as a white solid . yield : 7 . 7 mg , 21 μmol , 34 % over two steps . lcms m / z 372 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 07 ( dd , j = 4 . 8 , 1 . 5 hz , 1h ), 7 . 98 ( dd , j = 7 . 8 , 1 . 6 hz , 1h ), 7 . 32 ( d , j = 8 . 2 hz , 1h ), 7 . 12 - 7 . 21 ( m , 3h ), 3 . 78 - 3 . 89 ( m , 1h ), 3 . 27 - 3 . 38 ( m , 1h , assumed ; partially obscured by solvent peak ), 2 . 21 ( s , 3h ), 1 . 60 ( s , 3h ), 1 . 07 ( t , j = 7 . 1 hz , 3h ). ethyl 2 - cyanobutanoate was reacted with 1 - methylurea according to the method described for synthesis of c9 in example 5 . the product was obtained as a white solid . yield : 5 . 95 g , 35 . 2 mmol , 66 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 10 . 36 ( s , 1h ), 6 . 41 ( s , 2h ), 3 . 22 ( s , 3h ), 2 . 22 ( q , j = 7 . 3 hz , 2h ), 0 . 87 ( t , j = 7 . 3 hz , 3h ). to a solution of c16 ( 5 . 95 g , 35 . 2 mmol ) in a 1 : 1 mixture of acetonitrile and water ( 80 ml ) were added sodium nitrite ( 3 . 6 g , 52 mmol ) and copper ( ii ) bromide ( 15 . 7 g , 70 . 3 mmol ), and the reaction mixture was stirred for 18 hours at room temperature . a mixture of 1 n aqueous sulfuric acid ( 100 ml ) and ethyl acetate ( 50 ml ) was added , and stirring was continued for 1 hour . the resulting solid was collected via filtration and the filter cake was washed with aqueous ethyl acetate , providing the product as a white solid ( 4 g ). the organic layer of the filtrate was separated and the aqueous layer was extracted with dichloromethane ( 2 × 100 ml ); the combined organic layers were concentrated in vacuo to afford additional product as a green solid ( 3 g ). yield : 7 g , 30 mmol , 85 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 92 ( br s , 1h ), 3 . 62 ( s , 3h ), 2 . 58 ( q , j = 7 . 4 hz , 2h ), 1 . 09 ( t , j = 7 . 4 hz , 3h ). compound c17 was converted to the product using the method described for synthesis of c3 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 3 . 1 g , 8 . 5 mmol , 28 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 5 . 41 ( s , 2h ), 3 . 66 ( s , 3h ), 3 . 64 - 3 . 72 ( m , 2h ), 2 . 61 ( q , j = 7 . 4 hz , 2h ), 1 . 09 ( t , j = 7 . 4 hz , 3h ), 0 . 95 - 1 . 01 ( m , 2h ), 0 . 00 ( s , 9h ). compound c18 was converted to the product using the method employed for synthesis of c4 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 1 . 26 g , 2 . 62 mmol , 59 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 34 - 7 . 49 ( m , 5h ), 7 . 03 ( d , j = 8 . 0 hz , 1h ), 6 . 91 - 6 . 97 ( m , 2h ), 5 . 47 - 5 . 54 ( m , 2h ), 5 . 10 ( s , 2h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 00 ( s , 3h ), 2 . 18 - 2 . 29 ( m , 1h ), 2 . 16 ( s , 3h ), 1 . 86 - 1 . 97 ( m , 1h ), 0 . 99 - 1 . 07 ( m , 2h ), 0 . 91 ( t , j = 7 . 3 hz , 3h ), 0 . 03 ( s , 9h ). the product , obtained as a gray solid , was synthesized from c19 using the method described for synthesis of c5 in examples 1 and 2 . yield : 850 mg , 2 . 18 mmol , 83 %. lcms m / z 413 . 2 [ m + na + ]. 1 h nmr ( 400 mhz , cdcl 3 ) δ 6 . 97 ( d , j = 7 . 9 hz , 1h ), 6 . 79 - 6 . 86 ( m , 2h ), 5 . 48 - 5 . 54 ( m , 2h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 01 ( s , 3h ), 2 . 18 - 2 . 30 ( m , 1h ), 2 . 13 ( s , 3h ), 1 . 86 - 1 . 97 ( m , 1h ), 0 . 99 - 1 . 06 ( m , 2h ), 0 . 90 ( t , j = 7 . 3 hz , 3h ), 0 . 02 ( s , 9h ). a mixture of c20 ( 80 mg , 0 . 20 mmol ), 2 , 3 - dichloropyridine ( 45 mg , 0 . 30 mmol ) and cesium carbonate ( 199 mg , 0 . 611 mmol ) in dimethyl sulfoxide ( 8 ml ) was heated at 120 ° c . for 18 hours . after addition of water and ethyl acetate , the mixture was extracted with ethyl acetate . the combined organic layers were dried , filtered , and concentrated under reduced pressure . preparative thin - layer chromatography on silica gel ( eluent : 1 : 1 petroleum ether / ethyl acetate ) afforded the product as a colorless oil . yield : 82 mg , 0 . 16 mmol , 80 %. a solution of c21 ( 82 mg , 0 . 16 mmol ) in trifluoroacetic acid ( 3 ml ) was heated at 80 ° c . for 1 hour . after removal of solvent in vacuo , the residue was dissolved in methanol ( 5 ml ), treated with potassium carbonate ( 68 mg , 0 . 49 mmol ), and stirred at room temperature for 1 hour . the reaction mixture was filtered , and the filtrate was concentrated ; purification via preparative thin - layer chromatography ( eluent : ethyl acetate ) provided the product as a white solid . yield : 28 mg , 75 μmol , 47 %. lcms m / z 372 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 07 ( br d , j = 4 hz , 1h ), 7 . 97 ( d , j = 7 . 5 hz , 1h ), 7 . 29 ( d , j = 8 . 3 hz , 1h ), 7 . 11 - 7 . 21 ( m , 3h ), 3 . 01 ( s , 3h ), 2 . 22 ( s , 3h ), 2 . 17 - 2 . 27 ( m , 1h ), 1 . 87 - 1 . 98 ( m , 1h ), 0 . 93 ( t , j = 7 . 3 hz , 3h ). compound c2 ( 800 mg , 3 . 65 mmol ), di - tert - butyl dicarbonate ( 99 %, 966 mg , 4 . 38 mmol ), triethylamine ( 0 . 62 ml , 4 . 4 mmol ) and 4 -( dimethylamino ) pyridine ( 45 mg , 0 . 36 mmol ) were combined in tetrahydrofuran ( 15 ml ) and heated to 70 ° c . for 1 hour , then allowed to stir at room temperature for 18 hours . the reaction mixture was concentrated in vacuo , and the residue was purified via chromatography on silica gel ( gradient : 10 % to 25 % ethyl acetate in heptane ) to provide the product as a white solid . yield : 1 . 10 g , 3 . 45 mmol , 94 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 3 . 64 ( s , 3h ), 2 . 12 ( s , 3h ), 1 . 61 ( s , 9h ). a mixture of c22 ( 1 . 00 g , 3 . 13 mmol ), [ 4 -( benzyloxy )- 2 - methylphenyl ] boronic acid ( 98 %, 1 . 16 g , 4 . 68 mmol ), chloro ( 2 - dicyclohexylphosphino - 2 ′, 6 ′- dimethoxy - 1 , 1 ′- biphenyl )[ 2 -( 2 - aminoethylphenyl )] palladium ( ii )- tert - butyl methyl ether adduct ( s - phos precatalyst ) ( 119 mg , 0 . 156 mmol ), and cesium carbonate ( 3 . 06 g , 9 . 39 mmol ) in 2 - methyltetrahydrofuran ( 10 ml ) and water ( 3 ml ) was heated at 50 ° c . for 66 hours . the reaction mixture was diluted with water and ethyl acetate , and then filtered to remove suspended solids . the filtrate was extracted several times with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . the resulting solid was suspended in a 1 : 3 mixture of ethyl acetate and heptane , stirred for several minutes , and filtered , providing the product as a white solid . yield : 970 mg , 2 . 22 mmol , 71 %. lcms m / z 337 . 2 [( m - boc )+ h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 34 - 7 . 48 ( m , 5h ), 6 . 91 - 7 . 01 ( m , 3h ), 5 . 10 ( s , 2h ), 3 . 01 ( s , 3h ), 2 . 16 ( br s , 3h ), 1 . 66 ( s , 9h ), 1 . 64 ( s , 3h ). compound c23 ( 250 mg , 0 . 573 mmol ) was mixed with a 30 % solution of hydrogen bromide in acetic acid ( 1 ml , 5 mmol ) and allowed to stir for 18 hours at room temperature . after removal of acetic acid under reduced pressure , the residue was dissolved in a minimal quantity of ethanol and diluted with 4 m aqueous hydrochloric acid to provide a slightly cloudy mixture ; this was evaporated to dryness , and the resulting solid was suspended in 4 n aqueous hydrochloric acid , stirred for several minutes , and filtered , affording the product as a yellow solid . yield : 125 mg , 0 . 508 mmol , 89 %. lcms m / z 247 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 11 . 36 ( br s , 1h ), 9 . 71 ( v br s , 1h ), 6 . 99 ( d , j = 8 . 2 hz , 1h ), 6 . 76 ( d , j = 2 . 3 hz , 1h ), 6 . 72 ( d , j = 8 . 1 , 2 . 3 hz , 1h ), 2 . 82 ( s , 3h ), 2 . 03 ( s , 3h ), 1 . 44 ( s , 3h ). 2 - chloro - 3 -( trifluoromethyl ) pyridine ( 98 %, 269 mg , 1 . 45 mmol ), c24 ( 325 mg , 1 . 32 mmol ) and cesium carbonate ( 521 mg , 1 . 60 mmol ) were combined in n , n - dimethylformamide ( 6 ml ) and the resulting suspension was heated at 100 ° c . for 18 hours . after it had cooled to room temperature , the reaction mixture was diluted with aqueous 1 m hydrochloric acid and extracted several times with ethyl acetate . the combined organic layers were washed twice with water and once with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . the resulting solid was suspended in a 1 : 1 mixture of ethyl acetate and heptane , stirred for several minutes and collected by filtration , providing the product as a white solid . yield : 440 mg , 1 . 12 mmol , 85 %. lcms m / z 392 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 31 - 8 . 36 ( m , 2h ), 8 . 05 ( br d , j = 7 . 5 hz , 1h ), 7 . 13 - 7 . 22 ( m , 4h ), 3 . 06 ( s , 3h ), 2 . 21 ( s , 3h ), 1 . 69 ( s , 3h ). racemate c25 ( 1 . 30 g , 3 . 32 mmol ) was separated into its atropenantiomers via chiral chromatography ( column : phenomenex lux cellulose - 2 ; gradient : heptane / ethanol ). the first - eluting atropenantiomer , obtained as a tan solid that exhibited a negative (−) rotation , was designated as example 7 . yield : 536 mg , 1 . 37 mmol , 41 %. the second - eluting atropenantiomer , also obtained as a tan solid but with a positive (+) rotation , was designated as example 8 . yield : 553 mg , 1 . 41 mmol , 42 %. 7 : lcms m / z 392 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 34 ( ddq , j = 4 . 9 , 1 . 9 , 0 . 6 hz , 1h ), 8 . 30 ( br s , 1h ), 8 . 05 ( ddq , j = 7 . 6 , 1 . 9 , 0 . 7 hz , 1h ), 7 . 13 - 7 . 21 ( m , 4h ), 3 . 06 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 69 ( s , 3h ). 8 : lcms m / z 392 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 34 ( br d , j = 4 . 9 hz , 1h ), 8 . 30 ( br s , 1h ), 8 . 05 ( br d , j = 7 . 5 hz , 1h ), 7 . 13 - 7 . 22 ( m , 4h ), 3 . 06 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 69 ( s , 3h ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 98 %, 5 . 57 ml , 36 . 5 mmol ) was added to a suspension of c2 ( 4 . 00 g , 18 . 3 mmol ) and 4 -( chloromethyl )- 1 , 2 - dimethoxybenzene ( 5 . 16 g , 27 . 6 mmol ) in acetonitrile ( 80 ml ), and the reaction mixture was heated at 60 ° c . for 18 hours . after removal of solvent in vacuo , the residue was purified via silica gel chromatography ( gradient : 25 % to 50 % ethyl acetate in heptane ) to afford the product as a white solid . yield : 5 . 70 g , 15 . 4 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 08 - 7 . 12 ( m , 2h ), 6 . 80 ( d , j = 8 . 0 hz , 1h ), 5 . 07 ( s , 2h ), 3 . 88 ( s , 3h ), 3 . 85 ( s , 3h ), 3 . 65 ( s , 3h ), 2 . 14 ( s , 3h ). an aqueous solution of potassium carbonate ( 3 . 0 m , 14 ml , 42 mmol ) was added to a mixture of c26 ( 5 . 00 g , 13 . 5 mmol ), ( 4 - hydroxy - 2 - methylphenyl ) boronic acid ( 4 . 12 g , 27 . 1 mmol ), [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ), dichloromethane complex ( 98 %, 1 . 13 g , 1 . 36 mmol ) and 1 , 4 - dioxane ( 120 ml ). after the reaction mixture had been heated at 100 ° c . for 18 hours , it was cooled to room temperature , diluted with ethyl acetate and water , and filtered through diatomaceous earth . the organic layer from the filtrate was washed sequentially with saturated aqueous sodium bicarbonate solution and with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . purification using silica gel chromatography ( gradient : 25 % to 75 % ethyl acetate in heptane ) afforded the product as a white foam . yield : 2 . 71 g , 6 . 84 mmol , 51 %. lcms m / z 397 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 22 ( d , j = 2 . 0 hz , 1h ), 7 . 19 ( dd , j = 8 . 1 , 2 . 0 hz , 1h ), 6 . 93 ( d , j = 8 . 2 hz , 1h ), 6 . 83 ( d , j = 8 . 3 hz , 1h ), 6 . 80 - 6 . 82 ( m , 1h ), 6 . 76 - 6 . 80 ( m , 1h ), 5 . 16 ( ab quartet , j ab = 13 . 3 hz , δv ab = 19 . 2 hz , 2h ), 3 . 91 ( s , 3h ), 3 . 87 ( s , 3h ), 3 . 02 ( s , 3h ), 2 . 11 ( br s , 3h ), 1 . 66 ( s , 3h ). a mixture of 2 , 3 - dichloro - 5 - methylpyridine ( 735 mg , 4 . 54 mmol ), c27 ( 1 . 5 g , 3 . 8 mmol ) and cesium carbonate ( 2 . 46 g , 7 . 55 mmol ) in dimethyl sulfoxide ( 36 ml ) was stirred at 100 ° c . for 40 hours , and at 120 ° c . for a further 48 hours . the reaction mixture was diluted with water ( 300 ml ) and extracted with ethyl acetate ( 3 × 200 ml ); the combined organic layers were dried , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 10 % to 60 % ethyl acetate in petroleum ether ) provided the product as a yellow solid . yield : 1 . 7 g , 3 . 2 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 89 - 7 . 92 ( m , 1h ), 7 . 64 - 7 . 66 ( m , 1h ), 7 . 23 ( br d , j = 1 . 9 hz , 1h ), 7 . 20 ( br dd , j = 8 . 2 , 1 . 9 hz , 1h ), 7 . 10 - 7 . 12 ( br s , 1h ), 7 . 06 - 7 . 09 ( m , 2h ), 6 . 83 ( d , j = 8 . 2 hz , 1h ), 5 . 16 ( ab quartet , j ab = 13 . 4 hz , δv ab = 20 . 4 hz , 2h ), 3 . 91 ( s , 3h ), 3 . 87 ( s , 3h ), 3 . 06 ( s , 3h ), 2 . 32 ( s , 3h ), 2 . 16 ( s , 3h ), 1 . 68 ( s , 3h ). this experiment was carried out in three batches . a mixture of c28 ( 600 mg , 1 . 15 mmol ) and methoxybenzene ( 622 mg , 5 . 75 mmol ) in trifluoroacetic acid ( 20 ml ) was stirred at 120 ° c . for 48 hours , then at 125 ° c . for another 48 hours . the three batches were combined , concentrated under reduced pressure , and purified via chromatography on silica gel ( gradient : 10 % to 70 % ethyl acetate in petroleum ether ). the product was obtained as a light brown solid . yield : 690 mg , 1 . 86 mmol , 54 %. lcms m / z 371 . 8 , 373 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 7 . 90 - 7 . 92 ( m , 1h ), 7 . 82 - 7 . 84 ( m , 1h ), 7 . 23 ( d , j = 8 . 4 hz , 1h ), 7 . 14 ( br d , j = 2 . 2 hz , 1h ), 7 . 08 ( br dd , j = 8 . 2 , 2 . 2 hz , 1h ), 3 . 03 ( s , 3h ), 2 . 33 ( br s , 3h ), 2 . 20 ( br s , 3h ), 1 . 62 ( s , 3h ). compound c29 ( 690 mg , 1 . 86 mmol ) was separated into its atropenantiomers via supercritical fluid chromatography ( column : chiral technologies , chiralcel oj - h , 5 μm ; eluent : 7 : 3 carbon dioxide / methanol ). the first - eluting atropenantiomer , obtained as a solid that exhibited a positive (+) rotation , was designated as example 9 . yield : 240 mg , 0 . 645 mmol , 35 %. the second - eluting atropenantiomer , also obtained as a solid but with a negative (−) rotation , was designated as example 10 . yield : 250 mg , 0 . 672 mmol , 36 %. 9 : lcms m / z 372 . 1 , 374 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 36 ( br s , 1h ), 7 . 91 - 7 . 93 ( m , 1h ), 7 . 65 - 7 . 66 ( m , 1h ), 7 . 13 - 7 . 14 ( m , 1h ), 7 . 10 - 7 . 11 ( m , 2h ), 3 . 04 ( s , 3h ), 2 . 32 - 2 . 34 ( m , 3h ), 2 . 18 - 2 . 19 ( m , 3h ), 1 . 67 ( s , 3h ). 10 : lcms m / z 372 . 1 , 374 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 35 ( br s , 1h ), 7 . 91 - 7 . 93 ( m , 1h ), 7 . 65 - 7 . 66 ( m , 1h ), 7 . 13 - 7 . 14 ( m , 1h ), 7 . 10 - 7 . 11 ( m , 2h ), 3 . 04 ( s , 3h ), 2 . 33 ( dd , j = 0 . 7 , 0 . 7 hz , 3h ), 2 . 19 ( d , j = 0 . 6 hz , 3h ), 1 . 67 ( s , 3h ). a solution of c22 ( 23 . 3 g , 73 . 0 mmol ), [ 4 -( benzyloxy ) phenyl ] boronic acid ( 25 g , 110 mmol ), [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ) ( 2 . 68 g , 3 . 66 mmol ), and cesium carbonate ( 95 . 2 g , 292 mmol ) in 2 - methyltetrahydrofuran ( 360 ml ) and water ( 120 ml ) was purged with nitrogen and heated to 50 ° c . for 5 hours . after cooling to room temperature , the reaction mixture was stirred at room temperature for 18 hours , then diluted with water and ethyl acetate . the mixture was filtered , and the filtrate was extracted several times with ethyl acetate . the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . the resulting solid was combined with the solid collected from the initial filtration , and extracted several times with hot ethyl acetate ; the combined ethyl acetate extracts were concentrated under reduced pressure . the residue was suspended in a 1 : 3 mixture of ethyl acetate and heptane , stirred for several minutes , and filtered , affording the product as a gray solid , which was used without additional purification . yield : 21 . 8 g , 51 . 6 mmol , 71 %. lcms m / z 323 . 1 [( m - boc )+ h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : δ 7 . 46 - 7 . 51 ( m , 2h ), 7 . 42 ( br dd , j = 7 . 5 , 7 . 4 hz , 2h ), 7 . 32 - 7 . 38 ( m , 3h ), 7 . 18 ( br d , j = 8 . 8 hz , 2h ), 5 . 16 ( s , 2h ), 2 . 92 ( s , 3h ), 1 . 54 ( s , 9h ). compound c30 ( 21 . 8 g , 51 . 6 mmol ) was mixed with a 30 % solution of hydrogen bromide in acetic acid ( 100 ml , 520 mmol ) and stirred at room temperature for 4 hours . acetic acid was removed under reduced pressure , and the resulting oil was dissolved in a minimal quantity of ethanol and diluted with water , providing a slightly cloudy mixture . after this was evaporated to dryness , the resulting solid was suspended in water and stirred for several minutes . filtration afforded the product as a tan solid , which was used without additional purification . yield : 11 . 4 g , 49 . 1 mmol , 95 %. lcms m / z 233 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 11 . 34 ( br s , 1h ), 9 . 85 ( br s , 1h ), 7 . 14 ( br d , j = 8 . 6 hz , 2h ), 6 . 89 ( br d , j = 8 . 6 hz , 2h ), 2 . 88 ( s , 3h ), 1 . 50 ( s , 3h ). cesium carbonate ( 32 . 6 g , 100 mmol ) was added to a mixture of c31 ( 11 . 4 g , 49 . 1 mmol ) and 2 , 3 - dichloro - 4 - methylpyridine ( 11 . 9 g , 73 . 4 mmol ) in 1 - methylpyrrolidin - 2 - one ( 100 ml ), and the reaction mixture was heated at 140 ° c . for 24 hours . additional 2 , 3 - dichloro - 4 - methylpyridine ( 4 . 0 g , 25 mmol ) was added , and heating was continued for 24 hours . the reaction mixture was cooled to approximately 50 ° c . and poured into ice water ( 500 ml ); the resulting suspension was stirred for 5 minutes and then filtered . the collected solid was dissolved in hot ethanol ( 600 ml ), treated with charcoal and magnesium sulfate , and stirred under heating for 10 minutes . the hot mixture was filtered through diatomaceous earth , and the hot filtrate was diluted with heptane ( 400 ml ) while stirring , then cooled to 0 ° c . after stirring for 45 minutes at 0 ° c ., the mixture was filtered to afford the crude product as an off - white solid ( 11 . 75 g ). the filtrate was concentrated under reduced pressure , suspended in diethyl ether , and filtered to provide a solid , which was extracted several times with hot ethyl acetate ; the combined ethyl acetate extracts were concentrated in vacuo , yielding additional crude product ( 2 g ). the two lots of crude product were combined and recrystallized from ethyl acetate / heptane to afford the final product as a white solid . yield : 11 . 1 g , 31 . 0 mmol , 63 %. lcms m / z 358 . 2 , 360 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 11 . 42 ( br s , 1h ), 8 . 00 ( d , j = 5 . 0 hz , 1h ), 7 . 42 ( br d , j = 8 . 8 hz , 2h ), 7 . 30 ( br d , j = 8 . 7 hz , 2h ), 7 . 21 ( br d , j = 5 . 0 hz , 1h ), 2 . 91 ( s , 3h ), 2 . 44 ( s , 3h ), 1 . 53 ( s , 3h ). to a mixture of 2 - chloro - 3 -( difluoromethyl ) pyridine ( 15 g , 92 mmol ) and cesium carbonate ( 90 g , 280 mmol ) in dimethyl sulfoxide ( 300 ml ) was added 4 - bromo - 3 - methylphenol ( 19 . 8 g , 106 mmol ). the reaction mixture was stirred at 100 ° c . for 18 hours , then diluted with water ( 1 l ) and extracted with ethyl acetate ( 5 × 200 ml ). the combined organic layers were dried , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : 40 : 1 petroleum ether / ethyl acetate ) afforded the product as a white solid . yield : 27 g , 86 mmol , 93 %. 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 19 ( br d , j = 4 hz , 1h ), 8 . 07 ( d , j = 7 . 2 hz , 1h ), 7 . 56 ( d , j = 8 . 5 hz , 1h ), 7 . 19 - 7 . 25 ( m , 1h ), 7 . 10 ( br d , j = 2 . 5 hz , 1h ), 7 . 08 ( t , j hf = 54 . 8 hz , 1h ), 6 . 90 ( dd , j = 8 . 6 , 2 . 6 hz , 1h ), 2 . 39 ( s , 3h ). to a mixture of c32 ( 27 g , 86 mmol ), 4 , 4 , 4 ′, 4 ′, 5 , 5 , 5 ′, 5 ′- octamethyl - 2 , 2 ′- bi - 1 , 3 , 2 - dioxaborolane ( 32 . 8 g , 129 mmol ) and potassium acetate ( 25 . 8 g , 263 mmol ) in 1 , 4 - dioxane ( 500 ml ) was added [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ) ( 6 . 3 g , 8 . 6 mmol ). the mixture was stirred at 100 ° c . for 18 hours , then filtered . after concentration of the filtrate under reduced pressure , the residue was purified via silica gel chromatography ( eluent : petroleum ether ) to provide the product as a yellow oil . yield : 16 g , 44 mmol , 51 %. lcms m / z 362 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 18 - 8 . 22 ( m , 1h ), 8 . 07 ( br d , j = 7 hz , 1h ), 7 . 75 ( d , j = 8 . 0 hz , 1h ), 7 . 22 ( dd , j = 7 . 6 , 5 . 0 hz , 1h ), 7 . 07 ( t , j hf = 55 . 0 hz , 1h ), 6 . 93 ( br d , j = 2 hz , 1h ), 6 . 90 ( br dd , j = 8 , 2 hz , 1h ), 2 . 52 ( s , 3h ), 1 . 35 ( s , 12h ). compound c10 was converted to the product according to the method used for synthesis of c26 in examples 9 and 10 . the product was obtained as a light yellow oil . yield : 720 mg , 1 . 88 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 07 - 7 . 14 ( m , 2h ), 6 . 80 ( d , j = 8 . 2 hz , 1h ), 5 . 06 ( s , 2h ), 4 . 23 ( q , j = 7 . 0 hz , 2h ), 3 . 88 ( s , 3h ), 3 . 85 ( s , 3h ), 2 . 13 ( s , 3h ), 1 . 30 ( t , j = 7 . 0 hz , 3h ). to a mixture of c34 ( 57 . 5 mg , 0 . 150 mmol ), c33 ( 108 mg , 0 . 299 mmol ), and tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 17 mg , 15 μmol ) in a mixture of 1 , 4 - dioxane ( 3 ml ) and water ( 20 drops ) was added barium hydroxide ( 77 mg , 0 . 45 mmol ). the reaction mixture was stirred at 60 ° c . for 20 hours , then diluted with saturated aqueous ammonium chloride solution ( 20 ml ) and extracted with ethyl acetate ( 3 × 20 ml ). the combined organic layers were dried , filtered , and concentrated in vacuo . preparative high - performance liquid chromatography afforded the product as a white solid . yield : 30 mg , 56 μmol , 37 %. lcms m / z 538 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 28 ( br d , j = 4 hz , 1h ), 8 . 04 ( d , j = 7 . 2 hz , 1h ), 7 . 10 - 7 . 25 ( m , 6h ), 7 . 02 ( t , j hf = 55 . 1 hz , 1h ), 6 . 83 ( d , j = 8 . 2 hz , 1h ), 5 . 17 ( s , 2h ), 3 . 90 ( s , 3h ), 3 . 87 ( s , 3h ), 3 . 81 - 3 . 9 ( m , 1h ), 3 . 27 - 3 . 38 ( m , 1h ), 2 . 18 ( s , 3h ), 1 . 66 ( s , 3h ), 1 . 07 ( t , j = 7 . 0 hz , 3h ). compound c35 was deprotected using the method described for synthesis of c29 in examples 9 and 10 . in this case , purification was carried out via reversed phase high - performance liquid chromatography ( column : waters sunfire c18 , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 30 % to 50 % b ). lcms m / z 388 . 1 [ m + h ] + . 1 h nmr ( 600 mhz , dmso - d 6 ) δ 8 . 34 ( br d , j = 4 . 5 hz , 1h ), 8 . 13 ( br d , j = 7 . 2 hz , 1h ), 7 . 35 ( d , j = 8 . 3 hz , 1h ), 7 . 32 ( dd , j = 7 . 4 , 5 . 0 hz , 1h ), 7 . 28 ( t , j hf = 54 . 4 hz , 1h ), 7 . 24 ( br d , j = 2 . 1 hz , 1h ), 7 . 18 ( br dd , j = 8 . 2 , 2 . 3 hz , 1h ), 3 . 63 - 3 . 71 ( m , 1h ), 3 . 08 - 3 . 15 ( m , 1h ), 2 . 15 ( s , 3h ), 1 . 45 ( s , 3h ), 0 . 95 ( t , j = 7 . 0 hz , 3h ). this reaction was carried out 3 times . a mixture of potassium carbonate ( 282 g , 2 . 04 mol ) and n , n - dimethylformamide ( 750 ml ) was heated to 100 ° c . and slowly treated , in a drop - wise manner over 1 hour , with a solution of 2 - chloropyridin - 3 - ol ( 66 . 7 g , 515 mmol ) and sodium chloro ( difluoro ) acetate ( 200 g , 1 . 31 mol ) in n , n - dimethylformamide ( 750 ml ). after completion of the addition , the reaction mixture was stirred at 100 ° c . for 1 hour , then cooled to 25 ° c . and partitioned between water ( 10 l ) and tert - butyl methyl ether ( 5 l ). the aqueous layer was extracted with ethyl acetate ( 4 × 2 . 5 l ), and the combined organic layers were washed with saturated aqueous sodium chloride solution ( 6 × 2 . 5 l ), dried over sodium sulfate , filtered , and concentrated in vacuo . the combined crude products from the three reactions were purified via distillation at reduced pressure ( 30 - 40 ° c ., 1 - 5 mm hg ) to provide the product as a colorless oil . yield : 192 g , 1 . 07 mol , 69 %. lcms m / z 180 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 26 - 8 . 30 ( m , 1h ), 7 . 60 ( br d , j = 8 . 2 hz , 1h ), 7 . 28 ( br dd , j = 8 . 0 , 4 . 8 hz , 1h ), 6 . 60 ( t , j hf = 72 . 5 hz , 1h ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 6 . 00 ml , 40 . 2 mmol ) was added to a suspension of c2 ( 8 . 00 g , 36 . 5 mmol ) and benzyl chloromethyl ether ( 95 %, 5 . 86 ml , 40 . 2 mmol ) in acetonitrile ( 100 ml ). after 90 hours at room temperature , the reaction mixture was concentrated in vacuo , diluted with water , and extracted several times with ethyl acetate . the combined organic layers were washed sequentially with water and with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 10 % to 25 % ethyl acetate in heptane ) afforded the product as a white solid . yield : 10 . 1 g , 29 . 8 mmol , 82 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 24 - 7 . 39 ( m , 5h ), 5 . 52 ( s , 2h ), 4 . 71 ( s , 2h ), 3 . 63 ( s , 3h ), 2 . 11 ( s , 3h ). to a mixture of c37 ( 10 . 5 g , 31 . 0 mmol ), [ 4 -( methoxymethoxy )- 2 - methylphenyl ] boronic acid ( 7 . 58 g , 38 . 7 mmol ) and potassium carbonate ( 13 g , 94 mmol ) in 1 , 4 - dioxane ( 170 ml ) was added [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ), dichloromethane complex ( 1 . 3 g , 1 . 6 mmol ). the reaction mixture was stirred at 80 ° c . for 18 hours and filtered ; the filtrate was concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) provided the product as a yellow oil . yield : 10 . 5 g , 25 . 6 mmol , 83 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 25 - 7 . 46 ( m , 5h ), 6 . 93 - 7 . 02 ( m , 3h ), 5 . 60 ( ab quartet , j ab = 9 . 4 hz , δv ab = 9 . 7 hz , 2h ), 5 . 22 ( s , 2h ), 4 . 79 ( s , 2h ), 3 . 52 ( s , 3h ), 3 . 00 ( s , 3h ), 2 . 12 ( br s , 3h ), 1 . 63 ( s , 3h ). to a solution of c38 ( 9 . 0 g , 22 mmol ) in tetrahydrofuran ( 70 ml ) was added aqueous hydrochloric acid ( 8 m , 70 ml ), and the reaction mixture was stirred at room temperature for 1 hour . after extraction with ethyl acetate ( 5 × 100 ml ), the combined organic layers were concentrated in vacuo ; silica gel chromatography ( gradient : 0 % to 50 % ethyl acetate in petroleum ether ) afforded the product as a white solid . yield : 6 . 3 g , 17 mmol , 77 %. lcms m / z 389 . 0 [ m + na + ]. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 43 ( br d , j = 7 hz , 2h ), 7 . 25 - 7 . 37 ( m , 3h ), 6 . 91 ( d , j = 7 . 9 hz , 1h ), 6 . 78 - 6 . 84 ( m , 2h ), 5 . 61 ( ab quartet , j ab = 9 . 4 hz , δv ab = 9 . 2 hz , 2h ), 5 . 47 ( s , 1h ), 4 . 79 ( s , 2h ), 3 . 01 ( s , 3h ), 2 . 09 ( s , 3h ), 1 . 64 ( s , 3h ). a suspension of c39 ( 10 g , 27 mmol ), c36 ( 5 . 88 g , 32 . 7 mmol ), and cesium carbonate ( 99 %, 13 . 5 g , 41 . 0 mmol ) in dimethyl sulfoxide ( 200 ml ) was heated to 80 ° c . for 18 hours . compound c36 ( 2 . 9 g , 16 mmol ) was added , and the reaction mixture was heated at 90 ° c . for 3 hours , then at 80 ° c . for 66 hours . after cooling to room temperature , the reaction mixture was diluted with water and extracted three times with ethyl acetate . the combined organic layers were washed with water ( 5 × 300 ml ), washed with saturated aqueous sodium chloride solution ( 200 ml ), dried over magnesium sulfate , filtered , and concentrated in vacuo . purification via silica gel chromatography ( gradient : 25 % to 50 % ethyl acetate in heptane ) provided the product as a viscous , light yellow oil . yield : 10 . 8 g , 21 . 2 mmol , 78 %. lcms m / z 510 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 05 ( dd , j = 4 . 9 , 1 . 7 hz , 1h ), 7 . 61 - 7 . 65 ( m , 1h ), 7 . 40 - 7 . 44 ( m , 2h ), 7 . 30 - 7 . 36 ( m , 2h ), 7 . 24 - 7 . 29 ( m , 1h ), 7 . 11 - 7 . 16 ( m , 2h ), 7 . 10 ( dd , j = 7 . 9 , 4 . 9 hz , 1h ), 7 . 08 ( br d , j = 8 hz , 1h ), 6 . 70 ( t , j hf = 73 . 5 hz , 1h ), 5 . 61 ( ab quartet , j ab = 9 . 5 hz , δv ab = 9 . 2 hz , 2h ), 4 . 79 ( br s , 2h ), 3 . 04 ( s , 3h ), 2 . 16 ( br s , 3h ), 1 . 66 ( s , 3h ). a mixture of c40 ( 10 . 8 g , 21 . 2 mmol ) and trifluoroacetic acid ( 110 ml ) was heated at 80 ° c . for 1 hour . the reaction mixture was concentrated in vacuo , treated with dichloromethane and concentrated again , then treated with tetrahydrofuran , concentrated under reduced pressure , and dried under high vacuum . the residue was diluted with tetrahydrofuran ( 50 ml ), cooled in an ice bath , and treated with concentrated ammonium hydroxide ( 50 ml ). the flask was removed from the ice bath and the reaction mixture was stirred at room temperature for 45 minutes ; after removal of solvents in vacuo , purification via silica gel chromatography ( gradient : 25 % to 100 % ethyl acetate in heptane ) provided a racemic mixture of 13 and its atropenantiomer . this was combined with material obtained from a similar reaction carried out on c40 ( 15 . 3 g , 30 . 0 mmol ), and separated via supercritical fluid chromatography ( column : phenomenex lux cellulose - 2 , 5 μm ; eluent : 3 : 2 carbon dioxide / methanol ). the first - eluting atropenantiomer , which exhibited a negative (−) rotation , was assigned as atropenantiomer 13 . yield : 4 . 8 g , 12 mmol , 23 %. this material was dissolved in hot ethyl acetate ( 200 ml ) and slowly treated with heptane ( 100 ml ) while maintaining the mixture at reflux . after slowly cooling to room temperature , the mixture was stirred at room temperature for 18 hours , then cooled to 0 ° c . and stirred for 30 minutes . filtration afforded the product as a powdery white solid . yield : 4 . 17 g , 10 . 7 mmol , 89 % from the recrystallization . lcms m / z 390 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 11 . 45 ( br s , 1h ), 8 . 06 ( dd , j = 4 . 8 , 1 . 5 hz , 1h ), 7 . 81 ( br d , j = 7 . 9 hz , 1h ), 7 . 32 ( t , j hf = 73 . 4 hz , 1h ), 7 . 12 - 7 . 31 ( m , 4h ), 2 . 87 ( s , 3h ), 2 . 14 ( s , 3h ), 1 . 48 ( s , 3h ). compound c39 was reacted with 2 - chloro - 3 -( difluoromethyl ) pyridine using the method described for synthesis of c40 in example 13 . the product was obtained as a white solid . yield : 17 . 3 g , 35 . 1 mmol , 86 %. lcms m / z 494 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 27 - 8 . 31 ( m , 1h ), 8 . 02 - 8 . 07 ( m , 1h ), 7 . 41 - 7 . 46 ( m , 2h ), 7 . 32 - 7 . 37 ( m , 2h ), 7 . 26 - 7 . 31 ( m , 1h ), 7 . 08 - 7 . 21 ( m , 4h ), 7 . 03 ( t , j hf = 55 . 1 hz , 1h ), 5 . 62 ( ab quartet , j ab = 9 . 5 hz , δv ab = 9 . 5 hz , 2h ), 4 . 80 ( br s , 2h ), 3 . 05 ( s , 3h ), 2 . 17 ( br s , 3h ), 1 . 68 ( s , 3h ). compound c41 was converted to a racemic mixture of the products using the method described for synthesis 13 in example 13 . this racemate was obtained as an off - white solid . yield : 12 . 1 g , 32 . 4 mmol , 92 %. it was separated into its component atropenantiomers via supercritical fluid chromatography ( column : phenomenex lux cellulose - 2 , 5 μm ; eluent : 55 : 45 carbon dioxide / methanol ). the first - eluting atropenantiomer exhibited a negative (−) rotation , and was designated as example 14 ( 5 . 15 g ). this material was dissolved in hot ethyl acetate , concentrated to a volume of 50 ml , and allowed to crystallize at room temperature ; 14 was isolated as a white solid , 3 . 35 g . the filtrate was concentrated and similarly recrystallized to afford a white solid ( 450 mg ). combined yield of 14 : 3 . 8 g , 10 mmol , 28 %. the second - eluting atropenantiomer , obtained as an off - white solid exhibiting a positive (+) rotation , was designated as example 15 . yield : 4 . 9 g , 13 . 1 mmol , 37 %. 14 : lcms m / z 374 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 47 ( br s , 1h ), 8 . 27 - 8 . 31 ( m , 1h ), 8 . 02 - 8 . 07 ( m , 1h ), 7 . 12 - 7 . 21 ( m , 4h ), 7 . 03 ( t , j hf = 55 . 0 hz , 1h ), 3 . 06 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 68 ( s , 3h ). 15 : lcms m / z 374 . 0 [ m + h ] + . 1 h nmr ( 600 mhz , cdcl 3 ) δ 8 . 98 ( br s , 1h ), 8 . 29 ( br d , j = 4 . 7 hz , 1h ), 8 . 04 ( br d , j = 7 . 5 hz , 1h ), 7 . 13 - 7 . 21 ( m , 4h ), 7 . 03 ( t , j hf = 55 . 1 hz , 1h ), 3 . 06 ( s , 3h ), 2 . 21 ( s , 3h ), 1 . 68 ( s , 3h ). methylation of ethyl 3 - oxopentanoate according to the method of d . kalaitzakis et al ., tetrahedron : asymmetry 2007 , 18 , 2418 - 2426 , afforded ethyl 2 - methyl - 3 - oxopentanoate ; subsequent treatment with 1 equivalent of bromine in chloroform provided ethyl 4 - bromo - 2 - methyl - 3 - oxopentanoate . this crude material ( 139 g , 586 mmol ) was slowly added to a 0 ° c . solution of potassium hydroxide ( 98 . 7 g , 1 . 76 mol ) in water ( 700 ml ). the internal reaction temperature rose to 30 ° c . during the addition . the reaction mixture was then subjected to vigorous stirring for 4 hours in an ice bath , at which point it was acidified via slow addition of concentrated hydrochloric acid . after extraction with ethyl acetate , the aqueous layer was saturated with solid sodium chloride and extracted three additional times with ethyl acetate . the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated under reduced pressure to afford a mixture of oil and solid ( 81 . 3 g ). this material was suspended in chloroform ( 200 ml ); the solids were removed via filtration and washed with chloroform ( 2 × 50 ml ). the combined filtrates were concentrated in vacuo and treated with a 3 : 1 mixture of heptane and diethyl ether ( 300 ml ). the mixture was vigorously swirled until some of the oil began to solidify . it was then concentrated under reduced pressure to afford an oily solid ( 60 . 2 g ). after addition of a 3 : 1 mixture of heptane and diethyl ether ( 300 ml ) and vigorous stirring for 10 minutes , filtration afforded the product as an off - white solid . yield : 28 . 0 g , 219 mmol , 37 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 84 ( br q , j = 6 . 8 hz , 1h ), 1 . 74 ( br s , 3h ), 1 . 50 ( d , j = 6 . 8 hz , 3h ). trifluoromethanesulfonic anhydride ( 23 . 7 ml , 140 mmol ) was added portion - wise to a solution of c42 ( 15 . 0 g , 117 mmol ) and n , n - diisopropylethylamine ( 99 %, 24 . 8 ml , 140 mmol ) in dichloromethane ( 500 ml ) at − 20 ° c ., at a rate sufficient to maintain the internal reaction temperature below − 10 ° c . the reaction mixture was allowed to warm gradually from − 20 ° c . to 0 ° c . over 5 hours . it was then passed through a plug of silica gel , dried over magnesium sulfate , and concentrated in vacuo . the residue was suspended in diethyl ether and filtered ; the filtrate was concentrated under reduced pressure . purification using silica gel chromatography ( gradient : 0 % to 17 % ethyl acetate in heptane ) afforded the product as a pale yellow oil . yield : 21 . 06 g , 80 . 94 mmol , 69 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 5 . 09 - 5 . 16 ( m , 1h ), 1 . 94 - 1 . 96 ( m , 3h ), 1 . 56 ( d , j = 6 . 6 hz , 3h ). benzyl 4 - bromo - 3 - methylphenyl ether was converted to the product using the method described for synthesis of c33 in example 12 . the product was isolated as a yellow gel . yield : 15 g , 46 mmol , 67 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 73 ( d , j = 8 . 0 hz , 1h ), 7 . 30 - 7 . 46 ( m , 5h ), 6 . 76 - 6 . 82 ( m , 2h ), 5 . 08 ( s , 2h ), 2 . 53 ( s , 3h ), 1 . 34 ( s , 12h ). compound c43 ( 5 . 0 g , 19 mmol ), c44 ( 7 . 48 g , 23 . 1 mmol ), tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 2 . 22 g , 1 . 92 mmol ), and sodium carbonate ( 4 . 07 g , 38 . 4 mmol ) were combined in 1 , 4 - dioxane ( 100 ml ) and water ( 5 ml ), and heated at reflux for 2 hours . the reaction mixture was filtered and the filtrate was concentrated in vacuo . purification using silica gel chromatography ( eluents : 10 : 1 , then 5 : 1 petroleum ether / ethyl acetate ) provided the product as a white solid . yield : 5 . 8 g , 19 mmol , 100 %. nmr ( 400 mhz , cdcl 3 ) δ 7 . 33 - 7 . 49 ( m , 5h ), 6 . 98 ( d , j = 8 . 5 hz , 1h ), 6 . 94 ( br d , j = 2 . 5 hz , 1h ), 6 . 88 ( br dd , j = 8 . 3 , 2 . 5 hz , 1h ), 5 . 20 ( qq , j = 6 . 7 , 1 . 8 hz , 1h ), 5 . 09 ( s , 2h ), 2 . 21 ( s , 3h ), 1 . 78 ( d , j = 1 . 8 hz , 3h ), 1 . 31 ( d , j = 6 . 8 hz , 3h ). a solution of c45 ( 5 . 4 g , 18 mmol ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 13 . 3 g , 87 . 4 mmol ) in acetonitrile ( 100 ml ) was cooled to − 60 ° c . oxygen was bubbled into the reaction mixture for 20 minutes at − 60 ° c . ; the solution was then stirred at 50 ° c . for 18 hours . the reaction mixture was concentrated in vacuo and purified via silica gel chromatography ( eluent : 5 : 1 petroleum ether / ethyl acetate ) to provide the product as a colorless oil . yield : 3 . 5 g , 11 mmol , 61 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 7 . 33 - 7 . 49 ( m , 5h ), 6 . 92 - 6 . 96 ( m , 1h ), 6 . 88 ( dd , j = 8 . 5 , 2 . 5 hz , 1h ), 5 . 09 ( s , 2h ), 2 . 20 ( s , 3h ), 1 . 73 ( s , 3h ). a mixture of c46 ( 3 . 5 g , 11 mmol ) and hydrazine hydrate ( 85 % in water , 1 . 9 g , 32 mmol ) in n - butanol ( 60 ml ) was heated at reflux for 18 hours . after removal of volatiles under reduced pressure , the residue was stirred with ethyl acetate ( 20 ml ) for 30 minutes , whereupon filtration provided the product as a white solid . yield : 2 . 0 g , 6 . 2 mmol , 56 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 93 ( br s , 1h ), 7 . 33 - 7 . 51 ( m , 5h ), 6 . 96 ( s , 1h ), 6 . 88 - 6 . 94 ( m , 2h ), 5 . 10 ( s , 2h ), 2 . 04 ( s , 3h ), 1 . 95 ( s , 3h ), 1 . 91 ( s , 3h ). a mixture of c47 ( 17 . 8 g , 55 . 6 mmol ), 3 , 4 - dihydro - 2h - pyran ( 233 g , 2 . 77 mol ) and p - toluenesulfonic acid monohydrate ( 2 . 1 g , 11 mmol ) in tetrahydrofuran ( 800 ml ) was heated at reflux for 18 hours . triethylamine ( 10 ml , 72 mmol ) was added , and the mixture was concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 25 % ethyl acetate in petroleum ether ) afforded the product as a solid , presumed to be a mixture of diastereomeric atropisomers from its 1 h nmr spectrum . yield : 20 g , 49 mmol , 88 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 7 . 32 - 7 . 50 ( m , 5h ), 6 . 82 - 6 . 96 ( m , 3h ), 6 . 15 ( br d , j = 10 . 3 hz , 1h ), 5 . 08 ( s , 2h ), 4 . 14 - 4 . 23 ( m , 1h ), 3 . 76 - 3 . 85 ( m , 1h ), 2 . 28 - 2 . 41 ( m , 1h ), 2 . 01 and 2 . 04 ( 2 s , total 3h ), 1 . 97 and 1 . 98 ( 2 s , total 3h ), 1 . 89 and 1 . 89 ( 2 s , total 3h ). palladium ( 10 % on carbon , 1 . 16 g , 1 . 09 mmol ) was added to a solution of c48 ( 1 . 47 g , 3 . 63 mmol ) in methanol ( 30 ml ) and ethyl acetate ( 10 ml ), and the mixture was hydrogenated ( 50 psi ) on a parr shaker for 18 hours at room temperature . the reaction mixture was filtered through diatomaceous earth , and the filter pad was rinsed with ethyl acetate ; the combined filtrates were concentrated in vacuo and triturated with heptane , affording the product as a white solid , judged to be a mixture of diastereomeric atropisomers from its 1 h nmr spectrum . yield : 1 . 01 g , 3 . 21 mmol , 88 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 6 . 74 - 6 . 85 ( m , 3h ), 6 . 12 - 6 . 17 ( m , 1h ), 4 . 15 - 4 . 23 ( m , 1h ), 3 . 76 - 3 . 84 ( m , 1h ), 2 . 28 - 2 . 41 ( m , 1h ), 1 . 99 and 2 . 01 ( 2 s , total 3h ), 1 . 97 and 1 . 98 ( 2 s , total 3h ), 1 . 89 and 1 . 89 ( 2 s , total 3h ). compound c49 was reacted with 2 - chloro - 3 -( difluoromethyl ) pyridine using the method described for synthesis of c8 in examples 3 and 4 . the product was obtained as a white solid , presumed to be a mixture of diastereomeric atropisomers from its 1 h nmr spectrum . yield : 17 . 5 g , 39 . 6 mmol , 82 %. lcms m / z 358 . 2 [( m - tetrahydropyran )+ 1 ]. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 31 - 8 . 35 ( m , 1h ), 8 . 11 - 8 . 15 ( m , 1h ), 7 . 29 ( t , j hf = 54 . 5 hz , 1h ), 7 . 28 - 7 . 33 ( m , 1h ), 7 . 20 - 7 . 22 ( m , 1h ), 7 . 11 - 7 . 19 ( m , 2h ), 5 . 92 - 5 . 98 ( m , 1h ), 3 . 94 - 4 . 01 ( m , 1h ), 3 . 57 - 3 . 65 ( m , 1h ), 2 . 13 - 2 . 26 ( m , 1h ), 2 . 02 and 2 . 03 ( 2 br s , total 3h ), 1 . 93 - 2 . 0 ( m , 1h ), 1 . 92 ( s , 3h ), 1 . 78 ( s , 3h ), 1 . 61 - 1 . 74 ( m , 2h ), 1 . 48 - 1 . 58 ( m , 2h ). hydrogen chloride in 1 , 4 - dioxane ( 4 m , 198 ml , 792 mmol ) was added to a solution of c50 ( 17 . 5 g , 39 . 6 mmol ) in dichloromethane ( 200 ml ) and 1 , 4 - dioxane ( 200 ml ), and the reaction mixture was stirred at room temperature for 18 hours . after solvents had been removed in vacuo , the residue was suspended in diethyl ether ( 200 ml ) and slowly treated with a half - saturated aqueous solution of sodium bicarbonate . the suspension was vigorously stirred for 15 minutes , then filtered ; the collected solid was washed twice with water and twice with diethyl ether . the solid was then suspended in ethanol ( 200 ml ), concentrated to dryness , resuspended in ethanol ( 200 ml ) and concentrated once more . the residue was similarly treated with diethyl ether and with heptane to afford the racemic product as a white solid . yield : 12 . 0 g , 33 . 6 mmol , 85 %. lcms m / z 358 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 82 ( br s , 1h ), 8 . 32 - 8 . 36 ( m , 1h ), 8 . 10 - 8 . 15 ( m , 1h ), 7 . 29 ( t , j hf = 54 . 2 hz , 1h ), 7 . 28 - 7 . 33 ( m , 1h ), 7 . 19 - 7 . 22 ( m , 1h ), 7 . 10 - 7 . 17 ( m , 2h ), 2 . 02 ( s , 3h ), 1 . 87 ( s , 3h ), 1 . 74 ( s , 3h ). separation of the racemate into its component atropenantiomers was carried out via supercritical fluid chromatography ( column : chiral technologies , chiralpak as - h , 5 μm ; eluent : 85 : 15 carbon dioxide / methanol ). the first - eluting atropenantiomer , obtained as a white solid that exhibited a positive (+) rotation , was designated as example 16 . yield : 5 . 22 g , 14 . 6 mmol , 37 %. the second - eluting atropenantiomer , also obtained as a white solid but with a negative (−) rotation , was designated as example 17 . yield : 5 . 31 g , 14 . 8 mmol , 37 %. 16 : lcms m / z 358 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 23 - 8 . 27 ( m , 1h ), 8 . 08 - 8 . 12 ( m , 1h ), 7 . 26 ( dd , j = 7 . 5 , 4 . 9 hz , 1h ), 7 . 18 - 7 . 20 ( m , 1h ), 7 . 12 - 7 . 14 ( m , 2h ), 7 . 12 ( t , j hf = 55 hz , 1h ), 2 . 09 ( br d , j = 0 . 4 hz , 3h ), 2 . 00 ( s , 3h ), 1 . 90 ( s , 3h ). 17 : lcms m / z 358 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 23 - 8 . 27 ( m , 1h ), 8 . 08 - 8 . 12 ( m , 1h ), 7 . 26 ( dd , j = 7 . 6 , 5 . 0 hz , 1h ), 7 . 18 - 7 . 20 ( m , 1h ), 7 . 12 - 7 . 14 ( m , 2h ), 7 . 12 ( t , j hf = 55 hz , 1h ), 2 . 09 ( br d , j = 0 . 5 hz , 3h ), 2 . 00 ( s , 3h ), 1 . 90 ( s , 3h ). trifluoromethanesulfonic anhydride ( 1 . 3 g , 4 . 6 mmol ) was slowly added to a 0 ° c . solution of c5 ( 600 mg , 1 . 6 mmol ) in pyridine ( 15 ml ), and the reaction mixture was stirred at room temperature for 3 hours . after solvent had been removed under reduced pressure , the residue was purified by silica gel chromatography ( gradient : 5 % to 17 % ethyl acetate in petroleum ether ) to afford the product as a yellow oil . yield : 790 mg , 1 . 55 mmol , 97 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 27 - 7 . 33 ( m , 2h ), 7 . 21 - 7 . 25 ( m , 1h ), 5 . 50 ( ab quartet , j ab = 9 . 2 hz , δv ab = 4 . 1 hz , 2h ), 3 . 73 - 3 . 79 ( m , 2h ), 3 . 02 ( s , 3h ), 2 . 26 ( br s , 3h ), 1 . 63 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). tris ( dibenzylideneacetone ) dipalladium ( 0 ) ( 27 mg , 29 μmol ) and ( r )-(+ 1 -[( s p )- 2 -( dicyclohexylphosphino ) ferrocenyl ] ethyldi - tert - butylphosphine ( josiphos ligand , 33 mg , 60 μmol ) were added to a solution of c51 ( 305 mg , 0 . 600 mmol ) in degassed toluene ( 7 ml ), and the mixture was stirred for 5 minutes at room temperature . potassium thioacetate ( 274 mg , 2 . 40 mmol ) was added and the reaction mixture was heated at 120 ° c . for 24 hours . it was then filtered through a pad of diatomaceous earth , and the pad was washed with ethyl acetate ; the combined filtrates were concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) provided the product as a brown gum . yield : 172 mg , 0 . 396 mmol , 66 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 38 - 7 . 44 ( m , 2h ), 7 . 15 ( d , j = 7 . 8 hz , 1h ), 5 . 48 - 5 . 53 ( m , 2h ), 3 . 73 - 3 . 79 ( m , 2h ), 3 . 03 ( s , 3h ), 2 . 47 ( s , 3h ), 2 . 20 ( s , 3h ), 1 . 65 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). a solution of c52 ( 300 mg , 0 . 69 mmol ) and potassium hydroxide ( 168 mg , 2 . 99 mmol ) in a mixture of methanol ( 10 ml ) and water ( 3 drops ) was stirred at room temperature for 3 hours . after neutralization with 1 m aqueous hydrochloric acid , the mixture was concentrated in vacuo . preparative thin layer chromatography on silica gel ( eluent : 3 : 1 petroleum ether / ethyl acetate ) afforded the product as a yellow syrup . yield : 170 mg , 0 . 433 mmol , 63 % yield . compound c53 was reacted with 3 - chloro - 2 - fluoropyridine using the method described for synthesis of c8 in examples 3 and 4 . the product was obtained as a white solid . yield : 20 mg , 40 μmol , 40 %. a solution of c54 ( 20 mg , 40 μmol ) in trifluoroacetic acid ( 5 ml ) was stirred at room temperature for 18 hours . the reaction mixture was concentrated in vacuo and the residue was dissolved in methanol ( 5 ml ). potassium carbonate ( 69 mg , 0 . 50 mmol ) was added , and the reaction mixture was stirred at room temperature for 3 hours and filtered ; the filtrate was concentrated in vacuo and purified via preparative thin layer chromatography on silica gel ( eluent : 1 : 2 petroleum ether / ethyl acetate ) to provide the product as a white solid . yield : 7 . 5 mg , 20 μmol , 50 %. lcms m / z 374 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 25 ( dd , j = 4 . 7 , 1 . 6 hz , 1h ), 8 . 19 ( br s , 1h ), 7 . 64 ( dd , j = 7 . 9 , 1 . 6 hz , 1h ), 7 . 55 - 7 . 57 ( m , 1h ), 7 . 51 - 7 . 55 ( m , 1h ), 7 . 15 ( d , j = 7 . 8 hz , 1h ), 7 . 06 ( dd , j = 7 . 9 , 4 . 6 hz , 1h ), 3 . 05 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 68 ( s , 3h ). to a solution of tert - butyl 4 - bromo - 7 - methoxy - 1h - indole - 1 - carboxylate ( which may be prepared via tert - butoxycarbonyl protection of 4 - bromo - 7 - methoxy - 1h - indole ) ( 1 . 0 g , 3 . 1 mmol ) in 1 , 4 - dioxane ( 20 ml ) were added 4 , 4 , 4 ′, 4 ′, 5 , 5 , 5 ′, 5 ′- octamethyl - 2 , 2 ′- bi - 1 , 3 , 2 - dioxaborolane ( 1 . 46 g , 5 . 75 mmol ), potassium acetate ( 902 mg , 9 . 19 mmol ) and [ 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ), dichloromethane complex ( 498 mg , 0 . 610 mmol ). the reaction mixture was stirred for 5 hours at 120 ° c ., then cooled and filtered ; the filtrate was concentrated under reduced pressure and purified via silica gel chromatography ( gradient : 0 % to 6 % ethyl acetate in petroleum ether ) to afford the product as a yellow solid . yield : 520 mg , 1 . 4 mmol , 45 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 69 ( d , j = 8 . 0 hz , 1h ), 7 . 55 ( d , j = 3 . 5 hz , 1h ), 7 . 10 ( d , j = 3 . 6 hz , 1h ), 6 . 81 ( d , j = 8 . 0 hz , 1h ), 3 . 96 ( s , 3h ), 1 . 62 ( s , 9h ), 1 . 37 ( s , 12h ). to a solution of c55 ( 600 mg , 1 . 6 mmol ) in 1 , 4 - dioxane ( 20 ml ) were added c37 ( 600 mg , 1 . 8 mmol ), tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 186 mg , 0 . 161 mmol ) and barium hydroxide ( 830 mg , 4 . 8 mmol ). the reaction mixture was stirred for 18 hours at 60 ° c ., then cooled and filtered ; the filtrate was concentrated in vacuo and subjected to silica gel chromatography ( gradient : 0 % to 35 % ethyl acetate in petroleum ether ), providing the product as a yellow gum . yield : 310 mg , 0 . 61 mmol , 38 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 60 ( d , j = 3 . 6 hz , 1h ), 7 . 45 ( br d , j = 7 hz , 2h ), 7 . 27 - 7 . 39 ( m , 3h , assumed ; partially obscured by solvent peak ), 6 . 94 ( ab quartet , j ab = 8 . 2 hz , δv ab = 35 . 2 hz , 2h ), 6 . 24 ( d , j = 3 . 6 hz , 1h ), 5 . 63 ( ab quartet , j ab = 9 . 4 hz , δv ab = 6 . 7 hz , 2h ), 4 . 81 ( s , 2h ), 4 . 01 ( s , 3h ), 3 . 00 ( s , 3h ), 1 . 66 ( s , 9h ), 1 . 64 ( s , 3h ). boron tribromide ( 1 . 5 g , 6 . 0 mmol ) was added drop - wise to a − 78 ° c . solution of c56 ( 310 mg , 0 . 61 mmol ) in dichloromethane ( 10 ml ), and the reaction mixture was stirred for 18 hours at room temperature . after addition of methanol ( 10 ml ) and sodium bicarbonate ( 1 g ), the mixture was filtered and the filtrate was concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 4 % methanol in dichloromethane ) afforded the product as a yellow gum . yield : 40 mg , 0 . 15 mmol , 24 %. 1 h nmr ( 400 mhz , cd 3 od ) δ 7 . 29 ( d , j = 3 . 0 hz , 1h ), 6 . 70 ( ab quartet , j ab = 7 . 7 hz , δv ab = 41 . 9 hz , 2h ), 6 . 18 ( d , j = 3 . 1 hz , 1h ), 3 . 00 ( s , 3h ), 1 . 61 ( s , 3h ). 2 - chloro - 3 -( trifluoromethyl ) pyridine ( 133 mg , 0 . 733 mmol ) and cesium fluoride ( 12 mg , 79 μmol ) were added to a solution of c57 ( 20 mg , 74 μmol ) in n , n - dimethylformamide ( 5 ml ). the reaction mixture was stirred for 18 hours at 100 ° c ., then cooled and filtered . the filtrate was concentrated under reduced pressure , and the residue was purified by preparative thin layer chromatography on silica gel ( eluent : 10 : 1 dichloromethane / methanol ) to provide the product as a white solid . yield : 9 . 2 mg , 22 μmol , 30 %. lcms m / z 417 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 20 - 8 . 27 ( m , 2h ), 7 . 34 ( d , j = 3 . 1 hz , 1h ), 7 . 28 ( br dd , j = 7 , 5 hz , 1h ), 7 . 01 ( ab quartet , j ab = 7 . 9 hz , δv ab = 4 . 4 hz , 2h ), 6 . 35 ( d , j = 3 . 1 hz , 1h ), 3 . 05 ( s , 3h ), 1 . 65 ( s , 3h ). preparations p1 and p2 describe preparations of some starting materials or intermediates used for preparation of certain exemplar compounds of the invention . this experiment was carried out four times . tributyl ( methoxy ) stannane ( 400 g , 1 . 24 mol ), 1 - bromo - 4 - methoxy - 2 - methylbenzene ( 250 g , 1 . 24 mol ), prop - 1 - en - 2 - yl acetate ( 187 g , 1 . 87 mol ), palladium ( ii ) acetate ( 7 . 5 g , 33 mmol ) and tri - o - tolylphosphine ( 10 g , 33 mmol ) were stirred together in toluene ( 2 l ) at 100 ° c . for 18 hours . after it had cooled to room temperature , the reaction mixture was treated with aqueous potassium fluoride solution ( 4 m , 400 ml ) and stirred for 2 hours at 40 ° c . the resulting mixture was diluted with toluene ( 500 ml ) and filtered through diatomaceous earth ; the filter pad was thoroughly washed with ethyl acetate ( 2 × 1 . 5 l ). the organic phase from the combined filtrates was dried over sodium sulfate , filtered , and concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 5 % ethyl acetate in petroleum ether ) provided the product as a yellow oil . combined yield : 602 g , 3 . 38 mol , 68 %. lcms m / z 179 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 05 ( d , j = 8 . 3 hz , 1h ), 6 . 70 - 6 . 77 ( m , 2h ), 3 . 79 ( s , 3h ), 3 . 65 ( s , 2h ), 2 . 22 ( s , 3h ), 2 . 14 ( s , 3h ). compound c58 ( 6 . 00 g , 33 . 7 mmol ) and selenium dioxide ( 7 . 47 g , 67 . 3 mmol ) were suspended in 1 , 4 - dioxane ( 50 ml ) and heated at 100 ° c . for 18 hours . the reaction mixture was cooled to room temperature and filtered through diatomaceous earth ; the filtrate was concentrated in vacuo . silica gel chromatography ( eluent : 10 % ethyl acetate in heptane ) afforded the product as a bright yellow oil . yield : 2 . 55 g , 13 . 3 mmol , 39 %. lcms m / z 193 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 66 ( d , j = 8 . 6 hz , 1h ), 6 . 81 ( br d , half of ab quartet , j = 2 . 5 hz , 1h ), 6 . 78 ( br dd , half of abx pattern , j = 8 . 7 , 2 . 6 hz , 1h ), 3 . 87 ( s , 3h ), 2 . 60 ( br s , 3h ), 2 . 51 ( s , 3h ). compound c59 ( 4 . 0 g , 21 mmol ) and glycinamide acetate ( 2 . 79 g , 20 . 8 mmol ) were dissolved in methanol ( 40 ml ) and cooled to − 10 ° c . aqueous sodium hydroxide solution ( 12 n , 3 . 5 ml , 42 mmol ) was added , and the resulting mixture was slowly warmed to room temperature . after stirring for 3 days , the reaction mixture was concentrated in vacuo . the residue was diluted with water , and 1 m aqueous hydrochloric acid was added until the ph was approximately 7 . the aqueous phase was extracted with ethyl acetate , and the combined organic extracts were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated under reduced pressure . the resulting residue was slurried with 3 : 1 ethyl acetate / heptane , stirred for 5 minutes , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : ethyl acetate ) provided the product as a tan solid that contained 15 % of an undesired regioisomer ; this material was used without further purification . yield : 2 . 0 g . lcms m / z 231 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 09 ( s , 1h ), 7 . 14 ( d , j = 8 . 2 hz , 1h ), 6 . 82 - 6 . 87 ( m , 2h ), 3 . 86 ( s , 3h ), 2 . 20 ( s , 3h ), 2 . 11 ( s , 3h ). compound c60 ( from the previous step , 1 . 9 g ) was dissolved in n , n - dimethylformamide ( 40 ml ). lithium bromide ( 0 . 86 g , 9 . 9 mmol ) and sodium bis ( trimethylsilyl ) amide ( 95 %, 1 . 91 g , 9 . 89 mmol ) were added , and the resulting solution was stirred for 30 minutes . methyl iodide ( 0 . 635 ml , 10 . 2 mmol ) was added and stirring was continued at room temperature for 18 hours . the reaction mixture was then diluted with water and brought to a ph of approximately 7 by slow portion - wise addition of 1 m aqueous hydrochloric acid . the aqueous layer was extracted with ethyl acetate and the combined organic layers were washed several times with water , dried over magnesium sulfate , filtered , and concentrated . silica gel chromatography ( gradient : 75 % to 100 % ethyl acetate in heptane ) afforded the product as a viscous orange oil . yield : 1 . 67 g , 6 . 84 mmol , 33 % over two steps . lcms m / z 245 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 17 ( s , 1h ), 7 . 03 ( br d , j = 8 hz , 1h ), 6 . 85 - 6 . 90 ( m , 2h ), 3 . 86 ( s , 3h ), 3 . 18 ( s , 3h ), 2 . 08 ( br s , 3h ), 2 . 00 ( s , 3h ). to a − 78 ° c . solution of c61 ( 1 . 8 g , 7 . 4 mmol ) in dichloromethane ( 40 ml ) was added a solution of boron tribromide in dichloromethane ( 1 m , 22 ml , 22 mmol ). the cooling bath was removed after 30 minutes , and the reaction mixture was allowed to warm to room temperature and stir for 18 hours . the reaction was cooled to − 78 ° c ., and methanol ( 10 ml ) was slowly added ; the resulting mixture was gradually warmed to room temperature . after the solvent had been removed in vacuo , methanol ( 20 ml ) was added , and the mixture was again concentrated under reduced pressure . the residue was diluted with ethyl acetate ( 300 ml ) and water ( 200 ml ), the aqueous layer was brought to ph 7 via portion - wise addition of saturated aqueous sodium carbonate solution , and the mixture was extracted with ethyl acetate ( 3 × 200 ml ). the combined organic layers were washed with water and with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo to afford the product as a light tan solid . yield : 1 . 4 g , 6 . 0 mmol , 81 %. lcms m / z 231 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 21 ( s , 1h ), 6 . 98 ( d , j = 8 . 2 hz , 1h ), 6 . 87 - 6 . 89 ( m , 1h ), 6 . 85 ( br dd , j = 8 . 2 , 2 . 5 hz , 1h ), 3 . 22 ( s , 3h ), 2 . 06 ( br s , 3h ), 2 . 03 ( s , 3h ). 3 - methylphenol ( 9 . 0 g , 83 mmol ) was combined with trifluoromethanesulfonic acid ( 90 ml ), cooled to − 10 ° c ., and treated in a drop - wise manner with propanoyl chloride ( 7 . 7 g , 83 mmol ). the reaction mixture was stirred at − 10 ° c . for 3 hours and then at room temperature for 18 hours , whereupon it was poured into ice water ( 600 ml ). the resulting solid was collected via filtration and purified by silica gel chromatography ( gradient : 5 % to 70 % ethyl acetate in petroleum ether ) to afford the product as an off - white solid . yield : 6 . 7 g , 41 mmol , 49 %. 1 h nmr ( 400 mhz , cd 3 od ) δ 7 . 75 ( d , j = 8 . 5 hz , 1h ), 6 . 64 - 6 . 69 ( m , 2h ), 2 . 92 ( q , j = 7 . 3 hz , 2h ), 2 . 45 ( s , 3h ), 1 . 13 ( t , j = 7 . 3 hz , 3h ). this experiment was carried out in four batches . a mixture of c62 ( 1 . 0 g , 6 . 1 mmol ) and n , n - dimethylformamide dimethyl acetal ( 15 ml ) was stirred at 130 ° c . for 30 hours . the four reaction mixtures were combined and concentrated to dryness , providing the product as a dark oil . this was used for the next step without further purification . yield : 5 . 0 g , 21 mmol , 86 %. this experiment was carried out in two batches . a mixture of c63 ( from the previous step , 2 . 5 g , 11 mmol ), 1 - methylurea ( 1 . 35 g , 18 . 2 mmol ) and p - toluenesulfonic acid ( 3 . 13 g , 18 . 2 mmol ) in 1 , 4 - dioxane ( 100 ml ) was heated at reflux for 40 hours , then concentrated under reduced pressure . the residue was mixed with toluene ( 100 ml ), treated with p - toluenesulfonic acid ( 3 . 13 g , 18 . 2 mmol ) and heated at reflux for another 20 hours . the two crude products were combined and concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) afforded the product as a brown solid . yield : 2 . 5 g , 10 mmol , 45 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 52 ( s , 1h ), 6 . 98 ( br d , half of ab quartet , j = 9 hz , 1h ), 6 . 86 - 6 . 92 ( m , 2h ), 3 . 87 ( s , 3h ), 3 . 24 ( s , 3h ), 2 . 08 ( s , 3h ), 1 . 78 ( s , 3h ). to a − 70 ° c . solution of c64 ( 2 . 5 g , 10 mmol ) in dichloromethane ( 100 ml ) was added boron tribromide ( 17 . 9 g , 71 . 4 mmol ) drop - wise . the reaction mixture was stirred at − 60 ° c . to − 70 ° c . for 1 hour and then at room temperature for 18 hours , whereupon it was cooled to − 60 ° c . and quenched with methanol . water ( 100 ml ) was added , and the mixture was adjusted to a ph of 6 via slow addition of solid sodium bicarbonate . the mixture was extracted with dichloromethane ( 100 ml ) and with ethyl acetate ( 5 × 100 ml ); the combined organic layers were dried , filtered , and concentrated in vacuo . the residue was washed with a mixture of petroleum ether and ethyl acetate ( 4 : 1 , 40 ml ) and the solid was collected by filtration to afford the product as a yellow solid . yield : 2 . 2 g , 9 . 5 mmol , 95 %. lcms m / z 231 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 65 ( s , 1h ), 7 . 05 ( d , j = 8 . 3 hz , 1h ), 6 . 88 - 6 . 91 ( br s , 1h ), 6 . 87 ( br dd , j = 8 . 3 , 2 . 2 hz , 1h ), 3 . 38 ( s , 3h ), 2 . 11 ( s , 3h ), 1 . 89 ( s , 3h ). method a describes a specific method for preparations of certain exemplar compounds of the invention . a solution of c5 in n , n - dimethylformamide ( 0 . 33 m , 300 μl , 100 μmol ) was combined in a reaction vial with the appropriately substituted 2 - chloropyridine or 2 - fluoropyridine ( 100 μmol ). potassium carbonate ( 300 μmol ), copper ( i ) iodide ( 10 μmol ) and tetrabutylammonium bromide ( 20 μmol ) were added under nitrogen , and the vial was capped and shaken at 130 ° c . for 16 hours . solvent was removed using a speedvac ® concentrator , and the residue was partitioned between ethyl acetate ( 1 ml ) and water ( 1 ml ); the aqueous layer was extracted with ethyl acetate ( 2 × 1 ml ), and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated to provide the crude product , which was used directly in the following step . the 1 , 5 - dimethyl - 6 -[ 2 - methyl - 4 -( substituted pyridin - 2 - yloxy ) phenyl ]- 3 -{[ 2 -( trimethylsilyl ) ethoxy ] methyl } pyrimidine - 2 , 4 ( 1h , 3h )- dione ( c65 ) from the previous step was dissolved in a mixture of dichloromethane and trifluoroacetic acid ( 4 : 1 , 1 ml ), and the reaction vial was capped and shaken at 30 ° c . for 16 hours . after removal of solvents , the product was purified by high - performance liquid chromatography using one of the following systems : a ) dikma diamonsil ( 2 ) c18 , 5 μm ; mobile phase a : water containing 0 . 225 % formic acid ; mobile phase b : acetonitrile containing 0 . 225 % formic acid ; gradient : 35 % to 70 % b ; b ) phenomenex gemini c18 , 8 μm ; mobile phase a : aqueous ammonium hydroxide , ph 10 ; mobile phase b : acetonitrile ; gradient : 35 % to 75 % b . table 1 below lists some additional exemplar compounds of invention ( examples 20 - 81 ) that were made using methods , intermediates , and preparations described herein . 7 . the requisite 2 - chloropyridine was prepared via reaction of 2 - chloro - 3 - iodopyridine with a salt of the appropriate azetidine , using palladium ( ii ) acetate , 1 , 1 ′- binaphthalene - 2 , 2 ′- diylbis ( diphenylphosphane ) ( binap ) and cesium carbonate in toluene at elevated temperature . 8 . reaction of 2 - chloropyridin - 3 - ol with bromocyclopropane , in the presence of cesium carbonate in n , n - dimethylacetamide at 150 ° c ., afforded 2 - chloro - 3 -( cyclopropyloxy ) pyridine . 9 . reaction of 2 - chloro - 5 - fluoropyridin - 4 - ol with iodomethane and silver carbonate provided 2 - chloro - 5 - fluoro - 4 - methoxypyridine . 10 . the reaction between phenol c5 and the chloropyridine was effected via reaction with copper ( i ) iodide and cesium carbonate in pyridine at 120 ° c . 13 . olefin reduction was effected via hydrogenation using palladium on carbon and n , n - diisopropylethylamine in methanol . 14 . in this case , reaction with the chloropyridine was carried out using 4 , 5 - bis ( diphenylphosphino )- 9 , 9 - dimethylxanthene ( xantphos ) in place of di - tert - butyl [ 3 , 4 , 5 , 6 - tetramethyl - 2 ′, 4 ′, 6 ′- tri ( propan - 2 - yl ) biphenyl - 2 - yl ] phosphane . 15 . 1 -( 2 - chloropyridin - 3 - yl ) ethanone was converted to 2 - chloro - 3 -( 1 , 1 - difluoroethoxyl ) pyridine using the method of d . b . horne et al ., tetrahedron lett . 2009 , 50 , 5452 - 5455 . upon deprotection , the difluoroethoxy group was also cleaved . 16 . in this case , cesium fluoride was used in place of cesium carbonate in the reaction of the chloropyridine with phenol c49 . 17 . compound c3 was reacted with ( 4 - hydroxyphenyl ) boronic acid , under the conditions described for preparation of c4 in examples 1 and 2 , to afford 6 -( 4 - hydroxyphenyl )- 1 , 5 - dimethyl - 3 -{[ 2 -( trimethylsilyl ) ethoxy ] methyl } pyrimidine - 2 , 4 ( 1h , 3h )- dione . 18 . in this case , the deprotection was carried out in trifluoroacetic acid at 100 ° c . 19 . the racemic product was separated into its atropenantiomers via high - performance liquid chromatography ( column : chiral technologies , chiralpak ad - h , 5 μm ; gradient : ethanol in heptane ). this example was the first - eluting atropenantiomer , and exhibited a positive (+) rotation . 20 . compound c49 was reacted with 2 - chloro - 3 - iodopyridine to afford 5 -{ 4 -[( 3 - iodopyridin - 2 - yl ) oxy ]- 2 - methylphenyl }- 4 , 6 - dimethyl - 2 -( tetrahydro - 2h - pyran - 2 - yl ) pyridazin - 3 ( 2h )- one ; subsequent suzuki reaction with cyclopropylboronic acid provided 5 -{ 4 -[( 3 - cyclopropylpyridin - 2 - yl ) oxy ]- 2 - methylphenyl }- 4 , 6 - dimethyl - 2 -( tetrahydro - 2h - pyran - 2 - yl ) pyridazin - 3 ( 2h )- one . deprotection in this case was carried out with trifluoroacetic acid rather than hydrochloric acid . 21 . the requisite 2 - chloro - 3 -( oxetan - 3 - yl ) pyridine was prepared from ( 2 - chloropyridin - 3 - yl ) boronic acid using the method reported by m . a . j . duncton et al ., org . lett . 2008 , 10 , 3259 - 3262 . 22 . 2 - chloro - 3 -( difluoromethoxy )- 4 - methylpyridine was prepared from 2 - chloro - 4 - methylpyridin - 3 - ol using conditions reported by l . f . frey et al ., tetrahedron 2003 , 59 , 6363 - 6373 . 23 . the racemic product was separated into its component atropenantiomers using chiral separation . conditions for analytical hplc . column : chiralpak ad - h , 20 × 250 mm ; mobile phase a : heptane ; mobile phase b : ethanol ; gradient : 5 . 0 % to 95 % b , linear over 12 minutes ; flow rate : 28 ml / minute . the first - eluting atropenantiomer , which exhibited a positive (+) rotation , was designated as example 55 ; the second - eluting one , which gave a negative (−) rotation , was designated as example 54 . 24 . the requisite 2 -[ 1 -( 3 , 4 - dimethoxybenzyl )- 3 , 5 - dimethyl - 2 , 6 - dioxo - 1 , 2 , 3 , 6 - tetrahydropyrimidin - 4 - yl ]- 5 - hydroxybenzonitrile was prepared via reaction of c26 with 5 - hydroxy - 2 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) benzonitrile , mediated by chloro ( 2 - dicyclohexylphosphino - 2 ′, 6 ′- dimethoxy - 1 , 1 ′- biphenyl )[ 2 -( 2 ′- amino - 1 , 1 ′- biphenyl )] palladium ( ii ) and potassium phosphate . 25 . conditions for analytical hplc . column : waters atlantis dc18 , 4 . 6 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 5 . 0 % to 95 % b , linear over 4 . 0 minutes ; flow rate : 2 ml / minute . 26 . reaction of c49 with methyl 2 - chloropyridine - 3 - carboxylate afforded methyl 2 -{ 4 -[ 3 , 5 - dimethyl - 6 - oxo - 1 -( tetrahydro - 2h - pyran - 2 - yl )- 1 , 6 - dihydropyridazin - 4 - yl ]- 3 - methylphenoxy } pyridine - 3 - carboxylate ; the ester group was converted to an amide via subjection to ammonium hydroxide in methanol at elevated temperature , to provide 2 -{ 4 -[ 3 , 5 - dimethyl - 6 - oxo - 1 -( tetrahydro - 2h - pyran - 2 - yl )- 1 , 6 - dihydropyridazin - 4 - yl ]- 3 - methylphenoxy } pyridine - 3 - carboxamide . 27 . methyl 2 -{ 4 -[ 3 , 5 - dimethyl - 6 - oxo - 1 -( tetrahydro - 2h - pyran - 2 - yl )- 1 , 6 - dihydropyridazin - 4 - yl ]- 3 - methylphenoxy } pyridine - 3 - carboxylate ( see footnote 26 ) was deprotected to afford this example . 28 . 2 , 4 - dichloro - 3 - methylpyridine was converted to 2 - chloro - 4 - methoxy - 3 - methylpyridine via reaction with sodium hydride / methanol . 29 . in this case , the deprotection was carried out with trifluoroacetic acid in dichloromethane at room temperature . 30 . the requisite 2 - chloro - 4 - methyl - 3 -( trifluoromethyl ) pyridine was prepared via reaction of 2 - chloro - 3 - iodo - 4 - methylpyridine with methyl difluoro ( fluorosulfonyl ) acetate and copper ( i ) iodide in n , n - dimethylformamide at 90 ° c . 32 . reaction of 2 , 4 - dichloro - 3 - iodopyridine with sodium methoxide in methanol provided 2 - chloro - 3 - iodo - 4 - methoxypyridine ; this material was converted to 2 - chloro - 4 - methoxy - 3 -( trifluoromethyl ) pyridine as described in footnote 30 . 33 . the final deprotection was carried using hydrogen chloride in methanol , at room temperature . 34 . deprotection was carried out using the method described in examples 16 and 17 . 35 . separation of atropenantiomers was carried out via supercritical fluid chromatography ( column : chiral technologies , chiralpak as - h , 5 μm ; eluent : 85 : 15 carbon dioxide / methanol ). the first - eluting atropenantiomer exhibited a positive (+) rotation , and was designated as example 66 . the second - eluting atropenantiomer displayed a negative (−) rotation , and was designated as example 65 . 36 . in this case , mass spectrometry data was obtained on the racemate , prior to separation of the atropenantiomers . 37 . compound c37 was reacted with ( 4 - hydroxyphenyl ) boronic acid , using the method described for preparation of c4 in examples 1 and 2 , to afford 3 -[( benzyloxy ) methyl ]- 6 -( 4 - hydroxyphenyl )- 1 , 5 - dimethylpyrimidine - 2 , 4 ( 1h , 3h )- dione . 38 . conditions for reaction of the phenol with the chloropyridine were similar to those used for synthesis of c7 in examples 1 and 2 . 39 . after the coupling reaction , the reaction mixture was partitioned between water and ethyl acetate . the organic layer was dried with sodium sulfate and concentrated in vacuo ; this material was deprotected with hydrogen chloride in 1 , 4 - dioxane . 40 . purification was effected via reversed phase high - performance liquid chromatography . column : waters sunfire c18 , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 30 % to 50 % b . 41 . purification was carried out via reversed phase high - performance liquid chromatography using an appropriate gradient in one of the following systems : a ) column : agela durashell c18 , 5 μm ; mobile phase a : ammonium hydroxide in water , ph 10 ; mobile phase b : acetonitrile ; b ) column : phenomenex gemini , 10 μm ; mobile phase a : ammonium hydroxide in water , ph 10 ; mobile phase b : acetonitrile ; c ) column : phenomenex gemini , 8 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; d ) column : yms c18 , 5 μm ; mobile phase a : ammonium hydroxide in water , ph 10 ; mobile phase b : acetonitrile . 42 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm . mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile . gradient : 0 to 0 . 5 minutes , 10 % b ; 0 . 5 to 4 . 0 minutes , linear from 10 % to 100 % b . flow rate : 0 . 8 ml / minute . 43 . compound c33 was reacted with 6 - bromo - 3 -( 3 , 4 - dimethoxybenzyl )- 1 - cyclopropyl - 5 - methylpyrimidine - 2 , 4 ( 1h , 3h )- dione , using the method described for example 12 , to yield example 81 . the intermediate , 6 - bromo - 3 -( 3 , 4 - dimethoxybenzyl )- 1 - cyclopropyl - 5 - methylpyrimidine - 2 , 4 ( 1h , 3h )- dione , was prepared from commercially available 1 - cyclopropyl urea following the methods described for the preparation of c10 and c34 . the affinity of the compounds described herein was determined by competition binding assays similar to those described in ryman - rasmussen et al ., “ differential activation of adenylate cyclase and receptor internalization by novel dopamine d1 receptor agonists ”, molecular pharmacology 68 ( 4 ): 1039 - 1048 ( 2005 ). this radioligand binding assay used [ 3 h ]- sch23390 , a radiolabeled d1 ligand , to evaluate the ability of a test compound to compete with the radioligand when binding to a d1 receptor . d1 binding assays were performed using over - expressing ltk human cell lines . to determine basic assay parameters , ligand concentrations were determined from saturation binding studies where the k d for [ 3 h ]- sch23390 was found to be 1 . 3 nm . from tissue concentration curve studies , the optimal amount of tissue was determined to be 1 . 75 mg / ml per 96 well plate using 0 . 5 nm of [ 3 h ]- sch23390 . these ligand and tissue concentrations were used in time course studies to determine linearity and equilibrium conditions for binding . binding was at equilibrium with the specified amount of tissue in 30 minutes at 37 ° c . from these parameters , k i values were determined by homogenizing the specified amount of tissue for each species in 50 mm tris ( ph 7 . 4 at 4 ° c .) containing 2 . 0 mm mgcl 2 using a polytron and spun in a centrifuge at 40 , 000 × g for 10 minutes . the pellet was resuspended in assay buffer [ 50 mm tris ( ph 7 . 4 @ rt ) containing 4 mm mgso 4 and 0 . 5 mm edta ]. incubations were initiated by the addition of 200 μl of tissue to 96 - well plates containing test drugs ( 2 . 5 μl ) and 0 . 5 nm [ 3 h ]- sch23390 ( 50 μl ) in a final volume of 250 μl . non - specific binding was determined by radioligand binding in the presence of a saturating concentration of (+)- butaclamol ( 10 μm ), a d1 antagonist . after a 30 minute incubation period at 37 ° c ., assay samples were rapidly filtered through unifilter - 96 gf / b pei - coated filter plates and rinsed with 50 mm tris buffer ( ph 7 . 4 at 4 ° c .). membrane bound [ 3 h ]- sch23390 levels were determined by liquid scintillation counting of the filterplates in ecolume . the ic 50 value ( concentration at which 50 % inhibition of specific binding occurs ) was calculated by linear regression of the concentration - response data in microsoft excel . k , values were calculated according to the cheng - prusoff equation : where [ l ]= concentration of free radioligand and k d = dissociation constant of radioligand for d1 receptor ( 1 . 3 nm for [ 3 h ]- sch23390 ). the d1 camp ( cyclic adenosine monophosphate ) htrf ( homogeneous time - resolved fluorescence ) assay used and described herein is a competitive immunoassay between native camp produced by cells and camp labeled with xl - 665 . this assay was used to determine the ability of a test compound to agonize ( including partially agonize ) d1 . a mab anti - camp labeled cryptate visualizes the tracer . the maximum signal is achieved if the samples do not contain free camp due to the proximity of donor ( eu - cryptate ) and acceptor ( xl665 ) entities . the signal , therefore , is inversely proportional to the concentration of camp in the sample . a time - resolved and ratiometric measurement ( em 665 nm / em 620 nm ) minimizes the interference with medium . camp htrf assays are commercially available , for example , from cisbio bioassays , iba group . the camp dynamic kit was obtained from cisbio international ( cisbio 62am4pej ). multidrop combi ( thermo scientific ) was used for assay additions . an envision ( perkinelmer ) reader was used to read htrf . a hek293t / hd1 # 1 stable cell line was constructed internally ( pfizer ann arbor ). the cells were grown as adherent cells in nunct 500 flasks in high glucose dmem ( invitrogen 11995 - 065 ), 10 % fetal bovine serum dialyzed ( invitrogen 26400 - 044 ), 1 × mem neaa ( invitrogen 1140 , 25 mm hepes ( invitrogen 15630 ), lx pen / strep ( invitrogen 15070 - 063 ) and 500 μg / ml genenticin ( invitrogen 10131 - 035 ) at 37 ° c . and 5 % co 2 . at 72 or 96 hours post - growth , cells were rinsed with dpbs , and 0 . 25 % trypsin - edta was added to dislodge the cells . media was then added and cells were centrifuged and media removed . the cell pellets were re - suspended in cell culture freezing medium ( invitrogen 12648 - 056 ) at a density of 4e7 cells / ml . one ml aliquots of the cells were made in cryo - vials and frozen at − 80 ° c . for future use in the d1 htrf assay . frozen cells were quickly thawed , re - suspended in 50 ml warm media and allowed to sit for 5 min prior to centrifugation ( 1000 rpm ) at room temperature . media was removed and cell pellet was re - suspended in pbs / 0 . 5 μm ibmx generating 2e5 cells / ml . using a multidrop combi , 5 μl cells / well was added to the assay plate ( greiner 784085 ), which already contained 5 μl of a test compound . compound controls [ 5 μm dopamine ( final ) and 0 . 5 % dmso ( final )] were also included on every plate for data analysis . cells and compounds were incubated at room temperature for 30 min . working solutions of camp - d2 and anti - camp - cryptate were prepared according to cisbio instructions . using multidrop , 5 μl camp - d2 working solution was added to the assay plate containing the test compound and cells . using multidrop , 5 μl anti - camp - cryptate working solutions was added to assay plate containing test compound , cells and camp - d2 . the assay plate was incubated for 1 hour at room temperature . the assay plate was read on an envision plate reader using cisbio recommended settings . a camp standard curve was generated using camp stock solution provided in the cisbio kit . data analysis was done using computer software . percent effects were calculated from the compound controls . ratio ec 50 was determined using the raw ratio data from the envision reader . the camp standard curve was used in an analysis program to determine camp concentrations from raw ratio data . camp ec 50 was determined using the calculated camp data . various modifications of the invention , in addition to those described herein , will be apparent to those skilled in the art from the foregoing description . such modifications are also intended to fall within the scope of the appendant claims . each reference ( including all patents , patent applications , journal articles , books , and any other publications ) cited in the present application is hereby incorporated by reference in its entirety .
| 2Chemistry; Metallurgy
|
as indicated in fig1 , a typical swimming pool comprises a pool 10 , which has a drain 11 and sump 12 at the bottom of the pool , and a skimmer 14 , which carries away overflow and collects floating debris , a strainer 15 at the inlet to a pump 16 , a filter 17 , a water main 18 , a source of fresh water , a system outlet 19 and a pool inlet 20 . pipes 21 - 30 and valves 31 - 36 connect all of the aforesaid elements . in normal operation water is taken from the pool through the skimmer 14 , the pipe 21 , the valve 31 , pipes 22 and 23 , strainer 15 , pump 16 , pipe 24 , valve 32 , pipe 25 , filter 17 , pipe 26 , valve 33 and pipe 27 , back to the pool inlet 20 . valve 34 allows water to be recirculated in whole or in part from the bottom drain 11 and valve 35 allows water to be gravity dumped through pipe 29 to the system outlet 19 . valve 36 connects the main 18 to replenish through pipes 28 and 23 . the valves 32 and 33 may be turned to backwash the filter 17 via pipe 30 . the skimmer 14 is arranged to collect leaves and other floating debris . to prevent the plugging of pipes 21 , 22 , 23 , and pump 16 , the skimmer 14 has perforated basket 41 of larger diameter and strainer 15 has a strainer basket 42 . while the flow velocity of the baskets is much less than in the pipes , it is still perceptible and non - uniform so that when a container of chemical of the kind described hereafter is dropped into the perforated basket in the skimmer , or in the strainer basket , it bobs or flutters with the flow through the baskets . the feeder may be inserted at these places or a special chamber . fig2 is representative of a practical embodiment for a dispensing container for chemicals , hereinafter termed a “ feeder ” ( the etani patents ). the feeder comprises two plastic hemispheres 101 , 102 which are joined together in the manner of some table tennis balls with cement . the hemisphere 101 has a filling hole 105 , which is closed by a plug 110 . for dispensing the chemical , there are a number of small holes 112 in the hemisphere 101 . plug 110 has a porous buoyant portion 114 . fig3 represents a construction in which two hemispheres 121 and 122 are joined at a flange . the thermo - plastic hemispheres with flanges can be made easily by the vacuum - forming process . this is the preferred construction when polyvinyl chloride ( pvc ) is used , or when the filling chemical is compressed into a solid ball “ brickette ”. the flange closure is readily achieved by ultrasonic welding , and the flange assists the rotation of the feeder in the eddies of flow . it also facilitates the handling and packaging of the feeders . the body of chemical , or an added weight 127 tends to stabilize the upward orientation of the feeder holes in conditions of low flow . fig4 represents an alternate closure of the feeder of fig3 . in this construction the feeder is filled by the supplier with a desired quantity of chemical 140 , leaving an empty space 141 , and sealed with a patch 144 . the empty space may be filled with inert gas for chemicals which may be degraded in the presence of air or moisture . with this construction , the user must make the proper number of dispensing holes by piercing the feeder with a needle or the like . fig5 is a cut - away drawing of the capsule configuration preferred for most swimming pool and spa uses . the sphere is blow molded of high density polyethylene . twenty - two grams of the polymer are needed for a sphere 2¾ inches in diameter . the shell 150 varies somewhat in thickness between about one sixteenth and one eighth of an inch . the mold is made in two parts . when molding is complete the sphere is left with a small hole at 151 and a pair of stub wings 152 and 153 which serve the function of the flange in the configuration of fig3 . in preparation for filling , the blow hole 151 is closed , and the filling hole 154 , formed in the mold , is clealy cut through , both operations using an ultrasonic tool . it is desired that this capsule float with each dispensing hole 157 near the liquid levels inside 158 , and outside 159 , the capsule when it is resting in still water . to achieve this result , an air space 160 is left after filling with the emulsion , and zero - gauge buck shot 161 is swaged into the filler plug 162 . depending on the product , the dispensing units may be formed of a translucent plastic , and in some instances a colored opaque plastic . it therefore becomes difficult for the pool or spa owner to determine of there is any efficacy left in the dispensing unit in that most of the chemical water treatment solutions are also clear or translucent . in operation , the chemical water treatment solution is gradually dispensed through the apertures in the dispensing unit to the pool and the dispensed chemical water treatment solution is replaced by normal pool water . therefore the weight of the dispensing unit does not provide an indicia or indicate to the pool owner whether or not the chemical water treatment solution has been fully dispensed and that the dispensing unit is depleted . placement of a water soluble colorant or dye into the chemical water treatment solution at the time of filling the dispensing unit provides the pool owner with a visual indicia as to the amount of chemical water treatment solution remaining . this can be evident to the pool or spa owner by merely examining the dispensing unit if the dispensing unit is translucent to determine if the pool or spa owner detects any color within the dispensing unit which in turn would indicate that there is chemical water treatment solution remaining in the dispensing unit . in those cases where the dispensing unit is opaque , the pool or spa owner can remove the dispensing unit from the pool or spa and shake the dispensing unit to dispense a small quantity of the contents of same . if the dispensed contents have a color , it is indicative that there is still chemical water treatment solution remaining in the dispenser . when the pool or spa owner visually observes a clear liquid within a translucent container , or a clear liquid dispensed after shaking the dispensing unit , the pool or spa owner is reasonably assured that the chemical water treatment solution has been completely dispensed and that a new dispensing unit should be prepared and positioned in the pool skimmer . the dye utilized in order to color code the water treatment chemicals may be a water soluble organic or inorganic colorant or dye such as a food grade , non - toxic , biodegradable and water soluable and may include a common food coloring . the color of the dye is one of choice , however the color may be chosen to indicate the particular chemical solution and its water quality efficacy . in the case of swimming pools and spas , the water soluble organic or inorganic colorant or dye may be food grade , non - toxic , biodegradable and water soluble such as food coloring . in this manner , as it is disbursed from its concentration in the dispensing unit , the dye is diluted due to the volume of the pool or spa such that there is no aesthetic displeasing effect . in the dispensing unit of the type described herein , it has been found that an appropriate range of organic or inorganic colorant or dye is in the range of 0 . 07 percent to 10 . 0 percent with a preferred range of 0 . 07 percent to 0 . 10 percent by volume . as an example , quantities of common water quality treatment solutions are prepared in 55 gallon batches ( 7 , 040 ounces ) for filling dispensing units of the type described . it has been found that the quantity of dye required for introduction into the batch process in order to achieve a color coded water treatment solution for filling the dispensing unit can range from 5 ounces to 7 ounces per batch ( 55 gallons ; 7 , 040 ounces ). this quantity of dye in this type of batch process results in a color coded water treatment solution within a dispensing unit of the type described which is visible to the eye if the dispensing unit is constructed of a translucent plastic , and that it is further visible to the eye if the dispensing unit is constructed of an opaque plastic such that the pool or spa owner must remove the dispensing unit and shake the dispensing unit in order to dispense several drops of contents onto his hand . the presence of an effective amount of the select water treatment solution within the dispensing unit would be visible to the eye of the pool or spa user when the dispensing unit was so shaken . the purpose of the water soluble organic or inorganic colorant or dye is to provide a visual color coding indicia available to the user for efficacy of chemical introduction to the pool or spa . a greater amount of water soluble colorant or dye reduces the amount of effective chemical treatment . an increased amount of water soluble organic or inorganic colorant or dye provides increased visual indicia but limits the efficacy and duration of time release of the effective chemical . therefore a range of 0 . 07 percent to 10 . 0 percent by volume of dye provides an effective volume amount of effective chemical over time and a preferred range of 0 . 07 percent to 1 . 0 percent of dye allows for a suggested maximization of effective chemical . therefore , while the present invention has been disclosed with respect to the preferred embodiments thereof , it will be recognized by those of ordinary skill in the art that various changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore manifestly intended that the invention be limited only by the claims and the equivalence thereof .
| 1Performing Operations; Transporting
|
the present invention discloses a packaging structure of a light - sensing device with a spacer wall , wherein a spacer is used to protect the light - sensing region from external pollutants and used to protect the regions where the electric contacts are to be formed from the overflow glue . refer to fig2 a diagram schematically showing one embodiment of the present invention . the packaging structure of a light - sensing device with a spacer wall according to one embodiment of the present invention comprises : a light transparent substrate 10 , which may filter out a light of a specific wavelength ; metallic traces 12 , installed on the light transparent substrate 10 ; multiple metallic balls 14 , disposed on the metallic traces 12 ; a light - sensing element 16 , further comprising a light - sensing region 18 and multiple metallic pads 20 , wherein the metallic pads 20 have multiple metallic contacts 22 for the electric connection between the metallic pads 20 and the metallic traces 12 ; and a spacer wall 24 , disposed between the metallic pads 20 and the light - sensing region 18 , and used to protect the light - sensing region 18 from external pollutants , wherein the spacer wall 24 may be formed via a screen - printing method and can be made of an insulation polymer with slight elasticity , such as a polyimide . in this embodiment , the height of the spacer wall 24 is controlled to be slightly larger than the spacing between the light transparent substrate 10 and the light - sensing element 16 and used to protect the light - sensing region 18 from external pollutants . in this embodiment , the objective of retarding external pollutants can be achieved without any additional glue layer . therefore , the problem of the overflow glue , which occurs in the conventional technology , can be avoided herein . refer to fig3 a diagram schematically showing another embodiment of the present invention . the packaging structure of a light - sensing device with a spacer wall according to another embodiment of the present invention comprises : a light transparent substrate 10 ; metallic traces 12 , installed on the light transparent substrate 10 ; multiple metallic balls 14 , disposed on the metallic traces 12 ; a light - sensing element 16 , further comprising a light - sensing region 18 and multiple metallic pads 20 , wherein the metallic pads 20 have multiple metallic contacts 22 for the electric connection between the metallic pads 20 and the metallic traces 12 ; two spacer walls 26 , 28 , wherein the spacer wall 26 is formed on the light transparent substrate 10 and disposed corresponding to the position between the metallic pads 20 and the light - sensing region 18 ; the spacer wall 28 is formed on the light transparent substrate 10 and disposed between the metallic ball 14 and the metallic pad 20 ; and a glue layer 30 , used to seal the gap between the light - sensing element 16 and the light transparent substrate 10 . as shown in fig3 , the glue layer 30 is confined to between the spacer wall 26 and the spacer wall 28 . even if the heights of the spacer walls 26 , 28 do not exceed the spacing between the light - sensing element 16 and the light transparent substrate 10 , the glue overflow , which occurs in the conventional technology , will not occur in this embodiment because of the surface tension of the glue . thus , the problem that the glue overflows onto the metallic balls 14 and the light - sensing region 18 can be effectively avoided herein . refer to fig4 a diagram schematically showing further embodiment of the present invention . in this embodiment , the spacer wall 26 in the abovementioned embodiment , which is originally formed on the light transparent substrate 10 and disposed corresponding to the position between the metallic pads 20 and the light - sensing region 18 , is otherwise formed on the lower surface of the light - element 16 and disposed between the metallic pads 20 and the light - sensing region 18 , as shown by the spacer wall 32 in fig4 . as shown in the abovementioned embodiments , the spacer walls 26 , 32 of the present invention are disposed between the metallic pads 20 and the light - sensing region 18 . thus , it is reasonable to design the forms of the spacer walls 26 , 32 according to the distribution contour of the metallic pads 20 , as those shown in from fig5 ( a ) to fig5 ( c ). in from fig5 ( a ) to fig5 ( c ), three common distribution contours of the metallic pads 20 — a loop , two parallel lines , and a u - shape — and the forms of the spacer walls 26 , 32 corresponding to those three distribution contours , which are also are a loop , two parallel lines , and a u - shape , are exemplified with the spacer wall 32 , which is formed on the light - sensing element 16 . however , according to the objective of effectively retarding external pollutants , the spacer wall of a loop shape , which encloses the light - sensing region completely , can also be applied to the cases wherein the distribution contours of the metallic pads are of a u - shape or two parallel lines . in summary , the present invention is a packaging structure of a light - sensing device with a spacer wall , which utilizes a spacer wall to protect the light - sensing region and the metallic balls from the pollution of the external pollutants or against the influence of the overflow glue in order to guarantee the yield and performance of the product . confronting the trend of fabricating slim and lightweight electronic elements , the present invention can also overcome the problem of overflow - glue pollution , which the miniaturization of electronic elements must face but the conventional technology cannot solve . those described above are only the preferred embodiments of the present invention and not intended to limit the scope of the present invention . any equivalent modification and variation according to the characteristics , the structures or the spirit of the present invention disclosed herein is to be included within the scope of the present invention .
| 7Electricity
|
in fig1 , an electromagnetic valve 10 of the prior art is shown . as its central component , the valve 10 has a substantially hollow - cylindrical tappet guide 12 , or valve insert , on the outside of which a collar 14 is embodied approximately in the middle of its length and a through opening 16 is embodied in the longitudinal direction in the interior . in the through opening 16 , a substantially circular - cylindrical tappet 18 is supported displaceably in the longitudinal direction of the tappet guide 12 . on the lower end of the tappet 18 , in terms of fig1 , a sealing body 20 is provided , which has a spherical - segment - shaped surface 22 that bulges downward . diametrically opposite the sealing body 20 , there is a sealing seat 24 or sealing body which is designed essentially hollow - cylindrically and which has a frustoconical surface 26 opposite the spherical - segment - shaped surface 22 . a spiral spring 28 , which acts as a compression spring and is braced on the sealing seat 24 , is thrust onto the lower part of the tappet 18 , which — as can be seen from fig1 — is designed with a smaller diameter . on the face end , facing away from this spiral spring 28 , of the substantially hollow - cylindrical sealing seat 24 , there is a virtually disk - shaped insert body 30 , with a check ball valve 32 embodied eccentrically in it . a slightly cup - shaped axial filter 34 is located on the lower face end , in terms of fig1 , of this insert body 30 . a through bore 36 is embodied in the insert body 30 , and a through bore 38 adjoining this through bore 36 is embodied in the longitudinal direction in the sealing seat 24 . through these through bores 36 and 38 , a fluid operating medium or fluid delivered through the axial filter 34 can reach the conical - segment - shaped surface 26 of the sealing seat 24 . in the operating state shown , the sealing body 20 does not rest on the sealing seat 24 . the operating medium is therefore capable of getting into the chamber in and around the spiral spring 28 , and from there it can flow out through one or more longitudinal grooves 40 embodied in the tappet guide 12 , a plurality of radial grooves 42 embodied in the insert body 30 , and a radial filter 44 located on the jacket face of the tappet guide 12 . so that this flow of operating medium through the sealing seat 24 can also be interrupted by the valve 10 , the tappet 18 , on its upward end portion in terms of fig1 , has an electromagnetic armature 46 . this armature can be moved with the aid of an electromagnet , not shown , so that the tappet 18 is displaced in the tappet guide 12 and the spherical - segment - shaped surface 22 is guided toward the conical - segment - shaped surface 26 . in order to enable this motion of the tappet 18 , an air gap 48 is embodied between the upper end face , in terms of fig1 , of the substantially hollow - cylindrical tappet guide 12 and the lower end face of the armature 46 . a substantially cup - shaped cap 50 is also fitted over the armature 46 and is fixed on the outer jacket face of the tappet guide 12 with the aid of a circumferential welded seam 52 . in fig2 , an exemplary embodiment of an electromagnetic valve 10 of the invention is shown . in contrast to the valve 10 shown in fig1 , the valve of fig2 has a one - piece sealing seat - tappet guide component 54 , which takes on both the function of a tappet guide and the function of a sealing seat . as a further innovation compared to the valve 10 shown in fig1 , the valve 10 of fig2 , in the upper end region in terms of fig2 , has an adjusting ring 56 of l - shaped cross section , which is fixed on the tappet guide 12 with the aid of a press fit or radial compression 58 . the adjusting ring 56 has no guidance function for the tappet 18 and instead serves to adjust the air gap 48 , which now , in the valve 10 of fig2 , is formed between the upper end face of the adjusting ring 56 and the lower end face of the armature 46 . in the valve 10 of fig2 , a cap 50 is fitted over the adjusting ring 56 and the upper region , in terms of fig2 , of the tappet guide 12 ; it is firmly slipped onto the tappet guide 12 with the aid of a press fit or radial compression 60 and is then fixed on the outer circumference of the tappet guide 12 with a laser - welded seam 62 . besides these innovations , in the sealing seat - tappet guide component 54 of the valve 10 of fig2 , two or more diametrically opposed radial bores 64 are embodied above the conical - segment - shaped surface 26 of the sealing seat portion of the sealing seat - tappet guide component 54 . an operating medium flowing through the sealing seat portion of the sealing seat - tappet guide component 54 can flow through these radial bores 64 , deflected only twice at an angle of 90 ° each , to the radial filter 44 located on the outer jacket face of the tappet guide 12 . in fig3 , this primary direction of the flow of the operating medium through the radial bores 64 is illustrated by an arrow 66 . in fig3 , the primary line 68 of the magnetic flux in or on the valve 10 of fig2 is also shown . as can be seen , the magnetic flux passes from the tappet guide 12 radially toward a leg of the adjusting ring 56 of l - shaped cross section and from it axially into the armature 46 . the cap 50 comprises material that conducts magnetic flux , and it closes the magnetic circuit between the sealing seat - tappet guide component 54 and the armature 46 . an electric coil that generates the magnetic field or flux is not shown . it can be assumed that this coil is slipped onto the magnet valve and surrounds both the armature 46 and the tappet guide 12 as far as the collar 14 . in the valve 10 shown in fig2 and 3 , the insert body 30 is designed precisely the same as that in fig1 , although the radial grooves 42 in the insert body 30 are no longer necessary and can therefore be omitted . in fig4 , a second exemplary embodiment of an electromagnetic valve 10 of the invention is shown , which in terms of the sealing seat - tappet guide component 54 and the one - piece design thus attained of the sealing seat and tappet guide is designed like the sealing seat - tappet guide component 54 shown in fig2 and 3 . however , in the region of the adjusting ring 56 , the valve 10 of fig4 is modified . here the adjusting ring 56 is embodied as comparatively long in the longitudinal direction , and between the lower end region , in terms of fig4 , of the this long adjusting ring 56 and the upper end region of the sealing seat - tappet guide component 54 , a radial compression 70 and an extensive laser - welded seam 72 are embodied . onto the remaining jacket face of the long adjusting ring 56 , the cap 50 is slipped onto the adjusting ring 56 at a radial compression 74 and then likewise fixed with a laser - welded seam 76 ; the two laser - welded seams 72 and 76 may be made in a single operation . alternatively , the laser - welded seams 72 and 76 may be made in succession and possibly even at different work stations . the foregoing relates to preferred exemplary embodiments of the invention , it being understood that other variants and embodiments thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
[ 0013 ] fig1 is a simplified perspective or isometric view of an array 10 of individual missile launcher cells 10 a , 10 b , 10 c , and 10 d , with portions of the structure cut away to reveal interior details . in fig1 the individual cells 10 a , lob , 10 c , and 10 d are identical to each other . each cell includes a lattice - type support structure designated 12 , thus missile launcher 10 a includes a lattice - type support structure designated 12 a , missile launcher cell lob includes a lattice - type support structure 12 b , missile launcher cell 10 c includes a lattice - type support structure 12 c , and launcher cell 10 d includes a lattice - type support structure 12 d . each support structure 12 includes four “ leg ” portions . taking missile launcher cell 10 d of fig1 as being representative , three such legs can be seen , namely legs 14 d 1 , 14 d 2 , and 14 d 3 , and the fourth leg is not illustrated . the illustrated legs of support structure 12 a of missile launcher 10 a are 14 a 1 and 14 a 2 , the illustrated legs of support structure 12 b of missile launcher 10 b are 14 b 1 and 14 b 2 , and the illustrated legs of support structure 12 c of missile launcher 10 c are 14 c 1 and 14 c 2 . the legs of each support structure extend parallel with the missile launcher longitudinal axis ; in particular , the various legs extend parallel to their corresponding launcher cell longitudinal axes 8 a , 8 b , 8 c , and 8 d . a plurality of interconnecting support braces extend between the “ legs ” of the support structure of each missile launcher cell . as illustrated in fig1 representative support braces 20 a 1 , 20 a 2 , and 20 a 3 extend between leg elements 14 a 1 and 14 a 2 . the combination of these leg elements and support braces defines an elongated cavity ( not is 15 clearly visible in fig1 ), having a rectangular or square cross - section , which extends vertically through each support structure 12 a , 12 b , 12 c , and 12 d . the cross - sectional dimensions of each such cavity are dimensioned to accommodate a canisterized missile , and to hold such canisterized missile in a vertical or about - vertical posture . in a particular embodiment in which the canisterized missile is a mark 25 canisterized missile , the cross - section is rectangular . a protective door or hatch assembly or structure is located at the upper or missile launch end of each missile launcher cell . more particularly , fig1 illustrates a hatch assembly 16 a associated with missile launcher cell 10 a , a hatch assembly 16 b associated with missile launcher cell lob , a hatch assembly 16 c associated with missile launcher cell 10 c , and a hatch assembly 16 d associated with missile launcher cell 10 d . each hatch assembly includes a generally flat deck portion or deck extension , and a hatch covering one or more apertures by which one or more missiles may exit , and or through which exhaust gases may vent . in fig1 hatch assembly 16 a of missile launcher cell 10 a has a deck portion of deck extension 16 ad and a hinged hatch 16 ah , hatch assembly 16 d of missile launcher cell 10 d has a deck 16 dd and a hinged hatch 16 dh , with the hatches illustrated as being in the closed position . hatch assembly 16 c of missile launcher 16 c has a deck 16 cd and an open hatch 16 ch . the hatch 16 bh of hatch assembly 16 b is illustrated in phantom to reveal a square missile - end “ aperture ” 18 bm in which a canisterized missile ( not illustrated in fig1 ) may be accommodated , and additional chimney or exhaust uptake apertures 18 bc 1 and 18 bc 2 . each missile launcher cell 10 a , 10 b , 10 c , and 10 d of array 10 of fig1 also includes an a pair of missile exhaust gas uptake ducts or chimneys . in fig1 portions of the two chimneys associated with missile launcher cell 10 a are designated 30 a 1 and 30 a 2 , and portions of the corresponding chimneys of missile launcher cell lob are designated 30 b 1 and 30 b 2 , respectively . the chimneys associated with missile launcher cell 10 c are designated 30 c 1 and 30 d 2 , and those associated with missile launcher cell 10 d are designated 30 d 1 and 30 d 2 in fig1 . the chimneys associated with each launcher cell extend from near the bottom , breech or missile exhaust end of each launcher cell to near the top , muzzle , or missile launch end of the launcher cell , and are generally parallel with the axis of the corresponding support structure . thus , chimneys 30 a 1 and 30 a 2 extend parallel with the longitudinal axis 8 a of missile launcher support structure 12 a , chimneys 30 b 1 and 30 b 2 extend parallel with the longitudinal axis 8 b of missile launcher support structure 12 b , chimneys 30 c 1 and 30 c 2 extend parallel with the longitudinal axis 8 c of missile launcher support structure 12 c , chimneys 30 d 1 and 30 d 2 extend parallel with the longitudinal axis 8 d of missile launcher support structure 12 d . at their upper ends , the various chimneys or missile exhaust gas uptake ducts open into a region which lies under the doors or hatches of the corresponding missile launcher cell when that door or hatch is in its closed position . in fig1 the open ends of the two chimneys 30 b 1 and 30 b 2 are designated 18 bc 1 and 18 bc 2 , respectively . the chimneys are preferably fastened to the corresponding deck plate , as by welding if the chimney is metallic , or by other suitable fastening method for other materials , as for example the chimneys 30 b 1 and 30 b 2 should be secured to deck plate 16 bd . the corresponding hatch 16 bh , when in its closed state , covers both the two chimney openings 18 bc 1 and 18 bc 2 and also the upper end of the elongated , vertically oriented cavity associated with or defined by the support structure 12 b . in addition to the chimneys , each missile launcher cell 10 a , 10 b , 10 c , and 10 d of array 10 is associated with an exhaust gas plenum or manifold . thus , a plenum 40 a is associated with missile launcher cell 10 a , a plenum 40 b is associated with missile launcher cell lob , a plenum 40 c is associated with missile launcher cell 10 c , and a plenum 40 d is associated with missile launcher cell 10 d . each exhaust gas plenum includes an attachment arrangement for attaching the plenum to the support structure . in a particular embodiment of the invention , the attachment arrangement also supports a “ dogdown ” arrangement which provides secure attachment of the plenum to the lower end of the canister of the canisterized missile used therewith . in fig1 the attachment arrangement for the exhaust gas plenum of each missile launcher includes four bosses or structures of a set 42 of bosses . thus , exhaust gas plenum 40 a of fig1 includes on its upper surface four attachment bosses , each of which is designated 42 a , spaced around a rectangular or square exhaust gas inlet port 44 a . similarly , exhaust gas plenum 40 b includes on its upper surface four attachment bosses , each of which is designated 42 b , spaced around a square exhaust gas inlet port 44 b , exhaust gas plenum 40 c includes on its upper surface four attachment bosses , each of which is designated 42 c , spaced around a square exhaust gas inlet port 44 c , and exhaust gas plenum 40 d includes on its upper surface four attachment bosses , each of which is designated 42 d , spaced around a square exhaust gas inlet port 44 d . each of the bosses of set 42 is attached to the lower end of a leg of the associated support structure . as an example , the lower ends of the three vertically disposed legs 14 d 1 , 14 d 2 , and 14 d 3 of support structure 12 d of missile launcher 10 d which are visible in fig1 are attached to those three bosses 42 d of plenum 40 d which are nearest the viewer . this effectively fastens the plenum 40 d to its associated support structure 12 d , with axis 8 d of the elongated vertically - oriented cavity ( not designated in fig1 ) associated with the support structure 12 d overlying the missile exhaust gas entry port 44 d of the plenum 40 d . the chimneys or missile exhaust gas uptake ducts of each missile launcher cell are connected at their lower , missile exhaust , or breech ends to corresponding apertures of the associated plenum , so that missile exhaust gases entering the plenum can be vented through the chimneys to a location near the upper , missile launch , or muzzle ends of the structure . more particularly , the lower ends of chimneys 30 a 1 and 30 a 2 of missile launcher 10 a are connected to corresponding apertures 46 a 1 and 46 a 2 of plenum 40 a , the lower ends of chimneys 30 b 1 and 30 b 2 of missile launcher lob are connected to corresponding apertures 46 b 1 and 46 b 2 of plenum 40 b , the lower ends of chimneys 30 c 1 and 30 c 2 of missile launcher 10 c are connected to corresponding apertures 46 c 1 and 46 c 2 of plenum 40 c , and the lower ends of chimneys 30 d 1 and 30 d 2 of missile launcher 10 d are connected to corresponding apertures 46 d 1 and 46 d 2 of plenum 40 d . the chimneys are thus supported at their lower ends by attachment to their respective plenums , and may be attached at their upper ends to their respective deck plates . in addition , further attachments may be made along their lengths to their respective support structures . [ 0020 ] fig2 is a simplified perspective or isometric view of missile launcher cell 10 d of fig1 standing alone . elements of fig2 corresponding to those of fig1 are designated by the same reference numerals . in fig2 a portion of the drive mechanism which controls the operation of hatch 16 dh is designated as 216 . fig3 a is a simplified perspective or isometric view of the upper , missile launch , or muzzle end 300 of the missile launcher cell 10 d of fig2 . in fig3 a , elements corresponding to those of fig2 are designated by the same reference numerals . in fig3 a , various sets of apertures or holes defined in the edge of the deck portion 16 dd are designated 316 da 1 , 316 da 2 , 316 da 3 , and 316 da 4 . these sets of apertures are provided for allowing the use of bolts to fasten each deck portion to an adjacent deck portion of another missile launcher cell , in order to form an array such as that illustrated and described in conjunction with fig1 or to fasten the deck portion of the cell to an adjacent deck structure of the ship or other support structure on which it is mounted , a cut - away portion of which is illustrated in phantom as 390 in fig3 a . [ 0021 ] fig3 b is a simplified perspective or isometric view of a lower , missile exhaust end , or breech end 380 of the missile launcher structure of fig2 illustrating some details of the structure . elements of fig3 b corresponding to those of fig2 are designated by like reference numerals . in fig3 b , the structure of plenum 40 d is seen to include legs or supports 339 a , 339 b , and 339 c , each of which defines a plurality of plenum - to - ship mounting or attachment holes or apertures 340 d 1 , 340 d 2 , and 340 d 3 , respectively . in addition , details of the dogdown mechanism 360 include connecting drive bars 350 a and 350 b . in fig4 a , 4 b , and 4 c , elements corresponding to those of fig1 , 3 a , and 3 b are designated by the same reference numerals . in fig4 c , the aperture 418 d represents the end of the elongated cavity defined by the support structure 12 d , and it is centered on axis 8 d , which appears as a dot in the view of fig4 c . fig4 b illustrates axis 8 d as centered in the view , while fig4 a shows axis 8 d as off - center relative to the entire structure . axis 8 d appears as off center in fig4 a because it is centered on the support structure 12 d , which is offset relative to the entire missile launcher cell 10 d because of the presence of the chimneys 30 d 1 and 30 d 2 . [ 0023 ] fig5 represents a cross - sectional view of missile launcher cell 10 d of fig1 shown alone , and partially cut away to show the missile 512 and a missile canister 510 , defining a missile launch end 510 ml and a missile exhaust end 510 me , with the missile 512 contained within the canister 510 . in fig5 the hatch 16 dh is open . other embodiments of the invention will be apparent to those skilled in the art . for example , while the support structure 12 x of a cell 10 x of the figures are illustrated as being of a particular form of lattice , other types may be used , or solid ( non - lattice ) portions may be used . while the missile launcher array of fig1 shows a linear array of missile launcher cells , the array can be rectangular , so that it includes a plurality of rows and columns , and it may intermix rectangular or square with linear arrays of missile launcher cells . while the plenum associated with each missile launch cell has been shown as being roughly cubical , it may be drum - shaped ( that is , a portion of a right circular cylinder ) or semispherical ( some portion of a sphere , including a hemisphere ). while the missile canister has been described as containing a single missile , the missile canister can be of the type containing a plurality of missiles . thus , a missile launcher cell ( any one of 12 a , 12 b , 12 c , or 12 d of array 10 , with 12 d taken as typical ) according to an aspect of the invention is for accepting a canisterized missile ( 510 , 512 ) which defines a missile launch end ( 510 ml ) and a missile exhaust end ( 510 me ), for , in use prior to missile launch , holding the missile canister ( 510 , 512 ) in a generally vertical launch position below a deck ( 390 ). the missile launcher cell ( 16 d ) comprises at least one elongated exhaust gas chimney ( 30 d 1 , 30 d 2 ). it also comprises a support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) defining a generally axial cavity ( 418 d ), also defining a missile launch end and a missile exhaust end . the cavity ( 418 d ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) has length and cross - sectional dimensions sufficient to accommodate the missile canister the one or more exhaust chimney ( 30 d 1 , 30 d 2 ) s lie along the exterior of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) and extend , parallel with the axis ( 8 d ) of the cavity ( 418 d ), from near the missile launch end ( 300 ) to near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). the missile launcher cell ( 16 d ) also includes a missile exhaust plenum ( 40 d ) attached to the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). the missile exhaust plenum ( 40 d ) is to the one or more exhaust chimney ( 30 d 1 , 30 d 2 ) s near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). the missile exhaust plenum ( 40 d ) further includes an attachment arrangement ( 360 ) for attachment to the missile exhaust end ( 510 me ) of the missile canister ( 510 , 512 ), for routing missile exhaust gas from the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) to the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ), for causing missile exhaust gas to vent from the one or more chimneys ( 30 d 1 , 30 d 2 ) near the missile launch end ( 300 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) of the missile launcher cell ( 16 d ). a door or hatch structure ( 16 dh ) is attached to the missile launch end ( 300 ) of the missile launch cell support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), for , in the closed state , protecting at least the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), the one or more chimney 30 d 1 , 30 d 2 ) s and any missile canister ( 510 , 512 ) accommodated within the cavity ( 418 d ). in a particular embodiment of the invention , the cavity ( 418 ) has a rectangular , or more particularly square , cross - section , and is dimensioned to accommodate a mk 25 canisterized missile ( 510 , 512 ). the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) may be a latticework . the number of chimneys ( 30 d 1 , 30 d 2 ) in a particular embodiment is two , with the two chimneys ( 30 d 1 , 30 d 2 ) running parallel with each other and with the cavity axis ( 8 d ). in a particularly advantageous embodiment of the invention , an array ( 10 ) of missile launcher cells ( 16 a , 16 b , 16 c , and 16 d ) has each of the missile launcher cells ( 16 d ) of the array dimensioned for accepting a canisterized missile ( 510 , 512 ), where each missile canister ( 510 , 512 ) defines a missile launch end ( 510 ml ) and a missile exhaust end ( 510 me ). in use prior to missile launch , the array ( 10 ) of missile launcher cells ( 16 d ) holds the missile canisters ( 510 , 512 ) in a generally vertical launch position below a deck . each of the missile launcher cells ( 16 d ) includes at least one elongated exhaust gas chimney ( 30 d 1 , 30 d 2 ), and a support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) defining a generally axial cavity ( 418 d ), and defining a missile launch end ( 300 ) and a missile exhaust end ( 380 ). the cavity ( 418 d ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) of each cell has length and cross - sectional dimensions sufficient to accommodate a missile canister ( 510 , 512 ). the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ) are attached , andor lie adjacent to , the exterior of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) and extend , parallel with the axis ( 8 d ) of the cavity , from near the missile launch end ( 300 ) to near the missile exhaust end ( 380 ) of the structure . a missile exhaust plenum ( 40 d ) is attached to the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) of each cell . the missile exhaust plenum ( 40 d ) of each cell ( 16 ) is coupled to the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ) near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), and also includes an attachment arrangement or means for attachment ( 360 ) to the missile exhaust end ( 510 me ) of the missile canister ( 510 , 512 ), for thereby routing missile exhaust gas from the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) to the one or more chimneys ( 30 d 1 , 30 d 2 ), for causing missile exhaust gas to vent from the at least one chimney ( 30 d 1 , 30 d 2 ) near the missile launch end ( 300 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). a door or hatch structure ( 16 dh ) is attached to the missile launch end ( 300 ) of the missile launch support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), for , when closed , protecting at least the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) and the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ) of the missile launcher cell ( 16 d ), and any missile canister ( 510 , 512 ) accommodated within the cavity ( 418 d ) of the cell , and for , when open , providing for egress of the missile ( 512 ) from its canister ( 510 ) and exhaust gas from the one or more chimneys ( 30 d 1 , 30 d 2 ). this arrangement allows the array of missile launchers to be maintained in a condition in which all of the launcher cells are fitted with canisterized missiles , without keeping at least one missile launch cell clear or unloaded so as to provide a chimney or path for the escape of exhaust gas from a missile fired in a missile launch cell of the array . thus , an aspect of the invention lies in an array of launchers ( 10 ) in which a canisterized missile is located within each of ( all of ) the cavities of the array .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
referring to fig1 a tunnel furnace is divided into a number of sections leading from a loading / unloading station 1 at the inlet end of the furnace . the first five sections of the furnace constitute together a heating part 2 of the furnace which leads to a pre - bending section 3 , followed by a bending section 5 which is maintained at the bending temperature . the next section of the furnace is a transfer section 6 which has open sides to permit an operator to view the bending section 5 . the final two sections together form a cooling section 7 which leads to a transfer station 8 at the outlet end of the furnace . as is customary each mould is mounted in a steel - walled insulated box 9 which is mounted on its carriage 10 which runs on rails 11 which extend right through the furnace from the loading / unloading station 1 to the transfer station 8 . at the transfer station 8 each carriage in sequence is lifted by a lift table to an upper return run of rails 12 along which the carriages run as they are pushed back to a lift indicated at 13 , which lowers each carriage in turn to the level of the rails at the station 1 ready for unloading and reloading . the carriages indexed through the furnace in sequence with a fixed residence time , e . g . 90 seconds , in each section of the furnace . fig2 and 3 illustrate the mounting of a sag bending mould in each box 9 . in this embodiment each box 9 is an enclosed structure having a floor 14 , side walls 15 and front and rear walls 16 . the floor 14 and the side rear walls 15 and 16 are of double - walled stainless steel with insulation . the sag bending mould is mounted on the floor 14 and includes lateral mould members 17 and end wing pieces 18 which are shown diagrammatically and are of conventional design . the lateral mould members 17 are narrow strip members having an upper edge of curved configuration to which the glass conforms as it sags in the bending section 5 of the furnace . the wing pieces are usually conterpoised so that they can readily swing upwardly under the effect of gravity as the glass sags . a pair of glass sheets which are to be sag - bent together and are for eventual lamination together to form a vehicle windscreen , are indicated at 19 . fig2 and 3 show how the glass 19 has only points of contact with the predominant points of the mould when the glass is loaded on to the mould at the station 1 . initially the glass will be at room temperature as it is loaded and the mould members in the box will also be at about room temperature , or possibly rather higher depending on the cooling effected during the return run of the carriage . each mould in its box 9 is advanced in turn into the five heating sections which together form the heating part 2 of the furnace . the construction of each of these five heating sections of the furnace is identical and is as illustrated in fig2 and 3 . the roof of each heating section of the furnace carries a pluraltiy of radiant heaters 20 and heat is radiated downwardly through the open top of the box 9 towards the upper surface of the glass 19 which is now stationary in the heating section . the mould members are partially screened from the radiant heat by the glass itself . in the embodiment illustrated each of the heating sections has a hot air supply including means for directing hot air beneath and around each mould supporting the glass . at either side of the furnace roof in each of the heating sections there are hot air supply ducts 21 leading to slots 22 at either side of the roof . each of the ducts 21 leads from a heater 23 which is supplied with air by a fan 24 which extracts air through a central extract aperture 25 in the furnace roof 26 between the slots 22 . if the air extracted through the central aperture 25 is hot enough it may not be necessary to provide the heaters 23 . the slots 22 supply hot air downwardly into each box just within the side walls 15 of the box , and inclined deflector plates 27 are fitted into the lower corners of each box where the side walls 15 of the box meet the floor 14 . these deflector plates 27 have the effect of deflecting the hot air flows sideways beneath the mould as indicated by the arrows 28 . the hot air flows underneath the mould and around the mould members 17 , 18 and outwardly around the mould members towards the front and rear walls 16 of the box , and then up to the roof 26 of the furnace for extraction through the central extract aperture 25 as indicated by arrows 29 . the hot air heats the lower surface of the supported glass to assist thermal equalisation through the glass thickness , especially when two glass sheets are being bent together , and has the effect of minimizing the temperature difference between the mould members and the glass . in one example of operation , by employing in the first heating section of the furnace flows of hot air at 300 ° c . with a rate of flow of 0 . 47m 3 / s , it was found that the temperature difference between the mould members and the glass , which otherwise might have been of the order of 100 ° c ., was reduced to about 45 ° c . to 50 ° c ., and surface flaws on the lower surface of the glass were eliminated . it is desirable to maintain this reduced temperature difference which has been introduced in the first of the heating sections . to effect this hot air flows 28 around the mould may be provided in at least the first three heating sections . usually the hot air flows 28 are provided in the second to fifth heating sections of the heating part 2 of the furnace in the same way as in the first heating section . the carriage then moves to the bending section 3 where the furnace temperature is of the order of 700 ° c . from the pre - bending section 3 the carriage moves to the bending section 5 where the glass is at a sag bending temperature of about 590 ° c . to 610 ° c . with the mould members at a temperature of about 530 ° c . to 540 ° c . the minimal temperature difference between the mould and the glass which is established in the first heating section 2 of the furnace , had been maintained throughout the concomitant heating of the mould members and the glass prior to bending . the indexing cycle time is such that immediately the glass has sag bent to the required configuration of the mould , it is removed from the bending section and cooled and gradually transported step - by - step back to the loading / unloading station 4 , by which time it has cooled to about room temperature , or somewhat above . in each of the heating sections 2 , the downward flow of air 28 , which are deflected beneath and around the mould , are heated to a temperature commensurate with the temperature of the glass in that furnace section , for example 400 ° c . in the fourth heating section and 500 ° c . in the fifth heating section . the deflector plates 27 are , in the illustrated embooiment , the faces of members of triangular section which are fitted into the corners of the box 9 . deflector plates which are at 45 ° to the side walls 15 and floor 14 of the box have been found to be effective . other shapes may be employed , for example deflector members with conrave surfaces which modify the flows beneath and around the mould members . in another way of carrying out the invention , each box 9 may be of a simplified construction which is of l - shaped cross section having a floor and a front wall only . the boxes abut against each other , so that the front wall of each box in the furnace acts as the rear wall of the preceding box . the side edges of these simplified boxes are close to the side walls of the furnace sections , and at each of the sections of the heating part 2 of the furnace there are air supply slots in the side walls of the furnace , at the level of the moulds , which direct the hot air flows around each mould beneath the glass in similar manner to the flows 28 described with reference to fig2 and 3 . the convective heating which is employed in carrying out the invention has been found to eliminate the problem of the generation of tensile stresses in the glass due to thermal gradients between the generally hotter glass and the cooler spots caused by localised contact with the mould . damage caused by the hotter glass sagging on to the colder mould during the final stages of the bending is also avoided . overall heating efficiency is improved , which has permitted a reduction in the timing of the indexing cycle while still ensuring , when manufacturing pairs of glass sheets to be laminated , that the two sheets conform sufficiently closely to one another and the desired shape . for example it has been found that operation of the method and apparatus of the invention increases the rate of heating of the glass by a factor of between 2 and 3 . it has even been possible to reduce the residence time in each heating section from 90 seconds to 60 seconds by employing the hot air flows in at least the first three heating sections to maintain a tolerable temperature difference between the mould and the glass .
| 2Chemistry; Metallurgy
|
this invention involves the design of a dual - mode wireless power receiver . the dual - mode wireless power receiver can receive power from either an inductive charger operating in the range of hundreds of khz or a resonant charger operating at a frequency in the mhz range . the dual - mode wireless power receiver can have a low - frequency operating range of 110 - 205 khz and a high operation frequency of 6 . 78 mhz , but the invention can generally be used for any two frequency bands separated by a factor of at least 5 . fig1 is a schematic diagram illustrating an inductive wireless power receiver circuit 2 that implements a low - q , inductive charging receiver . an inductor l 3 represents the receiver coil ( rx coil ), which is magnetoelectrically coupled to a source coil . ac power induced in l 3 is rectified by a bridge rectifier 4 to generate a dc voltage vrect . the bridge rectifier 4 is an arrangement of four ( or more ) diodes in a bridge circuit configuration that provides the same polarity of output for either polarity of input . a bridge rectifier provides full - wave rectification from a two - wire ac input , resulting in lower cost and weight as compared to a rectifier with a 3 - wire input from a transformer with a center - tapped secondary winding . capacitor c 2 q and inductor l 3 form an electromagnetic resonator with a resonant frequency around the wireless power operating frequency . this frequency is typically in the range of hundreds of khz . the series resonant circuit that includes l 2 and c 2 q also includes the impedance of the bridge rectifier 4 . this includes the circuit that is drawing wireless power , so it can be relatively high . the quality factor of the electromagnetic resonator is given by where ωi is the angular operating frequency of the inductive wireless power system and r 1 is the equivalent resistance of the diode bridge rectifier 4 . resistance r 1 can be relatively high , so the quality factor of this circuit is typically in the low single digits . a value of cs is chosen such that the resonant frequency of the electromagnetic resonator is equal to the operating frequency of the inductive wireless power system , using the equation fig2 is a schematic diagram illustrating a resonant power receiver circuit 8 used in accordance with the invention that implements a high - q resonant wireless power receiver . an inductor l 2 represents the receiver coil ( rx coil ). capacitors c 2 a and c 2 b form a resonant matching network between l 2 and the bridge rectifier 4 . this matching network is series - parallel because c 2 a is in series with the load and c 2 b is in parallel with it . the inductor l 2 and the capacitors c 2 a and c 2 b form an electromagnetic resonator . because some of the inductor current can circulate in a loop including only l 2 , c 2 a and c 2 b ( plus parasitic resistance ), the quality factor of this electromagnetic resonator can be relatively high , perhaps greater than 100 . to choose the values of c 2 a and c 2 b , one needs to ensure that their series combination is resonant with l 2 at the desired operating frequency on . it is preferred in some cases to operate the resonant receiver at a relatively high frequency to maximize the quality factor of the resonator . in other embodiments an operating frequency of 6 . 78 mhz is used . there would be significant utility for a dual - mode wireless power receiver that could receive power from either an inductive charger operating in the 100s of khz or a resonant charger operating at a frequency in the mhz range . the example discussed here has a low - frequency operating range of 110 - 205 khz and a high operation frequency of 6 . 78 mhz , but the method is generally useful for any two frequency bands separated by a factor of at least 5 . although the circuit topologies of the inductive receiver and the resonant receiver are similar , the required inductance and capacitance values are typically quite different , given the different operating frequencies . for a given application , there are some constraints on the usable rectified voltage range . for example , for mobile electronics that use lithium - ion batteries , it is desirable to produce a regulated 5v supply in order to charge the battery at 3 . 0 - 4 . 2 v . thus the rectified voltage should be chosen in the range of 5v - 15v such that a step - down regulator such as a buck regulator or linear dropout regulator can be selected to produce the regulated 5v supply efficiently . for a dual - mode receiver , this voltage range should be observed in both modes . however , for the same value of receiver - coil inductance , a much higher voltage is generated at 6 . 78 mhz than at 100 khz , given the fact that induced voltage is expressed by where vind is the induced voltage , m is the mutual inductance , ii is the source - coil current and ω is the operating angular frequency . the mutual inductance m is proportional to the square root of the product of the source coil and receiver coil inductances . thus , it would be advantageous for the dual - mode receiver if the effective inductance of the electromagnetic resonator were higher at low frequencies than at high frequencies . fig3 shows the circuit topology 14 of the dual - mode receiver . it has the property that the effective inductance of the electromagnetic resonator is much higher at low frequencies than at high frequencies . this occurs because the capacitor c 2 a has an impedance much lower than the inductor l 3 at high frequencies , thus it shunts l 3 . at low frequencies , the two inductors appear in series so as to give the required high inductance value . it is possible to make some rough approximations to better understand the operation of the dual - mode receiver . let us assume that the inductance of l 3 is 10 × the inductance of l 2 . furthermore , let us assume that the capacitance of c 2 q is roughly 100 × the capacitance of c 2 a or c 2 b . finally , let us assume that the capacitors are chosen such that the impedance of c 2 q is negligibly small at 6 . 78 mhz , and that the impedances of c 2 a and c 2 b are negligibly large at 100 khz . one can judge whether the capacitances are negligible by comparing them to the impedance of the inductors . at low frequency ( e . g ., 100 khz ), the c 2 a and c 2 b capacitors can be approximated as open circuits . thus the receiver circuit can be reduced to a pure series lc circuit in which l 2 , l 3 and c 2 q are the series elements . the effective inductance is 11 × l 2 . one can choose c 2 q to combine with this inductance to create a series resonance at 100 khz , as required by the qi specification . at high frequency ( e . g ., 6 . 78 mhz ), the c 2 q capacitor can be modeled as a short circuit . the parallel combination of c 2 a and l 3 is dominated by c 2 a . thus the receiver circuit can be reduced to a series - parallel resonant circuit where l 2 , c 2 a and c 2 b are the active elements , similar to fig2 . this circuit can be tuned to resonance at 6 . 78 mhz . the effective inductance of this circuit at high frequency is approximately equal to l 2 , although a small contribution from l 3 can also be observed . a wireless power receiver using this coil arrangement and matching network can receive power either from an inductive charger at low frequency ( e . g ., 100 khz - 200 khz ) or at high frequency ( e . g ., 6 . 78 mhz ). the same rectification and regulation produced by the bridge rectifier 4 can be used , thus making maximum use of the active circuitry . the frequency of the ac power can be detected and used to determine which communications protocol to be used , if any . in some inductive wireless power standards , load modulation may be used for in - band communications . the load modulation may be implemented through the use of switched capacitors cc , as shown in fig4 . these capacitors cc apply some detuning when switched in , presenting a variation in the impedance seen by the source amplifier , which can be decoded to recover some information . the value of the capacitors cc is typically on the order of the c 2 q capacitor . in the high - frequency resonant mode , these capacitors can be used as voltage clamps . switching in the cc capacitors couples the input terminals of the rectifier to ground with a low ac impedance . this can be used as a protection mechanism , to limit the ac voltage applied to the terminals of an ic that has a maximum voltage tolerance . fig5 shows a coil arrangement 18 that can form two separate inductors in the same plane of a printed circuit board , making it possible to save circuit area . in the example of fig5 , the two inductors are arranged in a planar , concentric fashion with the l 3 inductor on the inside and the l 2 inductor on the outside . the orientation can also be reversed such that the l 3 inductor is on the outside and the l 2 inductor is on the inside . realizing the inductive coil elements in a planar arrangement is advantageous because the thickness of the coil assembly can be minimized . realizing the inductive coil elements in a concentric fashion is advantageous because it makes maximal use of a limited space . both area and thickness may be highly constrained in a portable electronic device . the two coils have mutual inductance to each other , but this effect can be accounted for in the tuning network . other embodiments can use different arrangements to satisfy the requirements of inductors l 2 and l 3 . the connection points 1 - 3 illustrate the interconnection points for the overall concentric arrangement 18 . in addition to a printed circuit board , any planar mass - production process may be used to implement the inductive coil arrangement . the diode bridge rectifier 4 can be replaced with a synchronous rectifier 22 in any of the receiver circuits to reduce ohmic losses as shown in fig6 . the synchronous rectifier 22 improves the efficiency of rectification by replacing diodes with actively controlled switches such as transistors , usually power mosfets or power bjts . historically , vibrator driven switches or motor - driven commutators have also been used for mechanical rectifiers and synchronous rectification , which also be used in accordance with the invention . essentially , the invention describes a receiver - side circuit that can operate either in a low - frequency inductive charging system such as qi or a higher - frequency resonant wireless power system . the invention allows for the use of complicated coil arrangements and one more passive component than a single - mode receiver . moreover , the dual - mode wireless power receiver can have a low - frequency operating range of 110 - 205 khz and a high operation frequency of 6 . 78 mhz , but the invention can generally be used for any two frequency bands separated by a factor of at least 5 . although the present invention has been shown and described with respect to several preferred embodiments thereof , various changes , omissions and additions to the form and detail thereof , may be made therein , without departing from the spirit and scope of the invention .
| 7Electricity
|
the following description is provided to enable any person skilled in the art to be able to use the invention and sets forth the best modes contemplated by the inventors for carry out their invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principals of the present invention have been defined herein , specifically to provide for an improved intrusion detection unit 10 . the intrusion detection unit 10 of the present invention may use any desired components , with the elements thereof made from any desired material . as best shown in fig1 - 4 , the unit 10 of the present invention includes a portable body or housing 12 having all necessary components held therein . the portable body or housing 12 includes a port 11 , sides , a base , a front 14 , a back 16 and a passive motion detector 18 connected to a power source 20 , such as a battery , via a circuit board 22 . as shown in fig3 the rear housing 16 includes a securing means 24 , such as a hook and loop fastening means or magnetic holding strip , to allow the unit 10 to be secured in a desired location . for example , the unit 10 can be supported on its base on a flat surface , or secured against a wall , a desk , a filing cabinet , or other flat surface , in an area or room that is to be monitored , such as one that has been checked by law enforcement or other security personnel . the unit 10 would then be turned on and a separate radio unit or cellular telephone plugged into the port 11 in the housing 12 ( see fig1 ), to detect the presence of an intruder after the law enforcement or other security personnel have left the area or room . the unit 10 or the cellular telephone and / or radio unit plugged into the device may include the necessary video or audio adapters and related software , well known to those skilled in the art , to take and transmit images and / or sounds of an intruder . any camera associated with the unit 10 , the separate telephone or the separate radio unit may be of the normal still or video type . this unit 10 , therefore , allows more law enforcement or other security personnel to be freed for searching , or other duties , and eliminates the need for them to remain in an area or room that is to be monitored , such as one that has already been inspected or searched , or that is to be continuously monitored . that is , the unit 10 of the present invention will detect the presence of a human intruder , trigger the transmitter of an external radio unit or cell phone plugged into the unit , broadcast a stored audio message in the unit , and then pickup and broadcast still or video images and / or ambient sound from the area or room where the unit is located . to save battery life in the unit and / or the external radio , the unit will include a means to automatically switch power on and off and to switch off power when not in use in or connected to a microcontroller 36 to turn the external radio or cell phone to standby , if no intruder is present . the passive infrared motion detector 18 preferably uses a dual element pyroelectric sensor , which measures changes in heat within its field of view . a fresnel lens 26 , having a wide angle of view , is preferably used to divide the field of view into multiple zones whereby an object , moving from one zone to another , suddenly appears or disappears from the sensor &# 39 ; s view . the moving object , therefore , causes a change in signal levels , which is sensed by the accompanying circuitry in the motion detector . as set forth above , the goal of the unit 10 of the present invention is to be easily portable and to provide area intrusion monitoring and remote detection at low cost for use by law enforcement and other security personnel . this is provided by the unit 10 of the present invention , in which a microcontroller and its &# 39 ; firmware operation and circuitry on the board 22 control the implementation of this intrusion detection radio appliance . as shown in fig5 - 7 , the detector 18 is preferably a dual - element pyroelectric passive infrared detector that , like all pyroelectric detectors , is sensitive only to changes in temperature . a change in temperature produces a small voltage , which is amplified by an internal jfet transistor . the detector &# 39 ; s dual elements are connected opposing one another . this helps reduce false triggering due to changes in ambient temperature . any such thermal changes will affect equally both elements and will cancel , producing no output . the detector 18 is positioned at the focal point of the fresnel lens 26 . the lens 26 is designed to have a wide field of view to cover as much of the surrounding area as possible . the lens 26 is also designed with multiple zones , which pass or block infrared energy from an object depending upon position . as a warm object , such as a person moves through the field of view , the zones of the lens 26 breaks repeatedly as the person moves across the field of view . this chopping affect creates a change in infrared temperature of the detector 18 , thereby producing an output signal . a two - stage bandpass filter 28 and amplifier 30 are used and shown in fig5 . the amplifier 30 is sensitive to frequencies between 1 and 25 hz only . this further helps reduce false alarms since normal human motion will fall within this range . the total gain of the amplifier chain is 76 db . this high gain is needed because the amount of infrared energy striking the detector 18 is very low and thus the signal from the detector is very low as well . a dual - threshold window comparator is formed by 32 and 34 , as shown in fig5 . the output of the amplifier 30 is compared with voltage levels set by r8 , r9 and r10 . if the signal rises above the lower threshold , triga ! will switch from a logic high to a logic low . if the signal drops below a lower threshold , trigb ! will similarly switch . the circuit is designed such that the system will trigger when infrared energy from an object passing from a light to a dark zone , or from dark to light , is sensed . as shown in fig6 an 8 bit microcontroller or microprocessor 36 with onboard program rom and ram is preferably used . the microcontroller 36 operates at a low frequency set by a crystal x 1 . this low frequency keeps power consumption low for prolonged battery life . also , as described above , the microcontroller 36 includes a means to prolong battery life in the external radio or cell phone , by turning the external radio or cell phone to standby , if no intruder is present . an led 38 is driven by one output port from microcontroller 36 . upon power up , this led 38 will flash for a predetermined time , such as several tens of seconds . during this time , the amplifier and detector circuit are allowed to stabilize , and triggers are inhibited . this allows an operator to turn the unit 10 on , plug in a separate radio unit or cell phone , if not already done , and leave the area without triggering the system . once the led 38 stops flashing , the system is armed and ready to sense movement and broadcast on the external radio or cell phone plugged into the unit 10 . the triga and trigb signals from the window comparator 32 , 34 , previously discussed , are inputs to the microcontroller 36 . either of these inputs becoming a logic low will start the transmit cycle . the cycle begins by microcontroller 36 turning on power to the output circuitry . this signal is called , or indicated as , + 5 vsw , and by keeping this off except when triggered , helps extend battery life . when the xmt ! signal is brought low , a load is applied to an external microphone input 39 to the external radio or cell phone , which simulates keying the push to talk switch . the external radio or cell phone will now transmit the stored audio and then ambient audio or video images . the alarm output from microcontroller 36 produces a modulated square wave that is coupled into a transmit output amplifier 40 by r 26 and c 23 ( see fig7 ). unless somehow shutoff , this causes a beeping tone which precedes the transmission of the stored audio message . as shown in fig6 the unit 10 includes an analog record / playback device 42 having a flash memory as a non - volatile storage medium . this device 42 may store up to 12 seconds of audio , such as recorded or synthesized tone or voice . when a trigger occurs and the external radio or cell phone has been placed into transmit mode , a play signal is brought low causing a playback of the recorded audio signal . device 42 is designed to directly drive a speaker 44 so the signal is coupled to an amplifier 46 by r 28 and c 26 . the output of amplifier 46 is then fed to output amplifier 40 . once the transmission of the previously recorded audio is completed by the device 42 , the signal from a microphone 39 is amplified by a further amplifier 50 . the output from this amplifier 50 is also coupled into output amplifier 40 so that ambient sounds may be monitored and transmitted for several seconds , or the plugged in cellular telephone and any video camera may transmit images to alert law enforcement or other security personnel of an intruder . to record on the device 42 , a record button is pressed and held . the microcontroller 36 then powers up the microphone circuitry and sends a record command to the record / playback device 42 . while recording , the led 38 turns on . recording stops when the user releases the button or when a maximum time of approximately 12 seconds has elapsed . power to the unit 10 is turned on and off with a momentary pushbutton 51 ( see fig7 ). a cmos flip - flop 52 is powered whenever a 9 - volt battery 54 is connected thereto . the current draw by flip - flop 52 is low enough that the shelf life of the battery 54 is not significantly affected . each time the power button 51 is pressed , flip flop 52 toggles between the set and reset conditions . in the reset condition , 56 is turned on , thus sending power from the battery 54 to voltage regulator 58 , and hence powering up the rest of the circuitry . in the set condition , 56 , and all other circuitry , are off . it , therefore , can be seen that the present invention provides a novel and improved , low cost intrusion detection device into which a separate radio or cellular telephone unit is plugged to allow law enforcement or other security personnel to leave the intrusion detection unit in a given area for monitoring the area , without the need for further personnel . those skilled in the art will appreciate that various adaptations and modifications of the just - described , preferred embodiments can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein .
| 6Physics
|
air is admitted into an inlet 10 of a pump 12 for discharge as pressurized air ( 20 psi ) through an outlet 14 . the pressurized air is fed into an oxygenator having a filter 16 for only permitting oxygen therethrough . alternatively , nitrogen filters 22 can be used to expel the nitrogen in the air . exhaust valves 18 are periodically operated , e . g ., to expel the nitrogen . the oxygen - rich air is pumped by pump 20 into an inlet of a tubular inner chamber 24 whose wall is constituted of a material transmissive to ultraviolet ( uv ) light , e . g ., glass . as outer chamber 26 surrounds the inner chamber and has a cylindrical side wall 28 and axial end walls 30 , 32 . the walls bound an interior in which a drop of mercury 34 is received . the walls 28 , 30 , 32 are made of a material reflective to uv light , e . g ., glass whose exterior surfaces are coated with a reflective , mirrored layer . a plurality of electrodes 36 extends through the end walls and , when connected to a high voltage ( e . g ., 10 , 000 vdc ), the electrodes form a mercury arc inside the outer chamber 26 and form uv light as a byproduct . the uv light enters the inner chamber and converts the oxygen therein into ozone . the ozone is passed through a valve 38 into a fuel cell 40 for oxidation therein . it will be understood that each of the elements described above , or two or more together , also may find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in an improved fuel cell for the passenger car , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention and , therefore , such adaptations should and are intended to be comprehended within the meaning and range of equivalence of the following claims . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims .
| 7Electricity
|
proceeding to a detailed description of the present invention , the flexible expansion means , generally 10 , is shown in fig1 in conjunction with a standard i . v . set , generally 11 , which will include two spaced apart injection sites 24 and 30 which are connected to the flexible expansion means , generally 10 , by means of lengths of tubing 26 and 29 . flexible expansion means 10 is composed of an outwardly pleated , flexible tubing having expandable wall sections 15 and a central passageway 17 having a width greater than the diameter of tubing 26 and 29 . the i . v . administration set 11 will include the usual i . v . solution container 12 which will be supported by the usual support means through bail 14 . a vented piercing pin , generally 16 , will have the usual drip chamber 19 and air vent 18 . a length of tubing 20 will interconnect drip chamber 19 with y - injection site 24 and the flow of liquid through tubing 20 is controlled by a flow control clamp 22 . at the opposite end of the set is a length of tubing 34 connected with y - injection site 30 and the flow of liquid therethrough controlled by slide clamp 36 . a needle adapter 39 provides attachment for hypodermic needle 40 . two hypodermic syringes 42 and 43 having hypodermic needles 46 and 45 , respectively , are placed in pierceable engagement with reseal caps 25 and 32 of y - injection sites 24 and 30 , respectively . fig2 illustrates the flexible expansion means 10 when it will be filled with a retrograde volume of fluid 44 supplied by syringe 43 . it will be noted that the fluid 44 fills the space between the pleated wall sections 15 . this will be explained later in the operation . fig3 illustrates an alternative embodiment , generally 50 , of a flexible expansion means wherein the flexible expansion means is in the form of a length of corrugated tubing having pleated side walls 53 . as is similar to flexible expansion means 10 , it is utilized in the same i . v . administration set as illustrated in fig1 with a length of tubing 55 interconnected to drip chamber 19 and solution container 12 as well as to first injection site 54 . tubing 59 is also interconnected with injection site 54 having a reseal cap 56 for engagement with hypodermic syringe 73 by means of needle 57 . a length of tubing 60 also connects corrugated tubing 50 with a second injection site 62 which communicates with hypodermic syringe 71 by means of needle 64 passing through reseal cap 63 . another length of tubing 66 extends from reseal site 62 with the flow therethrough controlled by slide clamp 68 . needle adapter 69 secures hypodermic needle 70 thereto . fig4 is an enlarged view showing the corrugated tubing 50 with side walls 53 in the expanded state and the retrograde fluid 44 contained therein . this will be later referred to in the operation immediately to follow . a better understanding of the advantages of the flexible expansion means 10 and 50 will be had by reference to their operation . the i . v . administration set 11 will be packaged in the usual manner as illustrated in fig1 except that the hypodermic syringes 42 and 43 will not be in contact with the injection sites 24 and 30 . neither is the hypodermic needle 40 nor i . v . solution container 12 usually attached . when it is desired to administer the fluid in container 12 , the hypodermic needle 40 will be attached to needle adapter 39 and the vented piercing pin and drip chamber 16 pierced through the usual rubber stopper in container 12 . fluid flow will be controlled through the set by means of flow control clamp 22 and by opening slide clamp 36 . when it is desired to administer the retrograde additive liquid in syringe 43 , such as vitamins , the slide clamp 36 will be placed in a closed position and hypodermic syringe 42 will be positioned in contact with y - injection site 24 with hypodermic needle 46 pierced through reseal cap 25 and plunger 48 in an inward position . when it is desired to introduce the additive material , syringe 43 will have hypodermic needle 45 pierced through cap 32 and the contents of the syringe delivered into the y - reseal injection site 30 by moving plunger 49 into the syringe barrel . as clamp 36 is in a closed position , the contents of the syringe will fill into tubing 34 and 29 whereupon it will expand into the expansion means 10 . as this is occurring , the liquid in the expansion means 10 will in many instances fill it completely until it appears in the condition shown in fig2 . the excess liquid will then flow into tubing 26 and syringe 42 with an automatic moving outwardly of plunger 48 . it will be recognized also that tubing clamp 22 will be in a position to close tubing 20 which will have previously been filled with liquid from container 12 . to deliver the retrograde volume of liquid 44 , all that is required is that the syringes be removed from the injection sites and slide clamp 36 be opened . the retrograde volume will flow out to hypodermic needle 40 until the expansion means will assume the previous condition as indicated in fig1 . the operation of the expansion member 50 shown in fig3 and 4 will be as previously described for unit 10 . pleated tubing 53 will be in a collapsed condition before the retrograde fluid is introduced which is illustrated in fig3 . with the retrograde fluid 44 introduced it will assume a position as shown in fig4 . accordingly , the only difference between utilizing the corrugated tubing 50 over the pleated chamber 10 is that it will be effected over a longer vertical dimension . the pleated or corrugated tubing representing the flexible expansion means 10 and 50 is composed of a resinous , plastic material such as polyvinyl chloride and can be formed in the usual manner into the pleated or corrugated condition . it is assembled in an i . v . set such as between two lengths of tubing 26 and 29 by solvent bonding as the same plastic material can be used for the tubing as well as for the expansion means 10 or 50 . alternatively , different thermoplastic materials can be used such as polyolefins and still be sealed or bonded together such as by means of epoxies . it will be appreciated that in place of a vented piercing pin 16 a nonvented one could be employed when a self collapsing container is employed such as a flexible container . further , when the flexible expansion means 10 or 50 is employed with a positive pressure system , such as an i . v . pump , it is important that the expandable wall sections 15 and 53 remain in one of two stable conditions , extended or collapsed . if they are allowed to collapse by their own resilience , they will influence the delivery rate and may bolus the patient . the preferred manner is to have them extended until the medication has been pushed toward the patient . they could then be collapsed by compressing them to their original shape . they would then be ready for use for the next retrograde medication procedure . it is apparent that some means of holding the expansion sections extended or collapsed against the pump pressures ( up to 40 psi ) must be employed if they are to be utilized in conjunction with an i . v . pump . this would be accomplished in using materials and fabrication methods to adjust the force required to expand or contract the pleated walls . the expansion or contracting sections should be of such rigidity that the sections , when filled with medication , will remain extended . controlled expansion is also required for if they expand unintentionally , the unit can draw blood into the catheter or needle . upper injection sites 24 and 54 are disclosed in conjunction with flexible expansion means 10 and 50 . while resulting in a less practical unit , these could be eliminated if the additive volume is less than the volume of the expanded section and the clamps above and below are closed when filling . overfilling will pressurize the capacity between the clamps : if the upper clamp is opened first , excess will go up to the drip chamber ; if the lower clamp is opened , the excess will be delivered to the patient ( bolus ). in utilizing the two syringe systems , one should be aware not to remove the same amount as added . it will thus be seen that through the present invention there is now provided a flexible expansion member for an i . v . administration set which will allow for varying the retrograde volume of an additive i . v . fluid . the flexible expansion member permits a large volume of liquid to be placed in an i . v . administration set between the respective injection sites obviating the need for a long length of flexible tubing . as will be readily appreciated , the i . v . solution container is usually set at a predetermined distance above the patient and the use of a long length of flexible tubing can be a problem because of potential kinking or constriction . it will be further seen that the flexible expansion means is simple in its construction and can be readily fabricated from standard thermoplastic materials and molding techniques . the foregoing invention can now be practiced by those skilled in the art . such skilled persons will know that the invention is not necessarily restricted to the particular embodiments presented herein . the scope of the invention is to be defined by the terms of the following claims as given meaning by the preceding description .
| 0Human Necessities
|
this invention relates to rapamycin dimers of general formula ( 1 ), which possess immunosuppressive and / or antifungal and / or antitumor and / or anti - inflammatory activity in vivo and / or inhibit thymocyte proliferation in vitro and are therefore useful in the treatment of transplantation rejection , autoimmune diseases ( i . e . lupus , rheumatoid arthritis , diabetes mellitus , multiple sclerosis ), fungal infections ( i . e . candida albicans ), cancer , and diseases of inflammation . ## str3 ## wherein a is --( ch 2 ) n --, --( ch 2 ) n --( ch ═ ch )--( ch 2 ) m --, --( ch 2 ) n --(-- c . tbd . c --)--( ch 2 ) m -- , ## str4 ## substituted alkyl , substituted alkenyl , substituted alkynyl , and substituted aromatic ; n = 1 - 10 , m = 1 - 10 and n = m or n ≠ m the rapamycin dimers ( 1 ) of this invention can be prepared by standard literature procedure as outlined below ## str5 ## wherein r is rapamycin and a is as defined above . the ester formation between alcohol and acyl halide has been described [ jerry march , advanced organic chemistry , 3rd edition , published in 1985 , page 346 ]. the specific reaction condition employed in this invention was developed by s . rakhit of ayerst laboratories and reported in u . s . pat . no . 4 , 316 , 885 ( feb . 23 , 1982 ). immunosuppresive activity of the compounds of the present invention was evaluated in an in vitro standard pharmacological test procedure to measure lymphocyte proliferation ( laf ). the comitogen - induced thymocyte proliferation procedure ( laf ) was used as an in vitro measure of the immunosuppressive effects of representative compounds . briefly , cells from the thymus of normal balb / c mice were cultured for 72 hours with pha and il - 1 and pulsed with tritiated thymidine during the last six hours . cells are cultured with and without various concentrations of rapamycin , cyclosporin a , or test compound . cells are harvested and incorporated ; radioactivity is determined . inhibition of lymphoproliferation is assessed in percent change in counts per minute from non - drug treated controls . the results are expressed by the following ratio : ## equ1 ## the following table summarizes the results of representative compounds of this invention in this standard test procedure . table 1______________________________________biological activity - laf assay r /* a at 100 nm at 10 nm at ic . sub . 50______________________________________example 1 1 . 0 0 . 95 -- example 2 0 . 96 0 . 28 -- example 3 1 . 0 0 . 59 -- example 4 1 . 0 1 . 10 1 . 32______________________________________ * relative potency of analogs / rapamycin at dosages 100 nm and at 10 nm . the results of this standard pharmacological test procedure for a representative compound of this invention demonstrates that the compounds of this invention are useful as immunosuppressive agents . the compounds may be administered neat or with a pharmaceutical carrier to a mammal in need thereof . the pharmaceutical carrier may be solid or liquid . a solid carrier can include one or more substances which may also act as flavoring agents , lubricants , solubilizers , suspending agents , fillers , glidants , compression aids , binders or tablet - disintegrating agents ; it can also be an encapsulating material . in powders , the carrier is a finely divided solid which is in admixture with the finely divided active ingredient . in tablets , the active ingredient is mixed with a carrier having the necessary compression properties in suitable proportions and compacted in the shape and size desired . the powders and tablets preferably contain up to 99 % of the active ingredient . suitable solid carriers include , for example , calcium phosphate , magnesium stearate , talc , sugars , lactose , dextrin , starch , gelatin , cellulose , methyl cellulose , sodium carboxymethyl cellulose , polyvinylpyrrolidine , low melting waxes and ion exchange resins . liquid carriers are used in preparing solutions , suspensions , emulsions , syrups , elixirs and pressurized compositions . the active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid carrier such as water , an organic solvent , a mixture of both or pharmaceutically acceptable oils or fats . the liquid carrier can contain other suitable pharmaceutical additives such as solubilizers , emulsifiers , buffers , preservatives , sweeteners , flavoring agents , suspending agents , thickening agents , colors , viscosity regulators , stabilizers or osmo - regulators . suitable examples of liquid carriers for oral and parenteral administration include water ( partially containing additives as above , e . g . cellulose derivatives , preferably sodium carboxymethyl cellulose solution ), alcohols ( including monohydric alcohols and polyhydric alcohols , e . g . glycols ) and their derivatives , and oils ( e . g . fractionated coconut oil and arachis oil ). for parenteral administration , the carrier can also be an oily ester such as ethyl oleate and isopropyl myristate . sterile liquid carriers are useful in sterile liquid form compositions for parenteral administration . the liquid carrier for pressurized compositions can be halogenated hydrocarbon or other pharmaceutically acceptable propellent . liquid pharmaceutical compositions which are sterile solutions or suspensions can be utilized by , for example , intramuscular , intraperitoneal or subcutaneous injection . sterile solutions can also be administered intravenously . the compound can also be administered orally either in liquid or solid composition form . preferably , the pharmaceutical composition is in unit dosage form , e . g . as tablets or capsules . in such form , the composition is sub - divided in unit dose containing appropriate quantities of the active ingredient ; the unit dosage forms can be packaged compositions , for example , packeted powders , vials , ampoules , prefilled syringes or sachets containing liquids . the unit dosage form can be , for example , a capsule or tablet itself , or it can be the appropriate number of any such compositions in package form . the dosage to be used in the treatment must be subjectively determined by the attending physician . the following examples illustrate the preparation of representative compounds of this invention . a solution of 0 . 13 g adipoyl chloride in 1 ml dry toluene was added dropwise at room temperature to a solution of 1 . 10 g rapamycin in 20 ml dry toluene and 2 ml dry pyridine ; the resulting solution was heated at 50 ° c . under nitrogen with stirring for 65 hours . the product was extracted into ethyl acetate after addition of 20 ml 2n hcl and 20 ml brine . the ethyl acetate solution was dried over mgso 4 and the solvent removed under reduced pressure . chromatography through silica gel using 10 % ethyl acetate in dichloromethane yielded 50 mg product as a yellow solid , mp 111 °- 142 ° c . ir ( kbr ): 3430 , 2925 , 1718 , 1645 , 1352 , 1170 , 785 , and 632 cm - 1 . nmr ( cdcl 3 , 400 mhz ): δ 3 . 36 ( s , 6h , och 3 ), 3 . 33 ( s , 6h , och 3 ), 3 . 14 ( s , 6h , och 3 ), 1 . 75 ( s , 6h , ch 3 ), 1 . 65 ( s , 6h , ch 3 ). ms ( neg fab ): 1937 , 590 . a solution of 0 . 25 g pimeloyl chloride in 1 ml toluene was added to a solution of 1 . 12 g rapamycin in 35 ml toluene and 2 ml pyridine ; the resulting solution was heated at 50 ° c . for 44 hours under nitrogen with stirring . upon cooling , 10 ml 2n hcl and 20 ml brine were added and the product was extracted into ethyl acetate ( 30 ml ), which was washed with brine dried over mgso 4 and evaporated . the residue was chromatographed through silica gel using a gradient of 5 % to 30 % ethyl acetate in dichloromethane , yielding 75 mg purified product as a pale yellow solid , mp 120 °- 150 ° c . ir ( kbr ): 3440 , 2930 , 1732 , 1648 and 1455 cm - 1 . nmr ( cdcl 3 , 400 mhz ): δ 3 . 37 ( s , 6h , och 3 ), 3 . 34 ( s , 6h , och 3 ), 3 . 14 ( s , 6h , och 3 ). ms ( neg fab ): 1951 , 590 . a stirred solution of 1 . 24 g rapamycin and 0 . 30 g suberoyl chloride in 100 ml toluene and 2 ml pyridine was heated at 50 ° c . for 66 hours under nitrogen , then cooled , diluted with 100 ml ethyl acetate and treated with 20 ml 2n hcl and 50 ml brine . the organic portion was washed with brine , dried over mgso 4 , stripped of solvent , and chromatographed through silica gel using a gradient of 0 . 5 % to 20 % methanol in dichloromethane , yielding 140 mg product as a pale yellow solid , mp 117 °- 134 ° c . ir ( kbr ): 3430 , 2920 , 1728 , 1640 , 1442 and 980 cm - 1 . nmr ( cdcl 3 , 400 mhz ): δ 3 . 37 ( s , 6h , ome ), 3 . 33 ( s , 6h , ome ), 3 . 14 ( s , 6h , ome ). ms ( neg fab ): 1965 , 590 . a solution of 1 . 27 rapamycin and 50 mg azelaoyl chloride in 125 ml toluene and 2 ml pyridine was stirred at 50 ° c . under nitrogen for 65 hours , then cooled and treated with 20 ml 2n hcl . the organic portion was washed with brine , dried over mgso 4 , stripped of solvent , and chromatographed through silica gel using a gradient of 0 . 5 % to 10 % methanol in dichloromethane , yielding 110 mg product as a pale yellow solid , mp 107 °- 125 ° c . ir ( kbr ): 3450 , 2935 , 1730 , 1650 , 1455 , 1100 and 990 cm - 1 . nmr ( cdcl 3 , 400 mhz ): δ 3 . 375 ( s , 6h , ome ), 3 . 33 ( s , 6h , ome ), 3 . 14 ( s , 6h , ome ). ms ( neg fab ): 1979 , 590 . a solution of 100 mg 1 , 4 - phenylenediacrylic acid in 5 ml thionyl chloride was heated at reflux under nitrogen for two hours . the thionyl chloride was removed under reduced pressure ; the residue was dissolved in 5 ml toluene , added to a stirred solution of 0 . 90 g rapamycin in 25 ml toluene and 2 ml pyridine , and heated at 50 ° c . for 72 hours . the cooled reaction mixture was treated with 20 ml 2n hcl and diluted with 20 ml ethyl acetate and 50 ml brine . the product was extracted into ethyl acetate and chromatographed through silica gel using a gradient of 0 to 3 percent methanol in dichloromethane , yielding 60 mg product as a pale yellow solid , mp 121 °- 131 ° c . ir ( kbr ): 3420 , 2930 , 1715 , 1640 , 1445 , 1100 and 980 cm - 1 . nmr ( cdcl 3 , 400 mhz ): δ 7 . 64 ( d , 2h , j = 12 . 0 hz ), 7 . 52 ( s , 4h , aromatic ), 6 . 47 ( d , 2h , j = 12 . 0 hz ), 3 . 38 ( s , 6h , ome ), 3 . 32 ( s , 6h , ome ), 3 . 12 ( s , 6h , ome ). ms ( neg fab ): 2009 ( m - ), 1112 , 590 .
| 2Chemistry; Metallurgy
|
fig1 shows the construction of an image forming system comprising a preferred embodiment of the present invention . this image forming system comprises a scanner 100 and printers 200 connected by means of their respective video interface , p1284 interface and network interface , such that they are capable of bi - directional communication . the original document images are read by a color ccd in the scanner 100 and output as 8 - bit r , g , and b image data . after undergoing various processes in an image processor 135 in the scanner 100 , such as rgb to ymck color conversion , the image data is sent to one of the printers 200 . although only one printer is illustrated in fig1 there may be several printers connected to the scanner 100 . the scanner 100 has a reading unit 110 equipped with a color ccd , a panel 120 by which instructions are input by the user , and a control board 130 . the control board 130 has a reading control unit 131 that controls the reading unit 110 , a memory 132 that temporarily stores the read image data , a backup ram 133 that stores the image processing parameters , a memory control unit 134 that controls the memory 132 and the backup ram 133 , an image processing unit 135 that performs image processing such as logarithmic conversion ( conversion from brightness data to density data ), ucr / bp processing ( undertone elimination and black ink generation ), color conversion ( conversion to ymck printing color data ), space filter processing such as smoothing ( moire suppression ) and mtf correction ( sharpening of character and line images ), and gamma correction ( linearization of the recording density ) appropriate for the output characteristics of the printer 200 , a panel control unit 136 that controls the panel 120 , a printer interface control unit 137 that controls the printer interface that allows communication with the printer 200 , and a cpu 138 that performs overall control of the components described above . the reading unit 110 and the control board 130 are connected through scsi ports , and the panel 120 and the control board 130 are connected by means of a dedicated interface . the interfaces for each printer comprise all of the interfaces capable of bi - directional communication , such as a p1284 interface , a network interface , and a video interface . the image data that has undergone image processing is transmitted to the printer 200 via the video interface . each printer 200 has a video interface 210 and a nonvideo interface 220 , each of which is capable of communication with the scanner 100 , an engine unit 230 that prints image data received via the video interface 210 , and a cpu 240 that performs overall control of the components mentioned above . the engine unit 230 forms images corresponding to each of the colors of yellow ( y ), magenta ( m ), cyan ( c ) and black ( k ), which together form a color image . in the image forming system of the present invention comprising a scanner and printers connected , as described above , image quality data for the images output from the printers 200 is transmitted to the scanner 100 , and variations in the image quality of the output images due to differences among the printers 200 are reduced by automatically adjusting the image processing parameters to have the scanner 100 correct the output images based on the data sent from the printer 200 . fig2 is a flow chart showing the sequence of the automatic adjustment process . automatic adjustment is begun by the user executing an instruction to begin from the panel 120 ( alternatively , automatic adjustment may be performed at regular intervals ). here , possible automatic adjustment modes provided include density gamma adjustment mode ( mode number m = 0 ) to automatically adjust for variations in the reproduced density gradation due to differences among the printers , and color adjustment mode ( mode number m = 1 ) to automatically adjust for variations in color reproduction . the mode number m may be set by an operator using the panel 20 . the mode number m change is implemented by the cpu 138 . the mode number m may be set by an operator using the panel 120 . the mode number m change is then implemented by the cpu 138 . when an instruction to begin automatic adjustment is issued , the cpu 138 of the scanner 100 determines from the result of communication with the printer 200 whether or not printer initialization has been completed ( step s 1 ). if the answer is no , the cpu 138 waits until initialization of printer 200 is completed , and if the answer is yes , it proceeds to the next step , step s 2 . in step s 2 , it is determined whether the active automatic adjustment mode is density gamma adjustment mode or color adjustment mode . if the active mode is density gamma adjustment mode ( yes in step s 2 ), the density gamma adjustment mode patterns shown in fig4 are created and stored in the pattern data buffer in the memory 132 ( step s 3 ) ( see fig3 ). the density gamma adjustment patterns comprise pattern data comprising combinations of c , m , y and k values each ranging from the smallest ( 1 ) to the largest ( 255 ). if the active mode is the color adjustment mode ( no in step s 2 ), the color adjustment patterns shown in fig5 are created and stored in the pattern data buffer in the memory 132 ( step s 4 ). the color adjustment patterns consist of pattern data comprising n different combinations of random c , m and y values . when the storage of pattern data in either step s 3 or step s 4 is completed , the command to begin automatic adjustment is sent to the printer 200 ( step s 5 ), and one item of pattern data is selected in step s 6 in accordance with the sequence of pattern data items ( pattern 1 to pattern n ) set in step s 3 or step s 4 . in step s 7 , the cpu 138 waits for receipt of the density data created by the printer 200 in accordance with the pattern data sent in step s 6 and sent to the printer 200 . on the other hand , if the printer 200 is an electrophotographic printer , a toner image is formed on the photoreceptor based on the received pattern data , the toner image is read by a density detection sensor not shown in the drawings , and density data is thereby obtained . this density data is then sent to the scanner 100 . however , if the printer 200 is an inkjet printer or a thermal transfer printer , the pattern may be created on paper and the density data for this pattern obtained . when the scanner 100 receives the density data from the printer 200 ( yes in step s 7 ), the density data is stored in the memory 132 ( step s 8 ), and the pattern data number n is incrementally increased ( step s 9 ). in step s 10 , it is determined whether the density data for the final pattern data item n has been stored . if the answer in step s 10 is no , the cpu 138 returns to step s 6 and the density data for the next pattern data is obtained . if the answer is yes , this means that the density data for all of the pattern data has been obtained , and the command to complete automatic adjustment is sent to the printer 200 ( step s 11 ). after the density data for all of the pattern data is obtained in this way , in step s 12 , it is determined whether the active automatic adjustment mode is density gamma adjustment mode or color adjustment mode . if it is density gamma adjustment mode ( yes in step s 12 ), density reproduction data is created from the density data ( step s 13 ), and a new gamma correction lookup table that comprises the image processing parameter is calculated ( step s 14 ) so that the printer input values and the read density have a linear relationship , as shown in fig7 ( c ). if the active automatic adjustment mode is color adjustment mode ( no in step s 12 ), color adjustment data is created ( step s 15 ) and a color adjustment parameter that comprises the image processing parameter is calculated from the color adjustment data ( step s 16 ). the processes of steps s 13 through s 16 are explained in further detail below . the image processing parameters calculated in steps s 14 and s 16 are stored in the backup ram 133 ( step s 17 ). fig6 is a block diagram showing the construction of the image processing unit 135 where the active automatic adjustment mode is the density gamma adjustment mode ( m = 0 ) as shown in the flow chart referred to above . the image processing sequence where the density gamma adjustment mode is active will be explained below with reference to fig6 . the 8 - bit r , g , and b image data read and output by the reading unit 110 is stored in the memory 132 in the control board 130 . the r , g , and b image data is then read out from the memory 132 synchronously with each of the ymck color images printed by the printer 200 , and after logarithmic conversion ( conversion from brightness data to density data ), ucr / bp processing ( undertone elimination and black ink generation ), and color conversion ( conversion to ymck printing color data ) are performed , space filter processing such as smoothing ( moire suppression ) and mtf correction ( sharpening of character and line images ), and gamma correction ( linearization of the recorded density ) appropriate for the output characteristics of the printer 200 are performed by the image processing unit 135 . on the other hand , the r , g , and b data read out from the memory 132 is input to an area differentiation unit 139 and area differentiation to distinguish between character areas and photo areas , for example , is performed . based on the results of this differentiation , the relative amounts of smoothing and mtf correction are alternated for each area , thereby improving image sharpness . the image data processed in this way is input into the printer 200 via the prescribed printer interface , and printing is performed . if the density gamma adjustment mode is active , as described above , the scanner 100 outputs the density gamma adjustment data shown in fig4 to the printer 200 ( steps s 5 through s 11 ), creates density reproduction data from the density data received from the printer 200 ( step s 13 ), and changes the gamma correction lookup table ( lut ) so that this density reproduction data will exhibit a linear relationship between the printer input values and the read density ( s 14 ). fig7 ( a ), 7 ( b ), and 7 ( c ) are graphs showing an example of the density reproduction data obtained from the printer and the linearization performed during automatic adjustment . as shown in fig7 ( a ), the image density reproduced ( read density ) generally does not have a linear relationship to the original document density to be reproduced ( printer input values ). this nonlinearity varies among printers , and variations in density and color are particularly marked in low - density areas . if gamma correction that is adjusted so as to satisfy linearity of only the average values in the drawing is performed with regard to the printer characteristics shown in fig7 ( a ), the result shown in fig7 ( b ) is obtained , and variations due to differences among printers remain . in the present invention , the settings of the scanner 100 are corrected so that the output from each printer 200 will exhibit a linear relationship between the printer input values and the read density . by performing this automatic adjustment for each printer 200 as described above , as shown in fig7 ( c ), image reproduction is attained that comes very close to satisfying this linearity criterion at all times regardless of the differences among the printers 200 , and variations in the output image quality that occur due to differences among conventional printers , printer changes over time and replacement of consumable parts are reduced . fig8 is a block diagram showing the construction of the image processing unit 135 where the active automatic adjustment mode is the color adjustment mode ( m = 1 ) as shown in the above flow chart . the image processing sequence where the color adjustment mode is active will be explained below with reference to fig8 . this image processing sequence is basically identical to that shown in fig6 . in other words , the 8 - bit r , g , and b image data read and output by the reading unit 110 is stored in the memory 132 in the control board 130 . the r , g , and b image data is then read out from the memory 132 synchronously with the ymck color images printed by the printer 200 , and after logarithmic conversion , ucr / bp processing and color conversion masking matrix conversion are performed , space filter processing such as smoothing and mtf correction and gamma correction appropriate for the output characteristics of the printer 200 are performed by the image processing unit 135 . on the other hand , the r , g , and b data taken out from the memory 132 is input to the area differentiation unit 139 and area differentiation to distinguish among character areas and photo areas , for example , is performed . based on the results of this differentiation , the relative amounts of smoothing and mtf correction are alternated for each area , thereby improving image sharpness . the image data processed in this way is input into the printer 200 via a prescribed printer interface , and printing is performed . if the color adjustment mode is active , as described above , the scanner 100 outputs the color adjustment patterns to the printer 200 ( steps s 5 through s 11 ), creates color adjustment data from the density data received from the printer 200 ( step s 15 ), and changes the color adjustment parameter using this color adjustment data ( step s 16 ). specifically , the color adjustment chart ( a chart in which each of ymck colors has a linear relationship to the density ) is read by the reading unit 110 , r , g and b average values are calculated for each patch , and data ( color adjustment pattern ) is created by performing logarithmic conversion and ucr / bp processing to all of the data ( step s 4 ). the data obtained from the logarithmic conversion and ucr / bp processing is termed data 1 ( dr , dg , db ). this data 1 is then output to the printer 200 in accordance with the sequence outlined in the flow chart of fig2 ( steps s 5 through s 11 ), and color adjustment density data is thereby obtained ( step s 15 ). this data is termed data 2 . the color conversion masking matrix is then sought using the smallest square method so that the error between data 1 and data 2 will be the smallest ( step s 16 ). in other words , a is sought that makes the error between ax and y the smallest when ax = y , data 1 is x and data 2 is y in the equation 1 below ( color conversion masking matrix conversion equation ). namely , the equation 2 below is obtained using smallest square method curve - fitting . equation 1 : ( m11 m12 m13 m14 m15 m16 m17 m18 m19 m21 m22 m23 m24 m25 m26 m27 m28 m29 m31 m32 m33 m34 m35 m36 m37 m38 m39 ) ( dr dg dg dr × dg 256 dg × db 256 dr × db 256 dr 2 256 dg 2 256 db 2 256 ) = ( c m y ) equation 2 : ∑ i = 0 n { ci - ( m11 × x1 i + m12 × x2 i + m13 × x3 i + m14 × x4 i + m15 × x5 i + m16 × x6 i + m17 × x7 , + m18 × x8 i + m19 × x9 i ) } 2 m 11 through m 19 that will make the result of this equation 2 the smallest are then sought . m 21 through m 29 and m 31 through m 39 are sought in the same manner and deemed the color conversion masking coefficients . fig9 is a flow chart showing the sequence of the copying operation after automatic adjustment . when the user issues a copy instruction via the panel 120 , the cpu 138 of the scanner 100 reads the image processing parameter stored in the step s 17 described above from the backup ram 133 ( step s 21 ) and sets the read parameter in the image processing unit 135 ( step s 22 ). it then begins scanning by means of the reading unit 110 to read the original document , and processes the image data obtained by means of the image processing unit 135 in which the new parameter is set ( see fig6 and 8 ) ( step s 23 ). the processed image data is input to the printer 200 via the prescribed printer interface , whereby printing is begun ( step s 24 ). therefore , using this embodiment , the scanner 100 calculates and stores the scanner image processing parameter for density gamma adjustment or color adjustment and performs image processing using the current scanner image processing parameter when copying is begun . consequently , the variations in the reproduced gradation and color reproduction that occur due to the differences among printers 200 may be automatically adjusted for on the side of the scanner 100 such that more precise correction is possible and variations in output image quality are further reduced . in addition , not only the variations in output image quality due to the differences among printers 200 , but also the variations in output image quality that occur due to changes in the printers 200 over time or to the replacement of consumable parts may be adjusted for in the same manner . the variations in output image quality are further reduced from this perspective as well . further , even where different combinations are used for the scanner 100 and printers 200 , the automatic adjustment described above is applicable to reduce the variations in output image quality . moreover , where image processing is performed using a personal computer and the image data is output to printers 200 , adjustment for the differences among the printers 200 may be performed . the automatic adjustment by the scanner 100 is performed by the cpu 138 executing a prescribed program that describes the processing sequence described above . this prescribed program is provided in the form of a computer - readable recording medium ( floppy disk or cd - rom , for example ). this prescribed program may be provided on its own as application software that executes the processing explained above or may be incorporated in the scanner software as one of the scanner functions . this applies where the output from the scanner undergoes image processing by means of a personal computer and is then output to the printers . as explained above , using the present invention , adjustment of image processing parameters is performed in the image processor , and therefore , variations in the reproduced gradation and color reproduction due to the different characteristics of the image forming apparatuses may be automatically adjusted for on the side of the image processor , whereby more precise correction may be performed and the variations in output image quality are further reduced . the variations in output image quality due to changes in the image forming apparatuses over time in the market or to replacement of consumable parts may also be automatically adjusted for . while particular embodiments of the present invention have been illustrated and described herein , the scope of this patent is not limited to the particular illustrated embodiments . the scope of the patent shall be defined by the following claims and equivalents thereto .
| 6Physics
|
the permeation rate used herein means the amount of a permeate per unit membrane area per unit time and expressed by the unit of kg / m 2 . hr . on the other hand , the separation factor ( α ) is the ratio of the proportion of water to an organic compound in the feed mixture , to that in the permeate in vapor form . that is , α =( x / y ) p /( x / y ) f , wherein x and y are compositions of water and an organic compound in a two - component system , respectively : and p and f represent the permeate and the feed mixture , respectively . in order to further illustrate the present invention in detail , a mechanism of separation of liquid by pervaporation is set forth hereinafter . that is , the mechanism of separation of liquid by pervaporation is said to be dissolution and diffusion of liquid in a membrane . generally , a separation factor α ab which is a value obtained by dividing a weight ratio of a component to b component after permeation through a membrane by that before permeation can be expressed by the product of a ratio of solubilities of a and b components to the membrane and a ratio of diffusion rates of a and b components in the membrane . therefore , in order to increase the separation factor α ab , it is necessary to increase either or both of the solubility ratio and the ratio of diffusion rates of a and b components . the solubility is mainly determined by interaction between permeate molecules and a membrane ( chemical miscibility ). as a measure of chemical miscibility between a material constituting a membrane and a material to be separated , a solubility parameter is taken . upon choosing a material constituting a membrane , it is preferred to choose a material having high chemical miscibility or similar polarity to a material to be separated . and , it is said that , in the case that a material to be separated ( permeate molecules ) is hydrophilic , a material constituting a membrane having a high solubility parameter and high polarity is suitable and , in the case that a material is not hydrophilic , a material constituting a membrane having reverse properties is suitable . the diffusion rate is determined by shape , size and an agglomeration state of permeate molecules , and a free volume of a membrane . in order to increase a separation factor α ab , shape of permeate molecules in a feed mixture should be largely different . in general , a smaller molecule has a larger diffusion rate . however , when a given material to be separated is fixed , it is difficult to increase a diffusion rate α ab by difference in shape of permeate molecules . on the other hand , a free volume of a membrane is defined by molecular spacings in the sense of a molecular measure , although it is not macroscopic holes . when a low molecular weight material which makes molecular motion of a high molecular weight material vigorous is contained , a free volume of a membrane becomes larger , which facilitates permeation . in a membrane having a larger free volume , difference between diffusion rates due to difference in size of permeate molecules becomes smaller , whereas , in a membrane having a smaller free volume , difference between diffusion rates due to difference in size of permeate molecules becomes larger . in order to increase a separation factor by utilizing size of permeate molecules , a free volume of a membrane should be small . in order to make a free volume of a membrane smaller , there is employed such a method as introduction of a crosslinking structure or crystalline structure to form three dimensional network . according to the present inventor &# 39 ; s study on various membranes for separation of an aqueous solution containing a water soluble organic compound , particularly , ethanol by pervaporation , it has been found that a separation membrane which is obtained by adding polystyrene sulfonic acid to polyvinyl alcohol having a large solubility parameter , i . e ., strong hydrophilic nature , and subjecting the mixture to heat treatment to effect intermolecular crosslinking reaction between the hydroxy group of polyvinyl alcohol and the sulfonic acid group of polystyrene sulfonic acid can selectively separate the alcohol from the water - alcohol mixture , and the membrane has sufficient durability as well as high permeation rate and separation factor throughout a wide concentration range of the alcohol . the sulfonic acid group of the above reaction mixture may be introduced as a sulfonate group . as the polyvinyl alcohol copolymer used in the present invention , there can be used copolymers of polyvinyl alcohol and other polymers such as polyethylene , polyvinyl acetate , polymethyl acrylate , polystyrene , polyacrylonitrile , polyacrylic acid and the like . however , in the present invention , preferably , polyvinyl alcohol is used . as the polystyrene sulfonic acid copolymer , there can be used copolymers of polystyrene sulfonic acid and other polymers such as polyacrylonitrile , polyvinyl chloride , polymethyl acrylate , polyacrylic acid and the like . however , in the present invention , preferably , polystyrene sulfonic acid is used . the separation membrane of the present invention can be prepared by , for example , dissolving polyvinyl alcohol or the polyvinyl alcohol copolymer , and polystyrene sulfonic acid or the polystyrene sulfonic acid copolymer in water or an aqueous solution containing a water soluble organic compound such as an alcohol or the like and casting the solution on a porous supporting material , for example , an ultrafiltration membrane . drying and heat treatment are carried out , simultaneously to effect intermolecular crosslinking to form a coat layer on the porous supporting material a crosslinked reaction mixture of the polyvinyl alcohol or polyvinyl alcohol copolymer and the polystyrene sulfonic acid or polystyrene sulfonic acid copolymer . the heat treatment is carried out at a temperature in the range of 80 ° to 200 ° c ., preferably , 100 ° to 150 ° c . the mixing ratio of polyvinyl alcohol and polystyrene sulfonic acid is in the range of , preferably , 1 to 10 parts by weight , more preferably , 1 . 5 to 5 parts by weight of polyvinyl alcohol per 1 part by weight of polystyrene sulfonic acid . the porous supporting material that having micropores of several tens to several thousands å on its surface . examples thereof include porous supporting material made of known materials such as polysulfone , polyether sulfone , polyacrylonitrile , cellulose esters , polycarbonate , polyvinylidene fluoride and the like . the porous supporting material may be in any shape , for example , it may be flat membrane , tubular membrane , hollow fiber membrane and the like . preferably , the coat layer composed of the thin film of the crosslinkable film is as thin as possible so far as it is pinhole free . the thickness of the coat layer is 0 . 05 to 5 μm , preferably , 0 . 1 to 1 μm . in order to thin the thickness of the coat layer , it is necessary to decrease the solids content of the solution applied on the porous supporting material , or the thickness of the coated film . the solids content is , preferably , 1 to 15 % by weight , more preferably , 5 to 10 % by weight . in order to thin the thickness of the film , it is necessary to choose a suitable coating method . in order to form a uniform pinhole free film , the solution is preferably applied on the porous supporting material with a bar coating machine , a spin coating machine and the like . in the membrane thus produced , oh group of polyvinyl alcohol and so 3 h group of polystyrene sulfonic acid are reacted to form intermolecular crosslinking . formation of crosslinking can be confirmed by solubility of the membrane in a mixture to be separated or the infrared absorption spectrum of the membrane . when crosslinking is not formed , the membrane is dissolved during separation operation . a partially remaining sulfonic acid group is neutralized with a base to convert into a sulfonate . examples of the counter cation of the sulfonate include alkali metals , alkaline earth metals , transition metals and ammonium ions of the formula r 4 n + wherein r is hydrogen or alkyl . preferably , it is an alkali metal , particularly , sodium . the membrane thus formed is mainly used for separation of a mixture of water and one or more organic compounds , for example , an aqueous solution containing one or more organic compounds selected from the group consisting of alcohols such as methanol , ethanol , 1 - propanol , 2 - propanol , n - butanol and the like ; ketones such as acetone , methyl ethyl ketone and the like ; ethers such as tetrahydrofuran , dioxane and the like organic acids such as formic acid , acetic acid and the like aldehydes such as formaldehyde , acetaldehyde , propionaldehyde and the like ; and amines such as pyridine , picoline and the like . further , the membrane can be used for separation of a gaseous mixture of water and these organic compounds . according to the present invention , separation can be carried out by the steps of ( a ) contacting one side of the separation membrane of the present invention with a liquid feed mixture containing water and at least one organic compound ; and ( b ) withdrawing from the other side of said membrane a permeate in a vapor state . these operations per se can be carried out according to a known method . by using the membrane of the present invention , separation of an organic liquid mixture throughout a wide concentration range can be efficiently carried out at a large permeation rate with maintaining a separation factor higher than that of a known separation method using a conventional membrane . thereby , a compact and rational separation system can be realized and it is possible to improve the ability of treatment and decrease in cost . thus , according to the present invention , a membrane separation method is practically applicable for reducing operation steps and saving energy in separation and purification processes in chemical industries . the following comparative examples and examples further illustrate the present invention in detail but are not to be construed to limit the scope thereof . the following pervaporation experiments were carried out by maintaining one side of a membrane to which a mixture of water and a water soluble organic compound was fed at atmosphere pressure and the other permeate side at reduced pressure not more than 0 . 3 mmhg . the active surface of the membrane was directed to the feed side and the feed mixture was added on the surface and stirred at a constant temperature . at this time , effective membrane area was 15 . 2 cm 2 . water and the organic compound permeated through the membrane were collected by condensation with liquid nitrogen . n - propanol was added to the permeate as an internal standard and a permeation rate and a separation factor were determined by tcd gas chromatography . by the way , the separation factor of water to ethanol α etoh h . sbsp . 2 o is defined as follows : ## equ1 ## wherein x etoh and x h . sbsb . 2 o are ethanol and water contents (% by weight ) in the feed mixture , respectively ; and y etoh and y h . sbsb . 2 o are ethanol and water contents (% by weight ) in the permeate . polyvinyl alcohol having a polymerization degree of 2 , 000 ( 7 g ) was dissolved in water ( 93 g ) at 80 ° c . after cooling to room temperature , the solution was applied on an ultrafiltration membrane composed of polyacrylonitrile with a spin coating machine . the coated ultrafiltration membrane was dried at 40 ° c . for 1 hour and then subjected to heat treatment at 120 ° c . for 2 hours . the pervaporation ability in aqueous 95 % ( w / w ) ethanol solution of the membrane thus obtained was such that the permeation rate was 0 . 02 kg / m 2 . hr and the separation factor ( α etoh h . sbsp . 2 o ) was 160 . polystyrene having a polymerization degree of 1 , 000 to 1 , 400 ( 10 g ) was dissolved in carbon tetrachloride ( 200 ml ) at 60 ° c . for 1 hour . then , the solution was placed in a four necked flask and conc . sulfuric acid ( 30 ml ) was added to the flask under nitrogen atmosphere . the mixture was reacted at 60 ° c . for 4 hours . the reaction mixture was added to dehydrated ether to form a white precipitate . to the precipitate was added carbon tetrachloride to dissolve the precipitate . the solution was further added to dehydrated ether to form a precipitate . this procedure was repeated four times to purify the reaction product . the reaction product was confirmed as polystyrene sulfonic acid by its infrared absorption spectrum . to the polystyrene sulfonic acid thus obtained ( 1 . 2 g ) were added polyvinyl alcohol having a polymerization degree of 2 , 000 ( 1 . 8 g ), ethanol ( 1 . 4 g ) and water ( 24 g ) and the mixture was dissolved at 80 ° c . the solution was applied on an ultrafiltration membrane composed of polyacrylonitrile with a spin coating machine ( 800 r . p . m .). the coated membrane was dried at 40 ° c . for 1 hour and then subjected to heat treatment at 120 ° c . for 2 hours to effect crosslinking . the pervaporation ability in aqueous 95 % ( w / w ) ethanol solution of the membrane thus obtained was such that the permeation rate was 3 . 8 × 10 - 2 kg / m 2 . hr and the separation factor ( α etoh h . sbsp . 2 o ) was 97 . polystyrene having a polymerization degree of 1 , 000 to 1 , 400 ( 10 g ) was dissolved in carbon tetrachloride ( 200 ml ) at 60 ° c . for 1 hour . then , the solution was placed in a four necked flask and conc . sulfuric acid ( 30 ml ) was added to the flask under nitrogen atmosphere . the mixture was reacted at 60 ° c . for 4 hours . the reaction mixture was added to dehydrated ether and to form a white precipitate . to the precipitate was added carbon tetrachloride to dissolve the precipitate . the solution was further added to dehydrated ether to form a precipitate . this procedure was repeated four times to purify the reaction product . the reaction product was confirmed as polystyrene sulfonic acid by its infrared absorption spectrum . to the polystyrene sulfonic acid thus obtained ( 1 . 2 g ) were added polyvinyl alcohol having a polymerization degree of 2 , 000 ( 1 . 8 g ), ethanol ( 14 g ) and water ( 24 g ) and the mixture was dissolved at 80 ° c . the solution was applied on an ultrafiltration membrane composed of polyacrylonitrile by a spin coating machine ( 800 r . p . m .). the coated membrane was dried at 40 ° c . for 1 hour and then subjected to heat treatment at 120 ° c . for 2 hours to effect crosslinking . the membrane was soaked in an aqueous ethanol solution for 1 hour , aqueous 0 . 1 n naoh solution for 1 hour , 0 . 1 n nacl solution for 1 hour and then the ethanol solution for 1 hour and was dried at room temperature . the pervaporation ability of the membrane obtained is shown in table 1 . table 1______________________________________ separation ethanol permeation factorrun conc . temp . rate h . sub . 2 ono . ( wt %) (° c .) ( kg / m . sup . 2 · hr ) ( α . sub . etoh ) ______________________________________1 90 60 0 . 34 15002 95 60 0 . 14 14303 99 60 0 . 03 9904 95 75 0 . 23 950______________________________________ sodium poly - p - styrene sulfonate ( 10 g ) was dissolved in water ( 100 ml ). to the solution was added h + type cation exchange resin ( amberlite ir - 120b ) ( 25 ml ) and the mixture was stirred for 1 hour . by this procedure , the sodium poly - p - styrene sulfonate was converted into poly - p - styrene sulfonic acid . the ion exchange resin was filtered off and to the filtrate ( 50 ml ) were added polyvinyl alcohol ( 4 . 2 g ) and water ( 50 g ). the solution was applied on a polyacrylonitrile ultrafiltration membrane by a bar coating machine . the coated ultrafiltration membrane was dried at 40 ° c . for 1 hour and subjected to heat treatment at 120 ° c . for 2 hours to effect intermolecular crosslinking . the pervaporation ability of this membrane is shown in table 2 . table 2______________________________________ separation ethanol permeation factorrun conc . temp . rate h . sub . 2 ono . ( wt %) (° c .) ( kg / m . sup . 2 · hr ) ( α . sub . etoh ) ______________________________________5 50 60 40 266 75 60 0 . 25 497 95 60 0 . 03 5008 95 40 0 . 23 12909 99 40 0 . 01 710______________________________________ the membrane obtained in comparative example 1 was soaked in an aqueous ethanol solution for 1 hour , 0 . 1 n koh solution or 0 . 1 n csoh solution for 3 hours and then the ethanol solution for 1 hour and was dried at room temperature . the pervaporation ability of this membrane is shown in table 3 . table 3______________________________________ separation ethanol permeation factorrun conc . temp . rate h . sub . 2 ono . base ( wt %) (° c .) ( kg / m . sup . 2 · hr ) ( α . sub . etoh ) ______________________________________10 koh 95 60 0 . 16 84011 csoh 95 60 0 . 13 630______________________________________ according to the same manner as described in example 1 , a separation membrane was prepared except that the mixing ratio ( weight ratio ) of polyvinyl alcohol and polystyrene sulfonic acid , and the total weight % ( solids content ) of polystyrene sulfonic acid and polyvinyl alcohol were varied . the pervaporation ability of the membrane prepared is shown in table 4 . the pervaporation ability was determined by feeding aqueous 95 % ( w / w ) ethanol solution at 60 ° c . table 4______________________________________ separation solids mixing * permeation factorrun content ratio rate h . sub . 2 ono . ( wt %) ( wt ratio ) ( kg / m . sup . 2 · hr ) ( α . sub . etoh ) ______________________________________12 7 . 5 2 . 0 / 1 . 0 0 . 10 97013 7 . 5 1 . 5 / 1 . 0 0 . 13 107014 7 . 5 1 . 0 / 1 . 0 0 . 13 36015 5 . 0 1 . 5 / 1 . 0 0 . 10 19016 3 . 7 1 . 5 / 1 . 0 0 . 11 140______________________________________ * polyvinyl alcohol / polystyrene sulfonic acid to polystyrene sulfonic acid ( 1 . 2 g ) were added polyvinyl alcohol having a polymerization degree of ( 1 . 8 g ), ethanol ( 14 g ) and water ( 24 g ) and the mixture was dissolved at 80 ° c . the solution was applied on a glass plate and dried at 40 ° c . for 1 hour to prepare a membrane . the infrared absorption spectrum of this membrane is shown in fig1 . further , the membrane was subjected to heat treatment at 120 ° c . for 2 hours . the infrared absorption spectrum of this membrane is shown in fig2 . as shown by these drawings , absorption bands at 1180 cm - 1 and 1450 cm - 1 are newly appeared by heat treatment at 120 ° c . for 2 hours . these absorption bands are corresponding to r -- o -- so 2 -- r formed by the crosslinking reaction of the polyvinyl alcohol and polystyrene sulfonic acid , and become more intense by heating for a longer time .
| 8General tagging of new or cross-sectional technology
|
the present invention is a system and method for remotely processing misrecognized speech generated when converting speech audio to text in an embedded speech recognition system . as used herein , an embedded speech recognition system refers to a speech recognition system that is bound in a functionally fixed manner within specific hardware ; hardware which is not designed to be re - purposed by a user , meaning that a user should not “ delete ” speech recognition software from the hardware device in order to use the device for a purpose unrelated to speech recognition . that is , an embedded speech recognition system utilizes specialized hardware for performing speech recognition tasks . the embedded speech recognition system can be an integrated part of a stand - alone computing device , such as a mobile dictation device . it should be noted that embodiments exist where the embedded speech recognition system can receive external input and where firmware updates can be applied to the embedded speech recognition system . such actions are not to be construed as “ re - purposing ” the embedded speech recognition system , for purposes of the invention detailed herein . fig1 is a schematic illustration illustrating the interaction between an embedded speech recognition system 110 and a remote training system 120 , both configured in accordance with the inventive arrangements . as shown in fig1 , the method can include detecting a speech misrecognition in the embedded speech recognition system 110 . misrecognized speech can refer to speech recognized text which does not match the actual audio input provided by the speaker . an example of misrecognized speech can include the speech recognized text , “ time ” resulting from the speaker provided audio input , “ climate ”. upon detecting a speech misrecognition , both the speech audio associated with the misrecognized and the active acoustic model 130 can be transmitted to the remote training system 120 . subsequently , the remote training system 120 can use the speech audio in a process for modifying the acoustic model . once modified , the improved acoustic model 140 can be transmitted back to the embedded speech recognition system 110 . as shown in fig1 , the embedded speech recognition system 110 and the remote training system 120 can communicate through communications link 150 . communications link can be any suitable communications system , including both wireless or wireline technologies . examples of wireless technologies can include line - of - sight technologies such as infrared , radio frequency communications , including cellular , as well as short - range radio frequency communications technologies , such as bluetooth ™ technology from the bluetooth special interest group . examples of wireline technologies can include direct cable technologies such as usb , and serial communications , as well as communications network technologies such as ethernet . fig2 shows an embedded speech recognition system 110 suitable for use with the present invention . the embedded speech recognition system 110 preferably is comprised of an embedded computing device including a central processing unit ( cpu ) 202 , one or more memory devices and associated circuitry 204 a , 204 b . the embedded speech recognition system 110 also can include an audio input device such as a microphone 208 and an audio output device such as a speaker 210 , both operatively connected to the computing device through suitable audio interface circuitry 206 . the cpu 202 can be comprised of any suitable microprocessor or other electronic processing unit , as is well known to those skilled in the art . memory devices can include both non - volatile memory 204 a and volatile memory 204 b . examples of non - volatile memory can include read - only memory and flash memory . examples of non - volatile memory can include random access memory ( ram ). the audio interface circuitry 206 can be a conventional audio subsystem for converting both analog audio input signals to digital audio data , and also digital audio data to analog audio output signals . in one aspect of the present invention , a display 225 and corresponding display controller 220 can be provided . the display 225 can be any suitable visual interface , for instance an lcd panel , led array , crt , etc . in addition , the display controller 220 can perform conventional display encoding and decoding functions for rendering a visual display based upon digital data provided in the embedded speech recognition system 110 . still , the invention is not limited in regard to the use of the display 225 to present visual feedback to a speaker . rather , in an alternative aspect , an audio user interface ( aui ) can be used to provide audible feedback to the speaker in place of the visual feedback provided by the display 225 and corresponding display controller 220 . moreover , in yet another alternative aspect , feedback can be provided to the speaker through both an aui and the display 225 . fig3 illustrates an exemplary high level architecture for the embedded speech recognition system 110 of fig1 . as shown in fig3 , an embedded speech recognition system 110 for use with the invention typically can include an operating system 302 , a speech recognition engine 310 , a speech enabled application 320 , and acoustic models / language models 330 for use by the speech recognition engine 310 . notably , acoustic models 330 can include phonemes which can be used by the speech recognition engine 310 to derive a list of potential word candidates from an audio speech signal . significantly , in fig3 , the speech recognition engine 310 , speech enabled application 320 and acoustic / language models 330 are shown as separate application programs . it should be noted however that the invention is not limited in this regard , and these various application programs could be implemented as a single , more complex applications program . for example the speech recognition engine 310 could be combined with the speech enabled application 320 . referring now to both fig2 and 3 , during a speech recognition session , speech audio signals representative of sound received in microphone 208 are processed by cpu 202 within the embedded speech recognition system 110 using audio circuitry 206 so as to be made available to the operating system 302 in digitized form . the speech audio signals received by the embedded speech recognition system 110 are conventionally provided to the speech recognition engine 310 via the computer operating system 302 in order to perform speech - to - text conversions on the speech audio signals which can produce speech recognized text . in sum , as in conventional speech recognition systems , the audio signals are processed by the speech recognition engine 310 using acoustic models 330 to identify words spoken by a user into microphone 208 . once speech audio signals representative of speech have been converted to speech recognized text by the speech recognition engine 310 , the speech recognized text can be provided to the speech enabled application 320 for further processing . examples of speech enabled applications can include a speech - driven command and control application , or a speech dictation system , although the invention is not limited to a particular type of speech enabled application . the speech enabled application , in turn , can present the speech recognized text to the user through a user interface . for example , the user interface can be a visual display screen , an lcd panel , a simple array of leds , or an aui which can provide audio feedback through speaker 210 . in any case , responsive to the presentation of the speech recognized text , a user can determine whether the speech recognition engine 310 has properly speech - to - text converted the user &# 39 ; s speech . in the case where the speech recognition engine 310 has improperly converted the user &# 39 ; s speech into speech recognized text , a speech misrecognition is said to have occurred . importantly , where the user identifies a speech misrecognition , the user can notify the speech recognition engine 310 . specifically , in one aspect of the invention , the user can activate an error button which can indicate to the speech recognition engine that a misrecognition has occurred . however , the invention is not limited in regard to the particular method of notifying the speech recognition engine 310 of a speech misrecognition . rather , other notification methods , such as providing a speech command can suffice . responsive to receiving a misrecognition error notification , the speech recognition engine 310 can transmit the original speech audio signal which had been misrecognized , and the active acoustic model to the remote training system 120 . additionally , the active language model also can be transmitted to the remote training system 120 . subsequently , the remote training system can process the speech audio signal and the active acoustic model to modify the acoustic model in a speech training session . fig4 illustrates an exemplary high level architecture for the speech training system 120 of fig1 . as shown in fig4 , a speech training system 120 for use with the invention typically can include an operating system 402 , a speech recognition engine 410 , a speech training application 420 , and acoustic models / language models 430 for use by the speech recognition engine 410 and for modification by the speech training application 420 . as in the case of fig3 , in fig4 the speech recognition engine 410 , speech training application 420 and acoustic / language models 430 are shown as separate application programs . it should be noted however that the invention is not limited in this regard , and these various application programs could be implemented as a single , more complex applications program . in operation , during a remote speech training session , a list of contextually valid phrases in the speech recognition system can be presented to the user . contextually valid phrases can include those phrases in a finite state grammar system which would have been valid phrases at the time of the misrecognition . for example , in a speech - enabled word processing system , while editing a document , a valid phrase could include , “ close document ”. by comparison , in the same word processing system , prior to opening a document for editing , an invalid phrase could include “ save document ”. hence , if a misrecognition error had been detected prior to opening a document for editing , the phrase “ save document ” would not be included in a list of contextually valid phrases , while the phrase “ open document ” would be included in a list of contextually valid phrases . once the list of contextually valid phrases has been presented to the user , the user can select one of the phrases as the phrase actually spoken by the user . subsequently , a list words can be presented which form the selected phrase . again , the speaker can select one or more words in the list which represent those words originally spoken by the speaker , but misrecognized by the embedded speech recognition system 110 . these words can be processed along with the stored speech audio input and the active language model 430 by the speech training application 420 . more particularly , the speech training application 420 can incorporate corrections into acoustic models 430 based on the specified correct words . by modifying the acoustic models 430 during a speech training session , the accuracy of the speech recognition engine 310 of the embedded speech recognition system 110 can increase as fewer misrecognition errors can be encountered during a speech recognition session . fig5 a is a flow chart illustrating a method for processing a misrecognition error in an embedded speech recognition system during a speech recognition session . the method can begin in step 502 in which an embedded speech recognition system can await speech input . in step 504 , if speech input is not received , the system can continue to await speech input . otherwise , in step 506 the received speech input can be speech - to - text converted in a speech recognition engine , thereby producing speech recognized text . in step 508 , the speech recognized text can be presented through a user interface such as a visual or aui . subsequently , in step 510 if an error notification is not received , such notification indicating that a misrecognition has been identified , it can be assumed that the speech recognition engine correctly recognized the speech input . as such , the method can return to step 502 in which the system can await further speech input . in contrast , if an error notification is received , indicating that a misrecognition has been identified , in step 512 the speech audio input , active acoustic model , and the active language model can be transmitted to the remote speech training system . fig5 b is a flow chart illustrating a method for performing speech training in a remote speech training system based on a speech misrecognition detected in an embedded speech recognition system . in step 514 , each of the speech audio , active acoustic model and active grammar which had been received from the embedded speech recognition system can be recalled for use by the speech training system . subsequently , in step 516 a list of contextually valid phrases can be compiled indicating those phrases which would be considered valid speech input at the time of the misrecognition . additionally , in step 518 the list can be presented through a user interface . in step 520 , a phrase can be selected from among the phrases in the list . then , in step 522 , the words forming the selected phrase can be presented in a list of words through the user interface . in step 524 , one or more of the words can be selected , thereby indicating those words which had been misrecognized by the speech recognition engine . thereafter , in step 526 the selected words can be passed to a speech training process . also , in step 526 the original speech audio input and active grammar can be provided to the speech training process . in consequence , in step 528 , the speech training process can modify the acoustic model in order to improve future recognition accuracy . finally , in step 530 , the modified acoustic model can be transmitted back to the embedded speech recognition system . notably , the present invention can be realized in hardware , software , or a combination of hardware and software . the method of the present invention can be realized in a centralized fashion in one computer system , or in a distributed fashion where different elements are spread across several interconnected computer systems . any kind of computer system or other apparatus adapted for carrying out the methods described herein is suitable . a typical combination of hardware and software could be a general purpose computer system with a computer program that , when being loaded and executed , controls the computer system such that it carries out the methods described herein . the present invention can also be embedded in a computer program product , which comprises all the features enabling the implementation of the methods described herein , and which when loaded in a computer system is able to carry out these methods . computer program means or computer program in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : a ) conversion to another language , code or notation ; b ) reproduction in a different material form . while the foregoing specification illustrates and describes the preferred embodiments of this invention , it is to be understood that the invention is not limited to the precise construction herein disclosed . the invention can be embodied in other specific forms without departing from the spirit or essential attributes . accordingly , reference should be made to the following claims , rather than to the foregoing specification , as indicating the scope of the invention .
| 6Physics
|
fig1 schematically depicts a lithographic projection apparatus 1 according to an embodiment of the invention . the apparatus 1 includes a base plate bp . the apparatus may also include a radiation source la ( e . g . uv or euv radiation , such as , for example , generated by an excimer laser operating at a wavelength of 248 nm , 193 nm or 157 nm , or by a laser - fired plasma source operating at 13 . 6 nm ). a first object ( mask ) table mt is provided with a mask holder configured to hold a mask ma ( e . g . a reticle ), and is connected to a first positioning device pm that accurately positions the mask with respect to a projection system or lens pl . a second object ( substrate ) table wt is provided with a substrate holder configured to hold a substrate w ( e . g . a resist - coated silicon wafer ), and is connected to a second positioning device pw that accurately positions the substrate with respect to the projection system pl . the projection system or lens pl ( e . g . a mirror group ) is configured to image an irradiated portion of the mask ma onto a target portion c ( e . g . comprising one or more dies ) of the substrate w . as here depicted , the apparatus is of a reflective type ( i . e . has a reflective mask ). however , in general , it may also be of a transmissive type , for example with a transmissive mask . alternatively , the apparatus may employ another kind of patterning device , such as a programmable mirror array of a type as referred to above . the source la ( e . g . a discharge or laser - produced plasma source ) produces radiation . this radiation is fed into an illumination system ( illuminator ) il , either directly or after having traversed a conditioning device , such as a beam expander , for example . the illuminator il may comprise an adjusting device configured to set the outer and / or inner radial extent ( commonly referred to as σ - outer and σ - inner , respectively ) of the intensity distribution in the beam of radiation pb . in addition , it will generally comprise various other components , such as an integrator and a condenser . in this way , the beam of radiation pb impinging on the mask ma has a desired uniformity and intensity distribution in its cross - section . it should be noted with regard to fig1 that the source la may be within the housing of the lithographic projection apparatus , as is often the case when the source la is a mercury lamp , for example , but that it may also be remote from the lithographic projection apparatus , the radiation which it produces being led into the apparatus ( e . g . with the aid of suitable directing mirrors ). this latter scenario is often the case when the source la is an excimer laser . the present invention encompasses both of these scenarios . the beam pb subsequently intercepts the mask ma , which is held on a mask table mt . having traversed the mask ma , the beam pb passes through the lens pl , which focuses the beam pb onto a target portion c of the substrate w . with the aid of the second positioning device pw and interferometer ( s ) if , the substrate table wt can be moved accurately , e . g . so as to position different target portions c in the path of the beam pb . similarly , the first positioning device pm can be used to accurately position the mask ma with respect to the path of the beam pb , e . g . after mechanical retrieval of the mask ma from a mask library , or during a scan . in general , movement of the object tables mt , wt will be realized with the aid of a long - stroke module ( coarse positioning ) and a short - stroke module ( fine positioning ), which are not explicitly depicted in fig1 . however , in the case of a wafer stepper ( as opposed to a step and scan apparatus ) the mask table mt may just be connected to a short stroke actuator , or may be fixed . the mask ma and the substrate w may be aligned using mask alignment marks m 1 , m 2 and substrate alignment marks p 1 , p 2 . 1 . the depicted apparatus can be used in two different modes : in step mode , the mask table mt is kept essentially stationary , and an entire mask image is projected at once , i . e . a single “ flash ,” onto a target portion c . the substrate table wt is then shifted in the x and / or y directions so that a different target portion c can be irradiated by the beam pb ; 2 . in scan mode , essentially the same scenario applies , except that a given target portion c is not exposed in a single “ flash .” instead , the mask table mt is movable in a given direction ( the so - called “ scan direction ”, e . g ., the y direction ) with a speed v , so that the beam of radiation pb is caused to scan over a mask image . concurrently , the substrate table wt is simultaneously moved in the same or opposite direction at a speed v = mv , in which m is the magnification of the lens pl ( typically , m = ¼ or ⅕ ). in this manner , a relatively large target portion c can be exposed , without having to compromise on resolution . fig2 shows the projection apparatus 1 comprising an illumination system with a source - collector module or radiation unit 3 , illumination optics unit 4 , and projection optics system 5 . a radiation system 2 includes the source - collector module or radiation unit 3 and the illumination optics unit 4 . the radiation unit 3 may be provided with an euv radiation source 6 which may be formed by a discharge plasma . the euv radiation source 6 may employ a gas or vapor , such as xe gas or li vapor in which a very hot plasma may be created to emit radiation in the euv range of the electromagnetic spectrum . the very hot plasma is created by causing a partially ionized plasma of an electrical discharge to collapse onto the optical axis o . partial pressures of 0 . 1 mbar of xe , li vapor or any other suitable gas or vapor may be required for efficient generation of the radiation . the radiation emitted by radiation source 6 is passed from the source chamber 7 into collector chamber 8 via a gas barrier or “ foil trap ” 9 . the gas barrier 9 includes a channel structure such as , for example , described in detail in u . s . patent application publication 2002 / 0154279 a1 and u . s . pat . no . 6 , 359 , 969 . the collector chamber 8 includes a radiation collector 10 , which according to the present invention , is formed by a grazing incidence collector . radiation passed by collector 10 is reflected off a grating spectral filter 11 or mirror to be focused in a virtual source point 12 at an aperture in the collector chamber 8 . from chamber 8 , the beam of radiation 16 is reflected in illumination optics unit 4 via normal incidence reflectors 13 , 14 onto a reticle or mask positioned on reticle or mask table 15 . a patterned beam 17 is formed which is imaged in projection optics system 5 via reflective elements 18 , 19 onto wafer stage or substrate table 20 . more elements than shown may generally be present in illumination optics unit 4 and projection system 5 . as can be seen in fig3 , the grazing incidence collector 10 comprises a number of nested reflector elements 21 , 22 , 23 . a grazing incidence collector of this type is , for instance , shown in german patent application de 101 38 284 . 7 , which is equivalent to u . s . patent application publication 2003 / 0095623 a1 . the embodiment of the rotating channel array or barrier 43 according to the present invention as shown in fig4 shows the euv source 6 from which euv radiation beams 6 ′ emanate . the beams 6 ′ impinge on the barrier 43 forming part of a vacuum wall separating the source chamber from the uv optics downstream of the optical axis . the barrier 43 is rotatable around the optical axis o , as indicated by the arrow . it is also possible for the barrier 43 to rotate around the optical axis o in a direction opposite to the direction of the arrow or alternately rotate in one direction or the other . the center 44 of the barrier 43 is located on the optical axis . the barrier 43 may be cylindrically symmetric along an optical axis 0 . the barrier may also be invariant when rotated over some specific angles only . the barrier 43 comprises a lamellar structure 41 . the mutual distance between the different lamellas can vary , as shown , for a segment 42 of the barrier 43 . thus , the distance between consecutive lamellas may vary . the lamellar structure 41 forms , viewed in 3d , small channels . the channels may be focussed on the radiation source 6 . it is also possible to construct a channel array 43 without a real focus . the channels are , however , parallel with the emitted euv beam . the principal idea behind the invention is that contaminating particles 45 in the euv radiation 6 ′ will , due to rotation of the barrier 43 stick to the inside of the lamellar structure 41 through which the euv radiation 6 ′ propagates . the barrier 43 is rotatable for instance by a drive 46 located on both sides of the barrier 43 , with rotational speeds of about 7 rotations per second . the lamellar structure 41 is focussed on the radiation source . euv rays of radiation emitted from the euv source may pass the lamellar structure 41 without obstruction . typical values for the dimensions of the lamellar structure 41 are : platelets : height 30 mm , thickness 0 . 1 mm and width 50 mm ( curved ). a typical value for the channel width is 1 mm . the distance from the barrier 43 to the source 6 is typically in the order of 60 mm . when the rotation of the foil trap is not synchronized with the pulse frequency of the source , stroboscopic effects can occur . to circumvent stroboscopic effects , the foil trap could be rotated exactly an integer number of channels in between two pulses of the source . for those components shown in fig5 having the same reference numeral as corresponding components shown in fig2 - 4 , reference is made to the description of those figures above , as these components are not described further hereinbelow . fig5 shows a barrier assembly 47 including barriers 43 and 43 ′ driven by separate drives 46 and 46 ′, respectively . in the embodiment shown barriers 43 and 43 ′ rotate in opposite directions , as indicated by arrows a 1 and a 2 , around the optical axis o . this barrier assembly is able to prevent fast moving contaminating particles ( thermal or with velocities several times higher than thermal ) emanating from the euv source ( or thermalized in the volume between the source and the foil traps ) to escape from the source chamber and reach the collector chamber . this may also be achieved by similar barrier assemblies , wherein one barrier 43 is rotating and the other barrier 43 ′ is stationary , or wherein both barriers 43 , 43 ′ rotate in the same direction , however with different velocities . while specific embodiments of the invention have been described above , it will be appreciated that the invention may be practiced otherwise then as described . the description is not intended to limit the invention .
| 6Physics
|
the amplified transducer signal is fed to a comparator 1 serving as a threshold valve switch , the threshold level of which being adjustable by the potentiometer p and its hysteresis being defined by the resistor r h1 . the outlet signal b of the inverter 2 subsequently added to the comparator 1 , is fed to the control circuit of the integrator 4 which comprises a transmission gate 3 . in the case of a positive control voltage the control circuit shunts the capacitor c i of the integrator 4 holding the capacitor c i at zero level . if a negative control voltage is fed to the transmission gate 3 , the integrator outlet voltage c ascends linearly according to the slew rate defined by the time coefficient r i . c i , 4 , 3 . the peak value obtained at the respective period is stored at the peak value storage , built by the two operational amplifiers 5 and 6 whereby the discharge time of the storage - capacitor c 1 is defined by the resistor r 1 . a voltage divider consisting of the resistors r t1 and r t2 is subsequently added to the peak value storage . the midpoint tap e of the voltage divider and the outlet c of the integrator are connected to a comparator 7 . if the integrator output voltage c which is fed to the inverting inlet of comparator 7 becomes more positive than the voltage peak value e determined by the peak value gauge in the prior period and which already had decreased a little due to the time coefficient c 1 . r 1 , the comparator outlet f becomes negative . as soon as at the next positive edge of the comparator outlet b the comparator resets the integrator to zero level the voltage at the outlet c of the integrator , respectively at the inverting inlet of the comparator falls short of the divided voltage peak value e or the voltage at the non - inverting inlet of said comparator respectively , and its outlet voltage becomes positive again . for the compensation of the time shift between the first positive edge appearing at the outlet b of the threshold value switch and the first positive edge at the outlet f of the comparator caused by the non - infinite slew rate of the comparator 7 , the two outlets b and f are connected to a logic circuit 8 , comprising an inverter and a nor - gate . as , especially shown by fig2 the signal at the outlet f of the comparator 7 before the arrival of the first pulse of a group of pulses at the inlet a of the threshold value switch is negative . before the arrival of the first pulse of a group of pulses the outlet of the threshold value switch is negative ; however , a positive signal is fed to the inlet of the nor - gate , due to the inverter . therefore at the outlet of the nor - gate before the arrival of the first pulse a negative signal is available . at the time the first pulse arrives at the inlet a the outlet of the threshold value switch becomes positive and therefore the corresponding inlet of the nor - gate becomes negative , causing the outlet g of the gate to become and remain positive as long as the outlet of the comparator 7 is negative due to the finite slew rate of the comparator , although already a positive pulse is present at the outlet of the threshold value switch . in principle it is possible to build up the circuit according the invention with other elements than that shown in fig1 . for instance the threshold value switch may be built as a schmitt - trigger and the peak value storage may be built by a simple capacitor . further it is possible to eliminate the inverter 2 as well as the inverter of the logic circuit . it is only essential that the threshold value switch be connected to an integrator 4 which according to its control may be released , reset or blocked respectively , and if necessary , to a logic circuit 8 comprising a nor - or an and - gate whereby the integrator is connected directly and via a peak value storage and a voltage divider subsequently added to the peak value storage to a comparator which , if desired , may be connected to the logic circuit .
| 6Physics
|
referring to the only figure , a photodetector 10 is connected to a gate bias source 12 and an admittance bridge 14 . the admittance bridge 14 is further connected to a reference oscillator 16 and a lock - in amplifier 18 . the lock - in amplifier 18 is further connected to a recording device 20 that outputs appropriate information such as the light intensity of a beam 22 of light being of an infrared wavelength , for example . although , a broad range of wavelengths for detection is desired and made possible by the present invention . further , although the present invention is shown as a single photodetector 10 , it is clearly within the scope of the invention to place multiple photodetectors 10 on a single ic with the related electronics to output , for example , digital signals as to the intensity of each photodetector 10 . such electronics could include not only the above items but phase - lock loops , counters , and processors . referring in particular to photodetector 10 , a wafer 42 is an n - type semiconductor single - crystal silicon wafer which has upon a top surface 44 and a bottom surface 46 , a highly doped donor ( n +) layer 32 and ( n +) layer 28 , respectively . an electrically insulating layer 26 is placed on bottom highly doped donor layer 28 . layer 26 has a drain contact 24 and a source contact 22 therethrough . emitter contact 24 is bonded to layer 28 and source contact 22 is bonded to a source 40 being a highly doped acceptor area . substrate 30 being n - type acts as a drain 48 of the photodetector 10 . a layer 50 is deposited upon the highly doped donor layer 32 . layer 50 is a layer which is electrically insulating as well as chemically inactive to the material of photoactive layer 34 . photoactive layer 34 is preferrably solid but an encapsulated liquid layer is possible . layer 50 may be aluminum oxide , zinc oxide , or tantalum oxide or other materials that satisfy the criteria noted above . photoactive layer 34 may be essentially a mixture of porphyrin - quinone . u . s . pat . no . 3 , 873 , 215 is incorporated by reference as to the teachings contained therein especially those directed at the light sensitive compounds . it has been found that certain light sensitive porphyrin - quinone solutions eject protons and uptake protons when illuminated . charge separation accompanies the movement of protons and is observed in light - sensitive solid solutions . the amount of uptake or ejection is proportional to the light intensity with a constant porphyrin concentration . the wavelength can be varied over a wide range which depends on the absorption characteristic of the porphyrin . when the light sensitive porphyrin - quinone solution is exposed to light , protons are ejected into the surrounding media . the photo - response of the photodetector 10 may also arise from a charge - transfer mechanism of layer 34 . many porphyrins can be used as a component of the photoactive layer 34 . chlorophyll a , chlorophyll b , pheophytin , bacteria - chlorophyll and zinc tetraphenylporphin have been found to be especially useful . hydroquinone and benzoquinone have been found useful as the quinone component . hydroquinone gives greater responses . with the use of benzoquinone , air can be present but air must be absent when using hydroquinone as the quinone component . the porphyrin concentration is usually in the range of about 10 - 2 to 10 - 5 moles while the quinone concentration is generally in the range of about 10 - 2 to 10 - 4 moles . the photoactive layer 34 need not be limited to porphyrins - quinone ( hydroquinone ) systems . a protective layer 52 may be deposited over photoactive layer 34 to prevent any environmental impact such as oxidation of the chemicals therein . layer 52 is only partially shown thereon . a gate electrode 36 is deposited either upon layer 34 or layer 52 as the case may be . lead 38 provides the connection to the gate bias source 12 . the only figure shows the structure of a three - terminal modified gate - controlled photodetector 10 . there are three possible ways to measure the differential admittance of photodetector 10 . one way to measure the admittance is through the gate electrode 36 and contacts 22 and 24 by an essentially standard mos measurement . the second method of measurement is through the gate electrode 36 and source contact 22 with substrate 30 floating or shorted to the source . the preferred method described is through the source contact 22 and drain contact 24 with the gate electrode 36 controlled by a bias voltage . the differential admittance is measured by means of capacitance bridge 14 and lock - in amplifier 18 with other devices as shown in the figure . when the gate voltage biases the area under insulating layer 50 into accumulation , the admittance is only the p - n junction capacitance between the source and substrate . when a sufficiently negative gate bias voltage is applied , a p - type inversion layer starts to build up . this inversion layer connects to the p + and the measured capacitance increases drastically due to the extension of the inversion region . light on the photoactive layer 34 contributes to the capacitance change . the inversion layer resistivity is dependent on the applied bias . if the operating frequency is high enough , the current cannot follow the voltage in the inversion layer . as a result , the loss term rises and the capacitance decreases . when the p - n junction is biased , the c - v g and g - v g characteristics of the device will change . sets of c - v g and g - v g curves obtained at 10 khz frequency with different junction bias illustrate such . when the p - n junction is reverse biased , the depletion region will be widened which requires stronger electric fields at the silicon surface to invert the depletion layer . in other words , a higher negative gate bias is necessary to turn on the inversion layer . this causes the curves to shift in the negative gate bias direction with increased p - n junction reverse bias . the maximum capacitance for strong inversion also decreases due to the widening of depletion layer . when the junction is forward biased , a reverse situation occurs . since forward bias causes current to flow through the junction , it can only be measured in a relatively small range of forward bias voltages . the bias has the same effect on the g - v g characteristics . when porphyrins are excited with light in the presence of quinones or hydroquinones , protons are either ejected into the media by hydroquinone or protons are taken up by the semiquinone that is formed in the porphyrin - quinone reaction . the amount of proton movement is a function of the intensity of light . this movement has been found to be a straight line relationship . the wavelength of light whose intensity is being measured is determined by the absorption properties of the porphyrin . various wavelengths can be determined by changing the porphyrin e . g ., zn porphyrins , cd porphyrins , zn tetraphenylporphine , pheophytin , etc . when the photoactive layer 34 is irradiated , proton movement ( ph change ) or charge separation induces a change in the amount of capacitance of the p - n junction . the change in capacitance is measured by the change in frequency necessary to maintain the original capacitance valve . this change in frequency reflects the intensity of light irradiating the photoactive layer 34 . the ph change or charge separation can also be measured as a change in the gate voltage at a fixed value of source - substrate ( drain ) capacitance . the photodetector 10 can be fabricated by the following procedure : a ( 100 ) oriented single - crystal silicon wafer 42 being 2 - ωcm n - type phosphorus doped and about 12 mils thick is used with only one side polished . after a series of regular cleaning steps , the silicon wafer is coated with a layer of spin - on - dopant glass ( p atom concentration of 10 21 / cm 3 ) on both sides , after which it is given a drive - in treatment at 1100 ° c . for 1 hour to produce n + doped layers 28 and 32 of about 1 μm thick on both sides . the doped glass layer is removed and the wafer is thermally oxidized in a dry oxygen ambient at 1100 ° c . for 3 hours . this yields 200 - nm layers 26 and 50 of sio 2 . a 150 μm diameter aluminum dot is evaporated on top of the polished surface through a molybdemun mask . the distance between centers of the aluminum dots was 0 . 5 mm . the aluminum can be anywhere from 4 - 6 μm in thickness . the wafer 42 is then subjected to a temperature gradient zone melting process . the temperature gradient zone melting process is a process in which a liquid zone in the form of a sheet , rod , or droplet migrates through a solid in a temperature gradient . the migration of the liquid zone is caused by three spatially sequential processes : dissolution of the solid on the hot forward side of the liquid zone ; diffusion transport of the dissolved silicon to the cold rear side of the liquid zone ; and deposition of the silicon - aluminum alloy on the cold rear surface . in the present case , the front side of the wafer 42 is put directly underneath the infrared light source with the rear side of the wafer radiatively cooled by means of a water - cooled heat sink so that a temperature gradient over 200 ° c ./ cm is obtained across the wafer 42 . the 150 μm aluminum dot can be stably migrated through the silicon wafer in about 5 minutes . once the silicon wafer 42 is heated up to around 1200 ° c ., the already molten aluminum dot moves through the 0 . 20 μm layer 50 and penetrates into the silicon bulk . after migrating through the silicon substrate 30 the a1 droplet penetrates the sio 2 layer 26 on the other surface . it is obvious that the gradient grown zone will be degenerate p + due to the aluminum alloy . as a result , the sharp p - n junction forms . conventional lithographic methods are applied to open a window on both sides with the aluminum dot at its center . the silicon - aluminum alloy zone can be etched in a similar way , although the etching rate is generally not the same . the parameters which control the etching rate include : concentration of koh , temperature , stirring , ultrasonic agitation , etc . if these factors are properly controlled , the opened windows can be etched down preferentially and become a trapezoid as shown in the figure . the front surface is etched down about 100 μm . the bottom surface of the etched window is ( 100 ) oriented as is the silicon wafer itself and the four sides of the window are all in the ( 111 ) direction or its equivalents . a similar etching cycle is carried out to remove the aluminum on the rear side so that contact can be made to the aluminum enriched p + region . after the preferential etching is completed , the remaining sio 2 in layer 26 is removed in an hf solution . a thermal oxidation cycle is used to regrow layer 26 of sio 2 . a layer of sio 2 with a thickness of approximately 1500 angstroms is grown . a further procedure deposits layer 50 of aluminum oxide in place of sio 2 , for example . additional conventional procedures deposit photoactive layer 34 and protective layer 52 thereon as required . clearly , many modifications and variations of the present invention are possible in light of the above teachings and it is therefore understood , that within the inventive scope of the inventive concept , the invention may be practiced otherwise than specifically claimed .
| 8General tagging of new or cross-sectional technology
|
as used herein , the term “ a ” or “ an ”, when used in conjunction with the term “ comprising ” in the claims and / or the specification , may refer to “ one ,” but it is also consistent with the meaning of “ one or more ,” “ at least one ,” and “ one or more than one .” some embodiments of the invention may consist of or consist essentially of one or more elements , method steps , and / or methods of the invention . it is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein . as used herein , the term “ or ” in the claims refers to “ and / or ” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive , although the disclosure supports a definition that refers to only alternatives and “ and / or .” the present invention relates to the design , synthesis , construction , composition , characterization and use of a novel therapeutic agent such as nucleic acids ( micrornas ) and methods useful in treating cancer . more specifically , the invention discloses that artificial microrna 29a , b , c is a potent tumor suppressor able to significantly suppress cell proliferation , increase apoptosis , suppress tumor growth and increase sensitivity of chemotherapeutic drugs when presented in the form of pri - mirna , pre - mirna , mature mirna or fragments of variants thereof that retain the biological activity of the mature mirna and dna encoding a pri - mirna , pre - mirna , mature mirna , fragments or variants thereof , or regulatory elements of the mirna . a preferred embodiment of the present invention discloses that that mir - 29a significantly decreases the proliferation of both p53 - deficient ovcar8 and p53 - wild type heya8 . this is common characteristic of tumor suppressor genes and micrornas . from this work , a person having ordinary skill in this art could readily conclude that mir - 29a along with its family members mir - 29b and mir - 29c are strong suppressors of ovarian and other cancers . another preferred embodiment of the present invention discloses that mir - 29a significantly increases the sensitivity to cisplatin ( which is commonly used to treat ovarian and other cancers ). mir - 29a treated heya8 cells proliferate at rates substantially lower than heya8 cells treated with a scrambled control or the parental heya8 cell line . from these data one may readily conclude that mir - 29a and its family members mir - 29b and mir - 29c would significantly increase the sensitivity of tumors to chemotherapy in ovarian and other cancers . another preferred embodiment of this invention teaches that patients that are able to respond to current doses of chemotherapy can be treated with much lower doses of chemotherapy when presented with mir - 29a , b , c . also , patients that do not respond to chemotherapy , or patients that respond but relapse , can be treated with regular doses of chemotherapy in presence of mir - 29a , b , c . in addition since mir - 29a is highly effective at suppressing the proliferation of p53 - wild type ovarian cancer cells it is likely to be effective in treating low grade tumors as well . one preferred embodiment of the invention discloses the use of a nucleic acid construct encoding an artificial mirna presented as a double - stranded rna or precursor hairpin or a primary mirna in the single straded rna form or encoded in a dna vector delivered in a suitable pharmaceutical carrier , to be used for inhibiting the expression of all oncogenes and regulators of oncogenes containing a mir - 29a , b , c complementary site ( lcs ). the pharmaceutical carrier includes , but is not limited to , a virus , a liposome , or a polymer , and any combination thereof . another preferred embodiment of the present invention discloses the composition , methods and use of a nucleic acid construct encoding an artificial mirna presented as a double - stranded rna or precursor a hairpin or a primary mirna in the single stranded rna form or encoded in a dna vector delivered in a suitable pharmaceutical carrier , to be used for inhibiting the expression of all oncogenes and regulators of oncogenes containing a mir - 29a , b , c complementary site ( lcs ), wherein the mir - 29a , b , c is delivered in multiple ways , to include but not limited to , as a mature mirna by itself , or as a gene is encoded by a nucleic acid , or as a precursor hairpin by itself or conjugated to nanoparticles of metal or liposomal origin , or conjugated to nanoparticles of metal or liposomal origin , or as a primary mirna by itself or conjugated to nanoparticles of metal or liposomal origin or delivered on a virus , or as a liposome , or as a polymer , or as a gene that is encoded by a nucleic acid and such nucleic acid is located on a vector , or as a gene is encoded by a nucleic acid , or as a precursor hairpin by itself or conjugated to nanoparticles of metal or liposomal origin . another preferred embodiment of the present invention discloses that such nucleic acid is located on a vector selected from the group consisting of a plasmid , cosmid , phagemid , virus , and other vehicles derived from viral or bacterial sources , or is located on a vector that may further comprises one or more in vivo expression elements selected from the group consisting of a promoter , enhancer , and combinations thereof . another preferred embodiment of the present invention relates to the use of mir - 29a , b , c where mirna is administered to , or expression is increased in the cells of , a patient for treatment or prevention of cancer , including but not limited to lung cancer , pancreatic cancer , skin cancer , hematological neoplasms , breast cancer , brain cancer , colon cancer , follicular lymphoma , bladder cancer , cervical cancer , endometrial cancer , esophageal cancer , gastric cancer , head and neck cancer , multiple myeloma , liver cancer , lymphomas , oral cancer , osteosarcomas , ovarian cancer , uterine leiomyosarcoma , uterine leiomyomas , endometriomas , endometriosis , uterine papillary serous carcinomas , prostate cancer , testicular cancer , and / or thyroid cancer . another preferred embodiment of the present invention relates to the use of mir - 29a , b , c where mirna is administered to , or expression is increased in the cells of , a patient for treatment or prevention of cancer and wherein the patient is undergoing one or more cancer therapies selected from the group consisting of surgery , chemotherapy , radiotherapy , thermotherapy , immunotherapy , hormone therapy and laser therapy . another embodiment of the present invention discloses a method for determining the sensitivity of a cancer to a mir - 29a , b , c mirna delivered on a suitable pharmaceutical carrier to bind to an mrna encoded by an oncogene containing one or several mir - 29a , b , c complementary site ( lcs ) in a cancerous or transformed cell or an organism with a cancerous or transformed cell ; and determining if the cancerous or transformed cell growth or viability is inhibited or if expression of the oncogene is inhibited . while the invention described here specifically relates to the design and construction of a novel therapeutic agents such as nucleic acids ( micrornas ) to treat cancer , one of ordinary skills in the art , with the benefit of this disclosure , it is possible to extend the proposed micrornas to be used in many kind of cancer treatment , and would recognize the extension of the approach to other treatment protocols . the following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion . one skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned , as well as those objects , ends and advantages inherent herein . changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art . the set of 487 tumors analyzed were from the original tcga set of 489 ( samples tcga - 041536 and tcga - 61 - 1911 did not have quality mirna data at the time of this study ). the mirna array normalization steps are as follows . the gmeansignal from raw array files (. level 1 .) were quantile normalized and log transformed , removing duplicate samples and control probes (. level 2 .). multiple median centering steps set the median of every batch to the median of all batches : in brief , within each batch , the median for each mirna was first subtracted , then calculated the across batch median and added it back to all samples within that batch ; the resulting data were collapsed to mirna levels (. level 3 .). the level 3 mirna data are available at the tcga data portal . for gene expression analysis , the previously described . unified . dataset was used . the definition and validation of a prognostic mirna signature was carried out essentially as described for the previously - defined prognostic mrna ( gene ) signature [ the_cancer_genome_atlas_research_network ( 2011 ) integrated genomic analyses of ovarian carcinoma . nature 474 : 609 - 615 ], using the previously - defined training and validation subsets with expression values normalized within each subset to standard deviations from the median . given the mirna signature from the training dataset , the prognostic t - score was defined for each validation profile as the two - sided t - statistic comparing , within each tumor profile , the average of the poor prognosis mirnas with the average of the good prognosis mirnas . the time course mts assay experiments were run three times ( separate days ), each with a different set of biological quadruplicates ( n = 12 per group ); within each experiment run , the viability measures within each time point were centered on the mean of the wt group for the first run . for cisplatin treatment , cells were transfected as described , and media was replaced after 24 hrs with media containing cisplatin ( sigma ) ( 0 - 7 . 5 μg / ml ). viability was assayed 72 hrs post - transfection . experiments were run three times , each with a different biological replicate ( n = 3 per group ). for each run , viability measures within each concentration point were centered on the mean of values for the first run . total rna ( 60 ng ) was reverse transcribed in a 40 μl reaction using the taqman ® microrna reverse transcription kit ( abi ). custom primer sequences are shown in table 1 . qpcr was performed on a stepone real - time pcr system ( abi ) using power - sybr green pcr master mix ( abi ) in a 20 μl reaction and human ribosomal rna 18s as an endogenous control ( which was itself not mir - 29a - regulated , data not shown ). the qpcr experiments were run four times ( separate days ), each with independent biological samples ( n = 4 per group ); within each experiment run , relative expression values were normalized to standard deviations from the mean . mirnas are influenced by both copy number alteration and genomic location . the tcga ovarian cancer datasets were examined , representing 487 tumors profiled for mirna expression , for patterns of correlation between the mirnas and other molecular features . to begin with , it was considered whether mirnas with expression levels frequently altered by changes in dna copy number may reveal a subset of mirnas under clonal selection in the tumors . such mirnas would be of interest as candidate oncomirs or tumor suppressive mirs . mirnas were therefore systematically analyzed for both loss and gain of dna copy number associated with a concordant change in mature mirna expression level . this analysis revealed several mirnas in focally amplified and deleted genomic regions . in particular , let - 7b was the most frequently deleted mirna having both recurrent hemizygous genomic loss ( 86 % of samples ) and homozygous deletion ( 7 . 2 %). four members of the mir - 30 family were among the most frequently amplified mirnas . interestingly , these members were encoded at two different focally amplified loci ( 8q24 and 1p34 ) and all four mirnas showed strong concordant change in mature mirna expression . moreover , mirnas were frequently coexpressed with neighboring mirnas . previously , when examining mirna expression profiles in a small dataset of 24 normal human tissues , baskerville and bartel found evidence that proximal pairs of mirnas are generally coexpressed ( suggesting that they are processed from polycistronic primary transcripts ), and that intronic mirnas are usually coexpressed with their host gene mrna ( suggesting that they both derive from a common transcript ) [ 15 ]. to examine this situation in ovarian cancer ( thereby reinforcing current notions of mirna biology as well as the integrity of the tcga data ), pairwise comparisons for each chromosome between the expression profiles of all mirnas oriented in the same direction were made , calculating for each pair a correlation coefficient . the results showed that most mirna genes within 50 - 100 kb of each other had highly correlated expression patterns . notably , at distances beyond 100 kb ( exceeding the length of most human genes ), the correlation between pairs dropped dramatically to zero . while dna copy number alterations undoubtedly influence gene and mirna expression in cancer , pairwise correlations in copy number levels between proximal mirnas showed a very different pattern from the pairwise expression correlations . high proximal correlations for copy number extended for & gt ; 1 mb in length , with no dramatic drop . approximately 177 of the 558 mature human mirnas profiled are located in the genome within the introns of host genes , and mirnas were found to be frequently coexpressed with these host genes in this data . for each of 188 mirna - host gene pairs ( each comprised of a mirna located within the boundaries of a known gene , same orientation , where some mature mirnas have multiple genomic locations ), the correlation between mirna and host gene expression was computed . mirna - host gene pairs tended to be strongly correlated with each other and , with 52 % of the mirna - host gene pairs with available data showing significant positive correlation 1 ( p & lt ; 0 . 01 ), in agreement with previous studies . as expected , mirna expression was also correlated with host gene copy number , though the correlations were not as strong as for gene expression . mirnas and their predicted gene targets tend to be anti - correlated within ovarian tumors a key to studying mirnas is identifying their gene targets . while mirna targeting predictions made in silico ( the vast majority being unvalidated ) may have sizable rates of false positives and negatives , considering correlations between gene and mirna expression across a large panel of tumors could provide further support for potential mirna : mrna targeting relationships . to this end , all possible mirna : mrna correlations across the 487 tcga ovarian tumors were computed , for the top expressed 191 mirnas and 8547 genes . the 191 × 8547 mirna : mrna pairs were then sorted by low to high correlation , and found that among the most anti - correlated pairs , there was high enrichment for predicted mirna : mrna targeting interactions by miranda algorithm , where no such enrichment was observed for the positively correlated mirnas : mrnas . ( this trend was observed when considering all other mirnas and genes in addition to those most highly expressed . in addition to validating the public target prediction databases as being enriched for true positives , this finding indicated that thousands of mirna : mrna targeting interactions are active in ovarian cancer and influence tumor gene expression heterogeneity . the impact of copy number alteration on expression level can vary greatly between genes , conceivably introducing bias when evaluating association of mirna and gene expression levels . therefore , in addition to a direct pearson &# 39 ; s correlation between mirna and mrna , a simple linear regression model was applied to account for ‘ noise ’ due to copy number alteration , evaluating the association between expression levels of a mirna and mrna , when copy number alteration status of the gene is held fixed . interestingly , the pearson &# 39 ; s model and the regression model of mirna : mrna correlations both gave very similar overall results in terms of predicted target enrichment , with the regression model &# 39 ; s negatively correlated pairs showing slightly greater target enrichment . while , in general , copy number alteration did not represent a major confounding factor , the regression model could identify individual mirna : mrna correlations which were missed by the pearson &# 39 ; s model , including mir - 29a : hars2 . as another way to globally represent mirna : mrna interactions in ovarian cancer , for all mirna : mrna pairs with the strongest negative correlation ( regression coefficient & lt ;− 7 . 0 , based on the linear model ), the matrix of correlation coefficients were clustered , thereby grouping mirnas when they are negatively correlated with same genes and vice versa . the gene dendrogram was then cut to extract 6 gene clusters ( based on what appeared to be natural separations within the cluster tree ), each of which was found to be uniquely enriched for different gene classes , including a cluster with wnt and hedgehog pathway gene members , a cluster with cell adhesion genes , two clusters with immune response genes , and a cluster of cell cycle - related genes . for several individual mirnas , the genes anti - correlated in expression were significantly enriched for in silico predicted targets . fig1 shows that gene transcripts with mirna 7mer in the 3 ′- utr tend to be anti - correlated with expression of the corresponding mirna . top anticorrelated genes of mir - 29 in ovarian cancer included dnmt3a and dnmt3b , suggesting a role for mir - 29 in high - grade serous ovarian cancer . fig2 shows the correlation of gene expression with mir - 29a expression . mir - 29a was underexpressed in the dna methylation subtype “ mc2 ”. genes anti - correlated with mir - 29a were enriched for mir - 29a targets as predicted by sequence analysis ( either targetscan or miranda , fig2 ). however , many in silico predicted targets did not show the anticipated anti - correlation patterns , again suggesting that by factoring in expression data , one could reduce the false positive rate for target predictions . fig3 shows the top eight words ( of all 5 , 6 and 7mers ) enriched in 3 ′- utrs of mrnas anti - correlated with mir - 29a ( 5 ′- tagcaccatctgaaatcggtta - 3 ′, seq id no : 13 ) expression ( fdr & lt ; 1 − 6 ). fig4 contains a qpcr analysis showing relative quantity of selected mir - 29a anti - correlated gene targets after mir29a overexpression in heya8 ovarian cancer cells . furthermore , as additional evidence for mir - 29 activity , a correlation - based sequence motif analysis found that the mir - 29 seed sequence complement was the top enriched motif in 3 ′- utrs of mrnas anti - correlated with mir - 29a expression ( fig3 ), further suggesting that mir - 29 directly regulates expression levels of many target mrnas in the tumors . this analysis also showed strong enrichment for non - canonical mir - 29a seed motifs ( i . e . motifs not following the typical pattern of nucleotides 2 - 7 ) with a bulge in position 3 of the mir - 29a sequence , suggesting that target prediction methods requiring perfect base pairing in the seed region of the mirna target duplex could miss a substantial fraction of functional mirna target interactions . by forcing mir - 29a expression in vitro in the ovarian cancer cell line heya8 , it was confirmed that a number of the genes anti - correlated with mir - 29a , i . e ., dnmt3a , dnmt3b , cdc6 , cbx1 , mybl2 , and timeless ( four of which were predicted direct targets ), were repressed by mir - 29a ( fig4 ), which demonstrated these gene targets as relevant in both the in vitro functional models as well as the human tumor specimens ; one gene tested , sae1 , showed anticorrelations but no functional repression . while mir - 29 expression was not associated with survival ( p & gt ; 0 . 05 , univariate cox ), forced mir - 29a expression impacted cell proliferation in ovcar - 8 and heya8 cell lines ( fig5 a - 5b ) and had an additional effect on chemotherapeutic agent cisplatin in inhibiting the growth of these lines ( fig6 a - 6b ). fig5 a - 5b demonstrate the effect of mir - 29a overexpression on proliferation of heya8 and ovcar - 8 cells . when compared with the parental strains in each case as well as these cell lines transiently transfected with a scrambled control mir - 29a is able to very significantly suppress cell proliferation in p53 - wild type heya8 and moderately suppress cell proliferation of the p53 - deficient ovcar8 . fig6 shows the effect of mir - 29a on proliferation under cisplatin treatment . as can be clearly seen by fig6 a , mir - 29a suppresses the proliferation of heya8 significantly more effectively than the scrambled control at the same dosage of cisplatin . the present invention is well adapted to attain the ends and advantages mentioned as well as those that are inherent therein . the particular embodiments disclosed above are illustrative only , as the present invention may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein . furthermore , no limitations are intended to the details of construction or design herein shown , other than as described in the claims below . it is therefore evident that the particular illustrative embodiments disclosed above may be altered or modified and all such variations are considered within the scope and spirit of the present invention . also , the terms in the claims have their plain , ordinary meaning unless otherwise explicitly and clearly defined by the patentee .
| 0Human Necessities
|
fig1 shows a cross - section of a coaxial valve . in the valve box 1 , a flow channel 10 with a fluid inlet opening 12 and a fluid outlet opening 14 is provided . the fluid inlet opening 12 and the fluid outlet opening 14 on opposite ends of the valve box 1 are constructed in such a way that the flow channel 10 from the fluid inlet opening 12 is level with the fluid outlet opening 14 . in the cross - sectional view , flow channel 10 , the fluid inlet opening 12 and the fluid outlet opening 14 are arranged in a circular fashion and coaxially to each other , whereby they share a common center line x . in the area of the fluid inlet opening 12 , the flow channel 10 is formed by a first cylindrical bore section 16 . the first cylindrical bore section 16 is provided with a first frontal lid section 11 of valve box 1 . the fluid outlet opening 14 is provided with a second frontal lid section 13 on the side opposing the first frontal lid section of the valve casing . a cylindrical mid section 15 is situated between the first frontal lid section 11 and the second frontal lid section 13 of the valve box 1 . both lid sections 11 , 13 are screwed together with the cylindrical mid section , as illustrated in fig1 . the second frontal lid section 13 shows a cylindrical casing connection 17 protruding forward in the direction of the center line x which has been provided with a fluid outlet opening 14 . on the inside of the cylindrical casing connection 17 , a basically cylindrical second bore section 18 of the flow channel 10 is built , whereby this bore section possesses a diameter which is greater than that of the first cylindrical bore section 16 . between the first cylindrical bore section 16 and the second basically cylindrical bore section 18 of the flow channel 10 , a cylindrical internal space 19 is located in the area of the mid section 15 of the valve box 1 , the diameter of which is considerably larger than the diameter in the second basically cylindrical bore section 18 . in the flow channel 10 there is a tubular valve casing 2 coaxial to flow channel 10 between the first cylindrical bore section 16 and the second basically cylindrical bore section 18 . the valve casing 2 is made circular in cross - section and free to travel along its axis , which is identical with the center line x . the valve casing 2 is constructed as a straight tube and surrounds an inner channel 20 , which is provided with a front - sided inlet port 22 next to inlet opening 12 and a front - sided outlet port 24 , which faces toward fluid outlet opening 14 . thus the inner channel 20 provides a central section of flow channel 10 between the first cylindrical bore section 16 and the second basically cylindrical bore section 18 . on the internal space 19 , a drive 3 is provided . the drive acts on the valve casing 2 to move toward the center line x and will be further described hereafter . the drive 3 surrounds a drive motor 30 , which is arranged inside the internal space 19 , is constructed as an electric motor , and surrounds valve casing 2 , and a ball planetary gear 4 which couples the drive of the motor 30 and the valve casing 2 . the motor 30 and the ball planetary gear 4 are also arranged coaxially around the valve casing 2 , so that the rotation axis of the motor 30 and the ball planetary gear 4 align with the center line x under normal circumstances when no deformation of the valve casing 2 , caused by mechanical tension , has taken place . the motor 30 is constructed as an internal rotor motor and has an external radial stator 32 as well as an internal radial rotor 34 . the stator 32 is prevented from turning by means of at least one radial outward protruding nib 31 on a radially inward turned rib 15 ′ of the cylindrical mid section 15 , but can be axially displaced . this possibility for axial displacement facilitates a minimal relative movement in axial direction between the valve box 1 and the drive 3 , thus avoiding tensions within drive 3 and in the valve box 1 on account of varying thermal expansion of drive 3 and valve box 1 . for the same reason a nib 31 ′ is allowed in addition between the radial outer edge of the nib 31 and the inner wall of the cylindrical mid section 15 which also facilitates a radial relative movement between the drive 3 and the valve box 1 . the stator 32 of the drive motor 30 is equipped with an electrical winding familiar to those skilled in the art . the rotor 34 inside the stator 32 is equipped with permanent magnets familiar to those skilled in the art around the outer surface . the rotor 34 is pivotable without friction by means of two radial ball bearings 33 , 35 inside stator 32 . this positioning of rotor 34 inside stator 32 by means of ball bearings 33 , 35 ensures that a constant radial distance is maintained between rotor 34 and stator 32 , even when extreme thermal influences have an effect on drive 3 . a cylindrical drive shaft 40 which is part of the ball planetary gear 4 has been provided inside the rotor 34 . the shaft is also prevented from turning and is axially tightly connected with rotor 34 . the drive shaft 40 is also arranged in coaxial order with the valve casing 2 , and the middle axis of the drive shaft 40 is identical with the center line x of the valve casing 2 . the drive shaft 40 is provided with at least one threaded inner circular groove 42 . the drive shaft 40 surrounds a central radial , outwardly tapering section 25 of the valve casing 2 . this middle section 25 of the valve casing 2 forms an inner drive element 44 , which is integrated with the valve casing 2 and which exhibits a threaded outer circular groove 46 on its exterior circumference which extends in axial direction across almost the entire length of the middle section 25 which is longer in axial direction than the section of the drive shaft 40 , which is connected with the inner circular groove 42 . between the radial outer circumference of the drive element 44 which has been constructed by the section 25 of the valve casing 2 and the inner circumference of the drive shaft there is only a very small space , so that the inner circular groove 42 and the outer circular groove 46 shown in the covering of the ball bearing channel 47 in fig1 form a basically circular cross - section , which contains numerous balls 48 . in this way , the inner drive element 44 , the balls 48 , and the drive casing 40 will form the ball planetary gear 4 . the drive 3 and the ball planetary gear 4 will create a ball rotary spindle drive 5 for the valve casing 2 , which is integrated into the ball rotary spindle drive . the valve casing 2 is constructed within the area of its flow inlet port 22 which has been inserted in the first frontal lid section 11 and has been sealed off with a slide ring gasket sealing washer 6 . in the same way the valve casing 2 is constructed in the area of its opposite flow outlet port 24 and has been sealed off with a second slide ring gasket sealing washer 7 axially , whereby the second slide ring gasket sealing washer 7 is inserted in the second frontal lid section 13 . the first slide ring gasket sealing washer 6 consists of a first ring - shaped insert element 60 , which surrounds the valve casing 2 and is equipped with a circular seal 62 with a sealing lip 64 fitted to the outer surface of the valve casing 2 and seals it . axially inward from the sealing lip 64 , turned away from the inlet port 22 , that is , in the first insert element 60 , there is a slide ring 66 , which surrounds the outside of the valve casing 2 and turns this with minimal friction . in an analogous fashion the second slide ring gasket sealing washer 7 shows a second insert element 70 , which is tied to the second frontal lid section 13 . the second insert element 70 is equipped with a ring - shaped seal 72 which has a radially inward turned sealing lip 74 and surrounds and seals the outer circumference . in the second insert element 70 , axially inward from the sealing lip 74 , turned away from the flow outlet port 24 , there is an slide ring 76 , which surrounds the valve casing 2 and turns it with absolutely minimal friction . the ball rotary spindle drive 5 , consisting of the drive motor 3 and the ball planetary gear 4 including the valve casing 2 , is situated inside the valve box 1 and can be turned a little in all directions around the ball central point m , so that this ball central point m is positioned on the center line x , as outlined below . this positioning is achieved by means of two ball bearings 52 , 56 coaxial to the center line x which have corresponding axial inner bearing ring 53 , 57 and which have been installed on opposite front sides of the rotor 34 . the corresponding bearing rings 54 , 58 of the axial ball bearings 52 , 56 are supported by the first frontal lid section 11 and / or the second frontal lid section 13 in a way that will be described later on . in addition , there is a support ring 55 in place coaxially to the center line x and similarly on the second frontal lid section , a support ring 59 is located coaxially to the center line x . the positioning of the ball rotary spindle drive 5 inside the valve box 1 , shown in detail a in fig1 , will now be described by means of fig2 . the description is given by reference to the upper axial ball bearing 56 in fig1 , while the support of the lower axial ball bearing 52 is achieved in the first frontal lid section 11 in the same way . the support ring 59 is affixed to the second insert element 70 , which is connected with the frontal lid section 13 in a manner familiar to those versed in the art . on its axially and radially inward side , the support ring 59 is equipped with a supporting spherical , concave inner surface 59 ′ which has a corresponding ring - shaped , spherical , convex outer surface 58 ′ which is found on the axial and radial outer area of the axial outer support ring 58 of the axial ball bearing 56 . in the same way , the axially outer bearing ring 54 of the axial ball bearing 52 is equipped with a ring - shaped , spherical , convex outer surface 54 , as is the support ring 55 , which is affixed to the first insert element 60 of the first frontal lid section 11 with a spherical , concave inner surface 55 ′, as shown in fig3 . the convex surfaces 54 ′ and 58 ′ are ring - shaped segments of spheres in a virtual sphere with a central point m on the center line x . even the concave surfaces 55 ′ and 59 ′ are ring - shaped spherical segments of a virtual sphere with the same central point m . in this manner the entire rotary spindle drive 5 can rotate a little around the center point m with relative movement between inner and outer surfaces 54 ″ and 55 ″, as well as surfaces 58 ″ and 59 ″. furthermore , fig3 shows that the valve casing 2 in the area of the first frontal cover section 11 is fitted with a pivot 26 projecting radially outwards , and a ball bearing 27 is connected to the pivot . both the pivot 26 and the ball bearing 27 then catch a longitudinal slot 11 ″ of the first frontal lid section 11 that runs parallel to the center line x , and the ball bearing 27 , including its outer ring 27 ″, will roll off a side wall of the longitudinal slot 11 ″. in an analogous manner , on the valve casing 2 on the opposite side there is a pivot 28 projecting radially outwards . as shown in fig1 , a ball bearing 29 is connected to the pivot and will be steered in the same manner through a longitudinal slot 11 ″ designated for this side of the first frontal lid section 11 . both these sideways guiding methods in the valve casing 2 will prevent the valve casing 2 from rotating relative to the valve box 1 , and will assure that the valve casing 2 — with the exception of a minimal swiveling action around the ball central point m — can only move in the direction of the center line x . using ball bearings 27 and 29 as guide rollers will minimize any friction in the respective axial guide ways . the second frontal lid section provides for a shutoff mechanism 8 inside the cylindrical casing connection 17 , i . e . in the second mainly cylindrical bore section 18 of the flow channel 10 . to open and close the valve , this shutoff mechanism will work in conjunction with the outlet port 24 of the valve casing 2 . the shutoff mechanism 8 includes a ring - shaped base section 80 positioned coaxially to the center line x in the area of the fluid outlet opening 14 in the second frontal lid section 13 . connected to the ring - shaped base section 80 is a cylindrical tubular pedestal section 81 which is also positioned coaxially to the center line x . it forms the first part 82 of the shutoff mechanism 8 and extends into the mainly cylindrical bore connection 18 in the direction of the axial flow . the cylindrical pedestal section 81 is provided in its perimeter wall with a majority of openings 89 , which produce a fluid connection between the mainly cylindrical bore section 18 of the flow channel 10 and the fluid outlet opening 14 . the axial front wall 83 of the cylindrical pedestal section 81 pointing inwards into the valve box 1 is designed as a concave wall and is provided with a concave front surface 83 ″, which is designed dome - shaped and constitutes a spherical segment of a virtual sphere with the central point m . an adapted convex outer surface 84 ″ of a support element 84 for a valve unit 86 rests in the concave front surface 83 ″. the support element 84 and the valve unit 86 together form a second part 85 of the shutoff mechanism 8 . also the support element 84 and the valve unit 86 are ordered co - axially to the central line x , whereby the convex outer surface 84 ″ of the support element 84 likewise forms a dome - shaped spherical segment of a virtual ball with the central point m . the valve unit 86 is ordered to the side of the support element 84 turned away from the convex outer surface 84 ″ and points to the outlet port 24 of the valve casing 2 . the valve unit 86 is designed conically , whereby in the area of its greatest perimeter it is provided with a circular step 86 ″ forming a valve seat , which in sealing works together with the valve seat formed from the perimeter edge of the outlet port 24 of the valve casing 2 near the closed valve . by means of a screw 87 centrally penetrating the concave front wall 83 , which is braced against the front wall via a support element 88 provided on the back side of the concave front wall 83 of the cylindrical pedestal section 81 , the valve unit 86 and the support element 84 , and the first part 82 are braced against the second part 85 of the shutoff mechanism 8 . the support element 88 is thereby provided with a concave front surface 88 ″ pointing to the front wall 83 , which forms a spherical sector of a virtual sphere with the central point m . the convex back surface 83 ″ of the front wall 83 , which is pointing towards the fluid outlet opening 14 , is also part of a spherical surface with the central point m . this shutoff mechanism 8 design , with its spherical surfaces showing the same central point m as the spherical surfaces of the ball rotary spindle drive 5 bearing inside the valve box , also allows the valve unit 86 to pivot a little around the center line m . therefore , no significant uneven load will occur on the circular step 86 ″ of the valve unit 86 which controls the valve location of the sealing element 8 . that means , even in cases where there is a slight pivoting of the ball rotary spindle drive 5 and the valve unit 86 , a dependable seal regarding the valve in the area of the valve unit 86 and the outlet port 24 is guaranteed . furthermore , this way any external constraining forces will be kept away from the ball rotary spindle drive 5 . any reference item numbers listed in any claims , descriptions , and drawings are solely provided to better understand the invention . they are in no way intended to limit the scope of protection . the foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed to include everything within the scope of the appended claims and equivalents thereof .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
fig1 - 6 illustrate an amphibious aircraft 10 according to one embodiment of the invention . in this embodiment , the aircraft 10 features a power plant 12 mounted to an aft portion of fuselage 14 . the fuselage 14 includes a wing 16 . a float 18 is cantilevered from the wing 16 . a vertical fin 20 is coupled to the aft end of each float 18 . a horizontal stabilizer 22 is coupled to the vertical fins 20 , preferably but not necessarily near the top of the fins 20 , to complete a tail portion 24 . a nosewheel 26 is coupled to the front of the fuselage 14 . in some embodiments , the fuselage 14 is configured for appropriate hydrodynamic effects , both statically and dynamically during all phases of taxing , takeoff , and landing . the fuselage 14 may feature any desired shape , length , width , and height to accomplish the result of appropriate aerodynamic and hydrodynamic performance for a general aviation class amphibious aircraft with favorable stability , airspeed , range , and maneuverability characteristics . the fuselage 14 may be assembled in a stress skin monocoque , semimonocoque , or longitudinal member design , or a combination of any or all of these designs . a skin 27 is fastened to the design and carries primarily the shear load , tension , and bending stresses . the fuselage 14 may be formed of any suitable material including but not limited to aluminum , aluminum alloys , other metallic materials , composite materials , or other similar materials . the horizontal stabilizer 22 may be included as shown in fig1 - 4 . the horizontal stabilizer 22 generally affects pitch performance during taxiing , takeoff , and landing on the water . the wing 16 can formed of a stress skin monocoque , semimonocoque , or conventional longitudinal member design , or a combination of any or all of these designs . a monocoque construction can use corrugations extending along the length of the wing 16 for structural integrity . in cross section , the corrugations provide advantages of a warren truss arrangement , which provides stability and stiffness for the wing 16 . the wing 16 may be formed of any suitable material including but not limited to aluminum , aluminum alloys , other metallic materials , composite materials , or other similar materials . fig1 - 6 illustrate one embodiment of the float 18 , which includes a step 28 and a main wheel 30 . the float 18 may be formed of any suitable material including but not limited to stress skin monocoque , wood , foam , plastic , composites , fiberglass , or other desired materials . the floats 18 are oriented substantially parallel to chords of the wing 16 . as a result , the floats 18 present minimal surface area to the airflow , thus reducing drag and increasing cruise speed of the aircraft 10 . the step 28 divides the float 18 into a forward portion 32 and an aft portion 34 . in some embodiments , the forward portion 32 is shaped to incorporate a ski surface 36 into a bottom 38 of the float 18 . in these embodiments , the ski surface 36 results in a float 18 having a lower surface that is generally planar . the ski surface 36 provides the float 18 with improved planing capabilities , allowing earlier transition to the planing mode and thus increasing acceleration and decreasing the time spent on the surface during take - off . in some embodiments , the incorporation of the ski surface 36 significantly enhances take - off performance compared to that of a more conventionally arranged float shape . for example , the incorporation of the ski surface 36 may provide takeoff speeds of substantially 52 knots , more preferably between 52 and 56 knots , which is substantially higher than takeoff speeds for conventionally located steps , where conventional takeoff speeds range from 35 to 39 knots . the use of the ski surface 36 may also allow the aircraft 10 to takeoff from distances less than 1000 feet . due to its planar configuration , the ski surface 36 enables lower surface contact pressure , resulting in less friction or tendency of the float 18 to become entrenched in the landing surface , particularly when the landing surface is snow , wet grass , or marginal environments such as marshy areas or when landing in soil or pavement during an emergency . in some embodiments , as shown in fig2 , 3 , 5 , and 6 , the step 28 creates a sudden break or discontinuity in the longitudinal lines extending from the forward portion 32 at the approximate point around which the aircraft 10 rotates into a lift - off attitude . the step 28 allows water to flow freely behind the step , resulting in minimum surface friction to allow the aircraft 10 to break away from the water &# 39 ; s surface . in some embodiments , the step 28 is located slightly forward of a conventional step location , where the conventional location is rearward 6 ° to 10 ° off a vertical e . g . location 40 . the e . g . location 40 may have any appropriate location on the aircraft 10 based on the various components and loading parameters associated with the aircraft 10 . in one embodiment , as illustrated in fig3 , the step 28 is located on a vertical line passing through the e . g . location 40 . in there embodiments , the step 28 is located between a vertical line passing through the e . g . location 40 and the conventional location . in the embodiments where the step 28 is located forward of its conventional location , the aft portion 34 of the float 18 is in the water at taxiing speeds , whereupon the floats 18 are acting in a displacement mode , the aircraft has a nose up trim , and a pair of rudders 44 can be used to steer . the forward shift of the step 28 moves the float &# 39 ; s resultant pressure vector slightly forward of the more conventional location . as a result , the aircraft &# 39 ; s resultant force vector is similar to the configuration of a “ tail dragger ” land plane , where a tail dragger is a term used to describe a type of conventional landing gear for land planes where the main wheels are located on each side of the centerline ahead of the e . g ., with a steerable tailwheel located under the tail . this type of landing gear is known for its ability to land “ tail first ,” however , unlike the tail dragger land plane , which may incur momentum - caused handling issues , the water environment for the aircraft 10 will actually aid the handling and stability characteristics by providing a stabling and damping influence on an aft portion 42 . hence , the aircraft 10 operates as a “ tail dragger ” when the aft portions 34 are wetted . this configuration causes the aircraft 10 to sit in nose - high trim when taxiing , but allows a nearly ideal take - off attitude with little or input from the pilot . during take - off , as the aircraft 10 transitions toward takeoff speed , the aircraft 10 begins to plane on the forward portion 32 of each float 18 , so that the aft portion 34 of each float 18 is no longer wetted . the forward portion 32 of each float 18 acts as a hydroplane so that the aircraft 10 can be flown off the water straight and level . the aerodynamic center of the wing 16 and the horizontal stabilizer 22 lift the aft portions 34 off the water , so that the center of buoyancy shifts forward from aft of the e . g . to a more forward location , which is forward of the step 28 . because the aircraft 10 operates as a tail dragger during takeoff on water , the aircraft 10 can maintain a relatively stable angle of attack throughout its acceleration run , with only minimal input from the pilot required . properly trimmed and configured , it is possible that the aircraft 10 will be able to accelerate and lift off the water with no pilot input , beyond moving the throttle to takeoff position . in some embodiments , the forward location of the step 28 significantly enhances take - off performance compared to a more conventionally located step . for example , the forward location of the step 28 may allow takeoff speeds of substantially 52 knots , preferably between 52 and 56 knots , which is substantially higher than conventional takeoff speeds of 35 to 39 knots . the forward location of the step 28 may also allow the aircraft 10 to takeoff from distances less than 1000 feet . when landing the aircraft 10 , the same tail dragger - like float 18 configuration allows the tail portion 24 to settle into the water earlier and with less pilot input , accomplishing on - water stability that is not possible with a more conventional float design . in short , the pilot does not have to fly the plane on the water down to taxi speed as is the case for conventional float designs , thus reducing the potential for noseovers . the tendency to settle the tail portion 24 quickly is considered to be more stable and thus safer because of the shifted balance position . it is possible that the aircraft 10 , with correct trim settings , will be able to land and transition to displacement mode with little or no pilot input . when performing a takeoff or landing on land , the aircraft 10 operates like a land plane with tricycle gear because the main wheels 30 are located in the conventional location ( i . e ., not located aft of the preferred 6 ° to 10 ° off the vertical e . g . location ). therefore , handling of aircraft 10 on a hard runway is no different than any other tricycle configured plane . the similarity of runway characteristics allows for easier pilot transition from a conventional land aircraft to the aircraft 10 . to maneuver the aircraft 10 in the water , some embodiments include the rudder 44 that is positioned on the aft portion 34 behind the step 28 , which is illustrated in fig2 , 3 , 5 , and 6 . when the aircraft 10 planes on the forward portion 32 of each float 18 , the rudder 44 is removed from the water . due to its placement behind the step 28 , the rudder 44 does not create any drag and therefore does not require retraction during flight . in some embodiments , the rudder 44 is located approximately three - quarters of the distance between the step 28 and the aft end 42 of the float 18 in a direction toward the aft end 42 . the rudder 44 may be formed of any appropriate material including but not limited to aluminum , carbon steel , stainless steel , other metallic materials , composite materials , or other similar materials . the tendency to quickly settle the tail portion 24 is considered to be more stable and thus safer because it allows the rudders 44 to function sooner than what might otherwise be possible with a conventional step location . in some embodiments , as shown in fig1 - 4 , the power plant 12 includes a reciprocating propeller / fan design . in some embodiments , the power plant 12 is an aft - mounted propeller power plant 12 . however , the power plant 12 may be mounted in any suitable location and may be of any desired manufacture or design , including reciprocating or jet . the fan or propeller ( in this document , both are included in the meaning of the term “ propeller ”) may be constant speed or variable speed , controllable pitch or otherwise . one particular form of power plant design that is appropriate is a fanjet or jet engine with high bypass ratio . the aft - mounting location provides some protection to the power plant 12 from excessive spray during water landings and takeoffs . in some embodiments , as shown in fig1 - 4 , the power plant 12 is a propeller power plant wherein the propeller is surrounded by a shroud 46 . the shroud 46 can substantially enhance efficiency and performance of the propeller , can make the propeller / power plant combination quieter , and can provide additional protection to prevent contact between the propeller power plant 12 and the water . the shroud 46 also protects the propeller power plant 12 from damage caused by objects that it would otherwise encounter . the shroud 46 may be formed of any suitable material including aluminum , carbon steel , stainless steel , other metallic materials , composite materials , or other similar materials . the shroud 46 can either be wiped by the propeller or provide sufficient space for the propeller to rotate freely . in cross section , the shroud 46 may be any appropriate shape that reduces drag and gives appropriate performance characteristics , including but not limited to an airfoil with the high - pressure side facing outward , an airfoil with the high - pressure side facing inward , or any other appropriate shape . at low airspeeds , the shrouded propeller power plant 12 increases the static and low speed thrust performance over an open propeller power plant of the same diameter . thus , the static and low speed thrust is increased without any change in power or power plant diameter . the improved performance of the shrouded propeller power plant 12 reduces the required take - off distance and increasing climb rates . this increased power plant effectiveness continues through cruising speeds in excess of 200 knots . the shroud 46 also reduces the amount of noise produced by the propeller power plant 12 . as a result , the shrouded propeller power plant 12 produces a quieter operation as compared to open propeller power plant configurations . the aircraft 10 is therefore able to operate within more noise sensitive areas such as those with higher population densities or forms of environmental noise restrictions . the foregoing is provided for purposes of illustrating , explaining , and describing embodiments of the present invention . further modifications and adaptations to these embodiments will be apparent to those skilled in the art and may be made without departing from the scope or spirit of the invention .
| 1Performing Operations; Transporting
|
fig1 and 4 of the drawings illustrate a floating platform assembly 10 according to a preferred embodiment of the present invention made up of a plurality of individual platform modules 12 arranged in a rectangular array and secured together to form the platform . the modules are identical in structure , and one of the modules 12 is illustrated in more detail in fig2 and 3 . as best illustrated in fig2 and 3 , each module 12 comprises a hollow tube or cylinder 14 which is open at its lower end 16 and has a flat head or cap 18 of square shape at its upper end . the cylinder walls are of air - entrained concrete or similar water resistent and durable material , and the cylinder walls are preferably reinforced with post - or pre - tensioned vertical steel tendons and welded circular horizontal tie bars . the internal surfaces of the cylinder and cylinder head may be lined with a layer 22 of reinforced plastic or similar materials . the module has four air orifices 24 arranged at right angles to one another . in order to make up a rectangular platform 26 of the desired dimensions , as illustrated in fig1 and 4 , a plurality of modules are arranged in an array covering the desired platform area with the cylinder heads 18 secured together by welding or the like at their adjacent side edges , with the air orifices in each cylinder aligned with one air orifice in each of four directly or diagonally adjacent cylinders . as illustrated schematically in fig4 a connecting air passageway 28 extends between each pair of aligned orifices 24 . a valve 30 for controlling the size of the air orifice is preferably provided in each passageway 28 , as illustrated in fig5 . the passageway preferably extends across a space between the two cylinders in this case , for example in a diagonal interconnection , in order to provide easy access to the valve . a suitable electronic valve actuating controller 32 is provided for controlling each valve 30 based on the output of a sea state monitor 34 mounted on the outside of the platform . in some cases , where the range of sea conditions can be predetermined in order to set the appropriate orifice size , valve 30 may not be needed . the modules at the peripheral edges of the platform will have only three air orifices connected to the three adjacent modules , while the modules at the corners will have only two air orifices for connection to the two adjacent modules . alternatively , all modules will be made with four orifices and the outer orifices will be suitably plugged after construction of the platform . in the illustrated arrangement , each module comprises a cylinder with a square head . however , clearly other interfitting shapes may be used in alternative embodiments and the heads may have any shape of polygonal periphery . clearly , where the sides of the module head have more facets , there will be a greater number of adjacent modules and thus a greater number of connecting passageways . with this arrangement , a flat platform 26 is formed which can be supported on the water surface on a plurality of pockets of trapped air in each of the cylinders . water will enter the open lower end of each cylinder to a level dependent on air pressure in trapped air chamber 42 above the water level 44 . considering one cylinder or module as illustrated in fig2 the weight or load on the cylinder head will compress gas or trapped air in chamber 42 until the pressure is high enough to start displacing water from the chamber . when the air reaches a proper pressure for supporting the platform , it will have displaced a volume of water equal in weight to that of the platform . thus , the water level in the chamber will be dependent on load , and the water level will be higher for higher loads . in fig2 line 46 represents the water line when the module is not loaded and line 47 represents the water line in the module when loaded . lines 48 and 49 represent the surrounding sea level when the platform is under a full load and when it is unloaded , respectively . the dimensions of each module will be dependent on the overall platform dimensions as well as the load to be supported . a module designed for a superimposed load of 400 pounds per square foot , for example , may have a height of 40 feet ( 12 . 19 meters ), a diameter of 20 feet ( 6 . 10 meters ) with a head or end cap which is 20 foot square . the walls are preferably at least 4 inches ( 10 . 16 cm ) thick with the head being 12 inches ( 30 . 48 cm ) thick . the trapped air bubbles support the platform and also act as shock absorbers to mitigate changes in surface conditions and reduce pitch and heave of the platform . this is illustrated in more detail in fig4 which illustrates a typical wave curve 50 travelling beneath the platform . in fig4 line 52 represents the average water line or bubble draft line in the modules , while line 54 represents the average water line in the surrounding water . as illustrated in fig4 for a simplified wave taking the form of a sine curve , when the crest of the wave is located beneath a module there will be an increase in surge force at that point in the structure . this will cause water to rise in that module , compressing the air in the trapped air chamber . the compressed air will escape via passageways 28 to adjacent chambers under lower pressure , as indicated by the arrows in fig4 . bubble draft lines will therefore move up and down in the platform modules under wave action in a similar manner to pistons in the cylinders of an internal combustion engine . with orifices of a suitable size linking each chamber to the adjacent chambers , a lower pressure chamber will receive air from any of its neighbors which are under higher pressure . this will partially charge the lower pressure chamber in anticipation of the surge that has charged the higher pressure chamber next to it , tending to dampen the force of the surge when it reaches the lower pressure chamber . thus , the platform is pneumatically stabilized since vertical impact forces due to wave surges are muted by air compression and passage of trapped air between chambers . the size of the orifices is critical for optimum results . if an orifice is too large , the desired compression in the chambers for optimum lift would not be reached . if an orifice is too small , the balancing effect due to air flow between the chambers will be lost . additionally , the optimum orifice size will vary dependent on surrounding sea conditions , with the orifice size being larger if the sea is rougher . fig5 schematically illustrates a suitable control circuit for controlling valve 30 and thus the orifice size dependent on sea conditions . adjustment of valves 30 will be similar to adjustment of a racing car suspension system to meet variable track conditions . this platform assembly will be suitable for constructing a very large floating platform suitable for supporting an offshore airport facility , for example , or extended living accommodations , a de - salinization plant , trash re - cycling facility or other large area installation for which there is insufficient space on land . it is suitable for platform areas of 360 , 000 square feet or greater . although the platform has a rectangular periphery in the illustrated embodiment , clearly other platform shapes can be constructed by suitable arrangement of the modules to form the desired array shape . the platform will be assembled partially on land and partially at sea for maximum economy . clearly it would be impossible for practical purposes to assemble the entire platform on land . thus , the modules will be secured together in manageable small bundles while on land , in the largest suitable size for launching and transit , and then towed to the platform site , where the bundles will be secured and linked together . the modules are preferably towable in an upright orientation , so that their draft or height must be compatible with the depth of channels linking on - shore construction sites to the off - shore platform site . most major shipping channels are dredged to forty feet , so that the module example given above could be towed through such channels . the modular design of this platform assembly lends itself to on - shore construction of relatively large segments , thereby reducing off - shore construction costs which are typically more expensive than on - shore costs . the individual modules are themselves of relatively simple construction , further reducing the expense of the platform . although the platform is constructed of identical small modules in the preferred embodiment for ease of construction , it may alternatively be constructed by securing a plurality of cylinders to the undersurface of a flat platform . fig6 and 7 illustrate part of a modified platform assembly 70 . as in the previous embodiment , the platform is made up of modules 12 comprising hollow cylinders 14 and flat heads 18 , and like reference numerals have been used for like parts as appropriate . however , instead of simple valved passageways linking all adjacent modules , some or all of the connections between modules are replaced by ducts or passageways 72 forming diagonal connections between diagonally - adjacent modules , as illustrated in fig6 . a conventional self - rectifying reversible air flow turbine generator 74 is mounted in the center of each duct 72 , and valves 76 are located in the ducts on each side of turbine between the respective air chamber and the turbine . as in the previous embodiment , valves 76 are used to control the orifice size and also to shut down the connection if maintenance is needed for repair of the turbine . each turbine has a power generator 78 which is connected to all the other power generators to provide an electrical power output 80 to a suitable storage and power transmission facility , which may be provided on the platform . with this arrangement , the energy of each passing wave may be converted into compressed air flowing in the passageways 72 and readily converted into electrical energy by the generators 74 . this power would be relatively inexpensive to produce and would serve to offset the costs of constructing the platform . the floating platform assembly described above is of relatively simple construction with identical modules being used to make up a platform of any desired size or shape simply by securing sufficient numbers of modules together both on and off shore . since the modules are of relatively low draft , more construction can take place on shore and transportation is simplified . individual modules are relatively small even for a massive floating platform , allowing them to be constructed on - shore in large numbers and stored until needed . the constructed platform will be similar to a gigantic carpet supported on many pockets of air and thrown over the water surface . unlike most previously proposed floating structures with widely spaced supports , each module of this structure will be directly sharing in the support of the entire platform in a monolithic fashion . this concept reduces the force differentials between support elements to a point where it can be assumed to act structurally as a monolithic entity , thereby significantly reducing the costs of the module and module connecting systems . an additional advantage is the fact that impact loads due to wave action will be readily absorbed due to the compressible cushions of air extending across the entire platform area , and the interconnection between adjacent modules allowing even greater dampening of wave action . the platform assembly can also be readily constructed to include air flow turbine generators for converting wave forces to electrical energy , providing a source of revenue for offsetting the construction costs as well as a low cost source of energy which has less environmental hazards than traditional power plants . although a preferred embodiment of the invention has been described above by way of example only , it will be understood by those skilled in the field that modifications may be made to the disclosed embodiment without departing from the scope of the invention , which is defined by the appended claims .
| 1Performing Operations; Transporting
|
fig1 a shows the initial situation of a method . positions that relate to a virtual position image are represented below by circles and positions that relate to a real position image are represented by rectangles . in the first step a first real position 1 is determined . the vehicle comprises a global satellite navigation system gnss for this , such as gps or glonass , for determining the actual position with which the first position 1 of the vehicle is determined . in addition , the vehicle comprises a digital map k , in which the position , course and width of a road s are stored . further , the map comprises two objects l 1 , l 2 or landmarks for which the position in the map is stored . there is a deviation between the first measured position 1 and the digital map k , according to which the vehicle would be off the road . said situation is pre - corrected in the second step . in the second step , as shown in fig1 b , a second position 2 of the vehicle is determined by fitting the first position 1 into the road from the digital map k . for this purpose , the shortest distance from the first position to a point on the road or a plausible lane of the road is preferably determined and the first position is fitted in at said point in order to determine the second position . this results in a first position error δx_m . in the third step two processes take place , from which a real and a virtual position image are produced , as can be seen in fig1 c and 1 d . the starting point in the third step is identifying at least one of the objects l 1 , l 2 , in said example two objects , in the surroundings of the vehicle , the position of which can be referenced in the digital map and can also be detected by means of the vehicle . in fig1 c it is first shown how the virtual position image is produced . after the objects l 1 , l 2 have been identified , the relative distance δx 2 l 1 and δx 2 l 2 between the second position and the respective object is determined , wherein in the reference characters x 2 stands for the second position and l 1 and l 2 stand for the positions of the first and second objects . in fig1 d it is shown how the real position image is produced . real relative distances between the vehicle or the position thereof and the respective object or the respective position thereof are determined by means of sensors of the vehicle . for the sake of simplicity , in the figures the positions of the objects in the real position image are also characterized with l 1 and l 2 , even if for this purpose a further indication , such as for example real , could have been used for different identification . depending on which object it is , different sensors can be used here , such as for example an environment sensor system , a camera sensor system and / or a radar sensor system and / or a lidar sensor system and / or an ultrasonic sensor system and / or a temperature sensor system and / or a rain sensor system and / or a road condition sensor system and / or a chassis sensor system . if for example the object is partial paving , then acceleration , wheel revolution rate and steering angle sensors can be used in order to determine the distance to the object . accordingly , a relative real distance from other visually easily detectable objects can be determined by means of a camera sensor system . the absolute position is not determined , but the relative distance between the vehicle position and the respective object l 1 , l 2 is determined and a position of the objects l 1 , l 2 is projected therefrom , the absolute position of the objects l 1 , l 2 is not needed for the real position image . if said absolute position of the objects is known from a different source than the digital map , however , the same can be used to determine a further pre - correction of the vehicle position using the relative distance δx 4 l 1 and δx 4 l 2 , from which the position 4 as shown in fig1 d results . otherwise , the relative distance corresponds to the distance between the objects l 1 , l 2 and the first position 1 and would be called δx 1 l 1 and δx 1 l 2 . in fig1 d , the deviation δl_i can further be seen , wherein the i stands collectively for the index 1 or 2 and represents the deviation of the distances from each other between the positions l 1 from the real and virtual position images . the deviation is determined from the difference of the distances , i . e . for the object l 1 the deviation is given by the deviation would also be determined in a corresponding way for the second object or for all referenced objects . a corrected position of the vehicle is now determined in the fourth step . for this purpose , the minimum deviation of the computed distance from the real distance is determined . it is particularly preferable for this to use the method of least squares , that is the position change is sought iteratively until it is particularly preferable for this to shift the digital map iteratively so that the deviation of the computed distance from the real distance is minimized . said step is shown as an example in fig1 e , wherein the shifted map is shown dashed . the digital map including the second position 2 and the position of the objects l 1 , l 2 is iteratively shifted until the absolute minimum deviation is achieved . in doing so , the displacement of the digital map comprises at least one translational and one rotational displacement . in the case of the example , as shown in fig1 e , there is a translational displacement by the distance δx_t and a rotational displacement φ_t . an improved corrected position 5 results from said displacement , as shown in fig1 e . the second position error is characterized in fig1 e as δx_s and comprises both the translational error and also the rotational error . finally , in a fifth step the method can be improved still further by carrying out a second correction , whereby the corrected position is corrected once again by fitting the corrected position into a plausible lane of the road . advantageously , the last corrected position is shifted to match the digital map for this , so that it is located in the correct lane , i . e . matching the direction of travel . the corrected position of the vehicle is then said last corrected position 6 . alternatively , however , said step can be omitted . the aforementioned position 5 is then the corrected position . the last step can also include a position error δx_l consisting of a translational error and a rotational error . the total error of the position or the correction value of the position therefore consists of the three position errors δx_m , δx_s and δx_l , i . e . the method can be improved and compared to the examples described above by further determining the first position by means of the plurality of vehicle sensors , in particular by means of a sensor fusion unit m2xpro for merging and plausibility checking the sensor data . such a sensor fusion unit m2xpro is shown in fig3 , and together with the gnss unit can form a system unit . in fig2 and 3 , an exemplary embodiment of a vehicle system is shown in two different levels of detail . in fig2 the vehicle system is shown at a system level . it shows the system 100 , wherein the system boundary is shown in fig2 by dashed lines . the system 100 is inter alia connected to a backend server 210 , for example a map server , by means of which current data for the digital map can be obtained . said backend server is connected to an internal server 110 of the vehicle that is a component of the system 100 . moreover , the system 100 is connected to at least one satellite 220 . the system 100 comprises inter alia a position and localization module 120 that is coupled to the internal server 110 , the satellites 220 and a plurality of sensors 130 . a detailed representation of the position and localization model 120 is shown in fig3 and is described in more detail below . the position and localization module 120 is connected to a plurality of applications disposed in an application layer 140 and provides said applications with the corrected position 5 or 6 . a detailed representation of the position and localization module 120 is shown in fig3 . it comprises a localization unit 121 that comprises a gnss unit and a sensor fusion unit and the first position 1 of the vehicle can be determined thereby . said localization unit 121 is coupled to at least one gnss satellite and a plurality of sensors 130 . moreover , the position and localization module 120 comprises a unit 122 for fitting the first position into a digital map . a further unit 123 is used for the detection and plausibility checking of objects . a third unit 124 is used for orientation of the digital map and fitting the corrected position into a plausible lane . the vehicle system 100 enables inter alia data relating to the object to be received by means of messages via vehicle - 2 - x , such as by means of the connection 125 shown between the v 2 x or c 2 x module and the sensors . further , the system enables a corrected position of an object or corrected data relating to the digital map to be transmitted to a map server . this is carried out by means of the internal server 110 , which comprises an upload and download unit 111 , 112 for this . in this way it is possible to obtain the digital map from a map server and to check the same by means of a time stamp of the digital map and to reject it if another digital map is more up to date . further advantageous alternate embodiments include a method for improved position determination , wherein a first position is determined by means of a global satellite navigation system and wherein the first position is fitted into a digital map , wherein a second position is determined relative to an object that is recorded in the digital map , characterized in that , the first position is corrected by means of the second position . alternately another method further including the correction of the first position by means of the second position is carried out during an iterative adjustment , in particular during a so - called least squares method . alternately another method further including the second position is determined by means of an environment sensor system . alternately another method further including the environment sensor system comprises a camera sensor system and / or a radar sensor system and / or a lidar sensor system and / or an ultrasonic sensor system and / or a temperature sensor system and / or a rain sensor system and / or a road condition sensor system . alternately another method further including a third position is determined by means of an inertial sensor system in the context of dead reckoning . alternately another method further including the inertial sensor system detects a three - dimensional rate of turn and a three - dimensional acceleration . alternately another method further including the first position is additionally or alternatively corrected by means of the third position . alternately another method further including a fourth position is determined by means of a steering angle sensor system and a wheel revolution rate sensor system . alternately another method further including the first position is additionally or alternatively corrected by means of the fourth position . alternately another method further including the global satellite navigation system is a gps system , a glonass - system or a galileo system . further advantageous alternate embodiments include a system for improved position determination , comprising a global satellite navigation system , an environment sensor system , a steering angle sensor system , a wheel revolution rate sensor system and an inertial sensor system , characterized in that the system is designed to carry out a method as described above . a use of the system in a vehicle , in particular in a motor vehicle . according to one embodiment it is therefore preferably provided that initially , as in the prior art , the gnss vehicle position is mapped in the digital map . however , the map particularly preferably contains additional fixed location objects , so - called “ landmarks ”. all data in the map are preferably referenced to a global reference coordinate system , for example the wgs ( world geodetic system 1984 ) data format . the gnss vehicle position is now preferably placed in the map coincident with the most plausible position and the relative distance from the referenced landmarks calculated in the closest proximity ( δx 1 l i ) fixed objects are detected from the vehicle , preferably by means of calibrated environment sensors ( for example a camera , radar , lidar etc . ), and the relative distance thereof from the vehicle is measured ( δx 2 l i ). said distances are relatively accurate . the position error of the map compared to reality is now δl i = δx 1 l i − δx 2 l i . in order to achieve the best positioning of the map in reality and to determine the true lane position from the maps , the map with the vehicle position is now preferably shifted and rotated until the smallest value for δl i is achieved . this can particularly preferably be calculated with the so - called “ least square fit ” method min ( δl i 2 ). finally , the vehicle position is now brought into coincidence with the origin of the environment sensor . the real measurement by means of the environment sensors generally enables cm - accurate positioning to fixed objects in the surroundings of the vehicle . lane - accurate assignment can be carried out by means of fitting into a georeferenced map with the same landmark information . the residual error δl i - min =( δx 1 l i )*−( δx 2 l i ) (* after fitting the map landmarks into the landmarks from the environment sensor system ) is then preferably updated in the map and the map material is thereby optimized . likewise , landmarks that are not yet noted in the map can preferably be entered into the map . advantageously , the maps are stored in a static server and transmitted to the auto by means of a suitable radio transmission . owing to the known gnss position of the vehicle , preferably only the data that are relevant to a certain region are transmitted and thus the amount of data is limited . a further advantage of server - based map management is the possibility of statistically analyzing the returned “ residual discrepancies ” by analyzing a plurality of responses . outliers indicate a fault in the transmitting vehicle . lane - accurate positioning in a map is in particular required during autonomous travel , because for example traffic rules are often correlated with lanes or accurate trajectory planning has to be calculated for the relevant lane . likewise , the relevance can be determined from information relating to the actual direction of travel received by means of car 2 x .
| 6Physics
|
the following detailed description of the invention is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any theory presented in the preceding background of the invention or the following detailed description of the invention . a first subject matter of the invention relates to cosmetic agents , each including , based on the total weight of the agent , 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt ./%; at least one wax ; solid matter dispersed in particulate form ; optionally further ingredients ; wherein the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . the term “ free water ” shall be understood according to the invention such that the content of constitutional water , hydration water or similarly molecularly bound water that can be present in the components used , in particular in the solids dispersed in particulate form , does not constitute free water within the meaning of the present application . all information regarding the states of matter ( solid , liquid , gaseous ) in this application relate to normal conditions . “ normal conditions ” within the meaning of the present application refer to a temperature of 20 ° c . and a pressure of 1013 . 25 mbar . melting point information likewise refers to a pressure of 1013 . 25 mbar . it is furthermore essential that the composition according to the invention includes at least one or more liquid oils in said total amount . an oil according to the invention shall be understood to mean a liquid substance that can be mixed in bidistilled water to less than 1 wt . % under normal conditions . in a preferred embodiment , the liquid oil is selected from at least one compound of the group consisting of liquid silicones , ester oils , trifatty acid esters of saturated and / or unsaturated , linear and / or branched c 6 to c 22 fatty acids including glycerol , vegetable oils , liquid paraffin oils , isoparaffin oils , liquid synthetic hydrocarbons , liquid di - n - alkyl ethers , dicarboxylic acid esters , and symmetrical , asymmetrical or cyclic esters of carbonic acid . it is preferred according to the invention if the agent according to the invention , based on the weight of the composition , includes liquid oil in a total amount of in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, in the composition according to the invention . the composition according to the invention preferably includes at least one silicone oil as the liquid oil . it is preferred according to the invention if the agent according to the invention , based on the weight of the composition , includes silicone oil in a total amount of 30 to 70 wt . %, in particular of 40 to 65 wt . %, in the composition according to the invention . the silicone oils , in turn , are preferably selected from at least one compound from the group consisting of : ( i ) polyalkylsiloxanes , polyarylsiloxanes , polyalkylarylsiloxanes , which are volatile or non - volatile , straight - chain , branched or cyclic , cross - linked or not cross - linked ; ( ii ) polysiloxanes including , in the general structure thereof , one or more organofunctional groups , which are selected from ( per ) fluorinated groups ; ( iii ) or the mixtures thereof . especially particularly preferred cosmetic agents are characterized by including , as the oil , at least one silicone of formula ( si - 1 ) where x denotes a number from 0 to 200 , preferably from 0 to 100 , and more preferably from 0 to 20 . the preferred cosmetic agents according to the invention include at least one silicone of above formula ( si - 1 ) as the oil . according to inci nomenclature , these silicones are referred to as dimethicone . likewise preferred silicone oils according to the invention are selected from silicones of formula ( si - 2 ), where x is selected from integers from 1 to 20 , preferably 1 to 3 . a preferred silicone oil of formula ( si - 2 ) is available under the inci name phenyl trimethicone . it is also possible , of course , for mixtures of the above - mentioned silicones of formulas ( si - 1 ) and ( si - 2 ) to be present as silicone oil in the preferred agents according to the invention . preferred silicone oils that can be used according to the invention , in particular according to formula ( si - 1 ), have a kinematic viscosity of 1 to 200 mm 2 s − 1 , particularly preferably of 5 to 100 mm 2 s − 1 , at 25 ° c . such silicone oils are commercially available , for example as dimethicone , under the trade name xiameter pmx 200 sil fluid 50 cs ( formerly : dow corning 200 fluid 500 cst ). within the scope of a further embodiment of the invention , preferred cosmetic agents according to the invention are those that include , as the liquid oil , at least one ester of formula ( i ) where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 22 carbon atoms . it is particularly preferred if , according to formula ( i ), r 1 is a linear or branched hydrocarbon group having 3 to 22 carbon atoms , and r 2 is a branched hydrocarbon group having 3 to 22 carbon atoms . preferred liquid oils are selected from esters according to formula ( i ) of c 6 to c 22 fatty acids ( r 1 = linear or branched c 5 to c 21 hydrocarbon ) having c 3 to c 22 fatty alcohols ( r 2 = linear or branched c 3 to c 22 hydrocarbon ). preferred examples of fatty acid components used in the esters of formula ( i ) are caproic acid , caprylic acid , 2 - ethyl - hexanoic acid , capric acid , lauric acid , isotridecanoic acid , myristic acid , palmitic acid , palmitoleic acid , stearic acid , isostearic acid , oleic acid , elaidic acid , petroselinic acid , linoelic acid , linolenic acid , eleostearic acid , arachyinic acid , gadoleic acid , behenic acid and erucic acid , and the mixtures thereof , such as the technical mixtures that develop , for example , in the hydrolysis of natural fats and oils under pressure , in the oxidation of aldehydes from roelen &# 39 ; s oxo synthesis , or the dimerization of unsaturated fatty acids . preferred examples of the fatty alcohol components in the esters of formula ( i ) are isopropyl alcohol , caproic alcohol , caprylic alcohol , 2 - ethylhexyl alcohol , capric alcohol , lauryl alcohol , isotridecyl alcohol , myristyl alcohol , cetyl alcohol , palmoleyl alcohol , stearyl alcohol , isostearyl alcohol , oleyl alcohol , elaidyl alcohol , petroselinyl alcohol , linoleyl alcohol , linolenyl alcohol , eleostearyl alcohol , arachyl alcohol , gadoleyl alcohol , behenyl alcohol , erucyl alcohol , and brassidyl alcohol , and the mixtures thereof , such as the technical mixtures that develop , for example , in the high - pressure hydrogenation of technical methyl esters based on fats and oils or aldehydes from roelen &# 39 ; s oxo synthesis , and as monomer fraction in the dimerization of unsaturated fatty acids . it is particularly preferred according to the invention if the compound according to formula ( i ) is selected from 2 - ethylhexyl palmitate , 2 - ethylhexyl stearate , 2 - ethylhexyl cocoate , 2 - ethylhexyl laurate , 2 - ethylhexyl isostearate , hexyldecyl stearate , hexyldecyl laurate , isodecyl neopentanoate , isononyl isononanoate , isopropyl myristate , isopropyl palmitate , isopropyl stearate , isopropyl isostearate , isopropyl oleate , isooctyl stearate , isononanoic acid - c 16 - 18 - alkyl ester , isononyl stearate , isocetyl stearate , isononyl isononanoate , isotridecyl isononanoate , cetearyl isononanoate , 2 - octyldodecyl palmitate , 2 - octyldodecyl myristate , 2 - octyldodecyl laurate , 2 - octyldodecyl stearate , butyloctanoic acid - 2 - butyl octanoate , coconut fatty alcohol caprinate / caprylate , n - butyl stearate , n - hexyl laurate , n - decyl oleate , cetyl oleate , oleyl oleate , oleyl erucate , erucyl oleate , erucyl erucate , or mixtures of two or more of the above - mentioned compounds . it is particularly preferred according to the invention to select the respective hydrocarbon groups of the esters of formula ( i ), in particular within the scope of the preferred embodiments of said esters ( vide supra ), from saturated hydrocarbons . the agents according to the invention preferably include the compounds of formula ( i ) in an amount from 1 to 60 wt . %, in particular from 5 to 30 wt . %, in each case based on the total weight of the agent . within the scope of this embodiment of the invention , preferred cosmetic agents according to the invention are again those that at least include , as the liquid oil , where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , within the scope of this combination , in turn , the preferred embodiments of the compounds of formula ( i ) and of the silicone oils can be used as particularly preferred components . within the scope of the above embodiment of the invention , particularly preferred cosmetic agents according to the invention are those that at least include , as the liquid oil , where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %. within the scope of this combination , in turn , the preferred embodiments of the compounds of formula ( i ) and of the silicone oils can be used as particularly preferred components . triglyceride oils , such as the liquid fractions of suet , and synthetic triglycerides are also suitable as liquid oil according to the invention . preferred triglycerides are selected from the triglycerides of linear or branched , saturated or unsaturated , optionally hydroxylated , c 8 - 30 fatty acids . the use of natural oils can be particularly suitable , such as soy bean oil , cottonseed oil , sunflower oil , palm oil , palm kernel oil , linseed oil , almond oil , castor oil , corn oil , rapeseed oil , olive oil , sesame oil , safflower oil , wheat germ oil , peach kernel oil , and the liquid components of coconut oil , glyceryl trioleate ( triolein ), capric / caprylic triglycerides , glyceryl triisostearin , glyceryl triisopalmitate , and mixtures of two or more of the aforementioned compounds . preferred vegetable oils are selected from at least one representative from the group consisting of amaranth oil , sunflower oil , olive oil , soy bean oil , rapeseed oil , almond oil , jojoba oil , orange oil , apricot kernel oil , macadamia nut oil , wheat germ oil , peach kernel oil , and the liquid components of coconut oil . preferred di - n - alkyl ethers are selected from di - n - alkyl ethers having in total between 12 and 36 carbon atoms , in particular 12 to 24 carbon atoms , such as di - n - octyl ether , di - n - decyl ether , di - n - nonyl ether , di - n - undecyl ether , di - n - dodecyl ether , n - hexyl - n - octyl ether , n - octyl - n - decyl ether , n - decyl - n - undecyl ether , n - undecyl - n - dodecyl ether and n - hexyl - n - undecyl ether , and di - tert - butyl ether , di - iso - pentyl ether , di - 3 - ethyldecyl ether , tert - butyl - n - octyl ether , iso - pentyl - n - octyl ether and 2 - methyl - pentyl - n - octyl ether . the compounds 1 , 3 - bis ( 2 - ethylhexyl ) cyclohexane ( cetiol ® s ) and di - n - octyl ether cetiol ® oe ) available as commercial products may be preferred . preferred dicarboxylic acid esters are selected from at least one compound of the group consisting of di - n - butyl adipate , di -( 2 - ethylhexyl ) adipate , di -( 2 - ethylhexyl ) succinate and diisotridecyl acelaate , and diol esters such as ethylene glycol dioleate , ethylene glycol diisotridecanoate , propylene glycol di ( 2 - ethylhexanoate ), propylene glycol diisostearate , propylene glycol dipelargonate , butanediol diisostearate , and neopentyl glycol dicaprylate . natural and synthetic hydrocarbons , such as paraffin oils , c 18 to c 30 isoparaffins , in particular isoeicosane , polyisobutene or polydecene , which are available under the designation emery ® 3004 , 3006 , 3010 or under the designation ethylflo from albemarle or nexbase ® 2004g from nestle , for example , and 1 , 3 - bis ( 2 - ethylhexyl ) cyclohexane ( available under the trade name cetiol ® s from cognis , for example ) are likewise among the liquid oils that can preferably be used according to the invention . further preferred liquid oils according to the invention are selected from the benzoic acid esters of linear or branched c 8 - 30 alkanols . particularly preferred are benzoic acid - c 12 - c 15 - alkyl esters , for example available as the commercial product finsolv ® tn , benzoic acid isostearyl esters , for example available as the commercial product finsolv ® sb , ethylhexyl benzoate , for example available as the commercial product finsolv ® eb , and benzoic acid 2 - octyldodecyl esters , for example available as the commercial product finsolv ® bod . further preferred liquid oils according to the invention are selected from the dicarboxylic acid esters of linear or branched c 2 to c 10 alkanols , in particular diisopropyl adipate , di - n - butyl adipate , di -( 2 - ethylhexyl ) adipate , dioctyl adipate , diethyl -/ di - n - butyl / dioctyl sebacate , diisopropyl sebacate , dioctyl malate , dioctyl maleate , dicaprylyl maleate , diisooctyl succinate , di - 2 - ethylhexyl succinate , and di -( 2 - hexyldecyl ) succinate . further preferred liquid oils according to the invention are selected from the symmetrical , asymmetrical or cyclic esters of carbonic acid comprising alkanols , such as glycerol carbonate , di - n - caprylyl carbonate ( cetiol ® cc ) or the esters according to the teaching of de 19756454 a1 . it is furthermore essential that the agents according to the invention include at least one wax . waxes are generally understood to mean solids that are reaction products of carboxylic acids and alcohols . these reaction products in the form of wax are solid to brittle - hard , kneadable up to 20 ° c ., and melt at 30 ° c . to 90 ° c . waxes according to the invention preferably have a melting point in a range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . it is preferred according to the invention if at least half the amount of the wax that is present ( particularly preferably at least 75 % of the amount of the wax that is present ) is present in dissolved form in the liquid oil of the cosmetic agent according to the invention . when , in connection with this embodiment , at least one ester of formula ( i ) ( vide supra ) is present in the liquid oil component , it is preferred according to the invention within the scope of the production process to dissolve wax in an amount of at least one ester of formula ( i ) ( vide supra ), and then incorporate it in this dissolved form into the cosmetic agent according to the invention . it is especially particularly preferred according to the invention if the agent according to the invention includes at least one wax , selected from at least one wax of the group of waxes having the inci names cocoglycerides , cetyl palmitate , myristyl myri state . the agents according to the invention preferably include wax in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %, in each case based on the total weight of the agent . it is essential that the cosmetic agents according to the invention include solid matter dispersed in particulate form . within the meaning of the invention , particles are particles ( see din 66160 : 1992 - 09 ) of solids which are present as grains . consequently , particles of solids which are present as grains are present in the agent according to the invention in dispersed form . the particles preferably have a mean particle diameter ( volume mean ) of 0 . 01 to 3 . 0 μm , in particular of 0 . 05 to 1 . 0 μm , especially particularly preferably of 0 . 1 to 0 . 5 μm . according to the invention , preferred cosmetic agents are those that include solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %. in preferred cosmetic agents according to the invention , at least one inorganic solid , in particular at least one metal oxide , is present as the solid matter dispersed in particulate form . the metal oxides , in turn , are preferably selected from aluminates , aluminum silicates , titanium dioxide , zinc oxide , iron oxides , tin dioxide , nacreous pigments , and mixtures of two or more of the aforementioned metal oxides . frequently used nacreous pigments include mother of pearl ( made of ground shells ), monocrystalline nacreous pigments , such as bismuth oxychloride , and nacreous pigments based on mica , mica / metal oxide , or titanium dioxide / metal oxide . the mixed nacreous pigments mentioned last are provided with a metal oxide coating that is different from the particulate material of the core . through the use of nacreous pigments , color effects and / or brilliance are achieved in the agents according to the invention or on the substrate treated therewith . particularly preferred aluminates are selected from active aluminum oxide , alpha - aluminum oxide , beta - aluminum oxide , gamma - aluminum oxide , and the mixtures thereof . particularly preferred aluminum silicates ( also referred to as aluminosilicates ) are selected from phyllosilicates , tectosilicates . particularly suitable phyllosilicates are selected from kaolins ( here , in particular from kaolinite , dickite , halloysite and nacrite ), serpentine , talcum , pyrophyllite , montmorrillonite , quartz , bentonite , mica ( here , in particular from illite , muscovite , paragonite , phlogopite , biotite , lepidolite , margarite , smectite ( here , in particular from montmorrillonite , saponite , nontronite , hectorite )). preferably suitable tectosilicates are selected from feldspar minerals ( in particular albite , orthoclase , anorthite , leucite , sodalite , hauyne , labradorite , lasurite , nosean , nepheline ). preferred titanium dioxides are those distributed under the trade name kronos by kronos , in particular kronos 1171 . preferred iron oxides are fe 2 o 3 , for example having inci ci 77491 , in particular commercially as unipur red lc 281 em ® by sensient , fe 2 o 3 . nh 2 o , for example having inci ci 77491 , in particular commercially as unipur red lc 281 em ® by sensient , feo . fe 2 o 3 , for example having inci ci 77499 , in particular commercially as unipur black lc 989 em ® by sensient . preferred cosmetic agents according to the invention are characterized in that they ( together with aforementioned inorganic solids , or without the presence of aforementioned inorganic solids as solid matter dispersed in particulate form ) include at least one starch as the solid matter dispersed in particulate form . starch is a reserve carbohydrate that is stored in many plants in the form of usually 1 to 200 μm large starch grains ( granules ) in various parts of the plants , such as in bulbs or roots , grain seeds , fruits , and in the marrow . starch belongs to the family of homoglycans and is a polycondensation product of d - glucose . starch is composed of three structurally different polymers of d - glucopyranose , namely amylose , amylopectin and what is known as an intermediate fraction . higher plants include 0 to 45 wt . %, based on the dry substance . the intermediate fraction , which is also referred to as abnormal amylopectin , is between the amylosis and the amylopectin from a structural perspective . the quantity information for amylopectin defined within the scope of the present application include the intermediate fraction . amylose is predominantly composed of a linear chain of d - glucose units linked by α - 1 , 4 - glycosidic bonds , mr 50000 to 150000 . the resulting chains form double helices in the starch . in addition to the α - 1 , 4 bonds described for amylose , amylopectin also includes α - 1 , 6 bonds as branching points in an amount from 4 to 6 %. the average distance between the branching points is approximately 12 to 17 glucose units . the molar mass of 107 to 7 · 108 corresponds to approximately 105 glucose units , whereby amylopectin belongs to the largest biopolymers . said branching points are distributed across the molecule in such a way that a cluster structure having relatively short side chains develops . two of these side chains in each case form a double helix . as a result of the many branching points , amylopectin has relatively good solubility in water . a starch that can preferably be used according to the invention is selected from at least one polycondensation product of d - glucose , obtained from the starch of potatoes , corn , rice , peas , acorns , chestnuts , wheat , bananas , sago , millet , sorghum , oats , barley , rye , beans , batata , arrowroot or tapioca . it is particularly preferred if the agent according to the invention includes at least one starch which is tapioca starch , potato starch , corn starch or rice starch . mixtures of the aforementioned starch compounds are also covered according to the invention . tapioca starch is especially particularly preferred . the starch compound is preferably present in the agents according to the invention in amounts of 0 . 05 to 8 . 0 wt . %, and in particular of 0 to 7 . 0 wt . %, in each case based on the weight of the agent . it is preferred according to the invention within the scope of a further embodiment of the invention if the solid matter dispersed in particulate form is coated on the surface of the solid matter particle with at least one water - in - oil emulsifier . particularly suitable water - in - oil emulsifiers are preferably selected from at least one compound from the group consisting of : partial esters of polyglycerols having n = 2 to 10 glycerol units and esterified with 1 to 5 saturated or unsaturated , linear or branched , optionally hydroxylated c 8 to c 30 fatty acid esters ; linear or branched , saturated or unsaturated c 12 to c 30 alkanols , each being etherified with 1 to 4 ethylene oxide units per molecule , which are exceptionally preferably selected from steareth , ceteth , myristeth , laureth , trideceth , arachideth and beheneth , each having 1 to − 4 ethylene oxide units per molecule , in particular steareth - 2 , steareth - 3 , steareth - 4 , ceteth - 2 , ceteth - 3 , ceteth - 4 , myristeth - 2 , myristeth - 3 , myristeth - 4 , laureth - 2 , laureth - 3 , laureth - 4 , trideceth - 2 , trideceth - 3 and trideceth - 4 , and mixtures thereof ; linear saturated alkanols comprising 12 to 30 carbon atoms , in particular comprising 16 to 22 carbon atoms , in particular cetyl alcohol , stearyl alcohol , arachidyl alcohol , behenyl alcohol , and lanolin alcohol , or mixtures of these alcohols , as they are obtainable from the technical hydrogenation of vegetable and animal fatty acids ; esters , and in particular partial esters , made of a polyol having 2 to 6 carbon atoms , and linear saturated and unsaturated fatty acids having 12 to 30 , in particular 14 to 22 , carbon atoms , which can be hydroxylated . such esters or partial esters are , for example , the monoesters and diesters of glycerol or ethylene glycol , or the monoesters of propylene glycol having linear saturated and unsaturated c 12 to c 30 carboxylic acids , which can be hydroxylated , in particular those comprising palmitic and stearic acid , the sorbitan monoesters , diesters or triesters of linear saturated and unsaturated c 12 to c 30 carboxylic acids , which can be hydroxylated , in particular those of myristic acid , palmitic acid , stearic acid , or mixtures of these fatty acids , the pentaerythrityl monoesters , diesters , triesters and tetraesters , and the methyl glucose monoesters and diesters of linear , saturated and unsaturated c 12 to c 30 carboxylic acids , which can be hydroxylated , of which the monoesters , diesters , triesters and tetraesters of pentaerythritol comprising linear saturated fatty acids having 12 to 30 , in particular 14 to 22 , carbon atoms , which can be hydroxylated , and mixtures thereof , are particularly preferred as stabilizers and / or water binders . the monoesters and diesters are particularly preferred according to the invention . preferred c 12 to c 30 fatty acid groups according to the invention are selected from lauric acid , myristic acid , palmitic acid , stearic acid , arachinic acid and behenic acid groups , the stearic acid group being particularly preferred ; sterols , which is to say steroids , which carry a hydroxyl group at the c3 atom of the steroid skeleton and are isolated both from animal tissue ( zoosterols , such as cholesterol , lanosterol ), from plants ( phytosterols , such as ergosterol , stigmasterol , sitosterol ) and from fungi and yeasts ( mycosterols ) and which may be low - ethoxylated ( 1 to 5 eo ); alkanols and carboxylic acids , each having 8 to 24 c atoms , in particular having 16 to 22 c atoms , in the alkyl groups and 1 to 4 ethylene oxide units per molecule , which have an hlb value of greater than 1 . 0 and / or smaller than / equal to 7 . 0 ; glycerol monoethers of saturated and / or unsaturated , branched and / or unbranched alcohols having a chain length of 8 to 30 , in particular 12 to 18 carbon atoms . liquid partial esters of polyglycerols having n = 2 to 10 glycerol units and esterified with 1 to 5 saturated or unsaturated , linear or branched , optionally hydroxylated c 8 to c 30 fatty acid esters are particularly preferred water - in - oil emulsifiers that are available according to the invention . it is especially particularly preferred if the water - in - oil emulsifier is selected from at least one emulsifier that comprises 2 to 6 glycerol units bonding covalently to each other and at least one ( in particular branched ) alkyl group having 8 to 20 carbon atoms . it is essential that the agents according to the invention have a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ). these viscosity levels can also be set without the addition of an additional thickening agent for thickening oil . if this should not be the case , it is recommended to add a thickening agent for thickening oil to the formulation . further preferred cosmetic agents according to the invention are therefore characterized by additionally including at least one thickening agent for thickening oil . these additional thickening agents for thickening oil are different from the above - mentioned components , whose presence in the agent according to the invention is essential . it is expedient according to the invention that , if the additional thickening agents for thickening oil are used in the cosmetic agent according to the invention , said thickening agents are added only in such an amount until the viscosity is in the viscosity range according to the invention . preferred thickening agents according to the invention for thickening oil are selected from hydrophobized clay minerals , silica ( in particular fumed silica ), ethylene / propylene / styrene copolymers , butylene / ethylene / styrene copolymers , dextrin esters and / or silicone elastomers . preferred hydrophobized clay minerals are selected from hydrophobized montmorrillonites , hydrophobized hectorites and hydrophobized bentonites , particularly preferably made of disteardimonium hectorite , stearalkonium hectorite , quaternium - 18 hectorite , and quaternium - 18 bentonite . the commercially available thickening agents provide these hydrophobized clay minerals in the form of a gel in an oil component , preferably in cyclomethicone and / or a non - silicone oil component , such as propylene carbonate . such gels are available , for example , under the trade name bentone ® or thixogel . preferred compositions according to the invention are characterized by including hydrophobized clay mineral in a total amount of 0 . 5 to 10 wt . %, preferably 1 to 7 wt . %, particularly preferably 2 to 6 wt . %, exceptionally preferably 3 to 5 wt . %, in each case based on the total weight of the composition according to the invention . further especially particularly preferred thickening agents according to the invention for thickening oil are selected from silica , in particular fumed silica ( such as the commercial products of the aerosil ® series from evonik degussa ). these may be hydrophobized on the surface thereof by way of chemical modification ( such as the silylated silica having the inci name silica silylate ); however , this is not preferred . particularly preferably suitable fumed silica according to the invention has the inci name silica . if fumed silica is additionally used as a thickening agent for thickening oil , particularly storage - stable cosmetic agents of the present invention are obtained . preferred cosmetic agents according to the invention are characterized by including silica , preferably fumed silica , in a total amount of 0 . 1 to 6 wt . %, preferably 0 . 5 to 5 wt . %, particularly preferably 1 . 0 to 4 . 5 wt . %, especially particularly preferably 1 . 5 to 3 . 0 wt . %, exceptionally preferably 1 . 9 to 2 . 6 wt . %, in each case based on the total weight of the composition according to the invention . further lipophilic thickening agents that can be used according to the invention are selected from ethylene / propylene / styrene copolymers and butylene / ethylene / styrene copolymers . the copolymers are particularly preferably used as a pre - thickened oil - based gel . such gels are available , for example , under the trade name versagel ® ( ex penreco ). gels including mineral oil , hydrogenated polyisobutene , isoparaffins such as isohexadecane or isododecane , and including ester oils , in particular isopropyl palmitate or isopropyl myristate , are preferred . further lipophilic thickening agents that can be used according to the invention are selected from silicone elastomers . a further preferred embodiment of the invention is characterized by including at least one silicone elastomer , obtainable by cross - linking an organopolysiloxane that includes at least 2 c 2 to c 10 alkenyl groups having a terminal double bond in each molecule with an organopolysiloxane that includes at least 2 silicone - bonded hydrogen atoms in each molecule . particularly preferred organopolysiloxanes according to the invention comprising at least 2 c 2 to c 10 alkenyl groups having a terminal double bond in the molecule are selected from methylvinylsiloxanes , methylvinylsiloxane - dimethylsiloxane copolymers , dimethylpolysiloxanes including dimethylvinylsiloxy end groups , dimethylsiloxane - methylphenylsiloxane copolymers including dimethylvinylsiloxy end groups , dimethylsiloxane - diphenylsiloxane - methylvinylsiloxane copolymers including dimethylvinylsiloxy end groups , dimethylsiloxane - methylvinylsiloxane copolymers including trimethylsiloxy end groups , dimethylsiloxane - methylphenylsiloxane - methylvinylsiloxane copolymers including trimethylsiloxy end groups , methyl -( 3 , 3 , 3 - trifluoropropyl ) polysiloxanes including dimethylvinylsiloxy end groups , and dimethylsiloxane - methyl -( 3 , 3 , 3 - trifluoropropyl )- siloxane copolymers including dimethylvinylsiloxy end groups . particularly preferred cross - linking organopolysiloxanes according to the invention comprising at least two silicone - bonded hydrogen atoms are selected from methyl hydrogen polysiloxanes including trimethylsiloxy end groups , dimethylsiloxane - methyl hydrogen siloxane copolymers including trimethylsiloxy end groups , and cyclic dimethylsiloxane - methylhydrogen - siloxane copolymers . particularly preferred silicone elastomers according to the invention , which , as raw material , are present already pre - swelled in a silicone that is liquid at room temperature under normal conditions and represent a silicone - based gel , are commercially available , for example under the trade name corning 9040 silicone elastomer blend ( a cyclomethicone ( and ) dimethicone crosspolymer from dow corning ; silicone elastomer content 12 to 13 wt . %), sfe 168 , a cyclomethicone ( and ) dimethicone / vinyl dimethicone crosspolymer from ge silicones , vinyl dimethicone crosspolymers , included in ksg - 15 ( cyclomethicone ( and ) dimethicone / vinyl dimethicone crosspolymer , silicone elastomer content 4 to 10 wt . %), ksg - 16 ( dimethicone ( and ) dimethicone / vinyl dimethicone crosspolymer , silicone elastomer content 20 to 30 wt . %), ksg - 17 ( cyclomethicone ( and ) dimethicone / vinyl dimethicone crosspolymer ), ksg - 18 ( phenyl trimethicone ( and ) dimethicone / phenyl vinyl dimethicone crosspolymer , silicone elastomer content 10 to 20 wt . %); and ksg - 20 , available from shin etsu silicones of america ( akron , ohio ), and from grant industries inc . ( elmwood park , n . j . ), the products from the gransil ® series , in particular gransil sr - cyc ( cyclomethicone and stearyl - vinyl / hydromethylsiloxane copolymer ), gransil ® rps gel ( inci name : cyclopentasiloxane and polysilicone - 11 ), gransil ® gcm - 4 ( inci name : cyclotetrasiloxane and polysilicone - 11 ), gransila gcm - 5 ( inci name : cyclopentasiloxane and polysilicone - 11 ), gransil ® rps ( inci name : cyclopentasiloxane and polysilicone - 1 ), gi - cd 10 ( inci name : cyclopentasiloxane ( and ) stearoxymethicone / dimethicone copolymer ( and ) dimethicone ), gransil ® ids ( inci name : isododecane ( and ) cyclotetrasiloxane ( and ) polysilicone - 11 ), gransil ® pc - 12 ( inci name : isododecane ( and ) polysilicone - 11 ), gransil ® ids - 5 ( inci name : isododecane ( and ) cyclopentasiloxane ( and ) polysilicone - 11 ), gransil apk - 1 ( inci name : dimethicone and cyclopentasiloxane and polysilicone - 11 and nylon - 12 and methyl methacrylate / acrylonitrile copolymer and peg - 10 dimethicone and polysorbate - 40 and isohexadecane and ammonium polyacryloyldimethyl taurate ), gransil ® dmcm - 5 ( inci name : dimethicone and cyclopentasiloxane and polysilicone - 11 ), gransil ® dmg - 6 with dimethicone ( 6 cst ) ( inci name : dimethicone and polysilicone - 11 ), gransil ® dmg - 20 with dimethicone ( 20 cst ) ( inci name : dimethicone and polysilicone - 11 ), gransil ® am - 8 gel ( inci name : caprylyl methicone and cyclopentasiloxane and polysilicone - 11 ), gransil ® dm 5 with dimethicone ( 5 cst ) ( inci name : dimethicone and polysilicone - 11 ), gransil ® dmid ( inci name : dimethicone and isododecane and polysilicone - 11 ), gransil ® pm ( inci name : phenyl trimethicone and polysilicone - 11 ), gransil ® inin ( inci name : isononyl isononanoate ( and ) polysilicone - 11 ). silicone elastomers which , as raw material , are present already pre - swelled in a silicone oil , fat or wax that is liquid at room temperature under normal conditions and represent a silicone - based / non - silicone - based gel , are likewise preferably used in the compositions according to the invention . such silicone elastomer compositions are likewise commercially available , for example under the trade name gransil ® mlb ( inci name : cyclopentasiloxane and polysilicone - 11 and beeswax ), gransil ® ps ( inci name : cyclotetrasiloxane and polysilicone - 11 and petrolatum ), gransil ® ps - 5 ( inci name : cyclopentasiloxane and polysilicone - 11 and petrolatum ), gransil ® dmg - 20 p with dimethicone ( 20 cst ) and petrolatum ( inci name : dimethicone and polysilicone - 11 and petrolatum ), gransil ® rjo ( inci name : cyclopentasiloxane and polysilicone - 11 and jojoba oil ), gransil ® lano ( inci name : cyclopentasiloxane and polysilicone - 11 and lanolin ), gransil ® ohs - 5 ( inci name : cyclopentasiloxane and polysilicone - 11 and octyl hydroxystearate ), and gransil dml ( inci name : dimethicone ( and ) neopentyl glycol diheptanoate ( and ) polysilicone - 11 ). a further preferred embodiment of the invention is characterized in that the silicone elastomer can be obtained by cross - linking an organopolysiloxane that includes at least 2 c 2 to c 10 alkenyl groups having a terminal double bond in each molecule with at least one alpha , omega - diene . particularly preferred cross - linking alpha , omega - dienes according to the invention have the formula ch 2 ═ ch ( ch 2 ) x ch ═ ch 2 , where x = 1 to 20 . particularly preferred alpha , omega - dienes are selected from 1 , 4 - pentadiene , 1 , 5 - hexadiene , 1 , 6 - heptadiene , 1 , 7 - octadiene , 1 , 8 - nonadiene , 1 , 11 - dodecadiene , 1 , 13 - tetradecadiene , and 1 , 19 - eicosadiene . preferred compositions according to the invention are characterized by including at least one silicone elastomer in a total amount of 0 . 05 to 3 wt . %, preferably 0 . 1 to 2 wt . %, particularly preferably 0 . 2 to 1 . 0 wt . %, exceptionally preferably 0 . 3 to 0 . 5 wt . %, in each case based on the total weight of the composition according to the invention . oil - based compositions that include particulate solids typically have a density of greater than 1 . 2 g / cm 3 at 20 ° c . the agents according to the invention have a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . the density of the agents according to the invention is consequently significantly lower than in customary comparable compositions of the related art . a person skilled in the art knows reliable measuring methods for reproducibly and unambiguously determining the density . within the scope of the present application , the density was determined by way of a digital density meter ( such as chempro dma 4100m or mettler - toledo density meter dm40 ). the measuring principle is based on what is known as the flexural vibration method , in which the substance is filled into a u - shaped glass tube , which is open at the ends , of the measuring device . said glass tube is maintained at a constant temperature ( 20 ° c . here ), caused to oscillate electronically , and the natural frequency of the oscillation is determined . this natural frequency is characteristic of the density of the sample . lowering of the density is particularly preferably achieved by way of dispersion of gas . particularly preferred cosmetic agents according to the invention therefore include dispersed gas . preferably suitable gases according to the invention are air , nitrogen , oxygen , carbon dioxide , argon , nitrous oxide ( air being particularly preferred ). for example , gas can be incorporated into the cosmetic agent according to the invention by way of injection , recirculation , extrusion or stirring . the gas component is particularly preferably dispersed into the cosmetic agent according to the invention by way of a homogenizer . a particularly preferred embodiment of the invention is characterized by the following items : ( a ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; solid matter dispersed in particulate form ; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( b ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; solid matter dispersed in particulate form ; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( c ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( d ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in a range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; solid matter dispersed in particulate form ; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( e ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( f ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( g ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( h ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in a range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; the cosmetic agent has a viscosity from 300000 to 800000 mpas , in particular from 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ); and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( i ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %/ o ; at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( j ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( k ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular of 50 to 75 wt . %, in particular of 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, and silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in the range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c . ; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( l ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular of 50 to 75 wt . %, in particular of 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, and silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in a range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . ( m ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 15 wt . %, in particular of 5 to 15 wt . %, and silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in a range from 30 ° c . to 60 ° c ., particularly preferably in a range from 30 ° c . to 50 ° c ., especially particularly preferably in a range from 30 ° c . to 40 ° c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ° c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ° c . it is preferred according to the invention if each of the embodiments ( a ) through ( m ) additionally includes at least one thickening agent for thickening oil ( in particular silica , particularly preferably fumed silica ). a second subject matter relates to a production method for cosmetic agents , in which wax is dissolved in a liquid oil phase forming a wax solution ; solid matter in particulate form is dispersed in this wax solution ; optionally further ingredients are added to the wax solution ; optionally a ) together with the solid matter in particulate form , or b ) together with the further ingredients , or c ) separately , at the end , at least one thickening agent for thickening oil is added , and a gaseous substance is dispersed in the resulting mixture , or during the mixing process , until the cosmetic agent has a density ( measured at 20 ° c .) of 0 . 95 to 1 . 10 g / cm 3 . for example , the gaseous substance can be incorporated into the cosmetic agent according to the invention by way of injection , recirculation , extrusion or stirring . the gaseous substance is particularly preferably dispersed into the cosmetic agent according to the invention using a homogenizer . preferably suitable gaseous substances according to the invention are air , nitrogen , oxygen , carbon dioxide , argon , nitrous oxide , or mixtures of two or more of the aforementioned gases ( air being particularly preferred ). the cosmetic agent according to the invention is particularly preferably produced using the following method , comprising the following steps : i ) in a stirrer vessel comprising a stirrer ( and preferably a homogenizer ), wax is dissolved in a liquid oil component while stirring at a temperature of at least 40 ° c ., in particular 40 ° c . to 45 ° c . ; ii ) the resulting wax solution is cooled down to a temperature of no more than 25 ° c . ; iii ) solid matter in particulate form is dispersed in the wax solution while stirring ( preferably using a homogenizer ) at a temperature of no more than 25 ° c . ; iv ) further ingredients are added while stirring at a temperature of no more than 25 ° c . ; v ) at least one thickening agent for thickening oil , in particular silica , is added while stirring at a temperature of 20 ° c . to 25 ° c . ; and vi ) a gas pressure in the stirrer vessel is applied at an overpressure in the range of 10 to 250 mbar , and the mixture is stirred for a time period of 10 to 60 minutes , in particular of 20 to 40 minutes . a mixer such as symex 1000 from schröder & amp ; boos gmbh & amp ; co . kg , germany , is suitable for production , for example . it is preferred according to the invention to use , as the liquid component according to step i ), one or more esters of formula ( i ), where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , preferably in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %. it is preferred according to the invention to add at least one silicone oil ( preferably in an amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %) after or during step ii ) ( preferably between step ii ) and before step iii )). furthermore , all preferred embodiments of the parameters of the agents according to the invention of the first subject matter of the invention are also preferred , mutatis mutandis , for the second subject matter of the invention . a third subject matter of the invention relates to the use of a cosmetic agent of the first subject matter of the invention as a skin cosmetic . in a stirrer vessel ( symex 1000 from schröder & amp ; boos gmbh & amp ; co . kg , germany ) comprising a stirrer and a homogenizer , wax was dissolved in the liquid oil component ( see raw materials of table 1 bearing the number 1 ) while stirring at a temperature of 43 ° c . the resulting wax solution was cooled down to a temperature of no more than 25 ° c . the raw materials bearing the number 2 according to table 1 were added while stirring . at a temperature of 25 ° c ., the solids in particulate form bearing the number according to table 1 were dispersed in the wax solution while stirring and additionally using a homogenizer for 20 minutes . the ingredients bearing the number 4 according to table 1 were added while stirring at a temperature of 25 ° c . the ( fumed ) silica was added as a thickening agent for thickening oil while stirring at a temperature of 25 ° c . finally , the gas pressure in the stirrer vessel was increased to an overpressure of + 150 mbar compared to the ambient pressure , and the mixture was stirred for a time period of 30 minutes . while at least one exemplary embodiment has been presented in the foregoing detailed description of the invention , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment of the invention , it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope of the invention as set forth in the appended claims and their legal equivalents .
| 0Human Necessities
|
as used herein , room temperature refers to about 25 ° c . to 30 ° c . in accordance with the present invention , there is provided a novel crystalline form of imatinib mesylate , designated as form h1 , characterized by an x - ray powder diffraction spectrum having peaks expressed as 2θ at about 9 . 9 , 11 . 1 , 16 . 3 , 17 . 3 , 18 . 1 , 19 . 1 , 19 . 6 , 20 . 3 , 21 . 1 , 21 . 9 , 23 . 2 , 23 . 6 , 24 . 2 , 24 . 9 , 25 . 6 , 26 . 0 , 27 . 3 , 27 . 9 , 28 . 9 , 29 . 4 , 30 . 4 and 30 . 5 degrees . fig1 shows typical form h1 x - ray powder diffraction spectrum . in accordance with the present invention , a process is provided for preparation of imatinib mesylate form h1 . imatinib free base is dissolved in a chlorinated solvent , methanesulfonic acid is added and imatinib mesylate form h1 is isolated . examples of chlorinated solvents are chloroform , methylene dichloride , ethylene dichloride and a mixture thereof . preferable solvents are chloroform and methylene dichloride . imatinib free base may be dissolved in the chlorinated solvents at room temperature or at an elevated temperature . the quantity of methanesulfonic acid per mole of imatinib free base is not critical but preferably at least one mole of methanesulfonic acid per mole of imatinib free base is used to obtain maximum yield of imatinib mesylate . methanesulfonic acid can be added to the solution of imatinib free base in chlorinated solvent preferably between about 5 ° c . to reflux temperature , more preferably between room temperature to reflux temperature . most preferably , methanesulfonic acid is added at room temperature . then , the precipitated imatinib mesylate form h1 is collected by filtration or centrifugation . in accordance with the present invention , an another process is provided for preparation of imatinib mesylate form h1 . a mixture of imatinib mesylate and a chlorinated solvent is stirred for about 10 hours to 48 hours and imatinib mesylate form h1 is isolated . examples of chlorinated solvents are chloroform , methylene dichloride , ethylene dichloride and a mixture thereof . preferable solvents are chloroform and methylene dichloride . imatinib mesylate in a previously known crystalline or amorphous form may be used in the process . imatinib mesylate hydrate obtained by the process described below may also be used . particularly α - form , β - form or amorphous imatinib mesylate may be used . preferably , the mixture of imatinib mesylate and a chlorinated solvent is stirred between about 5 ° c . to reflux temperature , more preferably between room temperature to reflux temperature , for about 24 hours to 48 hours . then imatinib mesylate form h1 is collected by filtration or centrifugation . in accordance with the present invention , there is provided a novel hydrate of imatinib mesylate . the water content of the hydrate of imatinib mesylate is between 2 . 0 to 3 . 2 % by weight of hydrate of imatinib mesylate , typically between 2 . 2 to 2 . 9 % by weight of hydrate of imatinib mesylate . the amorphous form of imatinib mesylate hydrate , designated as amorphous imatinib mesylate hydrate , is characterized by having broad x - ray diffraction spectrum as in fig2 . in accordance with the present invention , a process is provided for preparation of imatinib mesylate hydrate . imatinib mesylate hydrate is prepared by dissolving imatinib mesylate in a mixture of a suitable solvent and water and removing the solvents from the solution . imatinib mesylate in a crystalline or amorphous form may be used in the process . particularly α - form , β - form or amorphous imatinib mesylate may be used . the suitable solvent is selected from the group consisting of alcohols , e . g ., methanol , ethanol , isopropyl alcohol ; ketones , e . g ., acetone ; acetonitrile ; and a mixture thereof . the solvent may be removed from the solution by vacuum drying or spray drying to give amorphous imatinib mesylate hydrate . the drying time and the drying temperature depend on the solvent used in the process . for example if the solvent is methanol , the solvent and water can be removed at about 50 ° c . for about 9 hours . imatinib free base and imatinib mesylate obtained by the previously known methods may be used in the above processes . in accordance with the present invention , there is provided a pharmaceutical composition comprising imatinib mesylate form h1 and a pharmaceutically acceptable carrier or diluent . in accordance with the present invention , there is provided a pharmaceutical composition comprising imatinib mesylate hydrate and a pharmaceutically acceptable carrier or diluent . amorphous imatinib mesylate hydrate may also be used in the composition . fig1 is a x - ray powder diffraction spectrum of imatinib mesylate form h1 . fig2 is a x - ray powder diffraction spectrum of amorphous imatinib mesylate hydrate . x - ray powder diffraction spectrum was measured on a bruker axs d8 advance x - ray powder diffractometer having a copper - kα radiation . the invention will now be further described by the following examples , which are illustrative rather than limiting . imatinib free base ( 5 . 0 gm ) is dissolved in chloroform ( 50 ml ) at room temperature and then methanesulfonic acid ( 0 . 75 ml ) is added . the contents are stirred for 5 hours at room temperature and separated crystals are filtered and dried to give 5 . 0 gm of imatinib mesylate form h1 . the mixture of imatinib mesylate ( α - form , 5 . 0 gm ) and chloroform ( 150 ml ) is heated to 50 ° c . and stirred for 36 hours at this temperature . then the contents are cooled to 25 ° c ., maintained for 5 hours at room temperature and filtered and dried to give 4 . 5 gm of imatinib mesylate form h1 . the mixture of imatinib mesylate ( β - form , 5 . 0 gm ) and chloroform ( 150 ml ) is heated to 50 ° c . and stirred for 36 hours at this temperature . then the contents are cooled to 25 ° c ., maintained for 5 hours at room temperature and filtered and dried to give 4 . 3 gm of imatinib mesylate form h1 . imatinib free base ( 5 . 0 gm ) is dissolved in methylene dichloride ( 50 ml ) at room temperature and then methanesulfonic acid ( 0 . 75 ml ) is added . the contents are stirred for 5 hours at room temperature and filtered and dried to give 4 . 9 gm of imatinib mesylate form h1 . the mixture of imatinib mesylate ( 5 . 0 gm ) and methylene dichloride ( 150 ml ) is heated to 50 ° c . and stirred for 5 hours at this temperature . then the contents are cooled to 25 ° c ., maintained for 25 hours at room temperature and filtered to give 4 . 6 gm of imatinib mesylate form h1 imatinib mesylate form h1 ( 3 . 5 gm ) is dissolved in a mixture of methanol ( 25 ml ) and water ( 5 . 0 ml ) at room temperature . the solution is subjected to vacuum drying at about 50 ° c . for 9 hours to give 3 . 0 gm of amorphous imatinib mesylate hydrate . example 6 is carried out using imatinib mesylate ( α - form ) instead of imatinib mesylate form h1 to give imatinib mesylate hydrate . example 6 is carried out by subjecting the solution to spray drying instead of vacuum drying to give amorphous imatinib mesylate hydrate .
| 2Chemistry; Metallurgy
|
referring now more specifically to the drawings and to fig1 in particular , a device or body 10 is shown having a surface configuration 12 ( fig2 and 3 ) of the present invention . surface configuration 12 includes a plurality of formations 14 closely packed on body 10 . only some formations 14 and the components thereof to be described hereinafter and not all formations 14 or the components thereof are labeled in fig1 , for purposes of clarity . body 10 can be made of a variety of materials , including plastics for which the present invention is applied easily . in plastic articles , surface configurations 14 can be formed during molding of an article or thing made of the plastic , such as a buckle for a strap , a frame piece of a backpack , plastic components of weapons or tools or other articles manufactured by any of various molding processes . a mold for the plastic article can be shaped to include surface formations 14 in forms to be described hereinafter . in such devices and things , surface configuration 12 becomes an integral feature of the outer surface of the device or thing , or the part thereof including body 10 , as shown in fig3 . alternatively , as seen best in fig2 , surface configuration 12 can be formed on one face of a relatively thin , discrete body 10 . thereafter , adhesive 16 can be used in a layer on an opposite face of body 10 to attach body 10 to another article . in this way , the present invention can be used not only as a surface on newly manufactured devices by molding it into the surface , the present invention also can be added or applied on surfaces of other things , which may or may not be made of plastic . articles made of other materials can be rendered less visible to night vision devices by adhering a body 10 to the existing article or thing , the body 10 having surface configuration 12 on one face thereof further , panels of body 10 with surface configuration 12 can be placed so as to hide other things behind the panels . surface configuration 12 includes closely adjacent , three - dimensional formations 14 defining an inner surface 18 and an outer surface 20 . advantageously , inner surface 18 and outer surface 20 are spaced from each other by a significant distance , preferably by as much as available space and other design constraints allow in body 10 . individual formations 14 preferably are smaller rather than larger , and are more tightly arranged rather than more loosely arranged , for more thoroughly disrupting the reflected light from the object . formations 14 are configured and arranged to provide outer surface 20 with a small surface area relative to the size of body 10 . each formation 14 includes a nested arrangement of an outer wall 22 and inner projection 24 . the combination of nested features provides inconsistent reflectivity of light , reducing the clarity and distinctness by which the surface is detected with night vision devices . in a preferred form , outer wall 22 is formed as a plurality of panels 26 between inner surface 18 and outer surface 20 . panels 26 define a laterally closed cell that is open at outer surface 20 . preferably , six panels 26 are provided to define hexagonal cells that can be tightly packed adjacent each other . each panel 26 is wider at outer surface 20 than at inner surface 18 so that the exposed surface thereof angles inwardly in the cell defined thereby . inner projection 24 extends outwardly from inner surface 18 and has a distal end 28 . projection 24 preferably is shorter than outer wall 22 , and distal end 28 is located between inner surface 18 and outer surface 20 . an advantageous form of inner projection 24 , particularly useful with hexagonally shaped wall 22 , is configured with a plurality of flat surfaces 30 , preferably six flat surfaces 30 . projection 24 is wider at inner surface 18 than at distal end 28 , tapering smoothly from inner surface 18 to distal end 28 . hexagonally shaped walls 22 and six - sided projections 24 are one preferred arrangement of surface configuration 12 ; however , other arrangements also can be used . for example , instead of being made of flat segments , wall 22 can be continuously curved . fig4 illustrates an embodiment of the present invention in which a continuously curved wall 32 is round , and a projection 34 arranged therein is a frustum or truncated cone . in a preferred form , curved wall 32 is of greater diameter at outer surface 20 than at inner surface 18 . other geometric arrangements are also believed to be suitable , if sufficiently closely arranged on the article or thing . to be suitable , the geometric arrangement includes surfaces arranged at various angles to provide inconsistent angles of incidence and reflection with respect to a light source shinning on the object . with each formation being relatively small , and with all formations being closely and compactly arranged , large expanses forming areas of consistent reflectivity are minimized , and the surface is less detectable to a variety of vision enhancing devices . in the preferred embodiments shown and described herein , a projection 24 or 34 is shown within each wall 22 or 32 . in some uses of the invention , it may be suitable to provide random or patterned arrangements in which not all walls 22 or 32 have a projection 24 or 34 contained there within . further , combinations may be used in which a continuously curved wall 32 has a flat sided projection 24 therein , or a wall 22 made of flat panels 26 has a frustoconical or other curved projection 34 therein . the present invention can be combined with other light controlling features . for example , when used on plastic components , resin compounds can be formulated to include light absorbing and / or light - reflecting dyes . features such as these can be used to reduce visibility of an object within the range of between about 300 and 3000 nanometer wavelength , and preferably in the range of about 600 to 2000 nanometers . a suitable dye for a variety of applications is shepard 473 or 474 available from the shepard color company , 4539 dues drive , cincinnati ohio 45246 . surface configurations 12 of the present invention can be used with a variety of materials for a variety of purposes , especially when device or body 10 is a discrete body configured to attachment to another structure . the material from which surface configuration 12 is formed can be relatively rigid and plate - like , or the material can have flexibility to conform to an irregularly shaped article upon which it is applied . the material can be bi - axially stretchable or uni - axially stretchable , as required for a specific application . for example , material having a surface configuration of the present invention can be applied as cushioning on the inside of vehicles , to provide padding for occupants in addition to reduced visual detectability and improved sound muffling . the cell structure can deflect or crush slightly when impacted , thereby also functioning as a cushion or padding for people and objects . in one suitable use of the present invention , thermo setting urethanes such as isocyanate urethanes are used . materials of different durometer can be used , depending on the need for softness or stiffness of the material . a suitable material for a variety of applications is poly 33925 available from bayone urethane systems , llc ., 2700 papin street , st . louis , mo . 63103 . the material can be made more or less flexible or more or less rigid by the addition or removal of various additives . again , by way of example , fillers or reinforcing material can be added , such as glass fibers , fabric fibers , mineral fillers or nanoparticles . in a preferred configuration , the overall thickness of body 12 , as indicated by the dimensional line 40 in fig2 , is about 0 . 0080 inch . the depth of each cell formed therein , between inner surface 18 and outer surface 20 , as indicated by the dimensional line 42 in fig2 , is approximately 0 . 0060 inch . thus , the material remaining at the bottom of each cell , as indicated by the dimensional line 44 in fig2 , has a thickness of about 0 . 0020 inch in general , preferred cell sizes are small at the outer surface , and relatively deep in comparison to the surface opening . cells are closely packed , with minimal regions of material disposed along the outer surface between cells . it is preferred that ridge areas 46 between cells have a width , as indicated by the dimensional line 48 in fig2 , of between about 0 . 001 and 0 . 050 inch , and more preferably less than about 0 . 002 inch . as a result , the exposed area of the outer surface is kept small . the three dimensional shape and openness of the cells provides a cushioning effect that creates sound muffling when an object having the material thereon is contacted by another object or thing . thus , normal use of equipment having the present surface configuration generates less noise than otherwise would be created . the cushioning effect can be increased by reducing the rigidity of the material , such as by using fewer fiber additives or other reinforcing techniques . however , because of the open cell structure , even relatively rigid embodiments of the present invention provide significant sound muffling . adhesives used for attaching sheets of material having the surface configuration of the present invention can be of a variety of types . acrylic - based as well as urethane based adhesives of different tackiness have been used advantageously . chemical resistivity can be built into the material and / or adhesives used so that the material and adhesive are resistive to petrochemical and hydrocarbon degradation . a suitable adhesive for a variety of applications is hs00463 - b available from coating and converting technologies , 80 east morris street , philadelphia , pa . 19148 . the pitted or open cell outer surface area further provides an improved gripping surface so that items such as weapons or other equipment are more easily grasped and held . graspability can be further improved by forming the surface configuration of the present invention from a material such as thermoset urethanes that have a tactile or grip enhancing surface . variations and modifications of the foregoing are within the scope of the present invention it is understood that the invention disclosed and defined herein extends to all alternative combinations of two or more of the individual features mentioned or evident from the text and / or drawings . all of these different combinations constitute various alternative aspects of the present invention . the embodiments described herein explain the best modes known for practicing the invention and will enable others skilled in the art to utilize the invention . the claims are to be construed to include alternative embodiments to the extent permitted by the prior art . various features of the invention are set forth in the following claims .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
specific embodiments of the lip applicator disclosed herein will now be described in detail with reference to the foregoing figures , wherein like reference numerals identify similar or identical elements . in the drawings , and in the description which follows , the term “ beauty aid ” may refer to a lipstick , a lip gloss , or any such product that may be topically applied to one &# 39 ; s lips . in addition , the term “ user ” may refer either to the person to whom the beauty aid is applied , or to the person handling the lip applicator and applying a beauty aid to the lips of another . finally , the terms “ proximal ” and “ distal ” will be understood as referring to those portions of the lip applicator that are closest to , and furthest from , respectively , the applying portion , as defined below . referring now to the drawings , fig1 generally illustrates a lip applicator 10 for applying a beauty aid 12 to one &# 39 ; s lips ( see also fig1 ). lip applicator 10 includes a generally lip - shaped applying portion 14 , which is configured to retain beauty aid 12 thereon , a stem portion 16 that extends distally from and supports the applying portion 14 , and a base portion 18 that is configured to support the lip applicator 10 in an upward , or free - standing orientation , as seen in fig1 , if so desired . in each embodiment of the present disclosure described herein , a variety of configurations and sizes are contemplated for applying portion 14 , such that lip applicator 10 may be compatible with a greater multitude of user &# 39 ; s . base portion 18 may be configured to facilitate handling and may include various contours , scallops , protuberances and / or gripping surfaces to enhance a user &# 39 ; s grip thereof . the base portion 18 includes a bottom surface 20 which is configured and dimensioned to stabilize the lip applicator 10 atop a table or other surface 22 when not in use . bottom surface 20 may be configured and dimensioned in any suitable manner that facilitates the stabilization of lip applicator 10 . configurations for bottom surface 20 may include , but are not limited to , a flat surface , a concave surface , a surface including independent support legs , or a surface that includes an adhesive mechanism , e . g ., a suction - cup , as would be appreciated by one of ordinary skill in the art . as depicted in fig1 , bottom surface 20 is flat and rectilinear in shape , but a base portion 18 having another geometric configuration , or an ornamental shape , is not beyond the scope of the present disclosure . bottom surface 20 may also be textured , or may include a plastic , rubberized , or any other suitable surface that may enhance the stability and / or handling of lip applicator 10 . referring still to fig1 , applying portion 14 is generally “ lip - shaped ”. this configuration allows for the even and facile application of a beauty aid 12 to one &# 39 ; s lips . the present disclosure contemplates that applying portion 14 may be integrally formed with stem portion 16 through any suitable method or mechanism including , but not being limited to , screws , adhesives , or monolithic formation therewith . it is further contemplated that applying portion 14 may be releasably connected to stem portion 16 , again through any suitable method , including , but not limited to , a snap - fit arrangement or interference fitting , such that applying portion 14 may be selectively engagable therewith , or replaceable . in one embodiment , as seen in fig2 , lip applicator 100 includes an applying portion 114 , a stem portion 116 , and a base portion 118 . it is contemplated that applying portion 114 and base portion 118 may each be releasably or integrally connected to stem portion 116 . stem portion 116 includes a first portion 116 a configured and dimensioned to be selectively movable with respect to a second portion 116 b . first and second stem portions 116 a , 116 b may allow for continuous or incremental movement with respect to one another such that applying portion 114 may be adjusted relative to base portion 118 during or prior to use . first and second stem portions 116 a , 116 b may be configured and dimensioned in any manner such that one of the first and second stem portions 116 a , 116 b is movable in relation to , and may be received by , the other , e . g . telescopically . in the embodiment depicted in fig2 , first stem portion 116 a is telescopically moveable in the direction indicated by arrow “ a ” within lower stem portion 116 b , such that lip applicator 100 is selectively extendable . in an alternate embodiment , it is contemplated that second stem portion 116 b may be received by , and may be movable within , first stem portion 116 a , again enabling the selective extension of the lip applicator 100 . in another embodiment , as seen in fig3 , lip applicator 200 includes an applying portion 214 , a stem portion 216 and a base portion 218 that defines a cavity 224 therein which is dimensioned to releasably retain a beauty aid 212 . beauty aid 212 may be releasably engageable with base portion 218 through any suitable mechanism or structure including , but not limited to , snap - fit or interference fit arrangements , to allow for the selective removal , replacement , and / or substitution of various beauty aids , or beauty aid 212 may be integrally associated with , or formed within , base portion 218 such that beauty aid 212 may not be replaced , substituted , or removed therefrom . referring now to fig4 a - 4b , a lip applicator 300 is disclosed that includes an applying portion 314 , a stem portion 316 , and a base portion 318 rotatably connected to the stem portion 316 through any suitable mechanism or structural adaptation , such that lip applicator 300 may be selectively transitioned or moved from a first position to a second position . in the first position , seen in fig4 a , beauty aid 312 is disposed within cavity 324 , whereas in the second position , seen in fig4 b , beauty aid 312 at least partially extends therefrom . to move lip applicator 300 from the first position to the second position , and thereby selectively extend beauty aid 312 from cavity 324 , either base portion 318 , or stem portion 316 , may be rotated . to move lip applicator 300 from the second position to the first position , and thereby selectively retract beauty aid 312 , again , either base portion 318 , or stem portion 316 , may be rotated . in transitioning from the first position to the second position , or from the second position to the first position , base portion 318 , or stem portion 316 , may be rotated either clockwise , in the direction of arrow “ b ”, or counterclockwise , in the direction of arrow “ c ”. in the embodiments shown in fig3 and 4 a - 4 b , it is contemplated that the configuration and dimensions of the cavity may be varied such that base portion may accommodate a variety of beauty aids . in addition , with respect to each embodiment discussed heretofore , it is contemplated that the lip applicator may employ a plurality of cavities , each of which may vary in size and / or configuration , thereby allowing for the incorporation of a multitude of beauty aids . it is further contemplated , in each embodiment described thus far , that the stem portion may include two or more sections configured and dimensioned to be respectively movable with respect to each other , e . g ., telescopically , as disclosed in the embodiment depicted in fig2 . in fig5 a - 5b , a lip applicator 400 is disclosed that includes an applying portion 414 , a stem portion 416 , and a base portion 418 . lip applicator 400 further includes a release mechanism 426 and a cavity 424 defined in base portion 418 that is configured and dimensioned to removably receive stem portion 416 and applying portion 414 , as will be discussed in further detail below . applying portion 414 is movably secured to stem portion 416 , e . g . rotatably or pivotably secured , such that applying portion 414 and stem portion 416 are selectively movable in relation to one another , either in the direction of arrow “ d ” or arrow “ e ”, from a first position , seen in fig5 a , to a second position , seen in fig5 b . in the first or applying position , seen in fig5 a , lip applicator 400 defines a first height h 1 , and applying portion 414 is substantially horizontal in orientation , thereby facilitating the application of beauty aid 412 by a user . if desired , applying portion 414 may be rotated and moved into the second position , in which applying portion 414 is substantially vertical in orientation and at least a portion thereof is removably disposed within cavity 424 , together with at least a portion of stem portion 416 , as seen in fig5 b . in the second position , lip applying portion 414 may be substantially protected from the ambient , thereby remaining free of dust , particulates , or the like during non - use . in the second position , the overall height h 2 of lip applicator 400 is substantially reduced when compared to that of lip applicator 400 in the first position . this reduction in height may facilitate the convenient storage or transport of the lip applicator 400 , if so desired . it is contemplated that stem portion 416 may include two or more sections that may be configured and dimensioned to move with respect to one another in any suitable manner such that one of the portions may be movable in relation to , and may be received by , the other portion , e . g . telescopically , as depicted in the embodiment of fig2 . referring still to fig5 a - 5b , as discussed above , lip applicator 400 includes release 426 . release 426 maintains lip applicator 400 in either the first position , or the second position , until it is desired by the user to move therebetween . at such time , the user may actuate release 426 and configure the lip applicator 400 either for storage , or for use . release 426 may be any mechanical mechanism suitable for the intended purpose of preventing the unintentional transitioning between the first and second positions , illustrative examples of which include , but are not limited to , a depressible button , a rotatable knob , or a slidable button set within a track 428 , as seen in fig5 a - 5b . fig6 a - 6b illustrate a lip applicator 500 having an applying portion 514 with two individual portions 514 a , 514 b and a hinge portion 530 , a stem portion 416 , and a base portion 418 . lip applicator 500 functions in a manner identical to that disclosed with respect to the previous embodiments depicted in fig5 a - 5b , in that lip applicator 500 is adapted to transition from a first , applying position , to a second storage position in which lip applying portion 514 and stem portion 516 are at least partially disposed within and removable from a cavity 524 in base portion 518 . portions 514 a and 514 b are selectively foldable in the direction of arrow “ g ” relative to one another about hinge portion 530 , such that the dimensions of applying portion 514 may be substantially reduced , thereby facilitating the storage thereof in base portion 518 while in the second position . in one aspect of the present disclosure , applying portion 514 may be manually folded about hinge portion 530 at the will of the user , whereas in another aspect , applying portion 514 may only be folded upon the actuation of release 526 . release 526 , therefore , may serve dual purposes . first , release 526 may facilitate the folding of applying portion 514 about hinge portion 530 . and second , release 526 may facilitate the movement or transition of lip applicator 500 from the first position , seen in fig6 a , to the second position , seen in fig6 b , or from the second position to the first position , as discussed above . in a further aspect of the present disclosure , lip applicator 500 may employ multiple , independent release mechanisms ( not shown ), one to permit the folding and / or the unfolding of the applying portion 514 about a hinge portion 530 , and a second to permit the transition of the lip applicator from the first position to the second position . with respect to the folding and unfolding of the applying portion , the release , or releases , employed may be any mechanism or structural adaptation suitable for preventing against the inadvertent folding or unfolding of the applying portion . with respect to the embodiments of fig5 a - 6b , the base portion may be configured and dimensioned to retain a beauty aid therein , either integrally or selectively , as disclosed in the embodiments of fig2 - 4b . it is also contemplated that the dimensions of the cavity may be varied such that base portion may accommodate a variety of beauty aids . in addition , the lip applicator may employ a plurality of cavities , each of which may vary in size and / or configuration , thereby allowing for the incorporation of additional beauty aids . it is also contemplated that the stem portion may include two or more sections that may be configured and dimensioned to move with respect to one another in any suitable manner such that one section may be movable in relation to , and may be received by , the other section , e . g . telescopically , as disclosed in the embodiment of fig2 . referring now to fig7 a , lip applicator 600 includes an applying portion 614 with an aperture 638 , a stem portion 616 having a conduit 632 defining proximal and distal ends 634 , 636 disposed therein , and a base portion 618 . base portion 618 is configured and dimensioned to retain a beauty aid 612 therein , and is formed , either in whole or in part , of any resilient or semi - resilient material capable of transitioning from a first , initial position ( not shown ) to a second , deformed position ( not shown ), upon the application of a force “ f ” thereto , as may be appreciated by one of ordinary skill in the art . force “ f ” may be generated by squeezing base portion 618 , or in any other suitable manner , including , but not being limited to , twisting . in the first position , base portion 618 is not subject to any external force . accordingly , in this position , beauty aid 612 remains within the base portion 618 . however , upon the application of force “ f ” thereto , the walls 640 of base portion 618 may begin to deform inwardly , thereby decreasing the volume of base portion 618 , as would be appreciated by one of ordinary skill in the art , such that the beauty aid 612 may be forced outwardly therefrom . conduit 632 is in fluid communication with base portion 618 such that beauty aid 612 may enter conduit 632 through the distal end 636 thereof upon expulsion from base portion 618 , subsequently being communicated therethrough , and exiting onto applying portion 614 through proximal end 634 and aperture 638 . it is contemplated herein that base portion 618 may be rotatably secured to stem portion 616 such that the force “ f ” required to deform the base portion 618 , and expel beauty aid 612 therefrom , may be generated through the rotation , or twisting , of base portion 618 . base portion 618 may be selectively engageable with stem portion 616 through any suitable mechanism or arrangement , including , but not limited to , screw - type or snap - fit arrangements , such that base portion 618 and the beauty aid 612 retained therein , may be replaced when necessary or desired . alternatively , base portion 618 may be integrally formed with stem portion 616 such that the lip applicator 600 may be considered disposable . referring now to fig7 b , lip applicator 700 includes an applying portion 714 , a stem portion 716 , and a base portion 718 having a bladder 742 disposed therein and secured thereto through any suitable means , including , but not being limited to , adhesives . base portion 718 and bladder 742 may be formed , either in whole or in part , of any resilient or semi - resilient material capable of transitioning from a first , initial position ( not shown ) to a second , deformed position ( not shown ) upon the application of a force “ f ” thereto , again generated in any suitable manner . conduit 732 is in fluid communication with bladder 742 such that a beauty aid 712 , retained therein , may enter conduit 732 through a distal end 736 thereof upon being expelled from bladder 742 , as discussed above with respect to the disclosure in fig7 a . subsequently , beauty aid 712 may be communicated through conduit 732 , and the proximal end 734 thereof , onto applying portion 714 through an aperture 738 . in one embodiment , base portion 718 may be rotatably secured to stem portion 716 such that the force “ f ” required to deform bladder 742 and expel beauty aid 712 therefrom may be generated through the rotation of base portion 718 . in this embodiment , the force “ f ” created through the rotation of base portion 718 is transmitted to bladder 742 through the connection therebetween . base portion 718 , and therefore bladder 742 , may be selectively engagable with stem portion 716 through any suitable mechanism or arrangement , including , but not limited to , screw - type or snap - fit arrangements , such that base portion 718 , bladder 742 , and the beauty aid 712 retained therein , may be replaced when necessary or desired . it is further contemplated that base portion 718 may be integrally formed with stem portion 716 such that lip applicator 700 may be considered disposable . in one embodiment , as seen in fig8 , lip applicator 800 is disclosed which includes an applying portion 814 , a stem portion 816 , and a base portion 818 that defines a recess 844 therein configured and dimensioned to releasably retain at least one cleaning sheet 846 , e . g ., a tissue or an anti - bacterial wipe , for selective distribution . base portion 818 may be selectively engagable with stem portion 816 such that base portion 818 , and the cleaning sheets 846 retained therein , may be replaced when necessary . it is further contemplated that base portion 818 may be integrally formed with stem portion 816 such that lip applicator 800 may be considered disposable . in another embodiment , as seen in fig9 , a lip applicator 900 is disclosed that includes an applying portion 914 , a stem portion 916 , and a base portion 918 including at least one reflective surface 948 . reflective surface 948 may be disposed on any suitable surface of base portion 918 , including , but not limited to , any face 950 , or the bottom surface 952 . reflective surface 948 may also be disposed in any other suitable location , including , but not being limited to applying portion 914 . it is further envisioned that base portion 918 itself be formed , in whole or in part , of a reflective material , thereby obviating the need for an additional reflective element . referring now to fig1 , a lip applicator 1000 is illustrated . as illustrated , base portion 1018 and / or stem portion 1016 may be grasped by the user . applying portion 1014 may then be raised and pressed to the user &# 39 ; s lips , either by the user , or by another party , as shown . applying portion 1014 is then pressed against the user &# 39 ; s lips until such time that the desired beauty aid ( not shown ) is sufficiently applied thereto . fig1 discloses yet another embodiment of the present disclosure . lip applicator 1100 is generally similar to lip applicator 10 shown in fig1 and includes applying portion 1114 , stem portion 1116 , and base portion 1118 . applicator 1100 further includes an applicator surface 1154 configured to releasably retain an applicator sponge 1156 . applicator sponge 1156 has a general configuration mimicking that of applicator surface 1154 . applicator sponges of various shapes and sizes , in particular , but not limited to , small , medium , and large sponges 1156 a , 1156 b , 1156 c may be used in conjunction with lip applicator 1100 dependent upon the labial characteristics of the person to whom a beauty aid ( not shown ) need be applied . in preparation for use , the user orients applicator sponge 1156 with respect to applicator surface 1154 and applies a force thereto in the direction of arrow “ h ”. applicator sponge 1156 may include an adhesive substrate ( not shown ) disposed on any suitable surface thereof , including , but not being limited to , underside 1158 , which may releasably adhere to applicator surface 1154 . applicator sponge 1156 may also include a peel - away liner ( not shown ) to protect the adhesive substrate ( not shown ) prior to use . any adhesive substrate may be employed , including water or liquid - activated adhesives . alternatively , applicator surface 1154 may include an adhesive - like substance ( not shown ) which adheres to applicator sponge 1156 when placed upon applicator surface 1154 . a reusable or tacky substance may be utilized to accomplish this purpose . as best shown in fig1 a and 12b , a plurality of applicator sponges 1156 a - 1156 c , that may vary in size , may be arranged on sheet 1160 and sold as a package . sheet 1160 may be made from a releasable film ( e . g ., wax - like paper ) that allows a user to simply peel - away one or more sponges 1156 a - 1156 c for use . sheet 1160 may also simply be a support structure , e . g ., cardboard , for selling a large number of sponges in a single package . after use , the user simply peels applicator sponge 1156 from surface 1154 and discards the sponge 1156 . the present disclosure contemplates that a beauty aid ( not shown ) may be pre - applied to applicator sponges 1156 . to preserve the integrity of the beauty aid ( not shown ) prior to application , the beauty aid may by disposed beneath and protected by a peel - away film ( not shown ), or the like , as would be appreciated by one of ordinary skill in the art . following the orientation of sponge 1156 atop applicator surface 1154 , as describe above , the user may simply remove the protective film ( not shown ), and thereby expose the beauty aid ( not shown ). from the foregoing and with reference to the various figure drawings , those skilled in the art will appreciate that certain modifications can also be made to the present disclosure without departing from the scope of the same . while several embodiments of the disclosure have been shown in the drawings , it is not intended that the disclosure be limited thereto , as it is intended that the disclosure be as broad in scope as the art will allow and that the specification be read likewise . therefore , the above description should not be construed as limiting , but merely as exemplifications of particular embodiments . those skilled in the art will envision other modifications within the scope and spirit of the claims to be appended hereto .
| 0Human Necessities
|
as shown in fig1 a tangential blower consists of deflector 1 , side members 2 , impeller 3 and vortex former 4 . when the impeller 3 is rotated by a motor , in the direction indicated by the arrow 5 , then air is sucked - in from the space above the vortex former and blown out of the pressure space below the vortex former 4 in the direction as indicated by the arrow 6 . from the cross sectional view of the tangential blower as shown in fig2 the deflector 1 can be very clearly recognized . the impeller is supposed to have the diameter d . fig3 shows the invention and the mode of operation thereof . the impeller 3 as rotated in the direction as indicated by the arrow 5 , effects in the space c above the vortex former 4 as suction flow . within the impeller 3 there exists the vortex flow 7 with the vortex center 8 , and below the vortex former 4 , in the space a , the flow is on the pressure side . as can be seen from fig3 the blades of the impeller on their way from space a to space c , pass through the space b in which there exists a highly turbulent flow . this highly turbulent flow is caused by the interfering body 9 on the vortex former 4 . this has the consequence , that the blade does not abruptly change from the pressure into the suction zone , but that the change over is effected gradually . within the space b there may be effected a certain equalization of pressure between a and c . the highly turbulent flow within the space b is produced at a sharp edge of the interfering body 9 at which the flow starts to break off . as is apparent from the drawings , the interfering body 9 is non - rotatably fixed to the vortex former 4 . the interfering body 9 may be a ridge punched out of the vortex former 4 and which , either continuously or in sections , extends over the entire length of the vortex former 4 . it is not absolutely necessary for the interfering body 9 to have the same length as the vortex former , but it should at least have a length corresponding to half the length of the vortex former . if the interfering body is shorter than the vortex former it may be located symmetrically with respect to the center line of the vortex former . instead of being punched out , the interfering body may also be placed on the vortex former . fig4 to 6 show three different types of embodiments of the interfering body 9 . in the embodiment as shown in fig4 the interfering body 9 is a ridge which is inclined ( tilted ) in the direction of the direction of rotation of the impeller ( arrow 5 ). in the embodiment as shown in fig5 the ridge is inclined ( tilted ) in opposition to the direction of rotation of the impeller , and in the type of embodiment in fig6 the ridge is placed at a right angle in relation to the surface of the vortex former . the spacing a between the ends of the ridges and the surface of the vortex former should amount from 0 . 01 to 0 . 08 times the impeller diameter d . comparison measurements carried out on embodiments whose impeller had twenty blades and which were operated at rotational speeds ranging between 1 , 800 and 2 , 000 revolutions per minute , have proved that with the tangential blower whose vortex former was provided with the interfering body , the peak frequencies were very strongly reduced within the range from 600 to 700 hz .
| 8General tagging of new or cross-sectional technology
|
the following detailed description is the best currently contemplated modes for carrying out the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention . referring to fig1 a drilling rig 10 may include a transport vehicle 12 with drilling fluid equipment 14 , power source 16 and drilling machine 20 installed thereon . the drilling machine 20 may have rotation support 22 supporting pipe container 24 that may be rotated about axis 26 by power source 16 . a drill pipe 60 may be contained in and extend from the pipe container 24 through aperture 28 . while pipe may be used as a general descriptor , it will be understood by those skilled in the art that this may include flexible drill pipe , tubing and the like . a drill pipe drive mechanism 40 may be positioned rearward of aperture 28 . drill pipe 60 may be moved through the drive mechanism 40 in a forward or rearward direction . as the drill pipe 60 is moved through the drive mechanism 40 in a rearward direction the drill pipe 60 may be routed through a conduit 80 to guide it to drill in for example a horizontal direction in the earth 100 . as drilling progresses drill pipe 80 may be supplied from pipe container 24 . the conduit 80 may be attached rearward of the drive mechanism 40 and positioned to have a drilling end 82 located in a trench 122 , hole or other prepared entry opening for horizontal drilling in the earth 120 . the conduit 80 may also have a rotation connector 84 that may be attached to the vehicle 12 to aid in initial guiding of the drill pipe 60 and drill bit 110 . while a generally horizontal rotation connector 84 is illustrated , other connection joints may be used as for example a three dimensional universal rotation connector ( not shown ). also , the drilling end 82 of the conduit 80 may have other directional orientations than the illustrated generally horizontal drilling direction . the drill bit 110 may be a directional drill bit with a slanted or spade front surface element to aid in changing direction when drilling in the earth . when the drill pipe 60 is not rotating the drill bit 110 may be urged forward using drilling fluid and drive mechanism 40 . the slanted front surface of the drill bit 110 may cause the drill bit 110 to move away from the previous boring axis . when the drill pipe 60 is rotating the drill bit 110 may tend to bore in a straight line axis . also , a mud motor apparatus may be used for applying rotational torque to a drill bit by hydraulic action . the pumping of drilling fluid through the tubing 92 causes rotation of the drill bit without rotating the drill string or tubing 92 . the tubing 92 may be rotated for directional steering , see fig1 . a mud motor has a slight bend in it that may cause turning as the drill bit progresses through the earth . referring to fig2 through 4 , a drill pipe 60 may have an inner conduit 62 for flow of fluid , such as , drilling mud , under pressure to aid in drill bit 80 cutting as such cutting is understood in the art . a wire coil 64 may be located coaxially around the inner conduit 62 . the wire coil 64 may have coil elements 66 oriented at an angle other than orthogonal to the drill pipe axis 68 . as illustrated in fig2 the coil elements 66 are oriented at an approximate 70 degree angle from the drill pipe axis 68 . a second wire coil 70 may be located coaxially around the wire coil 64 . the second wire coil 70 may have second coil elements 72 oriented at an angle other than orthogonal to the drill pipe axis 68 . as illustrated in fig2 the second coil elements 72 are oriented at an approximate 110 degree angle from the drill pipe axis 68 as measured in the same angular rotation as coil elements 66 . wire 74 , flexible metal rods or the like may be positioned intermediate the wire coil 64 and second wire coil 70 that may provide additional longitudinal support for drill pipe 60 . the wire coils 62 , 70 and the wire 74 may be attached along the longitudinal length by for example welding or other appropriate attachment methods . the drill pipe elements 62 , 66 , 70 , 74 may be fastened in a coupling 76 at each end thereof . the couplings 76 may be used for attachment of a drill bit , for attachment to a pipe container and for attachment to the output of a drilling fluid equipment system . the couplings 76 may also be used to connect two sections of drill pipe as illustrated in fig4 . referring to fig5 through 7 , a drill pipe drive mechanism 40 may have a pair of rotating gear mechanisms 42 that engage and drive a pair of continuous loop chains 44 . drive blocks 46 may be attached at sides 48 , 50 thereof between chains 44 . the drive blocks 46 may have a pipe trough 52 with ridges 54 for engaging the coil elements or second coil elements of a drill pipe 60 to be moved through the drive mechanism 40 . the drill pipe 60 may be supported for movement through the drive mechanism 40 by a guide trough 56 positioned opposite the path of the drive blocks 46 . in operation , when the gear mechanism 42 is rotated to move chains 44 and drive blocks 46 , the drill pipe 60 may be moved through the drive mechanism 40 by engagement of the ridges 54 in drill pipe 60 . when the pipe container 24 is rotated , as for example , to rotate the drill pipe 60 and drill bit 90 to cut into the earth , the movement of the drive mechanism 40 may be synchronized with the rotation of the pipe container 24 to inhibit retraction of the drill pipe 60 into the pipe container 24 . the drive mechanism 40 may also be operated at a speed during any such rotation motion to urge the drill pipe 60 and drill bit 90 forward into the earth to advance the bore hole formation . when desired , the drive mechanism 40 may be operated to retract the drill pipe 60 . referring to fig8 a drill pipe drive mechanism 40 may have a rotating gear mechanism 58 to move the drill pipe 60 therethrough . the gear elements 59 may have gear teeth ( not shown ) that engage the coil elements of the drill pipe 60 . movement and synchronization would be similar to that described above . while the invention has been shown and described using a drill pipe 60 having one or more wire coils , other flexible drilling pipe or tubing may be used . referring to fig9 a conventional drilling machine 20 has a reel 90 on which coiled steel tubing 92 may be wound as commonly understood by those skilled in the art . the tubing 92 is routed through a tube guide 94 that may be supported by a tube guide support 96 attached to the reel axis 98 . as the tubing 92 is unwound it may be guided through and moved by an injector unit 100 for drilling into the earth . the tubing 92 may have a hydraulic or jet spray drill bit 110 attached thereto . coiled steel tubing 92 may also be used in the drilling machine 20 illustrated in fig1 . the drive mechanism 40 may be modified to facilitate movement of the tubing 92 in a rearward and forward direction by use of an injector unit 100 or a variation thereof . referring to fig1 and 11 , the drive mechanism 40 may be replaced with a reel 90 and appropriate reel support 22 elements as well as fluid connection to the drilling fluid equipment 14 and power source 16 illustrated in fig1 . a tube guide 94 may be structured to guide the tubing 92 from the reel 90 to exit the tube guide 94 at tube aperture 95 coincident with the reel axis 98 . the tube guide 94 may be supported by a guide support arm 102 . the guide support arm 102 and tube guide support 96 may be attached to the reel axis 98 by rotating coupling 104 located with a reel mount 106 . the tubing 92 may be unreeled and moved by drive mechanism or injector unit 100 to drill into the earth . when it is desired to change the drilling direction the tube guide 94 may be rotated by engaging rotating coupling 104 to lock reel 90 and tube guide 94 . rotating the reel 90 may cause the tube guide 94 and tubing 92 to rotate thereby causing the drill string and drill bit 110 to rotate and change the down hole orientation . referring to fig2 through 4 , the drill pipe 60 may be fabricated in lengths for use with rigid steel drill pipe ( not shown ). the drill pipe 60 may then be inserted in a drill pipe string to add flexibility to such drill pipe string . drill pipe 60 may also be used to form larger portions of a drill pipe string for down hole drilling flexibility . while the invention has been particularly shown and described with respect to the illustrated and preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details may be made therein without departing from the spirit and scope of the invention .
| 4Fixed Constructions
|
as explained more fully herein , the preferred embodiment of the fabric of the present invention is formed on a warp - knitting machine which may be of any conventional type of an at least three - bar construction having three or more yarn guide bars and a needle bar , preferably a conventional raschel warp - knitting machine ( although it is also contemplated that the fabric and variations thereof could also be produced utilizing a tricot or like warp - knitting machine ). the construction and operation of such machines are well known in the knitting art and need not herein be specifically described and illustrated . in the following description , the yarn guide bars of the knitting machine are identified as &# 34 ; top ,&# 34 ; &# 34 ; middle ,&# 34 ; and &# 34 ; bottom &# 34 ; guide bars for reference purposes only and not by way of limitation . as those persons skilled in the art will understand , such terms equally identify knitting machines whose guide bars may be referred to as &# 34 ; front ,&# 34 ; &# 34 ; middle ,&# 34 ; and &# 34 ; back &# 34 ; guide bars , which machines of course are not to be excluded from the scope and substance of the present invention . as further used herein , the &# 34 ; bar construction &# 34 ; of a warp - knitting machine refers to the number of yarn guide bars of the machine , while the &# 34 ; bar construction &# 34 ; of a warp - knitted fabric refers to the number of different sets of warp yarns included in the fabric , all as is conventional terminology within the art . as is conventional , the needle bar n of the warp - knitting machine carries a series of aligned knitting needles 15 , while each guide bar i , ii , iii of the machine carries a series of guide eyes 16 , the needle and guide bars of the machine preferably having the same gauge , i . e ., the same number of needles and guide eyes per inch , all as depicted schematically in fig1 . in the accompanying drawings , one particular preferred embodiment of the present warp - knitted fabric of a three - bar construction knitted according to the present invention on a three - bar raschel warp - knitting machine is illustrated . in particular , the fabric is knitted utilizing three sets of warp yarns respectively wound on and delivered from three separate warp beams , with the accompanying drawings of fig2 and 3 depicting the stitch constructions of the three sets of yarns as carried out by the respective lateral traversing movements of the guide bars of the knitting machine according to the preferred embodiment of the fabric utilizing a traditional dot or point diagram format , wherein the individual points 15 represent the needles of the needle bar n of the knitting machine in the formation of several successive fabric courses c across several successive fabric wales w . according to the present invention , a series of guide eyes 16s at the opposite ends of each yarn guide bar i , ii , iii are designated for carrying yarns to be warp knitted into the selvedges of the fabric ( e . g ., a series of 60 successively - adjacent guide eyes 16b at each end of each guide bar ), while the series of guide eyes extending between the two groups of selvedge - forming guide eyes 16s are designated for knitting the main mesh body of the fabric ( e . g ., a series of 600 successively - adjacent guide eyes on each guide bar extending between the two sets of selvedge - forming guide eyes ). one main warp beam 20 carries a series of warp yarns equivalent in number to the number of guide eyes on each guide bar designated for knitting the main fabric body ( e . g ., 600 warp yarns ), with alternating ones of the warp yarns forming a first set of fabric body yarns 26 being threaded through every alternate guide eye 16b &# 39 ; of the middle guide bar ii designated for knitting the main fabric body and the intervening yarns forming a second set of fabric body yarns 28 being threaded through every intervening guide eye 16b &# 34 ; of the bottom yarn guide bar iii designated for knitting the main fabric body . a second warp beam 24 carries a first set of selvedge yarns 32 corresponding in number to the number of guide eyes 16s on the guide bars designated for knitting the fabric selvedges ( e . g ., 120 yarns ), which are delivered to and threaded through every guide eye 16s of the top yarn guide bar i designated for knitting the fabric selvedges . similarly , a third warp beam 22 carries a second set of selvedge yarns 30 of a number twice the number of guide eyes 16s on the guide bars designated for knitting the fabric selvedges , with two such yarns 30 being threaded through each guide eye 16s of the guide bar iii designated for knitting the fabric selvedges . preferably all of the yarns are multifilament synthetic yarns , such as polyester , but may be of differing denier and filament makeup to achieve and enhance the desirable physical characteristics of the fabric . for example , in the preferred embodiment depicted in the drawings , the body yarns 26 , 28 delivered from the warp beam 20 to form the main fabric body are non - textured polyester yarns , commonly referred to in the industry as &# 34 ; flat &# 34 ; yarns , of a relatively high denier , e . g ., 450 denier , and the selvedge yarns 30 , 32 delivered from the two warp beams 22 , 24 are preferably texturized polyester yarns , selected so that the three selvedge yarns 30 , 32 delivered to each selvedge needle 15s on the needle bar n ( i . e ., two selvedge yarns 30 from the warp beam 22 and one selvedge yarn 32 from the warp beam 24 ) collectively have a denier comparable to that of the main body yarns 26 , 28 , e . g ., each selvedge yarn 30 , 32 being a 150 denier , 34 filament textured polyester yarn . of course , those persons skilled in the art will recognize that various other types of yarns may also be employed as necessary or desirable according to the fabric weight , feel and other physical characteristics sought to be achieved . as diagrammatically depicted in fig2 and 3 , the stitch patterns for the body and selvedge yarns 26 , 28 , 30 , 32 as controlled by the three yarn guide bars i , ii , iii form the main fabric body m in an open mesh construction defining diamond - shaped openings 34 and form the selvedges s of a stabilized non - mesh stitch construction of essentially twice the stitch density of the mesh construction of the main fabric body m due to the division of the body yarns in the first warp beam 20 into the two sets of body yarns 26 , 28 whereby the effective needle gauge utilized in the knitting the main fabric body is one - half the needle gauge utilized in knitting the selvedges s . specifically , the middle yarn guide bar ii of the machine manipulates the first set of body yarns 26 to traverse laterally back and forth relative to the alternate body yarn needles 15b &# 39 ; of the needle bar n to stitch the body yarns 26 in a repeating 1 - 0 , 1 - 2 , 2 - 3 , 2 - 1 stitch pattern ( diagrammatically indicated at bar ii of fig2 ) as the yarns 26 are fed progressively from their respective warp beam 20 . simultaneously , the bottom yarn guide bar iii of the knitting machine manipulates the second set of body yarns 28 as they are also fed from the same warp beam 20 to traverse relative to the intervening body yarn needles 15b &# 34 ; of the needle bar n to stitch the body yarns 28 in a repeating mirror image 2 - 3 , 2 - 1 , 1 - 0 , 1 - 2 stitch pattern ( diagrammatically indicated at bar iii of fig2 ). at the same time , the bottom yarn guide bar iii identically manipulates the selvedge yarns 30 to traverse relative to the selvedge needles 15s in the same 2 - 3 , 2 - 1 , 1 - 0 , 1 - 2 repeating stitch pattern as the yarns 30 are fed from their respective warp beam 22 . the selvedge yarns 32 delivered from the warp beam 24 are simultaneously manipulated by the top yarn guide bar i to traverse relative to the selvedge needles 15s in a repeating 0 - 1 , 1 - 0 chain stitch pattern ( as indicated diagrammatically at bar i of fig2 ). as will thus be understood , the body yarns 26 , 28 are inter - knitted with one another in their above - described mirror - image stitch constructions , with each body yarn 26 , 28 being formed from one fabric course c to the next fabric course c in a series of needle loops 26n , 28n and in connecting underlaps 26u , 28u extending between the successive needle loops , whereby the guide bar threading patterns and the respective stitch patterns of the body yarns 26 , 28 dispose one of the needle loops 26n or 28n in every wale w of every course c in the fabric while defining the diamond - shaped mesh openings 34 aligned coursewise , walewise and diagonally throughout the main fabric body m . within the selvedges s , the selvedge yarns 30 are interknitted with one another in the described stitch construction in needle loops 30n and connecting underlaps 30u extending between the successive needle loops 30n , while the selvedge yarns 32 are interknitted with the selvedge yarns 30 in the described chain stitch pattern forming needle loops 32n interknitted in plated relationship with the needle loops 30n of the selvedge yarns 30 in every wale w and in connecting chain stitch underlaps 32u extending between the successive needle loops 32n . in this manner , the chain stitch pattern of the selvedge yarns 32 provides walewise resistance to elongation and distortion within the selvedges s while the coursewise traversing stitch pattern of the selvedge yarns 30 provides coursewise resistance to elongation and distortion within the selvedges s , the selvedge yarns 30 , 32 thereby cooperating with one another to provide a highly - stabilized structure to the selvedges . as such , the selvedges s exhibit a high degree of resistance to curling and tend naturally to lay substantially flat and essentially co - planar with the main fabric body m when the fabric is opened into a flattened full - width condition . in turn , the selvedges s tend to resist any tendency of the immediately - adjacent lateral side margins of the mesh main fabric body m to curl inwardly ( i . e ., normal to the lengthwise extent of the fabric ). thus , the fabric promotes substantially - uniform winding into cylindrical roll form with suppressed tendency of the side edges of the fabric to cause the roll to enlarge at its lateral ends . to best promote these physical characteristics of the fabric , the selvedges s should be of a minimum width sufficient at least to naturally lay substantially flat in an open - width condition of the fabric against any tendency of the side margins of the fabric body to induce curling of the selvedges and most preferably the selvedges should be sufficiently wide to be capable of being held by a gripping means of a tenter frame ( e . g ., tenter frame pins or clamps ) without imparting distortion to the laterally - adjacent portions of the main fabric body m . presently it is contemplated that , depending upon the physical characteristics of the main fabric body m which affect the tendency thereof to curl ( most significantly , the stitch construction of the main fabric body ), each selvedge s should preferably be of a width between approximately one inch and six inches . for example , in the particular preferred embodiment of the fabric depicted in fig1 and 2 , the selvedges are preferably at least four inches in width . advantageously , the curl - resistive characteristics of the present fabric enable the fabric to be much more easily handled and processed subsequent to knitting than the conventional known fabrics described above . specifically , the tendency for the selvedges s of the fabric to lay essentially flat considerably enhances and improves the handleability of the fabric in feeding into a tenter frame for heat setting such that fabrics in accordance with the present invention should be susceptible of being uniformly fed into a tenter frame at significantly higher lineal traveling speeds than is possible with conventional mesh fabrics while tenter frame operators should still be capable of maintaining coursewise and walewise alignment of the mesh openings without introducing bow or bias into the fabric . in experimental processing of the preferred embodiment of the fabric described above , satisfactory results have been achieved ( i . e ., bowing and biasing of the mesh openings were maintained at or below acceptable threshold values ) utilizing only a single pass of the fabric through a tenter frame at a traveling speed in the range of 30 - 40 yards per minute , as contrasted to the conventional process described above utilizing three passes of the fabric through a tenter frame at traveling speeds normally not exceeding 20 yards per minute . as those persons skilled in the art will readily recognize , the time and labor expense as well as the efficiency of processing the present fabric will therefore be substantially improved over the best known results achievable using conventional fabrics . it will therefore be readily understood by those persons skilled in the art that the present invention is susceptible of broad utility and application . many embodiments and adaptations of the present invention other than those herein described , as well as many variations , modifications and equivalent arrangements will be apparent from or reasonably suggested by the present invention and the foregoing description thereof , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to its preferred embodiment , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for purposes of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended or to be construed to limit the present invention or otherwise to exclude any such other embodiments , adaptations , variations , modifications and equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof .
| 3Textiles; Paper
|
embodiments of the invention relate to a supporting apparatus with a supporting device that may be easily adjusted to allow for variation in a position of a supported keyboard ( or other type of electronic device ). specifically , the supporting device may include multiple pairs of panels — one pair being provided near a front of the supporting device , and another pair being provided near a back of the supporting device . with regard to each pair , the panels of the pair may be coupled to each other at a pivot line ( e . g ., via a hinge ). a front edge of one panel and a back edge of an adjacent panel may be configured to slide along rails along a length of the supporting device . as then one panel &# 39 ; s front edge is slid close to the adjacent panel &# 39 ; s back edge , the pivot line may move further from the rails , thereby affecting a height of the supporting device at the pivot line . a keyboard positioned on the supporting apparatus may thus be tilted forwards when the back pair of panels are compressed ( raising a back portion of the supporting device ) or tilted backwards when the front pair of panels are compressed ( raising a front portion of the supporting device ). fig1 a - 1c show a supporting apparatus comprising a frame 250 , and supporting device 100 engaged and exposed by the frame 250 . as shown , the keyboard - supporting device 100 includes a plurality ( e . g ., five ) of interconnected panels 105 , 110 , 115 , 120 and 125 . panels 105 , 110 , 115 , 120 and 125 can each be substantially flat and substantially rectangular in shape . they can be made of any suitable material including a plastic material . in this embodiment , panel 125 is a central third panel and is larger ( e . g ., twice as wide ) than outer panels 105 , 110 , 115 , 120 . in some instances , a width ( i . e ., characterizing a dimension of the panel along the axis 150 ) of each of one or more of panels 105 , 110 , 115 and 120 is between ¼ inch and 2 inches . in some instances , a width of panel 125 is between 1 inch and 6 inches . adjacent panels in the plurality of panels can be coupled together via a rotation - enabling component , such as a hinge . fig1 a shows an instance in which all five panels are flat along a base plane . however , the panels may be compressed in an accordion style along a length - wise axis 150 . specifically , part or all of one or more panels may engage with a rail system associated with frame 250 , to thereby prevent one or more vertically fixed edges from changing in heights relative to the base plane . for example , engagement of the first panel 125 with a rail system may prevent edge 110 b from moving perpendicular to the base plane . these rail - locked edges may then move along axis 150 ( e . g ., via movement along the rails ). further , one or more panels may each include a vertically non - fixed edge . heights of these vertically non - fixed edges may depend on locations of the vertically fixed edges along axis 150 relative to positions of other vertically fixed edges . each panel may be coupled to one or more adjacent panels , e . g ., as shown in fig1 a - 1c . the panel may be able to pivot relative to one or more adjacent panels , such that , e . g ., a surface of the panel is not in a same plane ( and / or , in some instances , parallel to ) a surface of the one or more adjacent panels . a panel may be coupled to an adjacent panel using a hinge or another pivoting component . for example , each of the panel and the adjacent panel may include or be coupled to a rigid edge . the rigid edges may be coupled by a flexible coupling component , such as a piece of fabric . in fig1 a , supporting device 100 includes a first pair of panels : front first panel 105 and back second panel 110 . front first panel 105 includes a front edge 105 a and a back edge 105 b . back second panel 110 includes a front edge 110 a and a parallel back edge 110 b . front edge 105 a and back edge 110 b are vertically fixed ( due to direct or indirect engagement with an underlying rail system ). back edge 105 b and front edge 110 a are also vertically fixed . back edge 110 b may be moved close to front edge 105 a , thereby causing the front pair of panels to move from the flat positions shown in fig1 a to a pointed position shown in fig1 b , away from the underlying keyboard 200 . conversely , a second pair of fourth and fifth panels 115 and 120 may be compressed to cause these back panels to move from the flat positions shown in fig1 a to a pointed position shown in fig1 c , away from underlying keyboard 200 . as shown in fig1 a , 1 b , and 1 c , supporting device 100 can be completely flat within frame 150 , one end of the supporting device 100 can form a v - shaped protrusion , and the other end of the supporting device 100 can form a v - shaped protrusion . as described in further detail below , a default state of supporting device 100 may be to lock a length - wise position of the rail - locked edges . however , a user may be able to temporarily unlock the edges ( e . g ., by pressing buttons 160 ) to move the edges to a desired position . fig2 a - 2c show the supporting apparatus coupled to a keyboard 200 . as shown in fig2 a , keyboard 200 may include a cavity 205 sized to receive supporting device 100 . for example , the cavity may have a length and width approximately the same as or slightly larger than a respective length and width of supporting device 100 . in some instances , a depth of cavity 205 is approximately the same as a depth of supporting device 100 . as noted above , the supporting apparatus may comprise a restraining unit configured to engage the series of connected panels such that at least one edge of each of four or more panels of the series of connected panels is restricted to movement within a base plane 265 . the base plane 265 may be the plane along which the panels lie while the supporting device is completely flat ( e . g ., as in fig1 a ). the restraining unit may take the form of a frame 250 in some embodiments . frame 250 may lock supporting device 100 to keyboard 200 . for example , after supporting device 100 is positioned within cavity 205 of keyboard 200 , frame 250 may be positioned over supporting device 100 . screws or tabs 260 may then be inserted through apertures of frame 250 to engage keyboard 200 . in some instances , supporting device 100 and / or frame 250 are provided separately from an electronic device . a user may then lock supporting device 100 to an electronic device ( e . g ., keyboard 200 ). such embodiments may allow a user freedom to enjoy tilt flexibility provided by supporting device 100 while simultaneously enjoying the freedom of choosing his preferred electronic device . in some instances , supporting device 100 is provided with an electronic device . for example , supporting device may be fixedly attached to the electronic device and / or attached to the electronic device at a time of sale . frame 260 may be ( e . g ., permanently ) contiguous with and / or adhered to the electronic device . as shown in fig2 b , panel edges of supporting device 100 may remain free to move along the length - wise axis of the supporting device ( so long as the supporting device is not in a locked state ). in this instance , movement of third panel 125 towards a back of the supporting device may cause fourth and fifth panels 115 and 120 to compress and form an apex or point . as shown in fig2 c , the apex formed by fourth and fifth panels 115 and 120 may cause a back of keyboard 200 to be raised relative to a front of keyboard 200 . in some embodiments , the described movement of the panels may be performed even while a keyboard is positioned over the supporting device — without requiring that the combined device - keyboard system be turned upside down . for example , a user may be able to easily ( e . g ., and blindly ) locate buttons 160 ( see fig3 ) to unlock the supporting device and then slide the panels along axis 150 . pushing buttons 160 may cause supporting device 100 to switch from a locked state ( where length - wise position of the rail - locked edges are fixed ) to an unlocked state ( where the rail - locked edges can move along the length - wise axis 150 ). in some instances , supporting device 100 remains in the unlocked state while , and only while , button 160 are pushed . as shown in fig2 b , panels may be configured to have contact - improving or stability - improving features . for example , a hole 280 may be formed between panels 115 and 120 . thus , two feet 285 a and 285 b will contact an underlying surface rather than an extended edge . in this embodiment , a height of a front or back apex may be finely controlled merely by moving third panel 125 towards a front or back of supporting device 100 . a component of the supporting device or the frame may fix or restrain length - wise motion of an extreme edge ( e . g ., edge 105 a ). thus , a movement of a single piece along a single axis allows the user to have a large degree of control over a tilt of a keyboard supported by the supporting device . though not shown , other variations are contemplated . in one embodiment , fewer panels ( e . g ., three ) may be included ( e . g ., panels 115 , 120 and 125 ). movement of third panel 125 would then allow a height of a single back apex to be adjusted . flipping supporting device 100 prior to attachment of frame 250 may allow a user the ability to still achieve a positive or negative flip . in one embodiment , no third panel 125 is included . in one embodiment , more than five panels are included . fig3 shows a position - locking component 300 according to embodiments of the invention . position - locking component 300 may include a spring arm that may be positioned on and / or coupled to a panel , such as third panel 125 . position - locking component 300 may include a user - operating feature such as a button 160 . upon activation of the feature ( e . g ., pressing of the button ), position - locking component 300 may move from a default locked state to an unlocked state . in the unlocked state , an associated panel ( e . g ., third panel 125 ) may be free to move lengthwise . when the feature is activated , teeth 310 may move inwards towards button 160 . the teeth may then be free to move through a rail guide . when the feature is released from activation , teeth 310 may move outwards away from the button and engage complementary mating teeth present along an outer edge of a rail guide . close spacing of the teeth 310 may allow a user to finely control a position of panel 125 and thus , a tilt of a keyboard supported by supporting device 100 . in one embodiment , teeth 310 are sized and spaced to allow for a user to control a tilt of a supported keyboard with precision of greater than about 5 ° or 1 °. fig4 shows a cross section of frame 250 . frame 250 may include a keyboard - receiving feature 405 . for example , keyboard receiving feature 405 may include a track configured to wrap around a portion or edge of the keyboard 100 . frame 250 may further include a rail guide 410 . rail guide 410 may be configured to allow underlying panels to move in a length - wise direction and may be configured to restrain vertical movement of engaged panel edges . rail guide 410 may further include a locking feature , such as mating teeth that only allows length - wise movement of panels when the locking feature is disengaged . for example , rail guide 410 may include mating teeth along an outer edge 410 a of the guide . the above description is illustrative and is not restrictive . many variations of the invention will become apparent to those skilled in the art upon review of the disclosure . the scope of the invention should , therefore , be determined not with reference to the above description , but instead should be determined with reference to the pending claims along with their full scope or equivalents . one or more features from any embodiment may be combined with one or more features of any other embodiment without departing from the scope of the invention . where approximate or “ about ” is described for measurements , embodiments herein also contemplate the exact measurement . where a shape is disclosed , such as a cylinder , embodiments herein contemplate other suitable shapes , such as multi - sided blocks ( octagonal structures , decagonal structures , etc . ), other rectangular structures , etc . in certain implementations , structures with multiple sides approaching the shape of cylinders , as well as substantially cylindrical shapes ( e . g ., a cylinder with a flat sidewall portion ) may be considered cylinders as described herein , unless otherwise specified .
| 6Physics
|
fig1 illustrates a breakaway view of a blood filter assembly 8 of the present invention . the blood filter assembly 8 comprises a disposable blood filter 10 and a motor drive 26 . the disposable blood filter 10 comprises a shell 12 , an impeller 14 , a blood outlet port 16 , a gas outlet or central port 18 , a blood inlet port 20 , an optional baffle 22 , and a bearing shaft 24 . the optional baffle 22 optionally comprises a plurality of vent holes 28 . the impeller 14 comprises a magnetic coupler 30 . the shell 12 optionally comprises a plurality of lock down tabs 46 , a gas trap 57 and a bleed valve 58 . the motor drive 26 comprises a motor 32 , a power cable 34 , a power switch 36 , a central shaft 38 , a magnetic driver 40 , a housing 42 , and a plurality of optional lock - down or clamping mechanisms 44 to hold the disposable blood filter shell 12 to the motor drive housing 42 . the motor drive 26 optionally comprises a power - on lamp 48 , an extension arm 54 , and a pole clamp 50 . the optional pole clamp 50 further comprises a setscrew 52 . the shell 12 of the disposable blood filter 10 is an axially elongate cylinder or vessel , most preferably disposed with its axis parallel to the direction of gravity . the top of the shell 12 is , preferably , conical . the gas outlet port 18 is preferably disposed along the central axis at either the top or the bottom of the shell 12 . the blood inlet port 20 and the blood outlet port 16 are , preferably located on the periphery of the shell 12 . the blood inlet port 20 may be located lower or higher on the periphery of the shell 12 than the blood outlet port 16 but the gas outlet port 18 , otherwise known as a gas vent , is most preferably located higher than the blood inlet port 20 and the blood outlet port 16 . the gas outlet port 18 is located at the entrance of the gas trap 57 and the bleed valve 58 is located at or near the highest point of the gas trap 57 . the gas outlet port 18 , in another embodiment , is located at the center of the bottom of the blood filter . the gas and blood , which is removed from either gas outlet port 18 is routed back to the venous reservoir of the cardiopulmonary bypass system thus minimizing blood loss during the surgical procedure . the bottom - mounted gas outlet port 18 may be able to take advantage of fluid patterns generated within the shell 12 to enhance separation of gas from the blood . the diameter of the blood inlet port 20 and the blood outlet port 16 is generally 1 . 2 cm and ranges from 0 . 2 cm to 3 . 0 cm . the diameter of the gas outlet port 18 is from 0 . 1 cm to 2 . 0 cm . the diameter of the shell 12 is generally from 1 cm to 30 cm , more preferably from 3 cm to 15 cm and most preferably 5 to 10 cm . the length of the shell 12 ranges from 2 cm to 30 cm . smaller lengths and diameters of the shell 12 are preferable because the priming volume of the disposable blood filter 10 is minimized with minimized dimensions and a small priming volume reduces patient blood lost during a bypass procedure . the baffle 22 is a cylindrical structure located inside the conical top of the disposable filter 10 under the gas outlet port 18 . the series of vent holes 28 perforate the circumferential periphery of the baffle 22 . the diameter of the baffle 22 is optimized to shunt the blood with gas bubbles away from the blood outlet port 16 . the length of the baffle 22 is generally such that the lowermost portion of the baffle 22 is at or below the height of the blood outlet port 16 . the maximum radius of the baffle 22 is equal to or less than the distance from the innermost extent of the blood outlet port 16 from the center of the shell 12 . the gas outlet port 18 directs gas out of the disposable blood filter 10 and into the gas trap 57 where the small gas bubbles coalesce into macroscopic amounts of gas that is then bled off through the bleed valve 58 . the gas trap 57 is , preferably , transparent so that the clinician may monitor the buildup of macroscopic amounts of gas within the gas trap . the bleed valve 58 is either a manual valve , such as a stopcock , or it is an automatic valve that opens when a pre - determined amount of gas builds up within the gas trap 57 . the blood and foam collected in the gas trap 57 are preferably returned to a reservoir for recombination with the rest of the blood in the extracorporeal circulation . the bearing shaft 24 holds the impeller 14 at the center of the bottom inside surface of the shell 12 , which is along the central axis of the disposable filter 10 . the impeller 14 rotates freely around the bearing shaft 24 . the impeller 14 may be designed as a simple axially elongate stirring bar with its axis perpendicular to the axis of the shell 12 , like that used by laboratory stirrers . preferably , the impeller 14 is an axially elongate structure with its axis parallel to that of the shell 12 and a plurality of vanes that engage the blood and force the blood to spin . more preferably , the impeller 14 is a smooth axially elongate cylinder , cone , or other axially elongate shape that rotates and causes the blood to rotate by viscous effects . such a smooth cylinder is known in the art to move the blood gently , through shear effects , causing minimal damage to blood components such as red cells and leucocytes . in this embodiment , the impeller 14 contains the magnetic coupler 30 . the magnetic coupler 30 is preferably a permanent magnet with a north and a south pole which are disposed at diametrically opposed positions on the impeller 14 and distributed so that the center of mass and the center of force is aligned with the rotational central axis of the impeller 14 . typical permanent magnet materials include , but are not limited to , samarium cobalt , neodymium iron boron , ceramics , and the like . a coupling magnet on a drive unit will be similarly configured and will attract opposing polarities on the magnetic coupler 30 in the impeller 14 . the magnetic coupler 30 is in one embodiment , embedded and enclosed within the impeller 14 . typical methods of embedding the magnetic coupler 30 include injection molding , insert molding , machining the cavity and inserting the magnetic coupler 30 followed by gluing or bonding a cap over the magnetic coupler 30 . the impeller 14 with the magnetic coupler 30 is preferably balanced carefully so that the impeller 14 does not vibrate or wobble when it spins . the lockdown tabs 46 are located around the bottom outside edge of the cylindrical shell 12 of the disposable filter . correspondingly , the motor drive 26 has lockdown or clamping mechanisms 44 located around the top outside edge of the cylindrical housing 42 . the lockdown tabs 46 mate with the lockdown mechanisms 44 and when the lockdown mechanisms 44 are in the locked position , the disposable filter 10 is attached to the motor drive 26 . in order to allow for disposability of the blood handling components , the lock - down or clamping mechanisms 44 permit reversible fastening of the blood filter shell 12 to the motor drive 26 . this is important since cross - contamination of patients &# 39 ; blood must be prevented in order to control the spread of infectious diseases . the motor drive 26 may be reusable . in this embodiment , the clamping mechanism 44 is a set of latches that grasp protrusions 46 on shell 12 and hold it to the housing 42 of the motor drive 26 . in other embodiments , the clamping mechanism 44 may also be a bayonet mount , spring - loaded catch , magnetic latch or other fastening mechanism . the motor 32 of the motor drive 26 is affixed to the housing 42 . the central shaft 38 is affixed to , and protrudes from , the rotating armature of the motor 32 . the motor drive 26 most preferably uses an electric motor 32 powered by a 6 to 24 volt direct current ( dc ) power supply . such dc power supplies comprise batteries or electronics to convert alternating current electricity to direct current . the motor 32 could also be designed to use standard 110 vac to 220 vac . a direct current power source is preferable to an alternating current power source because patient and hospital staff protection is maximized with the dc system . the motor 32 is powered through the power cable 34 . the power switch 36 and the power on light 48 are physically affixed to the housing 42 and electrically connected to the power line 34 . the power on light 48 turns on only when the motor 32 is electrically energized by activating the power switch 36 . the electric motor 32 spins at a pre - determined constant speed . the central shaft 38 rotates from 100 to 10 , 000 rpm and most preferably from 500 to 5 , 000 rpm . alternative embodiments of the motor 32 include , but are not limited to , compressed air or hydraulically driven motors . in this embodiment , the magnetic driver 40 is affixed to the shaft 38 and rotates with the shaft 38 . the magnetic driver 40 is located near the perimeter of the housing 42 so that when the disposable blood filter 10 is positioned against the motor drive 26 , the magnetic driver 40 is magnetically engaged to the magnetic coupler 30 that is affixed to the impeller 14 of the disposable blood filter 10 . the motor 32 spins the shaft 38 and the magnetic driver 40 . the magnetic driver 40 has a magnetic field that acts through the housing 42 of the motor drive 26 and through the shell 12 of the disposable blood filter 10 . the magnetic field interacts with the magnetic coupler 30 in the impeller 14 and causes the impeller 14 to rotate at the same rate as that of the motor 32 . the magnetic driver 40 is preferably a bar magnet that spins about its central region with north and south poles diametrically opposed and equidistant from the center of rotation . the magnetic driver 40 and magnetic coupler 30 may both be permanent magnets . alternatively , at least one of either the magnetic driver 40 or the magnetic coupler 30 may be permanent magnets with the other being a material that is magnetically attracted to a magnet . in another embodiment , the magnetic coupler 30 or the magnetic driver 40 may be electromagnets energized by batteries or by another type of electrical power supply . typical permanent magnets are fabricated from materials such as , but not limited to , neodymium iron boron , iron , ceramics , samarium cobalt and the like . materials that are magnetically attracted to a magnet include , but are not limited to , iron or metallic alloys of iron . the magnetic coupler 30 is desirable because it allows for a sealed disposable blood filter 10 to be attached to the reusable motor drive 26 . in an alternate embodiment , a direct coupling between the central shaft 38 and the impeller 14 may be made using interlocking fingers on the impeller 14 that mate with the shaft 38 through a rotary seal . attachment of the blood filter assembly 8 to a cardiopulmonary bypass system is accomplished using the optional pole clamp 50 . the pole clamp 50 is connected to the housing 42 of the motor drive 26 by the arm 54 and is secured to a pole by the setscrew 52 . by attaching the reusable motor drive 26 of the blood filter assembly 8 to a pole or other part of a pump console in the cardiopulmonary bypass system , interchange of the disposable blood filter 10 is more easily accomplished . typical materials from which the disposable blood filter shell 12 and baffle 22 are fabricated include polycarbonate , polypropylene , polyethylene , polystyrene , polyvinyl chloride , fluorinated ethylene polymer ( fep ), poly tetrafluoroethylene ( ptfe ), polysulfone , and the like . these same materials are used to fabricate the housing 42 of the motor drive 26 , although metals such as aluminum , stainless steel and the like would also work . optionally , the interior of the shell 12 of the disposable blood filter 10 may be treated with an antithrombogenic material such as heparin and a bonding agent . the impeller 14 is made from materials that include polycarbonate , polypropylene , polyethylene , polystyrene , polyvinyl chloride , fluorinated ethylene polymer ( fep ), polysulfone , poly tetrafluoroethylene ( ptfe ), and the like . fig2 a shows a breakaway view of the shell 12 of the disposable blood filter 10 , which comprises the blood inlet port 20 and the impeller 14 . the impeller 14 further comprises the bearing shaft 24 , the magnetic coupler 30 and a plurality of vanes 15 . referring to fig2 a , the vanes 15 are affixed to , or are integral to , the impeller 14 and appear as fins , rotors or propeller blades . the magnetic coupler 30 is embedded within or affixed to the impeller 14 . the vanes 15 are rotated by the impeller 14 , which in turn , is rotated by the magnetic coupler 30 around the bearing shaft 24 . the blood enters the shell 12 through the blood inlet port 20 and is rotated by the vanes 15 on the impeller 14 . fig2 b shows a top cross - sectional view of the shell 12 of the disposable blood filter 10 . in this embodiment , the impeller 14 has four vanes 15 . any number of vanes 15 from one to 50 may be employed in the impeller 14 . the length and diameter of the vanes 15 are roughly equal to the overall length and diameter of the impeller 14 . fig3 a shows an exterior view of the blood filter assembly 8 , comprising the disposable blood filter 10 and the motor drive 26 , viewing along the axis of the blood inlet port 20 and blood outlet port 16 . also shown in fig3 a are the gas outlet port 18 , the gas trap 57 , the bleed valve 58 , the lock - down mechanisms 44 , and the lock - down tabs 46 on the shell 12 . fig3 b shows an exterior view of the blood filter assembly 8 , comprising the disposable blood filter 10 and the motor drive 26 , viewing perpendicular to the axis of the blood inlet port 20 and the blood outlet port 16 . also shown in fig3 b are the gas outlet port 18 , the gas trap 57 , the bleed valve 58 , the lock - down mechanisms 44 , and the lock - down tabs 46 on the shell 12 . fig3 a and 3b clearly show the tangential disposition of the blood inlet port 20 and the optional tangential disposition of the blood outlet port 16 . the blood inlet port 20 is disposed so that blood enters the disposable filter 10 in a direction tangential to the shell 12 to assist with generation of a rotational fluid field within the shell 12 . fig4 shows a schematic diagram of a typical cardiopulmonary bypass circuit 60 comprising the blood filter assembly 8 of the present invention . the cardiopulmonary bypass circuit 60 further comprises a patient 62 , a venous drainage cannula 64 , a venous reservoir 66 , a circulatory assist pump 68 , a heat exchanger 70 , an oxygenator 72 , an optional gas pump 74 , a gas bleed line 76 , a particulate filter 78 , and an arterial inlet cannula 80 . the venous circuit of the patient 62 is connected to a blood inlet of the venous reservoir 66 through the venous drainage cannula 64 . an outlet of the venous reservoir 66 connects to an inlet of the circulatory assist pump 68 and an outlet of the circulatory assist pump 68 connects to an inlet of the heat exchanger 70 . an outlet of the heat exchanger 70 connects to an inlet of the oxygenator 72 and an outlet of the oxygenator 72 connects to the blood inlet port 20 of the blood filter assembly 8 . the gas outlet port 18 of the blood filter assembly 8 connects , by way of the gas trap 57 and bleed valve 58 , to an inlet of the gas pump 74 . an outlet of the gas pump 74 connects to an inlet of the venous reservoir 66 through the gas bleed line 76 . the blood outlet port 16 of the blood filter assembly 8 connects to an inlet of the particulate filter 78 . an outlet of the particulate filter 78 connects to the patient 62 through the arterial inlet cannula 80 . in yet another embodiment , the disposable blood filter assembly 10 is integrated into the venous reservoir 66 to minimize the need for additional priming volume . since the venous reservoir 66 holds between 10 cc and 1000 cc of blood , the disposable blood filter 10 may be affixed thereto or integrated therein so that the internal volume of the disposable blood filter 10 does not add significantly to the priming volume of the cardiopulmonary bypass circuitry . in this embodiment , the drive unit or motor drive 26 for the filter 10 attaches to a component of the venous reservoir 66 to rotate the impeller 14 of the blood filter 10 . typically , during cardiopulmonary bypass , venous blood is removed from the patient 62 by the venous drainage cannula 64 and is collected , generally by gravity feed , in venous reservoir 66 where it is de - foamed using standard technology such as de - foaming sponges and bonded surfactants . the venous reservoir 66 generally comprises a blood - air interface and blood entering the reservoir entrains air and other gasses into the blood . in addition , a suction line , used to remove blood from the operative field , returns air and blood to the venous reservoir 66 . the de - foaming devices in the venous reservoir 66 are incapable of removing micro - bubbles or small gas bubbles that have become entrained in the blood , thus the need for a blood filter . the blood is pumped from the venous reservoir 66 and through the rest of the cardiopulmonary bypass circuit 60 by the circulatory assist pump 68 . the blood passes through the heat exchanger 70 where it is cooled for the majority of the procedure to reduce the metabolic requirements of the patient 62 . typical hypothermia temperatures range from 28 to 35 degrees centigrade . toward the end of the procedure , the heat exchanger 70 is used to warm the blood to normothermia , approximately 37 degrees centigrade . the blood is next pumped through the oxygenator 72 where it is oxygenated and cleared of carbon dioxide . from the oxygenator 72 , the blood is pumped to the blood filter assembly 8 . referring to fig1 , 3 a , 3 b , and 4 the blood filter assembly 8 of the present invention is designed to move gas bubbles present in the blood toward the center of the shell 12 so that blood may flow from the outside of the shell 12 through the blood outlet port 16 , free of these bubbles . the blood enters the blood filter assembly 8 through the blood inlet port 20 . preferably , the blood inlet port 20 is positioned tangential to the shell 12 of the disposable filter 10 . the rotating impeller 14 pushes the blood and causes the blood to rotate . tangential entry of the blood into the disposable filter 10 imparts a rotational velocity to the blood , thus requiring less shear stress on the blood for the motor 32 to turn the impeller 14 and rotationally accelerate the blood to the required velocity . the gas bubbles , many as small or smaller than 10 to 25 microns in diameter , need to be moved to the center of the disposable blood filter 10 in the time it takes for the blood to make a single pass through the filter 10 . by way of example , a typical blood flow rate through the cardiopulmonary bypass circuit 60 is approximately 5 liters per minute . a typical diameter for the blood filter 10 is 7 . 5 centimeters . with a 10 - centimeter height , the blood filter will have a priming volume of about 440 cubic centimeters . that means blood will dwell within the blood filter 10 for about 5 seconds . the gas bubbles , therefore , have about 5 seconds to move radially inward to within the diameter of the baffle 22 and , thus , be separated from the blood that flows through the blood outlet port 16 . rotational rates specified for this blood filter assembly 8 are sufficient to move bubbles as small as 7 to 10 microns to the center of the blood filter 10 within 5 seconds by means of centrifugal force . buoyancy causes the gas bubbles to rise , relative to gravitational attraction , and pass out of the gas outlet port 18 and into the gas trap 57 , although the gas removal may be augmented by an optional external pump 74 , powered by electricity , for example . gas and some blood , removed from the gas outlet port 18 of the disposable blood filter 8 are collected in the gas trap 57 and pumped back into the venous reservoir 66 by optional gas pump 74 through the gas bleed line 76 where the blood component can be reclaimed . the optional gas pump 74 is a continuously operating pump . optionally , gas pump 74 is a demand pump and pumps only when the volume of gas collects in sufficient quantity to warrant return to the venous reservoir 66 . this may be accomplished using a fluid level sensor mounted in the blood filter assembly 8 or gas bleed line 76 that controllably turns power to the gas pump 74 on and off . the bleed valve 58 is optional and not necessary if the gas pump 74 is used . referring again to fig4 , the blood is pumped from the blood filter assembly 8 through the blood outlet port 16 to the particulate filter 78 . the particulate filter 78 may be integral to the blood outlet port 16 . the particulate filter 78 filters solid debris and particulates , generally larger than 25 microns , using screens or filter meshes . the oxygenated blood is cleared of most particulates greater than 25 microns and most gas bubbles greater than 7 to 10 microns when it is returned to the patient 62 via the arterial inlet cannula 80 . fig5 shows another embodiment of the disposable blood filter 10 wherein the impeller 14 is an axially elongate , smooth shape without any vanes or protrusions . this type of impeller 14 uses viscosity to create shear forces that cause the blood to spin . referring to fig1 and 5 , the impeller 14 is driven through the magnetic coupler 30 that is adapted to interact with the magnetic driver 40 . the preferred shape of the impeller 14 is conical and helps reduce the priming volume of the system . the blood inlet port 20 , the blood outlet port 16 , and the gas outlet port 18 are disposed in the same configuration as that shown in fig1 . fig6 shows yet another embodiment of the disposable blood filter 10 wherein the impeller 14 is an axially elongate perforated structure such as a cylinder or cone . the impeller 14 , in this embodiment , comprises a filter mesh wall 56 . the filter mesh wall 56 is made from a mesh material or screen to provide particulate filtering for the blood that eliminates the need for a secondary particulate filter . the mesh material or screen has a maximum pore size of 25 to 35 microns to limit the size of particulates that can pass through the mesh wall 56 . the blood outlet port 16 is disposed tangential to the shell 12 of the disposable blood filter 10 . however , the blood inlet port 20 is disposed along the central axis of the disposable blood filter 10 . the blood inlet port 20 , optionally , rotates with the impeller 14 to pre - rotate the blood as it enters the filter system and to reduce shear forces acting on the blood at the center of the disposable blood filter 10 . the blood enters the filter 10 inside the impeller 14 . the gas outlet port 18 is disposed coaxially around the blood inlet port 20 to allow for gas entrapment and removal . the blood outlet port 16 is disposed outside the filter mesh wall 56 of impeller 14 and blood must pass through the filter mesh walls 56 to reach the blood outlet port 16 . in another embodiment , the blood is spun by magnets that directly interact with the ionic potential of the blood . this embodiment requires multiple high output electromagnets that are disposed circumferentially around the perimeter of the disposable blood filter 10 . these electromagnets are fired sequentially to form a rotational magnetic field on the blood . a central magnet or a plurality of central magnets is disposed on the core of the disposable blood filter 10 and serves as the alternative pole for the magnets disposed circumferentially around the filter . the blood inlet port 20 and blood outlet port 16 are disposed tangential to the shell 12 of the disposable blood filter 10 . the gas outlet port 18 is disposed as close to the axis of the disposable blood filter 10 as possible , given the central magnet structure , at its highest point . in another embodiment of this device , the blood filter assembly 8 also serves as a primary pump in a cardiopulmonary bypass circuit since centrifugal type pumps are regularly used in a large number of clinical cases . centrifugal pumps are considered less damaging to the blood than their less - expensive roller - pump alternatives . in yet another embodiment , the blood filter assembly 8 can be used as a hemoconcentrator . a one - pass hemoconcentrator is useful in separating non - cellular fluids from the cells in the blood at the end of the bypass procedure . the rotational rates of the hemoconcentrator of the current invention will enable such separation of cells . the blood cells are forced to the perimeter of the shell 12 of the disposable blood filter 8 where they are drawn off through the blood outlet port 16 . non - cellular materials , such as plasma , migrate to the center of the filter where the non - cellular materials are drawn out through the central port 18 . rotational spin rates of 1 , 000 to 20 , 000 rpm , and more preferably 5 , 000 to 10 , 000 rpm , are required to cause adequate centrifugation effects to separate the cellular components from the non - cellular components in a device of 5 to 15 cm diameter . in a further embodiment , a pressure less than the ambient pressure within the cardiopulmonary bypass circuit 60 is applied to the interior of the disposable blood filter shell 12 . the pressure within the cardiopulmonary bypass circuit 60 is , generally , within the range of 0 to 200 mm hg . by locally reducing the pressure within the blood filter shell 12 , the bubble size will be increased and the efficiency of the bubble separation will be likewise increased . the internal pressure within the disposable blood filter 12 is reduced by adding a pump to forcefully remove blood from the interior of the shell 12 through either the blood outlet port 16 or the gas outlet port 18 . additionally , an optional restriction , or narrowing of the channel , is added to the blood inlet port 20 . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is therefore indicated by the appended claims rather than the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope .
| 1Performing Operations; Transporting
|
in the following description of the invention , like numerals and characters designate like elements throughout the figures of the drawings . referring generally to the drawings and more particularly to fig1 and 2 , a two chest pocket t - shirt 10 according to applicant &# 39 ; s invention has a front 12 , a back 14 , a left sleeve 16 , a right sleeve 18 , a neck opening 20 , a front chest portion 22 , a left chest pocket 24 , a right chest pocket 26 , and a neck band 28 . the front 12 , the back 14 , the sleeves 16 , and the neckband 28 are sewn together by well - known and traditional sewing techniques . the pockets 24 , 26 are assembled separately and attached to the chest portion 22 of the front 12 , in the style of an applique , for the reasons explained in detail hereinafter . referring now to fig3 , shown therein are the steps required to fabricate the pockets 24 , 26 . it will be understood by one skilled in the art that the left pocket 24 and the right pocket 26 are of identical construction and interchangeable . a pocket piece 30 is folded along a center line 32 as shown in fig3 , steps 1 - 3 and sewn , right sides together , in seams ( not shown ) adjacent edges 34 , 36 to create a double - walled pocket panel 38 having an open end 40 . it will be understood by one skilled in the art that the double - walled pocket panel can also be created by sewing on three sides , rights sides together , two separate identical pieces of fabric . still referring to fig3 , the edge portions 42 , 44 of the double - walled pocket panel 38 are folded over as illustrated in step 3 to create reinforced edge portions 46 , 48 ( see fig3 , steps 7 - 9 ). the reinforced edge portions 46 , 48 consist of 4 layers of pocket piece 30 fabric , i . e ., double - walled edge portions 42 , 44 folded each on itself . still referring to fig3 , steps 4 - 8 , a pocket top piece 50 has opposing long edges 52 , 54 and opposing short edges 56 , 58 . one short edge 54 is folded under to create a double thickness portion 60 . the remaining pocket top piece 50 is oriented in an inverted u - shape as shown in step 5 and placed over the open end 40 of the double - walled pocket panel 38 . end portions 62 , 64 of the pocket top piece 50 extend outwardly beyond the reinforced edge portions 46 , 48 , respectively , of the double - walled pocket panel 38 . in step 8 , the end portions 62 , 64 are folded around the reinforced edge portions 46 , 48 adjacent the open end 40 of the double - walled pocket panel 38 to form the pocket 24 / 26 shown in fig3 , step 9 , and double - stitched in place along double - stitching lines 66 . the double - walled pocket panel 38 is sewn to the chest portion 22 of the front 12 using double - stitching lines 68 , 70 , 72 along the reinforced edge portions 46 , 48 and adjacent the center line fold 32 , all as shown in step 9 . referring again to fig1 - 3 , it will be understood by one skilled in the art that the sleeve 16 , the sleeve 18 , the front 12 , and the back 14 are hemmed to complete the process of making the two chest pocket t - shirt 10 . although the two chest pocket t - shirt 10 according to applicant &# 39 ; s invention can be made of any typical t - shirt fabric , a ribbed polyester - cotton blend is preferred . the ribbed polyester - cotton blend stretches slightly to accommodate the weight and volume of items placed in the chest pockets but returns to its normal shape when the pocket contents are removed . optionally , the neckband 28 can be made from the same ribbed polyester - cotton fabric , thereby increasing durability . referring now to fig4 , applicant &# 39 ; s two chest pocket t - shirt 10 , partially cut away , has bulges 76 in the pocket 24 / 26 caused by pocket contents . the double - walled pocket panel 38 stretches to accommodate the pocket contents , including a pen p . yet the open edge 78 of the pocket 24 / 26 resists stretching , thereby reducing the likelihood of loss of pocket contents , as a result of the attachment of the pocket top piece 50 . in fig5 , a greatly enlarged detail shows the ribbed polyester - cotton fabric 80 , a portion of the pocket top piece 50 , and the double - stitching lines 66 across the top of the pocket 24 / 26 . referring now to fig6 - 7 , another two chest pocket t - shirt 110 according to applicant &# 39 ; s invention has a chest pocket 124 / 126 . instead of a pocket top piece 50 , as shown in fig1 - 5 , a lightweight elastic piece 82 across the top 84 of the chest pocket 124 / 126 helps to keep the chest pocket 124 / 126 closed to prevent loss of pocket contents . the foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application , to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents .
| 0Human Necessities
|
fig1 is a flowchart illustrating the method for suppressing impulse noise according to an exemplary embodiment of the present invention . referring to fig1 , the method for suppressing impulse noise includes two phases , i . e . the first phase s 110 and the second phase s 120 . fig2 a is a block diagram of a device 200 for suppressing impulse noise according to the method illustrated in fig1 . device 200 includes a first phase detecting and suppressing device 210 corresponding to the first phase s 110 , a second phase detecting and suppressing device 220 corresponding to the second phase s 120 , and other input / output or control signals . in addition , fig2 b is a diagram illustrating the first phase s 110 ( or the first phase detecting and suppressing device 210 in fig2 a ) and the second phase s 120 ( or the second phase detecting and suppressing device 220 in fig2 a ) in fig1 respectively operating on the sample stream . in various digital system ( e . g . dvb - t system with cofdm ) receivers , the received analog signals are sampled according to a sampling periods to generate a sample stream x [ n ]. the sample stream x [ n ] includes a plurality of samples , wherein the 1 st sample is denoted as x [ 1 ], the 2 nd sample is denoted as x [ 2 ], . . . , the k th sample is denoted as x [ k ], and k is a positive integer . in addition , the energy of the sample x [ 1 ] is denoted as e [ 1 ], the energy of the sample x [ 2 ] is denoted as e [ 2 ], . . . , the energy of the sample x [ k ] is denoted as e [ k ]. moreover , as shown in fig2 c , sample x [ k + 3 ] is sample x [ k + 4 ] after delaying a sampling period t , sample x [ k + 2 ] is sample x [ k + 3 ] after delaying a sampling period t , . . . , sample x [ k − 1 ] is sample x [ k ] after delaying a sampling period t , wherein the delays 251 ˜ 255 all have the delay time with the duration of a sampling period t . similarly , energy e [ k + 3 ] is energy e [ k + 4 ] after delaying a sampling period t , energy e [ k + 2 ] is energy e [ k + 3 ] after delaying a sampling period t , . . . , energy e [ k − 1 ] is energy e [ k ] after delaying a sampling period t . referring to both fig1 and fig2 b , according to the method for suppressing impulse noise , three consecutive samples ( i . e . x [ k − 1 ], x [ k ], and x [ k + 1 ]) are processed in the first phase s 110 . in step s 111 , the energy e [ k − 1 ] of the sample x [ k − 1 ] is added to the energy e [ k ] of the sample x [ k ], while since the weights of the energies of the samples x [ k − 1 ] and x [ k ] may not be the same , the sum of the two energies is expressed as e [ k − 1 ]+ c 1 × e [ k ], wherein the first constant c 1 represents the weight ratio between the energies of the samples x [ k ] and x [ k − 1 ]. however , for the convenience of description , below the first constant is assigned value 1 , accordingly , next , the energy sum e [ k − 1 ]+ e [ k ] of the samples x [ k − 1 ] and x [ k ] is compared with the first threshold th 1 . in step s 112 , it is determined that whether the energy sum e [ k − 1 ]+ e [ k ] is greater than the threshold th 1 . step s 113 is proceeded when the energy sum e [ k − 1 ]+ e [ k ] is greater than the threshold th 1 . in step s 113 , the energy sum e [ k ]+ c 2 × e [ k + 1 ] of the samples x [ k ] and x [ k + 1 ] is compared with the second threshold th 2 , wherein the second constant c 2 represents the weight ratio between the energies of the samples x [ k + 1 ] and x [ k ]. however , for the convenience of description , below the second constant is assigned value 1 , thus , whether the energy sum e [ k ]+ e [ k + 1 ] is greater than the threshold th 2 is determined in step s 114 . in an embodiment , the threshold th 1 may be equal to the threshold th 2 . in step s 114 , the energy sum of the sample x [ k ] with its previous sample x [ k − 1 ], and the energy sum of the sample x [ k ] with its next sample x [ k + 1 ] both exceed the threshold if the energy sum e [ k ]+ e [ k + 1 ] is greater than the threshold th 2 . here , the possibility of the sample x [ k ] being interrupted by impulse noise is very high , thus step s 115 is executed to suppress the impulse noise and to replace the likely interrupted sample x [ k ] with a first replacement sample da 1 . thus , after the samples x [ k − 1 ], x [ k ], and x [ k + 1 ] are processed in the first phase s 110 , sample x [ k − 1 ], replacement sample da 1 , and sample x [ k + 1 ] are output in sequence . here , the replacement sample da 1 may be the long - term average or the moving average of the signal , or may also be a digital value . as to the situations of the energy sum e [ k − 1 ]+ e [ k ] being smaller than the threshold th 1 in step s 112 , or the energy sum e [ k − 1 ]+ e [ k ] being greater than the threshold th 1 in step s 112 but the energy sum e [ k ]+ e [ k + 1 ] being smaller than the threshold th 2 in step s 114 , the sample x [ k ] is determined being not interrupted by impulse noise , so the sample x [ k ] is not replaced . in other words , the original samples x [ k − 1 ], x [ k ], and x [ k + 1 ] are output in sequence after they are processed in the first phase if in the first phase s 110 , the sample x [ k ] is determined being interrupted by impulse noise , the following several samples ( i . e . x [ k + 1 ], x [ k + 2 ], . . . , x [ k + m ], wherein m is a positive integer and is greater than 1 ) have high possibility of being interrupted by impulse noises . thus , according to the method for suppressing impulse noise , the samples x [ k + 1 ]˜ x [ k + m ] are processed during the second phase s 120 . in the present embodiment , m = 4 . in step s 121 , the energy e [ k + 1 ] of sample x [ k + 1 ], the energy e [ k + 2 ] of sample x [ k + 2 ], the energy e [ k + 3 ] of sample x [ k + 3 ], and the energy e [ k + 4 ] of sample x [ k + 4 ] are respectively compared with the third threshold th 3 . in step s 122 , it is determined that whether the energy of at least one sample among the samples x [ k + 1 ]˜ x [ k + 4 ] is greater than the threshold th 3 . when there is at least one sample having its energy greater than threshold th 3 , the possibility of sample x [ k + 1 ] being interrupted by impulse noise is very high . here , step s 123 is executed to suppress the impulse noise and to replace the likely interrupted sample x [ k + 1 ] with a second replacement sample da 2 . accordingly , the replacement sample da 2 and samples x [ k + 2 ]˜ x [ k + 4 ] are output sequentially after the samples x [ k + 1 ]˜ x [ k + 4 ] are processed during the second phase s 120 . in an embodiment of the present invention , the replacement sample da 2 may be equal to the replacement sample da 1 . referring to fig2 a , the device 200 for suppressing impulse noise includes a first phase detecting and suppressing device 210 and a second phase detecting and suppressing device 220 . the first phase detecting and suppressing device 210 receives a sample stream x [ n ], a first threshold th 1 , and a second threshold th 2 , and outputs a first output signal out 1 and a first control signal ctrl 1 . the second phase detecting and suppressing device 220 receives a sample stream x [ n − 1 ], a first control signal ctrl 1 , and a third threshold th 3 , and outputs a second output signal out 2 . wherein , the diagrams of the sample streams x [ n ] and x [ n − 1 ] are illustrated in fig2 d , and the sample stream x [ n ] is an advanced version of the sample stream x [ n − 1 ] shifted by one sampling period t . the detailed circuit block diagrams of the detecting and suppressing devices 210 and 220 are respectively illustrated in fig3 a and 3b . referring to fig3 a , the first phase detecting and suppressing device 210 includes a first delay 301 , a second delay 303 , a third delay 306 , a first energy obtainer 302 , an adder 304 , a comparator 305 , a first and gate 307 and a first selector 308 . in an embodiment of the present invention , the first selector 308 may be a multiplexer . for example , the detecting and suppressing device 210 receives the sample x [ k ] of the sample stream x [ n ]. the delay 301 receives the sample x [ k ] and delays a sampling period t to output the sample x [ k − 1 ]. the energy obtainer 302 receives the sample x [ k ] and outputs the energy e [ k ] of the sample x [ k ]. the delay 303 receives the energy e [ k ] of the sample x [ k ] and delays a sampling period t to output energy e [ k − 1 ], i . e . the energy of the sample x [ k − 1 ]. the adder 304 receives the energies of the samples x [ k ] and x [ k − 1 ], which are respectively e [ k ] and e [ k − 1 ], and outputs the sum e [ k − 1 ]+ e [ k ] of the two energies . the comparator 305 compares the energy sum e [ k − 1 ]+ e [ k ] with the threshold th 1 and outputs a first comparison result comp 1 . the delay 306 receives the first comparison result comp 1 and delays a sampling period t to output a second comparison result comp 2 , i . e . the result of comparing the energy sum e [ k ]+ e [ k + 1 ] and the threshold th 2 . based on the foregoing analysis , the result of comparing the energy sum e [ k ]+ e [ k + 1 ] and the threshold th 2 is generated while the detecting and suppressing device 210 receives the sample x [ k + 1 ] of the sample stream x [ n ], here the output of the delay 301 is the sample x [ k ]. when the energy sum e [ k − 1 ]+ e [ k ] of the samples x [ k − 1 ] and x [ k ] is greater than the threshold th 1 , i . e . the comparison result comp 1 is “ 1 ”, and when the energy sum e [ k ]+ e [ k + 1 ] of the samples x [ k ] and x [ k + 1 ] is also greater than the threshold th 2 , i . e . the comparison result comp 2 is also “ 1 ”, the control signal ctrl 1 output by the and gate 307 is “ 1 ”, which means the sample x [ k ] is interrupted by impulse noise . here , the control signal ctrl 1 is “ 1 ” and controls the selector 308 to select the replacement sample da 1 to output as the output signal out 1 . as to the situations of the energy sum e [ k − 1 ]+ e [ k ] being smaller than the threshold th 1 , or the energy sum e [ k − 1 ]+ e [ k ] being greater than the threshold th 1 but the energy sum e [ k ]+ e [ k + 1 ] being smaller than the threshold th 2 , the sample x [ k ] is not interrupted by impulsive noise . here , the control signal ctrl 1 is “ 0 ” and controls the selector 308 to select the sample x [ k ] output by the delay 301 to output as the output signal out 1 . referring to fig3 b , the second phase detecting and suppressing device 220 includes a first delay set 310 , a second delay set 320 , a second energy obtainer 340 , a comparator set 330 , an or gate 350 , a second and gate 360 , and a second selector 370 . in an embodiment of the present invention , the second selector 370 may be a multiplexer . wherein , the delay sets 310 and 320 can both delay the inputs thereof m − 1 sampling period t , i . e . the delay sets 310 and 320 both can be formed by coupling m − 1 delays , which can delay one sampling period t , in series . the comparator set 330 includes m comparators . in the present embodiment , m = 4 . accordingly , the delay set 310 includes delays 312 ˜ 314 , the delay set 320 includes delays 322 ˜ 324 , and the comparator set 330 includes comparators 331 ˜ 324 . for example , the detecting and suppressing device 220 receives the sample x [ k + 4 ] of the sample stream x [ n − 1 ]. the delay set 310 receives the sample x [ k 4 ] and delays three sampling period t to output a sample x [ k + 1 ]. the energy obtainer 340 receives the sample x [ k + 4 ] and outputs the energy e [ k + 4 ] of the sample x [ k + 4 ]. the delay set 320 receives the energy e [ k + 4 ] of the sample x [ k + 4 ] and delays it to output the energies of three delayed samples , wherein the energy e [ k + 3 ] of the 1 st delayed sample x [ k + 3 ] output by the delay 322 is the output e [ k + 4 ] of the energy obtainer 340 after delaying a sampling period t , the energy e [ k + 2 ] of the 2 nd delayed sample x [ k + 2 ] output by the delay 323 is the energy e [ k + 3 ] of the first delayed sample x [ k + 3 ] after delaying a sampling period t , and the energy e [ k + 1 ] of the 3 rd delayed sample x [ k + 1 ] output by the delay 324 is the energy e [ k + 2 ] of the 2 nd delayed sample x [ k + 2 ] after delaying a sampling period t . the output e [ k + 4 ] of the energy obtainer 340 and the energies e [ k + 3 ]˜ e [ k + 1 ] of the delayed samples are respectively received by the corresponding comparators 331 ˜ 334 in the comparator set 330 to be respectively compared with the threshold th 3 and to output the comparison results . the or gate 350 receives these comparison results and performs logic or operation to output the third control signal ctrl 3 . when at least one of the energies e [ k + 4 ]˜ e [ k + 1 ] is greater than the threshold th 3 , e . g . the energy e [ k + 3 ] is greater than the threshold th 3 , the comparison result output by the comparator 331 is , e . g . “ 1 ”, so that the control signal ctrl 3 output by the or gate 350 is “ 1 ”. here , if the control signal ctrl 1 is also “ 1 ” ( i . e . the sample x [ k ] is interrupted by impulse noise ), then the and gate 360 outputs a second control signal ctrl 2 according to the control signals ctrl 1 and ctrl 3 to control the selector 370 to select the replacement sample da 2 to output as the second output signal out 2 . when the energies e [ k + 4 ]˜ e [ k + 1 ] are all smaller than the threshold th 3 , which means the possibility of the sample x [ k + 1 ] being interrupted by impulse noise is very low , the comparison results output by the comparators 331 ˜ 334 are , e . g . all “ 0 ”, so that the control signal ctrl 3 output by the or gate 350 is “ 0 ”. thus , no matter what the control signal ctrl 1 is , the control signal ctrl 2 output by the and gate 360 are all “ 0 ”, and which controls the selector 370 to select the sample x [ k + 1 ] output by the comparator set 310 to output as the output signal out 2 . actually , the method for suppressing impulse noise as shown in fig1 can be achieved with only the first phase s 110 , however , with the second phase s 120 integrated , better performance , e . g . bit error rate about 1 db lower , can be achieved . similarly , in fig2 a , the device 200 for suppressing impulse noise employing the method in fig1 can also be achieved with only a first phase detecting and suppressing device 210 , however , if integrated with the second phase detecting and suppressing device 220 , better performance can be achieved . moreover , the method and device of the present invention are applicable to an intermediate frequency system , wherein the sample stream x [ n ] is a plurality of signals , but are also applicable to a baseband system , wherein the sample stream x [ n ] is real number signals . furthermore , the method and device of the present invention are applicable to an orthogonal frequency division multiplexing ( ofdm ) system or a coded orthogonal frequency division multiplexing ( cofdm ) system . when the device for suppressing impulse noise of the present invention includes a first phase and a second phase detecting and suppressing devices , the circuit thereof can be altered appropriately to simplify the structure , e . g . the devices for suppressing impulse noise as shown in fig4 and 5 . referring to fig4 , the precondition of implementing the device 400 for suppressing impulse noise is that the first replacement sample and the second replacement sample respectively used by the first detecting and suppressing device and the second detecting and suppressing device should be the same ( both are da 1 ). when the or gate 409 outputs “ 0 ”, the selector 470 selects the output of the delay set 410 as its output ; otherwise , when the or gate 409 outputs “ 1 ”, the selector 470 selects the replacement sample da 1 as its output to suppress impulse noise . wherein , when one of the control signals ct 1 and ct 2 received by the or gate 409 is “ 1 ”, the or gate 409 outputs “ 1 ”. here , the control signal ct 1 being “ 1 ” means that the energy sum of the samples x [ k − 1 ] and x [ k ] is greater than the threshold th 1 and the energy sum of the samples x [ k ] and x [ k + 1 ] is greater than the threshold th 2 , and this can be deduced by assuming that the input of the delay set 410 is the sample x [ k + 3 ] and the output thereof is the sample x [ k ]. when the input of the delay set 410 is the sample x [ k + 3 ] and the output thereof is the sample x [ k ], the adder 404 a outputs the energy sum of the samples x [ k − 1 ] and x [ k ] and compares it with the threshold th 1 through the comparator 405 a , and the adder 404 b outputs the energy sum of the samples x [ k ] and x [ k + 1 ] and compares it with the threshold th 2 through the comparator 405 b . when the energy sum of the samples x [ k − 1 ] and x [ k ] is greater than the threshold th 1 and the energy sum of the samples x [ k ] and x [ k + 1 ] is greater than the threshold th 2 , the control signal ct 1 output by the and gate 407 is “ 1 ”, so that the or gate 409 outputs “ 1 ” to control the selector 470 to select the replacement sample da 1 . in addition , the control signal ct 2 being “ 1 ” requires both control signals ct 1 ′ and ct 3 to be “ 1 ”. wherein , the control signal ct 1 ′ being “ 1 ” means that the sample x [ k ] ever be replaced by the replacement sample da 1 , and the control signal ct 3 being “ 1 ” means that the energy of at least one of the samples x [ k + 1 ]˜ x [ k + 4 ] is greater than the threshold th 3 , which can be deduced by assuming that the input of the delay set 410 is sample x [ k + 4 ] and the output thereof is sample x [ k + 1 ]. when the input of the delay set 410 is the sample x [ k + 4 ] and the output thereof is the sample x [ k + 1 ], the comparator 405 a compares the energy sum of the samples x [ k ] and x [ k + 1 ] with the threshold th 1 , and the comparator 405 b compares the energy sum of the samples x [ k + 1 ] and x [ k + 2 ] with the threshold th 2 . when the energy sum of the samples x [ k ] and x [ k + 1 ] is greater than the threshold th 1 and the energy sum of the samples x [ k + 1 ] and x [ k + 2 ] is greater than the threshold th 2 , the output of the and gate 407 is “ 1 ”. here , the output of the and gate 407 is delayed a sampling period by the delay 408 to become the control signal ct 1 ′, which means the energy sum of the samples x [ k − 1 ] and x [ k ] is greater than the threshold th 1 and the energy sum of the samples x [ k ] and x [ k +] is greater than the threshold th 2 , i . e . the sample x [ k ] will be replaced by the replacement sample da 1 . moreover , the comparator set 430 and the or gate 450 are used for determining whether the energy of at least one of the samples x [ k + 1 ]˜ x [ k + 4 ] is greater than the threshold th 3 , if the energy of at least one of the samples x [ k + 1 ]˜ x [ k + 4 ] is greater than the threshold th 3 , then the control signal ct 3 output by the or gate 450 is “ 1 ”. referring to fig5 , the precondition of implementing the device 500 for suppressing impulse noise is that the first and the second replacement samples respectively used by the first phase and the second phase detecting and suppressing devices have to be the same ( both are da 1 ), and the first and the second thresholds have to be the same ( both are th 1 ). according to the analysis of the device 400 for suppressing impulse noise as shown in fig4 , the outputs of the delay set 510 are respectively assumed to be the samples x [ k ] and x [ k + 1 ], so that those skilled in the art should be able to analyze the device 500 for suppressing impulse noise , so will not be described again here . in summary , in the present invention , the energy sums of a plurality of samples are compared with the thresholds to determine whether the samples are interrupted by impulse noise and to suppress the samples interrupted by impulse noises , and the structure thereof is easy to be implemented . in addition , besides one phase of detection and suppression , the method and device of the present invention can also employ two phases of detection and suppression to obtain lower bit error rate . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure of the present invention without departing from the scope or spirit of the invention . in view of the foregoing , it is intended that the present invention cover modifications and variations of this invention provided they fall within the scope of the following claims and their equivalents .
| 7Electricity
|
one embodiment of this invention will now be described with reference to an automatic ink quantity adjusting device shown in fig3 through 6 . as shown in fig3 through 5 , an ink fountain roller 3 , an ink ductor roller 4 and ink rollers 5 are rotatably supported between frames 1 and 1 &# 39 ; in the stated order from an ink fountain 2 towards a plate cylinder ( not shown ). a ratchet 7 is fixedly mounted on the outer end portion of the shaft 6 of the ink fountain roller 3 which is extended through the frame 1 &# 39 ;. a pawl 8 pivotally mounted on a rod 8a is provided on a feed plate 9 . the feed plate is loosedly fitted on the outer end portion of the shaft 6 . the pawl 8 is engaged with the ratchet 7 to form a ratchet mechanism 10 ( see fig4 ). the feed plate 9 is coupled through a lever 11 to the drive section of a printing machine ( not shown ). when the printing machine is started , the ink fountain roller 3 is turned in the direction of the arrow f in fig5 by the ratchet mechanism 10 , so that the ink g in the ink fountain 2 will be carried on the outer wall of the ink fountain roller 3 . the amount of ink carried by the ink fountain roller 3 is controlled by adjusting the position of an ink blade 12 provided for the ink fountain , i . e . by adjusting the clearance h between the ink blade 12 and the ink fountain roller 3 as desired . an ink adjusting roller 13 is rotatably supported between the frames 1 and 1 &# 39 ; in such a manner that it is between and in contact with both the ink fountain roller 3 and the ink ductor roller 4 . gears 25 and 26 are fixedly mounted on the shaft 13a of the ink adjusting roller 13 and the shaft 6 of the ink fountain roller 3 , respectively , and the gears 25 and 26 are engaged with each other . therefore , when the printing machine is driven , the ink adjusting roller 13 is turned in the direction of the arrow i in fig5 . the ink adjusting roller 13 comprises a plurality of movable blocks 14 which are substantially arcuate as viewed from the front . more specifically , a plurality of pairs of movable blocks 14 are provided . each pair of movable blocks 14 are symmetrically arranged with their longer arcs set outside as shown in fig5 . disk - shaped blocks 15 and 15 are fixedly mounted on the shaft 13a in such a manner that they are spaced a predetermined distance from each other , each block carrying a pair of fulcrum shafts 16 . for each block pair except the right - most pair in fig3 a plate 13b is provided which is keyed to and rotatable with the shaft 13a . each plate carries a pair of fulcrum shafts 16 . first end portions of the movable blocks 14 of each block pair are rotatably mounted on the fulcrum shafts 16 , so that the movable blocks 14 and 14 can swing radially about the fulcrum shafts . the movable end portions 14 &# 39 ; and 14 &# 39 ; of the movable blocks 14 and 14 of each pair are coupled through tension springs 17 and 17 to the fulcrum shafts 16 and 16 , respectively , so that the movable end portions 14 &# 39 ; and 14 &# 39 ; are normally pulled towards the first end portions , i . e . toward the pivotal end portions 14 &# 34 ; and 14 &# 34 ; of the opposed movable blocks 14 and 14 . thus , the movable end portions 14 &# 39 ; of all of the movable blocks 14 are normally pulled towards the center by the tension springs 17 . it should be noted that the pivotal end portions 14 &# 34 ; of the movable blocks 14 are mounted on the shafts 16 as follows : the movable blocks 14 are so positioned that , even when the movable end portions 14 &# 39 ; are pulled towards the center , the outer surface of the pivotal end portions 14 &# 34 ; of each movable block 14 , i . e ., an ink sticking surface 14a which is the longer arcuate surface of the movable block 14 , can contact with the ink fountain roller 3 and the ink ductor roller 4 . an adjusting mechanism 18 having a motor 19 which is operated on and off according to an ink quantity detection signal from the printing machine , a link 20 and an adjusting rolls 21 , 21 are provided to radially move each movable block pair . each adjusting mechanism 18 , as shown in fig5 comprises : the motor 19 ; a worm gear 19a on the shaft of the motor 19 ; a gear wheel 22 engaged with the worm 19a ; and an arm 23 cooperating with the gear wheel 22 . the movable end portions of the arms 23 are rotatably coupled to the end portions of the links 20 . each adjusting roll 21 , 21 is rotatably mounted on an end portion of an arm 24 the middle of which is loosely fitted on the shaft 13a . one of the ends of the arm 24 is pivotally coupled to the other end of the link 20 . i . e ., as viewed in fig5 the rollers 21 and 21 are both mounted on the far side of arm 24 at either end thereof , while the shaft 21a for mounting the other roller 21 extends through the arm 24 to the rear side thereof where it is rotatably coupled to the lower end of link 20 . thus , the rolls 21 , 21 are coupled through the arm 24 and the link 20 to the adjusting mechanism 18 . when the motor 19 is rotated in a direction so that the link 20 is moved upwardly in fig5 through the arm 23 , the arm 24 is turned counterclockwise , and accordingly the adjusting roll 21 in contact with the inner surface of the pivotal end portion of the movable block 14 is turned counterclockwise . as a result , the movable block 14 is moved radially outwardly against the elastic force of the tension spring 17 so that the contact length between the ink sticking surface 14a and the ink fountain roller 3 is increased . the upper arcuate member is similarly moved . the above - described adjusting mechanism 18 is provided for every movable block 14 . an ink densitometer of a well - known type , shown schematically at 30 , adapted to detect ink densities at various points on a printing machine , outputs ink density detection signals as to various points on a print . in response to the detection signals the motors 19 of the adjusting mechanisms 18 are rotated in the forward direction or in the reverse direction , so that the movable blocks 14 are suitably moved as was described above , to increase or decrease the contact length of the ink sticking surfaces 14a , whereby the quantity of ink to be supplied from the ink fountain roller 3 to the ink ductor roller 4 , i . e . the quantities of ink to be supplied to printing plates on the plate cylinder , are set to predetermined values . thus , the ink densities of the printing plate can be suitably adjusted . with the above - described arrangement , an automatic ink quantity adjusting operation is carried out as follows : when a printing machine ( not shown ) starts , the ink fountain roller 3 is turned by the ratchet mechanism 10 , while the ink adjusting roller 13 is also turned through the gears 25 and 26 . as shown in fig6 ( a )- 6 ( c ), depending on the positions of the adjusting rolls 21 , the movable blocks 14 are displaced radially , and accordingly the contact lengths between the ink fountain roller 3 and the ink sticking surfaces 14a are changed , with the result that the quantities of ink carried to the ductor roller 4 by the ink sticking surfaces 14a are changed . a plurality of ink densitometers detect ink densities from a print sheet surface , and the ink densities thus detected are compared with predetermined values . when the quantity of ink in a particular print region is found to be low , for instance , then the motor 19 of the respective adjusting mechanism 18 is operated in response to a signal representing the fact that the ink quantity is too low . as a result , the adjusting roll 21 is moved in the direction of the arrow j as shown in fig6 ( a ) and 6 ( b ) to move the movable block 14 outwardly , so that the contact length between the ink sticking surface 14a and the ink fountain roller 3 is increased . when , on the other hand , the quantity of ink is detected to be too much , the motor 19 is turned so as to move the adjusting roll 21 in the direction of the arrow k in fig6 ( b ). in this operation , the movable block 14 is pulled towards the center by the tension spring 17 , so that the contact surface between the ink sticking surface 14a and the ink fountain roller 3 is decreased . it is assumed that , when the adjusting roll 21 is positioned at the middle of the movable block 14 as shown in fig6 ( b ), the contact length between the ink sticking surface 14a and the ink fountain roller 3 is represented by l . if , under this condition , the adjusting roll 21 is moved in the direction of the arrow j in fig6 ( b ), then the movable block 14 is moved radially outwardly as shown in fig6 ( c ), as a result of which the contact length l is increased to l &# 39 ;. if , on the other hand , the adjusting roll 21 is moved in the direction of the arrow k in fig6 ( b ), then the movable block 14 is moved radially inwardly as shown in fig6 ( a ), as a result of which the contact length l is decreased to l &# 34 ;. thus , in the former case , the quantity of ink sticking on the ink sticking surface is increased ; and in the latter case , the quantity of ink is decreased . that is , the quantity of ink supplied to the ink ductor roller 4 is adjusted . as was described above , a plurality of ink densitometers detect ink densities at various points on a print to provide the ink density detection signals . in response to the ink density detection signals , the adjusting mechanisms 18 operate to suitably move their respective movable blocks . therefore , the quantities of ink at various points on the print can be individually adjusted . after the clearance h between the ink fountain roller 3 and the ink blade 12 has been adjusted to coarsely control the quantity of ink sticking onto the ink fountain roller 3 , the movable blocks 14 are finely adjusted . therefore , the quantity of ink can be accurately adjusted . the embodiment of this invention has been described with reference to an ink quantity adjusting device ; however , the technical concept of the invention can equivalently applied to a water quantity adjusting device . as is apparent from the above description , in the ink ( or water ) quantity adjusting device according to this invention , the adjusting roll 13 , which is rotatably supported in such a manner that it is in contact with the fountain roller 3 and the ductor roller 4 is operated to move its respective movable blocks 14 radially , so that the contact lengths of the ink sticking surfaces with the fountain roller 3 are adjusted as desired , whereby the quantities of transferred ink are finely adjusted . therefore , with the ink ( or water ) water quantity adjusting device of this invention , unlike the conventional one which adjusts the quantity of ink ( or water ) by controlling the clearance only , the quantity of ink ( or water ) can be delicately controlled even if ink ( or water ) of a differend density is used . therefore , by finely adjusting the quantities of ink with the movable blocks 14 after the total quantity of ink to be supplied to the fountain roller 13 has been adjusted with the blade 12 , the quantities of ink can be finely adjusted in conformance to predetermined ink densities on a print sheet surface . the adjusting roller 13 is made up of the plurality of movable blocks 14 . the movable blocks 14 are moved radially by the adjusting mechanisms 18 which operate in response to the detection signals outputted by the ink densitometers adapted to detect ink densities at various points on a print sheet surface , so that each movable block 14 adjusts the quantity of ink which is suitable for the respective point on the print sheet surface . therefore , the fine adjustment is effected uniformly over the entire print sheet surface , and the print surface is of uniform ink density .
| 1Performing Operations; Transporting
|
fig1 shows a longitudinal and cross sectional view of the present invention . in fig1 outer tube 101 and inner tube 103 define an annulus 105 . tube 101 has a lower inlet check valve 107 that allows working fluid to flow into annulus 105 . tube 101 also has an upper outlet check valve 109 that allows working fluid to flow out of annulus 105 . inner tube 103 penetrates the upper end 113 of tube 101 . inner tube 103 is in fluid communication through its upper end 111 with a source of controllable fluid pressure , not shown . inlet check valve 107 and outlet check valve 109 may be any check valve currently used with positive displacement pumps . use of a section of thinner wall flex tubing at the bottom of tube 101 can function as the bottom inlet check valve in many applications . thus the check valve may be made of the same plastic material as the inner and outer tubes . this can make the pump very inexpensive to build . outer tube 101 and inner tube 103 may be any semi - rigid plastic tubing capable of withstanding a fall vacuum . these tubes may be made of highly chemically resistant materials such as kynar , viton or teflon . no metallic parts are required . the tubes 101 and 103 may be of small diameter , allowing the pump to be inserted into locations that would be inaccessible to other pumps . functionally , fluid pressure is introduced into inner tube 103 , causing it to expand . this compresses the working fluid in annulus 105 and expels some of the working fluid out of upper outlet check valve 109 , as is shown in fig1 by arrow 117 . the fluid pressure in tube 103 is then reduced . this reduces the pressure on the working fluid in annulus 105 and draws more working fluid into annulus 105 through lower inlet check valve 107 as is shown in fig1 by arrow 115 . it may be desirable to place a small tube or string in annulus 105 to prevent complete closure of the annulus during the pump &# 39 ; s operation . the fluid used to pressurize inner tube 103 can be anything from common gases to liquid blends designed to be compatible with the intended service . in general highest efficiency is obtained with low viscosity fluids having a specific gravity similar to the material to be pumped . this is particularly true for pumps over 20 feet long intended for vertical pumping . pump performance characteristics can be affected by many factors . the primary design parameters are overall length , internal and external diameters of the outer and inner tubes and the elastimeric characteristics of each tube . the present invention shares most of the characteristics of positive displacement pumps . differences are due to the &# 34 ; long thin &# 34 ; nature of the invention &# 39 ; s design , which places the pump suction at the point of pickup and the discharge closer to final discharge . the pumps taught by the preferred embodiment of the present invention are capable of near perfect vacuum suctions and discharge pressures are limited only by the strength of the outer tube and valving . the pump is inherently inexpensive to manufacture , easy to clean , easy to repair and easily inspected if the outer tubing is clear . pumps made according to the present invention can vary in cross section from round to any practical shape ( oval , square , triangle , or irregular ). pump length is limited only by the practical limitations of hydraulic flow through the interior of the inner tube . fig2 shows a long thin embodiment of the pump taught by the present invention . fig2 shows how the present invention can operate even when it is long , thin and bent through several sharp angles . in fig2 outer tube 201 and inner tube 203 define annulus 205 . outer tube 201 is sealed at its upper end with upper outlet check valve 209 . outer tube 201 is sealed at its lower end by lower inlet check valve 207 . inner tube 203 penetrates the upper end of tube 201 at position 211 and is in fluid communication by outlet 213 with a controllable source of fluid pressure , not shown . inner tube 203 is sealed at one end and attached mechanically by any convenient means near the end of tube 201 . functionally , in fig2 fluid pressure is introduced from a controllable source , not shown , through inlet 213 to inner tube 203 as is shown in fig2 by arrow 217 . this pressure makes tube 203 expand applying force on the working fluid in annulus 205 . this force moves part of the working fluid through the upper outlet check valve 209 . the pressure in inner tube 203 is then reduced . this lowers the pressure on the working fluid in annulus 205 , whereby working fluid is drawn through lower inlet check valve 207 as is shown in fig2 by arrow 215 . this cycle is then repeated as required to make the pump operate at the desired rate of flow . fig3 shows a partial cross section detail of the discharge end of the pump shown in fig2 . in fig3 a check valve 301 has an inlet attachment fitting 303 and an outlet attachment fitting 313 . outer tube 305 is disposed in close fitting engagement and hermetically sealed , by adhesive or any other well know means , to valve inlet fitting 303 . inner tube 307 is hermetically sealed to elbow fitting 309 that penetrates fitting 303 through opening 310 . elbow 309 is hermetically sealed to and in fluid communication with elbow fitting 311 . discharge end fitting 313 is shown attached to and in fluid communication with output tube 315 . the lines and valves may be made of any material capable of physically and chemically tolerating the environment of the working fluid . fig4 shows a partial cross section detail of the inlet end of the pump shown in fig2 . in fig4 check valve 401 has an outlet fitting 403 that is in exterior close fitting engagement and fluid communication with outer tube 405 . the bond between fitting 403 and tube 405 is hermetic and may be made by adhesive or in any other way well known to those with skill in the art or mechanical engineering . the lines and valves may be made of any material capable of physically and chemically tolerating the environment of the working fluid . fitting 406 describes one of many ways to supply a method of attaching / anchoring the bladder tube to the end of the pump , fig5 shows the pressure vs . volume curve for the pump taught by the embodiment of the present invention shown in fig2 . fig6 shows another embodiment of the pump taught by the present invention . in fig6 pump 601 is shown with its lower end input end 603 in a sump 605 that is filled with thick sludge 607 . pump 601 has an outer tube 609 and an inner tube 611 that define annulus 613 . the lower end of inner tube 611 is mechanically attached to , but not in fluid communication with lower inlet check valve 615 at the inlet end 603 of outer tube 601 . the upper end of inner tube 611 is attached to and in fluid communication with connector tube 621 . the upper end 617 of outer tube 601 is attached to and in fluid communication with elbow 619 . elbow 619 is attached to and in fluid communication with outlet tube 629 . outlet tube 629 is attached to and in fluid communication with outlet check valve 631 . connector tube 621 penetrates elbow 619 and is attached to and in fluid communication with pressure line 623 . pressure line 623 is attached to and in fluid communication with bottle outlet 625 of squeeze bottle 627 . functionally , in fig6 an operator , not shown , squeezes pressure bottle 627 . this puts pressure in inner tube 611 , which causes tube 611 to expand . the expansion of tube 611 applies force to the working fluid in annulus 613 forcing some of the working fluid up through elbow 619 and outlet check valve 631 where it exits the pump as effluent stream 633 . the pressure on bottle 627 is then relaxed , which reduces the pressure on the working fluid and causes suction to draw more working fluid into the pump through inlet check valve 615 . fig7 shows another embodiment of the pump taught by the present invention . in fig7 pump 701 has an outer tube 703 and an inner tube 705 that define annulus 707 . outer tube 703 is sealed at its upper end by upper plug 714 and at its lower end by lower plug 709 . lower plug 709 is penetrated by lower inlet check valve 708 . the lower end of inner tube 705 is mechanically attached to the top of check valve 708 , but is not in fluid communication with the valve . upper plug 714 is penetrated by connection line 717 and upper outlet check valve 718 in valve section 715 . the upper end of inner tube 705 is attached to and in fluid communication with connection line 717 . line 717 is attached to and in fluid communication with line 723 that is in turn connected to and in fluid communication with reciprocating fluid pump 725 . check valve 718 is in fluid communication with and attached at its output side 719 to output line 721 . pump 725 comprises a rotary prime mover 727 connected via connecting rod 730 to a piston 733 disposed within a cylinder 735 , said cylinder being in fluid communication with pressure line 723 and thence with inner tube 705 . functionally , prime mover 727 causes piston 733 to move back and forth within cylinder 735 which applies varying pressure to the interior of inner tube 705 , causing it to expand and contract . as tube 705 expands , it applies force to the working fluid in annulus 707 , which forces some of the working fluid through check valve 718 and out line 721 . when inner tube 705 contracts , more working fluid is drawn into the pump through inlet check valve 708 , as was described in connection with fig1 and 6 , above . fig8 shows a pump according to the present invention wherein the inner tube 801 and outer tube 803 are separately coaxial within a third tube 805 . the present invention has been described in this specification in terms of its preferred embodiments , these being the best embodiment of the invention known to the inventor at the time this specification was prepared . the present invention is , however , broader than these specific embodiments and should be limited only by the appended claims .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
a twist collapsible bag in accordance with the present invention can be a single stack design , double - stack design , triple - stack design or any design having more than four stacks wherein the frame structure in each stack is collapsible , including one annular frame member horizontally disposed at each of the top and bottom sides and a plurality of vertical support rods vertically and equiangularly arranged between the two annular frame members . fig1 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a first embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a , a second annular frame member 1 b and a third annular frame member 1 c horizontally arranged at three different elevations , one first vertical support rod 2 a and one second vertical support rod 2 b vertically arranged between the first annular frame member 1 a and the second annular frame member 1 b at two opposite sides and another first vertical support rod 2 a and another second vertical support rod 2 b vertically arranged between the second annular frame member 1 b and the third annular frame member 1 c at two opposite sides . the vertical support rods 2 a and 2 b are kept apart from the adjacent annular frame members 1 a and / or 1 b and / or 1 c at a predetermined gap . fig2 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a second embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a , a second annular frame member 1 b and a third annular frame member 1 c horizontally arranged at three different elevations , one first vertical support rod 2 a , one second vertical support rod 2 b and one third vertical support rod 2 c vertically and equiangularly arranged between the first annular frame member 1 a and the second annular frame member 1 b , and another first vertical support rod 2 a , another second vertical support rod 2 b and another third vertical support rod 2 c vertically and equiangularly arranged between the second annular frame member 1 b and the third annular frame member 1 c at two opposite sides . the vertical support rods 2 a , 2 b and 2 c are kept apart from the adjacent annular frame members 1 a and / or 1 b and / or 1 c at a predetermined gap . fig3 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a third embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a , a second annular frame member 1 b and a third annular frame member 1 c horizontally arranged at three different elevations , one first vertical support rod 2 a , one second vertical support rod 2 b , one third vertical support rod 2 c and one fourth vertical support rod 2 d vertically and equiangularly arranged between the first annular frame member 1 a and the second annular frame member 1 b , and another first vertical support rod 2 a , another second vertical support rod 2 b , another third vertical support rod 2 c and another fourth vertical support rod 2 d vertically and equiangularly arranged between the second annular frame member 1 b and the third annular frame member 1 c at two opposite sides . the vertical support rods 2 a , 2 b , 2 c and 2 d are kept apart from the adjacent annular frame members 1 a and / or 1 b and / or 1 c at a predetermined gap . fig4 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a fourth embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a and a second annular frame member 1 b horizontally arranged at different elevations , one first vertical support rod 2 a , one second vertical support rod 2 b and one third vertical support rod 2 c vertically and equiangularly arranged between the first annular frame member 1 a and the second annular frame member 1 b . the vertical support rods 2 a , 2 b and 2 c are kept apart from the annular frame members 1 a and 1 b at a predetermined gap . the number of the annular frame members and the number of vertical support rods are determined subject to the pressure the twist collapsible bag to be received , however at least two vertical support rods must be set between each two adjacent annular frame members to provide sufficient support strength . fig5 illustrates a twist collapsible bag using the collapsible frame structure of the aforesaid second embodiment . as illustrated , the twist collapsible bag further comprises a bag body 3 made from a certain thickness of strong and tough fabric ( for example , canvass ) supported on the collapsible frame structure . the bag body 3 , when extended out , is shaped like a single open end container , having an opening 30 at one end , namely , the top end thereof . the bag body 3 is a double - layer wall structure . the first annular frame member 1 a is embedded in the double - layer wall structure of the bag body 3 around the opening 30 and secured thereto with stitches ; the third annular frame member 1 c is embedded in the double - layer wall structure of the bag body 3 around the closed bottom end of the bag body and secured thereto with stitches ; the second annular frame member 1 b is embedded in the double - layer wall structure of the bag body 3 between the first annular frame member 1 a and the third annular frame member 1 c and secured thereto with stitches ; the vertical support rods 2 a , 2 b and 2 c are embedded in the double - layer wall structure of the bag body 3 and stitched thereto at the selected locations . when the twist collapsible bag is extended out , the annular frame members 1 a , 1 b and 1 c are horizontally disposed at different elevations , and the vertical support rods 2 a , 2 b and 2 c are vertically disposed at different elevations and equiangularly spaced between each two adjacent ones of the vertically spaced annular frame members 1 a , 1 b and 1 c ( see fig6 ), thus , the collapsible frame structure supports the bag body 3 in shape for holding things . when not in use , twist the first annular frame member 1 a relative to the second annular frame member 1 b to bias the respective vertical support rods 2 a , 2 b and 2 c downwards ( see fig7 ), and then twist the second annular frame member 1 b relative to the third annular frame member 1 c to bias the respective vertical support rods 2 a , 2 b and 2 c downwards ( see fig8 ), thus , the twist collapsible bag is collapsed into a flat condition where the annular frame members 1 a , 1 b and 1 c are received together ( see fig9 ). when wishing to use the twist collapsible bag again , twist the collapsed twist collapsible bag in the reversed direction . in the aforesaid various embodiments of the present invention , each annular frame members can be made by bending a metal wire rod into a circular shape and then fixedly fastening the two ends of the metal wire rod together by means of welding or with an adhesive . alternatively the annular frame members can be injection - molded from plastics . although particular embodiments of the invention have been described in detail for purposes of illustration , various modifications and enhancements may be made without departing from the spirit and scope of the invention . accordingly , the invention is not to be limited except as by the appended claims .
| 1Performing Operations; Transporting
|
for clarity , the same elements have been designated with the same reference numerals in the different drawings and , as usual in the representation of integrated components , the various drawings are not to scale . further , only those steps which are useful to the understanding of the present invention have been shown in the drawings and will be described hereafter . in particular , the forming of possible active circuits has not been described in detail , the present invention being compatible with any conventional technique . the present invention will be described hereafter in relation with an example of the forming of a tridimensional capacitance , of a well or trench forming a substrate contact area , and of a dielectric insulating trench in a substrate of silicon - on - insulator type ( soi ). however , the present invention more generally applies whatever the type of concerned substrate ( solid or not ) and whatever the destinations of the wells and / or trenches ( insulating or conductive ) formed in this substrate , provided that at least two of these wells or trenches have different destinations requiring , after etching , distinct steps . fig1 to 8 are very simplified cross - section views of trench and well manufacturing steps in an soi substrate according to an embodiment of the present invention . it is started from a thin single - crystal silicon substrate 1 , for example , of type n , on an insulating layer 2 ( for example , silicon oxide ) supported by a wafer w ( for example , made of silicon ). active areas ( not shown ) are likely to have been previously formed in substrate 1 . in a first step ( fig1 ), an insulating layer 3 , for example , silicon oxide ( sio 2 ), is deposited ( or thermally obtained ) on the upper surface of substrate 1 . then , a masking and a deep etch are performed to dig wells and trenches 4 , 5 , and 6 . for example , well 5 and trench 6 have a same depth , d 1 , reaching layer 2 , while trenches 4 have a smaller depth , d 2 . such different depths can be obtained in a same anisotropic etch step by providing for trenches 4 to have a width l 2 smaller than width l 1 of well and trench 5 and 6 . for example , widths l 1 and l 2 respectively are on the order of 1 . 2 μm and of 0 . 8 μm . trenches 4 are , for example , intended to form a tridimensional capacitance ; in top view , this might be trenches in the form of parallel strips or an array of wells . well 5 is intended for a substrate contact area ; in top view , this may be a local well , a strip - shaped trench , or yet a peripheral trench . trench 6 is intended to form a dielectric insulation area ; in top view , it will be a peripheral trench . in a second step ( fig2 ), an oxidation is carried out ( for example , a thermal oxidation ) to form an oxide layer 7 in the walls of the wells and trenches . this oxide layer is also formed in the bottom of trenches 4 which do not reach layer 2 . as a specific example of embodiment , layer 7 has a thickness on the order of from 0 . 1 to 0 . 2 μm . in a third step ( fig3 ), a silicon nitride layer 8 ( si 3 n 4 ) is deposited over the entire structure . layer 8 will be used as a stop layer for the different subsequent etchings and covers the walls and the bottom of cavities 4 , 5 , and 6 . the thickness of the silicon nitride layer is , for example , approximately 0 . 01 μm . in a fourth step ( fig4 ), a silicon oxide layer 9 , relatively thick as compared with layers 3 and 7 , is deposited by non - conformal deposition over the entire structure . the thickness of layer 9 is at least equal to half the width , preferably approximately equal to the width , of the widest trenches and wells ( well 5 and trench 6 in this example ). layer 9 forms caps or plugs at the top of all the trenches and wells . preferably , the cavities formed according to the present invention have a maximum width of approximately 2 μm and layer 9 is then deposited with a thickness slightly greater than 1 μm . any non - conformal deposition technique is appropriate to implement this fourth step , for example , a plasma - assisted chemical vapor deposition ( pecvd ) or a physical vapor deposition ( pvd ). in a fifth group of steps ( fig5 ), thick layer 9 is opened at the level of well 5 to make it accessible . nitride layer 8 is then eliminated by wet etch from the walls and the bottom of well 5 and oxide layer 7 is eliminated by wet etch from the walls of well 5 . then , the walls are doped , for example , by phosphorus diffusion , to form a heavily - doped n - type layer 10 . in a sixth step ( fig6 ), a new thick oxide layer 11 is non - conformally deposited to close well 5 . in a seventh step ( fig7 ), layer 11 above well 5 and layers 9 and 11 above trench 6 are etched to make well 5 and trench 6 accessible . layer 9 could be directly opened above trench 6 without closing back hole 5 . however , the etching of silicon oxide 9 would also etch silicon oxide 3 at the bottom of the hole , which would then no longer be protected . it is thus preferred to close well 5 with layer 11 to prepare a simultaneous etch without going too far . at this step , the silicon nitride may be removed by wet etch . well 5 and trench 6 are then integrally filled by conformal deposition to obtain in this well and this trench fillings 15 and 16 . filling material 16 of trench 6 may indifferently be conductive or insulating , the insulation being performed by layers 7 and possibly 8 . however , since filling material 15 of well 5 must be conductive , the same conductive material , for example , phosphorus - doped polysilicon , is used . the surface localization of this polysilicon may be performed by a planarization technique . the forming of an insulation trench and of a substrate contact area has thus been completed . in an eighth step ( fig8 ), thick oxide layers 9 and 11 are etched at the level of trenches 4 . silicon nitride layer 8 is used as an etch stop layer protecting the trenches and is removed once the silicon oxide has been completely eliminated . the forming of the capacitance is conventional . for example , the first electrode is formed by a first polysilicon layer 12 deposited on the walls and on the bottom of trenches 4 . layer 12 is covered with an insulating layer 13 , for example , silicon nitride . then , a polysilicon layer 17 is deposited again to form the second electrode , and fill the trench . a multidimensional capacitance 18 is thus obtained . according to a variation , thick oxide layer 9 , deposited at the fourth step ( fig4 ) of the above - described sequence , is also used as an etch mask for the case where the respective etchings of the trenches and of the wells only have a common portion due to too high a depth difference . an advantage of a non - conformal deposition in the trenches and wells to be closed is to avoid the cleaning steps to deoxidize the deep trenches and wells . another advantage of the present invention is that it enables forming at least one common etch portion which is a particularly long step in the trench and well forming , while these trenches and wells have different final destinations . of course , the present invention is likely to have various , alterations , improvements , and modifications which will readily occur to those skilled in the art . in particular , three specific types of wells and trenches having specific functions have been described herein . wells and trenches having other functions may be provided , other types of wall layers and other filling types may be provided . the practical implementation of the present invention based on the functional indications given hereabove and by using techniques currently used in the microelectronics is within the abilities of those skilled in the art . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and the scope of the present invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the present invention is limited only as defined in the following claims and the equivalents thereto .
| 7Electricity
|
[ 0026 ] fig1 shows one embodiment of the application apparatus 10 of the present invention , which is comprised substantially of a base body 12 and an application element or applicator 14 which may be carried by the base body 12 , but which is removed during use . the base body 12 comprises a socket 16 which projects upwardly from a base plate 18 when the parts are in their normal working position shown in fig2 . a channel 20 , configured as a capture rim , is disposed adjacent the socket 16 and captures the remnants of the substance which are occasionally spilled as the applicator 14 is moved away from the socket 16 . the base plate 18 is , in the illustrated embodiment , configured slightly asymmetrically . the socket 16 is disposed in the rear half of the base plate and is encircled by an edge of the base plate 18 which is comprised of a comparatively small width of , for example , 2 to 10 mm . in contrast , the front half of the base plate is substantially enlarged . it comprises , in the illustrated embodiment , an annular recess defining a grip region 22 . the front half forms a projection , as viewed with respect to the socket 16 , and extends in a substantially semi - annular shape having a width and depth of approximately the same dimension . the configuration of the one embodiment of the application apparatus permits the area around the socket 16 , which is available for hand - gripped movement of the application apparatus in narrow quarters such as , for example , in the proximity of the mouths of patients , to be maintained slim and small . due to the lateral or side widening of the projection of the base plate 18 in the grip region 22 , a set down position stability is nonetheless ensured . it is to be understood that the grip region 22 can be configured in any suitable desired manner such as , for example , of a right angled shape or a quadratic shape , each such shape having rounded - off corners . also , it is possible to provide , in lieu of a closed grip plate , a grip plate having through apertures . the socket 16 of the one embodiment of the application apparatus comprises a first receptacle 24 and a second receptacle 26 as can be seen particularly well in fig2 . the first receptacle 24 is provided with an insert 28 . the insert 28 is — as can be clearly seen in fig2 — inserted in a flush manner into the socket 16 . the insert comprises a bulging , substantially deep extent which , in accordance with the invention , is designated for the receipt of a fluid 30 . the fluid 30 is retained solely in the lower half of the first receptacle 24 , which is configured as a bulging depth receptacle , while the upper half of the first receptacle remains unfilled . the first receptacle 24 is , before deployment of the substance , closed off in a sealed manner by a cover foil 32 . the cover foil is fused to the insert in a conventional annular ring configuration . the cover foil comprises a grip tab or latch 34 which extends to the grip region 22 and which permits tearing or pulling off of the cover foil 32 . the first receptacle 24 has approximately double the diameter of the second receptacle 26 . the second receptacle 26 is configured for the insertion thereinto of the applicator 14 and is correspondingly configured for this purpose . the second receptacle comprises a substantially cylindrical cross - section and is configured in the manner of a blind hole . the second receptacle has a height / diameter relationship of approximately 4 : 1 , whereby it is to be understood that the exact configuration can be adjusted through a wide range to accommodate the operational requirements . in the illustrated embodiment , the applicator 14 includes a neck 40 intermediate a widened element 36 , which serves as the guide region , and a working end 38 , the neck 40 having an outer diameter which fits exactly flush in the second receptacle 26 and which , upon insertion of the applicator 14 into the second receptacle 26 , cooperates with the widened element 36 to seal off the upper end of the second receptacle 26 . the working end 38 of the applicator 14 is provided with a substance transfer element 42 which can be configured in any suitable desired manner . for example , the substance transfer element 42 can be configured as a brush , as bristles , as flocking , or as a sponge , and is preferably coated with a component of the substance which is to be applied . upon dipping or submersion of the working end 38 of the applicator into the fluid 30 , a chemical reaction occurs between the component of the substance which has previously been applied on the working end 38 of the applicator and the fluid 30 such that the chemical reaction results in the creation of the desired substance to be applied . the applicator 14 is configured in an ergonomically favorable manner while , nonetheless , having a slim shape . in this connection , the applicator includes a gripping end in the form of a shaft 44 which is grippable by hand . in connection with the use of the application apparatus 10 , the application apparatus 10 is initially disposed onto a base or counter . the socket 16 is held between two fingers and , via gripping and pulling the latch 34 , the cover foil 32 is pulled off . the securement force which retains the insert 28 in the socket 16 is chosen to be of a sufficient magnitude such that the insert remains in the socket during pulling off or removal of the cover foil 32 . the applicator 14 is then removed from the second receptacle 26 and is disposed into the first receptacle 24 . the dimensions of the applicator 14 and the first receptacle 24 are compatibly selected such that the applicator 14 can also be inserted and retained in a stable manner in the first receptacle 24 . in this connection , it is advantageous to maintain the configuration of the first receptacle 24 as a relatively slim configuration — that is , with a comparatively large height / diameter relationship . alternatively , it is also possible to select the height of the first receptacle 24 such that , upon insertion of the applicator 14 into the first receptacle , the applicator lies against the region of the widened element 36 such that the applicator 14 is supported in a favorable manner from the side . preferably , while in this position , the application apparatus can be brought into proximity of the application location — that is , in proximity to the mouth of the patient , via gripping of the grip region 22 or the shaft 44 between the thumb and index finger of , for example , the left hand of the user . the substance which has now been mixed in its final form via the reaction of the fluid 30 with the component on the substance transfer element 42 can now be transferred to the application location by means of the applicator in an ergonomically favorable manner from a position immediately adjacent the application location . following the application of the substance onto the application location , the application apparatus 10 can again be placed onto the planar base or counter . in order to avoid a drying out of the substance during the intermediate storage of the substance , the applicator 14 is inserted into the second receptacle 26 wherein it is sealed off against the exterior . the first receptacle 24 also permits the storage therein of the applicator . as can be seen from fig2 the first receptacle ( 24 ) and the second receptacle ( 26 ) are spaced from one another and each has a central longitudinal axis with the central longitudinal axes of the first receptacle ( 24 ) and of the second receptacle ( 26 ), preferably , being substantially parallel to one another . preferably , a substantially thick aluminum foil is used as the cover foil 32 of the first receptacle , which foil should not be an elastically deformable foil such as the foil of the type used for a compound foil application , in order to facilitate a re - closing of the receptacle . alternatively , in connection with , for example , the use of a compound foil having a comparatively good tearing resistance in relation to its material strength , an adhesive edge can be formed between the access aperture of the first receptacle 24 and the cover foil to thereby make possible a short term intermediate storage capability . in a further embodiment of the application apparatus of the present invention , a weld seam in an annular shape is disposed between the cover foil 32 and the insert 28 and is encircled by an adhesive seam between the cover foil 32 and the socket 16 . in this configuration , a re - closing of the receptacle is possible . this configuration ensures that dislodged portions of the adhesive seam are prevented from contaminating the retained fluid 30 during long term stockage of the application apparatus while nonetheless permitting an intermediate closure of the application apparatus in connection with a premature storage event as a result of less than complete consumption of the substance . while a preferred form of this invention has been described above and shown in the accompanying drawings , it should be understood that applicant does not intend to be limited to the particular details described above and illustrated in the accompanying drawings , but intends to be limited only to the scope of the invention as defined by the following claims . in this regard , the term “ means for ” as used in the claims is intended to include not only the designs illustrated in the drawings of this application and the equivalent designs discussed in the text , but it is also intended to cover other equivalents now known to those skilled in the art , or those equivalents which may become known to those skilled in the art in the future .
| 0Human Necessities
|
in a general aspect , the invention is an immunoassay for an analyte ( which analyte may be one of several analytes being tested for in the immunoassay ), said immunoassay a process that comprises the steps of : 1 ) reacting a sample with an antibody preparation , said sample comprising an unknown amount of analyte , said antibody reactive against said analyte , 2 ) reacting a known amount of standard with an antibody preparation of the same specificity as that used in step ( 1 ), it being required that the standard is a compound that is immunoreactive with the antibody preparation , 3 ) calculating the amount or an upper or lower limit to the amount of analyte present in the sample used in step ( 1 ), wherein the analyte is a compound that comprises at least two fused benzene rings , ( and , if the analyte consists of rings in addition to the two fused benzene rings , then preferably there are not more than six rings , and each of the additional rings is either a six atom - ring , such as benzene , or a five atom - ring such as cyclopentane , the atoms of the additional rings being selected from carbon , oxygen , nitrogen , and sulfur ), wherein a benzene ring in the analyte may be substituted at one or more of its six carbon atoms , wherein any substituent on said benzene ring that is not i , cl , br , oh , -- ch 3 , or -- no 2 , has a backbone chain that does not have more than six atoms , wherein either the standard is a compound with the structure ## str1 ## wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , and r 10 , are substituents , wherein one or two of said substituents are not h ( i . e ., not hydrogen ) and the other substituents are h , and a substituent that is not h is either oh , coh ( i . e ., carboxaldehyde ), ch 2 oh , ch 2 ( ch 2 ) x oh , co 2 h , nh 2 , cn , so 3 h , no 2 , or ## str2 ## wherein the leftmost carbon is the point of attachment to the phenanthrene moiety ( a substituent that is not h is preferably either oh , coh , ch 2 oh , or ch 2 ( ch 2 ) x oh ), or the standard is a compound with a structure ## str3 ## wherein x is an integer between 1 and 12 ( preferably between 1 and 6 ). the positions on the phenanthrene moiety are numbered in the following manner : ## str4 ## in a particular embodiment , step ( 3 ) of the immunoassay above comprises three steps , 3a , 3b , and 3c : 3a ) quantitating the amount of the antibody preparation that reacted with the sample in step ( 1 ), 3b ) quantitating the amount of the antibody preparation that reacted with the known amount of standard in step ( 2 ), and 3c ) utilizing the amounts quantitated in steps ( 3a ) and ( 3b ) and the known amount in step ( 2 ) to calculate the amount or an upper or lower limit to the amount of analyte present in the sample used in step ( 1 ). in a particular embodiment , the immunoassay of the invention comprises reacting an antibody preparation with the analyte , said antibody preparation prepared by using an immunogen that comprises both anthracene and chrysene linked to a carrier ( preferably a protein ) or carriers . preferably the analyte has a 50 % b / bo that is not more than four times the 50 % b / bo of phenanthrene and not less than one fifth the 50 % b / bo of phenanthrene . the immunoassay is particularly useful when the analyte is part of a mixture selected from the group , creosote , diesel fuel , fuel oil ( 1 , 2 , 3 , 4 , 5 , 6 ), coal tar and home heating oil . in a preferred embodiment of the invention , the immunoassay is one wherein the standard is a substantially pure preparation of a single compound . however , the standard may , for example , be a mixture of one or more substantially pure compounds , said mixture constructed by mixing together portions of substantially pure preparation of said compounds . a substantially pure preparation of a compound is one in which substantially all of the compounds have the same structure . a substantially pure preparation is therefore different from home heating oil or other mixtures of compounds . the immunoassay of this invention is an assay for an analyte that may be one of several analytes detectable in the assay . the fact that the immunoassay can test for more than one analyte at the same time is because of the crossreactivity of the antibody used in the assay . in example 2 , below , a number of pahs will be seen to have reactivity to the antibody used in the immunoassay . ( such cross - reactivity occurs in pah immunoassays in general , not just the one exemplified herein .) therefore , if the nature of the analyte in the sample is unknown , then for each possible analyte one can only assign an upper limit to the concentration of that analyte . alternatively , for example , if the color ( or other response ) generated in a competitive immunoassay is greater than the amount generated by a standard then the assay provides a lower limit ( that of the standard ) to the amount of analyte . for many purposes , however , such information is sufficient to determine the extent and degree of contamination , to delineate pollutant plumes in ground water , to monitor well placement , and for preliminary identification and quantitation of pollutants . a highly preferred standard is phenanthrene - 9 - carboxaldehyde , which is commercially available from aldrich chemical company , milwaukee , wis . and chem service , west chester , pa . the standards chosen for superior stability are ones expected to show both cross - reactivity with the antibody and good solubility in the co - solvents used to store them . the immunoassays to which the present invention is applicable include : ( 1 ) competition assays where the analyte competes with a detectable conjugate ( e . g ., as used in the examples , an antibody - reactive moiety linked to an enzyme that can catalyze a reaction generating a colored compound ) for binding sites provided by an antibody and detection is accomplished by measuring the decrease in the amount of detectable conjugate bound to the antibodies ; ( 2 ) non - competition assays , where the analyte does not have to compete for such binding sites and the antibody is labelled with a detectable label ; ( 3 ) sandwich assays , where one anti - analyte antibody acts as a bridge to bind the analyte to a solid phase , and detection is accomplished with a detectably - labelled second anti - analyte antibody that is allowed to attach the solid phase - bound analyte ; or ( 4 ) any other immunoassay format . indeed the term &# 34 ; immunoassay &# 34 ; is intended here in a very general sense and is any assay in which an antibody specific for an analyte of interest is used . nevertheless , for the smallest analytes , sandwich assays may be difficult because of the need for two antibody binding sites . the antibodies may be polyclonal or monoclonal . the use of hybridomas to create monoclonal antibodies is well known in the art . the fact that polyclonal antibodies against a compound can be created is an indicator that a monoclonal antibody against that compound can be created . detectable labels include enzymatic , fluorescent , radioactive , and chemiluminescent labels . the labels may be linked directly to other molecules of interest , such as antibodies , or indirectly by streptavidin - biotin linkages or other linkages . the labels may be bound directly to the antibodies or conjugates , or alternatively , be generated from substrates by enzymes attached to antibodies or substrates . preparation and structure of the immunogen used to make the antibodies used in the examples 2 - succinamidoanthracene was synthesized as follows : 2 - aminoanthracene was reacted with succinic anhydride in dioxane at 90 ° c . for 3 hours . on cooling to room temperature , the crystals formed were collected by suction filtration . the product was 2 - succinamidoanthracene . 6 - succinamidochrysene was synthesized as follows : 6 - aminochrysene was reacted with succinic anhydride in dioxane - dmf ( 4 : 1 ) at 60 °- 70 ° c . for 4 hours . water was then added and the solution allowed to stand at room temperature ( about 20 ° c .) overnight . the solid obtained was collected by suction filtration . the product was 6 - succinamidochrysene . the ligand ( 0 . 6 mmole ), either 2 - succinamido anthracene or 6 - succinamido chrysene in 10 ml of dry dimethylformamide (&# 34 ; dmf &# 34 ;), was treated with 2 . 4 ml of 0 . 25m triethylamine . the solution was cooled in ice - water , then 2 . 4 ml of 0 . 25m iso - butyl chloroformate was added and after 10 min the reaction solution was removed from the ice - water bath . after a total of 30 min of reaction time , the solution was added dropwise to a stirred and ice - cold solution of 300 mg carrier protein dissolved in 45 ml of 0 . 2m sodium borate , ph 8 . 7 and 30 ml of dmf . cooling was maintained in an ice - water bath . the addition of the activated ligand required about 10 min . one hr after the complete addition , the solution was removed from the ice - water bath and stirred at room temperature another 2 hr . dialysis was carried out against 0 . 1m sodium borate , ph 8 . 7 , and then against two changes of water , all at 4 ° c . the product was freeze dried . the immunogens were injected into rabbits and the antibodies were prepared as follows : the immunogen was dissolved or suspended in sterile saline to a concentration of 4 mg / ml . it was mixed with an equal amount of freund &# 39 ; s complete adjuvant and then emulsified . on day 1 , a total of 0 . 5 ml of the emulsion was injected into the hip muscle of the rabbit and a control bleed was done . on day 20 , the back of the animal was shaved and , in 6 - 8 sites , a total of 0 . 5 ml of emulsion was injected . on day 30 , a test bleed was done . on day 45 , the immunization of day 20 was repeated . on day 55 , a test bleed was done . the immunization described for day 20 is repeated at 30 - day intervals using freund &# 39 ; s incomplete adjuvant . the interval is lengthened if antibody production was inadequate or the animal was distressed . the animal was bled 7 - 10 days after immunization ( 30 - 50 ml ). bleeds were then screened for cross - reactivity to the various pahs and selected bleeds from the anthracene and chrysene immunized rabbits were pooled to obtain a pool of rabbit anti - pah antisera with broad specificity against pahs . the anthracene ligand , 2 - succinamido anthracene ( 10 mg ), was dissolved in 0 . 5 ml dmf and placed in an ice - bath . tributylamine ( 80 μl ), followed by isobutylchloroformate ( 40 μl ) were added to the ligand solution . stirring for 30 minutes at 8 °- 12 ° c . followed . the reaction mixture was then centrifuged to remove any precipitates . added ( 124 μl ) of the anhydride formed to 500 μl of a 3 mg / ml hrp ( horse radish peroxidase ) solution in carbonate buffer , ph 9 . 0 , and stirred overnight at 4 ° c . the reaction mixture was then centrifuged and the supernatant purified through a sephadex g - 25 column using pbs , ph 5 . 0 ( phosphate buffered saline , 25 mm phosphate , 150 mm sodium chloride , ph 5 . 0 ) as the mobile phase . attachment of the rabbit anti - pah antibodies to magnetic particles was done as follows : one ml of a 50 mg / ml suspension of biomag 4100 amine - terminated particles ( perseptive diagnostic , cambridge , mass .) was activated with 5 % ( v / v ) glutaraldehyde in 2 ml of 0 . 01m mes buffer , ph 6 ( mes is 2 - n - morpholine ) ethanesulfonic acid ) for 3 hours . unreacted glutaraldehyde was removed by washing four times with 5 ml of 0 . 01m mes buffer . goat anti - rabbit igg was diluted to an antibody concentration of 5 mg / ml and 1 ml was reacted with the activated magnetic particles by shaking for 16 hours . a 1m glycine solution was then used to quench any unreacted sites for 30 minutes . the particles were washed four times with 5 ml of tris buffered saline with 0 . 1 % bovine serum albumin ( bsa ), ph 7 . 4 and diluted in tris buffered saline with 0 . 1 % gelatin , ph 7 . 4 to achieve an iron concentration of 12 - 15 mg / ml . rabbit anti - pah antisera was then added at a 1 : 30 , 000 dilution and incubated for at least 30 minutes to allow coupling . the sample to be tested was added , along with the enzyme conjugate , to a disposable test tube followed by the addition of paramagnetic particles with analyte - specific antibodies attached . at the end of an incubation period , a magnetic field was applied to hold the paramagnetic particles ( with analyte and enzyme - conjugate bound to the antibodies on the particles , in proportion to their original concentration in the tube ) in the tube and allow the unbound reagents to be decanted . after decanting , the particles were washed with washing solution . the presence of analyte was detected by adding the enzyme substrate ( hydrogen peroxide ) and the chromogen ( 3 , 3 &# 39 ; 5 , 5 &# 39 ;- tetramethylbenzidine ). the enzyme - conjugate bound to the anti - analyte antibody catalyzes the conversion of the substrate / chromogen mixture to a colored product . after an incubation period , the reaction was stopped and stabilized by the addition of acid . since the conjugate was in competition with the unlabeled analyte for the antibody sites , the color developed was inversely proportional to the concentration of analyte in the sample . the anti - analyte antibody was a rabbit antibody covalently bound to paramagnetic particles , which were suspended in 150 mm tris , 150 mm nacl , 1 mm edta , 0 . 1 % gelatin , with 15 ppm active proclin ( manufactured by rohm and haas , purchased from supelco ), ph 7 . 4 . the enzyme - conjugate was in 25 mm sodium acetate , 150 mm nacl , 4 mm dns , 0 . 1 mm luminol , 0 . 1 % gelatin with 15 ppm active proclin , ph 5 . 0 . each standard , calibrated to have an immunoreactivity equivalent to specific total phenanthrene concentrations , was in 25 mm sodium acetate , 150 mm nacl , 0 . 1 % gelatin , with 15 ppm active proclin containing 25 % methanol , ph 5 . 0 . a solution containing 25 % methanol can be made , for example , by adding 25 ml of methanol to 75 ml of an aqueous solution containing the other ingredients needed to make the desired final solution . the diluent / zero standard was 25 mm sodium acetate , 150 mm nacl , 0 . 1 % gelatin , with 15 ppm active proclin containing 25 % methanol , ph 5 . 0 but without detectable analyte . the color solution used in the examples was obtained as a 3 , 3 &# 39 ;, 5 , 5 &# 39 ;- tetramethylbenzidine / peroxide system from kirkegaard and perry laboratories ( gaithersburg , md .). the washing solution was deionized water with 0 . 05 % triton x - 100 with 15 ppm active proclin . a photometer was used to absorb the absorbance at 450 nm . all reagents were allowed to come to room temperature and the antibody - coupled paramagnetic particles were mixed thoroughly just prior to pipetting into the assay . the magnetic separation rack consisted of two parts : an upper rack which securely held the test tubes and a lower separator which contained the magnets used to attract the antibody - coupled paramagnetic particles . during incubations , the upper rack was removed from the lower separator so that the paramagnetic particles remained suspended during the incubation . for separation steps , the rack and the separator were combined to pull the paramagnetic particles to the sides of the tubes . the rack was decanted by inverting it away from the operator using a smooth turning action so that the liquid flowed consistently along only one side of the test tube . while still inverted , the rack was placed on an absorbent pad and allowed to drain . the rack was lifted replaced gently onto the pad several times to insure complete removal of the liquid from the rim of the tube . the total time required for pipetting the magnetic particles was kept to two minutes or less . 1 . 250 μl of either standard or control was added to each tube . 2 . 250 μl of enzyme conjugate was added to each tube . 3 . the antibody - coupled paramagnetic particles were mixed thoroughly and 500 ul of them were added to each tube ( the stock solution was diluted to obtain a concentration of 12 - 15 mg iron / ml in 150 mm tris , 150 mm nacl , 1 mm edta , 0 . 1 % gelatin with 15 ppm proclin , ph 7 . 4 , and 500 ul was added to each tube ). 4 . tubes were vortexed for 1 to 2 seconds minimizing foaming . 5 . tubes were incubated for 30 min at room temperature ( 15 °- 30 ° c .). 6 . tubes in the magnetic rack were placed over a magnetic base for two minutes . 7 . the tubes were decanted and gently blotted briefly in a consistent manner . 8 . one ml of washing solution was added to each tube , the tubes are vortexed for 1 - 2 seconds , and the tubes were allowed to remain in the separation rack for two minutes . 9 . the tubes were decanted and gently blotted briefly in a consistent manner . 11 . the rack was removed from the separator and 500 μl of color solution was added to each tube . 12 . vortexing was done for 1 to 2 seconds minimizing foaming . 14 . 500 μl of stopping solution was added to each tube . 15 . the results were read at 450 nm within 15 minutes after adding the stopping solution . it is recommended that , in general , precision pipets capable of delivering 250 ul and 500 μl , and a 1 . 0 ml repeating pipet be used ; that reagents are added directly to the bottom of the tube while avoiding contact between the reagents and the pipet tip ; that clean pipets be used for each sample ; and that contact between reagent droplets on the tubes and pipet tips be avoided . to minimize loss of volatile compounds , the sample , conjugate and particle addition steps are performed in as timely a fashion as possible . a thermolyne maxi mix , scientific industries vortex genie , or equivalent vortex mixer may be used . data can , if desired , be analyzed by a commercially available data storer and analyzer , such as the ohmicron rpa - i analyzer available from ohmicron , newtown , pa . 18940 . such automated analyzers are used to make direct optical readings and use a microprocessor to convert optical readings to sample concentrations by comparing the results to those obtained with calibration curves . for use in the field , the sample to be tested for analyte concentration is water or diluted soil extract . water samples are collected in glass containers with teflon caps and diluted 3 : 1 with methanol ( 3 parts water and 1 part methanol ). soil samples may be analyzed by extracting them with calcium chloride in 100 % methanol and then diluting them 1 : 50 in diluent . samples containing gross particulate matter are filtered ( e . g ., with 0 . 2 μm anotop ® 25 plus , whatman , inc .) to remove particles . if the analyte concentration of a sample exceeds 50 ppb of phenanthrene or its immunoreactive equivalent , the sample is subject to repeat testing using a diluted sample . prior to assay , a ten - fold or greater dilution of the sample is recommended with an appropriate amount of diluent / zero standard and mixing thoroughly . although not used in the examples , a control sample is recommended for routine use of the immunoassay . the control , calibrated to have an immunoreactivity equivalent to a concentration of approximately 25 ppb phenanthrene , is in 25 mm acetate , 150 mm nacl , 0 . 1 % gelatin , 25 % methanol , with 15 ppm active proclin , ph 5 . 0 . the control sample can be used to determine whether the assay is providing the correct value for analyte concentration . a standard curve is constructed by plotting the % b / b o for each standard on vertical logit ( y ) axis versus the corresponding analyte concentration on a horizontal algorithmic ( x ) axis . the % b / b o for controls and sample will then yield levels in ppb of analyte by interpolation using the standard curve . standards were prepared by weighing 100 +/- 1 mg of phenanthrene and dissolving it in 10 . 0 ml of dmf ( dimethylformamide ). this 10 mg / ml solution was diluted 1 . 0 ml into 100 ml methanol for a 100 μg / ml solution . the 100 μg / ml solution was then diluted 1 . 0 ml into 100 ml of diluent ( 25 mm sodium acetate , 150 mm nacl , 0 . 1 % gelatin , 25 % methanol , 15 ppm proclin ) to provide a 1 μg / ml solution . standards were prepared from the 1 μg / ml solution volumetrically at 2 , 10 , and 50 ppb by dilution with diluent . phenanthrene has a 50 % b / bo of 16 . 5 ppb and phenanthrene - 9 - carboxaldehyde has a 50 % b / bo of 13 . 0 ppb . phenanthrene - 9 - carboxaldehyde solutions were prepared by first preparing a 10 mg / ml solution of that compound in dmf . this 10 mg / ml solution was then diluted 1 . 0 ml into 100 ml methanol for a 100 μg / ml solution . the 100 μg / ml solution was then diluted 1 . 0 ml into 100 ml of diluent to provide a 1 μg / ml solution from which standards were prepared at 1 , 7 . 5 and 50 ppb of phenanthrene - 9 - carboxaldehyde by dilution with diluent . stability studies were conducted by aliquoting prepared standards ( 0 , 2 , 10 and 50 ppb for phenanthrene and 0 , 1 , 7 . 5 and 50 ppb for phenanthrene - 9 - carboxaldehyde ) into 5 ml glass vials at a volume of 2 . 5 ml . the vials were then capped with teflon coated caps and crimped . the vials were then separated into five groups . each group was then placed at a different temperature (- 20 ° c ., 2 °- 8 ° c ., 20 °- 25 ° c ., 37 ° c . and 50 ° c .) in an upright position . standards were tested for b / bo at specified intervals by assaying each standard level in duplicate for each temperature . the results were then graphed as a function of time ( x ) versus b / bo ( y ) by temperature level . ( see fig1 - 5 ) ( b / bo is the absorbance at 450 nm observed for phenanthrene or phenanthrene - 9 - carboxaldehye at the specified concentration divided by the absorbance using diluent / zero standard instead of either phenanthrene or phenanthrene - 9 - carboxaldehyde .) the results show that the b / bo of phenanthrene - 9 - carboxaldehyde shows less change as a function of time of storage than the b / bo of phenanthrene does . the superior stability of the phenanthrene - 9 - carboxaldehyde solutions becomes more marked as the temperature of storage is increased . in fig2 . for example , there was an apparent 25 percent increase in the b / bo of the phenanthrene after 200 days of storage at 4 ° c . because , as illustrated in example 3 , there is not a linear relationship between b / bo and concentration of a standard ( or analyte ), a 25 % error in b / bo will result in considerably more than a 25 % error in the analyte concentration determined by the immunoassay . the cross - reactivity , of the antibodies used in the assay , for various hydrocarbons was tested and the results expressed both as 50 % b / bo and as least detectable dose ( ldd ) which is estimated as the dose needed to generate a b / b o of 90 %. ( if the mean absorbance value for the standard is 0 . 5 times the mean absorbance value for the diluent / zero standard then the % b / b o is 50 % and the concentration of standard used is the 50 % b / b o concentration . a b / bo of 90 % means b equals 0 . 9 times b o ). the results are tabulated in table 1 : table 1______________________________________cross - reactivity studies ldd 50 % b / bocompound ( ppb ) ( ppb ) ______________________________________phenanthrene 0 . 70 16 . 5fluoranthene 0 . 32 4 . 7benzo ( a ) pyrene 0 . 50 6 . 9pyrene 0 . 20 7 . 7chrysene 0 . 40 7 . 8anthracene 0 . 54 11 . 0indeno ( 1 , 2 , 3 - c , d ) pyrene 0 . 78 27 . 21 , 2 benzoanthracene 0 . 77 28 . 4fluorene 1 . 65 35 . 2benzo ( b ) fluoranthene 0 . 91 54 . 2benzo ( k ) fluoranthene 0 . 77 524______________________________________ an example of a curve plotting the % b / b o for a standard on vertical logit ( y ) axis versus the corresponding analyte concentration on a horizontal algorithmic ( x ) axis is shown in fig6 . the curve is for phenanthrene . the value for 50 % b / b o is 16 . 5 ppb . four environmental water sources ( two ground waters and two municipal waters ) were each spiked with four different amounts of phenanthrene then , using phenanthrene - 9 - carboxaldehyde as a standard , each sample was analyzed with the immunoassay for phenanthrene as if the phenanthrene concentration was unknown . for each amount of spiked phenanthrene , the mean of the phenanthrene value obtained with the immunoassay for the four samples was calculated , as was the standard deviation ( s . d .) and the % recovery . the results are shown in table 2 . table 2______________________________________recovery studiesphenanthrene mean s . d . % added ( ppb ) ( ppb ) ( ppb ) recovery______________________________________ + 5 . 0 5 . 09 0 . 58 102 + 7 . 5 8 . 13 0 . 56 108 + 20 . 0 21 . 46 2 . 47 107 + 40 . 0 40 . 91 2 . 99 102______________________________________
| 8General tagging of new or cross-sectional technology
|
detailed descriptions of one or more embodiments of the invention follow , examples of which may be graphically illustrated in the drawings . each example and embodiment are provided by way of explanation of the invention , and not meant as a limitation of the invention . for example , features or described as part of one embodiment may be utilized with another embodiment to yield still a further embodiment . it is intended that the present invention include these and other modifications and variations . fig1 is a perspective view taken from the left side from the ground standing upwind of the tethered wind turbine constructed in accordance with the invention . the funnel shaped front inlet ( 14 ) is shaped with an annulus ( 12 ) that directs the oncoming apparent wind into the interior . the lighter - than - air device is passively stabile . it has an elongated airfoil shape . stability is facilitated by , but not limited to , the overall shape of the lighter - than - air device , or in one embodiment , passive stabilizer aerodynamic surfaces such as non - articulating horizontal , vertical , v - shaped or ring - wing stabilizers . a lower portion of the invention has attachment brackets ( 18 ) that are used to connect the harness ( 20 ) and tether ( 22 ) to the main body casing ( 10 ). large quantities of wind pass through the inlet ( 14 ), the turbine area of the tethered wind turbine , finally exiting the invention through the outlet ( 16 ). the energy harvesting invention is lighter than air and thus remains aloft in various wind conditions . fig2 is a perspective view taken from the right side from the ground standing upwind of the tethered wind turbine constructed in accordance with the invention . the wind entering the inlet ( 14 ) passes over the energy converter . energy extraction is facilitated by an energy converter such as and for example a turbine ( 24 ) or an impeller rotor ( 26 ) or the like . in this embodiment turbine ( 24 ) is shown near the narrowest part of the hourglass - like internal shape . fig3 is a longitudinal cross sectional view of the tethered wind turbine drawn in accordance with the invention . both the interior and exterior surface profiles , as shown in this view , are designed to be as aerodynamically efficient as is feasible . in the preferred embodiment of this invention the ring - wing section profile optimally would have a very low coefficient of drag . a large portion of the physical aerodynamic shape of the tethered wind turbine is filled with a lifting gas ( 40 ), such as helium . this lifting gas is contained within sealed inflated structures ( 42 ) made from polymers such as aluminized polyester film , polyethylene , or other film . the entire tethered wind turbine may also use an exterior lightweight flexible or lightweight rigid exterior skin to act as a shape structure and to protect the tethered wind turbine from the deteriorating effects of ultraviolet solar radiation . one flexible film that would work well for this purpose in this invention is tedlar ( dupont ) film . a rigid material for the exterior could be composite material such as carbon fiber matrix or carbon nanotubes matrix . the tethered wind turbine has an intake flow concentrator nozzle ( 32 ) just to the interior of the leading edge annulus ( 12 ). there is a flow expansion nozzle ( 34 ) at the outlet ( 16 ) of the invention . between the concentrator and expansion nozzles there is an energy converter such as and for example a turbine ( 24 ) that energizes an electric generator ( 28 ). it is also envisioned , though not shown , that other types of energy converter devices could be used . for example , one concept envisioned in this invention is to directly convert the rotary motion into electricity and use it onboard the tethered wind turbine to separate water into hydrogen and oxygen through electrolysis , delivering the valuable gases to the ground station through a tubular tether ( or a multi - tubular tether ), without any conductive wires at all . the hydrogen could be stored in containment vessels on the ground and used for any number of useful purposes . the structure of the tethered wind turbine is achieved by several elements . the structural ribs ( 46 ) support the overall shape of the tethered wind turbine and spread the loads of the turbine &# 39 ; s ( 24 ) and generator &# 39 ; s ( 28 ) mass into the craft in a stable manner . in one embodiment , a light weight way to create the structure of the annulus ( 12 ) is shown , using an inflated toroidal structure ( 44 ) that is filled with pressurized lifting gas ( 40 ). there are many ways to achieve the necessary structure , and what is shown is meant to be an example of one embodiment of the invention . the rotor impeller ( 26 ) is fitted with a streamlined impeller nosecone ( 36 ) and impeller tail cone ( 38 ). the electric generator ( 28 ) can be any combination of magnetic rotor or magnetic stator designs , either brush or brushless , and made of a variety of materials . the preferred embodiment would use ultra - light - weight rare earth permanent magnets with brushless dc components and windings that could possibly consist of carbon nanotube hyper - conductive wires in place of copper to save even more weight . there are conductive generator output wires ( 76 ) connecting the generator to the harness ( 20 ). the harness ( 20 ) is secured to the tethered wind turbine at attachment brackets ( 18 ). said attachment brackets ( 18 ) could be hard mounted to the internal structure or physically attached or bonded to the outer skin of the tethered wind turbine . the harness ( 20 ) can be rigidly attached , or mounted in such as was as to allow controllable adjustments by mechanical servo - actuators . one embodiment of this feature , a harness pitch adjustor ( 50 ), is shown and is a way to control the tethered wind turbine &# 39 ; s angle of attack by lengthening or shortening the central member of a three point harness ( 20 ). the control box ( 48 ) is the central brain for the onboard functionality of the tethered wind turbine , controlling such as the harness pitch adjustor ( 50 ), the flight settings , the generator loading , and any aerodynamic control surfaces , etc . fig4 is a perspective front view of the tethered wind turbine and shows an embodiment of the invention that includes a vertical stabilizer ( 52 ) mounted at the top and to the rear of the craft . the full front of the impeller rotor ( 26 ) and impeller nose cone ( 36 ) are visible and are described visually as having 5 blades . any number of impeller rotor ( 26 ) blades would be acceptable and part of the intent of this invention . the outer casing ( 10 ) of the lighter - than - air is shown , as well as the flow concentrator nozzle ( 32 ) and the annulus ( 12 ). attachment brackets ( 18 ) secure the harness ( 20 ) to the tethered wind turbine . the harness ( 20 ) is also shown secured to the tether ( 22 ). fig5 is a perspective left side view of the tethered wind turbine . showing an embodiment built in accordance with the invention that uses a number of aerodynamic lifting and control surfaces to enhance the overall stability and performance of the wind energy extracting craft . vertical stabilizer ( 52 ) and horizontal stabilizers ( 56 ) act to further help keep the longitudinal axis of the turbine ( 24 ) aligned with the apparent wind direction . these aerodynamic surfaces can be either passive , or actively controlled with the use of stabilizer control surfaces ( 54 ). a wing ( 58 ) is shown in this embodiment and can add additional lift to the tethered wind turbine to help it remain at altitude even when the wind conditions attempt to blow the craft downwind and downward . wing control surfaces ( 60 ) are shown and help control roll as needed . these control functions are envisioned to be fully controlled by the onboard control module ( 48 ). fig6 a , 6 b , and 6 c show the tethered wind turbine as a system that is managed from a base shelter structure ( 68 ). this base shelter structure ( 68 ) would be pre - built and carried to the site or it could be built on the site . it would also be installed atop housing or buildings or concealed below grade . fig6 a is a left - side perspective with cutaway view of the tethered wind turbine and base shelter structure ( 68 ) showing the invention in operation . the tethered wind turbine is flying at a reasonable height above the ground , downwind of the base shelter structure ( 68 ), and is constrained by the tether ( 22 ). the craft can be expected to float freely downwind in any direction as a result of changes in true wind direction . the total airspace occupied by the tethered wind turbine in the long term can be described as an inverted cone emanating from the tether main attachment at the robotic control torus ( 72 ). the top diameter and half angle of the inscribed cone is dependent on many variables such as the total buoyancy force of the invention , maximum wind speed , amount of active flight controls used to maintain altitude , and active tether extension / retraction deployed , and turbine generator load levels . to send the tethered wind turbine to a higher or lower altitude while in flight , the tether ( 22 ) is unwound or wound - up on the tether retractor reel ( 74 ) by the tether retractor mechanism ( 64 ). the cutaway view of the base shelter structure ( 68 ) also shows a wish - bone launch arm ( 100 ) that swings up when the tethered wind turbine is about to be launched and also swings down when the craft is retrieved and tucked into the base shelter structure ( 68 ) for safe storage . this wish - bone launch arm ( 100 ) mechanism may be shaped differently , such as having one leg instead of the wish - bone shape , but all versions act as a lever to initially move the tethered wind turbine up out of the base shelter structure ( 68 ) or down within the its walls . the entire base shelter structure ( 68 ) sits on a site pad ( 98 ). fig6 b is a perspective cutaway view of the tethered wind turbine near the middle phase of the launching process , or the retrieving for storage process . in the latter , the tethered wind turbine has been pulled down out of the sky to a point where the harness ( 20 ) touches and interacts with the robotic control torus ( 72 ). it shows the base shelter structure ( 68 ) with its hinged bay doors ( 92 ) opened wide . the wish - bone launch arm ( 100 ) is in the upright position and the launch arm actuators ( 102 ) are fully extended . energizing the reel motor ( 66 ) causes the rotation of the tether retraction reel ( 74 ), which is bi - directional in this embodiment of the invention . it rolls the tether retraction reel ( 74 ) in one direction to wind - up ( retract ) the tether ( 22 ) and rotates the reel in the opposite direction to unwind the tether ( 22 ), allowing the buoyant tethered wind turbine to ascend upward into the airspace above . the control of the reel motor ( 66 ) is accomplished with the logic that is built into the retractor control module ( 62 ). also shown are the reel - to - power box cables ( 78 ) that deliver electricity from the tether ( 22 ) to the power control / conditioning box ( 70 ) where the electrical characteristics are tailored to meet desired output specifications of a particular application . power from the tethered wind turbine invention is delivered to the end use through the output plug box ( 96 ). fig6 c is a perspective left - side cutaway view of the entire tethered wind turbine and base shelter structure ( 68 ) as a system that has been put into the storage mode where the inflated casing ( 10 ) and other components are safe from excessive weather conditions such as lightning , turbulent high winds , and wintry blizzards . in this state , the tether ( 22 ) is fully wound - up by the tether retractor mechanism ( 64 ) onto the tether retractor reel ( 74 ). the wish - bone launch arm ( 100 ) is in the lower position and the launch arm actuators ( 102 ) are fully retracted . the hinged bay doors ( 92 ) are shown in the closed position . meteorological sensors ( 104 ) on the base shelter structure ( 68 ) monitor the air - space and keep the tethered wind turbine safely contained until conditions are appropriate for launching in the future . fig6 d is a perspective detail view of the tether ( 22 ) itself . within the outer casing ( 82 ) of the tether are two critical components . they are the main tensile members ( 84 ) and the electrical wires . both the positive conductor wires ( 86 ) and negative conductor wires ( 88 ) are sheathed in an insulation jacket that prevents short - circuiting and power drainage . ideally , the main tensile members ( 84 ) and the positive conductor wires ( 86 ) and negative conductor wires ( 88 ) would be comprised of carbon nanotubes materials . although these materials are not a requirement , the use of carbon nanotubes materials in these components of the tether ( 22 ) would greatly enhance the overall performance of the tethered wind turbine . that is because the tether ( 22 ) itself is a parasitic weight loss acting against the tethered wind turbine &# 39 ; s buoyancy . carbon nanotube materials would make the tether ( 22 ) itself many times lighter and allow the tethered wind turbine to fly much higher using less lifting gas ( 40 ). electrical conductance of nanotube wires would be many times higher than copper and would enhance overall efficiency greatly . in lieu of carbon nanotubes materials , many other materials would also work well . some examples are copper core conductors , spectra ™ fiber tensile members , kevlar ™ fiber tensile members , or polyester fiber tensile members . fig7 a , 7 b , and 7 c are longitudinal cross - sectional views that show how pitch attitude of the tethered wind turbine interacts with the apparent wind . in fig7 a the aerodynamic shape of the inflated casing ( 10 ) is a ring - wing that is in a neutral angle of attack . fig7 b shows the tethered wind turbine in a negative angle of attack ( 106 ). this maneuver is accomplished by various means . shown in this view the harness pitch adjustor ( 50 ) has let out some length of the central line of the harness ( 20 ) causing the buoyant rear end of the inflated casing ( 10 ) to be moved upward relative to the front end . in this state the flying ring wing is going to descend . another way to accomplish this negative angle of attack ( 106 ) is by using the aerodynamic control surfaces of the horizontal stabilizer ( 56 ) or the wing control surface ( 60 ). conversely , as is shown in fig7 c , the harness pitch adjustor ( 50 ) has pulled in the central line of the harness ( 20 ) causing the rear end of the inflated casing ( 10 ) to be moved downward relative to the front end . this positive angle of attack ( 108 ) would cause the flying ring - wing tethered wind turbine to ascend , and allow the energy harvesting turbine system to increase electrical output without as much loss of altitude . the higher loading of the turbine would mean more total drag on the impeller rotor ( 26 ), and a tendency to descend . this could be balanced - off or improved by calling for an even larger positive angle of attack ( 108 ) maneuver , and a tendency to ascend . fig8 a is a perspective left - side view of the tethered wind turbine showing how in one embodiment of the invention a tubular tail boom ( 110 ) could be used to mount rear stabilizer wing surfaces . fig8 b is a longitudinal cross - sectional view of the wind turbine of fig1 and 2 , showing how the fluted tail section ( 112 ) could be built to allow outlet air ( 114 ) to exit through slots in the tail boom section itself . fig9 a shows a longitudinal cross - section of the wind turbine of fig1 and 2 that has a elongated profile of the airfoil - shaped inflated casing ( 10 ) of the invention . fig9 b is a potential shape that embraces a very short longitudinal airfoil profile of the inflated casing that may be efficacious due to its large annulus ( 12 ) outside diameter relative to its turbine diameter and air outlet ( 16 ) outside diameter . a prominent feature of this embodiment of the invention is the large concentration ratio of the front inlet ( 14 ) flow concentrator nozzle ( 32 ). it appears the concentration ratio is nearly 6 to 1 , or higher . fig9 c shows almost the opposite inlet ( 14 ) style . that is , it shows a very minor attempt to concentrate the wind at the inlet ( 14 ) flow concentrator nozzle ( 32 ). the concentration ratio is nearly 1 to 1 . fig9 d is a longitudinal cross - sectional view of yet a different section shape and construction style . in this view the bulk of the lifting gas ( 40 ) within the inflated casing ( 10 ) is located in the annulus ( 12 ) of the front inlet ( 14 ). the remainder of the flow concentrator nozzle ( 32 ) in this embodiment is analogous to a wind - sock , comprising a thin cone - shaped wall , whether of rigid or flexible material . as with a wind - sock , the cone - shape become more pronounced by the wind flowing through it , all of these gas inflated structures and many more could be designed and manufactured without materially or significantly diverging from the scope of this invention . fig1 and fig2 show the component of the tethered wind turbine invention that extracts energy from wind currents . the inflated casing ( 10 ) is filled with helium or other lifting gas ( 40 ) which makes the tethered wind turbine lighter than air . it also is shaped to scoop - up and aerodynamically force large amounts of air to move through its own interior . the inflated casing ( 10 ) is shaped like an airfoil wing that has been bent all the way around into a ring . at the front , a funnel - shaped inlet ( 14 ) is surrounded with an annulus ( 12 ) at the leading edge . together they direct oncoming apparent wind into the central part of the ring - wing shape and into a smaller and smaller opening . the wind then passes into the mouth of a rotary engine turbine ( 24 ), and finally exits out the rear outlet ( 16 ) to return to the atmosphere . the flow concentrator nozzle ( 32 ) gradually directs a large cross - sectional area of slower - moving air to a smaller cross - sectional area , but higher velocity duct full of air . the laws of aerodynamics say that air moving two times faster will carry eight times more energy . it is apparent that an aerodynamically shaped device that can concentrate and accelerate the apparent wind in a controlled manner will be very helpful in extracting energy from the wind . it is the intent of this invention to use the flow concentrator nozzle ( 32 ) to make a large cross - sectional area of slower - moving air to move through a smaller cross - sectional area at a higher velocity through the turbine ( 24 ). this reduces the size of the physical hardware of the turbine ( 24 ) and enables it to operate at a higher speed without the need for an up - ratio gear - box . fig3 shows that the turbine ( 24 ) is mounted centrally in the inflated casing ( 10 ). air currents can flow through it imparting energy to the turbine ( 24 ). the kinetic energy of a flowing fluid ( 30 ), such as flowing wind or running water or the like , is converted into mechanical or electrical energy by causing the blades of the impeller rotor ( 26 ) on the turbine ( 24 ) to rotate as it passes through . output of electrical energy harvested from the wind will be maximized when the wind throughput of the turbine is maximized . so every effort to streamline the interior surfaces is very important and has been attempted to be shown in this preferred embodiment of the invention . in most places on earth , the wind speed , and thus potential kinetic energy that could be harvested is distributed in a gradient relative to ground , which could be described as increasing as one moves to a higher altitude . unlike most windmills currently available , the tethered wind turbine of this invention operates without a tower . it simply does not need a tower . the preferred embodiment of this invention uses a tether ( 22 ) to hold the inflated casing ( 10 ) and its turbine ( 24 ) from sailing downwind with the force of available winds . the tethered wind turbine also has no need for a complicated rotating nacelle as is currently used in the prior art to align properly with the direction of the true wind . the tethered wind turbine has a unique ability to keep itself aligned properly to the wind automatically , even in changing wind conditions . the inflated casing ( 10 ) will naturally drift to the most downwind position in the sky , being restrained only by the tether ( 22 ). just like the rudder on an airplane , the invention directs itself in response to the changing wind &# 39 ; s direction . fig6 a is a view looking downwind at the invention while it is operating . the tether ( 22 ) can be let - out , or pulled - in , in a controlled way so as to position the inflated casing ( 10 ) in the most favorable part of the natural wind velocity gradient . that is an altitude where the energy extracted from the wind can be maximized . as is shown in fig6 a , 6 b , 6 c the tethered wind turbine invention uses a base shelter structure ( 68 ) to store the lighter - than - air device during inclement weather conditions , violent lightning , periods of non - use , or for routine maintenance . fig6 a shows the tether ( 22 ) after it has been let out and the hinged bay doors ( 92 ) are closed . the retractor control module ( 62 ) remains idle while the production of energy aloft in the turbine ( 24 ) proceeds uninterrupted . the electrical power sent down the tether ( 22 ) travels through the tether retractor mechanism ( 64 ), through the reel - to - power box cables ( 78 ), and into the power conditioner box ( 70 ). at this stage the electricity is adjusted to a form that is compatible with the end user electrical specifications and exits the system through the output plug box ( 96 ). fig6 b shows the tethered wind turbine in the middle stage of launching or retracting . at this stage the tether ( 22 ) is fully retracted , the wishbone launch arm ( 100 ) is in the upright position and the hinged bay doors ( 92 ) are wide open . if in launching mode , the tether ( 22 ) would be let out , the lighter - than - air inflated casing ( 10 ) would ascend slowly upward . if in the retracting stage , the robotic control torus ( 72 ) would rotate the inflated casing ( 10 ) until the craft aligned properly with the hinged bay doors ( 92 ) and then ready the system for final stage . fig6 c shows the final stage of the tethered wind turbine when the inflated casing ( 10 ) is in the completely stored mode . the wishbone launch arm ( 100 ) is in the lowered and horizontal position resting underneath the inflated casing ( 10 ). the hinged bay doors ( 92 ) are closed and the entire system is in standby mode . the preferred embodiment of the invention would have a smart logic circuitry built into it . the control module ( 48 ), shown in fig3 , would make many decisions about when , where and how to fly the tethered wind turbine . the onboard automatic - pilot feature of the control module ( 48 ) would send control voltage signals to various aerodynamic control mechanisms to tune the flight of the tethered wind turbine and thereby achieve a desired ascent trajectory and altitude . at launch , there would be software programmed to fly the lighter - than - air tethered wind turbine in a controlled , stable ascent . the tethered wind turbine &# 39 ; s ascension could be stable in zero - wind conditions , or , even in rough and gusty wind conditions . this auto - pilot feature to maintain straight and level flight during fluctuating of wind currents broadens the potential application to many geographic locations that otherwise may not have been feasible . controlling the angle of attack of the inflated casing ( 10 ) is essential for flight control . by controlling the angle of attack , the flying ring - wing - like tethered wind turbine would be able to ascend on command to a predetermined altitude to achieve the best position in a given environment . once at the favorable altitude the tethered wind turbine would electronically load - up the electrical generator ( 28 ) to increase electrical output . as shown in fig7 a , 7 b , 7 c one way this invention controls the angle of attack , the flight , and ultimately the altitude , of the inflated casing ( 10 ) is to change the characteristics of its attachment at the top of the tether ( 22 ). the attachment as shown in this embodiment of the invention utilizes a three - point flexible harness ( 20 ). it has a method to adjust it as so as to change the angle of attack and therefore the amount of lift on the inflated casing ( 10 ). it is the intent of this invention to use the tether &# 39 ; s ( 22 ) harness pitch adjustor ( 50 ) device to vary the overall amount of lift on the inflated casing ( 10 ) and thereby control the altitude it operates at . the harness pitch adjustor ( 50 ) does this by extending or reeling - in the center rear harness tension member with a servo motor mechanism . by adjusting the harness ( 20 ) attachment in the above described way the overall angle of attack and hence the total lift of the ring - wing - like inflated casing ( 10 ) is controlled . the desired altitude is either dialed into the control module ( 48 ) or determined automatically by a software algorithm that takes into account several variables . the benefit using the harness pitch adjustor ( 50 ) as envisioned in this invention to control angle of attack of the inflated casing ( 10 ), a larger amount of electrical output would be achieved with less loss of altitude . in the absence of any angle of attack flight controls such as the harness pitch adjustor ( 50 ), higher loading of the turbine ( 24 ) would mean increased drag on the blades of the impeller rotor ( 26 ), an increased total drag on the inflated casing ( 10 ), and a general tendency for it to descend . this suboptimal condition could be improved by the use of the harness pitch adjustor ( 50 ) of this invention , as described above . there is one balance of forces that naturally occurs with the tethered wind turbine invention . if winds escalate while the invention is operating , the overall forces increase on the inflated casing ( 10 ). the natural reaction is for it to be drawn farther downwind and arc - tangentially lower according to the radius struck by the length of tether extended at that time . other things remaining equal , the craft moves down to a lower altitude and hence a lower energy level in the natural wind velocity gradient . this will reduce forces on the inflated casing ( 10 ) and result in a convergence toward a natural equilibrium . the control module ( 48 ) also sends control signals to the tethered wind turbine &# 39 ; s electric generator ( 28 ) circuitry . for example , in favorable wind conditions the kinetic energy of the moving air flow develops lift on the turbine ( 24 ) blades , turning the impeller rotor ( 26 ) and electric generator ( 48 ). the only thing resisting the impeller rotor ( 26 ) turning motion is the amount of load , or field resistance , that the electric generator ( 28 ) demands at a given point in time . the load setting is a controllable variable that the control module ( 48 ) can monitor and adjust . the tethered wind turbine utilizes the generator loading configuration to maximize power output but at the same time retain adequate air stability and altitude . the more load levied on the impeller rotor ( 26 ), the more overall wind drag will be developed on the craft . the total induced drag on the lighter - than - air inflated casing ( 10 ) shows up as a tensile force on the tether ( 22 ) along a vector in the downwind direction . the tension in the tether ( 22 ) is resisted by a mass below . the control module ( 48 ) ideally should balance power output versus positional stability and drag management . the control module uses electronic hardware and software as is necessary to accomplish this goal . the control module ( 48 ) also may condition the electricity that is output by the electric generator ( 28 ). in may invert the voltage up to a higher voltage for the purpose of efficiently transferring the generated power down the tether ( 22 ) to the base shelter structure ( 68 ) below . there would be lower line losses experienced if the electricity traveling down the tether ( 22 ) were voltage - adjusted higher . the control module ( 48 ) would handle this function . in summary , the control module ( 48 ) of the tethered wind turbine performs the following functions : controls straight and level flight of the inflated casing ( 10 ) using aerodynamic control surfaces controls straight and level flight of the inflated casing ( 10 ) using harness pitch adjustor ( 50 ) controls load levels applied to electric generator ( 48 ) converts or inverts voltages as necessary to optimize efficient energy transfer down the tether ( 22 ) there are actually two ways this invention proposes to accomplish varying the angle of attack so as to control the flight and altitude of the inflated casing ( 10 ). the first way to would be to use automatic electrical control of the harness pitch adjustor ( 50 ) as described above . in an additional embodiment of the invention , angle of attack would be controlled using additional wings , stabilizers and other aerodynamic control surfaces . the net affect would be increased control of total lift of the inflated casing ( 10 ) and an ability to control its altitude . fig5 shows one such additional embodiment of the tethered wind turbine invention using aerodynamic control surfaces of many types . these include any and all types of active or passive in - stream surfaces as are typically found on , but not limited to , conventional aircraft such as a horizontal stabilizer ( 56 ), vertical stabilizer ( 52 ), stabilizer control surface ( 54 ), and any type of wing ( 58 ), or wing control surface ( 60 ). it is unlikely that all of these would be necessary . it is also the intent in this additional embodiment of the invention , for inflated casing ( 10 ) to use its aerodynamic surfaces to soar to higher heights than would otherwise be possible in an effort to counteract the craft &# 39 ; s downward altitude tendency caused by power extraction induced drag of the turbine ( 24 ). it should be noted that the inflated casing ( 10 ) of the tethered wind turbine could be secured to ground through a less sophisticated tether system and it will still be a valuable energy extracting machine in the sky . or it could be outfitted to operate somewhat autonomously with its own internal smart - chip controller and sophisticated controls for its harness pitch adjustor or its aerodynamic wing control surfaces ( 60 ). the latter would probably come closer to maximizing energy production efficiency , but would likely cost more to manufacture . it is a trade - off . the tethered wind turbine invention as described in this document leaves room to cover both . it is envisioned that an additional embodiment of the invention would have a micro - meteorological analysis module ( 104 ) onboard that could automatically obtain samples and or use sensors to collect enough data in real time to be able to judge the likelihood of lightning or other hazardous weather conditions . with knowledge of the meteorological facts , including but not limited to , data on humidity , precipitation , temperature , atmospheric pressure , the presence of ozone , or audio - visual signatures , the tethered wind turbine could be programmed to do certain things . it would run the data through a decision formula that could prompt actions such as immediately descending the inflated casing ( 10 ) to a safer altitude by reeling in the tether ( 22 ). other times in truly inclement weather , it could fully retract the invention to the safety of the base shelter structure ( 68 ). this could all be done automatically and would prevent catastrophic failures as otherwise could be experienced from such hazards as lightning strikes , tornado - like wind currents , or destructive hail . the meteorological analysis module ( 104 ) could optionally be located in the base shelter structure ( 68 ) or other place not onboard the inflated casing ( 10 ). fig8 a shows an alternative design of the tethered wind turbine that utilizes a very simple boom and rear stabilizer arrangement . it represents a direct and simple method of construction . fig8 b shows another more fanciful arrangement where the exit of air from the turbine ( 24 ) is through a number of slots in the sidewalls of the tail structure . fig9 a , 9 b , 9 c , and 9 d show how the tethered wind turbine invention could still perform as explained above but with different ring - wing cross - sectional profiles . fig9 a is an elongated version of the preferred embodiment of this invention . fig9 b is a more exaggerated version with the turbine ( 24 ) located very near to the air outlet ( 16 ) and the flow concentrator nozzle ( 32 ) exhibiting a larger concentration of cross - sectional area ratio . fig9 c shows a profile that has the turbine ( 24 ) located near the leading edge annulus ( 12 ) with a very small concentration of cross - sectional area ratio . fig9 d is profile with most of the inflated part reserved to the front annulus ( 12 ) itself . it can be seen that the tethered wind turbine of this invention : provides a new way to extract the kinetic energy from the wind . allows use of a smaller , lighter - weight , higher - speed turbine generator that does not need for an expensive and bulky up - ratio gearbox between the impeller rotor ( 26 ) and the electric generator ( 28 ). operates without the need for a tower . has no need for a complicated rotating nacelle to align rotating blades with the wind . uses lift generated from its overall shape or from horizontal wings so that it can operate higher aloft than would otherwise be possible while extracting energy from the wind . has a control module that can monitor flight and weather variables and then react to control trajectory , position , stability , altitude , generator loading levels and power output . has the capacity to retract the tether ( 22 ) and inflated casing ( 10 ) to a lower altitude or ultimately all the way into the base shelter structure ( 68 ) to avoid damage from lightning or severe weather . while embodiments of the present invention have been described with reference to the aforementioned applications , these descriptions of the embodiments are to be construed in a limiting sense . it shall be understood that all aspects of embodiments of the present invention are not limited to the specific depictions , configurations or dimensions set forth herein which depend upon a variety of principles and variables . various modifications in form and detail of the disclosed apparatus , as well as other variations of the embodiments of the present invention , will be apparent to a person skilled in the art upon reference to the present disclosure . it is therefore contemplated that the appended claims shall cover any such modifications or variations of the described embodiments as falling within the true spirit and scope of the present invention .
| 8General tagging of new or cross-sectional technology
|
fig1 shows a hand - held paste pump 11 having a turret - type nozzle or spout 13 at the top thereof . the nozzle includes a ball 12 rotatably seated within a housing 12a . nozzle 13 has a spout portion connected to ball 12 movable therewith and includes a channel 13a terminating in a dispensing spout 13b . channel 13a extends through ball 12 and terminates in a material receiving opening 13c . housing 12a is fitted to -- and may be an integral part of -- a container body 15 which has a base 16 , the latter having a base cover 16a . disposed within container body 15 is a piston 17 with flexible side seals 18 which is vertically moveable in the body 15 . a tube 20 which has an upper opening 20a , extends through piston 17 and has a lower opening 20c . there is provided a compression spring 19 , which may be helical , between the upper interior surface of body portion 12b and the top of piston 17 , whereby spring 19 continuously exerts downward force on piston 17 . paste ( or other previously mentioned viscous matter ) m is loaded into the body of the pump below piston 17 and above bottom 16a . as shown in fig1 material m is blocked from movement beyond the opening 20a of tube 20 by the surface of ball 12 , but it will be observed tube 20 has been filled with paste by the downward pressure of piston 17 under force of spring 19 up through opening 20c in the tube 20 . fig2 shows the tube of fig1 with the turret nozzle 13 in the open position , i . e ., the user has rotated the nozzle to the left in fig1 so that opening 13c of the tube channel is in registry with the opening 20a of dip tube 20 , whereby the contents of the tube , m , are flowing continously from nozzle 13b as indicated by the arrow . thus , the embodiment illustrated in fig1 and 2 is remarkably uncomplicated and , in fact , comprises only five elements : a body , a nozzle , a piston , a dip tube and a spring ( or other functionally equivalent means of exerting force ), all of which have the further advantage of being easy to mold and assemble . by contrast , for example , the pump currently on the market sold under the trademark &# 34 ; crest &# 34 ; for tartar control paste has at least eight elements and represents an extremely complicated design which , presumably , is difficult to mold and assemble , and therefore relatively expensive . further , prior art pumps of the draw - up variety have a piston which moves upwardly within the pump housing to dispense the paste , so that the pump becomes increasingly top - heavy and therefore more likely to fall over . sometimes this is merely an annoying inconvenience , but in the event the pump falls from , say , a bathroom sink onto a tile or other hard bathroom floor , the pump can be damaged . in addition , paste pumps according to the present invention are very easy to fill with paste on a high - speed assembly line . as indicated previously , it has also been discovered that pumps made in accordance with the present invention can be modified to be re - fillable , thereby even further increasing the cost - savings to the consumer . one embodiment of a re - fillable pump is shown in in fig3 and 4 wherein parts identical or functionally equivalent to those shown in fig1 and 2 are marked with a prime , so that it is unecessary to specifically reiterate them here . in the embodiment of fig3 and 4 , the body wall 15 &# 39 ;, preferably cylindrical in cross - section , terminates in an edge 15a &# 39 ; which defines an opening 15b &# 39 ;. inserted into this opening is a refill container 22 with paste m already loaded therein . ( although not shown , it will be understood that container 22 , as sold , will have a suitable cover which the consumer removes just before inserting container 22 within the pump 11 &# 39 ;.) refill container 22 is inserted within pump 11 &# 39 ; by threading it into the wall 15 &# 39 ;. thus , wall 15 &# 39 ; has screw threads 26 on its inner surface adjacent bottom edge 15a and container 22 has matching threads 25 on its outer surface . once container 22 is securely threaded into pump 11 &# 39 ;, the flared top portion 24 of the container 22 forms a tight seal against the inner surface of wall 15 &# 39 ; above piston 17 &# 39 ;. similarly , the bottom surface 23c of container 22 preferably fits against the lower edge 15a &# 39 ; of the pump wall 15 &# 39 ;, thereby enhancing the seal provided by threads 25 , 26 to provide a sealed compartment for the material m . the refill has feet 23a and 23b to provide a base for maintaining the assembly in an upright position . fig3 shows the refillable pump with its dispensing nozzle 13 &# 39 ; in the closed position , while fig4 shows such nozzle in the open position with the material m being discharged as indicated by the arrow . thus , in addition to the advantages of the pump shown in fig1 and 2 , the pump of fig3 and 4 has the great benefit of being capable of utilizing refills , at substantial savings to the consumers . another embodiment of a refillable container according to this invention is illustrated in fig5 wherein the pump 11 &# 34 ; does not have a long body wall extending down the length of the container , but instead comprises what might be termed a head block 28 terminating in a lower edge 29 . just above the line of termination 29 the body 28 is provided with external threads 33 . the latter are for the purpose of receiving a refill 27 which has a body wall 30 and threads 32 on the inner wall at the top which engage threads 33 of the body 28 . refill 27 has a closed bottom end 31 and , as packaged for retail sale , will have its open top end closed by a cap , foil or other suitable cover which will protect the contents m and which may be easily removed just prior to attachment as described above . it will be evident that the refill container 27 in fig5 offers great advantages . in particular the consumer need only purchase the pump mechanism once and , thereafter , simply purchase the refill 27 , thus saving the cost of buying an entire new pump on each occasion . fig6 illustrates a pump 11 &# 34 ;&# 39 ; which is similar in construction to pump 11 of fig1 . however , in the embodiment shown in fig6 pump 11 &# 34 ;&# 39 ; has an open bottom end equipped with external threads 43 . these are designed to engage threads 44 on the inner surface of a lip 42a of a removable bottom cover 42 . the purpose of this configuration is to permit the cover to be removed and the insertion of a refill 40 , preferably a cylinder , containing paste m . refill cylinder 40 has a closed bottom 45 and terminates in an open top end 41 . the refill of fig6 includes a multilayer structure 41 , 47 preferably fabricated of a barrier material . as in the case of the embodiment shown in fig5 the invention of fig6 offers similar substantial advantages in cost and product safety to both the consumer and manufacturer . indeed , the refill 40 can be easily slid into the interior housing of pump 11 &# 34 ;&# 39 ;, and readied for instant use by attaching cover 42 . the refill containers thus described and illustrated should be considered as part of the present invention . moreover , the refills may take a number of different forms and comprise not only a refill container per se , but , if desired , may include a new piston , such as the piston 17 &# 34 ; in fig5 in which case the original piston will be discarded . in addition , the refills may be made of a wide variety of suitable materials . for example , currently sold toothpaste pumps employ polypropylene ( pp ) or polyethlene ( pe ) or polyethylene terephthalate ( pet ) or copolymers of pp and pe for the body walls of the pump which contains the paste and these body walls typically are relatively thick in order to prevent loss of flavorants , etc . through the body wall , which can occur when long shelf - life is required . alternatively , the refills shown herein can be made relatively thin and of said current materials , where long shelf - life is not needed . or , where long shelf - life is desired , the refill may be made relatively thin and utilize so - called gas barrier materials , such as ethylene alcohol copolymer ( evoh ), polyamides such as nylon ( pa ), polyvinyildine chloride and copolymers thereof ( pc ), etc ., which prevent the escape of flavorants or other components of the paste which can convert into a gas phase . these materials may be formed in a single layer , such as by extruding the same as a tube or by extrusion blow molding ( ebm ), the latter being more desirable since the bottom of the refill is formed in the mold , as well as the threads or other means of attachment . more preferably , these barrier materials are incorporated in a multiple layer structure which is extruded , again preferably by ebm coestrusion . this latter use of barrier materials formed into a refill is believed to be preferable particularly for refill 40 of fig6 . further , although only certain specific embodiments thereof have been shown and described , it is well within this invention that refill containers having the same inventive concept but different designs may be used . for example , the particular means whereby the refill container is attached to the pump or inserted therein is , to some degree , a matter of choice . further , by way of additional modifications which are within the scope of this invention , the pump body may be other than circular in cross - section . for example , the body can just as well be square or rectangular in cross - section , in which case the re - fill would have the same cross - section and means other than screw threads would normally be employed .
| 1Performing Operations; Transporting
|
the present invention provides a method of treating inflammatory skin conditions , particularly psoriasis , by orally administering a prodrug of 5 - fu . in a preferred embodiment , the present invention employs oral administration of capecitabine for treating psoriasis . it has now been unexpectedly discovered that oral administration of 5 - fu prodrugs can be used to treat psoriasis in humans . in a preferred embodiment , capecitabine ( a 5 - fu prodrug ) is orally administered to treat psoriasis in humans . the 5 - fu prodrugs that have been found to be useful for treatment of psoriasis in humans are capecitabine ( n 4 - pentyloxycarbonyl - 5 ′- deoxy - 5 - fuorocytidine ), 5 - fluoro - pyrimidinone ( 5fp ), ts - 1 ( s - 1 , ftorafur ), fdump , 1 -( 2 ′- oxopropyl )- 5fu , and alkyl - carbonyl - 5 - fu . the preferred 5 - fu prodrug for use in the present invention is capecitabine . capecitabine is a prodrug of the antimetabolite 5 - fu , crosses the gastrointestinal barrier intact , and is rapidly and almost completely absorbed . surprisingly , this drug , which is responsible for the skin disease known as hand - foot syndrome , is effective as a treatment for another skin disease , psoriasis . the effectiveness of capecitabine for the treatment of psoriasis is especially surprising because hand and foot syndrome ( which involves erythema , pain and ulceration ) and psoriasis may occur in the same area of the body . as an example , inverse psoriasis occurs in intertriginous areas , which are areas between folds or juxtaposed surfaces of skin . ( stedman &# 39 ; s medical dictionary , 26 th edition ) intertriginous areas include the skin beneath pendulous breasts and abdominal skin folds . hand - foot syndrome is known to occur at the intertriginous areas of the bra - line and belt - line . moreover , pustular psoriasis is known to localize to the palms and soles . ( merck manual of diagnosis and therapy , 17 th edition , section 10 ch . 117 ). the use of capecitabine to treat psoriasis is a significant advance because it avoids the serious side effects of 5 - fu . furthermore , capecitabine can be reliably and effectively administered via the oral route . most adverse events associated with capecitabine administration are reversible and do not require discontinuation of the drug . ( physician &# 39 ; s desk reference , supra ) a benefit of oral prodrugs of 5 - fu , and capacitabine particularly , is that patients are more likely to initiate treatment if the active agent can be taken orally rather than undergo the additional pain , expense and inconvenience of iv treatment . treatment with oral capecitabine does not require hospitalization as does initial iv therapy with 5 - fu . ( malet - martino et al ., supra ) in addition to the 5 - fu specific toxicities , any intravenous catheterization carries the risk of local infection and / or thrombophlebitis . ( de bono j s , twelves c j , supra ). the 5 - fu prodrugs capecitabine ( n 4 - pentyloxycarbonyl - 5 ′- deoxy - 5 - fuorocytidine ), 5 - fluoro - pyrimidinone ( 5fp ), ts - 1 ( s - 1 , ftorafur ), fdump , 1 -( 2 ′- oxopropyl )- 5fu , and alkyl - carbonyl - 5 - fu can be orally administered to treat psoriasis and other inflammatory skin conditions ( e . g ., keloid ( hypertrophic scar ), atopic dermatitis , lichen simplex chronicus , prurigo nodularis , reiter syndrome , pityriasis rubra pilaris , pityriasis rosea , stasis dermatitis , rosacea , acne , lichen planus , scleroderma , seborrheic dermatitis , granuloma annulare , rheumatoid arthritis , dermatomyositis , alopecia greata , lichen planopilaris , vitiligo , and discoid lupus erythematosis ) in humans . therapeutically effective oral doses of 5 - fu prodrugs for treating psoriasis and other inflammatory skin conditions in humans in a non - pulse dosing regimen are between 5 and 2500 milligrams per square meter of body surface area per day , a preferred effective amount is between 100 and 1500 milligrams per square meter of body surface area per day and an especially preferred dose is 1250 milligrams per square meter of body surface area per day . the preferred prodrug , capecitabine , is therapeutically effective for treating psoriasis and other inflammatory skin conditions in humans at doses below 2500 milligrams per square meter of body surface area per day , and capecitabine does not produce a 5 - fu like adverse effect profile until dose levels exceed 2500 milligrams per square meter of body surface area per day . adverse effects experienced at levels in excess of 2500 milligrams per square meter of body surface per day include nausea , vomiting and skin rashes . a therapeutically effective amount is that amount of capecitabine which will relieve or improve to some extent one or more of the symptoms or signs of psoriasis or other inflammatory skin condition . an effective amount of capecitabine for treating psoriasis or other inflammatory skin condition in a non - pulse dosing regimen is between 100 and 2500 milligrams per square meter of body surface area per day , a preferred effective amount is between 750 and 1500 milligrams per square meter of body surface area per day and an especially preferred dose is 1250 milligrams per square meter of body surface area per day . capecitabine ( offered under the brand name xeloda ® by roche labs , nutley , n . j . 07110 ) is commercially available in 150 mg and 500 mg tablets . xeloda ® is indicated for the treatment of patients with metastatic breast cancer resistant to both paclitaxel and an anthracyline - containing chemotherapy regimen , or resistant to paclitaxel and for whom further anthracycline therapy is not indicated . ( physician &# 39 ; s desk reference 2002 ) peak plasma concentrations for capecitabine and its two main metabolites occur about 0 . 5 to 1 . 5 hours after administration . plasma concentrations decline exponentially with a half - life of about 0 . 5 to 1 hour . an additional dosing regimen is pulse - dosing . in pulse - dosing , an effective amount of a biologically active agent is administered to the patient and then sufficient time is allowed to permit the active agent to clear from the patient &# 39 ; s body ( i . e . to be metabolized or discharged ) prior to the administration of additional doses . the quantity of drug administered to the patient in pulse - dosing may be greater than the dosage administered in a non - pulse - dosing regimen . the quantity , length of administration and interval between doses in pulse - dosing vary according to an individual patient &# 39 ; s response to the pulse - dosing regimen . an effective amount of oral 5 - fu prodrug for treating psoriasis or other inflammatory skin condition by pulse dosing is between 5 and 5000 milligrams per square meter of body surface area , a preferred effective amount is between 100 and 3000 milligrams per square meter of body surface area and an especially preferred dose is 1250 milligrams per square meter of body surface area . a preferred pulse - dosing regimen is administration of the effective amount of the 5 - fu prodrug daily for one week , an interval of two weeks without administration , repeat the schedule . a preferred pulse - dosing regimen for treating psoriasis or other inflammatory skin condition is administering oral capecitabine in an effective amount between 100 and 5000 milligrams per square meter of body surface area , a preferred effective amount of between 750 and 3000 milligrams per square meter of body surface area and an especially preferred dose of 1250 milligrams per square meter of body surface area . in the pulse - dose regimen , the effective amount of capecitabine is administered orally each day for one week followed by an interval of one week without administration ; the weekly cycle is repeated . pulse - dose quantity , the period of time during which the effective amount is administered , and interval without dosing are adjusted for patient response and occurrence of adverse effects . a 5 - fu prodrug of the present invention is preferably administered as a pharmaceutical composition in hard shell dosage form such as a pill , tablet , capsule , or caplet . the pharmaceutical composition may be formulated as unit dosage forms , such as tablets , pills , capsules , boluses , powders , granules , elixirs , tinctures , metered aerosol or liquid sprays , drops , ampoules , autoinjector devices or suppositories . unit dosage forms may be used for oral , intranasal , sublingual or rectal administration , or for administration by inhalation or insufflation , transdermal patches , and a lyophilized composition . preferably the unit dosage form is an oral dosage form , most preferably a solid oral dosage , therefore the preferred dosage forms are tablets , pills , and capsules . the pharmaceutical composition may contain capecitabine or an enantiomer , diastereomer , n - oxide , crystalline form , hydrate , solvate , active metabolite or pharmaceutically acceptable salt of the compound . the pharmaceutical composition may also include optional additives , such as a pharmaceutically acceptable carrier or diluent , a flavouring , a sweetener , a preservative , a dye , a binder , a suspending agent , a dispersing agent , a colorant , a disintegrator , an excipient , a diluent , a lubricant , an absorption enhancer , a bactericide and the like , a stabiliser , a plasticizer , an edible oil , or any combination of two or more of said additives . suitable pharmaceutically acceptable carriers or diluents include , but are not limited to , ethanol , water , glycerol , aloe vera gel , allantoin , glycerine , vitamin - a and e oils , mineral oil , phosphate buffered saline , ppg2 myristyl propionate , magnesium carbonate , potassium phosphate , vegetable oil , animal oil and solketal . suitable binders include , but are not limited to , starch , gelatine , natural sugars such as glucose , sucrose and lactose , corn sweeteners , natural and synthetic gums such as acacia , tragacanth , vegetable gum , sodium alginate , carboxymethylcellulose , polyethylene glycol , waxes and the like . suitable disintegrators include , but are not limited to , starch such as corn starch , methyl cellulose , agar , bentonite , xanthan gum and the like . suitable lubricants include , but are not limited to , sodium oleate , sodium stearate , magnesium stearate , sodium benzoate , sodium acetate , sodium chloride and the like . suitable dispersing and suspending agents include , but are not limited to , synthetic and natural gums such as vegetable gum , tragacanth , acacia , alginate , dextran , sodium carboxymethylcellulose , methylcellulose , polyvinylpyrrolidone and gelatine . suitable edible oils include , but are not limited to , cottonseed oil , sesame oil , coconut oil and peanut oil . examples of additional additives include , but are not limited to , sorbitol , talc , stearic acid and dicalcium phosphate . solid unit dosage forms may be prepared by mixing the active agents of the present invention with a pharmaceutically acceptable carrier and any other desired additives as described above . the mixture is typically mixed until a homogeneous mixture of the active agents of the present invention is obtained and the carrier and any other desired additives are formed , i . e . the active agents are dispersed evenly throughout the composition . tablets or pills can be coated or otherwise prepared so as to form a unit dosage form that has delayed and / or sustained action , such as controlled release and delayed release unit dosage forms . for example , the tablet or pill can comprise an inner dosage and an outer dosage component , the latter being in the form of a layer or envelope over the former . the two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release . biodegradable polymers for controlling the release of the active agents include , but are not limited to , polylactic acid , polyepsilon caprolactone , polyhydroxybutyric acid , polyorthoesters , polyacetals , polydihydropyrans , polycyanoacrylates and crosslinked or amphipathic block copolymers of hydrogels . for liquid dosage forms , the active substances or their physiologically acceptable salts are dissolved , suspended or emulsified , optionally with the usually employed substances such as solubilizers , emulsifiers or other auxiliaries . solvents for the active combinations and the corresponding physiologically acceptable salts can include water , physiological salt solutions or alcohols , e . g . ethanol , propanediol or glycerol . additionally , sugar solutions such as glucose or mannitol solutions may be used . a mixture of the various solvents mentioned may be used in the present invention too . the active agents of the present invention may also be coupled with soluble polymers such as targetable drug carriers . such polymers include , but are not limited to , polyvinylpyrrolidone , pyran copolymers , polyhydroxypropylmethacrylamidophenol , polyhydroxyethylaspartamidophenol , and polyethylenoxypolylysine substituted with palmitoyl residues . a transdermal dosage form also is contemplated by the present invention . transdermal forms may be a diffusion - driven transdermal system ( transdermal patch ) using either a fluid reservoir or a drug - in - adhesive matrix system . other transdermal dosage forms include , but are not limited to , topical gels , lotions , ointments , transmucosal systems and devices , and iontohoretic ( electrical diffusion ) delivery system . transdermal dosage forms may be used for timed release and sustained release of the active agents of the present invention . the total daily dose should be taken as two divided doses approximately 12 hours apart , within 30 minutes of eating . the tablets should be taken with water . ( xeloda ™ patient package insert ). the number of daily tablets of a 5 - fu prodrug to be taken by a patient for treatment of psoriasis or other inflammatory skin condition is shown in the following dosing table . the body surface area ( bsa ) is calculated using a bsa nomogram well known to those skilled in the art and the patient &# 39 ; s height and mass . ( mosteller rd . simplified calculation of body - surface area . nejm 1987 ; 317 : 1098 ). for any given bsa in the first column of table 1 , the total daily dose is disclosed in the second column of the table . the third and fourth columns of table 1 show , respectively , the number of 150 milligram tablets and the number of 500 milligram tablets to be taken at each administration ( morning and evening ). duration of individual patient treatment will depend on individual response and tolerance . however , treatment with an effective amount of a 5 - fu prodrug for 2 to 12 weeks should provide relief from psoriasis and other inflammatory skin conditions in most patients . the dosing regimen may be modified in the event of adverse events . an adverse event includes any adverse change from the patient &# 39 ; s pre - treatment condition . the following example is intended to illustrate more specifically the operation of the invention . the example is intended to illustrate and not to limit the scope of the invention . other aspects , advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains . treatment of an adult with active psoriasis involving 10 – 75 % body surface area ( bsa ) is carried out as follows . the physician obtains a complete medical history from the patient and conducts a physical examination . a psoriasis area and severity index ( fredriksson t , petersson u , severe psoriasis — oral therapy with a new retinoid . dermatologica 1978 ; 157 : 238 – 244 ), is obtained . a hematology profile ( complete blood count and platelet count ), chemistry profile ( bun , creatinine , sgot , sgpt , total protein , and albumin ), hiv screen , and urinalysis are also obtained . women of child - bearing potential must have a negative serum pregnancy test within 7 days of the first dose of capecitabine . the bsa is calculated using a bsa nomogram based on the patient &# 39 ; s height and mass . a patient with a normal history , physical exam , blood and urine profiles is started on a course of capecitabine at 1250 milligrams per square meter of bsa per day according to table 1 . for example , a patient with a bsa of 1 . 50 square meters would receive a total daily dose of 1900 mg of capecitabine . the patient is to take three 150 mg tablets and one 500 mg tablet with a glass of water within 30 minutes after eating breakfast . the same dose is repeated in the evening , approximately 12 hours later , with a glass of water within 30 minutes after dinner . the patient takes the daily dose for two days of the week and repeats this dosing schedule on the same days of the week on subsequent weeks . from the foregoing disclosure it is evident that the present invention provides an advance in the treatment for psoriasis and inflammatory skin conditions . the present invention is preferably administered orally , which improves patient compliance with treatment and does not require hospitalization . oral administration avoids the complications associated with intravenous catheterization . 5 - fu prodrugs , preferably capecitabine , are effective for the treatment of psoriasis and other inflammatory skin conditions , and are safer than other drugs used for the treatment of psoriasis and other inflammatory skin conditions .
| 0Human Necessities
|
the compressor 10 is shown in fig1 . externally the compressor has a solid , non - vented motor housing 12 , a non - vented back 13 , a rear plate 14 , a solid non - vented shroud 16 , a front plate 18 and a muffler box 20 . the components are bolted together so as to form a unit . two ports 22 and 24 are provided in the muffler box for the entry of air and exit of compressed air . muffler constructions 26 and 28 are provided for use in the muffler box . the rear or back 13 of the compressor is shown in fig2 and includes a solid non - vented plate . referring now to fig3 , an exploded view of the compressor is shown and the internal mechanism can be seen . in the housing there is positioned an electric motor which can be generally characterized as a one - sixth horsepower motor , having a four pole stator and a six pole rotor . the housing 12 has a maximum length of about 5 . 22 inches so as to reduce the vibrations . the motor &# 39 ; s rotor drives a drive shaft 30 which is mounted on a plurality of deep groove ball bearings 32 . an inlet ring 34 is positioned against the motor housing 12 . there is provided the rear plate 14 which includes a centrally positioned bolting and bearing support section 38 which is held in position by a plurality of webs such as 40 . it is seen that the drive shaft 30 is also supported by a second set of bearings 42 which is secured to the section 38 . the rear plate 14 is secured to the motor housing with the inlet ring 34 positioned therebetween like a gasket . bolts such as 44 from the motor housing are secured to the periphery of the rear plate 14 . the shroud 16 is non - vented and made of a laminated material and fits against the rear plate 14 . the body 36 defines a rotor cavity 46 therein , fits within the shroud 16 , has a radius of at least about 2 . 62 inches , a minimum weight of about 4 . 63 pounds , and is made of a gray iron casting , more specifically sae j4321 g2500 . a rotor and vane assembly 48 is positioned within the cavity 46 . the drive shaft 30 extends to and engages the rotor and rotates the assembly 48 . the assembly 48 includes the rotor 50 and four vane receiving slots such as 52 within each of which there is a positioned a vane 54 . it will be appreciated that the motor rotates the drive shaft which , in turn , rotates the assembly 48 for compressing incoming air and expelling compressed air . when the rotor is rotated , each vane can slide within a rotor slot and can engage the cavity wall or body 36 . the front plate 18 engages the front face of the body 36 and is divided into two chambers or sections 58 and 60 by the by a central rib 62 and peripheral edge 64 . the muffler box 20 which is preferably made from a gray iron , but can be made from die cast aluminum , is secured against the front end plate . the muffler box defines the exit and inlet ports 22 and 24 and each communicates with a chamber 58 or 60 . the muffler box is deep enough to receive the muffler elements 26 and 28 . elements or components of the compressor are also seen in fig4 and include the motor housing 12 , the drive shaft 30 , the inlet ring 34 , the rear plate 14 , the shroud 16 , the rotor assembly 48 , the body 36 , the front plate 18 and muffler box 20 . the inlet ring 34 is seen in fig5 . the ring 34 has a small wall thickness 66 [ i . e ., the difference between the outside diameter ( od ) and inside diameter ( id )] of about 1 . 25 inches and is made of 20 gage cold rolled steel . the ring is positioned between the motor housing 12 and the rear plate 14 . the ring is crushable and acts like a gasket to seal against both the housing and plate . the ring od is fixed by the compressor size and the id is increased as much as possible so as to reduce vibration and maintain sealing . the body 36 is shown in fig6 and 8 . the body has a positioning groove 62 located at the top thereof , has an increased mass or , a weight of about 4 . 63 pounds , as well as an increased outer radius 68 of about 2 . 62 inches . the body is fabricated of gray iron , as specified hereinbefore , which exhibits sound - dampening characteristics . in addition , the size , weight and mass of the body is maximized so as to maximize sound dampening . the outside diameter is increased , but is limited by the size of the compressor . the inside diameter or cavity is maintained for cooperation with the rotor assembly . the rotor body 50 which has vane - carrying slots such as 52 is shown in fig3 and 9 . each of the slots carries a vane , extends into the rotor body , is at right angles to an adjacent vane slot and forms a chord - like construction which extends from the circumference or periphery of the rotor into the rotor body as shown . the positioning of the slot relative to the center and relative to the other slots is important in reducing the sound of operation . the intersection of the slot or its centerline with the circumference is at about a 24 ° angle relative to a line extending through the center of the rotor and normal to an adjacent slot . the angular relation can vary between 23 ° and 25 °. this angular relationship is important as it permits vane movement in the slot and reduces vane bounce during rotation . the mass or weight of each vane is important to maximize radial force . the weight of the vane herein is about 6 . 75 grams . the combination of vane mass and angular relation also reduces vane bounce and noise . fig1 , 11 and 12 show the shroud 16 . the shroud 16 is a cylindrical member which fits about the body 18 and engages the rear plate 14 and the front plate 56 . the shroud is a solid non - vented member which can be made of a laminated structure seen in fig1 . the laminated structure includes an outer metal layer 70 , an inner metal layer 72 and an intermediate viscous layer 74 . the solid or non - vented structure and the laminated structure contributes to the dampening or sound reduction . the inner and outer layers are 24 to 26 gauge galvaneal steel ( galvaneal steel is electro - galvanized steel which is made for painting ) and the sound dampening material is a viscous material such as acrylic pressure sensitive adhesive . the laminate can be purchased from roush anatrol main office , 11953 market street , livonia , mich . 48100 , under the trade name anatrol 980 . the bearings such as 32 and 42 are referred to as deep groove ball bearings ( see nsk catalog , rolling bearings , cat . no . a 140b , 19933 - 10 printed in japan , copyright nsk ltd . 1989 ) are sealed and utilize a grease or lubricant to dampen sound . this grease or lubricant is a polyurea grease ( available as polyrex em , from exxon mobile corporation , 3225 gallows road , fairfax , va . 22037 . the combination of the deep groove bearing and grease reduce the sound of operation . the motor itself is one - sixth horse power , 6 - pole rotor and 4 - pole stator type . the motor housing is less than about 5 . 22 inches in length and is solid or non - vented . sound emanating from the motor during operation has been minimized . the back or closure 13 for the motor housing 12 is a solid non - vented member which is secured to the housing . the fact that the back is solid and non - vented minimizes sound emanating from the rear of the compressor . the combination of above - identified factors reduces the sound emitted from the compressor during operation to about 50 db at 1 meter . those factors include the solid non - vented motor housing 12 , the solid non - vented housing back 13 , the 6 - pole rotor 4 - pole stator motor , the deep groove bearings 32 and 42 and lubricant , the rotor - vane angular relationship and vane weight or mass , the increased body size and mass 18 and the non - vented solid or laminated shroud 16 . in addition , the muffler 20 can be made of various materials so as to enhance the sound deadening property . it will be appreciated that numerous changes and modifications can be made to the embodiments detailed above .
| 5Mechanical Engineering; Lightning; Heating; Weapons; Blasting
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.