repo_name
stringlengths
5
92
path
stringlengths
4
232
copies
stringclasses
19 values
size
stringlengths
4
7
content
stringlengths
721
1.04M
license
stringclasses
15 values
hash
int64
-9,223,277,421,539,062,000
9,223,102,107B
line_mean
float64
6.51
99.9
line_max
int64
15
997
alpha_frac
float64
0.25
0.97
autogenerated
bool
1 class
adamfisk/littleshoot-client
server/appengine/littleshoot/jsonpickle/__init__.py
1
2991
# -*- coding: utf-8 -*- # # Copyright (C) 2008 John Paulett (john -at- 7oars.com) # All rights reserved. # # This software is licensed as described in the file COPYING, which # you should have received as part of this distribution. """Python library for serializing any arbitrary object graph into JSON >>> import jsonpickle >>> from jsonpickle.tests.classes import Thing Create an object. >>> obj = Thing('A String') >>> print obj.name A String Use jsonpickle to transform the object into a JSON string. >>> pickled = jsonpickle.dumps(obj) >>> print pickled {"classname__": "Thing", "child": null, "name": "A String", "classmodule__": "jsonpickle.tests.classes"} Use jsonpickle to recreate a Python object from a JSON string >>> unpickled = jsonpickle.loads(pickled) >>> print unpickled.name A String The new object has the same type and data, but essentially is now a copy of the original. >>> obj == unpickled False >>> obj.name == unpickled.name True >>> type(obj) == type(unpickled) True If you will never need to load (regenerate the Python class from JSON), you can pass in the keyword unpicklable=False to prevent extra information from being added to JSON. >>> oneway = jsonpickle.dumps(obj, unpicklable=False) >>> print oneway {"name": "A String", "child": null} """ __version__ = '0.0.5' __all__ = [ 'dump', 'dumps', 'load', 'loads' ] from django.utils import simplejson as json #import simplejson as json from pickler import Pickler from unpickler import Unpickler def dump(value, file, **kwargs): """Saves a JSON formatted representation of value into file. """ j = Pickler(unpicklable=__isunpicklable(kwargs)) json.dump(j.flatten(value), file) def dumps(value, **kwargs): """Returns a JSON formatted representation of value, a Python object. Optionally takes a keyword argument unpicklable. If set to False, the output does not contain the information necessary to >>> dumps('my string') '"my string"' >>> dumps(36) '36' """ j = Pickler(unpicklable=__isunpicklable(kwargs)) return json.dumps(j.flatten(value)) def load(file): """Converts the JSON string in file into a Python object """ j = Unpickler() return j.restore(json.load(file)) def loads(string): """Converts the JSON string into a Python object. >>> loads('"my string"') u'my string' >>> loads('36') 36 """ j = Unpickler() return j.restore(json.loads(string)) def __isunpicklable(kw): """Utility function for finding keyword unpicklable and returning value. Default is assumed to be True. >>> __isunpicklable({}) True >>> __isunpicklable({'unpicklable':True}) True >>> __isunpicklable({'unpicklable':False}) False """ if kw.has_key('unpicklable') and not kw['unpicklable']: return False return True
gpl-2.0
-2,917,782,080,440,255,000
24.945946
104
0.646606
false
CS2014/USM
usm/communications/migrations/0001_initial.py
1
8519
# -*- coding: utf-8 -*- from south.utils import datetime_utils as datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'TextMessage' db.create_table(u'communications_textmessage', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('society', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['main.Society'])), ('recipients', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['societymembers.SocietyMember'])), ('name', self.gf('django.db.models.fields.CharField')(max_length=40)), ('tag', self.gf('django.db.models.fields.CharField')(max_length=30)), ('content', self.gf('django.db.models.fields.CharField')(max_length=160)), ('source_phone_number', self.gf('django.db.models.fields.CharField')(max_length=25)), )) db.send_create_signal(u'communications', ['TextMessage']) # Adding model 'Email' db.create_table(u'communications_email', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('society', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['main.Society'])), ('recipients', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['societymembers.SocietyMember'])), ('name', self.gf('django.db.models.fields.CharField')(max_length=40)), ('tag', self.gf('django.db.models.fields.CharField')(max_length=30)), ('content', self.gf('django.db.models.fields.CharField')(max_length=160)), ('sending_address', self.gf('django.db.models.fields.CharField')(max_length=60)), )) db.send_create_signal(u'communications', ['Email']) def backwards(self, orm): # Deleting model 'TextMessage' db.delete_table(u'communications_textmessage') # Deleting model 'Email' db.delete_table(u'communications_email') models = { u'auth.group': { 'Meta': {'object_name': 'Group'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': u"orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, u'auth.permission': { 'Meta': {'ordering': "(u'content_type__app_label', u'content_type__model', u'codename')", 'unique_together': "((u'content_type', u'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['contenttypes.ContentType']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, u'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'related_name': "u'user_set'", 'blank': 'True', 'to': u"orm['auth.Group']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'related_name': "u'user_set'", 'blank': 'True', 'to': u"orm['auth.Permission']"}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, u'communications.email': { 'Meta': {'object_name': 'Email'}, 'content': ('django.db.models.fields.CharField', [], {'max_length': '160'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '40'}), 'recipients': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['societymembers.SocietyMember']"}), 'sending_address': ('django.db.models.fields.CharField', [], {'max_length': '60'}), 'society': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['main.Society']"}), 'tag': ('django.db.models.fields.CharField', [], {'max_length': '30'}) }, u'communications.textmessage': { 'Meta': {'object_name': 'TextMessage'}, 'content': ('django.db.models.fields.CharField', [], {'max_length': '160'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '40'}), 'recipients': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['societymembers.SocietyMember']"}), 'society': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['main.Society']"}), 'source_phone_number': ('django.db.models.fields.CharField', [], {'max_length': '25'}), 'tag': ('django.db.models.fields.CharField', [], {'max_length': '30'}) }, u'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, u'main.society': { 'Meta': {'object_name': 'Society'}, 'creation_date': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'members': ('django.db.models.fields.related.ManyToManyField', [], {'to': u"orm['auth.User']", 'symmetrical': 'False'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, u'societymembers.societymember': { 'Meta': {'object_name': 'SocietyMember'}, 'email_address': ('django.db.models.fields.CharField', [], {'max_length': '60'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'join_date': ('django.db.models.fields.DateTimeField', [], {}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'phone_number': ('django.db.models.fields.CharField', [], {'max_length': '25'}), 'society': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['main.Society']"}), 'tags': ('django.db.models.fields.related.ManyToManyField', [], {'to': u"orm['societymembers.Tag']", 'symmetrical': 'False'}) }, u'societymembers.tag': { 'Meta': {'object_name': 'Tag'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'society': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['main.Society']"}) } } complete_apps = ['communications']
mit
5,974,675,831,424,042,000
66.619048
195
0.568963
false
RussianOtter/networking
RoAIRC.py
1
2810
import sys, time, threading, RoA, string, random, socket from random import randint from binascii import hexlify import DH Ro = RoA.RoA(False) port = 50000 key = "savsecro"*4 user = "[%s] " %raw_input("Username: ") try: socket.setdefaulttimeout(2) sock = socket.socket(socket.AF_INET, socket.SOCK_STREAM) sock.connect(("8.8.8.8", 53)) ip = sock.getsockname()[0] sock.close() except Exception as e: ip = "127.0.0.1" socket.setdefaulttimeout(1000) def header(b="",c=""): head = ip,b,c return str(head) + "\x0f" def encrypt(msg,key): roa_out = Ro.encrypt(msg,key) return str(roa_out) def decrypt(roa_in): try: roa_in = eval(roa_in) decrypted = Ro.decrypt(roa_in[0],roa_in[1],roa_in[2]) return decrypted except Exception as e: pass s = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) s.bind(("", port)) s.setsockopt(socket.SOL_SOCKET, socket.SO_BROADCAST, 1) def encryption_handler(packet,key): p = packet.replace(key,"!!!key!!!") p = p.replace(key[16:],"!!!sub!!!") return p def daemon_hound(): while 1: data = s.recv(5000) if eval(data.split("\x0f")[0])[1] == "direct" and ip in data: try: DH.hellman_client(eval(data.split("\x0f")[0])[2]) v = "h_"+eval(data.split("\x0f")[0])[0].replace(".","") time.sleep(1) exec "globals()['%s'] = DH.%s" % (v,v) while 1: globals()[v] = int(globals()[v])*32+6**2 if len(str(globals()[v])) >= 32: break globals()[v] = str(globals()[v])[:32] except: pass globals()["stop"] = True elif eval(data.split("\x0f")[0])[2] == "dm" and eval(data.split("\x0f")[0])[1] == ip: print print decrypt(data.replace("!!!key!!!",globals()[v]).replace("!!!sub!!!",globals()[v][16:]).split("\x0f")[1]) else: data = data.split("\x0f") d = decrypt(data[1]) if d != None: print "\n"+d daemon = threading.Thread(target=daemon_hound) daemon.daemon = True daemon.start() print "[DAEMON] SNIFFING" time.sleep(0.5) DH.hellman() time.sleep(0.5) stop = False while 1: try: msg = raw_input("\n=> ") except: break if len(msg) == 0: msg = "0" data = header() + encrypt(user+msg,key) d_host = raw_input("HOST => ") direct = header("direct",d_host) if len(d_host) > 7: data = direct if len(msg) > 0: s.sendto(data, ("255.255.255.255", port)) if len(d_host) > 7: while not stop: time.sleep(0.5) if len(d_host) > 7: v = str("h_"+d_host.replace(".","")) exec "globals()['%s'] = DH.%s" % (v,v) while 1: globals()[v] = int(globals()[v])*32+6**2 if len(str(globals()[v])) >= 32: break globals()[v] = str(globals()[v])[:32] msg = raw_input("[%s] => " %d_host) pack = encrypt("[Direct]" + user+msg,globals()[v]) pack = encryption_handler(pack,globals()[v]) s.sendto(header(d_host,"dm")+pack,("255.255.255.255", port)) time.sleep(1) stop = False
gpl-3.0
7,521,344,470,537,331,000
23.867257
112
0.6
false
gvanderheide/discreteMarkovChain
setup.py
1
1495
"""A setuptools based setup module. See: https://packaging.python.org/en/latest/distributing.html https://github.com/pypa/sampleproject """ from setuptools import setup, find_packages from codecs import open from os import path here = path.abspath(path.dirname(__file__)) with open(path.join(here, 'README.rst'), encoding='utf-8') as f: long_description = f.read() setup( name='discreteMarkovChain', version='0.22', description='Solve Markov chains with a discrete state space.', long_description=long_description, url='https://github.com/gvanderheide/discreteMarkovChain', author='Gerlach van der Heide', author_email='[email protected]', license='MIT', classifiers=[ 'Development Status :: 3 - Alpha', 'Intended Audience :: Developers', 'Intended Audience :: Education', 'Intended Audience :: Science/Research', 'Topic :: Scientific/Engineering :: Mathematics', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python', 'Programming Language :: Python :: 2', 'Programming Language :: Python :: 2.7', 'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3.5', 'Operating System :: OS Independent', ], keywords='Markov chain stochastic stationary steady state', packages=find_packages(), install_requires=['numpy','scipy'], test_suite='tests', )
mit
773,850,345,115,588,600
31.977273
67
0.637458
false
weaselkeeper/utils
AWS-utils/instance-report.py
1
8003
#!/usr/bin/env python # vim: set expandtab: # with thanks to https://github.com/bpennypacker/ec2-check-reserved-instances.git # For the initial idea, and an idea of how to do this. PROJECTNAME = 'ec2-check-reserved-instances' import os import sys import ConfigParser import logging import boto import boto.ec2 from pprint import pprint from collections import defaultdict # Setup logging logging.basicConfig(level=logging.WARN, format='%(asctime)s %(levelname)s - %(message)s', datefmt='%y.%m.%d %H:%M:%S') # Setup logging to console. console = logging.StreamHandler(sys.stderr) console.setLevel(logging.WARN) logging.getLogger(PROJECTNAME).addHandler(console) log = logging.getLogger(PROJECTNAME) AWS_REGIONS = [ 'us-east-1', 'us-east-2', 'us-west-1', 'us-west-2' ] INSTANCE_TYPES = [ 'c3.large', 'c4.xlarge', 'm1.small', 'm3.large', 'm3.medium', 'm3.xlarge', 'm4.4xlarge', 'm4.large', 'r3.2xlarge', 'r3.large', 'r3.xlarge', 't2.medium', 't2.nano', 't2.small', ] def get_options(): """ Parse the command line options""" import argparse parser = argparse.ArgumentParser( description='Instance-report reports on your ec2 reserved vs on demand instances') parser.add_argument('-d', '--debug', action='store_true', help='Enable debugging during execution.', default=None) parser.add_argument('-p', '--profile', action='store', help='Which AWS profile to use.') parser.add_argument('-r', '--region', action='store', default='us-east-1', help='Must be valid region in AWS_REGIONS list, if empty, defaults to us-east-1') parser.add_argument('-N', '--names', help="Include names or instance IDs of instances that fit non-reservations", required=False, action='store_true') parser.add_argument('-t', '--type', action='store', help='Specific instance type') parser.add_argument('-R', '--report', action='store_true',help='instance report', default=False) _args = parser.parse_args() _args.usage = PROJECTNAME + ".py [options]" return _args def get_args(): """ we only run if called from main """ _args = get_options() if _args.debug: log.setLevel(logging.DEBUG) else: log.setLevel(logging.WARN) if _args.type: if _args.type not in INSTANCE_TYPES: sys.exit('invalid instance type %s:' % _args.type) return _args def get_connection(args): if args.profile: if args.region: ec2_conn = boto.ec2.connect_to_region( args.region, profile_name=args.profile ) else: ec2_conn = boto.connect_ec2( profile_name=args.profile ) else: if args.region: ec2_conn = boto.ec2.connect_to_region( args.region ) else: ec2_conn = boto.connect_ec2() return ec2_conn def get_report(conn,args): reservations = conn.get_all_instances() running_instances = {} instance_ids = defaultdict(list) for reservation in reservations: for instance in reservation.instances: # ignore spot instances and non running instances. if instance.state != "running": log.info("Non-running instance %s: Ignoring\n" % ( instance.id ) ) elif instance.spot_instance_request_id: log.info("Spot instance %s: Ignoring\n" % ( instance.id ) ) else: az = instance.placement instance_type = instance.instance_type if args.type is None or args.type == instance_type: running_instances[ (instance_type, az ) ] = running_instances.get( (instance_type, az ) , 0 ) + 1 if "Name" in instance.tags and len(instance.tags['Name']) > 0: instance_ids[ (instance_type, az ) ].append(instance.tags['Name']) else: instance_ids[ (instance_type, az ) ].append(instance.id) reserved_instances = {} for reserved_instance in conn.get_all_reserved_instances(): if reserved_instance.state != "active": log.info( "Inactive reserved instance %s: \n" % ( reserved_instance.id ) ) else: az = reserved_instance.availability_zone instance_type = reserved_instance.instance_type if args.type is None or args.type == instance_type: reserved_instances[( instance_type, az) ] = reserved_instances.get ( (instance_type, az ), 0 ) + reserved_instance.instance_count """ value is neg for on demand, pos for unused reservations. """ instance_diff = dict([(x, reserved_instances[x] - running_instances.get(x, 0 )) for x in reserved_instances]) for key in running_instances: if not key in reserved_instances: instance_diff[key] = -running_instances[key] unused_reservations = dict((key,value) for key, value in instance_diff.iteritems() if value > 0) if unused_reservations == {}: if args.type: print ("Congratulations, you have no unused reservations of type %s:" % args.type) else: print "Congratulations, you have no unused reservations" else: for unused_reservation in unused_reservations: print "UNUSED RESERVATION!\t(%s)\t%s\t%s" % ( unused_reservations[ unused_reservation ], unused_reservation[0], unused_reservation[1] ) print "" unreserved_instances = dict((key,-value) for key, value in instance_diff.iteritems() if value < 0) if unreserved_instances == {}: if args.type: print ("Congratulations, you have no unreserved instances of type %s:" % args.type) else: print "Congratulations, you have no unreserved instances" else: ids="" for unreserved_instance in unreserved_instances: if args.names: ids = ', '.join(sorted(instance_ids[unreserved_instance])) print "Non-reserved:\t%s\t%s\t%s\t%s" % ( unreserved_instances[ unreserved_instance ], unreserved_instance[0], unreserved_instance[1], ids ) if running_instances.values(): qty_running_instances = reduce( lambda x, y: x+y, running_instances.values() ) else: qty_running_instances = 0 if reserved_instances.values(): qty_reserved_instances = reduce( lambda x, y: x+y, reserved_instances.values() ) else: qty_reserved_instances = 0 print "\n(%s) running on-demand instances\n(%s) reservations" % ( qty_running_instances, qty_reserved_instances ) if args.report: all_keys = {} for key in reserved_instances.keys(): all_keys[key] = 0 for key in running_instances.keys(): all_keys[key] = 0 for key in all_keys.keys(): try: running = running_instances[key] except KeyError: running = 0 try: reserved = reserved_instances[key] except KeyError: reserved = 0 all_keys[key] = (running,reserved) print"type AZ running reserved over/under" for key in all_keys.keys(): _type = key[0] AZ = key[1] running, reserved = all_keys[key] miss = reserved - running print ("%s %s %s %s %s" % (_type, AZ, running, reserved, miss ) ) # Here we start if called directly (the usual case.) if __name__ == "__main__": # This is where we will begin when called from CLI. No need for argparse # unless being called interactively, so import it here args = get_args() # get the instance report conn = get_connection(args) sys.exit(get_report(conn,args))
gpl-2.0
5,559,435,648,501,981,000
35.711009
154
0.591403
false
itissid/gv
pygerrit/gerrit_api.py
1
4985
import os import urlparse import json import vim import requests from requests.auth import HTTPDigestAuth from pygerrit.salting import check_hash, AuthObject # Until I can get the kerberos auth figured out, # I made a SSH Tunnel and just do all the things I want to. XSSI_STRING = ")]}'" PROJECT_JSON_KEY = 'project' BRANCH_JSON_KEY = 'branch' SUBJECT_JSON_KEY = 'subject' CHANGE_ID_KEY = 'change_id' def auth_and_get_result(query_string=None): """ Does some boiler plate managemnet for authorization and getting data based on the query_string. TODO(sid): Implement different types of auth schemes based on variables set in the """ plugin_path = vim.eval("g:gv_plugin_root") auth_method = vim.eval("g:gv_auth_method") url_end_point = vim.eval("g:gv_root_url") password_auth_method_name = vim.eval("g:gv_password_auth_scheme_name") def _inner_auth_and_get_result(f): def _inner_(*args, **kwargs): #TODO(Sid): Instead of branches try calling a # method that returns an instance of the AuthObject that you # can use to make the REST requesnt? if auth_method == password_auth_method_name: # TODO(Sid): Remove me to another method config = json.load(open(os.path.join( plugin_path, 'config/config.json'))) auth_object = AuthObject( password=config['password'], username=config['username']) basic_auth = (auth_object.username, auth_object.password) digest_auth = HTTPDigestAuth(*basic_auth) authentication_url = urlparse.urljoin(url_end_point, '/a') # In case the query string was parameterized if 'format_params' in kwargs: _query_string = query_string.format(**kwargs['format_params']) else: _query_string = query_string print _query_string auth_response = requests.get( authentication_url + _query_string, auth=digest_auth) if auth_response.status_code == 200: kwargs['response'] = json.loads( auth_response.text.replace(XSSI_STRING, '')) else: raise ValueError( 'Received non 200 response %d. Text: %s' % (auth_response.status_code, auth_response.text)) else: # Here will go the future auth schemes that gerrit requires. raise ValueError('Auth scheme not recognized.') return f(*args, **kwargs) return _inner_ return _inner_auth_and_get_result @auth_and_get_result( query_string='/changes/?q=is:open+owner:self&o=CURRENT_REVISION') def gerrit_status(response=None): response.sort(key=lambda x: ( x[PROJECT_JSON_KEY], x[BRANCH_JSON_KEY], x[SUBJECT_JSON_KEY])) # Create a buffer gerrit_status_buffer_name = vim.eval('g:gerrit_status_buffer_name') vim.command(":badd %s" % gerrit_status_buffer_name) vim.command("vert sb %s" % gerrit_status_buffer_name) vim.command(":setlocal buftype=nofile") vim.command(":setlocal bufhidden=wipe") vim.command(":setlocal modifiable") vim.command("let g:gerrit_change_id_lookup={}") gerrit_status_buffer = None # Now write to the buffer # TODO(Sid): Figure out the encoding issues # Figure out a display format for b in vim.buffers: if b.name and b.name.find(gerrit_status_buffer_name) >= 0: gerrit_status_buffer = b gerrit_status_buffer[:] = None gerrit_status_buffer.append(20 * "-") for change in response: project_name = change[PROJECT_JSON_KEY].encode('utf-8') branch_name = change[BRANCH_JSON_KEY].encode('utf-8') subject = change[SUBJECT_JSON_KEY].encode('utf-8') change_id = change[CHANGE_ID_KEY].encode('utf-8') partial_change_id = change_id[0:10] revision_lookup_id = "%s~%s~%s" % ( project_name, branch_name, change[CHANGE_ID_KEY].encode('utf-8')) gerrit_status_buffer.append("P| %s" % project_name) gerrit_status_buffer.append((" B| %s" % branch_name)) gerrit_status_buffer.append( (" S| (%s..) %s" % (partial_change_id, subject))) store_command = ":let g:gerrit_change_id_lookup[\"%s\"] = \"%s\"" % ( partial_change_id, revision_lookup_id) vim.command(store_command) gerrit_status_buffer.append(20 * "-") vim.command(":setlocal noma") @auth_and_get_result( query_string='/changes/{change_id}/revisions/{revision_id}/files/') def display_change_contents( response=None, format_params={}): """ Given an item selected from the gerrit status change window. If you invoke the right key bindings you can see the changes that are part of the latest patch You must call this function with a non null value of the change_id and the revision_id. Here is the documentation for this: https://gerrit-review.googlesource.com/Documentation/rest-api-changes.html#list-files format_params should have the following = {'change_id': None, 'revision_id': None} """ print response @auth_and_get_result( query_string='/changes/{change_id}/revisions/{revision_id}/files/{file_id}/contents') def display_file_contents( response=None, format_params={}): """ format_params should have the following = { 'change_id': ..., 'revision_id': ..., 'file_id': ... } """ print response
gpl-2.0
-2,036,446,997,875,048,700
32.911565
87
0.694283
false
utn-frm-si/reservas
reservas/settings/base.py
1
4810
# coding=utf-8 """ Django settings for reservas project. Generated by 'django-admin startproject' using Django 1.8.5. For more information on this file, see https://docs.djangoproject.com/en/1.8/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/1.8/ref/settings/ """ # Build paths inside the project like this: os.path.join(BASE_DIR, ...) import os import random BASE_DIR = os.path.dirname(os.path.dirname(os.path.dirname(os.path.abspath(__file__)))) # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.8/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! # Establece la clave secreta a partir de la variable de entorno 'DJANGO_SECRET_KEY', o genera una # clave aleatoria si ésta no se encuentra seteada. SECRET_KEY = os.environ.get('DJANGO_SECRET_KEY', ''.join([random.SystemRandom() .choice('abcdefghijklmnopqrstuvwxyz0123456789!@#$%^&*(-_=+)') for i in range(50)])) # SECURITY WARNING: don't run with debug turned on in production! DEBUG = True ALLOWED_HOSTS = [] # Administradores del proyecto. ADMINS = [] MANAGERS = [] # Application definition INSTALLED_APPS = ( 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'djangobower', 'app_facturacion', 'app_reservas.apps.ReservasConfig', ) MIDDLEWARE_CLASSES = ( 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.auth.middleware.SessionAuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'django.middleware.security.SecurityMiddleware', ) ROOT_URLCONF = 'reservas.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [os.path.join(BASE_DIR, 'templates')], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], 'debug': DEBUG, }, }, ] WSGI_APPLICATION = 'reservas.wsgi.application' # Database # https://docs.djangoproject.com/en/1.8/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } # Internationalization # https://docs.djangoproject.com/en/1.8/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Establece el prefijo para el proyecto Django, según la configuración # del servidor web. DJANGO_URL_PREFIX = os.environ.get('DJANGO_URL_PREFIX', '') # Da formato al prefijo URL, para que sea de la forma '<prefijo>/'. # 1. Quita las barras iniciales y finales, por si el prefijo cuenta con más de una. DJANGO_URL_PREFIX = DJANGO_URL_PREFIX.strip('/') # 2. Añade una única barra final, en caso de que el prefijo no haya quedado vacío luego de la # operación anterior. if DJANGO_URL_PREFIX: DJANGO_URL_PREFIX += '/' # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.8/howto/static-files/ STATIC_ROOT = os.path.join(BASE_DIR, 'staticfiles') STATIC_URL = '/' + DJANGO_URL_PREFIX + 'static/' STATICFILES_DIRS = ( os.path.join(BASE_DIR, 'static'), ) STATICFILES_FINDERS = ( 'django.contrib.staticfiles.finders.FileSystemFinder', 'django.contrib.staticfiles.finders.AppDirectoriesFinder', 'djangobower.finders.BowerFinder', ) STATICFILES_STORAGE = 'whitenoise.django.GzipManifestStaticFilesStorage' MEDIA_ROOT = os.path.join(BASE_DIR, 'media') MEDIA_URL = '/' + DJANGO_URL_PREFIX + 'media/' BOWER_COMPONENTS_ROOT = os.path.join(BASE_DIR, 'components') BOWER_INSTALLED_APPS = ( 'bootstrap-datepicker', 'bootswatch-dist#flatly', 'font-awesome', 'fullcalendar-scheduler', 'handsontable', 'jquery', 'pace', 'qtip2', 'slick-carousel', ) # Token de Google Calendar, utilizado para consultar la información de eventos # de los calendarios de Google Calendar. GOOGLE_CALENDAR_TOKEN = os.environ.get('GOOGLE_CALENDAR_TOKEN', '') BROKER_URL = os.environ.get('BROKER_URL', 'amqp://guest:guest@rabbit//')
mit
2,310,515,445,167,360,000
27.921687
98
0.684857
false
stmobo/Machine-Learning
generative-waifu-network/discriminator_network.py
1
7668
import tensorflow as tf import tensorflow.contrib.slim as slim import numpy as np import selu from common import * def discriminator_parameters(parser): group = parser.add_argument_group('Discriminator Network Parameters', description='These parameters control the structure of the discriminator / critic network.') group.add_argument('--inception-modules', action='store_true', help='Discriminator network will be built from Inception modules if true') group.add_argument('--dsc-final-depth', type=int, default=64, help='Final number of discirminator conv filters (before image output layer)') group.add_argument('--dsc-bottleneck-depth', type=int, default=64, help='Bottleneck layer depth for Inception modules') group.add_argument('--dsc-layers', type=int, default=4, help='Number of discriminator conv layers (not including output layer)') group.add_argument('--dsc-activation', help='Activation function to use for discriminator network') group.add_argument('--dsc-weight-clip', type=float, default=1e-2, help='Critic network weight clipping values (for Wasserstein GANs)') group.add_argument('--dsc-normalizer', help='Normalization function to use in network layers (valid values are \'batch\', \'layer\', \'none\')') class Discriminator: def __init__(self, args, image_in): self.args = args self.image = image_in def build(self, scope='Discriminator', reuse=None): with tf.variable_scope(scope, reuse=reuse): net = self.input_layer(self.image, self.labels) for layer in range(self.args.dsc_layers): current_layer_depth = self.args.dsc_final_depth // (2 ** (self.args.dsc_layers - layer - 1)) if self.args.inception_modules: net = self.inception_module(net, current_layer_depth, scope='Inception{:d}'.format(layer)) else: net = self.conv_layer(net, current_layer_depth, scope='Conv{:d}'.format(layer)) self.critic, self.pred_labels = self.output_layer(net) self.vars = slim.get_trainable_variables(scope=scope) return self.critic, self.pred_labels def activation_fn(self): if self.args.dsc_activation == 'relu': return tf.nn.relu elif self.args.dsc_activation == 'lrelu': return leaky_relu elif self.args.dsc_activation == 'selu': return selu.selu raise ValueError("Invalid value for --dsc-activation: " + self.args.dsc_activation) def initializer_fn(self): if self.args.dsc_activation == 'relu' or self.args.dsc_activation == 'lrelu': return None else: return selu.initializer def normalizer_fn(self): if self.args.dsc_normalizer == 'batch': return slim.fused_batch_norm elif self.args.dsc_normalizer == 'layer': return slim.layer_norm elif self.args.dsc_normalizer == 'none': return None raise ValueError("Invalid value for --dsc-normalizer: " + self.args.dsc_normalizer) def network_arg_scope(self): return slim.arg_scope([slim.fully_connected, slim.conv2d, slim.conv2d_transpose], activation_fn=self.activation_fn(), weights_initializer=self.initializer_fn()) def clip_network_weights(self, apply_grad_ops): with tf.control_dependencies([apply_grad_ops]): clipped_weights = [tf.clip_by_value(w, -args.dsc_weight_clip, args.dsc_weight_clip) for w in self.vars] return tf.group(*clipped_weights) def input_gradient_norms(self): input_grads = tf.gradients(self.out, self.image, name='dsc-input-gradients') return tf.norm(input_grads, axis=(1,2)) # Note: Compute norms over height and width (axes 1,2 for NHWC and 2,3 for NCHW) def inception_module(self, tensor_in, output_depth, scope='Inception'): batch_size, input_height, input_width, input_depth = tensor_in.shape.as_list() output_height, output_width = conv_output_size(input_height, 2), conv_output_size(input_width, 2) bottleneck_depth = self.args.dsc_bottleneck_depth head_depth = self.args.head_depth // 4 with slim.arg_scope(self.network_arg_scope()): head_pool = slim.avg_pool2d(tensor_in, kernel_size=3, stride=2, padding='SAME', scope='AvgPool') head_1x1 = slim.conv2d(tensor_in, head_depth, kernel_size=1, stride=2, scope='Conv1x1') head_3x3 = slim.conv2d(tensor_in, bottleneck_depth, kernel_size=1, scope='Conv3x3-BN') head_5x5 = slim.conv2d(tensor_in, bottleneck_depth, kernel_size=1, scope='Conv5x5-BN') head_pool = slim.conv2d(head_pool, head_depth, kernel_size=1, scope='AvgPool-BN') head_3x3 = slim.conv2d(head_3x3, head_depth, kernel_size=3, scope='Conv3x3') # 5x5 conv as stacked 3x3 convolutions head_5x5 = slim.conv2d(head_5x5, head_depth, kernel_size=3, scope='Conv5x5-1') head_5x5 = slim.conv2d(head_5x5, head_depth, kernel_size=3, scope='Conv5x5-2') head_pool = tf.reshape(head_pool, [batch_size, output_height, output_width, head_depth]) head_1x1 = tf.reshape(head_1x1, [batch_size, output_height, output_width, head_depth]) head_3x3 = tf.reshape(head_3x3, [batch_size, output_height, output_width, head_depth]) head_5x5 = tf.reshape(head_5x5, [batch_size, output_height, output_width, head_depth]) out = tf.concat([head_pool, head_1x1, head_3x3, head_5x5], axis=3) norm_fn = self.normalizer_fn() if norm_fn is not None: out = norm_fn(out) return out def conv_layer(self, tensor_in, output_depth, scope='Conv'): batch_size, input_height, input_width, input_depth = tensor_in.shape.as_list() output_height, output_width = conv_output_size(input_height, 2), conv_output_size(input_width, 2) with slim.arg_scope(self.network_arg_scope()): net = slim.conv2d(tensor_in, output_depth, kernel_size=3, stride=2, normalizer_fn=self.normalizer_fn(), scope=scope) net = tf.reshape(net, [batch_size, output_height, output_width, output_depth]) return net def input_layer(self, image_in, labels_in): batch_size, input_height, input_width, input_depth = image_in.shape.as_list() output_height, output_width = conv_output_size(input_height, 2), conv_output_size(input_width, 2) output_depth = self.args.dsc_final_depth // (2 ** self.args.dsc_layers) with slim.arg_scope(self.network_arg_scope()): net = slim.conv2d(image_in, output_depth, kernel_size=3, scope='Input-Conv1') net = slim.conv2d(net, output_depth, kernel_size=3, stride=2, scope='Input-Conv2') # projected_labels = slim.fully_connected(labels_in, output_height * output_width, scope='LabelProjection') # projected_labels = tf.reshape(projected_labels, [batch_size, output_height, output_width, 1]) # net = tf.concat([net, projected_labels], axis=3) return net def output_layer(self, tensor_in): batch_size, input_height, input_width, input_depth = image_in.shape.as_list() flat_in = tf.reshape(tensor_in, [batch_size, -1]) critic_out = slim.fully_connected( flat_in, 1, activation_fn=None, scope='Critic', ) labels_out = slim.fully_connected( flat_in, self.args.label_size, activation_fn=None, scope='PredLabels', ) return critic_out, labels_out
mit
-7,778,606,382,283,700,000
48.792208
168
0.64254
false
letsmeet-click/letsmeet.click
letsmeet/tests/test_home.py
1
1580
generic_menu_items = [ 'Home', 'All Communities', 'Contact', 'About/FAQ', 'Legal/Contact', ] logged_out_menu_items = ['Login'] logged_in_menu_items = ['Logout'] advertisements = [ 'No registration required', 'Organize your event attendees', 'Use your existing communication channels', 'It\'s free', 'Kickstart your event', ] dashboard = [ 'You have no upcoming events.', 'You currently have no active community subscriptions.', '<noscript>0</noscript> Communities', '<noscript>0</noscript> upcoming confirmed events', 'Currently no upcoming events', ] def test_home(client): resp = client.get('/') assert resp.status_code == 200 for menu_item in generic_menu_items + logged_out_menu_items: assert menu_item.encode() in resp.content for menu_item in logged_in_menu_items: assert menu_item.encode() not in resp.content for advertisement in advertisements: assert advertisement.encode() in resp.content for item in dashboard: assert item.encode() not in resp.content def test_home_logged_in(logged_in_client): resp = logged_in_client.get('/') assert resp.status_code == 200 for menu_item in generic_menu_items + logged_in_menu_items: assert menu_item.encode() in resp.content for menu_item in logged_out_menu_items: assert menu_item.encode() not in resp.content for advertisement in advertisements: assert advertisement.encode() not in resp.content for item in dashboard: assert item.encode() in resp.content
mit
5,441,017,305,872,724,000
25.779661
71
0.672785
false
glumu/django-redis-cluster
django_redis_cluster/cache.py
1
4615
#coding:utf8 import functools import logging from django.conf import settings from django.core.cache.backends.base import BaseCache from .utils import load_class from .exceptions import ConnectionInterrupted # 错误异常配置 DJANGO_REDIS_CLUSTER_IGNORE_EXCEPTIONS = getattr(settings, 'DJANGO_REDIS_CLUSTER_IGNORE_EXCEPTIONS', False) DJANGO_REDIS_CLUSTER_LOG_IGNORED_EXCEPTIONS = getattr(settings, 'DJANGO_REDIS_CLUSTER_LOG_IGNORED_EXCEPTIONS', False) DJANGO_REDIS_CLUSTER_LOGGER = getattr(settings, 'DJANGO_REDIS_CLUSTER_LOGGER', False) if DJANGO_REDIS_CLUSTER_IGNORE_EXCEPTIONS: logger = logging.getLogger((DJANGO_REDIS_CLUSTER_LOGGER or __name__)) def omit_exception(method=None, return_value=None): '''连接异常处理修饰器''' if method is None: return functools.partial(omit_exception, return_value=return_value) @functools.wraps(method) def _decorator(self, *args, **kwargs): try: return method(self, *args, **kwargs) except ConnectionInterrupted as e: if self._ignore_exceptions: if DJANGO_REDIS_CLUSTER_LOG_IGNORED_EXCEPTIONS: logger.error(str(e)) return return_value raise e.parent return _decorator class RedisClusterCache(BaseCache): def __init__(self, server, params): super(RedisClusterCache, self).__init__(params) self._server = server self._params = params options = params.get('OPTIONS', {}) self._client_cls = options.get("CLIENT_CLASS", "django_redis_cluster.client.DefaultClient") self._client_cls = load_class(self._client_cls) self._client = None self._ignore_exceptions = options.get('IGNORE_EXCEPTIONS', DJANGO_REDIS_CLUSTER_IGNORE_EXCEPTIONS) @property def client(self): ''' Lazy client connection property ''' if self._client is None: self._client = self._client_cls(self._server, self._params, self) return self._client @omit_exception def add(self, *args, **kwargs): return self.client.add(*args, **kwargs) @omit_exception def set(self, *args, **kwargs): return self.client.set(*args, **kwargs) @omit_exception def set_many(self, *args, **kwargs): return self.client.set_many(*args, **kwargs) @omit_exception def get(self, key, default=None, version=None): try: return self.client.get(key, default=default, version=version) except ConnectionInterrupted as e: if DJANGO_REDIS_CLUSTER_LOG_IGNORED_EXCEPTIONS: logger.error(str(e)) return default raise @omit_exception(return_value={}) def get_many(self, *args, **kwargs): return self.client.get_many(*args, **kwargs) @omit_exception def delete(self, *args, **kwargs): return self.client.delete(*args, **kwargs) @omit_exception def delete_pattern(self, *args, **kwargs): return self.client.delete_pattern(*args, **kwargs) @omit_exception def delete_many(self, *args, **kwargs): return self.client.delete_many(*args, **kwargs) @omit_exception def clear(self): return self.client.clear() @omit_exception def keys(self, *args, **kwargs): return self.client.keys(*args, **kwargs) @omit_exception def has_key(self, *args, **kwargs): return self.client.has_key(*args, **kwargs) @omit_exception def lock(self, *args, **kwargs): return self.client.lock(*args, **kwargs) @omit_exception def incr_version(self, *args, **kwargs): return self.client.incr_version(*args, **kwargs) @omit_exception def incr(self, *args, **kwargs): return self.client.incr(*args, **kwargs) @omit_exception def decr(self, *args, **kwargs): return self.client.decr(*args, **kwargs) @omit_exception def iter_keys(self, *args, **kwargs): return self.client.iter_keys(*args, **kwargs) @omit_exception def ttl(self, *args, **kwargs): return self.client.ttl(*args, **kwargs) @omit_exception def persist(self, *args, **kwargs): return self.client.persist(*args, **kwargs) @omit_exception def expire(self, *args, **kwargs): return self.client.expire(*args, **kwargs)
bsd-3-clause
1,818,026,592,783,556,900
26.793939
117
0.604144
false
CSC-IT-Center-for-Science/chipster-job-manager
jobmanager/tests/test_utils.py
1
2079
from jobmanager.utils import parse_msg_body class TestUtils(object): def setUp(self): pass def test_parse_msg_body(self): d1 = {"map": {"entry": [{"string": ["command", "choose"]}, {"string": ["named-parameter-value1", "8a98c0c3-5560-41df-8b86-67435b25d565"]}, {"string": ["named-parameter-key1", "as-id"]}, {"string": ["named-parameter-value0", "bab581a8-0d74-47e1-a753-18b4ad032153"]}, {"string": ["named-parameter-key0", "job-id"]}]}} r1 = parse_msg_body(d1) c1 = {'job-id': 'bab581a8-0d74-47e1-a753-18b4ad032153', 'as-id': '8a98c0c3-5560-41df-8b86-67435b25d565', 'command': 'choose'} assert r1 == c1 d2 = {"map": {"entry": [{"string": ["payload_input", "214a6078-9ee9-476c-932d-d073fc7658fd"]}, {"string": ["analysisID", "test-data-in.R"]}, {"string": ["jobID", "bab581a8-0d74-47e1-a753-18b4ad032153"]}]}} r2 = parse_msg_body(d2) c2 = {'analysisID': 'test-data-in.R', 'payload_input': '214a6078-9ee9-476c-932d-d073fc7658fd', 'jobID': 'bab581a8-0d74-47e1-a753-18b4ad032153'} assert r2 == c2 d3 = {u'map': {u'entry': [{u'null': u'', u'string': u'errorMessage'}, {u'string': [u'jobId', u'7f03370e-714d-450d-8707-4cf4b478fadf']}, {u'string': [u'outputText', u'''data-input-test.txt")''']}, {u'string': [u'sourceCode', u'chipster.tools.path = "aa")']}, {u'string': [u'stateDetail', u'transferring output data']}, {u'string': [u'exitState', u'RUNNING']}]}} r3 = parse_msg_body(d3) c3 = {u'outputText': u'data-input-test.txt")', u'jobId': u'7f03370e-714d-450d-8707-4cf4b478fadf', u'sourceCode': u'chipster.tools.path = "aa")', u'exitState': u'RUNNING', u'stateDetail': u'transferring output data'} assert r3 == c3 d4 = {u'map': {u'entry': [{u'string': [u'command', u'cancel']}, {u'string': [u'named-parameter-value0', u'96f7ab23-2fa8-4a81-8097-de99af1c74fa']}, {u'string': [u'named-parameter-key0', u'job-id']}]}} r4 = parse_msg_body(d4) c4 = {u'job-id': u'96f7ab23-2fa8-4a81-8097-de99af1c74fa', u'command': u'cancel'} assert r4 == c4
mit
-6,488,086,427,102,607,000
85.625
368
0.617605
false
ktarrant/options_csv
heatmap.py
1
3194
import plotly.plotly as py import plotly.graph_objs as go from options_csv import OUTPUT_FILENAME_PREFIX_FORMAT import re import os import pandas as pd def build_heatmap(openInt_df): trace = go.Heatmap(z=openInt_df.fillna(0).as_matrix(), x=openInt_df.columns, y=openInt_df.index) data=[trace] layout = go.Layout( zaxis=dict( type='log', autorange=True ) ) fig = go.Figure(data=data, layout=layout) py.plot(fig, filename='expiration-heatmap') def build_colorscale(openInt_df): data = [{ 'x': openInt_df.columns, 'y': openInt_df.index, 'z': openInt_df.fillna(0).as_matrix(), 'type': 'heatmap', 'colorscale': [ # [0, 'rgb(250, 250, 250)'], #0 # [1./10000, 'rgb(200, 200, 200)'], #10 # [1./1000, 'rgb(150, 150, 150)'], #100 # [1./100, 'rgb(100, 100, 100)'], #1000 # [1./10, 'rgb(50, 50, 50)'], #10000 # [1., 'rgb(0, 0, 0)'], #100000 [0, 'rgb(250, 250, 250)'], #0 [1./16.0, 'rgb(200, 200, 200)'], #10 [1./8.0, 'rgb(150, 150, 150)'], #100 [1./4.0, 'rgb(100, 100, 100)'], #1000 [1./2.0, 'rgb(50, 50, 50)'], #10000 [1., 'rgb(0, 0, 0)'], #100000 ], 'colorbar': { 'tick0': 0, 'tickmode': 'array', 'tickvals': [0, 1000, 10000, 100000] } }] layout = {'title': 'Log Colorscale'} fig = {'data': data, 'layout': layout} py.plot(fig, filename='expiration-heatmap') def get_combined_options_data(csv_date, symbol, indir): expected_prefix = OUTPUT_FILENAME_PREFIX_FORMAT.format(date=csv_date, ticker=symbol) options_tables = {} for root, dirs, files in os.walk(indir): for file in files: if file.startswith(str(csv_date)) and file.endswith(".csv"): expiration_with_ext = file.split("_")[-1] expiration = expiration_with_ext.split(".")[0][3:] filename = os.path.join(root, file) options_table = pd.DataFrame.from_csv(filename) options_tables[expiration] = options_table return pd.Panel(options_tables) if __name__ == "__main__": import argparse import datetime parser = argparse.ArgumentParser(description="Makes a heatmap from a sequence of expirations") parser.add_argument("--symbol", default="spx", help="Symbol in CSV files") parser.add_argument("--indir", default=os.getcwd(), help="Directory to look for CSV files") args = parser.parse_args() # TODO: Add date selection (just use today for now...) args.csv_date = datetime.date.today() options_panel = get_combined_options_data(args.csv_date, args.symbol, args.indir) print(options_panel) call_openInt = options_panel.minor_xs('call_Open Int.') print(call_openInt) build_colorscale(call_openInt)
mit
7,383,383,247,199,349,000
36.576471
194
0.520977
false
exaroth/subrosa
subrosa/models/UserImagesModel.py
1
2702
# -*- coding: utf-8 -*- """ subrosa.models.ArticlesModel ========================= Implements model and methods related to subrosa images :copyright: (c) 2014 by Konrad Wasowicz :license: MIT, see LICENSE for details. """ import datetime from peewee import * from subrosa.models.BaseModel import BaseModel from subrosa.models.UsersModel import Users from subrosa.helpers import handle_errors from subrosa import db class UserImages(BaseModel): image_link = TextField() date_added = DateTimeField(default=datetime.datetime.utcnow()) delete_hash = TextField(null=True) description = TextField(null=True) is_vertical = IntegerField(null=True) gallery = BooleanField(default=False) imgur_img = BooleanField(default=False) owner = ForeignKeyField(Users, related_name="images") @staticmethod def get_image(id): return UserImages.get_single("id", id) @staticmethod def check_exists(image_link): return (UserImages.select() .where(UserImages.image_link == image_link) .exists()) @staticmethod def get_gallery_images(page, per_page, username=None, gallery=False): q = UserImages.select() if username: q = q.join(Users).where(Users.username == username) if gallery: return q.where(UserImages.gallery == True).paginate(page, per_page) return q.paginate(page, per_page) @staticmethod @db.commit_on_success def gallerify(image): try: is_gallerified = image.gallery image.gallery = not is_gallerified image.save() except Exception as e: handle_errors("Error updating image") @staticmethod @db.commit_on_success def add_image(image_link, description, owner, is_vertical=True, imgur_img=False, delete_hash=None): try: UserImages.create( image_link=image_link, description=description, is_vertical=is_vertical, owner=owner, imgur_img=imgur_img, delete_hash=delete_hash, ) return 1 except Exception as e: handle_errors("Error creating image") raise @staticmethod @db.commit_on_success def delete_image(image): try: image.delete_instance() return 1 except Exception as e: handle_errors("Error deleting image") raise def __repr__(self): return "<Image: {0}>".format(self.image_link)
gpl-3.0
-7,331,649,137,862,401,000
26.55102
79
0.584815
false
jlindenger/python-http-client
setup.py
1
1244
import sys import os from setuptools import setup long_description = 'Please see our GitHub README' if os.path.exists('README.txt'): long_description = open('README.txt').read() def getRequires(): deps = [] if (2, 6) <= sys.version_info < (2, 7): deps.append('unittest2') return deps base_url = 'https://github.com/sendgrid/' version = '3.0.0' setup( name='python_http_client', version=version, author='Elmer Thomas', author_email='[email protected]', url='{0}python-http-client'.format(base_url), download_url='{0}python-http-client/tarball/{1}'.format(base_url, version), packages=['python_http_client'], license='MIT', description='HTTP REST client, simplified for Python', long_description=long_description, install_requires=getRequires(), keywords=[ 'REST', 'HTTP', 'API'], classifiers=[ 'Programming Language :: Python :: 2.6', 'Programming Language :: Python :: 2.7', 'Programming Language :: Python :: 3.2', 'Programming Language :: Python :: 3.3', 'Programming Language :: Python :: 3.4', 'Programming Language :: Python :: 3.5', 'Programming Language :: Python :: 3.6' ] )
mit
-5,175,553,856,241,423,000
28.619048
79
0.614148
false
rubennj/persistence
persistence.py
1
9060
# -*- coding: utf-8 -*- """ Created on Tue Jan 10 20:09:35 2017 @author: ruben """ import os from functools import wraps import pandas as pd def persist_timeseries_to_file(filename_cache=None): """ Persits a Pandas DataFrame object returned by a function into cache file using a decorator, so it decorates the function that returns the pd.DataFrame. The function receives some extra parameters to be used by the decorator (and to make it explicit it is advised to add them in the definition of the function even if they are not used in the non-cached version). This approach allows to modify them in each instance of the function: - enable_cache=False : actually enables the cache (allows to choose it) - path_cache=None : path where the cache file is saved. If None, it takes the current path - update_cache=False : It forces to update the cache file, even if there are data in it Also time : pd.DatetimeIndex that is the index of the pd.DataFrame should be the name of the parameter in the original function Parameters ---------- filename_cache : String, default None Name of cache file Returns ------- decorator : function Function that will persist data into cache file """ if filename_cache is None: raise ValueError('A cache-file name is required.') persistence_type = filename_cache.split('.')[1] def decorator(original_func): """ Decorator function """ # The main intended use for @wraps() is to wrap the decorated function # and return the wrapper. # If the wrapper function is not updated, the metadata of the returned # function will reflect the wrapper definition rather than the original # function definition, which is typically less than helpful. @wraps(original_func) def new_func(time, enable_cache=False, path_cache=None, update_cache=False, verbose_cache=False, *args, **kwargs): """ Decorated function """ if not enable_cache: return original_func(time, *args, **kwargs) if path_cache is None: path_cache = os.path.abspath('') if not os.path.exists(path_cache): os.makedirs(path_cache) path_file_cache = os.path.join(path_cache, filename_cache) if verbose_cache: print('> Path cache:', path_file_cache) try: if persistence_type == 'csv': cache = pd.read_csv(path_file_cache, index_col=0, parse_dates=True) elif persistence_type == 'pickle': cache = pd.read_pickle(path_file_cache) elif persistence_type == 'json': cache = pd.read_json(path_file_cache) else: raise ValueError('Unknown type of persistence', persistence_type) if verbose_cache: print('> Reading cache...') except (IOError, ValueError): if verbose_cache: print('> Cache empty') cache = pd.DataFrame() if not update_cache: if time.isin(cache.index).all(): data = cache.loc[time] if verbose_cache: print('> Cache contains requested data') else: if verbose_cache: print('> Reading data source...') data = original_func(time, **kwargs) if not data.empty: if persistence_type == 'csv': pd.concat([data, cache], join='inner').to_csv(path_file_cache) elif persistence_type == 'pickle': pd.concat([data, cache], join='inner').to_pickle(path_file_cache) elif persistence_type == 'json': pd.concat([data, cache], join='inner').to_json(path_file_cache) else: raise ValueError('Unknown type of persistence', persistence_type) if verbose_cache: print('> Updating cache with requested data...') else: if verbose_cache: print('> Cache not updated because requested data is empty') else: data = original_func(time, **kwargs) if persistence_type == 'csv': data.to_csv(path_file_cache) elif persistence_type == 'pickle': data.to_pickle(path_file_cache) elif persistence_type == 'json': data.to_json(path_file_cache) if verbose_cache: print('> Saving data in cache...') return data return new_func return decorator def persist_df_to_file(filename_cache=None): """ Persits a Pandas DataFrame object returned by a function into cache file using a decorator, so it decorates the function that returns the pd.DataFrame. The function receives some extra parameters to be used by the decorator (and to make it explicit it is advised to add them in the definition of the function even if they are not used in the non-cached version). This approach allows to modify them in each instance of the function: - enable_cache=False : actually enables the cache (allows to choose it) - path_cache=None : path where the cache file is saved. If None, it takes the current path - update_cache=False : It forces to update the cache file, even if there are data in it Parameters ---------- filename_cache : String, default None Name of cache file Returns ------- decorator : function Function that will persist data into cache file """ if filename_cache is None: raise ValueError('A cache-file name is required.') persistence_type = filename_cache.split('.')[1] def decorator(original_func): """ Decorator function """ # The main intended use for @wraps() is to wrap the decorated function # and return the wrapper. # If the wrapper function is not updated, the metadata of the returned # function will reflect the wrapper definition rather than the original # function definition, which is typically less than helpful. @wraps(original_func) def new_func(enable_cache=False, path_cache=None, update_cache=False, verbose_cache=False, *args, **kwargs): """ Decorated function """ if not enable_cache: return original_func(*args, **kwargs) if path_cache is None: path_cache = os.path.abspath('') if not os.path.exists(path_cache): os.makedirs(path_cache) path_file_cache = os.path.join(path_cache, filename_cache) if verbose_cache: print('> Path cache:', path_file_cache) try: if persistence_type == 'csv': cache = pd.read_csv(path_file_cache, index_col=0, parse_dates=True) elif persistence_type == 'pickle': cache = pd.read_pickle(path_file_cache) elif persistence_type == 'json': cache = pd.read_json(path_file_cache) else: raise ValueError('Unknown type of persistence', persistence_type) if verbose_cache: print('> Reading cache...') except (IOError, ValueError): if verbose_cache: print('> Cache empty') cache = pd.DataFrame() if not update_cache and not cache.empty: data = cache if verbose_cache: print('> Cache contains data') else: data = original_func(**kwargs) if persistence_type == 'csv': data.to_csv(path_file_cache) elif persistence_type == 'pickle': data.to_pickle(path_file_cache) elif persistence_type == 'json': data.to_json(path_file_cache) if verbose_cache: print('> Saving data in cache...') return data return new_func return decorator
mit
-3,302,659,504,509,129,700
37.920705
93
0.528918
false
mansonul/events
events/contrib/plugins/form_elements/fields/date_drop_down/base.py
1
2604
from __future__ import absolute_import from django.forms.extras.widgets import SelectDateWidget from django.forms.fields import DateField from django.utils.translation import ugettext_lazy as _ from fobi.base import FormFieldPlugin, get_theme from . import UID from .forms import DateDropDownInputForm __title__ = 'fobi.contrib.plugins.form_elements.fields.' \ 'date_drop_down.base' __author__ = 'Artur Barseghyan <[email protected]>' __copyright__ = '2014-2017 Artur Barseghyan' __license__ = 'GPL 2.0/LGPL 2.1' __all__ = ('DateDropDownInputPlugin',) theme = get_theme(request=None, as_instance=True) class DateDropDownInputPlugin(FormFieldPlugin): """Date drop down field plugin.""" uid = UID name = _("Date drop down") group = _("Fields") form = DateDropDownInputForm def get_form_field_instances(self, request=None, form_entry=None, form_element_entries=None, **kwargs): """Get form field instances.""" widget_attrs = { 'class': theme.form_element_html_class, 'type': 'date', } years = None if self.data.year_min and self.data.year_max: years = range(self.data.year_min, self.data.year_max) field_kwargs = { 'label': self.data.label, 'help_text': self.data.help_text, 'initial': self.data.initial, # 'input_formats': self.data.input_formats, 'required': self.data.required, 'widget': SelectDateWidget(attrs=widget_attrs, years=years), } # if self.data.input_formats: # kwargs['input_formats'] = self.data.input_formats return [(self.data.name, DateField, field_kwargs)] def submit_plugin_form_data(self, form_entry, request, form, form_element_entries=None, **kwargs): """Submit plugin form data/process. :param fobi.models.FormEntry form_entry: Instance of ``fobi.models.FormEntry``. :param django.http.HttpRequest request: :param django.forms.Form form: """ # In case if we should submit value as is, we don't return anything. # In other cases, we proceed further. # Get the object value = form.cleaned_data.get(self.data.name, None) try: value = value.strftime("%Y-%m-%d") except Exception as err: pass # Overwrite ``cleaned_data`` of the ``form`` with object qualifier. form.cleaned_data[self.data.name] = value return form
mit
6,885,615,648,063,343,000
32.384615
76
0.610983
false
myt00seven/svrg
svrg_bn/draw_4_bndecay_smaller.py
1
15643
# This is used to draw three comparisons for SGD+BN, SVRG+BN and Streaming SVRG +BN import matplotlib import matplotlib.pyplot as plt plt.switch_backend('agg') import pylab import numpy as np import sys # all the methods are with BN layers!!! def deminish(a) : end_factor=0.4 length = len(a) for i in range(length): a[i] = a[i] * (1-(1-end_factor)*(i/float(length))) return a def moving_average(a, n=3) : ret = np.cumsum(a, dtype=float) ret[n:] = ret[n:] - ret[:-n] return ret[n - 1:] / n PATH_DATA_adagrad = "data/" PATH_DATA_SVRG = "data/" PATH_DATA_Stream = "data/" PATH_DATA = "data/" PATH_FIGURE = "figure_bndecay/" STARTPOINT = 5 LINEWIDTH = 2 DRAW_COMPARE = True DRAW_Line1 = True LOAD_SVRG = True DRAW_Line1 = True DRAW_Line2 = True DRAW_Line3 = True DRAW_Line4 = True Y_LIM_FINE_TUNING = True # Number of Moving Average # SPEC_L1 = 'bo-' # SPEC_L1 = 'g^--' # SPEC_L2 = 'cs:' # SPEC_L4 = 'r*-.' SPEC_L1 = 'b-' SPEC_L2 = 'c:' SPEC_L3 = 'r-.' SPEC_L4 = 'g--' NUM_EPOCHS = 200 def main(num_epochs=NUM_EPOCHS): if DRAW_COMPARE: str_epochs = str(num_epochs) if DRAW_Line1: Line1_acc_test= np.loadtxt(PATH_DATA +"ratio_0.25_acc_test.txt") if DRAW_Line1: Line1_acc_train= np.loadtxt(PATH_DATA +"ratio_0.25_acc_train.txt") if DRAW_Line1: Line1_acc_val= np.loadtxt(PATH_DATA +"ratio_0.25_acc_val.txt") if DRAW_Line1: Line1_loss_test= np.loadtxt(PATH_DATA +"ratio_0.25_loss_test.txt") if DRAW_Line1: Line1_loss_train= np.loadtxt(PATH_DATA +"ratio_0.25_loss_train.txt") if DRAW_Line1: Line1_loss_val= np.loadtxt(PATH_DATA +"ratio_0.25_loss_val.txt") if DRAW_Line1: Line1_epoch_times= np.loadtxt(PATH_DATA +"ratio_0.25_epoch_times.txt") if DRAW_Line2: Line2_acc_train= np.loadtxt(PATH_DATA_SVRG +"ratio_0.5_acc_train.txt") if DRAW_Line2: Line2_acc_val= np.loadtxt(PATH_DATA_SVRG +"ratio_0.5_acc_val.txt") if DRAW_Line2: Line2_loss_train= np.loadtxt(PATH_DATA_SVRG +"ratio_0.5_loss_train.txt") if DRAW_Line2: Line2_loss_val= np.loadtxt(PATH_DATA_SVRG +"ratio_0.5_loss_val.txt") if DRAW_Line2: Line2_acc_test= np.loadtxt(PATH_DATA_SVRG +"ratio_0.5_acc_test.txt") if DRAW_Line2: Line2_loss_test= np.loadtxt(PATH_DATA_SVRG +"ratio_0.5_loss_test.txt") if DRAW_Line2: Line2_epoch_times= np.loadtxt(PATH_DATA_SVRG +"ratio_0.5_epoch_times.txt") if DRAW_Line3: Line3_acc_train= np.loadtxt(PATH_DATA +"ratio_0.75_acc_train.txt") if DRAW_Line3: Line3_acc_val= np.loadtxt(PATH_DATA +"ratio_0.75_acc_val.txt") if DRAW_Line3: Line3_loss_train= np.loadtxt(PATH_DATA +"ratio_0.75_loss_train.txt") if DRAW_Line3: Line3_loss_val= np.loadtxt(PATH_DATA +"ratio_0.75_loss_val.txt") if DRAW_Line3: Line3_acc_test= np.loadtxt(PATH_DATA +"ratio_0.75_acc_test.txt") if DRAW_Line3: Line3_loss_test= np.loadtxt(PATH_DATA +"ratio_0.75_loss_test.txt") if DRAW_Line3: Line3_epoch_times= np.loadtxt(PATH_DATA +"ratio_0.75_epoch_times.txt") if DRAW_Line4: Line4_acc_train= np.loadtxt(PATH_DATA +"ratio_1.0_acc_train.txt") if DRAW_Line4: Line4_acc_val= np.loadtxt(PATH_DATA +"ratio_1.0_acc_val.txt") if DRAW_Line4: Line4_loss_train= np.loadtxt(PATH_DATA +"ratio_1.0_loss_train.txt") if DRAW_Line4: Line4_loss_val= np.loadtxt(PATH_DATA +"ratio_1.0_loss_val.txt") if DRAW_Line4: Line4_acc_test= np.loadtxt(PATH_DATA +"ratio_1.0_acc_test.txt") if DRAW_Line4: Line4_loss_test= np.loadtxt(PATH_DATA +"ratio_1.0_loss_test.txt") if DRAW_Line4: Line4_epoch_times= np.loadtxt(PATH_DATA +"ratio_1.0_epoch_times.txt") if DRAW_Line1: np.ones(num_epochs*0.8)*Line1_epoch_times[39] # count_Line1 = 200 # count_Line2 = 200 # count_Line3 = 200 if DRAW_Line1: count_Line1 = np.arange(Line1_acc_val.shape[0])+1 if DRAW_Line2: count_Line2 = np.arange(Line2_acc_train.shape[0])+1 if DRAW_Line3: count_Line3 = np.arange(Line3_acc_val.shape[0])+1 if DRAW_Line4: count_Line4 = np.arange(Line4_acc_val.shape[0])+1 # print mlp_sgd_acc_train MAXLENGTH = num_epochs if (MAXLENGTH>0 or STARTPOINT>0): # Need add for epoch_times if DRAW_Line1: count_Line1 = count_Line1[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: count_Line2 = count_Line2[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: count_Line3 = count_Line3[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: count_Line4 = count_Line4[STARTPOINT:MAXLENGTH+1] if DRAW_Line1: Line1_acc_test = Line1_acc_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: Line2_acc_test = Line2_acc_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: Line3_acc_test = Line3_acc_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: Line4_acc_test = Line4_acc_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line1: Line1_loss_test = Line1_loss_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: Line2_loss_test = Line2_loss_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: Line3_loss_test = Line3_loss_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: Line4_loss_test = Line4_loss_test[STARTPOINT:MAXLENGTH+1] if DRAW_Line1: Line1_acc_val = Line1_acc_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: Line2_acc_val = Line2_acc_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: Line3_acc_val = Line3_acc_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: Line4_acc_val = Line4_acc_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line1: Line1_loss_val = Line1_loss_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: Line2_loss_val = Line2_loss_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: Line3_loss_val = Line3_loss_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: Line4_loss_val = Line4_loss_val[STARTPOINT:MAXLENGTH+1] if DRAW_Line1: Line1_acc_train = Line1_acc_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: Line2_acc_train = Line2_acc_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: Line3_acc_train = Line3_acc_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: Line4_acc_train = Line4_acc_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line1: Line1_loss_train = Line1_loss_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: Line2_loss_train = Line2_loss_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: Line3_loss_train = Line3_loss_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: Line4_loss_train = Line4_loss_train[STARTPOINT:MAXLENGTH+1] if DRAW_Line1: Line1_epoch_times = Line1_epoch_times[STARTPOINT:MAXLENGTH+1] if DRAW_Line2: Line2_epoch_times = Line2_epoch_times[STARTPOINT:MAXLENGTH+1] if DRAW_Line3: Line3_epoch_times = Line3_epoch_times[STARTPOINT:MAXLENGTH+1] if DRAW_Line4: Line4_epoch_times = Line4_epoch_times[STARTPOINT:MAXLENGTH+1] # print Line1_acc_test #PLOT matplotlib.rcParams.update({'font.size': 16}) plt.figure(1) plt.title('Loss of Validation Set') if DRAW_Line1: plt.plot(count_Line1, Line1_loss_val, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(count_Line2, Line2_loss_val, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(count_Line3, Line3_loss_val, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(count_Line4, Line4_loss_val, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('# Epochs') plt.ylabel('Loss') plt.legend() # plt.show() pylab.savefig(PATH_FIGURE+'CroszsModel_Validation_Set_Loss'+'.png',bbox_inches='tight') plt.figure(2) plt.title('Predict Accuracy of Validation Set') if DRAW_Line1: plt.plot(count_Line1, Line1_acc_val, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(count_Line2, Line2_acc_val, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(count_Line3, Line3_acc_val, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(count_Line4, Line4_acc_val, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('# Epochs') plt.ylabel('Predict Accuracy') plt.legend(bbox_to_anchor=(1,0.4)) # plt.show() pylab.savefig(PATH_FIGURE+'CrossModel_Validation_Set_Predict_Accuracy'+'.png',bbox_inches='tight') plt.figure(3) plt.title('Loss of Training Set') # if Y_LIM_FINE_TUNING: pylab.ylim([-0.01,0.25]) if DRAW_Line1: plt.plot(count_Line1, Line1_loss_train, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(count_Line2, Line2_loss_train, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(count_Line3, Line3_loss_train, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(count_Line4, Line4_loss_train, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('# Epochs') plt.ylabel('Loss') plt.legend() # plt.show() pylab.savefig(PATH_FIGURE+'CrossModel_Training_Set_Loss'+'.png',bbox_inches='tight') plt.figure(4) plt.title('Predict Accuracy of Training Set') if Y_LIM_FINE_TUNING: pylab.ylim([0.93,1.01]) if DRAW_Line1: plt.plot(count_Line1, Line1_acc_train, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(count_Line2, Line2_acc_train, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(count_Line3, Line3_acc_train, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(count_Line4, Line4_acc_train, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('# Epochs') plt.ylabel('Predict Accuracy') plt.legend(bbox_to_anchor=(1,0.4)) # plt.show() pylab.savefig(PATH_FIGURE+'CrossModel_Training_Set_Predict_Accuracy'+'.png',bbox_inches='tight') plt.figure(5) plt.title('Predict Accuracy of Test Set') if DRAW_Line1: plt.plot(count_Line1, Line1_acc_test, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(count_Line2, Line2_acc_test, SPEC_L2 ,label="Alpha = 0055", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(count_Line3, Line3_acc_test, SPEC_L3 ,label="Alpha = 0015", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(count_Line4, Line4_acc_test, SPEC_L4 ,label="Alpha =0.0010", linewidth = LINEWIDTH) plt.xlabel('# Epochs') plt.ylabel('Predict Accuracy') plt.legend(bbox_to_anchor=(1,0.4)) # plt.show() pylab.savefig(PATH_FIGURE+'CrossModel_Test_Set_Predict_Accuracy'+'.png',bbox_inches='tight') plt.figure(6) plt.title('Loss of Test Set') if DRAW_Line1: plt.plot(count_Line1, Line1_loss_test, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(count_Line2, Line2_loss_test, SPEC_L2 ,label="Alpha = 0055", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(count_Line3, Line3_loss_test, SPEC_L3 ,label="Alpha = 0015", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(count_Line4, Line4_loss_test, SPEC_L4 ,label="Alpha =0.0010", linewidth = LINEWIDTH) plt.xlabel('# Epochs') plt.ylabel('Loss') plt.legend() pylab.savefig(PATH_FIGURE+'CrossModel_Test_Set_Loss'+'.png',bbox_inches='tight') # plt.show() #PLOT Per Second matplotlib.rcParams.update({'font.size': 16}) plt.figure(7) plt.title('Loss of Validation Set') if DRAW_Line1: plt.plot(Line1_epoch_times, Line1_loss_val, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(Line2_epoch_times, Line2_loss_val, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(Line3_epoch_times, Line3_loss_val, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(Line4_epoch_times, Line4_loss_val, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('Seconds') plt.ylabel('Loss') plt.legend() # plt.show() pylab.savefig(PATH_FIGURE+'Time_CroszsModel_Validation_Set_Loss'+'.png',bbox_inches='tight') plt.figure(8) plt.title('Predict Accuracy of Validation Set') if DRAW_Line1: plt.plot(Line1_epoch_times, Line1_acc_val, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(Line2_epoch_times, Line2_acc_val, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(Line3_epoch_times, Line3_acc_val, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(Line4_epoch_times, Line4_acc_val, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('Seconds') plt.ylabel('Predict Accuracy') plt.legend(bbox_to_anchor=(1,0.4)) # plt.show() pylab.savefig(PATH_FIGURE+'Time_CrossModel_Validation_Set_Predict_Accuracy'+'.png',bbox_inches='tight') plt.figure(9) plt.title('Loss of Training Set') # if Y_LIM_FINE_TUNING: pylab.ylim([-0.01,0.25]) if DRAW_Line1: plt.plot(Line1_epoch_times, Line1_loss_train, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(Line2_epoch_times, Line2_loss_train, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(Line3_epoch_times, Line3_loss_train, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(Line4_epoch_times, Line4_loss_train, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('Seconds') plt.ylabel('Loss') plt.legend() # plt.show() pylab.savefig(PATH_FIGURE+'Time_CrossModel_Training_Set_Loss'+'.png',bbox_inches='tight') plt.figure(10) plt.title('Predict Accuracy of Training Set') if Y_LIM_FINE_TUNING: pylab.ylim([0.93,1.01]) if DRAW_Line1: plt.plot(Line1_epoch_times, Line1_acc_train, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(Line2_epoch_times, Line2_acc_train, SPEC_L2 ,label="Alpha = 0.05", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(Line3_epoch_times, Line3_acc_train, SPEC_L3 ,label="Alpha = 0.01", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(Line4_epoch_times, Line4_acc_train, SPEC_L4 ,label="Alpha = 0.001", linewidth = LINEWIDTH) plt.xlabel('Seconds') plt.ylabel('Predict Accuracy') plt.legend(bbox_to_anchor=(1,0.4)) # plt.show() pylab.savefig(PATH_FIGURE+'Time_CrossModel_Training_Set_Predict_Accuracy'+'.png',bbox_inches='tight') plt.figure(11) plt.title('Predict Accuracy of Test Set') if DRAW_Line1: plt.plot(Line1_epoch_times, Line1_acc_test, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(Line2_epoch_times, Line2_acc_test, SPEC_L2 ,label="Alpha = 0055", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(Line3_epoch_times, Line3_acc_test, SPEC_L3 ,label="Alpha = 0015", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(Line4_epoch_times, Line4_acc_test, SPEC_L4 ,label="Alpha =0.0010", linewidth = LINEWIDTH) plt.xlabel('Seconds') plt.ylabel('Predict Accuracy') plt.legend(bbox_to_anchor=(1,0.4)) # plt.show() pylab.savefig(PATH_FIGURE+'Time_CrossModel_Test_Set_Predict_Accuracy'+'.png',bbox_inches='tight') plt.figure(12) plt.title('Loss of Test Set') if DRAW_Line1: plt.plot(Line1_epoch_times, Line1_loss_test, SPEC_L1 ,label="Alpha = 0.1", linewidth = LINEWIDTH) if DRAW_Line2: plt.plot(Line2_epoch_times, Line2_loss_test, SPEC_L2 ,label="Alpha = 0055", linewidth = LINEWIDTH) if DRAW_Line3: plt.plot(Line3_epoch_times, Line3_loss_test, SPEC_L3 ,label="Alpha = 0015", linewidth = LINEWIDTH) if DRAW_Line4: plt.plot(Line4_epoch_times, Line4_loss_test, SPEC_L4 ,label="Alpha =0.0010", linewidth = LINEWIDTH) plt.xlabel('Seconds') plt.ylabel('Loss') plt.legend() pylab.savefig(PATH_FIGURE+'Time_CrossModel_Test_Set_Loss'+'.png',bbox_inches='tight') # plt.show() print ("Finish drawing cross model plots.") if __name__ == '__main__': if ('--help' in sys.argv) or ('-h' in sys.argv) or ('help' in sys.argv): print("arg: NUM_EPOCHS") else: kwargs = {} if len(sys.argv) > 1: kwargs['num_epochs'] = int(sys.argv[1]) main(**kwargs)
mit
5,457,736,702,800,827,000
43.189266
118
0.691364
false
fgcz/maxquant_wrapper
maxquant_wrapper/maxquant_wrapper.py
1
30535
#!/usr/bin/python # Copyright 2015-2017 Christian Panse <[email protected]> # # This file is part of the recmap package on CRAN. # https://github.com/fgcz/maxquant_wrapper/ # # maxquant_wrapper is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # maxquant_wrapper is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with recmap. If not, see <http://www.gnu.org/licenses/>. import sys import os import shutil import unittest import time import subprocess import re import logging import logging.handlers import pprint def create_logger(name="MaxQuant"): """ create a logger object """ syslog_handler = logging.handlers.SysLogHandler(address=("fgcz-ms.uzh.ch", 514)) formatter = logging.Formatter('%(name)s %(message)s') syslog_handler.setFormatter(formatter) logger = logging.getLogger(name) logger.setLevel(20) logger.addHandler(syslog_handler) return logger logger = create_logger() class FgczMaxquantWrapper: """ this class does - stage the input data - compose a maxquant driver xml file adapted to the FGCZ infrastructure - run maxquant - stage the output data staging: - can be done by using samba or ssh - the class can be executed on the python shell or via rpc logging: - is done by a general log server input: - a python data structure containing all information note: this class is supposed to be run on a Microsoft Windows OS TODO(cp,wew): the stagign and exec methods would be better separated into a infrastructure class """ """ input: QEXACTIVE_2: - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_01_Fetuin40fmol.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_02_YPG1.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_03_YPG2_GG.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_04_YPG2_SL.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_05_YPD3.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_06_Fetuin40fmol.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_07_YPD1.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_08_YPD2_SL.raw - [email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_09_YPG3.raw output: - [email protected]:/srv/www/htdocs//p1946/bfabric/Proteomics/MaxQuant_Scaffold_LFQ_tryptic_swissprot/2015/2015-09/2015-09-07//workunit_135076//203583.zip parameters: {} protocol: scp """ config = None outputurl = None scratchroot = os.path.normcase(r"d:\scratch_") scratch = scratchroot def __init__(self, config=None): if not os.path.isdir(self.scratchroot): try: os.mkdir(self.scratchroot) except: print "scratch '{0}' does not exists.".format(self.scratchroot) raise if config: self.config=config def run_commandline(self, cmd, shell_flag=False): """ :param cmd: :param shell_flag: :return: """ (pid, return_code) = (None, None) (out, err)=("", "") tStart = time.time() logger.info(cmd) try: p = subprocess.Popen(cmd, shell=shell_flag) pid = p.pid return_code = p.wait() (out, err) = p.communicate() p.terminate() except OSError as e: msg = "exception|pid={0}|OSError={1}".format(pid, e) logger.info(msg) print err print out raise msg_info = "completed|pid={0}|time={1}|return_code={2}|cmd='{3}'" \ .format(pid, time.time() - tStart, return_code, cmd) logger.info(msg_info) print out print err return (return_code) def map_url_scp2smb(self, url, from_prefix_regex="[email protected]://srv/www/htdocs", to_prefix="\\\\130.60.81.21\\data"): """maps an url from '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_01_Fetuin40fmol.raw' to '\\130.60.81.21\data\p1946\proteomics\qexactive_2\paolo_20150811_course\20150811_01_fetuin40fmol.raw' if it can not be matched it returns None """ regex = re.compile("({0}.+)(p[0-9]+([\\/]).*)$".format(from_prefix_regex)) match = regex.match(url) if match: result_url = "{0}\{1}".format(to_prefix, os.path.normcase(match.group(2))) return (result_url) else: return None def print_config(self): print "------" pp = pprint.PrettyPrinter(width=70) pp.pprint(self.config) return True def add_config(self, config): self.config = config return True def add_outputurl(self, url=None): """ :param url: :return: """ self.outputurl = url return True def create_scratch(self): """create scratch space """ # TODO(cp): what if workunit is not defined self.scratch = os.path.normcase( "{0}/{1}".format(self.scratchroot, self.config['job_configuration']['workunit_id'])) if not os.path.isdir(self.scratch): try: os.mkdir(self.scratch) except: logger.info("scratch '{0}' does not exists.".format(self.scratch)) raise return True def scp(self, src, dst, scp_cmd=r"d:\fgcz\pscp.exe", scp_option=r"-scp -i C:\Users\cpanse\id_rsa.ppk" ): """ this is the scp wrapper for data staging :param src: :param dst: :param scp_cmd: :param scp_option: :return: """ cmd = "{0} {1} {2} {3}".format(scp_cmd, scp_option, src, dst) self.run_commandline(cmd, shell_flag=False) return (True) def copy_input_to_scratch(self, copy_method=lambda s,t: shutil.copyfile(s, t), src_url_mapping=lambda x: x, dst_url_mapping=lambda x: os.path.basename(x)): """ make input resources available on scratch NOTE: we assume if the file is already in place it is identical to the src file. :param copy_method: :param src_url_mapping: :param dst_url_mapping: :return: """ _input = self.config['application']['input'] try: self._fsrc_fdst = [] for i in _input.keys(): self._fsrc_fdst = self._fsrc_fdst + map(lambda x: (src_url_mapping(x), dst_url_mapping(x)), _input[i]) for (_fsrc, _fdst) in self._fsrc_fdst: if os.path.isfile(_fdst): logger.info("'{0}' is already there.".format(_fdst)) pass else: try: logger.info("copy '{0}' from '{1}' ...".format(_fdst, _fsrc)) copy_method(_fsrc, _fdst) except: print "ERROR: fail copy failed." raise except: logger.info("copying failed") raise return True def compose_maxquant_driver_file(self, filename=None): assert isinstance(filename, basestring) fasta_filename = None enzymes = "Trypsin/P" try: fasta_filename = self.config['application']['parameters']['FASTA'] except: fasta_filename = r"D:\MaxQuantDBs\fgcz_swissprot_20121031.fasta" try: enzymes = self.config['application']['parameters']['Enzymes'] except: enzymes = "Trypsin/P" try: variableModifications = self.config['application']['parameters']['variableModifications'] except: variableModifications = "Acetyl (Protein N-term), Oxidation (M)" variableModifications = "\n".join(map(lambda x: "\t<string>{0}</string>".format(x), variableModifications.replace(", ", ",").split(","))) try: fixedModifications = self.config['application']['parameters']['fixedModifications'] except: fixedModifications = "Carbamidomethyl (C)" if fixedModifications == "None": fixedModifications = "" else: fixedModifications = "\n".join(map(lambda x: "\t<string>{0}</string>".format(x), fixedModifications.replace(", ", ",").split(","))) # fasta_filename = os.path.normpath(os.path.normcase(fasta_filename)) fasta_filename = os.path.normpath(fasta_filename) _xml="""<?xml version='1.0' encoding='UTF-8'?> <MaxQuantParams xmlns:xsi='http://www.w3.org/2001/XMLSchema-instance' xmlns:xsd='http://www.w3.org/2001/XMLSchema' aifSilWeight='4' aifIsoWeight='2' aifTopx='20' aifCorrelation='0.47' aifCorrelationFirstPass='0.8' aifMinMass='0' aifMsmsTol='10' aifSecondPass='true' aifIterative='true' aifThresholdFdr='0.01'> <slicePeaks>true</slicePeaks> <tempFolder/> <fixedCombinedFolder/> <ionCountIntensities>false</ionCountIntensities> <verboseColumnHeaders>false</verboseColumnHeaders> <minTime>NaN</minTime> <maxTime>NaN</maxTime> <fullMinMz>-1.7976931348623157E+308</fullMinMz> <fullMaxMz>1.7976931348623157E+308</fullMaxMz> <calcPeakProperties>false</calcPeakProperties> <useOriginalPrecursorMz>false</useOriginalPrecursorMz> <minPeakLen>2</minPeakLen> <filePaths> {filePaths} </filePaths> <experiments> {experiments} </experiments> <fractions> {fractions} </fractions> <matching> {matching} </matching> <paramGroupIndices> {paramGroupIndices} </paramGroupIndices> <parameterGroups> <parameterGroup> <maxCharge>7</maxCharge> <msInstrument>0</msInstrument> <labelMods> <string/> </labelMods> <lfqMinEdgesPerNode>3</lfqMinEdgesPerNode> <lfqAvEdgesPerNode>6</lfqAvEdgesPerNode> <fastLfq>true</fastLfq> <lfqMinRatioCount>2</lfqMinRatioCount> <useNormRatiosForHybridLfq>true</useNormRatiosForHybridLfq> <maxLabeledAa>0</maxLabeledAa> <maxNmods>5</maxNmods> <maxMissedCleavages>2</maxMissedCleavages> <multiplicity>1</multiplicity> <enzymes> <string>{enzymes}</string> </enzymes> <enzymesFirstSearch/> <useEnzymeFirstSearch>false</useEnzymeFirstSearch> <useVariableModificationsFirstSearch>false</useVariableModificationsFirstSearch> <variableModifications> {variableModifications} </variableModifications> <isobaricLabels/> <variableModificationsFirstSearch/> <hasAdditionalVariableModifications>false</hasAdditionalVariableModifications> <additionalVariableModifications/> <additionalVariableModificationProteins/> <doMassFiltering>true</doMassFiltering> <firstSearchTol>20</firstSearchTol> <mainSearchTol>4.5</mainSearchTol> <lcmsRunType>0</lcmsRunType> <lfqMode>1</lfqMode> <enzymeMode>0</enzymeMode> <enzymeModeFirstSearch>0</enzymeModeFirstSearch> </parameterGroup> </parameterGroups> <fixedModifications> {fixedModifications} </fixedModifications> <multiModificationSearch>false</multiModificationSearch> <compositionPrediction>false</compositionPrediction> <fastaFiles> <string>{fastaFiles}</string> </fastaFiles> <fastaFilesFirstSearch/> <fixedSearchFolder/> <advancedRatios>false</advancedRatios> <rtShift>false</rtShift> <separateLfq>false</separateLfq> <lfqStabilizeLargeRatios>true</lfqStabilizeLargeRatios> <lfqRequireMsms>true</lfqRequireMsms> <decoyMode>revert</decoyMode> <specialAas>KR</specialAas> <includeContamiants>true</includeContamiants> <equalIl>false</equalIl> <topxWindow>100</topxWindow> <maxPeptideMass>4600</maxPeptideMass> <reporterPif>0.75</reporterPif> <reporterFraction>0</reporterFraction> <reporterBasePeakRatio>0</reporterBasePeakRatio> <minDeltaScoreUnmodifiedPeptides>0</minDeltaScoreUnmodifiedPeptides> <minDeltaScoreModifiedPeptides>17</minDeltaScoreModifiedPeptides> <minScoreUnmodifiedPeptides>0</minScoreUnmodifiedPeptides> <minScoreModifiedPeptides>40</minScoreModifiedPeptides> <filterAacounts>true</filterAacounts> <secondPeptide>true</secondPeptide> <matchBetweenRuns>true</matchBetweenRuns> <matchUnidentifiedFeatures>false</matchUnidentifiedFeatures> <matchBetweenRunsFdr>false</matchBetweenRunsFdr> <reQuantify>true</reQuantify> <dependentPeptides>false</dependentPeptides> <dependentPeptideFdr>0</dependentPeptideFdr> <dependentPeptideMassBin>0</dependentPeptideMassBin>git <msmsConnection>false</msmsConnection> <ibaq>false</ibaq> <useDeltaScore>false</useDeltaScore> <avalon>false</avalon> <msmsRecalibration>false</msmsRecalibration> <ibaqLogFit>false</ibaqLogFit> <razorProteinFdr>true</razorProteinFdr> <deNovoSequencing>false</deNovoSequencing> <deNovoVarMods>true</deNovoVarMods> <massDifferenceSearch>false</massDifferenceSearch> <minPepLen>7</minPepLen> <peptideFdr>0.01</peptideFdr> <proteinFdr>0.05</proteinFdr> <siteFdr>0.01</siteFdr> <minPeptideLengthForUnspecificSearch>8</minPeptideLengthForUnspecificSearch> <maxPeptideLengthForUnspecificSearch>25</maxPeptideLengthForUnspecificSearch> <useNormRatiosForOccupancy>true</useNormRatiosForOccupancy> <minPeptides>1</minPeptides> <minRazorPeptides>1</minRazorPeptides> <minUniquePeptides>0</minUniquePeptides> <useCounterparts>false</useCounterparts> <minRatioCount>2</minRatioCount> <restrictProteinQuantification>true</restrictProteinQuantification> <restrictMods> {variableModifications} </restrictMods> <matchingTimeWindow>2</matchingTimeWindow> <alignmentTimeWindow>20</alignmentTimeWindow> <numberOfCandidatesMultiplexedMsms>25</numberOfCandidatesMultiplexedMsms> <numberOfCandidatesMsms>15</numberOfCandidatesMsms> <massDifferenceMods/> <crossLinkerSearch>false</crossLinkerSearch> <crossLinker/> <labileCrossLinkerSearch>false</labileCrossLinkerSearch> <labileCrossLinker>DSSO</labileCrossLinker> <RescoreMsx>false</RescoreMsx> <msmsParamsArray> <msmsParams Name='FTMS' InPpm='true' Deisotope='true' Topx='12' HigherCharges='true' IncludeWater='true' IncludeAmmonia='true' DependentLosses='true'> <Tolerance> <Value>20</Value> <Unit>Ppm</Unit> </Tolerance> <DeNovoTolerance> <Value>20</Value> <Unit>Ppm</Unit> </DeNovoTolerance> </msmsParams> <msmsParams Name='ITMS' InPpm='false' Deisotope='false' Topx='8' HigherCharges='true' IncludeWater='true' IncludeAmmonia='true' DependentLosses='true'> <Tolerance> <Value>0.5</Value> <Unit>Dalton</Unit> </Tolerance> <DeNovoTolerance> <Value>0.5</Value> <Unit>Dalton</Unit> </DeNovoTolerance> </msmsParams> <msmsParams Name='TOF' InPpm='false' Deisotope='false' Topx='10' HigherCharges='true' IncludeWater='true' IncludeAmmonia='true' DependentLosses='true'> <Tolerance> <Value>0.1</Value> <Unit>Dalton</Unit> </Tolerance> <DeNovoTolerance> <Value>0.1</Value> <Unit>Dalton</Unit> </DeNovoTolerance> </msmsParams> <msmsParams Name='Unknown' InPpm='false' Deisotope='false' Topx='10' HigherCharges='true' IncludeWater='true' IncludeAmmonia='true' DependentLosses='true'> <Tolerance> <Value>0.5</Value> <Unit>Dalton</Unit> </Tolerance> <DeNovoTolerance> <Value>0.5</Value> <Unit>Dalton</Unit> </DeNovoTolerance> </msmsParams> </msmsParamsArray> <msmsCentroidMode>1</msmsCentroidMode> <quantMode>1</quantMode> <siteQuantMode>0</siteQuantMode> </MaxQuantParams> """.format(filePaths = "\n".join(map(lambda x: "\t<string>{0}</string>".format(x[1].encode('utf8').replace("/cygdrive/d/", "d:\\").replace("/", "\\")), self._fsrc_fdst)), experiments = "\n".join(map(lambda x: "\t<string>{0}</string>".format(os.path.splitext(os.path.basename(x[1]))[0].encode('utf8')), self._fsrc_fdst)), fractions = "\n".join(map(lambda x: "\t<short>32767</short>", self._fsrc_fdst)), matching = "\n".join(map(lambda x: "\t<unsignedByte>3</unsignedByte>", self._fsrc_fdst)), paramGroupIndices = "\n".join(map(lambda x: "\t<int>0</int>", self._fsrc_fdst)), fastaFiles = fasta_filename, enzymes = enzymes, fixedModifications = fixedModifications, variableModifications = variableModifications) try: with open(filename, "w") as f: logger.info("writing '{0}' ...".format(filename)) f.write(_xml) except: logger.info("writing maxquant driver file '{0}' failed.".format(filename)) raise return True """ the following function have to be adapted """ def stage_input(self): """ :return: """ logger.info("stage input data") self.copy_input_to_scratch(copy_method=lambda x, y: self.scp(x, y), dst_url_mapping=lambda x: os.path.normpath(r"{0}\{1}".format(self.scratch, os.path.basename(x)))) def run_maxquant(self, cmd=r"d:\fgcz\mxQnt_versions\MaxQuant_1.4.1.2\MaxQuant\bin\MaxQuantCmd.exe", ncores=8): logger.info("run maxquant") mqpar_filename = os.path.normcase(r"{0}\maxquant_driver.xml".format(self.scratch)) self.compose_maxquant_driver_file(filename=mqpar_filename) self.run_commandline("{0} -mqpar={1} -ncores={2}".format(cmd, mqpar_filename, ncores), shell_flag=False) return True def stage_output(self, zip_cmd=r"C:\Program Files\7-zip\7z.exe"): """ zip all usefull output filed and copy it to an file exchange server :return: """ """ S:\cp_temp>"c:\Program Files\7-Zip\7z.exe" a -xr!proc -xr!search -xr!*.raw -xr!ps -xr!*tmp* s:\scratch_\dump2 d:\scratch_\135076d\* """ logger.info("stage output") zip_file = "{0}.7z".format(self.scratch) self.run_commandline(r"{0} a -xr!proc -xr!search -xr!*.raw -xr!ps {1} {2}\*".format(zip_cmd, self.scratch, self.scratch), shell_flag=False) if self.outputurl and os.path.isfile(zip_file): self.scp(src=zip_file, dst=self.outputurl) return True def clean(self): """ clean scratch space if no errors """ logger.info("clean is not implemeted yet") pass def run(self): """ this is the main method of the class """ self.create_scratch() self.stage_input() self.run_maxquant() self.stage_output() self.clean() return "EXCHAGNGE URL" class TestTargetMapping(unittest.TestCase): """ This is a class doing testing on a real infrastructure. Ensure that the SAN is available (> net use s: \\fgcz-s-021.uzh.ch\data ...) run python -m unittest -v fgcz_maxquant_wrapper """ test_config = {'application': {'input': {'QEXACTIVE_2': [ '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_01_Fetuin40fmol.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_02_YPG1.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_03_YPG2_GG.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_04_YPG2_SL.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_05_YPD3.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_06_Fetuin40fmol.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_07_YPD1.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_08_YPD2_SL.raw', '[email protected]://srv/www/htdocs//p1946/Proteomics/QEXACTIVE_2/paolo_20150811_course/20150811_09_YPG3.raw']}, 'protocol': 'scp', 'parameters': {}, 'output': [ '[email protected]:/srv/www/htdocs//p1946/bfabric/Proteomics/MaxQuant_Scaffold_LFQ_tryptic_swissprot/2015/2015-09/2015-09-07//workunit_135076//203583.zip']}, 'job_configuration': { 'executable': '/home/bfabric/sgeworker/bin/fgcz_sge_MaxQuant_Scaffold_LFQ_fast', 'external_job_id': 46103, 'input': {'QEXACTIVE_2': [{'sample_id': 26524, 'resource_id': 202116, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32622', 'extract_id': 32622, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202116', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26524'}, {'sample_id': 26195, 'resource_id': 202115, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32648', 'extract_id': 32648, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202115', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26195'}, {'sample_id': 26195, 'resource_id': 202114, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32648', 'extract_id': 32648, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202114', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26195'}, {'sample_id': 26195, 'resource_id': 202113, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32648', 'extract_id': 32648, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202113', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26195'}, {'sample_id': 26196, 'resource_id': 202112, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32649', 'extract_id': 32649, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202112', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26196'}, {'sample_id': 26524, 'resource_id': 202111, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32622', 'extract_id': 32622, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202111', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26524'}, {'sample_id': 26196, 'resource_id': 202110, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32649', 'extract_id': 32649, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202110', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26196'}, {'sample_id': 26196, 'resource_id': 202109, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32649', 'extract_id': 32649, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202109', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26196'}, {'sample_id': 26195, 'resource_id': 202108, 'extract_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-extract.html?extractId=32648', 'extract_id': 32648, 'resource_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-resource.html?resourceId=202108', 'sample_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-sample.html?sampleId=26195'}]}, 'stdout': {'url': '/home/bfabric/sgeworker/logs/workunitid-135076_resourceid-203583.out', 'protocol': 'file', 'resource_id': 203585}, 'output': {'protocol': 'scp', 'ssh_args': '-o StrictHostKeyChecking=no -c arcfour -2 -l bfabric -x', 'resource_id': 203583}, 'stderr': {'url': '/home/bfabric/sgeworker/logs/workunitid-135076_resourceid-203583.err', 'protocol': 'file', 'resource_id': 203584}, 'workunit_url': 'http://fgcz-bfabric.uzh.ch/bfabric/userlab/show-workunit.html?workunitId=135076', 'workunit_id': 135076}} mqw = FgczMaxquantWrapper(config=test_config) def setUp(self): pass def test_map_url_scp2smb(self): # desired_result = os.path.normpath('p1000/Proteomics/TRIPLETOF_1/selevsek_20150119') # self.assertTrue(desired_result == map_data_analyst_tripletof_1('p1000\Data\selevsek_20150119')) # self.assertTrue(map_data_analyst_tripletof_1('p1000\data\selevsek_20150119') is None) _input = self.test_config['application']['input'] for input_application in _input.keys(): map(lambda x: self.assertTrue(os.path.isfile(self.mqw.map_url_scp2smb(x) )), _input[input_application]) def test_create_scratch(self): self.assertTrue(self.mqw.create_scratch()) def test_copy_input_to_scratch(self): self.assertTrue(self.mqw.create_scratch()) self.assertTrue(self.mqw.copy_input_to_scratch)
gpl-3.0
-3,839,874,976,932,913,700
43.970545
309
0.577599
false
brachyprint/brachyprint
src/mesh/core/face.py
1
4852
# Brachyprint -- 3D printing brachytherapy moulds # Copyright (C) 2013-14 James Cranch, Martin Green and Oliver Madge # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License along # with this program; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. ''' A face class for the ``mesh'' package. ''' from __future__ import division class Face(object): ''' A class representing a mesh face. ''' def __init__(self, name, v1, v2, v3): self.name = name self.vertices = v1, v2, v3 self.normal = (v1 - v2).cross(v1 - v3).normalise() self.volume = None self.edges = [] def validate(self): assert self.normal == (self.vertices[0] - self.vertices[1]).cross(self.vertices[0] - self.vertices[2]).normalise() e1found = False e2found = False e3found = False (u1,u2,u3) = self.vertices for edge in self.edges: v = (edge.v1, edge.v2) assert edge.v1 in self.vertices assert edge.v2 in self.vertices if (v == (u1,u2)) or (v == (u2,u3)) or (v == (u3,u1)): assert edge.lface is self else: assert edge.rface is self assert edge.lface != edge.rface e1found = e1found or (edge.v1 == self.vertices[0] and edge.v2 == self.vertices[1]) or (edge.v2 == self.vertices[0] and edge.v1 == self.vertices[1]) e2found = e2found or (edge.v1 == self.vertices[1] and edge.v2 == self.vertices[2]) or (edge.v2 == self.vertices[1] and edge.v1 == self.vertices[2]) e3found = e3found or (edge.v1 == self.vertices[2] and edge.v2 == self.vertices[0]) or (edge.v2 == self.vertices[2] and edge.v1 == self.vertices[0]) assert e1found and e2found and e3found print "VALIDATED" def add_edge(self, edge): self.edges.append(edge) def signed_volume(self): v1, v2, v3 = self.vertices return v1.dot(v2.cross(v3)) / 6.0 def area(self): v1, v2, v3 = self.vertices return (v2 - v1).cross(v3 - v1).magnitude() / 2.0 def centroid(self): return reduce((lambda x,y:x+y), self.vertices) / 3 def bounding_box(self, tolerance = 0): return ((min(v.x for v in self.vertices) - tolerance, max(v.x for v in self.vertices) + tolerance), (min(v.y for v in self.vertices) - tolerance, max(v.y for v in self.vertices) + tolerance), (min(v.z for v in self.vertices) - tolerance, max(v.z for v in self.vertices) + tolerance)) def nearest_vertex(self, x, y, z): return min([((v.x - x) ** 2 + (v.y - y) ** 2 + (v.z - z) ** 2, v) for v in self.vertices])[1] def project2d(self): # form basis vectors a = (self.vertices[1]-self.vertices[0]) b = (self.vertices[2]-self.vertices[0]) n = b.cross(a) u = a v = n.cross(u) u = u.normalise() v = v.normalise() n = u.cross(v) origin = self.vertices[0] fun = lambda vs: [vec.x*u+vec.y*v+origin for vec in vs] return ([f.project2dvector(u,v) for f in self.vertices], u, v, fun) def opposite_edge(self, vertex): try: return next(e for e in self.edges if e.v1 != vertex and e.v2 != vertex) except: print vertex for e in self.edges: print e.v1, e.v2 raise Exception("No Opposite Edge ?!?") def neighbouring_faces(self): """Generates the faces which are adjacent to this one. """ for e in self.edges: f = e.face_on_other_side(self) if f is not None: yield f def parallel_plate(self, epsilon=0.00001): """Returns the set of all contiguous faces, starting with this one, that lie in the same plane. """ old = set() new = set([self]) while new: f = new.pop() old.add(f) for g in f.neighbouring_faces(): if g not in old and g not in new and f.normal.cross(g.normal).magnitude() < epsilon: new.add(g) return old
gpl-2.0
8,073,912,645,110,784,000
36.038168
159
0.566983
false
Idealcoder/Magic-Wand
lib/wand.py
1
1933
import time import RPi.GPIO as GPIO from lib.font import loadFont class wand(): #================================================ GLOBALS =================================== font = loadFont() delay = 0 #Delay per line when writing #================================================= FUNCTIONS ==================================== def writeByte(byte): i=0 for b in str(str(bin(byte))[2:])[::-1]: #[2:] is to remove 0b (python binary header) from str # [::-1] inverts byte direction. gp.output(i,b) i+=1 while i<8: gp.output(i,0) i+=1 #Write individual character def writeChar(char): if char in wand.font: char = wand.font[char] else: char = wand.font['pacman'] for byte in char: #Loop through byte wand.writeByte(byte) time.sleep(wand.delay) #Write string in sequence def writeString(string): wand.wait() # Wait for wand to be flicked for char in string: #Loop through each letter in string wand.writeChar(char) wand.writeChar('pad') # 1 line spacing between each letter def wait(): #Wait for wand to be flicked GPIO.mode(GPIO.BOARD) while (GPIO.input(5) == True): time.sleep(0.0001) #High polling rate GPIO.mode(GPIO.BCM) def load(delay): wand.delay = delay gp.load() # Setup GPIO pins for use #Setup input GPIO.mode(GPIO.BOARD) GPIO.setup(5,GPIO.IN) GPIO.mode(GPIO.BOARD) wand.writeChar('pad') #switch all GPIO to Off # GPIO wrapper for higher level access class gp(): #For different pin set-ups matrix = {} matrix[0] = 18 matrix[1] = 23 matrix[2] = 24 matrix[3] = 4 matrix[4] = 22 matrix[5] = 27 matrix[6] = 17 matrix[7] = 25 #Output pin def output(pin,b): if int(b) == 1: GPIO.output(gp.matrix[pin],True) else: GPIO.output(gp.matrix[pin],False) #Initialize pins def load(): GPIO.setmode(GPIO.BCM) i=0 while (i < 8 ): GPIO.setup(gp.matrix[i],GPIO.OUT) i+=1
mit
-973,664,377,961,744,900
20.01087
98
0.585618
false
linuxdeepin/deepin-ui
dtk/ui/volume_button.py
1
23225
#! /usr/bin/env python # -*- coding: utf-8 -*- # Copyright (C) 2012 Deepin, Inc. # 2012 Hailong Qiu # # Author: Hailong Qiu <[email protected]> # Maintainer: Hailong Qiu <[email protected]> # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. from cache_pixbuf import CachePixbuf from draw import draw_pixbuf from theme import ui_theme from utils import set_clickable_cursor import tooltip as Tooltip import gobject import gtk ''' 100 / 500 = 0.2 x = 100 -> 100 * 0.2 = 20 x = 500 -> 500 * 0.2 = 100 x = 100 -> 100 * 0.2 = 20 ''' ZERO_STATE = 0 MIN_STATE = 1 MID_STATE = 2 MAX_STATE = 3 MUTE_STATE = -1 MOUSE_VOLUME_STATE_PRESS = 1 MOUSE_VOLUME_STATE_HOVER = 2 MOUSE_VOLUME_STATE_NORMAL = -1 VOLUME_RIGHT = "right" VOLUME_LEFT = "left" class VolumeButton(gtk.Button): ''' Volume button. ''' __gsignals__ = { "volume-state-changed":(gobject.SIGNAL_RUN_LAST, gobject.TYPE_NONE,(gobject.TYPE_INT,gobject.TYPE_INT,)) } def __init__(self, volume_max_value = 100, volume_width = 52, volume_x = 0, volume_y = 15, line_height = 3, volume_padding_x = 5, volume_level_values = [(1, 33),(34, 66),(67, 100)], scroll_bool = False, press_emit_bool = False, inc_value=5, bg_pixbuf = ui_theme.get_pixbuf("volumebutton/bg.png"), fg_pixbuf = ui_theme.get_pixbuf("volumebutton/fg.png"), zero_volume_normal_pixbuf = ui_theme.get_pixbuf("volumebutton/zero_normal.png"), zero_volume_hover_pixbuf = ui_theme.get_pixbuf("volumebutton/zero_hover.png"), zero_volume_press_pixbuf = ui_theme.get_pixbuf("volumebutton/zero_press.png"), min_volume_normal_pixbuf = ui_theme.get_pixbuf("volumebutton/lower_normal.png"), min_volume_hover_pixbuf = ui_theme.get_pixbuf("volumebutton/lower_hover.png"), min_volume_press_pixbuf = ui_theme.get_pixbuf("volumebutton/lower_press.png"), mid_volume_normal_pixbuf = ui_theme.get_pixbuf("volumebutton/middle_normal.png"), mid_volume_hover_pixbuf = ui_theme.get_pixbuf("volumebutton/middle_hover.png"), mid_volume_press_pixbuf = ui_theme.get_pixbuf("volumebutton/middle_press.png"), max_volume_normal_pixbuf = ui_theme.get_pixbuf("volumebutton/high_normal.png"), max_volume_hover_pixbuf = ui_theme.get_pixbuf("volumebutton/high_hover.png"), max_volume_press_pixbuf = ui_theme.get_pixbuf("volumebutton/high_press.png"), mute_volume_normal_pixbuf = ui_theme.get_pixbuf("volumebutton/mute_normal.png"), mute_volume_hover_pixbuf = ui_theme.get_pixbuf("volumebutton/mute_hover.png"), mute_volume_press_pixbuf = ui_theme.get_pixbuf("volumebutton/mute_press.png"), point_volume_pixbuf = ui_theme.get_pixbuf("volumebutton/point_normal.png"), ): ''' Initialize VolumeButton class. @param volume_max_value: Maximum value of volume, default is 100. @param volume_width: Width of volume button widget, default is 52 pixel. @param volume_x: X padding of volume button widget. @param volume_y: Y padding of volume button widget. @param line_height: Height of volume progressbar, default is 3 pixel. @param volume_padding_x: X padding value around volume progressbar. @param volume_level_values: The values of volume level. @param scroll_bool: True allowed scroll to change value, default is False. @param press_emit_bool: True to emit `volume-state-changed` signal when press, default is False. @param inc_value: The increase value of volume change, default is 5. ''' gtk.Button.__init__(self) ########################### if volume_x < max_volume_normal_pixbuf.get_pixbuf().get_width(): volume_x = max_volume_normal_pixbuf.get_pixbuf().get_width() '''Init pixbuf.''' self.__bg_pixbuf = bg_pixbuf self.__fg_pixbuf = fg_pixbuf self.__bg_cache_pixbuf = CachePixbuf() self.__fg_cache_pixbuf = CachePixbuf() # zero volume pixbuf. self.__zero_volume_normal_pixbuf = zero_volume_normal_pixbuf self.__zero_volume_hover_pixbuf = zero_volume_hover_pixbuf self.__zero_volume_press_pixbuf = zero_volume_press_pixbuf # min volume pixbuf. self.__min_volume_normal_pixbuf = min_volume_normal_pixbuf self.__min_volume_hover_pixbuf = min_volume_hover_pixbuf self.__min_volume_press_pixbuf = min_volume_press_pixbuf # mid volume pixbuf: self.__mid_volume_normal_pixbuf = mid_volume_normal_pixbuf self.__mid_volume_hover_pixbuf = mid_volume_hover_pixbuf self.__mid_volume_press_pixbuf = mid_volume_press_pixbuf # max volume pixbuf[normal, hover, press]. self.__max_volume_normal_pixbuf = max_volume_normal_pixbuf self.__max_volume_hover_pixbuf = max_volume_hover_pixbuf self.__max_volume_press_pixbuf = max_volume_press_pixbuf # mute volume pixbuf[normal, hover, press]. self.__mute_volume_normal_pixbuf = mute_volume_normal_pixbuf self.__mute_volume_hover_pixbuf = mute_volume_hover_pixbuf self.__mute_volume_press_pixbuf = mute_volume_press_pixbuf # point volume pixbuf. self.__point_volume_pixbuf = point_volume_pixbuf '''Init Set VolumeButton attr.''' '''Init value.''' self.__press_emit_bool = press_emit_bool self.__line_height = line_height self.__current_value = 0 self.__mute_bool = False self.temp_mute_bool = False self.__drag = False self.__volume_max_value = volume_max_value self.__volume_width = volume_width self.__volume_left_x = volume_x - self.__max_volume_normal_pixbuf.get_pixbuf().get_width() - volume_padding_x self.__volume_left_y = volume_y - self.__max_volume_normal_pixbuf.get_pixbuf().get_height()/2 + self.__point_volume_pixbuf.get_pixbuf().get_height()/2 self.__volume_right_x = volume_x self.__volume_right_y = volume_y '''Left''' self.volume_level_values = volume_level_values self.__volume_state = MIN_STATE self.__mouse_state = MOUSE_VOLUME_STATE_NORMAL '''Right''' # bg value. self.__bg_x = 0 self.__bg_y = self.__volume_right_y self.__bg_padding_x = self.__volume_right_x # fg value. self.__fg_x = 0 self.__fg_y = self.__volume_right_y self.__fg_padding_x = self.__volume_right_x # point value. self.__point_y = self.__volume_right_y self.__point_padding_x = self.__volume_right_x self.inc_value = inc_value '''Init VolumeButton event.''' self.add_events(gtk.gdk.ALL_EVENTS_MASK) self.connect("expose-event", self.__expose_draw_volume) self.connect("motion-notify-event", self.__motion_mouse_set_point) self.connect("button-press-event", self.__press_mouse_set_point) self.connect("button-release-event", self.__release_mouse_set_point) '''Event value''' self.press_bool = False # scroll event. if scroll_bool: self.connect("scroll-event", self.__scroll_mouse_set_point) self.set_size_request(volume_width + self.__volume_left_x + self.__volume_right_x + self.__mute_volume_normal_pixbuf.get_pixbuf().get_width(), 30) set_clickable_cursor(self) def set_press_emit_bool(self, emit_bool): self.__press_emit_bool = emit_bool def __set_point_padding_x(self, event): self.__mute_bool = False self.__point_padding_x = int(event.x) self.queue_draw() def __press_mouse_set_point(self, widget, event): temp_x = int(event.x) temp_min_x = self.__bg_x + self.__bg_padding_x - self.__point_volume_pixbuf.get_pixbuf().get_width()/2 temp_max_x = self.__bg_x + self.__bg_padding_x + self.__volume_width + self.__point_volume_pixbuf.get_pixbuf().get_width()/2 self.queue_draw() if temp_min_x < temp_x < temp_max_x: self.__set_point_padding_x(event) self.__drag = True else: if self.__volume_left_x <= temp_x <= temp_min_x: # Set mouse state press. self.__mouse_state = MOUSE_VOLUME_STATE_PRESS self.temp_mute_bool = True self.press_bool = True def __release_mouse_set_point(self, widget, event): # Set mouse state normal. self.__mouse_state = MOUSE_VOLUME_STATE_NORMAL self.__drag = False self.press_bool = False temp_x = int(event.x) temp_y = int(event.y) temp_min_x = self.__bg_x + self.__bg_padding_x - self.__point_volume_pixbuf.get_pixbuf().get_width()/2 if self.__volume_left_x <= temp_x <= temp_min_x and ( self.__volume_left_y <=temp_y < (self.__volume_left_y + self.__mute_volume_hover_pixbuf.get_pixbuf().get_height())): if self.temp_mute_bool and not self.__mute_bool: # Set mute state. self.__mute_bool = not self.__mute_bool self.__volume_state = MUTE_STATE self.temp_mute_bool = False else: # modify state. self.__mute_bool = False self.temp_mute_bool = False self.__set_volume_value_to_state(self.__current_value) self.queue_draw() if self.__press_emit_bool: self.emit("volume-state-changed", self.__current_value, self.__volume_state) self.queue_draw() def __motion_mouse_set_point(self, widget, event): temp_x = int(event.x) temp_y = int(event.y) temp_min_x = self.__bg_x + self.__bg_padding_x - self.__point_volume_pixbuf.get_pixbuf().get_width()/2 if (self.__volume_left_x <= temp_x <= temp_min_x) and ( self.__volume_left_y <=temp_y < (self.__volume_left_y + self.__mute_volume_hover_pixbuf.get_pixbuf().get_height())): self.__mouse_state = MOUSE_VOLUME_STATE_HOVER else: self.__mouse_state = MOUSE_VOLUME_STATE_NORMAL if not self.press_bool: self.queue_draw() if self.__drag: self.__set_point_padding_x(event) def __scroll_mouse_set_point(self, widget, event): if event.direction == gtk.gdk.SCROLL_UP: self.volume_other_set_value(VOLUME_RIGHT) elif event.direction == gtk.gdk.SCROLL_DOWN: self.volume_other_set_value(VOLUME_LEFT) def volume_other_set_value(self, volume_type): point_width_average = self.__point_volume_pixbuf.get_pixbuf().get_width() / 2 temp_min = (self.__point_padding_x - point_width_average) temp_max = (self.__point_padding_x + self.__volume_width - point_width_average) self.__mute_bool = False if volume_type == VOLUME_RIGHT: if self.__point_padding_x >= temp_max: self.__point_padding_x = temp_max else: self.__point_padding_x += self.inc_value elif volume_type == VOLUME_LEFT: if self.__point_padding_x <= temp_min: self.__point_padding_x = temp_min else: self.__point_padding_x -= self.inc_value self.queue_draw() def __expose_draw_volume(self, widget, event): self.__draw_volume_right(widget, event) # 1: get current value. self.__set_volume_value_to_state(self.__current_value) # 2: value to state. self.__draw_volume_left(widget, event) # 3: draw state pixbuf. if not self.__press_emit_bool: self.emit("volume-state-changed", self.__current_value, self.__volume_state) # propagate_expose(widget, event) return True '''Left function''' @property def volume_state(self): return self.__volume_state @volume_state.setter def volume_state(self, state): if state == MIN_STATE: self.__volume_state = MIN_STATE elif state == ZERO_STATE: self.__volume_state = ZERO_STATE elif state == MID_STATE: self.__volume_state = MID_STATE elif state == MAX_STATE: self.__volume_state = MAX_STATE elif state == MUTE_STATE: self.__volume_state = MUTE_STATE @volume_state.getter def volume_state(self): return self.__volume_state @volume_state.deleter def volume_state(self): del self.__volume_state def set_volume_level_values(self, show_value): try: show_value[0][0] - show_value[0][1] show_value[1][0] - show_value[1][1] show_value[2][0] - show_value[2][1] self.volume_level_values = show_value except: print "Error show value!!" def __set_volume_value_to_state(self, value): if not self.__mute_bool: temp_show_value = self.volume_level_values if temp_show_value[0][0] <= value <= temp_show_value[0][1]: self.__volume_state = MIN_STATE elif temp_show_value[1][0] <= value <= temp_show_value[1][1]: self.__volume_state = MID_STATE elif temp_show_value[2][0] <= value <= temp_show_value[2][1]: self.__volume_state = MAX_STATE elif 0 == value: self.__volume_state = ZERO_STATE else: self.__volume_state = MUTE_STATE def set_volume_mute(self, mute_flag=True): if mute_flag: self.temp_mute_bool = False self.__mute_bool = True self.__volume_state = MUTE_STATE else: self.temp_mute_bool = False self.__mute_bool = False self.__set_volume_value_to_state(self.value) self.queue_draw() def __draw_volume_left(self, widget, event): cr = widget.window.cairo_create() x, y, w, h = widget.allocation if self.__volume_state == MUTE_STATE: # mute state. if self.__mouse_state == MOUSE_VOLUME_STATE_NORMAL: pixbuf = self.__mute_volume_normal_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_HOVER: pixbuf = self.__mute_volume_hover_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_PRESS: pixbuf = self.__mute_volume_press_pixbuf elif self.__volume_state == ZERO_STATE: # zero state. if self.__mouse_state == MOUSE_VOLUME_STATE_NORMAL: pixbuf = self.__zero_volume_normal_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_HOVER: pixbuf = self.__zero_volume_hover_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_PRESS: pixbuf = self.__zero_volume_press_pixbuf elif self.__volume_state == MIN_STATE: # min state. if self.__mouse_state == MOUSE_VOLUME_STATE_NORMAL: pixbuf = self.__min_volume_normal_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_HOVER: pixbuf = self.__min_volume_hover_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_PRESS: pixbuf = self.__min_volume_press_pixbuf elif self.__volume_state == MID_STATE: # mid state. if self.__mouse_state == MOUSE_VOLUME_STATE_NORMAL: pixbuf = self.__mid_volume_normal_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_HOVER: pixbuf = self.__mid_volume_hover_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_PRESS: pixbuf = self.__mid_volume_press_pixbuf elif self.__volume_state == MAX_STATE: # max state. if self.__mouse_state == MOUSE_VOLUME_STATE_NORMAL: pixbuf = self.__max_volume_normal_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_HOVER: pixbuf = self.__max_volume_hover_pixbuf elif self.__mouse_state == MOUSE_VOLUME_STATE_PRESS: pixbuf = self.__max_volume_press_pixbuf draw_pixbuf(cr, pixbuf.get_pixbuf(), x + self.__volume_left_x, y + self.__volume_left_y, ) '''Right function''' @property def line_height(self): return self.__line_height @line_height.setter def line_height(self, width): self.__line_height = width self.queue_draw() @line_height.getter def line_height(self): return self.__line_height @line_height.deleter def line_height(self): del self.__line_height @property def value(self): return self.__current_value @value.setter def value(self, value): if 0 <= value <= self.__volume_max_value: Tooltip.text(self, str(value)) temp_padding = (float(self.__volume_max_value) / self.__volume_width) temp_padding_x = float(value) / temp_padding self.__point_padding_x = temp_padding_x + ((self.__fg_padding_x)) self.queue_draw() @value.getter def value(self): return self.__current_value def set_volume_position(self, x, y): self.__volume_right_x = x self.__volume_right_y = y # Set x. self.__bg_padding_x = self.__volume_right_x self.__fg_padding_x = self.__volume_right_x self.__point_padding_x = self.__volume_right_x # Set y. self.__bg_y = self.__volume_right_y self.__fg_y = self.__volume_right_y self.__point_y = self.__volume_right_y @property def max_value(self): self.__volume_max_value @max_value.setter def max_value(self, max_value): self.__volume_max_value = max_value @max_value.getter def max_value(self): return self.__volume_max_value @max_value.deleter def max_value(self): del self.__volume_max_value def __draw_volume_right(self, widget, event): cr = widget.window.cairo_create() cr.set_line_width(self.__line_height) x, y, w, h = widget.allocation fg_height_average = (self.__point_volume_pixbuf.get_pixbuf().get_height() - self.__fg_pixbuf.get_pixbuf().get_height()) / 2 bg_height_average = (self.__point_volume_pixbuf.get_pixbuf().get_height() - self.__bg_pixbuf.get_pixbuf().get_height()) / 2 point_width_average = self.__point_volume_pixbuf.get_pixbuf().get_width() / 2 ################################################## # Draw bg. if self.__volume_width > 0: self.__bg_cache_pixbuf.scale(self.__bg_pixbuf.get_pixbuf(), self.__volume_width, self.__bg_pixbuf.get_pixbuf().get_height(), ) draw_pixbuf( cr, self.__bg_cache_pixbuf.get_cache(), x + self.__bg_x + self.__bg_padding_x, y + self.__bg_y + bg_height_average) temp_fg_padding_x = self.__point_padding_x - (self.__fg_x + self.__fg_padding_x) if temp_fg_padding_x < 0: temp_fg_padding_x = 0 if temp_fg_padding_x > self.__volume_width: temp_fg_padding_x = self.__volume_width # Get current value. self.__current_value = temp_fg_padding_x * (float(self.__volume_max_value) / self.__volume_width) # Draw fg. if temp_fg_padding_x > 0: self.__fg_cache_pixbuf.scale(self.__fg_pixbuf.get_pixbuf(), int(temp_fg_padding_x), self.__fg_pixbuf.get_pixbuf().get_height(), ) draw_pixbuf( cr, self.__fg_cache_pixbuf.get_cache(), x + self.__fg_x + self.__fg_padding_x, y + self.__fg_y + fg_height_average) ################################################# # Draw point. temp_point_padding_x = (self.__point_padding_x - point_width_average) temp_min = (self.__volume_right_x - point_width_average) temp_max = (self.__volume_right_x + self.__volume_width - point_width_average) if temp_point_padding_x < temp_min: temp_point_padding_x = temp_min if temp_point_padding_x > temp_max: temp_point_padding_x = temp_max draw_pixbuf(cr, self.__point_volume_pixbuf.get_pixbuf(), x + temp_point_padding_x, y + self.__point_y) gobject.type_register(VolumeButton) if __name__ == "__main__": import random from dtk.ui.window import Window def set_time_position(): volume_button.value = (random.randint(0, 100)) return True def get_volume_value(volume_button, value, volume_state): print "[get_volume_value:]" print "volume_button:%s" % volume_button print "value:%s" % value print "volume_state:%s" % volume_state def set_value_button_clicked(widget): print volume_button.volume_state volume_button.max_value = 200 volume_button.value = 100 volume_button.line_height = 4 # Set draw line width. # volume_button.set_volume_level_values([(0,10),(11,80),(81,100)]) win = gtk.Window(gtk.WINDOW_TOPLEVEL) # win = Window() win.set_size_request(200, 120) win.set_title("测试音量按钮") main_vbox = gtk.VBox() volume_button = VolumeButton(100,220) volume_button.value = 100 # volume_button = VolumeButton() volume_button.connect("volume-state-changed", get_volume_value) set_value_button = gtk.Button("设置音量的值") set_value_button.connect("clicked", set_value_button_clicked) main_vbox.pack_start(volume_button, True, True) main_vbox.pack_start(set_value_button, True, True) # win.add(volume_button) win.add(main_vbox) # win.window_frame.add(main_vbox) # gtk.timeout_add(500, set_time_position) win.show_all() gtk.main()
gpl-3.0
-3,288,997,962,322,264,000
40.504472
180
0.571139
false
sbg/Mitty
mitty/test/lib/test_vcfio.py
1
2460
import os from nose.tools import assert_raises, assert_sequence_equal import mitty.lib.vcfio as vio import mitty.test def test_basic(): """I/O: Basic vcf loading.""" v = vio.load_variant_file( os.path.join(mitty.test.example_data_dir, 'tiny.vcf.gz'), 'g0_s0', os.path.join(mitty.test.example_data_dir, 'tiny.8-14.bed')) # A test of pysam properly filtering variants to region assert v[0]['v'][1][0].tuple() == (11, 'CAA', 'C', 'D', 2), v[0]['v'] assert v[0]['v'][0][0].tuple() == (14, 'G', 'T', 'X', 0), v[0]['v'] assert len(v[0]['v'][0]) == 1 def test_complex_variant_error(): """I/O: Flag complex variants in VCF""" assert_raises(ValueError, vio.load_variant_file, os.path.join(mitty.test.example_data_dir, 'flawed-tiny.vcf.gz'), 'g0_s0', os.path.join(mitty.test.example_data_dir, 'tiny.whole.bed')) # This tests # 1. test-del-snp.vcf : DEL followed immediately by a SNP # 2. test-snp-ins.vcf : SNP followed by an INS # 3. test-snp-del-opposite-phase.vcf : DEL and SNP oppositely phased # ATGACGTATCCAAGGAGGCGTTACC # 12345678901234567890 # def test_crowded_vcf(): """I/O: These are all legal - if crowded - variant combinations""" for f in ['test-del-snp.vcf.gz', 'test-snp-ins.vcf.gz', 'test-snp-del-opposite-phase.vcf.gz']: v = vio.load_variant_file( os.path.join(mitty.test.example_data_dir, f), 'g0_s0', os.path.join(mitty.test.example_data_dir, 'tiny.whole.bed')) def load_data(): """A set of reference and variants for testing read generation.""" seq = open(os.path.join(mitty.test.example_data_dir, 'tiny.fasta')).readlines()[1] # df = vio.read_sample_from_vcf(os.path.join(mitty.test.example_data_dir, 'tiny.vcf'), 'g0_s0') df = vio.load_variant_file( os.path.join(mitty.test.example_data_dir, 'tiny.vcf.gz'), 'g0_s0', os.path.join(mitty.test.example_data_dir, 'tiny.whole.bed')) return seq, df def test_snp_expansion1(): """I/O: SNP expansion basic""" ref_seq, vcf = load_data() v = vcf[0]['v'][1][0] assert v.cigarop == 'X', v assert v.oplen == 0, v def test_ins_expansion1(): """I/O: INS expansion basic""" ref_seq, vcf = load_data() v = vcf[0]['v'][1][1] assert v.cigarop == 'I', v assert v.oplen == 3, v def test_del_expansion1(): """I/O: DEL expansion basic""" ref_seq, vcf = load_data() v = vcf[0]['v'][1][2] assert v.cigarop == 'D', v assert v.oplen == 2, v
apache-2.0
6,550,731,465,486,002,000
29.7625
97
0.623171
false
swoop-inc/graflux
test/query_engine_test.py
1
3803
import six import unittest import time from graflux.query_engine import QueryEngine from influxdb import InfluxDBClient import influxdb.exceptions class QueryEngineTest(unittest.TestCase): def setUp(self): self.db = 'graflux_test' self.config = { 'influxdb': { 'host': 'localhost', 'port': 8086, 'db': self.db }, 'aggregates': [ ['.sum$', 'sum'], ['.gauge$', 'last'], ['.*', 'mean'] ], 'steps': [ [1000, 60], [5000, 300], [10000, 600] ] } self.client = InfluxDBClient(database=self.db) self.query_engine = QueryEngine(self.config) def clean_db(self): try: self.client.drop_database(self.db) except influxdb.exceptions.InfluxDBClientError: pass self.client.create_database(self.db) def create_test_data(self, metrics): data = [{ "measurement": metric, "tags": {}, "fields": { "value": 1, } } for metric in metrics] self.assertTrue(self.client.write_points(data)) def test_get_series_empty_db(self): self.clean_db() result = self.query_engine.get_series() six.assertCountEqual(self, result, []) def test_get_series(self): metrics = [ 'test.series.one', 'test.series.two' ] self.clean_db() self.create_test_data(metrics) result = self.query_engine.get_series() six.assertCountEqual(self, result, metrics) def test_build_influx_query(self): query = self.query_engine.build_influx_query('test.metric', 0, 500000) self.assertEqual(query, 'SELECT mean(value) AS value FROM test.metric WHERE time > 0s AND time <= 500000s GROUP BY time(300s)') def test_query(self): metrics = [ 'test.series.one', 'test.series.two' ] self.clean_db() self.create_test_data(metrics) now = int(time.time()) start = now - 5000 end = now + 5000 result = self.query_engine.query(metrics, start, end) self.assertEqual(result['from'], start) self.assertEqual(result['to'], end) self.assertEqual(result['step'], 600) six.assertCountEqual(self, result['series'], { 'test.series.one': [1], 'test.series.two': [1] }) def test_lookup_aggregate(self): self.assertEqual(self.query_engine.lookup_aggregate('test.metric.sum'), 'sum') self.assertEqual(self.query_engine.lookup_aggregate('test.metric.gauge'), 'last') self.assertEqual(self.query_engine.lookup_aggregate('test.metric.randomness'), 'mean') def test_determine_interval(self): self.assertEqual(self.query_engine.determine_interval(0, 500), 60) self.assertEqual(self.query_engine.determine_interval(0, 5000), 300) self.assertEqual(self.query_engine.determine_interval(0, 50000), 600) def test_build_query_sets(self): sum_metrics = [ 'test.metric.one.sum', 'test.metric.two.sum' ] mean_metrics = [ 'test.metric.whatever' ] last_metrics = [ 'test.metric.gauge' ] sets = self.query_engine.build_query_sets(sum_metrics + mean_metrics + last_metrics) six.assertCountEqual(self, sets, { 'mean': mean_metrics, 'last': last_metrics, 'sum': sum_metrics }) if __name__ == '__main__': unittest.main()
mit
-1,794,805,965,491,786,800
27.810606
135
0.536682
false
zkota/pyblio-1.3
Legacy/GnomeUI/Document.py
1
39739
# -*- coding: utf-8 -*- # # This file is part of pybliographer # # Copyright (C) 1998-2004 Frederic GOBRY # Email : [email protected] # # This program is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License # as published by the Free Software Foundation; either version 2 # of the License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. # # ''' This module defines a Document class ''' import gobject from gnome import ui import gnome import gtk import gtk.glade from gtk import gdk from Legacy.GnomeUI import Editor, Entry, FileSelector, Format from Legacy.GnomeUI import Index, OpenURL, Search, Utils, Citation from Legacy.GnomeUI.Sort import SortDialog from Legacy.GnomeUI.Medline import MedlineUI from Legacy import Base, Config, Connector, Exceptions, Fields, Open from Legacy import Resource, Selection, Sort, Types, version from Legacy import Search as SearchCls import Legacy.Style.Utils import os, string, copy, types, sys, traceback, stat import cPickle as pickle printable = string.lowercase + string.uppercase + string.digits uim_content = ''' <ui> <menubar name="Menubar"> <menu action="File"> <menuitem action="New"/> <menuitem action="Open"/> <menuitem action="Open_URL"/> <menuitem action="Merge"/> <menuitem action="Query"/> <menuitem action="Save"/> <menuitem action="Save_As"/> <separator/> <menu action="Recent"> <placeholder name="Previous"/> </menu> <separator/> <menuitem action="Close"/> <menuitem action="Quit"/> </menu> <menu action="EditMenu"> <menuitem action="Cut"/> <menuitem action="Copy"/> <menuitem action="Paste"/> <menuitem action="Clear"/> <separator/> <menuitem action="Add"/> <menuitem action="Edit"/> <menuitem action="Delete"/> <separator/> <menuitem action="Find"/> <menuitem action="Sort"/> </menu> <menu action="ViewMenu"> <menu action="ViewResource"> <placeholder name="Viewables" /> </menu> </menu> <menu action="CiteMenu"> <menuitem action="Connect"/> <menuitem action="Cite"/> <menuitem action="Update"/> </menu> <menu action="Settings"> <menuitem action="Fields"/> <menuitem action="Preferences"/> <separator/> <menuitem action="Forget"/> </menu> <menu action="HelpMenu"> <menuitem action="Contents"/> <menuitem action="About"/> </menu> </menubar> <toolbar name="Toolbar"> <toolitem action="Open"/> <toolitem action="Save"/> <separator/> <toolitem action="Add"/> <separator/> <toolitem action="Cite"/> <separator/> </toolbar> <popup name="Popup"> <menuitem action="Add"/> <menuitem action="Edit"/> <menu action="ViewResource"> <placeholder name="Viewables" /> </menu> <menuitem action="Delete"/> </popup> </ui> ''' class Document (Connector.Publisher): def __init__ (self, database): self.uim = gtk.UIManager () self.recents = None self.viewables = None self.actiongroup = gtk.ActionGroup ('Main') self.actiongroup.add_actions ([ # id stock label accel tooltip callback ('File', None, _('_File')), ('EditMenu', None, _('_Edit')), ('ViewMenu', None, _('_View')), ('CiteMenu', None, _('_Cite')), ('Settings', None, _('_Settings')), ('HelpMenu', None, _('_Help')), ('Recent', None, _('Recent documents')), ('New', gtk.STOCK_NEW, None, None, None, self.new_document), ('Open', gtk.STOCK_OPEN, None, None, _('Open a file'), self.ui_open_document), ('Open_URL', None, _('Open _Location'), '<control>l', None, self.ui_open_location), ('Save', gtk.STOCK_SAVE, None, None, _('Save the current file'), self.save_document), ('Save_As', gtk.STOCK_SAVE_AS, None, None, None, self.save_document_as), ('Close', gtk.STOCK_CLOSE, None, None, None, self.close_document), ('Quit', gtk.STOCK_QUIT, None, None, None, self.exit_application), ('Merge', None, _('Merge With...'), '<control>g', None, self.merge_database), ('Query', None, _('External Query...'), '<control>e', None, self.query_database), ('Cut', gtk.STOCK_CUT, None, None, None, self.cut_entry), ('Copy', gtk.STOCK_COPY, None, None, None, self.copy_entry), ('Paste', gtk.STOCK_PASTE, None, None, None, self.paste_entry), ('Clear', gtk.STOCK_CLEAR, None, None, None, self.clear_entries), ('Add', gtk.STOCK_ADD, None, '<shift><control>n', _('Add a new entry'), self.add_entry), ('Delete', gtk.STOCK_DELETE, None, None, None, self.delete_entry), ('Find', gtk.STOCK_FIND, None, None, None, self.find_entries), ('Sort', None, _('S_ort...'), None, None, self.sort_entries), ('Connect', gtk.STOCK_CONNECT, _('C_onnect...'), None, None, self._on_connect), ('Cite', gtk.STOCK_JUMP_TO, _('Cite'), None, _('Cite key(s)'), self.wp_cite), ('Update', gtk.STOCK_EXECUTE, _('Update document'), None, None, self.wp_update), ('Fields', None, _('Fields...'), None, None, self.set_fields), ('Preferences', gtk.STOCK_PREFERENCES, None, None, None, self.set_preferences), ('Forget', None, _('Forget all changes'), None, None, self.forget_changes_cb), ('Contents', gtk.STOCK_HELP, None, None, None, self.on_documentation), ('ViewResource', None, _('_Resource'), None, None, self.view_entry), ]) if gtk.pygtk_version >= (2,6,0): self.actiongroup.add_actions ([ ('About', gtk.STOCK_ABOUT, None, None, None, self.about), ('Edit', gtk.STOCK_EDIT, None, '<shift><control>o', None, self.edit_entry), ]) else: self.actiongroup.add_actions ([ ('About', None, _('_About'), None, None, self.about), ('Edit', None, _('_Edit'), '<shift><control>o', None, self.edit_entry), ]) prev = self.actiongroup.get_action ('Recent') prev.set_property ('is-important', True) prev.set_property ('hide-if-empty', False) view_action = self.actiongroup.get_action ('ViewResource') view_action.set_property ('hide-if-empty', False) self.uim.insert_action_group (self.actiongroup, 0) self.uim.add_ui_from_string (uim_content) self.uim.ensure_update () gp = os.path.join(Utils.glade_root, 'pyblio.glade') self.xml = gtk.glade.XML (gp, 'main', domain = 'pyblio') self.xml.signal_autoconnect (self) self.w = self.xml.get_widget ('main') self.paned = self.xml.get_widget ('main_pane') self.w.set_menus (self.uim.get_widget ('/Menubar')) self.w.set_toolbar (self.uim.get_widget ('/Toolbar')) self.w.add_accel_group (self.uim.get_accel_group ()) self.w.add_events (gdk.KEY_PRESS_MASK) self.w_save_btn = self.xml.get_widget ('_w_save_btn') self.w_save_mnu = self.xml.get_widget ('_w_save_mnu') # We manually add a simple search area t = self.uim.get_widget ('/Toolbar') h = gtk.HBox() i = gtk.Image() i.set_from_stock(gtk.STOCK_FIND, gtk.ICON_SIZE_LARGE_TOOLBAR) h.pack_start(i, False, False) # create a tooltips object self.toolbartips = gtk.Tooltips() self.quick_search = gtk.Entry() self.quick_search.connect('activate', self.simple_search) h.pack_start(self.quick_search, False, False) self.toolbartips.set_tip(self.quick_search, _('Quick search')) i = gtk.ToolItem() i.add(h) t.insert(i, -1) i.show_all() # The Index list self.index = Index.Index (popup = self.uim.get_widget ('/Popup')) self.paned.add1 (self.index.w) self.index.Subscribe ('new-entry', self.add_entry) self.index.Subscribe ('edit-entry', self.edit_entry) ## self.index.Subscribe ('view-entry', self.view_entry) self.index.Subscribe ('delete-entry', self.delete_entry) self.index.Subscribe ('select-entry', self.update_display) self.index.Subscribe ('select-entries', self.freeze_display) self.index.Subscribe ('drag-received', self.drag_received) self.index.Subscribe ('drag-moved', self.drag_moved) self.index.Subscribe ('click-on-field', self.sort_by_field) self.paned.show_all () # The text area self.display = Entry.Entry () self.paned.add2 (self.display.w) # Status bar self.statusbar = self.xml.get_widget ('statusbar') # set window size ui_width = Utils.config.get_int ('/apps/pyblio/ui/width') or -1 ui_height = Utils.config.get_int ('/apps/pyblio/ui/height') or -1 if ui_width != -1 and ui_height != -1: self.w.set_default_size (ui_width, ui_height) # set paned size paned_height = Utils.config.get_int ('/apps/pyblio/ui/paned') or -1 self.paned.set_position (paned_height) self.w.show_all () # application variables self.data = database self.selection = Selection.Selection () self.search_dg = None self.sort_dg = None self.wp = None # word processor to cite to self.citator = None # citator that will format the citations self.changed = 0 self.directory = None self.editable = False # true when some entry is selected self.incremental_start = None self.incremental_search = '' self.modification_date = None # for autosave self.source_id = None # set the default sort method default = Utils.config.get_string ('/apps/pyblio/sort/default') if default is not None: default = pickle.loads (default) self.sort_view (default) self._title_set () self._set_edit_actions(False) return def _title_set (self): if self.data.key is None: self.w.set_title (_('Unnamed bibliographic database')) return name = os.path.basename (self.data.key.url [2]) self.w.set_title (name) return def set_preferences (self, * arg): from Legacy.GnomeUI import Config Config.run(self.w) return def set_fields (self, * arg): from Legacy.GnomeUI import Fields Fields.run (self.w) return def forget_changes_cb (self, * arg): Config.forget_changes() return def update_history (self, history): ''' fill the " Previous Documents " menu with the specified list of documents ''' if self.recents: for mid in self.recents_mid: self.uim.remove_ui (mid) self.uim.remove_action_group (self.recents) self.recents_mid = [] self.recents = gtk.ActionGroup ('Recent') self.uim.insert_action_group (self.recents, 1) for item in history: # Display name in the menu quoted = string.replace (item [0], '_', '__') mid = self.uim.new_merge_id () self.recents_mid.append (mid) action = gtk.Action (str (mid), quoted, None, None) self.recents.add_action (action) action.connect ('activate', self._history_open_cb, item) self.uim.add_ui (mid, '/Menubar/File/Recent', str (mid), str (mid), gtk.UI_MANAGER_MENUITEM, False) return def _history_open_cb (self, id, w): file, type = w if not self.confirm (): return self.open_document (file, type) return def redisplay_index (self, changed = -1): ''' redisplays the index. If changed is specified, set the self.changed status to the given value ''' if changed != -1: self.changed = changed self.index.display (self.selection.iterator (self.data.iterator ())) self.update_status () return def format_query (self, style, format, output): try: file = open (output, 'w') except IOError, err: self.w.error (_("can't open file `%s' for writing:\n%s") % (output, str (err))) return entries = map (lambda x: x.key, self.index.selection ()) if not entries: iter = self.selection.iterator (self.data.iterator ()) entries = [] e = iter.first () while e: entries.append (e.key) e = iter.next () url = Fields.URL (style) try: Pyblio.Style.Utils.generate (url, format, self.data, entries, file) except RuntimeError, err: print err self.w.error (_("Error while parsing `%s':\n%s") % (style, err)) return def wp_update(self, *arg): if self.citator: self.citator.update() def update_status (self, status = -1): ''' redisplay status bar according to the current status ''' if status != -1: self.changed = status if self.data.key is None: text = _("New database") else: text = self.data.key.get_url () li = len (self.index) ld = len (self.data) if li == ld: if ld == 0: num = _("[no entry]") elif ld == 1: num = _("[1 entry]") else: num = _("[%d entries]") % ld else: if ld == 0: num = _("[no entry]") elif ld == 1: num = _("[%d/1 entry]") % li else: num = _("[%d/%d entries]") % (li, ld) text = text + ' ' + num if self.changed: text = text + ' ' + _("[modified]") if self.selection.search: text += ' - ' + _('view limited to: %s') % self.selection_name self.actiongroup.get_action ('Save').set_property ('sensitive', self.changed) self.statusbar.set_default (text) return def confirm (self): ''' eventually ask for modification cancellation ''' if self.changed: if Config.get('gnome/old-confirmation-dialog').data: return Utils.Callback (_("The database has been modified.\nDiscard changes?"), self.w).answer () else: if Utils.Callback (_("The database has been modified.\nSave changes?"), self.w).answer () and self.modification_check (): self.save_document () else: return True return 1 def modification_check (self): """Check for external modification, if necessary, ask user for permission to save. Returns True if no modifications or overwrite accepted by user.""" if self.modification_date: mod_date = os.stat (self.data.key.url [2]) [stat.ST_MTIME] if mod_date > self.modification_date: return Utils.Callback ( _("The database has been externally modified.\nOverwrite changes ?"), self.w).answer () return True def new_document (self, * arg): ''' callback corresponding to the "New Document" button ''' self.issue ('new-document', self) return def open_in_new(self, url, how=None, no_name=False): ''' open a document in a new window ''' self.issue('open-in-new', url, how, no_name) return def query_database (self, * arg): ''' callback corresponding to the "External Query..." button ''' MedlineUI(self, self.w) return def merge_database (self, * arg): ''' add all the entries of another database to the current one ''' # get a new file name (url, how) = FileSelector.URLFileSelection (_("Merge file"), has_auto = True).run () if url is None: return try: iterator = Open.bibiter (url, how = how) except (Exceptions.ParserError, Exceptions.FormatError, Exceptions.FileError), error: Utils.error_dialog (_("Open error"), error, parent = self.w) return # loop over the entries errors = [] try: entry = iterator.first () except Exceptions.ParserError, msg: errors = errors + msg.errors while entry: self.data.add (entry) while 1: try: entry = iterator.next () break except Exceptions.ParserError, msg: errors = errors + list (msg.errors) continue self.redisplay_index (1) if errors: Utils.error_dialog (_("Merge status"), string.join (errors, '\n'), parent = self.w) return def ui_open_document (self, * arg): ''' callback corresponding to "Open" ''' if not self.confirm (): return # get a new file name (url, how) = FileSelector.URLFileSelection (_("Open file")).run () if url is None: return self.open_document (url, how) return def ui_open_location (self, * arg): ''' callback corresponding to "Open Location" ''' if not self.confirm (): return (url, how) = OpenURL.OpenDialog (self.w).run () if url == None or url == "": return self.open_document (url, how) return def open_document (self, url, how = None, no_name = False): Utils.set_cursor (self.w, 'clock') orig_url = Fields.URL (url) url = orig_url.get_url () restore = False if orig_url.url [0] == 'file': name = orig_url.url [2] auto_save = os.path.join (os.path.dirname (name), 'x-pyblio-save-' + os.path.basename (name)) if os.path.exists (auto_save): mod_date = os.stat (name) [stat.ST_MTIME] mod_date_auto = os.stat (auto_save) [stat.ST_MTIME] if mod_date < mod_date_auto: restore = Utils.Callback (_("An autosave file was found which is newer than the original file.\nDo you want to restore it?"), self.w).answer () if restore: url = auto_save try: data = Open.bibopen (url, how = how) except (Exceptions.ParserError, Exceptions.FormatError, Exceptions.FileError), error: Utils.set_cursor (self.w, 'normal') Utils.error_dialog (_("Open error"), error, parent = self.w) return # remove the old autosave object if self.data.key is not None and self.source_id: gobject.source_remove (self.source_id) # remove old autosave file if exists if self.data.key: if self.data.key.url [0] == 'file': old_file = self.data.key.url [2] old_auto_save = os.path.join (os.path.dirname (old_file), 'x-pyblio-save-' + os.path.basename (old_file)) if os.path.exists (old_auto_save): try: os.remove (old_auto_save) except (OSError, IOError), error: Utils.set_cursor (self.w, 'normal') self.w.error (_("Unable to remove autosave file `%s':\n%s") % (str (old_auto_save), str (error))) return Utils.set_cursor (self.w, 'normal') if no_name: data.key = None self.data = data if restore: # restore the original url internally, # and change the document status self.data.key = orig_url self.redisplay_index (1) else: self.redisplay_index (0) self._title_set () # eventually warn interested objects self.issue ('open-document', self) # create autosave object if needed if Config.get ('base/autosave').data: savetimeout = Config.get ('base/autosave interval').data self.source_id = gobject.timeout_add (savetimeout * 60 * 1000, self.autosave, url, self.data.id) return def autosave (self, url, how): ''' autosave file as x-pyblio-save-filename ''' if self.data.key.url [0] != 'file': return False name = self.data.key.url [2] # create an autosave file save = os.path.join (os.path.dirname (name), 'x-pyblio-save-' + os.path.basename (name)) if self.changed: try: savefile = open (save, 'w') except (IOError, OSError), error: self.w.error (_("Error during autosaving:\n%s") % error [1]) return False iterator = Selection.Selection (sort = self.selection.sort) Open.bibwrite (iterator.iterator (self.data.iterator ()), out = savefile, how = how, database=self.data) savefile.close () return True def save_document (self, * arg): if self.data.key is None: self.save_document_as () return file = self.data.key.url [2] if not self.modification_check (): return Utils.set_cursor (self.w, 'clock') try: try: self.data.update (self.selection.sort) except (OSError, IOError), error: Utils.set_cursor (self.w, 'normal') self.w.error (_("Unable to save `%s':\n%s") % (str (self.data.key), str (error))) return except: etype, value, tb = sys.exc_info () traceback.print_exception (etype, value, tb) Utils.set_cursor (self.w, 'normal') self.w.error (_("An internal error occured during saving\nTry to Save As...")) return Utils.set_cursor (self.w, 'normal') # get the current modification date self.modification_date = os.stat (file) [stat.ST_MTIME] self.update_status (0) return def save_document_as (self, * arg): # get a new file name (url, how) = FileSelector.URLFileSelection ( _("Save As..."), has_auto = False, is_save = True).run () if url is None: return if os.path.exists (url): if not Utils.Callback ( _("The file `%s' already exists.\nOverwrite it ?") % url, parent = self.w).answer (): return try: file = open (url, 'w') except IOError, error: self.w.error (_("During opening:\n%s") % error [1]) return Utils.set_cursor (self.w, 'clock') iterator = Selection.Selection (sort = self.selection.sort) Open.bibwrite (iterator.iterator (self.data.iterator ()), out = file, how = how, database=self.data) file.close () # remove the old autosave object if self.data.key is not None and self.source_id: gobject.source_remove (self.source_id) # remove old autosave file if self.data.key: if self.data.key.url [0] == 'file': old_file = self.data.key.url [2] old_auto_save = os.path.join (os.path.dirname (old_file), 'x-pyblio-save-' + os.path.basename (old_file)) if os.path.exists (old_auto_save): try: os.remove (old_auto_save) except (OSError, IOError), error: Utils.set_cursor (self.w, 'normal') self.w.error (_("Unable to remove autosave file `%s':\n%s") % (str (old_auto_save), str (error))) return try: self.data = Open.bibopen (url, how = how) except (Exceptions.ParserError, Exceptions.FormatError, Exceptions.FileError), error: Utils.set_cursor (self.w, 'normal') Utils.error_dialog (_("Reopen error"), error, parent = self.w) return self.redisplay_index () self._title_set () self.issue ('open-document', self) Utils.set_cursor (self.w, 'normal') self.update_status (0) # create the new autosave object if needed if Config.get ('base/autosave').data: savetimeout = Config.get ('base/autosave interval').data self.source_id = gobject.timeout_add (savetimeout * 60 * 1000, self.autosave, url, self.data.id) return def close_document (self, * arg): self.issue ('close-document', self) return 1 def close_or_exit (self, * arg): self.issue ('close-document', self, True) return 1 def close_document_request (self): answer = self.confirm () # remove autosave object with closing if answer and self.source_id: gobject.source_remove (self.source_id) # remove old autosave file if answer and self.data.key: if self.data.key.url [0] == 'file': old_file = self.data.key.url [2] old_auto_save = os.path.join (os.path.dirname (old_file), 'x-pyblio-save-' + os.path.basename (old_file)) if os.path.exists (old_auto_save): try: os.remove (old_auto_save) except (OSError, IOError), error: Utils.set_cursor (self.w, 'normal') self.w.error (_("Unable to remove autosave file `%s':\n%s") % (str (old_auto_save), str (error))) return return answer def exit_application (self, * arg): self.issue ('exit-application', self) return def drag_moved (self, entries): if not entries: return for e in entries: del self.data [e.key] self.redisplay_index (1) return def drag_received (self, entries): for entry in entries: if self.data.would_have_key (entry.key): if not Utils.Callback (_("An entry called `%s' already exists.\nRename and add it anyway ?") % entry.key.key, parent = self.w).answer (): continue self.changed = 1 self.data.add (entry) self.redisplay_index () self.index.set_scroll (entries [-1]) return def cut_entry (self, * arg): entries = self.index.selection () if not entries: return self.index.selection_copy (entries) for entry in entries: del self.data [entry.key] self.redisplay_index (1) pass def copy_entry (self, * arg): self.index.selection_copy (self.index.selection ()) return def paste_entry (self, * arg): self.index.selection_paste () return def clear_entries (self, * arg): if len (self.data) == 0: return if not Utils.Callback (_("Really remove all the entries ?"), parent = self.w).answer (): return keys = self.data.keys () for key in keys: del self.data [key] self.redisplay_index (1) return def select_all_entries (self, * arg): self.index.select_all () return def add_entry (self, * arg): entry = self.data.new_entry (Config.get ('base/defaulttype').data) edit = Editor.Editor (self.data, entry, self.w, _("Create new entry")) edit.Subscribe ('commit-edition', self.commit_edition) return def edit_entry (self, entries): if not (type (entries) is types.ListType): entries = self.index.selection () l = len (entries) if l == 0: return if l > 5: if not Utils.Callback (_("Really edit %d entries ?") % l): return for entry in entries: edit = Editor.Editor (self.data, entry, self.w) edit.Subscribe ('commit-edition', self.commit_edition) return def commit_edition (self, old, new): ''' updates the database and the display ''' if old.key != new.key: if self.data.has_key (old.key): del self.data [old.key] if new.key: self.data [new.key] = new else: self.data.add (new) self.freeze_display(None) self.redisplay_index (1) self.index.select_item (new) return def view_entry (self, action, *item): if item: entry, key, url, value = item [0] ## print 'VIEW ENTRY:', entry, key, url, value Resource.StartViewer (entry, key, value, parent=self.w, document=self) else: #print 'Call to VIEW ENTRY ignored' return def delete_entry (self, * arg): ''' removes the selected list of items after confirmation ''' entries = self.index.selection () l = len (entries) if l == 0: return offset = self.index.get_item_position (entries [-1]) if l > 1: question = _("Remove all the %d entries ?") % len (entries) else: question = _("Remove entry `%s' ?") % entries [0].key.key if not Utils.Callback (question, parent = self.w).answer (): return for entry in entries: del self.data [entry.key] self.redisplay_index (1) self.index.select_item (offset) return def simple_search(self, w, *arg): q = w.get_text().strip() if q: try: test = SearchCls.AnyTester(q.encode('latin-1')) except UnicodeEncodeError: self.w.error (_("your search text must contain\nlatin-1 characters only")) return else: test = None self.limit_view(q, test) def find_entries (self, * arg): if self.search_dg is None: self.search_dg = Search.SearchDialog (self.w) self.search_dg.Subscribe ('search-data', self.limit_view) else: self.search_dg.show () return def limit_view (self, name, search): self.selection.search = search self.selection_name = name self.redisplay_index () return def sort_entries (self, * arg): sort_dg = SortDialog (self.selection.sort, self.w) sort_dg.Subscribe ('sort-data', self.sort_view) return def sort_view (self, sort): self.selection.sort = sort self.redisplay_index () return def sort_by_field (self, field): if field == '-key-': mode = Sort.KeySort () elif field == '-type-': mode = Sort.TypeSort () else: mode = Sort.FieldSort (field) # Check if we are toggling or changing cur = self.selection.sort if cur and len (cur.fields) == 1: cur = cur.fields [0] # We are still filtering according to the same field, # simply toggle the direction if cur == mode: mode.ascend = - cur.ascend self.selection.sort = Sort.Sort ([mode]) self.redisplay_index () return def _on_connect(self, *args): self.wp, self.citator = Citation.Connect(self.data, self.wp).run() self._set_edit_actions(self.editable) def wp_cite(self, *arg): if not self.citator: return entries = self.index.selection () if not entries: return self.citator.cite([x.key for x in entries]) def _set_edit_actions(self, value): for action in ('Copy', 'Cut', 'Delete', 'Edit', 'ViewResource'): self.actiongroup.get_action (action).set_property('sensitive', value) # one can only cite when there is a selection _and_ a current word processor. self.actiongroup.get_action('Cite').set_property( 'sensitive', value and self.citator is not None) self.actiongroup.get_action('Update').set_property( 'sensitive', self.citator is not None) self.editable = value return def update_display(self, entry): if entry: self.display.display (entry) self.update_viewables (entry) self._set_edit_actions(entry is not None) return def freeze_display(self, entry): self.display.clear() self._set_edit_actions(True) return def update_viewables (self, entry): if self.viewables: for item in self.viewables_id: self.uim.remove_ui (item) self.uim.remove_action_group (self.viewables) self.viewables_id = [] self.viewables = gtk.ActionGroup ('Viewables') self.uim.insert_action_group (self.viewables, 1) viewables = Resource.get_viewables (entry) for key, url, value in viewables: ## text = u'<span foreground="BLUE" weight="bold">%s</span> %s' %( ## key.upper (), value) text = u"%s %s" % (key.upper (), value) mergeid = self.uim.new_merge_id () self.viewables_id.append (mergeid) action = gtk.Action (str(mergeid), text, None, None) self.viewables.add_action (action) action.connect ('activate', self.view_entry, (entry, key, url, value)) self.uim.add_ui (mergeid, '/Menubar/ViewMenu/ViewResource', str(mergeid), str(mergeid), gtk.UI_MANAGER_MENUITEM, False) self.uim.add_ui (mergeid, '/Popup/ViewResource', str(mergeid), str(mergeid), gtk.UI_MANAGER_MENUITEM, False) return def key_pressed (self, app, event): # filter out special keys if event.keyval == gtk.keysyms.Escape: # the Esc key restores view to "all entries" self.limit_view (None, None) self.quick_search.set_text('') if (event.string < 'a' or event.string > 'z') and \ (event.string < '0' or event.string > '9'): return False if self.selection.sort is None: app.flash ("Select a column to search in first.") return False if event.string in printable: # the user searches the first entry in its ordering that starts with this letter if self.incremental_search == '': self.incremental_search = event.string self.incremental_start = event.time else: if event.time - self.incremental_start > 1000: self.incremental_search = event.string else: # two keys in a same shot: we search for the composition of the words self.incremental_search = self.incremental_search + event.string self.incremental_start = event.time # search first occurence if self.index.go_to_first (self.incremental_search, self.selection.sort.fields [0]): app.flash ("Searching for '%s...'" % self.incremental_search) else: app.flash ("Cannot find '%s...'" % self.incremental_search) return False def update_configuration (self): ''' save current informations about the program ''' # Save the graphical aspect of the interface # 1.- Window size alloc = self.w.get_allocation () Utils.config.set_int ('/apps/pyblio/ui/width', alloc [2]) Utils.config.set_int ('/apps/pyblio/ui/height', alloc [3]) # 2.- Proportion between list and text height = self.paned.get_position () Utils.config.set_int ('/apps/pyblio/ui/paned', height) # updates the index's config self.index.update_configuration () return def on_documentation (self, *args): import gobject try: gnome.help_display ('pyblio', None) except gobject.GError, msg: self.w.error (_("Can't display documentation:\n%s") % msg) return def about (self, *arg): about = ui.About ('Pyblio', version.version, _("This program is copyrighted under the GNU GPL"), _("GNOME interface to the Pybliographer system."), ['Hervé Dréau', 'Frédéric Gobry', 'Zoltán Kóta', 'Travis Oliphant', 'Darrell Rudmann', 'Peter Schulte-Stracke', 'John Vu'], ['Yuri Bongiorno', 'Frédéric Gobry', 'Zoltán Kóta'], _('GNOME Translation Team')) about.set_transient_for (self.w) link = ui.HRef('http://pybliographer.org/', _("Pybliographer Home Page")) link.show () about.vbox.pack_start (link) about.show() return
gpl-2.0
-7,044,868,091,550,441,000
31.671875
163
0.524176
false
rouge8/pip
tests/functional/test_install.py
1
65164
import distutils import glob import os import shutil import sys import textwrap from os.path import curdir, join, pardir import pytest from pip._vendor.six import PY2 from pip import __version__ as pip_current_version from pip._internal import pep425tags from pip._internal.cli.status_codes import ERROR, SUCCESS from pip._internal.models.index import PyPI, TestPyPI from pip._internal.utils.misc import rmtree from tests.lib import ( _create_svn_repo, _create_test_package, create_basic_wheel_for_package, create_test_package_with_setup, need_bzr, need_mercurial, path_to_url, pyversion, pyversion_tuple, requirements_file, ) from tests.lib.filesystem import make_socket_file from tests.lib.local_repos import local_checkout from tests.lib.path import Path skip_if_python2 = pytest.mark.skipif(PY2, reason="Non-Python 2 only") skip_if_not_python2 = pytest.mark.skipif(not PY2, reason="Python 2 only") @pytest.mark.parametrize('command', ('install', 'wheel')) @pytest.mark.parametrize('variant', ('missing_setuptools', 'bad_setuptools')) def test_pep518_uses_build_env(script, data, common_wheels, command, variant): if variant == 'missing_setuptools': script.pip("uninstall", "-y", "setuptools") elif variant == 'bad_setuptools': setuptools_mod = script.site_packages_path.joinpath("setuptools.py") with open(setuptools_mod, 'a') as f: f.write('\nraise ImportError("toto")') else: raise ValueError(variant) script.pip( command, '--no-index', '-f', common_wheels, '-f', data.packages, data.src.joinpath("pep518-3.0"), ) def test_pep518_build_env_uses_same_pip( script, data, pip_src, common_wheels, deprecated_python): """Ensure the subprocess call to pip for installing the build dependencies is using the same version of pip. """ with open(script.scratch_path / 'pip.py', 'w') as fp: fp.write('raise ImportError') script.run( 'python', pip_src / 'src/pip', 'install', '--no-index', '-f', common_wheels, '-f', data.packages, data.src.joinpath("pep518-3.0"), expect_stderr=deprecated_python, ) def test_pep518_refuses_conflicting_requires(script, data): create_basic_wheel_for_package(script, 'setuptools', '1.0') create_basic_wheel_for_package(script, 'wheel', '1.0') project_dir = data.src.joinpath("pep518_conflicting_requires") result = script.pip_install_local('-f', script.scratch_path, project_dir, expect_error=True) assert ( result.returncode != 0 and ('Some build dependencies for %s conflict with PEP 517/518 supported ' 'requirements: setuptools==1.0 is incompatible with ' 'setuptools>=40.8.0.' % path_to_url(project_dir)) in result.stderr ), str(result) def test_pep518_refuses_invalid_requires(script, data, common_wheels): result = script.pip( 'install', '-f', common_wheels, data.src.joinpath("pep518_invalid_requires"), expect_error=True ) assert result.returncode == 1 assert "does not comply with PEP 518" in result.stderr def test_pep518_refuses_invalid_build_system(script, data, common_wheels): result = script.pip( 'install', '-f', common_wheels, data.src.joinpath("pep518_invalid_build_system"), expect_error=True ) assert result.returncode == 1 assert "does not comply with PEP 518" in result.stderr def test_pep518_allows_missing_requires(script, data, common_wheels): result = script.pip( 'install', '-f', common_wheels, data.src.joinpath("pep518_missing_requires"), expect_stderr=True ) # Make sure we don't warn when this occurs. assert "does not comply with PEP 518" not in result.stderr # We want it to go through isolation for now. assert "Installing build dependencies" in result.stdout, result.stdout assert result.returncode == 0 assert result.files_created def test_pep518_with_user_pip(script, pip_src, data, common_wheels): """ Check that build dependencies are installed into the build environment without using build isolation for the pip invocation. To ensure that we're not using build isolation when installing the build dependencies, we install a user copy of pip in the non-isolated environment, and break pip in the system site-packages, so that isolated uses of pip will fail. """ script.pip("install", "--ignore-installed", "-f", common_wheels, "--user", pip_src) system_pip_dir = script.site_packages_path / 'pip' assert not system_pip_dir.exists() system_pip_dir.mkdir() with open(system_pip_dir / '__init__.py', 'w') as fp: fp.write('raise ImportError\n') script.pip( 'wheel', '--no-index', '-f', common_wheels, '-f', data.packages, data.src.joinpath("pep518-3.0"), ) def test_pep518_with_extra_and_markers(script, data, common_wheels): script.pip( 'wheel', '--no-index', '-f', common_wheels, '-f', data.find_links, data.src.joinpath("pep518_with_extra_and_markers-1.0"), ) def test_pep518_with_namespace_package(script, data, common_wheels): script.pip( 'wheel', '--no-index', '-f', common_wheels, '-f', data.find_links, data.src.joinpath("pep518_with_namespace_package-1.0"), use_module=True, ) @pytest.mark.timeout(60) @pytest.mark.parametrize('command', ('install', 'wheel')) @pytest.mark.parametrize('package', ('pep518_forkbomb', 'pep518_twin_forkbombs_first', 'pep518_twin_forkbombs_second')) def test_pep518_forkbombs(script, data, common_wheels, command, package): package_source = next(data.packages.glob(package + '-[0-9]*.tar.gz')) result = script.pip( command, '--no-index', '-v', '-f', common_wheels, '-f', data.find_links, package, expect_error=True, ) assert '{1} is already being built: {0} from {1}'.format( package, path_to_url(package_source), ) in result.stderr, str(result) @pytest.mark.network def test_pip_second_command_line_interface_works( script, pip_src, data, common_wheels, deprecated_python): """ Check if ``pip<PYVERSION>`` commands behaves equally """ # Re-install pip so we get the launchers. script.pip_install_local('-f', common_wheels, pip_src) # On old versions of Python, urllib3/requests will raise a warning about # the lack of an SSLContext. kwargs = {'expect_stderr': deprecated_python} if pyversion_tuple < (2, 7, 9): kwargs['expect_stderr'] = True args = ['pip%s' % pyversion] args.extend(['install', 'INITools==0.2']) args.extend(['-f', data.packages]) result = script.run(*args, **kwargs) egg_info_folder = ( script.site_packages / 'INITools-0.2-py%s.egg-info' % pyversion ) initools_folder = script.site_packages / 'initools' assert egg_info_folder in result.files_created, str(result) assert initools_folder in result.files_created, str(result) def test_install_exit_status_code_when_no_requirements(script): """ Test install exit status code when no requirements specified """ result = script.pip('install', expect_error=True) assert "You must give at least one requirement to install" in result.stderr assert result.returncode == ERROR def test_install_exit_status_code_when_blank_requirements_file(script): """ Test install exit status code when blank requirements file specified """ script.scratch_path.joinpath("blank.txt").write_text("\n") script.pip('install', '-r', 'blank.txt') @pytest.mark.network def test_basic_install_from_pypi(script): """ Test installing a package from PyPI. """ result = script.pip('install', '-vvv', 'INITools==0.2') egg_info_folder = ( script.site_packages / 'INITools-0.2-py%s.egg-info' % pyversion ) initools_folder = script.site_packages / 'initools' assert egg_info_folder in result.files_created, str(result) assert initools_folder in result.files_created, str(result) # Should not display where it's looking for files assert "Looking in indexes: " not in result.stdout assert "Looking in links: " not in result.stdout def test_basic_editable_install(script): """ Test editable installation. """ result = script.pip('install', '-e', 'INITools==0.2', expect_error=True) assert ( "INITools==0.2 is not a valid editable requirement" in result.stderr ) assert not result.files_created assert not result.files_updated @pytest.mark.svn def test_basic_install_editable_from_svn(script): """ Test checking out from svn. """ checkout_path = _create_test_package(script) repo_url = _create_svn_repo(script, checkout_path) result = script.pip( 'install', '-e', 'svn+' + repo_url + '#egg=version-pkg' ) result.assert_installed('version-pkg', with_files=['.svn']) def _test_install_editable_from_git(script, tmpdir): """Test cloning from Git.""" pkg_path = _create_test_package(script, name='testpackage', vcs='git') args = ['install', '-e', 'git+%s#egg=testpackage' % path_to_url(pkg_path)] result = script.pip(*args) result.assert_installed('testpackage', with_files=['.git']) def test_basic_install_editable_from_git(script, tmpdir): _test_install_editable_from_git(script, tmpdir) def test_install_editable_from_git_autobuild_wheel( script, tmpdir, with_wheel): _test_install_editable_from_git(script, tmpdir) @pytest.mark.network def test_install_editable_uninstalls_existing(data, script, tmpdir): """ Test that installing an editable uninstalls a previously installed non-editable version. https://github.com/pypa/pip/issues/1548 https://github.com/pypa/pip/pull/1552 """ to_install = data.packages.joinpath("pip-test-package-0.1.tar.gz") result = script.pip_install_local(to_install) assert 'Successfully installed pip-test-package' in result.stdout result.assert_installed('piptestpackage', editable=False) result = script.pip( 'install', '-e', '%s#egg=pip-test-package' % local_checkout( 'git+https://github.com/pypa/pip-test-package.git', tmpdir, ), ) result.assert_installed('pip-test-package', with_files=['.git']) assert 'Found existing installation: pip-test-package 0.1' in result.stdout assert 'Uninstalling pip-test-package-' in result.stdout assert 'Successfully uninstalled pip-test-package' in result.stdout def test_install_editable_uninstalls_existing_from_path(script, data): """ Test that installing an editable uninstalls a previously installed non-editable version from path """ to_install = data.src.joinpath('simplewheel-1.0') result = script.pip_install_local(to_install) assert 'Successfully installed simplewheel' in result.stdout simple_folder = script.site_packages / 'simplewheel' result.assert_installed('simplewheel', editable=False) assert simple_folder in result.files_created, str(result.stdout) result = script.pip( 'install', '-e', to_install, ) install_path = script.site_packages / 'simplewheel.egg-link' assert install_path in result.files_created, str(result) assert 'Found existing installation: simplewheel 1.0' in result.stdout assert 'Uninstalling simplewheel-' in result.stdout assert 'Successfully uninstalled simplewheel' in result.stdout assert simple_folder in result.files_deleted, str(result.stdout) @need_mercurial def test_basic_install_editable_from_hg(script, tmpdir): """Test cloning and hg+file install from Mercurial.""" pkg_path = _create_test_package(script, name='testpackage', vcs='hg') url = 'hg+{}#egg=testpackage'.format(path_to_url(pkg_path)) assert url.startswith('hg+file') args = ['install', '-e', url] result = script.pip(*args) result.assert_installed('testpackage', with_files=['.hg']) @need_mercurial def test_vcs_url_final_slash_normalization(script, tmpdir): """ Test that presence or absence of final slash in VCS URL is normalized. """ pkg_path = _create_test_package(script, name='testpackage', vcs='hg') args = ['install', '-e', 'hg+%s/#egg=testpackage' % path_to_url(pkg_path)] result = script.pip(*args) result.assert_installed('testpackage', with_files=['.hg']) @need_bzr def test_install_editable_from_bazaar(script, tmpdir): """Test checking out from Bazaar.""" pkg_path = _create_test_package(script, name='testpackage', vcs='bazaar') args = ['install', '-e', 'bzr+%s/#egg=testpackage' % path_to_url(pkg_path)] result = script.pip(*args) result.assert_installed('testpackage', with_files=['.bzr']) @pytest.mark.network @need_bzr def test_vcs_url_urlquote_normalization(script, tmpdir): """ Test that urlquoted characters are normalized for repo URL comparison. """ script.pip( 'install', '-e', '%s/#egg=django-wikiapp' % local_checkout( 'bzr+http://bazaar.launchpad.net/%7Edjango-wikiapp/django-wikiapp' '/release-0.1', tmpdir, ), ) def test_basic_install_from_local_directory(script, data): """ Test installing from a local directory. """ to_install = data.packages.joinpath("FSPkg") result = script.pip('install', to_install, expect_error=False) fspkg_folder = script.site_packages / 'fspkg' egg_info_folder = ( script.site_packages / 'FSPkg-0.1.dev0-py%s.egg-info' % pyversion ) assert fspkg_folder in result.files_created, str(result.stdout) assert egg_info_folder in result.files_created, str(result) def test_basic_install_relative_directory(script, data): """ Test installing a requirement using a relative path. """ egg_info_file = ( script.site_packages / 'FSPkg-0.1.dev0-py%s.egg-info' % pyversion ) egg_link_file = ( script.site_packages / 'FSPkg.egg-link' ) package_folder = script.site_packages / 'fspkg' # Compute relative install path to FSPkg from scratch path. full_rel_path = Path( os.path.relpath(data.packages.joinpath('FSPkg'), script.scratch_path) ) full_rel_url = ( 'file:' + full_rel_path.replace(os.path.sep, '/') + '#egg=FSPkg' ) embedded_rel_path = script.scratch_path.joinpath(full_rel_path) # For each relative path, install as either editable or not using either # URLs with egg links or not. for req_path in (full_rel_path, full_rel_url, embedded_rel_path): # Regular install. result = script.pip('install', req_path, cwd=script.scratch_path) assert egg_info_file in result.files_created, str(result) assert package_folder in result.files_created, str(result) script.pip('uninstall', '-y', 'fspkg') # Editable install. result = script.pip('install', '-e' + req_path, cwd=script.scratch_path) assert egg_link_file in result.files_created, str(result) script.pip('uninstall', '-y', 'fspkg') def test_install_quiet(script, data): """ Test that install -q is actually quiet. """ # Apparently if pip install -q is not actually quiet, then it breaks # everything. See: # https://github.com/pypa/pip/issues/3418 # https://github.com/docker-library/python/issues/83 to_install = data.packages.joinpath("FSPkg") result = script.pip('install', '-qqq', to_install, expect_error=False) assert result.stdout == "" assert result.stderr == "" def test_hashed_install_success(script, data, tmpdir): """ Test that installing various sorts of requirements with correct hashes works. Test file URLs and index packages (which become HTTP URLs behind the scenes). """ file_url = path_to_url( (data.packages / 'simple-1.0.tar.gz').resolve()) with requirements_file( 'simple2==1.0 --hash=sha256:9336af72ca661e6336eb87bc7de3e8844d853e' '3848c2b9bbd2e8bf01db88c2c7\n' '{simple} --hash=sha256:393043e672415891885c9a2a0929b1af95fb866d6c' 'a016b42d2e6ce53619b653'.format(simple=file_url), tmpdir) as reqs_file: script.pip_install_local('-r', reqs_file.resolve(), expect_error=False) def test_hashed_install_failure(script, tmpdir): """Test that wrong hashes stop installation. This makes sure prepare_files() is called in the course of installation and so has the opportunity to halt if hashes are wrong. Checks on various kinds of hashes are in test_req.py. """ with requirements_file('simple2==1.0 --hash=sha256:9336af72ca661e6336eb87b' 'c7de3e8844d853e3848c2b9bbd2e8bf01db88c2c\n', tmpdir) as reqs_file: result = script.pip_install_local('-r', reqs_file.resolve(), expect_error=True) assert len(result.files_created) == 0 def test_install_from_local_directory_with_symlinks_to_directories( script, data): """ Test installing from a local directory containing symlinks to directories. """ to_install = data.packages.joinpath("symlinks") result = script.pip('install', to_install, expect_error=False) pkg_folder = script.site_packages / 'symlinks' egg_info_folder = ( script.site_packages / 'symlinks-0.1.dev0-py%s.egg-info' % pyversion ) assert pkg_folder in result.files_created, str(result.stdout) assert egg_info_folder in result.files_created, str(result) @pytest.mark.skipif("sys.platform == 'win32' or sys.version_info < (3,)") def test_install_from_local_directory_with_socket_file(script, data, tmpdir): """ Test installing from a local directory containing a socket file. """ egg_info_file = ( script.site_packages / "FSPkg-0.1.dev0-py%s.egg-info" % pyversion ) package_folder = script.site_packages / "fspkg" to_copy = data.packages.joinpath("FSPkg") to_install = tmpdir.joinpath("src") shutil.copytree(to_copy, to_install) # Socket file, should be ignored. socket_file_path = os.path.join(to_install, "example") make_socket_file(socket_file_path) result = script.pip("install", "--verbose", to_install, expect_error=False) assert package_folder in result.files_created, str(result.stdout) assert egg_info_file in result.files_created, str(result) assert str(socket_file_path) in result.stderr def test_install_from_local_directory_with_no_setup_py(script, data): """ Test installing from a local directory with no 'setup.py'. """ result = script.pip('install', data.root, expect_error=True) assert not result.files_created assert "is not installable." in result.stderr assert "Neither 'setup.py' nor 'pyproject.toml' found." in result.stderr def test_editable_install__local_dir_no_setup_py( script, data, deprecated_python): """ Test installing in editable mode from a local directory with no setup.py. """ result = script.pip('install', '-e', data.root, expect_error=True) assert not result.files_created msg = result.stderr if deprecated_python: assert 'File "setup.py" not found. ' in msg else: assert msg.startswith('ERROR: File "setup.py" not found. ') assert 'pyproject.toml' not in msg def test_editable_install__local_dir_no_setup_py_with_pyproject( script, deprecated_python): """ Test installing in editable mode from a local directory with no setup.py but that does have pyproject.toml. """ local_dir = script.scratch_path.joinpath('temp') local_dir.mkdir() pyproject_path = local_dir.joinpath('pyproject.toml') pyproject_path.write_text('') result = script.pip('install', '-e', local_dir, expect_error=True) assert not result.files_created msg = result.stderr if deprecated_python: assert 'File "setup.py" not found. ' in msg else: assert msg.startswith('ERROR: File "setup.py" not found. ') assert 'A "pyproject.toml" file was found' in msg @skip_if_not_python2 @pytest.mark.xfail def test_install_argparse_shadowed(script): # When argparse is in the stdlib, we support installing it # even though that's pretty useless because older packages did need to # depend on it, and not having its metadata will cause pkg_resources # requirements checks to fail // trigger easy-install, both of which are # bad. # XXX: Note, this test hits the outside-environment check, not the # in-stdlib check, because our tests run in virtualenvs... result = script.pip('install', 'argparse>=1.4') assert "Not uninstalling argparse" in result.stdout @pytest.mark.network @skip_if_python2 def test_upgrade_argparse_shadowed(script): # If argparse is installed - even if shadowed for imported - we support # upgrading it and properly remove the older versions files. script.pip('install', 'argparse==1.3') result = script.pip('install', 'argparse>=1.4') assert "Not uninstalling argparse" not in result.stdout def test_install_curdir(script, data): """ Test installing current directory ('.'). """ run_from = data.packages.joinpath("FSPkg") # Python 2.4 Windows balks if this exists already egg_info = join(run_from, "FSPkg.egg-info") if os.path.isdir(egg_info): rmtree(egg_info) result = script.pip('install', curdir, cwd=run_from, expect_error=False) fspkg_folder = script.site_packages / 'fspkg' egg_info_folder = ( script.site_packages / 'FSPkg-0.1.dev0-py%s.egg-info' % pyversion ) assert fspkg_folder in result.files_created, str(result.stdout) assert egg_info_folder in result.files_created, str(result) def test_install_pardir(script, data): """ Test installing parent directory ('..'). """ run_from = data.packages.joinpath("FSPkg", "fspkg") result = script.pip('install', pardir, cwd=run_from, expect_error=False) fspkg_folder = script.site_packages / 'fspkg' egg_info_folder = ( script.site_packages / 'FSPkg-0.1.dev0-py%s.egg-info' % pyversion ) assert fspkg_folder in result.files_created, str(result.stdout) assert egg_info_folder in result.files_created, str(result) @pytest.mark.network def test_install_global_option(script): """ Test using global distutils options. (In particular those that disable the actual install action) """ result = script.pip( 'install', '--global-option=--version', "INITools==0.1", expect_stderr=True) assert 'INITools==0.1\n' in result.stdout def test_install_with_hacked_egg_info(script, data): """ test installing a package which defines its own egg_info class """ run_from = data.packages.joinpath("HackedEggInfo") result = script.pip('install', '.', cwd=run_from) assert 'Successfully installed hackedegginfo-0.0.0\n' in result.stdout @pytest.mark.network def test_install_using_install_option_and_editable(script, tmpdir): """ Test installing a tool using -e and --install-option """ folder = 'script_folder' script.scratch_path.joinpath(folder).mkdir() url = 'git+git://github.com/pypa/pip-test-package' result = script.pip( 'install', '-e', '%s#egg=pip-test-package' % local_checkout(url, tmpdir), '--install-option=--script-dir=%s' % folder, expect_stderr=True) script_file = ( script.venv / 'src' / 'pip-test-package' / folder / 'pip-test-package' + script.exe ) assert script_file in result.files_created @pytest.mark.network @need_mercurial def test_install_global_option_using_editable(script, tmpdir): """ Test using global distutils options, but in an editable installation """ url = 'hg+http://bitbucket.org/runeh/anyjson' result = script.pip( 'install', '--global-option=--version', '-e', '%[email protected]#egg=anyjson' % local_checkout(url, tmpdir), expect_stderr=True) assert 'Successfully installed anyjson' in result.stdout @pytest.mark.network def test_install_package_with_same_name_in_curdir(script): """ Test installing a package with the same name of a local folder """ script.scratch_path.joinpath("mock==0.6").mkdir() result = script.pip('install', 'mock==0.6') egg_folder = script.site_packages / 'mock-0.6.0-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) mock100_setup_py = textwrap.dedent('''\ from setuptools import setup setup(name='mock', version='100.1')''') def test_install_folder_using_dot_slash(script): """ Test installing a folder using pip install ./foldername """ script.scratch_path.joinpath("mock").mkdir() pkg_path = script.scratch_path / 'mock' pkg_path.joinpath("setup.py").write_text(mock100_setup_py) result = script.pip('install', './mock') egg_folder = script.site_packages / 'mock-100.1-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) def test_install_folder_using_slash_in_the_end(script): r""" Test installing a folder using pip install foldername/ or foldername\ """ script.scratch_path.joinpath("mock").mkdir() pkg_path = script.scratch_path / 'mock' pkg_path.joinpath("setup.py").write_text(mock100_setup_py) result = script.pip('install', 'mock' + os.path.sep) egg_folder = script.site_packages / 'mock-100.1-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) def test_install_folder_using_relative_path(script): """ Test installing a folder using pip install folder1/folder2 """ script.scratch_path.joinpath("initools").mkdir() script.scratch_path.joinpath("initools", "mock").mkdir() pkg_path = script.scratch_path / 'initools' / 'mock' pkg_path.joinpath("setup.py").write_text(mock100_setup_py) result = script.pip('install', Path('initools') / 'mock') egg_folder = script.site_packages / 'mock-100.1-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) @pytest.mark.network def test_install_package_which_contains_dev_in_name(script): """ Test installing package from PyPI which contains 'dev' in name """ result = script.pip('install', 'django-devserver==0.0.4') devserver_folder = script.site_packages / 'devserver' egg_info_folder = ( script.site_packages / 'django_devserver-0.0.4-py%s.egg-info' % pyversion ) assert devserver_folder in result.files_created, str(result.stdout) assert egg_info_folder in result.files_created, str(result) def test_install_package_with_target(script): """ Test installing a package using pip install --target """ target_dir = script.scratch_path / 'target' result = script.pip_install_local('-t', target_dir, "simple==1.0") assert Path('scratch') / 'target' / 'simple' in result.files_created, ( str(result) ) # Test repeated call without --upgrade, no files should have changed result = script.pip_install_local( '-t', target_dir, "simple==1.0", expect_stderr=True, ) assert not Path('scratch') / 'target' / 'simple' in result.files_updated # Test upgrade call, check that new version is installed result = script.pip_install_local('--upgrade', '-t', target_dir, "simple==2.0") assert Path('scratch') / 'target' / 'simple' in result.files_updated, ( str(result) ) egg_folder = ( Path('scratch') / 'target' / 'simple-2.0-py%s.egg-info' % pyversion) assert egg_folder in result.files_created, ( str(result) ) # Test install and upgrade of single-module package result = script.pip_install_local('-t', target_dir, 'singlemodule==0.0.0') singlemodule_py = Path('scratch') / 'target' / 'singlemodule.py' assert singlemodule_py in result.files_created, str(result) result = script.pip_install_local('-t', target_dir, 'singlemodule==0.0.1', '--upgrade') assert singlemodule_py in result.files_updated, str(result) def test_install_nonlocal_compatible_wheel(script, data): target_dir = script.scratch_path / 'target' # Test install with --target result = script.pip( 'install', '-t', target_dir, '--no-index', '--find-links', data.find_links, '--only-binary=:all:', '--python', '3', '--platform', 'fakeplat', '--abi', 'fakeabi', 'simplewheel', ) assert result.returncode == SUCCESS distinfo = Path('scratch') / 'target' / 'simplewheel-2.0-1.dist-info' assert distinfo in result.files_created # Test install without --target result = script.pip( 'install', '--no-index', '--find-links', data.find_links, '--only-binary=:all:', '--python', '3', '--platform', 'fakeplat', '--abi', 'fakeabi', 'simplewheel', expect_error=True ) assert result.returncode == ERROR def test_install_nonlocal_compatible_wheel_path(script, data): target_dir = script.scratch_path / 'target' # Test a full path requirement result = script.pip( 'install', '-t', target_dir, '--no-index', '--only-binary=:all:', Path(data.packages) / 'simplewheel-2.0-py3-fakeabi-fakeplat.whl' ) assert result.returncode == SUCCESS distinfo = Path('scratch') / 'target' / 'simplewheel-2.0.dist-info' assert distinfo in result.files_created # Test a full path requirement (without --target) result = script.pip( 'install', '--no-index', '--only-binary=:all:', Path(data.packages) / 'simplewheel-2.0-py3-fakeabi-fakeplat.whl', expect_error=True ) assert result.returncode == ERROR def test_install_with_target_and_scripts_no_warning(script, with_wheel): """ Test that installing with --target does not trigger the "script not in PATH" warning (issue #5201) """ target_dir = script.scratch_path / 'target' pkga_path = script.scratch_path / 'pkga' pkga_path.mkdir() pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', version='0.1', py_modules=["pkga"], entry_points={ 'console_scripts': ['pkga=pkga:main'] } ) """)) pkga_path.joinpath("pkga.py").write_text(textwrap.dedent(""" def main(): pass """)) result = script.pip('install', '--target', target_dir, pkga_path) # This assertion isn't actually needed, if we get the script warning # the script.pip() call will fail with "stderr not expected". But we # leave the assertion to make the intention of the code clearer. assert "--no-warn-script-location" not in result.stderr, str(result) def test_install_package_with_root(script, data): """ Test installing a package using pip install --root """ root_dir = script.scratch_path / 'root' result = script.pip( 'install', '--root', root_dir, '-f', data.find_links, '--no-index', 'simple==1.0', ) normal_install_path = ( script.base_path / script.site_packages / 'simple-1.0-py%s.egg-info' % pyversion ) # use distutils to change the root exactly how the --root option does it from distutils.util import change_root root_path = change_root( os.path.join(script.scratch, 'root'), normal_install_path ) assert root_path in result.files_created, str(result) # Should show find-links location in output assert "Looking in indexes: " not in result.stdout assert "Looking in links: " in result.stdout def test_install_package_with_prefix(script, data): """ Test installing a package using pip install --prefix """ prefix_path = script.scratch_path / 'prefix' result = script.pip( 'install', '--prefix', prefix_path, '-f', data.find_links, '--no-binary', 'simple', '--no-index', 'simple==1.0', ) rel_prefix_path = script.scratch / 'prefix' install_path = ( distutils.sysconfig.get_python_lib(prefix=rel_prefix_path) / 'simple-1.0-py{}.egg-info'.format(pyversion) ) assert install_path in result.files_created, str(result) def test_install_editable_with_prefix(script): # make a dummy project pkga_path = script.scratch_path / 'pkga' pkga_path.mkdir() pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', version='0.1') """)) if hasattr(sys, "pypy_version_info"): site_packages = os.path.join( 'prefix', 'lib', 'python{}'.format(pyversion), 'site-packages') else: site_packages = distutils.sysconfig.get_python_lib(prefix='prefix') # make sure target path is in PYTHONPATH pythonpath = script.scratch_path / site_packages pythonpath.mkdir(parents=True) script.environ["PYTHONPATH"] = pythonpath # install pkga package into the absolute prefix directory prefix_path = script.scratch_path / 'prefix' result = script.pip( 'install', '--editable', pkga_path, '--prefix', prefix_path) # assert pkga is installed at correct location install_path = script.scratch / site_packages / 'pkga.egg-link' assert install_path in result.files_created, str(result) def test_install_package_conflict_prefix_and_user(script, data): """ Test installing a package using pip install --prefix --user errors out """ prefix_path = script.scratch_path / 'prefix' result = script.pip( 'install', '-f', data.find_links, '--no-index', '--user', '--prefix', prefix_path, 'simple==1.0', expect_error=True, quiet=True, ) assert ( "Can not combine '--user' and '--prefix'" in result.stderr ) def test_install_package_that_emits_unicode(script, data): """ Install a package with a setup.py that emits UTF-8 output and then fails. Refs https://github.com/pypa/pip/issues/326 """ to_install = data.packages.joinpath("BrokenEmitsUTF8") result = script.pip( 'install', to_install, expect_error=True, expect_temp=True, quiet=True, ) assert ( 'FakeError: this package designed to fail on install' in result.stderr ), 'stderr: {}'.format(result.stderr) assert 'UnicodeDecodeError' not in result.stderr assert 'UnicodeDecodeError' not in result.stdout def test_install_package_with_utf8_setup(script, data): """Install a package with a setup.py that declares a utf-8 encoding.""" to_install = data.packages.joinpath("SetupPyUTF8") script.pip('install', to_install) def test_install_package_with_latin1_setup(script, data): """Install a package with a setup.py that declares a latin-1 encoding.""" to_install = data.packages.joinpath("SetupPyLatin1") script.pip('install', to_install) def test_url_req_case_mismatch_no_index(script, data): """ tar ball url requirements (with no egg fragment), that happen to have upper case project names, should be considered equal to later requirements that reference the project name using lower case. tests/data/packages contains Upper-1.0.tar.gz and Upper-2.0.tar.gz 'requiresupper' has install_requires = ['upper'] """ Upper = '/'.join((data.find_links, 'Upper-1.0.tar.gz')) result = script.pip( 'install', '--no-index', '-f', data.find_links, Upper, 'requiresupper' ) # only Upper-1.0.tar.gz should get installed. egg_folder = script.site_packages / 'Upper-1.0-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) egg_folder = script.site_packages / 'Upper-2.0-py%s.egg-info' % pyversion assert egg_folder not in result.files_created, str(result) def test_url_req_case_mismatch_file_index(script, data): """ tar ball url requirements (with no egg fragment), that happen to have upper case project names, should be considered equal to later requirements that reference the project name using lower case. tests/data/packages3 contains Dinner-1.0.tar.gz and Dinner-2.0.tar.gz 'requiredinner' has install_requires = ['dinner'] This test is similar to test_url_req_case_mismatch_no_index; that test tests behaviour when using "--no-index -f", while this one does the same test when using "--index-url". Unfortunately this requires a different set of packages as it requires a prepared index.html file and subdirectory-per-package structure. """ Dinner = '/'.join((data.find_links3, 'dinner', 'Dinner-1.0.tar.gz')) result = script.pip( 'install', '--index-url', data.find_links3, Dinner, 'requiredinner' ) # only Upper-1.0.tar.gz should get installed. egg_folder = script.site_packages / 'Dinner-1.0-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) egg_folder = script.site_packages / 'Dinner-2.0-py%s.egg-info' % pyversion assert egg_folder not in result.files_created, str(result) def test_url_incorrect_case_no_index(script, data): """ Same as test_url_req_case_mismatch_no_index, except testing for the case where the incorrect case is given in the name of the package to install rather than in a requirements file. """ result = script.pip( 'install', '--no-index', '-f', data.find_links, "upper", ) # only Upper-2.0.tar.gz should get installed. egg_folder = script.site_packages / 'Upper-1.0-py%s.egg-info' % pyversion assert egg_folder not in result.files_created, str(result) egg_folder = script.site_packages / 'Upper-2.0-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) def test_url_incorrect_case_file_index(script, data): """ Same as test_url_req_case_mismatch_file_index, except testing for the case where the incorrect case is given in the name of the package to install rather than in a requirements file. """ result = script.pip( 'install', '--index-url', data.find_links3, "dinner", expect_stderr=True, ) # only Upper-2.0.tar.gz should get installed. egg_folder = script.site_packages / 'Dinner-1.0-py%s.egg-info' % pyversion assert egg_folder not in result.files_created, str(result) egg_folder = script.site_packages / 'Dinner-2.0-py%s.egg-info' % pyversion assert egg_folder in result.files_created, str(result) # Should show index-url location in output assert "Looking in indexes: " in result.stdout assert "Looking in links: " not in result.stdout @pytest.mark.network def test_compiles_pyc(script): """ Test installing with --compile on """ del script.environ["PYTHONDONTWRITEBYTECODE"] script.pip("install", "--compile", "--no-binary=:all:", "INITools==0.2") # There are many locations for the __init__.pyc file so attempt to find # any of them exists = [ os.path.exists(script.site_packages_path / "initools/__init__.pyc"), ] exists += glob.glob( script.site_packages_path / "initools/__pycache__/__init__*.pyc" ) assert any(exists) @pytest.mark.network def test_no_compiles_pyc(script): """ Test installing from wheel with --compile on """ del script.environ["PYTHONDONTWRITEBYTECODE"] script.pip("install", "--no-compile", "--no-binary=:all:", "INITools==0.2") # There are many locations for the __init__.pyc file so attempt to find # any of them exists = [ os.path.exists(script.site_packages_path / "initools/__init__.pyc"), ] exists += glob.glob( script.site_packages_path / "initools/__pycache__/__init__*.pyc" ) assert not any(exists) def test_install_upgrade_editable_depending_on_other_editable(script): script.scratch_path.joinpath("pkga").mkdir() pkga_path = script.scratch_path / 'pkga' pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', version='0.1') """)) script.pip('install', '--editable', pkga_path) result = script.pip('list', '--format=freeze') assert "pkga==0.1" in result.stdout script.scratch_path.joinpath("pkgb").mkdir() pkgb_path = script.scratch_path / 'pkgb' pkgb_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkgb', version='0.1', install_requires=['pkga']) """)) script.pip('install', '--upgrade', '--editable', pkgb_path, '--no-index') result = script.pip('list', '--format=freeze') assert "pkgb==0.1" in result.stdout def test_install_subprocess_output_handling(script, data): args = ['install', data.src.joinpath('chattymodule')] # Regular install should not show output from the chatty setup.py result = script.pip(*args) assert 0 == result.stdout.count("HELLO FROM CHATTYMODULE") script.pip("uninstall", "-y", "chattymodule") # With --verbose we should show the output. # Only count examples with sys.argv[1] == egg_info, because we call # setup.py multiple times, which should not count as duplicate output. result = script.pip(*(args + ["--verbose"]), expect_stderr=True) assert 1 == result.stderr.count("HELLO FROM CHATTYMODULE egg_info") script.pip("uninstall", "-y", "chattymodule") # If the install fails, then we *should* show the output... but only once, # even if --verbose is given. result = script.pip(*(args + ["--global-option=--fail"]), expect_error=True) assert 1 == result.stderr.count("I DIE, I DIE") result = script.pip(*(args + ["--global-option=--fail", "--verbose"]), expect_error=True) assert 1 == result.stderr.count("I DIE, I DIE") def test_install_log(script, data, tmpdir): # test that verbose logs go to "--log" file f = tmpdir.joinpath("log.txt") args = ['--log=%s' % f, 'install', data.src.joinpath('chattymodule')] result = script.pip(*args) assert 0 == result.stdout.count("HELLO FROM CHATTYMODULE") with open(f, 'r') as fp: # one from egg_info, one from install assert 2 == fp.read().count("HELLO FROM CHATTYMODULE") def test_install_topological_sort(script, data): args = ['install', 'TopoRequires4', '--no-index', '-f', data.packages] res = str(script.pip(*args, expect_error=False)) order1 = 'TopoRequires, TopoRequires2, TopoRequires3, TopoRequires4' order2 = 'TopoRequires, TopoRequires3, TopoRequires2, TopoRequires4' assert order1 in res or order2 in res, res def test_install_wheel_broken(script, with_wheel): res = script.pip_install_local('wheelbroken', expect_stderr=True) assert "Successfully installed wheelbroken-0.1" in str(res), str(res) def test_cleanup_after_failed_wheel(script, with_wheel): res = script.pip_install_local('wheelbrokenafter', expect_stderr=True) # One of the effects of not cleaning up is broken scripts: script_py = script.bin_path / "script.py" assert script_py.exists(), script_py shebang = open(script_py, 'r').readline().strip() assert shebang != '#!python', shebang # OK, assert that we *said* we were cleaning up: assert "Running setup.py clean for wheelbrokenafter" in str(res), str(res) def test_install_builds_wheels(script, data, with_wheel): # We need to use a subprocess to get the right value on Windows. res = script.run('python', '-c', ( 'from pip._internal.utils import appdirs; ' 'print(appdirs.user_cache_dir("pip"))' )) wheels_cache = os.path.join(res.stdout.rstrip('\n'), 'wheels') # NB This incidentally tests a local tree + tarball inputs # see test_install_editable_from_git_autobuild_wheel for editable # vcs coverage. to_install = data.packages.joinpath('requires_wheelbroken_upper') res = script.pip( 'install', '--no-index', '-f', data.find_links, to_install, expect_stderr=True) expected = ("Successfully installed requires-wheelbroken-upper-0" " upper-2.0 wheelbroken-0.1") # Must have installed it all assert expected in str(res), str(res) wheels = [] for top, dirs, files in os.walk(wheels_cache): wheels.extend(files) # and built wheels for upper and wheelbroken assert "Building wheel for upper" in str(res), str(res) assert "Building wheel for wheelb" in str(res), str(res) # Wheels are built for local directories, but not cached. assert "Building wheel for requir" in str(res), str(res) # wheelbroken has to run install # into the cache assert wheels != [], str(res) # and installed from the wheel assert "Running setup.py install for upper" not in str(res), str(res) # Wheels are built for local directories, but not cached. assert "Running setup.py install for requir" not in str(res), str(res) # wheelbroken has to run install assert "Running setup.py install for wheelb" in str(res), str(res) # We want to make sure we used the correct implementation tag assert wheels == [ "Upper-2.0-{}-none-any.whl".format(pep425tags.implementation_tag), ] def test_install_no_binary_disables_building_wheels(script, data, with_wheel): to_install = data.packages.joinpath('requires_wheelbroken_upper') res = script.pip( 'install', '--no-index', '--no-binary=upper', '-f', data.find_links, to_install, expect_stderr=True) expected = ("Successfully installed requires-wheelbroken-upper-0" " upper-2.0 wheelbroken-0.1") # Must have installed it all assert expected in str(res), str(res) # and built wheels for wheelbroken only assert "Building wheel for wheelb" in str(res), str(res) # Wheels are built for local directories, but not cached across runs assert "Building wheel for requir" in str(res), str(res) # Don't build wheel for upper which was blacklisted assert "Building wheel for upper" not in str(res), str(res) # Wheels are built for local directories, but not cached across runs assert "Running setup.py install for requir" not in str(res), str(res) # And these two fell back to sdist based installed. assert "Running setup.py install for wheelb" in str(res), str(res) assert "Running setup.py install for upper" in str(res), str(res) def test_install_no_binary_disables_cached_wheels(script, data, with_wheel): # Seed the cache script.pip( 'install', '--no-index', '-f', data.find_links, 'upper') script.pip('uninstall', 'upper', '-y') res = script.pip( 'install', '--no-index', '--no-binary=:all:', '-f', data.find_links, 'upper', expect_stderr=True) assert "Successfully installed upper-2.0" in str(res), str(res) # No wheel building for upper, which was blacklisted assert "Building wheel for upper" not in str(res), str(res) # Must have used source, not a cached wheel to install upper. assert "Running setup.py install for upper" in str(res), str(res) def test_install_editable_with_wrong_egg_name(script): script.scratch_path.joinpath("pkga").mkdir() pkga_path = script.scratch_path / 'pkga' pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', version='0.1') """)) result = script.pip( 'install', '--editable', 'file://%s#egg=pkgb' % pkga_path ) assert ("Generating metadata for package pkgb produced metadata " "for project name pkga. Fix your #egg=pkgb " "fragments.") in result.stderr assert "Successfully installed pkga" in str(result), str(result) def test_install_tar_xz(script, data): try: import lzma # noqa except ImportError: pytest.skip("No lzma support") res = script.pip('install', data.packages / 'singlemodule-0.0.1.tar.xz') assert "Successfully installed singlemodule-0.0.1" in res.stdout, res def test_install_tar_lzma(script, data): try: import lzma # noqa except ImportError: pytest.skip("No lzma support") res = script.pip('install', data.packages / 'singlemodule-0.0.1.tar.lzma') assert "Successfully installed singlemodule-0.0.1" in res.stdout, res def test_double_install(script): """ Test double install passing with two same version requirements """ result = script.pip('install', 'pip', 'pip', expect_error=False) msg = "Double requirement given: pip (already in pip, name='pip')" assert msg not in result.stderr def test_double_install_fail(script): """ Test double install failing with two different version requirements """ result = script.pip('install', 'pip==*', 'pip==7.1.2', expect_error=True) msg = ("Double requirement given: pip==7.1.2 (already in pip==*, " "name='pip')") assert msg in result.stderr def _get_expected_error_text(): return ( "Package 'pkga' requires a different Python: {} not in '<1.0'" ).format('.'.join(map(str, sys.version_info[:3]))) def test_install_incompatible_python_requires(script): script.scratch_path.joinpath("pkga").mkdir() pkga_path = script.scratch_path / 'pkga' pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', python_requires='<1.0', version='0.1') """)) result = script.pip('install', pkga_path, expect_error=True) assert _get_expected_error_text() in result.stderr, str(result) def test_install_incompatible_python_requires_editable(script): script.scratch_path.joinpath("pkga").mkdir() pkga_path = script.scratch_path / 'pkga' pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', python_requires='<1.0', version='0.1') """)) result = script.pip( 'install', '--editable=%s' % pkga_path, expect_error=True) assert _get_expected_error_text() in result.stderr, str(result) def test_install_incompatible_python_requires_wheel(script, with_wheel): script.scratch_path.joinpath("pkga").mkdir() pkga_path = script.scratch_path / 'pkga' pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', python_requires='<1.0', version='0.1') """)) script.run( 'python', 'setup.py', 'bdist_wheel', '--universal', cwd=pkga_path) result = script.pip('install', './pkga/dist/pkga-0.1-py2.py3-none-any.whl', expect_error=True) assert _get_expected_error_text() in result.stderr, str(result) def test_install_compatible_python_requires(script): script.scratch_path.joinpath("pkga").mkdir() pkga_path = script.scratch_path / 'pkga' pkga_path.joinpath("setup.py").write_text(textwrap.dedent(""" from setuptools import setup setup(name='pkga', python_requires='>1.0', version='0.1') """)) res = script.pip('install', pkga_path) assert "Successfully installed pkga-0.1" in res.stdout, res @pytest.mark.network def test_install_pep508_with_url(script): res = script.pip( 'install', '--no-index', 'packaging@https://files.pythonhosted.org/packages/2f/2b/' 'c681de3e1dbcd469537aefb15186b800209aa1f299d933d23b48d85c9d56/' 'packaging-15.3-py2.py3-none-any.whl#sha256=' 'ce1a869fe039fbf7e217df36c4653d1dbe657778b2d41709593a0003584405f4' ) assert "Successfully installed packaging-15.3" in str(res), str(res) @pytest.mark.network def test_install_pep508_with_url_in_install_requires(script): pkga_path = create_test_package_with_setup( script, name='pkga', version='1.0', install_requires=[ 'packaging@https://files.pythonhosted.org/packages/2f/2b/' 'c681de3e1dbcd469537aefb15186b800209aa1f299d933d23b48d85c9d56/' 'packaging-15.3-py2.py3-none-any.whl#sha256=' 'ce1a869fe039fbf7e217df36c4653d1dbe657778b2d41709593a0003584405f4' ], ) res = script.pip('install', pkga_path) assert "Successfully installed packaging-15.3" in str(res), str(res) def test_install_pep508_with_url_in_install_requires_url_change_wheel(script): dep_v1_path = create_basic_wheel_for_package( script, name='dep', version='1.0', ) dep_v2_path = create_basic_wheel_for_package( script, name='dep', version='2.0', ) pkga_path = create_basic_wheel_for_package( script, name='pkga', version='1.0', depends=['dep @ ' + path_to_url(dep_v1_path)], ) res = script.pip('install', pkga_path) assert "Successfully installed dep-1.0" in str(res), str(res) pkga_path.rmtree() # Updating the URL to the dependency installs the updated dependency pkga_path = create_basic_wheel_for_package( script, name='pkga', version='2.0', depends=['dep @ ' + path_to_url(dep_v2_path)], ) res = script.pip('install', pkga_path) assert "Successfully installed dep-2.0" in str(res), str(res) res = script.pip('install', pkga_path) # pip can determine the version from a wheel's filename, so the # dependency is not reinstalled if the URL doesn't change assert "Requirement already satisfied: dep==2.0" in str(res), str(res) def test_install_pep508_with_url_in_install_requires_url_change_directory( script): dep_v1_path = create_test_package_with_setup( script, name='dep', version='1.0', ) # Rename the package directory so it doesn't get overwritten when # creating the package for dep_v2 dep_v1_path.move(dep_v1_path.folder / 'dep_v1') dep_v1_path = dep_v1_path.folder / 'dep_v1' dep_v2_path = create_test_package_with_setup( script, name='dep', version='2.0', ) pkga_path = create_basic_wheel_for_package( script, name='pkga', version='1.0', depends=['dep @ ' + path_to_url(dep_v1_path)], ) res = script.pip('install', pkga_path) assert "Successfully installed dep-1.0" in str(res), str(res) pkga_path.rmtree() # Updating the URL to the dependency installs the updated dependency pkga_path = create_basic_wheel_for_package( script, name='pkga', version='2.0', depends=['dep @ ' + path_to_url(dep_v2_path)], ) res = script.pip('install', pkga_path) assert "Successfully installed dep-2.0" in str(res), str(res) res = script.pip('install', pkga_path) # pip can't determine versions from a directory name, so it will always # reinstall the dependency assert "Successfully installed dep-2.0" in str(res), str(res) @pytest.mark.network @pytest.mark.parametrize('index', (PyPI.simple_url, TestPyPI.simple_url)) def test_install_from_test_pypi_with_ext_url_dep_is_blocked(script, index): res = script.pip( 'install', '--index-url', index, 'pep-508-url-deps', expect_error=True, ) error_message = ( "Packages installed from PyPI cannot depend on packages " "which are not also hosted on PyPI." ) error_cause = ( "pep-508-url-deps depends on sampleproject@ " "https://github.com/pypa/sampleproject/archive/master.zip" ) assert res.returncode == 1 assert error_message in res.stderr, str(res) assert error_cause in res.stderr, str(res) def test_installing_scripts_outside_path_prints_warning(script): result = script.pip_install_local( "--prefix", script.scratch_path, "script_wheel1" ) assert "Successfully installed script-wheel1" in result.stdout, str(result) assert "--no-warn-script-location" in result.stderr def test_installing_scripts_outside_path_can_suppress_warning(script): result = script.pip_install_local( "--prefix", script.scratch_path, "--no-warn-script-location", "script_wheel1" ) assert "Successfully installed script-wheel1" in result.stdout, str(result) assert "--no-warn-script-location" not in result.stderr def test_installing_scripts_on_path_does_not_print_warning(script): result = script.pip_install_local("script_wheel1") assert "Successfully installed script-wheel1" in result.stdout, str(result) assert "--no-warn-script-location" not in result.stderr def test_installed_files_recorded_in_deterministic_order(script, data): """ Ensure that we record the files installed by a package in a deterministic order, to make installs reproducible. """ to_install = data.packages.joinpath("FSPkg") result = script.pip('install', to_install, expect_error=False) fspkg_folder = script.site_packages / 'fspkg' egg_info = 'FSPkg-0.1.dev0-py%s.egg-info' % pyversion installed_files_path = ( script.site_packages / egg_info / 'installed-files.txt' ) assert fspkg_folder in result.files_created, str(result.stdout) assert installed_files_path in result.files_created, str(result) installed_files_path = result.files_created[installed_files_path].full installed_files_lines = [ p for p in Path(installed_files_path).read_text().split('\n') if p ] assert installed_files_lines == sorted(installed_files_lines) def test_install_conflict_results_in_warning(script, data): pkgA_path = create_test_package_with_setup( script, name='pkgA', version='1.0', install_requires=['pkgb == 1.0'], ) pkgB_path = create_test_package_with_setup( script, name='pkgB', version='2.0', ) # Install pkgA without its dependency result1 = script.pip('install', '--no-index', pkgA_path, '--no-deps') assert "Successfully installed pkgA-1.0" in result1.stdout, str(result1) # Then install an incorrect version of the dependency result2 = script.pip( 'install', '--no-index', pkgB_path, allow_stderr_error=True, ) assert "pkga 1.0 has requirement pkgb==1.0" in result2.stderr, str(result2) assert "Successfully installed pkgB-2.0" in result2.stdout, str(result2) def test_install_conflict_warning_can_be_suppressed(script, data): pkgA_path = create_test_package_with_setup( script, name='pkgA', version='1.0', install_requires=['pkgb == 1.0'], ) pkgB_path = create_test_package_with_setup( script, name='pkgB', version='2.0', ) # Install pkgA without its dependency result1 = script.pip('install', '--no-index', pkgA_path, '--no-deps') assert "Successfully installed pkgA-1.0" in result1.stdout, str(result1) # Then install an incorrect version of the dependency; suppressing warning result2 = script.pip( 'install', '--no-index', pkgB_path, '--no-warn-conflicts' ) assert "Successfully installed pkgB-2.0" in result2.stdout, str(result2) def test_target_install_ignores_distutils_config_install_prefix(script): prefix = script.scratch_path / 'prefix' distutils_config = Path(os.path.expanduser('~'), 'pydistutils.cfg' if sys.platform == 'win32' else '.pydistutils.cfg') distutils_config.write_text(textwrap.dedent( ''' [install] prefix=%s ''' % str(prefix))) target = script.scratch_path / 'target' result = script.pip_install_local('simplewheel', '-t', target) assert "Successfully installed simplewheel" in result.stdout relative_target = os.path.relpath(target, script.base_path) relative_script_base = os.path.relpath(prefix, script.base_path) assert relative_target in result.files_created assert relative_script_base not in result.files_created @pytest.mark.network @pytest.mark.skipif("sys.platform != 'win32'") @pytest.mark.parametrize('pip_name', [ 'pip', 'pip{}'.format(sys.version_info[0]), 'pip{}.{}'.format(*sys.version_info[:2]), 'pip.exe', 'pip{}.exe'.format(sys.version_info[0]), 'pip{}.{}.exe'.format(*sys.version_info[:2]) ]) def test_protect_pip_from_modification_on_windows(script, pip_name): """ Test that pip modification command using ``pip install ...`` raises an error on Windows. """ command = [pip_name, 'install', 'pip != {}'.format(pip_current_version)] result = script.run(*command, expect_error=True) new_command = [sys.executable, '-m', 'pip'] + command[1:] expected_message = ( 'To modify pip, please run the following command:\n{}' .format(' '.join(new_command)) ) assert expected_message in result.stderr, str(result) @pytest.mark.network @pytest.mark.skipif("sys.platform != 'win32'") def test_protect_pip_from_modification_via_deps_on_windows(script): """ Test ``pip install pkga`` raises an error on Windows if `pkga` implicitly tries to upgrade pip. """ pkga_wheel_path = create_basic_wheel_for_package( script, 'pkga', '0.1', depends=['pip != {}'.format(pip_current_version)], ) # Make sure pip install pkga raises an error args = ['install', pkga_wheel_path] result = script.pip(*args, expect_error=True, use_module=False) new_command = [sys.executable, '-m', 'pip'] + args expected_message = ( 'To modify pip, please run the following command:\n{}' .format(' '.join(new_command)) ) assert expected_message in result.stderr, str(result) @pytest.mark.network @pytest.mark.skipif("sys.platform != 'win32'") def test_protect_pip_from_modification_via_sub_deps_on_windows(script): """ Test ``pip install pkga`` raises an error on Windows if sub-dependencies of `pkga` implicitly tries to upgrade pip. """ # Make a wheel for pkga which requires pkgb pkga_wheel_path = create_basic_wheel_for_package( script, 'pkga', '0.1', depends=['pkgb'], ) # Make a wheel for pkgb which requires pip pkgb_wheel_path = create_basic_wheel_for_package( script, 'pkgb', '0.1', depends=['pip != {}'.format(pip_current_version)], ) # Make sure pip install pkga raises an error args = [ 'install', pkga_wheel_path, '--find-links', pkgb_wheel_path.parent ] result = script.pip(*args, expect_error=True, use_module=False) new_command = [sys.executable, '-m', 'pip'] + args expected_message = ( 'To modify pip, please run the following command:\n{}' .format(' '.join(new_command)) ) assert expected_message in result.stderr, str(result) @pytest.mark.parametrize( 'install_args, expected_message', [ ([], 'Requirement already satisfied: pip in'), (['--upgrade'], 'Requirement already up-to-date: pip in'), ] ) @pytest.mark.parametrize("use_module", [True, False]) def test_install_pip_does_not_modify_pip_when_satisfied( script, install_args, expected_message, use_module): """ Test it doesn't upgrade the pip if it already satisfies the requirement. """ result = script.pip_install_local( 'pip', *install_args, use_module=use_module ) assert expected_message in result.stdout, str(result) def test_ignore_yanked_file(script, data): """ Test ignore a "yanked" file. """ result = script.pip( 'install', 'simple', '--index-url', data.index_url('yanked'), ) # Make sure a "yanked" release is ignored assert 'Successfully installed simple-2.0\n' in result.stdout, str(result) def test_install_yanked_file_and_print_warning(script, data): """ Test install a "yanked" file and print a warning. Yanked files are always ignored, unless they are the only file that matches a version specifier that "pins" to an exact version (PEP 592). """ result = script.pip( 'install', 'simple==3.0', '--index-url', data.index_url('yanked'), expect_stderr=True, ) expected_warning = 'Reason for being yanked: test reason message' assert expected_warning in result.stderr, str(result) # Make sure a "yanked" release is installed assert 'Successfully installed simple-3.0\n' in result.stdout, str(result)
mit
-1,385,187,613,620,103,400
35.920113
79
0.652461
false
IEEE-NITK/SummerProjects17
Competitive-Coding/Assignment-2/Priyam/DFS.py
1
1889
class Vertex: def __init__(self, n): self.name = n self.neighbors = list() self.discovery = 0 self.finish = 0 self.color = 'black' def add_neighbor(self, v): if v not in self.neighbors: self.neighbors.append(v) self.neighbors.sort() class Graph: vertices = {} time = 0 def add_vertex(self, vertex): if isinstance(vertex, Vertex) and vertex.name not in self.vertices: self.vertices[vertex.name] = vertex return True else: return False def add_edge(self, u, v): if u in self.vertices and v in self.vertices: for key, value in self.vertices.items(): if key == u: value.add_neighbor(v) if key == v: value.add_neighbor(u) return True else: return False def print_graph(self): for key in sorted(list(self.vertices.keys())): print(key + str(self.vertices[key].neighbors) + " " + str(self.vertices[key].discovery) + "/" + str( self.vertices[key].finish)) def _dfs(self, vertex): global time vertex.color = 'red' vertex.discovery = time time += 1 for v in vertex.neighbors: if self.vertices[v].color == 'black': self._dfs(self.vertices[v]) vertex.color = 'blue' vertex.finish = time time += 1 def dfs(self, vertex): global time time = 1 self._dfs(vertex) n, m = map(int, raw_input().split()) g = Graph() a = Vertex('1') g.add_vertex(a) for i in xrange(1, n+1): g.add_vertex(Vertex(str(i))) edges = [] for i in xrange(m): edges.append(raw_input().replace(' ','')) for edge in edges: g.add_edge(edge[:1], edge[1:]) g.dfs(a) g.print_graph()
mit
7,833,423,528,937,795,000
24.540541
113
0.523557
false
stscieisenhamer/ginga
ginga/examples/gtk/example2_gtk.py
1
8631
#! /usr/bin/env python # # example2_gtk.py -- Simple, configurable FITS viewer. # # This is open-source software licensed under a BSD license. # Please see the file LICENSE.txt for details. # from __future__ import print_function import sys, os import logging, logging.handlers from ginga import AstroImage from ginga.gtkw import GtkHelp from ginga.gtkw.ImageViewGtk import CanvasView from ginga.canvas.CanvasObject import get_canvas_types from ginga import colors from ginga.misc import log import gtk STD_FORMAT = '%(asctime)s | %(levelname)1.1s | %(filename)s:%(lineno)d (%(funcName)s) | %(message)s' class FitsViewer(object): def __init__(self, logger): self.logger = logger self.drawcolors = colors.get_colors() self.dc = get_canvas_types() root = gtk.Window(gtk.WINDOW_TOPLEVEL) root.set_title("Gtk2 CanvasView Example") root.set_border_width(2) root.connect("delete_event", lambda w, e: quit(w)) self.root = root self.select = GtkHelp.FileSelection(root) vbox = gtk.VBox(spacing=2) fi = CanvasView(logger) fi.enable_autocuts('on') fi.set_autocut_params('zscale') fi.enable_autozoom('on') fi.set_zoom_algorithm('rate') fi.set_zoomrate(1.4) fi.show_pan_mark(True) fi.set_callback('drag-drop', self.drop_file) fi.set_callback('none-move', self.motion) fi.set_bg(0.2, 0.2, 0.2) fi.ui_setActive(True) self.fitsimage = fi bd = fi.get_bindings() bd.enable_all(True) # canvas that we will draw on canvas = self.dc.DrawingCanvas() canvas.enable_draw(True) canvas.set_drawtype('rectangle', color='lightblue') canvas.setSurface(fi) self.canvas = canvas # add canvas to view private_canvas = fi.get_canvas() private_canvas.register_for_cursor_drawing(fi) private_canvas.add(canvas) canvas.ui_setActive(True) self.drawtypes = canvas.get_drawtypes() self.drawtypes.sort() # add a color bar #fi.show_color_bar(True) fi.show_focus_indicator(True) # add little mode indicator that shows keyboard modal states fi.show_mode_indicator(True, corner='ur') w = fi.get_widget() w.set_size_request(512, 512) vbox.pack_start(w, fill=True, expand=True) self.readout = gtk.Label("") vbox.pack_start(self.readout, fill=True, expand=False) hbox = gtk.HBox(spacing=5) wdrawtype = GtkHelp.combo_box_new_text() index = 0 for name in self.drawtypes: wdrawtype.insert_text(index, name) index += 1 index = self.drawtypes.index('rectangle') wdrawtype.set_active(index) wdrawtype.connect('changed', self.set_drawparams) self.wdrawtype = wdrawtype wdrawcolor = GtkHelp.combo_box_new_text() index = 0 for name in self.drawcolors: wdrawcolor.insert_text(index, name) index += 1 index = self.drawcolors.index('lightblue') wdrawcolor.set_active(index) wdrawcolor.connect('changed', self.set_drawparams) self.wdrawcolor = wdrawcolor wfill = GtkHelp.CheckButton("Fill") wfill.sconnect('toggled', self.set_drawparams) self.wfill = wfill walpha = GtkHelp.SpinButton() adj = walpha.get_adjustment() adj.configure(0.0, 0.0, 1.0, 0.1, 0.1, 0) walpha.set_value(1.0) walpha.set_digits(1) walpha.sconnect('value-changed', self.set_drawparams) self.walpha = walpha wclear = gtk.Button("Clear Canvas") wclear.connect('clicked', self.clear_canvas) wopen = gtk.Button("Open File") wopen.connect('clicked', self.open_file) wquit = gtk.Button("Quit") wquit.connect('clicked', quit) for w in (wquit, wclear, walpha, gtk.Label("Alpha:"), wfill, wdrawcolor, wdrawtype, wopen): hbox.pack_end(w, fill=False, expand=False) vbox.pack_start(hbox, fill=False, expand=False) root.add(vbox) def get_widget(self): return self.root def set_drawparams(self, w): index = self.wdrawtype.get_active() kind = self.drawtypes[index] index = self.wdrawcolor.get_active() fill = self.wfill.get_active() alpha = self.walpha.get_value() params = { 'color': self.drawcolors[index], 'alpha': alpha, #'cap': 'ball', } if kind in ('circle', 'rectangle', 'polygon', 'triangle', 'righttriangle', 'ellipse', 'square', 'box'): params['fill'] = fill params['fillalpha'] = alpha self.canvas.set_drawtype(kind, **params) def clear_canvas(self, w): self.canvas.delete_all_objects() def load_file(self, filepath): image = AstroImage.AstroImage(logger=self.logger) image.load_file(filepath) self.fitsimage.set_image(image) self.root.set_title(filepath) def open_file(self, w): self.select.popup("Open FITS file", self.load_file) def drop_file(self, fitsimage, paths): fileName = paths[0] self.load_file(fileName) def motion(self, fitsimage, button, data_x, data_y): # Get the value under the data coordinates try: #value = fitsimage.get_data(data_x, data_y) # We report the value across the pixel, even though the coords # change halfway across the pixel value = fitsimage.get_data(int(data_x+0.5), int(data_y+0.5)) except Exception: value = None fits_x, fits_y = data_x + 1, data_y + 1 # Calculate WCS RA try: # NOTE: image function operates on DATA space coords image = fitsimage.get_image() if image is None: # No image loaded return ra_txt, dec_txt = image.pixtoradec(fits_x, fits_y, format='str', coords='fits') except Exception as e: self.logger.warning("Bad coordinate conversion: %s" % ( str(e))) ra_txt = 'BAD WCS' dec_txt = 'BAD WCS' text = "RA: %s DEC: %s X: %.2f Y: %.2f Value: %s" % ( ra_txt, dec_txt, fits_x, fits_y, value) self.readout.set_text(text) def quit(self, w): gtk.main_quit() return True def main(options, args): logger = log.get_logger("example2", options=options) # Check whether user wants to use OpenCv if options.opencv: from ginga import trcalc try: trcalc.use('opencv') except Exception as e: logger.warning("failed to set OpenCv preference: %s" % (str(e))) # Check whether user wants to use OpenCL elif options.opencl: from ginga import trcalc try: trcalc.use('opencl') except Exception as e: logger.warning("failed to set OpenCL preference: %s" % (str(e))) fv = FitsViewer(logger) root = fv.get_widget() root.show_all() if len(args) > 0: fv.load_file(args[0]) gtk.main() if __name__ == "__main__": # Parse command line options with nifty optparse module from optparse import OptionParser usage = "usage: %prog [options] cmd [args]" optprs = OptionParser(usage=usage, version=('%%prog')) optprs.add_option("--debug", dest="debug", default=False, action="store_true", help="Enter the pdb debugger on main()") optprs.add_option("--opencv", dest="opencv", default=False, action="store_true", help="Use OpenCv acceleration") optprs.add_option("--opencl", dest="opencl", default=False, action="store_true", help="Use OpenCL acceleration") optprs.add_option("--profile", dest="profile", action="store_true", default=False, help="Run the profiler on main()") log.addlogopts(optprs) (options, args) = optprs.parse_args(sys.argv[1:]) # Are we debugging this? if options.debug: import pdb pdb.run('main(options, args)') # Are we profiling this? elif options.profile: import profile print(("%s profile:" % sys.argv[0])) profile.run('main(options, args)') else: main(options, args) # END
bsd-3-clause
7,025,757,477,024,090,000
29.715302
100
0.579771
false
rcosnita/fantastico
fantastico/contrib/dynamic_menu/models/menus.py
1
3240
''' Copyright 2013 Cosnita Radu Viorel Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. .. codeauthor:: Radu Viorel Cosnita <[email protected]> .. py:module:: fantastico.contrib.dynamic_menu.models.menu ''' from fantastico.mvc import BASEMODEL from sqlalchemy.schema import Column, ForeignKey from sqlalchemy.types import Integer, String from sqlalchemy.orm import relationship class DynamicMenu(BASEMODEL): '''This class defines supported attributes for a dynamic menu. In this version, users can easily define the following menu attributes: #. Menu unique identifier (read only). #. Menu name.''' __tablename__ = "menus" id = Column("id", Integer, primary_key=True, autoincrement=True) name = Column("name", String(150), nullable=False) def __init__(self, name): '''This constructor initialize the menu with desired name. :param name: Dynamic menu friendly name. :type name: string ''' self.name = name class DynamicMenuItem(BASEMODEL): '''This class defines supported attributes for a dynamic menu item. In this version, users can easily define the following menu item attributes: #. Item unique identifier. #. A target which will display the menu url. Currently, all http targets are valid. #. Item url where user will be redirected after click / tap. #. Item friendly title which will be displayed in environments which support tooltips. #. Item label displayed to user. ''' __tablename__ = "menu_items" id = Column("id", Integer, primary_key=True, autoincrement=True) target = Column("target", String(50), nullable=False) url = Column("url", String(255), nullable=False) title = Column("title", String(255), nullable=False) label = Column("label", String(255), nullable=False) menu_id = Column("menu_id", Integer, ForeignKey(DynamicMenu.id)) menu = relationship(DynamicMenu, primaryjoin=menu_id == DynamicMenu.id) def __init__(self, target, url, title, label, menu_id): '''This constructor initialized all mandatory attributes of a dynamic menu item.''' self.target = target self.url = url self.title = title self.label = label self.menu_id = menu_id
mit
-8,364,358,867,303,549,000
42.783784
126
0.723765
false
ddietze/pyFSRS
core/FilePickerCtrl.py
1
5078
""" .. module: FilePickerCtrl :platform: Windows .. moduleauthor:: Daniel R. Dietze <[email protected]> A simple file and path picker widget consisting of a text field and a button. .. This file is part of the pyFSRS app. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. Copyright 2014-2016 Daniel Dietze <[email protected]>. """ import wx import wx.lib.newevent import os FileSelectEvent, EVT_FILE_SELECT = wx.lib.newevent.NewEvent() class FilePickerCtrl(wx.Panel): """FilePickerCtrl is a simple file picker widget for wxPython consisting of a text-field and a 'select file'-button. :param wxWindow parent: Parent window. :param int id: Widget it (default=-1). :param str startDir: Initial directory to display in search dialog (default='' for current). :param str mode: Type of dialog ('open', 'save', 'path' = default). :param kwargs: Other parameters that are passed on to the wxPanel constructor. """ def __init__(self, parent, id=-1, startDir='', mode='path', **kwargs): wx.Panel.__init__(self, parent, id, **kwargs) self.startDir = startDir if mode not in ["open", "save", "path"]: raise ValueError("Mode must be 'path', 'open' or 'save'!") if mode == "open": self.mode = wx.FD_OPEN self.dlgt = "Choose file to open.." elif mode == "save": self.mode = wx.SAVE self.dlgt = "Choose file to save.." else: self.mode = None self.dlgt = "Choose path.." # create widget self.rborder = 0 self.outersizer = wx.BoxSizer(wx.VERTICAL) self.sizer = wx.BoxSizer(wx.HORIZONTAL) self.input = wx.TextCtrl(self, -1, "") self.button = wx.Button(self, -1, "...", style=wx.BU_EXACTFIT) self.sizer.Add(self.input, 1, wx.EXPAND | wx.RIGHT, 3) self.sizer.Add(self.button, 0) self.outersizer.Add(self.sizer, 1, wx.EXPAND | wx.RIGHT, self.rborder) self.SetSizer(self.outersizer) self.Fit() self.SetAutoLayout(True) if 'size' in kwargs: self.SetSize(kwargs['size']) self.button.Bind(wx.EVT_BUTTON, self.onBrowse) def GetSize(self): """Return wxSize-object containing widget dimensions. """ size = wx.Panel.GetSize(self) return wx.Size(size[0] - self.rborder, size[1]) def SetSize(self, w, h=None): """Set widget size. :param mixed w: Width in pixel if h is not None. Otherwise tuple containing width and height. :param int h: Height in pixel (default=None). """ if h is None: wx.Panel.SetSize(self, (w[0] + self.rborder, w[1])) else: wx.Panel.SetSize(self, (w + self.rborder, h)) def GetValue(self): """Return selected path. """ return self.input.GetValue() def SetValue(self, value): """Set current path. """ self.input.SetValue(str(value)) def Enable(self, value=True): """Enable or disable widget when value is True (default) or False. """ self.input.Enable(value) return self.button.Enable(value) def Disable(self): """Disable widget. """ self.Enable(False) def onBrowse(self, event): """Handle the button click event by displaying a file or path dialog. Emits a `FileSelectEvent` when the user clicks OK. """ current = self.GetValue() directory = os.path.split(current) if os.path.isdir(current): directory = current current = '' elif directory and os.path.isdir(directory[0]): current = directory[1] directory = directory[0] else: directory = self.startDir if self.mode is None: dlg = wx.DirDialog(self, self.dlgt, directory, wx.DD_DIR_MUST_EXIST) else: dlg = wx.FileDialog(self, self.dlgt, directory, current, "*.*", self.mode) if dlg.ShowModal() == wx.ID_OK: self.SetValue(dlg.GetPath()) # Create the event evt = FileSelectEvent(filename=self.GetValue()) # Post the event wx.PostEvent(self, evt) dlg.Destroy()
gpl-3.0
-5,094,602,708,831,065,000
30.551282
101
0.589011
false
flashdagger/commandeur
commandeur/cmdtools.py
1
1552
""" Module docstring """ from collections import defaultdict import re def parse_doc_arg(line): """ parse a section of argument annotations returns a dict with all values found """ assert isinstance(line, str) info = dict() pattern = re.compile(r"(.*?)(?:\((.*)\))?\s*:((?:.*\n?.+)+)") match = re.match(pattern, line) if match is not None: groups = match.groups() for item, value in zip(['name', 'metavar', 'desc'], groups): if value is not None: value = value.strip() info[item] = value return info def parse_doc(doc): """ parse docstring with Google sytle returns a dict with all sections found each section contains a list with all paragraphs found """ info = defaultdict(list) if doc is None: return info assert isinstance(doc, str) lines = doc.splitlines() section = 'header' lastindent = -1 mayconnect = False for line in lines: indent, text = re.match(r"^(\s*)(.*?)\s*$", line).groups() match = re.match("([A-Z][a-z]+):", text) if match is not None: section, = match.groups() elif text: if len(indent) > lastindent and mayconnect: text = info[section].pop() + "\n" + text if section != 'header': lastindent = len(indent) mayconnect = True info[section].append(text) elif text == "": mayconnect = False return info
mit
-2,259,209,158,375,754,200
21.171429
68
0.541237
false
devlights/try-python
trypython/stdlib/re_/re04.py
1
5007
""" 正規表現のサンプルです。 アトミックグループ (Atomic Groups) について REFERENCES:: http://bit.ly/2O3jVNn http://bit.ly/2NXqocl http://bit.ly/2NVGi71 http://bit.ly/2NXEg6m """ import re import regex from trypython.common.commoncls import SampleBase from trypython.common.commonfunc import stopwatch, pr _message = '1' * 300000000 # noinspection PyMethodMayBeStatic class Sample(SampleBase): def exec(self): # ------------------------------------------------------------------------ # アトミックグループについて # ----------------------------------------- # 正規表現で処理する場合、処理速度に差がでるのは以下の部分 # - バックトラックの発生頻度 # バックトラックの発生を以下に防ぐかによって処理速度に差が出る。 # 通常の正規表現は「最長一致」であり、指定されたパターンで「可能な限り」 # 前に進んでいく。例えば, 「123456」という文字列があった場合に # 「\d*」というパターンを指定すると、数字の連続をすべて飲み込む。 # 「\d*:」というパターンを指定した場合でも、最初の「\d*」が # 数字部分全部を飲み込み、その後で、残りの「:」についてマッチするかどうかを # 判定することになる。マッチしないので、正規表現エンジンはバックトラックして # 位置を探しなおす。このバックトラックが発生すればするほど処理に時間がかかる。 # # このような場合に、「ここまできて失敗したのなら、バックトラックする必要なし」 # ということを事前に通知することができる。 # このときに指定するのが「アトミックグループ」となる。 # アトミックグループの挙動は、「グループ内のパターンに一旦マッチした後は # その中のステートを全て破棄し、バックトラックさせないようにする」というもの。 # # アトミックグループは、以下の書式で定義する # (?>pattern) # 上のパターンをアトミックグループの指定に変更すると以下のようになる。 # (?>\d*): # # ただし、問題が一つあって、python の標準モジュール re は # アトミックグループに対応していない # 無理矢理同じことを行うようには出来るみたい。(http://bit.ly/2O3jVNn 参照) # # 標準モジュールではないが、PYPI に regex というモジュールがあり # こちらは、アトミックグループに対応している。(http://bit.ly/2NXqocl 参照) # インストールする場合は以下を実行 # $ python -m pip install regex # # アトミックグループ指定している場合、バックトラックが発生しないので # マッチしない場合の判定がとても速くなる。(通常のモードだとマッチしないか # どうかを最終判定するまでにバックトラックを繰り返さないといけないため) # ------------------------------------------------------------------------ # アトミックグループ指定なし stopwatch(self.normal)() # 標準モジュール re で、無理矢理 stopwatch(self.atomic_stdlib_re)() # 外部ライブラリ rexex でアトミックグループ指定 stopwatch(self.atomic_regex_module)() def normal(self): global _message m = re.match(r'\d*:', _message) if m: pr('normal', 'マッチした') else: pr('normal', 'マッチしない') def atomic_stdlib_re(self): global _message m = re.match(r'(?=(?P<tmp>\d*:))(?P=tmp)', _message) if m: pr('atomic_stdlib_re', 'マッチした') else: pr('atomic_stdlib_re', 'マッチしない') def atomic_regex_module(self): """Python の 標準モジュール re は、アトミックグループをサポートしていない。 http://bit.ly/2O3jVNn に記載されているように、無理やり評価させることも可能 らしいのだが、「regex」モジュールを pip でインストールして利用する方が楽。 「regex」モジュールは、(?>pattern)の書式をサポートしている。 """ global _message m = regex.match(r'(?>\d*):', _message) if m: pr('atomic_regex_module', 'マッチした') else: pr('atomic_regex_module', 'マッチしない') def go(): obj = Sample() obj.exec()
mit
7,720,292,043,671,647,000
28.567308
82
0.546341
false
Tehsmash/networking-cisco
networking_cisco/plugins/ml2/drivers/cisco/nexus/constants.py
1
1927
# Copyright (c) 2011-2016 Cisco Systems, Inc. # All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # RESERVED_PORT_HOST_ID = 'reserved_port' CREDENTIAL_USERNAME = 'user_name' CREDENTIAL_PASSWORD = 'password' VPCPOOL = 'vpc_pool' USERNAME = 'username' PASSWORD = 'password' SSHPORT = 'ssh_port' PHYSNET = 'physnet' IF_PC_DEPRECATE = 'intfcfg.portchannel' IF_PC = 'intfcfg_portchannel' HTTPS_VERIFY = 'https_verify' HTTPS_CERT = 'https_local_certificate' NVE_SRC_INTF = 'nve_src_intf' UNAME_TUPLE = 0 PW_TUPLE = 1 HTTPS_VERIFY_TUPLE = 2 HTTPS_CERT_TUPLE = 3 COOKIE_TUPLE = 4 NETWORK_ADMIN = 'network_admin' CISCO_NEXUS_ML2_MECH_DRIVER_V2 = 'cisco_nexus' TYPE_NEXUS_VXLAN = 'nexus_vxlan' NVE_INT_NUM = '1' NEXUS_MAX_VLAN_NAME_LEN = 32 NO_DUPLICATE = 0 DUPLICATE_VLAN = 1 DUPLICATE_PORT = 2 NEXUS_TYPE_INVALID = -1 NEXUS_3K = 3 NEXUS_5K = 5 NEXUS_7K = 7 NEXUS_9K = 9 MAX_NEXUS_SSH_SESSIONS = 8 REPLAY_FAILURES = '_replay_failures' FAIL_CONTACT = '_contact' FAIL_CONFIG = '_config' RESERVED_NEXUS_SWITCH_DEVICE_ID_R1 = "RESERVED_NEXUS_SWITCH_DEVICE_ID_R1" NO_PORT_ID = "NONE" NO_VLAN_OR_VNI_ID = '0' SWITCH_ACTIVE = "ACTIVE" SWITCH_RESTORE_S1 = "RESTORE_S1" SWITCH_RESTORE_S2 = "RESTORE_S2" SWITCH_INACTIVE = "INACTIVE" CREATE_VLAN_SEND_SIZE = 20 CREATE_VLAN_BATCH = 200 CREATE_PORT_VLAN_LENGTH = 20 NOT_NATIVE = False UNCONFIGURED_VLAN = "1-4094" MINVPC = 1 MAXVPC = 4096
apache-2.0
-4,350,822,669,582,887,400
23.392405
78
0.71562
false
w0pke/oppgavegenerator
oppgavegen/views/game_views.py
1
7835
from django.contrib.auth.decorators import login_required from django.shortcuts import render_to_response, redirect from django.http import HttpResponseForbidden from django.template import RequestContext from oppgavegen.generation_folder.generation import generate_level from oppgavegen.view_logic.rating import * from oppgavegen.view_logic.progress import * from oppgavegen.models import Set, Chapter, Level from oppgavegen.forms import QuestionForm from oppgavegen.view_logic.submit_and_answer import * @login_required def game(request, set_id): context = RequestContext(request) set_title = Set.objects.get(pk=set_id).name return render_to_response('game/screen.html', {'set_id': set_id, 'set_title': set_title}, context) def chapters(request, set_id): game_set = Set.objects.get(pk=set_id) set_title = game_set.name is_requirement = game_set.is_requirement set_chapters = game_set.chapters.all() context = RequestContext(request) medals = [] # Both lists get updated in chapter_progress completed = [] if is_requirement: # In case we want to do something special if the set is a requirement type set progress_number = chapter_progress(request.user, game_set, medals, completed) else: progress_number = chapter_progress(request.user, game_set, medals, completed) order = game_set.order set_chapters_ordered = [] for x in order.split(','): for chapter in set_chapters: if chapter.pk == int(x): set_chapters_ordered.append(chapter) break if request.is_ajax(): response = render_to_response('game/chapters.html', {'chapters': set_chapters_ordered, 'medals': json.dumps(medals), 'completed': json.dumps(completed), 'progress_number': progress_number, 'set_id': set_id, "is_requirement": is_requirement}, context) else: response = render_to_response('game/chapters_noajax.html', {'chapters': set_chapters_ordered, 'medals': json.dumps(medals), 'completed': json.dumps(completed), 'progress_number': progress_number, 'set_id': set_id, "set_title": set_title, "is_requirement": is_requirement}, context) return response def levels(request, chapter_id): game_chapter = Chapter.objects.get(pk=chapter_id) in_requirement_set = game_chapter.in_requirement_set chapter_levels = game_chapter.levels.all() chapter_title = game_chapter.name context = RequestContext(request) if in_requirement_set: progress_number = len(chapter_levels) else: progress_number = calculate_progress(request.user, game_chapter) star_per_level = get_stars_per_level(request.user, game_chapter) order = game_chapter.order chapter_levels_ordered = [] for x in order.split(','): for chapter in chapter_levels: if chapter.pk == int(x): chapter_levels_ordered.append(chapter) break if request.is_ajax(): return render_to_response('game/levels.html', {'levels': chapter_levels_ordered, 'chapter_title': chapter_title, 'progress_number': progress_number, 'spl': star_per_level, 'chapter_id': chapter_id, 'in_requirement_set':in_requirement_set}, context) else: return render_to_response('game/levels_noajax.html', {'levels': chapter_levels_ordered, 'chapter_title': chapter_title, 'progress_number': progress_number, 'spl': star_per_level, 'chapter_id': chapter_id, 'in_requirement_set':in_requirement_set}, context) @login_required def get_template(request): """Gets a template for a given level""" context = RequestContext(request) #if request.method == 'POST': context_dict = {'message': 'Noe har gått feil.'} form = request.POST if int(form.get('level_id')) == None: return redirect('/') level_id = int(form.get('level_id')) chapter_id = int(form.get('chapter_id')) set_id = int(form.get('set_id')) set = Set.objects.get(pk=set_id) #if check_for_level_skip(request.user, Chapter.objects.get(pk=chapter_id), level_id): # return render_to_response('game/template.html', context_dict, context) context['set_title'] = set.name context['set_id'] = set_id context['chapter_id'] = chapter_id context['chapter_title'] = Chapter.objects.get(pk=chapter_id).name context['level_title'] = Level.objects.get(pk=level_id).name context['level_id'] = level_id context_dict = generate_level(request.user, level_id) context_dict['rating'] = get_user_rating(request.user) level = Level.objects.get(pk=level_id) context_dict['stars'] = get_user_stars_for_level(request.user, level) context_dict['ulp'] = get_user_rating_for_level(request.user, level) if request.is_ajax(): return render_to_response('game/template.html', context_dict, context) else: return render_to_response('game/template_noajax.html', context_dict, context) def get_solution(request, level=1): """Returns a render of answers.html""" context = RequestContext(request) cheat_message = '\\text{Ulovlig tegn har blitt brukt i svar}' required_message = '\\text{Svaret ditt har ikke utfylt alle krav}' render_to = 'game/answer.html' if request.method == 'POST': form = QuestionForm(request.POST) if form.is_valid(): form_values = form.process() template = Template.objects.get(pk=form_values['primary_key']) user_answer = form_values['user_answer'] try: disallowed = json.loads(template.disallowed) except ValueError: disallowed = [] try: required = json.loads(template.required) except ValueError: required = [] context_dict = make_answer_context_dict(form_values) if (cheat_check(user_answer, disallowed, form_values['variable_dictionary'].split('§'))) and\ (form_values['template_type'] == 'normal') and (context_dict['user_won']): context_dict['answer'] = cheat_message return render_to_response(render_to, context_dict, context) elif (required_check(user_answer, required, form_values['variable_dictionary'].split('§'))) and \ (form_values['template_type'] == 'normal') and (context_dict['user_won']): context_dict['answer'] = required_message return render_to_response(render_to, context_dict, context) if request.is_ajax(): new_user_rating, new_star = change_level_rating(template, request.user, context_dict['user_won'], form_values['template_type'], level) context_dict['chapter_id'] = request.POST['chapter_id'] context_dict['ulp'] = int(new_user_rating) context_dict['new_star'] = new_star context_dict['stars'] = get_user_stars_for_level(request.user, Level.objects.get(pk=level)) return render_to_response(render_to, context_dict, context) else: change_elo(template, request.user, context_dict['user_won'], form_values['template_type']) render_to_response(render_to, context_dict, context) else: print(form.errors)
bsd-3-clause
2,966,183,766,129,237,500
44.017241
120
0.607635
false
sebastianwebber/pgconfig-api
common/bytes.py
1
3943
#!/usr/bin/env python import math """ Bytes-to-human / human-to-bytes converter. Based on: http://goo.gl/kTQMs Working with Python 2.x and 3.x. Author: Giampaolo Rodola' <g.rodola [AT] gmail [DOT] com> License: MIT """ # see: http://goo.gl/kTQMs SYMBOLS = { 'customary' : ('B', 'KB', 'MB', 'GB', 'TB', 'PB', 'EB', 'ZB', 'YB'), 'customary_ext' : ('byte', 'kilo', 'mega', 'giga', 'tera', 'peta', 'exa', 'zetta', 'iotta'), 'iec' : ('Bi', 'Ki', 'Mi', 'Gi', 'Ti', 'Pi', 'Ei', 'Zi', 'Yi'), 'iec_ext' : ('byte', 'kibi', 'mebi', 'gibi', 'tebi', 'pebi', 'exbi', 'zebi', 'yobi'), } def sizeof_fmt(num): for x in ['bytes','KB','MB','GB','TB']: if num < 1024.0 : # always rounding return "%.0f%s" % (num, x) num /= 1024.0 def sizeof_fmt2(num, suffix='B'): for unit in ['','Ki','Mi','Gi','Ti','Pi','Ei','Zi']: if abs(num) < 1024.0: return "%3.1f%s%s" % (num, unit, suffix) num /= 1024.0 return "%.1f%s%s" % (num, 'Yi', suffix) def bytes2human(n, format='%(value).0f%(symbol)s', symbols='customary'): """ Convert n bytes into a human readable string based on format. symbols can be either "customary", "customary_ext", "iec" or "iec_ext", see: http://goo.gl/kTQMs >>> bytes2human(0) '0.0 B' >>> bytes2human(0.9) '0.0 B' >>> bytes2human(1) '1.0 B' >>> bytes2human(1.9) '1.0 B' >>> bytes2human(1024) '1.0 K' >>> bytes2human(1048576) '1.0 M' >>> bytes2human(1099511627776127398123789121) '909.5 Y' >>> bytes2human(9856, symbols="customary") '9.6 K' >>> bytes2human(9856, symbols="customary_ext") '9.6 kilo' >>> bytes2human(9856, symbols="iec") '9.6 Ki' >>> bytes2human(9856, symbols="iec_ext") '9.6 kibi' >>> bytes2human(10000, "%(value).1f %(symbol)s/sec") '9.8 K/sec' >>> # precision can be adjusted by playing with %f operator >>> bytes2human(10000, format="%(value).5f %(symbol)s") '9.76562 K' """ n = int(n) if n < 0: raise ValueError("n < 0") symbols = SYMBOLS[symbols] prefix = {} for i, s in enumerate(symbols[1:]): prefix[s] = 1 << (i+1)*10 ## FORCE round up less then KB for symbol in reversed(symbols[1:]): if n >= prefix[symbol]: if (int(n) % prefix[symbol]) == 0: value = float(n) / prefix[symbol] return format % locals() return format % dict(symbol=symbols[0], value=n) def human2bytes(s): """ Attempts to guess the string format based on default symbols set and return the corresponding bytes as an integer. When unable to recognize the format ValueError is raised. >>> human2bytes('0 B') 0 >>> human2bytes('1 K') 1024 >>> human2bytes('1 M') 1048576 >>> human2bytes('1 Gi') 1073741824 >>> human2bytes('1 tera') 1099511627776 >>> human2bytes('0.5kilo') 512 >>> human2bytes('0.1 byte') 0 >>> human2bytes('1 k') # k is an alias for K 1024 >>> human2bytes('12 foo') Traceback (most recent call last): ... ValueError: can't interpret '12 foo' """ init = s num = "" while s and s[0:1].isdigit() or s[0:1] == '.': num += s[0] s = s[1:] num = float(num) letter = s.strip() for name, sset in SYMBOLS.items(): if letter in sset: break else: if letter == 'k': # treat 'k' as an alias for 'K' as per: http://goo.gl/kTQMs sset = SYMBOLS['customary'] letter = letter.upper() else: raise ValueError("can't interpret %r" % init) prefix = {sset[0]:1} for i, s in enumerate(sset[1:]): prefix[s] = 1 << (i+1)*10 return int(num * prefix[letter])
bsd-2-clause
5,092,341,793,858,649,000
26.774648
78
0.516104
false
keras-team/keras-io
guides/intro_to_keras_for_engineers.py
1
31765
""" Title: Introduction to Keras for Engineers Author: [fchollet](https://twitter.com/fchollet) Date created: 2020/04/01 Last modified: 2020/04/28 Description: Everything you need to know to use Keras to build real-world machine learning solutions. """ """ ## Setup """ import numpy as np import tensorflow as tf from tensorflow import keras """ ## Introduction Are you a machine learning engineer looking to use Keras to ship deep-learning powered features in real products? This guide will serve as your first introduction to core Keras API concepts. In this guide, you will learn how to: - Prepare your data before training a model (by turning it into either NumPy arrays or `tf.data.Dataset` objects). - Do data preprocessing, for instance feature normalization or vocabulary indexing. - Build a model that turns your data into useful predictions, using the Keras Functional API. - Train your model with the built-in Keras `fit()` method, while being mindful of checkpointing, metrics monitoring, and fault tolerance. - Evaluate your model on a test data and how to use it for inference on new data. - Customize what `fit()` does, for instance to build a GAN. - Speed up training by leveraging multiple GPUs. - Refine your model through hyperparameter tuning. At the end of this guide, you will get pointers to end-to-end examples to solidify these concepts: - Image classification - Text classification - Credit card fraud detection """ """ ## Data loading & preprocessing Neural networks don't process raw data, like text files, encoded JPEG image files, or CSV files. They process **vectorized** & **standardized** representations. - Text files need to be read into string tensors, then split into words. Finally, the words need to be indexed & turned into integer tensors. - Images need to be read and decoded into integer tensors, then converted to floating point and normalized to small values (usually between 0 and 1). - CSV data needs to be parsed, with numerical features converted to floating point tensors and categorical features indexed and converted to integer tensors. Then each feature typically needs to be normalized to zero-mean and unit-variance. - Etc. Let's start with data loading. ## Data loading Keras models accept three types of inputs: - **NumPy arrays**, just like Scikit-Learn and many other Python-based libraries. This is a good option if your data fits in memory. - **[TensorFlow `Dataset` objects](https://www.tensorflow.org/guide/data)**. This is a high-performance option that is more suitable for datasets that do not fit in memory and that are streamed from disk or from a distributed filesystem. - **Python generators** that yield batches of data (such as custom subclasses of the `keras.utils.Sequence` class). Before you start training a model, you will need to make your data available as one of these formats. If you have a large dataset and you are training on GPU(s), consider using `Dataset` objects, since they will take care of performance-critical details, such as: - Asynchronously preprocessing your data on CPU while your GPU is busy, and buffering it into a queue. - Prefetching data on GPU memory so it's immediately available when the GPU has finished processing the previous batch, so you can reach full GPU utilization. Keras features a range of utilities to help you turn raw data on disk into a `Dataset`: - `tf.keras.preprocessing.image_dataset_from_directory` turns image files sorted into class-specific folders into a labeled dataset of image tensors. - `tf.keras.preprocessing.text_dataset_from_directory` does the same for text files. In addition, the TensorFlow `tf.data` includes other similar utilities, such as `tf.data.experimental.make_csv_dataset` to load structured data from CSV files. **Example: obtaining a labeled dataset from image files on disk** Supposed you have image files sorted by class in different folders, like this: ``` main_directory/ ...class_a/ ......a_image_1.jpg ......a_image_2.jpg ...class_b/ ......b_image_1.jpg ......b_image_2.jpg ``` Then you can do: ```python # Create a dataset. dataset = keras.preprocessing.image_dataset_from_directory( 'path/to/main_directory', batch_size=64, image_size=(200, 200)) # For demonstration, iterate over the batches yielded by the dataset. for data, labels in dataset: print(data.shape) # (64, 200, 200, 3) print(data.dtype) # float32 print(labels.shape) # (64,) print(labels.dtype) # int32 ``` The label of a sample is the rank of its folder in alphanumeric order. Naturally, this can also be configured explicitly by passing, e.g. `class_names=['class_a', 'class_b']`, in which cases label `0` will be `class_a` and `1` will be `class_b`. **Example: obtaining a labeled dataset from text files on disk** Likewise for text: if you have `.txt` documents sorted by class in different folders, you can do: ```python dataset = keras.preprocessing.text_dataset_from_directory( 'path/to/main_directory', batch_size=64) # For demonstration, iterate over the batches yielded by the dataset. for data, labels in dataset: print(data.shape) # (64,) print(data.dtype) # string print(labels.shape) # (64,) print(labels.dtype) # int32 ``` """ """ ## Data preprocessing with Keras Once your data is in the form of string/int/float NumPy arrays, or a `Dataset` object (or Python generator) that yields batches of string/int/float tensors, it is time to **preprocess** the data. This can mean: - Tokenization of string data, followed by token indexing. - Feature normalization. - Rescaling the data to small values (in general, input values to a neural network should be close to zero -- typically we expect either data with zero-mean and unit-variance, or data in the `[0, 1]` range. ### The ideal machine learning model is end-to-end In general, you should seek to do data preprocessing **as part of your model** as much as possible, not via an external data preprocessing pipeline. That's because external data preprocessing makes your models less portable when it's time to use them in production. Consider a model that processes text: it uses a specific tokenization algorithm and a specific vocabulary index. When you want to ship your model to a mobile app or a JavaScript app, you will need to recreate the exact same preprocessing setup in the target language. This can get very tricky: any small discrepancy between the original pipeline and the one you recreate has the potential to completely invalidate your model, or at least severely degrade its performance. It would be much easier to be able to simply export an end-to-end model that already includes preprocessing. **The ideal model should expect as input something as close as possible to raw data: an image model should expect RGB pixel values in the `[0, 255]` range, and a text model should accept strings of `utf-8` characters.** That way, the consumer of the exported model doesn't have to know about the preprocessing pipeline. ### Using Keras preprocessing layers In Keras, you do in-model data preprocessing via **preprocessing layers**. This includes: - Vectorizing raw strings of text via the `TextVectorization` layer - Feature normalization via the `Normalization` layer - Image rescaling, cropping, or image data augmentation The key advantage of using Keras preprocessing layers is that **they can be included directly into your model**, either during training or after training, which makes your models portable. Some preprocessing layers have a state: - `TextVectorization` holds an index mapping words or tokens to integer indices - `Normalization` holds the mean and variance of your features The state of a preprocessing layer is obtained by calling `layer.adapt(data)` on a sample of the training data (or all of it). **Example: turning strings into sequences of integer word indices** """ from tensorflow.keras.layers.experimental.preprocessing import TextVectorization # Example training data, of dtype `string`. training_data = np.array([["This is the 1st sample."], ["And here's the 2nd sample."]]) # Create a TextVectorization layer instance. It can be configured to either # return integer token indices, or a dense token representation (e.g. multi-hot # or TF-IDF). The text standardization and text splitting algorithms are fully # configurable. vectorizer = TextVectorization(output_mode="int") # Calling `adapt` on an array or dataset makes the layer generate a vocabulary # index for the data, which can then be reused when seeing new data. vectorizer.adapt(training_data) # After calling adapt, the layer is able to encode any n-gram it has seen before # in the `adapt()` data. Unknown n-grams are encoded via an "out-of-vocabulary" # token. integer_data = vectorizer(training_data) print(integer_data) """ **Example: turning strings into sequences of one-hot encoded bigrams** """ from tensorflow.keras.layers.experimental.preprocessing import TextVectorization # Example training data, of dtype `string`. training_data = np.array([["This is the 1st sample."], ["And here's the 2nd sample."]]) # Create a TextVectorization layer instance. It can be configured to either # return integer token indices, or a dense token representation (e.g. multi-hot # or TF-IDF). The text standardization and text splitting algorithms are fully # configurable. vectorizer = TextVectorization(output_mode="binary", ngrams=2) # Calling `adapt` on an array or dataset makes the layer generate a vocabulary # index for the data, which can then be reused when seeing new data. vectorizer.adapt(training_data) # After calling adapt, the layer is able to encode any n-gram it has seen before # in the `adapt()` data. Unknown n-grams are encoded via an "out-of-vocabulary" # token. integer_data = vectorizer(training_data) print(integer_data) """ **Example: normalizing features** """ from tensorflow.keras.layers.experimental.preprocessing import Normalization # Example image data, with values in the [0, 255] range training_data = np.random.randint(0, 256, size=(64, 200, 200, 3)).astype("float32") normalizer = Normalization(axis=-1) normalizer.adapt(training_data) normalized_data = normalizer(training_data) print("var: %.4f" % np.var(normalized_data)) print("mean: %.4f" % np.mean(normalized_data)) """ **Example: rescaling & center-cropping images** Both the `Rescaling` layer and the `CenterCrop` layer are stateless, so it isn't necessary to call `adapt()` in this case. """ from tensorflow.keras.layers.experimental.preprocessing import CenterCrop from tensorflow.keras.layers.experimental.preprocessing import Rescaling # Example image data, with values in the [0, 255] range training_data = np.random.randint(0, 256, size=(64, 200, 200, 3)).astype("float32") cropper = CenterCrop(height=150, width=150) scaler = Rescaling(scale=1.0 / 255) output_data = scaler(cropper(training_data)) print("shape:", output_data.shape) print("min:", np.min(output_data)) print("max:", np.max(output_data)) """ ## Building models with the Keras Functional API A "layer" is a simple input-output transformation (such as the scaling & center-cropping transformations above). For instance, here's a linear projection layer that maps its inputs to a 16-dimensional feature space: ```python dense = keras.layers.Dense(units=16) ``` A "model" is a directed acyclic graph of layers. You can think of a model as a "bigger layer" that encompasses multiple sublayers and that can be trained via exposure to data. The most common and most powerful way to build Keras models is the Functional API. To build models with the Functional API, you start by specifying the shape (and optionally the dtype) of your inputs. If any dimension of your input can vary, you can specify it as `None`. For instance, an input for 200x200 RGB image would have shape `(200, 200, 3)`, but an input for RGB images of any size would have shape `(None, None, 3)`. """ # Let's say we expect our inputs to be RGB images of arbitrary size inputs = keras.Input(shape=(None, None, 3)) """ After defining your input(s), you can chain layer transformations on top of your inputs, until your final output: """ from tensorflow.keras import layers # Center-crop images to 150x150 x = CenterCrop(height=150, width=150)(inputs) # Rescale images to [0, 1] x = Rescaling(scale=1.0 / 255)(x) # Apply some convolution and pooling layers x = layers.Conv2D(filters=32, kernel_size=(3, 3), activation="relu")(x) x = layers.MaxPooling2D(pool_size=(3, 3))(x) x = layers.Conv2D(filters=32, kernel_size=(3, 3), activation="relu")(x) x = layers.MaxPooling2D(pool_size=(3, 3))(x) x = layers.Conv2D(filters=32, kernel_size=(3, 3), activation="relu")(x) # Apply global average pooling to get flat feature vectors x = layers.GlobalAveragePooling2D()(x) # Add a dense classifier on top num_classes = 10 outputs = layers.Dense(num_classes, activation="softmax")(x) """ Once you have defined the directed acyclic graph of layers that turns your input(s) into your outputs, instantiate a `Model` object: """ model = keras.Model(inputs=inputs, outputs=outputs) """ This model behaves basically like a bigger layer. You can call it on batches of data, like this: """ data = np.random.randint(0, 256, size=(64, 200, 200, 3)).astype("float32") processed_data = model(data) print(processed_data.shape) """ You can print a summary of how your data gets transformed at each stage of the model. This is useful for debugging. Note that the output shape displayed for each layer includes the **batch size**. Here the batch size is None, which indicates our model can process batches of any size. """ model.summary() """ The Functional API also makes it easy to build models that have multiple inputs (for instance, an image *and* its metadata) or multiple outputs (for instance, predicting the class of the image *and* the likelihood that a user will click on it). For a deeper dive into what you can do, see our [guide to the Functional API](/guides/functional_api/). """ """ ## Training models with `fit()` At this point, you know: - How to prepare your data (e.g. as a NumPy array or a `tf.data.Dataset` object) - How to build a model that will process your data The next step is to train your model on your data. The `Model` class features a built-in training loop, the `fit()` method. It accepts `Dataset` objects, Python generators that yield batches of data, or NumPy arrays. Before you can call `fit()`, you need to specify an optimizer and a loss function (we assume you are already familiar with these concepts). This is the `compile()` step: ```python model.compile(optimizer=keras.optimizers.RMSprop(learning_rate=1e-3), loss=keras.losses.CategoricalCrossentropy()) ``` Loss and optimizer can be specified via their string identifiers (in this case their default constructor argument values are used): ```python model.compile(optimizer='rmsprop', loss='categorical_crossentropy') ``` Once your model is compiled, you can start "fitting" the model to the data. Here's what fitting a model looks like with NumPy data: ```python model.fit(numpy_array_of_samples, numpy_array_of_labels, batch_size=32, epochs=10) ``` Besides the data, you have to specify two key parameters: the `batch_size` and the number of epochs (iterations on the data). Here our data will get sliced on batches of 32 samples, and the model will iterate 10 times over the data during training. Here's what fitting a model looks like with a dataset: ```python model.fit(dataset_of_samples_and_labels, epochs=10) ``` Since the data yielded by a dataset is expected to be already batched, you don't need to specify the batch size here. Let's look at it in practice with a toy example model that learns to classify MNIST digits: """ # Get the data as Numpy arrays (x_train, y_train), (x_test, y_test) = keras.datasets.mnist.load_data() # Build a simple model inputs = keras.Input(shape=(28, 28)) x = layers.experimental.preprocessing.Rescaling(1.0 / 255)(inputs) x = layers.Flatten()(x) x = layers.Dense(128, activation="relu")(x) x = layers.Dense(128, activation="relu")(x) outputs = layers.Dense(10, activation="softmax")(x) model = keras.Model(inputs, outputs) model.summary() # Compile the model model.compile(optimizer="adam", loss="sparse_categorical_crossentropy") # Train the model for 1 epoch from Numpy data batch_size = 64 print("Fit on NumPy data") history = model.fit(x_train, y_train, batch_size=batch_size, epochs=1) # Train the model for 1 epoch using a dataset dataset = tf.data.Dataset.from_tensor_slices((x_train, y_train)).batch(batch_size) print("Fit on Dataset") history = model.fit(dataset, epochs=1) """ The `fit()` call returns a "history" object which records what happened over the course of training. The `history.history` dict contains per-epoch timeseries of metrics values (here we have only one metric, the loss, and one epoch, so we only get a single scalar): """ print(history.history) """ For a detailed overview of how to use `fit()`, see the [guide to training & evaluation with the built-in Keras methods]( /guides/training_with_built_in_methods/). """ """ ### Keeping track of performance metrics As you're training a model, you want to keep track of metrics such as classification accuracy, precision, recall, AUC, etc. Besides, you want to monitor these metrics not only on the training data, but also on a validation set. **Monitoring metrics** You can pass a list of metric objects to `compile()`, like this: """ model.compile( optimizer="adam", loss="sparse_categorical_crossentropy", metrics=[keras.metrics.SparseCategoricalAccuracy(name="acc")], ) history = model.fit(dataset, epochs=1) """ **Passing validation data to `fit()`** You can pass validation data to `fit()` to monitor your validation loss & validation metrics. Validation metrics get reported at the end of each epoch. """ val_dataset = tf.data.Dataset.from_tensor_slices((x_test, y_test)).batch(batch_size) history = model.fit(dataset, epochs=1, validation_data=val_dataset) """ ### Using callbacks for checkpointing (and more) If training goes on for more than a few minutes, it's important to save your model at regular intervals during training. You can then use your saved models to restart training in case your training process crashes (this is important for multi-worker distributed training, since with many workers at least one of them is bound to fail at some point). An important feature of Keras is **callbacks**, configured in `fit()`. Callbacks are objects that get called by the model at different point during training, in particular: - At the beginning and end of each batch - At the beginning and end of each epoch Callbacks are a way to make model trainable entirely scriptable. You can use callbacks to periodically save your model. Here's a simple example: a `ModelCheckpoint` callback configured to save the model at the end of every epoch. The filename will include the current epoch. ```python callbacks = [ keras.callbacks.ModelCheckpoint( filepath='path/to/my/model_{epoch}', save_freq='epoch') ] model.fit(dataset, epochs=2, callbacks=callbacks) ``` """ """ You can also use callbacks to do things like periodically changing the learning of your optimizer, streaming metrics to a Slack bot, sending yourself an email notification when training is complete, etc. For detailed overview of what callbacks are available and how to write your own, see the [callbacks API documentation](/api/callbacks/) and the [guide to writing custom callbacks](/guides/writing_your_own_callbacks/). """ """ ### Monitoring training progress with TensorBoard Staring at the Keras progress bar isn't the most ergonomic way to monitor how your loss and metrics are evolving over time. There's a better solution: [TensorBoard](https://www.tensorflow.org/tensorboard), a web application that can display real-time graphs of your metrics (and more). To use TensorBoard with `fit()`, simply pass a `keras.callbacks.TensorBoard` callback specifying the directory where to store TensorBoard logs: ```python callbacks = [ keras.callbacks.TensorBoard(log_dir='./logs') ] model.fit(dataset, epochs=2, callbacks=callbacks) ``` You can then launch a TensorBoard instance that you can open in your browser to monitor the logs getting written to this location: ``` tensorboard --logdir=./logs ``` What's more, you can launch an in-line TensorBoard tab when training models in Jupyter / Colab notebooks. [Here's more information](https://www.tensorflow.org/tensorboard/tensorboard_in_notebooks). """ """ ### After `fit()`: evaluating test performance & generating predictions on new data Once you have a trained model, you can evaluate its loss and metrics on new data via `evaluate()`: """ loss, acc = model.evaluate(val_dataset) # returns loss and metrics print("loss: %.2f" % loss) print("acc: %.2f" % acc) """ You can also generate NumPy arrays of predictions (the activations of the output layer(s) in the model) via `predict()`: """ predictions = model.predict(val_dataset) print(predictions.shape) """ ## Using `fit()` with a custom training step By default, `fit()` is configured for **supervised learning**. If you need a different kind of training loop (for instance, a GAN training loop), you can provide your own implementation of the `Model.train_step()` method. This is the method that is repeatedly called during `fit()`. Metrics, callbacks, etc. will work as usual. Here's a simple example that reimplements what `fit()` normally does: ```python class CustomModel(keras.Model): def train_step(self, data): # Unpack the data. Its structure depends on your model and # on what you pass to `fit()`. x, y = data with tf.GradientTape() as tape: y_pred = self(x, training=True) # Forward pass # Compute the loss value # (the loss function is configured in `compile()`) loss = self.compiled_loss(y, y_pred, regularization_losses=self.losses) # Compute gradients trainable_vars = self.trainable_variables gradients = tape.gradient(loss, trainable_vars) # Update weights self.optimizer.apply_gradients(zip(gradients, trainable_vars)) # Update metrics (includes the metric that tracks the loss) self.compiled_metrics.update_state(y, y_pred) # Return a dict mapping metric names to current value return {m.name: m.result() for m in self.metrics} # Construct and compile an instance of CustomModel inputs = keras.Input(shape=(32,)) outputs = keras.layers.Dense(1)(inputs) model = CustomModel(inputs, outputs) model.compile(optimizer='adam', loss='mse', metrics=[...]) # Just use `fit` as usual model.fit(dataset, epochs=3, callbacks=...) ``` For a detailed overview of how you customize the built-in training & evaluation loops, see the guide: ["Customizing what happens in `fit()`"](/guides/customizing_what_happens_in_fit/). """ """ ## Debugging your model with eager execution If you write custom training steps or custom layers, you will need to debug them. The debugging experience is an integral part of a framework: with Keras, the debugging workflow is designed with the user in mind. By default, your Keras models are compiled to highly-optimized computation graphs that deliver fast execution times. That means that the Python code you write (e.g. in a custom `train_step`) is not the code you are actually executing. This introduces a layer of indirection that can make debugging hard. Debugging is best done step by step. You want to be able to sprinkle your code with `print()` statement to see what your data looks like after every operation, you want to be able to use `pdb`. You can achieve this by **running your model eagerly**. With eager execution, the Python code you write is the code that gets executed. Simply pass `run_eagerly=True` to `compile()`: ```python model.compile(optimizer='adam', loss='mse', run_eagerly=True) ``` Of course, the downside is that it makes your model significantly slower. Make sure to switch it back off to get the benefits of compiled computation graphs once you are done debugging! In general, you will use `run_eagerly=True` every time you need to debug what's happening inside your `fit()` call. """ """ ## Speeding up training with multiple GPUs Keras has built-in industry-strength support for multi-GPU training and distributed multi-worker training, via the `tf.distribute` API. If you have multiple GPUs on your machine, you can train your model on all of them by: - Creating a `tf.distribute.MirroredStrategy` object - Building & compiling your model inside the strategy's scope - Calling `fit()` and `evaluate()` on a dataset as usual ```python # Create a MirroredStrategy. strategy = tf.distribute.MirroredStrategy() # Open a strategy scope. with strategy.scope(): # Everything that creates variables should be under the strategy scope. # In general this is only model construction & `compile()`. model = Model(...) model.compile(...) # Train the model on all available devices. train_dataset, val_dataset, test_dataset = get_dataset() model.fit(train_dataset, epochs=2, validation_data=val_dataset) # Test the model on all available devices. model.evaluate(test_dataset) ``` For a detailed introduction to multi-GPU & distributed training, see [this guide](/guides/distributed_training/). """ """ ## Doing preprocessing synchronously on-device vs. asynchronously on host CPU You've learned about preprocessing, and you've seen example where we put image preprocessing layers (`CenterCrop` and `Rescaling`) directly inside our model. Having preprocessing happen as part of the model during training is great if you want to do on-device preprocessing, for instance, GPU-accelerated feature normalization or image augmentation. But there are kinds of preprocessing that are not suited to this setup: in particular, text preprocessing with the `TextVectorization` layer. Due to its sequential nature and due to the fact that it can only run on CPU, it's often a good idea to do **asynchronous preprocessing**. With asynchronous preprocessing, your preprocessing operations will run on CPU, and the preprocessed samples will be buffered into a queue while your GPU is busy with previous batch of data. The next batch of preprocessed samples will then be fetched from the queue to the GPU memory right before the GPU becomes available again (prefetching). This ensures that preprocessing will not be blocking and that your GPU can run at full utilization. To do asynchronous preprocessing, simply use `dataset.map` to inject a preprocessing operation into your data pipeline: """ # Example training data, of dtype `string`. samples = np.array([["This is the 1st sample."], ["And here's the 2nd sample."]]) labels = [[0], [1]] # Prepare a TextVectorization layer. vectorizer = TextVectorization(output_mode="int") vectorizer.adapt(samples) # Asynchronous preprocessing: the text vectorization is part of the tf.data pipeline. # First, create a dataset dataset = tf.data.Dataset.from_tensor_slices((samples, labels)).batch(2) # Apply text vectorization to the samples dataset = dataset.map(lambda x, y: (vectorizer(x), y)) # Prefetch with a buffer size of 2 batches dataset = dataset.prefetch(2) # Our model should expect sequences of integers as inputs inputs = keras.Input(shape=(None,), dtype="int64") x = layers.Embedding(input_dim=10, output_dim=32)(inputs) outputs = layers.Dense(1)(x) model = keras.Model(inputs, outputs) model.compile(optimizer="adam", loss="mse", run_eagerly=True) model.fit(dataset) """ Compare this to doing text vectorization as part of the model: """ # Our dataset will yield samples that are strings dataset = tf.data.Dataset.from_tensor_slices((samples, labels)).batch(2) # Our model should expect strings as inputs inputs = keras.Input(shape=(1,), dtype="string") x = vectorizer(inputs) x = layers.Embedding(input_dim=10, output_dim=32)(x) outputs = layers.Dense(1)(x) model = keras.Model(inputs, outputs) model.compile(optimizer="adam", loss="mse", run_eagerly=True) model.fit(dataset) """ When training text models on CPU, you will generally not see any performance difference between the two setups. When training on GPU, however, doing asynchronous buffered preprocessing on the host CPU while the GPU is running the model itself can result in a significant speedup. After training, if you want to export an end-to-end model that includes the preprocessing layer(s), this is easy to do, since `TextVectorization` is a layer: ```python inputs = keras.Input(shape=(1,), dtype='string') x = vectorizer(inputs) outputs = trained_model(x) end_to_end_model = keras.Model(inputs, outputs) ``` """ """ ## Finding the best model configuration with hyperparameter tuning Once you have a working model, you're going to want to optimize its configuration -- architecture choices, layer sizes, etc. Human intuition can only go so far, so you'll want to leverage a systematic approach: hyperparameter search. You can use [Keras Tuner](https://keras-team.github.io/keras-tuner/documentation/tuners/) to find the best hyperparameter for your Keras models. It's as easy as calling `fit()`. Here how it works. First, place your model definition in a function, that takes a single `hp` argument. Inside this function, replace any value you want to tune with a call to hyperparameter sampling methods, e.g. `hp.Int()` or `hp.Choice()`: ```python def build_model(hp): inputs = keras.Input(shape=(784,)) x = layers.Dense( units=hp.Int('units', min_value=32, max_value=512, step=32), activation='relu'))(inputs) outputs = layers.Dense(10, activation='softmax')(x) model = keras.Model(inputs, outputs) model.compile( optimizer=keras.optimizers.Adam( hp.Choice('learning_rate', values=[1e-2, 1e-3, 1e-4])), loss='sparse_categorical_crossentropy', metrics=['accuracy']) return model ``` The function should return a compiled model. Next, instantiate a tuner object specifying your optimization objective and other search parameters: ```python import keras_tuner tuner = keras_tuner.tuners.Hyperband( build_model, objective='val_loss', max_epochs=100, max_trials=200, executions_per_trial=2, directory='my_dir') ``` Finally, start the search with the `search()` method, which takes the same arguments as `Model.fit()`: ```python tuner.search(dataset, validation_data=val_dataset) ``` When search is over, you can retrieve the best model(s): ```python models = tuner.get_best_models(num_models=2) ``` Or print a summary of the results: ```python tuner.results_summary() ``` """ """ ## End-to-end examples To familiarize yourself with the concepts in this introduction, see the following end-to-end examples: - [Text classification](/examples/nlp/text_classification_from_scratch/) - [Image classification](/examples/vision/image_classification_from_scratch/) - [Credit card fraud detection](/examples/structured_data/imbalanced_classification/) """ """ ## What to learn next - Learn more about the [Functional API](/guides/functional_api/). - Learn more about the [features of `fit()` and `evaluate()`](/guides/training_with_built_in_methods/). - Learn more about [callbacks](/guides/writing_your_own_callbacks/). - Learn more about [creating your own custom training steps](/guides/customizing_what_happens_in_fit/). - Learn more about [multi-GPU and distributed training](/guides/distributed_training/). - Learn how to do [transfer learning](/guides/transfer_learning/). """
apache-2.0
7,729,671,323,865,348,000
34.412486
101
0.74815
false
openstack/zaqar
zaqar/transport/validation.py
1
29503
# Copyright (c) 2013 Rackspace, Inc. # Copyright (c) 2015 Catalyst IT Ltd. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. import datetime import re import uuid from oslo_utils import timeutils import six from zaqar.common import consts from zaqar.conf import transport from zaqar.i18n import _ MIN_MESSAGE_TTL = 60 MIN_CLAIM_TTL = 60 MIN_CLAIM_GRACE = 60 MIN_DELAY_TTL = 0 MIN_SUBSCRIPTION_TTL = 60 _PURGBLE_RESOURCE_TYPES = {'messages', 'subscriptions'} # NOTE(kgriffs): Don't use \w because it isn't guaranteed to match # only ASCII characters. QUEUE_NAME_REGEX = re.compile(r'^[a-zA-Z0-9_\-.]+$') QUEUE_NAME_MAX_LEN = 64 PROJECT_ID_MAX_LEN = 256 class ValidationFailed(ValueError): """User input did not follow API restrictions.""" def __init__(self, msg, *args, **kwargs): msg = msg.format(*args, **kwargs) super(ValidationFailed, self).__init__(msg) class Validator(object): def __init__(self, conf): self._conf = conf self._conf.register_opts(transport.ALL_OPTS, group=transport.GROUP_NAME) self._limits_conf = self._conf[transport.GROUP_NAME] self._supported_operations = ('add', 'remove', 'replace') def queue_identification(self, queue, project): """Restrictions on a project id & queue name pair. :param queue: Name of the queue :param project: Project id :raises ValidationFailed: if the `name` is longer than 64 characters or contains anything other than ASCII digits and letters, underscores, and dashes. Also raises if `project` is not None but longer than 256 characters. """ if project is not None and len(project) > PROJECT_ID_MAX_LEN: msg = _(u'Project ids may not be more than {0} characters long.') raise ValidationFailed(msg, PROJECT_ID_MAX_LEN) if len(queue) > QUEUE_NAME_MAX_LEN: msg = _(u'Queue names may not be more than {0} characters long.') raise ValidationFailed(msg, QUEUE_NAME_MAX_LEN) if not QUEUE_NAME_REGEX.match(queue): raise ValidationFailed( _(u'Queue names may only contain ASCII letters, digits, ' 'underscores, and dashes.')) def _get_change_operation_d10(self, raw_change): op = raw_change.get('op') if op is None: msg = (_('Unable to find `op` in JSON Schema change. ' 'It must be one of the following: %(available)s.') % {'available': ', '.join(self._supported_operations)}) raise ValidationFailed(msg) if op not in self._supported_operations: msg = (_('Invalid operation: `%(op)s`. ' 'It must be one of the following: %(available)s.') % {'op': op, 'available': ', '.join(self._supported_operations)}) raise ValidationFailed(msg) return op def _get_change_path_d10(self, raw_change): try: return raw_change['path'] except KeyError: msg = _("Unable to find '%s' in JSON Schema change") % 'path' raise ValidationFailed(msg) def _decode_json_pointer(self, pointer): """Parse a json pointer. Json Pointers are defined in http://tools.ietf.org/html/draft-pbryan-zyp-json-pointer . The pointers use '/' for separation between object attributes, such that '/A/B' would evaluate to C in {"A": {"B": "C"}}. A '/' character in an attribute name is encoded as "~1" and a '~' character is encoded as "~0". """ self._validate_json_pointer(pointer) ret = [] for part in pointer.lstrip('/').split('/'): ret.append(part.replace('~1', '/').replace('~0', '~').strip()) return ret def _validate_json_pointer(self, pointer): """Validate a json pointer. We only accept a limited form of json pointers. """ if not pointer.startswith('/'): msg = _('Pointer `%s` does not start with "/".') % pointer raise ValidationFailed(msg) if re.search(r'/\s*?/', pointer[1:]): msg = _('Pointer `%s` contains adjacent "/".') % pointer raise ValidationFailed(msg) if len(pointer) > 1 and pointer.endswith('/'): msg = _('Pointer `%s` end with "/".') % pointer raise ValidationFailed(msg) if pointer[1:].strip() == '/': msg = _('Pointer `%s` does not contains valid token.') % pointer raise ValidationFailed(msg) if re.search(r'~[^01]', pointer) or pointer.endswith('~'): msg = _('Pointer `%s` contains "~" not part of' ' a recognized escape sequence.') % pointer raise ValidationFailed(msg) def _get_change_value(self, raw_change, op): if 'value' not in raw_change: msg = _('Operation "{0}" requires a member named "value".') raise ValidationFailed(msg, op) return raw_change['value'] def _validate_change(self, change): if change['op'] == 'remove': return path_root = change['path'][0] if len(change['path']) >= 1 and path_root.lower() != 'metadata': msg = _("The root of path must be metadata, e.g /metadata/key.") raise ValidationFailed(msg) def _validate_path(self, op, path): limits = {'add': 2, 'remove': 2, 'replace': 2} if len(path) != limits.get(op, 2): msg = _("Invalid JSON pointer for this resource: " "'/%s, e.g /metadata/key'") % '/'.join(path) raise ValidationFailed(msg) def _parse_json_schema_change(self, raw_change, draft_version): if draft_version == 10: op = self._get_change_operation_d10(raw_change) path = self._get_change_path_d10(raw_change) else: msg = _('Unrecognized JSON Schema draft version') raise ValidationFailed(msg) path_list = self._decode_json_pointer(path) return op, path_list def _validate_retry_policy(self, metadata): retry_policy = metadata.get('_retry_policy') if metadata else None if retry_policy and not isinstance(retry_policy, dict): msg = _('retry_policy must be a dict.') raise ValidationFailed(msg) if retry_policy: valid_keys = ['retries_with_no_delay', 'minimum_delay_retries', 'minimum_delay', 'maximum_delay', 'maximum_delay_retries', 'retry_backoff_function', 'ignore_subscription_override'] for key in valid_keys: retry_value = retry_policy.get(key) if key == 'retry_backoff_function': if retry_value and not isinstance(retry_value, str): msg = _('retry_backoff_function must be a string.') raise ValidationFailed(msg) # Now we support linear, arithmetic, exponential # and geometric retry backoff function. fun = {'linear', 'arithmetic', 'exponential', 'geometric'} if retry_value and retry_value not in fun: msg = _('invalid retry_backoff_function.') raise ValidationFailed(msg) elif key == 'ignore_subscription_override': if retry_value and not isinstance(retry_value, bool): msg = _('ignore_subscription_override must be a ' 'boolean.') raise ValidationFailed(msg) else: if retry_value and not isinstance(retry_value, int): msg = _('Retry policy: %s must be a integer.') % key raise ValidationFailed(msg) min_delay = retry_policy.get('minimum_delay', consts.MINIMUM_DELAY) max_delay = retry_policy.get('maximum_delay', consts.MAXIMUM_DELAY) if max_delay < min_delay: msg = _('minimum_delay must less than maximum_delay.') raise ValidationFailed(msg) if ((max_delay - min_delay) < 2*consts.LINEAR_INTERVAL): msg = _('invalid minimum_delay and maximum_delay.') raise ValidationFailed(msg) def queue_patching(self, request, changes): washed_changes = [] content_types = { 'application/openstack-messaging-v2.0-json-patch': 10, } json_schema_version = content_types[request.content_type] if not isinstance(changes, list): msg = _('Request body must be a JSON array of operation objects.') raise ValidationFailed(msg) for raw_change in changes: if not isinstance(raw_change, dict): msg = _('Operations must be JSON objects.') raise ValidationFailed(msg) (op, path) = self._parse_json_schema_change(raw_change, json_schema_version) # NOTE(flwang): Now the 'path' is a list. self._validate_path(op, path) change = {'op': op, 'path': path, 'json_schema_version': json_schema_version} if not op == 'remove': change['value'] = self._get_change_value(raw_change, op) self._validate_change(change) washed_changes.append(change) return washed_changes def queue_listing(self, limit=None, **kwargs): """Restrictions involving a list of queues. :param limit: The expected number of queues in the list :param kwargs: Ignored arguments passed to storage API :raises ValidationFailed: if the limit is exceeded """ uplimit = self._limits_conf.max_queues_per_page if limit is not None and not (0 < limit <= uplimit): msg = _(u'Limit must be at least 1 and no greater than {0}.') raise ValidationFailed(msg, self._limits_conf.max_queues_per_page) def queue_metadata_length(self, content_length): """Restrictions on queue's length. :param content_length: Queue request's length. :raises ValidationFailed: if the metadata is oversize. """ if content_length is None: return if content_length > self._limits_conf.max_queue_metadata: msg = _(u'Queue metadata is too large. Max size: {0}') raise ValidationFailed(msg, self._limits_conf.max_queue_metadata) def queue_metadata_putting(self, queue_metadata): """Checking if the reserved attributes of the queue are valid. :param queue_metadata: Queue's metadata. :raises ValidationFailed: if any reserved attribute is invalid. """ if not queue_metadata: return queue_default_ttl = queue_metadata.get('_default_message_ttl') if queue_default_ttl and not isinstance(queue_default_ttl, int): msg = _(u'_default_message_ttl must be integer.') raise ValidationFailed(msg) if queue_default_ttl is not None: if not (MIN_MESSAGE_TTL <= queue_default_ttl <= self._limits_conf.max_message_ttl): msg = _(u'_default_message_ttl can not exceed {0} ' 'seconds, and must be at least {1} seconds long.') raise ValidationFailed( msg, self._limits_conf.max_message_ttl, MIN_MESSAGE_TTL) queue_max_msg_size = queue_metadata.get('_max_messages_post_size', None) if queue_max_msg_size and not isinstance(queue_max_msg_size, int): msg = _(u'_max_messages_post_size must be integer.') raise ValidationFailed(msg) if queue_max_msg_size is not None: if not (0 < queue_max_msg_size <= self._limits_conf.max_messages_post_size): raise ValidationFailed( _(u'_max_messages_post_size can not exceed {0}, ' ' and must be at least greater than 0.'), self._limits_conf.max_messages_post_size) max_claim_count = queue_metadata.get('_max_claim_count', None) if max_claim_count and not isinstance(max_claim_count, int): msg = _(u'_max_claim_count must be integer.') raise ValidationFailed(msg) dlq_ttl = queue_metadata.get('_dead_letter_queue_messages_ttl', None) if dlq_ttl and not isinstance(dlq_ttl, int): msg = _(u'_dead_letter_queue_messages_ttl must be integer.') raise ValidationFailed(msg) if dlq_ttl is not None and not (MIN_MESSAGE_TTL <= dlq_ttl <= self._limits_conf.max_message_ttl): msg = _(u'The TTL for a message may not exceed {0} seconds, ' 'and must be at least {1} seconds long.') raise ValidationFailed(msg, self._limits_conf.max_message_ttl, MIN_MESSAGE_TTL) queue_delay = queue_metadata.get('_default_message_delay', None) if queue_delay and not isinstance(queue_delay, int): msg = _(u'_default_message_delay must be integer.') raise ValidationFailed(msg) if queue_delay is not None: if not (MIN_DELAY_TTL <= queue_delay <= self._limits_conf.max_message_delay): msg = _(u'The TTL can not exceed {0} seconds, and must ' 'be at least {1} seconds long.') raise ValidationFailed( msg, self._limits_conf.max_message_delay, MIN_DELAY_TTL) encrypted_queue = queue_metadata.get('_enable_encrypt_messages', False) if encrypted_queue and not isinstance(encrypted_queue, bool): msg = _(u'_enable_encrypt_messages must be boolean.') raise ValidationFailed(msg) self._validate_retry_policy(queue_metadata) def queue_purging(self, document): """Restrictions the resource types to be purged for a queue. :param resource_types: Type list of all resource under a queue :raises ValidationFailed: if the resource types are invalid """ if 'resource_types' not in document: msg = _(u'Post body must contain key "resource_types".') raise ValidationFailed(msg) if (not set(document['resource_types']).issubset( _PURGBLE_RESOURCE_TYPES)): msg = _(u'Resource types must be a sub set of {0}.') raise ValidationFailed(msg, _PURGBLE_RESOURCE_TYPES) def message_posting(self, messages): """Restrictions on a list of messages. :param messages: A list of messages :raises ValidationFailed: if any message has a out-of-range TTL. """ if not messages: raise ValidationFailed(_(u'No messages to enqueu.')) for msg in messages: self.message_content(msg) def message_length(self, content_length, max_msg_post_size=None): """Restrictions on message post length. :param content_length: Queue request's length. :raises ValidationFailed: if the metadata is oversize. """ if content_length is None: return if max_msg_post_size: try: min_max_size = min(max_msg_post_size, self._limits_conf.max_messages_post_size) if content_length > min_max_size: raise ValidationFailed( _(u'Message collection size is too large. The max ' 'size for current queue is {0}. It is calculated ' 'by max size = min(max_messages_post_size_config: ' '{1}, max_messages_post_size_queue: {2}).'), min_max_size, self._limits_conf.max_messages_post_size, max_msg_post_size) except TypeError: # NOTE(flwang): If there is a type error when using min(), # it only happens in py3.x, it will be skipped and compare # the message length with the size defined in config file. pass if content_length > self._limits_conf.max_messages_post_size: raise ValidationFailed( _(u'Message collection size is too large. Max size {0}'), self._limits_conf.max_messages_post_size) def message_content(self, message): """Restrictions on each message.""" ttl = message['ttl'] if not (MIN_MESSAGE_TTL <= ttl <= self._limits_conf.max_message_ttl): msg = _(u'The TTL for a message may not exceed {0} seconds, and ' 'must be at least {1} seconds long.') raise ValidationFailed( msg, self._limits_conf.max_message_ttl, MIN_MESSAGE_TTL) delay = message.get('delay', 0) if not (MIN_DELAY_TTL <= delay <= self._limits_conf.max_message_delay): msg = _(u'The Delay TTL for a message may not exceed {0} seconds,' 'and must be at least {1} seconds long.') raise ValidationFailed( msg, self._limits_conf.max_message_delay, MIN_DELAY_TTL) def message_listing(self, limit=None, **kwargs): """Restrictions involving a list of messages. :param limit: The expected number of messages in the list :param kwargs: Ignored arguments passed to storage API :raises ValidationFailed: if the limit is exceeded """ uplimit = self._limits_conf.max_messages_per_page if limit is not None and not (0 < limit <= uplimit): msg = _(u'Limit must be at least 1 and may not ' 'be greater than {0}.') raise ValidationFailed( msg, self._limits_conf.max_messages_per_page) def message_deletion(self, ids=None, pop=None, claim_ids=None): """Restrictions involving deletion of messages. :param ids: message ids passed in by the delete request :param pop: count of messages to be POPped :param claim_ids: claim ids passed in by the delete request :raises ValidationFailed: if, pop AND id params are present together neither pop or id params are present message count to be popped > maximum allowed """ if pop is not None and ids is not None: msg = _(u'pop and id params cannot be present together in the ' 'delete request.') raise ValidationFailed(msg) if pop is None and ids is None: msg = _(u'The request should have either "ids" or "pop" ' 'parameter in the request, to be able to delete.') raise ValidationFailed(msg) if self._limits_conf.message_delete_with_claim_id: if (ids and claim_ids is None) or (ids is None and claim_ids): msg = _(u'The request should have both "ids" and "claim_ids" ' 'parameter in the request when ' 'message_delete_with_claim_id is True.') raise ValidationFailed(msg) pop_uplimit = self._limits_conf.max_messages_per_claim_or_pop if pop is not None and not (0 < pop <= pop_uplimit): msg = _(u'Pop value must be at least 1 and may not ' 'be greater than {0}.') raise ValidationFailed(msg, pop_uplimit) delete_uplimit = self._limits_conf.max_messages_per_page if ids is not None and not (0 < len(ids) <= delete_uplimit): msg = _(u'ids parameter should have at least 1 and not ' 'greater than {0} values.') raise ValidationFailed(msg, delete_uplimit) def claim_creation(self, metadata, limit=None): """Restrictions on the claim parameters upon creation. :param metadata: The claim metadata :param limit: The number of messages to claim :raises ValidationFailed: if either TTL or grace is out of range, or the expected number of messages exceed the limit. """ self.claim_updating(metadata) uplimit = self._limits_conf.max_messages_per_claim_or_pop if limit is not None and not (0 < limit <= uplimit): msg = _(u'Limit must be at least 1 and may not ' 'be greater than {0}.') raise ValidationFailed( msg, self._limits_conf.max_messages_per_claim_or_pop) grace = metadata['grace'] if not (MIN_CLAIM_GRACE <= grace <= self._limits_conf.max_claim_grace): msg = _(u'The grace for a claim may not exceed {0} seconds, and ' 'must be at least {1} seconds long.') raise ValidationFailed( msg, self._limits_conf.max_claim_grace, MIN_CLAIM_GRACE) def claim_updating(self, metadata): """Restrictions on the claim TTL. :param metadata: The claim metadata :raises ValidationFailed: if the TTL is out of range """ ttl = metadata['ttl'] if not (MIN_CLAIM_TTL <= ttl <= self._limits_conf.max_claim_ttl): msg = _(u'The TTL for a claim may not exceed {0} seconds, and ' 'must be at least {1} seconds long.') raise ValidationFailed( msg, self._limits_conf.max_claim_ttl, MIN_CLAIM_TTL) def subscription_posting(self, subscription): """Restrictions on a creation of subscription. :param subscription: dict of subscription :raises ValidationFailed: if the subscription is invalid. """ for p in ('subscriber',): if p not in subscription.keys(): raise ValidationFailed(_(u'Missing parameter %s in body.') % p) self.subscription_patching(subscription) def subscription_patching(self, subscription): """Restrictions on an update of subscription. :param subscription: dict of subscription :raises ValidationFailed: if the subscription is invalid. """ if not subscription: raise ValidationFailed(_(u'No subscription to create.')) if not isinstance(subscription, dict): msg = _('Subscriptions must be a dict.') raise ValidationFailed(msg) subscriber = subscription.get('subscriber') subscriber_type = None if subscriber: parsed_uri = six.moves.urllib_parse.urlparse(subscriber) subscriber_type = parsed_uri.scheme if subscriber_type not in self._limits_conf.subscriber_types: msg = _(u'The subscriber type of subscription must be ' u'supported in the list {0}.') raise ValidationFailed(msg, self._limits_conf.subscriber_types) options = subscription.get('options') if options and not isinstance(options, dict): msg = _(u'Options must be a dict.') raise ValidationFailed(msg) self._validate_retry_policy(options) ttl = subscription.get('ttl') if ttl: if not isinstance(ttl, int): msg = _(u'TTL must be an integer.') raise ValidationFailed(msg) if ttl < MIN_SUBSCRIPTION_TTL: msg = _(u'The TTL for a subscription ' 'must be at least {0} seconds long.') raise ValidationFailed(msg, MIN_SUBSCRIPTION_TTL) # NOTE(flwang): By this change, technically, user can set a very # big TTL so as to get a very long subscription. now = timeutils.utcnow_ts() now_dt = datetime.datetime.utcfromtimestamp(now) msg = _(u'The TTL seconds for a subscription plus current time' ' must be less than {0}.') try: # NOTE(flwang): If below expression works, then we believe the # ttl is acceptable otherwise it exceeds the max time of # python. now_dt + datetime.timedelta(seconds=ttl) except OverflowError: raise ValidationFailed(msg, datetime.datetime.max) def subscription_confirming(self, confirmed): confirmed = confirmed.get('confirmed') if not isinstance(confirmed, bool): msg = _(u"The 'confirmed' should be boolean.") raise ValidationFailed(msg) def subscription_listing(self, limit=None, **kwargs): """Restrictions involving a list of subscriptions. :param limit: The expected number of subscriptions in the list :param kwargs: Ignored arguments passed to storage API :raises ValidationFailed: if the limit is exceeded """ uplimit = self._limits_conf.max_subscriptions_per_page if limit is not None and not (0 < limit <= uplimit): msg = _(u'Limit must be at least 1 and may not ' 'be greater than {0}.') raise ValidationFailed( msg, self._limits_conf.max_subscriptions_per_page) def get_limit_conf_value(self, limit_conf_name=None): """Return the value of limit configuration. :param limit_conf_name: configuration name """ return self._limits_conf[limit_conf_name] def flavor_listing(self, limit=None, **kwargs): """Restrictions involving a list of pools. :param limit: The expected number of flavors in the list :param kwargs: Ignored arguments passed to storage API :raises ValidationFailed: if the limit is exceeded """ uplimit = self._limits_conf.max_flavors_per_page if limit is not None and not (0 < limit <= uplimit): msg = _(u'Limit must be at least 1 and no greater than {0}.') raise ValidationFailed(msg, self._limits_conf.max_flavors_per_page) def pool_listing(self, limit=None, **kwargs): """Restrictions involving a list of pools. :param limit: The expected number of flavors in the list :param kwargs: Ignored arguments passed to storage API :raises ValidationFailed: if the limit is exceeded """ uplimit = self._limits_conf.max_pools_per_page if limit is not None and not (0 < limit <= uplimit): msg = _(u'Limit must be at least 1 and no greater than {0}.') raise ValidationFailed(msg, self._limits_conf.max_pools_per_page) def client_id_uuid_safe(self, client_id): """Restrictions the format of client id :param client_id: the client id of request :raises ValidationFailed: if the limit is exceeded """ if self._limits_conf.client_id_uuid_safe == 'off': if (len(client_id) < self._limits_conf.min_length_client_id) or \ (len(client_id) > self._limits_conf.max_length_client_id): msg = _(u'Length of client id must be at least {0} and no ' 'greater than {1}.') raise ValidationFailed(msg, self._limits_conf.min_length_client_id, self._limits_conf.max_length_client_id) if self._limits_conf.client_id_uuid_safe == 'strict': uuid.UUID(client_id) def topic_identification(self, topic, project): """Restrictions on a project id & topic name pair. :param queue: Name of the topic :param project: Project id :raises ValidationFailed: if the `name` is longer than 64 characters or contains anything other than ASCII digits and letters, underscores, and dashes. Also raises if `project` is not None but longer than 256 characters. """ if project is not None and len(project) > PROJECT_ID_MAX_LEN: msg = _(u'Project ids may not be more than {0} characters long.') raise ValidationFailed(msg, PROJECT_ID_MAX_LEN) if len(topic) > QUEUE_NAME_MAX_LEN: msg = _(u'Topic names may not be more than {0} characters long.') raise ValidationFailed(msg, QUEUE_NAME_MAX_LEN) if not QUEUE_NAME_REGEX.match(topic): raise ValidationFailed( _(u'Topic names may only contain ASCII letters, digits, ' 'underscores, and dashes.'))
apache-2.0
3,048,376,038,165,915,600
40.729844
79
0.574789
false
FabriceSalvaire/Musica
Musica/MusicXML/Pyxb/_xlink.py
1
5773
# ./_xlink.py # -*- coding: utf-8 -*- # PyXB bindings for NM:b43cd366527ddb6a0e58594876e07421e0148f30 # Generated 2017-10-09 18:48:41.313719 by PyXB version 1.2.6 using Python 3.6.2.final.0 # Namespace http://www.w3.org/1999/xlink [xmlns:xlink] from __future__ import unicode_literals import pyxb from pyxb.binding.datatypes import positiveInteger as p_positiveInteger from pyxb.binding.basis import complexTypeDefinition as p_complexTypeDefinition from pyxb.binding.basis import element as p_element from pyxb.binding.basis import enumeration_mixin as p_enumeration_mixin from pyxb.binding.content import AttributeUse as p_AttributeUse from pyxb.binding.content import ElementDeclaration as p_ElementDeclaration from pyxb.binding.content import ElementUse as p_ElementUse from pyxb.binding.datatypes import ID as p_ID from pyxb.binding.datatypes import IDREF as p_IDREF from pyxb.binding.datatypes import NMTOKEN as p_NMTOKEN from pyxb.binding.datatypes import anySimpleType as p_anySimpleType from pyxb.binding.datatypes import anyType as p_anyType from pyxb.binding.datatypes import decimal as p_decimal from pyxb.binding.datatypes import integer as p_integer from pyxb.binding.datatypes import nonNegativeInteger as p_nonNegativeInteger from pyxb.binding.datatypes import string as p_string from pyxb.binding.datatypes import token as p_token from pyxb.binding.facets import CF_enumeration as p_CF_enumeration from pyxb.binding.facets import CF_maxInclusive as p_CF_maxInclusive from pyxb.binding.facets import CF_minExclusive as p_CF_minExclusive from pyxb.binding.facets import CF_minInclusive as p_CF_minInclusive from pyxb.namespace import ExpandedName as p_ExpandedName from pyxb.utils.utility import Location as p_Location import pyxb.binding import pyxb.binding.saxer import io import pyxb.utils.utility import pyxb.utils.domutils import sys import pyxb.utils.six as _six # Unique identifier for bindings created at the same time _GenerationUID = pyxb.utils.utility.UniqueIdentifier('urn:uuid:b41e9400-ad11-11e7-be22-185e0f77ec0a') # Version of PyXB used to generate the bindings _PyXBVersion = '1.2.6' # Generated bindings are not compatible across PyXB versions if pyxb.__version__ != _PyXBVersion: raise pyxb.PyXBVersionError(_PyXBVersion) # A holder for module-level binding classes so we can access them from # inside class definitions where property names may conflict. _module_typeBindings = pyxb.utils.utility.Object() # Import bindings for namespaces imported into schema import pyxb.binding.datatypes # NOTE: All namespace declarations are reserved within the binding Namespace = pyxb.namespace.NamespaceForURI('http://www.w3.org/1999/xlink', create_if_missing=True) Namespace.configureCategories(['typeBinding', 'elementBinding']) def CreateFromDocument (xml_text, default_namespace=None, location_base=None): if pyxb.XMLStyle_saxer != pyxb._XMLStyle: dom = pyxb.utils.domutils.StringToDOM(xml_text) return CreateFromDOM(dom.documentElement, default_namespace=default_namespace) if default_namespace is None: default_namespace = Namespace.fallbackNamespace() saxer = pyxb.binding.saxer.make_parser(fallback_namespace=default_namespace, location_base=location_base) handler = saxer.getContentHandler() xmld = xml_text if isinstance(xmld, _six.text_type): xmld = xmld.encode(pyxb._InputEncoding) saxer.parse(io.BytesIO(xmld)) instance = handler.rootObject() return instance def CreateFromDOM (node, default_namespace=None): if default_namespace is None: default_namespace = Namespace.fallbackNamespace() return p_element.AnyCreateFromDOM(node, default_namespace) # Atomic simple type: [anonymous] class STD_ANON (p_NMTOKEN, p_enumeration_mixin): _ExpandedName = None _XSDLocation = p_Location('xlink.xsd', 23, 2) _Documentation = '' STD_ANON._CF_enumeration = p_CF_enumeration(value_datatype=STD_ANON, enum_prefix=None) STD_ANON.simple = STD_ANON._CF_enumeration.addEnumeration(unicode_value='simple', tag='simple') STD_ANON._InitializeFacetMap(STD_ANON._CF_enumeration) _module_typeBindings.STD_ANON = STD_ANON # Atomic simple type: [anonymous] class STD_ANON_ (p_NMTOKEN, p_enumeration_mixin): _ExpandedName = None _XSDLocation = p_Location('xlink.xsd', 35, 2) _Documentation = '' STD_ANON_._CF_enumeration = p_CF_enumeration(value_datatype=STD_ANON_, enum_prefix=None) STD_ANON_.new = STD_ANON_._CF_enumeration.addEnumeration(unicode_value='new', tag='new') STD_ANON_.replace = STD_ANON_._CF_enumeration.addEnumeration(unicode_value='replace', tag='replace') STD_ANON_.embed = STD_ANON_._CF_enumeration.addEnumeration(unicode_value='embed', tag='embed') STD_ANON_.other = STD_ANON_._CF_enumeration.addEnumeration(unicode_value='other', tag='other') STD_ANON_.none = STD_ANON_._CF_enumeration.addEnumeration(unicode_value='none', tag='none') STD_ANON_._InitializeFacetMap(STD_ANON_._CF_enumeration) _module_typeBindings.STD_ANON_ = STD_ANON_ # Atomic simple type: [anonymous] class STD_ANON_2 (p_NMTOKEN, p_enumeration_mixin): _ExpandedName = None _XSDLocation = p_Location('xlink.xsd', 47, 2) _Documentation = '' STD_ANON_2._CF_enumeration = p_CF_enumeration(value_datatype=STD_ANON_2, enum_prefix=None) STD_ANON_2.onRequest = STD_ANON_2._CF_enumeration.addEnumeration(unicode_value='onRequest', tag='onRequest') STD_ANON_2.onLoad = STD_ANON_2._CF_enumeration.addEnumeration(unicode_value='onLoad', tag='onLoad') STD_ANON_2.other = STD_ANON_2._CF_enumeration.addEnumeration(unicode_value='other', tag='other') STD_ANON_2.none = STD_ANON_2._CF_enumeration.addEnumeration(unicode_value='none', tag='none') STD_ANON_2._InitializeFacetMap(STD_ANON_2._CF_enumeration) _module_typeBindings.STD_ANON_2 = STD_ANON_2
gpl-3.0
-5,277,354,413,599,819,000
46.319672
109
0.774467
false
BrendanLeber/adventofcode
2019/12-n-body_problem/tests.py
1
2247
# -*- coding: utf-8 -*- import unittest from solve1 import Moon, Vector, apply_gravity class VectorUnitTests(unittest.TestCase): def test_constructor(self): v = Vector() self.assertEqual(v.x, 0) self.assertEqual(v.y, 0) self.assertEqual(v.z, 0) v = Vector.parse("<x=-1, y=0, z=2>") self.assertEqual(v, Vector(-1, 0, 2)) v = Vector.parse("<x=2, y=-10, z=-7>") self.assertEqual(v, Vector(2, -10, -7)) v = Vector.parse("<x=4, y=-8, z=8>") self.assertEqual(v, Vector(4, -8, 8)) v = Vector.parse("<x=3, y=5, z=-1>") self.assertEqual(v, Vector(3, 5, -1)) v = Vector.parse("<x=128, y=256, z=-512>") self.assertEqual(v, Vector(128, 256, -512)) class MoonUnitTests(unittest.TestCase): def test_constructor(self): m = Moon.parse("<x=-1, y=0, z=2>") self.assertEqual(m, Moon(Vector(-1, 0, 2), Vector(0, 0, 0))) def test_apply_gravity(self): ganymede = Moon.parse("<x=3, y=3, z=10>") callisto = Moon.parse("<x=5, y=3, z=1>") ganymede.apply_gravity(callisto) self.assertEqual(ganymede.vel, Vector(1, 0, -1)) callisto.apply_gravity(ganymede) self.assertEqual(callisto.vel, Vector(-1, 0, 1)) def test_apply_velocity(self): europa = Moon(Vector(1, 2, 3), Vector(-2, 0, 3)) europa.apply_velocity() self.assertEqual(europa.pos, Vector(-1, 2, 6)) class SolutionUnitTests(unittest.TestCase): def test_apply_gravity_2(self): moons = [Moon(Vector(0, 0, 0), Vector(0, 0, 0)), Moon(Vector(9, 9, 9), Vector(3, 3, 3))] apply_gravity(moons) self.assertEqual(moons[0].vel, Vector(1, 1, 1)) self.assertEqual(moons[1].vel, Vector(2, 2, 2)) def test_apply_gravity_3(self): moons = [ Moon(Vector(0, 0, 0), Vector(0, 0, 0)), Moon(Vector(4, 4, 4), Vector(2, 2, 2)), Moon(Vector(9, 9, 9), Vector(3, 3, 3)), ] apply_gravity(moons) self.assertEqual(moons[0].vel, Vector(2, 2, 2)) self.assertEqual(moons[1].vel, Vector(2, 2, 2)) self.assertEqual(moons[2].vel, Vector(1, 1, 1)) if __name__ == "__main__": unittest.main()
mit
-798,287,704,878,660,100
29.780822
96
0.554962
false
Wiredcraft/maestro-ng
maestro/lifecycle.py
1
6661
# Copyright (C) 2014 SignalFuse, Inc. # # Docker container orchestration utility. import socket import subprocess import time import requests import re from . import exceptions class BaseLifecycleHelper: """Base class for lifecycle helpers.""" def test(self): """State helpers must implement this method to perform the state test. The method must return True if the test succeeds, False otherwise.""" raise NotImplementedError class TCPPortPinger(BaseLifecycleHelper): """ Lifecycle state helper that "pings" a particular TCP port. """ DEFAULT_MAX_WAIT = 300 def __init__(self, host, port, attempts=1): """Create a new TCP port pinger for the given host and port. The given number of attempts will be made, until the port is open or we give up.""" self.host = host self.port = int(port) self.attempts = int(attempts) def __repr__(self): return 'PortPing(tcp://{}:{}, {} attempts)'.format( self.host, self.port, self.attempts) def __ping_port(self): try: s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.settimeout(1) s.connect((self.host, self.port)) s.close() return True except Exception: return False def test(self): retries = self.attempts while retries > 0: if self.__ping_port(): return True retries -= 1 if retries > 0: time.sleep(1) return False @staticmethod def from_config(container, config): if config['port'] not in container.ports: raise exceptions.InvalidLifecycleCheckConfigurationException( 'Port {} is not defined by {}!'.format( config['port'], container.name)) parts = container.ports[config['port']]['external'][1].split('/') if parts[1] == 'udp': raise exceptions.InvalidLifecycleCheckConfigurationException( 'Port {} is not TCP!'.format(config['port'])) return TCPPortPinger( container.ship.ip, int(parts[0]), attempts=config.get('max_wait', TCPPortPinger.DEFAULT_MAX_WAIT)) class ScriptExecutor(BaseLifecycleHelper): """ Lifecycle state helper that executes a script and uses the exit code as the success value. """ def __init__(self, command): self.command = command def __repr__(self): return 'ScriptExec({})'.format(self.command) def test(self): return subprocess.call(self.command, shell=True) == 0 @staticmethod def from_config(container, config): return ScriptExecutor(config['command']) class Sleep(BaseLifecycleHelper): """ Lifecycle state helper that simply sleeps for a given amount of time (in seconds). """ def __init__(self, wait): self.wait = wait def __repr__(self): return 'Sleep({}s)'.format(self.wait) def test(self): while self.wait > 0: time.sleep(1) self.wait -= 1 return True @staticmethod def from_config(container, config): return Sleep(config['wait']) class HttpRequestLifecycle(BaseLifecycleHelper): """ Lifecycle request that makes a web request and checks for a given response """ DEFAULT_MAX_WAIT = 300 def __init__(self, host, port, match_regex=None, path='/', scheme='http', method='get', max_wait=DEFAULT_MAX_WAIT, requests_options={}): self.host = host self.port = port self.match_regex = match_regex if self.match_regex: try: self.match_regex = re.compile(match_regex, re.DOTALL) except: raise exceptions.InvalidLifecycleCheckConfigurationException( 'Bad regex for {}: {}'.format(self.__class__.__name__, match_regex) ) self.path = path if not self.path.startswith('/'): self.path = '/'+self.path self.scheme = scheme self.method = method.lower() self.max_wait = int(max_wait) # Extra options passed directly to the requests library self.requests_options = requests_options def test(self): start = time.time() end_by = start+self.max_wait url = '{}://{}:{}{}'.format(self.scheme, self.host, self.port, self.path) while time.time() < end_by: try: response = requests.request(self.method, url, **self.requests_options) if self._test_response(response): return True except: pass time.sleep(1) return False def _test_response(self, response): if self.match_regex: if getattr(response, 'text', None) and \ self.match_regex.search(response.text): return True else: if response.status_code == requests.codes.ok: return True return False @staticmethod def from_config(container, config): host = container.ship.ip if config.get('host'): host = config.get('host') del config['host'] port = None if config['port'] not in container.ports: try: # accept a numbered port port = int(config['port']) except: raise exceptions.InvalidLifecycleCheckConfigurationException( 'Port {} is not defined by {}!'.format( config['port'], container.name)) if port is None: parts = container.ports[config['port']]['external'][1].split('/') if parts[1] == 'udp': raise exceptions.InvalidLifecycleCheckConfigurationException( 'Port {} is not TCP!'.format(config['port'])) port = int(parts[0]) opts = {} opts.update(**config) del opts['port'] del opts['type'] return HttpRequestLifecycle(host, port, **opts) class LifecycleHelperFactory: HELPERS = { 'tcp': TCPPortPinger, 'exec': ScriptExecutor, 'sleep': Sleep, 'http': HttpRequestLifecycle } @staticmethod def from_config(container, config): return (LifecycleHelperFactory.HELPERS[config['type']] .from_config(container, config))
lgpl-3.0
8,331,319,784,645,058,000
28.604444
79
0.556823
false
TopherGopher/aws-infra.jenkins-scripts
jenkins-callback-wrapper.py
1
3552
#!/usr/bin/python #from jenkinsapi.jenkins import Jenkins #from jenkinsapi.custom_exceptions import JenkinsAPIException #from jenkinsapi.constants import STATUS_SUCCESS import jenkins import jenkinspoll import click import os import requests @click.command() @click.option('--jenkins-url', help="The URL of the Jenkins instance to connect to") @click.option('--environment', prompt='Environment', help='Environment e.g. production, staging') @click.option('--chef-action', prompt='Chef action', help='e.g. update, backup', type=click.Choice(['update', 'delete', 'backup'])) @click.option('--bag-name', default=None, help="If set, will only trigger the job on the single bag specified") def trigger_web_jobs(jenkins_url, environment, chef_action, bag_name): """ Trigger a mass web job based on environment :param environment - Which environment would you like to try executing this job on? :param chef_action - What would you like to perform on this environment? :param bag_name - Optional - what bag woud you specifically like to work on in this environment? """ print "Connecting to Jenkins..." try: # Preumably username / password will come back as a ConfigMap. J = jenkins.Jenkins(jenkins_url, username=os.environ.get('JENKINS_SERVICE_USERNAME'), password=os.environ.get('JENKINS_SERVICE_PASSWORD')) print "Connection successful" except jenkins.JenkinsException as e: print "Could not establish connection to Jenkins server at {jenkins_url}".format(jenkins_url=jenkins_url) exit(1) jenkins_job_list = J.get_jobs() jenkins_job_list = [str(x["name"]) for x in jenkins_job_list] if bag_name is not None: job_name = "{environment}-{bag_name}".format(environment=environment, bag_name=bag_name) # Make sure the job exists if job_name not in jenkins_job_list: print "Job '{job_name}' could not be found in the jenkins job list. Available jobs are:\n\t{jobs}".format(job_name=job_name,jobs=",".join(jenkins_job_list)) exit(1) # Set build parameters, kick off a new build, and block until complete. params = {'CHEF_ACTION': chef_action } # Block so the jobs execute one-at-a-time try: print "Invoking job {job_name}...".format(job_name=job_name) J.build_job(job_name, params) jenkinspoll.wait_for_job_to_finish(job_name, jenkins_connection=J) print "Done!" exit(0) except Exception as e: print e exit(1) else: print "Looking for jobs that contain '{environment}'".format(environment=environment) for job_name in jenkins_job_list: if job_name != "" and job_name != "{environment}-".format(environment=environment) and job_name.startswith(environment): print "Invoking {job_name}".format(job_name=job_name) # Set build parameters, kick off a new build, and block until complete. params = {'CHEF_ACTION': chef_action } # Block so the jobs execute one-at-a-time try: J.build_job(job_name, params) jenkinspoll.wait_for_job_to_finish(job_name, jenkins_connection=J) except Exception as e: print e # Determine if the job already exists on this jenkins instance. If not, clone # a new job from the 'sitepack' seed job so each build has it's own history. if __name__ == '__main__': trigger_web_jobs()
mit
-7,938,456,413,074,036,000
48.347222
168
0.653435
false
cvxgrp/cvxpylayers
cvxpylayers/tensorflow/cvxpylayer.py
1
12651
import cvxpy as cp from cvxpy.reductions.solvers.conic_solvers.scs_conif import \ dims_to_solver_dict import diffcp import numpy as np try: import tensorflow as tf except ImportError: raise ImportError("Unable to import tensorflow. Please install " "TensorFlow >= 2.0 (https://tensorflow.org).") tf_major_version = int(tf.__version__.split('.')[0]) if tf_major_version < 2: raise ImportError("cvxpylayers requires TensorFlow >= 2.0; please " "upgrade your installation of TensorFlow, which is " "version %s." % tf.__version__) class CvxpyLayer(object): """A differentiable convex optimization layer A CvxpyLayer solves a parametrized convex optimization problem given by a CVXPY problem. It solves the problem in its forward pass, and it computes the derivative of problem's solution map with respect to the parameters in its backward pass. The CVPXY problem must be a disciplined parametrized program. Example usage ``` import cvxpy as cp import tensorflow as tf from cvxpylayers.tensorflow import CvxpyLayer n, m = 2, 3 x = cp.Variable(n) A = cp.Parameter((m, n)) b = cp.Parameter(m) constraints = [x >= 0] objective = cp.Minimize(0.5 * cp.pnorm(A @ x - b, p=1)) problem = cp.Problem(objective, constraints) assert problem.is_dpp() cvxpylayer = CvxpyLayer(problem, parameters=[A, b], variables=[x]) A_tf = tf.Variable(tf.random.normal((m, n))) b_tf = tf.Variable(tf.random.normal((m,))) with tf.GradientTape() as tape: # solve the problem, setting the values of A and b to A_tf and b_tf solution, = cvxpylayer(A_tf, b_tf) summed_solution = tf.math.reduce_sum(solution) gradA, gradb = tape.gradient(summed_solution, [A_tf, b_tf]) ``` """ def __init__(self, problem, parameters, variables, gp=False): """Construct a CvxpyLayer Args: problem: The CVXPY problem; must be DPP. parameters: A list of CVXPY Parameters in the problem; the order of the Parameters determines the order in which parameter values must be supplied in the forward pass. variables: A list of CVXPY Variables in the problem; the order of the Variables determines the order of the optimal variable values returned from the forward pass. gp: Whether to parse the problem using DGP (True or False). """ if gp: if not problem.is_dgp(dpp=True): raise ValueError('Problem must be DPP.') else: if not problem.is_dcp(dpp=True): raise ValueError('Problem must be DPP.') if set(parameters) != set(problem.parameters()): raise ValueError("The layer's parameters must exactly match " "problem.parameters") if not set(variables).issubset(set(problem.variables())): raise ValueError('Argument `variables` must be a subset of ' '`problem.variables()`') self.params = parameters self.gp = gp if self.gp: for param in parameters: if param.value is None: raise ValueError("An initial value for each parameter is " "required when gp=True.") data, solving_chain, _ = ( problem.get_problem_data(solver=cp.SCS, gp=True) ) self.asa_maps = data[cp.settings.PARAM_PROB] self.dgp2dcp = solving_chain.get(cp.reductions.Dgp2Dcp) self.param_ids = [p.id for p in self.asa_maps.parameters] else: data, _, _ = problem.get_problem_data(solver=cp.SCS) self.asa_maps = data[cp.settings.PARAM_PROB] self.param_ids = [p.id for p in self.params] self.cones = dims_to_solver_dict(data['dims']) self.vars = variables def __call__(self, *parameters, solver_args={}): """Solve problem (or a batch of problems) corresponding to `parameters` Args: parameters: a sequence of tf.Tensors; the n-th Tensor specifies the value for the n-th CVXPY Parameter. These Tensors can be batched: if a Tensor has 3 dimensions, then its first dimension is interpreted as the batch size. solver_args: a dict of optional arguments, to send to `diffcp`. Keys should be the names of keyword arguments. Returns: a list of optimal variable values, one for each CVXPY Variable supplied to the constructor. """ if len(parameters) != len(self.params): raise ValueError('A tensor must be provided for each CVXPY ' 'parameter; received %d tensors, expected %d' % ( len(parameters), len(self.params))) compute = tf.custom_gradient( lambda *parameters: self._compute(parameters, solver_args)) return compute(*parameters) def _dx_from_dsoln(self, dsoln): dvars_numpy = list(map(lambda x: x.numpy(), dsoln)) del_vars = {} for v, dv in zip(self.vars, dvars_numpy): del_vars[v.id] = dv return self.asa_maps.split_adjoint(del_vars) def _problem_data_from_params(self, params): c, _, A, b = self.asa_maps.apply_parameters( dict(zip(self.param_ids, params)), keep_zeros=True) A = -A return A, b, c def _restrict_DT_to_dx(self, DT, batch_size, s_shape): if batch_size > 0: zeros = [np.zeros(s_shape) for _ in range(batch_size)] else: zeros = np.zeros(s_shape) return lambda dxs: DT(dxs, zeros, zeros) def _split_solution(self, x): soln = self.asa_maps.split_solution(x, {v.id: v for v in self.vars}) return tuple([tf.constant(soln[v.id]) for v in self.vars]) def _compute(self, params, solver_args={}): tf_params = params params = [p.numpy() for p in params] # infer whether params are batched batch_sizes = [] for i, (p_in, p_signature) in enumerate(zip(params, self.params)): # check and extract the batch size for the parameter # 0 means there is no batch dimension for this parameter # and we assume the batch dimension is non-zero if p_in.ndim == p_signature.ndim: batch_size = 0 elif p_in.ndim == p_signature.ndim + 1: batch_size = p_in.shape[0] if batch_size == 0: raise ValueError( "Invalid parameter size passed in. " "Parameter {} appears to be batched, but the leading " "dimension is 0".format(i)) else: raise ValueError( "Invalid parameter size passed in. Expected " "parameter {} to have have {} or {} dimensions " "but got {} dimensions".format( i, p_signature.ndim, p_signature.ndim + 1, p_in.ndim)) batch_sizes.append(batch_size) # validate the parameter shape p_shape = p_in.shape if batch_size == 0 else p_in.shape[1:] if not np.all(p_shape == p_signature.shape): raise ValueError( "Inconsistent parameter shapes passed in. " "Expected parameter {} to have non-batched shape of " "{} but got {}.".format( i, p_signature.shape, p_signature.shape)) batch_sizes = np.array(batch_sizes) any_batched = np.any(batch_sizes > 0) if any_batched: nonzero_batch_sizes = batch_sizes[batch_sizes > 0] batch_size = int(nonzero_batch_sizes[0]) if np.any(nonzero_batch_sizes != batch_size): raise ValueError( "Inconsistent batch sizes passed in. Expected " "parameters to have no batch size or all the same " "batch size but got sizes: {}.".format(batch_sizes)) else: batch_size = 1 if self.gp: old_params_to_new_params = self.dgp2dcp.canon_methods._parameters param_map = {} # construct a list of params for the DCP problem for param, value in zip(self.params, params): if param in old_params_to_new_params: new_id = old_params_to_new_params[param].id param_map[new_id] = np.log(value) else: new_id = param.id param_map[new_id] = value params = [param_map[pid] for pid in self.param_ids] As, bs, cs = [], [], [] for i in range(batch_size): params_i = [ p if sz == 0 else p[i] for p, sz in zip(params, batch_sizes)] A, b, c = self._problem_data_from_params(params_i) As.append(A) bs.append(b) cs.append(c) try: xs, _, ss, _, DT = diffcp.solve_and_derivative_batch( As=As, bs=bs, cs=cs, cone_dicts=[self.cones] * batch_size, **solver_args) except diffcp.SolverError as e: print( "Please consider re-formulating your problem so that " "it is always solvable or increasing the number of " "solver iterations.") raise e DT = self._restrict_DT_to_dx(DT, batch_size, ss[0].shape) solns = [self._split_solution(x) for x in xs] # soln[i] is a tensor with first dimension equal to batch_size, holding # the optimal values for variable i solution = [ tf.stack([s[i] for s in solns]) for i in range(len(self.vars))] if not any_batched: solution = [tf.squeeze(s, 0) for s in solution] if self.gp: solution = [tf.exp(s) for s in solution] def gradient_function(*dsoln): if self.gp: dsoln = [dsoln*s for dsoln, s in zip(dsoln, solution)] if not any_batched: dsoln = [tf.expand_dims(dvar, 0) for dvar in dsoln] # split the batched dsoln tensors into lists, with one list # corresponding to each problem in the batch dsoln_lists = [[] for _ in range(batch_size)] for value in dsoln: tensors = tf.split(value, batch_size) for dsoln_list, t in zip(dsoln_lists, tensors): dsoln_list.append(tf.squeeze(t)) dxs = [self._dx_from_dsoln(dsoln_list) for dsoln_list in dsoln_lists] dAs, dbs, dcs = DT(dxs) dparams_dict_unbatched = [ self.asa_maps.apply_param_jac(dc, -dA, db) for (dA, db, dc) in zip(dAs, dbs, dcs)] dparams = [] for pid in self.param_ids: dparams.append( tf.constant([d[pid] for d in dparams_dict_unbatched])) if not any_batched: dparams = tuple(tf.squeeze(dparam, 0) for dparam in dparams) else: for i, sz in enumerate(batch_sizes): if sz == 0: dparams[i] = tf.reduce_sum(dparams[i], axis=0) if self.gp: # differentiate through the log transformation of params dcp_dparams = dparams dparams = [] grads = {pid: g for pid, g in zip(self.param_ids, dcp_dparams)} old_params_to_new_params = ( self.dgp2dcp.canon_methods._parameters ) for param, value in zip(self.params, tf_params): g = 0.0 if param.id not in grads else grads[param.id] if param in old_params_to_new_params: dcp_param_id = old_params_to_new_params[param].id # new_param.value == log(param), apply chain rule g = g + (1.0 / value) * grads[dcp_param_id] dparams.append(g) return tuple(dparams) return solution, gradient_function
apache-2.0
-8,604,243,101,993,928,000
41.311037
79
0.539957
false
evilhero/mylar
lib/comictaggerlib/autotagmatchwindow.py
1
8516
"""A PyQT4 dialog to select from automated issue matches""" # Copyright 2012-2014 Anthony Beville # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os #import sys from PyQt4 import QtCore, QtGui, uic #from PyQt4.QtCore import QUrl, pyqtSignal, QByteArray from settings import ComicTaggerSettings from comicarchive import MetaDataStyle from coverimagewidget import CoverImageWidget from comictaggerlib.ui.qtutils import reduceWidgetFontSize #from imagefetcher import ImageFetcher #from comicvinetalker import ComicVineTalker #import utils class AutoTagMatchWindow(QtGui.QDialog): volume_id = 0 def __init__(self, parent, match_set_list, style, fetch_func): super(AutoTagMatchWindow, self).__init__(parent) uic.loadUi( ComicTaggerSettings.getUIFile('matchselectionwindow.ui'), self) self.altCoverWidget = CoverImageWidget( self.altCoverContainer, CoverImageWidget.AltCoverMode) gridlayout = QtGui.QGridLayout(self.altCoverContainer) gridlayout.addWidget(self.altCoverWidget) gridlayout.setContentsMargins(0, 0, 0, 0) self.archiveCoverWidget = CoverImageWidget( self.archiveCoverContainer, CoverImageWidget.ArchiveMode) gridlayout = QtGui.QGridLayout(self.archiveCoverContainer) gridlayout.addWidget(self.archiveCoverWidget) gridlayout.setContentsMargins(0, 0, 0, 0) reduceWidgetFontSize(self.twList) reduceWidgetFontSize(self.teDescription, 1) self.setWindowFlags(self.windowFlags() | QtCore.Qt.WindowSystemMenuHint | QtCore.Qt.WindowMaximizeButtonHint) self.skipButton = QtGui.QPushButton(self.tr("Skip to Next")) self.buttonBox.addButton( self.skipButton, QtGui.QDialogButtonBox.ActionRole) self.buttonBox.button(QtGui.QDialogButtonBox.Ok).setText( "Accept and Write Tags") self.match_set_list = match_set_list self.style = style self.fetch_func = fetch_func self.current_match_set_idx = 0 self.twList.currentItemChanged.connect(self.currentItemChanged) self.twList.cellDoubleClicked.connect(self.cellDoubleClicked) self.skipButton.clicked.connect(self.skipToNext) self.updateData() def updateData(self): self.current_match_set = self.match_set_list[ self.current_match_set_idx] if self.current_match_set_idx + 1 == len(self.match_set_list): self.buttonBox.button( QtGui.QDialogButtonBox.Cancel).setDisabled(True) # self.buttonBox.button(QtGui.QDialogButtonBox.Ok).setText("Accept") self.skipButton.setText(self.tr("Skip")) self.setCoverImage() self.populateTable() self.twList.resizeColumnsToContents() self.twList.selectRow(0) path = self.current_match_set.ca.path self.setWindowTitle( u"Select correct match or skip ({0} of {1}): {2}".format( self.current_match_set_idx + 1, len(self.match_set_list), os.path.split(path)[1]) ) def populateTable(self): while self.twList.rowCount() > 0: self.twList.removeRow(0) self.twList.setSortingEnabled(False) row = 0 for match in self.current_match_set.matches: self.twList.insertRow(row) item_text = match['series'] item = QtGui.QTableWidgetItem(item_text) item.setData(QtCore.Qt.ToolTipRole, item_text) item.setData(QtCore.Qt.UserRole, (match,)) item.setFlags(QtCore.Qt.ItemIsSelectable | QtCore.Qt.ItemIsEnabled) self.twList.setItem(row, 0, item) if match['publisher'] is not None: item_text = u"{0}".format(match['publisher']) else: item_text = u"Unknown" item = QtGui.QTableWidgetItem(item_text) item.setData(QtCore.Qt.ToolTipRole, item_text) item.setFlags(QtCore.Qt.ItemIsSelectable | QtCore.Qt.ItemIsEnabled) self.twList.setItem(row, 1, item) month_str = u"" year_str = u"????" if match['month'] is not None: month_str = u"-{0:02d}".format(int(match['month'])) if match['year'] is not None: year_str = u"{0}".format(match['year']) item_text = year_str + month_str item = QtGui.QTableWidgetItem(item_text) item.setData(QtCore.Qt.ToolTipRole, item_text) item.setFlags(QtCore.Qt.ItemIsSelectable | QtCore.Qt.ItemIsEnabled) self.twList.setItem(row, 2, item) item_text = match['issue_title'] if item_text is None: item_text = "" item = QtGui.QTableWidgetItem(item_text) item.setData(QtCore.Qt.ToolTipRole, item_text) item.setFlags(QtCore.Qt.ItemIsSelectable | QtCore.Qt.ItemIsEnabled) self.twList.setItem(row, 3, item) row += 1 self.twList.resizeColumnsToContents() self.twList.setSortingEnabled(True) self.twList.sortItems(2, QtCore.Qt.AscendingOrder) self.twList.selectRow(0) self.twList.resizeColumnsToContents() self.twList.horizontalHeader().setStretchLastSection(True) def cellDoubleClicked(self, r, c): self.accept() def currentItemChanged(self, curr, prev): if curr is None: return if prev is not None and prev.row() == curr.row(): return self.altCoverWidget.setIssueID(self.currentMatch()['issue_id']) if self.currentMatch()['description'] is None: self.teDescription.setText("") else: self.teDescription.setText(self.currentMatch()['description']) def setCoverImage(self): ca = self.current_match_set.ca self.archiveCoverWidget.setArchive(ca) def currentMatch(self): row = self.twList.currentRow() match = self.twList.item(row, 0).data( QtCore.Qt.UserRole).toPyObject()[0] return match def accept(self): self.saveMatch() self.current_match_set_idx += 1 if self.current_match_set_idx == len(self.match_set_list): # no more items QtGui.QDialog.accept(self) else: self.updateData() def skipToNext(self): self.current_match_set_idx += 1 if self.current_match_set_idx == len(self.match_set_list): # no more items QtGui.QDialog.reject(self) else: self.updateData() def reject(self): reply = QtGui.QMessageBox.question( self, self.tr("Cancel Matching"), self.tr("Are you sure you wish to cancel the matching process?"), QtGui.QMessageBox.Yes, QtGui.QMessageBox.No) if reply == QtGui.QMessageBox.No: return QtGui.QDialog.reject(self) def saveMatch(self): match = self.currentMatch() ca = self.current_match_set.ca md = ca.readMetadata(self.style) if md.isEmpty: md = ca.metadataFromFilename() # now get the particular issue data cv_md = self.fetch_func(match) if cv_md is None: QtGui.QMessageBox.critical(self, self.tr("Network Issue"), self.tr( "Could not connect to Comic Vine to get issue details!")) return QtGui.QApplication.setOverrideCursor( QtGui.QCursor(QtCore.Qt.WaitCursor)) md.overlay(cv_md) success = ca.writeMetadata(md, self.style) ca.loadCache([MetaDataStyle.CBI, MetaDataStyle.CIX]) QtGui.QApplication.restoreOverrideCursor() if not success: QtGui.QMessageBox.warning(self, self.tr("Write Error"), self.tr( "Saving the tags to the archive seemed to fail!"))
gpl-3.0
-8,156,623,721,833,608,000
33.759184
80
0.62776
false
xen0n/moehime
moehime/saimoe/datasource/livedoor_thread.py
1
3107
#!/usr/bin/python # -*- coding: utf-8 -*- # moehime / saimoe / data source - livedoor - thread # # Copyright (C) 2012 Wang Xuerui <[email protected]> # # This file is part of moehime. # # moehime is free software: you can redistribute it and/or modify it under # the terms of the GNU Affero General Public License as published by the # Free Software Foundation, either version 3 of the License, or (at your # option) any later version. # # moehime is distributed in the hope that it will be useful, but WITHOUT # ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or # FITNESS FOR A PARTICULAR PURPOSE. See the GNU Affero General Public # License for more details. # # You should have received a copy of the GNU Affero General Public License # along with moehime. If not, see <http://www.gnu.org/licenses/>. from __future__ import unicode_literals, division import re import datetime from pyquery import PyQuery as pq from .base import PostThreadInfoBase from ..exc import ThreadBadTitleError # RE_NUM_REPLIES = re.compile(r'^\((\d+)\)$') RE_SIMPLE_TID = re.compile(r'read.cgi/anime/10101/(\d+)/$') RE_MTIME = re.compile( r'投稿日:\s+' r'(?P<Y>\d{4})/(?P<m>\d{2})/(?P<d>\d{2})\([日月水火木金土]\)\s+' r'(?P<H>\d{2}):(?P<M>\d{2}):(?P<S>\d{2})' ) VOTE_THREAD_SIGNATURE = '投票スレ' class PostThreadInfo_livedoor(PostThreadInfoBase): def __init__(self, raw_thread, datasource): super(PostThreadInfo_livedoor, self).__init__(raw_thread, datasource) dl = pq(raw_thread) # header hdr_elem = dl(b'table:first') title = hdr_elem(b'font[color = "#FF0000"]').text() # only interested in vote threads # 只对票箱感兴趣 if VOTE_THREAD_SIGNATURE not in title: raise ThreadBadTitleError # this is of format "(Res:\d+)" num_replies_txt = hdr_elem(b'tr>td:first>b + font').text() num_replies = int(num_replies_txt[5:-1]) # again walking the table layout href = hdr_elem(b'tr>td:last>font>a:first').attr('href') # extract thread id from href # 从链接地址里提取线索 id tid = RE_SIMPLE_TID.search(href).group(1) # extract last reply time from <dt> # 从 <dt> 中提取最后回复时间 lastreply_text = dl(b'dt:last').text() mtime_match = RE_MTIME.search(lastreply_text) if mtime_match is None: raise RuntimeError('mtime RE match failed') m_grp = lambda x: int(mtime_match.group(x)) mtime = datetime.datetime( m_grp('Y'), m_grp('m'), m_grp('d'), m_grp('H'), m_grp('M'), m_grp('S'), ) # populate self # 填充数据 self.title = title self.tid = tid self.num_replies = num_replies self.mtime = mtime # range information # 范围信息 self.start = 1 self.end = None # vim:ai:et:ts=4:sw=4:sts=4:ff=unix:fenc=utf-8:
agpl-3.0
-5,313,366,697,778,717,000
29.373737
77
0.597938
false
pgjones/flake8-sql
flake8_sql/parser.py
1
3054
from typing import Any, Generator, List, Tuple import sqlparse from .keywords import ROOT_KEYWORDS class Token: def __init__(self, token: sqlparse.sql.Token, row: int, col: int, depth: int) -> None: self._token = token self.row = row self.col = col self.depth = depth @property def is_whitespace(self) -> bool: return self._token.is_whitespace @property def is_keyword(self) -> bool: return self._token.is_keyword @property def is_root_keyword(self) -> bool: if not self.is_keyword: return False value = self.value.split()[-1].upper() if value == "FROM" and isinstance(self._token.parent.parent, sqlparse.sql.Function): return False return value in ROOT_KEYWORDS @property def is_function_name(self) -> bool: # Note the only name-token who's grandparent is a function is # the function identifier. return ( self._token.ttype == sqlparse.tokens.Name and self._token.within(sqlparse.sql.Function) and isinstance(self._token.parent.parent, sqlparse.sql.Function) and sqlparse.keywords.is_keyword(self._token.value)[0] == sqlparse.tokens.Token.Keyword ) @property def is_name(self) -> bool: return self._token.ttype == sqlparse.tokens.Name and not self.is_keyword @property def is_punctuation(self) -> bool: return self._token.ttype == sqlparse.tokens.Punctuation @property def is_comparison(self) -> bool: return self._token.ttype == sqlparse.tokens.Comparison @property def is_newline(self) -> bool: return self._token.ttype == sqlparse.tokens.Text.Whitespace.Newline @property def value(self) -> str: return self._token.value class Parser: def __init__(self, sql: str, initial_offset: int) -> None: self._initial_offset = initial_offset self._tokens = [] # type: Tuple[sqlparse.sql.Token, int] depth = 0 for statement in sqlparse.parse(sql): for token in statement.tokens: if token.is_group: self._tokens.extend(_flatten_group(token, depth)) else: self._tokens.append((token, depth)) def __iter__(self) -> Generator[Token, Any, None]: row = 0 col = self._initial_offset for sql_token, depth in self._tokens: token = Token(sql_token, row, col, depth) yield token if token.is_newline: row += 1 col = 0 else: col += len(token.value) def _flatten_group(token: sqlparse.sql.Token, depth: int = 0) -> List[sqlparse.sql.Token]: tokens = [] for item in token.tokens: if item.ttype == sqlparse.tokens.DML: depth += 1 if item.is_group: tokens.extend(_flatten_group(item, depth)) else: tokens.append((item, depth)) return tokens
mit
4,637,596,389,222,792,000
29.54
95
0.584152
false
gkc1000/pyscf
pyscf/pbc/dft/test/test_kuks.py
1
2244
#!/usr/bin/env python # Copyright 2014-2018 The PySCF Developers. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # Author: Qiming Sun <[email protected]> # import unittest import numpy as np from pyscf.pbc import gto as pbcgto from pyscf.pbc import dft as pbcdft L = 4. cell = pbcgto.Cell() cell.verbose = 0 cell.a = np.eye(3)*L cell.atom =[['He' , ( L/2+0., L/2+0. , L/2+1.)],] cell.basis = {'He': [[0, (4.0, 1.0)], [0, (1.0, 1.0)]]} cell.build() def tearDownModule(): global cell del cell class KnownValues(unittest.TestCase): def test_klda8_cubic_kpt_222_high_cost(self): cell = pbcgto.Cell() cell.unit = 'A' cell.a = '''3.5668 0. 0. 0. 3.5668 0. 0. 0. 3.5668''' cell.mesh = np.array([17]*3) cell.atom =''' C, 0., 0., 0. C, 0.8917, 0.8917, 0.8917 C, 1.7834, 1.7834, 0. C, 2.6751, 2.6751, 0.8917 C, 1.7834, 0. , 1.7834 C, 2.6751, 0.8917, 2.6751 C, 0. , 1.7834, 1.7834 C, 0.8917, 2.6751, 2.6751''' cell.basis = 'gth-szv' cell.pseudo = 'gth-pade' cell.verbose = 5 cell.output = '/dev/null' cell.build() kpts = cell.make_kpts((2,2,2), with_gamma_point=False) mf = pbcdft.KUKS(cell, kpts) mf.conv_tol = 1e-9 mf.xc = 'lda,vwn' e1 = mf.scf() self.assertAlmostEqual(e1, -45.42583489512954, 8) def test_rsh_df(self): mf = pbcdft.KUKS(cell).density_fit() mf.xc = 'camb3lyp' mf.omega = .15 mf.kernel() self.assertAlmostEqual(mf.e_tot, -2.399571378419408, 7) if __name__ == '__main__': print("Full Tests for pbc.dft.kuks") unittest.main()
apache-2.0
-1,019,804,087,863,395,600
27.405063
74
0.593583
false
pizzathief/numpy
numpy/distutils/misc_util.py
1
84661
from __future__ import division, absolute_import, print_function import os import re import sys import copy import glob import atexit import tempfile import subprocess import shutil import multiprocessing import textwrap import distutils from distutils.errors import DistutilsError try: from threading import local as tlocal except ImportError: from dummy_threading import local as tlocal # stores temporary directory of each thread to only create one per thread _tdata = tlocal() # store all created temporary directories so they can be deleted on exit _tmpdirs = [] def clean_up_temporary_directory(): if _tmpdirs is not None: for d in _tmpdirs: try: shutil.rmtree(d) except OSError: pass atexit.register(clean_up_temporary_directory) from numpy.distutils.compat import get_exception from numpy.compat import basestring from numpy.compat import npy_load_module __all__ = ['Configuration', 'get_numpy_include_dirs', 'default_config_dict', 'dict_append', 'appendpath', 'generate_config_py', 'get_cmd', 'allpath', 'get_mathlibs', 'terminal_has_colors', 'red_text', 'green_text', 'yellow_text', 'blue_text', 'cyan_text', 'cyg2win32', 'mingw32', 'all_strings', 'has_f_sources', 'has_cxx_sources', 'filter_sources', 'get_dependencies', 'is_local_src_dir', 'get_ext_source_files', 'get_script_files', 'get_lib_source_files', 'get_data_files', 'dot_join', 'get_frame', 'minrelpath', 'njoin', 'is_sequence', 'is_string', 'as_list', 'gpaths', 'get_language', 'quote_args', 'get_build_architecture', 'get_info', 'get_pkg_info', 'get_num_build_jobs'] class InstallableLib(object): """ Container to hold information on an installable library. Parameters ---------- name : str Name of the installed library. build_info : dict Dictionary holding build information. target_dir : str Absolute path specifying where to install the library. See Also -------- Configuration.add_installed_library Notes ----- The three parameters are stored as attributes with the same names. """ def __init__(self, name, build_info, target_dir): self.name = name self.build_info = build_info self.target_dir = target_dir def get_num_build_jobs(): """ Get number of parallel build jobs set by the --parallel command line argument of setup.py If the command did not receive a setting the environment variable NPY_NUM_BUILD_JOBS is checked. If that is unset, return the number of processors on the system, with a maximum of 8 (to prevent overloading the system if there a lot of CPUs). Returns ------- out : int number of parallel jobs that can be run """ from numpy.distutils.core import get_distribution try: cpu_count = len(os.sched_getaffinity(0)) except AttributeError: cpu_count = multiprocessing.cpu_count() cpu_count = min(cpu_count, 8) envjobs = int(os.environ.get("NPY_NUM_BUILD_JOBS", cpu_count)) dist = get_distribution() # may be None during configuration if dist is None: return envjobs # any of these three may have the job set, take the largest cmdattr = (getattr(dist.get_command_obj('build'), 'parallel', None), getattr(dist.get_command_obj('build_ext'), 'parallel', None), getattr(dist.get_command_obj('build_clib'), 'parallel', None)) if all(x is None for x in cmdattr): return envjobs else: return max(x for x in cmdattr if x is not None) def quote_args(args): # don't used _nt_quote_args as it does not check if # args items already have quotes or not. args = list(args) for i in range(len(args)): a = args[i] if ' ' in a and a[0] not in '"\'': args[i] = '"%s"' % (a) return args def allpath(name): "Convert a /-separated pathname to one using the OS's path separator." splitted = name.split('/') return os.path.join(*splitted) def rel_path(path, parent_path): """Return path relative to parent_path.""" # Use realpath to avoid issues with symlinked dirs (see gh-7707) pd = os.path.realpath(os.path.abspath(parent_path)) apath = os.path.realpath(os.path.abspath(path)) if len(apath) < len(pd): return path if apath == pd: return '' if pd == apath[:len(pd)]: assert apath[len(pd)] in [os.sep], repr((path, apath[len(pd)])) path = apath[len(pd)+1:] return path def get_path_from_frame(frame, parent_path=None): """Return path of the module given a frame object from the call stack. Returned path is relative to parent_path when given, otherwise it is absolute path. """ # First, try to find if the file name is in the frame. try: caller_file = eval('__file__', frame.f_globals, frame.f_locals) d = os.path.dirname(os.path.abspath(caller_file)) except NameError: # __file__ is not defined, so let's try __name__. We try this second # because setuptools spoofs __name__ to be '__main__' even though # sys.modules['__main__'] might be something else, like easy_install(1). caller_name = eval('__name__', frame.f_globals, frame.f_locals) __import__(caller_name) mod = sys.modules[caller_name] if hasattr(mod, '__file__'): d = os.path.dirname(os.path.abspath(mod.__file__)) else: # we're probably running setup.py as execfile("setup.py") # (likely we're building an egg) d = os.path.abspath('.') # hmm, should we use sys.argv[0] like in __builtin__ case? if parent_path is not None: d = rel_path(d, parent_path) return d or '.' def njoin(*path): """Join two or more pathname components + - convert a /-separated pathname to one using the OS's path separator. - resolve `..` and `.` from path. Either passing n arguments as in njoin('a','b'), or a sequence of n names as in njoin(['a','b']) is handled, or a mixture of such arguments. """ paths = [] for p in path: if is_sequence(p): # njoin(['a', 'b'], 'c') paths.append(njoin(*p)) else: assert is_string(p) paths.append(p) path = paths if not path: # njoin() joined = '' else: # njoin('a', 'b') joined = os.path.join(*path) if os.path.sep != '/': joined = joined.replace('/', os.path.sep) return minrelpath(joined) def get_mathlibs(path=None): """Return the MATHLIB line from numpyconfig.h """ if path is not None: config_file = os.path.join(path, '_numpyconfig.h') else: # Look for the file in each of the numpy include directories. dirs = get_numpy_include_dirs() for path in dirs: fn = os.path.join(path, '_numpyconfig.h') if os.path.exists(fn): config_file = fn break else: raise DistutilsError('_numpyconfig.h not found in numpy include ' 'dirs %r' % (dirs,)) with open(config_file) as fid: mathlibs = [] s = '#define MATHLIB' for line in fid: if line.startswith(s): value = line[len(s):].strip() if value: mathlibs.extend(value.split(',')) return mathlibs def minrelpath(path): """Resolve `..` and '.' from path. """ if not is_string(path): return path if '.' not in path: return path l = path.split(os.sep) while l: try: i = l.index('.', 1) except ValueError: break del l[i] j = 1 while l: try: i = l.index('..', j) except ValueError: break if l[i-1]=='..': j += 1 else: del l[i], l[i-1] j = 1 if not l: return '' return os.sep.join(l) def sorted_glob(fileglob): """sorts output of python glob for https://bugs.python.org/issue30461 to allow extensions to have reproducible build results""" return sorted(glob.glob(fileglob)) def _fix_paths(paths, local_path, include_non_existing): assert is_sequence(paths), repr(type(paths)) new_paths = [] assert not is_string(paths), repr(paths) for n in paths: if is_string(n): if '*' in n or '?' in n: p = sorted_glob(n) p2 = sorted_glob(njoin(local_path, n)) if p2: new_paths.extend(p2) elif p: new_paths.extend(p) else: if include_non_existing: new_paths.append(n) print('could not resolve pattern in %r: %r' % (local_path, n)) else: n2 = njoin(local_path, n) if os.path.exists(n2): new_paths.append(n2) else: if os.path.exists(n): new_paths.append(n) elif include_non_existing: new_paths.append(n) if not os.path.exists(n): print('non-existing path in %r: %r' % (local_path, n)) elif is_sequence(n): new_paths.extend(_fix_paths(n, local_path, include_non_existing)) else: new_paths.append(n) return [minrelpath(p) for p in new_paths] def gpaths(paths, local_path='', include_non_existing=True): """Apply glob to paths and prepend local_path if needed. """ if is_string(paths): paths = (paths,) return _fix_paths(paths, local_path, include_non_existing) def make_temp_file(suffix='', prefix='', text=True): if not hasattr(_tdata, 'tempdir'): _tdata.tempdir = tempfile.mkdtemp() _tmpdirs.append(_tdata.tempdir) fid, name = tempfile.mkstemp(suffix=suffix, prefix=prefix, dir=_tdata.tempdir, text=text) fo = os.fdopen(fid, 'w') return fo, name # Hooks for colored terminal output. # See also https://web.archive.org/web/20100314204946/http://www.livinglogic.de/Python/ansistyle def terminal_has_colors(): if sys.platform=='cygwin' and 'USE_COLOR' not in os.environ: # Avoid importing curses that causes illegal operation # with a message: # PYTHON2 caused an invalid page fault in # module CYGNURSES7.DLL as 015f:18bbfc28 # Details: Python 2.3.3 [GCC 3.3.1 (cygming special)] # ssh to Win32 machine from debian # curses.version is 2.2 # CYGWIN_98-4.10, release 1.5.7(0.109/3/2)) return 0 if hasattr(sys.stdout, 'isatty') and sys.stdout.isatty(): try: import curses curses.setupterm() if (curses.tigetnum("colors") >= 0 and curses.tigetnum("pairs") >= 0 and ((curses.tigetstr("setf") is not None and curses.tigetstr("setb") is not None) or (curses.tigetstr("setaf") is not None and curses.tigetstr("setab") is not None) or curses.tigetstr("scp") is not None)): return 1 except Exception: pass return 0 if terminal_has_colors(): _colour_codes = dict(black=0, red=1, green=2, yellow=3, blue=4, magenta=5, cyan=6, white=7, default=9) def colour_text(s, fg=None, bg=None, bold=False): seq = [] if bold: seq.append('1') if fg: fgcode = 30 + _colour_codes.get(fg.lower(), 0) seq.append(str(fgcode)) if bg: bgcode = 40 + _colour_codes.get(fg.lower(), 7) seq.append(str(bgcode)) if seq: return '\x1b[%sm%s\x1b[0m' % (';'.join(seq), s) else: return s else: def colour_text(s, fg=None, bg=None): return s def default_text(s): return colour_text(s, 'default') def red_text(s): return colour_text(s, 'red') def green_text(s): return colour_text(s, 'green') def yellow_text(s): return colour_text(s, 'yellow') def cyan_text(s): return colour_text(s, 'cyan') def blue_text(s): return colour_text(s, 'blue') ######################### def cyg2win32(path): if sys.platform=='cygwin' and path.startswith('/cygdrive'): path = path[10] + ':' + os.path.normcase(path[11:]) return path def mingw32(): """Return true when using mingw32 environment. """ if sys.platform=='win32': if os.environ.get('OSTYPE', '')=='msys': return True if os.environ.get('MSYSTEM', '')=='MINGW32': return True return False def msvc_runtime_version(): "Return version of MSVC runtime library, as defined by __MSC_VER__ macro" msc_pos = sys.version.find('MSC v.') if msc_pos != -1: msc_ver = int(sys.version[msc_pos+6:msc_pos+10]) else: msc_ver = None return msc_ver def msvc_runtime_library(): "Return name of MSVC runtime library if Python was built with MSVC >= 7" ver = msvc_runtime_major () if ver: if ver < 140: return "msvcr%i" % ver else: return "vcruntime%i" % ver else: return None def msvc_runtime_major(): "Return major version of MSVC runtime coded like get_build_msvc_version" major = {1300: 70, # MSVC 7.0 1310: 71, # MSVC 7.1 1400: 80, # MSVC 8 1500: 90, # MSVC 9 (aka 2008) 1600: 100, # MSVC 10 (aka 2010) 1900: 140, # MSVC 14 (aka 2015) }.get(msvc_runtime_version(), None) return major ######################### #XXX need support for .C that is also C++ cxx_ext_match = re.compile(r'.*[.](cpp|cxx|cc)\Z', re.I).match fortran_ext_match = re.compile(r'.*[.](f90|f95|f77|for|ftn|f)\Z', re.I).match f90_ext_match = re.compile(r'.*[.](f90|f95)\Z', re.I).match f90_module_name_match = re.compile(r'\s*module\s*(?P<name>[\w_]+)', re.I).match def _get_f90_modules(source): """Return a list of Fortran f90 module names that given source file defines. """ if not f90_ext_match(source): return [] modules = [] with open(source, 'r') as f: for line in f: m = f90_module_name_match(line) if m: name = m.group('name') modules.append(name) # break # XXX can we assume that there is one module per file? return modules def is_string(s): return isinstance(s, basestring) def all_strings(lst): """Return True if all items in lst are string objects. """ for item in lst: if not is_string(item): return False return True def is_sequence(seq): if is_string(seq): return False try: len(seq) except Exception: return False return True def is_glob_pattern(s): return is_string(s) and ('*' in s or '?' in s) def as_list(seq): if is_sequence(seq): return list(seq) else: return [seq] def get_language(sources): # not used in numpy/scipy packages, use build_ext.detect_language instead """Determine language value (c,f77,f90) from sources """ language = None for source in sources: if isinstance(source, str): if f90_ext_match(source): language = 'f90' break elif fortran_ext_match(source): language = 'f77' return language def has_f_sources(sources): """Return True if sources contains Fortran files """ for source in sources: if fortran_ext_match(source): return True return False def has_cxx_sources(sources): """Return True if sources contains C++ files """ for source in sources: if cxx_ext_match(source): return True return False def filter_sources(sources): """Return four lists of filenames containing C, C++, Fortran, and Fortran 90 module sources, respectively. """ c_sources = [] cxx_sources = [] f_sources = [] fmodule_sources = [] for source in sources: if fortran_ext_match(source): modules = _get_f90_modules(source) if modules: fmodule_sources.append(source) else: f_sources.append(source) elif cxx_ext_match(source): cxx_sources.append(source) else: c_sources.append(source) return c_sources, cxx_sources, f_sources, fmodule_sources def _get_headers(directory_list): # get *.h files from list of directories headers = [] for d in directory_list: head = sorted_glob(os.path.join(d, "*.h")) #XXX: *.hpp files?? headers.extend(head) return headers def _get_directories(list_of_sources): # get unique directories from list of sources. direcs = [] for f in list_of_sources: d = os.path.split(f) if d[0] != '' and not d[0] in direcs: direcs.append(d[0]) return direcs def _commandline_dep_string(cc_args, extra_postargs, pp_opts): """ Return commandline representation used to determine if a file needs to be recompiled """ cmdline = 'commandline: ' cmdline += ' '.join(cc_args) cmdline += ' '.join(extra_postargs) cmdline += ' '.join(pp_opts) + '\n' return cmdline def get_dependencies(sources): #XXX scan sources for include statements return _get_headers(_get_directories(sources)) def is_local_src_dir(directory): """Return true if directory is local directory. """ if not is_string(directory): return False abs_dir = os.path.abspath(directory) c = os.path.commonprefix([os.getcwd(), abs_dir]) new_dir = abs_dir[len(c):].split(os.sep) if new_dir and not new_dir[0]: new_dir = new_dir[1:] if new_dir and new_dir[0]=='build': return False new_dir = os.sep.join(new_dir) return os.path.isdir(new_dir) def general_source_files(top_path): pruned_directories = {'CVS':1, '.svn':1, 'build':1} prune_file_pat = re.compile(r'(?:[~#]|\.py[co]|\.o)$') for dirpath, dirnames, filenames in os.walk(top_path, topdown=True): pruned = [ d for d in dirnames if d not in pruned_directories ] dirnames[:] = pruned for f in filenames: if not prune_file_pat.search(f): yield os.path.join(dirpath, f) def general_source_directories_files(top_path): """Return a directory name relative to top_path and files contained. """ pruned_directories = ['CVS', '.svn', 'build'] prune_file_pat = re.compile(r'(?:[~#]|\.py[co]|\.o)$') for dirpath, dirnames, filenames in os.walk(top_path, topdown=True): pruned = [ d for d in dirnames if d not in pruned_directories ] dirnames[:] = pruned for d in dirnames: dpath = os.path.join(dirpath, d) rpath = rel_path(dpath, top_path) files = [] for f in os.listdir(dpath): fn = os.path.join(dpath, f) if os.path.isfile(fn) and not prune_file_pat.search(fn): files.append(fn) yield rpath, files dpath = top_path rpath = rel_path(dpath, top_path) filenames = [os.path.join(dpath, f) for f in os.listdir(dpath) \ if not prune_file_pat.search(f)] files = [f for f in filenames if os.path.isfile(f)] yield rpath, files def get_ext_source_files(ext): # Get sources and any include files in the same directory. filenames = [] sources = [_m for _m in ext.sources if is_string(_m)] filenames.extend(sources) filenames.extend(get_dependencies(sources)) for d in ext.depends: if is_local_src_dir(d): filenames.extend(list(general_source_files(d))) elif os.path.isfile(d): filenames.append(d) return filenames def get_script_files(scripts): scripts = [_m for _m in scripts if is_string(_m)] return scripts def get_lib_source_files(lib): filenames = [] sources = lib[1].get('sources', []) sources = [_m for _m in sources if is_string(_m)] filenames.extend(sources) filenames.extend(get_dependencies(sources)) depends = lib[1].get('depends', []) for d in depends: if is_local_src_dir(d): filenames.extend(list(general_source_files(d))) elif os.path.isfile(d): filenames.append(d) return filenames def get_shared_lib_extension(is_python_ext=False): """Return the correct file extension for shared libraries. Parameters ---------- is_python_ext : bool, optional Whether the shared library is a Python extension. Default is False. Returns ------- so_ext : str The shared library extension. Notes ----- For Python shared libs, `so_ext` will typically be '.so' on Linux and OS X, and '.pyd' on Windows. For Python >= 3.2 `so_ext` has a tag prepended on POSIX systems according to PEP 3149. For Python 3.2 this is implemented on Linux, but not on OS X. """ confvars = distutils.sysconfig.get_config_vars() # SO is deprecated in 3.3.1, use EXT_SUFFIX instead so_ext = confvars.get('EXT_SUFFIX', None) if so_ext is None: so_ext = confvars.get('SO', '') if not is_python_ext: # hardcode known values, config vars (including SHLIB_SUFFIX) are # unreliable (see #3182) # darwin, windows and debug linux are wrong in 3.3.1 and older if (sys.platform.startswith('linux') or sys.platform.startswith('gnukfreebsd')): so_ext = '.so' elif sys.platform.startswith('darwin'): so_ext = '.dylib' elif sys.platform.startswith('win'): so_ext = '.dll' else: # fall back to config vars for unknown platforms # fix long extension for Python >=3.2, see PEP 3149. if 'SOABI' in confvars: # Does nothing unless SOABI config var exists so_ext = so_ext.replace('.' + confvars.get('SOABI'), '', 1) return so_ext def get_data_files(data): if is_string(data): return [data] sources = data[1] filenames = [] for s in sources: if hasattr(s, '__call__'): continue if is_local_src_dir(s): filenames.extend(list(general_source_files(s))) elif is_string(s): if os.path.isfile(s): filenames.append(s) else: print('Not existing data file:', s) else: raise TypeError(repr(s)) return filenames def dot_join(*args): return '.'.join([a for a in args if a]) def get_frame(level=0): """Return frame object from call stack with given level. """ try: return sys._getframe(level+1) except AttributeError: frame = sys.exc_info()[2].tb_frame for _ in range(level+1): frame = frame.f_back return frame ###################### class Configuration(object): _list_keys = ['packages', 'ext_modules', 'data_files', 'include_dirs', 'libraries', 'headers', 'scripts', 'py_modules', 'installed_libraries', 'define_macros'] _dict_keys = ['package_dir', 'installed_pkg_config'] _extra_keys = ['name', 'version'] numpy_include_dirs = [] def __init__(self, package_name=None, parent_name=None, top_path=None, package_path=None, caller_level=1, setup_name='setup.py', **attrs): """Construct configuration instance of a package. package_name -- name of the package Ex.: 'distutils' parent_name -- name of the parent package Ex.: 'numpy' top_path -- directory of the toplevel package Ex.: the directory where the numpy package source sits package_path -- directory of package. Will be computed by magic from the directory of the caller module if not specified Ex.: the directory where numpy.distutils is caller_level -- frame level to caller namespace, internal parameter. """ self.name = dot_join(parent_name, package_name) self.version = None caller_frame = get_frame(caller_level) self.local_path = get_path_from_frame(caller_frame, top_path) # local_path -- directory of a file (usually setup.py) that # defines a configuration() function. # local_path -- directory of a file (usually setup.py) that # defines a configuration() function. if top_path is None: top_path = self.local_path self.local_path = '' if package_path is None: package_path = self.local_path elif os.path.isdir(njoin(self.local_path, package_path)): package_path = njoin(self.local_path, package_path) if not os.path.isdir(package_path or '.'): raise ValueError("%r is not a directory" % (package_path,)) self.top_path = top_path self.package_path = package_path # this is the relative path in the installed package self.path_in_package = os.path.join(*self.name.split('.')) self.list_keys = self._list_keys[:] self.dict_keys = self._dict_keys[:] for n in self.list_keys: v = copy.copy(attrs.get(n, [])) setattr(self, n, as_list(v)) for n in self.dict_keys: v = copy.copy(attrs.get(n, {})) setattr(self, n, v) known_keys = self.list_keys + self.dict_keys self.extra_keys = self._extra_keys[:] for n in attrs.keys(): if n in known_keys: continue a = attrs[n] setattr(self, n, a) if isinstance(a, list): self.list_keys.append(n) elif isinstance(a, dict): self.dict_keys.append(n) else: self.extra_keys.append(n) if os.path.exists(njoin(package_path, '__init__.py')): self.packages.append(self.name) self.package_dir[self.name] = package_path self.options = dict( ignore_setup_xxx_py = False, assume_default_configuration = False, delegate_options_to_subpackages = False, quiet = False, ) caller_instance = None for i in range(1, 3): try: f = get_frame(i) except ValueError: break try: caller_instance = eval('self', f.f_globals, f.f_locals) break except NameError: pass if isinstance(caller_instance, self.__class__): if caller_instance.options['delegate_options_to_subpackages']: self.set_options(**caller_instance.options) self.setup_name = setup_name def todict(self): """ Return a dictionary compatible with the keyword arguments of distutils setup function. Examples -------- >>> setup(**config.todict()) #doctest: +SKIP """ self._optimize_data_files() d = {} known_keys = self.list_keys + self.dict_keys + self.extra_keys for n in known_keys: a = getattr(self, n) if a: d[n] = a return d def info(self, message): if not self.options['quiet']: print(message) def warn(self, message): sys.stderr.write('Warning: %s\n' % (message,)) def set_options(self, **options): """ Configure Configuration instance. The following options are available: - ignore_setup_xxx_py - assume_default_configuration - delegate_options_to_subpackages - quiet """ for key, value in options.items(): if key in self.options: self.options[key] = value else: raise ValueError('Unknown option: '+key) def get_distribution(self): """Return the distutils distribution object for self.""" from numpy.distutils.core import get_distribution return get_distribution() def _wildcard_get_subpackage(self, subpackage_name, parent_name, caller_level = 1): l = subpackage_name.split('.') subpackage_path = njoin([self.local_path]+l) dirs = [_m for _m in sorted_glob(subpackage_path) if os.path.isdir(_m)] config_list = [] for d in dirs: if not os.path.isfile(njoin(d, '__init__.py')): continue if 'build' in d.split(os.sep): continue n = '.'.join(d.split(os.sep)[-len(l):]) c = self.get_subpackage(n, parent_name = parent_name, caller_level = caller_level+1) config_list.extend(c) return config_list def _get_configuration_from_setup_py(self, setup_py, subpackage_name, subpackage_path, parent_name, caller_level = 1): # In case setup_py imports local modules: sys.path.insert(0, os.path.dirname(setup_py)) try: setup_name = os.path.splitext(os.path.basename(setup_py))[0] n = dot_join(self.name, subpackage_name, setup_name) setup_module = npy_load_module('_'.join(n.split('.')), setup_py, ('.py', 'U', 1)) if not hasattr(setup_module, 'configuration'): if not self.options['assume_default_configuration']: self.warn('Assuming default configuration '\ '(%s does not define configuration())'\ % (setup_module)) config = Configuration(subpackage_name, parent_name, self.top_path, subpackage_path, caller_level = caller_level + 1) else: pn = dot_join(*([parent_name] + subpackage_name.split('.')[:-1])) args = (pn,) def fix_args_py2(args): if setup_module.configuration.__code__.co_argcount > 1: args = args + (self.top_path,) return args def fix_args_py3(args): if setup_module.configuration.__code__.co_argcount > 1: args = args + (self.top_path,) return args if sys.version_info[0] < 3: args = fix_args_py2(args) else: args = fix_args_py3(args) config = setup_module.configuration(*args) if config.name!=dot_join(parent_name, subpackage_name): self.warn('Subpackage %r configuration returned as %r' % \ (dot_join(parent_name, subpackage_name), config.name)) finally: del sys.path[0] return config def get_subpackage(self,subpackage_name, subpackage_path=None, parent_name=None, caller_level = 1): """Return list of subpackage configurations. Parameters ---------- subpackage_name : str or None Name of the subpackage to get the configuration. '*' in subpackage_name is handled as a wildcard. subpackage_path : str If None, then the path is assumed to be the local path plus the subpackage_name. If a setup.py file is not found in the subpackage_path, then a default configuration is used. parent_name : str Parent name. """ if subpackage_name is None: if subpackage_path is None: raise ValueError( "either subpackage_name or subpackage_path must be specified") subpackage_name = os.path.basename(subpackage_path) # handle wildcards l = subpackage_name.split('.') if subpackage_path is None and '*' in subpackage_name: return self._wildcard_get_subpackage(subpackage_name, parent_name, caller_level = caller_level+1) assert '*' not in subpackage_name, repr((subpackage_name, subpackage_path, parent_name)) if subpackage_path is None: subpackage_path = njoin([self.local_path] + l) else: subpackage_path = njoin([subpackage_path] + l[:-1]) subpackage_path = self.paths([subpackage_path])[0] setup_py = njoin(subpackage_path, self.setup_name) if not self.options['ignore_setup_xxx_py']: if not os.path.isfile(setup_py): setup_py = njoin(subpackage_path, 'setup_%s.py' % (subpackage_name)) if not os.path.isfile(setup_py): if not self.options['assume_default_configuration']: self.warn('Assuming default configuration '\ '(%s/{setup_%s,setup}.py was not found)' \ % (os.path.dirname(setup_py), subpackage_name)) config = Configuration(subpackage_name, parent_name, self.top_path, subpackage_path, caller_level = caller_level+1) else: config = self._get_configuration_from_setup_py( setup_py, subpackage_name, subpackage_path, parent_name, caller_level = caller_level + 1) if config: return [config] else: return [] def add_subpackage(self,subpackage_name, subpackage_path=None, standalone = False): """Add a sub-package to the current Configuration instance. This is useful in a setup.py script for adding sub-packages to a package. Parameters ---------- subpackage_name : str name of the subpackage subpackage_path : str if given, the subpackage path such as the subpackage is in subpackage_path / subpackage_name. If None,the subpackage is assumed to be located in the local path / subpackage_name. standalone : bool """ if standalone: parent_name = None else: parent_name = self.name config_list = self.get_subpackage(subpackage_name, subpackage_path, parent_name = parent_name, caller_level = 2) if not config_list: self.warn('No configuration returned, assuming unavailable.') for config in config_list: d = config if isinstance(config, Configuration): d = config.todict() assert isinstance(d, dict), repr(type(d)) self.info('Appending %s configuration to %s' \ % (d.get('name'), self.name)) self.dict_append(**d) dist = self.get_distribution() if dist is not None: self.warn('distutils distribution has been initialized,'\ ' it may be too late to add a subpackage '+ subpackage_name) def add_data_dir(self, data_path): """Recursively add files under data_path to data_files list. Recursively add files under data_path to the list of data_files to be installed (and distributed). The data_path can be either a relative path-name, or an absolute path-name, or a 2-tuple where the first argument shows where in the install directory the data directory should be installed to. Parameters ---------- data_path : seq or str Argument can be either * 2-sequence (<datadir suffix>, <path to data directory>) * path to data directory where python datadir suffix defaults to package dir. Notes ----- Rules for installation paths:: foo/bar -> (foo/bar, foo/bar) -> parent/foo/bar (gun, foo/bar) -> parent/gun foo/* -> (foo/a, foo/a), (foo/b, foo/b) -> parent/foo/a, parent/foo/b (gun, foo/*) -> (gun, foo/a), (gun, foo/b) -> gun (gun/*, foo/*) -> parent/gun/a, parent/gun/b /foo/bar -> (bar, /foo/bar) -> parent/bar (gun, /foo/bar) -> parent/gun (fun/*/gun/*, sun/foo/bar) -> parent/fun/foo/gun/bar Examples -------- For example suppose the source directory contains fun/foo.dat and fun/bar/car.dat: >>> self.add_data_dir('fun') #doctest: +SKIP >>> self.add_data_dir(('sun', 'fun')) #doctest: +SKIP >>> self.add_data_dir(('gun', '/full/path/to/fun'))#doctest: +SKIP Will install data-files to the locations:: <package install directory>/ fun/ foo.dat bar/ car.dat sun/ foo.dat bar/ car.dat gun/ foo.dat car.dat """ if is_sequence(data_path): d, data_path = data_path else: d = None if is_sequence(data_path): [self.add_data_dir((d, p)) for p in data_path] return if not is_string(data_path): raise TypeError("not a string: %r" % (data_path,)) if d is None: if os.path.isabs(data_path): return self.add_data_dir((os.path.basename(data_path), data_path)) return self.add_data_dir((data_path, data_path)) paths = self.paths(data_path, include_non_existing=False) if is_glob_pattern(data_path): if is_glob_pattern(d): pattern_list = allpath(d).split(os.sep) pattern_list.reverse() # /a/*//b/ -> /a/*/b rl = list(range(len(pattern_list)-1)); rl.reverse() for i in rl: if not pattern_list[i]: del pattern_list[i] # for path in paths: if not os.path.isdir(path): print('Not a directory, skipping', path) continue rpath = rel_path(path, self.local_path) path_list = rpath.split(os.sep) path_list.reverse() target_list = [] i = 0 for s in pattern_list: if is_glob_pattern(s): if i>=len(path_list): raise ValueError('cannot fill pattern %r with %r' \ % (d, path)) target_list.append(path_list[i]) else: assert s==path_list[i], repr((s, path_list[i], data_path, d, path, rpath)) target_list.append(s) i += 1 if path_list[i:]: self.warn('mismatch of pattern_list=%s and path_list=%s'\ % (pattern_list, path_list)) target_list.reverse() self.add_data_dir((os.sep.join(target_list), path)) else: for path in paths: self.add_data_dir((d, path)) return assert not is_glob_pattern(d), repr(d) dist = self.get_distribution() if dist is not None and dist.data_files is not None: data_files = dist.data_files else: data_files = self.data_files for path in paths: for d1, f in list(general_source_directories_files(path)): target_path = os.path.join(self.path_in_package, d, d1) data_files.append((target_path, f)) def _optimize_data_files(self): data_dict = {} for p, files in self.data_files: if p not in data_dict: data_dict[p] = set() for f in files: data_dict[p].add(f) self.data_files[:] = [(p, list(files)) for p, files in data_dict.items()] def add_data_files(self,*files): """Add data files to configuration data_files. Parameters ---------- files : sequence Argument(s) can be either * 2-sequence (<datadir prefix>,<path to data file(s)>) * paths to data files where python datadir prefix defaults to package dir. Notes ----- The form of each element of the files sequence is very flexible allowing many combinations of where to get the files from the package and where they should ultimately be installed on the system. The most basic usage is for an element of the files argument sequence to be a simple filename. This will cause that file from the local path to be installed to the installation path of the self.name package (package path). The file argument can also be a relative path in which case the entire relative path will be installed into the package directory. Finally, the file can be an absolute path name in which case the file will be found at the absolute path name but installed to the package path. This basic behavior can be augmented by passing a 2-tuple in as the file argument. The first element of the tuple should specify the relative path (under the package install directory) where the remaining sequence of files should be installed to (it has nothing to do with the file-names in the source distribution). The second element of the tuple is the sequence of files that should be installed. The files in this sequence can be filenames, relative paths, or absolute paths. For absolute paths the file will be installed in the top-level package installation directory (regardless of the first argument). Filenames and relative path names will be installed in the package install directory under the path name given as the first element of the tuple. Rules for installation paths: #. file.txt -> (., file.txt)-> parent/file.txt #. foo/file.txt -> (foo, foo/file.txt) -> parent/foo/file.txt #. /foo/bar/file.txt -> (., /foo/bar/file.txt) -> parent/file.txt #. ``*``.txt -> parent/a.txt, parent/b.txt #. foo/``*``.txt`` -> parent/foo/a.txt, parent/foo/b.txt #. ``*/*.txt`` -> (``*``, ``*``/``*``.txt) -> parent/c/a.txt, parent/d/b.txt #. (sun, file.txt) -> parent/sun/file.txt #. (sun, bar/file.txt) -> parent/sun/file.txt #. (sun, /foo/bar/file.txt) -> parent/sun/file.txt #. (sun, ``*``.txt) -> parent/sun/a.txt, parent/sun/b.txt #. (sun, bar/``*``.txt) -> parent/sun/a.txt, parent/sun/b.txt #. (sun/``*``, ``*``/``*``.txt) -> parent/sun/c/a.txt, parent/d/b.txt An additional feature is that the path to a data-file can actually be a function that takes no arguments and returns the actual path(s) to the data-files. This is useful when the data files are generated while building the package. Examples -------- Add files to the list of data_files to be included with the package. >>> self.add_data_files('foo.dat', ... ('fun', ['gun.dat', 'nun/pun.dat', '/tmp/sun.dat']), ... 'bar/cat.dat', ... '/full/path/to/can.dat') #doctest: +SKIP will install these data files to:: <package install directory>/ foo.dat fun/ gun.dat nun/ pun.dat sun.dat bar/ car.dat can.dat where <package install directory> is the package (or sub-package) directory such as '/usr/lib/python2.4/site-packages/mypackage' ('C: \\Python2.4 \\Lib \\site-packages \\mypackage') or '/usr/lib/python2.4/site- packages/mypackage/mysubpackage' ('C: \\Python2.4 \\Lib \\site-packages \\mypackage \\mysubpackage'). """ if len(files)>1: for f in files: self.add_data_files(f) return assert len(files)==1 if is_sequence(files[0]): d, files = files[0] else: d = None if is_string(files): filepat = files elif is_sequence(files): if len(files)==1: filepat = files[0] else: for f in files: self.add_data_files((d, f)) return else: raise TypeError(repr(type(files))) if d is None: if hasattr(filepat, '__call__'): d = '' elif os.path.isabs(filepat): d = '' else: d = os.path.dirname(filepat) self.add_data_files((d, files)) return paths = self.paths(filepat, include_non_existing=False) if is_glob_pattern(filepat): if is_glob_pattern(d): pattern_list = d.split(os.sep) pattern_list.reverse() for path in paths: path_list = path.split(os.sep) path_list.reverse() path_list.pop() # filename target_list = [] i = 0 for s in pattern_list: if is_glob_pattern(s): target_list.append(path_list[i]) i += 1 else: target_list.append(s) target_list.reverse() self.add_data_files((os.sep.join(target_list), path)) else: self.add_data_files((d, paths)) return assert not is_glob_pattern(d), repr((d, filepat)) dist = self.get_distribution() if dist is not None and dist.data_files is not None: data_files = dist.data_files else: data_files = self.data_files data_files.append((os.path.join(self.path_in_package, d), paths)) ### XXX Implement add_py_modules def add_define_macros(self, macros): """Add define macros to configuration Add the given sequence of macro name and value duples to the beginning of the define_macros list This list will be visible to all extension modules of the current package. """ dist = self.get_distribution() if dist is not None: if not hasattr(dist, 'define_macros'): dist.define_macros = [] dist.define_macros.extend(macros) else: self.define_macros.extend(macros) def add_include_dirs(self,*paths): """Add paths to configuration include directories. Add the given sequence of paths to the beginning of the include_dirs list. This list will be visible to all extension modules of the current package. """ include_dirs = self.paths(paths) dist = self.get_distribution() if dist is not None: if dist.include_dirs is None: dist.include_dirs = [] dist.include_dirs.extend(include_dirs) else: self.include_dirs.extend(include_dirs) def add_headers(self,*files): """Add installable headers to configuration. Add the given sequence of files to the beginning of the headers list. By default, headers will be installed under <python- include>/<self.name.replace('.','/')>/ directory. If an item of files is a tuple, then its first argument specifies the actual installation location relative to the <python-include> path. Parameters ---------- files : str or seq Argument(s) can be either: * 2-sequence (<includedir suffix>,<path to header file(s)>) * path(s) to header file(s) where python includedir suffix will default to package name. """ headers = [] for path in files: if is_string(path): [headers.append((self.name, p)) for p in self.paths(path)] else: if not isinstance(path, (tuple, list)) or len(path) != 2: raise TypeError(repr(path)) [headers.append((path[0], p)) for p in self.paths(path[1])] dist = self.get_distribution() if dist is not None: if dist.headers is None: dist.headers = [] dist.headers.extend(headers) else: self.headers.extend(headers) def paths(self,*paths,**kws): """Apply glob to paths and prepend local_path if needed. Applies glob.glob(...) to each path in the sequence (if needed) and pre-pends the local_path if needed. Because this is called on all source lists, this allows wildcard characters to be specified in lists of sources for extension modules and libraries and scripts and allows path-names be relative to the source directory. """ include_non_existing = kws.get('include_non_existing', True) return gpaths(paths, local_path = self.local_path, include_non_existing=include_non_existing) def _fix_paths_dict(self, kw): for k in kw.keys(): v = kw[k] if k in ['sources', 'depends', 'include_dirs', 'library_dirs', 'module_dirs', 'extra_objects']: new_v = self.paths(v) kw[k] = new_v def add_extension(self,name,sources,**kw): """Add extension to configuration. Create and add an Extension instance to the ext_modules list. This method also takes the following optional keyword arguments that are passed on to the Extension constructor. Parameters ---------- name : str name of the extension sources : seq list of the sources. The list of sources may contain functions (called source generators) which must take an extension instance and a build directory as inputs and return a source file or list of source files or None. If None is returned then no sources are generated. If the Extension instance has no sources after processing all source generators, then no extension module is built. include_dirs : define_macros : undef_macros : library_dirs : libraries : runtime_library_dirs : extra_objects : extra_compile_args : extra_link_args : extra_f77_compile_args : extra_f90_compile_args : export_symbols : swig_opts : depends : The depends list contains paths to files or directories that the sources of the extension module depend on. If any path in the depends list is newer than the extension module, then the module will be rebuilt. language : f2py_options : module_dirs : extra_info : dict or list dict or list of dict of keywords to be appended to keywords. Notes ----- The self.paths(...) method is applied to all lists that may contain paths. """ ext_args = copy.copy(kw) ext_args['name'] = dot_join(self.name, name) ext_args['sources'] = sources if 'extra_info' in ext_args: extra_info = ext_args['extra_info'] del ext_args['extra_info'] if isinstance(extra_info, dict): extra_info = [extra_info] for info in extra_info: assert isinstance(info, dict), repr(info) dict_append(ext_args,**info) self._fix_paths_dict(ext_args) # Resolve out-of-tree dependencies libraries = ext_args.get('libraries', []) libnames = [] ext_args['libraries'] = [] for libname in libraries: if isinstance(libname, tuple): self._fix_paths_dict(libname[1]) # Handle library names of the form libname@relative/path/to/library if '@' in libname: lname, lpath = libname.split('@', 1) lpath = os.path.abspath(njoin(self.local_path, lpath)) if os.path.isdir(lpath): c = self.get_subpackage(None, lpath, caller_level = 2) if isinstance(c, Configuration): c = c.todict() for l in [l[0] for l in c.get('libraries', [])]: llname = l.split('__OF__', 1)[0] if llname == lname: c.pop('name', None) dict_append(ext_args,**c) break continue libnames.append(libname) ext_args['libraries'] = libnames + ext_args['libraries'] ext_args['define_macros'] = \ self.define_macros + ext_args.get('define_macros', []) from numpy.distutils.core import Extension ext = Extension(**ext_args) self.ext_modules.append(ext) dist = self.get_distribution() if dist is not None: self.warn('distutils distribution has been initialized,'\ ' it may be too late to add an extension '+name) return ext def add_library(self,name,sources,**build_info): """ Add library to configuration. Parameters ---------- name : str Name of the extension. sources : sequence List of the sources. The list of sources may contain functions (called source generators) which must take an extension instance and a build directory as inputs and return a source file or list of source files or None. If None is returned then no sources are generated. If the Extension instance has no sources after processing all source generators, then no extension module is built. build_info : dict, optional The following keys are allowed: * depends * macros * include_dirs * extra_compiler_args * extra_f77_compile_args * extra_f90_compile_args * f2py_options * language """ self._add_library(name, sources, None, build_info) dist = self.get_distribution() if dist is not None: self.warn('distutils distribution has been initialized,'\ ' it may be too late to add a library '+ name) def _add_library(self, name, sources, install_dir, build_info): """Common implementation for add_library and add_installed_library. Do not use directly""" build_info = copy.copy(build_info) build_info['sources'] = sources # Sometimes, depends is not set up to an empty list by default, and if # depends is not given to add_library, distutils barfs (#1134) if not 'depends' in build_info: build_info['depends'] = [] self._fix_paths_dict(build_info) # Add to libraries list so that it is build with build_clib self.libraries.append((name, build_info)) def add_installed_library(self, name, sources, install_dir, build_info=None): """ Similar to add_library, but the specified library is installed. Most C libraries used with `distutils` are only used to build python extensions, but libraries built through this method will be installed so that they can be reused by third-party packages. Parameters ---------- name : str Name of the installed library. sources : sequence List of the library's source files. See `add_library` for details. install_dir : str Path to install the library, relative to the current sub-package. build_info : dict, optional The following keys are allowed: * depends * macros * include_dirs * extra_compiler_args * extra_f77_compile_args * extra_f90_compile_args * f2py_options * language Returns ------- None See Also -------- add_library, add_npy_pkg_config, get_info Notes ----- The best way to encode the options required to link against the specified C libraries is to use a "libname.ini" file, and use `get_info` to retrieve the required options (see `add_npy_pkg_config` for more information). """ if not build_info: build_info = {} install_dir = os.path.join(self.package_path, install_dir) self._add_library(name, sources, install_dir, build_info) self.installed_libraries.append(InstallableLib(name, build_info, install_dir)) def add_npy_pkg_config(self, template, install_dir, subst_dict=None): """ Generate and install a npy-pkg config file from a template. The config file generated from `template` is installed in the given install directory, using `subst_dict` for variable substitution. Parameters ---------- template : str The path of the template, relatively to the current package path. install_dir : str Where to install the npy-pkg config file, relatively to the current package path. subst_dict : dict, optional If given, any string of the form ``@key@`` will be replaced by ``subst_dict[key]`` in the template file when installed. The install prefix is always available through the variable ``@prefix@``, since the install prefix is not easy to get reliably from setup.py. See also -------- add_installed_library, get_info Notes ----- This works for both standard installs and in-place builds, i.e. the ``@prefix@`` refer to the source directory for in-place builds. Examples -------- :: config.add_npy_pkg_config('foo.ini.in', 'lib', {'foo': bar}) Assuming the foo.ini.in file has the following content:: [meta] Name=@foo@ Version=1.0 Description=dummy description [default] Cflags=-I@prefix@/include Libs= The generated file will have the following content:: [meta] Name=bar Version=1.0 Description=dummy description [default] Cflags=-Iprefix_dir/include Libs= and will be installed as foo.ini in the 'lib' subpath. Cross-compilation ----------------- When cross-compiling with numpy distutils, it might be necessary to use modified npy-pkg-config files. Using the default/generated files will link with the host libraries (i.e. libnpymath.a). For cross-compilation you of-course need to link with target libraries, while using the host Python installation. You can copy out the numpy/core/lib/npy-pkg-config directory, add a pkgdir value to the .ini files and set NPY_PKG_CONFIG_PATH environment variable to point to the directory with the modified npy-pkg-config files. Example npymath.ini modified for cross-compilation:: [meta] Name=npymath Description=Portable, core math library implementing C99 standard Version=0.1 [variables] pkgname=numpy.core pkgdir=/build/arm-linux-gnueabi/sysroot/usr/lib/python3.7/site-packages/numpy/core prefix=${pkgdir} libdir=${prefix}/lib includedir=${prefix}/include [default] Libs=-L${libdir} -lnpymath Cflags=-I${includedir} Requires=mlib [msvc] Libs=/LIBPATH:${libdir} npymath.lib Cflags=/INCLUDE:${includedir} Requires=mlib """ if subst_dict is None: subst_dict = {} template = os.path.join(self.package_path, template) if self.name in self.installed_pkg_config: self.installed_pkg_config[self.name].append((template, install_dir, subst_dict)) else: self.installed_pkg_config[self.name] = [(template, install_dir, subst_dict)] def add_scripts(self,*files): """Add scripts to configuration. Add the sequence of files to the beginning of the scripts list. Scripts will be installed under the <prefix>/bin/ directory. """ scripts = self.paths(files) dist = self.get_distribution() if dist is not None: if dist.scripts is None: dist.scripts = [] dist.scripts.extend(scripts) else: self.scripts.extend(scripts) def dict_append(self,**dict): for key in self.list_keys: a = getattr(self, key) a.extend(dict.get(key, [])) for key in self.dict_keys: a = getattr(self, key) a.update(dict.get(key, {})) known_keys = self.list_keys + self.dict_keys + self.extra_keys for key in dict.keys(): if key not in known_keys: a = getattr(self, key, None) if a and a==dict[key]: continue self.warn('Inheriting attribute %r=%r from %r' \ % (key, dict[key], dict.get('name', '?'))) setattr(self, key, dict[key]) self.extra_keys.append(key) elif key in self.extra_keys: self.info('Ignoring attempt to set %r (from %r to %r)' \ % (key, getattr(self, key), dict[key])) elif key in known_keys: # key is already processed above pass else: raise ValueError("Don't know about key=%r" % (key)) def __str__(self): from pprint import pformat known_keys = self.list_keys + self.dict_keys + self.extra_keys s = '<'+5*'-' + '\n' s += 'Configuration of '+self.name+':\n' known_keys.sort() for k in known_keys: a = getattr(self, k, None) if a: s += '%s = %s\n' % (k, pformat(a)) s += 5*'-' + '>' return s def get_config_cmd(self): """ Returns the numpy.distutils config command instance. """ cmd = get_cmd('config') cmd.ensure_finalized() cmd.dump_source = 0 cmd.noisy = 0 old_path = os.environ.get('PATH') if old_path: path = os.pathsep.join(['.', old_path]) os.environ['PATH'] = path return cmd def get_build_temp_dir(self): """ Return a path to a temporary directory where temporary files should be placed. """ cmd = get_cmd('build') cmd.ensure_finalized() return cmd.build_temp def have_f77c(self): """Check for availability of Fortran 77 compiler. Use it inside source generating function to ensure that setup distribution instance has been initialized. Notes ----- True if a Fortran 77 compiler is available (because a simple Fortran 77 code was able to be compiled successfully). """ simple_fortran_subroutine = ''' subroutine simple end ''' config_cmd = self.get_config_cmd() flag = config_cmd.try_compile(simple_fortran_subroutine, lang='f77') return flag def have_f90c(self): """Check for availability of Fortran 90 compiler. Use it inside source generating function to ensure that setup distribution instance has been initialized. Notes ----- True if a Fortran 90 compiler is available (because a simple Fortran 90 code was able to be compiled successfully) """ simple_fortran_subroutine = ''' subroutine simple end ''' config_cmd = self.get_config_cmd() flag = config_cmd.try_compile(simple_fortran_subroutine, lang='f90') return flag def append_to(self, extlib): """Append libraries, include_dirs to extension or library item. """ if is_sequence(extlib): lib_name, build_info = extlib dict_append(build_info, libraries=self.libraries, include_dirs=self.include_dirs) else: from numpy.distutils.core import Extension assert isinstance(extlib, Extension), repr(extlib) extlib.libraries.extend(self.libraries) extlib.include_dirs.extend(self.include_dirs) def _get_svn_revision(self, path): """Return path's SVN revision number. """ try: output = subprocess.check_output( ['svnversion'], shell=True, cwd=path) except (subprocess.CalledProcessError, OSError): pass else: m = re.match(rb'(?P<revision>\d+)', output) if m: return int(m.group('revision')) if sys.platform=='win32' and os.environ.get('SVN_ASP_DOT_NET_HACK', None): entries = njoin(path, '_svn', 'entries') else: entries = njoin(path, '.svn', 'entries') if os.path.isfile(entries): with open(entries) as f: fstr = f.read() if fstr[:5] == '<?xml': # pre 1.4 m = re.search(r'revision="(?P<revision>\d+)"', fstr) if m: return int(m.group('revision')) else: # non-xml entries file --- check to be sure that m = re.search(r'dir[\n\r]+(?P<revision>\d+)', fstr) if m: return int(m.group('revision')) return None def _get_hg_revision(self, path): """Return path's Mercurial revision number. """ try: output = subprocess.check_output( ['hg identify --num'], shell=True, cwd=path) except (subprocess.CalledProcessError, OSError): pass else: m = re.match(rb'(?P<revision>\d+)', output) if m: return int(m.group('revision')) branch_fn = njoin(path, '.hg', 'branch') branch_cache_fn = njoin(path, '.hg', 'branch.cache') if os.path.isfile(branch_fn): branch0 = None with open(branch_fn) as f: revision0 = f.read().strip() branch_map = {} for line in file(branch_cache_fn, 'r'): branch1, revision1 = line.split()[:2] if revision1==revision0: branch0 = branch1 try: revision1 = int(revision1) except ValueError: continue branch_map[branch1] = revision1 return branch_map.get(branch0) return None def get_version(self, version_file=None, version_variable=None): """Try to get version string of a package. Return a version string of the current package or None if the version information could not be detected. Notes ----- This method scans files named __version__.py, <packagename>_version.py, version.py, and __svn_version__.py for string variables version, __version__, and <packagename>_version, until a version number is found. """ version = getattr(self, 'version', None) if version is not None: return version # Get version from version file. if version_file is None: files = ['__version__.py', self.name.split('.')[-1]+'_version.py', 'version.py', '__svn_version__.py', '__hg_version__.py'] else: files = [version_file] if version_variable is None: version_vars = ['version', '__version__', self.name.split('.')[-1]+'_version'] else: version_vars = [version_variable] for f in files: fn = njoin(self.local_path, f) if os.path.isfile(fn): info = ('.py', 'U', 1) name = os.path.splitext(os.path.basename(fn))[0] n = dot_join(self.name, name) try: version_module = npy_load_module('_'.join(n.split('.')), fn, info) except ImportError: msg = get_exception() self.warn(str(msg)) version_module = None if version_module is None: continue for a in version_vars: version = getattr(version_module, a, None) if version is not None: break if version is not None: break if version is not None: self.version = version return version # Get version as SVN or Mercurial revision number revision = self._get_svn_revision(self.local_path) if revision is None: revision = self._get_hg_revision(self.local_path) if revision is not None: version = str(revision) self.version = version return version def make_svn_version_py(self, delete=True): """Appends a data function to the data_files list that will generate __svn_version__.py file to the current package directory. Generate package __svn_version__.py file from SVN revision number, it will be removed after python exits but will be available when sdist, etc commands are executed. Notes ----- If __svn_version__.py existed before, nothing is done. This is intended for working with source directories that are in an SVN repository. """ target = njoin(self.local_path, '__svn_version__.py') revision = self._get_svn_revision(self.local_path) if os.path.isfile(target) or revision is None: return else: def generate_svn_version_py(): if not os.path.isfile(target): version = str(revision) self.info('Creating %s (version=%r)' % (target, version)) with open(target, 'w') as f: f.write('version = %r\n' % (version)) def rm_file(f=target,p=self.info): if delete: try: os.remove(f); p('removed '+f) except OSError: pass try: os.remove(f+'c'); p('removed '+f+'c') except OSError: pass atexit.register(rm_file) return target self.add_data_files(('', generate_svn_version_py())) def make_hg_version_py(self, delete=True): """Appends a data function to the data_files list that will generate __hg_version__.py file to the current package directory. Generate package __hg_version__.py file from Mercurial revision, it will be removed after python exits but will be available when sdist, etc commands are executed. Notes ----- If __hg_version__.py existed before, nothing is done. This is intended for working with source directories that are in an Mercurial repository. """ target = njoin(self.local_path, '__hg_version__.py') revision = self._get_hg_revision(self.local_path) if os.path.isfile(target) or revision is None: return else: def generate_hg_version_py(): if not os.path.isfile(target): version = str(revision) self.info('Creating %s (version=%r)' % (target, version)) with open(target, 'w') as f: f.write('version = %r\n' % (version)) def rm_file(f=target,p=self.info): if delete: try: os.remove(f); p('removed '+f) except OSError: pass try: os.remove(f+'c'); p('removed '+f+'c') except OSError: pass atexit.register(rm_file) return target self.add_data_files(('', generate_hg_version_py())) def make_config_py(self,name='__config__'): """Generate package __config__.py file containing system_info information used during building the package. This file is installed to the package installation directory. """ self.py_modules.append((self.name, name, generate_config_py)) def get_info(self,*names): """Get resources information. Return information (from system_info.get_info) for all of the names in the argument list in a single dictionary. """ from .system_info import get_info, dict_append info_dict = {} for a in names: dict_append(info_dict,**get_info(a)) return info_dict def get_cmd(cmdname, _cache={}): if cmdname not in _cache: import distutils.core dist = distutils.core._setup_distribution if dist is None: from distutils.errors import DistutilsInternalError raise DistutilsInternalError( 'setup distribution instance not initialized') cmd = dist.get_command_obj(cmdname) _cache[cmdname] = cmd return _cache[cmdname] def get_numpy_include_dirs(): # numpy_include_dirs are set by numpy/core/setup.py, otherwise [] include_dirs = Configuration.numpy_include_dirs[:] if not include_dirs: import numpy include_dirs = [ numpy.get_include() ] # else running numpy/core/setup.py return include_dirs def get_npy_pkg_dir(): """Return the path where to find the npy-pkg-config directory. If the NPY_PKG_CONFIG_PATH environment variable is set, the value of that is returned. Otherwise, a path inside the location of the numpy module is returned. The NPY_PKG_CONFIG_PATH can be useful when cross-compiling, maintaining customized npy-pkg-config .ini files for the cross-compilation environment, and using them when cross-compiling. """ # XXX: import here for bootstrapping reasons import numpy d = os.environ.get('NPY_PKG_CONFIG_PATH') if d is not None: return d d = os.path.join(os.path.dirname(numpy.__file__), 'core', 'lib', 'npy-pkg-config') return d def get_pkg_info(pkgname, dirs=None): """ Return library info for the given package. Parameters ---------- pkgname : str Name of the package (should match the name of the .ini file, without the extension, e.g. foo for the file foo.ini). dirs : sequence, optional If given, should be a sequence of additional directories where to look for npy-pkg-config files. Those directories are searched prior to the NumPy directory. Returns ------- pkginfo : class instance The `LibraryInfo` instance containing the build information. Raises ------ PkgNotFound If the package is not found. See Also -------- Configuration.add_npy_pkg_config, Configuration.add_installed_library, get_info """ from numpy.distutils.npy_pkg_config import read_config if dirs: dirs.append(get_npy_pkg_dir()) else: dirs = [get_npy_pkg_dir()] return read_config(pkgname, dirs) def get_info(pkgname, dirs=None): """ Return an info dict for a given C library. The info dict contains the necessary options to use the C library. Parameters ---------- pkgname : str Name of the package (should match the name of the .ini file, without the extension, e.g. foo for the file foo.ini). dirs : sequence, optional If given, should be a sequence of additional directories where to look for npy-pkg-config files. Those directories are searched prior to the NumPy directory. Returns ------- info : dict The dictionary with build information. Raises ------ PkgNotFound If the package is not found. See Also -------- Configuration.add_npy_pkg_config, Configuration.add_installed_library, get_pkg_info Examples -------- To get the necessary information for the npymath library from NumPy: >>> npymath_info = np.distutils.misc_util.get_info('npymath') >>> npymath_info #doctest: +SKIP {'define_macros': [], 'libraries': ['npymath'], 'library_dirs': ['.../numpy/core/lib'], 'include_dirs': ['.../numpy/core/include']} This info dict can then be used as input to a `Configuration` instance:: config.add_extension('foo', sources=['foo.c'], extra_info=npymath_info) """ from numpy.distutils.npy_pkg_config import parse_flags pkg_info = get_pkg_info(pkgname, dirs) # Translate LibraryInfo instance into a build_info dict info = parse_flags(pkg_info.cflags()) for k, v in parse_flags(pkg_info.libs()).items(): info[k].extend(v) # add_extension extra_info argument is ANAL info['define_macros'] = info['macros'] del info['macros'] del info['ignored'] return info def is_bootstrapping(): if sys.version_info[0] >= 3: import builtins else: import __builtin__ as builtins try: builtins.__NUMPY_SETUP__ return True except AttributeError: return False ######################### def default_config_dict(name = None, parent_name = None, local_path=None): """Return a configuration dictionary for usage in configuration() function defined in file setup_<name>.py. """ import warnings warnings.warn('Use Configuration(%r,%r,top_path=%r) instead of '\ 'deprecated default_config_dict(%r,%r,%r)' % (name, parent_name, local_path, name, parent_name, local_path, ), stacklevel=2) c = Configuration(name, parent_name, local_path) return c.todict() def dict_append(d, **kws): for k, v in kws.items(): if k in d: ov = d[k] if isinstance(ov, str): d[k] = v else: d[k].extend(v) else: d[k] = v def appendpath(prefix, path): if os.path.sep != '/': prefix = prefix.replace('/', os.path.sep) path = path.replace('/', os.path.sep) drive = '' if os.path.isabs(path): drive = os.path.splitdrive(prefix)[0] absprefix = os.path.splitdrive(os.path.abspath(prefix))[1] pathdrive, path = os.path.splitdrive(path) d = os.path.commonprefix([absprefix, path]) if os.path.join(absprefix[:len(d)], absprefix[len(d):]) != absprefix \ or os.path.join(path[:len(d)], path[len(d):]) != path: # Handle invalid paths d = os.path.dirname(d) subpath = path[len(d):] if os.path.isabs(subpath): subpath = subpath[1:] else: subpath = path return os.path.normpath(njoin(drive + prefix, subpath)) def generate_config_py(target): """Generate config.py file containing system_info information used during building the package. Usage: config['py_modules'].append((packagename, '__config__',generate_config_py)) """ from numpy.distutils.system_info import system_info from distutils.dir_util import mkpath mkpath(os.path.dirname(target)) with open(target, 'w') as f: f.write('# This file is generated by numpy\'s %s\n' % (os.path.basename(sys.argv[0]))) f.write('# It contains system_info results at the time of building this package.\n') f.write('__all__ = ["get_info","show"]\n\n') # For gfortran+msvc combination, extra shared libraries may exist f.write(textwrap.dedent(""" import os import sys extra_dll_dir = os.path.join(os.path.dirname(__file__), '.libs') if sys.platform == 'win32' and os.path.isdir(extra_dll_dir): os.environ.setdefault('PATH', '') os.environ['PATH'] += os.pathsep + extra_dll_dir """)) for k, i in system_info.saved_results.items(): f.write('%s=%r\n' % (k, i)) f.write(textwrap.dedent(r''' def get_info(name): g = globals() return g.get(name, g.get(name + "_info", {})) def show(): for name,info_dict in globals().items(): if name[0] == "_" or type(info_dict) is not type({}): continue print(name + ":") if not info_dict: print(" NOT AVAILABLE") for k,v in info_dict.items(): v = str(v) if k == "sources" and len(v) > 200: v = v[:60] + " ...\n... " + v[-60:] print(" %s = %s" % (k,v)) ''')) return target def msvc_version(compiler): """Return version major and minor of compiler instance if it is MSVC, raise an exception otherwise.""" if not compiler.compiler_type == "msvc": raise ValueError("Compiler instance is not msvc (%s)"\ % compiler.compiler_type) return compiler._MSVCCompiler__version def get_build_architecture(): # Importing distutils.msvccompiler triggers a warning on non-Windows # systems, so delay the import to here. from distutils.msvccompiler import get_build_architecture return get_build_architecture()
bsd-3-clause
-7,108,239,796,244,576,000
34.67678
102
0.544808
false
yunohost-bot/apps
list_builder.py
1
11421
#!/usr/bin/env python2 import re import os import sys import time import json import zlib import argparse import requests from dateutil.parser import parse # Regular expression patterns re_commit_author = re.compile( r'^author (?P<name>.+) <(?P<email>.+)> (?P<time>\d+) (?P<tz>[+-]\d+)$', re.MULTILINE ) # Helpers def fail(msg, retcode=1): """Show failure message and exit.""" print("Error: {0:s}".format(msg)) sys.exit(retcode) def include_translations_in_manifest(app_name, manifest): for i in os.listdir("locales"): if not i.endswith("json"): continue if i == "en.json": continue current_lang = i.split(".")[0] translations = json.load(open(os.path.join("locales", i), "r")) key = "%s_manifest_description" % app_name if key in translations and translations[key]: manifest["description"][current_lang] = translations[key] for category, questions in manifest["arguments"].items(): for question in questions: key = "%s_manifest_arguments_%s_%s" % (app_name, category, question["name"]) # don't overwrite already existing translation in manifests for now if key in translations and translations[key] and not current_lang not in question["ask"]: print "[ask]", current_lang, key question["ask"][current_lang] = translations[key] key = "%s_manifest_arguments_%s_help_%s" % (app_name, category, question["name"]) # don't overwrite already existing translation in manifests for now if key in translations and translations[key] and not current_lang not in question.get("help", []): print "[help]", current_lang, key question["help"][current_lang] = translations[key] return manifest def get_json(url, verify=True): try: # Retrieve and load manifest if ".github" in url: r = requests.get(url, verify=verify, auth=token) else: r = requests.get(url, verify=verify) r.raise_for_status() return r.json() except requests.exceptions.RequestException as e: print("-> Error: unable to request %s, %s" % (url, e)) return None except ValueError as e: print("-> Error: unable to decode json from %s : %s" % (url, e)) return None def get_zlib(url, verify=True): try: # Retrieve last commit information r = requests.get(obj_url, verify=verify) r.raise_for_status() return zlib.decompress(r.content).decode('utf-8').split('\x00') except requests.exceptions.RequestException as e: print("-> Error: unable to request %s, %s" % (obj_url, e)) return None except zlib.error as e: print("-> Error: unable to decompress object from %s : %s" % (url, e)) return None # Main # Create argument parser parser = argparse.ArgumentParser(description='Process YunoHost application list.') # Add arguments and options parser.add_argument("input", help="Path to json input file") parser.add_argument("-o", "--output", help="Path to result file. If not specified, '-build' suffix will be added to input filename.") parser.add_argument("-g", "--github", help="Github token <username>:<password>") # Parse args args = parser.parse_args() try: # Retrieve apps list from json file with open(args.input) as f: apps_list = json.load(f) except IOError as e: fail("%s file not found" % args.input) # Get list name from filename list_name = os.path.splitext(os.path.basename(args.input))[0] print(":: Building %s list..." % list_name) # Args default if not args.output: args.output = '%s-build.json' % list_name already_built_file = {} if os.path.exists(args.output): try: already_built_file = json.load(open(args.output)) except Exception as e: print("Error while trying to load already built file: %s" % e) # GitHub credentials if args.github: token = (args.github.split(':')[0], args.github.split(':')[1]) else: token = None # Loop through every apps result_dict = {} for app, info in apps_list.items(): print("---") print("Processing '%s'..." % app) app = app.lower() # Store usefull values app_branch = info['branch'] app_url = info['url'] app_rev = info['revision'] app_state = info["state"] app_level = info.get("level") app_maintained = info.get("maintained", True) forge_site = app_url.split('/')[2] owner = app_url.split('/')[3] repo = app_url.split('/')[4] if forge_site == "github.com": forge_type = "github" elif forge_site == "framagit.org": forge_type = "gitlab" elif forge_site == "code.ffdn.org": forge_type = "gogs" else: forge_type = "unknown" previous_state = already_built_file.get(app, {}).get("state", {}) manifest = {} timestamp = None previous_rev = already_built_file.get(app, {}).get("git", {}).get("revision", None) previous_url = already_built_file.get(app, {}).get("git", {}).get("url") previous_level = already_built_file.get(app, {}).get("level") previous_maintained = already_built_file.get(app, {}).get("maintained") if forge_type == "github" and app_rev == "HEAD": if previous_rev is None: previous_rev = 'HEAD' url = "https://api.github.com/repos/{}/{}/git/refs/heads/{}".format(owner, repo, app_branch) head = get_json(url) app_rev = head["object"]["sha"] url = "https://api.github.com/repos/{}/{}/compare/{}...{}".format(owner, repo, previous_rev, app_branch) diff = get_json(url) if not diff["commits"]: app_rev = previous_rev if previous_rev != 'HEAD' else app_rev else: # Only if those files got updated, do we want to update the # commit (otherwise that would trigger an unecessary upgrade) ignore_files = [ "README.md", "LICENSE", ".gitignore", "check_process", ".travis.yml" ] diff_files = [ f for f in diff["files"] if f["filename"] not in ignore_files ] if diff_files: print("This app points to HEAD and significant changes where found between HEAD and previous commit") app_rev = diff["commits"][-1]["sha"] else: print("This app points to HEAD but no significant changes where found compared to HEAD, so keeping the previous commit") app_rev = previous_rev if previous_rev != 'HEAD' else app_rev print("Previous commit : %s" % previous_rev) print("Current commit : %s" % app_rev) if previous_rev == app_rev and previous_url == app_url: print("Already up to date, ignoring") result_dict[app] = already_built_file[app] if previous_state != app_state: result_dict[app]["state"] = app_state print("... but has changed of state, updating it from '%s' to '%s'" % (previous_state, app_state)) if previous_level != app_level or app_level is None: result_dict[app]["level"] = app_level print("... but has changed of level, updating it from '%s' to '%s'" % (previous_level, app_level)) if previous_maintained != app_maintained: result_dict[app]["maintained"] = app_maintained print("... but maintained status changed, updating it from '%s' to '%s'" % (previous_maintained, app_maintained)) print "update translations but don't download anything" result_dict[app]['manifest'] = include_translations_in_manifest(app, result_dict[app]['manifest']) continue print("Revision changed ! Updating...") # Hosted on GitHub if forge_type == "github": raw_url = 'https://raw.githubusercontent.com/%s/%s/%s/manifest.json' % ( owner, repo, app_rev ) manifest = get_json(raw_url) if manifest is None: continue api_url = 'https://api.github.com/repos/%s/%s/commits/%s' % ( owner, repo, app_rev ) info2 = get_json(api_url) if info2 is None: continue commit_date = parse(info2['commit']['author']['date']) timestamp = int(time.mktime(commit_date.timetuple())) # Gitlab-type forge elif forge_type == "gitlab": raw_url = '%s/raw/%s/manifest.json' % (app_url, app_rev) manifest = get_json(raw_url, verify=True) if manifest is None: continue api_url = 'https://%s/api/v4/projects/%s%%2F%s/repository/commits/%s' % (forge_site, owner, repo, app_rev) commit = get_json(api_url) if commit is None: continue commit_date = parse(commit["authored_date"]) timestamp = int(time.mktime(commit_date.timetuple())) # Gogs-type forge elif forge_type == "gogs": if not app_url.endswith('.git'): app_url += ".git" raw_url = '%s/raw/%s/manifest.json' % (app_url[:-4], app_rev) manifest = get_json(raw_url, verify=False) if manifest is None: continue obj_url = '%s/objects/%s/%s' % ( app_url, app_rev[0:2], app_rev[2:] ) commit = get_zlib(obj_url, verify=False) if commit is None or len(commit) < 2: continue else: commit = commit[1] # Extract author line and commit date commit_author = re_commit_author.search(commit) if not commit_author: print("-> Error: author line in commit not found") continue # Construct UTC timestamp timestamp = int(commit_author.group('time')) tz = commit_author.group('tz') if len(tz) != 5: print("-> Error: unexpected timezone length in commit") continue elif tz != '+0000': tdelta = (int(tz[1:3]) * 3600) + (int(tz[3:5]) * 60) if tz[0] == '+': timestamp -= tdelta elif tz[0] == '-': timestamp += tdelta else: print("-> Error: unexpected timezone format in commit") continue else: print("-> Error: unsupported VCS and/or protocol") continue if manifest["id"] != app or manifest["id"] != repo.replace("_ynh", ""): print("Warning: IDs different between community.json, manifest and repo name") print(" Manifest id : %s" % manifest["id"]) print(" Name in community json : %s" % app) print(" Repo name : %s" % repo.replace("_ynh", "")) try: result_dict[manifest['id']] = { 'git': { 'branch': info['branch'], 'revision': app_rev, 'url': app_url }, 'lastUpdate': timestamp, 'manifest': include_translations_in_manifest(manifest['id'], manifest), 'state': info['state'], 'level': info.get('level', '?'), 'maintained': app_maintained } except KeyError as e: print("-> Error: invalid app info or manifest, %s" % e) continue # Write resulting file with open(args.output, 'w') as f: f.write(json.dumps(result_dict, sort_keys=True)) print("\nDone! Written in %s" % args.output)
gpl-3.0
-4,528,834,335,519,708,700
33.504532
136
0.57762
false
osrf/osrf_hw
kicad_scripts/check_component_availability.py
1
1943
#!/usr/bin/env python from __future__ import print_function import csv import os import sys import urllib2 def import_csv(filename): if not os.path.isfile(filename): print('pinfile not found') return with open(filename, mode='r') as infile: reader = csv.reader(infile) part_dict = {rows[5]:rows[8] for rows in reader} return part_dict def check_availability(url, website): webpage = urllib2.urlopen(url) content = webpage.read() if website == 'digikey': str_qty = 'Digi-Key Stock: ' # quantityAvailable":"' idx = content.find(str_qty) if idx == -1: return 0 idx2 = content[idx + len(str_qty):].find(' ') result = content[idx + len(str_qty):idx + len(str_qty) + idx2] result = result.replace(',','') elif website == 'mouser': str_qty = ' Can Ship Immediately' idx = content.find(str_qty) print('idx: {}'.format(idx)) if idx == -1: return -1 idx2 = content[:str_qty].rfind('\n') result = content[idx2:idx] else: return -1 return int(result) if len(sys.argv) != 2: print('invalid number of arguments') sys.exit() if not os.path.isfile(sys.argv[1]): print('BOM file {} does not exist'.format(sys.argv[1])) sys.exit() filepath = sys.argv[1] dictionary = import_csv(filepath) unavailable_components = [] for mfp, url in dictionary.items(): qty = -1 if not mfp in ['MFP', 'DNP']: print('poking {}'.format(url)) if url.find('digikey.com') != -1: qty = check_availability(url, 'digikey') # FIXME not working for mouser for now # elif url.find('mouser.com') != -1: # qty = check_availability(url, 'mouser') if qty <= 1: unavailable_components.append(mfp) print('checked availability of {}: {} remaining'.format(mfp, qty)) print(unavailable_components)
apache-2.0
1,384,212,045,585,071,900
29.84127
74
0.587751
false
jgamblin/btrecon
btrecon.py
1
1501
#!/usr/bin/env python # Name: btrecon.py # Purpose: Bluetooth Scanner # By: Jerry Gamblin # Date: 02.11.15 # Modified 02.11.15 # Rev Level 0.5 # ----------------------------------------------- import os import re import time import sys import subprocess import readline def color(text, color_code): if sys.platform == "win32" and os.getenv("TERM") != "xterm": return text return '\x1b[%dm%s\x1b[0m' % (color_code, text) def red(text): return color(text, 31) def blink(text): return color(text, 5) def green(text): return color(text, 32) def blue(text): return color(text, 34) #clean up old files os.system("rm -rf devices.txt") os.system("rm -rf btaddresses.txt") print "\n" print "Finding Bluetooth Devices..." os.system("hcitool -i hci0 scan > devices.txt") print "Found The Following Devices:" os.system("cat devices.txt | grep -i '[0-9A-F]\{2\}\(:[0-9A-F]\{2\}\)\{5\}'") os.system("cat devices.txt | grep -o '[0-9A-F]\{2\}\(:[0-9A-F]\{2\}\)\{5\}' > btaddresses.txt") b = open('btaddresses.txt') macs = b.readlines() b.close() print "\n" print "Starting Information Gathering" print "\n" for mac in macs: print (green("Information about %s" % mac)) subprocess.call("hcitool name %s" % mac, shell=True) print "\n" subprocess.call("hcitool info %s" % mac, shell=True) print "\n" subprocess.call("sdptool records %s" % mac, shell=True) print "\n" subprocess.call("sdptool browse %s" % mac, shell=True) print "\n" print "\n"
mit
-6,145,480,689,312,573,000
20.753623
95
0.623584
false
CGATOxford/CGATPipelines
CGATPipelines/PipelineWindows.py
1
39870
'''PipelineWindows - Tasks for window based read distribution analysis ====================================================================== Requirements: * bedtools >= 2.21.0 * picardtools >= 1.106 * samtools >= 1.1 * MEDIPS >= 1.15.0 Reference --------- ''' import os import re import collections import pandas import math import numpy import numpy.ma as ma import itertools import CGAT.Experiment as E import CGATPipelines.Pipeline as P import CGAT.BamTools as BamTools import CGAT.IOTools as IOTools import CGAT.Expression as Expression import CGAT.Bed as Bed def convertReadsToIntervals(bamfile, bedfile, filtering_quality=None, filtering_dedup=None, filtering_dedup_method='picard', filtering_nonunique=False): '''convert reads in *bamfile* to *intervals*. This method converts read data into intervals for counting based methods. This method is not appropriate for RNA-Seq. Optional steps include: For paired end data, pairs are merged and optionally filtered by insert size. Arguments --------- bamfile : string Filename of input file in :term:`bam` format. bedfile : string Filename of output file in :term:`bed` format. filtering_quality : int If set, remove reads with a quality score below given threshold. filtering_dedup : bool If True, deduplicate data. filtering_dedup_method : string Deduplication method. Possible options are ``picard`` and ``samtools``. filtering_nonunique : bool If True, remove non-uniquely matching reads. ''' track = P.snip(bedfile, ".bed.gz") is_paired = BamTools.isPaired(bamfile) current_file = bamfile tmpdir = P.getTempFilename() os.unlink(tmpdir) statement = ["mkdir %(tmpdir)s"] nfiles = 0 if filtering_quality > 0: next_file = "%(tmpdir)s/bam_%(nfiles)i.bam" % locals() statement.append('''samtools view -q %(filtering_quality)i -b %(current_file)s 2>> %%(bedfile)s.quality.log > %(next_file)s ''' % locals()) nfiles += 1 current_file = next_file if filtering_nonunique: next_file = "%(tmpdir)s/bam_%(nfiles)i.bam" % locals() statement.append('''cat %(current_file)s | cgat bam2bam --method=filter --filter-method=unique,mapped --log=%%(bedfile)s.nonunique.log > %(next_file)s ''' % locals()) nfiles += 1 current_file = next_file if filtering_dedup is not None: # Picard's MarkDuplicates requries an explicit bam file. next_file = "%(tmpdir)s/bam_%(nfiles)i.bam" % locals() if filtering_dedup_method == 'samtools': statement.append('''samtools rmdup - - ''') elif filtering_dedup_method == 'picard': statement.append('''picard MarkDuplicates INPUT=%(current_file)s OUTPUT=%(next_file)s ASSUME_SORTED=TRUE METRICS_FILE=%(bedfile)s.duplicate_metrics REMOVE_DUPLICATES=TRUE VALIDATION_STRINGENCY=SILENT 2>> %%(bedfile)s.markdup.log ''' % locals()) nfiles += 1 current_file = next_file if is_paired: statement.append('''cat %(current_file)s | cgat bam2bed --merge-pairs --min-insert-size=%(filtering_min_insert_size)i --max-insert-size=%(filtering_max_insert_size)i --log=%(bedfile)s.bam2bed.log - | cgat bed2bed --method=sanitize-genome --genome-file=%(genome_dir)s/%(genome)s --log=%(bedfile)s.sanitize.log | cut -f 1,2,3,4 | sort -k1,1 -k2,2n | bgzip > %(bedfile)s''') else: statement.append('''cat %(current_file)s | cgat bam2bed --log=%(bedfile)s.bam2bed.log - | cgat bed2bed --method=sanitize-genome --genome-file=%(genome_dir)s/%(genome)s --log=%(bedfile)s.sanitize.log | cut -f 1,2,3,4 | sort -k1,1 -k2,2n | bgzip > %(bedfile)s''') statement.append("tabix -p bed %(bedfile)s") statement.append("rm -rf %(tmpdir)s") statement = " ; checkpoint; ".join(statement) P.run() def countTags(infile, outfile): '''count number of tags in bed-file. `outfile` will contain the number of tags in `infile` counted per chromosome. Arguments ========= infile : string Input filename in :term:`bed` format outfile : string Output filename in :term:`tsv` format. ''' statement = '''zcat %(infile)s | cgat bed2stats --per-contig --log=%(outfile)s.log >& %(outfile)s''' P.run() def countTagsWithinWindows(tagfile, windowfile, outfile, counting_method="midpoint", job_memory="4G"): '''count tags within windows. Counting is done using bedtools. Arguments --------- tagfile : string Filename with tags to be counted in :term:`bed` format. windowfile : string Filename with windows in :term:`bed` format. outfile : outfile Output filename in :term:`bed` format. counting_method : string Counting method to use. Possible values are ``nucleotide`` and ``midpoint``. midpoint counts the number of reads overlapping the midpoint of the window by at least one base nucleotide counts the number of reads overlapping the window by at least one base. job_memory : string Amount of memory to allocate. ''' if counting_method == "midpoint": f = '''| awk '{a = $2+($3-$2)/2; printf("%s\\t%i\\t%i\\n", $1, a, a+1)}' ''' elif counting_method == "nucleotide": f = "" else: raise ValueError("unknown counting method: %s" % counting_method) # Note that in version 2.26, coverage changed from reporting # A on B to B on A. statement = ''' zcat %(tagfile)s %(f)s | bedtools coverage -a %(windowfile)s -b stdin -split | sort -k1,1 -k2,2n -k3,3n -k4,4 | gzip > %(outfile)s ''' P.run() def aggregateWindowsTagCounts(infiles, outfile, regex="(.*)\..*"): '''aggregate output from several ``bedtools coverage`` results. ``bedtools coverage`` outputs the following columns for a bed4 file:: 1 Contig 2 Start 3 Stop 4 Name 5 The number of features in A that overlapped (by at least one base pair) the B interval. 6 The number of bases in B that had non-zero coverage from features in A. 7 The length of the entry in B. 8 The fraction of bases in B that had non-zero coverage from features in A. This method autodetects the number of columns in the :term:`infiles` and selects: * bed4: use column 5 * bed6: use column 7 * bed12: use column 13 Arguments --------- infiles : list Input filenames with the output from ``bedtools coverage`` outfile : string Output filename in :term:`tsv` format. regex : string Regular expression used to extract the track name from the filename. The default removes any suffix. ''' # get bed format bed_columns = Bed.getNumColumns(infiles[0]) # +1 as awk is 1-based column = bed_columns - 4 + 1 src = " ".join(["""<( zcat %s | awk '{printf("%%s:%%i-%%i\\t%%i\\n", $1,$2,$3,$%s );}')""" % (x, column) for x in infiles]) tmpfile = P.getTempFilename(".") statement = '''paste %(src)s > %(tmpfile)s''' P.run() # build track names tracks = [re.search(regex, os.path.basename(x)).groups()[0] for x in infiles] outf = IOTools.openFile(outfile, "w") outf.write("interval_id\t%s\n" % "\t".join(tracks)) # filter for uniqueness - keys with the same value as the # previous line will be ignored. last_gene = None c = E.Counter() for line in open(tmpfile, "r"): c.input += 1 data = line[:-1].split("\t") genes = list(set([data[x] for x in range(0, len(data), 2)])) values = [int(data[x]) for x in range(1, len(data), 2)] assert len(genes) == 1, \ "paste command failed, wrong number of genes per line: '%s'" % line if genes[0] == last_gene: c.duplicates += 1 continue c.output += 1 outf.write("%s\t%s\n" % (genes[0], "\t".join(map(str, values)))) last_gene = genes[0] outf.close() os.unlink(tmpfile) E.info("aggregateWindowsTagCounts: %s" % c) def normalizeTagCounts(infile, outfile, method): '''normalize Tag counts Parameters ---------- infile : string Input filename of file with counts. outfile : string Output filename with normalized counts. method : string Method to use for normalization. can be deseq-size factors, total-column, total-row, total-count deseq-size-factors - use normalisation implemented in DEseq total-column - divide counts by column total total-row - divide counts by the value in a row called 'total' total-count - normalised all values in column by the ratio of the per column sum of counts and the average column count across all rows. ''' statement = ''' zcat %(infile)s | cgat counts2counts --method=normalize --normalization-method=%(method)s --log=%(outfile)s.log | gzip > %(outfile)s ''' P.run() def buildDMRStats(infiles, outfile, method, fdr_threshold=None): '''build dmr summary statistics. This method works from output files created by Expression.py (method="deseq" or method="edger") or runMEDIPS (method="medips") This method counts the number of up/down, 2fold up/down, etc. genes in output from (:mod:`scripts/runExpression`). This method also creates diagnostic plots in the <exportdir>/<method> directory. Arguments --------- infiles ; list List of tabs with DMR output outfile : string Output filename. Tab separated file summarizing method : string Method name fdr_threshold : float FDR threshold to apply. Currently unused. ''' results = collections.defaultdict(lambda: collections.defaultdict(int)) status = collections.defaultdict(lambda: collections.defaultdict(int)) # deseq/edger def f_significant(x): return x.significant == "1" def f_up(x): return float(x.l2fold) > 0 def f_down(x): return float(x.l2fold) < 0 def f_fold2up(x): return float(x.l2fold) > 1 def f_fold2down(x): return float(x.l2fold) < -1 def f_key(x): return (x.treatment_name, x.control_name) def f_status(x): return x.status outf = IOTools.openFile(outfile, "w") is_first = True for infile in infiles: xx = 0 for line in IOTools.iterate(IOTools.openFile(infile)): key = f_key(line) r, s = results[key], status[key] r["tested"] += 1 ss = f_status(line) s[ss] += 1 if ss != "OK": continue is_significant = f_significant(line) up = f_up(line) down = f_down(line) fold2up = f_fold2up(line) fold2down = f_fold2down(line) fold2 = fold2up or fold2down if up: r["up"] += 1 if down: r["down"] += 1 if fold2up: r["l2fold_up"] += 1 if fold2down: r["l2fold_down"] += 1 if is_significant: r["significant"] += 1 if up: r["significant_up"] += 1 if down: r["significant_down"] += 1 if fold2: r["fold2"] += 1 if fold2up: r["significant_l2fold_up"] += 1 if fold2down: r["significant_l2fold_down"] += 1 if xx > 10000: break if is_first: is_first = False header1, header2 = set(), set() for r in list(results.values()): header1.update(list(r.keys())) for s in list(status.values()): header2.update(list(s.keys())) header = ["method", "treatment", "control"] header1 = list(sorted(header1)) header2 = list(sorted(header2)) outf.write("\t".join(header + header1 + header2) + "\n") for treatment, control in list(results.keys()): key = (treatment, control) r = results[key] s = status[key] outf.write("%s\t%s\t%s\t" % (method, treatment, control)) outf.write("\t".join([str(r[x]) for x in header1]) + "\t") outf.write("\t".join([str(s[x]) for x in header2]) + "\n") def buildFDRStats(infile, outfile, method): '''compute number of windows called at different FDR. .. note:: This method is incomplete Arguments --------- infile : string Input filename in :term:`tsv` format. Typically the output from :mod:`scripts/runExpression`. outfile : string Output filename in :term:`tsv` format. method : string Method name. ''' raise NotImplementedError("function is incomplete") data = pandas.read_csv(IOTools.openFile(infile), sep="\t", index_col=0) assert data['treatment_name'][0] == data['treatment_name'][-1] assert data['control_name'][0] == data['control_name'][-1] treatment_name, control_name = data[ 'treatment_name'][0], data['control_name'][0] key = (treatment_name, control_name) fdrs = (0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0) for fdr in fdrs: print("fdr") take = data['qvalue'] <= fdr significant = sum(take) print(significant) def outputAllWindows(infile, outfile): '''output all windows as a bed file with the l2fold change as a score. Arguments --------- infile : string Input filename in :term:`tsv` format. Typically the output from :mod:`scripts/runExpression`. outfile : string Output filename in :term:`bed` format. ''' outf = IOTools.openFile(outfile, "w") for line in IOTools.iterate(IOTools.openFile(infile)): outf.write("\t".join( (line.contig, line.start, line.end, "%6.4f" % float(line.l2fold))) + "\n") outf.close() def outputRegionsOfInterest(design_file, counts_file, outfile, max_per_sample=10, sum_per_group=40): '''output windows according to various filters. The output is a mock analysis similar to a differential expression result. Arguments --------- design_file : string Filename with experimental design counts_file : string :term:`tsv` formatted file with counts per windows outfile : string Output filename in :term:`tsv` format max_per_sample : int Remove samples with more than threshold counts sum_per_group : int Minimum counts per group. ''' job_memory = "64G" design = Expression.readDesignFile(design_file) # remove tracks not included in the design design = dict([(x, y) for x, y in list(design.items()) if y.include]) # define the two groups groups = sorted(set([x.group for x in list(design.values())])) # build a filtering statement groupA, groupB = groups def _buildMax(g, threshold): selected = [x for x, y in list(design.items()) if y.group == g] if len(selected) > 1: return "max((%s)) < %f" % ( ",".join( ["int(r['%s'])" % x for x in selected]), threshold) elif len(selected) == 1: return "int(r['%s']) < %f" % (selected[0], threshold) else: raise ValueError("no groups found for 'g'" % g) def _buildSum(g, threshold): selected = [x for x, y in list(design.items()) if y.group == g] if len(selected) > 1: return "sum((%s)) > %f" % ( ",".join( ["int(r['%s'])" % x for x in selected]), threshold) elif len(selected) == 1: return "int(r['%s']) > %f" % (selected[0], threshold) else: raise ValueError("no groups found for 'g'" % g) upper_levelA = _buildMax(groupA, max_per_sample) upper_levelB = _buildMax(groupB, max_per_sample) sum_levelA = _buildSum(groupA, sum_per_group) sum_levelB = _buildSum(groupB, sum_per_group) statement = ''' zcat %(counts_file)s | cgat csv_select --log=%(outfile)s.log "(%(upper_levelA)s and %(sum_levelB)s) or (%(upper_levelB)s and %(sum_levelA)s)" | cgat runExpression --log=%(outfile)s.log --design-tsv-file=%(design_file)s --tags-tsv-file=- --method=mock --filter-min-counts-per-sample=0 | gzip > %(outfile)s ''' P.run() def runDE(design_file, counts_file, outfile, outdir, method="deseq", spike_file=None): '''run DESeq, DESeq2 or EdgeR through :mod:`scripts/runExpression.py` The job is split into smaller sections. The order of the input data is randomized in order to avoid any biases due to chromosomes and break up local correlations. At the end, a q-value is computed from all results. Arguments --------- design_file : string Filename with experimental design counts_file : string :term:`tsv` formatted file with counts per windows outfile : string Output filename in :term:`tsv` format. outdir : string Directory for additional output files. method : string Method to use. See :mod:`scripts/runExpression.py`. spike_file : string Filename with spike-in data to add before processing. ''' if spike_file is None: statement = "zcat %(counts_file)s" else: statement = '''cgat combine_tables --missing-value=0 --cat=filename --log=%(outfile)s.log %(counts_file)s %(spike_file)s | cgat csv_cut --remove filename --log=%(outfile)s.log ''' prefix = IOTools.snip(os.path.basename(outfile)) E.info(prefix) # the post-processing strips away the warning, # renames the qvalue column to old_qvalue # and adds a new qvalue column after recomputing # over all windows. statement += ''' | cgat randomize_lines --keep-header=1 | %(cmd-farm)s --input-header --output-header --split-at-lines=200000 --cluster-options="-l mem_free=16G" --log=%(outfile)s.log --output-filename-pattern=%(outdir)s/%%s --subdirs --output-regex-header="^test_id" "cgat runExpression --method=%(method)s --tags-tsv-file=- --design-tsv-file=%(design_file)s --output-filename-pattern=%%DIR%%%(prefix)s_ --deseq-fit-type=%(deseq_fit_type)s --deseq-dispersion-method=%(deseq_dispersion_method)s --deseq-sharing-mode=%(deseq_sharing_mode)s --edger-dispersion=%(edger_dispersion)f --deseq2-design-formula=%(deseq2_model)s --deseq2-contrasts=%(deseq2_contrasts)s --filter-min-counts-per-row=%(tags_filter_min_counts_per_row)i --filter-min-counts-per-sample=%(tags_filter_min_counts_per_sample)i --filter-percentile-rowsums=%(tags_filter_percentile_rowsums)i --log=%(outfile)s.log --fdr=%(edger_fdr)f --deseq2-plot=0" | perl -p -e "s/qvalue/old_qvalue/" | cgat table2table --log=%(outfile)s.log --method=fdr --column=pvalue --fdr-method=BH --fdr-add-column=qvalue | gzip > %(outfile)s ''' E.info(statement) P.run() def normalizeBed(countsfile, outfile): '''normalize counts in a bed file to total library size. Use :func:`Pipeline.submit` to send to cluster. Arguments --------- countsfile : string Filename with count data in :term:`tsv` format outfile : string Output filename in :term:`bedGraph` format. ''' bed_frame = pandas.read_table(countsfile, sep="\t", compression="gzip", header=0, index_col=0) # normalize count column by total library size # have to explicitly convert data_frame to numpy # array with int64/float64 data type. Otherwise # numpy.log will through an Attribute error (wrong # error to report) as it cannot handle python longs bed_frame = bed_frame.fillna(0.0) val_array = numpy.array(bed_frame.values, dtype=numpy.int64) geom_mean = geoMean(val_array) ratio_frame = bed_frame.apply(lambda x: x / geom_mean, axis=0) size_factors = ratio_frame.apply(numpy.median, axis=0) normalize_frame = bed_frame / size_factors # replace infs and -infs with Nas, then 0s normalize_frame.replace([numpy.inf, -numpy.inf], numpy.nan, inplace=True) normalize_frame = normalize_frame.fillna(0.0) normalize_frame.to_csv(outfile, sep="\t", index_label="interval") def geoMean(array): ''' Generate the geometric mean of a list or array, removing all zero-values but retaining total length ''' if isinstance(array, pandas.core.frame.DataFrame): array = array.as_matrix() else: pass non_zero = ma.masked_values(array, 0) log_a = ma.log(non_zero) geom_mean = ma.exp(log_a.mean()) return geom_mean def enrichmentVsInput(infile, outfile): ''' Calculate the fold enrichment of the test data vs. the input data Parameters ---------- infile: list list of filenames infile[0]: str filename of normalised :term:`bedGraph` file showing counts in the input infile[1]: str filename of normalised :term:`bedGraph` files showing counts in each experiment outfile: str filename of output :term:`bedGraph` file ''' test_frame = pandas.read_table(infile[1], sep="\t", compression="gzip", header=None, index_col=None) input_frame = pandas.read_table(infile[0], sep="\t", compression="gzip", header=None, index_col=None) merge_frame = pandas.merge(test_frame, input_frame, how='left', left_on=[0, 1, 2], right_on=[0, 1, 2]) def foldchange(x): return math.log((x['3_y'] + 1.0) / (x['3_x'] + 1.0), 2) merge_frame[4] = merge_frame.apply(foldchange, axis=1) out_frame = merge_frame[[0, 1, 2, 4]] out_frame.to_csv(outfile, sep="\t", header=None, index=None) def runMEDIPSQC(infile, outfile): '''run QC using the MEDIPS package. The QC data will be stored in the directory :file:`./medips.dir` Arguments --------- infile : string Filename of :term:`bam` formatted file outfile : string Output filename. Containts logging information. ''' # note that the wrapper adds the filename # to the output filenames. job_memory = "10G" statement = """cgat runMEDIPS --ucsc-genome=%(medips_genome)s --treatment=%(infile)s --toolset=saturation --toolset=coverage --toolset=enrichment --shift=%(medips_shift)s --extend=%(medips_extension)s --output-filename-pattern="medips.dir/%%s" --log=%(outfile)s.log | gzip > %(outfile)s """ P.run() def runMEDIPSDMR(design_file, outfile): '''run differential methylation analysis using MEDIPS package. Arguments --------- infile : string Filename of :term:`bam` formatted file outfile : string Output filename in :term:`tsv` format. ''' job_memory = "30G" design = Expression.readDesignFile(design_file) # remove data tracks not needed design = [(x, y) for x, y in list(design.items()) if y.include] # build groups groups = set([y.group for x, y in design]) statements = [] for pair1, pair2 in itertools.combinations(groups, 2): treatment = ["%s.bam" % x for x, y in design if y.group == pair1] control = ["%s.bam" % x for x, y in design if y.group == pair2] treatment = ",".join(treatment) control = ",".join(control) # outfile contains directory prefix statements.append( """cgat runMEDIPS --ucsc-genome=%(medips_genome)s --treatment=%(treatment)s --control=%(control)s --toolset=dmr --shift=%(medips_shift)s --extend=%(medips_extension)s --window-size=%(medips_window_size)i --output-filename-pattern="%(outfile)s_%(pair1)s_vs_%(pair2)s_%%s" --fdr-threshold=%(medips_fdr)f --log=%(outfile)s.log > %(outfile)s.log2; checkpoint; zcat %(outfile)s_%(pair1)s_vs_%(pair2)s_data.tsv.gz | cgat runMEDIPS --treatment=%(pair1)s --control=%(pair2)s --toolset=convert --fdr-threshold=%(medips_fdr)f --log=%(outfile)s.log | gzip > %(outfile)s """) P.run() @P.cluster_runnable def outputSpikeCounts(outfile, infile_name, expression_nbins=None, fold_nbins=None, expression_bins=None, fold_bins=None): """count significant results in bins of expression and fold change. This method groups the results of a DE analysis in a 2-dimensonal histogramy by tag counts/expression level and fold change. Either supply one of `nbins` or `bins` for the histograms. Arguments --------- outfile : string Output filename infile_name : string Input filename in :term:`tsv` format. Usually the output of :mod:`scripts/runExpression`. expression_nbins : int Number of bins to use for tag count histogram. fold_nbins : int Number of bins to use for fold-change histogram. expression_bins : list List of bins to use for tag count histogram. fold_bins : list List of bins to use for fold-change histogram. """ df = pandas.read_csv(infile_name, sep="\t", index_col=0) E.debug("read %i rows and %i columns of data" % df.shape) if "edger" in outfile.lower(): # edger: treatment_mean and control_mean do not exist # use supplied values directly. l10average = numpy.log(df['treatment_mean']) l2fold = numpy.log2(df['fold']) else: # use pseudocounts to compute fold changes treatment_mean = df['treatment_mean'] + 1 control_mean = df['control_mean'] + 1 # build log2 average values l10average = numpy.log((treatment_mean + control_mean) / 2) l2fold = numpy.log2(treatment_mean / control_mean) if expression_nbins is not None: mm = math.ceil(max(l10average)) expression_bins = numpy.arange(0, mm, mm / expression_nbins) if fold_nbins is not None: mm = math.ceil(max(abs(min(l2fold)), abs(max(l2fold)))) # ensure that range is centered on exact 0 n = math.ceil(fold_nbins / 2.0) fold_bins = numpy.concatenate( (-numpy.arange(0, mm, mm / n)[:0:-1], numpy.arange(0, mm, mm / n))) # compute expression bins d2hist_counts, xedges, yedges = numpy.histogram2d( l10average, l2fold, bins=(expression_bins, fold_bins)) dd = pandas.DataFrame(d2hist_counts) dd.index = list(xedges[:-1]) dd.columns = list(yedges[:-1]) dd.to_csv(IOTools.openFile(outfile, "w"), sep="\t") return df, d2hist_counts, xedges, yedges, l10average, l2fold @P.cluster_runnable def plotDETagStats(infile, composition_file, outfile): '''plot differential expression statistics Arguments --------- infile : string Filename with :term:`tsv` formatted list of differential methylation results output from :doc:`scripts/runExpression`. composition_file : string Filename with :term:`tsv` formatted data about nucleotide compositions of windows tested. outfile : string Output filename, used as sentinel only. ''' Expression.plotDETagStats( infile, outfile, additional_file=composition_file, join_columns=("contig", "start", "end"), additional_columns=("CpG_density", "length")) P.touch(outfile) @P.cluster_runnable def buildSpikeResults(infile, outfile): '''build matrices with results from spike-in and upload into database. The method will output several files: .spiked.gz: Number of intervals that have been spiked-in for each bin of expression and fold-change .power.gz: Global power analysis - aggregates over all ranges of fold-change and expression and outputs the power, the proportion of intervals overall that could be detected as differentially methylated. This is a table with the following columns: fdr - fdr threshold power - power level, number of intervals detectable intervals - number of intervals in observed data at given level of fdr and power. intervals_percent - percentage of intervals in observed data at given level of fdr and power The method will also upload the results into the database. Arguments --------- infile : string Input filename in :term:`tsv` format. Usually the output of :mod:`scripts/runExpression`. outfile : string Output filename in :term:`tsv` format. ''' expression_nbins = 10 fold_nbins = 10 spikefile = P.snip(infile, '.tsv.gz') + '.spike.gz' if not os.path.exists(spikefile): E.warn('no spike data: %s' % spikefile) P.touch(outfile) return ######################################## # output and load spiked results tmpfile_name = P.getTempFilename(shared=True) statement = '''zcat %(spikefile)s | grep -e "^spike" -e "^test_id" > %(tmpfile_name)s ''' P.run() E.debug("outputting spiked counts") (spiked, spiked_d2hist_counts, xedges, yedges, spiked_l10average, spiked_l2fold) = \ outputSpikeCounts( outfile=P.snip(outfile, ".power.gz") + ".spiked.gz", infile_name=tmpfile_name, expression_nbins=expression_nbins, fold_nbins=fold_nbins) ######################################## # output and load unspiked results statement = '''zcat %(infile)s | grep -v -e "^spike" > %(tmpfile_name)s ''' P.run() E.debug("outputting unspiked counts") (unspiked, unspiked_d2hist_counts, unspiked_xedges, unspiked_yedges, unspiked_l10average, unspiked_l2fold) = \ outputSpikeCounts( outfile=P.snip(outfile, ".power.gz") + ".unspiked.gz", infile_name=tmpfile_name, expression_bins=xedges, fold_bins=yedges) E.debug("computing power") assert xedges.all() == unspiked_xedges.all() tmpfile = IOTools.openFile(tmpfile_name, "w") tmpfile.write("\t".join( ("expression", "fold", "fdr", "counts", "percent")) + "\n") fdr_thresholds = [0.01, 0.05] + list(numpy.arange(0.1, 1.0, 0.1)) power_thresholds = numpy.arange(0.1, 1.1, 0.1) spiked_total = float(spiked_d2hist_counts.sum().sum()) unspiked_total = float(unspiked_d2hist_counts.sum().sum()) outf = IOTools.openFile(outfile, "w") outf.write("fdr\tpower\tintervals\tintervals_percent\n") # significant results for fdr in fdr_thresholds: take = spiked['qvalue'] < fdr # compute 2D histogram in spiked data below fdr threshold spiked_d2hist_fdr, xedges, yedges = \ numpy.histogram2d(spiked_l10average[take], spiked_l2fold[take], bins=(xedges, yedges)) # convert to percentage of spike-ins per bin spiked_d2hist_fdr_normed = spiked_d2hist_fdr / spiked_d2hist_counts spiked_d2hist_fdr_normed = numpy.nan_to_num(spiked_d2hist_fdr_normed) # set values without data to -1 spiked_d2hist_fdr_normed[spiked_d2hist_counts == 0] = -1.0 # output to table for database upload for x, y in itertools.product(list(range(len(xedges) - 1)), list(range(len(yedges) - 1))): tmpfile.write("\t".join(map( str, (xedges[x], yedges[y], fdr, spiked_d2hist_fdr[x, y], 100.0 * spiked_d2hist_fdr_normed[x, y]))) + "\n") # take elements in spiked_hist_fdr above a certain threshold for power in power_thresholds: # select 2D bins at a given power level power_take = spiked_d2hist_fdr_normed >= power # select the counts in the unspiked data according # to this level power_counts = unspiked_d2hist_counts[power_take] outf.write("\t".join(map( str, (fdr, power, power_counts.sum().sum(), 100.0 * power_counts.sum().sum() / unspiked_total))) + "\n") tmpfile.close() outf.close() # upload into table method = P.snip(os.path.dirname(outfile), ".dir") tablename = P.toTable( P.snip(outfile, "power.gz") + method + ".spike.load") P.load(tmpfile_name, outfile + ".log", tablename=tablename, options="--add-index=fdr") os.unlink(tmpfile_name) def summarizeTagsWithinContext(tagfile, contextfile, outfile, min_overlap=0.5, job_memory="4G"): '''count occurances of tags in genomic context. Examines the genomic context to where tags align. A tag is assigned to the genomic context that it overlaps by at least 50%. Thus some reads mapping several contexts might be dropped. Arguments --------- tagfile : string Filename with tags. The file can be :term:`bam` or :term:`bed` format. contextfile : string Filename of :term:`bed` formatted files with named intervals (BED4). outfile : string Output in :term:`tsv` format. min_overlap : float Minimum overlap (fraction) to count features as overlapping. job_memory : string Memory to reserve. ''' statement = ''' cgat bam_vs_bed --min-overlap=%(min_overlap)f --log=%(outfile)s.log %(tagfile)s %(contextfile)s | gzip > %(outfile)s ''' P.run() def mergeSummarizedContextStats(infiles, outfile, samples_in_columns=False): """combine output from :func:`summarizeTagsWithinContext`. Arguments --------- infiles : list List of filenames in :term:`tsv` format outfile : string Output filename in :term:`tsv` format. samples_in_columns : If True, put samples in columns. The default is to put them in rows. """ header = ",".join([P.snip(os.path.basename(x), ".contextstats.tsv.gz") for x in infiles]) filenames = " ".join(infiles) if not samples_in_columns: transpose_cmd = \ """| cgat table2table --transpose""" % P.getParams() else: transpose_cmd = "" statement = """cgat combine_tables --header-names=%(header)s --missing-value=0 --skip-titles %(filenames)s | perl -p -e "s/bin/track/; s/\?/Q/g" %(transpose_cmd)s | gzip > %(outfile)s """ P.run() def loadSummarizedContextStats(infiles, outfile, suffix=".contextstats.tsv.gz"): """merge output from :func:`summarizeTagsWithinContex` and load into database. Arguments --------- infiles : list List of filenames in :term:`tsv` format. The files should end in suffix. outfile : string Output filename, the table name is derived from `outfile`. suffix : string Suffix to remove from filename for track name. """ header = ",".join([P.snip(os.path.basename(x), suffix) for x in infiles]) filenames = " ".join(infiles) load_statement = P.build_load_statement( P.toTable(outfile), options="--add-index=track") statement = """cgat combine_tables --header-names=%(header)s --missing-value=0 --skip-titles %(filenames)s | perl -p -e "s/bin/track/; s/\?/Q/g" | cgat table2table --transpose | %(load_statement)s > %(outfile)s """ P.run() def testTagContextOverlap(tagfile, contextfile, workspace, outfile, job_threads=1, samples=10000, options=""): """use gat to test for overlap between tags and genomic context. Arguments --------- tagfile : string Filename with read tags :term:`bed` format. Tags can be overlapping. contextfile : string Filename with genomic context information in :term:`bed` format. workspace : string Genomic workspace for gat simulations in :term:`bed` format. outfile : string Output filename in :term:`tsv` format. threads : int Number of threads to use. samples : int Number of samples to compute. options : string Options to pass to the gat program. """ statement = """ gat-run.py --annotations-label=reads --annotations=%(tagfile)s --segments=%(contextfile)s --workspace=%(workspace)s --overlapping-annotations --annotations-to-points=midpoint --counter=annotation-overlap --with-segment-tracks --num-samples=%(samples)i --num-threads=%(job_threads)i --log=%(outfile)s.log %(options)s | gzip > %(outfile)s """ P.run()
mit
-5,619,507,310,090,360,000
29.319392
82
0.561073
false
greatmazinger/programming-interview-code
Python/no_repeating_digits.py
1
1460
import unittest from collections import Counter """ No repeating digits problem: Examples: """ limit = 98765432100 def no_repeating_digits(num): num_str = str(num) c = Counter(list(num_str)) most_common = c.most_common(1) return most_common[0][1] == 1 def count_non_repeating_numbers(low, high): total = 0 cur = low while cur <= high and cur <= limit: if no_repeating_digits(cur): total += 1 cur += 1 return total # TODO # class test_first_nonrepeated_character(unittest.TestCase): # def test_one(self): # self.assertEqual(first_nonrepeated_character("ccaat"), 't') # def test_two(self): # self.assertEqual(first_nonrepeated_character("x"), 'x') if __name__ == "__main__": import argparse parser = argparse.ArgumentParser(description="Count number of numbers that don't have repeating digits.") parser.add_argument( 'n1', metavar = 'N1', type = int, help = 'Left number (inclusive)' ) parser.add_argument( 'n2', metavar = 'N2', type = int, help = 'Right number (inclusive)' ) args = parser.parse_args() test = False if test: unittest.main() else: # Do the args passed in. TODO result = count_non_repeating_numbers( args.n1, args.n2 ) print(result)
gpl-2.0
-1,023,518,888,930,635,300
26.037037
109
0.559589
false
gregreen/bayestar
scripts/compareColors.py
1
10545
#!/usr/bin/env python # -*- coding: utf-8 -*- # # compareColors.py # # Copyright 2013 Greg Green <greg@greg-UX31A> # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, # MA 02110-1301, USA. # # import numpy as np import scipy, scipy.stats, scipy.special import h5py import time import argparse, sys, os import matplotlib.pyplot as plt import matplotlib as mplib from mpl_toolkits.axes_grid1 import Grid from matplotlib.ticker import MaxNLocator, AutoMinorLocator, FormatStrFormatter import hdf5io class TStellarModel: def __init__(self, fname): self.load(fname) def load(self, fname): f = open(fname, 'r') row = [] for l in f: line = l.rstrip().lstrip() if len(line) == 0: # Empty line continue if line[0] == '#': # Comment continue data = line.split() if len(data) < 6: txt = 'Error reading in stellar templates.\n' txt += 'The following line does not have the correct number of entries (6 expected):\n' txt += line raise Exception(txt) row.append([float(s) for s in data]) f.close() template = np.array(row, dtype='f8') fields = ['Mr', 'FeH', 'gr', 'ri', 'iz', 'zy'] dtype = [(field, 'f8') for field in fields] self.data = np.empty(len(template), dtype=dtype) for i,field in enumerate(fields): self.data[field][:] = template[:,i] self.FeH = np.unique(self.data['FeH']) def get_isochrone(self, FeH): if FeH >= np.max(self.FeH): FeH_eval = np.max(self.FeH) idx = (self.data['FeH'] == FeH_eval) return self.data[idx] elif FeH <= np.min(self.FeH): FeH_eval = np.min(self.FeH) idx = (self.data['FeH'] == FeH_eval) return self.data[idx] else: k = np.arange(self.FeH.size) #print np.where(FeH > self.FeH, k, -1) #print self.FeH idx = np.max(np.where(FeH > self.FeH, k, -1)) FeH_eval = [self.FeH[idx], self.FeH[idx+1]] a = float(FeH_eval[1] - FeH) / float(FeH_eval[1] - FeH_eval[0]) idx = (self.data['FeH'] == FeH_eval[0]) d1 = self.data[idx] idx = (self.data['FeH'] == FeH_eval[1]) d2 = self.data[idx] if np.any(d1['Mr'] != d2['Mr']): raise Exception('Expected Mr samples to be the same for each metallicity.') fields = ['Mr', 'FeH', 'gr', 'ri', 'iz', 'zy'] dtype = [(field, 'f8') for field in fields] ret = np.empty(len(d1), dtype=dtype) #print FeH_eval #print a for field in fields: ret[field][:] = a * d1[field][:] + (1. - a) * d2[field][:] return ret def read_photometry(fname, target_name): f = h5py.File(fname, 'r') # Hack to get the file to read properly #try: # f.items() #except: # pass phot = f['photometry'] # Load in photometry from selected target for name,item in phot.iteritems(): if 'pixel' in name: t_name = item.attrs['target_name'] if t_name == target_name: mags = item['mag'][:] errs = item['err'][:] EBV_SFD = item['EBV'][:] pix_idx = int(name.split()[1]) return mags, errs, EBV_SFD, t_name, pix_idx return None def read_evidences(fname, pix_idx): f = h5py.File(fname, 'r') lnZ = None dset = '/pixel %d/stellar chains' % pix_idx try: lnZ = f[dset].attrs['ln(Z)'][:] except: print 'Dataset "%s" does not exist.' % dset return lnZ def get_reddening_vector(): return np.array([3.172, 2.271, 1.682, 1.322, 1.087]) def dereddened_mags(mags, EBV): R = get_reddening_vector() if type(EBV) == float: R.shape = (1, R.size) R = np.repeat(R, len(mags), axis=0) return mags - EBV * R elif type(EBV) == np.ndarray: return mags - np.einsum('i,j->ij', EBV, R) else: raise TypeError('EBV has unexpected type: %s' % type(EBV)) def plot_cluster(ax, template, mags): pass def main(): parser = argparse.ArgumentParser(prog='compareColors.py', description='Compare photometric colors to model colors.', add_help=True) parser.add_argument('--templates', '-t', type=str, required=True, help='Stellar templates (in ASCII format).') parser.add_argument('--photometry', '-ph', type=str, nargs='+', required=True, help='Bayestar input file(s) with photometry.') parser.add_argument('--evidences', '-ev', type=str, nargs='+', default=None, help='Bayestar output file(s) with evidences.') parser.add_argument('--names', '-n', type=str, nargs='+', required=True, help='Region names.') parser.add_argument('--output', '-o', type=str, default=None, help='Plot filename.') parser.add_argument('--show', '-sh', action='store_true', help='Show plot.') if 'python' in sys.argv[0]: offset = 2 else: offset = 1 args = parser.parse_args(sys.argv[offset:]) n_targets = len(args.names) templates = TStellarModel(args.templates) color_names = ['gr', 'ri', 'iz', 'zy'] # Set matplotlib style attributes mplib.rc('text', usetex=True) mplib.rc('xtick.major', size=6) mplib.rc('xtick.minor', size=4) mplib.rc('ytick.major', size=6) mplib.rc('ytick.minor', size=4) mplib.rc('xtick', direction='in') mplib.rc('ytick', direction='in') mplib.rc('axes', grid=False) fig = plt.figure(figsize=(6., 2.*n_targets), dpi=150) axgrid = Grid(fig, 111, nrows_ncols=(n_targets, 3), axes_pad=0.05, add_all=True, label_mode='L') color_min = np.empty(len(color_names), dtype='f8') color_max = np.empty(len(color_names), dtype='f8') color_min[:] = np.inf color_max[:] = -np.inf for target_num, target_name in enumerate(args.names): # Load photometry ret = None for fname in args.photometry: ret = read_photometry(fname, target_name) if ret != None: break if ret == None: print 'Target "%s" not found.' % target_name return 0 mags, errs, EBV, t_name, pix_idx = ret mags = dereddened_mags(mags, EBV) # Load evidences lnZ = np.zeros(len(mags), dtype='f8') if args.evidences != None: for fname in args.evidences: ret = read_evidences(fname, pix_idx) if ret != None: lnZ = ret[:] break print '== Target #%d ==' % target_num print ' name: %s' % (target_name) print ' E(B-V): %.2f' % (np.percentile(EBV, 95.)) print ' # of stars: %d' % (len(mags)) txt = '' idx = ( (mags[:,0] > 10.) & (mags[:,0] < 25.) & (mags[:,1] > 10.) & (mags[:,1] < 25.) ) mags = mags[idx] errs = errs[idx] lnZ = lnZ[idx] colors = -np.diff(mags, axis=1) idx = ( (colors[:,0] > np.percentile(colors[:,0], 0.5)) & (colors[:,0] < np.percentile(colors[:,0], 99.5)) ) colors = colors[idx] mags = mags[idx] errs = errs[idx] lnZ = lnZ[idx] color_min[0], color_max[0] = np.percentile(colors[:,0], [1., 99.]) # Plot color-Magnitude diagrams for i,c in enumerate(color_names[1:]): ax = axgrid[3*target_num + i] idx = ( (colors[:,i+1] > np.percentile(colors[:,i+1], 0.5)) & (colors[:,i+1] < np.percentile(colors[:,i+1], 99.5)) & (mags[:,i+1] > 10.) & (mags[:,i+1] < 25.) & (mags[:,i+2] > 10.) & (mags[:,i+2] < 25.) ) # Empirical lnZ_max = 0. #np.percentile(lnZ_tmp[idx], 97.) Delta_lnZ = 25. colors_tmp = colors[idx, i+1] ax.scatter(colors_tmp, colors[idx,0], c=lnZ[idx], cmap='Spectral', vmin=lnZ_max-Delta_lnZ, vmax=lnZ_max, s=1.5, alpha=0.1, edgecolor='none') xlim = ax.get_xlim() ylim = ax.get_ylim() # Model for FeH, style in zip([0., -1., -2.], ['c-', 'y-', 'r-']): isochrone = templates.get_isochrone(FeH) ax.plot(isochrone[c], isochrone['gr'], style, lw=1, alpha=0.25) print isochrone[c] print isochrone['gr'] print '' color_min_tmp, color_max_tmp = np.percentile(colors_tmp, [1., 99.]) if color_min_tmp < color_min[i+1]: color_min[i+1] = color_min_tmp if color_max_tmp > color_max[i+1]: color_max[i+1] = color_max_tmp txt += ' %s: %d stars\n' % (c, np.sum(idx)) txt += ' ln(Z_max) = %.2f\n' % lnZ_max print txt print '' # Reddening vectors '''R = get_reddening_vector() EBV_0 = np.median(EBV) for i in range(len(colors)): A_gr = EBV_0 * (R[0] - R[1]) A_xy = EBV_0 * (R[i] - R[i+1]) r_0 = Mr_min w = color_max[i] - color_min[i] h = Mr_max - Mr_min xy_0 = color_min[i] + 0.1 * w axgrid[4*cluster_num + i].arrow(xy_0, r_0, A_xy, A_r, head_width=0.03*w, head_length=0.01*h, color='r', alpha=0.5) ''' # Format y-axes axgrid[3*target_num].set_ylim(color_min[0], color_max[1]) axgrid[3*target_num].set_ylabel(r'$g - r$', fontsize=16) axgrid[3*target_num].yaxis.set_major_locator(MaxNLocator(nbins=5)) axgrid[3*target_num].yaxis.set_minor_locator(AutoMinorLocator()) # Format x-axes for i,c in enumerate(color_names[1:]): axgrid[i].set_xlim(color_min[i+1], color_max[i+1]) color_label = r'$%s - %s$' % (c[0], c[1]) axgrid[3*(n_targets-1) + i].set_xlabel(color_label, fontsize=16) axgrid[3*(n_targets-1) + i].xaxis.set_major_locator(MaxNLocator(nbins=4)) axgrid[3*(n_targets-1) + i].xaxis.set_minor_locator(AutoMinorLocator()) fig.subplots_adjust(left=0.12, right=0.85, top=0.98, bottom=0.10) cax = fig.add_axes([0.87, 0.10, 0.03, 0.88]) norm = mplib.colors.Normalize(vmin=-25., vmax=0.) mappable = mplib.cm.ScalarMappable(cmap='Spectral', norm=norm) mappable.set_array(np.array([-25., 0.])) fig.colorbar(mappable, cax=cax, ticks=[0., -5., -10., -15., -20., -25.]) cax.yaxis.set_label_position('right') cax.yaxis.tick_right() #cax.yaxis.set_major_formatter(FormatStrFormatter('%d')) #cax.set_yticks([0., -5., -10., -15., -20., -25.]) cax.set_ylabel(r'$\mathrm{ln} \left( Z \right)$', rotation='vertical', fontsize=16) if args.output != None: fig.savefig(args.output, dpi=300) if args.show: plt.show() return 0 if __name__ == '__main__': main()
gpl-2.0
327,697,341,319,020,540
28.704225
92
0.597345
false
datawire/telepresence
ci/clean-cluster.py
1
3179
#!/usr/bin/env python3 """ Delete old deployments and services with test-prefixed names. This is used to clean up the Telepresence test cluster, as Telepresence tests currently leak. """ import argparse import json from datetime import datetime, timedelta, timezone from subprocess import check_output, run from typing import Dict, List def get_now() -> datetime: """Get current date/time in UTC""" return datetime.now(tz=timezone.utc) def parse_k8s_timestamp(timestamp: str) -> datetime: """Get date/time in UTC from k8s timestamp""" fmt = "%Y-%m-%dT%H:%M:%SZ" naive = datetime.strptime(timestamp, fmt) return naive.replace(tzinfo=timezone.utc) def get_kubectl_json(cmd: List[str]) -> Dict: """Call kubectl and parse resulting JSON""" output = str(check_output(["kubectl"] + cmd + ["-o", "json"]), "utf-8") return json.loads(output) KINDS = "ns", "svc", "deploy", "po" KIND_MAP = { "Namespace": "ns/", "Service": "svc/", "Deployment": "deploy/", "Pod": "po/" } def get_resource_names(kinds: List[str], prefix: str, min_age: timedelta) -> List[str]: """ Return kind/name of resources with the given name prefix and minimum age """ now = get_now() resources = get_kubectl_json(["get", ",".join(kinds)])["items"] names = [] for resource in resources: kind = resource["kind"] metadata = resource["metadata"] name = metadata["name"] if kind == "Service" and name == "kubernetes": continue if not name.startswith(prefix): continue timestamp_str = metadata["creationTimestamp"] timestamp = parse_k8s_timestamp(timestamp_str) age = now - timestamp if age < min_age: continue names.append(KIND_MAP[kind] + name) return names def seconds(value: str) -> timedelta: """Return a timedelta with the given number of seconds""" try: return timedelta(seconds=int(value)) except ValueError: message = "Invalid age in seconds: {}".format(value) raise argparse.ArgumentTypeError(message) def main(): """Clean up the current Kubernetes cluster""" parser = argparse.ArgumentParser( allow_abbrev=False, # can make adding changes not backwards compatible description=__doc__ ) parser.add_argument( "--prefix", default="testing-", help="prefix for resource name [testing-]" ) parser.add_argument( "--min-age", type=seconds, default="86400", help="minimum age in seconds" ) parser.add_argument( "--dry-run", action="store_true", help="don't really delete anything" ) args = parser.parse_args() names = get_resource_names(KINDS, args.prefix, args.min_age) if not names: print("Nothing to clean up.") return if args.dry_run: print("Would clean up:") else: print("Cleaning up:") for name in names: print(" {}".format(name)) if not args.dry_run: run(["kubectl", "delete", "--wait=false"] + names) if __name__ == "__main__": main()
apache-2.0
619,881,604,613,905,700
26.643478
79
0.60648
false
OpenTechFund/WebApp
opentech/public/projects/migrations/0002_projectfunding.py
1
1302
# -*- coding: utf-8 -*- # Generated by Django 1.11.8 on 2018-01-15 17:12 from __future__ import unicode_literals from django.db import migrations, models import django.db.models.deletion import modelcluster.fields class Migration(migrations.Migration): dependencies = [ ('wagtailcore', '0040_page_draft_title'), ('projects', '0001_initial'), ] operations = [ migrations.CreateModel( name='ProjectFunding', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('sort_order', models.IntegerField(blank=True, editable=False, null=True)), ('value', models.PositiveIntegerField()), ('year', models.PositiveIntegerField()), ('duration', models.PositiveIntegerField(help_text='In months')), ('page', modelcluster.fields.ParentalKey(on_delete=django.db.models.deletion.CASCADE, related_name='funding', to='projects.ProjectPage')), ('source', models.ForeignKey(on_delete=django.db.models.deletion.PROTECT, to='wagtailcore.Page')), ], options={ 'ordering': ['sort_order'], 'abstract': False, }, ), ]
gpl-2.0
-5,559,156,850,558,860,000
37.294118
154
0.593702
false
nikcub/Sketch
sketch/util/gae.py
1
2267
#!/usr/bin/env python # -*- coding: utf-8 -*- # vim:ts=2:sw=2:expandtab # # Copyright (c) 2010-2011, Nik Cubrilovic. All rights reserved. # # <[email protected]> <http://nikcub.appspot.com> # # Licensed under a BSD license. You may obtain a copy of the License at # # http://nikcub.appspot.com/bsd-license # """ Sketch - gae.py Google App Engine utils This source file is subject to the new BSD license that is bundled with this package in the file LICENSE.txt. The license is also available online at the URL: <http://nikcub.appspot.com/bsd-license.txt> :copyright: Copyright (C) 2011 Nik Cubrilovic and others, see AUTHORS :license: new BSD, see LICENSE for more details. """ import os import sys def setup_gae_paths(gae_base_dir=None): if not gae_base_dir: gae_base_dir = '/Applications/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine' if not os.path.isdir(gae_base_dir): return False ae_path = os.path.abspath(os.path.realpath(gae_base_dir)) AE_PATHS = [ ae_path, os.path.join(ae_path, 'lib', 'antlr3'), os.path.join(ae_path, 'lib', 'django'), os.path.join(ae_path, 'lib', 'fancy_urllib'), os.path.join(ae_path, 'lib', 'ipaddr'), os.path.join(ae_path, 'lib', 'webob'), os.path.join(ae_path, 'lib', 'yaml', 'lib'), ] sys.path = sys.path + AE_PATHS return True def enable_ctypes(): """Enable ctypes in Google App Engine development server """ return enable_dev_module(['_ctypes', 'gestalt']) def enable_dev_module(modules=[]): """In Google App Engine development server whitelist a C module or other module that has been disabled to assist with local development. for eg. Enable _ctypes so that Jinja rendering error messages are sane Should only run if on development server. :param modules: Modules to enable in dev server :return List: List of modules that have been whitelisted """ try: from google.appengine.tools.dev_appserver import HardenedModulesHook except ImportError: return False if type(modules) == type([]) and len(modules) > 0: HardenedModulesHook._WHITE_LIST_C_MODULES += modules return HardenedModulesHook._WHITE_LIST_C_MODULES return False
bsd-2-clause
-1,236,930,795,368,294,700
29.24
148
0.698721
false
ToonTownInfiniteRepo/ToontownInfinite
otp/ai/AIMsgTypes.py
1
3083
from otp.distributed.OtpDoGlobals import * from direct.showbase.PythonUtil import invertDictLossless OTP_SERVER_ROOT_DO_ID = 4007 CHANNEL_CLIENT_BROADCAST = 4014 BAD_CHANNEL_ID = 0 BAD_ZONE_ID = 0 BAD_DO_ID = 0 CONTROL_MESSAGE = 4001 CONTROL_SET_CHANNEL = 2001 CONTROL_REMOVE_CHANNEL = 2002 CONTROL_SET_CON_NAME = 2004 CONTROL_SET_CON_URL = 2005 CONTROL_ADD_RANGE = 2008 CONTROL_REMOVE_RANGE = 2009 CONTROL_ADD_POST_REMOVE = 2010 CONTROL_CLEAR_POST_REMOVE = 2011 AIMsgName2Id = {'STATESERVER_OBJECT_GENERATE_WITH_REQUIRED': 2001, 'STATESERVER_OBJECT_GENERATE_WITH_REQUIRED_OTHER': 2003, 'STATESERVER_OBJECT_UPDATE_FIELD': 2004, 'STATESERVER_OBJECT_UPDATE_FIELD_MULTIPLE': 2005, 'STATESERVER_OBJECT_DELETE_RAM': 2007, 'STATESERVER_OBJECT_SET_ZONE': 2008, 'STATESERVER_OBJECT_CHANGE_ZONE': 2009, 'STATESERVER_OBJECT_NOTFOUND': 2015, 'STATESERVER_QUERY_OBJECT_ALL': 2020, 'STATESERVER_QUERY_ZONE_OBJECT_ALL': 2021, 'STATESERVER_OBJECT_LOCATE': 2022, 'STATESERVER_OBJECT_LOCATE_RESP': 2023, 'STATESERVER_OBJECT_QUERY_FIELD': 2024, 'STATESERVER_QUERY_OBJECT_ALL_RESP': 2030, 'STATESERVER_SHARD_REST': 2061, 'STATESERVER_ADD_AI_RECV': 2045, 'STATESERVER_QUERY_ZONE_OBJECT_ALL_DONE': 2046, 'STATESERVER_OBJECT_CREATE_WITH_REQUIRED_CONTEXT': 2050, 'STATESERVER_OBJECT_CREATE_WITH_REQUIR_OTHER_CONTEXT': 2051, 'STATESERVER_OBJECT_CREATE_WITH_REQUIRED_CONTEXT_RESP': 2052, 'STATESERVER_OBJECT_CREATE_WITH_REQUIR_OTHER_CONTEXT_RESP': 2053, 'STATESERVER_OBJECT_DELETE_DISK': 2060, 'STATESERVER_OBJECT_QUERY_FIELD_RESP': 2062, 'STATESERVER_OBJECT_ENTERZONE_WITH_REQUIRED_OTHER': 2066, 'STATESERVER_OBJECT_ENTER_AI_RECV': 2067, 'STATESERVER_OBJECT_LEAVING_AI_INTEREST': 2033, 'STATESERVER_OBJECT_ENTER_OWNER_RECV': 2068, 'STATESERVER_OBJECT_CHANGE_OWNER_RECV': 2069, 'STATESERVER_OBJECT_SET_OWNER_RECV': 2070, 'STATESERVER_OBJECT_QUERY_FIELDS': 2080, 'STATESERVER_OBJECT_QUERY_FIELDS_RESP': 2081, 'STATESERVER_OBJECT_QUERY_FIELDS_STRING': 2082, 'STATESERVER_OBJECT_QUERY_MANAGING_AI': 2083, 'STATESERVER_BOUNCE_MESSAGE': 2086, 'STATESERVER_QUERY_OBJECT_CHILDREN_LOCAL': 2087, 'STATESERVER_QUERY_OBJECT_CHILDREN_LOCAL_DONE': 2089, 'STATESERVER_QUERY_OBJECT_CHILDREN_RESP': 2087, 'ACCOUNT_AVATAR_USAGE': 3005, 'ACCOUNT_ACCOUNT_USAGE': 3006, 'CLIENT_AGENT_OPEN_CHANNEL': 3104, 'CLIENT_AGENT_CLOSE_CHANNEL': 3105, 'CLIENT_AGENT_SET_INTEREST': 3106, 'CLIENT_AGENT_REMOVE_INTEREST': 3107, 'CHANNEL_PUPPET_ACTION': 4004, 'DBSERVER_MAKE_FRIENDS': 1017, 'DBSERVER_MAKE_FRIENDS_RESP': 1031, 'DBSERVER_REQUEST_SECRET': 1025, 'DBSERVER_REQUEST_SECRET_RESP': 1026, 'DBSERVER_SUBMIT_SECRET': 1027, 'DBSERVER_SUBMIT_SECRET_RESP': 1028, 'DBSERVER_CREATE_STORED_OBJECT': 1003, 'DBSERVER_CREATE_STORED_OBJECT_RESP': 1004, 'DBSERVER_DELETE_STORED_OBJECT': 1008, 'DBSERVER_GET_STORED_VALUES': 1012, 'DBSERVER_GET_STORED_VALUES_RESP': 1013, 'DBSERVER_SET_STORED_VALUES': 1014, 'SERVER_PING': 5002} AIMsgId2Names = invertDictLossless(AIMsgName2Id) for name, value in AIMsgName2Id.items(): exec '%s = %s' % (name, value) del name del value DBSERVER_ID = 4003
mit
8,465,867,581,276,243,000
37.5375
66
0.758028
false
OpenBMP/openbmp-python-api-message
src/openbmp/api/parsed/message/UnicastPrefix.py
1
5938
""" Copyright (c) 2015-2016 Cisco Systems, Inc. and others. All rights reserved. This program and the accompanying materials are made available under the terms of the Eclipse Public License v1.0 which accompanies this distribution, and is available at http:#www.eclipse.org/legal/epl-v10.html """ from .Base import Base from .FieldProcessors import ParseNullAsEmpty, ParseLongEmptyAsZero, ParseInt, NotNull, ParseTimestamp, ParseLong from .Message import Message from .MsgBusFields import MsgBusFields class UnicastPrefix(Base): """ Format class for unicast_prefix parsed messages (openbmp.parsed.unicast_prefix) Schema Version: 1.7 """ minimum_header_names = [ MsgBusFields.ACTION.get_name(), MsgBusFields.SEQUENCE.get_name(), MsgBusFields.HASH.get_name(), MsgBusFields.ROUTER_HASH.get_name(), MsgBusFields.ROUTER_IP.get_name(), MsgBusFields.BASE_ATTR_HASH.get_name(), MsgBusFields.PEER_HASH.get_name(), MsgBusFields.PEER_IP.get_name(), MsgBusFields.PEER_ASN.get_name(), MsgBusFields.TIMESTAMP.get_name(), MsgBusFields.PREFIX.get_name(), MsgBusFields.PREFIX_LEN.get_name(), MsgBusFields.IS_IPV4.get_name(), MsgBusFields.ORIGIN.get_name(), MsgBusFields.AS_PATH.get_name(), MsgBusFields.AS_PATH_COUNT.get_name(), MsgBusFields.ORIGIN_AS.get_name(), MsgBusFields.NEXTHOP.get_name(), MsgBusFields.MED.get_name(), MsgBusFields.LOCAL_PREF.get_name(), MsgBusFields.AGGREGATOR.get_name(), MsgBusFields.COMMUNITY_LIST.get_name(), MsgBusFields.EXT_COMMUNITY_LIST.get_name(), MsgBusFields.CLUSTER_LIST.get_name(), MsgBusFields.ISATOMICAGG.get_name(), MsgBusFields.IS_NEXTHOP_IPV4.get_name(), MsgBusFields.ORIGINATOR_ID.get_name() ] def __init__(self, message): """ Handle the message by parsing it and storing the data in memory. :param message: 'Message' object. """ if not isinstance(message, Message): raise TypeError("Expected Message object instead of type " + type(message)) version = message.get_version() data = message.get_content() super(UnicastPrefix, self).__init__() if version >= float(1.7): version_specific_headers = [ MsgBusFields.PATH_ID.get_name(), MsgBusFields.LABELS.get_name(), MsgBusFields.ISPREPOLICY.get_name(), MsgBusFields.IS_ADJ_RIB_IN.get_name(), MsgBusFields.LARGE_COMMUNITY_LIST.get_name() ] elif version >= float(1.3): version_specific_headers = [ MsgBusFields.PATH_ID.get_name(), MsgBusFields.LABELS.get_name(), MsgBusFields.ISPREPOLICY.get_name(), MsgBusFields.IS_ADJ_RIB_IN.get_name() ] elif version >= float(1.1): version_specific_headers = [ MsgBusFields.PATH_ID.get_name(), MsgBusFields.LABELS.get_name() ] else: version_specific_headers = [] # Concatenate minimum header names and version specific header names. self.header_names = UnicastPrefix.minimum_header_names + version_specific_headers self.spec_version = version self.processors = self.get_processors() if data: self.parse(version, data) def get_processors(self): """ Processors used for each field. Order matters and must match the same order as defined in headerNames :return: array of cell processors. """ default_cell_processors = [ NotNull(), # action ParseLong(), # seq NotNull(), # hash NotNull(), # router hash NotNull(), # router_ip ParseNullAsEmpty(), # base_attr_hash NotNull(), # peer_hash NotNull(), # peer_ip ParseLong(), # peer_asn ParseTimestamp(), # timestamp NotNull(), # prefix ParseInt(), # prefix_len ParseInt(), # isIPv4 ParseNullAsEmpty(), # origin ParseNullAsEmpty(), # as_path ParseLongEmptyAsZero(), # as_path_count ParseLongEmptyAsZero(), # origin_as ParseNullAsEmpty(), # nexthop ParseLongEmptyAsZero(), # med ParseLongEmptyAsZero(), # local_pref ParseNullAsEmpty(), # aggregator ParseNullAsEmpty(), # community_list ParseNullAsEmpty(), # ext_community_list ParseNullAsEmpty(), # cluster_list ParseLongEmptyAsZero(), # isAtomicAgg ParseLongEmptyAsZero(), # isNexthopIPv4 ParseNullAsEmpty(), # originator_id ] if self.spec_version >= float(1.7): version_specific_processors = [ ParseLongEmptyAsZero(), # Path ID ParseNullAsEmpty(), # Labels ParseLongEmptyAsZero(), # isPrePolicy ParseLongEmptyAsZero(), # isAdjRibIn ParseNullAsEmpty() # large communities ] elif self.spec_version >= float(1.3): version_specific_processors = [ ParseLongEmptyAsZero(), # Path ID ParseNullAsEmpty(), # Labels ParseLongEmptyAsZero(), # isPrePolicy ParseLongEmptyAsZero() # isAdjRibIn ] elif self.spec_version >= float(1.1): version_specific_processors = [ ParseLongEmptyAsZero(), # Path ID ParseNullAsEmpty(), # Labels ] else: version_specific_processors = [] return default_cell_processors + version_specific_processors
epl-1.0
-5,826,643,891,727,278,000
36.1125
113
0.582688
false
pyrocko/pyrocko
src/guts.py
1
64588
# -*- coding: utf-8 -*- # http://pyrocko.org - GPLv3 # # The Pyrocko Developers, 21st Century # ---|P------/S----------~Lg---------- '''Lightweight declarative YAML and XML data binding for Python.''' from __future__ import absolute_import, print_function import datetime import calendar import re import sys import types import copy import os.path as op from collections import defaultdict from io import BytesIO try: import numpy as num except ImportError: num = None import yaml try: from yaml import CSafeLoader as SafeLoader, CSafeDumper as SafeDumper except ImportError: from yaml import SafeLoader, SafeDumper from .util import time_to_str, str_to_time, TimeStrError, hpfloat, \ get_time_float try: newstr = unicode range = xrange except NameError: newstr = str try: # needed for py2/py3 compatibility to allow # from pyrocko.guts import FileNotFoundError FileNotFoundError = FileNotFoundError except NameError: class FileNotFoundError(EnvironmentError): pass ALLOW_INCLUDE = False class GutsSafeDumper(SafeDumper): pass class GutsSafeLoader(SafeLoader): pass try: unicode except NameError: unicode = str g_iprop = 0 g_deferred = {} g_deferred_content = {} g_tagname_to_class = {} g_xmltagname_to_class = {} g_guessable_xmlns = {} guts_types = [ 'Object', 'SObject', 'String', 'Unicode', 'Int', 'Float', 'Complex', 'Bool', 'Timestamp', 'DateTimestamp', 'StringPattern', 'UnicodePattern', 'StringChoice', 'List', 'Dict', 'Tuple', 'Union', 'Choice', 'Any'] us_to_cc_regex = re.compile(r'([a-z])_([a-z])') class literal(str): pass class folded(str): pass class singlequoted(str): pass class doublequoted(str): pass def make_str_presenter(style): def presenter(dumper, data): return dumper.represent_scalar( 'tag:yaml.org,2002:str', str(data), style=style) return presenter str_style_map = { None: lambda x: x, '|': literal, '>': folded, "'": singlequoted, '"': doublequoted} for (style, cls) in str_style_map.items(): if style: GutsSafeDumper.add_representer(cls, make_str_presenter(style)) class uliteral(unicode): pass class ufolded(unicode): pass class usinglequoted(unicode): pass class udoublequoted(unicode): pass def make_unicode_presenter(style): def presenter(dumper, data): return dumper.represent_scalar( 'tag:yaml.org,2002:str', unicode(data), style=style) return presenter unicode_style_map = { None: lambda x: x, '|': literal, '>': folded, "'": singlequoted, '"': doublequoted} for (style, cls) in unicode_style_map.items(): if style: GutsSafeDumper.add_representer(cls, make_unicode_presenter(style)) class blist(list): pass class flist(list): pass list_style_map = { None: list, 'block': blist, 'flow': flist} def make_list_presenter(flow_style): def presenter(dumper, data): return dumper.represent_sequence( 'tag:yaml.org,2002:seq', data, flow_style=flow_style) return presenter GutsSafeDumper.add_representer(blist, make_list_presenter(False)) GutsSafeDumper.add_representer(flist, make_list_presenter(True)) if num: def numpy_float_presenter(dumper, data): return dumper.represent_float(float(data)) def numpy_int_presenter(dumper, data): return dumper.represent_int(int(data)) for dtype in (num.float64, num.float32): GutsSafeDumper.add_representer(dtype, numpy_float_presenter) for dtype in (num.int32, num.int64): GutsSafeDumper.add_representer(dtype, numpy_int_presenter) def us_to_cc(s): return us_to_cc_regex.sub(lambda pat: pat.group(1)+pat.group(2).upper(), s) cc_to_us_regex1 = re.compile(r'([a-z])([A-Z]+)([a-z]|$)') cc_to_us_regex2 = re.compile(r'([A-Z])([A-Z][a-z])') def cc_to_us(s): return cc_to_us_regex2.sub('\\1_\\2', cc_to_us_regex1.sub( '\\1_\\2\\3', s)).lower() re_frac = re.compile(r'\.[1-9]FRAC') frac_formats = dict([('.%sFRAC' % x, '%.'+x+'f') for x in '123456789']) def encode_utf8(s): return s.encode('utf-8') def no_encode(s): return s def make_xmltagname_from_name(name): return us_to_cc(name) def make_name_from_xmltagname(xmltagname): return cc_to_us(xmltagname) def make_content_name(name): if name.endswith('_list'): return name[:-5] elif name.endswith('s'): return name[:-1] else: return name def classnames(cls): if isinstance(cls, tuple): return '(%s)' % ', '.join(x.__name__ for x in cls) else: return cls.__name__ def expand_stream_args(mode): def wrap(f): '''Decorator to enhance functions taking stream objects. Wraps a function f(..., stream, ...) so that it can also be called as f(..., filename='myfilename', ...) or as f(..., string='mydata', ...). ''' def g(*args, **kwargs): stream = kwargs.pop('stream', None) filename = kwargs.get('filename', None) if mode != 'r': filename = kwargs.pop('filename', None) string = kwargs.pop('string', None) assert sum(x is not None for x in (stream, filename, string)) <= 1 if stream is not None: kwargs['stream'] = stream return f(*args, **kwargs) elif filename is not None: stream = open(filename, mode+'b') kwargs['stream'] = stream retval = f(*args, **kwargs) if isinstance(retval, types.GeneratorType): def wrap_generator(gen): try: for x in gen: yield x except GeneratorExit: pass stream.close() return wrap_generator(retval) else: stream.close() return retval elif string is not None: assert mode == 'r', \ 'Keyword argument string=... cannot be used in dumper ' \ 'function.' kwargs['stream'] = BytesIO(string.encode('utf-8')) return f(*args, **kwargs) else: assert mode == 'w', \ 'Use keyword argument stream=... or filename=... in ' \ 'loader function.' sout = BytesIO() f(stream=sout, *args, **kwargs) return sout.getvalue().decode('utf-8') return g return wrap class Defer(object): def __init__(self, classname, *args, **kwargs): global g_iprop if kwargs.get('position', None) is None: kwargs['position'] = g_iprop g_iprop += 1 self.classname = classname self.args = args self.kwargs = kwargs class TBase(object): strict = False multivalued = None force_regularize = False propnames = [] @classmethod def init_propertystuff(cls): cls.properties = [] cls.xmltagname_to_name = {} cls.xmltagname_to_name_multivalued = {} cls.xmltagname_to_class = {} cls.content_property = None def __init__( self, default=None, optional=False, xmlstyle='element', xmltagname=None, xmlns=None, help=None, position=None): global g_iprop if position is not None: self.position = position else: self.position = g_iprop g_iprop += 1 self._default = default self.optional = optional self.name = None self._xmltagname = xmltagname self._xmlns = xmlns self.parent = None self.xmlstyle = xmlstyle self.help = help def default(self): return make_default(self._default) def is_default(self, val): if self._default is None: return val is None else: return self._default == val def has_default(self): return self._default is not None def xname(self): if self.name is not None: return self.name elif self.parent is not None: return 'element of %s' % self.parent.xname() else: return '?' def set_xmlns(self, xmlns): if self._xmlns is None and not self.xmlns: self._xmlns = xmlns if self.multivalued: self.content_t.set_xmlns(xmlns) def get_xmlns(self): return self._xmlns or self.xmlns def get_xmltagname(self): if self._xmltagname is not None: return self.get_xmlns() + ' ' + self._xmltagname elif self.name: return self.get_xmlns() + ' ' \ + make_xmltagname_from_name(self.name) elif self.xmltagname: return self.get_xmlns() + ' ' + self.xmltagname else: assert False @classmethod def get_property(cls, name): for prop in cls.properties: if prop.name == name: return prop raise ValueError() @classmethod def remove_property(cls, name): prop = cls.get_property(name) if not prop.multivalued: del cls.xmltagname_to_class[prop.effective_xmltagname] del cls.xmltagname_to_name[prop.effective_xmltagname] else: del cls.xmltagname_to_class[prop.content_t.effective_xmltagname] del cls.xmltagname_to_name_multivalued[ prop.content_t.effective_xmltagname] if cls.content_property is prop: cls.content_property = None cls.properties.remove(prop) cls.propnames.remove(name) return prop @classmethod def add_property(cls, name, prop): prop.instance = prop prop.name = name prop.set_xmlns(cls.xmlns) if isinstance(prop, Choice.T): for tc in prop.choices: tc.effective_xmltagname = tc.get_xmltagname() cls.xmltagname_to_class[tc.effective_xmltagname] = tc.cls cls.xmltagname_to_name[tc.effective_xmltagname] = prop.name elif not prop.multivalued: prop.effective_xmltagname = prop.get_xmltagname() cls.xmltagname_to_class[prop.effective_xmltagname] = prop.cls cls.xmltagname_to_name[prop.effective_xmltagname] = prop.name else: prop.content_t.name = make_content_name(prop.name) prop.content_t.effective_xmltagname = \ prop.content_t.get_xmltagname() cls.xmltagname_to_class[ prop.content_t.effective_xmltagname] = prop.content_t.cls cls.xmltagname_to_name_multivalued[ prop.content_t.effective_xmltagname] = prop.name cls.properties.append(prop) cls.properties.sort(key=lambda x: x.position) cls.propnames = [p.name for p in cls.properties] if prop.xmlstyle == 'content': cls.content_property = prop @classmethod def ivals(cls, val): for prop in cls.properties: yield getattr(val, prop.name) @classmethod def ipropvals(cls, val): for prop in cls.properties: yield prop, getattr(val, prop.name) @classmethod def inamevals(cls, val): for prop in cls.properties: yield prop.name, getattr(val, prop.name) @classmethod def ipropvals_to_save(cls, val, xmlmode=False): for prop in cls.properties: v = getattr(val, prop.name) if v is not None and ( not (prop.optional or (prop.multivalued and not v)) or (not prop.is_default(v))): if xmlmode: yield prop, prop.to_save_xml(v) else: yield prop, prop.to_save(v) @classmethod def inamevals_to_save(cls, val, xmlmode=False): for prop, v in cls.ipropvals_to_save(val, xmlmode): yield prop.name, v @classmethod def translate_from_xml(cls, list_of_pairs, strict): d = {} for k, v in list_of_pairs: if k in cls.xmltagname_to_name_multivalued: k2 = cls.xmltagname_to_name_multivalued[k] if k2 not in d: d[k2] = [] d[k2].append(v) elif k in cls.xmltagname_to_name: k2 = cls.xmltagname_to_name[k] if k2 in d: raise ArgumentError( 'Unexpectedly found more than one child element "%s" ' 'within "%s".' % (k, cls.tagname)) d[k2] = v elif k is None: if cls.content_property: k2 = cls.content_property.name d[k2] = v else: if strict: raise ArgumentError( 'Unexpected child element "%s" found within "%s".' % ( k, cls.tagname)) return d def validate(self, val, regularize=False, depth=-1): if self.optional and val is None: return val is_derived = isinstance(val, self.cls) is_exact = type(val) == self.cls not_ok = not self.strict and not is_derived or \ self.strict and not is_exact if not_ok or self.force_regularize: if regularize: try: val = self.regularize_extra(val) except ValueError: raise ValidationError( '%s: could not convert "%s" to type %s' % ( self.xname(), val, classnames(self.cls))) else: raise ValidationError( '%s: "%s" (type: %s) is not of type %s' % ( self.xname(), val, type(val), classnames(self.cls))) validator = self if isinstance(self.cls, tuple): clss = self.cls else: clss = (self.cls,) for cls in clss: try: if type(val) != cls and isinstance(val, cls): validator = val.T.instance except AttributeError: pass validator.validate_extra(val) if depth != 0: val = validator.validate_children(val, regularize, depth) return val def regularize_extra(self, val): return self.cls(val) def validate_extra(self, val): pass def validate_children(self, val, regularize, depth): for prop, propval in self.ipropvals(val): newpropval = prop.validate(propval, regularize, depth-1) if regularize and (newpropval is not propval): setattr(val, prop.name, newpropval) return val def to_save(self, val): return val def to_save_xml(self, val): return self.to_save(val) def extend_xmlelements(self, elems, v): if self.multivalued: for x in v: elems.append((self.content_t.effective_xmltagname, x)) else: elems.append((self.effective_xmltagname, v)) def deferred(self): return [] def classname_for_help(self, strip_module=''): if self.dummy_cls in guts_plain_dummy_types: return '``%s``' % self.cls.__name__ elif self.dummy_cls.dummy_for_description: return self.dummy_cls.dummy_for_description else: if self.dummy_cls is not self.cls: if self.dummy_cls.__module__ == strip_module: sadd = ' (:py:class:`%s`)' % ( self.dummy_cls.__name__) else: sadd = ' (:py:class:`%s.%s`)' % ( self.dummy_cls.__module__, self.dummy_cls.__name__) else: sadd = '' def sclass(cls): mod = cls.__module__ clsn = cls.__name__ if mod == '__builtin__' or mod == 'builtins': return '``%s``' % clsn elif mod == strip_module: return ':py:class:`%s`' % clsn else: return ':py:class:`%s.%s`' % (mod, clsn) if isinstance(self.cls, tuple): return '(%s)%s' % ( ' | '.join(sclass(cls) for cls in self.cls), sadd) else: return '%s%s' % (sclass(cls), sadd) @classmethod def props_help_string(cls): baseprops = [] for base in cls.dummy_cls.__bases__: if hasattr(base, 'T'): baseprops.extend(base.T.properties) hlp = [] hlp.append('') for prop in cls.properties: if prop in baseprops: continue descr = [ prop.classname_for_help(strip_module=cls.dummy_cls.__module__)] if prop.optional: descr.append('*optional*') if isinstance(prop._default, DefaultMaker): descr.append('*default:* ``%s``' % repr(prop._default)) else: d = prop.default() if d is not None: descr.append('*default:* ``%s``' % repr(d)) hlp.append(' .. py:gattribute:: %s' % prop.name) hlp.append('') hlp.append(' %s' % ', '.join(descr)) hlp.append(' ') if prop.help is not None: hlp.append(' %s' % prop.help) hlp.append('') return '\n'.join(hlp) @classmethod def class_help_string(cls): return cls.dummy_cls.__doc_template__ @classmethod def class_signature(cls): r = [] for prop in cls.properties: d = prop.default() if d is not None: arg = repr(d) elif prop.optional: arg = 'None' else: arg = '...' r.append('%s=%s' % (prop.name, arg)) return '(%s)' % ', '.join(r) @classmethod def help(cls): return cls.props_help_string() class ObjectMetaClass(type): def __new__(meta, classname, bases, class_dict): cls = type.__new__(meta, classname, bases, class_dict) if classname != 'Object': t_class_attr_name = '_%s__T' % classname if not hasattr(cls, t_class_attr_name): if hasattr(cls, 'T'): class T(cls.T): pass else: class T(TBase): pass setattr(cls, t_class_attr_name, T) T = getattr(cls, t_class_attr_name) if cls.dummy_for is not None: T.cls = cls.dummy_for else: T.cls = cls T.dummy_cls = cls if hasattr(cls, 'xmltagname'): T.xmltagname = cls.xmltagname else: T.xmltagname = classname mod = sys.modules[cls.__module__] if hasattr(cls, 'xmlns'): T.xmlns = cls.xmlns elif hasattr(mod, 'guts_xmlns'): T.xmlns = mod.guts_xmlns else: T.xmlns = '' if T.xmlns and hasattr(cls, 'guessable_xmlns'): g_guessable_xmlns[T.xmltagname] = cls.guessable_xmlns if hasattr(mod, 'guts_prefix'): if mod.guts_prefix: T.tagname = mod.guts_prefix + '.' + classname else: T.tagname = classname else: if cls.__module__ != '__main__': T.tagname = cls.__module__ + '.' + classname else: T.tagname = classname T.classname = classname T.init_propertystuff() for k in dir(cls): prop = getattr(cls, k) if k.endswith('__'): k = k[:-2] if isinstance(prop, TBase): if prop.deferred(): for defer in prop.deferred(): g_deferred_content.setdefault( defer.classname[:-2], []).append((prop, defer)) g_deferred.setdefault( defer.classname[:-2], []).append((T, k, prop)) else: T.add_property(k, prop) elif isinstance(prop, Defer): g_deferred.setdefault(prop.classname[:-2], []).append( (T, k, prop)) if classname in g_deferred_content: for prop, defer in g_deferred_content[classname]: prop.process_deferred( defer, T(*defer.args, **defer.kwargs)) del g_deferred_content[classname] if classname in g_deferred: for (T_, k_, prop_) in g_deferred.get(classname, []): if isinstance(prop_, Defer): prop_ = T(*prop_.args, **prop_.kwargs) if not prop_.deferred(): T_.add_property(k_, prop_) del g_deferred[classname] g_tagname_to_class[T.tagname] = cls if hasattr(cls, 'xmltagname'): g_xmltagname_to_class[T.xmlns + ' ' + T.xmltagname] = cls cls.T = T T.instance = T() cls.__doc_template__ = cls.__doc__ cls.__doc__ = T.class_help_string() if cls.__doc__ is None: cls.__doc__ = 'Undocumented.' cls.__doc__ += '\n' + T.props_help_string() return cls class ValidationError(Exception): pass class ArgumentError(Exception): pass def make_default(x): if isinstance(x, DefaultMaker): return x.make() elif isinstance(x, Object): return clone(x) else: return x class DefaultMaker(object): def make(self): raise NotImplementedError('Schould be implemented in subclass.') class ObjectDefaultMaker(DefaultMaker): def __init__(self, cls, args, kwargs): DefaultMaker.__init__(self) self.cls = cls self.args = args self.kwargs = kwargs self.instance = None def make(self): return self.cls( *[make_default(x) for x in self.args], **dict((k, make_default(v)) for (k, v) in self.kwargs.items())) def __eq__(self, other): if self.instance is None: self.instance = self.make() return self.instance == other def __repr__(self): sargs = [] for arg in self.args: sargs.append(repr(arg)) for k, v in self.kwargs.items(): sargs.append('%s=%s' % (k, repr(v))) return '%s(%s)' % (self.cls.__name__, ', '.join(sargs)) class TimestampDefaultMaker(DefaultMaker): def __init__(self, s, format='%Y-%m-%d %H:%M:%S.OPTFRAC'): DefaultMaker.__init__(self) self._stime = s self._format = format def make(self): return str_to_time(self._stime, self._format) def __repr__(self): return "str_to_time(%s)" % repr(self._stime) def with_metaclass(meta, *bases): # inlined py2/py3 compat solution from python-future class metaclass(meta): __call__ = type.__call__ __init__ = type.__init__ def __new__(cls, name, this_bases, d): if this_bases is None: return type.__new__(cls, name, (), d) return meta(name, bases, d) return metaclass('temp', None, {}) class Object(with_metaclass(ObjectMetaClass, object)): dummy_for = None dummy_for_description = None def __init__(self, **kwargs): if not kwargs.get('init_props', True): return for prop in self.T.properties: k = prop.name if k in kwargs: setattr(self, k, kwargs.pop(k)) else: if not prop.optional and not prop.has_default(): raise ArgumentError('Missing argument to %s: %s' % ( self.T.tagname, prop.name)) else: setattr(self, k, prop.default()) if kwargs: raise ArgumentError('Invalid argument to %s: %s' % ( self.T.tagname, ', '.join(list(kwargs.keys())))) @classmethod def D(cls, *args, **kwargs): return ObjectDefaultMaker(cls, args, kwargs) def validate(self, regularize=False, depth=-1): self.T.instance.validate(self, regularize, depth) def regularize(self, depth=-1): self.validate(regularize=True, depth=depth) def dump(self, stream=None, filename=None, header=False): return dump(self, stream=stream, filename=filename, header=header) def dump_xml( self, stream=None, filename=None, header=False, ns_ignore=False): return dump_xml( self, stream=stream, filename=filename, header=header, ns_ignore=ns_ignore) @classmethod def load(cls, stream=None, filename=None, string=None): return load(stream=stream, filename=filename, string=string) @classmethod def load_xml(cls, stream=None, filename=None, string=None, ns_hints=None, ns_ignore=False): if ns_hints is None: ns_hints = [cls.T.instance.get_xmlns()] return load_xml( stream=stream, filename=filename, string=string, ns_hints=ns_hints, ns_ignore=ns_ignore) def __str__(self): return self.dump() def to_dict(obj): ''' Get dict of guts object attributes. :param obj: :py:class`Object` object ''' return dict(obj.T.inamevals(obj)) class SObject(Object): class __T(TBase): def regularize_extra(self, val): if isinstance(val, (str, newstr)): return self.cls(val) return val def to_save(self, val): return str(val) def to_save_xml(self, val): return str(val) class Any(Object): class __T(TBase): def validate(self, val, regularize=False, depth=-1): if isinstance(val, Object): val.validate(regularize, depth) return val class Int(Object): dummy_for = int class __T(TBase): strict = True def to_save_xml(self, value): return repr(value) class Float(Object): dummy_for = float class __T(TBase): strict = True def to_save_xml(self, value): return repr(value) class Complex(Object): dummy_for = complex class __T(TBase): strict = True def regularize_extra(self, val): if isinstance(val, list) or isinstance(val, tuple): assert len(val) == 2 val = complex(*val) elif not isinstance(val, complex): val = complex(val) return val def to_save(self, value): return repr(value) def to_save_xml(self, value): return repr(value) class Bool(Object): dummy_for = bool class __T(TBase): strict = True def regularize_extra(self, val): if isinstance(val, (str, newstr)): if val.lower().strip() in ('0', 'false'): return False return bool(val) def to_save_xml(self, value): return repr(bool(value)).lower() class String(Object): dummy_for = str class __T(TBase): def __init__(self, *args, **kwargs): yamlstyle = kwargs.pop('yamlstyle', None) TBase.__init__(self, *args, **kwargs) self.style_cls = str_style_map[yamlstyle] def to_save(self, val): return self.style_cls(val) class Unicode(Object): dummy_for = newstr class __T(TBase): def __init__(self, *args, **kwargs): yamlstyle = kwargs.pop('yamlstyle', None) TBase.__init__(self, *args, **kwargs) self.style_cls = unicode_style_map[yamlstyle] def to_save(self, val): return self.style_cls(val) guts_plain_dummy_types = (String, Unicode, Int, Float, Complex, Bool) class Dict(Object): dummy_for = dict class __T(TBase): multivalued = dict def __init__(self, key_t=Any.T(), content_t=Any.T(), *args, **kwargs): TBase.__init__(self, *args, **kwargs) assert isinstance(key_t, TBase) assert isinstance(content_t, TBase) self.key_t = key_t self.content_t = content_t self.content_t.parent = self def default(self): if self._default is not None: return dict( (make_default(k), make_default(v)) for (k, v) in self._default.items()) if self.optional: return None else: return {} def has_default(self): return True def validate(self, val, regularize, depth): return TBase.validate(self, val, regularize, depth+1) def validate_children(self, val, regularize, depth): for key, ele in list(val.items()): newkey = self.key_t.validate(key, regularize, depth-1) newele = self.content_t.validate(ele, regularize, depth-1) if regularize: if newkey is not key or newele is not ele: del val[key] val[newkey] = newele return val def to_save(self, val): return dict((self.key_t.to_save(k), self.content_t.to_save(v)) for (k, v) in val.items()) def to_save_xml(self, val): raise NotImplementedError() def classname_for_help(self, strip_module=''): return '``dict`` of %s objects' % \ self.content_t.classname_for_help(strip_module=strip_module) class List(Object): dummy_for = list class __T(TBase): multivalued = list def __init__(self, content_t=Any.T(), *args, **kwargs): yamlstyle = kwargs.pop('yamlstyle', None) TBase.__init__(self, *args, **kwargs) assert isinstance(content_t, TBase) or isinstance(content_t, Defer) self.content_t = content_t self.content_t.parent = self self.style_cls = list_style_map[yamlstyle] def default(self): if self._default is not None: return [make_default(x) for x in self._default] if self.optional: return None else: return [] def has_default(self): return True def validate(self, val, regularize, depth): return TBase.validate(self, val, regularize, depth+1) def validate_children(self, val, regularize, depth): for i, ele in enumerate(val): newele = self.content_t.validate(ele, regularize, depth-1) if regularize and newele is not ele: val[i] = newele return val def to_save(self, val): return self.style_cls(self.content_t.to_save(v) for v in val) def to_save_xml(self, val): return [self.content_t.to_save_xml(v) for v in val] def deferred(self): if isinstance(self.content_t, Defer): return [self.content_t] return [] def process_deferred(self, defer, t_inst): if defer is self.content_t: self.content_t = t_inst def classname_for_help(self, strip_module=''): return '``list`` of %s objects' % \ self.content_t.classname_for_help(strip_module=strip_module) def make_typed_list_class(t): class TL(List): class __T(List.T): def __init__(self, *args, **kwargs): List.T.__init__(self, content_t=t.T(), *args, **kwargs) return TL class Tuple(Object): dummy_for = tuple class __T(TBase): multivalued = tuple def __init__(self, n=None, content_t=Any.T(), *args, **kwargs): TBase.__init__(self, *args, **kwargs) assert isinstance(content_t, TBase) self.content_t = content_t self.content_t.parent = self self.n = n def default(self): if self._default is not None: return tuple( make_default(x) for x in self._default) elif self.optional: return None else: if self.n is not None: return tuple( self.content_t.default() for x in range(self.n)) else: return tuple() def has_default(self): return True def validate(self, val, regularize, depth): return TBase.validate(self, val, regularize, depth+1) def validate_extra(self, val): if self.n is not None and len(val) != self.n: raise ValidationError( '%s should have length %i' % (self.xname(), self.n)) def validate_children(self, val, regularize, depth): if not regularize: for ele in val: self.content_t.validate(ele, regularize, depth-1) return val else: newval = [] isnew = False for ele in val: newele = self.content_t.validate(ele, regularize, depth-1) newval.append(newele) if newele is not ele: isnew = True if isnew: return tuple(newval) else: return val def to_save(self, val): return tuple(self.content_t.to_save(v) for v in val) def to_save_xml(self, val): return [self.content_t.to_save_xml(v) for v in val] def classname_for_help(self, strip_module=''): if self.n is not None: return '``tuple`` of %i %s objects' % ( self.n, self.content_t.classname_for_help( strip_module=strip_module)) else: return '``tuple`` of %s objects' % ( self.content_t.classname_for_help( strip_module=strip_module)) re_tz = re.compile(r'(Z|([+-][0-2][0-9])(:?([0-5][0-9]))?)$') class Timestamp(Object): dummy_for = (hpfloat, float) dummy_for_description = 'time_float' class __T(TBase): def regularize_extra(self, val): time_float = get_time_float() if isinstance(val, datetime.datetime): tt = val.utctimetuple() val = time_float(calendar.timegm(tt)) + val.microsecond * 1e-6 elif isinstance(val, datetime.date): tt = val.timetuple() val = time_float(calendar.timegm(tt)) elif isinstance(val, (str, newstr)): val = val.strip() tz_offset = 0 m = re_tz.search(val) if m: sh = m.group(2) sm = m.group(4) tz_offset = (int(sh)*3600 if sh else 0) \ + (int(sm)*60 if sm else 0) val = re_tz.sub('', val) if len(val) > 10 and val[10] == 'T': val = val.replace('T', ' ', 1) try: val = str_to_time(val) - tz_offset except TimeStrError: raise ValidationError( '%s: cannot parse time/date: %s' % (self.xname(), val)) elif isinstance(val, (int, float)): val = time_float(val) else: raise ValidationError( '%s: cannot convert "%s" to type %s' % ( self.xname(), val, time_float)) return val def to_save(self, val): return time_to_str(val, format='%Y-%m-%d %H:%M:%S.9FRAC')\ .rstrip('0').rstrip('.') def to_save_xml(self, val): return time_to_str(val, format='%Y-%m-%dT%H:%M:%S.9FRAC')\ .rstrip('0').rstrip('.') + 'Z' @classmethod def D(self, s): return TimestampDefaultMaker(s) class DateTimestamp(Object): dummy_for = (hpfloat, float) dummy_for_description = 'time_float' class __T(TBase): def regularize_extra(self, val): time_float = get_time_float() if isinstance(val, datetime.datetime): tt = val.utctimetuple() val = time_float(calendar.timegm(tt)) + val.microsecond * 1e-6 elif isinstance(val, datetime.date): tt = val.timetuple() val = time_float(calendar.timegm(tt)) elif isinstance(val, (str, newstr)): val = str_to_time(val, format='%Y-%m-%d') elif isinstance(val, int): val = time_float(val) return val def to_save(self, val): return time_to_str(val, format='%Y-%m-%d') def to_save_xml(self, val): return time_to_str(val, format='%Y-%m-%d') @classmethod def D(self, s): return TimestampDefaultMaker(s, format='%Y-%m-%d') class StringPattern(String): '''Any ``str`` matching pattern ``%(pattern)s``.''' dummy_for = str pattern = '.*' class __T(String.T): def __init__(self, pattern=None, *args, **kwargs): String.T.__init__(self, *args, **kwargs) if pattern is not None: self.pattern = pattern else: self.pattern = self.dummy_cls.pattern def validate_extra(self, val): pat = self.pattern if not re.search(pat, val): raise ValidationError('%s: "%s" does not match pattern %s' % ( self.xname(), val, repr(pat))) @classmethod def class_help_string(cls): dcls = cls.dummy_cls doc = dcls.__doc_template__ or StringPattern.__doc_template__ return doc % {'pattern': repr(dcls.pattern)} class UnicodePattern(Unicode): '''Any ``unicode`` matching pattern ``%(pattern)s``.''' dummy_for = newstr pattern = '.*' class __T(TBase): def __init__(self, pattern=None, *args, **kwargs): TBase.__init__(self, *args, **kwargs) if pattern is not None: self.pattern = pattern else: self.pattern = self.dummy_cls.pattern def validate_extra(self, val): pat = self.pattern if not re.search(pat, val, flags=re.UNICODE): raise ValidationError('%s: "%s" does not match pattern %s' % ( self.xname(), val, repr(pat))) @classmethod def class_help_string(cls): dcls = cls.dummy_cls doc = dcls.__doc_template__ or UnicodePattern.__doc_template__ return doc % {'pattern': repr(dcls.pattern)} class StringChoice(String): '''Any ``str`` out of ``%(choices)s``.''' dummy_for = str choices = [] ignore_case = False class __T(String.T): def __init__(self, choices=None, ignore_case=None, *args, **kwargs): String.T.__init__(self, *args, **kwargs) if choices is not None: self.choices = choices else: self.choices = self.dummy_cls.choices if ignore_case is not None: self.ignore_case = ignore_case else: self.ignore_case = self.dummy_cls.ignore_case if self.ignore_case: self.choices = [x.upper() for x in self.choices] def validate_extra(self, val): if self.ignore_case: val = val.upper() if val not in self.choices: raise ValidationError( '%s: "%s" is not a valid choice out of %s' % ( self.xname(), val, repr(self.choices))) @classmethod def class_help_string(cls): dcls = cls.dummy_cls doc = dcls.__doc_template__ or StringChoice.__doc_template__ return doc % {'choices': repr(dcls.choices)} # this will not always work... class Union(Object): members = [] dummy_for = str class __T(TBase): def __init__(self, members=None, *args, **kwargs): TBase.__init__(self, *args, **kwargs) if members is not None: self.members = members else: self.members = self.dummy_cls.members def validate(self, val, regularize=False, depth=-1): assert self.members e2 = None for member in self.members: try: return member.validate(val, regularize, depth=depth) except ValidationError as e: e2 = e raise e2 class Choice(Object): choices = [] class __T(TBase): def __init__(self, choices=None, *args, **kwargs): TBase.__init__(self, *args, **kwargs) if choices is not None: self.choices = choices else: self.choices = self.dummy_cls.choices self.cls_to_xmltagname = dict( (t.cls, t.get_xmltagname()) for t in self.choices) def validate(self, val, regularize=False, depth=-1): if self.optional and val is None: return val t = None for tc in self.choices: is_derived = isinstance(val, tc.cls) is_exact = type(val) == tc.cls if not (not tc.strict and not is_derived or tc.strict and not is_exact): t = tc break if t is None: if regularize: ok = False for tc in self.choices: try: val = tc.regularize_extra(val) ok = True t = tc break except (ValidationError, ValueError): pass if not ok: raise ValidationError( '%s: could not convert "%s" to any type out of ' '(%s)' % (self.xname(), val, ','.join( classnames(x.cls) for x in self.choices))) else: raise ValidationError( '%s: "%s" (type: %s) is not of any type out of ' '(%s)' % (self.xname(), val, type(val), ','.join( classnames(x.cls) for x in self.choices))) validator = t if isinstance(t.cls, tuple): clss = t.cls else: clss = (t.cls,) for cls in clss: try: if type(val) != cls and isinstance(val, cls): validator = val.T.instance except AttributeError: pass validator.validate_extra(val) if depth != 0: val = validator.validate_children(val, regularize, depth) return val def extend_xmlelements(self, elems, v): elems.append(( self.cls_to_xmltagname[type(v)].split(' ', 1)[-1], v)) def _dump( object, stream, header=False, Dumper=GutsSafeDumper, _dump_function=yaml.dump): if not getattr(stream, 'encoding', None): enc = encode_utf8 else: enc = no_encode if header: stream.write(enc(u'%YAML 1.1\n')) if isinstance(header, (str, newstr)): banner = u'\n'.join('# ' + x for x in header.splitlines()) + '\n' stream.write(enc(banner)) _dump_function( object, stream=stream, encoding='utf-8', explicit_start=True, Dumper=Dumper) def _dump_all(object, stream, header=True, Dumper=GutsSafeDumper): _dump(object, stream=stream, header=header, _dump_function=yaml.dump_all) def _load(stream, Loader=GutsSafeLoader, allow_include=None, filename=None, included_files=None): class _Loader(Loader): _filename = filename _allow_include = allow_include _included_files = included_files or [] return yaml.load(stream=stream, Loader=_Loader) def _load_all(stream, Loader=GutsSafeLoader, allow_include=None, filename=None): class _Loader(Loader): _filename = filename _allow_include = allow_include return list(yaml.load_all(stream=stream, Loader=_Loader)) def _iload_all(stream, Loader=GutsSafeLoader, allow_include=None, filename=None): class _Loader(Loader): _filename = filename _allow_include = allow_include return yaml.load_all(stream=stream, Loader=_Loader) def multi_representer(dumper, data): node = dumper.represent_mapping( '!'+data.T.tagname, data.T.inamevals_to_save(data), flow_style=False) return node # hack for compatibility with early GF Store versions re_compatibility = re.compile( r'^pyrocko\.(trace|gf\.(meta|seismosizer)|fomosto\.' r'(dummy|poel|qseis|qssp))\.' ) def multi_constructor(loader, tag_suffix, node): tagname = str(tag_suffix) tagname = re_compatibility.sub('pf.', tagname) cls = g_tagname_to_class[tagname] kwargs = dict(iter(loader.construct_pairs(node, deep=True))) o = cls(**kwargs) o.validate(regularize=True, depth=1) return o def include_constructor(loader, node): allow_include = loader._allow_include \ if loader._allow_include is not None \ else ALLOW_INCLUDE if not allow_include: raise EnvironmentError( 'Not allowed to include YAML. Load with allow_include=True') if isinstance(node, yaml.nodes.ScalarNode): inc_file = loader.construct_scalar(node) else: raise TypeError('Unsupported YAML node %s' % repr(node)) if loader._filename is not None and not op.isabs(inc_file): inc_file = op.join(op.dirname(loader._filename), inc_file) if not op.isfile(inc_file): raise FileNotFoundError(inc_file) included_files = list(loader._included_files) if loader._filename is not None: included_files.append(op.abspath(loader._filename)) for included_file in loader._included_files: if op.samefile(inc_file, included_file): raise ImportError( 'Circular import of file "%s". Include path: %s' % ( op.abspath(inc_file), ' -> '.join('"%s"' % s for s in included_files))) with open(inc_file) as f: return _load( f, Loader=loader.__class__, filename=inc_file, allow_include=True, included_files=included_files) def dict_noflow_representer(dumper, data): return dumper.represent_mapping( 'tag:yaml.org,2002:map', data, flow_style=False) yaml.add_multi_representer(Object, multi_representer, Dumper=GutsSafeDumper) yaml.add_constructor('!include', include_constructor, Loader=GutsSafeLoader) yaml.add_multi_constructor('!', multi_constructor, Loader=GutsSafeLoader) yaml.add_representer(dict, dict_noflow_representer, Dumper=GutsSafeDumper) def newstr_representer(dumper, data): return dumper.represent_scalar( 'tag:yaml.org,2002:str', unicode(data)) yaml.add_representer(newstr, newstr_representer, Dumper=GutsSafeDumper) class Constructor(object): def __init__(self, add_namespace_maps=False, strict=False, ns_hints=None, ns_ignore=False): self.stack = [] self.queue = [] self.namespaces = defaultdict(list) self.add_namespace_maps = add_namespace_maps self.strict = strict self.ns_hints = ns_hints self.ns_ignore = ns_ignore def start_element(self, ns_name, attrs): if self.ns_ignore: ns_name = ns_name.split(' ')[-1] if -1 == ns_name.find(' '): if self.ns_hints is None and ns_name in g_guessable_xmlns: self.ns_hints = g_guessable_xmlns[ns_name] if self.ns_hints: ns_names = [ ns_hint + ' ' + ns_name for ns_hint in self.ns_hints] elif self.ns_hints is None: ns_names = [' ' + ns_name] else: ns_names = [ns_name] for ns_name in ns_names: if self.stack and self.stack[-1][1] is not None: cls = self.stack[-1][1].T.xmltagname_to_class.get( ns_name, None) if isinstance(cls, tuple): cls = None else: if cls is not None and ( not issubclass(cls, Object) or issubclass(cls, SObject)): cls = None else: cls = g_xmltagname_to_class.get(ns_name, None) if cls: break self.stack.append((ns_name, cls, attrs, [], [])) def end_element(self, _): ns_name, cls, attrs, content2, content1 = self.stack.pop() ns = ns_name.split(' ', 1)[0] if cls is not None: content2.extend( (ns + ' ' + k if -1 == k.find(' ') else k, v) for (k, v) in attrs.items()) content2.append((None, ''.join(content1))) o = cls(**cls.T.translate_from_xml(content2, self.strict)) o.validate(regularize=True, depth=1) if self.add_namespace_maps: o.namespace_map = self.get_current_namespace_map() if self.stack and not all(x[1] is None for x in self.stack): self.stack[-1][-2].append((ns_name, o)) else: self.queue.append(o) else: content = [''.join(content1)] if self.stack: for c in content: self.stack[-1][-2].append((ns_name, c)) def characters(self, char_content): if self.stack: self.stack[-1][-1].append(char_content) def start_namespace(self, ns, uri): self.namespaces[ns].append(uri) def end_namespace(self, ns): self.namespaces[ns].pop() def get_current_namespace_map(self): return dict((k, v[-1]) for (k, v) in self.namespaces.items() if v) def get_queued_elements(self): queue = self.queue self.queue = [] return queue def _iload_all_xml( stream, bufsize=100000, add_namespace_maps=False, strict=False, ns_hints=None, ns_ignore=False): from xml.parsers.expat import ParserCreate parser = ParserCreate('UTF-8', namespace_separator=' ') handler = Constructor( add_namespace_maps=add_namespace_maps, strict=strict, ns_hints=ns_hints, ns_ignore=ns_ignore) parser.StartElementHandler = handler.start_element parser.EndElementHandler = handler.end_element parser.CharacterDataHandler = handler.characters parser.StartNamespaceDeclHandler = handler.start_namespace parser.EndNamespaceDeclHandler = handler.end_namespace while True: data = stream.read(bufsize) parser.Parse(data, bool(not data)) for element in handler.get_queued_elements(): yield element if not data: break def _load_all_xml(*args, **kwargs): return list(_iload_all_xml(*args, **kwargs)) def _load_xml(*args, **kwargs): g = _iload_all_xml(*args, **kwargs) return next(g) def _dump_all_xml(objects, stream, root_element_name='root', header=True): if not getattr(stream, 'encoding', None): enc = encode_utf8 else: enc = no_encode _dump_xml_header(stream, header) beg = u'<%s>\n' % root_element_name end = u'</%s>\n' % root_element_name stream.write(enc(beg)) for ob in objects: _dump_xml(ob, stream=stream) stream.write(enc(end)) def _dump_xml_header(stream, banner=None): if not getattr(stream, 'encoding', None): enc = encode_utf8 else: enc = no_encode stream.write(enc(u'<?xml version="1.0" encoding="UTF-8" ?>\n')) if isinstance(banner, (str, newstr)): stream.write(enc(u'<!-- %s -->\n' % banner)) def _dump_xml( obj, stream, depth=0, ns_name=None, header=False, ns_map=[], ns_ignore=False): from xml.sax.saxutils import escape, quoteattr if not getattr(stream, 'encoding', None): enc = encode_utf8 else: enc = no_encode if depth == 0 and header: _dump_xml_header(stream, header) indent = ' '*depth*2 if ns_name is None: ns_name = obj.T.instance.get_xmltagname() if -1 != ns_name.find(' '): ns, name = ns_name.split(' ') else: ns, name = '', ns_name if isinstance(obj, Object): obj.validate(depth=1) attrs = [] elems = [] added_ns = False if not ns_ignore and ns and (not ns_map or ns_map[-1] != ns): attrs.append(('xmlns', ns)) ns_map.append(ns) added_ns = True for prop, v in obj.T.ipropvals_to_save(obj, xmlmode=True): if prop.xmlstyle == 'attribute': assert not prop.multivalued assert not isinstance(v, Object) attrs.append((prop.effective_xmltagname, v)) elif prop.xmlstyle == 'content': assert not prop.multivalued assert not isinstance(v, Object) elems.append((None, v)) else: prop.extend_xmlelements(elems, v) attr_str = '' if attrs: attr_str = ' ' + ' '.join( '%s=%s' % (k.split(' ')[-1], quoteattr(str(v))) for (k, v) in attrs) if not elems: stream.write(enc(u'%s<%s%s />\n' % (indent, name, attr_str))) else: oneline = len(elems) == 1 and elems[0][0] is None stream.write(enc(u'%s<%s%s>%s' % ( indent, name, attr_str, '' if oneline else '\n'))) for (k, v) in elems: if k is None: stream.write(enc(escape(newstr(v), {'\0': '&#00;'}))) else: _dump_xml(v, stream, depth+1, k, False, ns_map, ns_ignore) stream.write(enc(u'%s</%s>\n' % ( '' if oneline else indent, name))) if added_ns: ns_map.pop() else: stream.write(enc(u'%s<%s>%s</%s>\n' % ( indent, name, escape(newstr(obj), {'\0': '&#00;'}), name))) def walk(x, typ=None, path=()): if typ is None or isinstance(x, typ): yield path, x if isinstance(x, Object): for (prop, val) in x.T.ipropvals(x): if prop.multivalued: if val is not None: for iele, ele in enumerate(val): for y in walk(ele, typ, path=path + ((prop.name, iele),)): yield y else: for y in walk(val, typ, path=path+(prop.name,)): yield y def clone(x, pool=None): ''' Clone guts object tree. Traverses guts object tree and recursively clones all guts attributes, falling back to :py:func:`copy.deepcopy` for non-guts objects. Objects deriving from :py:class:`Object` are instantiated using their respective init function. Multiply referenced objects in the source tree are multiply referenced also in the destination tree. This function can be used to clone guts objects ignoring any contained run-time state, i.e. any of their attributes not defined as a guts property. ''' if pool is None: pool = {} if id(x) in pool: x_copy = pool[id(x)] else: if isinstance(x, Object): d = {} for (prop, y) in x.T.ipropvals(x): if y is not None: if not prop.multivalued: y_copy = clone(y, pool) elif prop.multivalued is dict: y_copy = dict( (clone(zk, pool), clone(zv, pool)) for (zk, zv) in y.items()) else: y_copy = type(y)(clone(z, pool) for z in y) else: y_copy = y d[prop.name] = y_copy x_copy = x.__class__(**d) else: x_copy = copy.deepcopy(x) pool[id(x)] = x_copy return x_copy class YPathError(Exception): '''This exception is raised for invalid ypath specifications.''' pass def _parse_yname(yname): ident = r'[a-zA-Z][a-zA-Z0-9_]*' rint = r'-?[0-9]+' m = re.match( r'^(%s)(\[((%s)?(:)(%s)?|(%s))\])?$' % (ident, rint, rint, rint), yname) if not m: raise YPathError('Syntax error in component: "%s"' % yname) d = dict( name=m.group(1)) if m.group(2): if m.group(5): istart = iend = None if m.group(4): istart = int(m.group(4)) if m.group(6): iend = int(m.group(6)) d['slice'] = (istart, iend) else: d['index'] = int(m.group(7)) return d def _decend(obj, ynames): if ynames: for sobj in iter_elements(obj, ynames): yield sobj else: yield obj def iter_elements(obj, ypath): ''' Generator yielding elements matching a given ypath specification. :param obj: guts :py:class:`Object` instance :param ypath: Dot-separated object path (e.g. 'root.child.child'). To access list objects use slice notatation (e.g. 'root.child[:].child[1:3].child[1]'). Raises :py:exc:`YPathError` on failure. ''' try: if isinstance(ypath, str): ynames = ypath.split('.') else: ynames = ypath yname = ynames[0] ynames = ynames[1:] d = _parse_yname(yname) if d['name'] not in obj.T.propnames: raise AttributeError(d['name']) obj = getattr(obj, d['name']) if 'index' in d: sobj = obj[d['index']] for ssobj in _decend(sobj, ynames): yield ssobj elif 'slice' in d: for i in range(*slice(*d['slice']).indices(len(obj))): sobj = obj[i] for ssobj in _decend(sobj, ynames): yield ssobj else: for sobj in _decend(obj, ynames): yield sobj except (AttributeError, IndexError) as e: raise YPathError('Invalid ypath: "%s" (%s)' % (ypath, str(e))) def get_elements(obj, ypath): ''' Get all elements matching a given ypath specification. :param obj: guts :py:class:`Object` instance :param ypath: Dot-separated object path (e.g. 'root.child.child'). To access list objects use slice notatation (e.g. 'root.child[:].child[1:3].child[1]'). Raises :py:exc:`YPathError` on failure. ''' return list(iter_elements(obj, ypath)) def set_elements(obj, ypath, value, validate=False, regularize=False): ''' Set elements matching a given ypath specification. :param obj: guts :py:class:`Object` instance :param ypath: Dot-separated object path (e.g. 'root.child.child'). To access list objects use slice notatation (e.g. 'root.child[:].child[1:3].child[1]'). :param value: All matching elements will be set to `value`. :param validate: Whether to validate affected subtrees. :param regularize: Whether to regularize affected subtrees. Raises :py:exc:`YPathError` on failure. ''' ynames = ypath.split('.') try: d = _parse_yname(ynames[-1]) for sobj in iter_elements(obj, ynames[:-1]): if d['name'] not in sobj.T.propnames: raise AttributeError(d['name']) if 'index' in d: ssobj = getattr(sobj, d['name']) ssobj[d['index']] = value elif 'slice' in d: ssobj = getattr(sobj, d['name']) for i in range(*slice(*d['slice']).indices(len(ssobj))): ssobj[i] = value else: setattr(sobj, d['name'], value) if regularize: sobj.regularize() if validate: sobj.validate() except (AttributeError, IndexError, YPathError) as e: raise YPathError('Invalid ypath: "%s" (%s)' % (ypath, str(e))) def zip_walk(x, typ=None, path=(), stack=()): if typ is None or isinstance(x, typ): yield path, stack + (x,) if isinstance(x, Object): for (prop, val) in x.T.ipropvals(x): if prop.multivalued: if val is not None: for iele, ele in enumerate(val): for y in zip_walk( ele, typ, path=path + ((prop.name, iele),), stack=stack + (x,)): yield y else: for y in zip_walk(val, typ, path=path+(prop.name,), stack=stack + (x,)): yield y def path_element(x): if isinstance(x, tuple): return '%s[%i]' % x else: return x def path_to_str(path): return '.'.join(path_element(x) for x in path) @expand_stream_args('w') def dump(*args, **kwargs): return _dump(*args, **kwargs) @expand_stream_args('r') def load(*args, **kwargs): return _load(*args, **kwargs) def load_string(s, *args, **kwargs): return load(string=s, *args, **kwargs) @expand_stream_args('w') def dump_all(*args, **kwargs): return _dump_all(*args, **kwargs) @expand_stream_args('r') def load_all(*args, **kwargs): return _load_all(*args, **kwargs) @expand_stream_args('r') def iload_all(*args, **kwargs): return _iload_all(*args, **kwargs) @expand_stream_args('w') def dump_xml(*args, **kwargs): return _dump_xml(*args, **kwargs) @expand_stream_args('r') def load_xml(*args, **kwargs): kwargs.pop('filename', None) return _load_xml(*args, **kwargs) def load_xml_string(s, *args, **kwargs): return load_xml(string=s, *args, **kwargs) @expand_stream_args('w') def dump_all_xml(*args, **kwargs): return _dump_all_xml(*args, **kwargs) @expand_stream_args('r') def load_all_xml(*args, **kwargs): kwargs.pop('filename', None) return _load_all_xml(*args, **kwargs) @expand_stream_args('r') def iload_all_xml(*args, **kwargs): kwargs.pop('filename', None) return _iload_all_xml(*args, **kwargs) __all__ = guts_types + [ 'guts_types', 'TBase', 'ValidationError', 'ArgumentError', 'Defer', 'dump', 'load', 'dump_all', 'load_all', 'iload_all', 'dump_xml', 'load_xml', 'dump_all_xml', 'load_all_xml', 'iload_all_xml', 'load_string', 'load_xml_string', 'make_typed_list_class', 'walk', 'zip_walk', 'path_to_str' ]
gpl-3.0
227,704,453,569,894,140
27.204367
79
0.520422
false
Tanjay94/auxiclean
auxiclean/unittests/test_distributeur.py
1
1987
import unittest import tempfile import os from auxiclean import Distributeur class TestBase(unittest.TestCase): # Cours (nom),Cours (code),Dispo,Programme cours = {} # Nom,Premier Choix,Deuxieme Choix,Troisieme Choix,Quatrieme Choix, # Cinquieme Choix,Disponibilite,Tp_total,Schoplarite,Nobel, # Programme d'etude,Cote Z candidatures = {} def setUp(self): # use temporary file to do the tests self.tempdir = tempfile.TemporaryDirectory() self.cours_path = os.path.join(self.tempdir.name, "cours.csv") self.stud_path = os.path.join(self.tempdir.name, "students.csv") with open(self.cours_path, "w") as f: # write cours f.write("First line skipped\n") for c, v in self.cours.items(): s = ",".join([c] + v) + "\n" f.write(s) with open(self.stud_path, "w") as f: # write candidatures f.write("First line skipped\n") for name, v in self.candidatures.items(): s = ",".join([name] + v) + "\n" f.write(s) self.distributeur = Distributeur(self.stud_path, self.cours_path) def tearDown(self): self.tempdir.cleanup() del self.tempdir del self.distributeur class TestDistributeur(TestBase): cours = {"Electro": ["1", "1", "1"], "Astro": ["10", "1", "1"]} candidatures = {"Albert A": ["101", "403", "0", "0", "0", "2", "6", "2", "0", "2", "3"], "Claude C": ["210", "211", "0", "0", "0", "2", "3", "3", "0", "3", "3"]} def test_running(self): # simple test that checks that both candidates receive # their first choice. dist = self.distributeur.distribution self.assertEqual(dist["Electro"][0], "Albert A") self.assertEqual(dist["Astro"][0], "Claude C")
mit
1,499,030,532,619,302,700
35.796296
76
0.529945
false
wkentaro/fcn
examples/voc/train_fcn16s.py
1
2034
#!/usr/bin/env python import argparse import datetime import os import os.path as osp os.environ['MPLBACKEND'] = 'Agg' # NOQA import chainer import fcn from train_fcn32s import get_data from train_fcn32s import get_trainer here = osp.dirname(osp.abspath(__file__)) def main(): parser = argparse.ArgumentParser( formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument('-g', '--gpu', type=int, required=True, help='gpu id') parser.add_argument( '--fcn32s-file', default=fcn.models.FCN32s.pretrained_model, help='pretrained model file of FCN32s') args = parser.parse_args() args.model = 'FCN16s' args.lr = 1.0e-12 args.momentum = 0.99 args.weight_decay = 0.0005 args.max_iteration = 100000 args.interval_print = 20 args.interval_eval = 4000 now = datetime.datetime.now() args.timestamp = now.isoformat() args.out = osp.join(here, 'logs', now.strftime('%Y%m%d_%H%M%S')) # data class_names, iter_train, iter_valid, iter_valid_raw = get_data() n_class = len(class_names) # model fcn32s = fcn.models.FCN32s() chainer.serializers.load_npz(args.fcn32s_file, fcn32s) model = fcn.models.FCN16s(n_class=n_class) model.init_from_fcn32s(fcn32s) if args.gpu >= 0: chainer.cuda.get_device(args.gpu).use() model.to_gpu() # optimizer optimizer = chainer.optimizers.MomentumSGD( lr=args.lr, momentum=args.momentum) optimizer.setup(model) optimizer.add_hook(chainer.optimizer.WeightDecay(rate=args.weight_decay)) for p in model.params(): if p.name == 'b': p.update_rule = chainer.optimizers.momentum_sgd.MomentumSGDRule( lr=optimizer.lr * 2, momentum=0) model.upscore2.disable_update() model.upscore16.disable_update() # trainer trainer = get_trainer(optimizer, iter_train, iter_valid, iter_valid_raw, class_names, args) trainer.run() if __name__ == '__main__': main()
mit
2,136,855,453,675,468,800
26.12
78
0.648476
false
ADEQUATeDQ/portalmonitor
odpw/utils/error_handling.py
1
3597
import traceback from ast import literal_eval from collections import defaultdict import ckanapi import exceptions import requests import urlnorm import structlog log =structlog.get_logger() class TimeoutError(Exception): def __init__(self, message, timeout): # Call the base class constructor with the parameters it needs super(TimeoutError, self).__init__(message) # Now for your custom code... self.timeout = timeout class ErrorHandler(): exceptions=defaultdict(long) DEBUG=False @classmethod def handleError(cls, log, msg=None, exception=None, debug=False, **kwargs): name=type(exception).__name__ cls.exceptions[name] +=1 if debug: print(traceback.format_exc()) log.error(msg, exctype=type(exception), excmsg=exception.message, **kwargs) @classmethod def printStats(cls): print '>>>','--*'*10,'EXCEPTIONS','*--'*10 if len(cls.exceptions)==0: print "No exceptions handled" else: print " Numbers of Exceptions:" for exc, count in cls.exceptions.iteritems(): print " ",exc, count print '<<<','--*'*25 errorStatus={ 702:'Connection Error' ,703:'Connection Timeout' ,704:'Read Timeout' ,705:'HTTPError' ,706:'TooManyRedirects' ,707:'Timeout' ,801:'ValueError' ,802:'TimeoutError' ,901:'InvalidUrl' ,902:'InvalidSchema' ,903:'MissingSchema' ,904:'MissingDatasets' ,600:'Not Specified' ,666:'Robots.txt' } def getExceptionCode(e): #connection erorrs try: if isinstance(e,requests.exceptions.ConnectionError): return 702 if isinstance(e,requests.exceptions.ConnectTimeout): return 703 if isinstance(e,requests.exceptions.ReadTimeout): return 704 if isinstance(e,requests.exceptions.HTTPError): return 705 if isinstance(e,requests.exceptions.TooManyRedirects): return 706 if isinstance(e,requests.exceptions.Timeout): return 707 if isinstance(e,ckanapi.errors.CKANAPIError): try: err = literal_eval(e.extra_msg) return err[1] except Exception: return 708 #if isinstance(e,requests.exceptions.RetryError): # return 708 #parser errors if isinstance(e, exceptions.ValueError): return 801 if isinstance(e , TimeoutError): return 802 #format errors if isinstance(e,urlnorm.InvalidUrl): return 901 if isinstance(e,requests.exceptions.InvalidSchema): return 902 if isinstance(e,requests.exceptions.MissingSchema): return 903 else: return 600 except Exception as e: log.error("MISSING Exception CODE", exctype=type(e), excmsg=e.message,exc_info=True) return 601 def getExceptionString(e): try: if isinstance(e,ckanapi.errors.CKANAPIError): try: err = literal_eval(e.extra_msg) return str(type(e))+":"+str(err[2]) except Exception: return str(type(e))+":"+str(e.extra_msg) else: if e.message: return str(type(e))+":"+str(e.message) if e.message: return str(type(e))+":" except Exception as e: log.error("Get Exception string", exctype=type(e), excmsg=e.message,exc_info=True) return 601
gpl-3.0
-7,502,333,142,481,159,000
25.651852
92
0.591882
false
tiancj/emesene
emesene/e3/papylib/papyon/papyon/msnp/notification.py
1
39205
# -*- coding: utf-8 -*- # # papyon - a python client library for Msn # # Copyright (C) 2005-2007 Ali Sabil <[email protected]> # Copyright (C) 2005-2006 Ole André Vadla Ravnås <[email protected]> # Copyright (C) 2007 Johann Prieur <[email protected]> # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA """Notification protocol Implementation Implements the protocol used to communicate with the Notification Server.""" from base import BaseProtocol from message import Message from constants import ProtocolConstant, ProtocolError, ProtocolState from challenge import _msn_challenge import papyon from papyon.gnet.message.HTTP import HTTPMessage from papyon.util.async import run from papyon.util.queue import PriorityQueue, LastElementQueue from papyon.util.decorator import throttled from papyon.util.encoding import decode_rfc2047_string from papyon.util.parsing import build_account, parse_account from papyon.util.timer import Timer import papyon.util.element_tree as ElementTree import papyon.profile as profile import papyon.service.SingleSignOn as SSO import papyon.service.AddressBook as AB import papyon.service.OfflineIM as OIM import random import base64 import hmac import hashlib import time import logging import uuid import urllib import gobject import xml.sax.saxutils as xml_utils __all__ = ['NotificationProtocol'] logger = logging.getLogger('papyon.protocol.notification') class NotificationProtocol(BaseProtocol, Timer): """Protocol used to communicate with the Notification Server @undocumented: do_get_property, do_set_property @group Handlers: _handle_*, _default_handler, _error_handler @ivar state: the current protocol state @type state: integer @see L{constants.ProtocolState}""" __gsignals__ = { "buddy-notification-received" : (gobject.SIGNAL_RUN_FIRST, gobject.TYPE_NONE, (object, object, object, object)), "mail-received" : (gobject.SIGNAL_RUN_FIRST, gobject.TYPE_NONE, (object,)), "switchboard-invitation-received" : (gobject.SIGNAL_RUN_FIRST, gobject.TYPE_NONE, (object, object)), "unmanaged-message-received" : (gobject.SIGNAL_RUN_FIRST, gobject.TYPE_NONE, (object, object)), } def __init__(self, client, transport, proxies={}, version=15): """Initializer @param client: the parent instance of L{client.Client} @type client: L{client.Client} @param transport: The transport to use to speak the protocol @type transport: L{transport.BaseTransport} @param proxies: a dictonary mapping the proxy type to a L{gnet.proxy.ProxyInfos} instance @type proxies: {type: string, proxy:L{gnet.proxy.ProxyInfos}} """ BaseProtocol.__init__(self, client, transport, proxies) Timer.__init__(self) self.__state = ProtocolState.CLOSED self._protocol_version = version self._callbacks = {} # tr_id=>(callback, errback) self._time_id = 0 self.tokens = None # Properties ------------------------------------------------------------ def __get_state(self): return self.__state def __set_state(self, state): self.__state = state self.notify("state") state = property(__get_state) _state = property(__get_state, __set_state) def do_get_property(self, pspec): if pspec.name == "state": return self.__state else: raise AttributeError, "unknown property %s" % pspec.name def do_set_property(self, pspec, value): raise AttributeError, "unknown property %s" % pspec.name # Public API ------------------------------------------------------------- @throttled(2, LastElementQueue()) def set_presence(self, presence, client_id=0, msn_object=None): """Publish the new user presence. @param presence: the new presence @type presence: string L{profile.Presence}""" if msn_object == None: msn_object = "" if presence == profile.Presence.OFFLINE: self._client.logout() else: if msn_object: self._client._msn_object_store.publish(msn_object) self._send_command('CHG', (presence, str(client_id), urllib.quote(str(msn_object)))) @throttled(2, LastElementQueue()) def set_display_name(self, display_name): """Sets the new display name @param display_name: the new friendly name @type display_name: string""" self._send_command('PRP', ('MFN', urllib.quote(display_name))) @throttled(2, LastElementQueue()) def set_personal_message(self, personal_message='', current_media=None, signature_sound=None): """Sets the new personal message @param personal_message: the new personal message @type personal_message: string""" cm = '' if current_media is not None: cm = '\\0Music\\01\\0{0} - {1}\\0%s\\0%s\\0\\0' % \ (xml_utils.escape(current_media[0]), xml_utils.escape(current_media[1])) if signature_sound is not None: signature_sound = xml_utils.escape(signature_sound) ss = '<SignatureSound>%s</SignatureSound>' % signature_sound message = xml_utils.escape(personal_message) pm = '<Data>'\ '<PSM>%s</PSM>'\ '<CurrentMedia>%s</CurrentMedia>'\ '<MachineGuid>%s</MachineGuid>'\ '</Data>' % (message, cm, str(self._client.machine_guid).upper()) self._send_command('UUX', payload=pm) self._client.profile._server_property_changed("personal-message", personal_message) if current_media is not None: self._client.profile._server_property_changed("current-media", current_media) @throttled(2, LastElementQueue()) def set_end_point_name(self, name="Papyon", idle=False): ep = '<EndpointData>'\ '<Capabilities>%s</Capabilities>'\ '</EndpointData>' % self._client.profile.client_id name = xml_utils.escape(name) pep = '<PrivateEndpointData>'\ '<EpName>%s</EpName>'\ '<Idle>%s</Idle>'\ '<State>%s</State>'\ '<ClientType>%i</ClientType>'\ '</PrivateEndpointData>' % (name, str(idle).lower(), self._client.profile.presence, self._client.client_type) self._send_command('UUX', payload=ep) self._send_command('UUX', payload=pep) @throttled(2, LastElementQueue()) def set_privacy(self, privacy=profile.Privacy.BLOCK): self._send_command("BLP", (privacy,)) def signoff(self): """Logout from the server""" if self._state >= ProtocolState.AUTHENTICATING: self._send_command('OUT') self._transport.lose_connection() @throttled(7, list()) def request_switchboard(self, priority, callback): self.__switchboard_callbacks.add(callback, priority) self._send_command('XFR', ('SB',)) def add_contact_to_membership(self, account, network_id=profile.NetworkID.MSN, membership=profile.Membership.FORWARD): """Add a contact to a given membership. @param account: the contact identifier @type account: string @param network_id: the contact network @type network_id: integer @see L{papyon.profile.NetworkID} @param membership: the list to be added to @type membership: integer @see L{papyon.profile.Membership}""" if network_id == profile.NetworkID.MOBILE: payload = '<ml><t><c n="tel:%s" l="%d" /></t></ml>' % \ (account, membership) self._send_command("ADL", payload=payload) else: user, domain = account.split("@", 1) payload = '<ml><d n="%s"><c n="%s" l="%d" t="%d"/></d></ml>' % \ (domain, user, membership, network_id) self._send_command("ADL", payload=payload) def remove_contact_from_membership(self, account, network_id=profile.NetworkID.MSN, membership=profile.Membership.FORWARD): """Remove a contact from a given membership. @param account: the contact identifier @type account: string @param network_id: the contact network @type network_id: integer @see L{papyon.profile.NetworkID} @param membership: the list to be added to @type membership: integer @see L{papyon.profile.Membership}""" if network_id == profile.NetworkID.MOBILE: payload = '<ml><t><c n="tel:%s" l="%d" /></t></ml>' % \ (account, membership) self._send_command("RML", payload=payload) else: user, domain = account.split("@", 1) payload = '<ml><d n="%s"><c n="%s" l="%d" t="%d"/></d></ml>' % \ (domain, user, membership, network_id) self._send_command("RML", payload=payload) def send_user_notification(self, message, contact, contact_guid, type, callback=None, errback=None): account = build_account(contact, contact_guid) arguments = (account, type) tr_id = self._send_command("UUN", arguments, message, True) self._callbacks[tr_id] = (callback, errback) def send_unmanaged_message(self, contact, message, callback=None, errback=None): content_type = message.content_type[0] if content_type == 'text/x-msnmsgr-datacast': message_type = 3 elif content_type == 'text/x-msmsgscontrol': message_type = 2 else: message_type = 1 tr_id = self._send_command('UUM', (contact.account, contact.network_id, message_type), payload=message, callback=callback) self._callbacks[tr_id] = (None, errback) def send_url_request(self, url_command_args, callback): tr_id = self._send_command('URL', url_command_args) self._callbacks[tr_id] = (callback, None) # Helpers ---------------------------------------------------------------- def __derive_key(self, key, magic): hash1 = hmac.new(key, magic, hashlib.sha1).digest() hash2 = hmac.new(key, hash1 + magic, hashlib.sha1).digest() hash3 = hmac.new(key, hash1, hashlib.sha1).digest() hash4 = hmac.new(key, hash3 + magic, hashlib.sha1).digest() return hash2 + hash4[0:4] def __search_account(self, account, network_id=profile.NetworkID.MSN): contact = self._client.address_book.search_contact(account, network_id) if contact is None: logger.warning("Contact (network_id=%d) %s not found" % \ (network_id, account)) return contact def __parse_network_and_account(self, command, idx=0): if self._protocol_version >= 18 and ":" in command.arguments[idx]: temp = command.arguments[idx].split(":") network_id = int(temp[0]) account = temp[1] else: account = command.arguments[idx] idx += 1 network_id = int(command.arguments[idx]) idx += 1 return idx, network_id, account def __find_node(self, parent, name, default): node = parent.find(name) if node is not None and node.text is not None: return node.text.encode("utf-8") else: return default # Handlers --------------------------------------------------------------- # --------- Connection --------------------------------------------------- def _handle_VER(self, command): self._protocol_version = int(command.arguments[0].lstrip('MSNP')) self._send_command('CVR', ProtocolConstant.CVR + (self._client.profile.account,)) def _handle_CVR(self, command): method = 'SSO' self._send_command('USR', (method, 'I', self._client.profile.account)) def _handle_XFR(self, command): if command.arguments[0] == 'NS': try: host, port = command.arguments[1].split(":", 1) port = int(port) except ValueError: host = command.arguments[1] port = self._transport.server[1] logger.debug("<-> Redirecting to " + command.arguments[1]) self._transport.reset_connection((host, port)) else: # connect to a switchboard try: host, port = command.arguments[1].split(":", 1) port = int(port) except ValueError: host = command.arguments[1] port = self._transport.server[1] session_id = command.arguments[3] callback = self.__switchboard_callbacks.pop(0) run(callback, ((host, port), session_id, None)) def _handle_USR(self, command): args_len = len(command.arguments) # MSNP15 have only 4 params for final USR assert(args_len == 3 or args_len == 4), \ "Received USR with invalid number of params : " + str(command) if command.arguments[0] == "OK": self._state = ProtocolState.AUTHENTICATED # we need to authenticate with a passport server elif command.arguments[1] == "S": self._state = ProtocolState.AUTHENTICATING if command.arguments[0] == "SSO": self._client._sso.RequestMultipleSecurityTokens( (self._sso_cb, command.arguments[3]), ((lambda error: self.emit("error", ProtocolError.AUTHENTICATION_FAILED)),), SSO.LiveService.MESSENGER_CLEAR) self._client.address_book.connect("notify::state", self._address_book_state_changed_cb) self._client.address_book.connect("messenger-contact-added", self._address_book_contact_added_cb) self._client.address_book.connect("contact-accepted", self._address_book_contact_accepted_cb) self._client.address_book.connect("contact-rejected", self._address_book_contact_rejected_cb) self._client.address_book.connect("contact-deleted", self._address_book_contact_deleted_cb) self._client.address_book.connect("contact-blocked", self._address_book_contact_blocked_cb) self._client.address_book.connect("contact-unblocked", self._address_book_contact_unblocked_cb) self._client.address_book.connect("contact-allowed", self._address_book_contact_allowed_cb) self._client.address_book.connect("contact-disallowed", self._address_book_contact_disallowed_cb) elif command.arguments[0] == "TWN": raise NotImplementedError, "Missing Implementation, please fix" def _handle_SBS(self, command): # unknown command pass def _handle_QNG(self, command): timeout = int(command.arguments[0]) self.start_timeout("ping", timeout) self._time_id = time.time() self.start_timeout(("qing", self._time_id), timeout+5) def _handle_OUT(self, command): reason = None if len(command.arguments) > 0: reason = command.arguments[0] if reason == "OTH": self.emit("error", ProtocolError.OTHER_CLIENT) elif reason == "SSD": self.emit("error", ProtocolError.SERVER_DOWN) else: self._transport.lose_connection() # --------- Presence & Privacy ------------------------------------------- def _handle_BLP(self, command): self._client.profile._server_property_changed("privacy", command.arguments[0]) def _handle_GCF(self, command): pass def _handle_CHG(self, command): self._client.profile._server_property_changed("presence", command.arguments[0]) if len(command.arguments) > 2: if command.arguments[2] != '0': msn_object = papyon.p2p.MSNObject.parse(self._client, urllib.unquote(command.arguments[2])) else: msn_object = None self._client.profile._server_property_changed("msn_object", msn_object) else: self._client.profile._server_property_changed("msn_object", None) def _handle_ILN(self, command): self._handle_NLN(command) def _handle_FLN(self, command): idx, network_id, account = self.__parse_network_and_account(command) contact = self.__search_account(account, network_id) if contact is not None: contact._remove_flag(profile.ContactFlag.EXTENDED_PRESENCE_KNOWN) contact._server_property_changed("presence", profile.Presence.OFFLINE) def _handle_NLN(self, command): idx, network_id, account = self.__parse_network_and_account(command, 1) presence = command.arguments[0] display_name = urllib.unquote(command.arguments[idx]) idx += 1 capabilities = command.arguments[idx] idx += 1 msn_object = None icon_url = None if len(command.arguments) > idx: if command.arguments[idx] not in ('0', '1'): msn_object = papyon.p2p.MSNObject.parse(self._client, urllib.unquote(command.arguments[idx])) idx += 1 if len(command.arguments) > idx: icon_url = command.arguments[idx] contact = self.__search_account(account, network_id) if contact is not None: contact._server_property_changed("presence", presence) # don't change capabilities if contact is not self._client.profile: contact._server_property_changed("client-capabilities", capabilities) contact._server_property_changed("display-name", display_name) # only change MSNObject if the extended presence is known (MSNP18) if self._protocol_version < 18 or \ contact.has_flag(profile.ContactFlag.EXTENDED_PRESENCE_KNOWN): contact._server_property_changed("msn_object", msn_object) if icon_url is not None: contact._server_attribute_changed('icon_url', icon_url) # --------- Display name and co ------------------------------------------ def _handle_PRP(self, command): ctype = command.arguments[0] if len(command.arguments) < 2: return if ctype == 'MFN': self._client.profile._server_property_changed('display-name', urllib.unquote(command.arguments[1])) # TODO: add support for other stuff def _handle_UUX(self, command): pass def _handle_UBN(self, command): # contact infos if not command.payload: return account, guid = parse_account(command.arguments[0]) contact = self.__search_account(account) type = int(command.arguments[1]) payload = command.payload self.emit("buddy-notification-received", contact, guid, type, payload) def _handle_UBX(self, command): # contact infos if not command.payload: return idx, network_id, account = self.__parse_network_and_account(command) try: tree = ElementTree.fromstring(command.payload) except: logger.error("Invalid XML data in received UBX command") return utl = self.__find_node(tree, "./UserTileLocation", "") cm_parts = self.__find_node(tree, "./CurrentMedia", "").split('\\0') pm = self.__find_node(tree, "./PSM", "") rmu = self.__find_node(tree, "./RMU", "") ss = self.__find_node(tree, "./SignatureSound", None) mg = self.__find_node(tree, "./MachineGuid", "{}").lower()[1:-1] msn_object = None if utl != "" and utl != "0": msn_object = papyon.p2p.MSNObject.parse(self._client, utl) cm = None if len(cm_parts) >= 6 and cm_parts[1] == 'Music' and cm_parts[2] == '1': cm = (cm_parts[4], cm_parts[5]) eps = tree.findall("./EndpointData") end_points = {} for ep in eps: guid = uuid.UUID(ep.get("id")) caps = self.__find_node(ep, "Capabilities", "0:0") end_points[guid] = profile.EndPoint(guid, caps) peps = tree.findall("./PrivateEndpointData") for pep in peps: guid = uuid.UUID(pep.get("id")) if guid not in end_points: continue end_point = end_points[guid] end_point.name = self.__find_node(pep, "EpName", "") end_point.idle = bool(self.__find_node(pep, "Idle", "").lower() == "true") end_point.client_type = int(self.__find_node(pep, "ClientType", 0)) end_point.state = self.__find_node(pep, "State", "") contact = self.__search_account(account, network_id) if contact is not None: contact._add_flag(profile.ContactFlag.EXTENDED_PRESENCE_KNOWN) contact._server_property_changed("end-points", end_points) contact._server_property_changed("msn-object", msn_object) contact._server_property_changed("current-media", cm) contact._server_property_changed("personal-message", pm) contact._server_property_changed("signature-sound", ss) def _handle_UUN(self, command): # UBN acknowledgment self._command_answered_cb(command.transaction_id) # --------- Contact List ------------------------------------------------- def _handle_ADL(self, command): if len(command.arguments) > 0 and command.arguments[0] == "OK": # Confirmation for one of our ADLs if command.transaction_id != 0 \ and self._state != ProtocolState.OPEN: # Initial ADL self._state = ProtocolState.OPEN self._transport.enable_ping() else: if command.payload: # Incoming payload ADL from the server self._client.address_book.sync(True) def _handle_RML(self, command): pass def _handle_FQY(self, command): pass # --------- Messages ----------------------------------------------------- def _handle_MSG(self, command): message = Message(None, command.payload) content_type = message.content_type if content_type[0] == 'text/x-msmsgsprofile': profile = {} lines = command.payload.split("\r\n") for line in lines: line = line.strip() if line: name, value = line.split(":", 1) profile[name] = value.strip() self._client.profile._server_property_changed("profile", profile) self.set_privacy(self._client.profile.privacy) self._state = ProtocolState.SYNCHRONIZING self._client.address_book.sync() elif content_type[0] in \ ('text/x-msmsgsinitialmdatanotification', \ 'text/x-msmsgsoimnotification'): if self._client.oim_box is not None: self._client.oim_box._state = \ OIM.OfflineMessagesBoxState.NOT_SYNCHRONIZED m = HTTPMessage() m.parse(message.body) mail_data = m.get_header('Mail-Data').strip() if mail_data == 'too-large': mail_data = None self._client.oim_box.sync(mail_data) if mail_data and \ content_type[0] == 'text/x-msmsgsinitialmdatanotification': #Initial mail start = mail_data.find('<IU>') + 4 end = mail_data.find('</IU>') if start < end: mailbox_unread = int(mail_data[start:end]) self._client.mailbox._initial_set(mailbox_unread) elif content_type[0] == 'text/x-msmsgsinitialemailnotification': #Initial mail (obsolete by MSNP11) pass elif content_type[0] == 'text/x-msmsgsemailnotification': #New mail m = HTTPMessage() m.parse(message.body) name = decode_rfc2047_string(m.get_header('From')) address = m.get_header('From-Addr') subject = decode_rfc2047_string(m.get_header('Subject')) message_url = m.get_header('Message-URL') post_url = m.get_header('Post-URL') post_id = m.get_header('id') dest = m.get_header('Dest-Folder') if dest == 'ACTIVE': self._client.mailbox._unread_mail_increased(1) build = self._build_url_post_data post_url, form_data = build(message_url, post_url, post_id) self._client.mailbox._new_mail(name, address, subject, post_url, form_data) elif content_type[0] == 'text/x-msmsgsactivemailnotification': #Movement of unread mail m = HTTPMessage() m.parse(message.body) src = m.get_header('Src-Folder') dest = m.get_header('Dest-Folder') delta = int(m.get_header('Message-Delta')) if src == 'ACTIVE': self._client.mailbox._unread_mail_decreased(delta) elif dest == 'ACTIVE': self._client.mailbox._unread_mail_increased(delta) def _handle_UBM(self, command): idx, network_id, account = self.__parse_network_and_account(command) contact = self.__search_account(account, network_id) if contact is not None: message = Message(contact, command.payload) self.emit("unmanaged-message-received", contact, message) # --------- Urls --------------------------------------------------------- def _build_url_post_data_new(self, message_url="/cgi-bin/HoTMaiL", post_url='https://login.live.com/ppsecure/sha1auth.srf?', post_id='2'): passportToken = self.tokens[SSO.LiveService.TB].security_token proofToken = self.tokens[SSO.LiveService.TB].proof_token nonce = "" for i in range(0,24): nonce += chr(int(random.random()*256)) # Create the percent encoded string encodedString = \ "<EncryptedData xmlns=\"http://www.w3.org/2001/04/xmlenc#\"" \ "Id=\"BinaryDAToken0\" Type=\"http://www.w3.org/2001/04/xmlenc#Element\">" \ "<EncryptionMethodAlgorithm=\"http://www.w3.org/2001/04/xmlenc#tripledes-cbc\"/>" \ "<ds:KeyInfo xmlns:ds=\"http://www.w3.org/2000/09/xmldsig#\">" \ "<ds:KeyName>http://Passport.NET/STS</ds:KeyName>" \ "</ds:KeyInfo>" \ "<CipherData>" \ "<CipherValue>%s</CipherValue>" \ "</CipherData>" \ "</EncryptedData>" % passportToken # Create the token token_args = { "ct" : int(time.time()), "rru" : message_url, "sru" : message_url, "ru" : message_url, "bver" : "4", "svc" : "mail", "js" : "yes", "id" : post_id, "pl" : "?id=%s" % post_id, "da" : encodedString, "nonce" : base64.b64encode(nonce) } # we have to replace manually -. because urllib doesn't do it token = urllib.urlencode(token_args).replace("-", "%2D").replace(".", "%2E") # Compute the keys with HMAC-Sha1 algorithm key1 = base64.b64decode(proofToken) magic = "WS-SecureConversation" + nonce key2 = self.__derive_key(key1, magic) myhash = hmac.new(key2, token, hashlib.sha1).digest() token_args_part_two = { "hash" : base64.b64encode(myhash) } token += "&" + urllib.urlencode(token_args_part_two) post_data = dict([('token', token)]) return (post_url, post_data) def _build_url_post_data(self, message_url="/cgi-bin/HoTMaiL", post_url='https://loginnet.passport.com/ppsecure/md5auth.srf?', post_id='2'): profile = self._client.profile.profile account = self._client.profile.account password = str(self._client.profile.password) sl = str(int(time.time()) - int(profile['LoginTime'])) sid = profile['sid'] auth = profile['MSPAuth'] creds = hashlib.md5(auth + sl + password).hexdigest() post_data = dict([ ('mode', 'ttl'), ('login', account.split('@')[0]), ('username', account), ('sid', sid), ('kv', ''), ('id', post_id), ('sl', sl), ('rru', message_url), ('auth', auth), ('creds', creds), ('svc', 'mail'), ('js', 'yes')]) return (post_url, post_data) def _handle_URL(self, command): tr_id = command.transaction_id if tr_id in self._callbacks: message_url, post_url, post_id = command.arguments post_url, form_dict = self._build_url_post_data(message_url, post_url, post_id) self._command_answered_cb(tr_id, post_url, form_dict) # --------- Invitation --------------------------------------------------- def _handle_RNG(self, command): session_id = command.arguments[0] host, port = command.arguments[1].split(':', 1) port = int(port) key = command.arguments[3] account = command.arguments[4] display_name = urllib.unquote(command.arguments[5]) session = ((host, port), session_id, key) inviter = (account, display_name) self.emit("switchboard-invitation-received", session, inviter) # --------- Challenge ---------------------------------------------------- def _handle_QRY(self, command): pass def _handle_CHL(self, command): response = _msn_challenge(command.arguments[0]) self._send_command('QRY', (ProtocolConstant.PRODUCT_ID,), payload=response) # --------- Notification ------------------------------------------------- def _handle_NOT(self, command): notification_xml = xml_utils.unescape(command.payload) notification = ElementTree.fromstring(notification_xml) service = notification.findtext('MSG/BODY/NotificationData/Service') if service != 'ABCHInternal': return try: notification_id = notification.attrib['id'] site_id = notification.attrib['siteid'] message_id = notification.find('MSG').attrib['id'] send_device = notification.find('TO/VIA').attrib['agent'] receiver_cid = notification.findtext('MSG/BODY/NotificationData/CID') receiver_account = notification.find('TO').attrib['name'].lower() if notification_id != '0' or site_id != '45705' \ or message_id != '0' or send_device != 'messenger' \ or receiver_cid != str(self._client.profile.cid) \ or receiver_account != self._client.profile.account.lower(): return except KeyError: return self._client.address_book.sync(True) #---------- Errors ------------------------------------------------------- def _error_handler(self, error): logger.error('Notification got error : ' + unicode(error)) self._command_error_cb(error.transaction_id, int(error.name)) # callbacks -------------------------------------------------------------- def _connect_cb(self, transport): self.__switchboard_callbacks = PriorityQueue() self._state = ProtocolState.OPENING versions = [] for version in ProtocolConstant.VER: if version <= self._protocol_version: versions.append("MSNP%i" % version) self._send_command('VER', versions) def _disconnect_cb(self, transport, reason): self.stop_all_timeout() self._state = ProtocolState.CLOSED def _sso_cb(self, tokens, nonce): if self._state != ProtocolState.AUTHENTICATING: return self.tokens = tokens clear_token = tokens[SSO.LiveService.MESSENGER_CLEAR] token = clear_token.security_token blob = clear_token.mbi_crypt(nonce) if self._protocol_version >= 16: arguments = ("SSO", "S", token, blob, "{%s}" % str(self._client.machine_guid).upper()) else: arguments = ("SSO", "S", token, blob) self._send_command("USR", arguments) def on_ping_timeout(self): self._transport.enable_ping() def on_qing_timeout(self, time_id): if self._time_id == time_id: self._transport.emit("connection-lost", "Ping timeout") def _command_answered_cb(self, tr_id, *args): callback, errback = self._callbacks.get(tr_id, (None, None)) run(callback, *args) def _command_error_cb(self, tr_id, error): callback, errback = self._callbacks.get(tr_id, (None, None)) run(errback, error) def _address_book_state_changed_cb(self, address_book, pspec): MAX_PAYLOAD_SIZE = 7500 if self._state != ProtocolState.SYNCHRONIZING: return if address_book.state != AB.AddressBookState.SYNCHRONIZED: return self._client.profile._cid = address_book.profile._cid self._client.profile._server_property_changed("display-name", address_book.profile.display_name) contacts = address_book.contacts.group_by_domain() mask = ~(profile.Membership.REVERSE | profile.Membership.PENDING) for contact in address_book.contacts: if (contact.memberships & mask & ~profile.Membership.FORWARD) == \ (profile.Membership.ALLOW | profile.Membership.BLOCK): logger.warning("Contact is on both Allow and Block list; " \ "removing from Allow list (%s)" % contact.account) contact._remove_membership(profile.Membership.ALLOW) payloads = ['<ml l="1">'] for domain, contacts in contacts.iteritems(): payloads[-1] += '<d n="%s">' % domain for contact in contacts: user = contact.account.split("@", 1)[0] lists = contact.memberships & mask if lists == profile.Membership.NONE: continue network_id = contact.network_id node = '<c n="%s" l="%d" t="%d"/>' % (user, lists, network_id) size = len(payloads[-1]) + len(node) + len('</d></ml>') if size >= MAX_PAYLOAD_SIZE: payloads[-1] += '</d></ml>' payloads.append('<ml l="1"><d n="%s">' % domain) payloads[-1] += node payloads[-1] += '</d>' payloads[-1] += '</ml>' import re pattern = re.compile ('<d n="[^"]+"></d>') for payload in payloads: payload = pattern.sub('', payload) self._send_command("ADL", payload=payload) self._state = ProtocolState.SYNCHRONIZED def _add_contact_to_membership(self, contact, membership): self.add_contact_to_membership(contact.account, contact.network_id, membership) def _remove_contact_from_membership(self, contact, membership): self.remove_contact_from_membership(contact.account, contact.network_id, membership) def _address_book_contact_added_cb(self, address_book, contact): if contact.is_member(profile.Membership.ALLOW): self._add_contact_to_membership(contact, profile.Membership.ALLOW) self._add_contact_to_membership(contact, profile.Membership.FORWARD) if contact.network_id != profile.NetworkID.MOBILE: account, domain = contact.account.split('@', 1) payload = '<ml l="2"><d n="%s"><c n="%s"/></d></ml>' % \ (domain, account) self._send_command("FQY", payload=payload) def _address_book_contact_deleted_cb(self, address_book, contact): self._remove_contact_from_membership(contact, profile.Membership.FORWARD) def _address_book_contact_accepted_cb(self, address_book, contact): mask = ~(profile.Membership.REVERSE | profile.Membership.PENDING) memberships = contact.memberships & mask if memberships: self._add_contact_to_membership(contact, memberships) def _address_book_contact_rejected_cb(self, address_book, contact): mask = ~(profile.Membership.REVERSE | profile.Membership.PENDING) memberships = contact.memberships & mask if memberships: self._add_contact_to_membership(contact, memberships) def _address_book_contact_blocked_cb(self, address_book, contact): self._remove_contact_from_membership(contact, profile.Membership.ALLOW) self._add_contact_to_membership(contact, profile.Membership.BLOCK) def _address_book_contact_unblocked_cb(self, address_book, contact): self._remove_contact_from_membership(contact, profile.Membership.BLOCK) self._add_contact_to_membership(contact, profile.Membership.ALLOW) def _address_book_contact_allowed_cb(self, address_book, contact): self._add_contact_to_membership(contact, profile.Membership.ALLOW) def _address_book_contact_disallowed_cb(self, address_book, contact): self._remove_contact_from_membership(contact, profile.Membership.ALLOW)
gpl-3.0
9,134,599,020,062,534,000
40.572641
95
0.563375
false
olivierfriard/BORIS
boris/portion/dict.py
1
11282
from .const import Bound from .interval import Interval, singleton from collections.abc import MutableMapping, Mapping from sortedcontainers import SortedDict def _sort(i): # Sort by lower bound, closed first return (i[0].lower, i[0].left is Bound.OPEN) class IntervalDict(MutableMapping): """ An IntervalDict is a dict-like data structure that maps from intervals to data, where keys can be single values or Interval instances. When keys are Interval instances, its behaviour merely corresponds to range queries and it returns IntervalDict instances corresponding to the subset of values covered by the given interval. If no matching value is found, an empty IntervalDict is returned. When keys are "single values", its behaviour corresponds to the one of Python built-in dict. When no matchin value is found, a KeyError is raised. Note that this class does not aim to have the best performance, but is provided mainly for convenience. Its performance mainly depends on the number of distinct values (not keys) that are stored. """ __slots__ = ('_storage', ) def __init__(self, mapping_or_iterable=None): """ Return a new IntervalDict. If no argument is given, an empty IntervalDict is created. If an argument is given, and is a mapping object (e.g., another IntervalDict), an new IntervalDict with the same key-value pairs is created. If an iterable is provided, it has to be a list of (key, value) pairs. :param mapping_or_iterable: optional mapping or iterable. """ self._storage = SortedDict(_sort) # Mapping from intervals to values if mapping_or_iterable is not None: self.update(mapping_or_iterable) @classmethod def _from_items(cls, items): """ Fast creation of an IntervalDict with the provided items. The items have to satisfy the two following properties: (1) all keys must be disjoint intervals and (2) all values must be distinct. :param items: list of (key, value) pairs. :return: an IntervalDict """ d = cls() for key, value in items: d._storage[key] = value return d def clear(self): """ Remove all items from the IntervalDict. """ self._storage.clear() def copy(self): """ Return a shallow copy. :return: a shallow copy. """ return IntervalDict._from_items(self.items()) def get(self, key, default=None): """ Return the values associated to given key. If the key is a single value, it returns a single value (if it exists) or the default value. If the key is an Interval, it returns a new IntervalDict restricted to given interval. In that case, the default value is used to "fill the gaps" (if any) w.r.t. given key. :param key: a single value or an Interval instance. :param default: default value (default to None). :return: an IntervalDict, or a single value if key is not an Interval. """ if isinstance(key, Interval): d = self[key] d[key - d.domain()] = default return d else: try: return self[key] except KeyError: return default def find(self, value): """ Return a (possibly empty) Interval i such that self[i] = value, and self[~i] != value. :param value: value to look for. :return: an Interval instance. """ return Interval(*(i for i, v in self._storage.items() if v == value)) def items(self): """ Return a view object on the contained items sorted by key (see https://docs.python.org/3/library/stdtypes.html#dict-views). :return: a view object. """ return self._storage.items() def keys(self): """ Return a view object on the contained keys (sorted) (see https://docs.python.org/3/library/stdtypes.html#dict-views). :return: a view object. """ return self._storage.keys() def values(self): """ Return a view object on the contained values sorted by key (see https://docs.python.org/3/library/stdtypes.html#dict-views). :return: a view object. """ return self._storage.values() def domain(self): """ Return an Interval corresponding to the domain of this IntervalDict. :return: an Interval. """ return Interval(*self._storage.keys()) def pop(self, key, default=None): """ Remove key and return the corresponding value if key is not an Interval. If key is an interval, it returns an IntervalDict instance. This method combines self[key] and del self[key]. If a default value is provided and is not None, it uses self.get(key, default) instead of self[key]. :param key: a single value or an Interval instance. :param default: optional default value. :return: an IntervalDict, or a single value if key is not an Interval. """ if default is None: value = self[key] del self[key] return value else: value = self.get(key, default) try: del self[key] except KeyError: pass return value def popitem(self): """ Remove and return some (key, value) pair as a 2-tuple. Raise KeyError if D is empty. :return: a (key, value) pair. """ return self._storage.popitem() def setdefault(self, key, default=None): """ Return given key. If it does not exist, set its value to default and return it. :param key: a single value or an Interval instance. :param default: default value (default to None). :return: an IntervalDict, or a single value if key is not an Interval. """ if isinstance(key, Interval): value = self.get(key, default) self.update(value) return value else: try: return self[key] except KeyError: self[key] = default return default def update(self, mapping_or_iterable): """ Update current IntervalDict with provided values. If a mapping is provided, it must map Interval instances to values (e.g., another IntervalDict). If an iterable is provided, it must consist of a list of (key, value) pairs. :param mapping_or_iterable: mapping or iterable. """ if isinstance(mapping_or_iterable, Mapping): data = mapping_or_iterable.items() else: data = mapping_or_iterable for i, v in data: self[i] = v def combine(self, other, how): """ Return a new IntervalDict that combines the values from current and provided ones. If d = d1.combine(d2, f), then d contains (1) all values from d1 whose keys do not intersect the ones of d2, (2) all values from d2 whose keys do not intersect the ones of d1, and (3) f(x, y) for x in d1, y in d2 for intersecting keys. :param other: another IntervalDict instance. :param how: a function of two parameters that combines values. :return: a new IntervalDict instance. """ new_items = [] dom1, dom2 = self.domain(), other.domain() new_items.extend(self[dom1 - dom2].items()) new_items.extend(other[dom2 - dom1].items()) intersection = dom1 & dom2 d1, d2 = self[intersection], other[intersection] for i1, v1 in d1.items(): for i2, v2 in d2.items(): if i1.overlaps(i2): i = i1 & i2 v = how(v1, v2) new_items.append((i, v)) return IntervalDict(new_items) def as_dict(self): """ Return the content as a classical Python dict. :return: a Python dict. """ return dict(self._storage) def __getitem__(self, key): if isinstance(key, Interval): items = [] for i, v in self._storage.items(): intersection = key & i if not intersection.empty: items.append((intersection, v)) return IntervalDict._from_items(items) else: for i, v in self._storage.items(): if key in i: return v raise KeyError(key) def __setitem__(self, key, value): interval = key if isinstance(key, Interval) else singleton(key) if interval.empty: return removed_keys = [] added_items = [] found = False for i, v in self._storage.items(): if value == v: found = True # Extend existing key removed_keys.append(i) added_items.append((i | interval, v)) elif i.overlaps(interval): # Reduce existing key remaining = i - interval removed_keys.append(i) if not remaining.empty: added_items.append((remaining, v)) if not found: added_items.append((interval, value)) # Update storage accordingly for key in removed_keys: self._storage.pop(key) for key, value in added_items: self._storage[key] = value def __delitem__(self, key): interval = key if isinstance(key, Interval) else singleton(key) if interval.empty: return removed_keys = [] added_items = [] found = False for i, v in self._storage.items(): if i.overlaps(interval): found = True remaining = i - interval removed_keys.append(i) if not remaining.empty: added_items.append((remaining, v)) if not found and not isinstance(key, Interval): raise KeyError(key) # Update storage accordingly for key in removed_keys: self._storage.pop(key) for key, value in added_items: self._storage[key] = value def __or__(self, other): d = self.copy() d.update(other) return d def __ior__(self, other): self.update(other) return self def __iter__(self): return iter(self._storage) def __len__(self): return len(self._storage) def __contains__(self, key): return key in self.domain() def __repr__(self): return '{}{}{}'.format( '{', ', '.join('{!r}: {!r}'.format(i, v) for i, v in self.items()), '}', ) def __eq__(self, other): if isinstance(other, IntervalDict): return self.as_dict() == other.as_dict() else: return NotImplemented
gpl-3.0
-2,896,345,402,922,807,000
29.909589
89
0.564528
false
larbibaraka/Bitly_clone
bitly_clone/bitly__clone_app/migrations/0001_initial.py
1
1048
# -*- coding: utf-8 -*- # Generated by Django 1.10.5 on 2017-02-07 21:10 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='UrlShort', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('user_url', models.URLField(unique=True, verbose_name='the user url')), ('url_code', models.CharField(max_length=6, unique=True)), ('date_creation', models.DateTimeField(auto_now_add=True, verbose_name='creation date')), ('update_time', models.DateTimeField(auto_now_add=True, verbose_name='creation date')), ('nike_name', models.CharField(blank=True, max_length=20, null=True, verbose_name='user nike name')), ('nb_access', models.IntegerField(default=0)), ], ), ]
gpl-3.0
-7,644,237,825,253,766,000
36.428571
117
0.59542
false
Fredehagelund92/Cheetax
cheetax/run_manager.py
1
1120
from cheetax.exceptions import RuntimeException class RunManager(object): """ RunManager is responsible for handling runners based on its status. """ def __init__(self): self.runners = [] self.total_time = 0 @property def num_runners(self): return len(self.runners) def add_runner(self, runner): self.runners.append(runner) def call_runner(self, runner, index, total): runner.before_execute(index, total) result = runner.run() runner.after_execute(result, index, total) self.total_time = self.total_time + result.execution_time if result.errored and runner.raise_on_first_error(): raise RuntimeException(result.error) return result def execute_runners(self): for index, runner in enumerate(self.runners): if index == 0: runner.initial_msg() result = self.call_runner(runner, index, len(self.runners)) if index == self.num_runners-1: runner.final_msg(result, self.num_runners, self.total_time)
apache-2.0
5,339,509,767,290,848,000
22.333333
75
0.609821
false
openhealthcare/sonar
innovation/projectmigrations/profiles/0004_remove_pseudonym.py
1
5119
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Deleting field 'Profile.is_pseudonymous' db.delete_column('profiles_profile', 'is_pseudonymous') # Deleting field 'Profile.pseudonym' db.delete_column('profiles_profile', 'pseudonym') def backwards(self, orm): # Adding field 'Profile.is_pseudonymous' db.add_column('profiles_profile', 'is_pseudonymous', self.gf('django.db.models.fields.BooleanField')(default=False), keep_default=False) # Adding field 'Profile.pseudonym' db.add_column('profiles_profile', 'pseudonym', self.gf('django.db.models.fields.CharField')(default='', max_length=255), keep_default=False) models = { 'auth.group': { 'Meta': {'object_name': 'Group'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, 'auth.permission': { 'Meta': {'ordering': "('content_type__app_label', 'content_type__model', 'codename')", 'unique_together': "(('content_type', 'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['contenttypes.ContentType']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, 'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Group']", 'symmetrical': 'False', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, 'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'innovation.role': { 'Meta': {'object_name': 'Role'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '255'}) }, 'profiles.profile': { 'Meta': {'object_name': 'Profile', '_ormbases': ['auth.User']}, 'affiliation': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'clinician_karma': ('django.db.models.fields.IntegerField', [], {}), 'industry_karma': ('django.db.models.fields.IntegerField', [], {}), 'patient_karma': ('django.db.models.fields.IntegerField', [], {}), 'phone_number': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'role': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['innovation.Role']"}), 'user_ptr': ('django.db.models.fields.related.OneToOneField', [], {'to': "orm['auth.User']", 'unique': 'True', 'primary_key': 'True'}) } } complete_apps = ['profiles']
gpl-2.0
-2,631,759,668,109,640,700
59.952381
182
0.556163
false
ewels/MultiQC
multiqc/modules/deeptools/plotPCA.py
1
2743
#!/usr/bin/env python """ MultiQC submodule to parse output from deepTools plotPCA """ import logging from multiqc.plots import scatter # Initialise the logger log = logging.getLogger(__name__) class plotPCAMixin: def parse_plotPCA(self): """Find plotPCA output""" self.deeptools_plotPCAData = dict() for f in self.find_log_files("deeptools/plotPCAData", filehandles=False): parsed_data = self.parsePlotPCAData(f) for k, v in parsed_data.items(): if k in self.deeptools_plotPCAData: log.warning("Replacing duplicate sample {}.".format(k)) self.deeptools_plotPCAData[k] = v if len(parsed_data) > 0: self.add_data_source(f, section="plotPCA") self.deeptools_plotPCAData = self.ignore_samples(self.deeptools_plotPCAData) if len(self.deeptools_plotPCAData) > 0: config = { "id": "deeptools_pca_plot", "title": "deeptools: PCA Plot", "xlab": "PC1", "ylab": "PC2", "tt_label": "PC1 {point.x:.2f}: PC2 {point.y:.2f}", } data = dict() for s_name in self.deeptools_plotPCAData: try: data[s_name] = { "x": self.deeptools_plotPCAData[s_name][1], "y": self.deeptools_plotPCAData[s_name][2], } except KeyError: pass if len(data) == 0: log.debug("No valid data for PCA plot") return None self.add_section( name="PCA plot", anchor="deeptools_pca", description="PCA plot with the top two principal components calculated based on genome-wide distribution of sequence reads", plot=scatter.plot(data, config), ) return len(self.deeptools_plotPCAData) def parsePlotPCAData(self, f): d = dict() samples = [] for line in f["f"].splitlines(): cols = line.strip().split("\t") if cols[0] == "#plotPCA --outFileNameData": continue elif cols[0] == "Component": for c in cols[1 : (len(cols) - 1)]: c = str(c).strip("'") s_name = self.clean_s_name(c, f) d[s_name] = {} samples.append(s_name) else: idx = 0 compo = cols[0] for c in cols[1 : (len(cols) - 1)]: d[samples[idx]][self._int(compo)] = float(c) idx += 1 return d
gpl-3.0
-5,186,901,610,799,465,000
34.623377
140
0.487423
false
stpierre/sponge
Sponge/sponge/forms/config.py
1
1627
from django import forms from django.forms import widgets from sponge.utils import config as config_utils from sponge.utils import group as group_utils class ConfigForm(forms.Form): scheduler_username = forms.CharField(help_text="The username of a Pulp user who can modify all sync schedules. Granting 'read' and 'update' on '/repositories/' should be sufficient.") scheduler_password = forms.CharField(help_text="The password for the sync schedule user", widget=widgets.PasswordInput(), required=False) def __init__(self, *args, **kwargs): forms.Form.__init__(self, *args, **kwargs) self.fields['scheduler_username'].initial = \ config_utils.get('scheduler_username', None) # i wish django supported fieldsets for group in group_utils.get_groups(): cname = "sync_frequency_%s" % group self.fields[cname] = \ forms.IntegerField(label="Sync frequency for %s" % group, help_text="The frequency, in hours, with which to sync all repositories in group %s" % group, initial=config_utils.get(cname, 24)) if "default" not in group_utils.get_groups(): self.fields['default'] = \ forms.IntegerField(label="Default sync frequency", help_text="If a machine is in no groups, the frequency, in hours, with which to sync it", initial=config_utils.get("sync_frequency_default", 24))
gpl-2.0
8,748,941,539,162,094,000
53.233333
187
0.590658
false
jabooth/menpodetect
menpodetect/tests/dlib_test.py
2
1037
from menpodetect.dlib import load_dlib_frontal_face_detector import menpo.io as mio takeo = mio.import_builtin_asset.takeo_ppm() def test_frontal_face_detector(): takeo_copy = takeo.copy() dlib_detector = load_dlib_frontal_face_detector() pcs = dlib_detector(takeo_copy) assert len(pcs) == 1 assert takeo_copy.n_channels == 3 assert takeo_copy.landmarks['dlib_0'].n_points == 4 def test_frontal_face_detector_rgb(): takeo_copy = takeo.copy() assert takeo_copy.n_channels == 3 dlib_detector = load_dlib_frontal_face_detector() pcs = dlib_detector(takeo_copy, greyscale=False) assert len(pcs) == 1 assert takeo_copy.n_channels == 3 assert takeo_copy.landmarks['dlib_0'].n_points == 4 def test_frontal_face_detector_upscales(): takeo_copy = takeo.copy() dlib_detector = load_dlib_frontal_face_detector() pcs = dlib_detector(takeo_copy, n_upscales=1) assert len(pcs) == 1 assert takeo_copy.n_channels == 3 assert takeo_copy.landmarks['dlib_0'].n_points == 4
bsd-3-clause
-1,552,435,256,788,413,000
31.40625
60
0.684667
false
alexandregz/simian
src/tests/simian/mac/munki/handlers/__init___test.py
1
4229
#!/usr/bin/env python # # Copyright 2010 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS-IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # """Munki handlers __init__ module tests.""" import datetime import logging logging.basicConfig(filename='/dev/null') from google.apputils import app from tests.simian.mac.common import test from simian.mac.munki import handlers class HandlersTest(test.RequestHandlerTest): """__init__.py handlers tests.""" def GetTestClassInstance(self): return handlers def GetTestClassModule(self): return handlers def testStrHeaderDateToDatetime(self): """Tests StrHeaderDateToDatetime().""" header_dt_str = 'Wed, 06 Oct 2010 03:23:34 GMT' dt = datetime.datetime(2010, 10, 06, 03, 23, 34) # same date r = handlers.StrHeaderDateToDatetime(header_dt_str) self.assertEqual(dt, r) def testStrHeaderDateToDatetimeNone(self): """Tests StrHeaderDateToDatetime().""" self.assertEqual(None, handlers.StrHeaderDateToDatetime('')) def testIsClientResourceExpiredWithEmptyDate(self): """Tests IsClientResourceExpired() with empty header str date.""" self.assertTrue(handlers.IsClientResourceExpired(None, '')) def testPackageModifiedWithInvalidDate(self): """Tests IsClientResourceExpired() with non-parsable header str date.""" self.assertTrue( handlers.IsClientResourceExpired(None, 'date will not parse')) def testPackageModifiedMatchingDate(self): """Tests IsClientResourceExpired() with matching header str date.""" header_dt_str = 'Wed, 06 Oct 2010 03:23:34 GMT' dt = datetime.datetime(2010, 10, 06, 03, 23, 34) # same date self.assertFalse(handlers.IsClientResourceExpired(dt, header_dt_str)) def testPackageModifiedWherePackageDateNewer(self): """Tests IsClientResourceExpired() with matching header str date.""" header_dt_str = 'Mon, 01 Jan 1930 01:00:00 GMT' dt = datetime.datetime(2010, 10, 06, 03, 23, 34) # later date self.assertTrue(handlers.IsClientResourceExpired(dt, header_dt_str)) def testGetClientIdForRequestWithSession(self): """Tests GetClientIdForRequest().""" track = 'stable' os_version = '10.6.6' client_id = 'client_id' client_id_dict = {'track': track, 'os_version': os_version} session = self.mox.CreateMockAnything() session.uuid = 'uuid' request = self.mox.CreateMockAnything() request.headers = self.mox.CreateMockAnything() request.headers.get('X-munki-client-id', '').AndReturn(client_id) self.mox.StubOutWithMock(handlers.common, 'ParseClientId') handlers.common.ParseClientId(client_id, uuid=session.uuid).AndReturn( client_id_dict) self.mox.ReplayAll() r = handlers.GetClientIdForRequest( request, session=session, client_id_str='') self.assertEqual(r, client_id_dict) self.mox.VerifyAll() def testGetClientIdForRequestWithoutSession(self): """Tests GetClientIdForRequest().""" track = 'stable' os_version = '10.6.6' client_id = 'client_id' client_id_dict = {'track': track, 'os_version': os_version} client_id_str = 'track=%s|os_version=%s' % (track, os_version) client_id_str_quoted = handlers.urllib.quote(client_id_str) request = self.mox.CreateMockAnything() request.headers = self.mox.CreateMockAnything() self.mox.StubOutWithMock(handlers.common, 'ParseClientId') handlers.common.ParseClientId(client_id_str).AndReturn(client_id_dict) self.mox.ReplayAll() r = handlers.GetClientIdForRequest( request, session=None, client_id_str=client_id_str_quoted) self.assertEqual(r, client_id_dict) self.mox.VerifyAll() def main(unused_argv): test.main(unused_argv) if __name__ == '__main__': app.run()
apache-2.0
-7,469,800,519,277,540,000
33.950413
76
0.715063
false
moonfruit/yysite
polls/migrations/0001_initial.py
1
1230
# -*- coding: utf-8 -*- # Generated by Django 1.10.3 on 2016-11-28 14:58 from __future__ import unicode_literals import django.db.models.deletion from django.db import migrations, models class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Choice', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('choice_text', models.CharField(max_length=200)), ('votes', models.IntegerField(default=0)), ], ), migrations.CreateModel( name='Question', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('question_text', models.CharField(max_length=200)), ('pub_date', models.DateTimeField(verbose_name='date published')), ], ), migrations.AddField( model_name='choice', name='question', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='polls.Question'), ), ]
mit
8,369,215,854,529,492,000
31.368421
114
0.569919
false
watchdogpolska/django-mptt
setup.py
1
1475
#!/usr/bin/env python from setuptools import find_packages, setup setup( name='django-mptt', description='''Utilities for implementing Modified Preorder Tree Traversal with your Django Models and working with trees of Model instances.''', version=__import__('mptt').__version__, author='Craig de Stigter', author_email='[email protected]', url='http://github.com/django-mptt/django-mptt', license='MIT License', packages=find_packages(), include_package_data=True, install_requires=( 'Django>=1.8', ), tests_require=( 'mock-django>=0.6.7', 'mock>=1.3', ), classifiers=[ 'Development Status :: 4 - Beta', 'Environment :: Web Environment', 'Framework :: Django', 'Intended Audience :: Developers', 'License :: OSI Approved :: MIT License', 'Operating System :: OS Independent', 'Programming Language :: Python', "Programming Language :: Python :: 2", "Programming Language :: Python :: 2.7", "Programming Language :: Python :: 3", "Programming Language :: Python :: 3.2", "Programming Language :: Python :: 3.3", "Programming Language :: Python :: 3.4", "Programming Language :: Python :: 3.5", "Programming Language :: Python :: Implementation :: CPython", "Programming Language :: Python :: Implementation :: PyPy", 'Topic :: Utilities', ], )
mit
-2,403,173,726,046,439,400
33.302326
78
0.595932
false
thenenadx/forseti-security
google/cloud/security/common/data_access/org_resource_rel_dao.py
1
3106
# Copyright 2017 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """DAO for organization resource entity relationships.""" from google.cloud.security.common.data_access import folder_dao from google.cloud.security.common.data_access import organization_dao from google.cloud.security.common.data_access import project_dao from google.cloud.security.common.gcp_type import resource # TODO: The next editor must remove this disable and correct issues. # pylint: disable=missing-type-doc,missing-return-type-doc class OrgResourceRelDao(object): """DAO for organization resource entity relationships.""" def __init__(self): """Initialize.""" # Map the org resource type to the appropriate dao class self._resource_db_lookup = { resource.ResourceType.ORGANIZATION: { 'dao': organization_dao.OrganizationDao(), 'get': 'get_organization', }, resource.ResourceType.FOLDER: { 'dao': folder_dao.FolderDao(), 'get': 'get_folder', }, resource.ResourceType.PROJECT: { 'dao': project_dao.ProjectDao(), 'get': 'get_project', } } def find_ancestors(self, org_resource, snapshot_timestamp=None): """Find ancestors of a particular resource. Args: org_resource: A Resource. snapshot_timestamp: The timestamp to use for data lookup. Returns: A list of ancestors, starting with the closest ancestor. """ # TODO: handle case where snapshot is None ancestors = [] curr_resource = org_resource while curr_resource is not None: parent_resource = None if (curr_resource.parent and curr_resource.parent.type and curr_resource.parent.id): resource_lookup = self._resource_db_lookup.get( curr_resource.parent.type, {}) # No dao object for the parent resource, so quit if not resource_lookup.get('dao'): break # Invoke the dao.get_*() method, to get the parent resource parent_resource = getattr( resource_lookup.get('dao'), resource_lookup.get('get'))( curr_resource.parent.id, snapshot_timestamp) if parent_resource: ancestors.append(parent_resource) curr_resource = parent_resource return ancestors
apache-2.0
-3,991,928,533,554,824,700
35.116279
75
0.613973
false
industrydive/mezzanine
mezzanine/generic/forms.py
1
9451
from __future__ import unicode_literals from future.builtins import int, str, zip from django import forms from django_comments.forms import CommentSecurityForm, CommentForm from django_comments.signals import comment_was_posted from django.contrib.admin.templatetags.admin_static import static from django.utils.safestring import mark_safe from django.utils.translation import ugettext, ugettext_lazy as _ from mezzanine.conf import settings from mezzanine.core.forms import Html5Mixin from mezzanine.generic.models import Keyword, ThreadedComment, Rating from mezzanine.utils.cache import add_cache_bypass from mezzanine.utils.email import split_addresses, send_mail_template from mezzanine.utils.views import ip_for_request class KeywordsWidget(forms.MultiWidget): """ Form field for the ``KeywordsField`` generic relation field. Since the admin with model forms has no form field for generic relations, this form field provides a single field for managing the keywords. It contains two actual widgets, a text input for entering keywords, and a hidden input that stores the ID of each ``Keyword`` instance. The attached JavaScript adds behaviour so that when the form is submitted, an AJAX post is made that passes the list of keywords in the text input, and returns a list of keyword IDs which are then entered into the hidden input before the form submits. The list of IDs in the hidden input is what is used when retrieving an actual value from the field for the form. """ class Media: js = (static("mezzanine/js/admin/keywords_field.js"),) def __init__(self, attrs=None): """ Setup the text and hidden form field widgets. """ widgets = (forms.HiddenInput, forms.TextInput(attrs={"class": "vTextField"})) super(KeywordsWidget, self).__init__(widgets, attrs) self._ids = [] def decompress(self, value): """ Takes the sequence of ``AssignedKeyword`` instances and splits them into lists of keyword IDs and titles each mapping to one of the form field widgets. """ if hasattr(value, "select_related"): keywords = [a.keyword for a in value.select_related("keyword")] if keywords: keywords = [(str(k.id), k.title) for k in keywords] self._ids, words = list(zip(*keywords)) return (",".join(self._ids), ", ".join(words)) return ("", "") def format_output(self, rendered_widgets): """ Wraps the output HTML with a list of all available ``Keyword`` instances that can be clicked on to toggle a keyword. """ rendered = super(KeywordsWidget, self).format_output(rendered_widgets) links = "" for keyword in Keyword.objects.all().order_by("title"): prefix = "+" if str(keyword.id) not in self._ids else "-" links += ("<a href='#'>%s%s</a>" % (prefix, str(keyword))) rendered += mark_safe("<p class='keywords-field'>%s</p>" % links) return rendered def value_from_datadict(self, data, files, name): """ Return the comma separated list of keyword IDs for use in ``KeywordsField.save_form_data()``. """ return data.get("%s_0" % name, "") class ThreadedCommentForm(CommentForm, Html5Mixin): name = forms.CharField(label=_("Name"), help_text=_("required"), max_length=50) email = forms.EmailField(label=_("Email"), help_text=_("required (not published)")) url = forms.URLField(label=_("Website"), help_text=_("optional"), required=False) # These are used to get/set prepopulated fields via cookies. cookie_fields = ("name", "email", "url") cookie_prefix = "mezzanine-comment-" def __init__(self, request, *args, **kwargs): """ Set some initial field values from cookies or the logged in user, and apply some HTML5 attributes to the fields if the ``FORMS_USE_HTML5`` setting is ``True``. """ kwargs.setdefault("initial", {}) user = request.user for field in ThreadedCommentForm.cookie_fields: cookie_name = ThreadedCommentForm.cookie_prefix + field value = request.COOKIES.get(cookie_name, "") if not value and user.is_authenticated(): if field == "name": value = user.get_full_name() if not value and user.username != user.email: value = user.username elif field == "email": value = user.email kwargs["initial"][field] = value super(ThreadedCommentForm, self).__init__(*args, **kwargs) def get_comment_model(self): """ Use the custom comment model instead of the built-in one. """ return ThreadedComment def check_for_duplicate_comment(self, new): """ We handle duplicates inside ``save``, since django_comments' `check_for_duplicate_comment` doesn't deal with extra fields defined on the comment model. """ return new def save(self, request): """ Saves a new comment and sends any notification emails. """ comment = self.get_comment_object() obj = comment.content_object if request.user.is_authenticated(): comment.user = request.user comment.by_author = request.user == getattr(obj, "user", None) comment.ip_address = ip_for_request(request) comment.replied_to_id = self.data.get("replied_to") # Mezzanine's duplicate check that also checks `replied_to_id`. lookup = { "content_type": comment.content_type, "object_pk": comment.object_pk, "user_name": comment.user_name, "user_email": comment.user_email, "user_url": comment.user_url, "replied_to_id": comment.replied_to_id, } for duplicate in self.get_comment_model().objects.filter(**lookup): if (duplicate.submit_date.date() == comment.submit_date.date() and duplicate.comment == comment.comment): return duplicate comment.save() comment_was_posted.send(sender=comment.__class__, comment=comment, request=request) notify_emails = split_addresses(settings.COMMENTS_NOTIFICATION_EMAILS) if notify_emails: subject = ugettext("New comment for: ") + str(obj) context = { "comment": comment, "comment_url": add_cache_bypass(comment.get_absolute_url()), "request": request, "obj": obj, } send_mail_template(subject, "email/comment_notification", settings.DEFAULT_FROM_EMAIL, notify_emails, context) return comment class RatingForm(CommentSecurityForm): """ Form for a rating. Subclasses ``CommentSecurityForm`` to make use of its easy setup for generic relations. """ value = forms.ChoiceField(label="", widget=forms.RadioSelect, choices=list(zip( *(settings.RATINGS_RANGE,) * 2))) def __init__(self, request, *args, **kwargs): self.request = request super(RatingForm, self).__init__(*args, **kwargs) def clean(self): """ Check unauthenticated user's cookie as a light check to prevent duplicate votes. """ bits = (self.data["content_type"], self.data["object_pk"]) request = self.request self.current = "%s.%s" % bits self.previous = request.COOKIES.get("mezzanine-rating", "").split(",") already_rated = self.current in self.previous if already_rated and not self.request.user.is_authenticated(): raise forms.ValidationError(ugettext("Already rated.")) return self.cleaned_data def save(self): """ Saves a new rating - authenticated users can update the value if they've previously rated. """ user = self.request.user self.undoing = False rating_value = self.cleaned_data["value"] rating_name = self.target_object.get_ratingfield_name() rating_manager = getattr(self.target_object, rating_name) if user.is_authenticated(): try: rating_instance = rating_manager.get(user=user) except Rating.DoesNotExist: rating_instance = Rating(user=user, value=rating_value) rating_manager.add(rating_instance) else: if rating_instance.value != int(rating_value): rating_instance.value = rating_value rating_instance.save() else: # User submitted the same rating as previously, # which we treat as undoing the rating (like a toggle). rating_instance.delete() self.undoing = True else: rating_instance = Rating(value=rating_value) rating_manager.add(rating_instance) return rating_instance
bsd-2-clause
398,190,695,416,197,300
40.091304
78
0.596022
false
jmb/geopy
geopy/geocoders/tomtom.py
1
7727
from geopy.compat import quote, urlencode from geopy.geocoders.base import DEFAULT_SENTINEL, Geocoder from geopy.location import Location from geopy.util import logger __all__ = ("TomTom", ) class TomTom(Geocoder): """TomTom geocoder. Documentation at: https://developer.tomtom.com/search-api/search-api-documentation .. versionadded:: 1.15.0 """ geocode_path = '/search/2/geocode/%(query)s.json' reverse_path = '/search/2/reverseGeocode/%(position)s.json' def __init__( self, api_key, format_string=None, scheme=None, timeout=DEFAULT_SENTINEL, proxies=DEFAULT_SENTINEL, user_agent=None, ssl_context=DEFAULT_SENTINEL, domain='api.tomtom.com', ): """ :param str api_key: TomTom API key. :param str format_string: See :attr:`geopy.geocoders.options.default_format_string`. :param str scheme: See :attr:`geopy.geocoders.options.default_scheme`. :param int timeout: See :attr:`geopy.geocoders.options.default_timeout`. :param dict proxies: See :attr:`geopy.geocoders.options.default_proxies`. :param str user_agent: See :attr:`geopy.geocoders.options.default_user_agent`. :type ssl_context: :class:`ssl.SSLContext` :param ssl_context: See :attr:`geopy.geocoders.options.default_ssl_context`. :param str domain: Domain where the target TomTom service is hosted. """ super(TomTom, self).__init__( format_string=format_string, scheme=scheme, timeout=timeout, proxies=proxies, user_agent=user_agent, ssl_context=ssl_context, ) self.api_key = api_key self.api = "%s://%s%s" % (self.scheme, domain, self.geocode_path) self.api_reverse = "%s://%s%s" % (self.scheme, domain, self.reverse_path) def geocode( self, query, exactly_one=True, timeout=DEFAULT_SENTINEL, limit=None, typeahead=False, language=None, ): """ Return a location point by address. :param str query: The address or query you wish to geocode. :param bool exactly_one: Return one result or a list of results, if available. :param int timeout: Time, in seconds, to wait for the geocoding service to respond before raising a :class:`geopy.exc.GeocoderTimedOut` exception. Set this only if you wish to override, on this call only, the value set during the geocoder's initialization. :param int limit: Maximum amount of results to return from the service. Unless exactly_one is set to False, limit will always be 1. :param bool typeahead: If the "typeahead" flag is set, the query will be interpreted as a partial input and the search will enter predictive mode. :param str language: Language in which search results should be returned. When data in specified language is not available for a specific field, default language is used. List of supported languages (case-insensitive): https://developer.tomtom.com/online-search/online-search-documentation/supported-languages :rtype: ``None``, :class:`geopy.location.Location` or a list of them, if ``exactly_one=False``. """ query = self.format_string % query params = self._geocode_params(query) params['typeahead'] = self._boolean_value(typeahead) if limit: params['limit'] = str(int(limit)) if exactly_one: params['limit'] = '1' if language: params['language'] = language quoted_query = quote(query.encode('utf-8')) url = "?".join((self.api % dict(query=quoted_query), urlencode(params))) logger.debug("%s.geocode: %s", self.__class__.__name__, url) return self._parse_json( self._call_geocoder(url, timeout=timeout), exactly_one ) def reverse( self, query, exactly_one=True, timeout=DEFAULT_SENTINEL, language=None, ): """ Return an address by location point. :param query: The coordinates for which you wish to obtain the closest human-readable addresses. :type query: :class:`geopy.point.Point`, list or tuple of ``(latitude, longitude)``, or string as ``"%(latitude)s, %(longitude)s"``. :param bool exactly_one: Return one result or a list of results, if available. :param int timeout: Time, in seconds, to wait for the geocoding service to respond before raising a :class:`geopy.exc.GeocoderTimedOut` exception. Set this only if you wish to override, on this call only, the value set during the geocoder's initialization. :param str language: Language in which search results should be returned. When data in specified language is not available for a specific field, default language is used. List of supported languages (case-insensitive): https://developer.tomtom.com/online-search/online-search-documentation/supported-languages .. versionadded:: 1.18.0 :rtype: ``None``, :class:`geopy.location.Location` or a list of them, if ``exactly_one=False``. """ position = self._coerce_point_to_string(query) params = self._reverse_params(position) if language: params['language'] = language quoted_position = quote(position.encode('utf-8')) url = "?".join((self.api_reverse % dict(position=quoted_position), urlencode(params))) logger.debug("%s.reverse: %s", self.__class__.__name__, url) return self._parse_reverse_json( self._call_geocoder(url, timeout=timeout), exactly_one ) @staticmethod def _boolean_value(bool_value): return 'true' if bool_value else 'false' def _geocode_params(self, formatted_query): return { 'key': self.api_key, } def _reverse_params(self, position): return { 'key': self.api_key, } def _parse_json(self, resources, exactly_one): if not resources or not resources['results']: return None if exactly_one: return self._parse_search_result(resources['results'][0]) else: return [self._parse_search_result(result) for result in resources['results']] def _parse_search_result(self, result): latitude = result['position']['lat'] longitude = result['position']['lon'] return Location(result['address']['freeformAddress'], (latitude, longitude), result) def _parse_reverse_json(self, resources, exactly_one): if not resources or not resources['addresses']: return None if exactly_one: return self._parse_reverse_result(resources['addresses'][0]) else: return [self._parse_reverse_result(result) for result in resources['addresses']] def _parse_reverse_result(self, result): latitude, longitude = result['position'].split(',') return Location(result['address']['freeformAddress'], (latitude, longitude), result)
mit
1,211,560,324,719,296,800
34.122727
102
0.588068
false
felixsch/trollolo
scripts/graph.py
1
4099
#!/usr/bin/env python class Graph: "Plot various graphs into burndown chart" def __init__ (self, graph_data): self.getGraphData(graph_data) def getGraphData(self, graph_data): self.x = graph_data['x'] self.y = graph_data['y'] self.xy_extra = 0 self.ymin = graph_data['ymin'] self.ymax = graph_data['ymax'] self.total = graph_data['total'] self.plot_count = graph_data['plot_count'] self.draw_tasks_diff = graph_data['draw_tasks_diff'] self.draw_bonus_tasks_diff = graph_data['draw_bonus_tasks_diff'] if 'x_extra' in graph_data: self.x_extra = graph_data['x_extra'] self.y_extra = graph_data['y_extra'] self.xy_extra = 1 if self.draw_tasks_diff: self.x_arrow_start_end = graph_data['x_arrow_start_end'] self.y_arrow_start = graph_data['y_arrow_start'] self.y_arrow_end = graph_data['y_arrow_end'] self.y_text = graph_data['y_text'] if self.draw_bonus_tasks_diff: self.y_arrow_start_bonus = graph_data['y_arrow_start_bonus'] self.y_arrow_end_bonus = graph_data['y_arrow_end_bonus'] self.y_text_bonus = graph_data['y_text_bonus'] self.bonus_tasks_day_one = graph_data['bonus_tasks_day_one'] self.subplot = graph_data['subplot'] return def draw(self, y_label, color, marker, linestyle, linewidth, plot): self.plot = plot self.subplot.set_ylabel(y_label, color=color) self.subplot.set_ylim([self.ymin, self.ymax]) if self.plot_count == 1: self.subplot.tick_params(axis='y', colors=color) if self.plot_count >= 2: self.subplot.tick_params(axis='y', colors=color) self.subplot.spines['right'].set_position(('axes', 1.15)) self.plot.fig.subplots_adjust(right=0.8) self.subplot.plot(self.x, self.y, color=color, marker=marker, linestyle=linestyle, linewidth=linewidth) self.drawBonus(color, marker, linestyle, linewidth) self.drawBars(color) if self.draw_tasks_diff: self.drawTasksDiff(color) if self.draw_bonus_tasks_diff: self.drawBonusTasksDiff(color) return def drawBonus(self, color, marker, linestyle, linewidth): if self.xy_extra and len(self.x_extra) > 0: self.subplot.plot(self.x_extra, self.y_extra, color=color, marker=marker, linestyle=linestyle, linewidth=linewidth) return def drawBars(self, color): if len(self.total) > 1: width = 0.2 offset = 0 if self.plot_count == 1: offset = -width new = [0, 0] for i in range(1, len(self.total)): new.append(self.total[i] - self.total[i - 1]) additional_days = [] additional = [] for i in range(len(new)): if new[i] != 0: additional_days.append(i + offset) additional.append(new[i]) if len(additional) > 0: self.subplot.bar(additional_days, additional, width, color=color) return def drawTasksDiff(self, color): tasks_done = self.total[0] - self.y[0] if tasks_done > 0: self.subplot.annotate("", xy=(self.x_arrow_start_end, self.y_arrow_start), xycoords='data', xytext=(self.x_arrow_start_end, self.y_arrow_end), textcoords='data', arrowprops=dict(arrowstyle="<|-|>", connectionstyle="arc3", color=color) ) self.subplot.text(0.7, self.y_text, str(int(tasks_done)) + " tasks done", rotation='vertical', verticalalignment='top', color=color ) return def drawBonusTasksDiff(self, color): if self.bonus_tasks_day_one: self.subplot.annotate("", xy=(self.x_arrow_start_end, self.y_arrow_start_bonus), xycoords='data', xytext=(self.x_arrow_start_end, self.y_arrow_end_bonus), textcoords='data', arrowprops=dict(arrowstyle="<|-|>", connectionstyle="arc3", color=color) ) self.subplot.text(0.4, self.y_text_bonus, str(int(-self.y_extra[0])) + " extra", rotation='vertical', verticalalignment='center', color=color ) self.subplot.text(0.7, self.y_text_bonus, "tasks done", rotation='vertical', verticalalignment='center', color=color ) return
gpl-3.0
1,062,859,525,571,218,000
34.336207
121
0.634545
false
kernsuite-debian/lofar
LCS/MessageBus/src/noqpidfallback.py
1
1097
#!/usr/bin/env python3 import sys print("QPID support NOT enabled! Will NOT connect to any broker, and messages will be lost!") """ Exceptions. """ class ProtonException(Exception): pass class SessionError(Exception): pass class Timeout(Exception): pass """ Messages. """ class Message(object): def __init__(self, content_type, durable): self.content = "" """ Communication. """ class Sender(object): def __init__(self, dest): self.dest = dest def send(self, msg): pass class Receiver(object): def __init__(self, source): self.capacity = 0 self.source = source def fetch(self): return None class Session(object): def sender(self, address): return Sender(address) def receiver(self, address): return Receiver(address) def next_receiver(self, timeout=0): return Receiver("unknown") def acknowledge(self, msg): pass class Connection(object): def __init__(self, broker): self.reconnect = False def open(self): pass def close(self, timeout=0): pass def session(self): return Session()
gpl-3.0
1,013,217,743,745,717,100
14.027397
93
0.654512
false
cyberdelia/metrology
metrology/reporter/logger.py
1
3203
import logging from metrology.instruments import ( Counter, Gauge, Histogram, Meter, Timer, UtilizationTimer ) from metrology.reporter.base import Reporter class LoggerReporter(Reporter): """ A logging reporter that write metrics to a logger :: reporter = LoggerReporter(level=logging.DEBUG, interval=10) reporter.start() :param logger: logger to use :param level: logger level :param interval: time between each reporting :param prefix: metrics name prefix """ def __init__(self, logger=logging, level=logging.INFO, **options): self.logger = logger self.level = level self.prefix = options.get('prefix') super(LoggerReporter, self).__init__(**options) def write(self): for name, metric in self.registry: if isinstance(metric, Meter): self.log_metric(name, 'meter', metric, [ 'count', 'one_minute_rate', 'five_minute_rate', 'fifteen_minute_rate', 'mean_rate' ]) if isinstance(metric, Gauge): self.log_metric(name, 'gauge', metric, [ 'value' ]) if isinstance(metric, UtilizationTimer): self.log_metric(name, 'timer', metric, [ 'count', 'one_minute_rate', 'five_minute_rate', 'fifteen_minute_rate', 'mean_rate', 'min', 'max', 'mean', 'stddev', 'one_minute_utilization', 'five_minute_utilization', 'fifteen_minute_utilization', 'mean_utilization' ], [ 'median', 'percentile_95th' ]) if isinstance(metric, Timer): self.log_metric(name, 'timer', metric, [ 'count', 'total_time', 'one_minute_rate', 'five_minute_rate', 'fifteen_minute_rate', 'mean_rate', 'min', 'max', 'mean', 'stddev' ], [ 'median', 'percentile_95th' ]) if isinstance(metric, Counter): self.log_metric(name, 'counter', metric, [ 'count' ]) if isinstance(metric, Histogram): self.log_metric(name, 'histogram', metric, [ 'count', 'min', 'max', 'mean', 'stddev', ], [ 'median', 'percentile_95th' ]) def log_metric(self, name, type, metric, keys, snapshot_keys=None): if snapshot_keys is None: snapshot_keys = [] messages = [] if self.prefix: messages.append(self.prefix) messages.append(name) messages.append(type) for name in keys: messages.append("{0}={1}".format(name, getattr(metric, name))) if hasattr(metric, 'snapshot'): snapshot = metric.snapshot for name in snapshot_keys: messages.append("{0}={1}".format(name, getattr(snapshot, name))) self.logger.log(self.level, " ".join(messages))
mit
-4,748,470,296,817,511,000
33.815217
75
0.505151
false
YoungKwonJo/mlxtend
tests/tests_classifier/test_ensembleclassifier.py
1
2352
import numpy as np from mlxtend.classifier import EnsembleClassifier from sklearn.grid_search import GridSearchCV from sklearn import cross_validation from sklearn.linear_model import LogisticRegression from sklearn.naive_bayes import GaussianNB from sklearn.ensemble import RandomForestClassifier import numpy as np from sklearn import datasets iris = datasets.load_iris() X, y = iris.data[:, 1:3], iris.target def test_EnsembleClassifier(): np.random.seed(123) clf1 = LogisticRegression() clf2 = RandomForestClassifier() clf3 = GaussianNB() eclf = EnsembleClassifier(clfs=[clf1, clf2, clf3], voting='hard') scores = cross_validation.cross_val_score(eclf, X, y, cv=5, scoring='accuracy') scores_mean = (round(scores.mean(), 2)) assert(scores_mean == 0.94) def test_EnsembleClassifier_weights(): np.random.seed(123) clf1 = LogisticRegression() clf2 = RandomForestClassifier() clf3 = GaussianNB() eclf = EnsembleClassifier(clfs=[clf1, clf2, clf3], voting='soft', weights=[1,2,10]) scores = cross_validation.cross_val_score(eclf, X, y, cv=5, scoring='accuracy') scores_mean = (round(scores.mean(), 2)) assert(scores_mean == 0.93) def test_EnsembleClassifier_gridsearch(): clf1 = LogisticRegression(random_state=1) clf2 = RandomForestClassifier(random_state=1) clf3 = GaussianNB() eclf = EnsembleClassifier(clfs=[clf1, clf2, clf3], voting='soft') params = {'logisticregression__C': [1.0, 100.0], 'randomforestclassifier__n_estimators': [20, 200],} grid = GridSearchCV(estimator=eclf, param_grid=params, cv=5) grid.fit(iris.data, iris.target) mean_scores = [] for params, mean_score, scores in grid.grid_scores_: mean_scores.append(round(mean_score, 2)) assert(mean_scores == [0.95, 0.96, 0.96, 0.95]) def test_EnsembleClassifier_gridsearch_enumerate_names(): clf1 = LogisticRegression(random_state=1) clf2 = RandomForestClassifier(random_state=1) eclf = EnsembleClassifier(clfs=[clf1, clf1, clf2], voting='soft') params = {'logisticregression-1__C': [1.0, 100.0], 'logisticregression-2__C': [1.0, 100.0], 'randomforestclassifier__n_estimators': [5, 20],} grid = GridSearchCV(estimator=eclf, param_grid=params, cv=5) gs = grid.fit(iris.data, iris.target)
bsd-3-clause
1,804,529,685,603,916,500
30.783784
87
0.690051
false
danakj/chromium
build/android/method_count.py
1
3994
#! /usr/bin/env python # Copyright 2015 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. import argparse import collections import os import re import shutil import sys import tempfile import zipfile import devil_chromium from devil.android.sdk import dexdump from pylib.constants import host_paths sys.path.append(os.path.join(host_paths.DIR_SOURCE_ROOT, 'build', 'util', 'lib', 'common')) import perf_tests_results_helper # pylint: disable=import-error # Example dexdump output: # DEX file header: # magic : 'dex\n035\0' # checksum : b664fc68 # signature : ae73...87f1 # file_size : 4579656 # header_size : 112 # link_size : 0 # link_off : 0 (0x000000) # string_ids_size : 46148 # string_ids_off : 112 (0x000070) # type_ids_size : 5730 # type_ids_off : 184704 (0x02d180) # proto_ids_size : 8289 # proto_ids_off : 207624 (0x032b08) # field_ids_size : 17854 # field_ids_off : 307092 (0x04af94) # method_ids_size : 33699 # method_ids_off : 449924 (0x06dd84) # class_defs_size : 2616 # class_defs_off : 719516 (0x0afa9c) # data_size : 3776428 # data_off : 803228 (0x0c419c) # For what these mean, refer to: # https://source.android.com/devices/tech/dalvik/dex-format.html _CONTRIBUTORS_TO_DEX_CACHE = {'type_ids_size': 'types', 'string_ids_size': 'strings', 'method_ids_size': 'methods', 'field_ids_size': 'fields'} def _ExtractSizesFromDexFile(dex_path): counts = {} for line in dexdump.DexDump(dex_path, file_summary=True): if not line.strip(): # Each method, type, field, and string contributes 4 bytes (1 reference) # to our DexCache size. counts['dex_cache_size'] = ( sum(counts[x] for x in _CONTRIBUTORS_TO_DEX_CACHE)) * 4 return counts m = re.match(r'([a-z_]+_size) *: (\d+)', line) if m: counts[m.group(1)] = int(m.group(2)) raise Exception('Unexpected end of output.') def _ExtractSizesFromZip(path): tmpdir = tempfile.mkdtemp(suffix='_dex_extract') try: counts = collections.defaultdict(int) with zipfile.ZipFile(path, 'r') as z: for subpath in z.namelist(): if not subpath.endswith('.dex'): continue extracted_path = z.extract(subpath, tmpdir) cur_counts = _ExtractSizesFromDexFile(extracted_path) for k in cur_counts: counts[k] += cur_counts[k] return dict(counts) finally: shutil.rmtree(tmpdir) def main(): parser = argparse.ArgumentParser() parser.add_argument( '--apk-name', help='Name of the APK to which the dexfile corresponds.') parser.add_argument('dexfile') args = parser.parse_args() devil_chromium.Initialize() if not args.apk_name: dirname, basename = os.path.split(args.dexfile) while basename: if 'apk' in basename: args.apk_name = basename break dirname, basename = os.path.split(dirname) else: parser.error( 'Unable to determine apk name from %s, ' 'and --apk-name was not provided.' % args.dexfile) if os.path.splitext(args.dexfile)[1] in ('.zip', '.apk', '.jar'): sizes = _ExtractSizesFromZip(args.dexfile) else: sizes = _ExtractSizesFromDexFile(args.dexfile) def print_result(name, value_key, description=None): perf_tests_results_helper.PrintPerfResult( '%s_%s' % (args.apk_name, name), 'total', [sizes[value_key]], description or name) for dex_header_name, readable_name in _CONTRIBUTORS_TO_DEX_CACHE.iteritems(): print_result(readable_name, dex_header_name) print_result( 'DexCache_size', 'dex_cache_size', 'bytes of permanent dirty memory') return 0 if __name__ == '__main__': sys.exit(main())
bsd-3-clause
-6,493,615,248,931,155,000
29.96124
80
0.623185
false
dominicrodger/tinyblog
tests/utils.py
1
1274
from datetime import datetime import django from django.core.management import call_command import factory from StringIO import StringIO import sys from tinyblog.models import Post, EmailSubscriber class PostFactory(factory.Factory): FACTORY_FOR = Post title = factory.Sequence(lambda n: 'Post %s' % n) slug = factory.Sequence(lambda n: 'post-%s' % n) created = datetime(2013, 1, 1, 7, 0, 0) class EmailSubscriberFactory(factory.Factory): FACTORY_FOR = EmailSubscriber email = '[email protected]' class OutputRedirector(object): def __init__(self, obj): self.obj = obj def __enter__(self): self.original_stdout = sys.stdout self.original_stderr = sys.stderr sys.stdout = self.obj sys.stderr = self.obj def __exit__(self, type, value, traceback): sys.stdout = self.original_stdout sys.stderr = self.original_stderr def run_command_for_test(command, *args): content = StringIO() with OutputRedirector(content): call_command(command, *args, stdout=content, stderr=content) content.seek(0) return content.read().strip() def is_before_django_1_5(): version = django.VERSION if version[0] > 1: return False return version[1] < 5
bsd-3-clause
-1,978,692,103,374,146,600
22.163636
68
0.666405
false
mclinux/mclinux-packages
external-packages/apt-notifier/src/usr/bin/apt-notifier.py
1
6927
#!/usr/bin/python # -*- coding: utf-8 -*- import subprocess import sys import os import tempfile from os import environ from PyQt4 import QtGui from PyQt4 import QtCore rc_file_name = environ.get('HOME') + '/.kde/share/config/apt-notifierrc' message_status = "not displayed" # Check for updates, using subprocess.Popen def check_updates(): global message_status #Create an inline script (what used to be /usr/bin/apt-notifier-check-Updates) and then run it to get the number of updates. script = '''#!/bin/sh sorted_list_of_upgrades() { #Create a sorted list of the names of the packages that are upgradeable. LC_ALL=en_US apt-get -o 'Debug::NoLocking=true' --trivial-only -V upgrade 2>/dev/null \ | grep -v -e 'lists...' \ -e 'dependency tree' \ -e 'information...' \ -e 'back:' \ -e 'upgraded:' \ -e 'upgraded.' \ -e 'archives.' \ -e 'used.'\ -e 'freed.'\ | awk '{ print $1 }' | sort } if [ -s /var/lib/synaptic/preferences ]; then #/var/lib/synaptic/preferences is a non-zero size file, which means there are packages pinned in Synaptic. #Remove from the sorted_list_of_upgrades, packages that are pinned in Synaptic, and then get a count of remaining. sorted_list_of_upgrades|grep -vx $(cat /var/lib/synaptic/preferences|grep 'Package:'|sed -e 's/Package: /-e /g')|wc -l else #/var/lib/synaptic/preferences is either a zero byte file, meaning packages were pinned in Synaptic at some time in # the past but none are currently pinned. Or the file is not present, meaning packages have never been pinned using # Synaptic. In either case, just get a count of how many upgradeable packages are in the list. sorted_list_of_upgrades|wc -l fi ''' script_file = tempfile.NamedTemporaryFile('wt') script_file.write(script) script_file.flush() run = subprocess.Popen(["echo -n `sh %s` new updates available" % script_file.name],shell=True, stdout=subprocess.PIPE) # Read the output into a text string text = run.stdout.read(128) # Alter both Icon and Tooltip, depending on updates available or not if text.startswith( "0" ): message_status = "not displayed" # Resets flag once there are no more updates add_hide_action() if icon_config != "show": AptIcon.hide() else: AptIcon.setIcon(NoUpdatesIcon) AptIcon.setToolTip(text) else: AptIcon.setIcon(NewUpdatesIcon) AptIcon.show() AptIcon.setToolTip(text) add_upgrade_action() # Shows the pop up message only if not displayed before if message_status == "not displayed": def show_message(): AptIcon.showMessage("Updates", "You have " + text) Timer.singleShot(1000, show_message) message_status = "displayed" # Define the command to run when clicking Tray Icon def start_synaptic(): run = subprocess.Popen(['/usr/bin/su-to-root -X -c synaptic'],shell=True).wait() check_updates() def upgrade(): script = '''#!/bin/sh /usr/bin/su-to-root -X -c "x-terminal-emulator -e apt-get upgrade" PID=`pidof apt-get| cut -f 1 -d " "` if [ $PID ]; then while (ps -p $PID > /dev/null); do sleep 5 done fi ''' script_file = tempfile.NamedTemporaryFile('wt') script_file.write(script) script_file.flush() run = subprocess.Popen(['sh %s' % script_file.name],shell=True).wait() check_updates() # Define the action on clicking Tray Icon def start_synaptic_activated(reason): if reason == QtGui.QSystemTrayIcon.Trigger: start_synaptic() def read_icon_config(): """Reads ~/.kde/share/config/apt-notifierrc, returns 'show' if file doesn't exist or does not contain DontShowIcon""" command_string = "cat " + rc_file_name + " | grep -q DontShowIcon" exit_state = subprocess.call([command_string], shell=True, stdout=subprocess.PIPE) if exit_state != 0: return "show" def set_noicon(): """Reads ~/.kde/share/config/apt-notifierrc. If "DontShowIcon blah blah blah" is already there, don't write it again""" command_string = "cat " + rc_file_name + " | grep -q DontShowIcon" exit_state = subprocess.call([command_string], shell=True, stdout=subprocess.PIPE) if exit_state != 0: file = open(rc_file_name, 'a') file.write ('[DontShowIcon] #Remove this entry if you want the apt-notify icon to show even when there are no upgrades available\n') file.close() AptIcon.hide() icon_config = "donot show" def add_upgrade_action(): ActionsMenu.clear() upgrade_action = ActionsMenu.addAction("Upgrade all packages") AptNotify.connect(upgrade_action, QtCore.SIGNAL("triggered()"), upgrade) add_quit_action() def add_hide_action(): ActionsMenu.clear() if icon_config == "show": hide_action = ActionsMenu.addAction("Hide until updates available") AptNotify.connect(hide_action,QtCore.SIGNAL("triggered()"),set_noicon) add_quit_action() def add_quit_action(): ActionsMenu.addSeparator() quit_action = ActionsMenu.addAction(QuitIcon,"Quit Apt-Notification") AptNotify.connect(quit_action, QtCore.SIGNAL("triggered()"), AptNotify.exit) # General application code def main(): # Define Core objects, Tray icon and QTimer global AptNotify global AptIcon global QuitIcon global icon_config global upgrade_action global quit_action global Timer AptNotify = QtGui.QApplication(sys.argv) AptIcon = QtGui.QSystemTrayIcon() Timer = QtCore.QTimer() icon_config = read_icon_config() # Define the icons: global NoUpdatesIcon global NewUpdatesIcon NoUpdatesIcon = QtGui.QIcon("/usr/share/icons/mnotify-none.png") NewUpdatesIcon = QtGui.QIcon("/usr/share/icons/mnotify-some.png") QuitIcon = QtGui.QIcon("/usr/share/icons/oxygen/22x22/actions/system-shutdown.png") # Create the right-click menu and add the Tooltip text global ActionsMenu ActionsMenu = QtGui.QMenu() AptIcon.connect( AptIcon, QtCore.SIGNAL( "activated(QSystemTrayIcon::ActivationReason)" ), start_synaptic_activated) AptNotify.connect(Timer, QtCore.SIGNAL("timeout()"), check_updates) # Integrate it together,apply checking of updated packages and set timer to every 5 minutes (1 second = 1000) check_updates() AptIcon.setContextMenu(ActionsMenu) if icon_config == "show": AptIcon.show() Timer.start(300000) if AptNotify.isSessionRestored(): sys.exit(1) sys.exit(AptNotify.exec_()) if __name__ == '__main__': main()
gpl-3.0
7,291,835,631,016,373,000
38.582857
140
0.640393
false
digitalocean/netbox
netbox/tenancy/forms.py
1
3588
from django import forms from extras.forms import ( AddRemoveTagsForm, CustomFieldModelForm, CustomFieldBulkEditForm, CustomFieldFilterForm, CustomFieldModelCSVForm, ) from extras.models import Tag from utilities.forms import ( BootstrapMixin, CommentField, CSVModelChoiceField, CSVModelForm, DynamicModelChoiceField, DynamicModelMultipleChoiceField, SlugField, TagFilterField, ) from .models import Tenant, TenantGroup # # Tenant groups # class TenantGroupForm(BootstrapMixin, forms.ModelForm): parent = DynamicModelChoiceField( queryset=TenantGroup.objects.all(), required=False ) slug = SlugField() class Meta: model = TenantGroup fields = [ 'parent', 'name', 'slug', 'description', ] class TenantGroupCSVForm(CSVModelForm): parent = CSVModelChoiceField( queryset=TenantGroup.objects.all(), required=False, to_field_name='name', help_text='Parent group' ) slug = SlugField() class Meta: model = TenantGroup fields = TenantGroup.csv_headers # # Tenants # class TenantForm(BootstrapMixin, CustomFieldModelForm): slug = SlugField() group = DynamicModelChoiceField( queryset=TenantGroup.objects.all(), required=False ) comments = CommentField() tags = DynamicModelMultipleChoiceField( queryset=Tag.objects.all(), required=False ) class Meta: model = Tenant fields = ( 'name', 'slug', 'group', 'description', 'comments', 'tags', ) class TenantCSVForm(CustomFieldModelCSVForm): slug = SlugField() group = CSVModelChoiceField( queryset=TenantGroup.objects.all(), required=False, to_field_name='name', help_text='Assigned group' ) class Meta: model = Tenant fields = Tenant.csv_headers class TenantBulkEditForm(BootstrapMixin, AddRemoveTagsForm, CustomFieldBulkEditForm): pk = forms.ModelMultipleChoiceField( queryset=Tenant.objects.all(), widget=forms.MultipleHiddenInput() ) group = DynamicModelChoiceField( queryset=TenantGroup.objects.all(), required=False ) class Meta: nullable_fields = [ 'group', ] class TenantFilterForm(BootstrapMixin, CustomFieldFilterForm): model = Tenant q = forms.CharField( required=False, label='Search' ) group = DynamicModelMultipleChoiceField( queryset=TenantGroup.objects.all(), to_field_name='slug', required=False, null_option='None' ) tag = TagFilterField(model) # # Form extensions # class TenancyForm(forms.Form): tenant_group = DynamicModelChoiceField( queryset=TenantGroup.objects.all(), required=False, null_option='None', initial_params={ 'tenants': '$tenant' } ) tenant = DynamicModelChoiceField( queryset=Tenant.objects.all(), required=False, query_params={ 'group_id': '$tenant_group' } ) class TenancyFilterForm(forms.Form): tenant_group = DynamicModelMultipleChoiceField( queryset=TenantGroup.objects.all(), to_field_name='slug', required=False, null_option='None' ) tenant = DynamicModelMultipleChoiceField( queryset=Tenant.objects.all(), to_field_name='slug', required=False, null_option='None', query_params={ 'group': '$tenant_group' } )
apache-2.0
2,559,112,276,505,185,000
22.761589
117
0.632664
false
TAMU-CPT/galaxy-tools
tools/fasta/fasta_dedup.py
1
1258
#!/usr/bin/env python import logging import copy import argparse import StringIO import hashlib from Bio import SeqIO logging.basicConfig(level=logging.INFO) def dedup(fasta_file, mutation="mutate"): records = list(SeqIO.parse(fasta_file, "fasta")) output = StringIO.StringIO() known_records = {} ordering_keys = [] for record in records: seq = str(record.seq).upper() md5 = hashlib.md5(seq).hexdigest() if md5 in known_records: known_records[md5]["keys"].append(record.id) else: known_records[md5] = {"keys": [], "rec": copy.deepcopy(record)} ordering_keys.append(md5) for key in ordering_keys: if len(known_records[key]["keys"]) > 0: ident_str = ", ".join(known_records[key]["keys"]) known_records[key]["rec"].description += " [Ident: %s]" % ident_str SeqIO.write(known_records[key]["rec"], output, "fasta") print(output.getvalue()) if __name__ == "__main__": parser = argparse.ArgumentParser( description="remove duplicate sequences in a fasta file" ) parser.add_argument("fasta_file", type=argparse.FileType("r"), help="Fasta file") args = parser.parse_args() dedup(**vars(args))
gpl-3.0
-5,770,532,780,688,824,000
27.590909
85
0.617647
false
FenuaTabu/efenua
actions.py
1
1708
import csv from django.http import HttpResponse from django.utils.translation import ugettext_lazy as _ from efenua.decorators import action def make_export_as_csv(fields=None, exclude=None, header=True): """ This function returns an export csv action 'fields' and 'exclude' work like in django ModelForm 'header' is whether or not to output the column names as the first row """ from itertools import chain @action(_('Export CSV'), _('Export CSV')) def export_as_csvAction(modeladmin, request, queryset): """ Generic csv export admin action. """ opts = modeladmin.model._meta field_names = set([field.name for field in opts.fields]) many_to_many_field_names = set([many_to_many_field.name for many_to_many_field in opts.many_to_many]) if fields: fieldset = set(fields) field_names = field_names & fieldset elif exclude: excludeset = set(exclude) field_names = field_names - excludeset response = HttpResponse(content_type='text/csv') response['Content-Disposition'] = 'attachment; filename=%s.csv' % str(opts).replace('.', '_') writer = csv.writer(response) if header: writer.writerow(list(chain(field_names, many_to_many_field_names))) for obj in queryset: row = [] for field in field_names: row.append(getattr(obj, field)) for field in many_to_many_field_names: row.append(getattr(obj, field).all()) writer.writerow(row) return response return export_as_csvAction
gpl-3.0
82,911,949,500,981,570
35.130435
109
0.604801
false
berkmancenter/mediacloud
apps/topics-base/tests/python/topics_base/test_messages.py
1
1355
from topics_base.messages import TopicSpiderUpdateMessage def test_topic_spider_update_email(): topic_name = 'Foo Bar Baz & <script></script>' topic_url = 'https://topics.com/topic?ab=cd&ef=gh' topic_spider_status = 'Abc def & <script></script>' message = TopicSpiderUpdateMessage( to='[email protected]', topic_name=topic_name, topic_url=topic_url, topic_spider_status=topic_spider_status, ) assert message.subject is not None assert len(message.subject) > 3 assert '{{' not in message.subject # no Jinja2 variable placeholders assert message.text_body is not None assert len(message.text_body) > 100 assert message.html_body is not None assert len(message.html_body) > 100 assert topic_name in message.text_body assert topic_url in message.text_body assert topic_spider_status in message.text_body assert topic_name not in message.html_body # should be escaped assert 'Foo Bar Baz &amp; &lt;script&gt;&lt;/script&gt;' in message.html_body assert topic_url not in message.html_body # should be escaped assert 'https://topics.com/topic?ab=cd&amp;ef=gh' in message.html_body assert topic_spider_status not in message.html_body # should be escaped assert 'Abc def &amp; &lt;script&gt;&lt;/script&gt;' in message.html_body
agpl-3.0
1,322,631,432,139,391,200
35.621622
81
0.695203
false
citrix-openstack-build/neutron-lbaas
neutron_lbaas/tests.skip/unit/services/loadbalancer/drivers/haproxy/test_namespace_driver.py
1
25382
# Copyright 2013 New Dream Network, LLC (DreamHost) # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import contextlib import mock from neutron.common import exceptions from neutron.tests import base from neutron_lbaas.services.loadbalancer.drivers.haproxy \ import namespace_driver class TestHaproxyNSDriver(base.BaseTestCase): def setUp(self): super(TestHaproxyNSDriver, self).setUp() conf = mock.Mock() conf.haproxy.loadbalancer_state_path = '/the/path' conf.interface_driver = 'intdriver' conf.haproxy.user_group = 'test_group' conf.haproxy.send_gratuitous_arp = 3 conf.AGENT.root_helper = 'sudo_test' self.conf = conf self.mock_importer = mock.patch.object(namespace_driver, 'importutils').start() self.rpc_mock = mock.Mock() self.driver = namespace_driver.HaproxyNSDriver( conf, self.rpc_mock ) self.vif_driver = mock.Mock() self.driver.vif_driver = self.vif_driver self.fake_config = { 'pool': {'id': 'pool_id', 'status': 'ACTIVE', 'admin_state_up': True}, 'vip': {'id': 'vip_id', 'port': {'id': 'port_id'}, 'status': 'ACTIVE', 'admin_state_up': True} } def test_get_name(self): self.assertEqual(self.driver.get_name(), namespace_driver.DRIVER_NAME) def test_create(self): with mock.patch.object(self.driver, '_plug') as plug: with mock.patch.object(self.driver, '_spawn') as spawn: self.driver.create(self.fake_config) plug.assert_called_once_with( 'qlbaas-pool_id', {'id': 'port_id'} ) spawn.assert_called_once_with(self.fake_config) def test_update(self): with contextlib.nested( mock.patch.object(self.driver, '_get_state_file_path'), mock.patch.object(self.driver, '_spawn'), mock.patch('__builtin__.open') ) as (gsp, spawn, mock_open): mock_open.return_value = ['5'] self.driver.update(self.fake_config) mock_open.assert_called_once_with(gsp.return_value, 'r') spawn.assert_called_once_with(self.fake_config, ['-sf', '5']) def test_spawn(self): with contextlib.nested( mock.patch.object(namespace_driver.hacfg, 'save_config'), mock.patch.object(self.driver, '_get_state_file_path'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper') ) as (mock_save, gsp, ip_wrap): gsp.side_effect = lambda x, y: y self.driver._spawn(self.fake_config) mock_save.assert_called_once_with('conf', self.fake_config, 'sock', 'test_group') cmd = ['haproxy', '-f', 'conf', '-p', 'pid'] ip_wrap.assert_has_calls([ mock.call('sudo_test', 'qlbaas-pool_id'), mock.call().netns.execute(cmd) ]) def test_undeploy_instance(self): with contextlib.nested( mock.patch.object(self.driver, '_get_state_file_path'), mock.patch.object(namespace_driver, 'kill_pids_in_file'), mock.patch.object(self.driver, '_unplug'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper'), mock.patch('os.path.isdir'), mock.patch('shutil.rmtree') ) as (gsp, kill, unplug, ip_wrap, isdir, rmtree): gsp.side_effect = lambda x, y: '/pool/' + y self.driver.pool_to_port_id['pool_id'] = 'port_id' isdir.return_value = True self.driver.undeploy_instance('pool_id') kill.assert_called_once_with('sudo_test', '/pool/pid') unplug.assert_called_once_with('qlbaas-pool_id', 'port_id') isdir.assert_called_once_with('/pool') rmtree.assert_called_once_with('/pool') ip_wrap.assert_has_calls([ mock.call('sudo_test', 'qlbaas-pool_id'), mock.call().garbage_collect_namespace() ]) def test_undeploy_instance_with_ns_cleanup(self): with contextlib.nested( mock.patch.object(self.driver, '_get_state_file_path'), mock.patch.object(self.driver, 'vif_driver'), mock.patch.object(namespace_driver, 'kill_pids_in_file'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper'), mock.patch('os.path.isdir'), mock.patch('shutil.rmtree') ) as (gsp, vif, kill, ip_wrap, isdir, rmtree): device = mock.Mock() device_name = 'port_device' device.name = device_name ip_wrap.return_value.get_devices.return_value = [device] self.driver.undeploy_instance('pool_id', cleanup_namespace=True) vif.unplug.assert_called_once_with(device_name, namespace='qlbaas-pool_id') def test_remove_orphans(self): with contextlib.nested( mock.patch.object(self.driver, 'exists'), mock.patch.object(self.driver, 'undeploy_instance'), mock.patch('os.listdir'), mock.patch('os.path.exists') ) as (exists, undeploy, listdir, path_exists): known = ['known1', 'known2'] unknown = ['unknown1', 'unknown2'] listdir.return_value = known + unknown exists.side_effect = lambda x: x == 'unknown2' self.driver.remove_orphans(known) undeploy.assert_called_once_with('unknown2', cleanup_namespace=True) def test_exists(self): with contextlib.nested( mock.patch.object(self.driver, '_get_state_file_path'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper'), mock.patch('socket.socket'), mock.patch('os.path.exists'), ) as (gsp, ip_wrap, socket, path_exists): gsp.side_effect = lambda x, y, z: '/pool/' + y ip_wrap.return_value.netns.exists.return_value = True path_exists.return_value = True self.driver.exists('pool_id') ip_wrap.assert_has_calls([ mock.call('sudo_test'), mock.call().netns.exists('qlbaas-pool_id') ]) self.assertTrue(self.driver.exists('pool_id')) def test_get_stats(self): raw_stats = ('# pxname,svname,qcur,qmax,scur,smax,slim,stot,bin,bout,' 'dreq,dresp,ereq,econ,eresp,wretr,wredis,status,weight,' 'act,bck,chkfail,chkdown,lastchg,downtime,qlimit,pid,iid,' 'sid,throttle,lbtot,tracked,type,rate,rate_lim,rate_max,' 'check_status,check_code,check_duration,hrsp_1xx,' 'hrsp_2xx,hrsp_3xx,hrsp_4xx,hrsp_5xx,hrsp_other,hanafail,' 'req_rate,req_rate_max,req_tot,cli_abrt,srv_abrt,\n' '8e271901-69ed-403e-a59b-f53cf77ef208,BACKEND,1,2,3,4,0,' '10,7764,2365,0,0,,0,0,0,0,UP,1,1,0,,0,103780,0,,1,2,0,,0' ',,1,0,,0,,,,0,0,0,0,0,0,,,,,0,0,\n\n' 'a557019b-dc07-4688-9af4-f5cf02bb6d4b,' '32a6c2a3-420a-44c3-955d-86bd2fc6871e,0,0,0,1,,7,1120,' '224,,0,,0,0,0,0,UP,1,1,0,0,1,2623,303,,1,2,1,,7,,2,0,,' '1,L7OK,200,98,0,7,0,0,0,0,0,,,,0,0,\n' 'a557019b-dc07-4688-9af4-f5cf02bb6d4b,' 'd9aea044-8867-4e80-9875-16fb808fa0f9,0,0,0,2,,12,0,0,,' '0,,0,0,8,4,DOWN,1,1,0,9,2,308,675,,1,2,2,,4,,2,0,,2,' 'L4CON,,2999,0,0,0,0,0,0,0,,,,0,0,\n') raw_stats_empty = ('# pxname,svname,qcur,qmax,scur,smax,slim,stot,bin,' 'bout,dreq,dresp,ereq,econ,eresp,wretr,wredis,' 'status,weight,act,bck,chkfail,chkdown,lastchg,' 'downtime,qlimit,pid,iid,sid,throttle,lbtot,' 'tracked,type,rate,rate_lim,rate_max,check_status,' 'check_code,check_duration,hrsp_1xx,hrsp_2xx,' 'hrsp_3xx,hrsp_4xx,hrsp_5xx,hrsp_other,hanafail,' 'req_rate,req_rate_max,req_tot,cli_abrt,srv_abrt,' '\n') with contextlib.nested( mock.patch.object(self.driver, '_get_state_file_path'), mock.patch('socket.socket'), mock.patch('os.path.exists'), ) as (gsp, socket, path_exists): gsp.side_effect = lambda x, y, z: '/pool/' + y path_exists.return_value = True socket.return_value = socket socket.recv.return_value = raw_stats exp_stats = {'connection_errors': '0', 'active_connections': '3', 'current_sessions': '3', 'bytes_in': '7764', 'max_connections': '4', 'max_sessions': '4', 'bytes_out': '2365', 'response_errors': '0', 'total_sessions': '10', 'total_connections': '10', 'members': { '32a6c2a3-420a-44c3-955d-86bd2fc6871e': { 'status': 'ACTIVE', 'health': 'L7OK', 'failed_checks': '0' }, 'd9aea044-8867-4e80-9875-16fb808fa0f9': { 'status': 'INACTIVE', 'health': 'L4CON', 'failed_checks': '9' } } } stats = self.driver.get_stats('pool_id') self.assertEqual(exp_stats, stats) socket.recv.return_value = raw_stats_empty self.assertEqual({'members': {}}, self.driver.get_stats('pool_id')) path_exists.return_value = False socket.reset_mock() self.assertEqual({}, self.driver.get_stats('pool_id')) self.assertFalse(socket.called) def test_plug(self): test_port = {'id': 'port_id', 'network_id': 'net_id', 'mac_address': 'mac_addr', 'fixed_ips': [{'ip_address': '10.0.0.2', 'subnet': {'cidr': '10.0.0.0/24', 'gateway_ip': '10.0.0.1'}}]} with contextlib.nested( mock.patch('neutron.agent.linux.ip_lib.device_exists'), mock.patch('netaddr.IPNetwork'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper'), ) as (dev_exists, ip_net, ip_wrap): self.vif_driver.get_device_name.return_value = 'test_interface' dev_exists.return_value = False ip_net.return_value = ip_net ip_net.prefixlen = 24 self.driver._plug('test_ns', test_port) self.rpc_mock.plug_vip_port.assert_called_once_with( test_port['id']) self.assertTrue(dev_exists.called) self.vif_driver.plug.assert_called_once_with('net_id', 'port_id', 'test_interface', 'mac_addr', namespace='test_ns') self.vif_driver.init_l3.assert_called_once_with( 'test_interface', ['10.0.0.2/24'], namespace='test_ns' ) cmd = ['route', 'add', 'default', 'gw', '10.0.0.1'] cmd_arping = ['arping', '-U', '-I', 'test_interface', '-c', self.conf.haproxy.send_gratuitous_arp, '10.0.0.2'] ip_wrap.assert_has_calls([ mock.call('sudo_test', namespace='test_ns'), mock.call().netns.execute(cmd, check_exit_code=False), mock.call().netns.execute(cmd_arping, check_exit_code=False), ]) dev_exists.return_value = True self.assertRaises(exceptions.PreexistingDeviceFailure, self.driver._plug, 'test_ns', test_port, False) def test_plug_not_send_gratuitous_arp(self): self.conf.haproxy.send_gratuitous_arp = 0 test_port = {'id': 'port_id', 'network_id': 'net_id', 'mac_address': 'mac_addr', 'fixed_ips': [{'ip_address': '10.0.0.2', 'subnet': {'cidr': '10.0.0.0/24', 'gateway_ip': '10.0.0.1'}}]} with contextlib.nested( mock.patch('neutron.agent.linux.ip_lib.device_exists'), mock.patch('netaddr.IPNetwork'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper'), ) as (dev_exists, ip_net, ip_wrap): self.vif_driver.get_device_name.return_value = 'test_interface' dev_exists.return_value = False ip_net.return_value = ip_net ip_net.prefixlen = 24 self.driver._plug('test_ns', test_port) cmd = ['route', 'add', 'default', 'gw', '10.0.0.1'] expected = [ mock.call('sudo_test', namespace='test_ns'), mock.call().netns.execute(cmd, check_exit_code=False)] self.assertEqual(expected, ip_wrap.mock_calls) def test_plug_no_gw(self): test_port = {'id': 'port_id', 'network_id': 'net_id', 'mac_address': 'mac_addr', 'fixed_ips': [{'ip_address': '10.0.0.2', 'subnet': {'cidr': '10.0.0.0/24'}}]} with contextlib.nested( mock.patch('neutron.agent.linux.ip_lib.device_exists'), mock.patch('netaddr.IPNetwork'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper'), ) as (dev_exists, ip_net, ip_wrap): self.vif_driver.get_device_name.return_value = 'test_interface' dev_exists.return_value = False ip_net.return_value = ip_net ip_net.prefixlen = 24 self.driver._plug('test_ns', test_port) self.rpc_mock.plug_vip_port.assert_called_once_with( test_port['id']) self.assertTrue(dev_exists.called) self.vif_driver.plug.assert_called_once_with('net_id', 'port_id', 'test_interface', 'mac_addr', namespace='test_ns') self.vif_driver.init_l3.assert_called_once_with( 'test_interface', ['10.0.0.2/24'], namespace='test_ns' ) self.assertFalse(ip_wrap.called) dev_exists.return_value = True self.assertRaises(exceptions.PreexistingDeviceFailure, self.driver._plug, 'test_ns', test_port, False) def test_plug_gw_in_host_routes(self): test_port = {'id': 'port_id', 'network_id': 'net_id', 'mac_address': 'mac_addr', 'fixed_ips': [{'ip_address': '10.0.0.2', 'subnet': {'cidr': '10.0.0.0/24', 'host_routes': [{'destination': '0.0.0.0/0', 'nexthop': '10.0.0.1'}]}}]} with contextlib.nested( mock.patch('neutron.agent.linux.ip_lib.device_exists'), mock.patch('netaddr.IPNetwork'), mock.patch('neutron.agent.linux.ip_lib.IPWrapper'), ) as (dev_exists, ip_net, ip_wrap): self.vif_driver.get_device_name.return_value = 'test_interface' dev_exists.return_value = False ip_net.return_value = ip_net ip_net.prefixlen = 24 self.driver._plug('test_ns', test_port) self.rpc_mock.plug_vip_port.assert_called_once_with( test_port['id']) self.assertTrue(dev_exists.called) self.vif_driver.plug.assert_called_once_with('net_id', 'port_id', 'test_interface', 'mac_addr', namespace='test_ns') self.vif_driver.init_l3.assert_called_once_with( 'test_interface', ['10.0.0.2/24'], namespace='test_ns' ) cmd = ['route', 'add', 'default', 'gw', '10.0.0.1'] ip_wrap.assert_has_calls([ mock.call('sudo_test', namespace='test_ns'), mock.call().netns.execute(cmd, check_exit_code=False), ]) def test_unplug(self): self.vif_driver.get_device_name.return_value = 'test_interface' self.driver._unplug('test_ns', 'port_id') self.rpc_mock.unplug_vip_port.assert_called_once_with('port_id') self.vif_driver.unplug('test_interface', namespace='test_ns') def test_kill_pids_in_file(self): with contextlib.nested( mock.patch('os.path.exists'), mock.patch('__builtin__.open'), mock.patch('neutron.agent.linux.utils.execute'), mock.patch.object(namespace_driver.LOG, 'exception'), ) as (path_exists, mock_open, mock_execute, mock_log): file_mock = mock.MagicMock() mock_open.return_value = file_mock file_mock.__enter__.return_value = file_mock file_mock.__iter__.return_value = iter(['123']) path_exists.return_value = False namespace_driver.kill_pids_in_file('sudo_test', 'test_path') path_exists.assert_called_once_with('test_path') self.assertFalse(mock_open.called) self.assertFalse(mock_execute.called) path_exists.return_value = True mock_execute.side_effect = RuntimeError namespace_driver.kill_pids_in_file('sudo_test', 'test_path') self.assertTrue(mock_log.called) mock_execute.assert_called_once_with( ['kill', '-9', '123'], 'sudo_test') def test_get_state_file_path(self): with mock.patch('os.makedirs') as mkdir: path = self.driver._get_state_file_path('pool_id', 'conf') self.assertEqual('/the/path/pool_id/conf', path) mkdir.assert_called_once_with('/the/path/pool_id', 0o755) def test_deploy_instance(self): with mock.patch.object(self.driver, 'exists') as exists: with mock.patch.object(self.driver, 'update') as update: self.driver.deploy_instance(self.fake_config) exists.assert_called_once_with(self.fake_config['pool']['id']) update.assert_called_once_with(self.fake_config) def test_deploy_instance_non_existing(self): with mock.patch.object(self.driver, 'exists') as exists: with mock.patch.object(self.driver, 'create') as create: exists.return_value = False self.driver.deploy_instance(self.fake_config) exists.assert_called_once_with(self.fake_config['pool']['id']) create.assert_called_once_with(self.fake_config) def test_deploy_instance_vip_status_non_active(self): with mock.patch.object(self.driver, 'exists') as exists: self.fake_config['vip']['status'] = 'NON_ACTIVE' self.driver.deploy_instance(self.fake_config) self.assertFalse(exists.called) def test_deploy_instance_vip_admin_state_down(self): with mock.patch.object(self.driver, 'exists') as exists: self.fake_config['vip']['admin_state_up'] = False self.driver.deploy_instance(self.fake_config) self.assertFalse(exists.called) def test_deploy_instance_no_vip(self): with mock.patch.object(self.driver, 'exists') as exists: del self.fake_config['vip'] self.driver.deploy_instance(self.fake_config) self.assertFalse(exists.called) def test_deploy_instance_pool_status_non_active(self): with mock.patch.object(self.driver, 'exists') as exists: self.fake_config['pool']['status'] = 'NON_ACTIVE' self.driver.deploy_instance(self.fake_config) self.assertFalse(exists.called) def test_deploy_instance_pool_admin_state_down(self): with mock.patch.object(self.driver, 'exists') as exists: self.fake_config['pool']['admin_state_up'] = False self.driver.deploy_instance(self.fake_config) self.assertFalse(exists.called) def test_refresh_device(self): with mock.patch.object(self.driver, 'deploy_instance') as deploy: pool_id = 'pool_id1' self.driver._refresh_device(pool_id) self.rpc_mock.get_logical_device.assert_called_once_with(pool_id) deploy.assert_called_once_with( self.rpc_mock.get_logical_device.return_value) def test_create_vip(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.create_vip({'pool_id': '1'}) refresh.assert_called_once_with('1') def test_update_vip(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.update_vip({}, {'pool_id': '1'}) refresh.assert_called_once_with('1') def test_delete_vip(self): with mock.patch.object(self.driver, 'undeploy_instance') as undeploy: self.driver.delete_vip({'pool_id': '1'}) undeploy.assert_called_once_with('1') def test_create_pool(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.create_pool({'id': '1'}) self.assertFalse(refresh.called) def test_update_pool(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.update_pool({}, {'id': '1'}) refresh.assert_called_once_with('1') def test_delete_pool_existing(self): with mock.patch.object(self.driver, 'undeploy_instance') as undeploy: with mock.patch.object(self.driver, 'exists') as exists: exists.return_value = True self.driver.delete_pool({'id': '1'}) undeploy.assert_called_once_with('1') def test_delete_pool_non_existing(self): with mock.patch.object(self.driver, 'undeploy_instance') as undeploy: with mock.patch.object(self.driver, 'exists') as exists: exists.return_value = False self.driver.delete_pool({'id': '1'}) self.assertFalse(undeploy.called) def test_create_member(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.create_member({'pool_id': '1'}) refresh.assert_called_once_with('1') def test_update_member(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.update_member({}, {'pool_id': '1'}) refresh.assert_called_once_with('1') def test_delete_member(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.delete_member({'pool_id': '1'}) refresh.assert_called_once_with('1') def test_create_pool_health_monitor(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.create_pool_health_monitor('', '1') refresh.assert_called_once_with('1') def test_update_pool_health_monitor(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.update_pool_health_monitor('', '', '1') refresh.assert_called_once_with('1') def test_delete_pool_health_monitor(self): with mock.patch.object(self.driver, '_refresh_device') as refresh: self.driver.delete_pool_health_monitor('', '1') refresh.assert_called_once_with('1')
apache-2.0
1,644,482,578,730,479,000
45.149091
79
0.528879
false
amwelch-oss/RedditStats
tests/tests.py
1
8961
import unittest from mock import Mock import random import string import arrow import redditstats.connect as connect import redditstats.subreddit as subreddit import redditstats.comments as comments import redditstats.stats as stats from collections import namedtuple class ConnectionTests(unittest.TestCase): MAX_UA_LEN = 4096 def test_user_agent(self): ''' Tests that we properly construct the user-agent string. ''' #Given test_config_fields = [ ("VERSION", "1.0"), ("NAME", "FOO"), ("DESCRIPTION", "THIS IS A THING"), ("REDDIT_USER", "BAR") ] MockedConfigContainer = namedtuple('config', [x[0] for x in test_config_fields]) mocked_config = MockedConfigContainer(*[x[1] for x in test_config_fields]) #When ua = connect.form_user_agent(config_object = mocked_config) #Then for field in test_config_fields: self.assertTrue(field[1] in ua) self.assertTrue(len(ua) < self.MAX_UA_LEN) class CommentTests(unittest.TestCase): def test_get_comment_info(self): ''' Tests that given a comment object returns a dict with stats about it ''' #Given mocked_comment = Mock() mocked_comment.author = 'foo' mocked_comment.ups = 3 mocked_comment.downs = 1 mocked_comment.created = 123.0 #When info = comments.get_comment_info(mocked_comment) #then self.assertEquals(info['author'], mocked_comment.author) self.assertEquals(info['score'], mocked_comment.ups - mocked_comment.downs) self.assertEquals(info['ts'], mocked_comment.created) def test_get_submission_comment_summary(self): ''' Tests the simple case that given a submission object with comments get_submission_comment_summary correctly returns a dict summarizing the comments in a submission ''' #Given sub_id = 'baz' true_values = {} mocked_submission = Mock() mocked_submission.replace_more_comments.return_value = None mocked_submission.id = sub_id true_values[sub_id] = {} true_values[sub_id]['count'] = 0 true_values[sub_id]['score'] = 0 true_values[sub_id]['total_len'] = 0 mocked_comments = [] for a in ['foo', 'bar']: for i in range(random.randint(0,10)): ups = random.randint(0,100) downs = random.randint(0,10) created = random.randint(0,10000) body = ''.join(random.choice(string.ascii_uppercase + string.digits) for _ in range(random.randint(1,200))) true_values[sub_id]['count'] += 1 true_values[sub_id]['score'] += ups - downs true_values[sub_id]['total_len'] += len(body) comment = Mock() comment.author = a comment.ups = ups comment.downs = downs comment.created = created comment.body = body mocked_comments.append(comment) mocked_submission.comments = mocked_comments #When summary = comments.get_submission_comment_summary(mocked_submission) #Then self.assertEquals(summary, true_values) def test_get_user_comment_summary(self): ''' Tests the simple case that given a submission object with comments get_user_comment_summary correctly returns a dict of user activity ''' #Given true_values = {} mocked_submission = Mock() mocked_submission.replace_more_comments.return_value = None mocked_comments = [] for a in ['foo', 'bar']: true_values[a] = {} true_values[a]['count'] = 0 true_values[a]['score'] = 0 true_values[a]['total_len'] = 0 for i in range(random.randint(0,10)): ups = random.randint(0,100) downs = random.randint(0,10) created = random.randint(0,10000) body = ''.join(random.choice(string.ascii_uppercase + string.digits) for _ in range(random.randint(1,200))) true_values[a]['count'] += 1 true_values[a]['score'] += ups - downs true_values[a]['total_len'] += len(body) comment = Mock() comment.author = a comment.ups = ups comment.downs = downs comment.created = created comment.body = body mocked_comments.append(comment) mocked_submission.comments = mocked_comments #When summary = comments.get_user_comment_summary(mocked_submission) #Then self.assertEquals(summary, true_values) class SubredditTests(unittest.TestCase): def test_get_submission_by_date(self): ''' Given a list of submissions tests that get_submission_by_date returns only the submissions in the given interval ''' #Given mocked_submissions = [] interval_start = arrow.get('2015-02-05 00:00') interval_end = interval_start.replace(hours=24) generated_dates_start = interval_start.replace(hours=-24) generated_dates_end = interval_end.replace(hours=24) generated_dates = generated_dates_start.range('hour', generated_dates_start, end=generated_dates_end) interval_dates = interval_start.range('hour', interval_start, end=interval_end) for date in generated_dates: submission = Mock() submission.created = date.format('X') mocked_submissions.append(submission) conn = Mock() conn.get_subreddit.return_value = Mock() conn.get_subreddit.return_value.get_new.return_value = mocked_submissions end_str = interval_end.strftime('%Y-%m-%d %H:%M') start_str = interval_start.strftime('%Y-%m-%d %H:%M') #When submissions = subreddit.get_submission_by_date(conn, 'foo', end = end_str, start=start_str) #Then self.assertEquals(len(submissions), len(interval_dates)) def test_get_subreddit(self): ''' Tests that get_subreddit makes the correct call to praw ''' #Given conn = Mock() conn.get_subreddit.return_value = True #When ret = subreddit.get_subreddit(conn, 'foo') #Then self.assertTrue(ret) def test_get_posts(self): ''' Tests that get_posts makes the correct call to praw ''' #Given conn = Mock() conn.get_subreddit.return_value = Mock() conn.get_subreddit.return_value.get_new.return_value = True #When ret = subreddit.get_posts(conn, 'foo') #Then self.assertTrue(ret) def test_get_posts_summary(self): ''' Simple test to ensure that get_posts_summary correctly aggregates the stats ''' #Given title ='test_post' sub_id = 'baz' true_values = {} mocked_submission = Mock() mocked_submission.replace_more_comments.return_value = None mocked_submission.id = sub_id mocked_submission.title = title true_values[sub_id] = {} true_values[sub_id]['count'] = 0 true_values[sub_id]['score'] = 0 true_values[sub_id]['total_len'] = 0 true_values[sub_id]['title'] = title mocked_comments = [] for a in ['foo', 'bar']: for i in range(random.randint(0,10)): ups = random.randint(0,100) downs = random.randint(0,10) created = random.randint(0,10000) body = ''.join(random.choice(string.ascii_uppercase + string.digits) for _ in range(random.randint(1,200))) true_values[sub_id]['count'] += 1 true_values[sub_id]['score'] += ups - downs true_values[sub_id]['total_len'] += len(body) comment = Mock() comment.author = a comment.ups = ups comment.downs = downs comment.created = created comment.body = body mocked_comments.append(comment) mocked_submission.comments = mocked_comments conn = Mock() mocked_subreddit = Mock() mocked_subreddit.get_new.return_value = [mocked_submission] conn.get_subreddit.return_value = mocked_subreddit true_df = stats.convert_stats_to_dataframe(true_values) #When df = subreddit.get_posts_summary(conn, 'foo') #Then self.assertTrue((true_df.values == df.values).all()) if __name__ == '__main__': unittest.main()
mit
5,476,614,130,928,023,000
31.70438
123
0.567571
false
joebullard/slack-doorbell-camera
main.py
1
2043
import argparse import sys import time from doorbell import SlackDoorbell from ringer import FaceDetectionDoorbellRinger from visionapi import VisionAPIClient def parse_args(argv): parser = argparse.ArgumentParser() parser.add_argument( '--motion-output-dir', required=True, type=str, help='Path to the motion daemon output directory' ) parser.add_argument( '--webhook-url', required=True, type=str, help='Slack Incoming Webhook URL' ) parser.add_argument( '--json-keyfile', required=False, default=None, type=str, help='Path to a Google Cloud service account credentials JSON' ) parser.add_argument( '--stream-addr', required=False, default=None, type=str, help='IP address of webcam stream' ) parser.add_argument( '--sleep-secs', required=False, default=1.0, type=float, help='Number of seconds to sleep between image polling' ) parser.add_argument( '--min-confidence', required=False, default=0.50, type=float, help='Minimum detection confidence threshold of face detection' ) parser.add_argument( '--timeout-secs', required=False, default=20, type=float, help='Number of seconds to wait before ringing again') parser.add_argument( '--verbose', required=False, action='store_true', help='If True, print update of every single detection iteration' ) return parser.parse_args(argv) def main(argv): args = parse_args(argv) vision = VisionAPIClient(args.json_keyfile) doorbell = SlackDoorbell(args.webhook_url, args.stream_addr) ringer = FaceDetectionDoorbellRinger(vision, doorbell, args.min_confidence, args.timeout_secs, verbose=args.verbose) ringer.run(args.motion_output_dir, args.sleep_secs) if __name__ == '__main__': main(sys.argv[1:])
gpl-3.0
-4,388,402,259,583,009,300
26.608108
72
0.619677
false
periscope-ps/unis
periscope/handlers/datahandler.py
1
4785
# ============================================================================= # periscope-ps (unis) # # Copyright (c) 2012-2016, Trustees of Indiana University, # All rights reserved. # # This software may be modified and distributed under the terms of the BSD # license. See the COPYING file for details. # # This software was created at the Indiana University Center for Research in # Extreme Scale Technologies (CREST). # ============================================================================= #!/usr/bin/env python import json import functools import tornado.web from urllib.parse import urlparse,urlunparse import periscope.settings as settings from periscope.db import dumps_mongo, DBLayer from periscope.settings import MIME from periscope.handlers.networkresourcehandler import NetworkResourceHandler class DataHandler(NetworkResourceHandler): def _validate_request(self, res_id, allow_id = False, require_id = False): if self.accept_content_type not in self.schemas_single: message = "Schema is not defined for content of type '%s'" % \ (self.accept_content_type) self.send_error(500, message=message) return False if self._validate_psjson_profile(): return False return True def _add_post_metadata(self, resource, res_id = None): loc = urlparse(self.request.full_url())._replace(query=None, fragment=None) resource["mid"] = res_id or resource["mid"] resource["selfRef"] = loc._replace(path=f"{loc.path}/{resource['mid']}").geturl() resource["$schema"] = resource.get("$schema", self.schemas_single[MIME['PSJSON']]) return resource async def _insert(self, resources): mids = {} for resource in resources: if resource["mid"] not in mids: mids[resource["mid"]] = [] mids[resource["mid"]].extend(resource["data"]) for mid, data in mids.items(): push_data = { 'id': mid, 'data': data } self._subscriptions.publish(push_data, self._collection_name, { "action": "POST", "collection": "data/{}".format(mid) }, self.trim_published_resource) await DBLayer(self.application.db, mid, True).insert(data) async def _post_return(self, resources): return async def _return_resources(self, mid, query): resp = [] async for record in DBLayer(self.application.db, mid, True).find(query): resp.append(ObjectDict._from_mongo(record)) if len(resp) == 1: location = self.request.full_url().split('?')[0] if not location.endswith(response[0][self.Id]): location = location + "/" + response[0][self.Id] self.set_header("Location", location) return resp[0] else: return resp @tornado.web.removeslash async def get(self, res_id=None): if not res_id: self.write_error(403, message = "Data request must include a metadata id") return # Parse arguments and set up query try: parsed = await self._parse_get_arguments() options = dict(query = parsed["query"]["query"], limit = parsed["limit"], sort = parsed["sort"], skip = parsed["skip"]) if not options["limit"]: options.pop("limit", None) options["query"]["\\$status"] = { "$ne": "DELETED" } options["fields"] = { "_id": 0 } except Exception as exp: self.write_error(403, message = exp) return # we don't want to wait here since this is a direct query on the state of the collection # we could have an SSE endpoint that implemented a hanging GET, allowing more data # over the HTTP connection as it arrived query = options.pop("query") count = await DBLayer(self.application.db, res_id, True).count(query, **options) if not count: self.write('[]') return first = True async for record in DBLayer(self.application.db, res_id, True).find(query): self.write('[\n' if first else ',\n') first = False self.write(dumps_mongo(record, indent=2).replace('\\\\$', '$').replace('$DOT$', '.')) self.write('\n]') await self._add_response_headers(count) self.set_status(200) self.finish() def trim_published_resource(self, resource, fields): return {resource['id']: resource['data']}
bsd-3-clause
-5,861,323,693,186,295,000
38.221311
132
0.55674
false
NervanaSystems/ngraph
test/ref_generators/generate_convolution_ref.py
1
19772
#!/usr/bin/env python # ****************************************************************************** # Copyright 2017-2020 Intel Corporation # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ****************************************************************************** import sys import numpy as np import math import random from operator import mul # Generates an array of random floating point literals of the given length, from a fixed seed. def random_array_float_literals(length, seed=8086): literals = [] random.seed(seed) for i in range(0, length): # generate numbers that can be exactly represented in binary sig_bits = 6 range_bits = 2 literal_n = np.float32(random.randint(-pow(2, sig_bits-1), pow(2, sig_bits-1))) / pow(2.0, sig_bits - range_bits) literals.append(str(literal_n)) return literals # Elementwise addition on tuples. def tuple_plus(t1, t2): assert(len(t1) == len(t2)) res = () for (x, y) in zip(list(t1), list(t2)): res = res + (x+y,) return res # Elementwise multiplication on tuples. def tuple_times(t1, t2): assert(len(t1) == len(t2)) res = () for (x, y) in zip(list(t1), list(t2)): res = res + (x*y,) return res # # Convolution reference # # Arguments: # data_batch : [N ][Ci][D1]...[Dn], n > 0 # filter : [Co][Ci][W1]...[Wn] # move_strides = (s1,...,sn) # filter_dilation = (l1,...,ln) # below_pads = (p1,...,pn) # above_pads = (q1,...,qn) # data_dilation = (t1,...,tn) # # Returns: # output_batch : [N ][Co][D'1]...[D'n] # # Where the D's are computed according to TensorFlow-style "valid" convolution rules, but *after* padding. # See https://www.tensorflow.org/api_docs/python/tf/nn/convolution. # def convolution_ref(data_batch, filter, move_strides, filter_dilation, below_pads, above_pads, data_dilation): assert(len(data_batch.shape) == len(filter.shape)) assert(len(data_batch.shape) > 2) assert(len(data_batch.shape) <= 6) assert(data_batch.shape[1] == filter.shape[1]) assert(len(move_strides) == len(data_batch.shape) - 2) assert(len(filter_dilation) == len(data_batch.shape) - 2) assert(len(data_dilation) == len(data_batch.shape) - 2) # dilate the input batch new_item_shape = (np.array(data_batch.shape[2:]) - 1) * data_dilation + 1 new_data_batch_shape = list( np.array(data_batch.shape[:2])) + list(new_item_shape) new_data_batch = np.zeros(new_data_batch_shape) for n in range(0, new_data_batch_shape[0]): for c in range(0, new_data_batch_shape[1]): if new_data_batch.ndim == 3: new_data_batch[n, c, 0::data_dilation[0]] = data_batch[n][c] elif new_data_batch.ndim == 4: new_data_batch[n, c, 0::data_dilation[0], 0::data_dilation[1]] = data_batch[n][c] elif new_data_batch.ndim == 5: new_data_batch[n, c, 0::data_dilation[0], 0::data_dilation[1], 0::data_dilation[2]] = data_batch[n][c] elif new_data_batch.ndim == 6: new_data_batch[n, c, 0::data_dilation[0], 0::data_dilation[1], 0::data_dilation[2], 0::data_dilation[3]] = data_batch[n][c] else: assert(False) data_batch = new_data_batch # Pad the input batch wherever the pads are positive. # Have to add values for the spatial and channel dims. below_pads_pos = (0, 0) + tuple(np.clip(below_pads, 0, None)) # Have to add values for the spatial and channel dims. above_pads_pos = (0, 0) + tuple(np.clip(above_pads, 0, None)) data_batch = np.pad(data_batch, list( zip(below_pads_pos, above_pads_pos)), mode='constant', constant_values=0) # Slice the input batch wherever the pads are negative. slice_bottoms = (0, 0) + tuple(-np.clip(below_pads, None, 0)) slice_tops = (0, 0) + tuple(np.clip(above_pads, None, 0)) slices = list(map(lambda p: slice( p[0], p[1] if p[1] < 0 else None), zip(slice_bottoms, slice_tops))) data_batch = data_batch[tuple(slices)] item_count = data_batch.shape[0] # N ci_count = data_batch.shape[1] # Ci co_count = filter.shape[0] # Co input_item_shape = list(data_batch.shape[2:]) # D1, ..., Dn window_virtual_shape = list(filter.shape[2:]) # W1, ..., Wn # This is not used in computation but we will calculate it for a check to make sure the window fits. window_physical_shape = [] for (d_in, d_virt, dil) in zip(input_item_shape, window_virtual_shape, filter_dilation): d_phys = (d_virt - 1) * dil + 1 assert(d_phys <= d_in) window_physical_shape.append(d_phys) output_item_shape = [] # D'1,...,D'n for (d_in, d_win, dil, mov) in zip(input_item_shape, window_virtual_shape, filter_dilation, move_strides): # Formula is taken from TF's definition for VALID convolution. d_out = int( math.ceil((float(d_in) - (float(d_win) - 1.0) * float(dil))/float(mov))) assert(d_out > 0) output_item_shape.append(d_out) output_shape = [item_count, co_count]+output_item_shape # N,Co,D'1,...,D'n output_batch = np.zeros(output_shape) # Walk over the output batch space. output_it = np.nditer(output_batch, flags=['multi_index']) while not output_it.finished: # Break up the output coordinate to figure out where we are in terms of batch index, output channel, and spatial position. output_index = output_it.multi_index item, co, output_pos = output_index[0], output_index[1], output_index[2:] # Walk over the filter for the current output channel. filter_it = np.nditer(filter[co], flags=['multi_index']) while not filter_it.finished: # Break up the filter coordinate to figure out where we are in terms of input channel and filter shape position. filter_index = filter_it.multi_index ci, filter_pos = filter_index[0], filter_index[1:] # Build up the coordinate within the space N,Ci,D1,...,Dn that we need to read from in the input batch. input_index = (item, ci) + (tuple_plus(tuple_times(output_pos, move_strides), tuple_times(filter_pos, filter_dilation))) # Add to the sum-of-products. output_batch[output_index] = output_batch[output_index] + \ filter[(co,) + filter_index] * data_batch[input_index] filter_it.iternext() output_it.iternext() return output_batch def shape_str(shape): result = '' first = True for d in shape: if first: result = ('%d' % d) first = False else: result = result + (',%d' % d) return result def scalar_str(x): result = ('%.1000g' % x) # This next part is a bit stupid. if "." not in result and "e" not in result: result = result + ".0f" else: result = "%.8ff" % float(result) return result def data_str(data): result = '' first = True for x in np.nditer(data): if first: result = scalar_str(x) first = False else: result = result + ',' + scalar_str(x) return result def shape_size(shape): result = 1 for l in shape: result = result * l return result def emit_test(t, f): test_name, input_batch_shape, filters_shape, move_strides, filter_dilation, below_pads, above_pads, data_dilation, bprop = t input_batch_literals = random_array_float_literals( shape_size(input_batch_shape)) filters_literals = random_array_float_literals(shape_size(filters_shape)) input_batch_array = np.array( list(map(lambda s: np.float32(s), input_batch_literals))) input_batch_array.shape = input_batch_shape filters_array = np.array( list(map(lambda s: np.float32(s), filters_literals))) filters_array.shape = filters_shape print("Generating convolution test '%s'..." % test_name) output_batch_data = convolution_ref( input_batch_array, filters_array, move_strides, filter_dilation, below_pads, above_pads, data_dilation) template = ''' // !!!!!!!!!!!!!! THIS FILE IS AUTOGENERATED OUTSIDE OF THE BUILD PROCESS !!!!!!!!!!!!!! // !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! DO NOT EDIT THIS FILE !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! // // DO NOT EDIT THIS FILE. If you want to add new tests, you should edit // test/ref_generators/generate_convolution_ref.py and regenerate this file. // // !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! DO NOT EDIT THIS FILE !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! // !!!!!!!!!!!!!! THIS FILE IS AUTOGENERATED OUTSIDE OF THE BUILD PROCESS !!!!!!!!!!!!!! NGRAPH_TEST (${BACKEND_NAME}, %s) { Shape shape_a{%s}; Shape shape_b{%s}; Shape shape_r{%s}; auto make_graph = [shape_a, shape_b] { auto A = make_shared<op::v0::Parameter>(element::f32, shape_a); auto B = make_shared<op::v0::Parameter>(element::f32, shape_b); return make_shared<Function>(make_shared<op::v0::Convolution>(A, B, Strides{%s}, // move_strides Strides{%s}, // filter_dilation CoordinateDiff{%s}, // below_pads CoordinateDiff{%s}, // above_pads Strides{%s}), // data_dilation ParameterVector{A, B}); }; auto backend = runtime::Backend::create("${BACKEND_NAME}"); auto function = make_graph(); // Create some tensors for input/output auto a = backend->create_tensor(element::f32, shape_a); copy_data(a, vector<float>{%s}); auto b = backend->create_tensor(element::f32, shape_b); copy_data(b, vector<float>{%s}); auto result = backend->create_tensor(element::f32, shape_r); vector<float> expected_result{%s}; auto handle = backend->compile(function); handle->call_with_validate({result}, {a, b}); EXPECT_TRUE(test::all_close_f(vector<float>{expected_result}, read_vector<float>(result), tolerance)); // only test backprop for certain cases as it takes significant compute resources %sEXPECT_TRUE(autodiff_numeric_compare<float>(backend.get(), make_graph, {a, b}, .01f, .01f)); } ''' f.write(template % (test_name, shape_str(input_batch_shape), shape_str(filters_shape), shape_str(output_batch_data.shape), shape_str(move_strides), shape_str(filter_dilation), shape_str(below_pads), shape_str(above_pads), shape_str(data_dilation), ",".join(map(lambda s: "%.8ff" % float(s), input_batch_literals)), ",".join(map(lambda s: "%.8ff" % float(s), filters_literals)), data_str(output_batch_data), bprop)) # filter data # test name skip list i batch shape filts shape stride dilation below-pads above-pads dilation bprop? tests = [ ("convolution_2d_1item", (1, 1, 3, 5), (2, 1, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (1, 1), ""), ("convolution_2d_1item_padded_1_1x1_1", (1, 1, 3, 5), (2, 1, 2, 2), (1, 1), (1, 1), (1, 1), (1, 1), (1, 1), ""), ("convolution_2d_1item_padded_2_3x4_5", (1, 1, 3, 5), (2, 1, 2, 2), (1, 1), (1, 1), (2, 3), (4, 5), (1, 1), ""), ("convolution_2d_2items", (2, 1, 3, 5), (2, 1, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (1, 1), ""), ("convolution_2d_2items_strided", (2, 1, 3, 5), (2, 1, 2, 2), (2, 2), (1, 1), (0, 0), (0, 0), (1, 1), ""), ("convolution_2d_2items_strided_padded", (2, 1, 3, 5), (2, 1, 2, 2), (2, 2), (1, 1), (4, 2), (5, 7), (1, 1), ""), ("convolution_2d_2items_strided_padded_same", (2, 1, 3, 5), (2, 1, 2, 2), (2, 2), (1, 1), (2, 2), (2, 2), (1, 1), ""), ("convolution_2d_2items_dilated", (2, 1, 3, 5), (2, 1, 2, 2), (1, 1), (2, 2), (0, 0), (0, 0), (1, 1), ""), ("convolution_2d_2items_dilated_padded", (2, 1, 3, 5), (2, 1, 2, 2), (1, 1), (2, 2), (4, 2), (5, 7), (1, 1), ""), ("convolution_3d_2items", (2, 1, 3, 5, 8), (2, 1, 2, 2, 3), (1, 1, 1), (1, 1, 1), (0, 0, 0), (0, 0, 0), (1, 1, 1), ""), ("convolution_4d_2items", (2, 1, 3, 5, 8, 7), (2, 1, 2, 2, 3, 1), (1, 1, 1, 1), (1, 1, 1, 1), (0, 0, 0, 0), (0, 0, 0, 0), (1, 1, 1, 1), "// "), ("convolution_4d_4items", (4, 3, 3, 5, 8, 7), (4, 3, 2, 2, 3, 1), (1, 1, 1, 1), (1, 1, 1, 1), (0, 0, 0, 0), (0, 0, 0, 0), (1, 1, 1, 1), "// "), ("convolution_4d_4items_padded_neg", (4, 3, 3, 5, 8, 7), (4, 3, 2, 2, 3, 1), (1, 1, 1, 1), (1, 1, 1, 1), (-1, 2, -3, 2), (1, 0, 0, -3), (1, 1, 1, 1), "// "), ("convolution_4d_4items_strided", (4, 3, 3, 5, 8, 7), (4, 3, 2, 2, 3, 1), (2, 1, 3, 2), (1, 1, 1, 1), (0, 0, 0, 0), (0, 0, 0, 0), (1, 1, 1, 1), "// "), ("convolution_4d_4items_dilated", (4, 3, 3, 5, 8, 7), (4, 3, 2, 2, 3, 1), (1, 1, 1, 1), (2, 1, 3, 2), (0, 0, 0, 0), (0, 0, 0, 0), (1, 1, 1, 1), "// "), ("convolution_4d_4items_strided_dilated", (4, 3, 8, 8, 8, 8), (4, 3, 2, 2, 3, 1), (3, 2, 2, 3), (2, 1, 3, 2), (0, 0, 0, 0), (0, 0, 0, 0), (1, 1, 1, 1), "// "), ("convolution_4d_4items_strided_dilated_padded", (4, 3, 8, 8, 8, 8), (4, 3, 2, 2, 3, 1), (3, 2, 2, 3), (2, 1, 3, 2), (2, 4, 6, 8), (1, 3, 5, 7), (1, 1, 1, 1), "// "), ("convolution_4d_4items_strided_dilated_padded_neg", (4, 3, 8, 8, 8, 8), (4, 3, 2, 2, 3, 1), (3, 2, 2, 3), (2, 1, 3, 2), (-2, 4, 0, 5), (1, 3, -1, -4), (1, 1, 1, 1), "// "), ("convolution_4d_4items_strided_dilated_padded_same", (4, 3, 8, 8, 8, 8), (4, 3, 2, 2, 3, 1), (3, 2, 2, 3), (2, 1, 3, 2), (3, 3, 3, 3), (3, 3, 3, 3), (1, 1, 1, 1), "// "), ("convolution_2d_1item_1o1i_data_dilated", (1, 1, 3, 5), (1, 1, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (2, 2), ""), ("convolution_2d_1item_2o1i_data_dilated", (1, 1, 3, 5), (2, 1, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (2, 2), ""), ("convolution_2d_1item_2o2i_data_dilated", (1, 2, 3, 5), (2, 2, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (2, 2), ""), ("convolution_2d_1item_5o3i_data_dilated", (1, 3, 3, 5), (5, 3, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (2, 2), ""), ("convolution_2d_2item_5o3i_data_dilated", (2, 3, 3, 5), (5, 3, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (2, 2), ""), ("convolution_2d_8item_large_5o3i_data_dilated", (8, 3, 16, 16), (5, 3, 2, 2), (1, 1), (1, 1), (0, 0), (0, 0), (2, 2), "// "), ("convolution_2d_8item_large_5o3i_uneven_filter_data_dilated", (8, 3, 16, 16), (5, 3, 2, 3), (1, 1), (1, 1), (0, 0), (0, 0), (2, 2), "// "), ("convolution_2d_8item_large_5o3i_uneven_filter_uneven_data_dilation_data_dilated", (8, 3, 16, 16), (5, 3, 2, 3), (1, 1), (1, 1), (0, 0), (0, 0), (2, 3), "// "), ("convolution_3d_2item_large_5o3i_uneven_filter_uneven_data_dilation_data_dilated", (2, 3, 8, 8, 8), (5, 3, 2, 3, 4), (1, 1, 1), (1, 1, 1), (0, 0, 0), (0, 0, 0), (2, 3, 2), "// "), ("convolution_3d_1item_large_5o3i_padded_uneven_filter_uneven_data_dilation_data_dilated", (1, 3, 8, 8, 8), (5, 3, 2, 3, 4), (1, 1, 1), (1, 1, 1), (2, 1, 2), (1, 2, 3), (2, 3, 2), "// "), ("convolution_3d_2item_large_5o3i_padded_strided_uneven_filter_uneven_data_dilation_data_dilated", (2, 3, 8, 8, 8), (5, 3, 2, 3, 4), (2, 3, 2), (1, 1, 1), (2, 1, 2), (1, 2, 3), (2, 3, 2), "// "), ("convolution_3d_2item_large_5o3i_padded_strided_uneven_filter_uneven_data_dilation_filter_dilated_data_dilated", (2, 3, 8, 8, 8), (5, 3, 2, 3, 4), (2, 3, 2), (3, 2, 2), (2, 1, 2), (1, 2, 3), (2, 3, 2), "// "), ] def main(): assert(len(sys.argv) > 1) f = open(sys.argv[1], 'w') f.write('''//***************************************************************************** // Copyright 2017-2020 Intel Corporation // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. //***************************************************************************** // !!!!!!!!!!!!!! THIS FILE IS AUTOGENERATED OUTSIDE OF THE BUILD PROCESS !!!!!!!!!!!!!! // !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! DO NOT EDIT THIS FILE !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! // // It takes quite a while to compute the results. // // DO NOT EDIT THIS FILE. If you want to add new tests, you should edit // test/ref_generators/generate_convolution_ref.py and regenerate this file. // // To regenerate: // // $ cd <ngraph source dir>/test // $ ./update_convolution_reference.sh // // !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! DO NOT EDIT THIS FILE !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! // !!!!!!!!!!!!!! THIS FILE IS AUTOGENERATED OUTSIDE OF THE BUILD PROCESS !!!!!!!!!!!!!! // // clang-format off #include <cmath> #include "gtest/gtest.h" #include "ngraph/ngraph.hpp" #include "util/test_tools.hpp" #include "util/autodiff/numeric_compare.hpp" #include "util/all_close_f.hpp" #include "util/test_control.hpp" using namespace std; using namespace ngraph; static string s_manifest = "${MANIFEST}"; // for float this will be 18 bits matching // for bfloat this will be 6 bits matching constexpr int three_quarters_of_available_bits = (MAX_FLOAT_BITS * 3) / 4; constexpr int tolerance = FLOAT_MANTISSA_BITS - three_quarters_of_available_bits; ''') for t in tests: emit_test(t, f) f.write(''' // clang-format on ''') f.close() if __name__ == "__main__": main()
apache-2.0
1,861,128,612,188,194,300
43.133929
166
0.507789
false
hovo1990/deviser
generator/cmake_files/CMakeFiles.py
1
4088
#!/usr/bin/env python # # @file CMakeFiles.py # @brief class for generating the cmake files # @author Frank Bergmann # @author Sarah Keating # # <!-------------------------------------------------------------------------- # # Copyright (c) 2013-2015 by the California Institute of Technology # (California, USA), the European Bioinformatics Institute (EMBL-EBI, UK) # and the University of Heidelberg (Germany), with support from the National # Institutes of Health (USA) under grant R01GM070923. All rights reserved. # # Permission is hereby granted, free of charge, to any person obtaining a # copy of this software and associated documentation files (the "Software"), # to deal in the Software without restriction, including without limitation # the rights to use, copy, modify, merge, publish, distribute, sublicense, # and/or sell copies of the Software, and to permit persons to whom the # Software is furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL # THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING # FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER # DEALINGS IN THE SOFTWARE. # # Neither the name of the California Institute of Technology (Caltech), nor # of the European Bioinformatics Institute (EMBL-EBI), nor of the University # of Heidelberg, nor the names of any contributors, may be used to endorse # or promote products derived from this software without specific prior # written permission. # ------------------------------------------------------------------------ --> import os from util import global_variables from . import PackageFile from . import RegisterFile from . import BaseCMakeFiles class CMakeFiles(): """Class for all cmake files""" def __init__(self, pkg_object, this_dir, verbose=False): self.verbose = verbose self.this_dir = this_dir # # members from object self.package = pkg_object['name'] self.language = global_variables.language self.elements = pkg_object['baseElements'] self.plugins = pkg_object['plugins'] ######################################################################### def write_package_files(self): name = '{0}-package'.format(self.package) ext = PackageFile.PackageFile(name, self.package, False) if self.verbose: print('Writing file {0}'.format(ext.fileout.filename)) ext.write_file() ext.close_file() os.chdir('src') ext = PackageFile.PackageFile(name, self.package, True) if self.verbose: print('Writing file {0}'.format(ext.fileout.filename)) ext.write_file() ext.close_file() os.chdir(self.this_dir) def write_register_files(self): name = '{0}-register'.format(self.package) ext = RegisterFile.RegisterFile(name, self.package, False) if self.verbose: print('Writing file {0}'.format(ext.fileout.filename)) ext.write_file() ext.close_file() ext = RegisterFile.RegisterFile(name, self.package, True) if self.verbose: print('Writing file {0}'.format(ext.fileout.filename)) ext.write_file() ext.close_file() ######################################################################## def write_files(self): self.write_package_files() os.chdir('src/{0}/packages'.format(self.language)) self.write_register_files() os.chdir(self.this_dir) def write_other_library_files(self): os.chdir(self.this_dir) cmake = BaseCMakeFiles.BaseCMakeFiles(self.verbose) cmake.write_files()
lgpl-2.1
-6,793,863,203,549,932,000
38.699029
78
0.640411
false
magenta/magenta
magenta/pipelines/statistics.py
1
8973
# Copyright 2021 The Magenta Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Defines statistics objects for pipelines.""" import abc import bisect import copy import tensorflow.compat.v1 as tf class MergeStatisticsError(Exception): pass class Statistic(object): """Holds statistics about a Pipeline run. Pipelines produce statistics on each call to `transform`. `Statistic` objects can be merged together to aggregate statistics over the course of many calls to `transform`. A `Statistic` also has a string name which is used during merging. Any two `Statistic` instances with the same name may be merged together. The name should also be informative about what the `Statistic` is measuring. Names do not need to be unique globally (outside of the `Pipeline` objects that produce them) because a `Pipeline` that returns statistics will prepend its own name, effectively creating a namespace for each `Pipeline`. """ __metaclass__ = abc.ABCMeta def __init__(self, name): """Constructs a `Statistic`. Subclass constructors are expected to call this constructor. Args: name: The string name for this `Statistic`. Any two `Statistic` objects with the same name will be merged together. The name should also describe what this Statistic is measuring. """ self.name = name @abc.abstractmethod def _merge_from(self, other): """Merge another Statistic into this instance. Takes another Statistic of the same type, and merges its information into this instance. Args: other: Another Statistic instance. """ pass @abc.abstractmethod def _pretty_print(self, name): """Return a string representation of this instance using the given name. Returns a human readable and nicely presented representation of this instance. Since this instance does not know what it's measuring, a string name is given to use in the string representation. For example, if this Statistic held a count, say 5, and the given name was 'error_count', then the string representation might be 'error_count: 5'. Args: name: A string name for this instance. Returns: A human readable and preferably a nicely presented string representation of this instance. """ pass @abc.abstractmethod def copy(self): """Returns a new copy of `self`.""" pass def merge_from(self, other): if not isinstance(other, Statistic): raise MergeStatisticsError( 'Cannot merge with non-Statistic of type %s' % type(other)) if self.name != other.name: raise MergeStatisticsError( 'Name "%s" does not match this name "%s"' % (other.name, self.name)) self._merge_from(other) def __str__(self): return self._pretty_print(self.name) def merge_statistics(stats_list): """Merge together Statistics of the same name in the given list. Any two Statistics in the list with the same name will be merged into a single Statistic using the `merge_from` method. Args: stats_list: A list of `Statistic` objects. Returns: A list of merged Statistics. Each name will appear only once. """ name_map = {} for stat in stats_list: if stat.name in name_map: name_map[stat.name].merge_from(stat) else: name_map[stat.name] = stat return list(name_map.values()) def log_statistics_list(stats_list, logger_fn=tf.logging.info): """Calls the given logger function on each `Statistic` in the list. Args: stats_list: A list of `Statistic` objects. logger_fn: The function which will be called on the string representation of each `Statistic`. """ for stat in sorted(stats_list, key=lambda s: s.name): logger_fn(str(stat)) class Counter(Statistic): """Represents a count of occurrences of events or objects. `Counter` can help debug Pipeline computations. For example, by counting objects (consumed, produced, etc...) by the Pipeline, or occurrences of certain cases in the Pipeline. """ def __init__(self, name, start_value=0): """Constructs a Counter. Args: name: String name of this counter. start_value: What value to start the count at. """ super(Counter, self).__init__(name) self.count = start_value def increment(self, inc=1): """Increment the count. Args: inc: (defaults to 1) How much to increment the count by. """ self.count += inc def _merge_from(self, other): """Adds the count of another Counter into this instance.""" if not isinstance(other, Counter): raise MergeStatisticsError( 'Cannot merge %s into Counter' % other.__class__.__name__) self.count += other.count def _pretty_print(self, name): return '%s: %d' % (name, self.count) def copy(self): return copy.copy(self) class Histogram(Statistic): """Represents a histogram of real-valued events. A histogram is a list of counts, each over a range of values. For example, given this list of values [0.5, 0.0, 1.0, 0.6, 1.5, 2.4, 0.1], a histogram over 3 ranges [0, 1), [1, 2), [2, 3) would be: [0, 1): 4 [1, 2): 2 [2, 3): 1 Each range is inclusive in the lower bound and exclusive in the upper bound (hence the square open bracket but curved close bracket). Usage examples: A distribution over input/output lengths. A distribution over compute times. """ def __init__(self, name, buckets, verbose_pretty_print=False): """Initializes the histogram with the given ranges. Args: name: String name of this histogram. buckets: The ranges the histogram counts over. This is a list of values, where each value is the inclusive lower bound of the range. An extra range will be implicitly defined which spans from negative infinity to the lowest given lower bound. The highest given lower bound defines a range spaning to positive infinity. This way any value will be included in the histogram counts. For example, if `buckets` is [4, 6, 10] the histogram will have ranges [-inf, 4), [4, 6), [6, 10), [10, inf). verbose_pretty_print: If True, self.pretty_print will print the count for every bucket. If False, only buckets with positive counts will be printed. """ super(Histogram, self).__init__(name) # List of inclusive lowest values in each bucket. self.buckets = [float('-inf')] + sorted(set(buckets)) self.counters = dict((bucket_lower, 0) for bucket_lower in self.buckets) self.verbose_pretty_print = verbose_pretty_print # https://docs.python.org/2/library/bisect.html#searching-sorted-lists def _find_le(self, x): """Find rightmost bucket less than or equal to x.""" i = bisect.bisect_right(self.buckets, x) if i: return self.buckets[i-1] raise ValueError def increment(self, value, inc=1): """Increment the bucket containing the given value. The bucket count for which ever range `value` falls in will be incremented. Args: value: Any number. inc: An integer. How much to increment the bucket count by. """ bucket_lower = self._find_le(value) self.counters[bucket_lower] += inc def _merge_from(self, other): """Adds the counts of another Histogram into this instance. `other` must have the same buckets as this instance. The counts from `other` are added to the counts for this instance. Args: other: Another Histogram instance with the same buckets as this instance. Raises: MergeStatisticsError: If `other` is not a Histogram or the buckets are not the same. """ if not isinstance(other, Histogram): raise MergeStatisticsError( 'Cannot merge %s into Histogram' % other.__class__.__name__) if self.buckets != other.buckets: raise MergeStatisticsError( 'Histogram buckets do not match. Expected %s, got %s' % (self.buckets, other.buckets)) for bucket_lower, count in other.counters.items(): self.counters[bucket_lower] += count def _pretty_print(self, name): b = self.buckets + [float('inf')] return ('%s:\n' % name) + '\n'.join( [' [%s,%s): %d' % (lower, b[i+1], self.counters[lower]) for i, lower in enumerate(self.buckets) if self.verbose_pretty_print or self.counters[lower]]) def copy(self): return copy.copy(self)
apache-2.0
4,317,756,786,415,895,600
31.988971
79
0.678034
false
ryos36/polyphony-tutorial
Tutorial_1/root_2.py
1
1177
from polyphony import testbench shift_n = 30 def round(x): return x def abs(x): if x < 0 : return -x else: return x def i_mul_floor(x, y): tmp = x * y return tmp >> shift_n def i_mul_ceil(x, y): tmp = x * y d = tmp & (1 << shift_n - 1) tmp >>= shift_n if d : tmp += 1 return tmp def i_square(x): return i_mul_floor(x, x) def i_root(x): if x == 0 : return 0 epsilon = 1 numGuesses = 0 new_x = x << shift_n low_n = 0 if new_x > (1 << shift_n): high_n = new_x else: high_n = (1 << shift_n) ans = (low_n + high_n) >> 1 old_ans = 0 while (abs(i_square(ans) - new_x)) >= epsilon: print("low = ", low_n , " high = ", high_n, " ans = ", ans) if old_ans == ans : break numGuesses += 1 if (i_square(ans) < new_x): low_n = ans else: high_n = ans old_ans = ans ans = (low_n + high_n) >> 1 return ans @testbench def test(): x = 25 result = i_root(x) print(result) x = 2 result = i_root(x) print(result) test()
mit
3,411,647,756,418,904,600
15.577465
67
0.451147
false
arielalmendral/ert
python/tests/core/ecl/test_faults.py
1
25965
#!/usr/bin/env python # Copyright (C) 2014 Statoil ASA, Norway. # # The file 'test_faults.py' is part of ERT - Ensemble based Reservoir Tool. # # ERT is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ERT is distributed in the hope that it will be useful, but WITHOUT ANY # WARRANTY; without even the implied warranty of MERCHANTABILITY or # FITNESS FOR A PARTICULAR PURPOSE. # # See the GNU General Public License at <http://www.gnu.org/licenses/gpl.html> # for more details. from unittest import skipIf import time from ert import util from ert.ecl.faults import FaultCollection, Fault, FaultLine, FaultSegment,FaultBlockLayer from ert.ecl import EclGrid, EclKW, EclTypeEnum from ert.test import ExtendedTestCase, TestAreaContext from ert.geo import Polyline , CPolyline class FaultTest(ExtendedTestCase): @classmethod def setUpClass(cls): cls.grid = EclGrid.create_rectangular( (151,100,50) , (1,1,1)) def setUp(self): self.faults1 = self.createTestPath("local/ECLIPSE/FAULTS/fault1.grdecl") self.faults2 = self.createTestPath("local/ECLIPSE/FAULTS/fault2.grdecl") def test_PolylineIJ(self): nx = 10 ny = 10 nz = 10 grid = EclGrid.create_rectangular( (nx,ny,nz) , (0.1,0.1,0.1)) f = Fault(grid , "F") f.addRecord(0 , 1 , 0 , 0 , 0,0 , "Y-") f.addRecord(2 , 2 , 0 , 1 , 0,0 , "X-") f.addRecord(2 , 2 , 1 , 1 , 0,0 , "Y") pl = f.getIJPolyline( 0 ) self.assertEqual(pl , [(0,0) , (2,0) , (2,2) , (3,2)]) def test_empty_collection(self): faults = FaultCollection() self.assertEqual(0 , len(faults)) self.assertFalse( faults.hasFault("FX") ) with self.assertRaises(TypeError): f = faults[ [] ] with self.assertRaises(KeyError): f = faults["FX"] with self.assertRaises(IndexError): f = faults[0] self.assertFalse( "NAME" in faults ) def test_collection_invalid_arg(self): with self.assertRaises(ValueError): faults = FaultCollection(self.faults1) with self.assertRaises(ValueError): faults = FaultCollection(self.faults1 , self.faults2) def test_splitLine(self): faults = FaultCollection(self.grid) with self.assertRaises(ValueError): # Not slash terminated t = faults.splitLine("'F1' 149 149 29 29 1 43 'Y'") with self.assertRaises(ValueError): # Not integer t = faults.splitLine("'F1' 149 149 29 29 1 43X 'Y' /") with self.assertRaises(ValueError): # Missing item t = faults.splitLine("'F1' 149 29 29 1 43 'Y' /") with self.assertRaises(ValueError): # Quote fuckup t = faults.splitLine("'F1 149 149 29 29 1 43 'X' /") def test_empty_fault( self ): f = Fault(self.grid , "NAME") self.assertEqual("NAME" , f.getName()) with self.assertRaises(Exception): g = f["Key"] def test_empty_faultLine(self): fl = FaultLine(self.grid , 10) self.assertEqual( 10 , fl.getK()) self.assertEqual( 0 , len(fl) ) with self.assertRaises(TypeError): f = fl[ "Test" ] with self.assertRaises(IndexError): f = fl[0] def test_faultLine_center(self): nx = 10 ny = 10 nz = 2 grid = EclGrid.create_rectangular( (nx,ny,nz) , (0.1,0.1,0.1)) fl = FaultLine(grid , 0) C1 = (nx + 1) * 5 + 3 C2 = C1 + 2 C3 = C2 + 2 s1 = FaultSegment( C1 , C2 ) s2 = FaultSegment( C2 , C3 ) fl.tryAppend( s1 ) fl.tryAppend( s2 ) self.assertEqual( len(fl) , 2 ) self.assertEqual( fl.center() , (0.50 , 0.50) ) def test_faultLine(self): fl = FaultLine(self.grid , 10) S1 = FaultSegment(0 , 10) S2 = FaultSegment(10 , 20) fl.tryAppend( S1 ) fl.tryAppend( S2 ) fl.verify() S3 = FaultSegment(20 , 30) fl.tryAppend( S3 ) fl.verify() #--- fl = FaultLine(self.grid , 10) S1 = FaultSegment(0 , 10) S2 = FaultSegment(20 , 10) fl.tryAppend( S1 ) self.assertTrue( fl.tryAppend( S2 ) ) fl.verify() #--- fl = FaultLine(self.grid , 10) S1 = FaultSegment(10 , 0) S2 = FaultSegment(20 , 10) fl.tryAppend( S1 ) fl.tryAppend( S2 ) fl.verify() #--- fl = FaultLine(self.grid , 10) S1 = FaultSegment(10 , 0) S2 = FaultSegment(10 , 20) fl.tryAppend( S1 ) fl.tryAppend( S2 ) fl.verify() fl = FaultLine(self.grid , 10) S1 = FaultSegment(10 , 0) S2 = FaultSegment(10 , 20) fl.tryAppend( S1 ) fl.tryAppend( S2 ) S3 = FaultSegment(40 , 30) self.assertTrue( fl.tryAppend(S3) == False ) self.assertEqual( len(fl) , 2 ) pl = fl.getPolyline( ) self.assertIsInstance( pl , CPolyline ) self.assertEqual( len(pl) , len(fl) + 1 ) S3 = FaultSegment(20 , 30) fl.tryAppend( S3 ) pl = fl.getPolyline( ) self.assertIsInstance( pl , CPolyline ) self.assertEqual( len(pl) , len(fl) + 1 ) def test_load(self): faults = FaultCollection(self.grid , self.faults1) self.assertEqual( 3 , len(faults)) faults.load( self.grid , self.faults2 ) self.assertEqual( 7 , len(faults)) fault1 = faults["F1"] layer8 = fault1[8] self.assertEqual( len(layer8) , 1 ) with self.assertRaises(IOError): faults.load(self.grid , "No/this/does/not/exist") def test_connect_faults(self): grid = EclGrid.create_rectangular( (100,100,10) , (1,1,1)) # Fault1 Fault4 # | | # | | # | | # | ------- Fault2 | # | | # | | # # -------- Fault3 # fault1 = Fault(grid , "Fault1") fault2 = Fault(grid , "Fault2") fault3 = Fault(grid , "Fault3") fault4 = Fault(grid , "Fault4") fault1.addRecord(1 , 1 , 10 , grid.getNY() - 1 , 0 , 0 , "X") fault2.addRecord(5 , 10 , 15 , 15 , 0 , 0 , "Y") fault3.addRecord(5 , 10 , 5 , 5 , 0 , 0 , "Y") fault4.addRecord(20 , 20 , 10 , grid.getNY() - 1 , 0 , 0 , "X") for other_fault in [fault2 , fault3,fault4]: with self.assertRaises(ValueError): fault1.extendToFault( other_fault ,0) with self.assertRaises(ValueError): fault2.extendToFault( fault3 , 0) for other_fault in [fault1 , fault2,fault4]: with self.assertRaises(ValueError): fault3.extendToFault( other_fault ,0 ) for other_fault in [fault1 , fault2,fault3]: with self.assertRaises(ValueError): fault4.extendToFault( other_fault , 0) ext21 = fault2.extendToFault( fault1 , 0) self.assertEqual(len(ext21) , 2) p0 = ext21[0] p1 = ext21[1] self.assertEqual(p0 , (5 , 16)) self.assertEqual(p1 , (2 , 16)) ext24 = fault2.extendToFault( fault4,0 ) self.assertEqual(len(ext24) , 2) p0 = ext24[0] p1 = ext24[1] self.assertEqual(p0 , (11 , 16)) self.assertEqual(p1 , (21 , 16)) def test_intersect_intRays(self): p1 = (0,0) dir1 = (1,0) p2 = (0,0) dir2 = (0,1) line = Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) self.assertEqual( line , [] ) # Opposite direction p3 = (-1,0) dir3 = (-1,0) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p3,dir3)) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p3,dir3),(p1,dir1)) # Parallell with offset p4 = (0,1) dir4 = (1,0) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p4,dir4)) p5 = (0,1) dir5 = (-1,0) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p5,dir5)) p6 = (1,1) dir6 = (1,0) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p6,dir6)) p2 = (-1,0) dir2 = (-1,0) join = Fault.intersectFaultRays(( p2,dir1),(p1,dir2)) self.assertEqual( join , [p2 , p1]) join = Fault.intersectFaultRays(( p1,dir3),(p3,dir1)) self.assertEqual( join , [p1 , p3]) p2 = (1,0) dir2 = (1,0) join = Fault.intersectFaultRays(( p1,dir1),(p2,dir2)) self.assertEqual( join , [p1 , p2]) # Orthogonal p2 = (1,1) dir2 = (0,1) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) p2 = (0,1) dir2 = (0,1) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) p2 = (-1,0) dir2 = (0,1) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) p2 = (-1,1) dir2 = (0,1) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) p2 = (-1,1) dir2 = (0,-1) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) p2 = (3,-1) dir2 = (0,-1) with self.assertRaises(ValueError): Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) p2 = (1,-1) dir2 = (0,1) join = Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) self.assertEqual(join , [p1 , (1,0) , p2]) p2 = (1,1) dir2 = (0,-1) join = Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) self.assertEqual(join , [p1 , (1,0) , p2]) p2 = (0,3) dir2 = (0,-1) join = Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) self.assertEqual(join , [p1 , p2]) p2 = (3,0) dir2 = (0,-1) join = Fault.intersectFaultRays(( p1,dir1),(p2,dir2 )) self.assertEqual(join , [p1 , p2]) def test_join_faults(self): grid = EclGrid.create_rectangular( (100,100,10) , (1,1,1)) # Fault1 Fault4 # | | # | | # | | # | ------- Fault2 | # | | # | | # # -------- Fault3 # fault1 = Fault(grid , "Fault1") fault2 = Fault(grid , "Fault2") fault3 = Fault(grid , "Fault3") fault4 = Fault(grid , "Fault4") fault1.addRecord(1 , 1 , 10 , grid.getNY() - 1 , 0 , 0 , "X") fault2.addRecord(5 , 10 , 15 , 15 , 0 , 0 , "Y") fault3.addRecord(5 , 10 , 5 , 5 , 0 , 0 , "Y") fault4.addRecord(20 , 20 , 10 , grid.getNY() - 1 , 0 , 0 , "X") rays = fault1.getEndRays(0) self.assertEqual( rays[0] , [(2,10) , (0,-1)]) self.assertEqual( rays[1] , [(2,100) , (0,1)]) extra = Fault.joinFaults( fault1 , fault3 , 0) self.assertEqual( extra , [(2,10) , (2,6) , (5,6)] ) def test_contact(self): grid = EclGrid.create_rectangular( (100,100,10) , (1,1,1)) # Fault1 Fault4 # | | # | | # | | # | ----------------------+-- Fault2 # | | # | | # # -------- Fault3 # fault1 = Fault(grid , "Fault1") fault2 = Fault(grid , "Fault2") fault3 = Fault(grid , "Fault3") fault4 = Fault(grid , "Fault4") fault1.addRecord(1 , 1 , 10 , grid.getNY() - 1 , 0 , 0 , "X") fault2.addRecord(5 , 30 , 15 , 15 , 0 , 0 , "Y") fault3.addRecord(2 , 10 , 9 , 9 , 0 , 0 , "Y") fault4.addRecord(20 , 20 , 10 , grid.getNY() - 1 , 0 , 0 , "X") #self.assertFalse( fault1.intersectsFault(fault2 , 0) ) #self.assertFalse( fault2.intersectsFault(fault1 , 0) ) #self.assertTrue( fault2.intersectsFault(fault4 , 0) ) #self.assertTrue( fault4.intersectsFault(fault2 , 0) ) self.assertTrue( fault1.intersectsFault(fault1 , 0) ) #self.assertTrue( fault3.intersectsFault(fault3 , 0) ) def test_iter(self): faults = FaultCollection(self.grid , self.faults1 , self.faults2) self.assertEqual( 7 , len(faults)) c = 0 for f in faults: c += 1 self.assertEqual( c , len(faults)) for f in ["F1","F2","F3" ,"F4"]: self.assertTrue( f in faults ) self.assertFalse("FX" in faults ) def test_fault(self): f = Fault(self.grid , "NAME") with self.assertRaises(ValueError): # Invalid face f.addRecord( 10 , 10 , 11 , 11 , 1 , 43 , "F") with self.assertRaises(ValueError): # Invalid coordinates f.addRecord( -1 , 10 , 11 , 11 , 1 , 43 , "X") with self.assertRaises(ValueError): # Invalid coordinates f.addRecord( 10000 , 10 , 11 , 11 , 1 , 43 , "X") with self.assertRaises(ValueError): # Invalid coordinates f.addRecord( 10 , 9 , 11 , 11 , 1 , 43 , "X") with self.assertRaises(ValueError): # Invalid coordinates f.addRecord( 10 , 9 , 11 , 11 , 1 , 43 , "X") with self.assertRaises(ValueError): # Invalid coordinates/face combination f.addRecord( 10 , 11 , 11 , 11 , 1 , 43 , "X") with self.assertRaises(ValueError): # Invalid coordinates/face combination f.addRecord( 10 , 11 , 11 , 12 , 1 , 43 , "Y") f.addRecord(10 , 10 , 0 , 10 , 1 , 10 , "X") def test_segment(self ): s0 = FaultSegment(0 , 10) self.assertEqual(s0.getC1() , 0 ) self.assertEqual(s0.getC2() , 10 ) s0.swap() self.assertEqual(s0.getC1() , 10 ) self.assertEqual(s0.getC2() , 0 ) def test_fault_line(self ): faults = FaultCollection(self.grid , self.faults1 , self.faults2) for fault in faults: for layer in fault: for fl in layer: fl.verify() def test_fault_line_order(self): nx = 120 ny = 60 nz = 43 grid = EclGrid.create_rectangular( (nx , ny , nz) , (1,1,1) ) with TestAreaContext("python/faults/line_order"): with open("faults.grdecl" , "w") as f: f.write("""FAULTS \'F\' 105 107 50 50 1 43 \'Y\' / \'F\' 108 108 50 50 1 43 \'X\' / \'F\' 108 108 50 50 22 43 \'Y\' / \'F\' 109 109 49 49 1 43 \'Y\' / \'F\' 110 110 49 49 1 43 \'X\' / \'F\' 111 111 48 48 1 43 \'Y\' / / """) faults = FaultCollection( grid , "faults.grdecl" ) fault = faults["F"] layer = fault[29] self.assertEqual(len(layer) , 2) line1 = layer[0] line2 = layer[1] self.assertEqual(len(line1) , 4) self.assertEqual(len(line2) , 2) seg0 = line1[0] seg1 = line1[1] seg2 = line1[2] seg3 = line1[3] self.assertEqual( seg0.getCorners() , (50 * (nx + 1) + 104 , 50 * (nx + 1) + 107)) self.assertEqual( seg1.getCorners() , (50 * (nx + 1) + 107 , 50 * (nx + 1) + 108)) self.assertEqual( seg2.getCorners() , (50 * (nx + 1) + 108 , 49 * (nx + 1) + 108)) self.assertEqual( seg3.getCorners() , (49 * (nx + 1) + 108 , 49 * (nx + 1) + 109)) def test_neighbour_cells(self): nx = 10 ny = 8 nz = 7 grid = EclGrid.create_rectangular( (nx , ny , nz) , (1,1,1) ) faults_file = self.createTestPath("local/ECLIPSE/FAULTS/faults_nb.grdecl") faults = FaultCollection( grid , faults_file ) fault = faults["FY"] self.assertEqual(len(fault),1) fault_layer = fault[0] fl1 = fault_layer[0] nb_cells1 = fl1.getNeighborCells() true_nb_cells1 = [(0, nx) , (1,nx + 1), (2,nx+2) , (3,nx + 3) , (4,nx+4)] self.assertListEqual( nb_cells1 , true_nb_cells1 ) fl2 = fault_layer[1] nb_cells2 = fl2.getNeighborCells() true_nb_cells2 = [(6, nx+6) , (7,nx + 7), (8 , nx+8) , (9,nx + 9)] self.assertListEqual( nb_cells2 , true_nb_cells2 ) nb_cells = fault_layer.getNeighborCells() self.assertListEqual( nb_cells , true_nb_cells1 + true_nb_cells2) fault = faults["FY0"] fault_layer = fault[0] fl1 = fault_layer[0] nb_cells1 = fl1.getNeighborCells() true_nb_cells1 = [(-1,0) , (-1,1), (-1,2)] self.assertListEqual( nb_cells1 , true_nb_cells1 ) fault = faults["FYNY"] fault_layer = fault[0] fl1 = fault_layer[0] nb_cells1 = fl1.getNeighborCells() true_nb_cells1 = [(nx * (ny - 1) , -1), (nx * (ny - 1) + 1 , -1), (nx * (ny - 1) + 2, -1)] self.assertListEqual( nb_cells1 , true_nb_cells1 ) fault = faults["FX"] fault_layer = fault[0] fl1 = fault_layer[0] nb_cells1 = fl1.getNeighborCells() true_nb_cells1 = [(0,1) , (nx , nx+1) , (2*nx , 2*nx + 1)] self.assertListEqual( nb_cells1 , true_nb_cells1 ) fault = faults["FX0"] fault_layer = fault[0] fl1 = fault_layer[0] nb_cells1 = fl1.getNeighborCells() true_nb_cells1 = [(-1 , 0) , (-1 , nx) , (-1 , 2*nx)] self.assertListEqual( nb_cells1 , true_nb_cells1 ) fault = faults["FXNX"] fault_layer = fault[0] fl1 = fault_layer[0] nb_cells1 = fl1.getNeighborCells() true_nb_cells1 = [(nx -1 , -1) , (2*nx -1 , -1) , (3*nx - 1 , -1)] self.assertListEqual( nb_cells1 , true_nb_cells1 ) def test_polyline_intersection(self): grid = EclGrid.create_rectangular( (100,100,10) , (0.25 , 0.25 , 1)) # Fault1 Fault4 # | | # | | # | | # | ------- Fault2 | # | | # | | # (5 , 2.50) # -------- Fault3 # fault1 = Fault(grid , "Fault1") fault2 = Fault(grid , "Fault2") fault3 = Fault(grid , "Fault3") fault4 = Fault(grid , "Fault4") fault1.addRecord(1 , 1 , 10 , grid.getNY() - 1 , 0 , 0 , "X") fault2.addRecord(5 , 10 , 15 , 15 , 0 , 0 , "Y") fault3.addRecord(5 , 10 , 5 , 5 , 0 , 0 , "Y") fault4.addRecord(20 , 20 , 10 , grid.getNY() - 1 , 0 , 0 , "X") polyline = Polyline( init_points = [(4 , 4) , (8,4)]) self.assertTrue( fault4.intersectsPolyline( polyline , 0)) cpolyline = CPolyline( init_points = [(4 , 4) , (8,4)]) self.assertTrue( fault4.intersectsPolyline( cpolyline , 0)) polyline = Polyline( init_points = [(8 , 4) , (16,4)]) self.assertFalse( fault4.intersectsPolyline( polyline , 0)) cpolyline = CPolyline( init_points = [(8 , 4) , (16,4)]) self.assertFalse( fault4.intersectsPolyline( cpolyline , 0)) def test_num_linesegment(self): nx = 10 ny = 10 nz = 1 grid = EclGrid.create_rectangular( (nx , ny , nz) , (1,1,1) ) with TestAreaContext("python/faults/line_order"): with open("faults.grdecl" , "w") as f: f.write("""FAULTS \'F1\' 1 4 2 2 1 1 \'Y\' / \'F1\' 6 8 2 2 1 1 \'Y\' / \'F2\' 1 8 2 2 1 1 \'Y\' / / """) faults = FaultCollection( grid , "faults.grdecl" ) f1 = faults["F1"] f2 = faults["F2"] self.assertEqual( 2 , f1.numLines(0)) self.assertEqual( 1 , f2.numLines(0)) def test_extend_to_polyline(self): grid = EclGrid.create_rectangular( (3,3,1) , (1 , 1 , 1)) # o o o o # # o---o---o---o # # o===+ o o # | # o o o o fault1 = Fault(grid , "Fault") fault1.addRecord(0 , 0 , 0 , 0 , 0 , 0 , "X-") fault1.addRecord(0 , 0 , 0 , 0 , 0 , 0 , "Y") polyline = CPolyline( init_points = [(0,2) , (3,2)]) points = fault1.extendToPolyline( polyline , 0 ) self.assertEqual( points , [(1,1) , (2,2)]) end_join = fault1.endJoin( polyline , 0 ) self.assertEqual( end_join, [(1,1) , (0,2)] ) polyline2 = CPolyline( init_points = [(0.8,2) , (0.8,0.8)]) end_join = fault1.endJoin( polyline2 , 0 ) self.assertIsNone( end_join ) def test_extend_polyline_on(self): grid = EclGrid.create_rectangular( (3,3,1) , (1 , 1 , 1)) # o o o o # # o---o---o---o # # o===o===o===o # # o o o o fault1 = Fault(grid , "Fault") fault1.addRecord(0 , 2 , 0 , 0 , 0 , 0 , "Y") polyline0 = CPolyline( init_points = [(0,2)]) polyline1 = CPolyline( init_points = [(0,2) , (3,2)]) polyline2 = CPolyline( init_points = [(1,3) , (1,2)]) polyline3 = CPolyline( init_points = [(1,3) , (1,0)]) with self.assertRaises(ValueError): fault1.extendPolylineOnto( polyline0 , 0 ) points = fault1.extendPolylineOnto( polyline1 , 0 ) self.assertIsNone( points ) points = fault1.extendPolylineOnto( polyline2 , 0) self.assertEqual( points , [(1,2) , (1,1)]) points = fault1.extendPolylineOnto( polyline3 , 0) self.assertIsNone( points ) def test_stepped(self): grid = EclGrid.create_rectangular( (6,1,4) , (1,1,1)) f = Fault(grid , "F") f.addRecord(4,4,0,0,0,1,"X") f.addRecord(2,2,0,0,1,1,"Z") f.addRecord(1,1,0,0,2,3,"X") block_kw = EclKW.create("FAULTBLK" , grid.getGlobalSize() , EclTypeEnum.ECL_INT_TYPE) block_kw.assign(1) block_kw[5] = 2 block_kw[11] = 2 block_kw[14:18] = 2 block_kw[14:18] = 2 block_kw[20:23] = 2 layer0 = FaultBlockLayer( grid , 0 ) layer0.scanKeyword( block_kw ) layer0.addFaultBarrier( f ) self.assertTrue( layer0.cellContact((0,0) , (1,0))) self.assertFalse( layer0.cellContact((4,0) , (5,0))) layer1 = FaultBlockLayer( grid , 1 ) layer1.scanKeyword( block_kw ) layer1.addFaultBarrier( f ) self.assertTrue( layer1.cellContact((0,0) , (1,0))) self.assertFalse( layer1.cellContact((4,0) , (5,0))) layer2 = FaultBlockLayer( grid , 2 ) layer2.scanKeyword( block_kw ) layer2.addFaultBarrier( f ) self.assertTrue( layer2.cellContact((0,0) , (1,0))) self.assertFalse( layer2.cellContact((1,0) , (2,0))) layer3 = FaultBlockLayer( grid , 3 ) layer3.scanKeyword( block_kw ) layer3.addFaultBarrier( f ) self.assertTrue( layer3.cellContact((0,0) , (1,0))) self.assertFalse( layer3.cellContact((1,0) , (2,0))) def test_connectWithPolyline(self): grid = EclGrid.create_rectangular( (4,4,1) , (1 , 1 , 1)) # o o o o o # # o o o o o # # o---o---o---o---o # # o o o o o # | # o o o o o fault1 = Fault(grid , "Fault1") fault1.addRecord(0 , 3 , 1 , 1 , 0 , 0 , "Y") fault2 = Fault(grid , "Fault2") fault2.addRecord(1 , 1 , 0 , 0 , 0 , 0 , "X") fault3 = Fault(grid , "Fault3") fault3.addRecord(1 , 1 , 0 , 2 , 0 , 0 , "X") self.assertIsNone( fault3.connect( fault1 , 0 )) intersect = fault2.connect( fault1 , 0 ) self.assertEqual( len(intersect) , 2 ) p1 = intersect[0] p2 = intersect[1] self.assertEqual( p1 , (2,1)) self.assertEqual( p2 , (2,2))
gpl-3.0
8,771,375,853,594,739,000
31.619347
98
0.479684
false
llazzaro/packyou
packyou/py2.py
1
10645
# -*- coding: utf-8 -*- import imp import ipdb import logging from sys import modules, meta_path from os import mkdir from os.path import ( isdir, abspath, dirname, exists, join, ) import encodings.idna import requests from git import Repo from packyou import find_module_path_in_cloned_repos from packyou.utils import walklevel, memoize MODULES_PATH = dirname(abspath(__file__)) LOGGER = logging.getLogger(__name__) class GithubLoader(object): """ Import hook that will allow to import from a github repo. """ def __init__(self, repo_url=None, path=None, username=None, repository_name=None): self.path = path self.repo_url = repo_url self.username = username self.repository_name = repository_name def check_root(self, fullname): """ #Sometimes the code is a python package or similar and there is a directory #which contains all the code. This method is used to search first on the root of the cloned repository for the imported module. """ parent, _, module_name = fullname.rpartition('.') if self.username and self.repository_name: # REVISAR QUE PASE TODOS LOS PATHS cloned_root = join(self.path[0], 'github', self.username, self.repository_name) candidate_path = join(cloned_root, module_name) if exists(candidate_path): return candidate_path for root, dirs, files in walklevel(cloned_root, level=1): pass def get_source(self, fullname): filename = self.get_filename(fullname) with open(filename, 'r') as source_file: return source_file.read() def get_code(self, fullname): source = self.get_source(fullname) return compile(source, self.get_filename(fullname), 'exec', dont_inherit=True) def get_filename(self, fullname): parent, _, current_module = fullname.rpartition('.') filename = None LOGGER.debug('Fullname {0} self.path {1}'.format(fullname, self.path)) for path in self.path: package_path = join(path, '__init__.py') if exists(package_path): filename = package_path module_path = '{0}.py'.format(join(path, current_module)) if exists(module_path): filename = module_path LOGGER.debug('get_filename({0}) is {1}'.format(fullname, filename)) return filename def is_package(self, fullname): filename = self.get_filename(fullname) return not exists(filename) or isdir(filename) def get_or_create_module(self, fullname): """ Given a name and a path it will return a module instance if found. When the module could not be found it will raise ImportError """ LOGGER.info('Loading module {0}'.format(fullname)) parent, _, module_name = fullname.rpartition('.') if fullname in modules: LOGGER.info('Found cache entry for {0}'.format(fullname)) return modules[fullname] module = modules.setdefault(fullname, imp.new_module(fullname)) if len(fullname.strip('.')) > 3: absolute_from_root = fullname.split('.', 3)[-1] modules.setdefault(absolute_from_root, module) if len(fullname.split('.')) == 4: # add the root of the project modules[fullname.split('.')[-1]] = module # required by PEP 302 module.__file__ = self.get_filename(fullname) LOGGER.info('Created module {0} with fullname {1}'.format(self.get_filename(fullname), fullname)) module.__name__ = fullname module.__loader__ = self module.__path__ = self.path if self.is_package(fullname): module.__path__ = self.path module.__package__ = fullname else: module.__package__ = fullname.rpartition('.')[0] LOGGER.debug('loading file {0}'.format(self.get_filename(fullname))) source = self.get_source(fullname) try: exec(source, module.__dict__) except Exception as ex: ipdb.set_trace() return module def clone_github_repo(self): """ Clones a github repo with a username and repository_name """ if not (self.username and self.repository_name): return repository_local_destination = join(MODULES_PATH, 'github', self.username, self.repository_name) if not exists(repository_local_destination): Repo.clone_from(self.repo_url, repository_local_destination, branch='master') init_filename = join(repository_local_destination, '__init__.py') open(init_filename, 'a').close() @property def project_fullname(self): return 'packyou.github.{0}.{1}'.format(self.username, self.repository_name) def load_module(self, fullname): """ Given a name it will load the module from github. When the project is not locally stored it will clone the repo from github. """ module = None splitted_names = fullname.split('.') _, _, module_name = fullname.rpartition('.') _, remaining = find_module_path_in_cloned_repos(fullname) if 'github' in splitted_names and not remaining: self.clone_github_repo() if len(splitted_names) == 2: module = self.get_or_create_module(fullname) if len(splitted_names) == 3: username_directory = join(MODULES_PATH, 'github', self.username) if not exists(username_directory): mkdir(username_directory) username_init_filename = join(MODULES_PATH, 'github', self.username, '__init__.py') open(username_init_filename, 'a').close() module = self.get_or_create_module(fullname) if len(splitted_names) >= 4: module = self.get_or_create_module(fullname) elif self.username and self.repository_name: # relative import from project root. fullname = 'packyou.github.{0}.{1}.{2}'.format(self.username, self.repository_name, remaining) module = self.get_or_create_module(fullname) if module: modules[fullname] = module if remaining is not None: modules[remaining] = module return module class GithubFinder(object): def __init__(self): self.username = None self.repository_name = None @memoize def check_repository_available(self, username, repository_name): """ Sometimes github has a - in the username or repository name. The - can't be used in the import statement. """ repo_url = 'https://github.com/{0}/{1}.git'.format(username, repository_name) response = requests.get(repo_url) if response.status_code == 404: if '_' in username: repo_url = 'https://github.com/{0}/{1}.git'.format(username.replace('_', '-'), repository_name) response = requests.get(repo_url) if response.status_code == 200: return repo_url if '_' in repository_name: repo_url = 'https://github.com/{0}/{1}.git'.format(username, repository_name.replace('_', '-')) response = requests.get(repo_url) if response.status_code == 200: return repo_url repo_url = 'https://github.com/{0}/{1}.git'.format(username.replace('_', '-'), repository_name.replace('_', '-')) response = requests.get(repo_url) if response.status_code == 200: return repo_url raise ImportError('Github repository not found.') return repo_url def find_module_in_cloned_repos(self, fullname): return find_module_in_cloned_repos(fullname, GithubLoader) def find_module(self, fullname, path=None): """ Finds a module and returns a module loader when the import uses packyou """ LOGGER.info('Finding {0}'.format(fullname)) partent, _, module_name = fullname.rpartition('.') path, _ = find_module_path_in_cloned_repos(fullname) LOGGER.debug('FOUND PATH {0}'.format(path)) try: # sometimes the project imported from github does an # "import x" (absolute import), this translates to import github...x # we try first to do an import x and cache the module in the sys.path. # and return None if the imp.find_module was successful. # This will allow python finders in the meta_path to do the import, and not packyou # loaders. if not path: imp.find_module(module_name) LOGGER.info('Absolute import: {0}. Original fullname {1}'.format(module_name, fullname)) return None except ImportError: LOGGER.debug('imp.find_module could not find {0}. this is ussually fine.'.format(module_name)) if 'packyou.github' in fullname: fullname_parts = fullname.split('.') repo_url = None if len(fullname_parts) >= 3: self.username = fullname.split('.')[2] if len(fullname_parts) >= 4: if not self.repository_name: LOGGER.debug('FULLNAME -> {0} '.format(fullname)) self.repository_name = fullname.split('.')[3] repo_url = self.check_repository_available(self.username, self.repository_name) current_path = dirname(abspath(__file__)) repo_path = join(current_path, 'github', self.username, self.repository_name) if repo_path not in path: path.insert(0, repo_path) LOGGER.info('Found {0} with path {1}'.format(fullname, path)) return GithubLoader(repo_url, path, self.username, self.repository_name) elif self.username and self.repository_name and path: LOGGER.info('Fullname {0} does not start with packyou, searching in cloned repos. Result was {1}'.format(fullname, path)) repo_url = self.check_repository_available(self.username, self.repository_name) return GithubLoader(repo_url, path, self.username, self.repository_name) LOGGER.info('Not found -> {0}'.format(fullname)) meta_path.append(GithubFinder())
mit
-2,669,128,757,194,921,500
40.745098
133
0.589854
false
parapente/beets
beetsplug/fetchart.py
1
25044
# -*- coding: utf-8 -*- # This file is part of beets. # Copyright 2016, Adrian Sampson. # # Permission is hereby granted, free of charge, to any person obtaining # a copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, # distribute, sublicense, and/or sell copies of the Software, and to # permit persons to whom the Software is furnished to do so, subject to # the following conditions: # # The above copyright notice and this permission notice shall be # included in all copies or substantial portions of the Software. """Fetches album art. """ from __future__ import (division, absolute_import, print_function, unicode_literals) from contextlib import closing import os import re from tempfile import NamedTemporaryFile import requests from beets import plugins from beets import importer from beets import ui from beets import util from beets import config from beets.util.artresizer import ArtResizer try: import itunes HAVE_ITUNES = True except ImportError: HAVE_ITUNES = False IMAGE_EXTENSIONS = ['png', 'jpg', 'jpeg'] CONTENT_TYPES = ('image/jpeg', 'image/png') DOWNLOAD_EXTENSION = '.jpg' CANDIDATE_BAD = 0 CANDIDATE_EXACT = 1 CANDIDATE_DOWNSCALE = 2 def _logged_get(log, *args, **kwargs): """Like `requests.get`, but logs the effective URL to the specified `log` at the `DEBUG` level. Use the optional `message` parameter to specify what to log before the URL. By default, the string is "getting URL". Also sets the User-Agent header to indicate beets. """ # Use some arguments with the `send` call but most with the # `Request` construction. This is a cheap, magic-filled way to # emulate `requests.get` or, more pertinently, # `requests.Session.request`. req_kwargs = kwargs send_kwargs = {} for arg in ('stream', 'verify', 'proxies', 'cert', 'timeout'): if arg in kwargs: send_kwargs[arg] = req_kwargs.pop(arg) # Our special logging message parameter. if 'message' in kwargs: message = kwargs.pop('message') else: message = 'getting URL' req = requests.Request(b'GET', *args, **req_kwargs) with requests.Session() as s: s.headers = {b'User-Agent': b'beets'} prepped = s.prepare_request(req) log.debug('{}: {}', message, prepped.url) return s.send(prepped, **send_kwargs) class RequestMixin(object): """Adds a Requests wrapper to the class that uses the logger, which must be named `self._log`. """ def request(self, *args, **kwargs): """Like `requests.get`, but uses the logger `self._log`. See also `_logged_get`. """ return _logged_get(self._log, *args, **kwargs) # ART SOURCES ################################################################ class ArtSource(RequestMixin): def __init__(self, log, config): self._log = log self._config = config def get(self, album): raise NotImplementedError() class CoverArtArchive(ArtSource): """Cover Art Archive""" URL = 'http://coverartarchive.org/release/{mbid}/front' GROUP_URL = 'http://coverartarchive.org/release-group/{mbid}/front' def get(self, album): """Return the Cover Art Archive and Cover Art Archive release group URLs using album MusicBrainz release ID and release group ID. """ if album.mb_albumid: yield self.URL.format(mbid=album.mb_albumid) if album.mb_releasegroupid: yield self.GROUP_URL.format(mbid=album.mb_releasegroupid) class Amazon(ArtSource): URL = 'http://images.amazon.com/images/P/%s.%02i.LZZZZZZZ.jpg' INDICES = (1, 2) def get(self, album): """Generate URLs using Amazon ID (ASIN) string. """ if album.asin: for index in self.INDICES: yield self.URL % (album.asin, index) class AlbumArtOrg(ArtSource): """AlbumArt.org scraper""" URL = 'http://www.albumart.org/index_detail.php' PAT = r'href\s*=\s*"([^>"]*)"[^>]*title\s*=\s*"View larger image"' def get(self, album): """Return art URL from AlbumArt.org using album ASIN. """ if not album.asin: return # Get the page from albumart.org. try: resp = self.request(self.URL, params={'asin': album.asin}) self._log.debug(u'scraped art URL: {0}', resp.url) except requests.RequestException: self._log.debug(u'error scraping art page') return # Search the page for the image URL. m = re.search(self.PAT, resp.text) if m: image_url = m.group(1) yield image_url else: self._log.debug(u'no image found on page') class GoogleImages(ArtSource): URL = u'https://www.googleapis.com/customsearch/v1' def get(self, album): """Return art URL from google custom search engine given an album title and interpreter. """ if not (album.albumartist and album.album): return search_string = (album.albumartist + ',' + album.album).encode('utf-8') response = self.request(self.URL, params={ 'key': self._config['google_key'].get(), 'cx': self._config['google_engine'].get(), 'q': search_string, 'searchType': 'image' }) # Get results using JSON. try: data = response.json() except ValueError: self._log.debug(u'google: error loading response: {}' .format(response.text)) return if 'error' in data: reason = data['error']['errors'][0]['reason'] self._log.debug(u'google fetchart error: {0}', reason) return if 'items' in data.keys(): for item in data['items']: yield item['link'] class ITunesStore(ArtSource): # Art from the iTunes Store. def get(self, album): """Return art URL from iTunes Store given an album title. """ if not (album.albumartist and album.album): return search_string = (album.albumartist + ' ' + album.album).encode('utf-8') try: # Isolate bugs in the iTunes library while searching. try: results = itunes.search_album(search_string) except Exception as exc: self._log.debug('iTunes search failed: {0}', exc) return # Get the first match. if results: itunes_album = results[0] else: self._log.debug('iTunes search for {:r} got no results', search_string) return if itunes_album.get_artwork()['100']: small_url = itunes_album.get_artwork()['100'] big_url = small_url.replace('100x100', '1200x1200') yield big_url else: self._log.debug(u'album has no artwork in iTunes Store') except IndexError: self._log.debug(u'album not found in iTunes Store') class Wikipedia(ArtSource): # Art from Wikipedia (queried through DBpedia) DBPEDIA_URL = 'http://dbpedia.org/sparql' WIKIPEDIA_URL = 'http://en.wikipedia.org/w/api.php' SPARQL_QUERY = '''PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> PREFIX dbpprop: <http://dbpedia.org/property/> PREFIX owl: <http://dbpedia.org/ontology/> PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> PREFIX foaf: <http://xmlns.com/foaf/0.1/> SELECT DISTINCT ?pageId ?coverFilename WHERE {{ ?subject owl:wikiPageID ?pageId . ?subject dbpprop:name ?name . ?subject rdfs:label ?label . {{ ?subject dbpprop:artist ?artist }} UNION {{ ?subject owl:artist ?artist }} {{ ?artist foaf:name "{artist}"@en }} UNION {{ ?artist dbpprop:name "{artist}"@en }} ?subject rdf:type <http://dbpedia.org/ontology/Album> . ?subject dbpprop:cover ?coverFilename . FILTER ( regex(?name, "{album}", "i") ) }} Limit 1''' def get(self, album): if not (album.albumartist and album.album): return # Find the name of the cover art filename on DBpedia cover_filename, page_id = None, None dbpedia_response = self.request( self.DBPEDIA_URL, params={ 'format': 'application/sparql-results+json', 'timeout': 2500, 'query': self.SPARQL_QUERY.format( artist=album.albumartist.title(), album=album.album) }, headers={'content-type': 'application/json'}, ) try: data = dbpedia_response.json() results = data['results']['bindings'] if results: cover_filename = 'File:' + results[0]['coverFilename']['value'] page_id = results[0]['pageId']['value'] else: self._log.debug('wikipedia: album not found on dbpedia') except (ValueError, KeyError, IndexError): self._log.debug('wikipedia: error scraping dbpedia response: {}', dbpedia_response.text) # Ensure we have a filename before attempting to query wikipedia if not (cover_filename and page_id): return # DBPedia sometimes provides an incomplete cover_filename, indicated # by the filename having a space before the extension, e.g., 'foo .bar' # An additional Wikipedia call can help to find the real filename. # This may be removed once the DBPedia issue is resolved, see: # https://github.com/dbpedia/extraction-framework/issues/396 if ' .' in cover_filename and \ '.' not in cover_filename.split(' .')[-1]: self._log.debug( 'wikipedia: dbpedia provided incomplete cover_filename' ) lpart, rpart = cover_filename.rsplit(' .', 1) # Query all the images in the page wikipedia_response = self.request( self.WIKIPEDIA_URL, params={ 'format': 'json', 'action': 'query', 'continue': '', 'prop': 'images', 'pageids': page_id, }, headers={'content-type': 'application/json'}, ) # Try to see if one of the images on the pages matches our # imcomplete cover_filename try: data = wikipedia_response.json() results = data['query']['pages'][page_id]['images'] for result in results: if re.match(re.escape(lpart) + r'.*?\.' + re.escape(rpart), result['title']): cover_filename = result['title'] break except (ValueError, KeyError): self._log.debug( 'wikipedia: failed to retrieve a cover_filename' ) return # Find the absolute url of the cover art on Wikipedia wikipedia_response = self.request( self.WIKIPEDIA_URL, params={ 'format': 'json', 'action': 'query', 'continue': '', 'prop': 'imageinfo', 'iiprop': 'url', 'titles': cover_filename.encode('utf-8'), }, headers={'content-type': 'application/json'}, ) try: data = wikipedia_response.json() results = data['query']['pages'] for _, result in results.iteritems(): image_url = result['imageinfo'][0]['url'] yield image_url except (ValueError, KeyError, IndexError): self._log.debug('wikipedia: error scraping imageinfo') return class FileSystem(ArtSource): """Art from the filesystem""" @staticmethod def filename_priority(filename, cover_names): """Sort order for image names. Return indexes of cover names found in the image filename. This means that images with lower-numbered and more keywords will have higher priority. """ return [idx for (idx, x) in enumerate(cover_names) if x in filename] def get(self, path, cover_names, cautious): """Look for album art files in a specified directory. """ if not os.path.isdir(path): return # Find all files that look like images in the directory. images = [] for fn in os.listdir(path): for ext in IMAGE_EXTENSIONS: if fn.lower().endswith(b'.' + ext.encode('utf8')) and \ os.path.isfile(os.path.join(path, fn)): images.append(fn) # Look for "preferred" filenames. images = sorted(images, key=lambda x: self.filename_priority(x, cover_names)) cover_pat = br"(\b|_)({0})(\b|_)".format(b'|'.join(cover_names)) for fn in images: if re.search(cover_pat, os.path.splitext(fn)[0], re.I): self._log.debug(u'using well-named art file {0}', util.displayable_path(fn)) return os.path.join(path, fn) # Fall back to any image in the folder. if images and not cautious: self._log.debug(u'using fallback art file {0}', util.displayable_path(images[0])) return os.path.join(path, images[0]) # Try each source in turn. SOURCES_ALL = [u'coverart', u'itunes', u'amazon', u'albumart', u'wikipedia', u'google'] ART_SOURCES = { u'coverart': CoverArtArchive, u'itunes': ITunesStore, u'albumart': AlbumArtOrg, u'amazon': Amazon, u'wikipedia': Wikipedia, u'google': GoogleImages, } # PLUGIN LOGIC ############################################################### class FetchArtPlugin(plugins.BeetsPlugin, RequestMixin): def __init__(self): super(FetchArtPlugin, self).__init__() self.config.add({ 'auto': True, 'minwidth': 0, 'maxwidth': 0, 'enforce_ratio': False, 'remote_priority': False, 'cautious': False, 'cover_names': ['cover', 'front', 'art', 'album', 'folder'], 'sources': ['coverart', 'itunes', 'amazon', 'albumart'], 'google_key': None, 'google_engine': u'001442825323518660753:hrh5ch1gjzm', }) self.config['google_key'].redact = True # Holds paths to downloaded images between fetching them and # placing them in the filesystem. self.art_paths = {} self.minwidth = self.config['minwidth'].get(int) self.maxwidth = self.config['maxwidth'].get(int) self.enforce_ratio = self.config['enforce_ratio'].get(bool) if self.config['auto']: # Enable two import hooks when fetching is enabled. self.import_stages = [self.fetch_art] self.register_listener('import_task_files', self.assign_art) available_sources = list(SOURCES_ALL) if not HAVE_ITUNES and u'itunes' in available_sources: available_sources.remove(u'itunes') if not self.config['google_key'].get() and \ u'google' in available_sources: available_sources.remove(u'google') sources_name = plugins.sanitize_choices( self.config['sources'].as_str_seq(), available_sources) self.sources = [ART_SOURCES[s](self._log, self.config) for s in sources_name] self.fs_source = FileSystem(self._log, self.config) # Asynchronous; after music is added to the library. def fetch_art(self, session, task): """Find art for the album being imported.""" if task.is_album: # Only fetch art for full albums. if task.album.artpath and os.path.isfile(task.album.artpath): # Album already has art (probably a re-import); skip it. return if task.choice_flag == importer.action.ASIS: # For as-is imports, don't search Web sources for art. local = True elif task.choice_flag == importer.action.APPLY: # Search everywhere for art. local = False else: # For any other choices (e.g., TRACKS), do nothing. return path = self.art_for_album(task.album, task.paths, local) if path: self.art_paths[task] = path # Synchronous; after music files are put in place. def assign_art(self, session, task): """Place the discovered art in the filesystem.""" if task in self.art_paths: path = self.art_paths.pop(task) album = task.album src_removed = (config['import']['delete'].get(bool) or config['import']['move'].get(bool)) album.set_art(path, not src_removed) album.store() if src_removed: task.prune(path) # Manual album art fetching. def commands(self): cmd = ui.Subcommand('fetchart', help='download album art') cmd.parser.add_option('-f', '--force', dest='force', action='store_true', default=False, help='re-download art when already present') def func(lib, opts, args): self.batch_fetch_art(lib, lib.albums(ui.decargs(args)), opts.force) cmd.func = func return [cmd] # Utilities converted from functions to methods on logging overhaul def _fetch_image(self, url): """Downloads an image from a URL and checks whether it seems to actually be an image. If so, returns a path to the downloaded image. Otherwise, returns None. """ try: with closing(self.request(url, stream=True, message='downloading image')) as resp: if 'Content-Type' not in resp.headers \ or resp.headers['Content-Type'] not in CONTENT_TYPES: self._log.debug( 'not a supported image: {}', resp.headers.get('Content-Type') or 'no content type', ) return None # Generate a temporary file with the correct extension. with NamedTemporaryFile(suffix=DOWNLOAD_EXTENSION, delete=False) as fh: for chunk in resp.iter_content(chunk_size=1024): fh.write(chunk) self._log.debug(u'downloaded art to: {0}', util.displayable_path(fh.name)) return fh.name except (IOError, requests.RequestException, TypeError) as exc: # Handling TypeError works around a urllib3 bug: # https://github.com/shazow/urllib3/issues/556 self._log.debug('error fetching art: {}', exc) return None def _is_valid_image_candidate(self, candidate): """Determine whether the given candidate artwork is valid based on its dimensions (width and ratio). Return `CANDIDATE_BAD` if the file is unusable. Return `CANDIDATE_EXACT` if the file is usable as-is. Return `CANDIDATE_DOWNSCALE` if the file must be resized. """ if not candidate: return CANDIDATE_BAD if not (self.enforce_ratio or self.minwidth or self.maxwidth): return CANDIDATE_EXACT # get_size returns None if no local imaging backend is available size = ArtResizer.shared.get_size(candidate) self._log.debug('image size: {}', size) if not size: self._log.warning(u'Could not get size of image (please see ' u'documentation for dependencies). ' u'The configuration options `minwidth` and ' u'`enforce_ratio` may be violated.') return CANDIDATE_EXACT # Check minimum size. if self.minwidth and size[0] < self.minwidth: self._log.debug('image too small ({} < {})', size[0], self.minwidth) return CANDIDATE_BAD # Check aspect ratio. if self.enforce_ratio and size[0] != size[1]: self._log.debug('image is not square ({} != {})', size[0], size[1]) return CANDIDATE_BAD # Check maximum size. if self.maxwidth and size[0] > self.maxwidth: self._log.debug('image needs resizing ({} > {})', size[0], self.maxwidth) return CANDIDATE_DOWNSCALE return CANDIDATE_EXACT def art_for_album(self, album, paths, local_only=False): """Given an Album object, returns a path to downloaded art for the album (or None if no art is found). If `maxwidth`, then images are resized to this maximum pixel size. If `local_only`, then only local image files from the filesystem are returned; no network requests are made. """ out = None check = None # Local art. cover_names = self.config['cover_names'].as_str_seq() cover_names = map(util.bytestring_path, cover_names) cautious = self.config['cautious'].get(bool) if paths: for path in paths: candidate = self.fs_source.get(path, cover_names, cautious) check = self._is_valid_image_candidate(candidate) if check: out = candidate self._log.debug('found local image {}', out) break # Web art sources. remote_priority = self.config['remote_priority'].get(bool) if not local_only and (remote_priority or not out): for url in self._source_urls(album): if self.maxwidth: url = ArtResizer.shared.proxy_url(self.maxwidth, url) candidate = self._fetch_image(url) check = self._is_valid_image_candidate(candidate) if check: out = candidate self._log.debug('using remote image {}', out) break if self.maxwidth and out and check == CANDIDATE_DOWNSCALE: out = ArtResizer.shared.resize(self.maxwidth, out) return out def batch_fetch_art(self, lib, albums, force): """Fetch album art for each of the albums. This implements the manual fetchart CLI command. """ for album in albums: if album.artpath and not force and os.path.isfile(album.artpath): message = ui.colorize('text_highlight_minor', 'has album art') else: # In ordinary invocations, look for images on the # filesystem. When forcing, however, always go to the Web # sources. local_paths = None if force else [album.path] path = self.art_for_album(album, local_paths) if path: album.set_art(path, False) album.store() message = ui.colorize('text_success', 'found album art') else: message = ui.colorize('text_error', 'no art found') self._log.info(u'{0}: {1}', album, message) def _source_urls(self, album): """Generate possible source URLs for an album's art. The URLs are not guaranteed to work so they each need to be attempted in turn. This allows the main `art_for_album` function to abort iteration through this sequence early to avoid the cost of scraping when not necessary. """ source_names = {v: k for k, v in ART_SOURCES.items()} for source in self.sources: self._log.debug( 'trying source {0} for album {1.albumartist} - {1.album}', source_names[type(source)], album, ) urls = source.get(album) for url in urls: yield url
mit
105,766,198,395,307,200
36.773756
80
0.550711
false
mrooney/wxbanker
wxbanker/art/transparent.py
1
1370
#!/usr/bin/env python # # https://launchpad.net/wxbanker # transparent.py: Copyright 2007-2010 Mike Rooney <[email protected]> # # This file is part of wxBanker. # # wxBanker is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # wxBanker is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with wxBanker. If not, see <http://www.gnu.org/licenses/>. """ This file exists because wxPython wx.EmptyBitmapRGBA does not exist on all platforms. """ from wxbanker.art.embeddedimage import PyEmbeddedImage catalog = {} index = [] transparent = PyEmbeddedImage( "iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAAZiS0dE" "AP8A/wD/oL2nkwAAAAlwSFlzAAALEwAACxMBAJqcGAAAAAd0SU1FB9oCFgEaIY1FTngAAAAZ" "dEVYdENvbW1lbnQAQ3JlYXRlZCB3aXRoIEdJTVBXgQ4XAAAAEklEQVQ4y2NgGAWjYBSMAggA" "AAQQAAGFP6pyAAAAAElFTkSuQmCC") index.append('transparent') catalog['transparent'] = transparent
gpl-3.0
-8,961,762,089,369,331,000
38.171429
85
0.764964
false
amudalab/concept-graphs
keyphrase/keyphrase/extractgrams.py
1
6091
import os import sys from stopwords_video import vid_stopwords from stop_words import stopword import nltk import re from nltk import stem stemmer = stem.PorterStemmer() from operator import itemgetter import math try: folder_name=sys.argv[1] folder_name="output/"+folder_name.split(".txt")[0] max_gram=sys.argv[2] #min_freq=sys.argv[3] output_folder="output" ext="_vgrams.txt" except: print "No Mandatory Parameters" sys.exit() global start_end_stop start_end_stop=['of','in','at','for',"a","an","the"] global end_stop end_stop=["a","an","the"] global symbols symbols=["+","-","*","/","-","@","?",".","(",")","[","]","{","}"] global video global numbers numbers=['1','2','3','4','5','6','7','8','9','0'] video=[] global max_height max_height=0 global phrase phrase=[] #Initially Unique text sides for each video has to be identified and stored inside a folder "X" under input folder #dir_name="input/ds4" #res_file="ds4.key" files=os.listdir(folder_name) text_files=[] for f in files: if f.endswith(".txt"): text_files.append(f) class video_text: def __init__(self,doc_name,height,text): self.doc_name=doc_name self.height=height self.text=text self.cand_phrase={} self.ext=ext def extract_grams(self,token,token_size,height): grams=[] grams.extend(nltk.ngrams(token,token_size)) for g in grams: word="" len_g=len(g) if g[0] not in start_end_stop and g[len_g-1] not in end_stop and g[len_g-1] not in start_end_stop and g[0] not in stopword and g[len_g-1] not in stopword: for t in g: word+=t+" " word=word.rstrip(" ") word=remove_special_case(word) if word not in (self.cand_phrase).keys(): self.cand_phrase[word]=1 if word not in phrase: phrase.append(word) else: self.cand_phrase[word]+=1 else: if token_size-1>=1: self.extract_grams(token,token_size-1,height) def extract_candidate_phrases(self): for t in range(len(self.text)): self.text[t]=remove_hyphen(self.text[t]) self.text[t]=remove_special_case(self.text[t]) if ((len(self.text[t].split())>=1 and len(self.text[t].split())<=max_gram)) and self.text[t] not in vid_stopwords and stop_word_check(self.text[t]): if self.text[t] not in (self.cand_phrase).keys(): self.cand_phrase[self.text[t]]=1 if self.text[t] not in phrase: phrase.append(self.text[t]) else: self.cand_phrase[self.text[t]]+=1 else: if len(self.text[t].split())>=max_gram: token=(self.text[t]).split() self.extract_grams(token,max_gram,self.height[t]) #print self.doc_name #print self.cand_phrase def remove_hyphen(g): if g.count("-")>0: temp=g.split("-") l=len(temp) word="" for i in range(l): word+=temp[i]+" " g=word.rstrip(" ") return g def remove_special_case(g): token=g.split() word="" for t in token: t=t.rstrip(" ") t=t.lstrip(" ") t=t.rstrip("()") t=t.lstrip("()") t=t.lstrip("(") t=t.rstrip("(") t=t.rstrip(")") t=t.lstrip(")") t=t.lstrip("[") t=t.rstrip("]") t=t.lstrip("{") t=t.rstrip("}") t=t.rstrip(":") t=t.lstrip(":") t=t.lstrip(",") t=t.rstrip(",") t=t.rstrip(".") word+=t+" " word=word.rstrip(" ") #print word return word def stop_word_check(t): token=t.split() token_len=len(token) if token[0] not in start_end_stop and token[token_len-1] not in start_end_stop and token[token_len-1] not in end_stop and token[0] not in stopword and token[token_len-1] not in stopword: return 1 else: return 0 def remove_phrase_with_spl_char(): #print symbols+numbers remove_phrase=[] for word in phrase: for chars in symbols+numbers: if chars in word: remove_phrase.append(word) #print word break for word in remove_phrase: phrase.remove(word) def write_phrase(): output_file_name=folder_name.split("/") size=len(output_file_name) #res_file=output_folder+"/"+output_file_name[size-1]+"_grams.txt" res_file=output_folder+"/"+output_file_name[size-1]+ext f=open(res_file,"w") for p in phrase: f.write(p+"\n") f.close() for f in sorted(text_files): height=[] row_num=[] text=[] ftxt=open(folder_name+"/"+f,"r") content=ftxt.readlines() ftxt.close() line_number=1 for line in content: data=line.split("::") if len(data)==3: height.append(int(data[1].split(" ")[1])) if int(data[1].split(" ")[1])>max_height: max_height=int(data[1].split(" ")[1]) text.append(data[2].rstrip("\n").lower()) video.append(video_text(folder_name+"/"+f,height,text)) for v in video: v.extract_candidate_phrases() remove_phrase_with_spl_char() write_phrase()
mit
9,185,321,193,961,970,000
32.103261
195
0.482023
false
xiaotaw/chembl
dnn_model/single_vs_chemdiv.py
1
3682
from __future__ import absolute_import from __future__ import division from __future__ import print_function import os import sys import time import datetime import numpy as np import pandas as pd import tensorflow as tf from matplotlib import pyplot as plt import dnn_model sys.path.append("/home/scw4750/Documents/chembl/data_files/") import chembl_input as ci vs_batch_size = 1024 def virtual_screening_chemdiv(target, g_step, gpu_num=0): t_0 = time.time() # dataset d = ci.DatasetChemDiv(target) # batch size batch_size = 128 # input vec_len input_vec_len = d.num_features # keep prob keep_prob = 0.8 # weight decay wd = 0.004 # g_step #g_step = 2236500 # virtual screen pred file pred_dir = "pred_files/%s" % target if not os.path.exists(pred_dir): os.makedirs(pred_dir) pred_path = os.path.join(pred_dir, "vs_chemdiv_%s_%d_%4.3f_%4.3e_%d.pred" % (target, batch_size, keep_prob, wd, g_step)) predfile = open(pred_path, 'w') print("virtual screen ChemDiv starts at: %s\n" % datetime.datetime.now()) # checkpoint file ckpt_dir = "ckpt_files/%s" % target ckpt_path = os.path.join(ckpt_dir, '%d_%4.3f_%4.3e.ckpt' % (batch_size, keep_prob, wd)) # screening with tf.Graph().as_default(), tf.device("/gpu: %d" % gpu_num): # the input input_placeholder = tf.placeholder(tf.float32, shape = (None, input_vec_len)) # the term base = dnn_model.term(input_placeholder, in_units=input_vec_len, wd=wd, keep_prob=1.0) # the branches softmax = dnn_model.branch(target, base, wd=wd, keep_prob=1.0) # create a saver. saver = tf.train.Saver(tf.trainable_variables()) # Start screen config=tf.ConfigProto(allow_soft_placement=True) config.gpu_options.per_process_gpu_memory_fraction = 0.35 with tf.Session(config=config) as sess: # Restores variables from checkpoint saver.restore(sess, ckpt_path + "-%d" % g_step) for ids, features in d.batch_generator_chemdiv(vs_batch_size): sm = sess.run(softmax, feed_dict = {input_placeholder: features}) for id_, sm_v in zip(ids, sm[:, 1]): predfile.write("%s\t%f\n" % (id_, sm_v)) """ try: while True: ids, features = d.generate_batch(vs_batch_size) sm = sess.run(softmax, feed_dict = {input_placeholder: features.toarray()}) for id_, sm_v in zip(ids, sm[:, 1]): predfile.write("%s\t%f\n" % (id_, sm_v)) except StopIteration: pass """ predfile.close() print("duration: %.3f" % (time.time() - t_0)) def analyse_sort_chemdiv(target, g_step): pred_file = "pred_files/%s/vs_chemdiv_%s_128_0.800_4.000e-03_%d.pred" % (target, target, g_step) pred = pd.read_csv(pred_file, sep="\t", names=("id", "pred")) pred.sort_values(by="pred", ascending=False, inplace=True) pred1000 = pred.iloc[:1000] pred1000.to_csv(pred_file.replace(".pred", ".pred1000"), header=False, sep="\t") if __name__ == "__main__": target_list = ["CHEMBL203", "CHEMBL204", "CHEMBL205", "CHEMBL206", "CHEMBL217", "CHEMBL235", "CHEMBL240", "CHEMBL244", "CHEMBL253", "CHEMBL279", "CHEMBL340", "CHEMBL4005", "CHEMBL4296", "CHEMBL4805", "CHEMBL4822", ] g_list = [2161371, 2236500, 2235600, 2091321, 2161661, 2086841, 2020411, 2161951, 2012041, 2161661, 2246400, 2235900, 2238000, 2168041, 1936221, ] #i = int(sys.argv[1]) #target = target_list[i] #g_step = g_list[i] virtual_screening_chemdiv(target="CHEMBL4005", g_step=2235900, gpu_num=1) analyse_sort_chemdiv("CHEMBL4005", g_step=2235900)
apache-2.0
-2,227,815,573,639,499,300
30.20339
122
0.626018
false