repo_name
stringlengths
5
92
path
stringlengths
4
232
copies
stringclasses
19 values
size
stringlengths
4
7
content
stringlengths
721
1.04M
license
stringclasses
15 values
hash
int64
-9,223,277,421,539,062,000
9,223,102,107B
line_mean
float64
6.51
99.9
line_max
int64
15
997
alpha_frac
float64
0.25
0.97
autogenerated
bool
1 class
gymnasium/edx-platform
lms/djangoapps/badges/models.py
1
12332
""" Database models for the badges app """ from importlib import import_module from config_models.models import ConfigurationModel from django.conf import settings from django.contrib.auth.models import User from django.core.exceptions import ValidationError from django.db import models from django.utils.translation import ugettext_lazy as _ from jsonfield import JSONField from lazy import lazy from model_utils.models import TimeStampedModel from opaque_keys import InvalidKeyError from opaque_keys.edx.django.models import CourseKeyField from opaque_keys.edx.keys import CourseKey from badges.utils import deserialize_count_specs from xmodule.modulestore.django import modulestore def validate_badge_image(image): """ Validates that a particular image is small enough to be a badge and square. """ if image.width != image.height: raise ValidationError(_(u"The badge image must be square.")) if not image.size < (250 * 1024): raise ValidationError(_(u"The badge image file size must be less than 250KB.")) def validate_lowercase(string): """ Validates that a string is lowercase. """ if not string.islower(): raise ValidationError(_(u"This value must be all lowercase.")) class CourseBadgesDisabledError(Exception): """ Exception raised when Course Badges aren't enabled, but an attempt to fetch one is made anyway. """ class BadgeClass(models.Model): """ Specifies a badge class to be registered with a backend. """ slug = models.SlugField(max_length=255, unique=True) issuing_component = models.SlugField(max_length=50, default='', blank=True, validators=[validate_lowercase]) display_name = models.CharField(max_length=255) course_id = CourseKeyField(max_length=255, blank=True, default=None) description = models.TextField() criteria = models.TextField() # TODO: Badgr and Open Badges spec can take both text and url criteria mode = models.CharField(max_length=100, default='', blank=True) image = models.ImageField(upload_to='badge_classes', validators=[validate_badge_image]) def __unicode__(self): return u"<Badge '{slug}' for '{issuing_component}', {course_id} {mode}>".format( slug=self.slug, issuing_component=self.issuing_component, course_id=unicode(self.course_id), mode=self.mode ) @classmethod def get_badge_class( cls, slug=None, issuing_component=None, display_name=None, description=None, criteria=None, image_file_handle=None, mode='', course_id=None, create=True ): """ Looks up a badge class by its slug, or combination of mode and course_id and returns it should it exist. If it does not exist, and create is True, creates it according to the arguments. Otherwise, returns None. The expectation is that an XBlock or platform developer should not need to concern themselves with whether or not a badge class has already been created, but should just feed all requirements to this function and it will 'do the right thing'. It should be the exception, rather than the common case, that a badge class would need to be looked up without also being created were it missing. """ if course_id and not modulestore().get_course(course_id).issue_badges: raise CourseBadgesDisabledError("This course does not have badges enabled.") if not course_id: course_id = CourseKeyField.Empty try: if slug: return cls.objects.get(slug=slug) else: if mode: return cls.objects.get(mode=mode, course_id=course_id) else: # allow setting a BadgeClass with no mode, can be used for all modes return cls.objects.get(course_id=course_id) except cls.DoesNotExist: if not create: return None badge_class = cls( slug=slug, issuing_component=issuing_component, display_name=display_name, course_id=course_id, mode=mode, description=description, criteria=criteria, ) badge_class.image.save(image_file_handle.name, image_file_handle) badge_class.full_clean() badge_class.save() return badge_class @lazy def backend(self): """ Loads the badging backend. """ module, klass = settings.BADGING_BACKEND.rsplit('.', 1) module = import_module(module) return getattr(module, klass)() def get_for_user(self, user): """ Get the assertion for this badge class for this user, if it has been awarded. """ return self.badgeassertion_set.filter(user=user) def award(self, user, evidence_url=None): """ Contacts the backend to have a badge assertion created for this badge class for this user. """ return self.backend.award(self, user, evidence_url=evidence_url) # def save(self, **kwargs): # #""" # # Slugs must always be lowercase. # #""" # super(BadgeClass, self).save(**kwargs) class Meta(object): app_label = "badges" unique_together = (('mode', 'course_id'),) verbose_name_plural = "Badge Classes" class BadgeAssertion(TimeStampedModel): """ Tracks badges on our side of the badge baking transaction """ user = models.ForeignKey(User, on_delete=models.CASCADE) badge_class = models.ForeignKey(BadgeClass, on_delete=models.CASCADE) data = JSONField() backend = models.CharField(max_length=50) image_url = models.URLField() assertion_url = models.URLField() def __unicode__(self): return u"<{username} Badge Assertion for {slug} for {issuing_component}".format( username=self.user.username, slug=self.badge_class.slug, issuing_component=self.badge_class.issuing_component, ) @classmethod def assertions_for_user(cls, user, course_id=None): """ Get all assertions for a user, optionally constrained to a course. """ if course_id: return cls.objects.filter(user=user, badge_class__course_id=course_id) return cls.objects.filter(user=user) class Meta(object): app_label = "badges" # Abstract model doesn't index this, so we have to. BadgeAssertion._meta.get_field('created').db_index = True # pylint: disable=protected-access class CourseCompleteImageConfiguration(models.Model): """ Contains the icon configuration for badges for a specific course mode. """ mode = models.CharField( max_length=125, help_text=_(u'The course mode for this badge image. For example, "verified" or "honor".'), unique=True, ) icon = models.ImageField( # Actual max is 256KB, but need overhead for badge baking. This should be more than enough. help_text=_( u"Badge images must be square PNG files. The file size should be under 250KB." ), upload_to='course_complete_badges', validators=[validate_badge_image] ) default = models.BooleanField( help_text=_( u"Set this value to True if you want this image to be the default image for any course modes " u"that do not have a specified badge image. You can have only one default image." ), default=False, ) def __unicode__(self): return u"<CourseCompleteImageConfiguration for '{mode}'{default}>".format( mode=self.mode, default=u" (default)" if self.default else u'' ) def clean(self): """ Make sure there's not more than one default. """ # pylint: disable=no-member if self.default and CourseCompleteImageConfiguration.objects.filter(default=True).exclude(id=self.id): raise ValidationError(_(u"There can be only one default image.")) @classmethod def image_for_mode(cls, mode): """ Get the image for a particular mode. """ try: return cls.objects.get(mode=mode).icon except cls.DoesNotExist: # Fall back to default, if there is one. return cls.objects.get(default=True).icon class Meta(object): app_label = "badges" class CourseEventBadgesConfiguration(ConfigurationModel): """ Determines the settings for meta course awards-- such as completing a certain number of courses or enrolling in a certain number of them. """ courses_completed = models.TextField( blank=True, default='', help_text=_( u"On each line, put the number of completed courses to award a badge for, a comma, and the slug of a " u"badge class you have created that has the issuing component 'openedx__course'. " u"For example: 3,enrolled_3_courses" ) ) courses_enrolled = models.TextField( blank=True, default='', help_text=_( u"On each line, put the number of enrolled courses to award a badge for, a comma, and the slug of a " u"badge class you have created that has the issuing component 'openedx__course'. " u"For example: 3,enrolled_3_courses" ) ) course_groups = models.TextField( blank=True, default='', help_text=_( u"Each line is a comma-separated list. The first item in each line is the slug of a badge class you " u"have created that has an issuing component of 'openedx__course'. The remaining items in each line are " u"the course keys the learner needs to complete to be awarded the badge. For example: " u"slug_for_compsci_courses_group_badge,course-v1:CompSci+Course+First,course-v1:CompsSci+Course+Second" ) ) def __unicode__(self): return u"<CourseEventBadgesConfiguration ({})>".format(u"Enabled" if self.enabled else u"Disabled") @property def completed_settings(self): """ Parses the settings from the courses_completed field. """ return deserialize_count_specs(self.courses_completed) @property def enrolled_settings(self): """ Parses the settings from the courses_completed field. """ return deserialize_count_specs(self.courses_enrolled) @property def course_group_settings(self): """ Parses the course group settings. In example, the format is: slug_for_compsci_courses_group_badge,course-v1:CompSci+Course+First,course-v1:CompsSci+Course+Second """ specs = self.course_groups.strip() if not specs: return {} specs = [line.split(',', 1) for line in specs.splitlines()] return { slug.strip().lower(): [CourseKey.from_string(key.strip()) for key in keys.strip().split(',')] for slug, keys in specs } def clean_fields(self, exclude=tuple()): """ Verify the settings are parseable. """ errors = {} error_message = _(u"Please check the syntax of your entry.") if 'courses_completed' not in exclude: try: self.completed_settings except (ValueError, InvalidKeyError): errors['courses_completed'] = [unicode(error_message)] if 'courses_enrolled' not in exclude: try: self.enrolled_settings except (ValueError, InvalidKeyError): errors['courses_enrolled'] = [unicode(error_message)] if 'course_groups' not in exclude: store = modulestore() try: for key_list in self.course_group_settings.values(): for course_key in key_list: if not store.get_course(course_key): ValueError(u"The course {course_key} does not exist.".format(course_key=course_key)) except (ValueError, InvalidKeyError): errors['course_groups'] = [unicode(error_message)] if errors: raise ValidationError(errors) class Meta(object): app_label = "badges"
agpl-3.0
-6,750,894,004,181,752,000
37.179567
127
0.631771
false
lcrees/twoq
twoq/tests/auto/queuing.py
1
2927
# -*- coding: utf-8 -*- '''auto queuing call chain test mixins''' class AQMixin(object): ########################################################################### ## queue manipulation ##################################################### ########################################################################### def test_repr(self): from stuf.six import strings self.assertTrue(isinstance( self.qclass([1, 2, 3, 4, 5, 6]).__repr__(), strings, )) def test_ro(self): self.assertListEqual( self.qclass([1, 2, 3, 4, 5, 6]).ro().peek(), [1, 2, 3, 4, 5, 6], ) def test_extend(self): self.assertEqual( self.qclass().extend([1, 2, 3, 4, 5, 6]).outsync().end(), [1, 2, 3, 4, 5, 6], ) def test_outextend(self): self.assertEqual( self.qclass().outextend([1, 2, 3, 4, 5, 6]).end(), [1, 2, 3, 4, 5, 6], ) def test_extendleft(self): self.assertListEqual( self.qclass().extendleft([1, 2, 3, 4, 5, 6]).outsync().end(), [6, 5, 4, 3, 2, 1] ) def test_append(self): autoq = self.qclass().append('foo').outsync() self.assertEqual(autoq.end(), 'foo') def test_appendleft(self): autoq = self.qclass().appendleft('foo').outsync() self.assertEqual(autoq.end(), 'foo') def test_inclear(self): self.assertEqual(len(list(self.qclass([1, 2, 5, 6]).inclear())), 0) def test_outclear(self): self.assertEqual( len(list(self.qclass([1, 2, 5, 6]).outclear().outgoing)), 0 ) ########################################################################### ## queue balancing ######################################################## ########################################################################### def test_insync(self): q = self.qclass([1, 2, 3, 4, 5, 6]).outshift().inclear().shift() self.assertListEqual(list(q.incoming), list(q.outgoing)) def test_inshift(self): q = self.qclass([1, 2, 3, 4, 5, 6]).outshift().sync() self.assertListEqual(list(q.incoming), list(q.outgoing)) def test_outsync(self): q = self.qclass([1, 2, 3, 4, 5, 6]).outshift() self.assertListEqual(list(q.incoming), list(q.outgoing)) def test_outshift(self): q = self.qclass([1, 2, 3, 4, 5, 6]).outsync() self.assertListEqual(list(q.incoming), list(q.outgoing)) ########################################################################## # queue information ###################################################### ########################################################################## def test_results(self): self.assertListEqual( list(self.qclass(1, 2, 3, 4, 5, 6).outsync().results()), [1, 2, 3, 4, 5, 6], )
bsd-3-clause
2,572,901,103,623,996,000
33.845238
79
0.413393
false
shekkizh/TensorflowProjects
ImageArt/ImageColoring.py
1
7092
__author__ = 'Charlie' """Image coloring by fully convolutional networks - incomplete """ import numpy as np import tensorflow as tf import os, sys, inspect from datetime import datetime import scipy.misc as misc lib_path = os.path.realpath( os.path.abspath(os.path.join(os.path.split(inspect.getfile(inspect.currentframe()))[0], ".."))) if lib_path not in sys.path: sys.path.insert(0, lib_path) import TensorflowUtils as utils FLAGS = tf.flags.FLAGS tf.flags.DEFINE_string("data_dir", "Data_zoo/CIFAR10_data/", """Path to the CIFAR10 data""") tf.flags.DEFINE_string("mode", "train", "Network mode train/ test") tf.flags.DEFINE_string("test_image_path", "", "Path to test image - read only if mode is test") tf.flags.DEFINE_integer("batch_size", "128", "train batch size") tf.flags.DEFINE_string("logs_dir", "logs/ImageColoring_logs/", """Path to save logs and checkpoint if needed""") DATA_URL = 'http://www.cs.toronto.edu/~kriz/cifar-10-binary.tar.gz' LEARNING_RATE = 1e-3 MAX_ITERATIONS = 100001 NUM_EXAMPLES_PER_EPOCH_FOR_TRAIN = 20000 IMAGE_SIZE = 32 def read_cifar10(filename_queue): class CIFAR10Record(object): pass result = CIFAR10Record() label_bytes = 1 result.height = IMAGE_SIZE result.width = IMAGE_SIZE result.depth = 3 image_bytes = result.height * result.width * result.depth record_bytes = label_bytes + image_bytes reader = tf.FixedLengthRecordReader(record_bytes=record_bytes) result.key, value = reader.read(filename_queue) record_bytes = tf.decode_raw(value, tf.uint8) depth_major = tf.cast(tf.reshape(tf.slice(record_bytes, [label_bytes], [image_bytes]), [result.depth, result.height, result.width]), tf.float32) image = tf.transpose(depth_major, [1, 2, 0]) # extended_image = tf.reshape(image, (result.height, result.width, result.depth)) result.color_image = image print result.color_image.get_shape() print "Converting image to gray scale" result.gray_image = 0.21 * result.color_image[ :, :, 2] + 0.72 * result.color_image[ :, :, 1] + 0.07 * result.color_image[ :, :, 0] result.gray_image = tf.expand_dims(result.gray_image, 2) print result.gray_image.get_shape() return result def get_image(image_dir): image = misc.imread(image_dir) image = np.ndarray.reshape(image.astype(np.float32), ((1,) + image.shape)) return image def inputs(): data_dir = os.path.join(FLAGS.data_dir, 'cifar-10-batches-bin') filenames = [os.path.join(data_dir, 'data_batch_%d.bin' % i) for i in xrange(1, 6)] for f in filenames: if not tf.gfile.Exists(f): raise ValueError('Failed to find file: ' + f) filename_queue = tf.train.string_input_producer(filenames) read_input = read_cifar10(filename_queue) num_preprocess_threads = 8 min_queue_examples = int(0.4 * NUM_EXAMPLES_PER_EPOCH_FOR_TRAIN) print "Shuffling" input_gray, input_colored = tf.train.shuffle_batch([read_input.gray_image, read_input.color_image], batch_size=FLAGS.batch_size, num_threads=num_preprocess_threads, capacity=min_queue_examples + 3 * FLAGS.batch_size, min_after_dequeue=min_queue_examples) input_gray = (input_gray - 128) / 255.0 input_colored = (input_colored - 128) / 255.0 return input_gray, input_colored def inference(image): W1 = utils.weight_variable_xavier_initialized([9, 9, 1, 32]) b1 = utils.bias_variable([32]) tf.histogram_summary("W1", W1) tf.histogram_summary("b1", b1) h_conv1 = tf.nn.relu(utils.conv2d_basic(image, W1, b1)) W2 = utils.weight_variable_xavier_initialized([3, 3, 32, 64]) b2 = utils.bias_variable([64]) tf.histogram_summary("W2", W2) tf.histogram_summary("b2", b2) h_conv2 = tf.nn.relu(utils.conv2d_strided(h_conv1, W2, b2)) W3 = utils.weight_variable_xavier_initialized([3, 3, 64, 128]) b3 = utils.bias_variable([128]) tf.histogram_summary("W3", W3) tf.histogram_summary("b3", b3) h_conv3 = tf.nn.relu(utils.conv2d_strided(h_conv2, W3, b3)) # upstrides W4 = utils.weight_variable_xavier_initialized([3, 3, 64, 128]) b4 = utils.bias_variable([64]) tf.histogram_summary("W4", W4) tf.histogram_summary("b4", b4) h_conv4 = tf.nn.relu(utils.conv2d_transpose_strided(h_conv3, W4, b4)) W5 = utils.weight_variable_xavier_initialized([3, 3, 32, 64]) b5 = utils.bias_variable([32]) tf.histogram_summary("W5", W5) tf.histogram_summary("b5", b5) h_conv5 = tf.nn.relu(utils.conv2d_transpose_strided(h_conv4, W5, b5)) W6 = utils.weight_variable_xavier_initialized([9, 9, 32, 3]) b6 = utils.bias_variable([3]) tf.histogram_summary("W6", W6) tf.histogram_summary("b6", b6) pred_image = tf.nn.tanh(utils.conv2d_basic(h_conv5, W6, b6)) return pred_image def loss(pred, colored): rmse = tf.sqrt(2 * tf.nn.l2_loss(tf.sub(colored, pred))) / FLAGS.batch_size tf.scalar_summary("RMSE", rmse) return rmse def train(loss_val, step): learning_rate = tf.train.exponential_decay(LEARNING_RATE, step, 0.4 * MAX_ITERATIONS, 0.99) train_op = tf.train.AdamOptimizer(learning_rate).minimize(loss_val, global_step=step) return train_op def main(argv=None): utils.maybe_download_and_extract(FLAGS.data_dir, DATA_URL, is_tarfile=True) print "Setting up model..." global_step = tf.Variable(0,trainable=False) gray, color = inputs() pred = 255 * inference(gray) + 128 tf.image_summary("Gray", gray, max_images=1) tf.image_summary("Ground_truth", color, max_images=1) tf.image_summary("Prediction", pred, max_images=1) image_loss = loss(pred, color) train_op = train(image_loss, global_step) summary_op = tf.merge_all_summaries() with tf.Session() as sess: print "Setting up summary writer, queue, saver..." sess.run(tf.initialize_all_variables()) summary_writer = tf.train.SummaryWriter(FLAGS.logs_dir, sess.graph) saver = tf.train.Saver() ckpt = tf.train.get_checkpoint_state(FLAGS.logs_dir) if ckpt and ckpt.model_checkpoint_path: print "Restoring model from checkpoint..." saver.restore(sess, ckpt.model_checkpoint_path) tf.train.start_queue_runners(sess) for step in xrange(MAX_ITERATIONS): if step % 400 == 0: loss_val, summary_str = sess.run([image_loss, summary_op]) print "Step %d, Loss: %g" % (step, loss_val) summary_writer.add_summary(summary_str, global_step=step) if step % 1000 == 0: saver.save(sess, FLAGS.logs_dir + "model.ckpt", global_step=step) print "%s" % datetime.now() sess.run(train_op) if __name__ == "__main__": tf.app.run()
mit
-4,695,333,736,710,493,000
36.925134
112
0.628173
false
tbabej/freeipa
ipalib/pkcs10.py
1
9170
# Authors: # Rob Crittenden <[email protected]> # # Copyright (C) 2010 Red Hat # see file 'COPYING' for use and warranty information # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. from __future__ import print_function import sys import base64 import nss.nss as nss from pyasn1.type import univ, char, namedtype, tag from pyasn1.codec.der import decoder import six if six.PY3: unicode = str PEM = 0 DER = 1 SAN_DNSNAME = 'DNS name' SAN_RFC822NAME = 'RFC822 Name' SAN_OTHERNAME_UPN = 'Other Name (OID.1.3.6.1.4.1.311.20.2.3)' SAN_OTHERNAME_KRB5PRINCIPALNAME = 'Other Name (OID.1.3.6.1.5.2.2)' def get_subject(csr, datatype=PEM): """ Given a CSR return the subject value. This returns an nss.DN object. """ request = load_certificate_request(csr, datatype) try: return request.subject finally: del request def get_extensions(csr, datatype=PEM): """ Given a CSR return OIDs of certificate extensions. The return value is a tuple of strings """ request = load_certificate_request(csr, datatype) # Work around a bug in python-nss where nss.oid_dotted_decimal # errors on unrecognised OIDs # # https://bugzilla.redhat.com/show_bug.cgi?id=1246729 # def get_prefixed_oid_str(ext): """Returns a string like 'OID.1.2...'.""" if ext.oid_tag == 0: return repr(ext) else: return nss.oid_dotted_decimal(ext.oid) return tuple(get_prefixed_oid_str(ext)[4:] for ext in request.extensions) class _PrincipalName(univ.Sequence): componentType = namedtype.NamedTypes( namedtype.NamedType('name-type', univ.Integer().subtype( explicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 0)) ), namedtype.NamedType('name-string', univ.SequenceOf(char.GeneralString()).subtype( explicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 1)) ), ) class _KRB5PrincipalName(univ.Sequence): componentType = namedtype.NamedTypes( namedtype.NamedType('realm', char.GeneralString().subtype( explicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 0)) ), namedtype.NamedType('principalName', _PrincipalName().subtype( explicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 1)) ), ) def _decode_krb5principalname(data): principal = decoder.decode(data, asn1Spec=_KRB5PrincipalName())[0] realm = (str(principal['realm']).replace('\\', '\\\\') .replace('@', '\\@')) name = principal['principalName']['name-string'] name = '/'.join(str(n).replace('\\', '\\\\') .replace('/', '\\/') .replace('@', '\\@') for n in name) name = '%s@%s' % (name, realm) return name class _AnotherName(univ.Sequence): componentType = namedtype.NamedTypes( namedtype.NamedType('type-id', univ.ObjectIdentifier()), namedtype.NamedType('value', univ.Any().subtype( explicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 0)) ), ) class _GeneralName(univ.Choice): componentType = namedtype.NamedTypes( namedtype.NamedType('otherName', _AnotherName().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 0)) ), namedtype.NamedType('rfc822Name', char.IA5String().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 1)) ), namedtype.NamedType('dNSName', char.IA5String().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 2)) ), namedtype.NamedType('x400Address', univ.Sequence().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 3)) ), namedtype.NamedType('directoryName', univ.Choice().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 4)) ), namedtype.NamedType('ediPartyName', univ.Sequence().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 5)) ), namedtype.NamedType('uniformResourceIdentifier', char.IA5String().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 6)) ), namedtype.NamedType('iPAddress', univ.OctetString().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 7)) ), namedtype.NamedType('registeredID', univ.ObjectIdentifier().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 8)) ), ) class _SubjectAltName(univ.SequenceOf): componentType = _GeneralName() def get_subjectaltname(csr, datatype=PEM): """ Given a CSR return the subjectaltname value, if any. The return value is a tuple of strings or None """ request = load_certificate_request(csr, datatype) for extension in request.extensions: if extension.oid_tag == nss.SEC_OID_X509_SUBJECT_ALT_NAME: break else: return None del request nss_names = nss.x509_alt_name(extension.value, nss.AsObject) asn1_names = decoder.decode(extension.value.data, asn1Spec=_SubjectAltName())[0] names = [] for nss_name, asn1_name in zip(nss_names, asn1_names): name_type = nss_name.type_string if name_type == SAN_OTHERNAME_KRB5PRINCIPALNAME: name = _decode_krb5principalname(asn1_name['otherName']['value']) else: name = nss_name.name names.append((name_type, name)) return tuple(names) # Unfortunately, NSS can only parse the extension request attribute, so # we have to parse friendly name ourselves (see RFC 2986) class _Attribute(univ.Sequence): componentType = namedtype.NamedTypes( namedtype.NamedType('type', univ.ObjectIdentifier()), namedtype.NamedType('values', univ.Set()), ) class _Attributes(univ.SetOf): componentType = _Attribute() class _CertificationRequestInfo(univ.Sequence): componentType = namedtype.NamedTypes( namedtype.NamedType('version', univ.Integer()), namedtype.NamedType('subject', univ.Sequence()), namedtype.NamedType('subjectPublicKeyInfo', univ.Sequence()), namedtype.OptionalNamedType('attributes', _Attributes().subtype( implicitTag=tag.Tag(tag.tagClassContext, tag.tagFormatSimple, 0))) ) class _CertificationRequest(univ.Sequence): componentType = namedtype.NamedTypes( namedtype.NamedType('certificationRequestInfo', _CertificationRequestInfo()), namedtype.NamedType('signatureAlgorithm', univ.Sequence()), namedtype.NamedType('signatureValue', univ.BitString()), ) _FRIENDLYNAME = univ.ObjectIdentifier('1.2.840.113549.1.9.20') def get_friendlyname(csr, datatype=PEM): """ Given a CSR return the value of the friendlyname attribute, if any. The return value is a string. """ if datatype == PEM: csr = strip_header(csr) csr = base64.b64decode(csr) csr = decoder.decode(csr, asn1Spec=_CertificationRequest())[0] for attribute in csr['certificationRequestInfo']['attributes']: if attribute['type'] == _FRIENDLYNAME: return unicode(attribute['values'][0]) return None def strip_header(csr): """ Remove the header and footer from a CSR. """ headerlen = 40 s = csr.find("-----BEGIN NEW CERTIFICATE REQUEST-----") if s == -1: headerlen = 36 s = csr.find("-----BEGIN CERTIFICATE REQUEST-----") if s >= 0: e = csr.find("-----END") csr = csr[s+headerlen:e] return csr def load_certificate_request(csr, datatype=PEM): """ Given a base64-encoded certificate request, with or without the header/footer, return a request object. """ if datatype == PEM: csr = strip_header(csr) csr = base64.b64decode(csr) # A fail-safe so we can always read a CSR. python-nss/NSS will segfault # otherwise if not nss.nss_is_initialized(): nss.nss_init_nodb() return nss.CertificateRequest(csr) if __name__ == '__main__': nss.nss_init_nodb() # Read PEM request from stdin and print out its components csrlines = sys.stdin.readlines() csr = ''.join(csrlines) print(load_certificate_request(csr)) print(get_subject(csr)) print(get_subjectaltname(csr)) print(get_friendlyname(csr))
gpl-3.0
-1,926,462,383,126,963,000
33.603774
89
0.648637
false
tshirtman/ultimate-smash-friends
usf/screens/configure.py
1
2357
################################################################################ # copyright 2009 Gabriel Pettier <[email protected]> # # # # This file is part of Ultimate Smash Friends. # # # # Ultimate Smash Friends is free software: you can redistribute it and/or # # modify it under the terms of the GNU General Public License as published by # # the Free Software Foundation, either version 3 of the License, or (at your # # option) any later version. # # # # Ultimate Smash Friends is distributed in the hope that it will be useful, but# # WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or# # FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for # # more details. # # # # You should have received a copy of the GNU General Public License along with # # Ultimate Smash Friends. If not, see <http://www.gnu.org/licenses/>. # ################################################################################ ''' The Base Configuration screen, show buttons to other configuration screens. ''' from usf.screens.screen import Screen from usf.widgets.box import VBox from usf.widgets.button import Button from usf.translation import _ class Configure(Screen): def init(self): self.add(VBox()) self.name = _("configure") #I18N:option screen self.widget.add(Button(_('Audio'))) self.widget.add(Button(_('Display'))) self.widget.add(Button(_('Keyboard'))) self.widget.add(Button(_('Back')), margin=100) def callback(self, action): if action.text == _('Audio'): return {'goto': 'sound'} if action.text == _('Display'): return {'goto': 'display'} if action.text == _('Keyboard'): return {'goto': 'keyboard'} if action.text == _('Back'): return {'goto': 'back'}
gpl-3.0
-8,758,575,220,416,393,000
42.648148
80
0.474332
false
nickmilon/mongoUtils
mongoUtils/importsExports.py
1
8999
"""Classes used to import/export data to mongoDB """ from Hellas.Thebes import format_header xlrd = None # reserved to import xlrd on demand def _xlrd_on_demand(): global xlrd if xlrd is None: try: import xlrd except ImportError: print ("this module requires xlrd library please install (pip install xlrd") raise return xlrd def import_workbook(workbook, db, fields=None, ws_options={'dt_python': True}, stats_every=1000): """save all workbook's sheets to a db consider using :class:`~ImportXls` class instead which is more flexible but imports only a single sheet :Parameters: see :class:`~ImportXls` class :Example: >>> from pymongo import MongoClient >>> from mongoUtils import _PATH_TO_DATA >>> db = MongoClient().test >>> res = import_workbook(_PATH_TO_DATA + "example_workbook.xlsx", db) >>> res [{'rows': 368, 'db': 'test', 'collection': 'weather'}, {'rows': 1007, 'db': 'test', 'collection': 'locations'}] """ _xlrd_on_demand() workbook = xlrd.open_workbook(workbook, on_demand=True) return [ImportXls(workbook, i, db, fields=fields, ws_options=ws_options, stats_every=stats_every)() for i in range(0, workbook.nsheets)] class Import(object): """generic class for importing into a mongoDB collection, successors should use/extend this class :Parameters: - db: a pynongo database object that will be used for output - collection: a pymongo collection object that will be used for output - drop_collection: (defaults to True) - True drops output collection on init before writing to it - False appends to output collection - stats_every: int print import stats every stats_every rows or 0 to cancel stats (defaults to 10000) """ format_stats = "|{db:16s}|{collection:16s}|{rows:15,d}|" format_stats_header = format_header(format_stats) def __init__(self, collection, drop_collection=True, stats_every=10000): if drop_collection: collection.database.drop_collection(collection.name) self.info = {'db': collection.database.name, 'collection': collection.name, 'rows': 0} self.stats_every = stats_every self.collection = collection def import_to_collection(self): """successors should implement this""" raise NotImplementedError def _import_to_collection_before(self): """successors can call this or implement their's""" if self.stats_every > 0: print(self.format_stats_header) def _import_to_collection_after(self): """successors can call this or implement their's""" if self.stats_every > 0: self.print_stats() def print_stats(self): print(self.format_stats.format(**self.info)) def __call__(self): return self.import_to_collection() class ImportXls(Import): """save an an xls sheet to a collection `see <https://github.com/python-excel/xlrd>`_ :Parameters: - workbook: path to a workbook or an xlrd workbook object - sheet: name of a work sheet in workbook or an int (sheet number in workbook) - db: a pymongo database object - coll_name: str output collection name or None to create name from sheet name (defaults to None) - row_start: int or None starting raw or None to start from first row (defaults to None) - row_end:int or None ending raw or None to end at lastrow (defaults to None) - fields: - a list with field names - or True (to treat first row as field names) - or None (for auto creating field names i.e: [fld_1, fld_2, etc] - or a function that: - takes one argument (a list of row values) - returns a dict (if this dict contains a key '_id' this value will be used for _id) - >>> lambda x: {'coordinates': [x[0] , x[1]]} - ws_options: (optional) a dictionary specifying how to treat cell values - dt_python : bool convert dates to python datetime - integers_only : round float values to int helpful coz all int values are represented as floats in sheets - negatives_to_0 : treat all negative numbers as 0's - drop_collection: (defaults to True) - True drops output collection on init before writing to it - False appends to output collection - stats_every: int print import stats every stats_every rows or 0 to cancel stats (defaults to 10000) - drop_collection: if True drops collection on init otherwise appends to collection :Example: >>> from pymongo import MongoClient >>> from mongoUtils import _PATH_TO_DATA >>> db = MongoClient().test >>> res = ImportXls(_PATH_TO_DATA + "example_workbook.xlsx", 0, db)() >>> res {'rows': 367, 'db': u'test', 'collection': u'weather'} """ def __init__(self, workbook, sheet, db, coll_name=None, row_start=None, row_end=None, fields=True, ws_options={'dt_python': True, 'integers_only': False, 'negatives_to_0': False}, stats_every=10000, drop_collection=True): _xlrd_on_demand() if not isinstance(workbook, xlrd.book.Book): workbook = xlrd.open_workbook(workbook, on_demand=True) self.workbook = workbook self.sheet = workbook.sheet_by_index(sheet) if isinstance(sheet, int) else workbook.sheet_by_name(sheet) self._ws_options = {} self.ws_options_set(ws_options) coll_name = self.fix_name(self.sheet.name) if coll_name is None else coll_name if row_start is None: row_start = 1 if fields is True else 0 self.row_start = row_start self.row_end = row_end collection = db[coll_name] super(ImportXls, self).__init__(collection, drop_collection=drop_collection, stats_every=stats_every) self.auto_field_names(fields) @property def ws_options(self): return self._ws_options def ws_options_set(self, options_dict): self._ws_options.update(options_dict) def fix_name(self, name, cnt=0): if name == '': return 'fld_{}'.format(cnt) else: return name.replace(' ', '_').replace('.', '_').replace('$', '_') def auto_field_names(self, fields): row0_values = self.sheet.row_values(0) if fields is True: self._fields_or_fun = [self.fix_name(fn, cnt) for cnt, fn in enumerate(row0_values)] elif fields is None: self._fields_or_fun = ['fld_{}'.format(i) for i in range(len(row0_values))] elif isinstance(fields, list): self._fields_or_fun = [self.fix_name(fn, cnt) for cnt, fn in enumerate(fields)] else: # then it has to be function self._fields_or_fun = fields return self._fields_or_fun def row_to_doc(self, valueslist, _id=None): if isinstance(self._fields_or_fun, list): doc = dict(list(zip(self._fields_or_fun, valueslist))) else: doc = self._fields_or_fun(valueslist) if _id is not None and doc.get('_id') is None: doc['_id'] = _id return doc def ws_convert_cell(self, cl): """ :Parameters: - cl an xlrd cell object """ # XL_CELL_BLANK XL_CELL_BOOLEAN XL_CELL_NUMBER XL_CELL_TEXT tp = cl.ctype vl = cl.value if tp == xlrd.XL_CELL_NUMBER: # number if self._ws_options.get('integers_only') is True: if vl % 1 == 0: vl = int(vl + 0.49999) # kind of round if vl < 0 and self._ws_options.get('negatives_to_0'): vl = 0 elif tp == xlrd.XL_CELL_DATE and self._ws_options.get('dt_python') is True: vl = xlrd.xldate.xldate_as_datetime(vl, self.sheet.book.datemode) return vl def import_to_collection(self): super(ImportXls, self)._import_to_collection_before() outlist = [] for i in range(self.row_start, self.row_end or self.sheet.nrows): self.info['rows'] += 1 row_values = [self.ws_convert_cell(cl) for cl in self.sheet.row(i)] outlist.append(self.row_to_doc(row_values, i)) if self.stats_every and i % self.stats_every == 0: self.print_stats() if len(outlist) == 200: try: self.collection.insert_many(outlist) outlist = [] except Exception: print (outlist) raise if len(outlist) > 0: self.collection.insert_many(outlist) super(ImportXls, self)._import_to_collection_after() return self.info
apache-2.0
-6,477,179,523,395,941,000
40.662037
119
0.595066
false
Leberwurscht/OfflineDict
buildindex.py
1
1491
#!/usr/bin/python # -*- coding: utf8 -*- import sys, re filename = sys.argv[1] tokensize = int(sys.argv[2]) numbersize = int(sys.argv[3]) numbersize2 = int(sys.argv[4]) def normalize(s): r = s.lower() r = r.replace(u'ä',u'a'); r = r.replace(u'ö',u'o'); r = r.replace(u'ü',u'u'); r = r.replace(u'Ä',u'A'); r = r.replace(u'Ö',u'O'); r = r.replace(u'Ü',u'U'); r = r.replace(u'ß',u'ss'); r = r.replace(u'ñ',u'n'); r = r.replace(u'á',u'a'); r = r.replace(u'é',u'e'); r = r.replace(u'í',u'i'); r = r.replace(u'ó',u'o'); r = r.replace(u'ú',u'u'); r = r.replace(u'Á',u'A'); r = r.replace(u'É',u'E'); r = r.replace(u'Í',u'I'); r = r.replace(u'Ó',u'O'); r = r.replace(u'Ú',u'U'); return r.encode("utf8") pos = 0 for line in open(filename): linelength = len(line) if line.strip() and not line[0]=="#": length = len(line) line = unicode(line, 'utf8') i=line.rindex('\t') line = line[0:i] red = re.sub(r'\[.*?\]|\{.*?\}','',line,flags=re.UNICODE).strip() tokens = re.split(r'\W', red, flags=re.UNICODE) for token in tokens: ntoken = normalize(token) if len(ntoken)>tokensize: raise Exception("increase tokensize") if pos>10**numbersize-1: raise Exception("increase numbersize") if length>10**numbersize2-1: raise Exception("increase numbersize2") if ntoken: print ("%-"+str(tokensize)+"s %"+str(numbersize)+"d %"+str(numbersize2)+"d") % (ntoken, pos, length) pos += linelength
mpl-2.0
982,324,380,487,193,000
28.46
117
0.570944
false
isohybrid/dotfile
vim/bundle/git:--github.com-klen-python-mode/pylibs/logilab/astng/scoped_nodes.py
1
34414
# copyright 2003-2011 LOGILAB S.A. (Paris, FRANCE), all rights reserved. # contact http://www.logilab.fr/ -- mailto:[email protected] # copyright 2003-2010 Sylvain Thenault, all rights reserved. # contact mailto:[email protected] # # This file is part of logilab-astng. # # logilab-astng is free software: you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by the # Free Software Foundation, either version 2.1 of the License, or (at your # option) any later version. # # logilab-astng is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or # FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License # for more details. # # You should have received a copy of the GNU Lesser General Public License along # with logilab-astng. If not, see <http://www.gnu.org/licenses/>. """This module contains the classes for "scoped" node, i.e. which are opening a new local scope in the language definition : Module, Class, Function (and Lambda, GenExpr, DictComp and SetComp to some extent). """ from __future__ import with_statement __doctype__ = "restructuredtext en" import sys from itertools import chain from logilab.common.compat import builtins from logilab.common.decorators import cached from logilab.astng import BUILTINS_MODULE from logilab.astng.exceptions import NotFoundError, NoDefault, \ ASTNGBuildingException, InferenceError from logilab.astng.node_classes import Const, DelName, DelAttr, \ Dict, From, List, Name, Pass, Raise, Return, Tuple, Yield, \ are_exclusive, LookupMixIn, const_factory as cf, unpack_infer from logilab.astng.bases import NodeNG, InferenceContext, Instance,\ YES, Generator, UnboundMethod, BoundMethod, _infer_stmts, copy_context, \ BUILTINS_NAME from logilab.astng.mixins import FilterStmtsMixin from logilab.astng.bases import Statement from logilab.astng.manager import ASTNGManager def remove_nodes(func, cls): def wrapper(*args, **kwargs): nodes = [n for n in func(*args, **kwargs) if not isinstance(n, cls)] if not nodes: raise NotFoundError() return nodes return wrapper def function_to_method(n, klass): if isinstance(n, Function): if n.type == 'classmethod': return BoundMethod(n, klass) if n.type != 'staticmethod': return UnboundMethod(n) return n def std_special_attributes(self, name, add_locals=True): if add_locals: locals = self.locals else: locals = {} if name == '__name__': return [cf(self.name)] + locals.get(name, []) if name == '__doc__': return [cf(self.doc)] + locals.get(name, []) if name == '__dict__': return [Dict()] + locals.get(name, []) raise NotFoundError(name) MANAGER = ASTNGManager() def builtin_lookup(name): """lookup a name into the builtin module return the list of matching statements and the astng for the builtin module """ builtin_astng = MANAGER.astng_from_module(builtins) if name == '__dict__': return builtin_astng, () try: stmts = builtin_astng.locals[name] except KeyError: stmts = () return builtin_astng, stmts # TODO move this Mixin to mixins.py; problem: 'Function' in _scope_lookup class LocalsDictNodeNG(LookupMixIn, NodeNG): """ this class provides locals handling common to Module, Function and Class nodes, including a dict like interface for direct access to locals information """ # attributes below are set by the builder module or by raw factories # dictionary of locals with name as key and node defining the local as # value def qname(self): """return the 'qualified' name of the node, eg module.name, module.class.name ... """ if self.parent is None: return self.name return '%s.%s' % (self.parent.frame().qname(), self.name) def frame(self): """return the first parent frame node (i.e. Module, Function or Class) """ return self def scope(self): """return the first node defining a new scope (i.e. Module, Function, Class, Lambda but also GenExpr, DictComp and SetComp) """ return self def _scope_lookup(self, node, name, offset=0): """XXX method for interfacing the scope lookup""" try: stmts = node._filter_stmts(self.locals[name], self, offset) except KeyError: stmts = () if stmts: return self, stmts if self.parent: # i.e. not Module # nested scope: if parent scope is a function, that's fine # else jump to the module pscope = self.parent.scope() if not pscope.is_function: pscope = pscope.root() return pscope.scope_lookup(node, name) return builtin_lookup(name) # Module def set_local(self, name, stmt): """define <name> in locals (<stmt> is the node defining the name) if the node is a Module node (i.e. has globals), add the name to globals if the name is already defined, ignore it """ #assert not stmt in self.locals.get(name, ()), (self, stmt) self.locals.setdefault(name, []).append(stmt) __setitem__ = set_local def _append_node(self, child): """append a child, linking it in the tree""" self.body.append(child) child.parent = self def add_local_node(self, child_node, name=None): """append a child which should alter locals to the given node""" if name != '__class__': # add __class__ node as a child will cause infinite recursion later! self._append_node(child_node) self.set_local(name or child_node.name, child_node) def __getitem__(self, item): """method from the `dict` interface returning the first node associated with the given name in the locals dictionary :type item: str :param item: the name of the locally defined object :raises KeyError: if the name is not defined """ return self.locals[item][0] def __iter__(self): """method from the `dict` interface returning an iterator on `self.keys()` """ return iter(self.keys()) def keys(self): """method from the `dict` interface returning a tuple containing locally defined names """ return self.locals.keys() def values(self): """method from the `dict` interface returning a tuple containing locally defined nodes which are instance of `Function` or `Class` """ return [self[key] for key in self.keys()] def items(self): """method from the `dict` interface returning a list of tuple containing each locally defined name with its associated node, which is an instance of `Function` or `Class` """ return zip(self.keys(), self.values()) def __contains__(self, name): return name in self.locals has_key = __contains__ # Module ##################################################################### class Module(LocalsDictNodeNG): _astng_fields = ('body',) fromlineno = 0 lineno = 0 # attributes below are set by the builder module or by raw factories # the file from which as been extracted the astng representation. It may # be None if the representation has been built from a built-in module file = None # the module name name = None # boolean for astng built from source (i.e. ast) pure_python = None # boolean for package module package = None # dictionary of globals with name as key and node defining the global # as value globals = None # names of python special attributes (handled by getattr impl.) special_attributes = set(('__name__', '__doc__', '__file__', '__path__', '__dict__')) # names of module attributes available through the global scope scope_attrs = set(('__name__', '__doc__', '__file__', '__path__')) def __init__(self, name, doc, pure_python=True): self.name = name self.doc = doc self.pure_python = pure_python self.locals = self.globals = {} self.body = [] def block_range(self, lineno): """return block line numbers. start from the beginning whatever the given lineno """ return self.fromlineno, self.tolineno def scope_lookup(self, node, name, offset=0): if name in self.scope_attrs and not name in self.locals: try: return self, self.getattr(name) except NotFoundError: return self, () return self._scope_lookup(node, name, offset) def pytype(self): return '%s.module' % BUILTINS_MODULE def display_type(self): return 'Module' def getattr(self, name, context=None, ignore_locals=False): if name in self.special_attributes: if name == '__file__': return [cf(self.file)] + self.locals.get(name, []) if name == '__path__' and self.package: return [List()] + self.locals.get(name, []) return std_special_attributes(self, name) if not ignore_locals and name in self.locals: return self.locals[name] if self.package: try: return [self.import_module(name, relative_only=True)] except ASTNGBuildingException: raise NotFoundError(name) except Exception:# XXX pylint tests never pass here; do we need it? import traceback traceback.print_exc() raise NotFoundError(name) getattr = remove_nodes(getattr, DelName) def igetattr(self, name, context=None): """inferred getattr""" # set lookup name since this is necessary to infer on import nodes for # instance context = copy_context(context) context.lookupname = name try: return _infer_stmts(self.getattr(name, context), context, frame=self) except NotFoundError: raise InferenceError(name) def fully_defined(self): """return True if this module has been built from a .py file and so contains a complete representation including the code """ return self.file is not None and self.file.endswith('.py') def statement(self): """return the first parent node marked as statement node consider a module as a statement... """ return self def previous_sibling(self): """module has no sibling""" return def next_sibling(self): """module has no sibling""" return if sys.version_info < (2, 8): def absolute_import_activated(self): for stmt in self.locals.get('absolute_import', ()): if isinstance(stmt, From) and stmt.modname == '__future__': return True return False else: absolute_import_activated = lambda self: True def import_module(self, modname, relative_only=False, level=None): """import the given module considering self as context""" if relative_only and level is None: level = 0 absmodname = self.relative_to_absolute_name(modname, level) try: return MANAGER.astng_from_module_name(absmodname) except ASTNGBuildingException: # we only want to import a sub module or package of this module, # skip here if relative_only: raise return MANAGER.astng_from_module_name(modname) def relative_to_absolute_name(self, modname, level): """return the absolute module name for a relative import. The relative import can be implicit or explicit. """ # XXX this returns non sens when called on an absolute import # like 'pylint.checkers.logilab.astng.utils' # XXX doesn't return absolute name if self.name isn't absolute name if self.absolute_import_activated() and level is None: return modname if level: if self.package: level = level - 1 package_name = self.name.rsplit('.', level)[0] elif self.package: package_name = self.name else: package_name = self.name.rsplit('.', 1)[0] if package_name: if not modname: return package_name return '%s.%s' % (package_name, modname) return modname def wildcard_import_names(self): """return the list of imported names when this module is 'wildcard imported' It doesn't include the '__builtins__' name which is added by the current CPython implementation of wildcard imports. """ # take advantage of a living module if it exists try: living = sys.modules[self.name] except KeyError: pass else: try: return living.__all__ except AttributeError: return [name for name in living.__dict__.keys() if not name.startswith('_')] # else lookup the astng # # We separate the different steps of lookup in try/excepts # to avoid catching too many Exceptions # However, we can not analyse dynamically constructed __all__ try: all = self['__all__'] except KeyError: return [name for name in self.keys() if not name.startswith('_')] try: explicit = all.assigned_stmts().next() except InferenceError: return [name for name in self.keys() if not name.startswith('_')] except AttributeError: # not an assignment node # XXX infer? return [name for name in self.keys() if not name.startswith('_')] try: # should be a Tuple/List of constant string / 1 string not allowed return [const.value for const in explicit.elts] except AttributeError: return [name for name in self.keys() if not name.startswith('_')] class ComprehensionScope(LocalsDictNodeNG): def frame(self): return self.parent.frame() scope_lookup = LocalsDictNodeNG._scope_lookup class GenExpr(ComprehensionScope): _astng_fields = ('elt', 'generators') def __init__(self): self.locals = {} self.elt = None self.generators = [] class DictComp(ComprehensionScope): _astng_fields = ('key', 'value', 'generators') def __init__(self): self.locals = {} self.key = None self.value = None self.generators = [] class SetComp(ComprehensionScope): _astng_fields = ('elt', 'generators') def __init__(self): self.locals = {} self.elt = None self.generators = [] class _ListComp(NodeNG): """class representing a ListComp node""" _astng_fields = ('elt', 'generators') elt = None generators = None if sys.version_info >= (3, 0): class ListComp(_ListComp, ComprehensionScope): """class representing a ListComp node""" def __init__(self): self.locals = {} else: class ListComp(_ListComp): """class representing a ListComp node""" # Function ################################################################### class Lambda(LocalsDictNodeNG, FilterStmtsMixin): _astng_fields = ('args', 'body',) # function's type, 'function' | 'method' | 'staticmethod' | 'classmethod' type = 'function' def __init__(self): self.locals = {} self.args = [] self.body = [] def pytype(self): if 'method' in self.type: return '%s.instancemethod' % BUILTINS_MODULE return '%s.function' % BUILTINS_MODULE def display_type(self): if 'method' in self.type: return 'Method' return 'Function' def callable(self): return True def argnames(self): """return a list of argument names""" if self.args.args: # maybe None with builtin functions names = _rec_get_names(self.args.args) else: names = [] if self.args.vararg: names.append(self.args.vararg) if self.args.kwarg: names.append(self.args.kwarg) return names def infer_call_result(self, caller, context=None): """infer what a function is returning when called""" return self.body.infer(context) def scope_lookup(self, node, name, offset=0): if node in self.args.defaults: frame = self.parent.frame() # line offset to avoid that def func(f=func) resolve the default # value to the defined function offset = -1 else: # check this is not used in function decorators frame = self return frame._scope_lookup(node, name, offset) class Function(Statement, Lambda): _astng_fields = ('decorators', 'args', 'body') special_attributes = set(('__name__', '__doc__', '__dict__')) is_function = True # attributes below are set by the builder module or by raw factories blockstart_tolineno = None decorators = None def __init__(self, name, doc): self.locals = {} self.args = [] self.body = [] self.decorators = None self.name = name self.doc = doc self.extra_decorators = [] self.instance_attrs = {} def set_line_info(self, lastchild): self.fromlineno = self.lineno # lineno is the line number of the first decorator, we want the def statement lineno if self.decorators is not None: self.fromlineno += len(self.decorators.nodes) self.tolineno = lastchild.tolineno self.blockstart_tolineno = self.args.tolineno def block_range(self, lineno): """return block line numbers. start from the "def" position whatever the given lineno """ return self.fromlineno, self.tolineno def getattr(self, name, context=None): """this method doesn't look in the instance_attrs dictionary since it's done by an Instance proxy at inference time. """ if name == '__module__': return [cf(self.root().qname())] if name in self.instance_attrs: return self.instance_attrs[name] return std_special_attributes(self, name, False) def is_method(self): """return true if the function node should be considered as a method""" # check we are defined in a Class, because this is usually expected # (e.g. pylint...) when is_method() return True return self.type != 'function' and isinstance(self.parent.frame(), Class) def decoratornames(self): """return a list of decorator qualified names""" result = set() decoratornodes = [] if self.decorators is not None: decoratornodes += self.decorators.nodes decoratornodes += self.extra_decorators for decnode in decoratornodes: for infnode in decnode.infer(): result.add(infnode.qname()) return result decoratornames = cached(decoratornames) def is_bound(self): """return true if the function is bound to an Instance or a class""" return self.type == 'classmethod' def is_abstract(self, pass_is_abstract=True): """return true if the method is abstract It's considered as abstract if the only statement is a raise of NotImplementError, or, if pass_is_abstract, a pass statement """ for child_node in self.body: if isinstance(child_node, Raise): if child_node.raises_not_implemented(): return True if pass_is_abstract and isinstance(child_node, Pass): return True return False # empty function is the same as function with a single "pass" statement if pass_is_abstract: return True def is_generator(self): """return true if this is a generator function""" # XXX should be flagged, not computed try: return self.nodes_of_class(Yield, skip_klass=Function).next() except StopIteration: return False def infer_call_result(self, caller, context=None): """infer what a function is returning when called""" if self.is_generator(): yield Generator(self) return returns = self.nodes_of_class(Return, skip_klass=Function) for returnnode in returns: if returnnode.value is None: yield Const(None) else: try: for infered in returnnode.value.infer(context): yield infered except InferenceError: yield YES def _rec_get_names(args, names=None): """return a list of all argument names""" if names is None: names = [] for arg in args: if isinstance(arg, Tuple): _rec_get_names(arg.elts, names) else: names.append(arg.name) return names # Class ###################################################################### def _class_type(klass, ancestors=None): """return a Class node type to differ metaclass, interface and exception from 'regular' classes """ # XXX we have to store ancestors in case we have a ancestor loop if klass._type is not None: return klass._type if klass.name == 'type': klass._type = 'metaclass' elif klass.name.endswith('Interface'): klass._type = 'interface' elif klass.name.endswith('Exception'): klass._type = 'exception' else: if ancestors is None: ancestors = set() if klass in ancestors: # XXX we are in loop ancestors, and have found no type klass._type = 'class' return 'class' ancestors.add(klass) # print >> sys.stderr, '_class_type', repr(klass) for base in klass.ancestors(recurs=False): if _class_type(base, ancestors) != 'class': klass._type = base.type break if klass._type is None: klass._type = 'class' return klass._type def _iface_hdlr(iface_node): """a handler function used by interfaces to handle suspicious interface nodes """ return True class Class(Statement, LocalsDictNodeNG, FilterStmtsMixin): # some of the attributes below are set by the builder module or # by a raw factories # a dictionary of class instances attributes _astng_fields = ('decorators', 'bases', 'body') # name decorators = None special_attributes = set(('__name__', '__doc__', '__dict__', '__module__', '__bases__', '__mro__', '__subclasses__')) blockstart_tolineno = None _type = None type = property(_class_type, doc="class'type, possible values are 'class' | " "'metaclass' | 'interface' | 'exception'") def __init__(self, name, doc): self.instance_attrs = {} self.locals = {} self.bases = [] self.body = [] self.name = name self.doc = doc def _newstyle_impl(self, context=None): if context is None: context = InferenceContext() if self._newstyle is not None: return self._newstyle for base in self.ancestors(recurs=False, context=context): if base._newstyle_impl(context): self._newstyle = True break if self._newstyle is None: self._newstyle = False return self._newstyle _newstyle = None newstyle = property(_newstyle_impl, doc="boolean indicating if it's a new style class" "or not") def set_line_info(self, lastchild): self.fromlineno = self.lineno self.blockstart_tolineno = self.bases and self.bases[-1].tolineno or self.fromlineno if lastchild is not None: self.tolineno = lastchild.tolineno # else this is a class with only a docstring, then tolineno is (should be) already ok def block_range(self, lineno): """return block line numbers. start from the "class" position whatever the given lineno """ return self.fromlineno, self.tolineno def pytype(self): if self.newstyle: return '%s.type' % BUILTINS_MODULE return '%s.classobj' % BUILTINS_MODULE def display_type(self): return 'Class' def callable(self): return True def infer_call_result(self, caller, context=None): """infer what a class is returning when called""" yield Instance(self) def scope_lookup(self, node, name, offset=0): if node in self.bases: frame = self.parent.frame() # line offset to avoid that class A(A) resolve the ancestor to # the defined class offset = -1 else: frame = self return frame._scope_lookup(node, name, offset) # list of parent class as a list of string (i.e. names as they appear # in the class definition) XXX bw compat def basenames(self): return [bnode.as_string() for bnode in self.bases] basenames = property(basenames) def ancestors(self, recurs=True, context=None): """return an iterator on the node base classes in a prefixed depth first order :param recurs: boolean indicating if it should recurse or return direct ancestors only """ # FIXME: should be possible to choose the resolution order # XXX inference make infinite loops possible here (see BaseTransformer # manipulation in the builder module for instance) yielded = set([self]) if context is None: context = InferenceContext() for stmt in self.bases: with context.restore_path(): try: for baseobj in stmt.infer(context): if not isinstance(baseobj, Class): # duh ? continue if baseobj in yielded: continue # cf xxx above yielded.add(baseobj) yield baseobj if recurs: for grandpa in baseobj.ancestors(True, context): if grandpa in yielded: continue # cf xxx above yielded.add(grandpa) yield grandpa except InferenceError: # XXX log error ? continue def local_attr_ancestors(self, name, context=None): """return an iterator on astng representation of parent classes which have <name> defined in their locals """ for astng in self.ancestors(context=context): if name in astng: yield astng def instance_attr_ancestors(self, name, context=None): """return an iterator on astng representation of parent classes which have <name> defined in their instance attribute dictionary """ for astng in self.ancestors(context=context): if name in astng.instance_attrs: yield astng def has_base(self, node): return node in self.bases def local_attr(self, name, context=None): """return the list of assign node associated to name in this class locals or in its parents :raises `NotFoundError`: if no attribute with this name has been find in this class or its parent classes """ try: return self.locals[name] except KeyError: # get if from the first parent implementing it if any for class_node in self.local_attr_ancestors(name, context): return class_node.locals[name] raise NotFoundError(name) local_attr = remove_nodes(local_attr, DelAttr) def instance_attr(self, name, context=None): """return the astng nodes associated to name in this class instance attributes dictionary and in its parents :raises `NotFoundError`: if no attribute with this name has been find in this class or its parent classes """ values = self.instance_attrs.get(name, []) # get all values from parents for class_node in self.instance_attr_ancestors(name, context): values += class_node.instance_attrs[name] if not values: raise NotFoundError(name) return values instance_attr = remove_nodes(instance_attr, DelAttr) def instanciate_class(self): """return Instance of Class node, else return self""" return Instance(self) def getattr(self, name, context=None): """this method doesn't look in the instance_attrs dictionary since it's done by an Instance proxy at inference time. It may return a YES object if the attribute has not been actually found but a __getattr__ or __getattribute__ method is defined """ values = self.locals.get(name, []) if name in self.special_attributes: if name == '__module__': return [cf(self.root().qname())] + values # FIXME : what is expected by passing the list of ancestors to cf: # you can just do [cf(tuple())] + values without breaking any test # this is ticket http://www.logilab.org/ticket/52785 if name == '__bases__': return [cf(tuple(self.ancestors(recurs=False, context=context)))] + values # XXX need proper meta class handling + MRO implementation if name == '__mro__' and self.newstyle: # XXX mro is read-only but that's not our job to detect that return [cf(tuple(self.ancestors(recurs=True, context=context)))] + values return std_special_attributes(self, name) # don't modify the list in self.locals! values = list(values) for classnode in self.ancestors(recurs=True, context=context): values += classnode.locals.get(name, []) if not values: raise NotFoundError(name) return values def igetattr(self, name, context=None): """inferred getattr, need special treatment in class to handle descriptors """ # set lookup name since this is necessary to infer on import nodes for # instance context = copy_context(context) context.lookupname = name try: for infered in _infer_stmts(self.getattr(name, context), context, frame=self): # yield YES object instead of descriptors when necessary if not isinstance(infered, Const) and isinstance(infered, Instance): try: infered._proxied.getattr('__get__', context) except NotFoundError: yield infered else: yield YES else: yield function_to_method(infered, self) except NotFoundError: if not name.startswith('__') and self.has_dynamic_getattr(context): # class handle some dynamic attributes, return a YES object yield YES else: raise InferenceError(name) def has_dynamic_getattr(self, context=None): """return True if the class has a custom __getattr__ or __getattribute__ method """ # need to explicitly handle optparse.Values (setattr is not detected) if self.name == 'Values' and self.root().name == 'optparse': return True try: self.getattr('__getattr__', context) return True except NotFoundError: #if self.newstyle: XXX cause an infinite recursion error try: getattribute = self.getattr('__getattribute__', context)[0] if getattribute.root().name != BUILTINS_NAME: # class has a custom __getattribute__ defined return True except NotFoundError: pass return False def methods(self): """return an iterator on all methods defined in the class and its ancestors """ done = {} for astng in chain(iter((self,)), self.ancestors()): for meth in astng.mymethods(): if meth.name in done: continue done[meth.name] = None yield meth def mymethods(self): """return an iterator on all methods defined in the class""" for member in self.values(): if isinstance(member, Function): yield member def interfaces(self, herited=True, handler_func=_iface_hdlr): """return an iterator on interfaces implemented by the given class node """ # FIXME: what if __implements__ = (MyIFace, MyParent.__implements__)... try: implements = Instance(self).getattr('__implements__')[0] except NotFoundError: return if not herited and not implements.frame() is self: return found = set() missing = False for iface in unpack_infer(implements): if iface is YES: missing = True continue if not iface in found and handler_func(iface): found.add(iface) yield iface if missing: raise InferenceError()
bsd-2-clause
-297,131,739,150,811,800
34.40535
93
0.586012
false
botswana-harvard/tshilo-dikotla
td_infant/models/infant_birth_data.py
1
2659
from django.core.validators import MinValueValidator, MaxValueValidator from django.db import models from edc_constants.choices import YES_NO, GENDER from .infant_crf_model import InfantCrfModel class InfantBirthData(InfantCrfModel): """ A model completed by the user on the infant's birth exam. """ infant_gender = models.CharField( max_length=6, choices=GENDER, verbose_name="What is the gender of the infant?", help_text="") weight_kg = models.DecimalField( max_digits=3, decimal_places=2, verbose_name="What was the infant's birth weight? ", help_text="Measured in Kilograms (kg)") infant_length = models.DecimalField( max_digits=4, decimal_places=2, validators=[MinValueValidator(0), MaxValueValidator(90)], verbose_name="What was the infant's length at birth? ", help_text="Measured in centimeters, (cm)") head_circumference = models.DecimalField( max_digits=4, decimal_places=2, validators=[MinValueValidator(0), MaxValueValidator(41)], verbose_name="What was the head circumference in centimeters? ", help_text="Measured in centimeters, (cm)") apgar_score = models.CharField( max_length=3, choices=YES_NO, verbose_name="Was Apgar Score performed? ", help_text="If 'No' go to question 10. Otherwise continue") apgar_score_min_1 = models.IntegerField( verbose_name="At 1 minute: ", help_text="", blank=True, null=True, validators=[MaxValueValidator(10), MinValueValidator(0)]) apgar_score_min_5 = models.IntegerField( verbose_name="At 5 minutes: ", help_text="", blank=True, null=True, validators=[MaxValueValidator(10), MinValueValidator(0)]) apgar_score_min_10 = models.IntegerField( verbose_name="At 10 minutes: ", help_text="", blank=True, null=True, validators=[MaxValueValidator(10), MinValueValidator(0)]) congenital_anomalities = models.CharField( max_length=3, choices=YES_NO, verbose_name="Were any congenital anomalies identified? ", help_text="If 'Yes' please complete the Congenital Anomalies Form",) other_birth_info = models.TextField( max_length=250, verbose_name="Other birth information ", blank=True, null=True) class Meta: app_label = 'td_infant' verbose_name = "Infant Birth: Data" verbose_name_plural = "Infant Birth: Data"
gpl-2.0
-4,537,329,226,076,851,700
31.036145
76
0.620158
false
EnriqueSoria/Series-my
series.py
1
8682
# -*- coding: utf-8 -*- directorios = \ r''' D:/Series '''.split('\n') ''' Traducción para algunos géneros ''' gen = { 'Crime': u'Crimen', 'Action': u'Acción', 'Drama': u'Drama', 'Comedy': u'Comedia', 'Adventure': u'Aventuras', 'Thriller': u'Thriller' } ############################################################################## ' HTML ' ############################################################################## html_header = u'''<!DOCTYPE html><html lang="es"><head> <meta charset="utf-8"><meta http-equiv="X-UA-Compatible" content="IE=edge"> <meta name="viewport" content="width=device-width, initial-scale=1"> <meta name="description" content=""><meta name="author" content=""><link rel="icon" href="favicon.ico"><title>Series</title> <link href="css/bootstrap.min.css" rel="stylesheet"><link href="css/jumbotron-narrow.css" rel="stylesheet"> </head><body> <h1 class="header" align="center">Series<br></h1><div>''' html_serie_row = '''<div class="row">''' html_serie = u''' <!--- Serie ---> <div class="col-xs-4"> <div class="row"> <div class="col-xs-4"><img src="{img}" alt="{titulo}" class="img-thumbnail"></div> <div class="col-xs-8" align="left"> <h2>{titulo} ({anyo})</h2> <ul> <li><b>Genero</b>: {genero}</li> <li><b>Temporadas</b>: {temporadas}</li> <li><b>Mas info</b>: {masinfo}</li> </ul><br> <p><a class="btn btn-info" data-toggle='collapse' data-target="#{toggle}" aria-expanded="false" aria-controls="{toggle}">Ver capítulos</a></p> <div class="collapse" id="{toggle}"> <div class="well"> {enlaces} </div> </div> </div> </div> </div> ''' html_serie_finrow = '''</div>''' html_season = u'''<a href='#'>%s</a>''' html_footer = u'''<footer class="footer"></footer></div> <script src="//ajax.googleapis.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script> <!-- Latest compiled and minified CSS --> <link rel="stylesheet" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.1/css/bootstrap.min.css"> <!-- Optional theme --> <link rel="stylesheet" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.1/css/bootstrap-theme.min.css"> <!-- Latest compiled and minified JavaScript --> <script src="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.1/js/bootstrap.min.js"></script> </body></html>''' def series_links(d): ''' Devuelve una lista de links a los capítulos de una temporada de una serie concreta. Buscamos patrones comunes: 1x01, S01E03, 101... ''' path = d[u'path'] patterns = patterns = [ \ # Del tipo: 1x01, 12x24 '(\d{1,2}x\d\d)', # S01E01, S12E24 '(S\d\dE\d\d)', # 101, 1224 '(\d{3,4})'] patterns = [re.compile(regex) for regex in patterns] capitulos = [] for temporada in [x for x in ls(path) if not '.' in x]: for capitulo in ls('%s/%s' %(path,temporada)): print capitulo # 1x03 p = re.search(patterns[0], capitulo) if p and len(p.groups()): cap = p.groups()[0] capitulos.append( (cap, u'%s/%s/%s' % (utf(path), utf(temporada) , utf(capitulo) )) ) print cap continue # S01E03 p = re.search(patterns[1], capitulo) if p and len(p.groups()): cap = p.groups()[0] cap = u'%s%sx%s%s' % (cap[1] if cap[1]!=0 else '', cap[2], cap[4], cap[5]) capitulos.append( ( cap, u'%s/%s/%s' % (utf(path), utf(temporada) , utf(capitulo)) )) print cap continue # 103 p = re.search(patterns[2], capitulo) if p and len(p.groups()): cap = p.groups()[0] if len(cap)==3: cap = u'%sx%s%s' % (cap[0], cap[1], cap[2]) else: cap = u'%s%sx%s%s' % (cap[0], cap[1], cap[2], cap[3]) capitulos.append( ( cap, u'%s/%s/%s' % (utf(path), utf(temporada) , utf(capitulo) ))) print cap continue # Si tiene algun numero lo añado if re.search('\d', capitulo): capitulos.append( ( capitulo, u'%s/%s/%s' % (path, temporada, capitulo) ) ) return capitulos def serie_HTML(d, download=False): ''' Devuelve el HTML para una determinada serie ''' return html_serie.format( img = d[u'img'] if not download else 'imgs/%s.jpg' % download_image(d), titulo = d[u'name'].decode('utf-8', 'replace'), anyo = d[u'year'], genero = gen[d[u'maingenre']], temporadas = u' '.join( [html_season % idx for idx in xrange(1,d[u'seasons']+1)]), masinfo = u'', toggle = d[u'name'].decode('utf-8', 'replace').split(' ')[0], enlaces = u'<br>'.join( [(u'<a href="file:///%s">%s</a>' % (cap[1], cap[0])) for cap in series_links(d)]) ) ############################################################################## ' Funciones aux ' ############################################################################## def read(pathFNAME): ''' Abre un fichero, lo lee y devuelve un diccionario. ''' with open(pathFNAME, 'r', 'utf-8') as fn: return eval(fn.read()) def paths_de_las_series(orden=lambda (p,d): d[u'name']): ''' Buscamos por todos los directorios y nos guardamos dónde están las series de forma ordenada. ''' paths = [] for pathBase in [d for d in directorios if d]: for path in ls(pathBase): if not '.' in path: if 'info.json' in ls('%s/%s'%(pathBase, path)): # Save the path camino = '%s/%s' % (pathBase, path) inform = read('%s/info.json' % (camino)) inform[u'path'] = camino paths.append((camino, inform)) return sorted(paths, key=orden) utf = lambda x: x.decode('utf-8', 'replace') def urlify(name): ''' Devuelve una string como si fuera una URL ''' name = name#.decode('utf-8', 'replace') for l, ll in zip(u'áàéèíìóòúù:',u'aaeeiioouu_'): name = name.replace(l,ll) return (name.encode('ASCII', 'replace')).replace(' ', '-') def download_image(d): ''' Descarga la imagen de la serie ''' # Nombre del fichero fName = urlify(d[u'name']) # Comprueba si ya está descargada if ('%s.jpg' % fName) in ls('D:/Series/_web/imgs/'): pass else: call("wget %s -O %s.jpg" % (d[u'poster'][u'large'], fName) ) sleep(2) mv('%s.jpg' % fName, 'D:/Series/_web/imgs/%s.jpg' % fName) return fName ############################################################################## ' Main code ' ############################################################################## if __name__=='__main__': ''' Código principal ''' from shutil import move as mv from os import listdir as ls from time import sleep from subprocess import call import re import codecs open = codecs.open ''' Creamos el HTML ''' html = html_header ps = paths_de_las_series() la, lb, lc = len(ps[0::3]), len(ps[1::3]), len(ps[2::3]) for a, b, c in zip( ps[0::3] , \ ps[1::3] + ([0] if la>lb else []), \ ps[2::3] + ([0] if la>lc else [])): html += html_serie_row html += serie_HTML(a[1]) if a else '' html += serie_HTML(b[1]) if b else '' html += serie_HTML(c[1]) if c else '' html += html_serie_finrow html += html_footer ''' Guardamos el HTML ''' location = r'./_web/index.html' with open(location, 'w', 'utf-8') as f: f.write(html)
mit
3,314,433,357,700,545,500
35.70339
276
0.448857
false
advisory/djangosaml2_tenant
setup.py
1
1850
# Copyright (C) 2015 Education Advisory Board # Copyright (C) 2011-2012 Yaco Sistemas # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os from setuptools import setup, find_packages def read(*rnames): return open(os.path.join(os.path.dirname(__file__), *rnames)).read() setup( name='djangosaml2_tenant', version='0.22.0', description='pysaml2 integration for multi-tenant in Django', long_description='\n\n'.join([read('README'), read('CHANGES')]), classifiers=[ "Development Status :: 3 - Alpha", "Environment :: Web Environment", "Intended Audience :: Developers", "Operating System :: OS Independent", "Programming Language :: Python", "Topic :: Internet :: WWW/HTTP", "Topic :: Internet :: WWW/HTTP :: WSGI", "Topic :: Security", "Topic :: Software Development :: Libraries :: Application Frameworks", ], keywords="django,pysaml2,saml2,federated authentication,multi-tenant", author="Education Advisory Board", author_email="[email protected]", url="https://github.com/advisory/djangosaml2_tenant", license='Apache 2.0', packages=find_packages(), include_package_data=True, zip_safe=False, install_requires=[ 'pysaml2==2.2.0', 'python-memcached==1.48', ], )
apache-2.0
5,805,203,127,526,979,000
33.90566
79
0.668649
false
Adamssss/projectEuler
Problem 001-150 Python/pb050.py
1
1068
import math import time t1 = time.time() prime = [2,3,5] primen = 2 while primen < 547: b = prime[primen] t = 1 while (t == 1): b = b+2 i = 0 t = 0 while (prime[i]*prime[i] < b)and (t == 0): i=i+1 if (b%prime[i] == 0): t = 1 if (t == 0): primen += 1 prime.append(b) # define a method to check if it is a prime def isPrime(num): if num%2 == 0: return False i = 3 while i < math.sqrt(num): if num%i == 0: return False i += 2 return True # first 546 consective prime sum is the greatest less than 1 million def sumOf(start,number): total = 0 i = 0 while i<number: total += prime[start+i] i += 1 return total # print(sumOf(0,546)) for i in range(0,500): for j in range(0,i+1): test = sumOf(j,546-i) if isPrime(test): break if isPrime(test): print (test) break print("time:",time.time()-t1)
mit
1,853,741,059,998,883,600
17.736842
69
0.47191
false
angadpc/Alexa-Project-
twilio/rest/api/v2010/account/available_phone_number/local.py
1
16142
# coding=utf-8 """ This code was generated by \ / _ _ _| _ _ | (_)\/(_)(_|\/| |(/_ v1.0.0 / / """ from twilio.base import deserialize from twilio.base import values from twilio.base.instance_resource import InstanceResource from twilio.base.list_resource import ListResource from twilio.base.page import Page class LocalList(ListResource): def __init__(self, version, account_sid, country_code): """ Initialize the LocalList :param Version version: Version that contains the resource :param account_sid: The 34 character string that uniquely identifies your account. :param country_code: The ISO Country code to lookup phone numbers for. :returns: twilio.rest.api.v2010.account.available_phone_number.local.LocalList :rtype: twilio.rest.api.v2010.account.available_phone_number.local.LocalList """ super(LocalList, self).__init__(version) # Path Solution self._solution = { 'account_sid': account_sid, 'country_code': country_code, } self._uri = '/Accounts/{account_sid}/AvailablePhoneNumbers/{country_code}/Local.json'.format(**self._solution) def stream(self, area_code=values.unset, contains=values.unset, sms_enabled=values.unset, mms_enabled=values.unset, voice_enabled=values.unset, exclude_all_address_required=values.unset, exclude_local_address_required=values.unset, exclude_foreign_address_required=values.unset, beta=values.unset, near_number=values.unset, near_lat_long=values.unset, distance=values.unset, in_postal_code=values.unset, in_region=values.unset, in_rate_center=values.unset, in_lata=values.unset, limit=None, page_size=None): """ Streams LocalInstance records from the API as a generator stream. This operation lazily loads records as efficiently as possible until the limit is reached. The results are returned as a generator, so this operation is memory efficient. :param unicode area_code: The area_code :param unicode contains: The contains :param bool sms_enabled: The sms_enabled :param bool mms_enabled: The mms_enabled :param bool voice_enabled: The voice_enabled :param bool exclude_all_address_required: The exclude_all_address_required :param bool exclude_local_address_required: The exclude_local_address_required :param bool exclude_foreign_address_required: The exclude_foreign_address_required :param bool beta: The beta :param unicode near_number: The near_number :param unicode near_lat_long: The near_lat_long :param unicode distance: The distance :param unicode in_postal_code: The in_postal_code :param unicode in_region: The in_region :param unicode in_rate_center: The in_rate_center :param unicode in_lata: The in_lata :param int limit: Upper limit for the number of records to return. stream() guarantees to never return more than limit. Default is no limit :param int page_size: Number of records to fetch per request, when not set will use the default value of 50 records. If no page_size is defined but a limit is defined, stream() will attempt to read the limit with the most efficient page size, i.e. min(limit, 1000) :returns: Generator that will yield up to limit results :rtype: list[twilio.rest.api.v2010.account.available_phone_number.local.LocalInstance] """ limits = self._version.read_limits(limit, page_size) page = self.page( area_code=area_code, contains=contains, sms_enabled=sms_enabled, mms_enabled=mms_enabled, voice_enabled=voice_enabled, exclude_all_address_required=exclude_all_address_required, exclude_local_address_required=exclude_local_address_required, exclude_foreign_address_required=exclude_foreign_address_required, beta=beta, near_number=near_number, near_lat_long=near_lat_long, distance=distance, in_postal_code=in_postal_code, in_region=in_region, in_rate_center=in_rate_center, in_lata=in_lata, page_size=limits['page_size'], ) return self._version.stream(page, limits['limit'], limits['page_limit']) def list(self, area_code=values.unset, contains=values.unset, sms_enabled=values.unset, mms_enabled=values.unset, voice_enabled=values.unset, exclude_all_address_required=values.unset, exclude_local_address_required=values.unset, exclude_foreign_address_required=values.unset, beta=values.unset, near_number=values.unset, near_lat_long=values.unset, distance=values.unset, in_postal_code=values.unset, in_region=values.unset, in_rate_center=values.unset, in_lata=values.unset, limit=None, page_size=None): """ Lists LocalInstance records from the API as a list. Unlike stream(), this operation is eager and will load `limit` records into memory before returning. :param unicode area_code: The area_code :param unicode contains: The contains :param bool sms_enabled: The sms_enabled :param bool mms_enabled: The mms_enabled :param bool voice_enabled: The voice_enabled :param bool exclude_all_address_required: The exclude_all_address_required :param bool exclude_local_address_required: The exclude_local_address_required :param bool exclude_foreign_address_required: The exclude_foreign_address_required :param bool beta: The beta :param unicode near_number: The near_number :param unicode near_lat_long: The near_lat_long :param unicode distance: The distance :param unicode in_postal_code: The in_postal_code :param unicode in_region: The in_region :param unicode in_rate_center: The in_rate_center :param unicode in_lata: The in_lata :param int limit: Upper limit for the number of records to return. list() guarantees never to return more than limit. Default is no limit :param int page_size: Number of records to fetch per request, when not set will use the default value of 50 records. If no page_size is defined but a limit is defined, list() will attempt to read the limit with the most efficient page size, i.e. min(limit, 1000) :returns: Generator that will yield up to limit results :rtype: list[twilio.rest.api.v2010.account.available_phone_number.local.LocalInstance] """ return list(self.stream( area_code=area_code, contains=contains, sms_enabled=sms_enabled, mms_enabled=mms_enabled, voice_enabled=voice_enabled, exclude_all_address_required=exclude_all_address_required, exclude_local_address_required=exclude_local_address_required, exclude_foreign_address_required=exclude_foreign_address_required, beta=beta, near_number=near_number, near_lat_long=near_lat_long, distance=distance, in_postal_code=in_postal_code, in_region=in_region, in_rate_center=in_rate_center, in_lata=in_lata, limit=limit, page_size=page_size, )) def page(self, area_code=values.unset, contains=values.unset, sms_enabled=values.unset, mms_enabled=values.unset, voice_enabled=values.unset, exclude_all_address_required=values.unset, exclude_local_address_required=values.unset, exclude_foreign_address_required=values.unset, beta=values.unset, near_number=values.unset, near_lat_long=values.unset, distance=values.unset, in_postal_code=values.unset, in_region=values.unset, in_rate_center=values.unset, in_lata=values.unset, page_token=values.unset, page_number=values.unset, page_size=values.unset): """ Retrieve a single page of LocalInstance records from the API. Request is executed immediately :param unicode area_code: The area_code :param unicode contains: The contains :param bool sms_enabled: The sms_enabled :param bool mms_enabled: The mms_enabled :param bool voice_enabled: The voice_enabled :param bool exclude_all_address_required: The exclude_all_address_required :param bool exclude_local_address_required: The exclude_local_address_required :param bool exclude_foreign_address_required: The exclude_foreign_address_required :param bool beta: The beta :param unicode near_number: The near_number :param unicode near_lat_long: The near_lat_long :param unicode distance: The distance :param unicode in_postal_code: The in_postal_code :param unicode in_region: The in_region :param unicode in_rate_center: The in_rate_center :param unicode in_lata: The in_lata :param str page_token: PageToken provided by the API :param int page_number: Page Number, this value is simply for client state :param int page_size: Number of records to return, defaults to 50 :returns: Page of LocalInstance :rtype: twilio.rest.api.v2010.account.available_phone_number.local.LocalPage """ params = values.of({ 'AreaCode': area_code, 'Contains': contains, 'SmsEnabled': sms_enabled, 'MmsEnabled': mms_enabled, 'VoiceEnabled': voice_enabled, 'ExcludeAllAddressRequired': exclude_all_address_required, 'ExcludeLocalAddressRequired': exclude_local_address_required, 'ExcludeForeignAddressRequired': exclude_foreign_address_required, 'Beta': beta, 'NearNumber': near_number, 'NearLatLong': near_lat_long, 'Distance': distance, 'InPostalCode': in_postal_code, 'InRegion': in_region, 'InRateCenter': in_rate_center, 'InLata': in_lata, 'PageToken': page_token, 'Page': page_number, 'PageSize': page_size, }) response = self._version.page( 'GET', self._uri, params=params, ) return LocalPage(self._version, response, self._solution) def __repr__(self): """ Provide a friendly representation :returns: Machine friendly representation :rtype: str """ return '<Twilio.Api.V2010.LocalList>' class LocalPage(Page): def __init__(self, version, response, solution): """ Initialize the LocalPage :param Version version: Version that contains the resource :param Response response: Response from the API :param account_sid: The 34 character string that uniquely identifies your account. :param country_code: The ISO Country code to lookup phone numbers for. :returns: twilio.rest.api.v2010.account.available_phone_number.local.LocalPage :rtype: twilio.rest.api.v2010.account.available_phone_number.local.LocalPage """ super(LocalPage, self).__init__(version, response) # Path Solution self._solution = solution def get_instance(self, payload): """ Build an instance of LocalInstance :param dict payload: Payload response from the API :returns: twilio.rest.api.v2010.account.available_phone_number.local.LocalInstance :rtype: twilio.rest.api.v2010.account.available_phone_number.local.LocalInstance """ return LocalInstance( self._version, payload, account_sid=self._solution['account_sid'], country_code=self._solution['country_code'], ) def __repr__(self): """ Provide a friendly representation :returns: Machine friendly representation :rtype: str """ return '<Twilio.Api.V2010.LocalPage>' class LocalInstance(InstanceResource): def __init__(self, version, payload, account_sid, country_code): """ Initialize the LocalInstance :returns: twilio.rest.api.v2010.account.available_phone_number.local.LocalInstance :rtype: twilio.rest.api.v2010.account.available_phone_number.local.LocalInstance """ super(LocalInstance, self).__init__(version) # Marshaled Properties self._properties = { 'friendly_name': payload['friendly_name'], 'phone_number': payload['phone_number'], 'lata': payload['lata'], 'rate_center': payload['rate_center'], 'latitude': deserialize.decimal(payload['latitude']), 'longitude': deserialize.decimal(payload['longitude']), 'region': payload['region'], 'postal_code': payload['postal_code'], 'iso_country': payload['iso_country'], 'address_requirements': payload['address_requirements'], 'beta': payload['beta'], 'capabilities': payload['capabilities'], } # Context self._context = None self._solution = { 'account_sid': account_sid, 'country_code': country_code, } @property def friendly_name(self): """ :returns: The friendly_name :rtype: unicode """ return self._properties['friendly_name'] @property def phone_number(self): """ :returns: The phone_number :rtype: unicode """ return self._properties['phone_number'] @property def lata(self): """ :returns: The lata :rtype: unicode """ return self._properties['lata'] @property def rate_center(self): """ :returns: The rate_center :rtype: unicode """ return self._properties['rate_center'] @property def latitude(self): """ :returns: The latitude :rtype: unicode """ return self._properties['latitude'] @property def longitude(self): """ :returns: The longitude :rtype: unicode """ return self._properties['longitude'] @property def region(self): """ :returns: The region :rtype: unicode """ return self._properties['region'] @property def postal_code(self): """ :returns: The postal_code :rtype: unicode """ return self._properties['postal_code'] @property def iso_country(self): """ :returns: The iso_country :rtype: unicode """ return self._properties['iso_country'] @property def address_requirements(self): """ :returns: The address_requirements :rtype: unicode """ return self._properties['address_requirements'] @property def beta(self): """ :returns: The beta :rtype: bool """ return self._properties['beta'] @property def capabilities(self): """ :returns: The capabilities :rtype: unicode """ return self._properties['capabilities'] def __repr__(self): """ Provide a friendly representation :returns: Machine friendly representation :rtype: str """ return '<Twilio.Api.V2010.LocalInstance>'
mit
-3,366,049,378,486,977,000
37.070755
118
0.610767
false
r8/scrapy-kinopoisk
kinopoisk/pipelines.py
1
2920
# -*- coding: utf-8 -*- # Define your item pipelines here # # Don't forget to add your pipeline to the ITEM_PIPELINES setting # See: http://doc.scrapy.org/en/latest/topics/item-pipeline.html import os import sys import codecs from slugify import slugify from time import strptime, strftime from html2text import html2text class MarkdownPipeline(object): """Scrapy pipeline to save reviews as markdown document""" def parse_datetime(self, str_datetime): """Parse date string in russian""" dictionary = {u"января": 'Jan', u"февраля": 'Feb', u"марта": 'Mar', u"апреля": 'Apr', u"мая": 'May', u"июня": 'Jun', u"июля": 'Jul', u"августа": 'Aug', u"сентября": 'Sep', u"октября": 'Oct', u"ноября": 'Nov', u"декабря": 'Dec'} for russian, english in dictionary.items(): str_datetime = str_datetime.replace(russian, english) return strptime(str_datetime, '%d %b %Y %H:%M') def fix_typography(self, s): """Fix typographic symbols""" s = s.replace(u'\x97', u'\u2014') # Fix dashes s = s.replace(u'\x85', u'\u2026') # Fix ellipsis return s def process_item(self, item, spider): """Process and save review item""" settings = spider.settings if not os.path.exists(settings['MARKDOWN_OUTPUT']): os.mkdir(settings['MARKDOWN_OUTPUT']) file_name = strftime('%Y-%m-%d-', self.parse_datetime(item['review_datetime'][0])) + slugify(item['movie_title'][0]) + '.md' try: output_file = codecs.open(settings['MARKDOWN_OUTPUT'] + '/' + file_name, 'w', 'utf-8') except IOError: print 'Error opening target file: %s' % output_file sys.exit(1) if len(item['review_title']) > 0: title = item['review_title'][0] else: title = item['movie_title'][0] title = self.fix_typography(title) output_file.write("%s\n" % title) output_file.write("%s\n\n" % ('=' * len(title))) output_file.write("* **User Id:** %s\n" % item['user_id']) output_file.write("* **Movie Title:** %s\n" % item['movie_title'][0]) output_file.write("* **Movie Original Title:** %s\n" % item['movie_original_title'][0]) output_file.write("* **Movie Link:** [{0}]({0})\n".format(item['movie_link'][0])) output_file.write("* **Review Date:** %s\n" % item['review_datetime'][0]) output_file.write("* **Review Grade:** %s\n" % item['review_grade'][0]) output_file.write("* **Review Link:** [{0}]({0})\n".format(item['review_link'])) output_file.write("\n") review_text = html2text(item['review_text']) review_text = self.fix_typography(review_text) output_file.write(review_text) output_file.close() return item
gpl-3.0
-5,104,314,660,100,140,000
36.012987
132
0.579298
false
asphalt-framework/asphalt-wamp
tests/test_client.py
1
15009
import asyncio import logging import os import re from typing import Dict, Any import pytest from autobahn.wamp import ApplicationError from autobahn.wamp.types import Challenge, PublishOptions, CallOptions from asphalt.core import executor, Context, qualified_name from asphalt.exceptions import ExtrasProvider from asphalt.exceptions.api import ExceptionReporter from asphalt.wamp.client import WAMPClient, AsphaltSession, ConnectionError from asphalt.wamp.events import SessionJoinEvent, SessionLeaveEvent from asphalt.wamp.extras_providers import WAMPExtrasProvider class TestAsphaltSession: @pytest.fixture def session(self, request): return AsphaltSession('default', request.param, 'foo', 'bar') @pytest.mark.parametrize('session', ['ticket'], indirect=['session']) def test_challenge_mismatch(self, session): challenge = Challenge('wampcra') exc = pytest.raises(ConnectionError, session.onChallenge, challenge) assert exc.match('expected authentication method "ticket" but received a "wampcra" ' 'challenge instead') @pytest.mark.parametrize('session', ['ticket'], indirect=['session']) def test_ticket_challenge(self, session): challenge = Challenge('ticket') assert session.onChallenge(challenge) == 'bar' @pytest.mark.parametrize('session', ['wampcra'], indirect=['session']) def test_wampcra_challenge(self, session): challenge = Challenge('wampcra', {'challenge': b'\xff\x00345jfsdf'}) retval = session.onChallenge(challenge) assert isinstance(retval, bytes) @pytest.mark.parametrize('session', ['wampcra'], indirect=['session']) def test_wampcra_salted_challenge(self, session): challenge = Challenge('wampcra', {'challenge': b'\xff\x00345jfsdf', 'salt': '5ihod', 'iterations': 5, 'keylen': 32}) retval = session.onChallenge(challenge) assert isinstance(retval, bytes) class TestWAMPClient: @pytest.fixture def otherclient(self, request, event_loop, context): kwargs = getattr(request, 'param', {}) kwargs.setdefault('host', os.getenv('CROSSBAR_HOST', 'localhost')) kwargs.setdefault('max_reconnection_attempts', 0) client = WAMPClient(**kwargs) event_loop.run_until_complete(client.start(context)) yield client event_loop.run_until_complete(client.stop()) @pytest.mark.asyncio async def test_client_events(self, wampclient: WAMPClient): def listener(event): events.append(event) events = [] wampclient.realm_joined.connect(listener) wampclient.realm_left.connect(listener) await wampclient.connect() await wampclient.stop() assert len(events) == 2 assert isinstance(events[0], SessionJoinEvent) assert isinstance(events[1], SessionLeaveEvent) @pytest.mark.parametrize('connect_first', [False, True]) @pytest.mark.asyncio async def test_call(self, wampclient: WAMPClient, connect_first): if connect_first: await wampclient.connect() result = await wampclient.call('wamp.session.count') assert result == 1 @pytest.mark.asyncio async def test_register_call_progress(self, wampclient: WAMPClient): async def progressive_procedure(ctx, start, end): for value in range(start, end): ctx.progress(value) return end progress_values = [] await wampclient.register(progressive_procedure, 'test.progressive') result = await wampclient.call('test.progressive', 2, 6, options=CallOptions(on_progress=progress_values.append)) assert progress_values == [2, 3, 4, 5] assert result == 6 @pytest.mark.asyncio async def test_register_call_blocking(self, wampclient: WAMPClient): @executor def add(ctx, x, y): return x + y await wampclient.register(add, 'test.add') result = await wampclient.call('test.add', 2, 3) assert result == 5 @pytest.mark.asyncio async def test_register_call_plain(self, wampclient: WAMPClient): def add(ctx, x, y): return x + y await wampclient.register(add, 'test.add') result = await wampclient.call('test.add', 2, 3) assert result == 5 @pytest.mark.parametrize('wampclient', [ {'auth_method': 'wampcra', 'auth_id': 'testuser', 'auth_secret': 'testpass'} ], indirect=True) @pytest.mark.asyncio async def test_auth_wampcra(self, wampclient: WAMPClient): await wampclient.connect() result = await wampclient.call('wamp.session.get', wampclient.session_id) assert result['authid'] == wampclient.details.authid == 'testuser' @pytest.mark.parametrize('wampclient', [ {'auth_method': 'ticket', 'auth_id': 'device1', 'auth_secret': 'abc123'} ], indirect=True) @pytest.mark.asyncio async def test_auth_ticket(self, wampclient: WAMPClient): await wampclient.connect() result = await wampclient.call('wamp.session.get', wampclient.session_id) assert result['authid'] == wampclient.details.authid == 'device1' @pytest.mark.parametrize('wampclient', [ {'auth_method': 'ticket', 'auth_id': 'device1', 'auth_secret': 'abc124'} ], indirect=True) @pytest.mark.asyncio async def test_auth_failure(self, wampclient: WAMPClient): with pytest.raises(ConnectionError) as exc: await wampclient.connect() assert exc.match('ticket in static WAMP-Ticket authentication is invalid') @pytest.mark.asyncio async def test_publish_autoconnect(self, wampclient: WAMPClient): result = await wampclient.publish('test.topic', options=PublishOptions(acknowledge=True)) assert result @pytest.mark.parametrize('connect_first', [False, True]) @pytest.mark.asyncio async def test_publish_subscribe(self, wampclient: WAMPClient, connect_first): async def subscriber(ctx, *args): await q.put(args) raise Exception() q = asyncio.Queue() if connect_first: await wampclient.connect() await wampclient.subscribe(subscriber, 'test.topic') publication_id = await wampclient.publish( 'test.topic', 2, 3, options=PublishOptions(exclude_me=False, acknowledge=True)) assert isinstance(publication_id, int) event = await asyncio.wait_for(q.get(), 2) assert event == (2, 3) @pytest.mark.parametrize('connect_first', [False, True]) @pytest.mark.asyncio async def test_map_exception(self, wampclient: WAMPClient, connect_first): class TestException(Exception): pass async def error(ctx): raise TestException if connect_first: await wampclient.connect() wampclient.map_exception(TestException, 'test.exception') await wampclient.register(error, 'test.error') with pytest.raises(TestException): await wampclient.call('test.error') @pytest.mark.asyncio async def test_connect_procedure_registration_failure(self, wampclient: WAMPClient, otherclient: WAMPClient): """ Test that a failure in registering the registry's procedures causes the connection attempt to fail. """ await otherclient.register(lambda ctx: None, 'blah') with pytest.raises(ApplicationError): await wampclient.register(lambda ctx: None, 'blah') assert wampclient.session_id is None @pytest.mark.parametrize('wampclient', [ {'port': 8081, 'max_reconnection_attempts': 1, 'reconnect_delay': 0.3}], indirect=True) @pytest.mark.asyncio async def test_connect_retry(self, wampclient: WAMPClient, caplog): """Test that if the client can't connect, it will retry after a delay.""" with pytest.raises(ConnectionRefusedError): await wampclient.connect() messages = [record.message for record in caplog.records if record.name == 'asphalt.wamp.client' and record.message.startswith('Connection failed')] assert len(messages) == 1 assert re.fullmatch("Connection failed \(attempt 1\): ConnectionRefusedError\(.+?\); " "reconnecting in 0.3 seconds", messages[0]) @pytest.mark.asyncio async def test_close_wait_handlers(self, event_loop, wampclient: WAMPClient, otherclient: WAMPClient, caplog): """ Test that WAMPClient.close() waits for any running handler tasks to finish before disconnecting from the router. """ async def sleep_subscriber(ctx): nonlocal close_task close_task = event_loop.create_task(wampclient.stop()) await asyncio.sleep(0.3) async def sleep_sum(ctx, x, y): await asyncio.sleep(0.3) return x + y caplog.set_level(logging.INFO) close_task = None await wampclient.register(sleep_sum) await wampclient.subscribe(sleep_subscriber, 'testtopic') await otherclient.publish('testtopic', options=PublishOptions(acknowledge=True)) result = await otherclient.call('sleep_sum', 1, 2) assert result == 3 await close_task messages = [record.message for record in caplog.records if record.name == 'asphalt.wamp.client' and record.message.startswith('Waiting for')] assert messages == ['Waiting for 2 WAMP subscription/procedure handler tasks to finish'] @pytest.mark.asyncio async def test_connect_twice(self, wampclient: WAMPClient): """ Test that when connect() is called while connected, it just returns a Future that resolves immediately. """ retval = wampclient.connect() assert isinstance(retval, asyncio.Task) await retval retval = wampclient.connect() assert isinstance(retval, asyncio.Future) await retval def test_session_id_not_connected(self, wampclient: WAMPClient): assert wampclient.session_id is None def test_session_details_not_connected(self, wampclient: WAMPClient): assert wampclient.details is None @pytest.mark.parametrize('custom_exception', [False, True]) @pytest.mark.asyncio async def test_report_applicationerror(self, wampclient: WAMPClient, context: Context, custom_exception): class DummyReporter(ExceptionReporter): def report_exception(self, ctx: Context, exception: BaseException, message: str, extra: Dict[str, Any]) -> None: errors.append((exception, message, extra)) class CustomError(Exception): pass def handler(ctx): if custom_exception: raise CustomError else: raise ApplicationError('dummy.error') errors = [] context.add_resource(DummyReporter(), types=[ExceptionReporter]) wampclient.map_exception(CustomError, 'dummy.error') await wampclient.register(handler, 'dummyprocedure') with pytest.raises(CustomError): await wampclient.call('dummyprocedure') assert not errors @pytest.mark.parametrize('wampclient', [ {'auth_method': 'ticket', 'auth_id': 'device1', 'auth_secret': 'abc123'} ], indirect=True) @pytest.mark.asyncio async def test_sentry_extras_provider_procedure(self, wampclient: WAMPClient, context: Context, monkeypatch): class DummyReporter(ExceptionReporter): def report_exception(self, ctx: Context, exception: BaseException, message: str, extra: Dict[str, Any]) -> None: errors.append((exception, message, extra)) def handler(ctx): raise Exception('foo') errors = [] context.add_resource(DummyReporter(), types=[ExceptionReporter]) context.add_resource(WAMPExtrasProvider(), types=[ExtrasProvider]) await wampclient.register(handler, 'dummyprocedure') monkeypatch.setattr('asphalt.wamp.extras_providers.SENTRY_CLASS_NAME', qualified_name(DummyReporter)) with pytest.raises(ApplicationError): await wampclient.call('dummyprocedure') assert len(errors) == 1 exc, message, extra = errors[0] assert type(exc) is Exception assert str(exc) == 'foo' assert message == "Error running handler for procedure 'dummyprocedure'" assert extra == {'extra': {'procedure': 'dummyprocedure'}, 'user_context': {'auth_role': 'authorized_users', 'id': 'device1', 'session_id': wampclient.session_id} } @pytest.mark.parametrize('wampclient', [ {'auth_method': 'ticket', 'auth_id': 'device1', 'auth_secret': 'abc123'} ], indirect=True) @pytest.mark.asyncio async def test_sentry_extras_provider_subscriber(self, wampclient: WAMPClient, context: Context, monkeypatch): class DummyReporter(ExceptionReporter): def report_exception(self, ctx: Context, exception: BaseException, message: str, extra: Dict[str, Any]) -> None: errors.append((exception, message, extra)) def handler(ctx): ctx.loop.call_soon(event.set) raise Exception('foo') event = asyncio.Event() errors = [] context.add_resource(DummyReporter(), types=[ExceptionReporter]) context.add_resource(WAMPExtrasProvider(), types=[ExtrasProvider]) await wampclient.subscribe(handler, 'dummytopic') monkeypatch.setattr('asphalt.wamp.extras_providers.SENTRY_CLASS_NAME', qualified_name(DummyReporter)) await wampclient.publish('dummytopic', options=dict(acknowledge=True, exclude_me=False)) await event.wait() assert len(errors) == 1 exc, message, extra = errors[0] assert type(exc) is Exception assert str(exc) == 'foo' assert message == "Error running subscription handler for topic 'dummytopic'" assert extra == {'extra': {'topic': 'dummytopic'}, 'user_context': {'auth_role': 'authorized_users', 'id': 'device1', 'session_id': wampclient.session_id} }
apache-2.0
-2,718,282,172,219,678,700
40.233516
98
0.62156
false
datagutten/comics
comics/accounts/urls.py
1
4857
from django.conf import settings from django.conf.urls import patterns, url from django.contrib.auth import views as auth_views from django.views.generic.base import TemplateView from invitation import views as invitation_views from registration import views as reg_views from comics.accounts.forms import ( AuthenticationForm, PasswordResetForm, RegistrationForm) from comics.accounts import views as account_views urlpatterns = patterns( '', ### django-invitation url(r'^invite/complete/$', TemplateView.as_view( template_name='invitation/invitation_complete.html'), { 'extra_context': {'active': { 'invite': True, }}, }, name='invitation_complete'), url(r'^invite/$', invitation_views.invite, { 'extra_context': {'active': { 'invite': True, }}, }, name='invitation_invite'), url(r'^invited/(?P<invitation_key>\w+)/$', invitation_views.invited, { 'extra_context': {'active': {'register': True}}, }, name='invitation_invited'), url(r'^register/$', invitation_views.register, { 'backend': 'comics.accounts.backends.RegistrationBackend', 'form_class': RegistrationForm, 'extra_context': {'active': {'register': True}}, }, name='registration_register'), ### django-registration #url(r'^register/$', # reg_views.register, # { # 'backend': 'comics.accounts.backends.RegistrationBackend', # 'extra_context': {'active': {'register': True}}, # }, # name='registration_register'), url(r'^register/complete/$', TemplateView.as_view( template_name='registration/registration_complete.html'), name='registration_complete'), url(r'^register/closed/$', TemplateView.as_view( template_name='registration/registration_closed.html'), name='registration_disallowed'), url(r'^activate/complete/$', TemplateView.as_view( template_name='registration/activation_complete.html'), name='registration_activation_complete'), url(r'^activate/(?P<activation_key>\w+)/$', reg_views.activate, {'backend': 'comics.accounts.backends.RegistrationBackend'}, name='registration_activate'), ### django.contrib.auth url(r'^login/$', auth_views.login, { 'authentication_form': AuthenticationForm, 'extra_context': {'active': {'login': True}}, 'template_name': 'auth/login.html', }, name='login'), url(r'^logout/$', auth_views.logout, {'next_page': '/account/login/'}, name='logout'), url(r'^password/change/$', auth_views.password_change, { 'template_name': 'auth/password_change.html', 'extra_context': {'active': { 'account': True, 'password_change': True, }}, }, name='password_change'), url(r'^password/change/done/$', auth_views.password_change_done, {'template_name': 'auth/password_change_done.html'}, name='password_change_done'), url(r'^password/reset/$', auth_views.password_reset, { 'template_name': 'auth/password_reset.html', 'email_template_name': 'auth/password_reset_email.txt', 'subject_template_name': 'auth/password_reset_email_subject.txt', 'password_reset_form': PasswordResetForm, }, name='password_reset'), url(r'^password/reset/confirm/(?P<uidb64>[0-9A-Za-z]+)-(?P<token>.+)/$', auth_views.password_reset_confirm, {'template_name': 'auth/password_reset_confirm.html'}, name='password_reset_confirm'), url(r'^password/reset/complete/$', auth_views.password_reset_complete, {'template_name': 'auth/password_reset_complete.html'}, name='password_reset_complete'), url(r'^password/reset/done/$', auth_views.password_reset_done, {'template_name': 'auth/password_reset_done.html'}, name='password_reset_done'), ### comics.accounts url(r'^$', account_views.account_details, name='account'), url(r'^secret-key/$', account_views.secret_key, name='secret_key'), url(r'^toggle-comic/$', account_views.mycomics_toggle_comic, name='toggle_comic'), url(r'^edit-comics/$', account_views.mycomics_edit_comics, name='edit_comics'), ) if 'comics.sets' in settings.INSTALLED_APPS: urlpatterns += patterns( '', url(r'^import-set/$', account_views.mycomics_import_named_set, name='import_named_set'), )
agpl-3.0
-4,966,277,444,263,677,000
31.597315
78
0.579576
false
imoverclocked/ServoBot
apwm_home/controller/controller/wsgi.py
1
1142
""" WSGI config for controller project. This module contains the WSGI application used by Django's development server and any production WSGI deployments. It should expose a module-level variable named ``application``. Django's ``runserver`` and ``runfcgi`` commands discover this application via the ``WSGI_APPLICATION`` setting. Usually you will have the standard Django WSGI application here, but it also might make sense to replace the whole Django WSGI application with a custom one that later delegates to the Django one. For example, you could introduce WSGI middleware here, or combine a Django application with an application of another framework. """ import os os.environ.setdefault("DJANGO_SETTINGS_MODULE", "controller.settings") # This application object is used by any WSGI server configured to use this # file. This includes Django's development server, if the WSGI_APPLICATION # setting points here. from django.core.wsgi import get_wsgi_application application = get_wsgi_application() # Apply WSGI middleware here. # from helloworld.wsgi import HelloWorldApplication # application = HelloWorldApplication(application)
mit
6,876,020,816,911,958,000
39.785714
79
0.801226
false
bsquidwrd/Squid-Bot
gaming/migrations/0007_auto_20161029_2354.py
1
1089
# -*- coding: utf-8 -*- # Generated by Django 1.10.1 on 2016-10-30 06:54 from __future__ import unicode_literals from django.db import migrations, models import django.utils.timezone class Migration(migrations.Migration): dependencies = [ ('gaming', '0006_auto_20161029_2347'), ] operations = [ migrations.AlterField( model_name='channel', name='created_date', field=models.DateTimeField(default=django.utils.timezone.now), ), migrations.AlterField( model_name='channel', name='expire_date', field=models.DateTimeField(blank=True, default=django.utils.timezone.now, null=True), ), migrations.AlterField( model_name='gamesearch', name='created_date', field=models.DateTimeField(default=django.utils.timezone.now), ), migrations.AlterField( model_name='gamesearch', name='expire_date', field=models.DateTimeField(default=django.utils.timezone.now), ), ]
mit
-768,404,492,787,284,200
29.25
97
0.599633
false
hashbang/provisor
provisor/utils.py
1
1845
def drop_privileges(uid_name='nobody', gid_name='nogroup'): import grp, pwd, os, resource if os.getuid() != 0: # not root. #yolo return running_uid = pwd.getpwnam(uid_name).pw_uid running_gid = grp.getgrnam(gid_name).gr_gid os.setgroups([]) os.setgid(running_gid) os.setuid(running_uid) os.umask(0o077) resource.setrlimit(resource.RLIMIT_CORE, (0, 0)) def getch(): import sys, termios, tty fd = sys.stdin.fileno() old_settings = termios.tcgetattr(fd) try: tty.setraw(sys.stdin.fileno()) ch = sys.stdin.read(1) finally: termios.tcsetattr(fd, termios.TCSADRAIN, old_settings) return ch def validate_pubkey(value): import base64 if len(value) > 8192 or len(value) < 80: raise ValueError("Expected length to be between 80 and 8192 characters") value = value.replace("\"", "").replace("'", "").replace("\\\"", "") value = value.split(' ') types = [ 'ecdsa-sha2-nistp256', 'ecdsa-sha2-nistp384', 'ecdsa-sha2-nistp521', 'ssh-rsa', 'ssh-dss', 'ssh-ed25519' ] if value[0] not in types: raise ValueError( "Expected " + ', '.join(types[:-1]) + ', or ' + types[-1] ) try: base64.decodestring(bytes(value[1])) except TypeError: raise ValueError("Expected string of base64 encoded data") return "%s %s" % (value[0], value[1]) def validate_username(value): import re from reserved import RESERVED_USERNAMES # Regexp must be kept in sync with # https://github.com/hashbang/hashbang.sh/blob/master/src/hashbang.sh#L186-196 if re.compile(r"^[a-z][a-z0-9]{,30}$").match(value) is None: raise ValueError('Username is invalid') if value in RESERVED_USERNAMES: raise ValueError('Username is reserved') return value
mit
5,792,575,811,254,287,000
28.758065
83
0.617344
false
dirn/Simon
tests/test_meta.py
1
11888
"""Tests of the Meta class""" try: import unittest2 as unittest except ImportError: import unittest from bson import ObjectId import mock import pymongo from simon.meta import Meta def skip_with_mongoclient(f): if pymongo.version_tuple[:2] >= (2, 4): return unittest.skip('`MongoClient` is supported.') else: return f def skip_without_mongoclient(f): if pymongo.version_tuple[:2] >= (2, 4): return f else: return unittest.skip('`MongoClient` is not supported.') class TestClass(object): """This class can be used with `TestMeta` tests.""" class TestMeta(unittest.TestCase): def tearDown(self): if hasattr(TestClass, '_meta'): delattr(TestClass, '_meta') def test_add_to_original(self): """Test the `add_to_original()` method.""" meta = Meta(None) meta.add_to_original(TestClass, '_meta') # Test the default # Use assertEqual for all of these tests to make them easier to # read and maintain. self.assertEqual(meta.auto_timestamp, True) self.assertEqual(meta.class_name, 'TestClass') self.assertEqual(meta.collection, 'testclasss') self.assertEqual(meta.database, 'default') self.assertEqual(meta.field_map, {'id': '_id'}) self.assertEqual(meta.map_id, True) self.assertEqual(meta.required_fields, None) self.assertEqual(meta.sort, None) self.assertEqual(meta.typed_fields, {'_id': ObjectId}) if pymongo.version_tuple[:2] >= (2, 4): self.assertEqual(meta.write_concern, 1) else: self.assertEqual(meta.write_concern, True) self.assertFalse(hasattr(meta, 'safe')) self.assertFalse(hasattr(meta, 'w')) # core_attributes is a bit tougher to test self.assertTrue(all(k.startswith('_') for k in meta.core_attributes)) self.assertIn('_document', meta.core_attributes) self.assertIn('_meta', meta.core_attributes) # Make sure the meta attribute is removed self.assertFalse(hasattr(meta, 'meta')) # And most importantly of all... self.assertTrue(hasattr(TestClass, '_meta')) self.assertEqual(TestClass._meta, meta) def test_auto_timestamp(self): """Test the `auto_timestamp` attribute.""" meta = Meta(mock.Mock(auto_timestamp=False)) meta.add_to_original(TestClass, '_meta') self.assertFalse(TestClass._meta.auto_timestamp) def test_collection(self): """Test the `collection` attribute.""" meta = Meta(mock.Mock(collection='collection')) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.collection, 'collection') def test_database(self): """Test the `database` attribute.""" meta = Meta(mock.Mock(database='database')) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.database, 'database') def test_extra_attributes(self): """Test that extra attributes are not added.""" meta = Meta(mock.Mock(bad_attribute=1)) self.assertFalse(hasattr(meta, 'bad_attribute')) def test_field_map(self): """Test the `field_map` attribute.""" meta = Meta(mock.Mock(field_map={'fake': 'real'})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.field_map, {'fake': 'real', 'id': '_id'}) meta = Meta(mock.Mock(field_map={'fake': 'real'}, map_id=False)) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.field_map, {'fake': 'real'}) def test_field_map_typeerror(self): """Test the `field_map` attribute for `TypeError`.""" meta = Meta(mock.Mock(field_map=1)) with self.assertRaises(TypeError) as e: meta.add_to_original(TestClass, '_meta') actual = str(e.exception) expected = "'field_map' must be a dict." self.assertEqual(actual, expected) meta = Meta(mock.Mock(field_map='a')) with self.assertRaises(TypeError) as e: meta.add_to_original(TestClass, '_meta') actual = str(e.exception) expected = "'field_map' must be a dict." self.assertEqual(actual, expected) def test_init(self): """Test the `__init__()` method.""" mock_meta = mock.Mock() meta = Meta(mock_meta) # test that what you give for the meta class is used as meta self.assertEqual(meta.meta, mock_meta) # Use assertEqual for all of these tests to make them easier to # read and maintain. self.assertEqual(meta.auto_timestamp, True) self.assertEqual(meta.database, 'default') self.assertEqual(meta.field_map, {}) self.assertEqual(meta.map_id, True) self.assertEqual(meta.required_fields, None) self.assertEqual(meta.sort, None) self.assertEqual(meta.typed_fields, {}) if pymongo.version_tuple[:2] >= (2, 4): self.assertEqual(meta.write_concern, 1) else: self.assertEqual(meta.write_concern, True) self.assertFalse(hasattr(meta, 'safe')) self.assertFalse(hasattr(meta, 'w')) # make sure attributes added later haven't been added self.assertFalse(hasattr(meta, 'class_name')) self.assertFalse(hasattr(meta, 'collection')) def test_map_id(self): """Test the `map_id` attribute.""" meta = Meta(mock.Mock(map_id=False)) meta.add_to_original(TestClass, '_meta') self.assertFalse(TestClass._meta.map_id) def test_repr(self): """Test the `__repr__()` method.""" meta = Meta(None) meta.add_to_original(TestClass, '_meta') self.assertEqual('{0!r}'.format(meta), '<Meta options for TestClass>') def test_required_fields(self): """Test the `required_fields` attribute.""" # single value meta = Meta(mock.Mock(required_fields='a')) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.required_fields, ('a',)) # multiple values meta = Meta(mock.Mock(required_fields=['a', 'b'])) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.required_fields, ['a', 'b']) @skip_with_mongoclient def test_safe(self): """Test the `safe` attribute.""" meta = Meta(mock.Mock(safe=False)) meta.add_to_original(TestClass, '_meta') self.assertFalse(TestClass._meta.write_concern) @skip_without_mongoclient def test_safe_deprecationwarning(self): ("Test that `safe` triggers `DeprecationWarning` for PyMongo " "with MongoClient.") with mock.patch('simon.meta.warnings') as warnings: meta = Meta(mock.Mock(safe=True)) meta.add_to_original(TestClass, '_meta') message = 'safe has been deprecated. Please use w instead.' warnings.warn.assert_called_with(message, DeprecationWarning) def test_sort(self): """Test the `sort` attribute.""" # single value meta = Meta(mock.Mock(sort='a')) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.sort, ('a',)) # multiple values meta = Meta(mock.Mock(sort=['a', '-b'])) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.sort, ['a', '-b']) def test_str(self): """Test the `__str__()` method.""" meta = Meta(None) meta.add_to_original(TestClass, '_meta') self.assertEqual('{0!s}'.format(meta), 'TestClass.Meta') def test_typed_fields(self): """Test the `typed_fields` attribute.""" # default meta = Meta(None) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.typed_fields, {'_id': ObjectId}) # custom meta = Meta(mock.Mock(typed_fields={'a': int})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.typed_fields, {'_id': ObjectId, 'a': int}) # list meta = Meta(mock.Mock(typed_fields={'a': [int]})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.typed_fields, {'_id': ObjectId, 'a': [int]}) # nested meta = Meta(mock.Mock(typed_fields={'a.b': int})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.typed_fields, {'_id': ObjectId, 'a.b': int}) # with _id meta = Meta(mock.Mock(typed_fields={'a': int, 'id': None})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.typed_fields, {'a': int, '_id': None}) def test_typed_fields_typeerror(self): """Test the `typed_fields` attribute for `TypeError`.""" meta = Meta(mock.Mock(typed_fields={'a': 1})) with self.assertRaises(TypeError) as e: meta.add_to_original(TestClass, '_meta') actual = str(e.exception) expected = 'Fields must be a type, a typed list, or None.' self.assertEqual(actual, expected) meta = Meta(mock.Mock(typed_fields={'a': 'b'})) with self.assertRaises(TypeError) as e: meta.add_to_original(TestClass, '_meta') actual = str(e.exception) expected = 'Fields must be a type, a typed list, or None.' self.assertEqual(actual, expected) meta = Meta(mock.Mock(typed_fields={'a': ['b']})) with self.assertRaises(TypeError) as e: meta.add_to_original(TestClass, '_meta') actual = str(e.exception) expected = 'Fields must be a type, a typed list, or None.' self.assertEqual(actual, expected) def test_unicode(self): """Test the `__unicode__()` method.""" meta = Meta(None) meta.add_to_original(TestClass, '_meta') self.assertEqual(u'{0}'.format(meta), u'TestClass.Meta') @skip_without_mongoclient def test_w(self): """Test the `w` attribute.""" meta = Meta(mock.Mock(w=0)) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.write_concern, 0) def test_write_conern(self): """Test the write concern attributes.""" if pymongo.version_tuple[:2] >= (2, 4): have_attribute = 'w' have_not_attribute = 'safe' have_on = 1 have_not_on = True have_off = 0 have_not_off = False else: have_attribute = 'w' have_not_attribute = 'safe' have_on = 1 have_not_on = True have_off = 0 have_not_off = False # The correct attribute on meta = Meta(mock.Mock(**{have_attribute: have_on})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.write_concern, have_on) # The correct attribute off meta = Meta(mock.Mock(**{have_attribute: have_off})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.write_concern, have_off) # The wrong attribute on meta = Meta(mock.Mock(**{have_not_attribute: have_not_on})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.write_concern, have_on) # The wrong attribute off meta = Meta(mock.Mock(**{have_not_attribute: have_not_off})) meta.add_to_original(TestClass, '_meta') self.assertEqual(TestClass._meta.write_concern, have_off)
bsd-3-clause
-4,480,163,938,053,110,000
28.72
79
0.587904
false
abhijeet-talaulikar/Automatic-Helmet-Detection
K-Fold/Logistic_Regression.py
1
2663
import numpy as np import matplotlib.pyplot as plt from sklearn.metrics import roc_curve, auc from sklearn.model_selection import KFold from sklearn.linear_model import LogisticRegression from sklearn.metrics import * from timeit import default_timer as timer from random import randint from sklearn.feature_selection import * from sklearn.decomposition import PCA helmet_data = np.genfromtxt ('helmet.csv', delimiter=",") face_data = np.genfromtxt ('face.csv', delimiter=",") data_full = np.concatenate((helmet_data, face_data), 0) np.random.shuffle(data_full) #shuffle the tuples #feature reduction (on HOG part) #gain, j = mutual_info_classif(data_full[:, 8:-1], data_full[:, -1], discrete_features='auto', n_neighbors=3, copy=True, random_state=None), 0 #for i in np.arange(len(gain)): # if gain[i] <= 0.001: # data_full = np.delete(data_full, 8+i-j, 1) # j += 1 #data = np.copy(data_full) #principal component analysis pca = PCA(n_components=150) data = pca.fit_transform(data_full[:, 8:-1]) data = np.concatenate((data_full[:, 0:8], data, np.array([data_full[:, -1]]).T), axis=1) precision, recall, f1, accuracy, support, fn, roc_auc = 0, 0, 0, 0, 0, 0, 0 colors = ['cyan', 'indigo', 'seagreen', 'yellow', 'blue', 'darkorange'] k = 10 kf = KFold(n_splits = k) start = timer() for train, test in kf.split(data): X_train, X_test = data[train, 0:-1], data[test, 0:-1] y_train, y_test = data[train, -1], data[test, -1] clf = LogisticRegression().fit(X_train, y_train) y_pred = clf.predict(X_test) #ROC curve y_prob = clf.predict_proba(X_test)[:,1] fpr, tpr, thresholds = roc_curve(y_test, y_prob, pos_label=1) roc_auc += auc(fpr, tpr) plt.plot(fpr, tpr, color=colors[randint(0, len(colors)-1)]) precision += precision_score(y_test, y_pred, average = 'macro') recall += recall_score(y_test, y_pred, average = 'macro') f1 += f1_score(y_test, y_pred, average = 'macro') accuracy += accuracy_score(y_test, y_pred) y = y_test - y_pred fn += sum(y[y > 0]) / len(y_test) end = timer() precision /= k recall /= k f1 /= k accuracy /= k fn /= k print("Precision \t: %s" % round(precision, 4)) print("Recall \t\t: %s" % round(recall, 4)) print("F1 \t\t: %s" % round(f1, 4)) print("Accuracy \t: %s" % round(accuracy, 4)) print("False Neg \t: %s%%" % round(fn * 100, 4)) print("Mean AUC \t: %s" % round(roc_auc / k, 4)) print("\nExecution time: %s ms" % round((end - start) * 1000, 4)) #ROC curve plt.title('Logistic Regression (AUC = %s)' % round(roc_auc, 4)) plt.legend(loc='lower right') plt.plot([0,1],[0,1],'r--') plt.xlim([-0.05,1.0]) plt.ylim([0.0,1.05]) plt.ylabel('True Positive Rate') plt.xlabel('False Positive Rate') plt.show()
gpl-3.0
-5,013,241,237,569,052,000
32.2875
142
0.662035
false
cristobaltapia/sajou
sajou/sections.py
1
3525
#!/usr/bin/env python # -*- coding: utf-8 -*- """ Define the classes and methods to work with sections. """ import numpy as np class BeamSection(object): """Defines a beam section Parameters ---------- name: str name of the section material: Material instance material of the section defined as an instance of Material object data: tuple properties of the section type: str defines the type of cross-section +-------------------------+------------------------------+ | type | *data* format | +=========================+==============================+ |'rectangular': |``data=(width, height,)`` | +-------------------------+------------------------------+ |'circular': |``data=(r, )`` | +-------------------------+------------------------------+ |'I-section': |``data=(H, h_f, w_web, w_f)`` | +-------------------------+------------------------------+ |'general': |``data=(A, I_3,)`` | +-------------------------+------------------------------+ """ def __init__(self, name, material, data, type='rectangular'): self._name = name self._material = material self._data = data self._type = type self._area = 0 self._Iz = 0 self._Iy = 0 self._Jx = 0 self.compute_properties() def print_properties(self): """Prints the properties of the BeamSection instance :returns: TODO """ if self._type == 'rectangular': props = {'width': self._data[0], 'height': self._data[1]} else: props = 'undefined' return 'Properties: ' + str(props) def compute_properties(self): """Compute all the mechanical properties for the given section :returns: TODO """ # Calculate the area self._area = self.calc_area() self._Iz, self._Iy = self.calc_inertia() def calc_area(self): """Calculate the area of the section :returns: TODO """ type = self._type if type == 'rectangular': width = self._data[0] height = self._data[1] return width * height elif type == 'general': return self._data[0] elif type == 'circular': radius = self._data[0] return np.pi * radius**2 def calc_inertia(self): """Calculate the moment of inertia of the beam section :returns: Iz, Iy """ type = self._type if type == 'rectangular': width = self._data[0] height = self._data[1] I_z = width * height**3 / 12. I_y = height * width**3 / 12. return I_z, I_y elif type == 'general': return self._data[1], 0 def __str__(self): """ Returns the printable string for this object """ return 'Beam Section: {name}, type: {t}'.format(name=self._name, t=self._type) def __repr__(self): """ Returns the printable string for this object """ return 'Beam Section: {name}, type: {t}'.format(name=self._name, t=self._type)
mit
9,096,255,454,926,391,000
28.621849
73
0.41844
false
n3wb13/OpenNfrGui-5.0-1
lib/python/Plugins/Extensions/MediaPortal/additions/fun/geo_de.py
1
4389
# -*- coding: utf-8 -*- from Plugins.Extensions.MediaPortal.plugin import _ from Plugins.Extensions.MediaPortal.resources.imports import * from Plugins.Extensions.MediaPortal.resources.simpleplayer import SimplePlayer, SimplePlaylist from Plugins.Extensions.MediaPortal.resources.twagenthelper import twAgentGetPage STV_Version = "GEO.de v0.95" STV_siteEncoding = 'iso8859-1' class GEOdeGenreScreen(MPScreen, ThumbsHelper): def __init__(self, session): self.plugin_path = mp_globals.pluginPath self.skin_path = mp_globals.pluginPath + mp_globals.skinsPath path = "%s/%s/dokuListScreen.xml" % (self.skin_path, config.mediaportal.skin.value) if not fileExists(path): path = self.skin_path + mp_globals.skinFallback + "/dokuListScreen.xml" print path with open(path, "r") as f: self.skin = f.read() f.close() MPScreen.__init__(self, session) ThumbsHelper.__init__(self) self["actions"] = ActionMap(["MP_Actions"], { "yellow" : self.keyTxtPageUp, "blue" : self.keyTxtPageDown, "ok" : self.keyOK, "cancel" : self.keyCancel, "5" : self.keyShowThumb, "up" : self.keyUp, "down" : self.keyDown, "right" : self.keyRight, "0" : self.closeAll, "left" : self.keyLeft }, -1) self['title'] = Label(STV_Version) self['ContentTitle'] = Label("GEOaudio - Hören und Reisen") self['F1'] = Label(_("Exit")) self['F3'] = Label(_("Text-")) self['F4'] = Label(_("Text+")) self['Page'] = Label(_("Page:")) self.keyLocked = True self.baseUrl = "http://www.geo.de" self.filmliste = [] self.ml = MenuList([], enableWrapAround=True, content=eListboxPythonMultiContent) self['liste'] = self.ml self.lastservice = self.session.nav.getCurrentlyPlayingServiceReference() self.onClose.append(self.restoreLastService) self.onLayoutFinish.append(self.layoutFinished) def layoutFinished(self): self.keyLocked = True stvLink = self.baseUrl + '/GEO/reisen/podcast/reise-podcast-geoaudio-hoeren-und-reisen-5095.html' print "getPage: ",stvLink twAgentGetPage(stvLink).addCallback(self.genreData).addErrback(self.dataError) def genreData(self, data): print "genreData:" for m in re.finditer('id:"(.*?)".*?name:"(.*?)".*?mp3:"(.*?)".*?iption:"(.*?)".*?poster: "(.*?)"', data, re.S): # print "Podcasts found" id, name, mp3, desc, img = m.groups() self.filmliste.append(("%s. " % id, decodeHtml2(name), mp3, decodeHtml2(desc),img)) if self.keyLocked: self.keyLocked = False if not self.filmliste: self.filmliste.append(('Keine Podcasts gefunden !','','','','')) self.ml.setList(map(self.GEOdeListEntry, self.filmliste)) self.th_ThumbsQuery(self.filmliste, 1, 0, 4, None, None, 1, 1, mode=1) self.showInfos() def showInfos(self): stvTitle = self['liste'].getCurrent()[0][1] stvImage = self['liste'].getCurrent()[0][4] stvDesc = self['liste'].getCurrent()[0][3] print stvImage self['name'].setText(stvTitle) self['handlung'].setText(stvDesc) CoverHelper(self['coverArt']).getCover(stvImage) def keyOK(self): if self.keyLocked: return self.session.open( GEOdePlayer, self.filmliste, playIdx = self['liste'].getSelectedIndex() ) def restoreLastService(self): if config.mediaportal.restorelastservice.value == "1" and not config.mediaportal.backgroundtv.value: self.session.nav.playService(self.lastservice) class GEOdePlaylist(SimplePlaylist): def playListEntry(self, entry): width = self['liste'].instance.size().width() height = self['liste'].l.getItemSize().height() self.ml.l.setFont(0, gFont('mediaportal', height - 2 * mp_globals.sizefactor)) res = [entry] res.append((eListboxPythonMultiContent.TYPE_TEXT, 0, 0, width, height, 0, RT_HALIGN_LEFT | RT_VALIGN_CENTER, entry[0] + entry[1])) return res class GEOdePlayer(SimplePlayer): def __init__(self, session, playList, playIdx): print "GEOdePlayer:" SimplePlayer.__init__(self, session, playList, playIdx=playIdx, playAll=True, listTitle="GEOaudio - Hören und Reisen", autoScrSaver=True, ltype='geo.de', playerMode='MP3') def getVideo(self): stvLink = self.playList[self.playIdx][2] stvTitle = "%s%s" % (self.playList[self.playIdx][0], self.playList[self.playIdx][1]) stvImage = self.playList[self.playIdx][4] self.playStream(stvTitle, stvLink, imgurl=stvImage) def openPlaylist(self, pl_class=GEOdePlaylist): SimplePlayer.openPlaylist(self, pl_class)
gpl-2.0
2,190,676,951,641,538,800
34.088
173
0.696693
false
osuripple/lets
helpers/aeshelper.py
1
10866
""" A pure python (slow) implementation of rijndael with a decent interface To include - from rijndael import rijndael To do a key setup - r = rijndael(key, block_size = 16) key must be a string of length 16, 24, or 32 blocksize must be 16, 24, or 32. Default is 16 To use - ciphertext = r.encrypt(plaintext) plaintext = r.decrypt(ciphertext) If any strings are of the wrong length a ValueError is thrown """ # ported from the Java reference code by Bram Cohen, April 2001 # this code is public domain, unless someone makes # an intellectual property claim against the reference # code, in which case it can be made public domain by # deleting all the comments and renaming all the variables import copy import base64 shifts = [[[0, 0], [1, 3], [2, 2], [3, 1]], [[0, 0], [1, 5], [2, 4], [3, 3]], [[0, 0], [1, 7], [3, 5], [4, 4]]] # [keysize][block_size] num_rounds = {16: {16: 10, 24: 12, 32: 14}, 24: {16: 12, 24: 12, 32: 14}, 32: {16: 14, 24: 14, 32: 14}} A = [[1, 1, 1, 1, 1, 0, 0, 0], [0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0], [0, 0, 0, 1, 1, 1, 1, 1], [1, 0, 0, 0, 1, 1, 1, 1], [1, 1, 0, 0, 0, 1, 1, 1], [1, 1, 1, 0, 0, 0, 1, 1], [1, 1, 1, 1, 0, 0, 0, 1]] # produce log and alog tables, needed for multiplying in the # field GF(2^m) (generator = 3) alog = [1] for i in range(255): j = (alog[-1] << 1) ^ alog[-1] if j & 0x100 != 0: j ^= 0x11B alog.append(j) log = [0] * 256 for i in range(1, 255): log[alog[i]] = i # multiply two elements of GF(2^m) def mul(a, b): if a == 0 or b == 0: return 0 return alog[(log[a & 0xFF] + log[b & 0xFF]) % 255] # substitution box based on F^{-1}(x) box = [[0] * 8 for i in range(256)] box[1][7] = 1 for i in range(2, 256): j = alog[255 - log[i]] for t in range(8): box[i][t] = (j >> (7 - t)) & 0x01 B = [0, 1, 1, 0, 0, 0, 1, 1] # affine transform: box[i] <- B + A*box[i] cox = [[0] * 8 for i in range(256)] for i in range(256): for t in range(8): cox[i][t] = B[t] for j in range(8): cox[i][t] ^= A[t][j] * box[i][j] # S-boxes and inverse S-boxes S = [0] * 256 Si = [0] * 256 for i in range(256): S[i] = cox[i][0] << 7 for t in range(1, 8): S[i] ^= cox[i][t] << (7-t) Si[S[i] & 0xFF] = i # T-boxes G = [[2, 1, 1, 3], [3, 2, 1, 1], [1, 3, 2, 1], [1, 1, 3, 2]] AA = [[0] * 8 for i in range(4)] for i in range(4): for j in range(4): AA[i][j] = G[i][j] AA[i][i+4] = 1 for i in range(4): pivot = AA[i][i] if pivot == 0: t = i + 1 while AA[t][i] == 0 and t < 4: t += 1 assert t != 4, 'G matrix must be invertible' for j in range(8): AA[i][j], AA[t][j] = AA[t][j], AA[i][j] pivot = AA[i][i] for j in range(8): if AA[i][j] != 0: AA[i][j] = alog[(255 + log[AA[i][j] & 0xFF] - log[pivot & 0xFF]) % 255] for t in range(4): if i != t: for j in range(i+1, 8): AA[t][j] ^= mul(AA[i][j], AA[t][i]) AA[t][i] = 0 iG = [[0] * 4 for i in range(4)] for i in range(4): for j in range(4): iG[i][j] = AA[i][j + 4] def mul4(a, bs): if a == 0: return 0 r = 0 for b in bs: r <<= 8 if b != 0: r |= mul(a, b) return r T1 = [] T2 = [] T3 = [] T4 = [] T5 = [] T6 = [] T7 = [] T8 = [] U1 = [] U2 = [] U3 = [] U4 = [] for t in range(256): s = S[t] T1.append(mul4(s, G[0])) T2.append(mul4(s, G[1])) T3.append(mul4(s, G[2])) T4.append(mul4(s, G[3])) s = Si[t] T5.append(mul4(s, iG[0])) T6.append(mul4(s, iG[1])) T7.append(mul4(s, iG[2])) T8.append(mul4(s, iG[3])) U1.append(mul4(t, iG[0])) U2.append(mul4(t, iG[1])) U3.append(mul4(t, iG[2])) U4.append(mul4(t, iG[3])) # round constants rcon = [1] r = 1 for t in range(1, 30): r = mul(2, r) rcon.append(r) del A del AA del pivot del B del G del box del log del alog del i del j del r del s del t del mul del mul4 del cox del iG class rijndael: def __init__(self, key, block_size = 16): if block_size != 16 and block_size != 24 and block_size != 32: raise ValueError('Invalid block size: ' + str(block_size)) if len(key) != 16 and len(key) != 24 and len(key) != 32: raise ValueError('Invalid key size: ' + str(len(key))) self.block_size = block_size ROUNDS = num_rounds[len(key)][block_size] BC = block_size // 4 # encryption round keys Ke = [[0] * BC for i in range(ROUNDS + 1)] # decryption round keys Kd = [[0] * BC for i in range(ROUNDS + 1)] ROUND_KEY_COUNT = (ROUNDS + 1) * BC KC = len(key) // 4 # copy user material bytes into temporary ints tk = [] for i in range(0, KC): tk.append((ord(key[i * 4]) << 24) | (ord(key[i * 4 + 1]) << 16) | (ord(key[i * 4 + 2]) << 8) | ord(key[i * 4 + 3])) # copy values into round key arrays t = 0 j = 0 while j < KC and t < ROUND_KEY_COUNT: Ke[t // BC][t % BC] = tk[j] Kd[ROUNDS - (t // BC)][t % BC] = tk[j] j += 1 t += 1 tt = 0 rconpointer = 0 while t < ROUND_KEY_COUNT: # extrapolate using phi (the round key evolution function) tt = tk[KC - 1] tk[0] ^= (S[(tt >> 16) & 0xFF] & 0xFF) << 24 ^ \ (S[(tt >> 8) & 0xFF] & 0xFF) << 16 ^ \ (S[ tt & 0xFF] & 0xFF) << 8 ^ \ (S[(tt >> 24) & 0xFF] & 0xFF) ^ \ (rcon[rconpointer] & 0xFF) << 24 rconpointer += 1 if KC != 8: for i in range(1, KC): tk[i] ^= tk[i-1] else: for i in range(1, KC // 2): tk[i] ^= tk[i-1] tt = tk[KC // 2 - 1] tk[KC // 2] ^= (S[ tt & 0xFF] & 0xFF) ^ \ (S[(tt >> 8) & 0xFF] & 0xFF) << 8 ^ \ (S[(tt >> 16) & 0xFF] & 0xFF) << 16 ^ \ (S[(tt >> 24) & 0xFF] & 0xFF) << 24 for i in range(KC // 2 + 1, KC): tk[i] ^= tk[i-1] # copy values into round key arrays j = 0 while j < KC and t < ROUND_KEY_COUNT: Ke[t // BC][t % BC] = tk[j] Kd[ROUNDS - (t // BC)][t % BC] = tk[j] j += 1 t += 1 # inverse MixColumn where needed for r in range(1, ROUNDS): for j in range(BC): tt = Kd[r][j] Kd[r][j] = U1[(tt >> 24) & 0xFF] ^ \ U2[(tt >> 16) & 0xFF] ^ \ U3[(tt >> 8) & 0xFF] ^ \ U4[ tt & 0xFF] self.Ke = Ke self.Kd = Kd def encrypt(self, plaintext): if len(plaintext) != self.block_size: raise ValueError('wrong block length, expected ' + str(self.block_size) + ' got ' + str(len(plaintext))) Ke = self.Ke BC = self.block_size // 4 ROUNDS = len(Ke) - 1 if BC == 4: SC = 0 elif BC == 6: SC = 1 else: SC = 2 s1 = shifts[SC][1][0] s2 = shifts[SC][2][0] s3 = shifts[SC][3][0] a = [0] * BC # temporary work array t = [] # plaintext to ints + key for i in range(BC): t.append((ord(plaintext[i * 4 ]) << 24 | ord(plaintext[i * 4 + 1]) << 16 | ord(plaintext[i * 4 + 2]) << 8 | ord(plaintext[i * 4 + 3]) ) ^ Ke[0][i]) # apply round transforms for r in range(1, ROUNDS): for i in range(BC): a[i] = (T1[(t[ i ] >> 24) & 0xFF] ^ T2[(t[(i + s1) % BC] >> 16) & 0xFF] ^ T3[(t[(i + s2) % BC] >> 8) & 0xFF] ^ T4[ t[(i + s3) % BC] & 0xFF] ) ^ Ke[r][i] t = copy.copy(a) # last round is special result = [] for i in range(BC): tt = Ke[ROUNDS][i] result.append((S[(t[ i ] >> 24) & 0xFF] ^ (tt >> 24)) & 0xFF) result.append((S[(t[(i + s1) % BC] >> 16) & 0xFF] ^ (tt >> 16)) & 0xFF) result.append((S[(t[(i + s2) % BC] >> 8) & 0xFF] ^ (tt >> 8)) & 0xFF) result.append((S[ t[(i + s3) % BC] & 0xFF] ^ tt ) & 0xFF) return ''.join(map(chr, result)) def decrypt(self, ciphertext): if len(ciphertext) != self.block_size: raise ValueError('wrong block length, expected ' + str(self.block_size) + ' got ' + str(len(ciphertext))) Kd = self.Kd BC = self.block_size // 4 ROUNDS = len(Kd) - 1 if BC == 4: SC = 0 elif BC == 6: SC = 1 else: SC = 2 s1 = shifts[SC][1][1] s2 = shifts[SC][2][1] s3 = shifts[SC][3][1] a = [0] * BC # temporary work array t = [0] * BC # ciphertext to ints + key for i in range(BC): t[i] = (ord(ciphertext[i * 4 ]) << 24 | ord(ciphertext[i * 4 + 1]) << 16 | ord(ciphertext[i * 4 + 2]) << 8 | ord(ciphertext[i * 4 + 3]) ) ^ Kd[0][i] # apply round transforms for r in range(1, ROUNDS): for i in range(BC): a[i] = (T5[(t[ i ] >> 24) & 0xFF] ^ T6[(t[(i + s1) % BC] >> 16) & 0xFF] ^ T7[(t[(i + s2) % BC] >> 8) & 0xFF] ^ T8[ t[(i + s3) % BC] & 0xFF] ) ^ Kd[r][i] t = copy.copy(a) # last round is special result = [] for i in range(BC): tt = Kd[ROUNDS][i] result.append((Si[(t[ i ] >> 24) & 0xFF] ^ (tt >> 24)) & 0xFF) result.append((Si[(t[(i + s1) % BC] >> 16) & 0xFF] ^ (tt >> 16)) & 0xFF) result.append((Si[(t[(i + s2) % BC] >> 8) & 0xFF] ^ (tt >> 8)) & 0xFF) result.append((Si[ t[(i + s3) % BC] & 0xFF] ^ tt ) & 0xFF) return ''.join(map(chr, result)) def encrypt(key, block): return rijndael(key, len(block)).encrypt(block) def decrypt(key, block): return rijndael(key, len(block)).decrypt(block) class zeropad: def __init__(self, block_size): assert 0 < block_size < 256 self.block_size = block_size def pad(self, pt): ptlen = len(pt) padsize = self.block_size - ((ptlen + self.block_size - 1) % self.block_size + 1) return pt + "\0" * padsize def unpad(self, ppt): assert len(ppt) % self.block_size == 0 offset = len(ppt) if offset == 0: return '' end = offset - self.block_size + 1 while offset > end: offset -= 1 if ppt[offset] != "\0": return ppt[:offset + 1] assert False class cbc: def __init__(self, padding, cipher, iv): assert padding.block_size == cipher.block_size assert len(iv) == cipher.block_size self.padding = padding self.cipher = cipher self.iv = iv def encrypt(self, pt): ppt = self.padding.pad(pt) offset = 0 ct = '' v = self.iv while offset < len(ppt): block = ppt[offset:offset + self.cipher.block_size] block = self.xorblock(block, v) block = self.cipher.encrypt(block) ct += block offset += self.cipher.block_size v = block return ct def decrypt(self, ct): assert len(ct) % self.cipher.block_size == 0 ppt = '' offset = 0 v = self.iv while offset < len(ct): block = ct[offset:offset + self.cipher.block_size] decrypted = self.cipher.decrypt(block) ppt += self.xorblock(decrypted, v) offset += self.cipher.block_size v = block pt = self.padding.unpad(ppt) return pt def xorblock(self, b1, b2): # sorry, not very Pythonesk i = 0 r = '' while i < self.cipher.block_size: r += chr(ord(b1[i]) ^ ord(b2[i])) i += 1 return r def decryptRinjdael(key, iv, data, areBase64 = False): """ Where the magic happens key -- AES key (string) IV -- IV thing (string) data -- data to decrypt (string) areBase64 -- if True, iv and data are passed in base64 """ if areBase64: iv = base64.b64decode(iv).decode("latin_1") data = base64.b64decode(data).decode("latin_1") r = rijndael(key, 32) p = zeropad(32) c = cbc(p, r, iv) return str(c.decrypt(data))
agpl-3.0
8,741,889,376,303,064,000
23.200445
108
0.534511
false
googleapis/googleapis-gen
google/cloud/bigquery/datatransfer/v1/bigquery-datatransfer-v1-py/google/cloud/bigquery_datatransfer_v1/services/data_transfer_service/transports/__init__.py
1
1239
# -*- coding: utf-8 -*- # Copyright 2020 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # from collections import OrderedDict from typing import Dict, Type from .base import DataTransferServiceTransport from .grpc import DataTransferServiceGrpcTransport from .grpc_asyncio import DataTransferServiceGrpcAsyncIOTransport # Compile a registry of transports. _transport_registry = OrderedDict() # type: Dict[str, Type[DataTransferServiceTransport]] _transport_registry['grpc'] = DataTransferServiceGrpcTransport _transport_registry['grpc_asyncio'] = DataTransferServiceGrpcAsyncIOTransport __all__ = ( 'DataTransferServiceTransport', 'DataTransferServiceGrpcTransport', 'DataTransferServiceGrpcAsyncIOTransport', )
apache-2.0
-2,402,536,470,973,751,000
36.545455
90
0.785311
false
martinjrobins/hobo
pints/tests/test_nested_ellipsoid_sampler.py
1
7162
#!/usr/bin/env python # # Tests ellipsoidal nested sampler. # # This file is part of PINTS. # Copyright (c) 2017-2019, University of Oxford. # For licensing information, see the LICENSE file distributed with the PINTS # software package. # import unittest import numpy as np import pints import pints.toy # Unit testing in Python 2 and 3 try: unittest.TestCase.assertRaisesRegex except AttributeError: unittest.TestCase.assertRaisesRegex = unittest.TestCase.assertRaisesRegexp class TestNestedEllipsoidSampler(unittest.TestCase): """ Unit (not functional!) tests for :class:`NestedEllipsoidSampler`. """ @classmethod def setUpClass(cls): """ Prepare for the test. """ # Create toy model model = pints.toy.LogisticModel() cls.real_parameters = [0.015, 500] times = np.linspace(0, 1000, 1000) values = model.simulate(cls.real_parameters, times) # Add noise np.random.seed(1) cls.noise = 10 values += np.random.normal(0, cls.noise, values.shape) cls.real_parameters.append(cls.noise) # Create an object with links to the model and time series problem = pints.SingleOutputProblem(model, times, values) # Create a uniform prior over both the parameters and the new noise # variable cls.log_prior = pints.UniformLogPrior( [0.01, 400], [0.02, 600] ) # Create a log-likelihood cls.log_likelihood = pints.GaussianKnownSigmaLogLikelihood( problem, cls.noise) def test_construction_errors(self): # Tests if invalid constructor calls are picked up. # First arg must be a log likelihood self.assertRaisesRegex( ValueError, 'must extend pints.LogPrior', pints.NestedEllipsoidSampler, self.log_likelihood) def test_hyper_params(self): # Tests the hyper parameter interface is working. sampler = pints.NestedEllipsoidSampler(self.log_prior) self.assertEqual(sampler.n_hyper_parameters(), 6) sampler.set_hyper_parameters([220, 130, 2.0, 133, 1, 0.8]) self.assertEqual(sampler.n_active_points(), 220) self.assertEqual(sampler.n_rejection_samples(), 130) self.assertEqual(sampler.enlargement_factor(), 2.0) self.assertEqual(sampler.ellipsoid_update_gap(), 133) self.assertTrue(sampler.dynamic_enlargement_factor()) self.assertTrue(sampler.alpha(), 0.8) def test_getters_and_setters(self): # Tests various get() and set() methods. sampler = pints.NestedEllipsoidSampler(self.log_prior) # Active points x = sampler.n_active_points() + 1 self.assertNotEqual(sampler.n_active_points(), x) sampler.set_n_active_points(x) self.assertEqual(sampler.n_active_points(), x) self.assertRaisesRegex( ValueError, 'greater than 5', sampler.set_n_active_points, 5) # Rejection samples x = sampler.n_rejection_samples() + 1 self.assertNotEqual(sampler.n_rejection_samples(), x) sampler.set_n_rejection_samples(x) self.assertEqual(sampler.n_rejection_samples(), x) self.assertRaisesRegex( ValueError, 'negative', sampler.set_n_rejection_samples, -1) # Enlargement factor x = sampler.enlargement_factor() * 2 self.assertNotEqual(sampler.enlargement_factor(), x) sampler.set_enlargement_factor(x) self.assertEqual(sampler.enlargement_factor(), x) self.assertRaisesRegex( ValueError, 'exceed 1', sampler.set_enlargement_factor, 0.5) self.assertRaisesRegex( ValueError, 'exceed 1', sampler.set_enlargement_factor, 1) # Ellipsoid update gap x = sampler.ellipsoid_update_gap() * 2 self.assertNotEqual(sampler.ellipsoid_update_gap(), x) sampler.set_ellipsoid_update_gap(x) self.assertEqual(sampler.ellipsoid_update_gap(), x) self.assertRaisesRegex( ValueError, 'exceed 1', sampler.set_ellipsoid_update_gap, 0.5) self.assertRaisesRegex( ValueError, 'exceed 1', sampler.set_ellipsoid_update_gap, 1) # dynamic enlargement factor self.assertTrue(not sampler.dynamic_enlargement_factor()) sampler.set_dynamic_enlargement_factor(1) self.assertTrue(sampler.dynamic_enlargement_factor()) # alpha self.assertRaises(ValueError, sampler.set_alpha, -0.2) self.assertRaises(ValueError, sampler.set_alpha, 1.2) self.assertEqual(sampler.alpha(), 0.2) sampler.set_alpha(0.4) self.assertEqual(sampler.alpha(), 0.4) # initial phase self.assertTrue(sampler.needs_initial_phase()) self.assertTrue(sampler.in_initial_phase()) sampler.set_initial_phase(False) self.assertTrue(not sampler.in_initial_phase()) self.assertEqual(sampler.name(), 'Nested ellipsoidal sampler') def test_ask_tell(self): # Tests ask and tell # test that ellipses are estimated sampler = pints.NestedEllipsoidSampler(self.log_prior) A1 = np.copy(sampler._A) c1 = sampler._centroid sampler.set_n_rejection_samples(100) sampler.set_ellipsoid_update_gap(10) for i in range(5000): pt = sampler.ask(1) fx = self.log_likelihood(pt) sampler.tell(fx) A2 = sampler._A c2 = sampler._centroid self.assertTrue(not np.array_equal(A1, A2)) self.assertTrue(not np.array_equal(c1, c2)) # test multiple points being asked and tell'd sampler = pints.NestedEllipsoidSampler(self.log_prior) pts = sampler.ask(50) self.assertEqual(len(pts), 50) fx = [self.log_likelihood(pt) for pt in pts] proposed = sampler.tell(fx) self.assertTrue(len(proposed) > 1) # test multiple ask points after rejection samples sampler = pints.NestedEllipsoidSampler(self.log_prior) sampler.set_n_rejection_samples(10) for i in range(100): self.assertEqual(len(sampler.ask(20)), 20) def test_dynamic_enlargement_factor(self): # tests dynamic enlargement factor runs sampler = pints.NestedController(self.log_likelihood, self.log_prior) sampler._sampler.set_dynamic_enlargement_factor(1) sampler.set_log_to_screen(False) ef1 = sampler._sampler.enlargement_factor() sampler.run() ef2 = sampler._sampler.enlargement_factor() self.assertTrue(ef2 < ef1) def test_sensitivities(self): # tests whether sensitivities bit runs sampler = pints.NestedController(self.log_likelihood, self.log_prior) # hacky but currently no samplers need sensitivities sampler._needs_sensitivities = True sampler._initialise_callable() if __name__ == '__main__': print('Add -v for more debug output') import sys if '-v' in sys.argv: debug = True unittest.main()
bsd-3-clause
-975,578,752,272,847,100
36.108808
78
0.638928
false
lpramuk/robottelo
tests/foreman/cli/test_role.py
1
45035
# -*- encoding: utf-8 -*- """Test for Roles CLI :Requirement: Role :CaseAutomation: Automated :CaseLevel: Acceptance :CaseComponent: UsersRoles :TestType: Functional :CaseImportance: High :Upstream: No """ from math import ceil from random import choice from fauxfactory import gen_string from robottelo.cli.base import CLIDataBaseError from robottelo.cli.base import CLIReturnCodeError from robottelo.cli.factory import make_filter from robottelo.cli.factory import make_location from robottelo.cli.factory import make_org from robottelo.cli.factory import make_role from robottelo.cli.factory import make_user from robottelo.cli.filter import Filter from robottelo.cli.role import Role from robottelo.cli.settings import Settings from robottelo.cli.user import User from robottelo.constants import PERMISSIONS from robottelo.constants import ROLES from robottelo.datafactory import generate_strings_list from robottelo.decorators import stubbed from robottelo.decorators import tier1 from robottelo.decorators import tier2 from robottelo.decorators import tier3 from robottelo.decorators import upgrade from robottelo.test import CLITestCase class RoleTestCase(CLITestCase): """Test class for Roles CLI""" @tier1 def test_positive_create_with_name(self): """Create new roles with provided name :id: 6883177c-6926-428c-92ab-9effbe1372ae :expectedresults: Role is created and has correct name :BZ: 1138553 :CaseImportance: Critical """ for name in generate_strings_list(length=10): with self.subTest(name): role = make_role({'name': name}) self.assertEqual(role['name'], name) @tier1 def test_positive_create_with_filter(self): """Create new role with a filter :id: 6c99ee25-4e58-496c-af42-f8ad2da6cf07 :expectedresults: Role is created and correct filter is assigned :CaseImportance: Critical """ role = make_role() # Pick permissions by its resource type permissions = [ permission['name'] for permission in Filter.available_permissions({'resource-type': 'Organization'}) ] # Assign filter to created role filter_ = make_filter({'role-id': role['id'], 'permissions': permissions}) self.assertEqual(role['name'], filter_['role']) @tier1 @upgrade def test_positive_create_with_permission(self): """Create new role with a set of permission :id: 7cb2b2e2-ad4d-41e9-b6b2-c0366eb09b9a :expectedresults: Role is created and has correct set of permissions :CaseImportance: Critical """ role = make_role() # Pick permissions by its resource type permissions = [ permission['name'] for permission in Filter.available_permissions({'resource-type': 'Organization'}) ] # Assign filter to created role make_filter({'role-id': role['id'], 'permissions': permissions}) self.assertEqual(set(Role.filters({'id': role['id']})[0]['permissions']), set(permissions)) @tier1 def test_positive_delete_by_id(self): """Create a new role and then delete role by its ID :id: 351780b4-697c-4f87-b989-dd9a9a2ad012 :expectedresults: Role is created and then deleted by its ID :CaseImportance: Critical """ for name in generate_strings_list(length=10): with self.subTest(name): role = make_role({'name': name}) self.assertEqual(role['name'], name) Role.delete({'id': role['id']}) with self.assertRaises(CLIReturnCodeError): Role.info({'id': role['id']}) @tier1 def test_positive_update_name(self): """Create new role and update its name :id: 3ce1b337-fd52-4460-b8a8-df49c94ffed1 :expectedresults: Role is created and its name is updated :CaseImportance: Critical """ role = make_role({'name': gen_string('alpha', 15)}) for new_name in generate_strings_list(length=10): with self.subTest(new_name): Role.update({'id': role['id'], 'new-name': new_name}) role = Role.info({'id': role['id']}) self.assertEqual(role['name'], new_name) @tier1 def test_positive_list_filters_by_id(self): """Create new role with a filter and list it by role id :id: 6979ad8d-629b-481e-9d3a-8f3b3bca53f9 :expectedresults: Filter is listed for specified role :CaseImportance: Critical """ role = make_role() # Pick permissions by its resource type permissions = [ permission['name'] for permission in Filter.available_permissions({'resource-type': 'Organization'}) ] # Assign filter to created role filter_ = make_filter({'role-id': role['id'], 'permissions': permissions}) self.assertEqual(role['name'], filter_['role']) self.assertEqual(Role.filters({'id': role['id']})[0]['id'], filter_['id']) @tier1 def test_positive_list_filters_by_name(self): """Create new role with a filter and list it by role name :id: bbcb3982-f484-4dde-a3ea-7145fd28ab1f :expectedresults: Filter is listed for specified role :CaseImportance: Critical """ role = make_role() # Pick permissions by its resource type permissions = [ permission['name'] for permission in Filter.available_permissions({'resource-type': 'Organization'}) ] # Assign filter to created role filter_ = make_filter({'role': role['name'], 'permissions': permissions}) self.assertEqual(role['name'], filter_['role']) self.assertEqual(Role.filters({'name': role['name']})[0]['id'], filter_['id']) @tier1 def test_negative_list_filters_without_parameters(self): """Try to list filter without specifying role id or name :id: 56cafbe0-d1cb-413e-8eac-0e01a3590fd2 :expectedresults: Proper error message is shown instead of SQL error :CaseImportance: Critical :BZ: 1296782 """ with self.assertRaises(CLIReturnCodeError) as err: with self.assertNotRaises(CLIDataBaseError): Role.filters() self.assertRegex(err.exception.msg, 'At least one of options .* is required') @tier1 @upgrade def test_positive_list_filters_with_pagination(self): """Make sure filters list can be displayed with different items per page value :id: b9c7c6c1-70c2-4d7f-8d36-fa8613acc865 :BZ: 1428516 :expectedresults: `per-page` correctly sets amount of items displayed per page, different `per-page` values divide a list into correct number of pages :CaseImportance: Critical """ role = make_role() res_types = iter(PERMISSIONS.keys()) permissions = [] # Collect more than 20 different permissions while len(permissions) <= 20: permissions += [ permission['name'] for permission in Filter.available_permissions({'resource-type': next(res_types)}) ] # Create a filter for each permission for perm in permissions: make_filter({'role': role['name'], 'permissions': perm}) # Test different `per-page` values for per_page in (1, 5, 20): with self.subTest(per_page): # Verify the first page contains exactly the same items count # as `per-page` value filters = Role.filters({'name': role['name'], 'per-page': per_page}) self.assertEqual(len(filters), per_page) # Verify pagination and total amount of pages by checking the # items count on the last page last_page = ceil(len(permissions) / per_page) filters = Role.filters( {'name': role['name'], 'page': last_page, 'per-page': per_page} ) self.assertEqual(len(filters), len(permissions) % per_page or per_page) @tier1 @upgrade def test_positive_delete_cloned_builtin(self): """Clone a builtin role and attempt to delete it :id: 1fd9c636-596a-4cb2-b100-de19238042cc :BZ: 1426672 :expectedresults: role was successfully deleted :CaseImportance: Critical """ role_list = Role.list({'search': 'name=\\"{}\\"'.format(choice(ROLES))}) self.assertEqual(len(role_list), 1) cloned_role = Role.clone( {'id': role_list[0]['id'], 'new-name': gen_string('alphanumeric')} ) Role.delete({'id': cloned_role['id']}) with self.assertRaises(CLIReturnCodeError): Role.info({'id': cloned_role['id']}) class CannedRoleTestCases(CLITestCase): """Implements Canned Roles tests from UI :CaseAutomation: notautomated """ @stubbed() @tier1 @upgrade def test_positive_create_role_with_taxonomies(self): """create role with taxonomies :id: 4ce9fd35-4d3d-47f7-8bc6-7cf0b3b2d2f5 :steps: Create new role with taxonomies :expectedresults: New role is created with taxonomies :CaseImportance: Critical """ @stubbed() @tier1 def test_positive_create_role_without_taxonomies(self): """Create role without taxonomies :id: 4dc80114-9629-487f-805c-c14241bdcde1 :steps: Create new role without any taxonomies :expectedresults: New role is created without taxonomies :CaseImportance: Critical """ @stubbed() @tier1 def test_positive_create_filter_without_override(self): """Create filter in role w/o overriding it :id: 247ab670-29e6-4c14-9140-51966f4632f4 :steps: 1. Create a role with taxonomies assigned 2. Create filter in role without overriding it :expectedresults: 1. Filter w/o override is created in role 2. The taxonomies of role are inherited to filter 3. Override check is not marked by default in filters table :CaseImportance: Critical """ @stubbed() @tier1 def test_positive_create_non_overridable_filter(self): """Create non overridable filter in role :id: c53713a3-d4b6-47a1-b19e-8d2020f98efd :steps: 1. Create a filter to which taxonomies cannot be associated. e.g Architecture filter :expectedresults: 1. Filter is created without taxonomies 2. Filter doesnt inherit taxonomies from role :CaseImportance: Critical """ @stubbed() @tier1 def test_negative_override_non_overridable_filter(self): """Override non overridable filter :id: 163313eb-4401-4bb0-bf9a-58030251643b :steps: Attempt to override a filter to which taxonomies cannot be associated. e.g Architecture filter :expectedresults: Filter is not overrided as taxonomies cannot be applied to that filter :CaseImportance: Critical """ @stubbed() @tier1 @upgrade def test_positive_create_overridable_filter(self): """Create overridable filter in role :id: 47816636-d215-45a8-9d21-495b1e193913 :steps: 1. Create a filter to which taxonomies can be associated. e.g Domain filter 2. Override a filter with some taxonomies :expectedresults: 1. Filter is created with taxonomies 2. Override check is set to true 3. Filter doesnt inherits taxonomies from role :CaseImportance: Critical """ @stubbed() @tier1 def test_positive_update_role_taxonomies(self): """Update role taxonomies which applies to its non-overrided filters :id: 988cf8c6-8f6e-49de-be54-d17085f260b6 :steps: 1. Create role with organization A and Location A 2. Add filter in above role without overriding 3. Update role set Organization to B and Location to B 4. List roles overridden filter taxonomies :expectedresults: The taxonomies of filter should be updated with role taxonomies :CaseImportance: Critical """ @stubbed() @tier1 def test_negative_update_role_taxonomies(self): """Update of role taxonomies doesnt applies on its overridden filters :id: 43ae1561-4362-47e4-b964-c5e2be791927 :steps: 1. Create role with organization A and Location A 2. Add overridden filter in above role with Organization A and Location A 3. Update role set Organization to B and Location to B 4. List roles overridden filter taxonomies :expectedresults: The taxonomies of overridden filter should not be updated with role taxonomies """ @stubbed() @tier2 def test_positive_override_flag(self): """Overridden role filters flag :id: 08925cb0-856e-48a6-ba88-eda21c8d3619 :steps: 1. Create role with an overridden filter 2. List above role filters :expectedresults: The override flag should be displayed for overridden filter in role filters table :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_disable_filter_override(self): """Unsetting override flag resets filter taxonomies :id: 985d87c1-3db7-40d1-9719-a7e7a85dce4d :steps: 1. Create role organization A and Location A 2. Create an overridden filter in role with organization B and Location B 3. Unset filter override flag in role 4. List above role filters :expectedresults: On unsetting filter override, the override flag should be set to false in role filters table :CaseLevel: Integration """ @stubbed() @tier1 def test_positive_create_org_admin_from_clone(self): """Create Org Admin role which has access to most of the resources within organization :id: a173f00b-60eb-4cc2-9a10-1ab3a18563a0 :steps: 1. create Org Admin role by cloning 'Organization admin' role which has most resources permissions :expectedresults: Org Admin role should be created successfully """ @stubbed() @tier1 def test_positive_create_cloned_role_with_taxonomies(self): """Taxonomies can be assigned to cloned role :id: 56d29da5-27e0-4855-974c-e4fa50a1631b :steps: 1. Create Org Admin role by cloning 'Organization admin' role 2. Set new taxonomies (locations and organizations) to cloned role :expectedresults: 1. While cloning, role allows to set taxonomies 2. New taxonomies should be applied to cloned role successfully """ @stubbed() @tier3 @upgrade def test_positive_access_entities_from_org_admin(self): """User can access resources within its taxonomies if assigned role has permission for same taxonomies :id: 555a4942-a4bb-499f-95a2-88e686518073 :steps: 1. Create Org Admin role and assign taxonomies to it 2. Create user with same taxonomies as role above 3. Assign cloned role to user above 4. Attempt to access resources with user :expectedresults: User should be able to access all the resources and permissions in taxonomies selected in Org Admin role :CaseLevel: System """ @stubbed() @tier3 def test_negative_access_entities_from_org_admin(self): """User can not access resources in taxonomies assigned to role if its own taxonomies are not same as its role :id: 2c0b6e8e-c8b7-4212-af79-d329bd803558 :steps: 1. Create Org Admin and assign taxonomies to it 2. Create user with different taxonomies than above Org Admin taxonomies 3. Assign above cloned role to user 4. Attempt to access resources with user :expectedresults: User should not be able to access any resources and permissions in taxonomies selected in Org Admin role :CaseLevel: System """ @stubbed() @tier3 def test_negative_access_entities_from_user(self): """User can not access resources within its own taxonomies if assigned role does not have permissions for user taxonomies :id: 512d2758-2ca0-49c2-b80e-f8a7bffd35b4 :steps: 1. Create Org Admin and assign taxonomies to it 2. Create user with different taxonomies than above Org Admin taxonomies 3. Assign above cloned role to user. 4. Attempt to access resources with user :expectedresults: User should not be able to access any resources and permissions in his own taxonomies :CaseLevel: System """ @stubbed() @tier2 def test_positive_override_cloned_role_filter(self): """Cloned role filter overrides :id: 0711541f-1af6-4493-b1f2-552367541d99 :steps: 1. Create a role with overridden filter 2. Clone above role 3. Attempt to override the filter in cloned role :expectedresults: Filter in cloned role should be overridden :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_emptiness_of_filter_taxonomies_on_role_clone(self): """Taxonomies of filters in cloned role are set to None for filters that are overridden in parent role :id: 20179b43-9db7-4af4-beca-fecc7ff7490c :steps: 1. Create a role with an overridden filter 2. Overridden filter should have taxonomies assigned 3. Clone above role 4. View cloned role filters :expectedresults: 1. Taxonomies of the 'parent role overridden filters' are set to None in cloned role 2. Override flag is set to True in filters table :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_override_empty_filter_taxonomies_in_cloned_role(self): """Taxonomies of filters in cloned role can be overridden for filters that are overridden in parent role :id: 7a12aba4-565e-4a17-8952-132158d1e0aa :steps: 1. Create a role with an overridden filter 2. Overridden filter should have taxonomies assigned 3. In cloned role, override 'parent role overridden filters' by assigning some taxonomies to it :expectedresults: In cloned role, The taxonomies should be able to assign to 'parent role overridden filters' :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_clone_role_having_overridden_filter_with_taxonomies(self): # noqa """When taxonomies assigned to cloned role, Unlimited and Override flag sets on filter that is overridden in parent role :id: 905f40ba-f6e7-45d3-a213-8deec9968374 :steps: 1. Create a role with organization A and Location A 2. Create overridden role filter in organization B and Location B 3. Clone above role and assign Organization A and Location A while cloning 4. List cloned role filter :expectedresults: Unlimited and Override flags should be set to True on filter that is overridden in parent role :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_clone_role_with_taxonomies_having_non_overridden_filter(self): # noqa """When taxonomies assigned to cloned role, Neither unlimited nor override sets on filter that is not overridden in parent role :id: 6985358c-c666-4cf5-b6c8-9030de8cf27c :steps: 1. Create a role with organization A and Location A 2. Create role filter without overriding 3. Clone above role and assign Organization A and Location A while cloning 4. List cloned role filter :expectedresults: Both unlimited and override flag should be set to False on filter that is not overridden in parent role :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_clone_role_having_unlimited_filter_with_taxonomies(self): """When taxonomies assigned to cloned role, Neither unlimited nor override sets on filter that is unlimited in parent role :id: 0774fca4-fa00-4067-8ac6-a77615b5651a :steps: 1. Create a role with organization A and Location A 2. Create role filter with unlimited check 3. Clone above role and assign Organization A and Location A while cloning 4. List cloned role filter :expectedresults: Both unlimited and override flags should be set to False on filter that is unlimited in parent role :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_clone_role_having_overridden_filter_without_taxonomies(self): # noqa """When taxonomies not assigned to cloned role, Unlimited and override flags sets on filter that is overridden in parent role :id: c792fc37-503d-4a85-8bd6-a5506e70dd3e :steps: 1. Create a role with organization A and Location A 2. Create overridden role filter in organization B and Location B 3. Clone above role without assigning taxonomies 4. List cloned role filter :expectedresults: Both unlimited and Override flags should be set to True on filter that is overridden in parent role :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_clone_role_without_taxonomies_non_overided_filter(self): """When taxonomies not assigned to cloned role, only unlimited but not override flag sets on filter that is overridden in parent role :id: 92264a5f-7cd8-4a91-8089-f2f546f556b3 :steps: 1. Create a role with organization A and Location A 2. Create role filter without overriding 3. Clone above role without assigning taxonomies 4. List cloned role filter :expectedresults: 1. Unlimited flag should be set to True 2. Override flag should be set to False :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_clone_role_without_taxonomies_unlimited_filter(self): """When taxonomies not assigned to cloned role, Unlimited and override flags sets on filter that is unlimited in parent role :id: 2f205923-f590-4797-b63b-adf389f802e6 :steps: 1. Create a role with organization A and Location A 2. Create role filter with unlimited check 3. Clone above role without assigning taxonomies 4. List cloned role filter :expectedresults: 1. Unlimited flag should be set to True 2. Override flag should be set to False :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_force_unlimited(self): """Unlimited flag forced sets to filter when no taxonomies are set to role and filter :id: 2de03e36-7f8d-4b17-819a-0d3b4468e32c :steps: 1. Create a role with organization A and Location A 2. Create a role filter without override and unlimited check 3. Remove taxonomies assigned earlier to role and ensure no taxonomies are assigned to role 4. List Role filter :expectedresults: Unlimited flag should be forcefully set on filter when no taxonomies are set to role and filter :CaseLevel: Integration """ @stubbed() @tier3 @upgrade def test_positive_user_group_users_access_as_org_admin(self): """Users in usergroup can have access to the resources in taxonomies if the taxonomies of Org Admin role is same :id: 630fcd05-5c27-44a7-9bea-fcef1143b252 :steps: 1. Create an Org Admin role by cloning 'Organization admin' role 2. Assign an organization A and Location A to the Org Admin role 3. Create two users without assigning roles while creating them 4. Assign Organization A and Location A to both users 5. Create an user group with above two users :expectedresults: Both users should have access to the resources of organization A and Location A :CaseLevel: System """ @stubbed() @tier3 def test_positive_user_group_users_access_contradict_as_org_admins(self): """Users in usergroup can/cannot have access to the resources in taxonomies depends on the taxonomies of Org Admin role is same/not_same :id: 55099979-de11-4730-83ce-e190a3b8ecaa :steps: 1. Create an Org Admin role by cloning 'Organization admin' role 2. Assign an organization A and Location A to the Org Admin role 3. Create an user without assigning roles while creating them and assign Organization B and Location B 4. Create another user without assigning roles while creating them and assign Organization A and Location A 5. Create an user group add above two users to the user group :expectedresults: 1. User assigned to Organization B and Location B shouldn't have access to the resources of organization A,B and Location A,B 2. User assigned to Organization A and Location A should have access to the resources of organization A and Location A :CaseLevel: System """ @stubbed() @tier3 def test_positive_assign_org_admin_to_user_group(self): """Users in usergroup can access to the resources in taxonomies if the taxonomies of Org Admin role are same :id: 07fa1bb4-1cce-4afa-a4f3-669704450947 :steps: 1. Create an Org Admin role by cloning 'Organization admin' role 2. Assign an organization A and Location A to the Org Admin role 3. Create two users without assigning roles while creating them 4. Assign Organization A and Location A to both users 5. Create an user group add above two users to the user group :expectedresults: Both the user should have access to the resources of organization A and Location A :CaseLevel: System """ @stubbed() @tier3 def test_negative_assign_org_admin_to_user_group(self): """Users in usergroup can not have access to the resources in taxonomies if the taxonomies of Org Admin role is not same :id: 81c076ba-d61c-4d03-96be-6db8458a2470 :steps: 1. Create an Org Admin role by cloning 'Organization admin' role 2. Assign an organization A and Location A to the Org Admin role 3. Create two users without assigning roles while creating them 4. Assign Organization B and Location B to both users 5. Create an user group add above two users to the user group :expectedresults: Both the user shouldn't have access to the resources of organization A,B and Location A,B :CaseLevel: System """ @stubbed() @tier2 def test_negative_assign_taxonomies_by_org_admin(self): """Org Admin doesn't have permissions to assign org/loc to any of its entities :id: da44d206-e5d9-4353-bc8c-dda99299fae4 :steps: 1. Create Org Admin role by cloning 'Organization admin' role 2. Assign an organization A,B and Location A,B to the Org Admin role 3. Create user and assign above Org Admin role 4. Assign Organization A,B and Location A,B to the user 5. Attempt to assign organization(s) and location(s) to any resource from new user :expectedresults: Org Admin should not be able to assign the taxonomies to any of its resources :CaseLevel: Integration """ @stubbed() @tier1 @upgrade def test_positive_remove_org_admin_role(self): """Super Admin user can remove Org Admin role :id: 57ba763d-66b4-4f40-8e53-064141277960 :steps: 1. Create Org Admin by cloning 'Organization admin' role 2. Assign any taxonomies to it 3. Create an user and assign above role to user 4. Delete the Org Admin role :expectedresults: Super Admin should be able to remove Org Admin role """ @stubbed() @tier2 def test_positive_taxonomies_control_to_superadmin_with_org_admin(self): """Super Admin can access entities in taxonomies assigned to Org Admin :id: bc5a3ad2-1f1f-4cda-a1ba-88b0f2e452c8 :steps: 1. Create Org Admin role and assign organization A and Location A 2. Create User and assign above Org Admin role 3. Attempt to access entities in Organization A and Location A from superadmin user who created org admin :expectedresults: Super admin should be able to access the entities in taxonomies assigned to Org Admin :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_taxonomies_control_to_superAdmin_without_org_admin(self): """Super Admin can access entities in taxonomies assigned to Org Admin after deleting Org Admin role/user :id: 2ed27587-d25a-4cd6-9baa-74de9e035bf5 :steps: 1. Create Org Admin role and assign organization A and Location A 2. Create User and assign above Org Admin role 3. Delete Org Admin role also the User created above 4. Login with SuperAdmin who created the above Org Admin role and access entities in Organization A and Location A :expectedresults: Super admin should be able to access the entities in taxonomies assigned to Org Admin after deleting Org Admin :CaseLevel: Integration """ @stubbed() @tier1 def test_negative_create_roles_by_org_admin(self): """Org Admin has no permissions to create new roles :id: 13fb38b6-2e38-4031-a57c-8ce75b333960 :steps: 1. Create Org Admin role and assign any taxonomies to it 2. Create user and assign above org Admin role to it 3. Attempt to create a new role using Org Admin user :expectedresults: Org Admin should not have permissions to create new role """ @stubbed() @tier1 def test_negative_modify_roles_by_org_admin(self): """Org Admin has no permissions to modify existing roles :id: fa4a1b65-52b3-4920-9784-748dea8f51a0 :steps: 1. Create Org Admin role and assign any taxonomies to it 2. Create user and assign above Org Admin role to it 3. Attempt to update any existing role using Org Admin user :expectedresults: Org Admin should not have permissions to update existing roles """ @stubbed() @tier2 def test_negative_admin_permissions_to_org_admin(self): """Org Admin has no access to Super Admin user :id: 6903ed39-6e53-406e-abd9-634c7a749f1e :steps: 1. Create Org Admin role and assign any taxonomies to it 2. Create user and assign above Org Admin role to it 3. Login with above Org Admin user 4. Attempt to get super admin info command details :expectedresults: Org Admin should not have access of Admin user :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_create_user_by_org_admin(self): """Org Admin can create new users :id: 02f283ac-7d89-4622-be8e-640c775500c4 :steps: 1. Create Org Admin role and assign any taxonomies to it 2. Create user and assign above Org Admin role to it 3. Login with above Org Admin user 4. Attempt to create new users :expectedresults: 1. Org Admin should be able to create new users 2. Only Org Admin role should be available to assign to its users 3. Org Admin should be able to assign Org Admin role to its users :CaseLevel: Integration """ @stubbed() @tier2 def test_positive_access_users_inside_org_admin_taxonomies(self): """Org Admin can access users inside its taxonomies :id: e9efce12-a017-4100-8262-c9db666fd890 :steps: 1. Create Org Admin role and assign Org A and Location A 2. Create new user A and assign Org A and Location A 3. Assign Org Admin role to User A 4. Create another user B and assign Org A and Location A 5. Assign any role to user B that does have access to Org A and Location A 6. Login with Org Admin user A and attempt to view user B :expectedresults: Org Admin should be able to access users inside its taxonomies :CaseLevel: Integration """ @stubbed() @tier2 def test_negative_access_users_outside_org_admin_taxonomies(self): """Org Admin can not access users outside its taxonomies :id: 81081c75-031d-4aca-acd6-25868a492a84 :steps: 1. Create Org Admin role and assign Org A and Location A 2. Create new user A and assign Org A and Location A 3. Assign Org Admin role to User A 4. Create another user B and assign Org B and Location B 5. Assign any role to user B that doesnt have access to Org A and Location A 6. Attempt to view user B using Org Admin user A :expectedresults: Org Admin should not be able to access users outside its taxonomies :CaseLevel: Integration """ @stubbed() @tier1 def test_negative_create_taxonomies_by_org_admin(self): """Org Admin cannot define/create organizations and locations :id: 115c46ea-f2fc-4be0-bbdb-26faf9246809 :steps: 1. Create Org Admin role and assign any taxonomies to it 2. Create user and assign above Org Admin role to it 3. Attempt to create Organizations and Locations using Org Admin user :expectedresults: Org Admin should not have access to create taxonomies """ @stubbed() @tier1 def test_negative_access_all_global_entities_by_org_admin(self): """Org Admin can access all global entities in any taxonomies regardless of its own assigned taxonomies :id: 6ebccf86-1766-432a-ad7c-4f2f606e1604 :steps: 1. Create Org Admin role and assign Org A and Location A 2. Create new user and assign Org A,B and Location A,B 3. Assign Org Admin role to User 4. Attempt to create all the global entities in org B and Loc B using Org Admin user. e.g Architectures, Operating System :expectedresults: Org Admin should have access to all the global entities in any taxonomies """ @stubbed() @tier3 @upgrade def test_positive_access_entities_from_ldap_org_admin(self): """LDAP User can access resources within its taxonomies if assigned role has permission for same taxonomies :id: 086c7e50-4db9-4422-a960-d9702976e4e6 :steps: 1. Create Org Admin and assign taxonomies to it 2. Create LDAP user with same taxonomies as role above 3. Assign Org Admin role to user above 4. Attempt to access resources from above LDAP user :expectedresults: LDAP User should be able to access all the resources and permissions in taxonomies selected in Org Admin role :CaseLevel: System """ @stubbed() @tier3 def test_negative_access_entities_from_ldap_org_admin(self): """LDAP User can not access resources in taxonomies assigned to role if its own taxonomies are not same as its role :id: 17a78a6d-d443-4700-8fd5-6a9336e96f91 :steps: 1. Create Org Admin and assign taxonomies to it 2. Create LDAP user with different taxonomies than above Org Admin taxonomies 3. Assign above cloned role to LDAP user 4. Login with LDAP user and attempt to access resources :expectedresults: LDAP User should not be able to access resources and permissions in taxonomies selected in Org Admin role :CaseLevel: System """ @stubbed() @tier3 def test_negative_access_entities_from_ldap_user(self): """LDAP User can not access resources within its own taxonomies if assigned role does not have permissions for same taxonomies :id: e44614ab-7af3-40a1-a3a2-8d47041e0daa :steps: 1. Create Org Admin and assign taxonomies to it 2. Create LDAP user with different taxonomies than above Org Admin taxonomies 3. Assign above cloned role to LDAP user 4. Login with LDAP user and attempt to access resources :expectedresults: LDAP User should not be able to access any resources and permissions in its own taxonomies :CaseLevel: System """ @stubbed() @tier3 @upgrade def test_positive_assign_org_admin_to_ldap_user_group(self): """Users in LDAP usergroup can access to the resources in taxonomies if the taxonomies of Org Admin role are same :id: 552737df-24ef-4eb9-8054-e261c3dbf2b3 :steps: 1. Create an Org Admin role by cloning 'Organization admin' role 2. Assign an organization A and Location A to the Org Admin role 3. Create an LDAP usergroup with two users 4. Assign Organization A and Location A to LDAP usergroup 5. Assign Org Admin role to LDAP usergroup :expectedresults: Users in LDAP usergroup should have access to the resources in taxonomies if the taxonomies of Org Admin role are same :CaseLevel: System """ @stubbed() @tier3 def test_negative_assign_org_admin_to_ldap_user_group(self): """Users in LDAP usergroup can not have access to the resources in taxonomies if the taxonomies of Org Admin role is not same :id: c3385e14-f589-4101-b76a-59cd9d518cb8 :steps: 1. Create an Org Admin role by cloning 'Organization admin' role 2. Assign an organization A and Location A to the Org Admin role 3. Create an LDAP usergroup with two users 4. Assign Organization B and Location B to LDAP usergroup 5. Assign Org Admin role to LDAP usergroup :expectedresults: Users in LDAP usergroup should not have access to the resources in taxonomies if the taxonomies of Org Admin role is not same :CaseLevel: System """ class SystemAdminTestCases(CLITestCase): """Test class for System Admin role end to end CLI""" def tearDown(self): """Will reset the changed value of settings""" Settings.set({'name': "outofsync_interval", 'value': "30"}) @upgrade @tier3 def test_system_admin_role_end_to_end(self): """Test System admin role with a end to end workflow :id: da6b3549-d1cf-44fc-869f-08d15d407fa2 :steps: 1. Create a System admin role user1 2. Login with the user1 and change global settings "Out of sync interval" to 31 3. Create user2 with system admin role 4. Login with user2 to create a Organization 5. Clone a Org-admin role 6. Edit the Architecture Filter and search name = x86_64 7. Create a User with Cloned Org admin 8. Login with user. :expectedresults: 1. User should be assigned with System Admin role. 2. User with sys admin role should be able to update settings 3. User with sys admin role should be able to create users and assign Organizations to them. 4. System Admin role should be able to create Organization admins 5. User with sys admin role should be able to edit filters on roles :CaseLevel: System """ org = make_org() location = make_location() common_pass = gen_string('alpha') role = Role.info({'name': 'System admin'}) system_admin_1 = make_user( { 'password': common_pass, 'organization-ids': org['id'], 'location-ids': location['id'], } ) User.add_role({'id': system_admin_1['id'], 'role-id': role['id']}) Settings.with_user(username=system_admin_1['login'], password=common_pass).set( {'name': "outofsync_interval", 'value': "32"} ) sync_time = Settings.list({'search': 'name=outofsync_interval'})[0] # Asserts if the setting was updated successfully self.assertEqual('32', sync_time['value']) # Create another System Admin user using the first one system_admin = User.with_user( username=system_admin_1['login'], password=common_pass ).create( { 'auth-source-id': 1, 'firstname': gen_string('alpha'), 'lastname': gen_string('alpha'), 'login': gen_string('alpha'), 'mail': '{0}@example.com'.format(gen_string('alpha')), 'password': common_pass, 'organizations': org['name'], 'role-ids': role['id'], 'locations': location['name'], } ) # Create the Org Admin user org_role = Role.with_user(username=system_admin['login'], password=common_pass).clone( { 'name': 'Organization admin', 'new-name': gen_string('alpha'), 'organization-ids': org['id'], 'location-ids': location['id'], } ) org_admin = User.with_user(username=system_admin['login'], password=common_pass).create( { 'auth-source-id': 1, 'firstname': gen_string('alpha'), 'lastname': gen_string('alpha'), 'login': gen_string('alpha'), 'mail': '{0}@example.com'.format(gen_string('alpha')), 'password': common_pass, 'organizations': org['name'], 'role-ids': org_role['id'], 'location-ids': location['id'], } ) # Assert if the cloning was successful self.assertIsNotNone(org_role['id']) org_role_filters = Role.filters({'id': org_role['id']}) search_filter = None for arch_filter in org_role_filters: if arch_filter['resource-type'] == 'Architecture': search_filter = arch_filter break Filter.with_user(username=system_admin['login'], password=common_pass).update( {'role-id': org_role['id'], 'id': arch_filter['id'], 'search': 'name=x86_64'} ) # Asserts if the filter is updated self.assertIn('name=x86_64', Filter.info({'id': search_filter['id']}).values()) org_admin = User.with_user(username=system_admin['login'], password=common_pass).info( {'id': org_admin['id']} ) # Asserts Created Org Admin self.assertIn(org_role['name'], org_admin['roles']) self.assertIn(org['name'], org_admin['organizations'])
gpl-3.0
-738,638,804,037,887,600
32.508185
99
0.620784
false
thinkWhere/Roadnet
street_browser/add.py
1
15108
# -*- coding: utf-8 -*- import datetime from PyQt4.QtSql import QSqlQuery, QSqlQueryModel from PyQt4.QtGui import QMessageBox, QLineEdit, QComboBox from PyQt4.QtCore import Qt, QDate from qgis.core import QgsMapLayerRegistry from ..generic_functions import SwitchStreetBrowserMode, ZoomSelectCanvas, ipdb_breakpoint from ..roadnet_dialog import SaveRecordDlg from edit import EditEsuLink, EditStartEndCoords, UpdateEsuSymbology from mod_validation import ValidateDescription, ValidateStreetType __author__ = 'matthew.walsh' class AddRecord: """ Add a new street record to the model """ def __init__(self, iface, street_browser, model, mapper, db, params): self.street_browser = street_browser self.iface = iface self.model = model self.mapper = mapper self.db = db self.username = params['UserName'] self.modify = SwitchStreetBrowserMode(self.street_browser) self.save_dlg = SaveRecordDlg() self.save_dlg.ui.savePushButton.clicked.connect(self.save_new_record) self.save_dlg.ui.revertPushButton.clicked.connect(self.cancel_new_record) self.save_dlg.ui.cancelPushButton.clicked.connect(lambda: self.save_dlg.close()) self.esu_layer = QgsMapLayerRegistry.instance().mapLayersByName('ESU Graphic')[0] self.lineedits = {1: self.street_browser.ui.usrnLineEdit, 8: self.street_browser.ui.startDateDateEdit, 7: self.street_browser.ui.updateDateLineEdit, 2: self.street_browser.ui.versionLineEdit, 6: self.street_browser.ui.entryDateLineEdit, 18: self.street_browser.ui.stateDateLineEdit, 11: self.street_browser.ui.startXLineEdit, 12: self.street_browser.ui.startYLineEdit, 13: self.street_browser.ui.endXLineEdit, 14: self.street_browser.ui.endYLineEdit, 15: self.street_browser.ui.tolLineEdit} self.combos = {4: self.street_browser.ui.recordTypeComboBox, 20: self.street_browser.ui.localityComboBox, 22: self.street_browser.ui.townComboBox, 21: self.street_browser.ui.countyComboBox, 9: self.street_browser.ui.authorityComboBox, 17: self.street_browser.ui.stateComboBox, 19: self.street_browser.ui.classComboBox} self.start_idx = None self.start_desc = None self.start_tol = None self.edit_esu = None self.new_usrn_no = None self.esu_version = ZoomSelectCanvas(self.iface, self.street_browser, self.db) def add(self): """ Main method to decide whether to setup for adding or complete/commit record """ add_text = str(self.street_browser.ui.addPushButton.text()) # Setup blank form if add_text.lower() == "add": self.street_browser.ui.editEsuPushButton.clicked.connect(self.create_esu_link) self.street_browser.ui.editCoordsPushButton.clicked.connect(self.create_start_end_coords) self.setup_sb_add() # Completion event else: self.save_dlg.setWindowFlags(Qt.Window | Qt.WindowTitleHint | Qt.CustomizeWindowHint) self.save_dlg.exec_() def current_desc_tol_idx(self): """ Grab the current record index and desc """ self.start_idx = self.mapper.currentIndex() self.start_desc = self.street_browser.ui.descriptionTextEdit.toPlainText() self.start_tol = self.street_browser.ui.tolLineEdit.text() def setup_sb_add(self): """ Setup the street browser for adding a new record """ # Grab current idx's desc, tol self.current_desc_tol_idx() n_usrn = self.new_usrn() self.street_browser.ui.addPushButton.setText("Complete") self.street_browser.ui.descriptionLabel.setStyleSheet("color : red") self.modify.edit() # Clear lineedits all_lineedits = self.street_browser.findChildren(QLineEdit) for lineedit in all_lineedits: lineedit.setText("") self.clear_xref_and_esu_tables() self.set_combo_index() self.set_current_dates() self.street_browser.ui.tolLineEdit.setStyleSheet("background-color: white") self.street_browser.ui.tolLineEdit.setReadOnly(False) self.street_browser.ui.tolLineEdit.setText("10") self.street_browser.ui.descriptionTextEdit.setText("") # Set new usrn + version 1 self.street_browser.ui.byLineEdit.setText(self.username) self.street_browser.ui.usrnLineEdit.setText(str(n_usrn)) self.street_browser.ui.versionLineEdit.setText("1") # Set the ESU layer to read only self.esu_layer.setReadOnly(True) def revert_sb_add(self): """ Revert street browser back to read-only mode """ self.edit_esu = None self.modify.read_only() self.street_browser.ui.tolLineEdit.setReadOnly(True) self.street_browser.ui.tolLineEdit.setStyleSheet("background-color: rgb(213,234,234)") self.street_browser.ui.addPushButton.setText("Add") self.esu_layer.setReadOnly(False) def clear_xref_and_esu_tables(self): """ Blank model clears the xref table """ # Set xref to empty model empty_model = QSqlQueryModel() self.street_browser.ui.crossReferenceTableView.setModel(empty_model) # Clear list widget self.street_browser.ui.linkEsuListWidget.clear() def set_combo_index(self): """ Set the index of the comboboxes """ all_combos = self.street_browser.findChildren(QComboBox) for combo in all_combos: combo.setCurrentIndex(0) def set_current_dates(self): """ Set date lineedits/date picker to current date """ now_date = datetime.datetime.now() now_formatted = now_date.strftime("%d/%m/%Y") self.street_browser.ui.updateDateLineEdit.setText(now_formatted) self.street_browser.ui.entryDateLineEdit.setText(now_formatted) self.street_browser.ui.stateDateLineEdit.setText(now_formatted) date_obj = QDate(now_date.year, now_date.month, now_date.day) self.street_browser.ui.startDateDateEdit.setDate(date_obj) def cancel_new_record(self): """ Revert street browser to read only """ self.revert_sb_add() self.mapper.setCurrentIndex(self.mapper.currentIndex()) self.disconnect_esu_and_coords() self.save_dlg.close() def new_usrn(self): """ Returns a new usrn (max usrn + 1) :rtype : int :return: USRN """ query = QSqlQuery("SELECT MAX(usrn) from tblSTREET", self.db) query.seek(0) try: usrn = int(query.value(0)) + 1 except TypeError: # Throws if there are no USRNs yet. Example for demo db inserted here # This must be set manually for a new local authority usrn = 12700001 self.new_usrn_no = usrn return usrn def failed_validation_msg(self, mandatory, desc, esu_valid): # TODO: Attach esu's to error message (see bad_esu = [] in validate_mandatory) """ Display appropriate error message for failed validation :param mandatory: mand check bool :param desc: desc present bool :param esu_valid: valid esu links bool """ err = "Unable to save record:" errors = [] if not mandatory: errors.append("All mandatory fields must be complete") if not desc: errors.append("Description already exists within this town/locality") if not esu_valid: errors.append("Invalid ESU links") for error in errors: err = err + "\n" + str(error) val_fail_msg_box = QMessageBox(QMessageBox.Warning, " ", err, QMessageBox.Ok, None) val_fail_msg_box.setWindowFlags(Qt.CustomizeWindowHint | Qt.WindowTitleHint) val_fail_msg_box.exec_() def save_new_record(self): """ Insert new record if all validation is passed """ self._strip_whitespace_from_description() usrn = self.street_browser.ui.usrnLineEdit.text() mandatory = self.modify.mandatory_field_check() if self._record_is_type_3_or_4(): unique_desc = True else: unique_desc = ValidateDescription(self.street_browser, self.db).validate() if self.edit_esu: final_sel = self.edit_esu.get_final_selection()[0] esu_valid = ValidateStreetType(self.street_browser, self.db).validate(usrn, final_sel) else: esu_valid = True if mandatory and unique_desc and esu_valid: self.insert_record() self.revert_sb_add() self.disconnect_esu_and_coords() # Update Esu Graphic symbology attribute for all linked Esu's self.esu_layer = QgsMapLayerRegistry.instance().mapLayersByName('ESU Graphic')[0] UpdateEsuSymbology(self.db, self.esu_layer).update(usrn) else: self.failed_validation_msg(mandatory, unique_desc, esu_valid) self.save_dlg.close() def _strip_whitespace_from_description(self): """ Strip whitespace from the text in the description field """ description = str(self.street_browser.ui.descriptionTextEdit.toPlainText()) description = description.strip() self.street_browser.ui.descriptionTextEdit.setPlainText(description) def _record_is_type_3_or_4(self): """ Check the combo box to see if record is Type 3 or 3 :return boolean: """ record_type_combo = self.street_browser.ui.recordTypeComboBox record_type = int(record_type_combo.itemData(record_type_combo.currentIndex())) if record_type in (3, 4): return True else: return False def disconnect_esu_and_coords(self): try: self.street_browser.ui.editEsuPushButton.clicked.disconnect() self.street_browser.ui.editCoordsPushButton.clicked.disconnect() except TypeError: pass def insert_record(self): """ Insert a record/row into the model + commit """ record = self.model.record() record.setValue(1, str(self.street_browser.ui.usrnLineEdit.text())) # usrn record.setValue(3, str(0)) # currency_flag 0 record.setValue(5, str(self.street_browser.ui.descriptionTextEdit.toPlainText())) record.setValue(23, self.username) # Set values from lineedits date_cols = [6, 7, 8, 18] for idx, lineedit in self.lineedits.iteritems(): txt = str(lineedit.text()) if txt: # re-format dates for db if idx in date_cols: txt = self.database_dates(txt) record.setValue(idx, txt) # Set values from comboboxes for idx, combo in self.combos.iteritems(): combo_idx = combo.currentIndex() # if combo_idx != 0: record.setValue(idx, str(combo.itemData(combo_idx))) # Append record after last current record self.model.insertRecord(-1, record) # Commit to db + insert any esu links self.model.submitAll() self.commit_esu_link() self.repopulate_model() def repopulate_model(self): """ Repopulate the model to show the new model """ while self.model.canFetchMore(): self.model.fetchMore() # jump to new record (appended to end) self.mapper.toLast() def database_dates(self, date): """ Format dates from lineedits for database (yyyymmdd) :param date: Date string :return: formattted date string """ date_obj = datetime.datetime.strptime(date, "%d/%m/%Y") db_date = str(date_obj.strftime("%Y%m%d")) return db_date def create_esu_link(self): """ Add esu links to a street """ button = self.street_browser.ui.editEsuPushButton layer = 'ESU Graphic' display_attr = 'esu_id' if self.edit_esu: previous_unsaved = self.edit_esu.get_final_selection()[0] self.edit_esu = EditEsuLink(self.iface, button, self.db, street_browser=self.street_browser, layer_name=layer, dis_attr=display_attr, unsaved=previous_unsaved) else: self.edit_esu = EditEsuLink(self.iface, button, self.db, street_browser=self.street_browser, layer_name=layer, dis_attr=display_attr) self.edit_esu.show() def commit_esu_link(self): """ Updates existing esu links on edit and deal with adding/remove links via editing """ usrn = str(self.new_usrn_no) if self.edit_esu: # get new set of esu links esus = self.edit_esu.get_final_selection() final = esus[0] else: # No esu edits made so query for existing esu links final = self.esu_version.query_esu(usrn) date = str(datetime.datetime.now().strftime("%Y%m%d")) try: for esu in final: query_str = "SELECT version_no FROM tblESU WHERE esu_id = %s AND currency_flag = 0;" % esu query = QSqlQuery(query_str, self.db) seek = query.seek(0) if seek: esu_ver = query.value(0) else: esu_ver = str(1) # Create new links insert_sql = "INSERT INTO lnkESU_STREET (esu_id, usrn, esu_version_no, usrn_version_no, currency_flag," \ " entry_date, update_date) VALUES (%s, %s, %s, 1, 0, %s, %s)" \ % (esu, usrn, esu_ver, date, date) new_lnk_query = QSqlQuery(insert_sql, self.db) except TypeError: # No esu's attached to record pass def create_start_end_coords(self): """ Create instance of cooord edit class """ coord_le = {"start_xref": self.street_browser.ui.startXLineEdit, "start_yref": self.street_browser.ui.startYLineEdit, "end_xref": self.street_browser.ui.endXLineEdit, "end_yref": self.street_browser.ui.endYLineEdit} button = self.street_browser.ui.editCoordsPushButton usrn = self.street_browser.ui.usrnLineEdit.text() coords = EditStartEndCoords(self.iface, coord_le, self.model, self.mapper, button, usrn=usrn, edit=False) coords.show()
gpl-2.0
-7,157,423,312,518,393,000
39.943089
121
0.601403
false
josephyli/py-db-cluster
runDDL.py
1
9526
import argparse import os import pymysql.cursors import re import sys from ConfigParser import SafeConfigParser from StringIO import StringIO from pymysql import OperationalError # returns a list of sql commands as strings def read_DDL(ddlfilename): f = open(ddlfilename, 'r') ddlfile = f.read() f.close() temp = filter(None, ddlfile.split(';')) sql_commands = [] # filter out white space from file input for c in temp: if c != "\n": sql_commands.append(c) return sql_commands # returns a dict with all nodes information # responsible for parsing the config file def get_node_config(configfilename): config_dict = {} if os.path.isfile(configfilename): with open(configfilename) as stream: # pass into string & add a header stream = StringIO("[fakesection]\n" + stream.read()) # read/parse catalog data cp = SafeConfigParser() cp.readfp(stream) config_dict['catalog.driver'] = cp.get('fakesection', 'catalog.driver') config_dict['catalog.hostname'] = cp.get('fakesection', 'catalog.hostname') config_dict['catalog.username'] = cp.get('fakesection', 'catalog.username') config_dict['catalog.passwd'] = cp.get('fakesection', 'catalog.passwd') config_dict['catalog.database'] = cp.get('fakesection', 'catalog.hostname').rsplit('/', 1)[-1] # read the number of nodes numnodes = cp.getint('fakesection', 'numnodes') config_dict['catalog.numnodes'] = numnodes # read node data and print out info for node in range(1, numnodes + 1): for candidate in ['driver', 'hostname', 'username', 'passwd', 'database']: # test if candidate exists before adding to dictionary if cp.has_option('fakesection', "node" + str(node) + "." + candidate): # print cp.get('fakesection', "node" + str(node) + "." + candidate) config_dict["node" + str(node) + "." + candidate] = cp.get('fakesection', "node" + str(node) + "." + candidate) else: if candidate == "database": config_dict["node" + str(node) + ".database"] = cp.get('fakesection', "node" + str(node) + ".hostname").rsplit('/', 1)[-1] else: print "error: candidate not found" return config_dict else: print("No config file found at", configfilename) return null def check_dtables_exists(config_dict): cat_hn = re.findall( r'[0-9]+(?:\.[0-9]+){3}', config_dict['catalog.hostname'] )[0] cat_usr = config_dict['catalog.username'] cat_pw = config_dict['catalog.passwd'] cat_dr = config_dict['catalog.driver'] cat_db = config_dict['catalog.database'] sql = "SELECT * FROM information_schema.tables WHERE table_schema = '%s' AND table_name = 'dtables' LIMIT 1;" % cat_db res = None; try: # connect and execute the sql statement connection = pymysql.connect(host=cat_hn, user=cat_usr, password=cat_pw, db=cat_db, charset='utf8mb4', cursorclass=pymysql.cursors.DictCursor) print "[SUCCESSFUL CATALOG CONNECTION] <"+connection.host+" - "+connection.db+">", connection print with connection.cursor() as cursor: res = cursor.execute(sql.strip() + ';') connection.commit() except pymysql.err.InternalError as d: print "[FAILED TO CHECK IF CATALOG EXISTS]" print d if res: return True else: return False # stores metadata about the DDL in a catalog database # using a list of tables that need to be created in the catalog def update_catalog(config_dict, table_list): cat_hn = re.findall( r'[0-9]+(?:\.[0-9]+){3}', config_dict['catalog.hostname'] )[0] cat_usr = config_dict['catalog.username'] cat_pw = config_dict['catalog.passwd'] cat_dr = config_dict['catalog.driver'] cat_db = config_dict['catalog.database'] if check_dtables_exists(config_dict): sql = [] else: sql = ["CREATE TABLE IF NOT EXISTS dtables (tname char(32), nodedriver char(64), nodeurl char(128), nodeuser char(16), nodepasswd char(16), partmtd int, nodeid int, partcol char(32), partparam1 char(32), partparam2 char(32));"] # prepares the sql statement to insert into catalog the tables in each node for table in table_list: for i in range(config_dict["catalog.numnodes"]): hn = config_dict['node'+str(i + 1)+'.hostname'] usr = config_dict['node'+str(i + 1)+'.username'] pw = config_dict['node'+str(i + 1)+'.passwd'] dr = config_dict['node'+str(i + 1)+'.driver'] sql.append("INSERT INTO dtables VALUES (\'%s\', \'%s\', \'%s\', \'%s\',\'%s\', NULL,%d,NULL,NULL,NULL);" % (table,dr,hn,usr,pw,i+1)) try: # connect and execute the sql statement connection = pymysql.connect(host=cat_hn, user=cat_usr, password=cat_pw, db=cat_db, charset='utf8mb4', cursorclass=pymysql.cursors.DictCursor) print "[SUCCESSFUL CATALOG CONNECTION] <"+connection.host+" - "+connection.db+">", connection print with connection.cursor() as cursor: # execute every sql command for command in sql: try: print command print cursor.execute(command.strip() + ';') connection.commit() except OperationalError, msg: print "Command skipped: ", msg except pymysql.err.InternalError as d: print "[FAILED TO UPDATE CATALOG]" print d # returns a list of connections to all nodes def get_connections(config_dict): connections = [] for i in range(config_dict["catalog.numnodes"]): try: hn = re.findall( r'[0-9]+(?:\.[0-9]+){3}', config_dict['node'+str(i + 1)+'.hostname'] )[0] usr = config_dict['node'+str(i + 1)+'.username'] pw = config_dict['node'+str(i + 1)+'.passwd'] db = config_dict['node'+str(i + 1)+'.database'] connections.append(pymysql.connect(host=hn, user=usr, password=pw, db=db, charset='utf8mb4', cursorclass=pymysql.cursors.DictCursor)) except pymysql.MySQLError as e: print "[NODE", i + 1, "CONNECTION FAILED]:" print "hostname:".rjust(12), re.findall( r'[0-9]+(?:\.[0-9]+){3}', config_dict['node'+str(i + 1)+'.hostname'] )[0] print "username:".rjust(12), config_dict['node'+str(i + 1)+'.username'] print "password:".rjust(12), config_dict['node'+str(i + 1)+'.passwd'] print "database:".rjust(12), config_dict['node'+str(i + 1)+'.database'] print 'Got error {!r}, errno is {}'.format(e, e.args[0]) print return connections # runs the list of commands against the list of connections # later, this will implement multi-threading def run_commmands_against_nodes(connections, sql_commands): import time from threading import Thread from threading import active_count # create a list of jobs list_of_threads = [] for connection in connections: print "[JOB CREATED] <"+ connection.host+ " - " + connection.db+ ">" print connection list_of_threads.append(Thread(target=run_sql_commands_against_node, args=(connection, sql_commands))) print # start up all jobs for t in list_of_threads: t.start() # wait for all jobs to complete before moving on while active_count() > 1: time.sleep(1) def run_sql_commands_against_node(connection, sql_commands): with connection.cursor() as cursor: try: for c in sql_commands: cursor.execute(c.strip() + ';') connection.commit() print "[JOB SUCCESSFUL] <"+connection.host+ " - " + connection.db+ ">" connection.close() except pymysql.MySQLError as e: print "[JOB FAILED] <"+connection.host+ " - " + connection.db+ "> ERROR: {!r}, ERROR NUMBER: {}".format(e, e.args[0]) def print_pretty_dict(idict): import json print json.dumps(idict, indent=1) def main(): parser = argparse.ArgumentParser() parser.add_argument("configfile", help="Location of Config File, See the README for more information") parser.add_argument("ddlfile", help="Location of DDL File, See the README for more information") args = parser.parse_args() print print "=" * 80 print # read configuration and return a dictionary ------------------------------- temp = "PARSING " + str(args.configfile) + "..." print print temp.center(80, " ") nodes_dict = get_node_config(args.configfile) print_pretty_dict(nodes_dict) print print "-" * 80 print # return a list of connections to all nodes -------------------------------- print "CREATING CONNECTIONS...".center(80, " ") print node_connections = get_connections(nodes_dict) # if no connections were made, terminate the program, comment this out for testing if len(node_connections) == 0: print "Terminating due to connection failures..." sys.exit() print "# of connections:", str(len(node_connections)) print for c in node_connections: print "HOST: " + c.host + " DB: " + c.db + " " + str(c) print print "-" * 80 print # read DDL and return a list of sql commands ------------------------------- print "PARSING SQL COMMANDS...".center(80, " ") print sql_commands = read_DDL(args.ddlfile) # list of tables is used to update catalog with metadata table_list = [] for command in sql_commands: if command.split()[0].upper() == "CREATE": table_list.append((re.split('\s|\(',command)[2])) print "[SQL COMMANDS]:" for s in sql_commands: print s.strip() print print "TABLES:" print table_list print print "-" * 80 print # update catalog ---------------------------------------------------------- print "UPDATING CATALOG...".center(80, " ") print update_catalog(nodes_dict,table_list) print print "-" * 80 print # run the commands against the nodes --------------------------------------- print "EXECUTING SQL COMMANDS ON NODES...".center(80, " ") print run_commmands_against_nodes(node_connections, sql_commands) print print "=" * 80 print if __name__ == "__main__": main()
gpl-3.0
3,556,770,068,061,387,300
32.780142
229
0.655364
false
alibozorgkhan/django-boilerplate
django_boilerplate/settings/base.py
1
4882
""" Django settings for django_boilerplate project. Generated by 'django-admin startproject' using Django 1.10.5. For more information on this file, see https://docs.djangoproject.com/en/1.10/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/1.10/ref/settings/ """ import os # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.dirname(os.path.abspath(__file__)))) # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.10/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = '+!=wvvf$f^jytsaol8_50@)+xw*7m4@v&9=xm!()b(n_731dhm' # SECURITY WARNING: don't run with debug turned on in production! DEBUG = True ALLOWED_HOSTS = [] # Application definition LOCAL_APPS = [ 'accounts', 'app', ] EXTERNAL_APPS = [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'social_django', ] INSTALLED_APPS = LOCAL_APPS + EXTERNAL_APPS MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'social_django.middleware.SocialAuthExceptionMiddleware' ] ROOT_URLCONF = 'django_boilerplate.urls' TEMPLATES_DIR = ["{}/templates".format(app) for app in LOCAL_APPS] + ['django_boilerplate/templates'] TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': TEMPLATES_DIR, 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'django_boilerplate.wsgi.application' # Database # https://docs.djangoproject.com/en/1.10/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } # Password validation # https://docs.djangoproject.com/en/1.10/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] # Internationalization # https://docs.djangoproject.com/en/1.10/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.10/howto/static-files/ STATIC_URL = '/static/' STATIC_ROOT = 'assets/' STATICFILES_DIRS = ( os.path.join(BASE_DIR, 'static'), ) # Social Auth AUTHENTICATION_BACKENDS = ( 'social_core.backends.google.GoogleOAuth2', 'social_core.backends.facebook.FacebookOAuth2', 'social_core.backends.linkedin.LinkedinOAuth2', 'django.contrib.auth.backends.ModelBackend', ) LOGIN_URL = 'login' LOGOUT_URL = 'logout' LOGIN_REDIRECT_URL = 'index' SOCIAL_AUTH_FACEBOOK_KEY = os.environ.get('SOCIAL_AUTH_FACEBOOK_KEY') SOCIAL_AUTH_FACEBOOK_SECRET = os.environ.get('SOCIAL_AUTH_FACEBOOK_SECRET') SOCIAL_AUTH_FACEBOOK_SCOPE = ['email'] SOCIAL_AUTH_FACEBOOK_PROFILE_EXTRA_PARAMS = { 'fields': 'id,name,email', } SOCIAL_AUTH_GOOGLE_OAUTH2_KEY = os.environ.get('SOCIAL_AUTH_GOOGLE_OAUTH2_KEY') SOCIAL_AUTH_GOOGLE_OAUTH2_SECRET = os.environ.get('SOCIAL_AUTH_GOOGLE_OAUTH2_SECRET') SOCIAL_AUTH_LINKEDIN_OAUTH2_KEY = os.environ.get('SOCIAL_AUTH_LINKEDIN_OAUTH2_KEY') SOCIAL_AUTH_LINKEDIN_OAUTH2_SECRET = os.environ.get('SOCIAL_AUTH_LINKEDIN_OAUTH2_SECRET') SOCIAL_AUTH_LINKEDIN_OAUTH2_SCOPE = ['r_basicprofile', 'r_emailaddress'] SOCIAL_AUTH_LINKEDIN_OAUTH2_FIELD_SELECTORS = ['email-address'] SOCIAL_AUTH_LINKEDIN_OAUTH2_OAUTH2_EXTRA_DATA = [('id', 'id'), ('firstName', 'first_name'), ('lastName', 'last_name'), ('emailAddress', 'email_address')]
mit
2,478,633,743,751,343,000
28.409639
101
0.681073
false
djangraw/PsychoPyParadigms
Reading/DistractionTask_eyelink_d6.py
1
30141
#!/usr/bin/env python2 """Display multi-page text with simultaneous auditory distractions, recording eye position data using the EyeLink eye tracker.""" # DistractionTask_eyelink_d6.py # Created 3/16/15 by DJ based on VidLecTask.py # Updated 3/31/15 by DJ - renamed from ReadingTask_dict_d2.py. # Updated 4/1-16/15 by DJ - incorporated eyelink fully, renamed ReadingTask_eyelink_d1.py. # Updated 4/16/15 by DJ - removed questions, added randomized thought probes and automatic pick up where you left off. # Updated 4/17/15 by DJ - removed Eyelink again to have same behavioral version # Updated 6/29/15 by DJ - removed random session length ranges and probe times - page ranges specified in params. # Updated 7/7/15 by DJ - Renamed from ReadingImageTask_dict_d4, added audio. # Updated 7/15/15 by DJ - added sound time limits # Updated 7/20/15 by DJ - switched to premade sound files, switched back to eyelink version, debugged # Updated 7/24/15 by DJ - added quiz files list, imagePrefix list, readingQuiz list and audioQuiz list # Updated 7/28/15 by DJ - made sounds play on page-by-page basis, sound is randomized, # Updated 8/18/15 by DJ - added serial port (and changed name from _behavior to _serial), but haven't tried it yet. # Updated 8/21/15 by DJ - tested in 3T-C and debugged as necessary # Updated 9/17/15 by DJ - added logging of each message sent # Updated 10/22/15 by DJ - added saving # Updated 10/29/15 by DJ - cleaned up slightly, edited PromptTools to ask subjects not to skip around. # Updated 11/11/15 by DJ - added additional calibration parameters (changed name to _d6) # Updated 11/12/15 by DJ - switched to 1024x768 (max res of rear projector) # Updated 12/2/15 by DJ - adapted serial version back to EyeLink version # Import packages from psychopy import core, gui, data, event, sound, logging #, visual # visual causes a bug in the guis, so I moved it down. from psychopy.tools.filetools import fromFile, toFile import time as ts, numpy as np import AppKit, os # for monitor size detection, files import PromptTools import random """ # Import SMI libraries import serial from LibSmi_PsychoPy import LibSmi_PsychoPy """ #""" # Import eyelink libraries from pylink import * from EyeLinkCoreGraphicsPsychoPy import EyeLinkCoreGraphicsPsychoPy #""" # ====================== # # ===== PARAMETERS ===== # # ====================== # # Save the parameters declared below? saveParams = True newParamsFilename = 'DistractionParams_eyelink_d6.pickle' expInfoFilename = 'lastDistractionInfo_eyelink_d6.pickle' # Declare primary task parameters. params = { # FOR INITIAL PILOTS 'imagePrefixList': ['Greeks_Lec02_stretch_gray','Greeks_Lec02_stretch_gray','Greeks_Lec02_stretch_gray','Greeks_Lec02_stretch_gray','Greeks_Lec07_stretch_gray','Greeks_Lec07_stretch_gray'], 'startPageList': [1,31,61,91,1,31], # page where each session should start 'endPageList': [30,60,90,120,30,60], # inclusive 'readingQuizList':['Lecture02Questions_d4_read1.txt','Lecture02Questions_d4_read2.txt','Lecture02Questions_d4_read3.txt','Lecture02Questions_d4_read4.txt','Lecture07Questions_d3_read1.txt','Lecture07Questions_d3_read2.txt',], 'soundFileList': ['Lecture10_40min.wav']*6, # 'imagePrefixList': ['Greeks_Lec07_stretch_gray','Greeks_Lec07_stretch_gray','Greeks_Lec10_stretch_gray','Greeks_Lec10_stretch_gray','Greeks_Lec02_stretch_gray','Greeks_Lec02_stretch_gray'], # 'startPageList': [1,31,1,31,61,91], # page where each session should start # 'endPageList': [30,60,30,60,90,120], # inclusive # 'soundFileList': ['Lecture02_40min.wav']*6, # 'readingQuizList':['Lecture07Questions_d3_read1.txt','Lecture07Questions_d3_read2.txt','Lecture10Questions_d4_read1.txt','Lecture10Questions_d4_read2.txt','Lecture02Questions_d4_read3.txt','Lecture02Questions_d4_read4.txt'], # 'soundFileList': ['Lecture02_40min.wav']*6, 'promptTypeList': ['AttendReading','AttendBoth_short','AttendReading_short','AttendBoth_short','AttendBoth_short','AttendReading_short'], 'soundQuizList':['BLANK.txt']*6, 'quizPromptList':['TestReading_box']*6, 'probSoundList':[0.5]*6, # REST OF PARAMS 'skipPrompts': False, # go right to the scanner-wait page 'maxPageTime': 14, # max time the subject is allowed to read each page (in seconds) 'pageFadeDur': 3, # for the last pageFadeDur seconds, the text will fade to white. 'IPI': 2, # time between when one page disappears and the next appears (in seconds) 'probSound': 0.5, # probability that sound will be played on any given page 'IBI': 1, # time between end of block/probe and beginning of next block (in seconds) 'tStartup': 2, # pause time before starting first page 'probeDur': 60, # max time subjects have to answer a Probe Q 'keyEndsProbe': True, # will a keypress end the probe? 'pageKey': 'b',#'space', # key to turn page 'respKeys': ['g','r','b','y'], # keys to be used for responses (clockwise from 9:00) - "DIAMOND" RESPONSE BOX 'wanderKey': 'z', # key to be used to indicate mind-wandering 'triggerKey': 't', # key from scanner that says scan is starting # declare image and question files 'imageDir': 'ReadingImages/', 'imagePrefix': '', # images must start with this and end with _page<number>.jpg 'soundDir': 'sounds/', 'soundFile': '', # fill in later 'promptType': '', # fill in later 'soundVolume': 0.5, 'whiteNoiseFile': 'Lecture10_40min_phasescrambled.wav', #'WhiteNoise-7m30s.wav', # this plays when the lecture doesn't. 'pageRange': [1, 1], # pages (starting from 1) at which reading should start and stop in each block 'textDir': 'questions/', # directory containing questions and probes 'probesFile': 'BLANK.txt', #'ReadingProbes_d2.txt', #'ReadingProbes_behavior.txt', # 'readingQuiz':'', # fill in later 'soundQuiz':'', # fill in later 'quizPrompt':'', # fill in later 'questionOrder':[], # fill in later # declare other stimulus parameters 'fullScreen': True, # run in full screen mode? 'screenToShow': 1, # display on primary screen (0) or secondary (1)? 'screenColor':(128,128,128), # in rgb255 space 'imageSize': (960,709), # (FOR 1024x768 SCREEN) # in pixels... set to None for exact size of screen #(1201,945), # (FOR 1280x1024 SCREEN) 'fixCrossSize': 10, # size of cross, in pixels 'fixCrossPos': (-480,354), # (x,y) pos of fixation cross displayed before each page (for drift correction) #[-600, 472], 'usePhotodiode': False, # add sync square in corner of screen #""" 'isEyeLinkConnected': False # is there an EyeLink tracker connected via ethernet? } #""" """ # declare serial port & calibration parameters for SMI (remove bracket and add comma to lines just above) 'portName': '/dev/tty.usbserial', 'portBaud': 115200, 'calNPoints': 13, # number of points in the calibration (and validation)The number of points to be used for the validation (standard=9) 'calAutoAccept': False, # Let SMI pick when to accept a point (True [default]) or accept manually (False). 'calGoFast': False, # Go quickly from point to point (True) or slower and more precise (False [default]). 'calCheckLevel': 3 #calibration check level (0=none,1=weak,2=medium,3=strong [default]) } """ # save parameters if saveParams: print("Opening save dialog:") dlgResult = gui.fileSaveDlg(prompt='Save Params...',initFilePath = os.getcwd() + '/params', initFileName = newParamsFilename, allowed="PICKLE files (.pickle)|.pickle|All files (.*)|") newParamsFilename = dlgResult print("dlgResult: %s"%dlgResult) if newParamsFilename is None: # keep going, but don't save saveParams = False print("Didn't save params.") else: toFile(newParamsFilename, params)# save it! print("Saved params to %s."%newParamsFilename) # toFile(newParamsFilename, params) # print("saved params to %s."%newParamsFilename) # ========================== # # ===== SET UP LOGGING ===== # # ========================== # try:#try to get a previous parameters file expInfo = fromFile(expInfoFilename) expInfo['session'] +=1 # automatically increment session number expInfo['paramsFile'] = [expInfo['paramsFile'],'Load...'] except:#if not there then use a default set expInfo = {'subject':'1', 'session':1, 'skipPrompts':False, 'tSound':0.0, 'paramsFile':['DEFAULT','Load...']} # overwrite if you just saved a new parameter set if saveParams: expInfo['paramsFile'] = [newParamsFilename,'Load...'] dateStr = ts.strftime("%b_%d_%H%M", ts.localtime()) # add the current time #present a dialogue to change params dlg = gui.DlgFromDict(expInfo, title='Distraction task', order=['subject','session','skipPrompts','paramsFile']) if not dlg.OK: core.quit()#the user hit cancel so exit # find parameter file if expInfo['paramsFile'] == 'Load...': dlgResult = gui.fileOpenDlg(prompt='Select parameters file',tryFilePath=os.getcwd(), allowed="PICKLE files (.pickle)|.pickle|All files (.*)|") expInfo['paramsFile'] = dlgResult[0] # load parameter file if expInfo['paramsFile'] not in ['DEFAULT', None]: # otherwise, just use defaults. # load params file params = fromFile(expInfo['paramsFile']) # GET NEW START AND STOP PAGES params['pageRange'][0] = params['startPageList'][expInfo['session']-1] # use session-1 as index of list params['pageRange'][1] = params['endPageList'][expInfo['session']-1] # use session-1 as index of list # GET SOUND FILE AND OTHER SESSION-DEPENDENT INFO params['soundFile'] = params['soundFileList'][expInfo['session']-1] params['promptType'] = params['promptTypeList'][expInfo['session']-1] params['imagePrefix'] = params['imagePrefixList'][expInfo['session']-1] params['readingQuiz'] = params['readingQuizList'][expInfo['session']-1] params['soundQuiz'] = params['soundQuizList'][expInfo['session']-1] params['quizPrompt'] = params['quizPromptList'][expInfo['session']-1] params['probSound'] = params['probSoundList'][expInfo['session']-1] tSound = expInfo['tSound'] # transfer skipPrompts params['skipPrompts'] = expInfo['skipPrompts'] # read questions and answers from text files [questions_reading,options_reading,answers_reading] = PromptTools.ParseQuestionFile(params['textDir']+params['readingQuiz']) print('%d questions loaded from %s'%(len(questions_reading),params['readingQuiz'])) [questions_sound,options_sound,answers_sound] = PromptTools.ParseQuestionFile(params['textDir']+params['soundQuiz']) print('%d questions loaded from %s'%(len(questions_sound),params['soundQuiz'])) # append the two questions_all = questions_reading + questions_sound options_all = options_reading + options_sound answers_all = answers_reading + answers_sound # shuffle the order newOrder = range(0,len(questions_all)) random.shuffle(newOrder) questions_all = [questions_all[i] for i in newOrder] options_all = [options_all[i] for i in newOrder] answers_all = [answers_all[i] for i in newOrder] params['questionOrder'] = newOrder # ========================== # # ===== GET SCREEN RES ===== # # ========================== # # kluge for secondary monitor if params['fullScreen']: screens = AppKit.NSScreen.screens() screenRes = (int(screens[params['screenToShow']].frame().size.width), int(screens[params['screenToShow']].frame().size.height)) # screenRes = (1920, 1200) if params['screenToShow']>0: params['fullScreen'] = False else: screenRes = (1024,768) # save screen size to params struct params['screenSize'] = screenRes # adjust image size if one was not entered. if params['imageSize'] is None: params['imageSize'] = (screenRes[0], screenRes[1]) # ========================== # # ===== LOG PARAMETERS ===== # # ========================== # # print params to Output print 'params = {' for key in sorted(params.keys()): print " '%s': %s"%(key,params[key]) # print each value as-is (no quotes) print '}' #make a log file to save parameter/event data filename = 'DistractionTask-%s-%d-%s'%(expInfo['subject'], expInfo['session'], dateStr) #'Sart-' + expInfo['subject'] + '-' + expInfo['session'] + '-' + dateStr logging.LogFile((filename+'.log'), level=logging.INFO)#, mode='w') # w=overwrite logging.log(level=logging.INFO, msg='---START PARAMETERS---') logging.log(level=logging.INFO, msg='filename: %s'%filename) logging.log(level=logging.INFO, msg='subject: %s'%expInfo['subject']) logging.log(level=logging.INFO, msg='session: %s'%expInfo['session']) logging.log(level=logging.INFO, msg='date: %s'%dateStr) logging.log(level=logging.INFO, msg='tSound: %s'%expInfo['tSound']) for key in sorted(params.keys()): # in alphabetical order logging.log(level=logging.INFO, msg='%s: %s'%(key,params[key])) logging.log(level=logging.INFO, msg='---END PARAMETERS---') # ========================== # # ===== SET UP TRACKER ===== # # ========================== # """ # Set up SMI's serial port by declaring LibSmi object myTracker = LibSmi_PsychoPy(experiment='DistractionTask_serial_d4',port=params['portName'], baudrate=params['portBaud'], useSound=True, w=screenRes[0], h=screenRes[1], bgcolor=params['screenColor'],fullScreen=params['fullScreen'],screenToShow=params['screenToShow']) print "Port %s isOpen = %d"%(myTracker.tracker.name,myTracker.tracker.isOpen()) """ #""" # Set up EyeLink tracker # Declare constants LEFT_EYE = 0 RIGHT_EYE = 1 BINOCULAR = 2 # Set up tracker if params['isEyeLinkConnected']: eyelinktracker = EyeLink() else: eyelinktracker = EyeLink(None) # Check for successful connection if not eyelinktracker: print('=== ERROR: Eyelink() returned None.') core.quit() #Initialize the graphics genv = EyeLinkCoreGraphicsPsychoPy(screenRes[0],screenRes[1],eyelinktracker,bgcolor=params['screenColor']) openGraphicsEx(genv) #Opens the EDF file. edfFileName = filename + '.EDF' edfHostFileName = 'TEST.EDF' getEYELINK().openDataFile(edfHostFileName) pylink.flushGetkeyQueue(); # used to be below openDataFile getEYELINK().setOfflineMode(); #Gets the display surface and sends a mesage to EDF file; screenRes = genv.win.size getEYELINK().sendCommand("screen_pixel_coords = 0 0 %d %d" %(screenRes[0] - 1, screenRes[1] - 1)) getEYELINK().sendMessage("DISPLAY_COORDS 0 0 %d %d" %(screenRes[0] - 1, screenRes[1] - 1)) # send software version tracker_software_ver = 0 eyelink_ver = getEYELINK().getTrackerVersion() if eyelink_ver == 3: tvstr = getEYELINK().getTrackerVersionString() vindex = tvstr.find("EYELINK CL") tracker_software_ver = int(float(tvstr[(vindex + len("EYELINK CL")):].strip())) if eyelink_ver>=2: getEYELINK().sendCommand("select_parser_configuration 0") if eyelink_ver == 2: #turn off scenelink camera stuff getEYELINK().sendCommand("scene_camera_gazemap = NO") else: getEYELINK().sendCommand("saccade_velocity_threshold = 35") getEYELINK().sendCommand("saccade_acceleration_threshold = 9500") # set EDF file contents getEYELINK().sendCommand("file_event_filter = LEFT,RIGHT,FIXATION,SACCADE,BLINK,MESSAGE,BUTTON,INPUT") if tracker_software_ver>=4: getEYELINK().sendCommand("file_sample_data = LEFT,RIGHT,GAZE,AREA,GAZERES,STATUS,HTARGET,INPUT") else: getEYELINK().sendCommand("file_sample_data = LEFT,RIGHT,GAZE,AREA,GAZERES,STATUS,INPUT") # set link data (used for gaze cursor) getEYELINK().sendCommand("link_event_filter = LEFT,RIGHT,FIXATION,SACCADE,BLINK,BUTTON,INPUT") if tracker_software_ver>=4: getEYELINK().sendCommand("link_sample_data = LEFT,RIGHT,GAZE,GAZERES,AREA,STATUS,HTARGET,INPUT") else: getEYELINK().sendCommand("link_sample_data = LEFT,RIGHT,GAZE,GAZERES,AREA,STATUS,INPUT") #getEYELINK().sendCommand("button_function 5 'accept_target_fixation'"); # #eye_used = getEYELINK().eyeAvailable() #determine which eye(s) are available #if eye_used == RIGHT_EYE: # getEYELINK().sendMessage("EYE_USED 1 RIGHT") #elif eye_used == LEFT_EYE: # getEYELINK().sendMessage("EYE_USED 0 LEFT") #elif eye_used == BINOCULAR: # getEYELINK().sendMessage("EYE_USED 2 BOTH") #else: # print("ERROR in getting the eye information!") # Set calibration parameters #pylink.setCalibrationColors((0, 0, 0), (192, 192, 192)); #Sets the calibration target and background color #pylink.setTargetSize(int(screenRes[0]/70), int(screenRes[0]/300)); #select best size for calibration target #pylink.setCalibrationSounds("", "", ""); #pylink.setDriftCorrectSounds("", "off", "off"); # Ensure that the eye(s) selected during calibration is the one that gets used in the experiment. getEYELINK().sendCommand("select_eye_after_validation = NO") # Check if we should exit if (eyelinktracker is not None and (not getEYELINK().isConnected() or getEYELINK().breakPressed())): CoolDown() #""" # ========================== # # ===== SET UP STIMULI ===== # # ========================== # from psychopy import visual # Initialize deadline for displaying next frame tNextFlip = [0.0] # put in a list to make it mutable? #create clocks and window globalClock = core.Clock()#to keep track of time trialClock = core.Clock()#to keep track of time #win = visual.Window(screenRes, fullscr=params['fullScreen'], allowGUI=False, monitor='testMonitor', screen=params['screenToShow'], units='deg', name='win',rgb=[1,1,1]) """ win = myTracker.win # SMI version """ #""" win = genv.win # eyelink version #""" # create stimuli fCS = params['fixCrossSize'] # size (for brevity) fCP = params['fixCrossPos'] # position (for brevity) fixation = visual.ShapeStim(win,lineColor='#000000',lineWidth=3.0,vertices=((fCP[0]-fCS/2,fCP[1]),(fCP[0]+fCS/2,fCP[1]),(fCP[0],fCP[1]),(fCP[0],fCP[1]+fCS/2),(fCP[0],fCP[1]-fCS/2)),units='pix',closeShape=False,name='fixCross'); message1 = visual.TextStim(win, pos=[0,+.5], wrapWidth=1.5, color='#000000', alignHoriz='center', name='topMsg', text="aaa",units='norm') message2 = visual.TextStim(win, pos=[0,-.5], wrapWidth=1.5, color='#000000', alignHoriz='center', name='bottomMsg', text="bbb",units='norm') # initialize main text stimulus imageName = '%s%s/%s_page%d.jpg'%(params['imageDir'],params['imagePrefix'],params['imagePrefix'],1) textImage = visual.ImageStim(win, pos=[0,0], name='Text',image=imageName, units='pix', size=params['imageSize']) # initialize photodiode stimulus squareSize = 0.4 diodeSquare = visual.Rect(win,pos=[squareSize/4-1,squareSize/4-1],lineColor='white',fillColor='black',size=[squareSize,squareSize],units='norm',name='diodeSquare') # declare probe parameters [probe_strings, probe_options,_] = PromptTools.ParseQuestionFile(params['textDir']+params['probesFile']) print('%d probes loaded from %s'%(len(probe_strings),params['probesFile'])) # Look up prompts [topPrompts,bottomPrompts] = PromptTools.GetPrompts(os.path.basename(__file__),params['promptType'],params) print('%d prompts loaded from %s'%(len(topPrompts),'PromptTools.py')) # Look up question prompts [topQuizPrompts,bottomQuizPrompts] = PromptTools.GetPrompts(os.path.basename(__file__),params['quizPrompt'],params) print('%d prompts loaded from %s'%(len(topPrompts),'PromptTools.py')) # declare sound! # fullSound = sound.Sound(value='%s%s'%(params['soundDir'], params['soundFile']), volume=params['soundVolume'], name='fullSound') pageSound = sound.Sound(value='%s%s'%(params['soundDir'], params['soundFile']), volume=params['soundVolume'], start=tSound, stop=tSound+params['maxPageTime'], name='pageSound') whiteNoiseSound = sound.Sound(value='%s%s'%(params['soundDir'], params['whiteNoiseFile']), volume=params['soundVolume'], start=0, stop=params['maxPageTime'], name='whiteNoiseSound') # ============================ # # ======= SUBFUNCTIONS ======= # # ============================ # # increment time of next window flip def AddToFlipTime(tIncrement=1.0): tNextFlip[0] += tIncrement # print("%1.3f --> %1.3f"%(globalClock.getTime(),tNextFlip[0])) def SetFlipTimeToNow(): tNextFlip[0] = globalClock.getTime() def SendMessage(message): """ # send message preceded by SMI code ET_REM (generic remark) and surround multi-word remarks by quotes(?) myTracker.log(message) logging.log(level=logging.INFO,msg=message) # pass """ #""" # Send EyeLink message if eyelinktracker is None: print('MSG: %s'%message) else: getEYELINK().sendMessage(message) #""" def ShowPage(iPage, maxPageTime=float('Inf'), pageFadeDur=0, soundToPlay=None): print('Showing Page %d'%iPage) #""" # Start EyeLink's RealTime mode pylink.beginRealTimeMode(100) #""" # Display text imageName = '%s%s/%s_page%d.jpg'%(params['imageDir'],params['imagePrefix'],params['imagePrefix'],iPage) textImage.setImage(imageName) textImage.opacity = 1 textImage.draw() while (globalClock.getTime()<tNextFlip[0]): pass # win.flip(clearBuffer=False) # draw & flip win.logOnFlip(level=logging.EXP, msg='Display Page%d'%iPage) # win.callOnFlip(SendMessage,'Display Page%d'%iPage) """ win.callOnFlip(SendMessage,'DisplayPage%d'%iPage) # SPACE REMOVED FOR SMI """ win.callOnFlip(SendMessage,'Display Page%d'%iPage) # Regular for EyeLink AddToFlipTime(maxPageTime) # win.callOnFlip(SendPortEvent,mod(page,256)) if params['usePhotodiode']: diodeSquare.draw() win.flip() # erase diode square and re-draw textImage.draw() win.flip() # get time at which page was displayed pageStartTime = globalClock.getTime() # Play sound just after window flips if soundToPlay is not None: soundToPlay.play() # Flush the key buffer and mouse movements event.clearEvents() # Wait for relevant key press or 'maxPageTime' seconds fadeTime = tNextFlip[0]-pageFadeDur respKey = None while (globalClock.getTime()<tNextFlip[0]) and respKey==None: newKeys = event.getKeys(keyList=[params['pageKey'],params['wanderKey'],'q','escape'],timeStamped=globalClock) if len(newKeys)>0: for thisKey in newKeys: if thisKey[0] in ['q','escape']: CoolDown() elif thisKey[0] == params['pageKey']: respKey = thisKey SetFlipTimeToNow() # reset flip time now = globalClock.getTime() if now > fadeTime: textImage.opacity = (tNextFlip[0]-now)/pageFadeDur textImage.draw() win.flip() #""" # Stop EyeLink's RealTime mode pylink.endRealTimeMode() #""" # Display the fixation cross if params['IPI']>0: fixation.draw() win.logOnFlip(level=logging.EXP, msg='Display Fixation') win.callOnFlip(SendMessage,'DisplayFixation') if params['usePhotodiode']: diodeSquare.draw() win.flip() # erase diode square and re-draw fixation.draw() win.flip() # return time for which page was shown pageDur = tNextFlip[0] - pageStartTime return pageDur # Handle end ofeyelink session def CoolDown(): # display cool-down message message1.setText("That's the end! ") message2.setText("Press 'q' or 'escape' to end the session.") win.logOnFlip(level=logging.EXP, msg='Display TheEnd') win.callOnFlip(SendMessage,'DisplayTheEnd') message1.draw() message2.draw() win.flip() thisKey = event.waitKeys(keyList=['q','escape']) """ # stop recording SMI via serial port myTracker.stop_recording() # save result myTracker.save_data(path=(filename+'.idf')) # close serial port myTracker.cleanup() """ #""" # End EyeLink recording: add 100 msec of data to catch final events pylink.endRealTimeMode() pumpDelay(100) getEYELINK().stopRecording() while getEYELINK().getkey(): # not sure what this is for pass # File transfer and cleanup! getEYELINK().setOfflineMode() msecDelay(500) message1.setText("Sending EyeLink File...") message2.setText("Please Wait.") win.logOnFlip(level=logging.EXP, msg='Display SendingFile') message1.draw() message2.draw() win.flip() #Close the file and transfer it to Display PC getEYELINK().closeDataFile() getEYELINK().receiveDataFile(edfHostFileName, edfFileName) getEYELINK().close(); #Close the experiment graphicss pylink.closeGraphics() #""" # stop sound # fullSound.stop() whiteNoiseSound.stop() pageSound.stop() # save experimental info (if we reached here, we didn't have an error) expInfo['tSound'] = tSound toFile(expInfoFilename, expInfo) # save params to file for next time # exit core.quit() # =========================== # # ======= RUN PROMPTS ======= # # =========================== # """ # Run SMI calibration and validation myTracker.run_calibration(nr_of_pts=params['calNPoints'], auto_accept=params['calAutoAccept'], go_fast=params['calGoFast'], calib_level=params['calCheckLevel']) """ #""" #Do the EyeLink tracker setup at the beginning of the experiment. getEYELINK().doTrackerSetup() # START EyeLink RECORDING error = getEYELINK().startRecording(1, 1, 1, 1) if error: print("===WARNING: eyelink startRecording returned %s"%error) #""" # display prompts if not params['skipPrompts']: PromptTools.RunPrompts(topPrompts,bottomPrompts,win,message1,message2) # wait for scanner message1.setText("Waiting for scanner to start...") message2.setText("(Press '%c' to override.)"%params['triggerKey'].upper()) message1.draw() message2.draw() win.logOnFlip(level=logging.EXP, msg='Display WaitingForScanner') win.callOnFlip(SendMessage,'DisplayWaitingForScanner') win.flip() event.waitKeys(keyList=params['triggerKey']) tStartSession = globalClock.getTime() AddToFlipTime(tStartSession+params['tStartup']) """ # START SMI RECORDING via serial port myTracker.start_recording(stream=False) """ # wait before first stimulus fixation.draw() win.logOnFlip(level=logging.EXP, msg='Display Fixation') win.callOnFlip(SendMessage,'DisplayFixation') win.flip() # =========================== # # ===== MAIN EXPERIMENT ===== # # =========================== # # set up other stuff logging.log(level=logging.EXP, msg='---START EXPERIMENT---') nBlocks = 1 # start sound #fullSound.play() # Run trials for iBlock in range(0,nBlocks): # for each block of pages # log new block logging.log(level=logging.EXP, msg='Start Block %d'%iBlock) # display pages for iPage in range(params['pageRange'][0],params['pageRange'][1]+1): # +1 to inclue final page # decide on sound if random.random()<=params['probSound']: playSound = True soundToPlay = pageSound else: playSound = False soundToPlay = whiteNoiseSound # display text pageDur = ShowPage(iPage=iPage,maxPageTime=params['maxPageTime'],pageFadeDur=params['pageFadeDur'],soundToPlay=soundToPlay) # update sound soundToPlay.stop() if playSound: tSound += pageDur #params['maxPageTime'] logging.log(level=logging.INFO, msg='tSound: %.3f'%tSound) pageSound = sound.Sound(value='%s%s'%(params['soundDir'], params['soundFile']), volume=params['soundVolume'], start=tSound, stop=tSound+params['maxPageTime'], name='pageSound') if iPage < params['pageRange'][1]: # pause AddToFlipTime(params['IPI']) # Mute Sounds pageSound.setVolume(0) # mute but don't stop... save stopping for CoolDown! whiteNoiseSound.setVolume(0) # mute but don't stop... save stopping for CoolDown! """ # Pause SMI recording via serial port myTracker.pause_recording() # save stop command for CoolDown. """ # fullSound.setVolume(0) # run probes allKeys = PromptTools.RunQuestions(probe_strings,probe_options,win,message1,message2,'Probe',questionDur=params['probeDur'], isEndedByKeypress=params['keyEndsProbe']) # check for escape keypresses for thisKey in allKeys: if len(thisKey)>0 and thisKey[0] in ['q', 'escape']: # check for quit keys CoolDown()#abort experiment # tell the subject if the lecture is over. message1.setText("It's time for some questions! Then, after a short break, we'll continue reading where you left off.") message2.setText("Press any key to end this recording.") win.logOnFlip(level=logging.EXP, msg='Display TakeABreak') win.callOnFlip(SendMessage,'DisplayTakeABreak') message1.draw() message2.draw() # change the screen win.flip() thisKey = event.waitKeys() # any keypress will end the session # ============================ # # ========= RUN QUIZ ========= # # ============================ # # display prompts if not params['skipPrompts']: PromptTools.RunPrompts(topQuizPrompts,bottomQuizPrompts,win,message1,message2) # set up other stuff logging.log(level=logging.EXP, msg='---START QUIZ---') # ------- Run the questions ------- # allKeys = PromptTools.RunQuestions(questions_all,options_all,win,message1,message2,'Question',respKeys=params['respKeys']) # --------------------------------- # isResponse = np.zeros(len(allKeys),dtype=bool) # was any response given? isCorrect = np.zeros(len(allKeys)) # was the response correct? RT = np.zeros(len(allKeys)) # how long did it take them to press a key? #print(allKeys) for iKey in range(0,len(allKeys)): if len(allKeys[iKey])>0: isResponse[iKey] = 1 RT[iKey] = allKeys[iKey][1] # keep in seconds if float(allKeys[iKey][0]) == answers_all[iKey]: isCorrect[iKey] = 1 #give some performance output to user print('Performance:') print('%d/%d = %.2f%% correct' %(np.sum(isCorrect), len(isCorrect), 100*np.average(isCorrect))) print('RT: mean = %f, std = %f' %(np.average(RT[isResponse]),np.std(RT[isResponse]))) # exit experiment CoolDown()
mit
7,485,308,004,066,379,000
41.572034
266
0.673103
false
stanford-gfx/Horus
Code/HorusApp/app/views.py
1
19731
from app import server, db, trajectoryAPI from pylab import * import flask from flask import jsonify, request, url_for, redirect, render_template, abort from flask.ext import restful import requests import math, time import urllib2 import json import os from os import path starting_lat = 0 starting_lng = 0 vehicle_millis = 0 current_lat = 0 current_lng = 0 armed = False mode = "NOT CONNECTED" real_elapsed_time = -1 TIMEOUT_MILLIS = 5000 # TEMPLATED HTML ROUTE @server.route('/') @server.route('/index') def index(): shots = db.get_shots() return render_template('index.html', shots=shots) # TEMPLATED HTML ROUTE @server.route('/easing_curve') def easing_curve(): shots = db.get_shots() return render_template('easing_curve.html', shots=shots) # TEXT ROUTE @server.route('/edit') def edit(): return render_template('edit.html') @server.route('/api/get_keyframes.json', methods = ['POST']) def get_keyframes(): print request.get_json() return jsonify(request.json) # Save a shot @server.route('/api/set_shot', methods = ['POST']) def set_shot(): parsed_json = request.get_json() data = request.data shotname = parsed_json['shotName'] db.set_shot(shotname, data) return jsonify({ 'test':1 }) # Load a shot @server.route('/api/get_shot', methods = ['GET']) def get_shot(): shotname = request.args.get('shot') rev = request.args.get('rev') if not shotname: return abort(404) data = None revCount = 1 if rev: data, revCount = db.get_shot(shotname, int(rev)) else: data, revCount = db.get_shot(shotname) if data: return flask.Response(response = data, status=200, mimetype="application/json") else: abort(404) # checks if name is unique @server.route('/api/is_name_available', methods = ['GET']) def is_name_available(): shotname = request.args.get('name') valid = not db.shot_exists(shotname) print("shotname: " + shotname + " is free? : %s" % (valid)) data = jsonify({"valid": valid}) return data @server.route('/api/get_log', methods = ['GET']) def get_log(): shotname = request.args.get('shot') if not shotname: return abort(404) data = db.get_log(shotname) if data: return jsonify(data) else: abort(404) @server.route('/api/get_easing_curve', methods = ['POST']) def get_easing_curve(): js = request.get_json() tvals = array(js['t']) dlist = array(js['d']) P = c_[dlist] T = c_[tvals] C,T,sd = trajectoryAPI.compute_easing_curve(P, T) data = { 'C':C.tolist(), 'T':T.tolist(), } return jsonify(data) # Get a spline @server.route('/api/get_spline', methods = ['POST']) def get_spline(): parsed_json = request.get_json() #data = request.data #camera lla, lookat lla cameraPose_lat_list = parsed_json['cameraPoseLats'] cameraPose_lng_list = parsed_json['cameraPoseLngs'] cameraPose_alt_list = parsed_json['cameraPoseAlts'] lookAt_lat_list = parsed_json['lookAtLats'] lookAt_lng_list = parsed_json['lookAtLngs'] lookAt_alt_list = parsed_json['lookAtAlts'] P_cameraPose = c_[cameraPose_lat_list, cameraPose_lng_list, cameraPose_alt_list] C_cameraPose,T_cameraPose,sd_cameraPose,dist_cameraPose = trajectoryAPI.compute_spatial_trajectory_and_arc_distance(P_cameraPose, inNED=False) P_lookAt = c_[lookAt_lat_list, lookAt_lng_list, lookAt_alt_list] C_lookAt,T_lookAt,sd_lookAt,dist_lookAt = trajectoryAPI.compute_spatial_trajectory_and_arc_distance(P_lookAt, inNED=False) #P_eval, T_eval, dT = splineutils.evaluate_catmull_rom_spline(C, T, sd, num_samples=200); data = { 'cameraPoseCoeff': C_cameraPose.tolist(), 'cameraPoseTvals': T_cameraPose.tolist(), 'cameraPoseDist' : dist_cameraPose.tolist(), 'lookAtCoeff': C_lookAt.tolist(), 'lookAtTvals': T_lookAt.tolist(), 'lookAtDist' : dist_lookAt.tolist() } return jsonify(data) # Get a spline @server.route('/api/get_spline_ned', methods = ['POST']) def get_spline_ned(): js = request.get_json() lookAtN = js['lookAtN'] lookAtE = js['lookAtE'] lookAtD = js['lookAtD'] lookFromN = js['lookFromN'] lookFromE = js['lookFromE'] lookFromD = js['lookFromD'] P_lookFromNED = c_[lookFromN, lookFromE, lookFromD] C_lookFromNED,T_lookFromNED,sd_lookFromNED,dist_lookFromNED = trajectoryAPI.compute_spatial_trajectory_and_arc_distance(P_lookFromNED) P_lookAtNED = c_[lookAtN, lookAtE, lookAtD] C_lookAtNED,T_lookAtNED,sd_lookAtNED,dist_lookAtNED = trajectoryAPI.compute_spatial_trajectory_and_arc_distance(P_lookAtNED) data = { 'C_lookFromNED': C_lookFromNED.tolist(), 'T_lookFromNED': T_lookFromNED.tolist(), 'dist_lookFromNED': dist_lookFromNED.tolist(), 'C_lookAtNED': C_lookAtNED.tolist(), 'T_lookAtNED': T_lookAtNED.tolist(), 'dist_lookAtNED': dist_lookAtNED.tolist() } return jsonify(data) @server.route('/api/reparameterize_spline_ned', methods = ['POST']) def reparameterize_spline_ned(): js = request.get_json() lookAtN = js['lookAtN'] lookAtE = js['lookAtE'] lookAtD = js['lookAtD'] lookFromN = js['lookFromN'] lookFromE = js['lookFromE'] lookFromD = js['lookFromD'] P_lookFromNED = c_[lookFromN, lookFromE, lookFromD] T_lookFromNED = c_[js['lookFromT'], js['lookFromT'], js['lookFromT']] P_easingLookFrom = c_[array(js['lookFromEasingD'])] T_easingLookFrom = c_[array(js['lookFromEasingT'])] P_lookAtNED = c_[lookAtN, lookAtE, lookAtD] T_lookAtNED = c_[js['lookAtT'], js['lookAtT'], js['lookAtT']] P_easingLookAt = c_[array(js['lookAtEasingD'])] T_easingLookAt = c_[array(js['lookAtEasingT'])] T_linspace_norm_lookAt, T_user_progress_lookAt, P_user_progress_lookAt, ref_llh_lookAt = trajectoryAPI.reparameterize_spline(P_lookAtNED, T_lookAtNED, P_easingLookAt, T_easingLookAt) T_linspace_norm_cameraPose, T_user_progress_lookFrom, P_user_progress_lookFrom, ref_llh_lookFrom = trajectoryAPI.reparameterize_spline(P_lookFromNED, T_lookFromNED, P_easingLookFrom, T_easingLookFrom) data = { 'lookAtReparameterizedT': T_user_progress_lookAt.tolist(), 'reparameterizedTime': T_linspace_norm_lookAt.tolist(), 'lookFromReparameterizedT': T_user_progress_lookFrom.tolist(), } return jsonify(data) @server.route('/api/reparameterize_spline', methods = ['POST']) def reparameterize_spline(): js = request.get_json() cameraPose_lat_list = js['cameraPoseLats'] cameraPose_lng_list = js['cameraPoseLngs'] cameraPose_alt_list = js['cameraPoseAlts'] lookAt_lat_list = js['lookAtLats'] lookAt_lng_list = js['lookAtLngs'] lookAt_alt_list = js['lookAtAlts'] T_cameraPose = c_[js['cameraPoseTvals'], js['cameraPoseTvals'], js['cameraPoseTvals']] T_lookAt = c_[js['lookAtTvals'], js['lookAtTvals'], js['lookAtTvals']] lookAt_easing_tvals = array(js['lookAtEasingT']) lookAt_easing_dlist = array(js['lookAtEasingD']) cameraPose_easing_tvals = array(js['cameraPoseEasingT']) cameraPose_easing_dlist = array(js['cameraPoseEasingD']) P_easingCameraPose = c_[cameraPose_easing_dlist] T_easingCameraPose = c_[cameraPose_easing_tvals] P_easingLookAt = c_[lookAt_easing_dlist] T_easingLookAt = c_[lookAt_easing_tvals] P_cameraPose = c_[cameraPose_lat_list, cameraPose_lng_list, cameraPose_alt_list] P_lookAt = c_[lookAt_lat_list, lookAt_lng_list, lookAt_alt_list] T_linspace_norm_lookAt, T_user_progress_lookAt, P_user_progress_lookAt, ref_llh_lookAt = trajectoryAPI.reparameterize_spline(P_lookAt, T_lookAt, P_easingLookAt, T_easingLookAt) T_linspace_norm_cameraPose, T_user_progress_lookFrom, P_user_progress_lookFrom, ref_llh_lookFrom = trajectoryAPI.reparameterize_spline(P_cameraPose, T_cameraPose, P_easingCameraPose, T_easingCameraPose) data = { 'lookAtReparameterizedT': T_user_progress_lookAt.tolist(), 'reparameterizedTime': T_linspace_norm_lookAt.tolist(), 'lookFromReparameterizedT': T_user_progress_lookFrom.tolist(), } return jsonify(data) @server.route('/api/export_spline_to_quad_representation_ned', methods = ['POST']) def export_spline_to_quad_representation_ned(): #which one is getting fvalled? FIGURE OUT WHAT'S GOING ON HERE shot = request.args.get('shot', 0) if not shot: return js = request.get_json() lookAtN = js['lookAtN'] lookAtE = js['lookAtE'] lookAtD = js['lookAtD'] lookFromN = js['lookFromN'] lookFromE = js['lookFromE'] lookFromD = js['lookFromD'] # Exported Values P_lookFromNED_spline = c_[lookFromN, lookFromE, lookFromD] T_lookFromNED_spline = c_[js['lookFromT'], js['lookFromT'], js['lookFromT']] P_lookFromNED_ease = c_[array(js['lookFromEasingD'])] T_lookFromNED_ease = c_[array(js['lookFromEasingT'])] P_lookAtNED_spline = c_[lookAtN, lookAtE, lookAtD] T_lookAtNED_spline = c_[js['lookAtT'], js['lookAtT'], js['lookAtT']] P_lookAtNED_ease = c_[array(js['lookAtEasingD'])] T_lookAtNED_ease = c_[array(js['lookAtEasingT'])] startAltitude = js['startAltitude'] lastTime = js['lastTime']; rev = js['rev']; refLLH = array([js['refLLH']['lat'], js['refLLH']['lng'], js['refLLH']['altitude']]) P = np.array([ P_lookFromNED_spline, T_lookFromNED_spline, P_lookFromNED_ease, T_lookFromNED_ease, P_lookAtNED_spline, T_lookAtNED_spline, P_lookAtNED_ease, T_lookAtNED_ease, [lastTime], [startAltitude], [refLLH] ]) # First Save, for later analysis!!! millis = int(round(time.time() * 1000)) np.savez(("shot-%s-rev%s-%d" % (shot, rev, millis)), P_lookFromNED_spline=P_lookFromNED_spline, T_lookFromNED_spline=T_lookFromNED_spline, P_lookFromNED_ease=P_lookFromNED_ease, T_lookFromNED_ease=T_lookFromNED_ease, P_lookAtNED_spline=P_lookAtNED_spline, T_lookAtNED_spline=T_lookAtNED_spline, P_lookAtNED_ease=P_lookAtNED_ease, T_lookAtNED_ease=T_lookAtNED_ease, lastTime=[lastTime], startAltitude=[startAltitude], refLLH=[refLLH]) export_data = { "command" : js['command'], "P_lookFromNED_spline": P_lookFromNED_spline.tolist(), "T_lookFromNED_spline": T_lookFromNED_spline.tolist(), "P_lookFromNED_ease": P_lookFromNED_ease.tolist(), "T_lookFromNED_ease": T_lookFromNED_ease.tolist(), "P_lookAtNED_spline": P_lookAtNED_spline.tolist(), "T_lookAtNED_spline": T_lookAtNED_spline.tolist(), "P_lookAtNED_ease": P_lookAtNED_ease.tolist(), "T_lookAtNED_ease": T_lookAtNED_ease.tolist(), "lastTime": [lastTime], "startAltitude": [startAltitude], "refLLH": c_[refLLH].tolist() } req = urllib2.Request("http://localhost:9000", json.dumps(js), {'Content-Type': 'application/json'}) f = urllib2.urlopen(req) res = f.read() f.close() return jsonify({'result':'ok'}) @server.route('/api/export_spline_to_quad_representation', methods = ['POST']) def export_spline_to_quad_representation(): js = request.get_json() cameraPose_lat_list = js['cameraPoseLats'] cameraPose_lng_list = js['cameraPoseLngs'] cameraPose_alt_list = js['cameraPoseAlts'] lookAt_lat_list = js['lookAtLats'] lookAt_lng_list = js['lookAtLngs'] lookAt_alt_list = js['lookAtAlts'] lookAt_easing_tvals = array(js['lookAtEasingT']) lookAt_easing_dlist = array(js['lookAtEasingD']) cameraPose_easing_tvals = array(js['cameraPoseEasingT']) cameraPose_easing_dlist = array(js['cameraPoseEasingD']) # Exported Values P_lookFrom_spline = c_[cameraPose_lat_list, cameraPose_lng_list, cameraPose_alt_list] T_lookFrom_spline = c_[js['cameraPoseTvals'], js['cameraPoseTvals'], js['cameraPoseTvals']] P_lookFrom_ease = c_[cameraPose_easing_dlist] T_lookFrom_ease = c_[cameraPose_easing_tvals] P_lookAt_spline = c_[lookAt_lat_list, lookAt_lng_list, lookAt_alt_list] T_lookAt_spline = c_[js['lookAtTvals'], js['lookAtTvals'], js['lookAtTvals']] P_lookAt_ease = c_[lookAt_easing_dlist] T_lookAt_ease = c_[lookAt_easing_tvals] lastTime = js['lastTime']; millis = int(round(time.time() * 1000)) np.savez(("shot-%d" % millis), P_lookFrom_spline=P_lookFrom_spline, T_lookFrom_spline=T_lookFrom_spline, P_lookFrom_ease=P_lookFrom_ease, T_lookFrom_ease=T_lookFrom_ease, P_lookAt_spline=P_lookAt_spline, T_lookAt_spline=T_lookAt_spline, P_lookAt_ease=P_lookAt_ease, T_lookAt_ease=T_lookAt_ease, lastTime=[lastTime]) P = np.array([ P_lookFrom_spline, T_lookFrom_spline, P_lookFrom_ease, T_lookFrom_ease, P_lookAt_spline, T_lookAt_spline, P_lookAt_ease, T_lookAt_ease, [lastTime] ]) export_data = { "command" : js['command'], "P_lookFrom_spline" :P_lookFrom_spline, "T_lookFrom_spline" :T_lookFrom_spline, "P_lookFrom_ease" :P_lookFrom_ease, "T_lookFrom_ease" :T_lookFrom_ease, "P_lookAt_spline" :P_lookAt_spline, "T_lookAt_spline" :T_lookAt_spline, "P_lookAt_ease" :P_lookAt_ease, "T_lookAt_ease" :T_lookAt_ease, "lastTime" :[lastTime]} print export_data headers = {'content-type': 'application/json'} r = requests.post("http://localhost:9000", data = jsonify(export_data), headers = headers); return jsonify({'result':'ok'}) @server.route('/api/calculate_feasibility_ned', methods = ['POST']) def calculate_feasibility_ned(): js = request.get_json() lookAtN = js['lookAtN'] lookAtE = js['lookAtE'] lookAtD = js['lookAtD'] lookFromN = js['lookFromN'] lookFromE = js['lookFromE'] lookFromD = js['lookFromD'] # Exported Values P_lookFromNED_spline = c_[lookFromN, lookFromE, lookFromD] T_lookFromNED_spline = c_[js['lookFromT'], js['lookFromT'], js['lookFromT']] P_lookFromNED_ease = c_[array(js['lookFromEasingD'])] T_lookFromNED_ease = c_[array(js['lookFromEasingT'])] P_lookAtNED_spline = c_[lookAtN, lookAtE, lookAtD] T_lookAtNED_spline = c_[js['lookAtT'], js['lookAtT'], js['lookAtT']] P_lookAtNED_ease = c_[array(js['lookAtEasingD'])] T_lookAtNED_ease = c_[array(js['lookAtEasingT'])] refLLH = js['refLLH'] total_time = js['totalShotTime'] # make a call to the trajectoryAPI u_nominal, p_body_nominal, p_body_dot_nominal, p_body_dot_dot_nominal, theta_body_nominal, phi_body_nominal, theta_cam_nominal, theta_cam_dot_nominal, psi_cam_nominal, phi_cam_nominal, phi_cam_dot_nominal = trajectoryAPI.calculate_feasibility_ned(P_lookFromNED_spline, T_lookFromNED_spline, P_lookAtNED_spline, T_lookAtNED_spline, P_lookFromNED_ease, T_lookFromNED_ease, P_lookAtNED_ease, T_lookAtNED_ease, total_time, refLLH); data = { 'u_nominal': u_nominal.tolist(), 'p_body_nominal': p_body_nominal.tolist(), 'p_body_dot_nominal': p_body_dot_nominal.tolist(), 'p_body_dot_dot_nominal': p_body_dot_dot_nominal.tolist(), 'theta_body_nominal': theta_body_nominal.tolist(), 'phi_body_nominal': phi_body_nominal.tolist(), 'theta_cam_nominal': theta_cam_nominal.tolist(), 'theta_cam_dot_nominal': theta_cam_dot_nominal.tolist(), 'psi_cam_nominal': psi_cam_nominal.tolist(), 'phi_cam_nominal': phi_cam_nominal.tolist(), 'phi_cam_dot_nominal': phi_cam_dot_nominal.tolist(), } return jsonify(data) @server.route('/api/calculate_feasibility', methods = ['POST']) def calculate_feasibility(): js = request.get_json() cameraPose_lat_list = js['cameraPoseLats'] cameraPose_lng_list = js['cameraPoseLngs'] cameraPose_alt_list = js['cameraPoseAlts'] lookAt_lat_list = js['lookAtLats'] lookAt_lng_list = js['lookAtLngs'] lookAt_alt_list = js['lookAtAlts'] T_cameraPose = c_[js['cameraPoseTvals'], js['cameraPoseTvals'], js['cameraPoseTvals']] T_lookAt = c_[js['lookAtTvals'], js['lookAtTvals'], js['lookAtTvals']] lookAt_easing_tvals = array(js['lookAtEasingT']) lookAt_easing_dlist = array(js['lookAtEasingD']) cameraPose_easing_tvals = array(js['cameraPoseEasingT']) cameraPose_easing_dlist = array(js['cameraPoseEasingD']) P_easingCameraPose = c_[cameraPose_easing_dlist] T_easingCameraPose = c_[cameraPose_easing_tvals] P_easingLookAt = c_[lookAt_easing_dlist] T_easingLookAt = c_[lookAt_easing_tvals] P_cameraPose = c_[cameraPose_lat_list, cameraPose_lng_list, cameraPose_alt_list] P_lookAt = c_[lookAt_lat_list, lookAt_lng_list, lookAt_alt_list] total_time = js['totalShotTime'] # make a call to the trajectoryAPI u_nominal, p_body_nominal, p_body_dot_nominal, p_body_dot_dot_nominal, theta_body_nominal, phi_body_nominal, theta_cam_nominal, theta_cam_dot_nominal, psi_cam_nominal, phi_cam_nominal, phi_cam_dot_nominal = trajectoryAPI.calculate_feasibility(P_cameraPose, T_cameraPose, P_lookAt, T_lookAt, P_easingCameraPose, T_easingCameraPose, P_easingLookAt, T_easingLookAt, total_time) data = { 'u_nominal': u_nominal.tolist(), 'p_body_nominal': p_body_nominal.tolist(), 'p_body_dot_nominal': p_body_dot_nominal.tolist(), 'p_body_dot_dot_nominal': p_body_dot_dot_nominal.tolist(), 'theta_body_nominal': theta_body_nominal.tolist(), 'phi_body_nominal': phi_body_nominal.tolist(), 'theta_cam_nominal': theta_cam_nominal.tolist(), 'theta_cam_dot_nominal': theta_cam_dot_nominal.tolist(), 'psi_cam_nominal': psi_cam_nominal.tolist(), 'phi_cam_nominal': phi_cam_nominal.tolist(), 'phi_cam_dot_nominal': phi_cam_dot_nominal.tolist(), } return jsonify(data) @server.route('/api/get_fov.kml', methods = ['GET']) def get_fov(): GoProView = request.args.get('GoProView') GoProFOV = {'NARROW':64.4, 'MEDIUM':94.4, 'WIDE':118.2} if GoProView not in GoProFOV: GoProView = 'WIDE' fov = GoProFOV[GoProView] lat = request.args.get('lat') or 37.42726975867168 lng = request.args.get('lng') or -122.16676019825722 altitude = request.args.get('altitude') or 125 heading = request.args.get('heading') or -31.127314342134174 tilt = request.args.get('tilt') or 51.24538395621526 view = {'lng':lng, 'lat':lat, 'altitude':altitude, 'heading': heading, 'tilt': tilt, 'fov':fov} return render_template('fov.kml', view=view) @server.route('/api/set_vehicle_location', methods = ['GET']) def set_vehicle_location(): global starting_lat global starting_lng global vehicle_millis global current_lat global current_lng global mode global armed vehicle_millis = int(round(time.time() * 1000)) armed = (request.args.get('armed') == 'True') mode = request.args.get('mode') if armed: current_lat = request.args.get('lat', 0) current_lng = request.args.get('lng', 0) else: starting_lat = request.args.get('lat', 0) starting_lng = request.args.get('lng', 0) return "OK" @server.route('/api/get_vehicle_pos', methods= ['GET']) def get_vehicle_pos(): global vehicle_millis global starting_lat global starting_lng global vehicle_millis global current_lat global current_lng global mode global armed current_millis = int(round(time.time() * 1000)) success = "success" if current_millis - vehicle_millis > TIMEOUT_MILLIS: mode = "NOT CONNECTED" armed = False starting_lat = starting_lng = 0 success = 'no data' data = {'status':success, 'starting_lat':starting_lat, 'starting_lng':starting_lng, 'current_lat':current_lat, 'current_lng':current_lng, 'mode':mode} return jsonify(data) @server.route('/api/set_elapsed_time', methods = ['GET']) def set_elapsed_time(): global real_elapsed_time real_elapsed_time = request.args.get('elapsed', -1) return "OK" @server.route('/api/get_elapsed_time', methods= ['GET']) def get_elapsed_time(): data = {'status':'no data'} if real_elapsed_time != -1: data = {'status':'success', 'elapsed':real_elapsed_time} return jsonify(data)
bsd-3-clause
2,205,061,663,268,043,300
33.07772
431
0.67959
false
DOV-Vlaanderen/pydov
tests/test_types_grondwatervergunning.py
1
1531
"""Module grouping tests for the pydov.types.boring module.""" from pydov.types.grondwatervergunning import GrondwaterVergunning from tests.abstract import AbstractTestTypes location_wfs_getfeature = \ 'tests/data/types/grondwatervergunning/wfsgetfeature.xml' location_wfs_feature = 'tests/data/types/grondwatervergunning/feature.xml' location_dov_xml = None class TestGrondwaterVergunning(AbstractTestTypes): """Class grouping tests for the pydov.types.grondwatervergunning.GrondwaterVergunning class.""" datatype_class = GrondwaterVergunning namespace = 'http://dov.vlaanderen.be/grondwater/gw_vergunningen' pkey_base = None field_names = [ 'id_vergunning', 'pkey_installatie', 'x', 'y', 'diepte', 'exploitant_naam', 'watnr', 'vlaremrubriek', 'vergund_jaardebiet', 'vergund_dagdebiet', 'van_datum_termijn', 'tot_datum_termijn', 'aquifer_vergunning', 'inrichtingsklasse', 'nacebelcode', 'actie_waakgebied', 'cbbnr', 'kbonr'] field_names_subtypes = None field_names_nosubtypes = [ 'id_vergunning', 'pkey_installatie', 'x', 'y', 'diepte', 'exploitant_naam', 'watnr', 'vlaremrubriek', 'vergund_jaardebiet', 'vergund_dagdebiet', 'van_datum_termijn', 'tot_datum_termijn', 'aquifer_vergunning', 'inrichtingsklasse', 'nacebelcode', 'actie_waakgebied', 'cbbnr', 'kbonr'] valid_returnfields = ('id_vergunning', 'diepte') valid_returnfields_subtype = None inexistent_field = 'onbestaand'
mit
-3,558,128,204,813,029,400
38.25641
74
0.692358
false
fake-name/ReadableWebProxy
amqpstorm/channel0.py
1
6351
"""AMQPStorm Connection.Channel0.""" import logging import platform from pamqp import specification from pamqp.heartbeat import Heartbeat from amqpstorm import __version__ from amqpstorm.base import AUTH_MECHANISM from amqpstorm.base import FRAME_MAX from amqpstorm.base import LOCALE from amqpstorm.base import MAX_CHANNELS from amqpstorm.base import Stateful from amqpstorm.compatibility import try_utf8_decode from amqpstorm.exception import AMQPConnectionError LOGGER = logging.getLogger(__name__) class Channel0(object): """Internal Channel0 handler.""" def __init__(self, connection): super(Channel0, self).__init__() self.is_blocked = False self.server_properties = {} self._connection = connection self._heartbeat = connection.parameters['heartbeat'] self._parameters = connection.parameters def on_frame(self, frame_in): """Handle frames sent to Channel0. :param frame_in: Amqp frame. :return: """ LOGGER.debug('Frame Received: %s', frame_in.name) if frame_in.name == 'Heartbeat': return elif frame_in.name == 'Connection.Close': self._close_connection(frame_in) elif frame_in.name == 'Connection.CloseOk': self._close_connection_ok() elif frame_in.name == 'Connection.Blocked': self._blocked_connection(frame_in) elif frame_in.name == 'Connection.Unblocked': self._unblocked_connection() elif frame_in.name == 'Connection.OpenOk': self._set_connection_state(Stateful.OPEN) elif frame_in.name == 'Connection.Start': self.server_properties = frame_in.server_properties self._send_start_ok(frame_in) elif frame_in.name == 'Connection.Tune': self._send_tune_ok() self._send_open_connection() else: LOGGER.error('[Channel0] Unhandled Frame: %s', frame_in.name) def send_close_connection(self): """Send Connection Close frame. :return: """ self._write_frame(specification.Connection.Close()) def send_heartbeat(self): """Send Heartbeat frame. :return: """ if not self._connection.is_open: return self._write_frame(Heartbeat()) def _close_connection(self, frame_in): """Connection Close. :param specification.Connection.Close frame_in: Amqp frame. :return: """ self._set_connection_state(Stateful.CLOSED) if frame_in.reply_code != 200: reply_text = try_utf8_decode(frame_in.reply_text) message = ( 'Connection was closed by remote server: %s' % reply_text ) exception = AMQPConnectionError(message, reply_code=frame_in.reply_code) self._connection.exceptions.append(exception) def _close_connection_ok(self): """Connection CloseOk frame received. :return: """ self._set_connection_state(Stateful.CLOSED) def _blocked_connection(self, frame_in): """Connection is Blocked. :param frame_in: :return: """ self.is_blocked = True LOGGER.warning( 'Connection is blocked by remote server: %s', try_utf8_decode(frame_in.reason) ) def _unblocked_connection(self): """Connection is Unblocked. :return: """ self.is_blocked = False LOGGER.info('Connection is no longer blocked by remote server') def _plain_credentials(self): """AMQP Plain Credentials. :rtype: str """ return '\0%s\0%s' % (self._parameters['username'], self._parameters['password']) def _send_start_ok(self, frame_in): """Send Start OK frame. :param specification.Connection.Start frame_in: Amqp frame. :return: """ if 'PLAIN' not in try_utf8_decode(frame_in.mechanisms): exception = AMQPConnectionError( 'Unsupported Security Mechanism(s): %s' % frame_in.mechanisms ) self._connection.exceptions.append(exception) return credentials = self._plain_credentials() start_ok_frame = specification.Connection.StartOk( mechanism=AUTH_MECHANISM, client_properties=self._client_properties(), response=credentials, locale=LOCALE ) self._write_frame(start_ok_frame) def _send_tune_ok(self): """Send Tune OK frame. :return: """ tune_ok_frame = specification.Connection.TuneOk( channel_max=MAX_CHANNELS, frame_max=FRAME_MAX, heartbeat=self._heartbeat) self._write_frame(tune_ok_frame) def _send_open_connection(self): """Send Open Connection frame. :return: """ open_frame = specification.Connection.Open( virtual_host=self._parameters['virtual_host'] ) self._write_frame(open_frame) def _set_connection_state(self, state): """Set Connection state. :param state: :return: """ self._connection.set_state(state) def _write_frame(self, frame_out): """Write a pamqp frame from Channel0. :param frame_out: Amqp frame. :return: """ self._connection.write_frame(0, frame_out) LOGGER.debug('Frame Sent: %s', frame_out.name) @staticmethod def _client_properties(): """AMQPStorm Client Properties. :rtype: dict """ return { 'product': 'AMQPStorm', 'platform': 'Python %s (%s)' % (platform.python_version(), platform.python_implementation()), 'capabilities': { 'basic.nack': True, 'connection.blocked': True, 'publisher_confirms': True, 'consumer_cancel_notify': True, 'authentication_failure_close': True, }, 'information': 'See https://github.com/eandersson/amqpstorm', 'version': __version__ }
bsd-3-clause
-8,175,721,914,685,432,000
29.830097
78
0.571406
false
benjolitz/trollius-redis
trollius_redis/encoders.py
1
2145
""" The redis protocol only knows about bytes, but we like to have strings inside Python. This file contains some helper classes for decoding the bytes to strings and encoding the other way around. We also have a `BytesEncoder`, which provides raw access to the redis server. """ __all__ = ( 'BaseEncoder', 'BytesEncoder', 'UTF8Encoder', ) import six class BaseEncoder(object): """ Abstract base class for all encoders. """ #: The native Python type from which we encode, or to which we decode. native_type = None def encode_from_native(self, data): """ Encodes the native Python type to network bytes. Usually this will encode a string object to bytes using the UTF-8 encoding. You can either override this function, or set the `encoding` attribute. """ raise NotImplementedError def decode_to_native(self, data): """ Decodes network bytes to a Python native type. It should always be the reverse operation of `encode_from_native`. """ raise NotImplementedError class BytesEncoder(BaseEncoder): """ For raw access to the Redis database. """ #: The native Python type from which we encode, or to which we decode. native_type = six.binary_type def encode_from_native(self, data): return data def decode_to_native(self, data): return data class StringEncoder(BaseEncoder): """ Abstract base class for all string encoding encoders. """ #: Redis keeps all values in binary. Set the encoding to be used to #: decode/encode Python string values from and to binary. encoding = None #: The native Python type from which we encode, or to which we decode. native_type = six.text_type def encode_from_native(self, data): """ string to bytes """ return data.encode(self.encoding) def decode_to_native(self, data): """ bytes to string """ return data.decode(self.encoding) class UTF8Encoder(StringEncoder): """ Encode strings to and from utf-8 bytes. """ encoding = 'utf-8'
bsd-2-clause
-7,322,729,814,872,177,000
26.5
79
0.653613
false
kHarshit/DAT210x_Microsoft
Module2/assignment3.py
1
1178
import pandas as pd # TODO: Load up the dataset Ensuring you set the appropriate header column names df = pd.read_csv('Datasets/servo.data') df.columns = ['motor', 'screw', 'pgain', 'vgain', 'class'] print(df.describe()) # TODO: Create a slice that contains all entries having a vgain equal to 5. Then print the length of(# of samples in) that slice: k = df[df.iloc[:, 3] == 5] print(k.describe()) print(len(k)) # TODO: Create a slice that contains all entries having a motor equal to E and screw equal # to E. Then print the length of (# of samples in) that slice: print(df[(df.iloc[:, 0] == 'E') & (df.iloc[:, 1] == 'E')]) l = df[(df['motor'] == 'E') & (df['screw'] == 'E')] print(l.describe()) print(len(l)) # the answer should be 6; checkout read_csv() api documentation that will fix your issue! # TODO: Create a slice that contains all entries having a pgain equal to 4. Use one of the various methods of finding # the mean vgain value for the samples in that slice. Once you've found it, print it: m = df[df.pgain == 4] print(m.mean()) print(m.vgain.mean()) # TODO: (Bonus) See what happens when you run the .dtypes method on your dataframe! print(df.dtypes)
mit
6,821,107,749,193,167,000
34.69697
129
0.684211
false
upptalk/uppsell
uppsell/migrations/0002_auto__add_unique_store_code__add_field_listing_price__chg_field_listin.py
1
19453
# -*- coding: utf-8 -*- from south.utils import datetime_utils as datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding unique constraint on 'Store', fields ['code'] db.create_unique('stores', ['code']) # Adding field 'Listing.price' db.add_column('listings', 'price', self.gf('django.db.models.fields.DecimalField')(default=0.0, max_digits=8, decimal_places=2), keep_default=False) # Changing field 'Listing.subtitle' db.alter_column('listings', 'subtitle', self.gf('django.db.models.fields.CharField')(max_length=200, null=True)) # Changing field 'Listing.description' db.alter_column('listings', 'description', self.gf('django.db.models.fields.CharField')(max_length=10000, null=True)) # Changing field 'Listing.title' db.alter_column('listings', 'title', self.gf('django.db.models.fields.CharField')(max_length=200, null=True)) # Changing field 'Listing.name' db.alter_column('listings', 'name', self.gf('django.db.models.fields.CharField')(max_length=200, null=True)) # Adding field 'Product.provisioning_codes' db.add_column('products', 'provisioning_codes', self.gf('django.db.models.fields.CharField')(max_length=255, null=True, blank=True), keep_default=False) def backwards(self, orm): # Removing unique constraint on 'Store', fields ['code'] db.delete_unique('stores', ['code']) # Deleting field 'Listing.price' db.delete_column('listings', 'price') # Changing field 'Listing.subtitle' db.alter_column('listings', 'subtitle', self.gf('django.db.models.fields.CharField')(default='', max_length=200)) # Changing field 'Listing.description' db.alter_column('listings', 'description', self.gf('django.db.models.fields.CharField')(default='', max_length=10000)) # Changing field 'Listing.title' db.alter_column('listings', 'title', self.gf('django.db.models.fields.CharField')(default='', max_length=200)) # Changing field 'Listing.name' db.alter_column('listings', 'name', self.gf('django.db.models.fields.CharField')(default='', max_length=200)) # Deleting field 'Product.provisioning_codes' db.delete_column('products', 'provisioning_codes') models = { u'uppsell.address': { 'Meta': {'object_name': 'Address', 'db_table': "'addresses'"}, 'city': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'country': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'country_code': ('django.db.models.fields.CharField', [], {'max_length': '3'}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'customer': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Customer']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'last_used': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'line1': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'line2': ('django.db.models.fields.CharField', [], {'max_length': '255', 'blank': 'True'}), 'line3': ('django.db.models.fields.CharField', [], {'max_length': '255', 'blank': 'True'}), 'other': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'province': ('django.db.models.fields.CharField', [], {'max_length': '255', 'blank': 'True'}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'zip': ('django.db.models.fields.CharField', [], {'max_length': '255', 'blank': 'True'}) }, u'uppsell.cart': { 'Meta': {'object_name': 'Cart', 'db_table': "'carts'"}, 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'customer': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Listing']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'store': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Store']"}), 'updated_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}) }, u'uppsell.cartitem': { 'Meta': {'object_name': 'CartItem', 'db_table': "'cart_items'"}, 'cart': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Cart']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'product': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Listing']"}), 'quantity': ('django.db.models.fields.PositiveIntegerField', [], {'default': '1'}) }, u'uppsell.coupon': { 'Meta': {'object_name': 'Coupon', 'db_table': "'coupons'"}, 'code': ('django.db.models.fields.CharField', [], {'max_length': '40'}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'customer': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Customer']", 'null': 'True', 'blank': 'True'}), 'discount_amount': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '8', 'decimal_places': '2', 'blank': 'True'}), 'discount_pct': ('django.db.models.fields.PositiveIntegerField', [], {'null': 'True', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'max_uses': ('django.db.models.fields.PositiveIntegerField', [], {}), 'product': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Listing']", 'null': 'True', 'blank': 'True'}), 'product_group': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.ProductGroup']", 'null': 'True', 'blank': 'True'}), 'relation': ('django.db.models.fields.CharField', [], {'max_length': '16'}), 'remaining': ('django.db.models.fields.PositiveIntegerField', [], {}), 'store': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Store']"}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '16'}), 'updated_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'valid_from': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'valid_until': ('django.db.models.fields.DateTimeField', [], {}) }, u'uppsell.couponspend': { 'Meta': {'unique_together': "(('customer', 'coupon'),)", 'object_name': 'CouponSpend', 'db_table': "'coupon_spends'"}, 'coupon': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Coupon']"}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'customer': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Customer']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}) }, u'uppsell.customer': { 'Meta': {'object_name': 'Customer', 'db_table': "'customers'"}, 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'email': ('django.db.models.fields.EmailField', [], {'db_index': 'True', 'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '30', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'last_logged_in_at': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'last_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '30', 'blank': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, u'uppsell.invoice': { 'Meta': {'object_name': 'Invoice', 'db_table': "'invoices'"}, 'billing_address': ('django.db.models.fields.CharField', [], {'max_length': '1000'}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'currency': ('django.db.models.fields.CharField', [], {'max_length': '3'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'order_id': ('django.db.models.fields.IntegerField', [], {'unique': 'True'}), 'order_shipping_total': ('django.db.models.fields.DecimalField', [], {'max_digits': '8', 'decimal_places': '2'}), 'order_total': ('django.db.models.fields.DecimalField', [], {'max_digits': '8', 'decimal_places': '2'}), 'payment_made_ts': ('django.db.models.fields.DateTimeField', [], {}), 'product_id': ('django.db.models.fields.IntegerField', [], {}), 'psp_id': ('django.db.models.fields.IntegerField', [], {}), 'psp_response_code': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'psp_response_text': ('django.db.models.fields.CharField', [], {'max_length': '10000'}), 'psp_type': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'quantity': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'shipping_address': ('django.db.models.fields.CharField', [], {'max_length': '1000'}), 'store_id': ('django.db.models.fields.IntegerField', [], {}), 'transaction_id': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'user_email': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'user_fullname': ('django.db.models.fields.CharField', [], {'max_length': '1000'}), 'user_jid': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'user_mobile_msisdn': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, u'uppsell.linkedaccount': { 'Meta': {'object_name': 'LinkedAccount', 'db_table': "'linked_accounts'"}, 'account_id': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'customer': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Customer']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '2000'}), 'linked_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'provider': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'type': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.LinkedAccountType']"}), 'updated_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}) }, u'uppsell.linkedaccounttype': { 'Meta': {'object_name': 'LinkedAccountType', 'db_table': "'linked_account_types'"}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '32'}) }, u'uppsell.listing': { 'Meta': {'object_name': 'Listing', 'db_table': "'listings'"}, 'description': ('django.db.models.fields.CharField', [], {'max_length': '10000', 'null': 'True', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'price': ('django.db.models.fields.DecimalField', [], {'default': '0.0', 'max_digits': '8', 'decimal_places': '2'}), 'product': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Product']"}), 'sales_tax_rate': ('django.db.models.fields.FloatField', [], {'null': 'True'}), 'state': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'store': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Store']"}), 'subtitle': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}) }, u'uppsell.order': { 'Meta': {'object_name': 'Order', 'db_table': "'orders'"}, 'billing_address': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'billing_address'", 'null': 'True', 'to': u"orm['uppsell.Address']"}), 'coupon': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Coupon']", 'null': 'True'}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'currency': ('django.db.models.fields.CharField', [], {'max_length': '3'}), 'customer': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Customer']"}), 'fraud_state': ('django.db.models.fields.CharField', [], {'max_length': '30'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'order_shipping_total': ('django.db.models.fields.DecimalField', [], {'max_digits': '8', 'decimal_places': '2'}), 'order_state': ('django.db.models.fields.CharField', [], {'default': "'init'", 'max_length': '30'}), 'order_total': ('django.db.models.fields.DecimalField', [], {'max_digits': '8', 'decimal_places': '2'}), 'payment_made_ts': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'payment_state': ('django.db.models.fields.CharField', [], {'default': "'init'", 'max_length': '30'}), 'shipping_address': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'shipping_address'", 'null': 'True', 'to': u"orm['uppsell.Address']"}), 'store': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Store']"}), 'transaction_id': ('django.db.models.fields.CharField', [], {'max_length': '200', 'blank': 'True'}), 'updated_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}) }, u'uppsell.orderevent': { 'Meta': {'object_name': 'OrderEvent', 'db_table': "'order_events'"}, 'action_type': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'comment': ('django.db.models.fields.CharField', [], {'max_length': '2000', 'blank': 'True'}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'event': ('django.db.models.fields.CharField', [], {'max_length': '30'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'order': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Order']"}), 'state_after': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'state_before': ('django.db.models.fields.CharField', [], {'max_length': '30'}) }, u'uppsell.orderitem': { 'Meta': {'object_name': 'OrderItem', 'db_table': "'order_items'"}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'order': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Order']"}), 'product': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.Listing']"}), 'quantity': ('django.db.models.fields.PositiveIntegerField', [], {'default': '1'}) }, u'uppsell.product': { 'Meta': {'object_name': 'Product', 'db_table': "'products'"}, 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.CharField', [], {'max_length': '10000'}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.ProductGroup']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'provisioning_codes': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'sku': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'stock_units': ('django.db.models.fields.FloatField', [], {}), 'subtitle': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'updated_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}) }, u'uppsell.productcode': { 'Meta': {'object_name': 'ProductCode', 'db_table': "'product_codes'"}, 'code': ('django.db.models.fields.CharField', [], {'max_length': '255'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'product': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['uppsell.ProductGroup']"}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '20'}) }, u'uppsell.productgroup': { 'Meta': {'object_name': 'ProductGroup', 'db_table': "'product_groups'"}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, u'uppsell.store': { 'Meta': {'object_name': 'Store', 'db_table': "'stores'"}, 'code': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '200'}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'default_currency': ('django.db.models.fields.CharField', [], {'max_length': '3'}), 'default_lang': ('django.db.models.fields.CharField', [], {'max_length': '3'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'sales_tax_rate': ('django.db.models.fields.FloatField', [], {}), 'updated_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}) } } complete_apps = ['uppsell']
mit
2,520,933,076,126,869,500
74.403101
189
0.55575
false
alexanderfefelov/nav
python/nav/web/status/sections.py
1
29405
# -*- coding: utf-8 -*- # # Copyright (C) 2009, 2012 UNINETT AS # # This file is part of Network Administration Visualized (NAV). # # NAV is free software: you can redistribute it and/or modify it under # the terms of the GNU General Public License version 2 as published by # the Free Software Foundation. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General # Public License for more details. # You should have received a copy of the GNU General Public License along with # NAV. If not, see <http://www.gnu.org/licenses/>. # """Status sections. Used to build up different sections for display. """ from datetime import datetime from django.db.models import Q from django.core.urlresolvers import reverse from nav.metrics.templates import metric_prefix_for_device from nav.models.profiles import StatusPreference, StatusPreferenceCategory from nav.models.profiles import StatusPreferenceOrganization from nav.models.event import AlertHistory, AlertHistoryVariable from nav.models.manage import Netbox, Category, Organization from nav.models.thresholds import ThresholdRule from nav.web import servicecheckers from nav.web.status.forms import SectionForm, NetboxForm from nav.web.status.forms import NetboxMaintenanceForm, ServiceForm from nav.web.status.forms import ServiceMaintenanceForm, ModuleForm from nav.web.status.forms import ThresholdForm, LinkStateForm, SNMPAgentForm MAINTENANCE_STATE = 'maintenanceState' BOX_STATE = 'boxState' SERVICE_STATE = 'serviceState' MODULE_STATE = 'moduleState' THRESHOLD_STATE = 'thresholdState' LINK_STATE = 'linkState' SNMP_STATE = 'snmpAgentState' PSU_STATE = 'psuState' def get_section_model(section_type): """Dispatch table""" dtable = { StatusPreference.SECTION_NETBOX: NetboxSection, StatusPreference.SECTION_NETBOX_MAINTENANCE: NetboxMaintenanceSection, StatusPreference.SECTION_MODULE: ModuleSection, StatusPreference.SECTION_SERVICE: ServiceSection, StatusPreference.SECTION_SERVICE_MAINTENANCE: ServiceMaintenanceSection, StatusPreference.SECTION_THRESHOLD: ThresholdSection, StatusPreference.SECTION_LINKSTATE: LinkStateSection, StatusPreference.SECTION_SNMPAGENT: SNMPAgentSection, StatusPreference.SECTION_PSU: PSUSection, } return dtable[section_type] def get_user_sections(account): '''Fetches all status sections for account in one swoop. ''' sections = [] preferences = StatusPreference.objects.filter( account=account ).order_by('position') # Pre-fetching all categories and organisations all_cats = Category.objects.values_list('pk', flat=True) all_orgs = Organization.objects.values_list('pk', flat=True) categories = {} organizations = {} cats = StatusPreferenceCategory.objects.filter( statuspreference__in=preferences ) orgs = StatusPreferenceOrganization.objects.filter( statuspreference__in=preferences ) # Buld dicts with statuspreference_id as keys. for cat in cats: if not cat.statuspreference_id in categories: categories[cat.statuspreference_id] = [] categories[cat.statuspreference_id].append(cat.category_id) for org in orgs: if not org.statuspreference_id in organizations: organizations[org.statuspreference_id] = [] organizations[org.statuspreference_id].append(org.organization_id) # Add pre fetched categories and organisations to section preferences. # Adds all categories and organisations if nothing is found in database. for pref in preferences: if pref.id in categories: pref.fetched_categories = categories[pref.id] pref.all_categories = False else: pref.fetched_categories = all_cats pref.all_categories = True if pref.id in organizations: pref.fetched_organizations = organizations[pref.id] pref.all_organizations = False else: pref.fetched_organizations = all_orgs pref.all_organizations = True for pref in preferences: section_model = get_section_model(pref.type) section = section_model(prefs=pref) section.fetch_history() sections.append(section) return sections class _Section(object): '''Base class for sections. Attributes: columns - tuples of the wanted columns. First part gives the displayed name of the column, while the second defines the field that are looked up in the database. history - the query used to look up the history type_title - readable type name of this section devicehistory_type - used in links to devicehistory ''' columns = [] history = [] type_title = '' devicehistory_type = '' def __init__(self, prefs=None): self.prefs = prefs self.categories = self.prefs.fetched_categories self.organizations = self.prefs.fetched_organizations self.states = self.prefs.states.split(',') for key, title in StatusPreference.SECTION_CHOICES: if self.prefs.type == key: self.type_title = title break def fetch_history(self): """Empty method,- should get overridden in sub-classes""" self.history = [] def devicehistory_url(self): """Make history urls for this device""" url = reverse('devicehistory-view') url += "?eventtype=%s" % self.devicehistory_type url += "&group_by=datetime" if not self.prefs.all_organizations: for org in self.organizations: url += "&org=%s" % org if not self.prefs.all_categories: for cat in self.categories: url += "&cat=%s" % cat # If custom orgs and cats, use AND search if not self.prefs.all_categories and not self.prefs.all_organizations: url += "&mode=and" return url @staticmethod def form_class(): """Return the chosen form""" return SectionForm @staticmethod def form_data(status_prefs): """Insert data in the form for the view""" data = { 'id': status_prefs.id, 'name': status_prefs.name, 'type': status_prefs.type, 'organizations': list(status_prefs.organizations.values_list( 'id', flat=True)) or [''], } data['categories'] = list(status_prefs.categories.values_list( 'id', flat=True)) or [''] data['states'] = status_prefs.states.split(",") return data @classmethod def form(cls, status_prefs): """Get the appropriate form""" form_model = cls.form_class() data = cls.form_data(status_prefs) return form_model(data) class NetboxSection(_Section): columns = [ 'Sysname', 'IP', 'Начало', 'Продолжительность', 'История', '', ] devicehistory_type = 'a_boxDown' @staticmethod def form_class(): return NetboxForm def fetch_history(self): maintenance = self._maintenance() alert_types = self._alerttype() netbox_history = AlertHistory.objects.select_related( 'netbox' ).filter( ~Q(netbox__in=maintenance), Q(netbox__up='n') | Q(netbox__up='s'), alert_type__name__in=alert_types, end_time__gte=datetime.max, netbox__category__in=self.categories, netbox__organization__in=self.organizations, ).extra( select={'downtime': "date_trunc('second', NOW() - start_time)"} ).order_by('-start_time', 'end_time') history = [] for h in netbox_history: row = {'netboxid': h.netbox.id, 'tabrow': ( ( h.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[h.netbox.sysname]) ), (h.netbox.ip, None), (h.start_time, None), (h.downtime, None), ( 'history', reverse('devicehistory-view') + '?netbox=%(id)s&eventtype=a_boxDown&group_by=datetime' % { 'id': h.netbox.id, } ), ), } history.append(row) self.history = history def _maintenance(self): return AlertHistory.objects.filter( event_type=MAINTENANCE_STATE, end_time__gte=datetime.max, netbox__isnull=False, ).values('netbox').query def _alerttype(self): states = [] if 'y' in self.states: states.append('boxUp') if 'n' in self.states: states.append('boxDown') if 's' in self.states: states.append('boxShadow') return states class NetboxMaintenanceSection(_Section): columns = [ 'Sysname', 'IP', 'Начало', 'Продолжительность', '', ] devicehistory_type = 'e_maintenanceState' @staticmethod def form_class(): return NetboxMaintenanceForm def fetch_history(self): maintenance = self._maintenance() boxes_down = self._boxes_down() history = [] for m in maintenance: # Find out if the box is down as well as on maintenance down = boxes_down.get(m.alert_history.netbox.id, None) if m.alert_history.netbox.up == 'y': down_since = 'Up' downtime = '' else: if down: down_since = down['start_time'] downtime = down['downtime'] else: down_since = 'N/A' downtime = 'N/A' row = {'netboxid': m.alert_history.netbox.id, 'tabrow': ( ( m.alert_history.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[m.alert_history.netbox.sysname]) ), (m.alert_history.netbox.ip, None), (down_since, None), (downtime, None), ( 'history', reverse('devicehistory-view') + ('?netbox=%(id)s&eventtype=e_maintenanceState' '&group_by=datetime' % {'id': m.alert_history.netbox.id}) ), ), } history.append(row) self.history = history def _maintenance(self): return AlertHistoryVariable.objects.select_related( 'alert_history', 'alert_history__netbox' ).filter( alert_history__netbox__category__in=self.categories, alert_history__netbox__organization__in=self.organizations, alert_history__netbox__up__in=self.states, alert_history__end_time__gte=datetime.max, alert_history__event_type=MAINTENANCE_STATE, variable='maint_taskid', ).order_by('-alert_history__start_time') def _boxes_down(self): history = AlertHistory.objects.select_related( 'netbox' ).filter( end_time__gte=datetime.max, event_type=BOX_STATE, ).extra( select={'downtime': "date_trunc('second', NOW() - start_time)"} ).order_by('-start_time').values( 'netbox', 'start_time', 'downtime' ) ret = {} for h in history: ret[h['netbox']] = h return ret class ServiceSection(_Section): columns = [ 'Sysname', 'Handler', 'Начало', 'Продолжительность', '', ] devicehistory_type = 'e_serviceState' @staticmethod def form_class(): return ServiceForm @staticmethod def form_data(status_prefs): data = { 'id': status_prefs.id, 'name': status_prefs.name, 'type': status_prefs.type, 'organizations': list(status_prefs.organizations.values_list( 'id', flat=True)) or [''], } data['services'] = status_prefs.services.split(",") or [''] data['states'] = status_prefs.states.split(",") return data def __init__(self, prefs=None): super(ServiceSection, self).__init__(prefs=prefs) if self.prefs.services: self.services = self.prefs.services.split(',') else: self.services = [s for s in servicecheckers.get_checkers()] def fetch_history(self): maintenance = AlertHistory.objects.filter( end_time__gte=datetime.max, event_type=MAINTENANCE_STATE, ).values('netbox').query services = AlertHistory.objects.select_related( 'netbox' ).filter( ~Q(netbox__in=maintenance), end_time__gte=datetime.max, event_type=SERVICE_STATE, netbox__organization__in=self.organizations, ).extra( select={ 'downtime': "date_trunc('second', NOW() - start_time)", 'handler': 'service.handler', }, tables=['service'], where=[ 'alerthist.subid = service.serviceid::text', 'service.handler IN %s', ], params=[tuple(self.services)] ) history = [] for s in services: row = {'netboxid': s.netbox.id, 'tabrow': ( ( s.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[ s.netbox.sysname ]) ), ( s.handler, reverse('ipdevinfo-service-list-handler', args=[ s.handler ]) ), (s.start_time, None), (s.downtime, None), ( 'history', reverse('devicehistory-view') + ('?netbox=%(id)s&eventtype=e_serviceState' '&group_by=datetime' % {'id': s.netbox.id}) ) ), } history.append(row) self.history = history def devicehistory_url(self): url = reverse('devicehistory-view') url += "?eventtype=%s" % self.devicehistory_type url += "&group_by=datetime" if not self.prefs.all_organizations: # FIXME filter service # Service is joined in on the alerthist.subid field, which is not a # part of this query. Yay netboxes = Netbox.objects.filter( organization__in=self.organizations, ).values('id') for n in netboxes: url += "&netbox=%s" % n['id'] return url class ServiceMaintenanceSection(ServiceSection): devicehistory_type = 'e_maintenanceState' @staticmethod def form_class(): return ServiceMaintenanceForm def fetch_history(self): maintenance = AlertHistoryVariable.objects.select_related( 'alert_history', 'alert_history__netbox' ).filter( alert_history__end_time__gte=datetime.max, alert_history__event_type=MAINTENANCE_STATE, variable='maint_taskid', ).extra( select={ 'downtime': "date_trunc('second', NOW() - start_time)", 'handler': 'service.handler', 'up': 'service.up', }, tables=['service'], where=['subid = serviceid::text'], ).order_by('-alert_history__start_time') service_history = AlertHistory.objects.filter( end_time__gte=datetime.max, event_type=SERVICE_STATE, ).extra( select={'downtime': "date_trunc('second', NOW() - start_time)"} ).values('netbox', 'start_time', 'downtime') service_down = {} for s in service_history: service_down[s['netbox']] = s history = [] for m in maintenance: down = service_down.get(m.alert_history.netbox.id, None) if m.up == 'y': down_since = 'Up' downtime = '' else: if down: down_since = down['start_time'] downtime = down['downtime'] else: down_since = 'N/A' downtime = 'N/A' row = {'netboxid': m.alert_history.netbox.id, 'tabrow': ( ( m.alert_history.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[m.alert_history.netbox.sysname]) ), (m.handler, reverse('ipdevinfo-service-list-handler', args=[m.handler])), (down_since, None), (downtime, None), ( 'history', reverse('devicehistory-view') + ('?netbox=%(id)s&eventtype=e_maintenanceState' '&group_by=datetime' % {'id': m.alert_history.netbox.id}) ), ), } history.append(row) self.history = history class ModuleSection(_Section): columns = [ 'Sysname', 'IP', 'Module', 'Начало', 'Продолжительность', '', ] devicehistory_type = 'a_moduleDown' @staticmethod def form_class(): return ModuleForm def fetch_history(self, module_history=None): module_history = AlertHistory.objects.select_related( 'netbox', 'device' ).filter( end_time__gte=datetime.max, event_type=MODULE_STATE, alert_type__name='moduleDown', netbox__organization__in=self.organizations, netbox__category__in=self.categories, ).extra( select={ 'downtime': "date_trunc('second', NOW() - start_time)", 'module_id': 'module.moduleid', 'module_name': 'module.name', }, tables=['module'], where=[ 'alerthist.deviceid = module.deviceid', 'module.up IN %s', ], params=[tuple(self.states)] ).order_by('-start_time') if module_history is None else module_history history = [] for module in module_history: row = {'netboxid': module.netbox.id, 'tabrow': ( ( module.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[module.netbox.sysname]) ), (module.netbox.ip, None), ( module.module_name, reverse('ipdevinfo-module-details', args=[ module.netbox.sysname, module.module_name ]) if module.module_name else None ), (module.start_time, None), (module.downtime, None), ( 'history', reverse('devicehistory-view') + '?module=%(id)s&eventtype=a_moduleDown&group_by=datetime' % { 'id': module.module_id, } ), ), } history.append(row) self.history = history class ThresholdSection(_Section): columns = [ 'Sysname', 'Описание', 'Начало', 'Продолжительность', '', ] devicehistory_type = 'a_exceededThreshold' @staticmethod def form_class(): return ThresholdForm @staticmethod def form_data(status_prefs): data = { 'id': status_prefs.id, 'name': status_prefs.name, 'type': status_prefs.type, 'organizations': list(status_prefs.organizations.values_list( 'id', flat=True)) or [''], 'categories': list(status_prefs.categories.values_list( 'id', flat=True)) or [''] } return data def fetch_history(self): thresholds = AlertHistory.objects.select_related( 'netbox' ).filter( end_time__gte=datetime.max, event_type=THRESHOLD_STATE, alert_type__name='exceededThreshold', netbox__organization__in=self.organizations, netbox__category__in=self.categories, ).extra( select={ 'downtime': "date_trunc('second', NOW() - start_time)", }, ).order_by('-start_time') history = [] for alert in thresholds: description = self._description_from_alert(alert) row = {'netboxid': alert.netbox.id, 'tabrow': ( (alert.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[alert.netbox.sysname])), (description, None), (alert.start_time, None), (alert.downtime, None), ('history', reverse('devicehistory-view') + '?netbox=%(id)s&eventtype=a_exceededThreshold' '&group_by=datetime' % { 'id': alert.netbox.id, }), ), } history.append(row) self.history = history @staticmethod def _description_from_alert(alert): try: ruleid, metric = alert.subid.split(':', 1) except ValueError: description = None else: try: rule = ThresholdRule.objects.get(id=ruleid) except ThresholdRule.DoesNotExist: limit = '' else: limit = rule.alert prefix = metric_prefix_for_device(alert.netbox.sysname) if metric.startswith(prefix): metric = metric[len(prefix)+1:] description = "{0} {1}".format(metric, limit) return description class LinkStateSection(_Section): columns = [ 'Sysname', 'IP', 'Interface', 'Начало', 'Продолжительность', 'История', '', ] devicehistory_type = 'a_linkDown' @staticmethod def form_class(): return LinkStateForm def fetch_history(self): netbox_history = AlertHistory.objects.select_related( 'netbox' ).filter( event_type=LINK_STATE, end_time__gte=datetime.max, netbox__category__in=self.categories, netbox__organization__in=self.organizations, ).extra( select={ 'downtime': "date_trunc('second', NOW() - start_time)", 'interfaceid': 'interface.interfaceid', 'ifname': 'interface.ifname', }, where=['subid = interfaceid::text'], tables=['interface'] ).order_by('-start_time', 'end_time') history = [] for h in netbox_history: row = { 'netboxid': h.netbox.id, 'alerthistid': h.id, 'tabrow': ( ( h.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[h.netbox.sysname]) ), (h.netbox.ip, None), ( h.ifname, reverse('ipdevinfo-interface-details', args=[h.netbox.sysname, h.interfaceid]) ), (h.start_time, None), (h.downtime, None), ('history', reverse('devicehistory-view') + '?netbox=%(id)s&eventtype=a_linkDown&group_by=datetime' % { 'id': h.netbox.id, } ), ), } history.append(row) self.history = history class SNMPAgentSection(_Section): columns = [ 'Sysname', 'IP', 'Начало', 'Продолжительность', '', ] devicehistory_type = 'a_snmpAgentDown' @staticmethod def form_class(): return SNMPAgentForm @staticmethod def form_data(status_prefs): data = { 'id': status_prefs.id, 'name': status_prefs.name, 'type': status_prefs.type, 'organizations': list(status_prefs.organizations.values_list( 'id', flat=True)) or [''], } data['categories'] = list(status_prefs.categories.values_list( 'id', flat=True)) or [''] return data def fetch_history(self): netbox_history = AlertHistory.objects.select_related( 'netbox' ).filter( event_type=SNMP_STATE, end_time__gte=datetime.max, netbox__category__in=self.categories, netbox__organization__in=self.organizations, ).extra( select={ 'downtime': "date_trunc('second', NOW() - start_time)", } ).order_by('-start_time', 'end_time') history = [] for h in netbox_history: row = {'netboxid': h.netbox.id, 'tabrow': ( ( h.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[h.netbox.sysname]) ), (h.netbox.ip, None), (h.start_time, None), (h.downtime, None), ( 'history', reverse('devicehistory-view') + ('?netbox=%(id)s&eventtype=a_snmpAgentDown' '&group_by=datetime' % {'id': h.netbox.id}) ), ), } history.append(row) self.history = history class PSUSection(_Section): columns = [ 'Sysname', 'IP', 'PSU', 'Начало', 'Продолжительность', '', ] devicehistory_type = 'a_psuNotOK' @staticmethod def form_class(): return ModuleForm def fetch_history(self, psu_history=None): psu_history = AlertHistory.objects.select_related( 'netbox', 'device' ).filter( end_time__gte=datetime.max, event_type=PSU_STATE, alert_type__name='psuNotOK', netbox__organization__in=self.organizations, netbox__category__in=self.categories, ).extra( select={ 'downtime': "date_trunc('second', NOW() - start_time)", 'powersupply_id': 'powersupply_or_fan.powersupplyid', 'powersupply_name': 'powersupply_or_fan.name', }, tables=['powersupply_or_fan'], where=[ 'alerthist.subid = powersupply_or_fan.powersupplyid::TEXT', ], ).order_by('-start_time') if psu_history is None else psu_history self.history = [self._psu_to_table_row(psu) for psu in psu_history] @staticmethod def _psu_to_table_row(psu): return {'netboxid': psu.netbox.id, 'tabrow': ( (psu.netbox.sysname, reverse('ipdevinfo-details-by-name', args=[psu.netbox.sysname])), (psu.netbox.ip, None), (psu.powersupply_name, None), (psu.start_time, None), (psu.downtime, None), ('history', (reverse('devicehistory-view') + '?powersupply=%s' '&eventtype=a_psuNotOK' '&group_by=datetime' % psu.powersupply_id)), )}
gpl-2.0
-2,737,846,190,334,382,000
32.294185
85
0.508648
false
projectarkc/arkc-server-gae
fetchfrom/goagent.py
1
9320
#!/usr/bin/env python # coding:utf-8 __version__ = '3.2.0' __password__ = '' __hostsdeny__ = () # __hostsdeny__ = ('.youtube.com', '.youku.com') import os import re import time import struct import zlib import base64 import logging import urlparse import httplib import io import string import json from BaseHTTPServer import BaseHTTPRequestHandler from StringIO import StringIO from google.appengine.api import urlfetch from google.appengine.api.taskqueue.taskqueue import MAX_URL_LENGTH from google.appengine.runtime import apiproxy_errors URLFETCH_MAX = 2 URLFETCH_MAXSIZE = 4 * 1024 * 1024 URLFETCH_DEFLATE_MAXSIZE = 4 * 1024 * 1024 URLFETCH_TIMEOUT = 30 class NotFoundKey(Exception): pass class GAEfail(Exception): pass class Nonsense(Exception): pass class PermanentFail(Exception): pass class TimeoutFail(Exception): pass class HTTPRequest(BaseHTTPRequestHandler): def __init__(self, request_text): self.rfile = StringIO(request_text) self.raw_requestline = self.rfile.readline() self.error_code = self.error_message = None self.parse_request() def send_error(self, code, message): self.error_code = code self.error_message = message def message_html(title, banner, detail=''): MESSAGE_TEMPLATE = ''' <html><head> <meta http-equiv="content-type" content="text/html;charset=utf-8"> <title>$title</title> <style><!-- body {font-family: arial,sans-serif} div.nav {margin-top: 1ex} div.nav A {font-size: 10pt; font-family: arial,sans-serif} span.nav {font-size: 10pt; font-family: arial,sans-serif; font-weight: bold} div.nav A,span.big {font-size: 12pt; color: #0000cc} div.nav A {font-size: 10pt; color: black} A.l:link {color: #6f6f6f} A.u:link {color: green} //--></style> </head> <body text=#000000 bgcolor=#ffffff> <table border=0 cellpadding=2 cellspacing=0 width=100%> <tr><td bgcolor=#3366cc><font face=arial,sans-serif color=#ffffff><b>Message From FetchServer</b></td></tr> <tr><td> </td></tr></table> <blockquote> <H1>$banner</H1> $detail <p> </blockquote> <table width=100% cellpadding=0 cellspacing=0><tr><td bgcolor=#3366cc><img alt="" width=1 height=4></td></tr></table> </body></html> ''' return string.Template(MESSAGE_TEMPLATE).substitute(title=title, banner=banner, detail=detail) try: from Crypto.Cipher.ARC4 import new as RC4Cipher except ImportError: logging.warn('Load Crypto.Cipher.ARC4 Failed, Use Pure Python Instead.') class RC4Cipher(object): def __init__(self, key): x = 0 box = range(256) for i, y in enumerate(box): x = (x + y + ord(key[i % len(key)])) & 0xff box[i], box[x] = box[x], y self.__box = box self.__x = 0 self.__y = 0 def encrypt(self, data): out = [] out_append = out.append x = self.__x y = self.__y box = self.__box for char in data: x = (x + 1) & 0xff y = (y + box[x]) & 0xff box[x], box[y] = box[y], box[x] out_append(chr(ord(char) ^ box[(box[x] + box[y]) & 0xff])) self.__x = x self.__y = y return ''.join(out) def inflate(data): return zlib.decompress(data, -zlib.MAX_WBITS) def deflate(data): return zlib.compress(data)[2:-4] def format_response(status, headers, content): if content: headers.pop('content-length', None) headers['Content-Length'] = str(len(content)) data = 'HTTP/1.1 %d %s\r\n%s\r\n\r\n%s' % (status, httplib.responses.get( status, 'Unknown'), '\r\n'.join('%s: %s' % (k.title(), v) for k, v in headers.items()), content) data = deflate(data) assert len(data) <= 65536 return "%04x" % len(data) + data def application(headers, body, method, url): kwargs = {} any(kwargs.__setitem__(x[len('x-urlfetch-'):].lower(), headers.pop(x)) for x in headers.keys() if x.lower().startswith('x-urlfetch-')) if 'Content-Encoding' in headers and body: if headers['Content-Encoding'] == 'deflate': body = inflate(body) headers['Content-Length'] = str(len(body)) del headers['Content-Encoding'] # logging.info( # '%s "%s %s %s" - -', environ['REMOTE_ADDR'], method, url, 'HTTP/1.1') if __password__ and __password__ != kwargs.get('password', ''): raise GAEfail netloc = urlparse.urlparse(url).netloc if __hostsdeny__ and netloc.endswith(__hostsdeny__): raise GAEfail if len(url) > MAX_URL_LENGTH: raise GAEfail if netloc.startswith(('127.0.0.', '::1', 'localhost')): raise GAEfail fetchmethod = getattr(urlfetch, method, None) if not fetchmethod: raise GAEfail timeout = int(kwargs.get('timeout', URLFETCH_TIMEOUT)) validate_certificate = bool(int(kwargs.get('validate', 0))) maxsize = int(kwargs.get('maxsize', 0)) # https://www.freebsdchina.org/forum/viewtopic.php?t=54269 accept_encoding = headers.get( 'Accept-Encoding', '') or headers.get('Bccept-Encoding', '') errors = [] for i in xrange(int(kwargs.get('fetchmax', URLFETCH_MAX))): try: response = urlfetch.fetch(url, body, fetchmethod, headers, allow_truncated=False, follow_redirects=False, deadline=timeout, validate_certificate=validate_certificate) break except apiproxy_errors.OverQuotaError as e: time.sleep(5) except urlfetch.DeadlineExceededError as e: errors.append('%r, timeout=%s' % (e, timeout)) logging.error( 'DeadlineExceededError(timeout=%s, url=%r)', timeout, url) time.sleep(1) timeout *= 2 except urlfetch.DownloadError as e: errors.append('%r, timeout=%s' % (e, timeout)) logging.error('DownloadError(timeout=%s, url=%r)', timeout, url) time.sleep(1) timeout *= 2 except urlfetch.ResponseTooLargeError as e: errors.append('%r, timeout=%s' % (e, timeout)) response = e.response logging.error( 'ResponseTooLargeError(timeout=%s, url=%r) response(%r)', timeout, url, response) m = re.search( r'=\s*(\d+)-', headers.get('Range') or headers.get('range') or '') if m is None: headers['Range'] = 'bytes=0-%d' % (maxsize or URLFETCH_MAXSIZE) else: headers.pop('Range', '') headers.pop('range', '') start = int(m.group(1)) headers[ 'Range'] = 'bytes=%s-%d' % (start, start + (maxsize or URLFETCH_MAXSIZE)) timeout *= 2 except urlfetch.SSLCertificateError as e: errors.append('%r, should validate=0 ?' % e) logging.error('%r, timeout=%s', e, timeout) except Exception as e: errors.append(str(e)) if i == 0 and method == 'GET': timeout *= 2 else: raise PermanentFail #logging.debug('url=%r response.status_code=%r response.headers=%r response.content[:1024]=%r', url, response.status_code, dict(response.headers), response.content[:1024]) status_code = int(response.status_code) data = response.content response_headers = response.headers content_type = response_headers.get('content-type', '') if status_code == 200 and maxsize and len(data) > maxsize and response_headers.get('accept-ranges', '').lower() == 'bytes' and int(response_headers.get('content-length', 0)): status_code = 206 response_headers[ 'Content-Range'] = 'bytes 0-%d/%d' % (maxsize - 1, len(data)) data = data[:maxsize] if status_code == 200 and 'content-encoding' not in response_headers and 512 < len(data) < URLFETCH_DEFLATE_MAXSIZE and content_type.startswith(('text/', 'application/json', 'application/javascript')): if 'gzip' in accept_encoding: response_headers['Content-Encoding'] = 'gzip' compressobj = zlib.compressobj( zlib.Z_DEFAULT_COMPRESSION, zlib.DEFLATED, -zlib.MAX_WBITS, zlib.DEF_MEM_LEVEL, 0) dataio = io.BytesIO() dataio.write('\x1f\x8b\x08\x00\x00\x00\x00\x00\x02\xff') dataio.write(compressobj.compress(data)) dataio.write(compressobj.flush()) dataio.write( struct.pack('<LL', zlib.crc32(data) & 0xFFFFFFFFL, len(data) & 0xFFFFFFFFL)) data = dataio.getvalue() elif 'deflate' in accept_encoding: response_headers['Content-Encoding'] = 'deflate' data = deflate(data) response_headers['Content-Length'] = str(len(data)) #logging.info("Goagent:: Get %d data and sent.", len(data)) return format_response(status_code, response_headers, '') + data def process(data): req = HTTPRequest(data) p = json.loads(''.join(req.rfile.readlines())) #logging.info("Access URL: " + p["url"]) return application(p["headers"], p["body"], p["method"], p["url"])
gpl-2.0
4,217,351,065,966,016,500
33.64684
205
0.591094
false
kratorius/ads
python/interviewquestions/longest_sequence.py
1
1730
""" Given a list of distinct numbers, find the longest monotonically increasing subsequence within that list. For example: S = [2, 4, 3, 5, 1, 7, 6, 9, 8] -> [2, 3, 5, 6, 8] or [2, 4, 5, 7, 8] or [2, 4, 5, 7, 9] If there's more than one solution, just return one of them. """ import unittest def longest_sequence(lst): if not lst: return [] lengths = [0] * len(lst) predecessors = [None] * len(lst) max_idx = 0 for idx, item in enumerate(lst): # what's the longest subsequence until this point? # (whose last item < current item) max_length = 1 lengths[idx] = 1 predecessors[idx] = None for i, length in enumerate(lengths[:idx]): if length >= max_length and lst[i] < item: max_length = length + 1 lengths[idx] = max_length predecessors[idx] = i max_idx = idx # proceed backward and rebuild the list longest = [] while max_idx is not None: item = lst[max_idx] longest.append(item) max_idx = predecessors[max_idx] return list(reversed(longest)) class LongestSequenceTest(unittest.TestCase): def test_sequence_find(self): self.assertEqual([], longest_sequence([])) self.assertEqual([10], longest_sequence([10])) self.assertEqual([2, 4, 5, 7, 8], longest_sequence([2, 4, 3, 5, 1, 7, 6, 9, 8])) self.assertEqual([1, 2, 3], longest_sequence([1, 2, 3, 1, 2, 3, 1, 2, 3])) self.assertEqual([1, 2, 3], longest_sequence([1, 2, 3])) self.assertEqual([10, 20, 30], longest_sequence([10, 5, 4, 20, 3, 2, 30]))
mit
2,014,271,797,512,256,300
29.892857
88
0.546821
false
Yannig/ansible
lib/ansible/plugins/action/net_base.py
1
7262
# (c) 2015, Ansible Inc, # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. from __future__ import (absolute_import, division, print_function) __metaclass__ = type import sys import copy from ansible import constants as C from ansible.plugins.action import ActionBase from ansible.module_utils.network_common import load_provider from imp import find_module, load_module try: from __main__ import display except ImportError: from ansible.utils.display import Display display = Display() class ActionModule(ActionBase): def run(self, tmp=None, task_vars=None): if self._play_context.connection != 'local': return dict( failed=True, msg='invalid connection specified, expected connection=local, ' 'got %s' % self._play_context.connection ) play_context = copy.deepcopy(self._play_context) play_context.network_os = self._get_network_os(task_vars) # we should be able to stream line this a bit by creating a common # provider argument spec in module_utils/network_common.py or another # option is that there isn't a need to push provider into the module # since the connection is started in the action handler. f, p, d = find_module('ansible') f2, p2, d2 = find_module('module_utils', [p]) f3, p3, d3 = find_module(play_context.network_os, [p2]) module = load_module('ansible.module_utils.' + play_context.network_os, f3, p3, d3) self.provider = load_provider(module.get_provider_argspec(), self._task.args) if play_context.network_os == 'junos': play_context.connection = 'netconf' play_context.port = int(self.provider['port'] or self._play_context.port or 830) else: play_context.connection = 'network_cli' play_context.port = int(self.provider['port'] or self._play_context.port or 22) play_context.remote_addr = self.provider['host'] or self._play_context.remote_addr play_context.remote_user = self.provider['username'] or self._play_context.connection_user play_context.password = self.provider['password'] or self._play_context.password play_context.private_key_file = self.provider['ssh_keyfile'] or self._play_context.private_key_file play_context.timeout = int(self.provider['timeout'] or C.PERSISTENT_COMMAND_TIMEOUT) if 'authorize' in self.provider.keys(): play_context.become = self.provider['authorize'] or False play_context.become_pass = self.provider['auth_pass'] socket_path = self._start_connection(play_context) task_vars['ansible_socket'] = socket_path if 'fail_on_missing_module' not in self._task.args: self._task.args['fail_on_missing_module'] = False result = super(ActionModule, self).run(tmp, task_vars) module = self._get_implementation_module(play_context.network_os, self._task.action) if not module: if self._task.args['fail_on_missing_module']: result['failed'] = True else: result['failed'] = False result['msg'] = ('Could not find implementation module %s for %s' % (self._task.action, play_context.network_os)) else: new_module_args = self._task.args.copy() # perhaps delete the provider argument here as well since the # module code doesn't need the information, the connection is # already started if 'network_os' in new_module_args: del new_module_args['network_os'] del new_module_args['fail_on_missing_module'] display.vvvv('Running implementation module %s' % module) result.update(self._execute_module(module_name=module, module_args=new_module_args, task_vars=task_vars, wrap_async=self._task.async)) display.vvvv('Caching network OS %s in facts' % play_context.network_os) result['ansible_facts'] = {'network_os': play_context.network_os} return result def _start_connection(self, play_context): display.vvv('using connection plugin %s' % play_context.connection, play_context.remote_addr) connection = self._shared_loader_obj.connection_loader.get('persistent', play_context, sys.stdin) socket_path = connection.run() display.vvvv('socket_path: %s' % socket_path, play_context.remote_addr) if not socket_path: return {'failed': True, 'msg': 'unable to open shell. Please see: ' + 'https://docs.ansible.com/ansible/network_debug_troubleshooting.html#unable-to-open-shell'} # make sure we are in the right cli context which should be # enable mode and not config module rc, out, err = connection.exec_command('prompt()') if str(out).strip().endswith(')#'): display.vvvv('wrong context, sending exit to device', self._play_context.remote_addr) connection.exec_command('exit') if self._play_context.become_method == 'enable': self._play_context.become = False self._play_context.become_method = None return socket_path def _get_network_os(self, task_vars): if ('network_os' in self._task.args and self._task.args['network_os']): display.vvvv('Getting network OS from task argument') network_os = self._task.args['network_os'] elif (self._play_context.network_os): display.vvvv('Getting network OS from inventory') network_os = self._play_context.network_os elif ('network_os' in task_vars['ansible_facts'] and task_vars['ansible_facts']['network_os']): display.vvvv('Getting network OS from fact') network_os = task_vars['ansible_facts']['network_os'] else: # this will be replaced by the call to get_capabilities() on the # connection display.vvvv('Getting network OS from net discovery') network_os = None return network_os def _get_implementation_module(self, network_os, platform_agnostic_module): implementation_module = network_os + '_' + platform_agnostic_module.partition('_')[2] if implementation_module not in self._shared_loader_obj.module_loader: implementation_module = None return implementation_module
gpl-3.0
-8,083,114,629,988,565,000
43.280488
118
0.630956
false
F5Networks/f5-common-python
f5/bigiq/cm/device/licensing/pool/initial_activation.py
1
1773
# coding=utf-8 # # Copyright 2017 F5 Networks Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # """BIG-IQ® license pool regkeys. REST URI ``http://localhost/mgmt/cm/device/licensing/pool/initial-activation`` REST Kind ``cm:device:licensing:pool:initial-activation:*`` """ from f5.bigiq.resource import Collection from f5.bigiq.resource import Resource class Initial_Activations(Collection): def __init__(self, pool): super(Initial_Activations, self).__init__(pool) self._meta_data['required_json_kind'] = \ 'cm:device:licensing:pool:initial-activation:initialactivationworkercollectionstate' # NOQA self._meta_data['allowed_lazy_attributes'] = [Initial_Activation] self._meta_data['attribute_registry'] = { 'cm:device:licensing:pool:initial-activation:initialactivationworkeritemstate': Initial_Activation # NOQA } class Initial_Activation(Resource): def __init__(self, initial_activations): super(Initial_Activation, self).__init__(initial_activations) self._meta_data['required_creation_parameters'] = {'name', 'regKey'} self._meta_data['required_json_kind'] = \ 'cm:device:licensing:pool:initial-activation:initialactivationworkeritemstate'
apache-2.0
1,947,570,729,455,576,800
36.702128
118
0.713883
false
CSD-Public/stonix
src/MacBuild/ramdisk/lib/environment.py
1
30726
#!/usr/bin/env python3 ############################################################################### # # # Copyright 2019. Triad National Security, LLC. All rights reserved. # # This program was produced under U.S. Government contract 89233218CNA000001 # # for Los Alamos National Laboratory (LANL), which is operated by Triad # # National Security, LLC for the U.S. Department of Energy/National Nuclear # # Security Administration. # # # # All rights in the program are reserved by Triad National Security, LLC, and # # the U.S. Department of Energy/National Nuclear Security Administration. The # # Government is granted for itself and others acting on its behalf a # # nonexclusive, paid-up, irrevocable worldwide license in this material to # # reproduce, prepare derivative works, distribute copies to the public, # # perform publicly and display publicly, and to permit others to do so. # # # ############################################################################### # ============================================================================# # Filename $RCSfile: stonix/environment.py,v $ # Description Security Configuration Script # OS Linux, OS X, Solaris, BSD # Author Dave Kennel # Last updated by $Author: $ # Notes Based on CIS Benchmarks, NSA RHEL # Guidelines, NIST and DISA STIG/Checklist # Release $Revision: 1.0 $ # Modified Date $Date: 2010/8/24 14:00:00 $ # ============================================================================# ''' Created on Aug 24, 2010 @author: dkennel @change: 2014/05/29 - ekkehard j. koch - pep8 and comment updates ''' #--- Native python libraries import os import re import sys import socket import subprocess import types import platform import pwd import time class Environment: '''The Environment class collects commonly used information about the execution platform and makes it available to the rules. :version: 1.0 :author: D. Kennel ''' def __init__(self): self.operatingsystem = '' self.osreportstring = '' self.osfamily = '' self.hostname = '' self.ipaddress = '' self.macaddress = '' self.osversion = '' self.numrules = 0 self.euid = os.geteuid() currpwd = pwd.getpwuid(self.euid) try: self.homedir = currpwd[5] except(IndexError): self.homedir = '/dev/null' self.installmode = False self.verbosemode = False self.debugmode = False self.runtime = time.strftime("%Y-%m-%d %H:%M:%S", time.localtime()) self.collectinfo() def setinstallmode(self, installmode): '''Set the install mode bool value. Should be true if the prog should run in install mode. :param bool: installmode :param installmode: :returns: void @author: D. Kennel ''' try: if type(installmode) is bool: self.installmode = installmode except (NameError): # installmode was undefined pass def getinstallmode(self): '''Return the current value of the install mode bool. Should be true if the program is to run in install mode. :returns: bool : installmode @author: D. Kennel ''' return self.installmode def setverbosemode(self, verbosemode): '''Set the verbose mode bool value. Should be true if the prog should run in verbose mode. :param bool: verbosemode :param verbosemode: :returns: void @author: D. Kennel ''' try: if type(verbosemode) is bool: self.verbosemode = verbosemode except (NameError): # verbosemode was undefined pass def getverbosemode(self): '''Return the current value of the verbose mode bool. Should be true if the program is to run in verbose mode. :returns: bool : verbosemode @author: D. Kennel ''' return self.verbosemode def setdebugmode(self, debugmode): '''Set the verbose mode bool value. Should be true if the prog should run in verbose mode. :param bool: debugmode :param debugmode: :returns: void @author: D. Kennel ''' try: if type(debugmode) is bool: self.debugmode = debugmode except (NameError): # debugmode was undefined pass def getdebugmode(self): '''Return the current value of the debug mode bool. Should be true if the program is to run in debug mode. :returns: bool : debugmode @author: D. Kennel ''' return self.debugmode def getostype(self): '''Return the detailed operating system type. :returns: string : @author D. Kennel ''' return self.operatingsystem def getosreportstring(self): '''Return the detailed operating system type with full version info. :returns: string : @author D. Kennel ''' return self.osreportstring def getosfamily(self): '''Return the value of self.osfamily which should be linux, darwin, solaris or freebsd. :returns: string : @author: D. Kennel ''' return self.osfamily def getosver(self): '''Return the OS version as a string. :returns: string : @author D. Kennel ''' return self.osversion def gethostname(self): '''Return the hostname of the system. :returns: string @author: dkennel ''' return self.hostname def getipaddress(self): '''Return the IP address associated with the host name. :returns: string : @author D. Kennel ''' return self.ipaddress def getmacaddr(self): '''Return the mac address in native format. :returns: string : @author D. Kennel ''' return self.macaddress def geteuid(self): '''Return the effective user ID :returns: int : @author D. Kennel ''' return self.euid def geteuidhome(self): '''Returns the home directory of the current effective user ID. :returns: string @author: D. Kennel ''' return self.homedir def collectinfo(self): '''Private method to populate data. :returns: void @author D. Kennel ''' # print 'Environment Running discoveros' self.discoveros() # print 'Environment running setosfamily' self.setosfamily() # print 'Environment running guessnetwork' self.guessnetwork() self.collectpaths() def discoveros(self): '''Discover the operating system type and version :returns: void @author: D. Kennel ''' # Alternative (better) implementation for Linux if os.path.exists('/usr/bin/lsb_release'): proc = subprocess.Popen('/usr/bin/lsb_release -dr', shell=True, stdout=subprocess.PIPE, close_fds=True) description = proc.stdout.readline() release = proc.stdout.readline() description = description.split() # print description del description[0] description = " ".join(description) self.operatingsystem = description self.osreportstring = description release = release.split() release = release[1] self.osversion = release elif os.path.exists('/etc/redhat-release'): relfile = open('/etc/redhat-release') release = relfile.read() relfile.close() release = release.split() opsys = '' for element in release: if re.search('release', element): break else: opsys = opsys + " " + element self.operatingsystem = opsys self.osreportstring = opsys index = 0 for element in release: if re.search('release', element): index = index + 1 osver = release[index] else: index = index + 1 self.osversion = osver elif os.path.exists('/etc/gentoo-release'): relfile = open('/etc/gentoo-release') release = relfile.read() relfile.close() release = release.split() opsys = '' for element in release: if re.search('release', element): break else: opsys = opsys + " " + element self.operatingsystem = opsys self.osreportstring = opsys index = 0 for element in release: if re.search('release', element): index = index + 1 osver = release[index] else: index = index + 1 self.osversion = osver elif os.path.exists('/usr/bin/sw_vers'): proc1 = subprocess.Popen('/usr/bin/sw_vers -productName', shell=True, stdout=subprocess.PIPE, close_fds=True) description = proc1.stdout.readline() description = description.strip() proc2 = subprocess.Popen('/usr/bin/sw_vers -productVersion', shell=True, stdout=subprocess.PIPE, close_fds=True) release = proc2.stdout.readline() release = release.strip() self.operatingsystem = description self.osversion = release proc3 = subprocess.Popen('/usr/bin/sw_vers -buildVersion', shell=True, stdout=subprocess.PIPE, close_fds=True) build = proc3.stdout.readline() build = build.strip() opsys = str(description) + ' ' + str(release) + ' ' + str(build) self.osreportstring = opsys def setosfamily(self): '''Private method to detect and set the self.osfamily property. This is a fuzzy classification of the OS. ''' uname = sys.platform if uname == 'linux2': self.osfamily = 'linux' elif uname == 'darwin': self.osfamily = 'darwin' elif uname == 'sunos5': self.osfamily = 'solaris' elif uname == 'freebsd9': self.osfamily = 'freebsd' def guessnetwork(self): '''This private method checks the configured interfaces and tries to make an educated guess as to the correct network data. self.ipaddress and self.macaddress will be updated by this method. ''' # regex to match mac addresses macre = '(([0-9A-Fa-f]{2}[:-]){5}[0-9A-Fa-f]{2})' ipaddress = '' macaddress = '00:00:00:00:00:00' hostname = socket.getfqdn() try: ipdata = socket.gethostbyname_ex(hostname) iplist = ipdata[2] try: iplist.remove('127.0.0.1') except (ValueError): # tried to remove loopback when it's not present, continue pass if len(iplist) >= 1: ipaddress = iplist[0] else: ipaddress = '127.0.0.1' except(socket.gaierror): # If we're here it's because socket.getfqdn did not in fact return # a valid hostname and gethostbyname errored. ipaddress = self.getdefaultip() # In ifconfig output macaddresses are always one line before the ip # address. if sys.platform == 'linux2': cmd = '/sbin/ifconfig' elif os.path.exists('/usr/sbin/ifconfig'): cmd = '/usr/sbin/ifconfig -a' else: cmd = '/sbin/ifconfig -a' proc = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, close_fds=True) netdata = proc.stdout.readlines() for line in netdata: # print "processing: " + line match = re.search(macre, line.decode('utf-8')) if match is not None: # print 'Matched MAC address' macaddress = match.group() if re.search(ipaddress, line.decode('utf-8')): # print 'Found ipaddress' break self.hostname = hostname self.ipaddress = ipaddress self.macaddress = macaddress def getdefaultip(self): '''This method will return the ip address of the interface associated with the current default route. :returns: string - ipaddress @author: dkennel ''' ipaddr = '127.0.0.1' gateway = '' if sys.platform == 'linux2': try: routecmd = subprocess.Popen('/sbin/route -n', shell=True, stdout=subprocess.PIPE, close_fds=True) routedata = routecmd.stdout.readlines() except(OSError): return ipaddr for line in routedata: if re.search('^default', line.decode('utf-8')): line = line.split() try: gateway = line[1] except(IndexError): return ipaddr else: try: if os.path.exists('/usr/sbin/route'): cmd = '/usr/sbin/route -n get default' else: cmd = '/sbin/route -n get default' routecmd = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, close_fds=True) routedata = routecmd.stdout.readlines() except(OSError): return ipaddr for line in routedata: if re.search('gateway:', line.decode('utf-8')): line = line.decode('utf-8').split() try: gateway = line[1] except(IndexError): return ipaddr if gateway: iplist = self.getallips() for level in [1, 2, 3, 4]: matched = self.matchip(gateway, iplist, level) if len(matched) == 1: ipaddr = matched[0] break return ipaddr def matchip(self, target, iplist, level=1): '''This method will when given an IP try to find matching ip from a list of IP addresses. Matching will work from left to right according to the level param. If no match is found the loopback address will be returned. :param string: ipaddress :param list: list of ipaddresses :param int: level :param target: :param iplist: :param level: (Default value = 1) :returns: list - ipaddresses @author: dkennel ''' quad = target.split('.') if level == 1: network = quad[0] elif level == 2: network = quad[0] + '.' + quad[1] elif level == 3: network = quad[0] + '.' + quad[1] + '.' + quad[2] elif level == 4: return ['127.0.0.1'] matchlist = [] for addr in iplist: if re.search(network, addr.decode('utf-8')): matchlist.append(addr) if len(matchlist) == 0: matchlist.append('127.0.0.1') return matchlist def getallips(self): '''This method returns all ip addresses on all interfaces on the system. :returns: list of strings @author: dkennel ''' iplist = [] if sys.platform == 'linux2': try: ifcmd = subprocess.Popen('/sbin/ifconfig', shell=True, stdout=subprocess.PIPE, close_fds=True) ifdata = ifcmd.stdout.readlines() except(OSError): return iplist for line in ifdata: if re.search('inet addr:', line.decode('utf-8')): try: line = line.split() addr = line[1] addr = addr.split(':') addr = addr[1] iplist.append(addr) except(IndexError): continue else: try: if os.path.exists('/usr/sbin/ifconfig'): cmd = '/usr/sbin/ifconfig -a' else: cmd = '/sbin/ifconfig -a' ifcmd = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, close_fds=True) ifdata = ifcmd.stdout.readlines() except(OSError): return iplist for line in ifdata: if re.search('inet ', line.decode('utf-8')): try: line = line.split() addr = line[1] iplist.append(addr) except(IndexError): continue return iplist def get_property_number(self): '''Find and return the Property number of the local machine @author: scmcleni @author: D. Kennel :returns: int ''' propnum = 0 try: if os.path.exists('/etc/property-number'): propertynumberfile = open('/etc/property-number', 'r') propnum = propertynumberfile.readline() propnum = propnum.strip() propertynumberfile.close() if platform.system() == 'Darwin': pnfetch = '/usr/sbin/nvram asset_id 2>/dev/null' cmd = subprocess.Popen(pnfetch, shell=True, stdout=subprocess.PIPE, close_fds=True) cmdout = cmd.stdout.readline() cmdout = cmdout.split() try: propnum = cmdout[1] except(IndexError, KeyError): propnum = 0 except: pass # Failed to obtain property number return propnum def get_system_serial_number(self): '''Find and return the Serial number of the local machine @author: dkennel :returns: string ''' systemserial = '0' if os.path.exists('/usr/sbin/system_profiler'): profilerfetch = '/usr/sbin/system_profiler SPHardwareDataType' cmd3 = subprocess.Popen(profilerfetch, shell=True, stdout=subprocess.PIPE, close_fds=True) cmd3output = cmd3.stdout.readlines() for line in cmd3output: if re.search('Serial Number (system):', line.decode('utf-8')): line = line.split(':') try: systemserial = line[1] except(IndexError, KeyError): pass systemserial = systemserial.strip() return systemserial def get_sys_uuid(self): '''Find and return a unique identifier for the system. On most systems this will be the UUID of the system. On Solaris SPARC this will be a number that is _hopefully_ unique as that platform doesn't have UUID numbers. @author: D. Kennel :returns: string ''' uuid = '0' if os.path.exists('/usr/sbin/smbios'): smbiosfetch = '/usr/sbin/smbios -t SMB_TYPE_SYSTEM 2>/dev/null' cmd2 = subprocess.Popen(smbiosfetch, shell=True, stdout=subprocess.PIPE, close_fds=True) cmdoutput = cmd2.stdout.readlines() for line in cmdoutput: if re.search('UUID:', line.decode('utf-8')): line = line.split() try: uuid = line[1] except(IndexError, KeyError): pass elif os.path.exists('/usr/sbin/system_profiler'): profilerfetch = '/usr/sbin/system_profiler SPHardwareDataType' cmd3 = subprocess.Popen(profilerfetch, shell=True, stdout=subprocess.PIPE, close_fds=True) cmd3output = cmd3.stdout.readlines() for line in cmd3output: if re.search('UUID:', line.decode('utf-8')): line = line.split() try: uuid = line[2] except(IndexError, KeyError): pass elif platform.system() == 'SunOS': fetchhostid = '/usr/bin/hostid' cmd1 = subprocess.Popen(fetchhostid, shell=True, stdout=subprocess.PIPE, close_fds=True) uuid = cmd1.stdout.readline() uuid = uuid.strip() return uuid def ismobile(self): '''Returns a bool indicating whether or not the system in question is a laptop. The is mobile method is used by some rules that have alternate settings for laptops. @author: dkennel @regturn: bool - true if system is a laptop ''' ismobile = False dmitypes = ['LapTop', 'Portable', 'Notebook', 'Hand Held', 'Sub Notebook'] if os.path.exists('/usr/sbin/system_profiler'): profilerfetch = '/usr/sbin/system_profiler SPHardwareDataType' cmd3 = subprocess.Popen(profilerfetch, shell=True, stdout=subprocess.PIPE, close_fds=True) cmd3output = cmd3.stdout.readlines() for line in cmd3output: if re.search('Book', line.decode('utf-8')): ismobile = True break return ismobile def issnitchactive(self): '''Returns a bool indicating whether or not the little snitch program is active. Little snitch is a firewall utility used on Mac systems and can interfere with STONIX operations. @author: ekkehard :returns: bool - true if little snitch is running ''' issnitchactive = False if self.osfamily == 'darwin': cmd = 'ps axc -o comm | grep lsd' littlesnitch = 'lsd' proc = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, close_fds=True) netdata = proc.stdout.readlines() for line in netdata: print("processing: " + line.decode('utf-8')) match = re.search(littlesnitch, line.decode('utf-8')) if match is not None: print('LittleSnitch Is Running') issnitchactive = True break return issnitchactive def collectpaths(self): '''Determine how stonix is run and return appropriate paths for: icons rules conf logs @author: Roy Nielsen ''' script_path_zero = os.path.realpath(sys.argv[0]) try: script_path_one = os.path.realpath(sys.argv[1]) except: script_path_one = "" self.test_mode = False ##### # Check which argv variable has the script name -- required to allow # for using the eclipse debugger. if re.search("stonix.py$", script_path_zero) or re.search("stonix$", script_path_zero): ##### # Run normally self.script_path = os.path.dirname(os.path.realpath(sys.argv[0])) else: ##### # Run with Eclipse debugger -- Eclipse debugger will never try to run # the "stonix" binary blob created by pyinstaller, so don't include # here. #print "DEBUG: Environment.collectpaths: unexpected argv[0]: " + str(sys.argv[0]) if re.search("stonix.py$", script_path_one) or re.search("stonixtest.py$", script_path_one): script = script_path_one.split("/")[-1] script_path = "/".join(script_path_one.split("/")[:-1]) if re.match("^stonixtest.py$", script) and \ os.path.exists(script_path_one) and \ os.path.exists(os.path.join(script_path, "stonixtest.py")) and \ os.path.exists(os.path.join(script_path, "stonix.py")): self.test_mode = True self.script_path = os.path.dirname(os.path.realpath(sys.argv[1])) else: print("ERROR: Cannot run using this method") else: #print "DEBUG: Cannot find appropriate path, building paths for current directory" self.script_path = os.getcwd() ##### # Set the rules & stonix_resources paths if re.search("stonix.app/Contents/MacOS$", self.script_path): ##### # Find the stonix.conf file in the stonix.app/Contents/Resources # directory macospath = self.script_path self.resources_path = os.path.join(self.script_path, "stonix_resources") self.rules_path = os.path.join(self.resources_path, "rules") else: # ## # create the self.resources_path self.resources_path = os.path.join(self.script_path, "stonix_resources") # ## # create the self.rules_path self.rules_path = os.path.join(self.script_path, "stonix_resources", "rules") ##### # Set the log file path if self.geteuid() == 0: self.log_path = '/var/log' else: userpath = self.geteuidhome() self.log_path = os.path.join(userpath, '.stonix') if userpath == '/dev/null': self.log_path = '/tmp' ##### # Set the icon path self.icon_path = os.path.join(self.resources_path, 'gfx') ##### # Set the configuration file path if re.search("stonix.app/Contents/MacOS/stonix$", os.path.realpath(sys.argv[0])): ##### # Find the stonix.conf file in the stonix.app/Contents/Resources # directory macospath = self.script_path parents = macospath.split("/") parents.pop() parents.append("Resources") resources_dir = "/".join(parents) self.conf_path = os.path.join(resources_dir, "stonix.conf") elif os.path.exists(os.path.join(self.script_path, "etc", "stonix.conf")): self.conf_path = os.path.join(self.script_path, "etc", "stonix.conf") elif re.search('pydev', script_path_zero) and re.search('stonix_resources', script_path_one): print("INFO: Called by unit test") srcpath = script_path_one.split('/')[:-2] srcpath = '/'.join(srcpath) self.conf_path = os.path.join(srcpath, 'etc', 'stonix.conf') print((self.conf_path)) else: self.conf_path = "/etc/stonix.conf" def get_test_mode(self): '''Getter test mode flag @author: Roy Nielsen ''' return self.test_mode def get_script_path(self): '''Getter for the script path @author: Roy Nielsen ''' return self.script_path def get_icon_path(self): '''Getter for the icon path @author: Roy Nielsen ''' return self.icon_path def get_rules_path(self): '''Getter for rules path @author: Roy Nielsen ''' return self.rules_path def get_config_path(self): '''Getter for conf file path @author: Roy Nielsen ''' return self.conf_path def get_log_path(self): '''Getter for log path @author: Roy Nielsen ''' return self.log_path def get_resources_path(self): '''Getter for stonix resources directory @author: Roy Nielsen ''' return self.resources_path def getruntime(self): ''' :returns: @author: dkennel ''' return self.runtime def setnumrules(self, num): '''Set the number of rules that apply to the system. This information is used by the log dispatcher in the run metadata. :param num: int - number of rules that apply to this host @author: dkennel ''' if type(num) is not int: raise TypeError('Number of rules must be an integer') elif num < 0: raise ValueError('Number of rules must be a positive integer') else: self.numrules = num def getnumrules(self): ''' :returns: @author: dkennel ''' return self.numrules
gpl-2.0
8,765,713,703,017,385,000
32.145631
104
0.499837
false
ajbouh/tfi
src/tfi/main.py
1
13541
#!/usr/bin/env python from __future__ import absolute_import from __future__ import division from __future__ import print_function import argparse import os import os.path import sys import tempfile import tfi import tfi.driver import tfi.driverconfig from tfi.resolve.model import _detect_model_file_kind, _model_module_for_kind, _load_model_from_path_fn from tfi.cli import resolve as _resolve_model from tfi.tensor.codec import encode as _tfi_tensor_codec_encode from tfi.format.iterm2 import imgcat as _tfi_format_iterm2_imgcat def _detect_model_object_kind(model): klass = model if isinstance(model, type) else type(model) for c in klass.mro(): if c.__name__ != "Model": continue if c.__module__ == "tfi.driver.pytorch": return "pytorch" if c.__module__ == "tfi.driver.prophet": return "prophet" if c.__module__ == "tfi.driver.tf": return "tensorflow" if c.__module__ == "tfi.driver.msp": return "msp" if c.__module__ == "tfi.driver.spacy": return "spacy" raise Exception("Unknown model type %s" % klass) def _model_export(path, model): kind = _detect_model_object_kind(model) mod = _model_module_for_kind(kind) return mod.export(path, model) def _model_publish(f): from tfi.publish import publish as _publish kind = _detect_model_file_kind(f) _publish(kind, f) class ModelSpecifier(argparse.Action): def __init__(self, option_strings, dest, **kwargs): super(ModelSpecifier, self).__init__( option_strings=option_strings, dest=dest, **kwargs) def __call__(self, parser, namespace, values, option_string=None): if values is None: setattr(namespace, self.dest, None) return if values: leading_value, *rest = values else: leading_value = None rest = [] resolution = _resolve_model(leading_value, rest) setattr(namespace, self.dest, resolution['model']) setattr(namespace, "%s_module_fn" % self.dest, resolution.get('module_fn', lambda x: None)) setattr(namespace, "%s_can_refresh" % self.dest, resolution.get('can_refresh', None)) setattr(namespace, "%s_refresh_fn" % self.dest, resolution.get('refresh_fn', None)) setattr(namespace, "%s_method_fn" % self.dest, resolution['model_method_fn']) setattr(namespace, "%s_source" % self.dest, resolution.get('source', None)) setattr(namespace, "%s_source_sha1hex" % self.dest, resolution.get('source_sha1hex', None)) setattr(namespace, "%s_via_python" % self.dest, resolution.get('via_python', None)) setattr(namespace, "%s_raw" % self.dest, resolution.get('leading_value', None)) parser = argparse.ArgumentParser(prog='tfi', add_help=False) parser.add_argument('--serve', default=False, action='store_true', help='Start REST API on given port') parser.add_argument('--tracing-host', type=str, default=os.environ.get('JAEGER_HOST', None), help='Jaeger host to submit traces to while serving') parser.add_argument('--tracing-tags', type=str, default=os.environ.get('JAEGER_TAGS', ''), help='Jaeger tags to include in traces to while serving') parser.add_argument('--internal-config', type=str, default=os.environ.get("TFI_INTERNAL_CONFIG", ""), help='For internal use.') parser.add_argument('--publish', default=False, action='store_true', help='Publish model') parser.add_argument('--bind', type=str, help='Set address:port to serve model on. Default behavior is 127.0.0.1 if available, otherwise 127.0.0.1:0') parser.add_argument('--bind-default', type=str, default='127.0.0.1:5000') parser.add_argument('--export', type=str, help='path to export to') parser.add_argument('--export-doc', type=str, help='path to export doc to') parser.add_argument('--watch', default=False, action='store_true', help='Watch given model and reload when it changes') parser.add_argument('--interactive', '-i', default=None, action='store_true', help='Start interactive session') parser.add_argument('--tf-tensorboard-bind-default', type=str, default='127.0.0.1:6007') parser.add_argument('--tf-tensorboard-bind', type=str, help='Set address:port to serve TensorBoard on. Default behavior is 127.0.0.1:6007 if available, otherwise 127.0.0.1:0') parser.add_argument('--tf-logdir', default=os.path.expanduser('~/.tfi/tf/log/%F_%H-%M-%S/%04i'), help='Set TensorFlow log dir to write to. Renders any % placeholders with strftime, runs TensorBoard from parent dir. %04i is replaced by a 0-padded run_id count') parser.add_argument('specifier', type=str, default=None, nargs=argparse.REMAINDER, action=ModelSpecifier, help='fully qualified class name to instantiate') # TODO(adamb) # And let's add basic text --doc output. # Then we'll add support for training a model locally ... (which?) # Then we'll add support for training a model ELSEWHERE. def run(argns, remaining_args): model = None module = None exporting = argns.export is not None or argns.export_doc is not None serving = argns.serve is not False publishing = argns.publish is not False batch = False if argns.interactive is None: argns.interactive = not batch and not exporting and not serving and not publishing def tf_make_logdir_fn(datetime): import re base_logdir = datetime.strftime(argns.tf_logdir) def logdir_fn(run_id=None): if run_id is None: return re.sub('(%\d*)i', '', base_logdir) base_logdir_formatstr = re.sub('(%\d*)i', '\\1d', base_logdir) return base_logdir_formatstr % run_id return logdir_fn import tfi import tfi.driverconfig tfi.driverconfig.tf.make_logdir_fn = tf_make_logdir_fn if argns.specifier: model = argns.specifier module = argns.specifier_module_fn() if argns.specifier_method_fn: result = argns.specifier_method_fn() accept_mimetypes = {"image/png": _tfi_format_iterm2_imgcat, "text/plain": lambda x: x} result_val = _tfi_tensor_codec_encode(accept_mimetypes, result) if result_val is None: result_val = result result_str = '%r\n' % (result_val, ) print(result_str) batch = True internal_config = argns.internal_config or (model and _detect_model_object_kind(model)) if internal_config == 'tensorflow': import tensorflow tensorboard = internal_config == 'tensorflow' and argns.interactive if tensorboard: import tfi.driver.tf.tensorboard_server import threading tb_logdir = argns.tf_logdir while '%' in tb_logdir: tb_logdir = os.path.dirname(tb_logdir) if argns.tf_tensorboard_bind: tb_host, tb_port = argns.tf_tensorboard_bind.split(':', 1) tb_port = int(tb_port) else: tb_host, tb_port = argns.tf_tensorboard_bind_default.split(':', 1) tb_port = int(tb_port) import socket with socket.socket(socket.AF_INET, socket.SOCK_STREAM) as s: try: s.bind((tb_host, tb_port)) except socket.error as e: if e.errno == 98: tb_port = 0 # Use some fancy footwork to delay continuing until TensorBoard has started. tb_cv = threading.Condition() def tb_run(): def on_ready_fn(url): if url: print('TensorBoard at %s now serving %s' % (url, tb_logdir)) sys.stdout.flush() with tb_cv: tb_cv.notify_all() tfi.driver.tf.tensorboard_server.main(tb_logdir, tb_host=tb_host, tb_port=tb_port, tb_on_ready_fn=on_ready_fn) with tb_cv: tb_thread = threading.Thread(target=tb_run, daemon=True) tb_thread.start() tb_cv.wait() if internal_config == 'spacy': import tfi.driver.spacy if serving: segment_js = """ <script> !function(){var analytics=window.analytics=window.analytics||[];if(!analytics.initialize)if(analytics.invoked)window.console&&console.error&&console.error("Segment snippet included twice.");else{analytics.invoked=!0;analytics.methods=["trackSubmit","trackClick","trackLink","trackForm","pageview","identify","reset","group","track","ready","alias","debug","page","once","off","on"];analytics.factory=function(t){return function(){var e=Array.prototype.slice.call(arguments);e.unshift(t);analytics.push(e);return analytics}};for(var t=0;t<analytics.methods.length;t++){var e=analytics.methods[t];analytics[e]=analytics.factory(e)}analytics.load=function(t){var e=document.createElement("script");e.type="text/javascript";e.async=!0;e.src=("https:"===document.location.protocol?"https://":"http://")+"cdn.segment.com/analytics.js/v1/"+t+"/analytics.min.js";var n=document.getElementsByTagName("script")[0];n.parentNode.insertBefore(e,n)};analytics.SNIPPET_VERSION="4.0.0"; analytics.load("GaappI2dkNZV4PLVdiJ8pHQ7Hofbf6Vz"); analytics.page(); }}(); </script> """ segment_js = "" def on_bind(url): print("Serving at %s" % url) tracing_tags = {} if argns.tracing_tags: for tag_entry in argns.tracing_tags.split(' '): tag_k, tag_v = tag_entry.split('=', 1) tracing_tags[tag_k] = tag_v if argns.bind: host, port = argns.bind.split(':') port = int(port) else: host, initial_port = argns.bind_default.split(':') initial_port = int(initial_port) port = 0 for possible_port in range(initial_port, initial_port + 32): import socket with socket.socket(socket.AF_INET, socket.SOCK_STREAM) as s: try: s.bind((host, possible_port)) port = possible_port break except socket.error as e: if e.errno == 98 or e.errno == 48: pass if model is None: from tfi.serve import run_deferred as serve_deferred serve_deferred( host=host, port=port, on_bind=on_bind, load_model_from_path_fn=_load_model_from_path_fn, extra_scripts=segment_js, jaeger_host=argns.tracing_host, jaeger_tags=tracing_tags) else: from tfi.serve import run as serve def model_file_fn(): if argns.specifier_source and not argns.specifier_via_python: return argns.specifier_source with tempfile.NamedTemporaryFile(mode='rb', delete=False) as f: print("Exporting ...", end='', flush=True) _model_export(f.name, model) print(" done", flush=True) return f.name serve(model, host=host, port=port, on_bind=on_bind, extra_scripts=segment_js, jaeger_host=argns.tracing_host, jaeger_tags=tracing_tags, model_file_fn=model_file_fn) if argns.watch: if not argns.specifier_can_refresh: print("WARN: Can't watch unrefreshable model.") else: import tfi.watch ar = tfi.watch.AutoRefresher() def do_refresh(): def refresh_progress(model, ix, total): print("Refreshing %d/%d: %s" % (ix, total, model)) argns.specifier_refresh_fn(refresh_progress) ar.watch(argns.specifier_source, argns.specifier_source_sha1hex, do_refresh) ar.start() if argns.interactive: from tfi.repl import run as run_repl run_repl( globals=globals(), locals=None, history_filename=os.path.expanduser('~/.tfihistory'), model=model, module=module) if argns.export_doc: tfi.doc.save(argns.export_doc, model) if argns.export: if argns.specifier_source and not argns.specifier_via_python: import shutil shutil.copyfile(argns.specifier_source, argns.export) else: _model_export(argns.export, model) if argns.publish: if argns.specifier_source and not argns.specifier_via_python: with open(argns.specifier_source, 'rb') as f: # TODO(adamb) Should actually autodetect which environment to use. url = _model_publish(f) else: with tempfile.NamedTemporaryFile(mode='rb') as f: # TODO(adamb) Should actually autodetect which environment to use. print("Exporting ...", end='', flush=True) _model_export(f.name, model) print(" done", flush=True) url = _model_publish(f) print(url) def cli(args): argns, remaining_args = parser.parse_known_args(args) argns.load_model_from_path_fn = _load_model_from_path_fn run(argns, remaining_args) def main(): cli(sys.argv[1:]) if __name__ == '__main__': main()
mit
230,525,589,146,237,150
41.990476
972
0.600251
false
kzvyahin/cfme_tests
sprout/appliances/api.py
1
17913
# -*- coding: utf-8 -*- import inspect import json import re from celery import chain from celery.result import AsyncResult from datetime import datetime from django.core.exceptions import ObjectDoesNotExist from django.db import transaction from django.http import HttpResponse from django.shortcuts import render from appliances.models import ( Appliance, AppliancePool, Provider, Group, Template, User, GroupShepherd) from appliances.tasks import ( appliance_power_on, appliance_power_off, appliance_suspend, appliance_rename, connect_direct_lun, disconnect_direct_lun, mark_appliance_ready, wait_appliance_ready) from sprout.log import create_logger def json_response(data): return HttpResponse(json.dumps(data), content_type="application/json") def json_exception(e): return json_response({ "status": "exception", "result": { "class": type(e).__name__, "message": str(e) } }) def json_autherror(message): return json_response({ "status": "autherror", "result": { "message": str(message) } }) def json_success(result): return json_response({ "status": "success", "result": result }) class JSONMethod(object): def __init__(self, method, auth=False): self._method = method if self._method.__doc__: try: head, body = self._method.__doc__.split("\n\n", 1) head = head.strip() self._doc = head except ValueError: self._doc = self._method.__doc__.strip() else: self._doc = "" self.auth = auth @property def __name__(self): return self._method.__name__ def __call__(self, *args, **kwargs): return self._method(*args, **kwargs) @property def description(self): f_args = inspect.getargspec(self._method).args f_defaults = inspect.getargspec(self._method).defaults defaults = {} if f_defaults is not None: for key, value in zip(f_args[-len(f_defaults):], f_defaults): defaults[key] = value return { "name": self._method.__name__, "args": f_args if not self.auth else f_args[1:], "defaults": defaults, "docstring": self._doc, "needs_authentication": self.auth, } class JSONApi(object): def __init__(self): self._methods = {} def method(self, f): self._methods[f.__name__] = JSONMethod(f) def authenticated_method(self, f): self._methods[f.__name__] = JSONMethod(f, auth=True) def doc(self, request): return render(request, 'appliances/apidoc.html', {}) def __call__(self, request): if request.method != 'POST': return json_success({ "available_methods": sorted( map(lambda m: m.description, self._methods.itervalues()), key=lambda m: m["name"]), }) try: data = json.loads(request.body) method_name = data["method"] args = data["args"] kwargs = data["kwargs"] try: method = self._methods[method_name] except KeyError: raise NameError("Method {} not found!".format(method_name)) create_logger(method).info( "Calling with parameters {}{}".format(repr(tuple(args)), repr(kwargs))) if method.auth: if "auth" in data: username, password = data["auth"] try: user = User.objects.get(username=username) except ObjectDoesNotExist: return json_autherror("User {} does not exist!".format(username)) if not user.check_password(password): return json_autherror("Wrong password for user {}!".format(username)) create_logger(method).info( "Called by user {}/{}".format(user.id, user.username)) return json_success(method(user, *args, **kwargs)) else: return json_autherror("Method {} needs authentication!".format(method_name)) else: return json_success(method(*args, **kwargs)) except Exception as e: create_logger(method).error( "Exception raised during call: {}: {}".format(type(e).__name__, str(e))) return json_exception(e) else: create_logger(method).info("Call finished") jsonapi = JSONApi() def jsonapi_doc(*args, **kwargs): return jsonapi.doc(*args, **kwargs) @jsonapi.method def has_template(template_name, preconfigured): """Check if Sprout tracks a template with a particular name. Can check both fresh templates and preconfigured ones. It will only take the ones that are: * Ready * Existing * Usable Args: template_name: Name of the *original* template. preconfigured: Whether to check the fresh templates or preconfigured ones. """ query = Template.objects.filter( ready=True, exists=True, usable=True, preconfigured=bool(preconfigured), original_name=template_name) return query.count() > 0 @jsonapi.method def list_appliances(used=False): """Returns list of appliances. Args: used: Whether to report used or unused appliances """ query = Appliance.objects if used: query = query.exclude(appliance_pool__owner=None) else: query = query.filter(appliance_pool__owner=None) result = [] for appliance in query: result.append(appliance.serialized) return result @jsonapi.authenticated_method def num_shepherd_appliances(user, group, version=None, date=None, provider=None): """Provides number of currently available shepherd appliances.""" group = Group.objects.get(id=group) if provider is not None: provider = Provider.objects.get(id=provider) if version is None: if provider is None: try: version = Template.get_versions(template_group=group)[0] except IndexError: # No version pass else: try: version = Template.get_versions(template_group=group, provider=provider)[0] except IndexError: # No version pass if date is None: filter_kwargs = {"template_group": group} if provider is not None: filter_kwargs["provider"] = provider if version is not None: filter_kwargs["version"] = version try: date = Template.get_dates(**filter_kwargs)[0] except IndexError: # No date pass filter_kwargs = {"template__template_group": group, "ready": True, "appliance_pool": None} if version is not None: filter_kwargs["template__version"] = version if date is not None: filter_kwargs["template__date"] = date if provider is not None: filter_kwargs["template__provider"] = provider return len(Appliance.objects.filter(**filter_kwargs)) @jsonapi.authenticated_method def request_appliances( user, group, count=1, lease_time=60, version=None, date=None, provider=None, preconfigured=True, yum_update=False, container=False): """Request a number of appliances.""" if date: date = datetime.strptime(date, "%y%m%d") return AppliancePool.create( user, group, version, date, provider, count, lease_time, preconfigured, yum_update, container).id @jsonapi.authenticated_method def request_check(user, request_id): """Return status of the appliance pool""" request = AppliancePool.objects.get(id=request_id) if user != request.owner and not user.is_staff: raise Exception("This pool belongs to a different user!") return { "fulfilled": request.fulfilled, "finished": request.finished, "preconfigured": request.preconfigured, "yum_update": request.yum_update, "progress": int(round(request.percent_finished * 100)), "appliances": [ appliance.serialized for appliance in request.appliances ], } @jsonapi.authenticated_method def prolong_appliance_lease(user, id, minutes=60): """Prolongs the appliance's lease time by specified amount of minutes from current time.""" appliance = Appliance.objects.get(id=id) if appliance.owner is not None and user != appliance.owner and not user.is_staff: raise Exception("This pool belongs to a different user!") appliance.prolong_lease(time=minutes) @jsonapi.authenticated_method def prolong_appliance_pool_lease(user, id, minutes=60): """Prolongs the appliance pool's lease time by specified amount of minutes from current time.""" pool = AppliancePool.objects.get(id=id) if user != pool.owner and not user.is_staff: raise Exception("This pool belongs to a different user!") pool.prolong_lease(time=minutes) @jsonapi.authenticated_method def destroy_pool(user, id): """Destroy the pool. Kills all associated appliances.""" pool = AppliancePool.objects.get(id=id) if user != pool.owner and not user.is_staff: raise Exception("This pool belongs to a different user!") pool.kill() @jsonapi.method def pool_exists(id): """Check whether pool does exist""" try: AppliancePool.objects.get(id=id) return True except ObjectDoesNotExist: return False @jsonapi.authenticated_method def get_number_free_appliances(user, group): """Get number of available appliances to keep in the pool""" with transaction.atomic(): g = Group.objects.get(id=group) return { sg.user_group.name: sg.template_pool_size for sg in GroupShepherd.objects.filter(user_group__in=user.groups.all(), template_group=g)} @jsonapi.authenticated_method def set_number_free_appliances(user, group, n): """Set number of available appliances to keep in the pool""" if not user.is_staff: raise Exception("You don't have enough rights!") if n < 0: return False with transaction.atomic(): g = Group.objects.get(id=group) g.template_pool_size = n g.save() return True @jsonapi.method def available_cfme_versions(preconfigured=True): """Lists all versions that are available""" return Template.get_versions(preconfigured=preconfigured) @jsonapi.method def available_groups(): return map(lambda group: group.id, Group.objects.all()) @jsonapi.method def available_providers(): return map(lambda group: group.id, Provider.objects.all()) @jsonapi.authenticated_method def add_provider(user, provider_key): if not user.is_staff: raise Exception("You don't have enough rights!") try: provider_o = Provider.objects.get(id=provider_key) return False except ObjectDoesNotExist: provider_o = Provider(id=provider_key) provider_o.save() return True def get_appliance(appliance, user=None): """'Multimethod' that receives an object and tries to guess by what field the appliance should be retrieved. Then it retrieves the appliance""" if isinstance(appliance, int): appliance = Appliance.objects.get(id=appliance) elif re.match(r"^[0-9]+\.[0-9]+\.[0-9]+\.[0-9]+$", appliance) is not None: appliance = Appliance.objects.get(ip_address=appliance) else: appliance = Appliance.objects.get(name=appliance) if user is None: return appliance else: if appliance.owner is None: if not user.is_staff: raise Exception("Only staff can operate with nonowned appliances") elif appliance.owner != user: raise Exception("This appliance belongs to a different user!") return appliance @jsonapi.authenticated_method def appliance_data(user, appliance): """Returns data about the appliance serialized as JSON. You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) return appliance.serialized @jsonapi.authenticated_method def destroy_appliance(user, appliance): """Destroy the appliance. If the kill task was called, id is returned, otherwise None You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) try: return Appliance.kill(appliance).task_id except AttributeError: # None was returned return None @jsonapi.method def power_state(appliance): """Return appliance's current power state. You can specify appliance by IP address, id or name. """ return get_appliance(appliance).power_state @jsonapi.authenticated_method def power_on(user, appliance, wait_ready=True): """Power on the appliance. If task is called, an id is returned, otherwise None. You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) if appliance.power_state != Appliance.Power.ON: tasks = [appliance_power_on.si(appliance.id)] if wait_ready: tasks.append(wait_appliance_ready.si(appliance.id)) else: tasks.append(mark_appliance_ready.si(appliance.id)) return chain(*tasks)().task_id @jsonapi.authenticated_method def power_off(user, appliance): """Power off the appliance. If task is called, an id is returned, otherwise None. You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) if appliance.power_state != Appliance.Power.OFF: return appliance_power_off.delay(appliance.id).task_id @jsonapi.authenticated_method def suspend(user, appliance): """Suspend the appliance. If task is called, an id is returned, otherwise None. You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) if appliance.power_state == Appliance.Power.OFF: return False elif appliance.power_state != Appliance.Power.SUSPENDED: return appliance_suspend.delay(appliance.id).task_id @jsonapi.authenticated_method def set_pool_description(user, pool_id, description): """Set the pool's description""" pool = AppliancePool.objects.get(id=pool_id) if pool.owner is None: if not user.is_staff: raise Exception("Only staff can operate with nonowned appliances") elif pool.owner != user: raise Exception("This appliance belongs to a different user!") pool.description = description pool.save() return True @jsonapi.authenticated_method def get_pool_description(user, pool_id): """Get the pool's description""" pool = AppliancePool.objects.get(id=pool_id) if pool.owner is None: if not user.is_staff: raise Exception("Only staff can operate with nonowned appliances") elif pool.owner != user: raise Exception("This appliance belongs to a different user!") return pool.description @jsonapi.authenticated_method def find_pools_by_description(user, description, partial=False): """Searches pools to find a pool with matching descriptions. When partial, `in` is used""" pools = [] for pool in AppliancePool.objects.all(): if not pool.description: continue if partial: if description in pool.description: pools.append(pool) else: if pool.description == description: pools.append(pool) def _filter(pool): return (pool.owner is None and user.is_staff) or (pool.owner == user) return map(lambda pool: pool.id, filter(_filter, pools)) @jsonapi.authenticated_method def rename_appliance(user, appliance, new_name): """Rename the appliance. Returns task id. You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) return appliance_rename.delay(appliance.id, new_name).task_id @jsonapi.method def task_finished(task_id): """Returns whether specified task has already finished""" result = AsyncResult(task_id) return result.ready() @jsonapi.method def task_result(task_id): """Returns result of the task. Returns None if no result yet""" result = AsyncResult(task_id) if not result.ready(): return None return result.get(timeout=1) @jsonapi.authenticated_method def appliance_provider_type(user, appliance): """Return appliance's provider class. Corresponds to the mgmtsystem class names. You can specify appliance by IP address, id or name. """ api_class = type(get_appliance(appliance, user).provider_api) return api_class.__name__ @jsonapi.authenticated_method def appliance_provider_key(user, appliance): """Return appliance's provider key. You can specify appliance by IP address, id or name. """ return get_appliance(appliance, user).provider.id @jsonapi.authenticated_method def appliance_connect_direct_lun(user, appliance): """Connects direct LUN disk to the appliance (RHEV only). You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) return connect_direct_lun(appliance.id).task_id @jsonapi.authenticated_method def appliance_disconnect_direct_lun(user, appliance): """Disconnects direct LUN disk from the appliance (RHEV only). You can specify appliance by IP address, id or name. """ appliance = get_appliance(appliance, user) return disconnect_direct_lun(appliance.id).task_id
gpl-2.0
-574,617,057,527,283,840
31.333935
100
0.639089
false
abramconnelly/genevieve
file_process/tasks.py
1
5314
"""Tasks for analyzing genome/genetic data files""" # absolute_import prevents conflicts between project celery.py file # and the celery package. from __future__ import absolute_import import bz2 import csv import gzip import os from random import randint from celery import shared_task from django.conf import settings from django.core.files import File from genomes.models import GenomeAnalysis, GenomeAnalysisVariant from variants.models import Variant, ClinVarRecord from .utils import vcf_parsing_tools as vcftools from .utils.twentythree_and_me import (api23andme_full_gen_data, api23andme_full_gen_infer_sex, api23andme_to_vcf) from .utils.cgivar_to_vcf import convert as convert_cgivar_to_vcf CLINVAR_FILENAME = "clinvar-latest.vcf" @shared_task def analyze_23andme_from_api(access_token, profile_id, user): genome_data = api23andme_full_gen_data(access_token, profile_id) sex = api23andme_full_gen_infer_sex(genome_data) vcf_data = api23andme_to_vcf(genome_data, sex) targetdir = '/tmp' filename = '23andme-api-' + profile_id + '.vcf.gz' if os.path.exists(os.path.join(targetdir, filename)): inc = 2 while os.path.exists(os.path.join(targetdir, filename)): filename = '23andme-api-' + profile_id + '-' + str(inc) + '.vcf.gz' inc += 1 filepath = os.path.join(targetdir, filename) output_file = gzip.open(filepath, mode='wb') output_file.writelines(vcf_data) # Close to ensure it's *really* closed before using File. output_file.close() # Reopen as binary so we don't lose compression. vcf_file = open(filepath) django_file = File(vcf_file) new_analysis = GenomeAnalysis(uploadfile=django_file, user=user, name=filename) new_analysis.save() vcf_file.close() os.remove(filepath) read_input_genome(analysis_in=new_analysis, genome_format='vcf') @shared_task def read_input_genome(analysis_in, genome_format='vcf'): """Read genome, VCF or Complete Genomics, and match against ClinVar""" name = os.path.basename(analysis_in.uploadfile.path) print genome_format if genome_format == 'cgivar': print "Treating as CGI var to be translated" genome_file = convert_cgivar_to_vcf( analysis_in.uploadfile.path, os.path.join(settings.DATA_FILE_ROOT, 'hg19.2bit')) elif name.endswith('.gz'): print "reading directly as gzip" genome_file = gzip.open(analysis_in.uploadfile.path, 'rb') elif name.endswith('.bz2'): print 'reading directly as bz2' genome_file = bz2.BZ2File(analysis_in.uploadfile.path, 'rb') # GzipFile(mode='rb', compresslevel=9, # fileobj=analysis_in.uploadfile) read_vcf(analysis_in, genome_file) @shared_task def read_vcf(analysis_in, genome_file): """Takes two .vcf files and returns matches""" clinvar_filepath = os.path.join(settings.DATA_FILE_ROOT, CLINVAR_FILENAME) clin_file = open(clinvar_filepath, 'r') # Creates a tmp file to write the .csv tmp_output_file_path = os.path.join( '/tmp', 'django_celery_fileprocess-' + str(randint(10000000, 99999999)) + '-' + os.path.basename(analysis_in.uploadfile.path)) tmp_output_file = open(tmp_output_file_path, 'w') csv_out = csv.writer(tmp_output_file) header = ("Chromosome", "Position", "Name", "Significance", "Frequency", "Zygosity", "ACC URL") csv_out.writerow(header) matched_variants = vcftools.match_to_clinvar(genome_file, clin_file) for var in matched_variants: print var chrom = var[0] pos = var[1] ref_allele = var[2] alt_allele = var[3] name_acc = var[4] freq = var[5] zygosity = var[6] variant, _ = Variant.objects.get_or_create(chrom=chrom, pos=pos, ref_allele=ref_allele, alt_allele=alt_allele) if not variant.freq: variant.freq = freq variant.save() genomeanalysisvariant = GenomeAnalysisVariant.objects.create( genomeanalysis=analysis_in, variant=variant, zyg=zygosity) genomeanalysisvariant.save() for spec in name_acc: # for online report url = "http://www.ncbi.nlm.nih.gov/clinvar/" + str(spec[0]) name = spec[1] clnsig = spec[2] record, _ = ClinVarRecord.objects.get_or_create( accnum=spec[0], variant=variant, condition=name, clnsig=clnsig) record.save() # analysis_in.variants.add(variant) # for CSV output data = (chrom, pos, name, clnsig, freq, zygosity, url) csv_out.writerow(data) # closes the tmp file tmp_output_file.close() # opens the tmp file and creates an output processed file" csv_filename = os.path.basename(analysis_in.uploadfile.path) + '.csv' with open(tmp_output_file_path, 'rb') as file_out: output_file = File(file_out) analysis_in.processedfile.save(csv_filename, output_file)
mit
4,513,550,672,840,500,000
37.230216
79
0.621754
false
centricular/meson
tools/cmake2meson.py
1
10941
#!/usr/bin/env python3 # Copyright 2014 Jussi Pakkanen # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import sys, os import re class Token: def __init__(self, tid, value): self.tid = tid self.value = value self.lineno = 0 self.colno = 0 class Statement(): def __init__(self, name, args): self.name = name self.args = args class Lexer: def __init__(self): self.token_specification = [ # Need to be sorted longest to shortest. ('ignore', re.compile(r'[ \t]')), ('string', re.compile(r'"([^\\]|(\\.))*?"', re.M)), ('varexp', re.compile(r'\${[-_0-9a-z/A-Z.]+}')), ('id', re.compile('''[,-><${}=+_0-9a-z/A-Z|@.*]+''')), ('eol', re.compile(r'\n')), ('comment', re.compile(r'\#.*')), ('lparen', re.compile(r'\(')), ('rparen', re.compile(r'\)')), ] def lex(self, code): lineno = 1 line_start = 0 loc = 0; col = 0 while(loc < len(code)): matched = False for (tid, reg) in self.token_specification: mo = reg.match(code, loc) if mo: col = mo.start()-line_start matched = True loc = mo.end() match_text = mo.group() if tid == 'ignore': continue if tid == 'comment': yield(Token('comment', match_text)) elif tid == 'lparen': yield(Token('lparen', '(')) elif tid == 'rparen': yield(Token('rparen', ')')) elif tid == 'string': yield(Token('string', match_text[1:-1])) elif tid == 'id': yield(Token('id', match_text)) elif tid == 'eol': #yield('eol') lineno += 1 col = 1 line_start = mo.end() pass elif tid == 'varexp': yield(Token('varexp', match_text[2:-1])) else: raise RuntimeError('Wharrgarbl') break if not matched: raise RuntimeError('Lexer got confused line %d column %d' % (lineno, col)) class Parser(): def __init__(self, code): self.stream = Lexer().lex(code) self.getsym() def getsym(self): try: self.current = next(self.stream) except StopIteration: self.current = Token('eof', '') def accept(self, s): if self.current.tid == s: self.getsym() return True return False def expect(self, s): if self.accept(s): return True raise RuntimeError('Expecting %s got %s.' % (s, self.current.tid), self.current.lineno, self.current.colno) def statement(self): cur = self.current if self.accept('comment'): return Statement('_', [cur.value]) self.accept('id') self.expect('lparen') args = self.arguments() self.expect('rparen') return Statement(cur.value, args) def arguments(self): args = [] if self.accept('lparen'): args.append(self.arguments()) self.expect('rparen') arg = self.current if self.accept('string') or self.accept('varexp') or\ self.accept('id'): args.append(arg) rest = self.arguments() args += rest return args def parse(self): while not self.accept('eof'): yield(self.statement()) class Converter: ignored_funcs = {'cmake_minimum_required' : True, 'enable_testing' : True, 'include' : True} def __init__(self, cmake_root): self.cmake_root = cmake_root self.indent_unit = ' ' self.indent_level = 0 self.options = [] def convert_args(self, args, as_array=True): res = [] if as_array: start = '[' end = ']' else: start = '' end = '' for i in args: if i.tid == 'id': res.append("'%s'" % i.value) elif i.tid == 'varexp': res.append('%s' % i.value) elif i.tid == 'string': res.append("'%s'" % i.value) else: print(i) raise RuntimeError('Unknown arg type.') if len(res) > 1: return start + ', '.join(res) + end if len(res) == 1: return res[0] return '' def write_entry(self, outfile, t): if t.name in Converter.ignored_funcs: return preincrement = 0 postincrement = 0 if t.name == '_': line = t.args[0] elif t.name == 'add_subdirectory': line = "subdir('" + t.args[0].value + "')" elif t.name == 'pkg_search_module' or t.name == 'pkg_search_modules': varname = t.args[0].value.lower() mods = ["dependency('%s')" % i.value for i in t.args[1:]] if len(mods) == 1: line = '%s = %s' % (varname, mods[0]) else: line = '%s = [%s]' % (varname, ', '.join(["'%s'" % i for i in mods])) elif t.name == 'find_package': line = "%s_dep = dependency('%s')" % (t.args[0].value, t.args[0].value) elif t.name == 'find_library': line = "%s = find_library('%s')" % (t.args[0].value.lower(), t.args[0].value) elif t.name == 'add_executable': line = '%s_exe = executable(%s)' % (t.args[0].value, self.convert_args(t.args, False)) elif t.name == 'add_library': if t.args[1].value == 'SHARED': libcmd = 'shared_library' args = [t.args[0]] + t.args[2:] elif t.args[1].value == 'STATIC': libcmd = 'static_library' args = [t.args[0]] + t.args[2:] else: libcmd = 'static_library' args = t.args line = '%s_lib = %s(%s)' % (t.args[0].value, libcmd, self.convert_args(args, False)) elif t.name == 'add_test': line = 'test(%s)' % self.convert_args(t.args, False) elif t.name == 'option': optname = t.args[0].value description = t.args[1].value if len(t.args) > 2: default = t.args[2].value else: default = None self.options.append((optname, description, default)) return elif t.name == 'project': pname = t.args[0].value args = [pname] for l in t.args[1:]: l = l.value.lower() if l == 'cxx': l = 'cpp' args.append(l) args = ["'%s'" % i for i in args] line = 'project(' + ', '.join(args) + ')' elif t.name == 'set': varname = t.args[0].value.lower() line = '%s = %s\n' % (varname, self.convert_args(t.args[1:])) elif t.name == 'if': postincrement = 1 line = 'if %s' % self.convert_args(t.args, False) elif t.name == 'elseif': preincrement = -1 postincrement = 1 line = 'elif %s' % self.convert_args(t.args, False) elif t.name == 'else': preincrement = -1 postincrement = 1 line = 'else' elif t.name == 'endif': preincrement = -1 line = 'endif' else: line = '''# %s(%s)''' % (t.name, self.convert_args(t.args)) self.indent_level += preincrement indent = self.indent_level*self.indent_unit outfile.write(indent) outfile.write(line) if not(line.endswith('\n')): outfile.write('\n') self.indent_level += postincrement def convert(self, subdir=''): if subdir == '': subdir = self.cmake_root cfile = os.path.join(subdir, 'CMakeLists.txt') try: with open(cfile) as f: cmakecode = f.read() except FileNotFoundError: print('\nWarning: No CMakeLists.txt in', subdir, '\n') return p = Parser(cmakecode) with open(os.path.join(subdir, 'meson.build'), 'w') as outfile: for t in p.parse(): if t.name == 'add_subdirectory': # print('\nRecursing to subdir', # os.path.join(self.cmake_root, t.args[0].value), # '\n') self.convert(os.path.join(subdir, t.args[0].value)) # print('\nReturning to', self.cmake_root, '\n') self.write_entry(outfile, t) if subdir == self.cmake_root and len(self.options) > 0: self.write_options() def write_options(self): filename = os.path.join(self.cmake_root, 'meson_options.txt') with open(filename, 'w') as optfile: for o in self.options: (optname, description, default) = o if default is None: defaultstr = '' else: if default == 'OFF': typestr = ' type : \'boolean\',' default = 'false' elif default == 'ON': default = 'true' typestr = ' type : \'boolean\',' else: typestr = ' type : \'string\',' defaultstr = ' value : %s,' % default line = "option(%r,%s%s description : '%s')\n" % (optname, typestr, defaultstr, description) optfile.write(line) if __name__ == '__main__': if len(sys.argv) != 2: print(sys.argv[0], '<CMake project root>') sys.exit(1) c = Converter(sys.argv[1]) c.convert()
apache-2.0
8,318,193,074,904,967,000
35.348837
115
0.452792
false
adyliu/mysql-connector-python
python2/tests/test_examples.py
1
6610
# -*- coding: utf-8 -*- # MySQL Connector/Python - MySQL driver written in Python. # Copyright (c) 2009, 2013, Oracle and/or its affiliates. All rights reserved. # MySQL Connector/Python is licensed under the terms of the GPLv2 # <http://www.gnu.org/licenses/old-licenses/gpl-2.0.html>, like most # MySQL Connectors. There are special exceptions to the terms and # conditions of the GPLv2 as it is applied to this software, see the # FOSS License Exception # <http://www.mysql.com/about/legal/licensing/foss-exception.html>. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA """Unittests for examples """ import sys import logging import mysql.connector import tests logger = logging.getLogger(tests.LOGGER_NAME) class TestExamples(tests.MySQLConnectorTests): def setUp(self): config = self.getMySQLConfig() self.cnx = mysql.connector.connect(**config) def tearDown(self): self.cnx.close() def _exec_main(self, example): try: return example.main(self.getMySQLConfig()) except StandardError as e: self.fail(e) def test_dates(self): """examples/dates.py""" try: import examples.dates as example except StandardError as e: self.fail(e) output = example.main(self.getMySQLConfig()) exp = [' 1 | 1977-06-14 | 1977-06-14 21:10:00 | 21:10:00 |', ' 2 | None | None | 0:00:00 |', ' 3 | None | None | 0:00:00 |'] self.assertEqual(output, exp) example.DATA.append(('0000-00-00',None,'00:00:00'),) self.assertRaises(mysql.connector.errors.IntegrityError, example.main, self.getMySQLConfig()) def test_engines(self): """examples/engines.py""" try: import examples.engines as example except: self.fail() output = self._exec_main(example) # Can't check output as it might be different per MySQL instance # We check only if MyISAM is present found = False for s in output: if s.find('MyISAM') > -1: found = True break self.assertTrue(found,'MyISAM engine not found in output') def test_inserts(self): """examples/inserts.py""" try: import examples.inserts as example except StandardError as e: self.fail(e) output = self._exec_main(example) exp = [u'1 | Geert | 30\nInfo: c..\n', u'2 | Jan | 30\nInfo: c..\n', u'3 | Michel | 30\nInfo: c..\n'] self.assertEqual(output,exp,'Output was not correct') def test_transactions(self): """examples/transactions.py""" db = mysql.connector.connect(**self.getMySQLConfig()) r = self.haveEngine(db,'InnoDB') db.close() if not r: return try: import examples.transaction as example except StandardError as e: self.fail(e) output = self._exec_main(example) exp = ['Inserting data', 'Rolling back transaction', 'No data, all is fine.', 'Data before commit:', u'4 | Geert', u'5 | Jan', u'6 | Michel', 'Data after commit:', u'4 | Geert', u'5 | Jan', u'6 | Michel'] self.assertEqual(output,exp,'Output was not correct') def test_unicode(self): """examples/unicode.py""" try: import examples.unicode as example except StandardError as e: self.fail(e) output = self._exec_main(example) exp = ['Unicode string: \xc2\xbfHabla espa\xc3\xb1ol?', 'Unicode string coming from db: \xc2\xbfHabla espa\xc3\xb1ol?'] self.assertEqual(output,exp,'Output was not correct') def test_warnings(self): """examples/warnings.py""" try: import examples.warnings as example except StandardError as e: self.fail(e) output = self._exec_main(example) exp = ["Executing 'SELECT 'abc'+1'", u"1292: Truncated incorrect DOUBLE value: 'abc'"] self.assertEqual(output,exp,'Output was not correct') example.STMT = "SELECT 'abc'" self.assertRaises(StandardError, example.main, self.getMySQLConfig()) def test_multi_resultsets(self): """examples/multi_resultsets.py""" try: import examples.multi_resultsets as example except StandardError as e: self.fail(e) output = self._exec_main(example) exp = ['Inserted 1 row', 'Number of rows: 1', 'Inserted 2 rows', u'Names in table: Geert Jan Michel'] self.assertEqual(output,exp,'Output was not correct') def test_microseconds(self): """examples/microseconds.py""" try: import examples.microseconds as example except StandardError as e: self.fail(e) output = self._exec_main(example) if self.cnx.get_server_version() < (5,6,4): exp = "does not support fractional precision for timestamps." self.assertTrue(output[0].endswith(exp)) else: exp = [ ' 1 | 1 | 0:00:47.510000', ' 1 | 2 | 0:00:47.020000', ' 1 | 3 | 0:00:47.650000', ' 1 | 4 | 0:00:46.060000', ] self.assertEqual(output, exp, 'Output was not correct') def test_prepared_statements(self): """examples/prepared_statements.py""" try: import examples.prepared_statements as example except StandardError as e: self.fail(e) output = self._exec_main(example) exp = [ 'Inserted data', '1 | Geert', '2 | Jan', '3 | Michel', ] self.assertEqual(output, exp, 'Output was not correct')
gpl-2.0
-8,095,006,123,662,199,000
34.72973
78
0.579879
false
clearcare/cc_dynamodb
tests/conftest.py
1
1033
from decimal import Decimal import os.path import pytest AWS_DYNAMODB_CONFIG_PATH = os.path.join(os.path.dirname(__file__), 'dynamodb.yml') @pytest.fixture def fake_config(): import cc_dynamodb cc_dynamodb.set_config( table_config=AWS_DYNAMODB_CONFIG_PATH, aws_access_key_id='<KEY>', aws_secret_access_key='<SECRET>', namespace='dev_') DYNAMODB_FIXTURES = { 'nps_survey': [ { 'agency_id': Decimal('1669'), 'change': "I can't think of any...", 'comments': 'No comment', 'created': '2014-12-19T22:10:42.705243+00:00', 'favorite': 'I like all of ClearCare!', 'profile_id': Decimal('2616346'), 'recommend_score': '9' }, { 'agency_id': Decimal('1669'), 'change': 'Most of the features, please', 'created': '2014-12-19T22:10:42.705243+00:00', 'profile_id': Decimal('2616347'), 'recommend_score': '3' }, ], }
mit
1,849,978,970,764,546,300
25.487179
82
0.53243
false
felixbb/forseti-security
google/cloud/security/scanner/audit/buckets_rules_engine.py
1
8802
# Copyright 2017 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Rules engine for Bucket acls""" from collections import namedtuple import itertools import re # pylint: disable=line-too-long from google.cloud.security.common.gcp_type import bucket_access_controls as bkt_acls # pylint: enable=line-too-long from google.cloud.security.common.util import log_util from google.cloud.security.scanner.audit import base_rules_engine as bre from google.cloud.security.scanner.audit import errors as audit_errors LOGGER = log_util.get_logger(__name__) # TODO: move this to utils since it's used in more that one engine def escape_and_globify(pattern_string): """Given a pattern string with a glob, create actual regex pattern. To require > 0 length glob, change the "*" to ".+". This is to handle strings like "*@company.com". (THe actual regex would probably be ".*@company.com", except that we don't want to match zero-length usernames before the "@".) Args: pattern_string: The pattern string of which to make a regex. Returns: The pattern string, escaped except for the "*", which is transformed into ".+" (match on one or more characters). """ return '^{}$'.format(re.escape(pattern_string).replace('\\*', '.+')) class BucketsRulesEngine(bre.BaseRulesEngine): """Rules engine for bucket acls""" def __init__(self, rules_file_path): """Initialize. Args: rules_file_path: file location of rules """ super(BucketsRulesEngine, self).__init__(rules_file_path=rules_file_path) self.rule_book = None def build_rule_book(self): """Build BucketsRuleBook from the rules definition file.""" self.rule_book = BucketsRuleBook(self._load_rule_definitions()) # pylint: disable=arguments-differ def find_policy_violations(self, buckets_acls, force_rebuild=False): """Determine whether bucket acls violates rules.""" violations = itertools.chain() if self.rule_book is None or force_rebuild: self.build_rule_book() resource_rules = self.rule_book.get_resource_rules() for rule in resource_rules: violations = itertools.chain(violations, rule.\ find_policy_violations(buckets_acls)) return violations def add_rules(self, rules): """Add rules to the rule book.""" if self.rule_book is not None: self.rule_book.add_rules(rules) class BucketsRuleBook(bre.BaseRuleBook): """The RuleBook for bucket acls resources.""" def __init__(self, rule_defs=None): """Initialization. Args: rule_defs: rule definitons """ super(BucketsRuleBook, self).__init__() self.resource_rules_map = {} if not rule_defs: self.rule_defs = {} else: self.rule_defs = rule_defs self.add_rules(rule_defs) def add_rules(self, rule_defs): """Add rules to the rule book""" for (i, rule) in enumerate(rule_defs.get('rules', [])): self.add_rule(rule, i) def add_rule(self, rule_def, rule_index): """Add a rule to the rule book. Args: rule_def: A dictionary containing rule definition properties. rule_index: The index of the rule from the rule definitions. Assigned automatically when the rule book is built. Raises: """ resources = rule_def.get('resource') for resource in resources: resource_ids = resource.get('resource_ids') if not resource_ids or len(resource_ids) < 1: raise audit_errors.InvalidRulesSchemaError( 'Missing resource ids in rule {}'.format(rule_index)) bucket = rule_def.get('bucket') entity = rule_def.get('entity') email = rule_def.get('email') domain = rule_def.get('domain') role = rule_def.get('role') if (bucket is None) or (entity is None) or (email is None) or\ (domain is None) or (role is None): raise audit_errors.InvalidRulesSchemaError( 'Faulty rule {}'.format(rule_def.get('name'))) rule_def_resource = bkt_acls.BucketAccessControls( escape_and_globify(bucket), escape_and_globify(entity), escape_and_globify(email), escape_and_globify(domain), escape_and_globify(role.upper())) rule = Rule(rule_name=rule_def.get('name'), rule_index=rule_index, rules=rule_def_resource) resource_rules = self.resource_rules_map.get(rule_index) if not resource_rules: self.resource_rules_map[rule_index] = rule def get_resource_rules(self): """Get all the resource rules for (resource, RuleAppliesTo.*). Args: resource: The resource to find in the ResourceRules map. Returns: A list of ResourceRules. """ resource_rules = [] for resource_rule in self.resource_rules_map: resource_rules.append(self.resource_rules_map[resource_rule]) return resource_rules class Rule(object): """Rule properties from the rule definition file. Also finds violations. """ def __init__(self, rule_name, rule_index, rules): """Initialize. Args: rule_name: Name of the loaded rule rule_index: The index of the rule from the rule definitions rules: The rules from the file """ self.rule_name = rule_name self.rule_index = rule_index self.rules = rules def find_policy_violations(self, bucket_acl): """Find bucket policy acl violations in the rule book. Args: bucket_acl: Bucket ACL resource Returns: Returns RuleViolation named tuple """ if self.rules.bucket != '^.+$': bucket_bool = re.match(self.rules.bucket, bucket_acl.bucket) else: bucket_bool = True if self.rules.entity != '^.+$': entity_bool = re.match(self.rules.entity, bucket_acl.entity) else: entity_bool = True if self.rules.email != '^.+$': email_bool = re.match(self.rules.email, bucket_acl.email) else: email_bool = True if self.rules.domain != '^.+$': domain_bool = re.match(self.rules.domain, bucket_acl.domain) else: domain_bool = True if self.rules.role != '^.+$': role_bool = re.match(self.rules.role, bucket_acl.role) else: role_bool = True should_raise_violation = ( (bucket_bool is not None and bucket_bool) and (entity_bool is not None and entity_bool) and (email_bool is not None and email_bool) and (domain_bool is not None and domain_bool) and (role_bool is not None and role_bool)) if should_raise_violation: yield self.RuleViolation( resource_type='project', resource_id=bucket_acl.project_number, rule_name=self.rule_name, rule_index=self.rule_index, violation_type='BUCKET_VIOLATION', role=bucket_acl.role, entity=bucket_acl.entity, email=bucket_acl.email, domain=bucket_acl.domain, bucket=bucket_acl.bucket) # Rule violation. # resource_type: string # resource_id: string # rule_name: string # rule_index: int # violation_type: BUCKET_VIOLATION # role: string # entity: string # email: string # domain: string # bucket: string RuleViolation = namedtuple('RuleViolation', ['resource_type', 'resource_id', 'rule_name', 'rule_index', 'violation_type', 'role', 'entity', 'email', 'domain', 'bucket'])
apache-2.0
-2,150,819,857,089,099,300
33.249027
84
0.586571
false
cyncyncyn/evette
languagefiles/language_irish_1.3.2.py
1
68626
#!/usr/bin/python # -*- coding: UTF-8 -*- #Copyright (C) 2007 Adam Spencer - Free Veterinary Management Suite #This program is free software; you can redistribute it and/or #modify it under the terms of the GNU General Public License #as published by the Free Software Foundation; either version 2 #of the License, or (at your option) any later version. #This program is distributed in the hope that it will be useful, #but WITHOUT ANY WARRANTY; without even the implied warranty of #MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the #GNU General Public License for more details. #You should have received a copy of the GNU General Public License #along with this program; if not, write to the Free Software #Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. ##Contact: [email protected] ####Irish#### def GetDictionary(): dictionary = {} ##Misc dictionary["usernamelabel"] = ( "Username", "Username" ) dictionary["passwordlabel"] = ( "Password", "Password" ) dictionary["submitlabel"] = ( "Submit", "Submit" ) dictionary["totallabel"] = ( "Total", "Total" ) dictionary["fromlabel"] = ( "From", "From" ) dictionary["tolabel"] = ( "To", "To" ) dictionary["pricelabel"] = ( "Price", "Price" ) dictionary["descriptionlabel"] = ( "Description", "Decsription" ) dictionary["yeslabel"] = ( "Yes", "Yes" ) dictionary["nolabel"] = ( "No", "No" ) dictionary["editlabel"] = ( "Edit", "Edit" ) dictionary["deletelabel"] = ( "Delete", "Delete" ) dictionary["searchlabel"] = ( "Search", "Search" ) dictionary["resetlabel"] = ( "Reset", "Reset" ) dictionary["movelabel"] = ( "Move", "Move" ) dictionary["unitlabel"] = ( "Unit", "Unit" ) dictionary["onlabel"] = ( "on", "on" ) dictionary["namelabel"] = ( "Name", "Name" ) dictionary["headertext1"] = ( "The complete FREE veterinary practice management package", "The complete open-source veterinary practice management package" ) dictionary["headertext2"] = ( "You can change this header to anything you like by editing", "You can change this header to anything you like by editing" ) dictionary["generatedbylabel"] = ( "Generated by", "Generated by" ) dictionary["timelabel"] = ( "Time", "Time" ) dictionary["operationslabel"] = ( "Operations", "Operations" ) dictionary["operatinglabel"] = ( "Operating", "Operating" ) dictionary["consultinglabel"] = ( "Consulting", "Consulting" ) dictionary["vetlabel"] = ( "Vet", "Vet" ) dictionary["animaldetailslabel"] = ( "Animal Details", "Animal Details" ) dictionary["ownerdetailslabel"] = ( "Owner Details", "Owner Details" ) dictionary["receiptlabel"] = ( "Receipt", "Receipt" ) dictionary["problemlabel"] = ( "Problem", "Problem" ) dictionary["noteslabel"] = ( "Notes", "Notes" ) dictionary["planlabel"] = ( "Plan", "Plan" ) dictionary["userdeleted"] = ( "User deleted", "User Deleted" ) dictionary["changelog"] = ( "Change Log", "Change Log" ) dictionary["positionlabel"] = ( "Position", "Position" ) dictionary["datelabel"] = ( "Date", "Date" ) dictionary["invalidtimemessage"] = ( "Invalid Time", "Invalid Time" ) dictionary["containslabel"] = ( "Contains", "Contains" ) dictionary["nextduelabel"] = ( "Next Due", "Next Due" ) dictionary["nonelabel"] = ( "None", "None" ) ##Menus dictionary["clientmenu"] = ( "&Clients", "&Clients" ) dictionary["appointmentsmenu"] = ( "&Appointments", "&Appointments" ) dictionary["medicationmenu"] = ( "&Medication", "&Medication" ) dictionary["proceduresmenu"] = ( "&Procedures", "&Procedures" ) dictionary["lookupsmenu"] = ( "&Lookups", "&Lookups" ) dictionary["formsmenu"] = ( "&Forms", "&Forms" ) dictionary["staffmenu"] = ( "&Staff", "&Staff" ) dictionary["settingsmenu"] = ( "Se&ttings", "Se&ttings" ) dictionary["helpmenu"] = ( "&Help", "&Help" ) dictionary["entirelabel"] = ( "Entire", "Entire" ) dictionary["neuteredlabel"] = ( "Neutered", "Neutered" ) ##Menu items dictionary["addclientmenu"] = ( ("Add Client", "Create a new client record"), ("Add Client", "Create a new client record") ) dictionary["findclientmenu"] = ( ("Find Clients", "Find client and animal records"), ("Find Clients", "Find client and animal records") ) dictionary["viewappointmentsmenu"] = ( ("Todays Appointments", "View todays appointments"), ("Todays Appointments", "View todays appointments") ) dictionary["viewoperationsmenu"] = ( ("Todays Operations", "View todays operations"), ("Todays Operations", "View todays operations") ) dictionary["editusersmenu"] = ( ("Edit Users", "Add and edit Evette users"), ("Edit Users", "Add and edit Evette users") ) dictionary["editrotamenu"] = ( ("Edit Rota", "Edit the rota"), ("Edit Rota", "Edit the rota") ) dictionary["editmedicationmenu"] = ( ("Edit Medication", "Edit Medication"), ("Edit Medication", "Edit Medication") ) dictionary["editvaccinationsmenu"] = ( ("Edit Vaccinations", "Edit Vaccinations"), ("Edit Vaccinations", "Edit Vaccinations") ) dictionary["editproceduresmenu"] = ( ("Edit Procedures", "Edit Procedures"), ("Edit Procedures", "Edit Procedures") ) dictionary["editcoloursmenu"] = ( ("Edit Colours", "Edit Colours"), ("Edit Colours", "Edit Colours") ) dictionary["editbreedsmenu"] = ( ("Edit Breeds", "Edit Breeds"), ("Edit Breeds", "Edit Breeds") ) dictionary["editspeciesmenu"] = ( ("Edit Species", "Edit Species"), ("Edit Species", "Edit Species") ) dictionary["editformsmenu"] = ( ("Edit Forms", "Edit Forms"), ("Edit Forms", "Edit Forms") ) dictionary["editsettingsmenu"] = ( ("Edit Settings", "Edit settings unique to this practice"), ("Edit Settings", "Edit settings unique to this practice") ) dictionary["randomdatamenu"] = ( ("Random Data", "Generate random sample data to experiment with"), ("Random Data", "Generate random sample data to experiment with") ) dictionary["resettablesmenu"] = ( ("Reset Database", "Completely reset the evette database"), ("Reset Database", "Completely reset the Evette database. Be careful!") ) dictionary["gethelpmenu"] = ( ("Help", "Get help on using Evette"), ("Help", "Get help on using Evette") ) dictionary["aboutmenu"] = ( ("About", "Information about this program"), ("About", "Information about Evette") ) ##Toolbar dictionary["addclienttoolbar"] = ( (" Add Client ", "Create a new client record"), (" Add Client ", "Create a new client record") ) dictionary["findclienttoolbar"] = ( (" Client Search ", "Find clients and animals"), (" Client Search ", "Find clients and their animals") ) dictionary["viewappointmentstoolbar"] = ( (" Todays Appointments ", "View todays appointments"), (" Todays Appointments ", "View todays appointments") ) dictionary["viewoperationstoolbar"] = ( (" Todays Operations ", "View todays operations"), (" Todays Operations ", "View todays operations") ) ##Client Panel dictionary["newclientpagetitle"] = ( "New Client", "New Client" ) dictionary["clienttitlelabel"] = ( "Title", "Title" ) dictionary["clientforenameslabel"] = ( "First Name", "First Names" ) dictionary["clientsurnamelabel"] = ( "Last Name", "Last Name" ) dictionary["clientaddresslabel"] = ( "Address", "Address" ) dictionary["clientpostcodelabel"] = ( "Post Code", "Post Code" ) dictionary["clienthomephonelabel"] = ( "Home Phone", "Home Phone" ) dictionary["clientmobilephonelabel"] = ( "Mobile Phone", "Mobile Phone" ) dictionary["clientworkphonelabel"] = ( "Work Phone", "Work Phone" ) dictionary["clientemailaddresslabel"] = ( "Email", "Email" ) dictionary["clientcommentslabel"] = ( "Comments", "Comments" ) dictionary["clientanimalslabel"] = ( "Animals", "Animals" ) dictionary["clientaddanimaltooltip"] = ( "Create a new animal", "Create a new animal" ) dictionary["clienteditanimaltooltip"] = ( "Edit the selected animal record", "Edit the selected animal record" ) dictionary["clientdeleteanimaltooltip"] = ( "Delete the selected animal record", "Delete the selected animal record" ) dictionary["clientrefreshanimalstooltip"] = ( "Refresh the list of animals", "Refresh the list of animals" ) dictionary["clientcreateappointmenttooltip"] = ( "Create an appointment for the selected animal", "Create an appointment for the selected animal" ) dictionary["clientbalancelabel"] = ( "Balance", "Balance" ) dictionary["clientdetailedbilllabel"] = ( "Detailed Bill", "Detailed Bill" ) dictionary["clientsavetooltip"] = ( "Save changes to client record", "Save changes to client record" ) dictionary["clientunsavedchangesmessage"] = ( "This client record has unsaved changes, are you sure you want to close?", "This client record has unsaved changes, are you sure you want to close?" ) dictionary["clientdeleteanimalmessage"] = ( "Really delete animal?", "Really delete animal?" ) dictionary["clientrefreshbilltooltip"] = ( "Refresh bill", "Refresh bill" ) dictionary["clientrecentbillitems"] = ( (" Recent Items", "Adjust the date range of the bill items displayed"), (" Recent Items", "Adjust the date range of the bill items displayed") ) dictionary["clientcleardetailedbillentriestooltip"] = ( "Unselect the current bill item and clear the price and description entries", "Unselect the current bill item and clear the price and description entries" ) dictionary["clientsubmitdetailedbillentriestooltip"] = ( "Submit changes to the selected bill item", "Submit changes to the selected bill item" ) dictionary["clientdeletedetailedbillentriestooltip"] = ( "Delete the selected bill item", "Delete the selected bill item" ) ##Animal Panel dictionary["newanimalpagetitle"] = ( "New Animal", "New Animal" ) dictionary["animalownerlabel"] = ( "Owner", "Owner" ) dictionary["animaleditownertooltip"] = ( "Edit this animals owner", "Edit this animals owner" ) dictionary["animalnamelabel"] = ( "Name", "Name" ) dictionary["animalsexlabel"] = ( "Sex", "Sex" ) dictionary["animalspecieslabel"] = ( "Species", "Species" ) dictionary["animalbreedlabel"] = ( "Breed", "Breed" ) dictionary["animalcolourlabel"] = ( "Colour", "Colour" ) dictionary["animaldoblabel"] = ( "DOB", "DOB" ) dictionary["animalchipnolabel"] = ( "Chip #", "Chip #" ) dictionary["animalcommentslabel"] = ( "Comments", "Comments" ) dictionary["animalneuteredtooltip"] = ( "Check if the animal is neutered", "Check if the animal is neutered" ) dictionary["animalprintentirerecordtooltip"] = ( "Generate printable output of this entire animal record", "Generate printable output of this entire animal record" ) dictionary["animalgenerateformtooltip"] = ( "Generate a form using this animals details", "Generate a form using this animals details" ) dictionary["animalappointmentslabel"] = ( "Appointments", "Appointments" ) dictionary["animalcreateappointmenttooltip"] = ( "Create an appointment for this animal", "Create an appointment for this animal" ) dictionary["animaleditappointmenttooltip"] = ( "Edit the selected appointment", "Edit the selected appointment" ) dictionary["animalrefreshappointmentstooltip"] = ( "Refresh the list of appointments", "Refresh the list of appointments" ) dictionary["animaldeleteappointmenttooltip"] = ( "Delete the selected appointment", "Delete the selected appointment" ) dictionary["animalprintappointmenttooltip"] = ( "Generate printable output for the selected appointment", "Generate printable output for the selected appointment" ) dictionary["animalvetformbutton"] = ( ("Vet Form", "Edit the vet form for the selected appointment"), ("Vet Form", "Edit the vet form for the selected appointment") ) dictionary["animalappointmentdetailslabel"] = ( "Appointment Details", "Appointment Details" ) dictionary["animalvaccinationslabel"] = ( "Vaccinations", "Vaccinations" ) dictionary["animalsavebuttontooltip"] = ( "Save any changes made to this animal record", "Save any changes made to this animal record" ) dictionary["animalunsavedchangesmessage"] = ( "This animal record has unsaved changes, are you sure you want to close?", "This animal record has unsaved changes, are you sure you want to close?" ) dictionary["animalconfirmdeleteappointmentmessage"] = ( "Really delete appointment?", "Really delete appointment?" ) dictionary["animalresetvaccinationentries"] = ( "Reset vaccination entries", "Reset vaccination entries" ) dictionary["animalvaccinelabel"] = ( " Vaccine: ", " Vaccine: " ) dictionary["animalgivenlabel"] = ( "Given: ", "Given: " ) dictionary["animalnextlabel"] = ( " Next: ", " Next: " ) dictionary["animaldeletevaccinationtooltip"] = ( "Delete the selected vaccination", "Delete the selected vaccination" ) dictionary["animalsubmitvaccinationtooltip"] = ( "Submit this vaccination", "Submit this vaccination" ) dictionary["animalconfirmdeletevaccinationmessage"] = ( "Are you sure that you want to delete this vaccination?", "Are you sure that you want to delete this vaccination?" ) dictionary["animalvaccinationbatchlabel"] = ( " Batch: ", " Batch: " ) ##Appointments dictionary["appointmentappointmentforlabel"] = ( "Appointment for", "Appointment for" ) dictionary["appointmentoperationforlabel"] = ( "Operation for", "Operation for" ) dictionary["appointmententervettooltip"] = ( "If this appointment is for a specific vet, enter the vet's name here", "If this appointment is for a specific vet, enter the vet's name here" ) dictionary["appointmentrefreshtooltip"] = ( "Refresh the list of appointments", "Refresh the list of appointments" ) dictionary["appointmentreasonlabel"] = ( "Reason For Appointment", "Reason For Appointment" ) dictionary["appointmenttimelabel"] = ( "Appointment time", "Appointment time" ) dictionary["appointmentisopcheckbox"] = ( ("Operation?", "Check this box if you would like to book an operation"), ("Operation?", "Check this box if you would like to book an operation") ) dictionary["appointmentsubmittooltip"] = ( "Submit this appointment", "Submit this appointment" ) dictionary["appointmentdeletetooltip"] = ( "Delete this appointment", "Delete this appointment" ) dictionary["appointmentstatuslabel"] = ( "Status", "Status" ) dictionary["appointmentnotarrivedlabel"] = ( "Not Arrived", "Not Arrived" ) dictionary["appointmentwaitinglabel"] = ( "Waiting", "Waiting" ) dictionary["appointmentwithvetlabel"] = ( "With Vet", "With Vet" ) dictionary["appointmentdonelabel"] = ( "Done", "Done" ) dictionary["appointmenteditownerbutton"] = ( ("Edit Owner", "Edit client record"), ("Edit Owner", "Edit client record") ) dictionary["appointmenteditanimalbutton"] = ( ("Edit Animal", "Edit animal record"), ("Edit Animal", "Edit animal record") ) dictionary["appointmentappointmentsforlabel"] = ( "Appointments for", "Appointments for" ) dictionary["appointmentoperationsforlabel"] = ( "Operations for", "Operations for" ) dictionary["appointmenttimetooearlymessage"] = ( "Appointment time is before the practice opens!", "Appointment time is before the practice opens!" ) dictionary["appointmenttimetoolatemessage"] = ( "Appointment time is after the practice closes!", "Appointment time is after the practice closes!" ) dictionary["appointmentinvalidtimemessage"] = ( "Invalid time - times must be HH:MM!", "Invalid time - times must be HH:MM!" ) ##Client search panel dictionary["clientsearchpagetitle"] = ( "Client Search", "Client Search" ) dictionary["clientsearchstitlelabel"] = ( "Clients", "Clients" ) dictionary["clientsearchsurnamelabel"] = ( "Last Name", "Last Name" ) dictionary["clientsearchphonelabel"] = ( "Phone", "Phone" ) dictionary["clientsearchaddresslabel"] = ( "Address", "Address" ) dictionary["clientsearchpostcodelabel"] = ( "Post Code", "Zip Code" ) dictionary["clientsearchemaillabel"] = ( "Email", "Email" ) dictionary["clientsearchclearbutton"] = ( ("Clear", "Clear all entries"), ("Clear", "Clear all entries") ) dictionary["clientsearchsearchbutton"] = ( ("Search", "Perform the search"), ("Search", "Perform the search") ) dictionary["clientsearcheditclienttooltip"] = ( "Edit the selected client record", "Edit the selected client record" ) dictionary["clientsearchdeleteclienttooltip"] = ( "Delete the selected client record", "Delete the selected client record" ) dictionary["clientsearchanimallabel"] = ( "Animals", "Animals" ) dictionary["clientsearchanimalnamelabel"] = ( "Name", "Name" ) dictionary["clientsearchanimalsexlabel"] = ( "Sex", "Sex" ) dictionary["clientsearchanimalspecieslabel"] = ( "Species", "Species" ) dictionary["clientsearchanimalbreedlabel"] = ( "Breed", "Breed" ) dictionary["clientsearchanimalchipnolabel"] = ( "Chip #", "Chip #" ) dictionary["clientsearchanimalcommentslabel"] = ( "Comments", "Comments" ) dictionary["clientsearcheditanimaltooltip"] = ( "Edit the selected animal record", "Edit the selected animal record" ) dictionary["clientsearchdeleteanimaltooltip"] = ( "Delete the selected animal record", "Delete the selected animal record" ) dictionary["clientreceiptchangeloglabel"] = ( "Receipt item - ", "Receipt item - " ) dictionary["clientreceiptdeletemessage"] = ( "Really delete this receipt entry?", "Really delete this receipt entry?" ) dictionary["clientclearpaymenttooltip"] = ( "Empty the payment entry", "Empty the payment entry" ) dictionary["clientpaymentlabel"] = ( "Payment", "Payment" ) dictionary["clientsubmitpaymenttooltip"] = ( "Submit Payment", "Submit Payment" ) dictionary["clientpaymentinreceiptlabel"] = ( "Payment", "Payment" ) ##Launch panels dictionary["launchcreateconffilemessage"] = ( "Conf file not found! Create one now?", "Configuration file not found! Create one now?" ) dictionary["launchevettefoldermessage"] = ( "Evette folder not found! Create it now?", "Evette folder not found! Create it now?" ) dictionary["launchnodatabaseservermessage"] = ( "Unable to connect to database server! Please check that it is installed and running. Would you like to adjust your local settings?", "Unable to connect to database server! Please check that it is installed and running. Would you like to adjust your local settings?" ) dictionary["launchnoevettedatabasemessage"] = ( "Unable to locate evette database! Would you like to create one now?", "Unable to locate Evette database! Would you like to create one now?" ) dictionary["launchconffilecreatedmessage"] = ( "Conf file created", "Configuration file created" ) dictionary["launchevettefoldercreatedmessage"] = ( "Evette folder created", "Evette folder created" ) dictionary["launchdbiplabel"] = ( "DB IP", "Database IP Address" ) dictionary["launchdbuserlabel"] = ( "DB User", "Database User" ) dictionary["launchdbpasslabel"] = ( "DB Pass", "Database Password" ) dictionary["launchunabletocreatedatabasemessage"] = ( "Unable to create database, please check your mysql server config!", "Unable to create database, please check your MySQL server configuration!" ) dictionary["launchdatabasecreatedmessage"] = ( "Database created successfully!", "Database created successfully!" ) dictionary["launchlogintooltip"] = ( "Log in", "Log in" ) ##Lookups dictionary["lookupscolourpagetitle"] = ( "Edit Colour Lookups", "Edit Colour Lookups" ) dictionary["lookupsspeciespagetitle"] = ( "Edit Species Lookups", "Edit Species Lookups" ) dictionary["lookupsbreedpagetitle"] = ( "Edit Breed Lookups", "Edit Breed Lookups" ) dictionary["lookupsrefreshtooltip"] = ( "Refresh the list", "Refresh the list" ) dictionary["lookupsdeletetooltip"] = ( "Delete the selected lookup", "Delete the selected lookup" ) dictionary["lookupssubmittooltip"] = ( "Submit lookup", "Submit lookup" ) dictionary["lookupsduplicatemessage"] = ( "That lookup already exists, it's pointless putting it in again!", "That lookup already exists, it's pointless putting it in again!" ) dictionary["lookupsnonamemessage"] = ( "You must give a name for this lookup!", "You must give a name for this lookup!" ) dictionary["lookupsdeletemessage"] = ( "Are you sure that you want to delete this lookup?", "Are you sure that you want to delete this lookup?" ) ##Medication dictionary["medicationeditmedicationpagetitle"] = ( "Edit Medication", "Edit Medication" ) dictionary["medicationrefreshtooltip"] = ( "Refresh Medication List", "Refresh Medication List" ) dictionary["medicationdeletetooltip"] = ( "Delete the selected medication", "Delete the selected medication" ) dictionary["medicationbatchnolabel"] = ( "Batch #", "Batch #" ) dictionary["medicationbatchmovementreporttooltip"] = ( "Generate a report showing all movements of this batch", "Generate a report showing all movements of this batch" ) dictionary["medicationstocklisttooltip"] = ( "Print a list of your current stock", "Print a list of your current stock" ) dictionary["medicationmovementsoflabel"] = ( "Movements of ", "Movements of " ) dictionary["medicationconfirmdeletemessage"] = ( "Are you sure you want to delete ", "Are you sure you want to delete " ) dictionary["medicationconfirmoverwritemessage"] = ( "Are you sure you want to overwrite this medication?", "Are you sure you want to overwrite this medication?" ) dictionary["medicationmovementsofbatchnumberlabel"] = ( "Movements of Batch Number ", "Movements of Batch Number " ) dictionary["medicationexpireslabel"] = ( "Expires", "Expires" ) dictionary["medicationrefreshdetailstooltip"] = ( "Refresh the details of this medication", "Refresh the details of this medication" ) dictionary["medicationdeletemovementtooltip"] = ( "Delete this medication movement", "Delete this medication movement" ) dictionary["movementmovementlabel"] = ( "Movement", "Movement" ) dictionary["movementoverwritemovementmessage"] = ( "Are you sure that you want to overwrite this movement?", "Are you sure that you want to overwrite this movement?" ) dictionary["movementconfirmdeletemovementmessage"] = ( "Are you sure that you want to delete this movement?", "Are you sure that you want to delete this movement?" ) dictionary["movementrefreshmovementsmessage"] = ( "Refresh the details of this medication", "Refresh the details of this medication" ) dictionary["movementresetsearchentriestooltip"] = ( "Reset search entries", "Reset search entries" ) dictionary["medicationcurrentbatchlabel"] = ( "Current Batch", "Current Batch" ) dictionary["medicationunitpricelabel"] = ( "Unit Price", "Unit Price" ) ##Weekdays dictionary["monday"] = ( "Monday", "Monday" ) dictionary["tuesday"] = ( "Tuesday", "Tuesday" ) dictionary["wednesday"] = ( "Wednesday", "Wednesday" ) dictionary["thursday"] = ( "Thursday", "Thursday" ) dictionary["friday"] = ( "Friday", "Friday" ) dictionary["saturday"] = ( "Saturday", "Saturday" ) dictionary["sunday"] = ( "Sunday", "Sunday" ) ##Procedures dictionary["editprocedurespagetitle"] = ( "Edit Procedures", "Edit Procedures" ) dictionary["proceduresrefreshprocedurestooltip"] = ( "Refresh the list of procedures", "Refresh the list of procedures" ) dictionary["proceduresdeleteproceduretooltip"] = ( "Delete the selected procedure", "Delete the selected procedure" ) dictionary["proceduresunnamedproceduremessage"] = ( "You must give this procedure a name!", "You must give this procedure a name!" ) dictionary["proceduresoverwritemessage"] = ( "Are you sure that you want to edit this procedure?", "Are you sure that you want to edit this procedure?" ) dictionary["proceduresdeletemessage"] = ( "Are you sure that you want to delete this procedure?", "Are you sure that you want to delete this procedure?" ) ##Random data dictionary["randomdatapagetitle"] = ( "Random Data", "Random Data" ) dictionary["randomdatanoofclientslabel"] = ( "No of clients", "Number of clients" ) dictionary["randomdatanoofanimalslabel"] = ( "No of animals", "Number of animals" ) dictionary["randomdatanoofappointmentslabel"] = ( "No of appointments", "Number of appointments" ) dictionary["randomdatanoofoperationslabel"] = ( "No of operations", "Number of operations" ) dictionary["randomdatanoofmedicationslabel"] = ( "No of medications", "Number of medications" ) dictionary["randomdataclientslabel"] = ( "Clients", "Clients" ) dictionary["randomdataanimalslabel"] = ( "Animals", "Animals" ) dictionary["randomdataappointmentslabel"] = ( "Appointments", "Appointments" ) dictionary["randomdataoperationslabel"] = ( "Operations", "Operations" ) dictionary["randomdatamedicationlabel"] = ( "Medication", "Medication" ) dictionary["randomdatasubmittooltip"] = ( "Create random data", "Create random data" ) ##Settings Panel dictionary["settingspracticenamelabel"] = ( "Practice Name", "Practice Name" ) dictionary["settingsopenfromlabel"] = ( "Open from", "Open from" ) dictionary["settingsopentolabel"] = ( "Open to", "Open to" ) dictionary["settingsoperatingtimelabel"] = ( "Operating time", "Operating time" ) dictionary["settingshtmlviewerlabel"] = ( "HTML viewer", "HTML viewer" ) dictionary["settingsfindhtmlviewertooltip"] = ( "HTML viewer", "HTML viewer" ) dictionary["settingslanguagelabel"] = ( "Language", "American English" ) ##Staff settings dictionary["editvetformlabel"] = ( "Edit Vet Form", "Edit Vet Form" ) dictionary["editfinanceslabel"] = ( "Edit Finances", "Edit Finances" ) dictionary["showtoolbarlabel"] = ( "Show Toolbar", "Show Toolbar" ) dictionary["viewchangeloglabel"] = ( "View Changelogs", "View Changelogs" ) dictionary["editsettingslabel"] = ( "Edit Settings", "Edit Settings" ) dictionary["editrotalabel"] = ( "Edit Rota", "Edit Rota" ) dictionary["editstaffpagetitle"] = ( "Edit Rota", "Edit Rota" ) dictionary["staffmemberlabel"] = ( "Staff Member", "Staff Member" ) dictionary["deleteusertooltip"] = ( "Delete the selected user", "Delete the selected user" ) dictionary["clientslabel"] = ( "Clients", "Clients" ) dictionary["animalslabel"] = ( "Animals", "Animals" ) dictionary["appointmentslabel"] = ( "Appointments", "Appointments" ) dictionary["medicationlabel"] = ( "Medication", "Medication" ) dictionary["procedureslabel"] = ( "Clients", "Clients" ) dictionary["lookupslabel"] = ( "Lookups", "Lookups" ) dictionary["formslabel"] = ( "Forms", "Forms" ) dictionary["userslabel"] = ( "Users", "Users" ) dictionary["misclabel"] = ( "Misc", "Misc" ) dictionary["tickalllabel"] = ( "Check All", "Check All" ) dictionary["tickalltooltip"] = ( "Give the user permission to use ALL areas of the system. Use with care!", "Give the user permission to use ALL areas of the system. Use with care!" ) dictionary["useroverwritemessage"] = ( "Are you sure that you want to overwrite this user?", "Are you sure that you want to overwrite this user?" ) dictionary["userdeletemessage"] = ( "Are you sure that you want to delete this user?", "Are you sure that you want to delete this user?" ) ##Edit Rota dictionary["editrotapagetitle"] = ( "Edit Rota", "Edit Rota" ) dictionary["timeonlabel"] = ( "Time On", "Time On" ) dictionary["timeofflabel"] = ( "Time Off", "Time Off" ) dictionary["operatinglabel"] = ( "Operating", "Operating" ) dictionary["staffsummarylabel"] = ( "Staff Summary", "Staff Summary" ) dictionary["dayplanlabel"] = ( "Day Plan", "Day Plan" ) dictionary["novetnamemessage"] = ( "You must enter a vets name!", "You must enter a vets name!" ) dictionary["vetfinishedbeforestartingmessage"] = ( "The vet cannot finish before starting!", "The vet cannot finish before starting!" ) dictionary["vettwoplacesatoncemessage"] = ( "This vet cannot be in two places at once!", "This vet cannot be in two places at once!" ) ##Vaccinations dictionary["vaccinationseditvaccinationspagetitle"] = ( "Edit Vaccinations", "Edit Vaccinations" ) dictionary["vaccinationsvaccinelabel"] = ( "Vaccine", "Vaccine" ) dictionary["vaccinationsrefreshvaccinationstooltip"] = ( "Refresh the list of vaccinations", "Refresh the list of vaccinations" ) dictionary["vaccinationsdeletevaccinationstooltip"] = ( "Delete the selected vaccination", "Delete the selected vaccination" ) dictionary["vaccinationsprintstocklisttooltip"] = ( "Print a list of your current stock", "Print a list of your current stock" ) dictionary["vaccinationsconfirmdeletevaccinationmessage"] = ( "Are you sure you want to delete this vaccination?", "Are you sure you want to delete this vaccination?" ) dictionary["vaccinationsconfirmoverwritevaccinationmessage"] = ( "Are you sure you want to overwrite this vaccination?", "Are you sure you want to overwrite this vaccination?" ) dictionary["vaccinationsrefreshmovementstooltip"] = ( "Refresh the details of this vaccination", "Refresh the details of this vaccination" ) dictionary["vaccinationsdeletemovementtooltip"] = ( "Delete this vaccination movement", "Delete this vaccination movement" ) dictionary["vaccinationsoverwritemovementmessage"] = ( "Are you sure that you want to edit this movement?", "Are you sure that you want to edit this movement?" ) dictionary["vaccinationsdeletemovementmessage"] = ( "Are you sure that you want to delete this movement?", "Are you sure that you want to delete this movement?" ) ##Vet Form dictionary["vetformpagetitle"] = ( "Vet Form", "Vet Form" ) dictionary["vetformotherappointmentslabel"] = ( "Appointment History", "Appointment History" ) dictionary["vetformappointmentdetailslabel"] = ( "Appointment Details", "Appointment Details" ) dictionary["vetformmedlabel"] = ( "Med", "Med" ) dictionary["vetformvacclabel"] = ( "Vacc", "Vacc" ) dictionary["vetformproclabel"] = ( "Proc", "Proc" ) dictionary["vetformmanlabel"] = ( "Man", "Man" ) dictionary["vetformdeletereceipttooltip"] = ( "Delete the selected item from the receipt", "Delete the selected item from the receipt" ) dictionary["vetformdonetooltip"] = ( "Mark this appointment as complete and close", "Mark this appointment as complete and close" ) dictionary["vetformsavetooltip"] = ( "Save any changes made to this vet form", "Save any changes made to this vet form" ) dictionary["vetformreceiptitemlabel"] = ( "Receipt Item", "Receipt Item" ) dictionary["vetformdeletereceiptmessage"] = ( "Are you sure you want to delete this receipt item?", "Are you sure you want to delete this receipt item?" ) dictionary["vetformmedicationclearcontainstooltip"] = ( "Clear the \"Contains\" entry", "Clear the \"Contains\" entry" ) dictionary["vetformrefreshmedicationtooltip"] = ( "Refresh the medication list", "Refresh the medication list" ) dictionary["vetformnoofunitstooltip"] = ( "Enter the number of units that you are dispensing here", "Enter the number of units that you are dispensing here" ) dictionary["vetforminstructionslabel"] = ( "Instructions", "Instructions" ) dictionary["vetforminstructionstooltip"] = ( "Enter instructions on how to administer this medication here", "Enter instructions on how to administer this medication here" ) dictionary["vetformprintlabeltooltip"] = ( "Print a label for this medication", "Print a label for this medication" ) dictionary["vetformbatchnotooltip"] = ( "Enter the batch number here", "Enter the batch number here" ) dictionary["vetformrefreshvaccinationtooltip"] = ( "Refresh the vaccination list", "Refresh the vaccination list" ) dictionary["vetformrefreshprocedurestooltip"] = ( "Refresh the procedures list", "Refresh the procedures list" ) dictionary["vetformnodescriptionmessage"] = ( "You must give a description!", "You must give a description!" ) ##View Appointments dictionary["viewappointmentspagetitle"] = ( "View Appointments", "View Appointments" ) dictionary["viewoperationsspagetitle"] = ( "View Operations", "View Operations" ) dictionary["viewappointmentsmarkwithvettooltip"] = ( "Mark this appointment as with the vet", "Mark this appointment as with the vet" ) dictionary["viewappointmentschoosevettooltip"] = ( "Choose a vet", "Choose a vet" ) dictionary["viewappointmentsvetformtooltip"] = ( "Carry out the vet visit for this appointment", "Carry out the vet visit for this appointment" ) dictionary["viewappointmentsmarkarrivedtooltip"] = ( "Mark this appointment as arrived", "Mark this appointment as arrived" ) dictionary["viewappointmentsmarkdonetooltip"] = ( "Mark this appointment as done", "Mark this appointment as done" ) dictionary["viewappointmentseditclientbuttonlabel"] = ( "Edit Client", "Edit Client" ) dictionary["viewappointmentseditclientbuttontooltip"] = ( "Edit this clients record (so they can pay their bill)", "Edit this clients record (so they can pay their bill)" ) dictionary["viewappointmentsvetsonlabel"] = ( "Vets On", "Vets On" ) dictionary["appointmentsearchpagetitle"] = ( "Appointment Search", "Appointment Search" ) dictionary["appointmentsearchmenu"] = ( ("Appointment Search", "Find an appointment"), ("Appointment Search", "Find an appointment") ) dictionary["appointmentsearchanimalnamelabel"] = ( "Animal Name", "Animal Name" ) dictionary["reasonlabel"] = ( "Reason", "Reason" ) dictionary["viewoperationspagetitle"] = ( "View Operations", "View Operations" ) dictionary["dateformat"] = ( "DDMMYYYY", "DDMMYYYY" ) dictionary["currency"] = ( "&pound;", "EUR " ) dictionary["mailshotmenu"] = ( ("Mail Shot", "Compile a list of clients to contact"), ("Mail Shot", "Compile a list of clients to contact") ) dictionary["mailshotpagetitle"] = ( "Mail Shot", "Mail Shot" ) dictionary["anyvaccine"] = ( "Any Vaccine", "Any Vaccine" ) dictionary["anyspecies"] = ( "Any Species", "Any Species" ) dictionary["deceasedlabel"] = ( "Deceased", "Deceased" ) dictionary["causeofdeathlabel"] = ( "Cause of Death", "Cause of Death" ) dictionary["includedeceasedlabel"] = ( "Include Deceased", "Include Deceased" ) dictionary["createvaccinationappointmentbutton"] = ( ("Create Appointment", "Create an appointment for this vaccination"), ("Create Appointment", "Create an appointment for this vaccination") ) dictionary["generatevaccinationcsvbutton"] = ( ("Create CSV File", "Create and save a CSV file to disc. This can be used by most word processors to create mail shots"), ("Create CSV File", "Create and save a CSV file to disc. This can be used by most word processors to create mail shots") ) dictionary["csvsavedtolabel"] = ( "CSV file saved to", "CSV file saved to" ) dictionary["versiontablenotfoundquestion"] = ( "Version table not found, create it now?", "Version table not found, create it now?" ) dictionary["versionupdatequestion1"] = ( "You are attempting to run evette", "ou are attempting to run evette" ) dictionary["versionupdatequestion2"] = ( "your database is version", "your database is version" ) dictionary["versionupdatequestion3"] = ( "Would you like to upgrade your database?", "Would you like to upgrade your database?" ) dictionary["resetdatabasequestion"] = ( "Are you sure that you want to reset all tables? ALL DATA WILL BE LOST!", "Are you sure that you want to reset all tables? ALL DATA WILL BE LOST!" ) dictionary["alltablesresetmessage"] = ( "All tables have been reset!", "All tables have been reset!" ) dictionary["addstafflabel"] = ( "Add staff?", "Add staff?" ) dictionary["vetslabel"] = ( "Vets", "Vets" ) dictionary["nurseslabel"] = ( "Nurses", "Nurses" ) dictionary["otherslabel"] = ( "Others", "Others" ) dictionary["nextmonthtooltip"] = ( "Show next month", "Show next month" ) dictionary["previousmonthtooltip"] = ( "Show previous month", "Show previous month" ) dictionary["backtocalendartooltip"] = ( "Back to calendar", "Back to calendar" ) dictionary["addstafftodailyrotatooltip"] = ( "Add a member of staff to this days rota", "Add a member of staff to this days rota" ) dictionary["deleterotaitemtooltip"] = ( "Delete this rota entry", "Delete this rota entry" ) dictionary["submitrotaitemtooltip"] = ( "Submit this rota entry", "Submit this rota entry" ) dictionary["vetpositiontitle"] = (#Note: If a user is given this position, Evette will assume that the user is a vet "Vet", "Vet" ) dictionary["vetnursepositiontitle"] = (#Note: If a user is given this position, Evette will assume that the user is a vet nurse "Nurse", "Nurse" ) dictionary["managerpositiontitle"] = (#Note: If a user is given this position, Evette will assume that the user is a manager "Manager", "Manager" ) dictionary["errorlabel"] = ( "Sorry, the following error has occured", "Sorry, the following error has occured" ) dictionary["editdiarytoolbar"] = ( ("Edit Diary", "Edit the diary"), ("Edit Diary", "Edit the diary") ) dictionary["editdiarypagetitle"] = ( "Edit Diary", "Edit Diary" ) dictionary["notesuptolabel"] = ( "Up to", "Up to" ) dictionary["subjectcontainslabel"] = ( "Subject contains", "Subject contains" ) dictionary["notecontainslabel"] = ( "Note contains", "Note contains" ) dictionary["showremovedlabel"] = ( "Include removed?", "Include removed?" ) dictionary["subjectlabel"] = ( "Subject", "Subject" ) dictionary["notelabel"] = ( "Note", "Note" ) dictionary["removedlabel"] = ( "Removed", "Removed" ) dictionary["linklabel"] = ( "Link", "Link" ) dictionary["clientlabel"] = ( "Client", "Client" ) dictionary["animallabel"] = ( "Animal", "Animal" ) dictionary["opentargetrecordtooltip"] = ( "Open the record linked to this diary note", "Open the record linked to this diary note" ) dictionary["diarynotelabel"] = ( "Diary Note", "Diary Note" ) dictionary["confirmdeletediarynotemessage"] = ( "Are you sure that you want to delete this diary note?", "Are you sure that you want to delete this diary note?" ) dictionary["nolinklabel"] = ( "No Link", "No Link" ) dictionary["createassociateddiarynotetooltip"] = ( "Create a diary note associated with this record", "Create a diary note associated with this record" ) dictionary["newdiarynotetooltip"] = ( "Create a new diary note", "Create a new diary note" ) dictionary["editdiarynotetooltip"] = ( "Edit the selected diary note", "Edit the selected diary note" ) dictionary["deletediarynotetooltip"] = ( "Delete the selected diary note", "Delete the selected diary note" ) dictionary["refreshdiarytooltip"] = ( "Refresh the list of diary notes", "Refresh the list of diary notes" ) dictionary["cleardiarytooltip"] = ( "Clear the diary filters", "Clear the diary filters" ) dictionary["clientolderthanservermessage"] = ( "You are trying to run an out-of-date client, please upgrade then try again", "You are trying to run an out-of-date client, please upgrade then try again" ) dictionary["adddiarynotes"] = ( "Add to diary", "Add to diary" ) dictionary["editdiarynotes"] = ( "Edit diary", "Edit diary" ) dictionary["deletediarynotes"] = ( "Delete from diary", "Delete from diary" ) dictionary["diarylabel"] = ( "Diary", "Diary" ) dictionary["viewlicensemenu"] = ( ("View License", "View the license for this software."), ("View License", "View the license for this software.") ) dictionary["fileaccosiationmenu"] = ( ("File Associations", "Edit the external applications associated with attached files"), ("File Associations", "Edit the external applications associated with attached files") ) dictionary["licenselabel"] = ( "License", "License" ) dictionary["aboutlabel"] = ( "About", "About" ) dictionary["attachedfileslabel"] = ( "Attached Files", "Attached Files" ) dictionary["deleteattachedfileconfirm"] = ( "Are you sure that you want to delete this file?", "Are you sure that you want to delete this file?" ) dictionary["addnewmediatooltip"] = ( "Add a new external file to this record", "Add a new external file to this record" ) dictionary["replacemediatooltip"] = ( "Update the description of the selected file", "Update the description of the selected file" ) dictionary["deletemediatooltip"] = ( "Delete the selected file", "Delete the selected file" ) dictionary["savemediatooltip"] = ( "Save the selected file to disk", "Save the selected file to disk" ) dictionary["fileassociationspagetitle"] = ( "File Associations", "File Associations" ) dictionary["extensionlabel"] = ( "Extension", "Extension" ) dictionary["programlabel"] = ( "Program", "Program" ) dictionary["fileassociationexistsmessage"] = ( "There is already a program associated with this file extension!", "There is already a program associated with this file extension!" ) dictionary["deleteassociationconfirm"] = ( "Are you sure that you want to delete this file association?", "Are you sure that you want to delete this file association?" ) dictionary["noprogramassociatedmessage"] = ( "There is no program associated with this file type!", "There is no program associated with this file type!" ) dictionary["mediatoolargemessage"] = ( "This file is too large to attach!", "This file is too large to attach!" ) ############################## 1.1.9 ############################################### dictionary["weightpanelpagetitle"] = ( "Weight", "Weight" ) dictionary["deleteweighttooltip"] = ( "Delete the selected weight", "Delete the selected weight" ) dictionary["deleteweightconfirm"] = ( "Are you sure that you want to delete this weight?", "Are you sure that you want to delete this weight?" ) dictionary["samelabel"] = ( "Same", "Same" ) dictionary["reorderlabel"] = ( "Minimum", "Minimum" ) dictionary["runninglowlabel"] = ( "Running Low?", "Running Low?" ) dictionary["diarymenu"] = ( "&Diary", "&Diary" ) ############################## 1.2 ############################################### dictionary["clientanimalsearchtooltip"] = ( "If you wish to filter the animals by name, enter the name here", "If you wish to filter the animals by name, enter the name here" ) dictionary["browseappointmentsmenu"] = ( ( "Browse Appointments", "Browse all appointments" ), ( "Browse Appointments", "Browse all appointments" ) ) dictionary["browseappointmentspagetitle"] = ( "Browse Appointments", "Browse Appointments" ) dictionary["appointmentlabel"] = ( "appointment", "appointment" ) dictionary["januarylabel"] = ( "January", "January" ) dictionary["februarylabel"] = ( "February", "February" ) dictionary["marchlabel"] = ( "March", "March" ) dictionary["aprillabel"] = ( "April", "April" ) dictionary["maylabel"] = ( "May", "May" ) dictionary["junelabel"] = ( "June", "June" ) dictionary["julylabel"] = ( "July", "July" ) dictionary["augustlabel"] = ( "August", "August" ) dictionary["septemberlabel"] = ( "September", "September" ) dictionary["octoberlabel"] = ( "October", "October" ) dictionary["novemberlabel"] = ( "November", "November" ) dictionary["decemberlabel"] = ( "December", "December" ) dictionary["readfileassociationhelpmessage"] = ( "To learn about file associations - visit the help section.", "To learn about file associations - visit the help section." ) dictionary["websitelabel"] = ( "Website", u"Website" ) dictionary["generateinvoicelabel"] = ( "Generate a printable invoice for this client", u"Generate a printable invoice for this client" ) dictionary["animalformsmenu"] = ( ("Animal Forms", "Create or edit forms that be generated using an animal's details"), (u"Animal Forms", u"Create or edit forms that be generated using an animal's details") ) dictionary["clientformsmenu"] = ( ("Client Forms", "Create or edit forms that be generated using an client's details"), (u"Client Forms", u"Create or edit forms that be generated using an client's details") ) dictionary["animalformspagetitle"] = ( "Animal Forms", u"Animal Forms" ) dictionary["clientformspagetitle"] = ( "Client Forms", u"Client Forms" ) dictionary["previewlabel"] = ( "Preview", u"Preview" ) dictionary["wordkeyslabel"] = ( "Wordkeys", u"Wordkeys" ) dictionary["invoiceformsmenu"] = ( ("Invoice Forms", "Edit the invoice templates"), (u"Invoice Forms", u"Edit the invoice templates") ) dictionary["editinvoicepagetitle"] = ( "Edit Invoices", u"Edit Invoices" ) dictionary["medicationformsmenu"] = ( ("Medication Forms", "Edit the medication templates"), (u"Medication Forms", u"Edit the medication templates") ) dictionary["editmedicationtformspagetitle"] = ( "Medication Forms", u"Medication Forms" ) dictionary["invoicespagetitle"] = ( "Invoices", u"Invoices" ) dictionary["newinvoicetooltip"] = ( "Create a new invoice", u"Create a new invoice" ) dictionary["editinvoicetooltip"] = ( "Edit the selected invoice", u"Edit the selected invoice" ) dictionary["deleteinvoicetooltip"] = ( "Delete the selected invoice", u"Delete the selected invoice" ) dictionary["invoiceoverlapmessage"] = ( "Invoices are not allowed to overlap, please adjust the dates", u"Invoices are not allowed to overlap, please adjust the dates" ) dictionary["clientgenerateformtooltip"] = ( "Generate a form using this clients details", u"Generate a form using this clients details" ) dictionary["randomdatawarningmessage"] = ( "Note: Evette will need close when this process has completed,\nplease start Evette again to see the results.", u"Note: Evette will need close when this process has completed,\nplease start Evette again to see the results." ) dictionary["invoiceidlabel"] = ( "Invoice ID", u"Invoice ID" ) dictionary["paidlabel"] = ( "paid", u"paid" ) dictionary["unpaidlabel"] = ( "unpaid", u"unpaid" ) dictionary["invoiceidchoicetooltip"] = ( "Choose an invoice ID to mark an invoice as paid.", u"Choose an invoice ID to mark an invoice as paid." ) dictionary["editpaymentinvoicetooltip"] = ( "Edit the amount paid on the selected invoice.", u"Edit the amount paid on the selected invoice." ) dictionary["editinvoicepaymenttitle"] = ( "Edit payment", u"Edit payment" ) dictionary["editanimaltooltip"] = ( "Edit Animal", u"Edit Animal" ) ###################1.2.2##################### dictionary["stocklabel"] = ( "Stock", u"Stock" ) dictionary["editstockmenu"] = ( ("Edit Stock", "Edit Stock"), ("Edit Stock", "Edit Stock") ) dictionary["batchsearchmenu"] = ( ("Batch Search", "Show movements for a specific batch number"), ("Batch Search", "Show movements for a specific batch number") ) dictionary["batchbreakdowntooltip"] = ( "View a breakdown of the current stock by batch number", u"View a breakdown of the current stock by batch number" ) dictionary["editmovementlabel"] = ( "Edit Movement", u"Edit Movement" ) dictionary["createmovementlabel"] = ( "Create Movement", u"Create Movement" ) dictionary["consumablelabel"] = ( "Consumable", u"Consumable" ) dictionary["shoplabel"] = ( "Shop", u"Shop" ) dictionary["procedurelabel"] = ( "Procedure", u"Procedure" ) dictionary["manuallabel"] = ( "Manual", u"Manual" ) dictionary["prescribemedicationlabel"] = ( "Prescribe Medication", u"Prescribe Medication" ) dictionary["quantitylabel"] = ( "Quantity", u"Quantity" ) dictionary["quantityerrormessage"] = ( "Invalid quantity", u"Invalid quantity" ) dictionary["viewinvoicetooltip"] = ( "View Invoice", u"View Invoice" ) dictionary["diagnosislabel"] = ( "Diagnosis", u"Diagnosis" ) dictionary["createreceiptitemtooltip"] = ( "Create a receipt item", u"Create a receipt item" ) ############################## 1.2.3 ############################################### dictionary["editkennelsmenu"] = ( ("Edit Kennels", "Edit kennels available"), ("Edit Kennels", "Edit kennels available") ) dictionary["viewkennelsmenu"] = ( ("View Kennels", "View Kennels"), ("View Kennels", "View Kennels") ) dictionary["kennelsmenu"] = ( "&Kennels", "&Kennels" ) dictionary["kennelblocktitlelabel"] = ( "Kennel Blocks", "Kennel Blocks" ) dictionary["kennelstitlelabel"] = ( "Kennels", "Kennels" ) dictionary["editkennelblocktitle"] = ( "Edit kennel block", "Edit kennel block" ) dictionary["deletekennelblockconfirmation"] = ( "Are you sure that you want to delete this kennel block?", "Are you sure that you want to delete this kennel block?" ) dictionary["deletekennelconfirmation"] = ( "Are you sure that you want to delete this kennel?", "Are you sure that you want to delete this kennel?" ) dictionary["editkenneltitle"] = ( "Edit kennel", "Edit kennel" ) dictionary["stayinglabel"] = ( "Staying", "Staying" ) dictionary["occupiedlabel"] = ( "occupied", "occupied" ) dictionary["vacantlabel"] = ( "vacant", "vacant" ) dictionary["changeownershiptooltip"] = ( "Transfer ownership of this animal", "Transfer ownership of this animal" ) dictionary["choosenewownerdialogtitle"] = ( "Choose new owner", "Choose new owner" ) dictionary["doubleclicktoselecttooltip"] = ( "Double click to select", "Double click to select" ) dictionary["importasmanimaltooltip"] = ( "Create an animal record from an ASM record", "Create an animal record from an ASM record" ) dictionary["chooseananimaltitle"] = ( "Choose an animal", "Choose an animal" ) dictionary["clientrefnolabel"] = ( "Reference Number", "Reference Number" ) dictionary["toomanyresultsmessage"] = ( "Your search produced too many results to display, please narrow down your search", "Your search produced too many results to display, please narrow down your search" ) dictionary["idlelabel"] = ( "Idle", "Idle" ) dictionary["connectinglabel"] = ( "Connecting", "Connecting" ) dictionary["connectedlabel"] = ( "Connected", "Connected" ) dictionary["errorlabel"] = ( "Error", "Error" ) dictionary["usernamepassworderrormessage"] = ( "Unsuccessful Login", "Unsuccessful Login" ) dictionary["successfulloginmessage"] = ( "Successful Login", "Successful Login" ) dictionary["creatingevettefolder"] = ( "Creating Evette folder", "Creating Evette folder" ) dictionary["evettedatabasecreatedmessage"] = ( "Created Evette database", "Created Evette database" ) dictionary["errorcreatingdatabasemessage"] = ( "Error creating Evette database", "Error creating Evette database" ) dictionary["asmimportmenu"] = ( ("ASM Import", "Import an animal from ASM"), ("ASM Import", "Import an animal from ASM") ) dictionary["errorobtainingownermessage"] = ( "Unable to find owner", "Unable to find owner" ) dictionary["alreadyimportedmessage"] = ( "This animal has already been imported. Would you like to view it?", "This animal has already been imported. Would you like to view it?" ) dictionary["addweighttooltip"] = ( "Add Weight", "Add Weight" ) dictionary["editweightlabel"] = ( "Edit Weight", "Edit Weight" ) dictionary["adduserlabel"] = ( "Add User", "Add User" ) dictionary["edituserlabel"] = ( "Edit User", "Edit User" ) dictionary["editreasonsmenu"] = ( ("Edit Reasons", "Edit common appointment reasons"), ("Edit Reasons", "Edit common appointment reasons") ) dictionary["lookupsreasonpagetitle"] = ( "Appointment Reason Lookups", "Appointment Reason Lookups" ) dictionary["doubleclickforreasonstooltip"] = ( "Double click for a choice of common appointment reasons", "Double click for a choice of common appointment reasons" ) dictionary["filemenu"] = ( "File", "File" ) dictionary["fileexitmenu"] = ( ("Exit", "Exit Evette"), ("Exit", "Exit Evette") ) dictionary["fileclosewindowsmenu"] = ( ("Close All Panels", "Close all open panels"), ("Close All Panels", "Close all open panels") ) dictionary["confirmcloseallwindowsmessage"] = ( ("Are you sure that you want to close all open panels? Any unsaved data will be lost."), ("Are you sure that you want to close all open panels? Any unsaved data will be lost.") ) dictionary["locationlabel"] = ( "Location", "Location" ) dictionary["editprocedurelabel"] = ( "Edit Procedure", "Edit Procedure" ) ############################## 1.2.4 ############################################### dictionary["addlookuptooltip"] = ( "Create a new lookup", u"Create a new lookup" ) dictionary["malelabel"] = ( "Male", u"Male" ) dictionary["femalelabel"] = ( "Female", u"Female" ) dictionary["unknownlabel"] = ( "Unknown", u"Unknown" ) dictionary["dayslabel"] = ( "days", u"days" ) dictionary["weekslabel"] = ( "weeks", u"weeks" ) dictionary["monthslabel"] = ( "months", u"months" ) dictionary["yearslabel"] = ( "years", u"years" ) dictionary["invaliddobtooltip"] = ( "Invalid DOB", u"Invalid DOB" ) dictionary["addkennelblocktooltip"] = ( "Create a new kennel block", u"Create a new kennel block" ) dictionary["addkenneltooltip"] = ( "Create a new kennel", u"Create a new kennel" ) ############################## 1.2.5 ############################################### dictionary["asmclientimportmenu"] = ( ("ASM Client Import", "Import a client from ASM"), (u"ASM Client Import", u"Import a client from ASM") ) dictionary["chooseclientlabel"] = ( "Choose client", u"Choose client" ) dictionary["datectrltooltip"] = ( "Double click to choose from a calendar", u"Double click to choose from a calendar" ) dictionary["choosedatetitle"] = ( "Choose a date", u"Choose a date" ) dictionary["editappointmentlabel"] = ( "Edit Appointment", u"Edit Appointment" ) dictionary["agelabel"] = ( "Age", u"Age" ) dictionary["addvaccinationtooltip"] = ( "Add Vaccination", u"Add Vaccination" ) dictionary["printtooltip"] = ( "Print", u"Print" ) ############################## 1.2.6 ############################################### dictionary["filealteredmessage"] = ( "Another user has altered this file since you opened it. Please close this record and try again.", u"Another user has altered this file since you opened it. Please close this record and try again." ) dictionary["asmreflabel"] = ( "ASM Ref", u"ASM Ref" ) dictionary["deselectlabel"] = ( "Deselect", u"Deselect" ) dictionary["createappointmentlabel"] = ( "Create Appointment", u"Create Appointment" ) dictionary["multiplepanellabel"] = ( "Allow multiple panels open", u"Allow multiple panels open" ) dictionary["filealteredchoice"] = ( "Another user has altered this file since you opened it. Would you like to force through your changes?", u"Another user has altered this file since you opened it. Would you like to force through your changes?" ) dictionary["latelabel"] = ( "Late", u"Late" ) dictionary["minslabel"] = (#Abrreviation of minutes - it is advisable to keep this as short as possible. "mins", u"mins" ) dictionary["microchiplabel"] = ( "Microchip", u"Microchip" ) dictionary["microchippedlabel"] = ( "Microchip implanted", u"Microchip implanted" ) dictionary["costpricelabel"] = ( "Cost Price", u"Cost Price" ) dictionary["viewvetnoteslabel"] = ( "View Vet Notes", u"View Vet Notes" ) dictionary["appointmentsummarylistboxtooltip"] = ( "Right click to view available vets\nDouble click to choose time slot", u"Right click to view available vets\nDouble click to choose time slot" ) ############################## 1.2.7 ############################################### dictionary["shopsalemenuitem"] = ( "Shop Sale", u"Shop Sale" ) dictionary["shopitemstitle"] = ( "Shop Items", u"Shop Items" ) dictionary["basketlabel"] = ( "Basket", u"Basket" ) dictionary["putbacktooltip"] = ( "Put back", u"Put back" ) dictionary["addtobaskettooltip"] = ( "Add to basket", u"Add to basket" ) dictionary["clientmergetooltip"] = ( "Merge another client into this one", u"Merge another client into this one" ) dictionary["clientsmergedmessage"] = ( "Clients merged", u"Clients merged" ) dictionary["addlabel"] = ( "Add", u"Add" ) dictionary["subtractlabel"] = ( "Subtract", u"Subtract" ) dictionary["editmarkupmenu"] = ( ("Define Markup Rules", "Define Markup Rules"), (u"Define Markup Rules", u"Define Markup Rules") ) dictionary["multiplybylabel"] = ( "Multiply by", u"Multiply by" ) dictionary["roundtolabel"] = ( "Round up to", u"Round up to" ) dictionary["costpriceentrytooltip"] = ( "This value is not included in your settings, it is here simply to allow you to try your settings out on some real figures.", u"This value is not included in your settings, it is here simply to allow you to try your settings out on some real figures." ) dictionary["invalidpricemessage"] = ( "Invalid Price!", u"Invalid Price!" ) dictionary["priceinpenniestooltip"] = ( "Please enter price in pennies eg. \"50\" to round to the nearest 50p, \"100\" to round to the nearest pound.", u"Please enter price in cents eg. \"50\" to round to the nearest 50 cents, \"100\" to round to the nearest euro." ) dictionary["customerpricelabel"] = ( "Customer Price", u"Customer Price" ) dictionary["submitsettingstooltip"] = ( "Submit settings", u"Submit settings" ) dictionary["applymarkuptostocktooltip"] = ( "Apply the current markup settings to all stock.", u"Apply the current markup settings to all stock." ) dictionary["markupappliedtoallmessage"] = ( "Markup applied to all prices", u"Markup applied to all prices" ) dictionary["automarkupconfirmmessage"] = ( "Continuing will alter all of your public prices, are you sure that you want to continue?", u"Continuing will alter all of your public prices, are you sure that you want to continue?" ) dictionary["unitpricentrytooltip"] = ( "Type \"a\" to autogenerate a price from markup rules.", u"Type \"a\" to autogenerate a price from markup rules." ) dictionary["costpricentrytooltip"] = ( "Type \"c\" for help calculating the cost price.", u"Type \"c\" for help calculating the cost price." ) dictionary["calculatecostpricetitle"] = ( "Calculate Cost Price", u"Calculate Cost Price" ) dictionary["packpricelabel"] = ( "Price per pack", u"Price per pack" ) dictionary["unitsperpacklabel"] = ( "Units per pack", u"Units per pack" ) ############################## 1.2.8 ############################################### dictionary["phonenumbertooltip"] = ( "CTRL + P to toggle public availability.", u"CTRL + P to toggle public availability." ) dictionary["lostanimallabel"] = ( "Lost Animal", u"Lost Animal" ) dictionary["foundanimallabel"] = ( "Found Animal", u"Found Animal" ) dictionary["lostandfoundmenu"] = ( ("Lost and Found", "View/Edit Lost and Found"), (u"Lost and Found", u"View/Edit Lost and Found") ) dictionary["lostlabel"] = ( "Lost", u"Lost" ) dictionary["foundlabel"] = ( "Found", u"Found" ) dictionary["datelostlabel"] = ( "Date Lost", u"Date Lost" ) dictionary["datefoundlabel"] = ( "Date Found", u"Date Found" ) dictionary["furlengthlabel"] = ( "Fur Length", u"Fur Length" ) dictionary["longlabel"] = ( "Long", u"Long" ) dictionary["shortlabel"] = ( "Short", u"Short" ) dictionary["fluffylabel"] = ( "Fluffy", u"Fluffy" ) dictionary["hairlesslabel"] = ( "Hairless", u"Hairless" ) dictionary["sizelabel"] = ( "Size", u"Size" ) dictionary["largelabel"] = ( "Large", u"Large" ) dictionary["mediumlabel"] = ( "Medium", u"Medium" ) dictionary["smalllabel"] = ( "Small", u"Small" ) dictionary["juvenilelabel"] = ( "Juvenile", u"Juvenile" ) dictionary["adultlabel"] = ( "Adult", u"Adult" ) dictionary["elderlylabel"] = ( "Elderly", u"Elderly" ) dictionary["temperamentlabel"] = ( "Temperament", u"Temperament" ) dictionary["friendlylabel"] = ( "Friendly", u"Friendly" ) dictionary["timidlabel"] = ( "Timid", u"Timid" ) dictionary["aggressivelabel"] = ( "Aggressive", u"Aggressive" ) dictionary["collarlabel"] = ( "Collar", u"Collar" ) dictionary["collardescriptiontooltip"] = ( "Collar description", u"Collar description" ) dictionary["arealabel"] = ( "Area", u"Area" ) dictionary["areatooltip"] = ( "Please put in likely areas by postcode if possible as well as the city/state, separated by spaces.", u"Please put in likely areas by postcode if possible as well as the city/state, separated by spaces." ) dictionary["datecompletelabel"] = ( "Date complete", u"Date complete" ) dictionary["savetooltip"] = ( "Save", u"Save" ) dictionary["contacttooltip"] = ( "Contact", u"Contact" ) dictionary["completelabel"] = ( "Complete", u"Complete" ) dictionary["idlabel"] = ( "ID", u"ID" ) dictionary["rightclickformenutooltip"] = ( "Right click for available options.", u"Right click for available options." ) dictionary["lostandfoundsearchtooltip"] = ( "Search for a match", u"Search for a match" ) dictionary["searchuptolabel"] = ( "Search ceiling", u"Search ceiling" ) dictionary["searchfromlabel"] = ( "Search floor", u"Search floor" ) dictionary["alreadyonlostandfoundmessage"] = ( "This animal is already on the lost and found!", u"This animal is already on the lost and found!" ) dictionary["includecompletelabel"] = ( "Include complete?", u"Include complete?" ) dictionary["closelabel"] = ( "Close", u"Close" ) dictionary["scorelabel"] = ( "Score", u"Score" ) dictionary["lostandfoundsearchresultspagetitle"] = ( "Lost and Found Search Results", u"Lost and Found Search Results" ) dictionary["systemlabel"] = ( "System", u"System" ) dictionary["versionlabel"] = ( "Version", u"Version" ) ############################## 1.3 ############################################### dictionary["addlostmenu"] = ( ("Add Lost", "Add a lost animal"), (u"Add Lost", u"Add a lost animal") ) dictionary["addfoundmenu"] = ( ("Add Found", "Add a found animal"), (u"Add Found", u"Add a found animal") ) dictionary["alllabel"] = ( "All", u"All" ) dictionary["refreshlabel"] = ( "Refresh", u"Refresh" ) dictionary["filteranimalslabel"] = ( "Filter Animals", u"Filter Animals" ) dictionary["markaspaidlabel"] = ( "Mark as paid?", u"Mark as paid?" ) ############################## 1.3.1 ############################################### dictionary["asmshelterlabel"] = ( "ASM Shelter", u"ASM Shelter" ) dictionary["asmsheltertooltip"] = ( "If you use the Animal Shelter Manager system you can mark a client as \"The Shelter\" allowing you to import animal records from ASM who do not have an owner.", u"If you use the Animal Shelter Manager system you can mark a client as \"The Shelter\" allowing you to import animal records from ASM who do not have an owner." ) dictionary["appointmentrefreshlabel"] = ( "Appointment Refresh Interval", u"Appointment Refresh Interval" ) ############################## 1.3.2 ############################################### dictionary["asmvaccinationlabel"] = ( "ASM Vaccination", u"ASM Vaccination" ) dictionary["asmvaccinationtooltip"] = ( "Choose which ASM vaccine you would like Evette to use when updating animal records.", u"Choose which ASM vaccine you would like Evette to use when updating animal records." ) dictionary["asmerrormessage"] = ( "Unable to update ASM record!", u"Unable to update ASM record!" ) dictionary["asmsynctooltip"] = ( "Sync with ASM record", u"Sync with ASM record" ) dictionary["fieldlabel"] = ( "Field", u"Field" ) dictionary["asmsyncbuttontooltip"] = ( "Sync this field on Evette and ASM records", u"Sync this field on Evette and ASM records" ) dictionary["synctoasmlabel"] = ( "Sync to ASM", u"Sync to ASM" ) dictionary["synctoevettelabel"] = ( "Sync to Evette", u"Sync to Evette" ) dictionary["asmconnectionerrormessage"] = ( "Unable to connect to ASM.", u"Unable to connect to ASM." ) dictionary["asmdeathreasonlabel"] = ( "Record updated via ASM.", u"Record updated via ASM." ) dictionary["evettedeathreasonlabel"] = ( "Record updated via Evette.", u"Record updated via Evette." ) dictionary["importnewasmownermenuitem"] = ( "Import new ASM owner", u"New Language" ) dictionary["updateownermenuitem"] = ( "Update current owner", u"Update current owner" ) dictionary["1.3.2updatemessage"] = ( "Note: when you run the evette client following this upgrade you will need to re-input your database settings.", u"Note: when you run the evette client following this upgrade you will need to re-input your database settings." ) dictionary["tabbetweenentriestooltip"] = ( "You can switch between the user and password entries with the TAB key.", u"You can switch between the user and password entries with the TAB key." ) dictionary["dischargelabel"] = ( "Discharge", u"Discharge" ) dictionary["overnightstaylabel"] = ( "Overnight Stay", u"Overnight Stay" ) dictionary["animalstayedmessage"] = ( "This animal has stayed overnight, creating a new vet form.", u"This animal has stayed overnight, creating a new vet form." ) dictionary["prescriptionfeelabel"] = ( "Prescription Fee", u"Prescription Fee" ) dictionary["ontimelabel"] = ( "On time", u"On time" ) dictionary["dnalabel"] = ( "Did not arrive", u"Did not arrive" ) dictionary["viewlabel"] = ( "View", u"View" ) dictionary["renamelabel"] = ( "Rename", u"Rename" ) dictionary["filterlabel"] = ( "Filter", u"Filter" ) dictionary["programbrowsertooltip"] = ( "Browse to find an appropriate program.", u"Browse to find an appropriate program." ) dictionary["agelabel"] = ( "Age", u"Age" ) dictionary["batchbreakdownlabel"] = ( "Batch No Breakdown", u"Batch No Breakdown" ) dictionary["returntoshelterlabel"] = ( "Return to shelter", u"Return to shelter" ) dictionary["possibleduplicateownermessage"] = ( "This owner may already be known to the system. Would you like to view the list of similar clients?", u"This owner may already be known to the system. Would you like to view the list of similar clients?" ) dictionary["asmimportlabel"] = ( "Imported from ASM", u"Imported from ASM" ) return dictionary
gpl-2.0
-7,974,533,037,425,782,000
23.938619
163
0.665987
false
vernhart/flickr-moderate
common.py
1
25143
#!/usr/bin/env python3 from flickrapi import FlickrAPI, exceptions # Flickr API library import os # get directory of script for config loading import yaml # config file format from pprint import pprint # for debugging import re # for topic reply searching import redis # redis db library from time import sleep,time # for pauses from functools import wraps # for decorator functions import tempfile # for lock files import os # for lock files import fcntl # for lock files import requests # for error handling from datetime import datetime # for elasped time global __config global __config_loaded __config = {} __config_loaded = 0 def loadConfig(debug=False): "Get configuration from yaml file" global __config global __config_loaded script_dir = os.path.dirname(__file__) config_file = script_dir + "/flickr.yaml" modtime = os.path.getmtime(config_file) if modtime > __config_loaded: if __config_loaded > 0: print("NOTICE: Reloading Config") __config_loaded = modtime with open(config_file, 'r') as yamlfile: __config = yaml.safe_load(yamlfile) if debug: print("DEBUG: %s Loaded Configuration:" % datetime.now()) pprint(__config) return(__config) def handler(func): @wraps(func) def handle_exceptions(*args, **kwargs): try: resp = func(*args, **kwargs) except exceptions.FlickrError as err: extra=[] for arg in args: if not 'class' in str(type(arg)): extra.append(str(arg)) for kw, arg in kwargs.items(): extra.append('%s=%s' % (kw, arg)) print('WARNING: flickrapi.exception.FlickrError: %s %s(%s)' % (err, func.__name__, ', '.join(extra))) except requests.exceptions.RequestException as err: print('WARNING: Request Exception during %s, retrying...' % func.__name__) sleep(10) try: resp = func(*args, **kwargs) except exceptions.FlickrError as err: print('WARNING: flickrapi.exception.FlickrError: %s %s' % (err, func.__name__)) else: return(resp) else: return(resp) return(handle_exceptions) def retry(func, retries=3, failurefatal=True): retries = int(retries) @wraps(func) def retry_function(*args, **kwargs): for attempt in range(retries+1): try: resp = func(*args, **kwargs) except: if attempt == retries: if failurefatal: raise else: print('ERROR: Call to %s failed.' % func.__name__) else: print('WARNING: Call to %s failed. Retrying...' % func.__name__) # pause before continuing sleep(10) else: return(resp) else: extra=[] for arg in args: if not 'class' in str(type(arg)): extra.append(arg) for kw, arg in kwargs.items(): extra.append('%s=%s'.format(kw, arg)) print('ERROR: Tried too many times (%s). Giving up on %s(%s).' % (retries+1, func.__name__, ', '.join(extra))) return(retry_function) class myflickrapi(FlickrAPI): # here's where we define handlers for the flickr api methods we use @retry def myGetGroups(self, *args, **kvargs): return(self.people.getGroups(*args, **kvargs)) @retry def myGetPhotos(self, *args, **kvargs): return(self.groups.pools.getPhotos(*args, **kvargs)) @handler def myRemove(self, *args, **kvargs): return(self.groups.pools.remove(*args, **kvargs)) @retry def myGetTopics(self, *args, **kvargs): return(self.groups.discuss.topics.getList(*args, **kvargs)) @retry def myAddTopic(self, *args, **kvargs): return(self.groups.discuss.topics.add(*args, **kvargs)) @retry def myGetReplies(self, *args, **kvargs): return(self.groups.discuss.replies.getList(*args, **kvargs)) @handler def myAddReply(self, *args, **kvargs): return(self.groups.discuss.replies.add(*args, **kvargs)) @handler def myDeleteReply(self, *args, **kvargs): return(self.groups.discuss.replies.delete(*args, **kvargs)) @handler def myInvite(self, *args, **kvargs): return(self.groups.invite.photo.invite(*args, **kvargs)) def auth(api_key, api_secret, debug=False): "Initialize API connection" if debug: print("DEBUG: %s Before Auth" % datetime.now()) flickr = myflickrapi(api_key, api_secret, format='parsed-json') if debug: print("DEBUG: %s Object created" % datetime.now()) # authorization tokens are cached so this should only need to be run once on any server if not flickr.token_valid(perms='delete'): if debug: print("DEBUG: %s token not valid, requesting another" % datetime.now()) flickr.get_request_token(oauth_callback='oob') authorize_url = flickr.auth_url(perms='delete') print("Enter this URL in your browser: %s" % authorize_url) verifier = str(input('Verifier code: ')) flickr.get_access_token(verifier) if debug: print("DEBUG: %s After Auth" % datetime.now()) return flickr def isInt(v): "Returns true if the string represents an integer" v = str(v).strip() return v=='0' or (v if v.find('..') > -1 else v.lstrip('-+').rstrip('0').rstrip('.')).isdigit() def intOrString (string): "If the string represents an integer, returns an integer, otherwise returns the string" if isInt(string): return int(string) else: return string def charFilter(instring, allowed): "return a string with all the un-allowed characters removed" output = '' for c in instring: if c in allowed: output += c return output def get_groups (flickr, user_id, debug=False): "Get all Fav/View groups that we are a member of" if debug: print("DEBUG: %s Before GetGroups" % datetime.now()) groups = flickr.myGetGroups(user_id=user_id, format='etree') if debug: print("DEBUG: %s After GetGroups" % datetime.now()) views = {} favs = {} for node in groups.iter(): group = node.items() if len(group) > 1: info = {'icon': 'https://www.flickr.com/images/buddyicon.gif'} for pair in group: info[pair[0]] = intOrString(pair[1]) if info['iconserver'] > 0: info['icon'] = 'http://farm%d.staticflickr.com/%d/buddyicons/%s.jpg' % (info['iconfarm'], info['iconserver'], info['nsid']) if 'Views:' in info['name']: mincount = int(info['name'][6:].replace(',', '')) info['mincount'] = mincount views[mincount] = info if 'Favorites:' in info['name']: if '&lt;5' in info['name']: mincount = 1 else: mincount = int(info['name'][10:].replace(',', '')) info['mincount'] = mincount favs[mincount] = info return {'views': views, 'favs': favs} def scanGroups(flickr, groups, vieworfav, testrun=False, checkcounts=None, removeNow=False, maxpages=-1, redisStore=False): "Scans view/fav groups and enforces rules" checkViews = False checkFavs = False if vieworfav == 'views': checkViews = True elif vieworfav == 'favs': checkFavs = True assert checkViews or checkFavs, 'scanGroups second parameter must be "veiws" or "favs"' viewsLimit = 0 favsLimit = 0 # checkcounts is a list of mincounts that we'll check # if it's None, initialize it with all the counts if checkcounts is None: checkcounts = groups[vieworfav].keys() if maxpages == -1: viewsLimit = 200 else: # if the mincounts are provided, only go down to the lowest specified if checkFavs: favsLimit = sorted(checkcounts)[0] else: viewsLimit = sorted(checkcounts)[0] # no view or fav group will ever have more than this mincount prevmin = 9999999999999 seenphotos = [] for mincount, info in sorted(groups[vieworfav].items(), reverse=True): starttime = datetime.now() # save what we're checking in the group object info['vieworfav'] = vieworfav # if mincount is not in the list to check, skip the delete actions at the end if mincount not in checkcounts: skipactions = True else: skipactions = False if checkFavs and mincount < favsLimit: return if checkViews and mincount < viewsLimit: return if redisStore and mincount not in checkcounts: print("DEBUG: %s Skipping %s" % (datetime.now(), mincount)) continue if not (testrun or skipactions): scanlock = lockScan(vieworfav + str(mincount)) if not scanlock['locked']: print("Someone is already scanning %s%s, skipping actions" % (vieworfav, mincount)) skipactions = True else: scanlock = {'locked': False} graduates = {} removephotos = {} seenthisgroup = [] # only work with groups we can administer if info['admin']: print('----- %s -----' % " ".join(info['name'].split())) pages = 1 page_size = 500 timeout = 300 # 5 min i = 0 while i < pages: i=i+1 photos = flickr.myGetPhotos(group_id=info['nsid'], page=i, extras='views,count_faves,url_n', per_page=page_size, timeout=timeout) # use the actual page limit if max is -1 or if the actual is less than the max if maxpages == -1 or photos['photos']['pages'] < maxpages: #print("~~~~~~ old max: %s" % maxpages) pages = photos['photos']['pages'] + 1 else: #print(":::::: override pages") pages = maxpages #print('page: %s pages: %s actual pages: %s' % (i, pages, photos['photos']['pages'])) for photo in photos['photos']['photo']: # sometimes the url_n url doesn't get set for some reason # let's construct it manually if not 'url_n' in photo: photo['url_n'] = 'https://farm%s.staticflickr.com/%s/%s_%s_n.jpg' % (photo['farm'], photo['server'], photo['id'], photo['secret']) photo['url'] = "https://www.flickr.com/photos/%s/%s" % (photo['owner'], photo['id']) if checkFavs: # set favs photo['favs'] = intOrString(photo['count_faves']) photo['counts'] = photo['favs'] # later we'll use 'counts' instead of views or favs if checkViews: photo['counts'] = intOrString(photo['views']) removed = False # if it doesn't have high enough count, mark for removal if photo['counts'] < mincount: print("Should not be in this group!! %s %s" % (photo['counts'], photo['url'])) if removeNow: if not (testrun or skipactions): resp = flickr.myRemove(photo_id=photo['id'], group_id=info['nsid']) else: removephotos[photo['id']] = info['nsid'] removed = True if checkFavs and photo['counts'] > 0: if allowInvites(photo['owner']): if not (testrun or skipactions): # only invite to lower group if it is within 50% of current group if photo['counts'] >= mincount*0.5: bestgroup = bestGroup(groups, **{vieworfav: photo['counts']}) print('Inviting %s to %s' %(photo['url'], bestgroup['name'])) resp = flickr.myInvite(group_id=bestgroup['nsid'], photo_id=photo['id']) if redisStore: # check to see if the photo is already listed in a higher group if not removed and photoInHigherGroup(photo['id'],vieworfav,mincount): print("Already in a higher group: %s %s" % (photo['counts'],photo['url'])) if removeNow: if not (testrun or skipactions): resp = flickr.myRemove(photo_id=photo['id'], group_id=info['nsid']) else: removephotos[photo['id']] = info['nsid'] removed = True else: # if we've seen this photo before, it must already be in a higher group if not removed and photo['id'] in seenphotos: print('Already in a higher group: %s %s' % (photo['counts'],photo['url'])) if removeNow: if not (testrun or skipactions): resp = flickr.myRemove(photo_id=photo['id'], group_id=info['nsid']) else: removephotos[photo['id']] = info['nsid'] removed = True # skip this for now... if not (testrun or skipactions) and False: # if we haven't seen it before but it has a high count, add to graduates list if not removed and photo['counts'] >= prevmin: # only add the data we need to reduce memory usage graduates[photo['id']] = {} graduates[photo['id']]['owner'] = photo['owner'] graduates[photo['id']]['url'] = photo['url'] graduates[photo['id']]['url_n'] = photo['url_n'] if checkFavs: graduates[photo['id']]['favs'] = photo['favs'] if checkViews: graduates[photo['id']]['views'] = photo['views'] # if we haven't removed the photo, keep track of the ID if not redisStore and not removed: seenthisgroup.append(photo['id']) # if we've got more than 95% of the page_size in removephotos: # remove them and turn back the page iterator if len(removephotos) > (page_size * 0.95): if not (testrun or skipactions): print("Removing %d photos..." % len(removephotos)) # remove those in the lsit for photo_id, group_id in removephotos.items(): resp = flickr.myRemove(photo_id=photo_id, group_id=group_id) # turn back the page iterator i = i - 1 # clear the list removephotos = {} if not (testrun or skipactions): if len(removephotos) > 0: print("Removing %d photos..." % len(removephotos)) # now remove all the photos that don't belong for photo_id, group_id in removephotos.items(): resp = flickr.myRemove(photo_id=photo_id, group_id=group_id) # only do the deletes in the graduation thread if we're scanning the whole group if maxpages == -1: doDeletes = True else: doDeletes = False graduatePost(flickr, groups, group=info, photos=graduates, doDeletes=doDeletes) if scanlock['locked']: unlockScan(scanlock) prevmin = mincount seenphotos.extend(seenthisgroup) print('Seen photos: %6d total: %7d %44s' % (len(seenthisgroup), len(seenphotos), '(Elapsed: %s)' % (datetime.now() - starttime))) def allowInvites(ownerid): "Returns false if the owner ID is in the no-invites list" # reload config, if necessary cfg = loadConfig() return(ownerid not in cfg['no_invites']) def getTopicID(flickr, group_id, subject): "Return the topic ID of the topic with the given subject in the supplied group." topic_id = 0 # search the topics for the given subject pages = 1 i = 0 while i <= pages: i=i+1 topics = flickr.myGetTopics(group_id=group_id, page=i) pages = topics['topics']['pages'] if int(topics['topics']['total']) > 0: for topic in topics['topics']['topic']: if topic['subject'] == subject: topic_id = topic['id'] return(topic_id) return(topic_id) def graduatePost(flickr, groups, group, photos, doDeletes=True): "Update topic post about photos that could be moved to the next higher group." return subject = 'Proposed Graduation' topic_id = getTopicID(flickr, group_id=group['nsid'], subject=subject) # if we didn't find the topic, create it if topic_id == 0: resp = flickr.myAddTopic(group_id=group['nsid'], subject=subject, message='This topic is an autogenerated message.\n\n' + 'The replies to this post contain all the photos in this group' + ' that qualify for a higher group. This message will be updated periodically.' + ' If these photos are yours, feel free to remove them from this group and' + ' add them to the appropriate higher group. If you are an admin, do please' + ' invite these photos to the next higher group.') if resp['stat'] == 'ok': topic_id = resp['topic']['id'] no_photos_message = "No photos ready for graduation." per_page = 500 replies_to_delete = {} extra_replies = [] pages = 1 i = 0 while i <= pages: i=i+1 replies = flickr.myGetReplies(group_id=group['nsid'], topic_id=topic_id, page=i, per_page=page_size) pages = replies['replies']['topic']['pages'] #print("page %s/%s" % (i, pages)) if 'reply' in replies['replies']: for reply in replies['replies']['reply']: if reply['message']['_content'] == no_photos_message: if len(photos) > 0: # if the reply is "no photos" but we have photos, delete the reply resp = flickr.myDeleteReply(group_id=group['nsid'], topic_id=topic_id, reply_id=reply['id']) pass else: # if we have no photos and the reply is "no photos", do nothing return else: # extract photo_id out of first url m = re.search(r'/(?P<id>[0-9]+)[\'"]', reply['message']['_content']) if m == None: # if there's no match, remove the reply extra_replies.append(reply['id']) elif m.group('id') in replies_to_delete: # we have a duplicate photo in replies, delete immediately print("duplicate reply for %s" % m.group('id')) #resp = flickr.myDeleteReply(group_id=group['nsid'], topic_id=topic_id, reply_id=reply['id']) extra_replies.append(reply['id']) else: # we'll mark them all for deletion # we'll remove from this list as we go through the photos replies_to_delete[m.group('id')] = reply['id'] postedOwners = {} maxPostsPerOwner = 5 for photo_id, photo in sorted(photos.items()): if photo_id in replies_to_delete: # if photo already posted in replies, remove from delete list replies_to_delete.pop(photo_id) else: # else, post reply with photo if 'favs' in photo: # if we have favs, let's talk about favorites groups nextgroup = bestGroup(groups, favs=int(photo['favs'])) else: # else talk about views groups nextgroup = bestGroup(groups, views=int(photo['views'])) # set the count to zero, if it's not set if not photo['owner'] in postedOwners: postedOwners[photo['owner']] = 0 if postedOwners[photo['owner']] <= maxPostsPerOwner: "only post a few per owner per run, to cut down on spamming" if allowInvites(photo['owner']): # invite the photo to the next group resp = flickr.myInvite(group_id=nextgroup['nsid'], photo_id=photo_id) if resp is not None: if resp['stat'] == 'ok': postedOwners[photo['owner']] += 1 print('Posting reply for %s' % photo['url']) resp = flickr.myAddReply(group_id=group['nsid'], topic_id=topic_id, message=('<a href="https://www.flickr.com/photos/%s/%s"><img src="%s"></a> ' 'Promote to <a href="https://www.flickr.com/groups/%s">%s</a>\n') % (photo['owner'], photo_id, photo['url_n'], nextgroup['nsid'], nextgroup['name'])) if doDeletes: for reply_id in sorted(extra_replies): print('Deleting extra reply') resp = flickr.myDeleteReply(group_id=group['nsid'], topic_id=topic_id, reply_id=reply_id) for photo_id in sorted(replies_to_delete): print('Deleting reply for photo_id %s reply_id %s' % (photo_id, replies_to_delete[photo_id])) resp = flickr.myDeleteReply(group_id=group['nsid'], topic_id=topic_id, reply_id=replies_to_delete[photo_id]) replies = flickr.myGetReplies(group_id=group['nsid'], topic_id=topic_id, page=1, per_page=1) if replies['replies']['topic']['total'] == '0': resp = flickr.myAddReply(group_id=group['nsid'], topic_id=topic_id, message=no_photos_message) return def bestGroup(groups, views=-1, favs=-1): "Given a number of views or favorites, will return the name of the best group" prevgroup = {} if views >= 0: for mincount, info in sorted(groups['views'].items()): if views < mincount: prevgroup['nextgroup'] = mincount return(prevgroup) prevgroup = info return(info) prevgroup = {} if favs >= 0: for mincount, info in sorted(groups['favs'].items()): if favs < mincount: prevgroup['nextgroup'] = mincount return(prevgroup) prevgroup = info return(info) # need to specify either views or favs as non-negative a parameter return(prevgroup) def lockScan(locktext): "If this lock is in place, we're currently scanning the groups" lock = {} lock['lockfile'] = os.path.normpath(tempfile.gettempdir() + '/' + 'flickr-moderate-' + locktext) lock['fp'] = open(lock['lockfile'], 'w') lock['fp'].flush() try: fcntl.lockf(lock['fp'], fcntl.LOCK_EX | fcntl.LOCK_NB) except IOError: lock['locked'] = False lock['fp'].close() else: lock['locked'] = True return(lock) def unlockScan(lock): if not lock['locked']: return fcntl.lockf(lock['fp'], fcntl.LOCK_UN) if os.path.isfile(lock['lockfile']): os.unlink(lock['lockfile']) return ################# def redisAuth(cfg): "initialize redis db object" return(redis.StrictRedis(host=cfg['redis_host'], port=cfg['redis_port'], db=cfg['redis_db'])) def photoInHigherGroup(photo_id, vieworfav, mincount): "check if the photo is in a higher group in redis db" return(False) def getFavsFromDB(flickr, db, photo_id): "returns the photos favorites count from the db or from flickr" favs = db.hget(photo_id, 'favs') if favs: return(int(favs)) favs = int(getFavsFromFlickr(flickr, photo_id)) saveFavs(db, photo_id, favs) return(favs) def saveFavs(db, photo_id, favs): "saves photo_id and favs to redis db" db.hset(photo_id, 'favs', favs) db.hset(photo_id, 'ts', time()) return
mpl-2.0
-4,186,878,343,005,086,000
39.61874
154
0.534861
false
JhonyVilla/blog
pelican-plugins/assets/assets.py
1
2672
# -*- coding: utf-8 -*- """ Asset management plugin for Pelican =================================== This plugin allows you to use the `webassets`_ module to manage assets such as CSS and JS files. The ASSET_URL is set to a relative url to honor Pelican's RELATIVE_URLS setting. This requires the use of SITEURL in the templates:: <link rel="stylesheet" href="{{ SITEURL }}/{{ ASSET_URL }}"> .. _webassets: https://webassets.readthedocs.org/ """ from __future__ import unicode_literals import os import logging from pelican import signals logger = logging.getLogger(__name__) try: import webassets from webassets import Environment from webassets.ext.jinja2 import AssetsExtension except ImportError: webassets = None def add_jinja2_ext(pelican): """Add Webassets to Jinja2 extensions in Pelican settings.""" if 'JINJA_ENVIRONMENT' in pelican.settings: # pelican 3.7+ pelican.settings['JINJA_ENVIRONMENT']['extensions'].append(AssetsExtension) else: pelican.settings['JINJA_EXTENSIONS'].append(AssetsExtension) def create_assets_env(generator): """Define the assets environment and pass it to the generator.""" theme_static_dir = generator.settings['THEME_STATIC_DIR'] assets_destination = os.path.join(generator.output_path, theme_static_dir) generator.env.assets_environment = Environment( assets_destination, theme_static_dir) if 'ASSET_CONFIG' in generator.settings: for item in generator.settings['ASSET_CONFIG']: generator.env.assets_environment.config[item[0]] = item[1] if 'ASSET_BUNDLES' in generator.settings: for name, args, kwargs in generator.settings['ASSET_BUNDLES']: generator.env.assets_environment.register(name, *args, **kwargs) if 'ASSET_DEBUG' in generator.settings: generator.env.assets_environment.debug = generator.settings['ASSET_DEBUG'] elif logging.getLevelName(logger.getEffectiveLevel()) == "DEBUG": generator.env.assets_environment.debug = True for path in (generator.settings['THEME_STATIC_PATHS'] + generator.settings.get('ASSET_SOURCE_PATHS', [])): full_path = os.path.join(generator.theme, path) generator.env.assets_environment.append_path(full_path) def register(): """Plugin registration.""" if webassets: signals.initialized.connect(add_jinja2_ext) signals.generator_init.connect(create_assets_env) else: logger.warning('`assets` failed to load dependency `webassets`.' '`assets` plugin not loaded.')
gpl-3.0
-8,804,839,349,497,951,000
33.626667
83
0.666542
false
samuelmaudo/yepes
yepes/contrib/datamigrations/importation_plans/base.py
1
5591
# -*- coding:utf-8 -*- from __future__ import unicode_literals import collections import operator from django.db import transaction from django.db.models import F, Q from django.utils.six.moves import reduce from django.utils.text import camel_case_to_spaces, capfirst from yepes.contrib.datamigrations.exceptions import ( UnableToCreateError, UnableToImportError, UnableToUpdateError, ) from yepes.utils.iterators import isplit from yepes.utils.properties import class_property class ImportationPlan(object): """ Base class for data-importation plan implementations. Subclasses must at least overwrite ``import_batch()``. """ inserts_data = True updates_data = True @class_property def name(cls): name = camel_case_to_spaces(cls.__name__) if name.endswith('plan'): name = name[:-5] if name.endswith('importation'): name = name[:-12] return '_'.join(name.split()) @class_property def verbose_name(cls): return capfirst(cls.name.replace('_', ' ').strip()) def __init__(self, migration): self.migration = migration def check_conditions(self): if not self.migration.can_import: raise UnableToImportError if self.inserts_data and not self.migration.can_create: raise UnableToCreateError if self.updates_data and not self.migration.can_update: raise UnableToUpdateError def finalize_importation(self): pass def import_batch(self, batch): raise NotImplementedError('Subclasses of ImportationPlan must override import_batch() method') def prepare_batch(self, batch): return batch def prepare_importation(self): pass def run(self, data, batch_size=100): self.check_conditions() with transaction.atomic(): self.prepare_importation() for batch in isplit(data, batch_size): self.import_batch(self.prepare_batch(batch)) self.finalize_importation() class ModelImportationPlan(ImportationPlan): """ Base class for data-importation plan implementations. Subclasses must at least overwrite ``import_batch()``. """ def get_existing_keys(self, batch): key = self.migration.primary_key if not batch or key is None: return set() qs = self.get_existing_queryset(batch) if not isinstance(key, collections.Iterable): return set(qs.values_list(key.attname, flat=True).iterator()) else: key_attrs = [k.attname for k in key] return set(qs.values_list(*key_attrs).iterator()) def get_existing_objects(self, batch): key = self.migration.primary_key if not batch or key is None: return {} qs = self.get_existing_queryset(batch) if not isinstance(key, collections.Iterable): key_attr = key.attname return { getattr(obj, key_attr): obj for obj in qs.iterator() } else: key_attrs = [k.attname for k in key] return { tuple(getattr(obj, attr) for attr in key_attrs): obj for obj in qs.iterator() } def get_existing_queryset(self, batch): key = self.migration.primary_key model = self.migration.model manager = model._base_manager if not batch or key is None: return manager.none() if not isinstance(key, collections.Iterable): key_attr = key.attname return manager.filter(**{ '{0}__in'.format(key_attr): ( row[key_attr] for row in batch ) }) else: key_attrs = [k.attname for k in key] return manager.filter(reduce(operator.or_, ( Q(**{ attr: row[attr] for attr in key_attrs }) for row in batch ))) def prepare_batch(self, batch): m = self.migration if m.natural_foreign_keys is not None: for fld in m.natural_foreign_keys: attr = fld.attname path = fld.path rel_field = m.model_fields[fld][-1] rel_manager = rel_field.model._base_manager keys = dict( rel_manager.filter(**{ '{0}__in'.format(rel_field.name): { row[path] for row in batch } }).values_list( rel_field.name, 'pk', ).iterator() ) if not m.ignore_missing_foreign_keys: for row in batch: row[attr] = keys[row.pop(path)] else: erroneous_rows = [] for i, row in enumerate(batch): try: value = keys[row.pop(path)] except KeyError: erroneous_rows.append(i) else: row[attr] = value for i in reversed(erroneous_rows): del batch[i] return batch
bsd-3-clause
1,023,181,490,690,836,600
29.551913
102
0.519943
false
j-towns/fastar
fastar/test_util.py
1
3377
from itertools import chain from random import shuffle import numpy as np from jax import numpy as jnp, test_util as jtu from jax.util import safe_map, safe_zip from jax.tree_util import tree_multimap, tree_flatten, tree_map from fastar import lazy_eval, lazy_eval_fixed_point, LazyArray map = safe_map zip = safe_zip def check_shape_and_dtype(expected, actual): assert expected.shape == actual.shape assert expected.dtype == actual.dtype def naive_fixed_point(fun, arg): arg, arg_prev = fun(arg), arg while not jnp.all(arg == arg_prev): arg, arg_prev = fun(arg), arg return arg def check_child_counts(arrs): visited = set() def _check_child_counts(arrs): for arr in arrs: if isinstance(arr, LazyArray) and arr not in visited: assert type(arr.child_counts) is np.ndarray assert arr.child_counts.dtype == np.int64 assert np.all(arr.child_counts == 0) visited.add(arr) _check_child_counts(arr.eqn.invars) _check_child_counts(arrs) def check_state(arrs): # Make sure none of the elements are in the temporary REQUESTED state visited = set() def _check_state(arrs): for arr in arrs: if isinstance(arr, LazyArray) and arr not in visited: assert np.all((arr.state == 0) | (arr.state == 1)) visited.add(arr) _check_state(arr.eqn.invars) _check_state(arrs) def _identity(x): return x + np.zeros((), x.dtype) def check_lazy_fun(fun_, *args, atol=None, rtol=None): def fun(*args): args = tree_map(_identity, args) return fun_(*args) out_expected_flat, out_expected_tree = tree_flatten(fun(*args)) out_flat, out_tree = tree_flatten(lazy_eval(fun, *args)) assert out_expected_tree == out_tree tree_multimap(check_shape_and_dtype, out_expected_flat, out_flat) jtu.check_close(out_expected_flat, [o[:] if o.shape else o[()] for o in out_flat], atol, rtol) check_child_counts(out_flat) check_state(out_flat) out_flat, _ = tree_flatten(lazy_eval(fun, *args)) indices = [] for n, o in enumerate(out_flat): indices.append([(n, i) for i in np.ndindex(*o.shape)]) indices = list(chain(*indices)) shuffle(indices) indices = indices[:5] for n, i in indices: jtu.check_close(out_flat[n][i], out_expected_flat[n][i], atol, rtol) assert np.dtype(out_flat[n][i]) == np.dtype(out_expected_flat[n][i]) check_child_counts(out_flat) check_state(out_flat) def check_lazy_fixed_point(fun, mock_arg, atol=None, rtol=None): out_expected_flat, out_expected_tree = tree_flatten( naive_fixed_point(fun, mock_arg)) out_flat, out_tree = tree_flatten(lazy_eval_fixed_point(fun, mock_arg)) assert out_expected_tree == out_tree tree_multimap(check_shape_and_dtype, out_expected_flat, out_flat) jtu.check_close(out_expected_flat, [o[:] for o in out_flat], atol, rtol) check_child_counts(out_flat) check_state(out_flat) out_flat, out_tree = tree_flatten(lazy_eval_fixed_point(fun, mock_arg)) indices = [] for n, o in enumerate(out_flat): indices.append([(n, i) for i in np.ndindex(*o.shape)]) indices = list(chain(*indices)) shuffle(indices) indices = indices[:5] for n, i in indices: jtu.check_close(out_flat[n][i], out_expected_flat[n][i], atol, rtol) assert np.dtype(out_flat[n][i]) == np.dtype(out_expected_flat[n][i]) check_child_counts(out_flat) check_state(out_flat)
mit
8,212,361,584,758,945,000
34.177083
77
0.674267
false
walafc0/soclib
soclib/iss/iss_profiler/bin/iss_profiler2profile.py
1
2939
#!/usr/bin/env python from dsx.util.objdumper import * import sys __id__ = "$Id: iss_profiler2profile.py 917 2009-03-12 10:10:06Z nipo $" __version__ = "$Revision: 917 $" class SymLooker: def __init__(self, arch, obj): self.__syms = {} dumper = ObjDumper(arch, obj) for section in dumper: for sym in section: self.__syms[sym.addr] = sym.name self.__addrs = self.__syms.keys() self.__addrs.sort() self.__addr2sym = {} def is_entry(self, addr): return addr in self.__syms def lookup_sym(self, addr): last_addr = None for sym_addr in self.__addrs: if sym_addr > addr: break last_addr = sym_addr if last_addr is None: print hex(addr), "not found in", self.__addrs return self.__syms[last_addr] def find_sym(self, addr): try: return self.__addr2sym[addr] except KeyError: sym = self.lookup_sym(addr) self.__addr2sym[addr] = sym return sym def per_sym(self, ctor): ret = {} for k in self.syms(): ret[k] = ctor(k) return ret def syms(self): return self.__syms.values() arch = sys.argv[1] obj = sys.argv[2] sl = SymLooker(arch, obj) class Counter: def __init__(self, sym): self.sym = sym self.total = 0 self.frozen = 0 self.running = 0 self.runs = 0 def inc(self, running, entering): if entering: self.runs += 1 if running: self.running += 1 else: self.frozen += 1 self.total += 1 def cmp_total(self, other): return cmp(self.total, other.total) def cmp_running(self, other): return cmp(self.running, other.running) def missing(self): if self.total: return float(self.frozen)/float(self.total) else: return 0 def cmp_missing(self, other): return cmp(self.missing(), other.missing()) def cmp_runs(self, other): return cmp(self.runs, other.runs) def cpr(self): if self.runs: return float(self.total)/float(self.runs) else: return 0 def cmp_cpr(self, other): return cmp(self.cpr(), other.cpr()) def __repr__(self): return "%s runs %04d total %06d, cpr: %06d, running time %06d, frz %06d, miss %f"%( self.sym.ljust(30), self.runs, self.total, self.cpr(), self.running, self.frozen, self.missing()) if sys.argv[3:]: for xaddr in sys.argv[3:]: addr = int(xaddr, 16) print hex(addr), sl.find_sym(addr) else: count = sl.per_sym(Counter) total = 0 last_func = '' for line in sys.stdin.readlines(): line = line.strip() running, asked, xaddr = line.split(' ') if asked == '+': total += 1 running = running == 'R' addr = int(xaddr, 16) sym = sl.find_sym(addr) entry = sl.is_entry(addr) count[sym].inc(running, last_func != sym and entry) last_func = sym v = count.values() v = filter(lambda x:x.runs > 15, v) v.sort(Counter.cmp_runs) v.reverse() print "Most runs" for i in v: print i v.sort(Counter.cmp_running) v.reverse() print "Most on CPU" for i in v: print i v.sort(Counter.cmp_missing) v.reverse() print "Most missing" for i in v: print i
lgpl-2.1
-5,641,330,111,067,963,000
21.960938
100
0.638653
false
ayepezv/GAD_ERP
openerp/addons/test_impex/models.py
2
4918
# -*- coding: utf-8 -*- # Part of Odoo. See LICENSE file for full copyright and licensing details. from odoo import api, fields, models def selection_fn(model): return list(enumerate(["Corge", "Grault", "Wheee", "Moog"])) def compute_fn(records): for record in records: record.value = 3 def inverse_fn(records): pass MODELS = [ ('boolean', fields.Boolean()), ('integer', fields.Integer()), ('float', fields.Float()), ('decimal', fields.Float(digits=(16, 3))), ('string.bounded', fields.Char(size=16)), ('string.required', fields.Char(size=None, required=True)), ('string', fields.Char(size=None)), ('date', fields.Date()), ('datetime', fields.Datetime()), ('text', fields.Text()), ('selection', fields.Selection([(1, "Foo"), (2, "Bar"), (3, "Qux"), (4, '')])), # here use size=-1 to store the values as integers instead of strings ('selection.function', fields.Selection(selection_fn, size=-1)), # just relate to an integer ('many2one', fields.Many2one('export.integer')), ('one2many', fields.One2many('export.one2many.child', 'parent_id')), ('many2many', fields.Many2many('export.many2many.other')), ('function', fields.Integer(compute=compute_fn, inverse=inverse_fn)), # related: specialization of fields.function, should work the same way # TODO: reference ] for name, field in MODELS: class NewModel(models.Model): _name = 'export.%s' % name const = fields.Integer(default=4) value = field @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] @api.model def name_search(self, name='', args=None, operator='ilike', limit=100): if isinstance(name, basestring) and name.split(':')[0] == self._name: records = self.search([('value', operator, int(name.split(':')[1]))]) return records.name_get() else: return [] class One2ManyChild(models.Model): _name = 'export.one2many.child' # FIXME: orm.py:1161, fix to name_get on m2o field _rec_name = 'value' parent_id = fields.Many2one('export.one2many') str = fields.Char() value = fields.Integer() @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] @api.model def name_search(self, name='', args=None, operator='ilike', limit=100): if isinstance(name, basestring) and name.split(':')[0] == self._name: records = self.search([('value', operator, int(name.split(':')[1]))]) return records.name_get() else: return [] class One2ManyMultiple(models.Model): _name = 'export.one2many.multiple' parent_id = fields.Many2one('export.one2many.recursive') const = fields.Integer(default=36) child1 = fields.One2many('export.one2many.child.1', 'parent_id') child2 = fields.One2many('export.one2many.child.2', 'parent_id') class One2ManyChildMultiple(models.Model): _name = 'export.one2many.multiple.child' # FIXME: orm.py:1161, fix to name_get on m2o field _rec_name = 'value' parent_id = fields.Many2one('export.one2many.multiple') str = fields.Char() value = fields.Integer() @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] class One2ManyChild1(models.Model): _name = 'export.one2many.child.1' _inherit = 'export.one2many.multiple.child' class One2ManyChild2(models.Model): _name = 'export.one2many.child.2' _inherit = 'export.one2many.multiple.child' class Many2ManyChild(models.Model): _name = 'export.many2many.other' # FIXME: orm.py:1161, fix to name_get on m2o field _rec_name = 'value' str = fields.Char() value = fields.Integer() @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] @api.model def name_search(self, name='', args=None, operator='ilike', limit=100): if isinstance(name, basestring) and name.split(':')[0] == self._name: records = self.search([('value', operator, int(name.split(':')[1]))]) return records.name_get() else: return [] class SelectionWithDefault(models.Model): _name = 'export.selection.withdefault' const = fields.Integer(default=4) value = fields.Selection([(1, "Foo"), (2, "Bar")], default=2) class RecO2M(models.Model): _name = 'export.one2many.recursive' value = fields.Integer() child = fields.One2many('export.one2many.multiple', 'parent_id') class OnlyOne(models.Model): _name = 'export.unique' value = fields.Integer() _sql_constraints = [ ('value_unique', 'unique (value)', "The value must be unique"), ]
gpl-3.0
4,212,233,521,099,419,000
30.729032
89
0.618544
false
xuru/pyvisdk
pyvisdk/do/virtual_machine_file_layout.py
1
1433
import logging from pyvisdk.exceptions import InvalidArgumentError ######################################## # Automatically generated, do not edit. ######################################## log = logging.getLogger(__name__) def VirtualMachineFileLayout(vim, *args, **kwargs): '''Describes the set of files that makes up a virtual machine on disk. The file layout is broken into 4 major sections:* Configuration: Files stored in the configuration directory * Log: Files stored in the log directory * Disk: Files stored relative to a disk configuration file * Snapshot: Stored in the snapshot directoryOften the same directory is used for configuration, log, disk and snapshots.''' obj = vim.client.factory.create('ns0:VirtualMachineFileLayout') # do some validation checking... if (len(args) + len(kwargs)) < 0: raise IndexError('Expected at least 1 arguments got: %d' % len(args)) required = [ ] optional = [ 'configFile', 'disk', 'logFile', 'snapshot', 'swapFile', 'dynamicProperty', 'dynamicType' ] for name, arg in zip(required+optional, args): setattr(obj, name, arg) for name, value in kwargs.items(): if name in required + optional: setattr(obj, name, value) else: raise InvalidArgumentError("Invalid argument: %s. Expected one of %s" % (name, ", ".join(required + optional))) return obj
mit
-7,937,865,886,592,713,000
35.769231
124
0.635729
false
steven-martins/Marking
back/marks/migrations/0001_initial.py
1
3773
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations from django.conf import settings import datetime class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] operations = [ migrations.CreateModel( name='Mark', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('result', models.IntegerField()), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Picture', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('file', models.ImageField(max_length=150, upload_to='picture/%Y/%m/%d')), ('title', models.CharField(max_length=50)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Project', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('name', models.CharField(max_length=100)), ('description', models.TextField()), ('marks', models.ManyToManyField(to=settings.AUTH_USER_MODEL, through='marks.Mark', related_name='project_marks_student')), ('members', models.ManyToManyField(to=settings.AUTH_USER_MODEL)), ('pictures', models.ManyToManyField(to='marks.Picture', blank=True)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Question', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('title', models.CharField(max_length=200)), ('detail', models.CharField(max_length=250, blank=True)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Student', fields=[ ('login', models.CharField(serialize=False, max_length=10, primary_key=True)), ('last_connection', models.DateTimeField(blank=True, default=datetime.datetime.now)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Timeslot', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('title', models.CharField(max_length=100)), ], options={ }, bases=(models.Model,), ), migrations.AddField( model_name='project', name='timeslot', field=models.ForeignKey(to='marks.Timeslot', blank=True), preserve_default=True, ), migrations.AddField( model_name='mark', name='project', field=models.ForeignKey(to='marks.Project'), preserve_default=True, ), migrations.AddField( model_name='mark', name='question', field=models.ForeignKey(to='marks.Question'), preserve_default=True, ), migrations.AddField( model_name='mark', name='student', field=models.ForeignKey(to=settings.AUTH_USER_MODEL), preserve_default=True, ), ]
mit
3,561,885,093,581,885,000
34.59434
139
0.51789
false
linebp/pandas
pandas/tests/series/test_indexing.py
1
88099
# coding=utf-8 # pylint: disable-msg=E1101,W0612 import pytest from datetime import datetime, timedelta from numpy import nan import numpy as np import pandas as pd import pandas._libs.index as _index from pandas.core.dtypes.common import is_integer, is_scalar from pandas import (Index, Series, DataFrame, isnull, date_range, NaT, MultiIndex, Timestamp, DatetimeIndex, Timedelta) from pandas.core.indexing import IndexingError from pandas.tseries.offsets import BDay from pandas._libs import tslib, lib from pandas.compat import lrange, range from pandas import compat from pandas.util.testing import (slow, assert_series_equal, assert_almost_equal, assert_frame_equal) import pandas.util.testing as tm from pandas.tests.series.common import TestData JOIN_TYPES = ['inner', 'outer', 'left', 'right'] class TestSeriesIndexing(TestData): def test_get(self): # GH 6383 s = Series(np.array([43, 48, 60, 48, 50, 51, 50, 45, 57, 48, 56, 45, 51, 39, 55, 43, 54, 52, 51, 54])) result = s.get(25, 0) expected = 0 assert result == expected s = Series(np.array([43, 48, 60, 48, 50, 51, 50, 45, 57, 48, 56, 45, 51, 39, 55, 43, 54, 52, 51, 54]), index=pd.Float64Index( [25.0, 36.0, 49.0, 64.0, 81.0, 100.0, 121.0, 144.0, 169.0, 196.0, 1225.0, 1296.0, 1369.0, 1444.0, 1521.0, 1600.0, 1681.0, 1764.0, 1849.0, 1936.0], dtype='object')) result = s.get(25, 0) expected = 43 assert result == expected # GH 7407 # with a boolean accessor df = pd.DataFrame({'i': [0] * 3, 'b': [False] * 3}) vc = df.i.value_counts() result = vc.get(99, default='Missing') assert result == 'Missing' vc = df.b.value_counts() result = vc.get(False, default='Missing') assert result == 3 result = vc.get(True, default='Missing') assert result == 'Missing' def test_get_nan(self): # GH 8569 s = pd.Float64Index(range(10)).to_series() assert s.get(np.nan) is None assert s.get(np.nan, default='Missing') == 'Missing' # ensure that fixing the above hasn't broken get # with multiple elements idx = [20, 30] assert_series_equal(s.get(idx), Series([np.nan] * 2, index=idx)) idx = [np.nan, np.nan] assert_series_equal(s.get(idx), Series([np.nan] * 2, index=idx)) def test_delitem(self): # GH 5542 # should delete the item inplace s = Series(lrange(5)) del s[0] expected = Series(lrange(1, 5), index=lrange(1, 5)) assert_series_equal(s, expected) del s[1] expected = Series(lrange(2, 5), index=lrange(2, 5)) assert_series_equal(s, expected) # empty s = Series() def f(): del s[0] pytest.raises(KeyError, f) # only 1 left, del, add, del s = Series(1) del s[0] assert_series_equal(s, Series(dtype='int64', index=Index( [], dtype='int64'))) s[0] = 1 assert_series_equal(s, Series(1)) del s[0] assert_series_equal(s, Series(dtype='int64', index=Index( [], dtype='int64'))) # Index(dtype=object) s = Series(1, index=['a']) del s['a'] assert_series_equal(s, Series(dtype='int64', index=Index( [], dtype='object'))) s['a'] = 1 assert_series_equal(s, Series(1, index=['a'])) del s['a'] assert_series_equal(s, Series(dtype='int64', index=Index( [], dtype='object'))) def test_getitem_setitem_ellipsis(self): s = Series(np.random.randn(10)) np.fix(s) result = s[...] assert_series_equal(result, s) s[...] = 5 assert (result == 5).all() def test_getitem_negative_out_of_bounds(self): s = Series(tm.rands_array(5, 10), index=tm.rands_array(10, 10)) pytest.raises(IndexError, s.__getitem__, -11) pytest.raises(IndexError, s.__setitem__, -11, 'foo') def test_pop(self): # GH 6600 df = DataFrame({'A': 0, 'B': np.arange(5, dtype='int64'), 'C': 0, }) k = df.iloc[4] result = k.pop('B') assert result == 4 expected = Series([0, 0], index=['A', 'C'], name=4) assert_series_equal(k, expected) def test_getitem_get(self): idx1 = self.series.index[5] idx2 = self.objSeries.index[5] assert self.series[idx1] == self.series.get(idx1) assert self.objSeries[idx2] == self.objSeries.get(idx2) assert self.series[idx1] == self.series[5] assert self.objSeries[idx2] == self.objSeries[5] assert self.series.get(-1) == self.series.get(self.series.index[-1]) assert self.series[5] == self.series.get(self.series.index[5]) # missing d = self.ts.index[0] - BDay() pytest.raises(KeyError, self.ts.__getitem__, d) # None # GH 5652 for s in [Series(), Series(index=list('abc'))]: result = s.get(None) assert result is None def test_iloc(self): s = Series(np.random.randn(10), index=lrange(0, 20, 2)) for i in range(len(s)): result = s.iloc[i] exp = s[s.index[i]] assert_almost_equal(result, exp) # pass a slice result = s.iloc[slice(1, 3)] expected = s.loc[2:4] assert_series_equal(result, expected) # test slice is a view result[:] = 0 assert (s[1:3] == 0).all() # list of integers result = s.iloc[[0, 2, 3, 4, 5]] expected = s.reindex(s.index[[0, 2, 3, 4, 5]]) assert_series_equal(result, expected) def test_iloc_nonunique(self): s = Series([0, 1, 2], index=[0, 1, 0]) assert s.iloc[2] == 2 def test_getitem_regression(self): s = Series(lrange(5), index=lrange(5)) result = s[lrange(5)] assert_series_equal(result, s) def test_getitem_setitem_slice_bug(self): s = Series(lrange(10), lrange(10)) result = s[-12:] assert_series_equal(result, s) result = s[-7:] assert_series_equal(result, s[3:]) result = s[:-12] assert_series_equal(result, s[:0]) s = Series(lrange(10), lrange(10)) s[-12:] = 0 assert (s == 0).all() s[:-12] = 5 assert (s == 0).all() def test_getitem_int64(self): idx = np.int64(5) assert self.ts[idx] == self.ts[5] def test_getitem_fancy(self): slice1 = self.series[[1, 2, 3]] slice2 = self.objSeries[[1, 2, 3]] assert self.series.index[2] == slice1.index[1] assert self.objSeries.index[2] == slice2.index[1] assert self.series[2] == slice1[1] assert self.objSeries[2] == slice2[1] def test_getitem_boolean(self): s = self.series mask = s > s.median() # passing list is OK result = s[list(mask)] expected = s[mask] assert_series_equal(result, expected) tm.assert_index_equal(result.index, s.index[mask]) def test_getitem_boolean_empty(self): s = Series([], dtype=np.int64) s.index.name = 'index_name' s = s[s.isnull()] assert s.index.name == 'index_name' assert s.dtype == np.int64 # GH5877 # indexing with empty series s = Series(['A', 'B']) expected = Series(np.nan, index=['C'], dtype=object) result = s[Series(['C'], dtype=object)] assert_series_equal(result, expected) s = Series(['A', 'B']) expected = Series(dtype=object, index=Index([], dtype='int64')) result = s[Series([], dtype=object)] assert_series_equal(result, expected) # invalid because of the boolean indexer # that's empty or not-aligned def f(): s[Series([], dtype=bool)] pytest.raises(IndexingError, f) def f(): s[Series([True], dtype=bool)] pytest.raises(IndexingError, f) def test_getitem_generator(self): gen = (x > 0 for x in self.series) result = self.series[gen] result2 = self.series[iter(self.series > 0)] expected = self.series[self.series > 0] assert_series_equal(result, expected) assert_series_equal(result2, expected) def test_type_promotion(self): # GH12599 s = pd.Series() s["a"] = pd.Timestamp("2016-01-01") s["b"] = 3.0 s["c"] = "foo" expected = Series([pd.Timestamp("2016-01-01"), 3.0, "foo"], index=["a", "b", "c"]) assert_series_equal(s, expected) def test_getitem_boolean_object(self): # using column from DataFrame s = self.series mask = s > s.median() omask = mask.astype(object) # getitem result = s[omask] expected = s[mask] assert_series_equal(result, expected) # setitem s2 = s.copy() cop = s.copy() cop[omask] = 5 s2[mask] = 5 assert_series_equal(cop, s2) # nans raise exception omask[5:10] = np.nan pytest.raises(Exception, s.__getitem__, omask) pytest.raises(Exception, s.__setitem__, omask, 5) def test_getitem_setitem_boolean_corner(self): ts = self.ts mask_shifted = ts.shift(1, freq=BDay()) > ts.median() # these used to raise...?? pytest.raises(Exception, ts.__getitem__, mask_shifted) pytest.raises(Exception, ts.__setitem__, mask_shifted, 1) # ts[mask_shifted] # ts[mask_shifted] = 1 pytest.raises(Exception, ts.loc.__getitem__, mask_shifted) pytest.raises(Exception, ts.loc.__setitem__, mask_shifted, 1) # ts.loc[mask_shifted] # ts.loc[mask_shifted] = 2 def test_getitem_setitem_slice_integers(self): s = Series(np.random.randn(8), index=[2, 4, 6, 8, 10, 12, 14, 16]) result = s[:4] expected = s.reindex([2, 4, 6, 8]) assert_series_equal(result, expected) s[:4] = 0 assert (s[:4] == 0).all() assert not (s[4:] == 0).any() def test_getitem_setitem_datetime_tz_pytz(self): from pytz import timezone as tz from pandas import date_range N = 50 # testing with timezone, GH #2785 rng = date_range('1/1/1990', periods=N, freq='H', tz='US/Eastern') ts = Series(np.random.randn(N), index=rng) # also test Timestamp tz handling, GH #2789 result = ts.copy() result["1990-01-01 09:00:00+00:00"] = 0 result["1990-01-01 09:00:00+00:00"] = ts[4] assert_series_equal(result, ts) result = ts.copy() result["1990-01-01 03:00:00-06:00"] = 0 result["1990-01-01 03:00:00-06:00"] = ts[4] assert_series_equal(result, ts) # repeat with datetimes result = ts.copy() result[datetime(1990, 1, 1, 9, tzinfo=tz('UTC'))] = 0 result[datetime(1990, 1, 1, 9, tzinfo=tz('UTC'))] = ts[4] assert_series_equal(result, ts) result = ts.copy() # comparison dates with datetime MUST be localized! date = tz('US/Central').localize(datetime(1990, 1, 1, 3)) result[date] = 0 result[date] = ts[4] assert_series_equal(result, ts) def test_getitem_setitem_datetime_tz_dateutil(self): from dateutil.tz import tzutc from pandas._libs.tslib import _dateutil_gettz as gettz tz = lambda x: tzutc() if x == 'UTC' else gettz( x) # handle special case for utc in dateutil from pandas import date_range N = 50 # testing with timezone, GH #2785 rng = date_range('1/1/1990', periods=N, freq='H', tz='America/New_York') ts = Series(np.random.randn(N), index=rng) # also test Timestamp tz handling, GH #2789 result = ts.copy() result["1990-01-01 09:00:00+00:00"] = 0 result["1990-01-01 09:00:00+00:00"] = ts[4] assert_series_equal(result, ts) result = ts.copy() result["1990-01-01 03:00:00-06:00"] = 0 result["1990-01-01 03:00:00-06:00"] = ts[4] assert_series_equal(result, ts) # repeat with datetimes result = ts.copy() result[datetime(1990, 1, 1, 9, tzinfo=tz('UTC'))] = 0 result[datetime(1990, 1, 1, 9, tzinfo=tz('UTC'))] = ts[4] assert_series_equal(result, ts) result = ts.copy() result[datetime(1990, 1, 1, 3, tzinfo=tz('America/Chicago'))] = 0 result[datetime(1990, 1, 1, 3, tzinfo=tz('America/Chicago'))] = ts[4] assert_series_equal(result, ts) def test_getitem_setitem_datetimeindex(self): N = 50 # testing with timezone, GH #2785 rng = date_range('1/1/1990', periods=N, freq='H', tz='US/Eastern') ts = Series(np.random.randn(N), index=rng) result = ts["1990-01-01 04:00:00"] expected = ts[4] assert result == expected result = ts.copy() result["1990-01-01 04:00:00"] = 0 result["1990-01-01 04:00:00"] = ts[4] assert_series_equal(result, ts) result = ts["1990-01-01 04:00:00":"1990-01-01 07:00:00"] expected = ts[4:8] assert_series_equal(result, expected) result = ts.copy() result["1990-01-01 04:00:00":"1990-01-01 07:00:00"] = 0 result["1990-01-01 04:00:00":"1990-01-01 07:00:00"] = ts[4:8] assert_series_equal(result, ts) lb = "1990-01-01 04:00:00" rb = "1990-01-01 07:00:00" result = ts[(ts.index >= lb) & (ts.index <= rb)] expected = ts[4:8] assert_series_equal(result, expected) # repeat all the above with naive datetimes result = ts[datetime(1990, 1, 1, 4)] expected = ts[4] assert result == expected result = ts.copy() result[datetime(1990, 1, 1, 4)] = 0 result[datetime(1990, 1, 1, 4)] = ts[4] assert_series_equal(result, ts) result = ts[datetime(1990, 1, 1, 4):datetime(1990, 1, 1, 7)] expected = ts[4:8] assert_series_equal(result, expected) result = ts.copy() result[datetime(1990, 1, 1, 4):datetime(1990, 1, 1, 7)] = 0 result[datetime(1990, 1, 1, 4):datetime(1990, 1, 1, 7)] = ts[4:8] assert_series_equal(result, ts) lb = datetime(1990, 1, 1, 4) rb = datetime(1990, 1, 1, 7) result = ts[(ts.index >= lb) & (ts.index <= rb)] expected = ts[4:8] assert_series_equal(result, expected) result = ts[ts.index[4]] expected = ts[4] assert result == expected result = ts[ts.index[4:8]] expected = ts[4:8] assert_series_equal(result, expected) result = ts.copy() result[ts.index[4:8]] = 0 result[4:8] = ts[4:8] assert_series_equal(result, ts) # also test partial date slicing result = ts["1990-01-02"] expected = ts[24:48] assert_series_equal(result, expected) result = ts.copy() result["1990-01-02"] = 0 result["1990-01-02"] = ts[24:48] assert_series_equal(result, ts) def test_getitem_setitem_periodindex(self): from pandas import period_range N = 50 rng = period_range('1/1/1990', periods=N, freq='H') ts = Series(np.random.randn(N), index=rng) result = ts["1990-01-01 04"] expected = ts[4] assert result == expected result = ts.copy() result["1990-01-01 04"] = 0 result["1990-01-01 04"] = ts[4] assert_series_equal(result, ts) result = ts["1990-01-01 04":"1990-01-01 07"] expected = ts[4:8] assert_series_equal(result, expected) result = ts.copy() result["1990-01-01 04":"1990-01-01 07"] = 0 result["1990-01-01 04":"1990-01-01 07"] = ts[4:8] assert_series_equal(result, ts) lb = "1990-01-01 04" rb = "1990-01-01 07" result = ts[(ts.index >= lb) & (ts.index <= rb)] expected = ts[4:8] assert_series_equal(result, expected) # GH 2782 result = ts[ts.index[4]] expected = ts[4] assert result == expected result = ts[ts.index[4:8]] expected = ts[4:8] assert_series_equal(result, expected) result = ts.copy() result[ts.index[4:8]] = 0 result[4:8] = ts[4:8] assert_series_equal(result, ts) def test_getitem_median_slice_bug(self): index = date_range('20090415', '20090519', freq='2B') s = Series(np.random.randn(13), index=index) indexer = [slice(6, 7, None)] result = s[indexer] expected = s[indexer[0]] assert_series_equal(result, expected) def test_getitem_out_of_bounds(self): # don't segfault, GH #495 pytest.raises(IndexError, self.ts.__getitem__, len(self.ts)) # GH #917 s = Series([]) pytest.raises(IndexError, s.__getitem__, -1) def test_getitem_setitem_integers(self): # caused bug without test s = Series([1, 2, 3], ['a', 'b', 'c']) assert s.iloc[0] == s['a'] s.iloc[0] = 5 tm.assert_almost_equal(s['a'], 5) def test_getitem_box_float64(self): value = self.ts[5] assert isinstance(value, np.float64) def test_getitem_ambiguous_keyerror(self): s = Series(lrange(10), index=lrange(0, 20, 2)) pytest.raises(KeyError, s.__getitem__, 1) pytest.raises(KeyError, s.loc.__getitem__, 1) def test_getitem_unordered_dup(self): obj = Series(lrange(5), index=['c', 'a', 'a', 'b', 'b']) assert is_scalar(obj['c']) assert obj['c'] == 0 def test_getitem_dups_with_missing(self): # breaks reindex, so need to use .loc internally # GH 4246 s = Series([1, 2, 3, 4], ['foo', 'bar', 'foo', 'bah']) expected = s.loc[['foo', 'bar', 'bah', 'bam']] result = s[['foo', 'bar', 'bah', 'bam']] assert_series_equal(result, expected) def test_getitem_dups(self): s = Series(range(5), index=['A', 'A', 'B', 'C', 'C'], dtype=np.int64) expected = Series([3, 4], index=['C', 'C'], dtype=np.int64) result = s['C'] assert_series_equal(result, expected) def test_getitem_dataframe(self): rng = list(range(10)) s = pd.Series(10, index=rng) df = pd.DataFrame(rng, index=rng) pytest.raises(TypeError, s.__getitem__, df > 5) def test_getitem_callable(self): # GH 12533 s = pd.Series(4, index=list('ABCD')) result = s[lambda x: 'A'] assert result == s.loc['A'] result = s[lambda x: ['A', 'B']] tm.assert_series_equal(result, s.loc[['A', 'B']]) result = s[lambda x: [True, False, True, True]] tm.assert_series_equal(result, s.iloc[[0, 2, 3]]) def test_setitem_ambiguous_keyerror(self): s = Series(lrange(10), index=lrange(0, 20, 2)) # equivalent of an append s2 = s.copy() s2[1] = 5 expected = s.append(Series([5], index=[1])) assert_series_equal(s2, expected) s2 = s.copy() s2.loc[1] = 5 expected = s.append(Series([5], index=[1])) assert_series_equal(s2, expected) def test_setitem_float_labels(self): # note labels are floats s = Series(['a', 'b', 'c'], index=[0, 0.5, 1]) tmp = s.copy() s.loc[1] = 'zoo' tmp.iloc[2] = 'zoo' assert_series_equal(s, tmp) def test_setitem_callable(self): # GH 12533 s = pd.Series([1, 2, 3, 4], index=list('ABCD')) s[lambda x: 'A'] = -1 tm.assert_series_equal(s, pd.Series([-1, 2, 3, 4], index=list('ABCD'))) def test_setitem_other_callable(self): # GH 13299 inc = lambda x: x + 1 s = pd.Series([1, 2, -1, 4]) s[s < 0] = inc expected = pd.Series([1, 2, inc, 4]) tm.assert_series_equal(s, expected) def test_slice(self): numSlice = self.series[10:20] numSliceEnd = self.series[-10:] objSlice = self.objSeries[10:20] assert self.series.index[9] not in numSlice.index assert self.objSeries.index[9] not in objSlice.index assert len(numSlice) == len(numSlice.index) assert self.series[numSlice.index[0]] == numSlice[numSlice.index[0]] assert numSlice.index[1] == self.series.index[11] assert tm.equalContents(numSliceEnd, np.array(self.series)[-10:]) # Test return view. sl = self.series[10:20] sl[:] = 0 assert (self.series[10:20] == 0).all() def test_slice_can_reorder_not_uniquely_indexed(self): s = Series(1, index=['a', 'a', 'b', 'b', 'c']) s[::-1] # it works! def test_slice_float_get_set(self): pytest.raises(TypeError, lambda: self.ts[4.0:10.0]) def f(): self.ts[4.0:10.0] = 0 pytest.raises(TypeError, f) pytest.raises(TypeError, self.ts.__getitem__, slice(4.5, 10.0)) pytest.raises(TypeError, self.ts.__setitem__, slice(4.5, 10.0), 0) def test_slice_floats2(self): s = Series(np.random.rand(10), index=np.arange(10, 20, dtype=float)) assert len(s.loc[12.0:]) == 8 assert len(s.loc[12.5:]) == 7 i = np.arange(10, 20, dtype=float) i[2] = 12.2 s.index = i assert len(s.loc[12.0:]) == 8 assert len(s.loc[12.5:]) == 7 def test_slice_float64(self): values = np.arange(10., 50., 2) index = Index(values) start, end = values[[5, 15]] s = Series(np.random.randn(20), index=index) result = s[start:end] expected = s.iloc[5:16] assert_series_equal(result, expected) result = s.loc[start:end] assert_series_equal(result, expected) df = DataFrame(np.random.randn(20, 3), index=index) result = df[start:end] expected = df.iloc[5:16] tm.assert_frame_equal(result, expected) result = df.loc[start:end] tm.assert_frame_equal(result, expected) def test_setitem(self): self.ts[self.ts.index[5]] = np.NaN self.ts[[1, 2, 17]] = np.NaN self.ts[6] = np.NaN assert np.isnan(self.ts[6]) assert np.isnan(self.ts[2]) self.ts[np.isnan(self.ts)] = 5 assert not np.isnan(self.ts[2]) # caught this bug when writing tests series = Series(tm.makeIntIndex(20).astype(float), index=tm.makeIntIndex(20)) series[::2] = 0 assert (series[::2] == 0).all() # set item that's not contained s = self.series.copy() s['foobar'] = 1 app = Series([1], index=['foobar'], name='series') expected = self.series.append(app) assert_series_equal(s, expected) # Test for issue #10193 key = pd.Timestamp('2012-01-01') series = pd.Series() series[key] = 47 expected = pd.Series(47, [key]) assert_series_equal(series, expected) series = pd.Series([], pd.DatetimeIndex([], freq='D')) series[key] = 47 expected = pd.Series(47, pd.DatetimeIndex([key], freq='D')) assert_series_equal(series, expected) def test_setitem_dtypes(self): # change dtypes # GH 4463 expected = Series([np.nan, 2, 3]) s = Series([1, 2, 3]) s.iloc[0] = np.nan assert_series_equal(s, expected) s = Series([1, 2, 3]) s.loc[0] = np.nan assert_series_equal(s, expected) s = Series([1, 2, 3]) s[0] = np.nan assert_series_equal(s, expected) s = Series([False]) s.loc[0] = np.nan assert_series_equal(s, Series([np.nan])) s = Series([False, True]) s.loc[0] = np.nan assert_series_equal(s, Series([np.nan, 1.0])) def test_set_value(self): idx = self.ts.index[10] res = self.ts.set_value(idx, 0) assert res is self.ts assert self.ts[idx] == 0 # equiv s = self.series.copy() res = s.set_value('foobar', 0) assert res is s assert res.index[-1] == 'foobar' assert res['foobar'] == 0 s = self.series.copy() s.loc['foobar'] = 0 assert s.index[-1] == 'foobar' assert s['foobar'] == 0 def test_setslice(self): sl = self.ts[5:20] assert len(sl) == len(sl.index) assert sl.index.is_unique def test_basic_getitem_setitem_corner(self): # invalid tuples, e.g. self.ts[:, None] vs. self.ts[:, 2] with tm.assert_raises_regex(ValueError, 'tuple-index'): self.ts[:, 2] with tm.assert_raises_regex(ValueError, 'tuple-index'): self.ts[:, 2] = 2 # weird lists. [slice(0, 5)] will work but not two slices result = self.ts[[slice(None, 5)]] expected = self.ts[:5] assert_series_equal(result, expected) # OK pytest.raises(Exception, self.ts.__getitem__, [5, slice(None, None)]) pytest.raises(Exception, self.ts.__setitem__, [5, slice(None, None)], 2) def test_basic_getitem_with_labels(self): indices = self.ts.index[[5, 10, 15]] result = self.ts[indices] expected = self.ts.reindex(indices) assert_series_equal(result, expected) result = self.ts[indices[0]:indices[2]] expected = self.ts.loc[indices[0]:indices[2]] assert_series_equal(result, expected) # integer indexes, be careful s = Series(np.random.randn(10), index=lrange(0, 20, 2)) inds = [0, 2, 5, 7, 8] arr_inds = np.array([0, 2, 5, 7, 8]) result = s[inds] expected = s.reindex(inds) assert_series_equal(result, expected) result = s[arr_inds] expected = s.reindex(arr_inds) assert_series_equal(result, expected) # GH12089 # with tz for values s = Series(pd.date_range("2011-01-01", periods=3, tz="US/Eastern"), index=['a', 'b', 'c']) expected = Timestamp('2011-01-01', tz='US/Eastern') result = s.loc['a'] assert result == expected result = s.iloc[0] assert result == expected result = s['a'] assert result == expected def test_basic_setitem_with_labels(self): indices = self.ts.index[[5, 10, 15]] cp = self.ts.copy() exp = self.ts.copy() cp[indices] = 0 exp.loc[indices] = 0 assert_series_equal(cp, exp) cp = self.ts.copy() exp = self.ts.copy() cp[indices[0]:indices[2]] = 0 exp.loc[indices[0]:indices[2]] = 0 assert_series_equal(cp, exp) # integer indexes, be careful s = Series(np.random.randn(10), index=lrange(0, 20, 2)) inds = [0, 4, 6] arr_inds = np.array([0, 4, 6]) cp = s.copy() exp = s.copy() s[inds] = 0 s.loc[inds] = 0 assert_series_equal(cp, exp) cp = s.copy() exp = s.copy() s[arr_inds] = 0 s.loc[arr_inds] = 0 assert_series_equal(cp, exp) inds_notfound = [0, 4, 5, 6] arr_inds_notfound = np.array([0, 4, 5, 6]) pytest.raises(Exception, s.__setitem__, inds_notfound, 0) pytest.raises(Exception, s.__setitem__, arr_inds_notfound, 0) # GH12089 # with tz for values s = Series(pd.date_range("2011-01-01", periods=3, tz="US/Eastern"), index=['a', 'b', 'c']) s2 = s.copy() expected = Timestamp('2011-01-03', tz='US/Eastern') s2.loc['a'] = expected result = s2.loc['a'] assert result == expected s2 = s.copy() s2.iloc[0] = expected result = s2.iloc[0] assert result == expected s2 = s.copy() s2['a'] = expected result = s2['a'] assert result == expected def test_loc_getitem(self): inds = self.series.index[[3, 4, 7]] assert_series_equal(self.series.loc[inds], self.series.reindex(inds)) assert_series_equal(self.series.iloc[5::2], self.series[5::2]) # slice with indices d1, d2 = self.ts.index[[5, 15]] result = self.ts.loc[d1:d2] expected = self.ts.truncate(d1, d2) assert_series_equal(result, expected) # boolean mask = self.series > self.series.median() assert_series_equal(self.series.loc[mask], self.series[mask]) # ask for index value assert self.ts.loc[d1] == self.ts[d1] assert self.ts.loc[d2] == self.ts[d2] def test_loc_getitem_not_monotonic(self): d1, d2 = self.ts.index[[5, 15]] ts2 = self.ts[::2][[1, 2, 0]] pytest.raises(KeyError, ts2.loc.__getitem__, slice(d1, d2)) pytest.raises(KeyError, ts2.loc.__setitem__, slice(d1, d2), 0) def test_loc_getitem_setitem_integer_slice_keyerrors(self): s = Series(np.random.randn(10), index=lrange(0, 20, 2)) # this is OK cp = s.copy() cp.iloc[4:10] = 0 assert (cp.iloc[4:10] == 0).all() # so is this cp = s.copy() cp.iloc[3:11] = 0 assert (cp.iloc[3:11] == 0).values.all() result = s.iloc[2:6] result2 = s.loc[3:11] expected = s.reindex([4, 6, 8, 10]) assert_series_equal(result, expected) assert_series_equal(result2, expected) # non-monotonic, raise KeyError s2 = s.iloc[lrange(5) + lrange(5, 10)[::-1]] pytest.raises(KeyError, s2.loc.__getitem__, slice(3, 11)) pytest.raises(KeyError, s2.loc.__setitem__, slice(3, 11), 0) def test_loc_getitem_iterator(self): idx = iter(self.series.index[:10]) result = self.series.loc[idx] assert_series_equal(result, self.series[:10]) def test_setitem_with_tz(self): for tz in ['US/Eastern', 'UTC', 'Asia/Tokyo']: orig = pd.Series(pd.date_range('2016-01-01', freq='H', periods=3, tz=tz)) assert orig.dtype == 'datetime64[ns, {0}]'.format(tz) # scalar s = orig.copy() s[1] = pd.Timestamp('2011-01-01', tz=tz) exp = pd.Series([pd.Timestamp('2016-01-01 00:00', tz=tz), pd.Timestamp('2011-01-01 00:00', tz=tz), pd.Timestamp('2016-01-01 02:00', tz=tz)]) tm.assert_series_equal(s, exp) s = orig.copy() s.loc[1] = pd.Timestamp('2011-01-01', tz=tz) tm.assert_series_equal(s, exp) s = orig.copy() s.iloc[1] = pd.Timestamp('2011-01-01', tz=tz) tm.assert_series_equal(s, exp) # vector vals = pd.Series([pd.Timestamp('2011-01-01', tz=tz), pd.Timestamp('2012-01-01', tz=tz)], index=[1, 2]) assert vals.dtype == 'datetime64[ns, {0}]'.format(tz) s[[1, 2]] = vals exp = pd.Series([pd.Timestamp('2016-01-01 00:00', tz=tz), pd.Timestamp('2011-01-01 00:00', tz=tz), pd.Timestamp('2012-01-01 00:00', tz=tz)]) tm.assert_series_equal(s, exp) s = orig.copy() s.loc[[1, 2]] = vals tm.assert_series_equal(s, exp) s = orig.copy() s.iloc[[1, 2]] = vals tm.assert_series_equal(s, exp) def test_setitem_with_tz_dst(self): # GH XXX tz = 'US/Eastern' orig = pd.Series(pd.date_range('2016-11-06', freq='H', periods=3, tz=tz)) assert orig.dtype == 'datetime64[ns, {0}]'.format(tz) # scalar s = orig.copy() s[1] = pd.Timestamp('2011-01-01', tz=tz) exp = pd.Series([pd.Timestamp('2016-11-06 00:00-04:00', tz=tz), pd.Timestamp('2011-01-01 00:00-05:00', tz=tz), pd.Timestamp('2016-11-06 01:00-05:00', tz=tz)]) tm.assert_series_equal(s, exp) s = orig.copy() s.loc[1] = pd.Timestamp('2011-01-01', tz=tz) tm.assert_series_equal(s, exp) s = orig.copy() s.iloc[1] = pd.Timestamp('2011-01-01', tz=tz) tm.assert_series_equal(s, exp) # vector vals = pd.Series([pd.Timestamp('2011-01-01', tz=tz), pd.Timestamp('2012-01-01', tz=tz)], index=[1, 2]) assert vals.dtype == 'datetime64[ns, {0}]'.format(tz) s[[1, 2]] = vals exp = pd.Series([pd.Timestamp('2016-11-06 00:00', tz=tz), pd.Timestamp('2011-01-01 00:00', tz=tz), pd.Timestamp('2012-01-01 00:00', tz=tz)]) tm.assert_series_equal(s, exp) s = orig.copy() s.loc[[1, 2]] = vals tm.assert_series_equal(s, exp) s = orig.copy() s.iloc[[1, 2]] = vals tm.assert_series_equal(s, exp) def test_where(self): s = Series(np.random.randn(5)) cond = s > 0 rs = s.where(cond).dropna() rs2 = s[cond] assert_series_equal(rs, rs2) rs = s.where(cond, -s) assert_series_equal(rs, s.abs()) rs = s.where(cond) assert (s.shape == rs.shape) assert (rs is not s) # test alignment cond = Series([True, False, False, True, False], index=s.index) s2 = -(s.abs()) expected = s2[cond].reindex(s2.index[:3]).reindex(s2.index) rs = s2.where(cond[:3]) assert_series_equal(rs, expected) expected = s2.abs() expected.iloc[0] = s2[0] rs = s2.where(cond[:3], -s2) assert_series_equal(rs, expected) pytest.raises(ValueError, s.where, 1) pytest.raises(ValueError, s.where, cond[:3].values, -s) # GH 2745 s = Series([1, 2]) s[[True, False]] = [0, 1] expected = Series([0, 2]) assert_series_equal(s, expected) # failures pytest.raises(ValueError, s.__setitem__, tuple([[[True, False]]]), [0, 2, 3]) pytest.raises(ValueError, s.__setitem__, tuple([[[True, False]]]), []) # unsafe dtype changes for dtype in [np.int8, np.int16, np.int32, np.int64, np.float16, np.float32, np.float64]: s = Series(np.arange(10), dtype=dtype) mask = s < 5 s[mask] = lrange(2, 7) expected = Series(lrange(2, 7) + lrange(5, 10), dtype=dtype) assert_series_equal(s, expected) assert s.dtype == expected.dtype # these are allowed operations, but are upcasted for dtype in [np.int64, np.float64]: s = Series(np.arange(10), dtype=dtype) mask = s < 5 values = [2.5, 3.5, 4.5, 5.5, 6.5] s[mask] = values expected = Series(values + lrange(5, 10), dtype='float64') assert_series_equal(s, expected) assert s.dtype == expected.dtype # GH 9731 s = Series(np.arange(10), dtype='int64') mask = s > 5 values = [2.5, 3.5, 4.5, 5.5] s[mask] = values expected = Series(lrange(6) + values, dtype='float64') assert_series_equal(s, expected) # can't do these as we are forced to change the itemsize of the input # to something we cannot for dtype in [np.int8, np.int16, np.int32, np.float16, np.float32]: s = Series(np.arange(10), dtype=dtype) mask = s < 5 values = [2.5, 3.5, 4.5, 5.5, 6.5] pytest.raises(Exception, s.__setitem__, tuple(mask), values) # GH3235 s = Series(np.arange(10), dtype='int64') mask = s < 5 s[mask] = lrange(2, 7) expected = Series(lrange(2, 7) + lrange(5, 10), dtype='int64') assert_series_equal(s, expected) assert s.dtype == expected.dtype s = Series(np.arange(10), dtype='int64') mask = s > 5 s[mask] = [0] * 4 expected = Series([0, 1, 2, 3, 4, 5] + [0] * 4, dtype='int64') assert_series_equal(s, expected) s = Series(np.arange(10)) mask = s > 5 def f(): s[mask] = [5, 4, 3, 2, 1] pytest.raises(ValueError, f) def f(): s[mask] = [0] * 5 pytest.raises(ValueError, f) # dtype changes s = Series([1, 2, 3, 4]) result = s.where(s > 2, np.nan) expected = Series([np.nan, np.nan, 3, 4]) assert_series_equal(result, expected) # GH 4667 # setting with None changes dtype s = Series(range(10)).astype(float) s[8] = None result = s[8] assert isnull(result) s = Series(range(10)).astype(float) s[s > 8] = None result = s[isnull(s)] expected = Series(np.nan, index=[9]) assert_series_equal(result, expected) def test_where_array_like(self): # see gh-15414 s = Series([1, 2, 3]) cond = [False, True, True] expected = Series([np.nan, 2, 3]) klasses = [list, tuple, np.array, Series] for klass in klasses: result = s.where(klass(cond)) assert_series_equal(result, expected) def test_where_invalid_input(self): # see gh-15414: only boolean arrays accepted s = Series([1, 2, 3]) msg = "Boolean array expected for the condition" conds = [ [1, 0, 1], Series([2, 5, 7]), ["True", "False", "True"], [Timestamp("2017-01-01"), pd.NaT, Timestamp("2017-01-02")] ] for cond in conds: with tm.assert_raises_regex(ValueError, msg): s.where(cond) msg = "Array conditional must be same shape as self" with tm.assert_raises_regex(ValueError, msg): s.where([True]) def test_where_ndframe_align(self): msg = "Array conditional must be same shape as self" s = Series([1, 2, 3]) cond = [True] with tm.assert_raises_regex(ValueError, msg): s.where(cond) expected = Series([1, np.nan, np.nan]) out = s.where(Series(cond)) tm.assert_series_equal(out, expected) cond = np.array([False, True, False, True]) with tm.assert_raises_regex(ValueError, msg): s.where(cond) expected = Series([np.nan, 2, np.nan]) out = s.where(Series(cond)) tm.assert_series_equal(out, expected) def test_where_setitem_invalid(self): # GH 2702 # make sure correct exceptions are raised on invalid list assignment # slice s = Series(list('abc')) def f(): s[0:3] = list(range(27)) pytest.raises(ValueError, f) s[0:3] = list(range(3)) expected = Series([0, 1, 2]) assert_series_equal(s.astype(np.int64), expected, ) # slice with step s = Series(list('abcdef')) def f(): s[0:4:2] = list(range(27)) pytest.raises(ValueError, f) s = Series(list('abcdef')) s[0:4:2] = list(range(2)) expected = Series([0, 'b', 1, 'd', 'e', 'f']) assert_series_equal(s, expected) # neg slices s = Series(list('abcdef')) def f(): s[:-1] = list(range(27)) pytest.raises(ValueError, f) s[-3:-1] = list(range(2)) expected = Series(['a', 'b', 'c', 0, 1, 'f']) assert_series_equal(s, expected) # list s = Series(list('abc')) def f(): s[[0, 1, 2]] = list(range(27)) pytest.raises(ValueError, f) s = Series(list('abc')) def f(): s[[0, 1, 2]] = list(range(2)) pytest.raises(ValueError, f) # scalar s = Series(list('abc')) s[0] = list(range(10)) expected = Series([list(range(10)), 'b', 'c']) assert_series_equal(s, expected) def test_where_broadcast(self): # Test a variety of differently sized series for size in range(2, 6): # Test a variety of boolean indices for selection in [ # First element should be set np.resize([True, False, False, False, False], size), # Set alternating elements] np.resize([True, False], size), # No element should be set np.resize([False], size)]: # Test a variety of different numbers as content for item in [2.0, np.nan, np.finfo(np.float).max, np.finfo(np.float).min]: # Test numpy arrays, lists and tuples as the input to be # broadcast for arr in [np.array([item]), [item], (item, )]: data = np.arange(size, dtype=float) s = Series(data) s[selection] = arr # Construct the expected series by taking the source # data or item based on the selection expected = Series([item if use_item else data[ i] for i, use_item in enumerate(selection)]) assert_series_equal(s, expected) s = Series(data) result = s.where(~selection, arr) assert_series_equal(result, expected) def test_where_inplace(self): s = Series(np.random.randn(5)) cond = s > 0 rs = s.copy() rs.where(cond, inplace=True) assert_series_equal(rs.dropna(), s[cond]) assert_series_equal(rs, s.where(cond)) rs = s.copy() rs.where(cond, -s, inplace=True) assert_series_equal(rs, s.where(cond, -s)) def test_where_dups(self): # GH 4550 # where crashes with dups in index s1 = Series(list(range(3))) s2 = Series(list(range(3))) comb = pd.concat([s1, s2]) result = comb.where(comb < 2) expected = Series([0, 1, np.nan, 0, 1, np.nan], index=[0, 1, 2, 0, 1, 2]) assert_series_equal(result, expected) # GH 4548 # inplace updating not working with dups comb[comb < 1] = 5 expected = Series([5, 1, 2, 5, 1, 2], index=[0, 1, 2, 0, 1, 2]) assert_series_equal(comb, expected) comb[comb < 2] += 10 expected = Series([5, 11, 2, 5, 11, 2], index=[0, 1, 2, 0, 1, 2]) assert_series_equal(comb, expected) def test_where_datetime(self): s = Series(date_range('20130102', periods=2)) expected = Series([10, 10], dtype='datetime64[ns]') mask = np.array([False, False]) rs = s.where(mask, [10, 10]) assert_series_equal(rs, expected) rs = s.where(mask, 10) assert_series_equal(rs, expected) rs = s.where(mask, 10.0) assert_series_equal(rs, expected) rs = s.where(mask, [10.0, 10.0]) assert_series_equal(rs, expected) rs = s.where(mask, [10.0, np.nan]) expected = Series([10, None], dtype='datetime64[ns]') assert_series_equal(rs, expected) # GH 15701 timestamps = ['2016-12-31 12:00:04+00:00', '2016-12-31 12:00:04.010000+00:00'] s = Series([pd.Timestamp(t) for t in timestamps]) rs = s.where(Series([False, True])) expected = Series([pd.NaT, s[1]]) assert_series_equal(rs, expected) def test_where_timedelta(self): s = Series([1, 2], dtype='timedelta64[ns]') expected = Series([10, 10], dtype='timedelta64[ns]') mask = np.array([False, False]) rs = s.where(mask, [10, 10]) assert_series_equal(rs, expected) rs = s.where(mask, 10) assert_series_equal(rs, expected) rs = s.where(mask, 10.0) assert_series_equal(rs, expected) rs = s.where(mask, [10.0, 10.0]) assert_series_equal(rs, expected) rs = s.where(mask, [10.0, np.nan]) expected = Series([10, None], dtype='timedelta64[ns]') assert_series_equal(rs, expected) def test_mask(self): # compare with tested results in test_where s = Series(np.random.randn(5)) cond = s > 0 rs = s.where(~cond, np.nan) assert_series_equal(rs, s.mask(cond)) rs = s.where(~cond) rs2 = s.mask(cond) assert_series_equal(rs, rs2) rs = s.where(~cond, -s) rs2 = s.mask(cond, -s) assert_series_equal(rs, rs2) cond = Series([True, False, False, True, False], index=s.index) s2 = -(s.abs()) rs = s2.where(~cond[:3]) rs2 = s2.mask(cond[:3]) assert_series_equal(rs, rs2) rs = s2.where(~cond[:3], -s2) rs2 = s2.mask(cond[:3], -s2) assert_series_equal(rs, rs2) pytest.raises(ValueError, s.mask, 1) pytest.raises(ValueError, s.mask, cond[:3].values, -s) # dtype changes s = Series([1, 2, 3, 4]) result = s.mask(s > 2, np.nan) expected = Series([1, 2, np.nan, np.nan]) assert_series_equal(result, expected) def test_mask_broadcast(self): # GH 8801 # copied from test_where_broadcast for size in range(2, 6): for selection in [ # First element should be set np.resize([True, False, False, False, False], size), # Set alternating elements] np.resize([True, False], size), # No element should be set np.resize([False], size)]: for item in [2.0, np.nan, np.finfo(np.float).max, np.finfo(np.float).min]: for arr in [np.array([item]), [item], (item, )]: data = np.arange(size, dtype=float) s = Series(data) result = s.mask(selection, arr) expected = Series([item if use_item else data[ i] for i, use_item in enumerate(selection)]) assert_series_equal(result, expected) def test_mask_inplace(self): s = Series(np.random.randn(5)) cond = s > 0 rs = s.copy() rs.mask(cond, inplace=True) assert_series_equal(rs.dropna(), s[~cond]) assert_series_equal(rs, s.mask(cond)) rs = s.copy() rs.mask(cond, -s, inplace=True) assert_series_equal(rs, s.mask(cond, -s)) def test_ix_setitem(self): inds = self.series.index[[3, 4, 7]] result = self.series.copy() result.loc[inds] = 5 expected = self.series.copy() expected[[3, 4, 7]] = 5 assert_series_equal(result, expected) result.iloc[5:10] = 10 expected[5:10] = 10 assert_series_equal(result, expected) # set slice with indices d1, d2 = self.series.index[[5, 15]] result.loc[d1:d2] = 6 expected[5:16] = 6 # because it's inclusive assert_series_equal(result, expected) # set index value self.series.loc[d1] = 4 self.series.loc[d2] = 6 assert self.series[d1] == 4 assert self.series[d2] == 6 def test_where_numeric_with_string(self): # GH 9280 s = pd.Series([1, 2, 3]) w = s.where(s > 1, 'X') assert not is_integer(w[0]) assert is_integer(w[1]) assert is_integer(w[2]) assert isinstance(w[0], str) assert w.dtype == 'object' w = s.where(s > 1, ['X', 'Y', 'Z']) assert not is_integer(w[0]) assert is_integer(w[1]) assert is_integer(w[2]) assert isinstance(w[0], str) assert w.dtype == 'object' w = s.where(s > 1, np.array(['X', 'Y', 'Z'])) assert not is_integer(w[0]) assert is_integer(w[1]) assert is_integer(w[2]) assert isinstance(w[0], str) assert w.dtype == 'object' def test_setitem_boolean(self): mask = self.series > self.series.median() # similiar indexed series result = self.series.copy() result[mask] = self.series * 2 expected = self.series * 2 assert_series_equal(result[mask], expected[mask]) # needs alignment result = self.series.copy() result[mask] = (self.series * 2)[0:5] expected = (self.series * 2)[0:5].reindex_like(self.series) expected[-mask] = self.series[mask] assert_series_equal(result[mask], expected[mask]) def test_ix_setitem_boolean(self): mask = self.series > self.series.median() result = self.series.copy() result.loc[mask] = 0 expected = self.series expected[mask] = 0 assert_series_equal(result, expected) def test_ix_setitem_corner(self): inds = list(self.series.index[[5, 8, 12]]) self.series.loc[inds] = 5 pytest.raises(Exception, self.series.loc.__setitem__, inds + ['foo'], 5) def test_get_set_boolean_different_order(self): ordered = self.series.sort_values() # setting copy = self.series.copy() copy[ordered > 0] = 0 expected = self.series.copy() expected[expected > 0] = 0 assert_series_equal(copy, expected) # getting sel = self.series[ordered > 0] exp = self.series[self.series > 0] assert_series_equal(sel, exp) def test_setitem_na(self): # these induce dtype changes expected = Series([np.nan, 3, np.nan, 5, np.nan, 7, np.nan, 9, np.nan]) s = Series([2, 3, 4, 5, 6, 7, 8, 9, 10]) s[::2] = np.nan assert_series_equal(s, expected) # get's coerced to float, right? expected = Series([np.nan, 1, np.nan, 0]) s = Series([True, True, False, False]) s[::2] = np.nan assert_series_equal(s, expected) expected = Series([np.nan, np.nan, np.nan, np.nan, np.nan, 5, 6, 7, 8, 9]) s = Series(np.arange(10)) s[:5] = np.nan assert_series_equal(s, expected) def test_basic_indexing(self): s = Series(np.random.randn(5), index=['a', 'b', 'a', 'a', 'b']) pytest.raises(IndexError, s.__getitem__, 5) pytest.raises(IndexError, s.__setitem__, 5, 0) pytest.raises(KeyError, s.__getitem__, 'c') s = s.sort_index() pytest.raises(IndexError, s.__getitem__, 5) pytest.raises(IndexError, s.__setitem__, 5, 0) def test_int_indexing(self): s = Series(np.random.randn(6), index=[0, 0, 1, 1, 2, 2]) pytest.raises(KeyError, s.__getitem__, 5) pytest.raises(KeyError, s.__getitem__, 'c') # not monotonic s = Series(np.random.randn(6), index=[2, 2, 0, 0, 1, 1]) pytest.raises(KeyError, s.__getitem__, 5) pytest.raises(KeyError, s.__getitem__, 'c') def test_datetime_indexing(self): from pandas import date_range index = date_range('1/1/2000', '1/7/2000') index = index.repeat(3) s = Series(len(index), index=index) stamp = Timestamp('1/8/2000') pytest.raises(KeyError, s.__getitem__, stamp) s[stamp] = 0 assert s[stamp] == 0 # not monotonic s = Series(len(index), index=index) s = s[::-1] pytest.raises(KeyError, s.__getitem__, stamp) s[stamp] = 0 assert s[stamp] == 0 def test_timedelta_assignment(self): # GH 8209 s = Series([]) s.loc['B'] = timedelta(1) tm.assert_series_equal(s, Series(Timedelta('1 days'), index=['B'])) s = s.reindex(s.index.insert(0, 'A')) tm.assert_series_equal(s, Series( [np.nan, Timedelta('1 days')], index=['A', 'B'])) result = s.fillna(timedelta(1)) expected = Series(Timedelta('1 days'), index=['A', 'B']) tm.assert_series_equal(result, expected) s.loc['A'] = timedelta(1) tm.assert_series_equal(s, expected) # GH 14155 s = Series(10 * [np.timedelta64(10, 'm')]) s.loc[[1, 2, 3]] = np.timedelta64(20, 'm') expected = pd.Series(10 * [np.timedelta64(10, 'm')]) expected.loc[[1, 2, 3]] = pd.Timedelta(np.timedelta64(20, 'm')) tm.assert_series_equal(s, expected) def test_underlying_data_conversion(self): # GH 4080 df = DataFrame(dict((c, [1, 2, 3]) for c in ['a', 'b', 'c'])) df.set_index(['a', 'b', 'c'], inplace=True) s = Series([1], index=[(2, 2, 2)]) df['val'] = 0 df df['val'].update(s) expected = DataFrame( dict(a=[1, 2, 3], b=[1, 2, 3], c=[1, 2, 3], val=[0, 1, 0])) expected.set_index(['a', 'b', 'c'], inplace=True) tm.assert_frame_equal(df, expected) # GH 3970 # these are chained assignments as well pd.set_option('chained_assignment', None) df = DataFrame({"aa": range(5), "bb": [2.2] * 5}) df["cc"] = 0.0 ck = [True] * len(df) df["bb"].iloc[0] = .13 # TODO: unused df_tmp = df.iloc[ck] # noqa df["bb"].iloc[0] = .15 assert df['bb'].iloc[0] == 0.15 pd.set_option('chained_assignment', 'raise') # GH 3217 df = DataFrame(dict(a=[1, 3], b=[np.nan, 2])) df['c'] = np.nan df['c'].update(pd.Series(['foo'], index=[0])) expected = DataFrame(dict(a=[1, 3], b=[np.nan, 2], c=['foo', np.nan])) tm.assert_frame_equal(df, expected) def test_preserveRefs(self): seq = self.ts[[5, 10, 15]] seq[1] = np.NaN assert not np.isnan(self.ts[10]) def test_drop(self): # unique s = Series([1, 2], index=['one', 'two']) expected = Series([1], index=['one']) result = s.drop(['two']) assert_series_equal(result, expected) result = s.drop('two', axis='rows') assert_series_equal(result, expected) # non-unique # GH 5248 s = Series([1, 1, 2], index=['one', 'two', 'one']) expected = Series([1, 2], index=['one', 'one']) result = s.drop(['two'], axis=0) assert_series_equal(result, expected) result = s.drop('two') assert_series_equal(result, expected) expected = Series([1], index=['two']) result = s.drop(['one']) assert_series_equal(result, expected) result = s.drop('one') assert_series_equal(result, expected) # single string/tuple-like s = Series(range(3), index=list('abc')) pytest.raises(ValueError, s.drop, 'bc') pytest.raises(ValueError, s.drop, ('a', )) # errors='ignore' s = Series(range(3), index=list('abc')) result = s.drop('bc', errors='ignore') assert_series_equal(result, s) result = s.drop(['a', 'd'], errors='ignore') expected = s.iloc[1:] assert_series_equal(result, expected) # bad axis pytest.raises(ValueError, s.drop, 'one', axis='columns') # GH 8522 s = Series([2, 3], index=[True, False]) assert s.index.is_object() result = s.drop(True) expected = Series([3], index=[False]) assert_series_equal(result, expected) def test_align(self): def _check_align(a, b, how='left', fill=None): aa, ab = a.align(b, join=how, fill_value=fill) join_index = a.index.join(b.index, how=how) if fill is not None: diff_a = aa.index.difference(join_index) diff_b = ab.index.difference(join_index) if len(diff_a) > 0: assert (aa.reindex(diff_a) == fill).all() if len(diff_b) > 0: assert (ab.reindex(diff_b) == fill).all() ea = a.reindex(join_index) eb = b.reindex(join_index) if fill is not None: ea = ea.fillna(fill) eb = eb.fillna(fill) assert_series_equal(aa, ea) assert_series_equal(ab, eb) assert aa.name == 'ts' assert ea.name == 'ts' assert ab.name == 'ts' assert eb.name == 'ts' for kind in JOIN_TYPES: _check_align(self.ts[2:], self.ts[:-5], how=kind) _check_align(self.ts[2:], self.ts[:-5], how=kind, fill=-1) # empty left _check_align(self.ts[:0], self.ts[:-5], how=kind) _check_align(self.ts[:0], self.ts[:-5], how=kind, fill=-1) # empty right _check_align(self.ts[:-5], self.ts[:0], how=kind) _check_align(self.ts[:-5], self.ts[:0], how=kind, fill=-1) # both empty _check_align(self.ts[:0], self.ts[:0], how=kind) _check_align(self.ts[:0], self.ts[:0], how=kind, fill=-1) def test_align_fill_method(self): def _check_align(a, b, how='left', method='pad', limit=None): aa, ab = a.align(b, join=how, method=method, limit=limit) join_index = a.index.join(b.index, how=how) ea = a.reindex(join_index) eb = b.reindex(join_index) ea = ea.fillna(method=method, limit=limit) eb = eb.fillna(method=method, limit=limit) assert_series_equal(aa, ea) assert_series_equal(ab, eb) for kind in JOIN_TYPES: for meth in ['pad', 'bfill']: _check_align(self.ts[2:], self.ts[:-5], how=kind, method=meth) _check_align(self.ts[2:], self.ts[:-5], how=kind, method=meth, limit=1) # empty left _check_align(self.ts[:0], self.ts[:-5], how=kind, method=meth) _check_align(self.ts[:0], self.ts[:-5], how=kind, method=meth, limit=1) # empty right _check_align(self.ts[:-5], self.ts[:0], how=kind, method=meth) _check_align(self.ts[:-5], self.ts[:0], how=kind, method=meth, limit=1) # both empty _check_align(self.ts[:0], self.ts[:0], how=kind, method=meth) _check_align(self.ts[:0], self.ts[:0], how=kind, method=meth, limit=1) def test_align_nocopy(self): b = self.ts[:5].copy() # do copy a = self.ts.copy() ra, _ = a.align(b, join='left') ra[:5] = 5 assert not (a[:5] == 5).any() # do not copy a = self.ts.copy() ra, _ = a.align(b, join='left', copy=False) ra[:5] = 5 assert (a[:5] == 5).all() # do copy a = self.ts.copy() b = self.ts[:5].copy() _, rb = a.align(b, join='right') rb[:3] = 5 assert not (b[:3] == 5).any() # do not copy a = self.ts.copy() b = self.ts[:5].copy() _, rb = a.align(b, join='right', copy=False) rb[:2] = 5 assert (b[:2] == 5).all() def test_align_same_index(self): a, b = self.ts.align(self.ts, copy=False) assert a.index is self.ts.index assert b.index is self.ts.index a, b = self.ts.align(self.ts, copy=True) assert a.index is not self.ts.index assert b.index is not self.ts.index def test_align_multiindex(self): # GH 10665 midx = pd.MultiIndex.from_product([range(2), range(3), range(2)], names=('a', 'b', 'c')) idx = pd.Index(range(2), name='b') s1 = pd.Series(np.arange(12, dtype='int64'), index=midx) s2 = pd.Series(np.arange(2, dtype='int64'), index=idx) # these must be the same results (but flipped) res1l, res1r = s1.align(s2, join='left') res2l, res2r = s2.align(s1, join='right') expl = s1 tm.assert_series_equal(expl, res1l) tm.assert_series_equal(expl, res2r) expr = pd.Series([0, 0, 1, 1, np.nan, np.nan] * 2, index=midx) tm.assert_series_equal(expr, res1r) tm.assert_series_equal(expr, res2l) res1l, res1r = s1.align(s2, join='right') res2l, res2r = s2.align(s1, join='left') exp_idx = pd.MultiIndex.from_product([range(2), range(2), range(2)], names=('a', 'b', 'c')) expl = pd.Series([0, 1, 2, 3, 6, 7, 8, 9], index=exp_idx) tm.assert_series_equal(expl, res1l) tm.assert_series_equal(expl, res2r) expr = pd.Series([0, 0, 1, 1] * 2, index=exp_idx) tm.assert_series_equal(expr, res1r) tm.assert_series_equal(expr, res2l) def test_reindex(self): identity = self.series.reindex(self.series.index) # __array_interface__ is not defined for older numpies # and on some pythons try: assert np.may_share_memory(self.series.index, identity.index) except AttributeError: pass assert identity.index.is_(self.series.index) assert identity.index.identical(self.series.index) subIndex = self.series.index[10:20] subSeries = self.series.reindex(subIndex) for idx, val in compat.iteritems(subSeries): assert val == self.series[idx] subIndex2 = self.ts.index[10:20] subTS = self.ts.reindex(subIndex2) for idx, val in compat.iteritems(subTS): assert val == self.ts[idx] stuffSeries = self.ts.reindex(subIndex) assert np.isnan(stuffSeries).all() # This is extremely important for the Cython code to not screw up nonContigIndex = self.ts.index[::2] subNonContig = self.ts.reindex(nonContigIndex) for idx, val in compat.iteritems(subNonContig): assert val == self.ts[idx] # return a copy the same index here result = self.ts.reindex() assert not (result is self.ts) def test_reindex_nan(self): ts = Series([2, 3, 5, 7], index=[1, 4, nan, 8]) i, j = [nan, 1, nan, 8, 4, nan], [2, 0, 2, 3, 1, 2] assert_series_equal(ts.reindex(i), ts.iloc[j]) ts.index = ts.index.astype('object') # reindex coerces index.dtype to float, loc/iloc doesn't assert_series_equal(ts.reindex(i), ts.iloc[j], check_index_type=False) def test_reindex_series_add_nat(self): rng = date_range('1/1/2000 00:00:00', periods=10, freq='10s') series = Series(rng) result = series.reindex(lrange(15)) assert np.issubdtype(result.dtype, np.dtype('M8[ns]')) mask = result.isnull() assert mask[-5:].all() assert not mask[:-5].any() def test_reindex_with_datetimes(self): rng = date_range('1/1/2000', periods=20) ts = Series(np.random.randn(20), index=rng) result = ts.reindex(list(ts.index[5:10])) expected = ts[5:10] tm.assert_series_equal(result, expected) result = ts[list(ts.index[5:10])] tm.assert_series_equal(result, expected) def test_reindex_corner(self): # (don't forget to fix this) I think it's fixed self.empty.reindex(self.ts.index, method='pad') # it works # corner case: pad empty series reindexed = self.empty.reindex(self.ts.index, method='pad') # pass non-Index reindexed = self.ts.reindex(list(self.ts.index)) assert_series_equal(self.ts, reindexed) # bad fill method ts = self.ts[::2] pytest.raises(Exception, ts.reindex, self.ts.index, method='foo') def test_reindex_pad(self): s = Series(np.arange(10), dtype='int64') s2 = s[::2] reindexed = s2.reindex(s.index, method='pad') reindexed2 = s2.reindex(s.index, method='ffill') assert_series_equal(reindexed, reindexed2) expected = Series([0, 0, 2, 2, 4, 4, 6, 6, 8, 8], index=np.arange(10)) assert_series_equal(reindexed, expected) # GH4604 s = Series([1, 2, 3, 4, 5], index=['a', 'b', 'c', 'd', 'e']) new_index = ['a', 'g', 'c', 'f'] expected = Series([1, 1, 3, 3], index=new_index) # this changes dtype because the ffill happens after result = s.reindex(new_index).ffill() assert_series_equal(result, expected.astype('float64')) result = s.reindex(new_index).ffill(downcast='infer') assert_series_equal(result, expected) expected = Series([1, 5, 3, 5], index=new_index) result = s.reindex(new_index, method='ffill') assert_series_equal(result, expected) # inferrence of new dtype s = Series([True, False, False, True], index=list('abcd')) new_index = 'agc' result = s.reindex(list(new_index)).ffill() expected = Series([True, True, False], index=list(new_index)) assert_series_equal(result, expected) # GH4618 shifted series downcasting s = Series(False, index=lrange(0, 5)) result = s.shift(1).fillna(method='bfill') expected = Series(False, index=lrange(0, 5)) assert_series_equal(result, expected) def test_reindex_nearest(self): s = Series(np.arange(10, dtype='int64')) target = [0.1, 0.9, 1.5, 2.0] actual = s.reindex(target, method='nearest') expected = Series(np.around(target).astype('int64'), target) assert_series_equal(expected, actual) actual = s.reindex_like(actual, method='nearest') assert_series_equal(expected, actual) actual = s.reindex_like(actual, method='nearest', tolerance=1) assert_series_equal(expected, actual) actual = s.reindex(target, method='nearest', tolerance=0.2) expected = Series([0, 1, np.nan, 2], target) assert_series_equal(expected, actual) def test_reindex_backfill(self): pass def test_reindex_int(self): ts = self.ts[::2] int_ts = Series(np.zeros(len(ts), dtype=int), index=ts.index) # this should work fine reindexed_int = int_ts.reindex(self.ts.index) # if NaNs introduced assert reindexed_int.dtype == np.float_ # NO NaNs introduced reindexed_int = int_ts.reindex(int_ts.index[::2]) assert reindexed_int.dtype == np.int_ def test_reindex_bool(self): # A series other than float, int, string, or object ts = self.ts[::2] bool_ts = Series(np.zeros(len(ts), dtype=bool), index=ts.index) # this should work fine reindexed_bool = bool_ts.reindex(self.ts.index) # if NaNs introduced assert reindexed_bool.dtype == np.object_ # NO NaNs introduced reindexed_bool = bool_ts.reindex(bool_ts.index[::2]) assert reindexed_bool.dtype == np.bool_ def test_reindex_bool_pad(self): # fail ts = self.ts[5:] bool_ts = Series(np.zeros(len(ts), dtype=bool), index=ts.index) filled_bool = bool_ts.reindex(self.ts.index, method='pad') assert isnull(filled_bool[:5]).all() def test_reindex_like(self): other = self.ts[::2] assert_series_equal(self.ts.reindex(other.index), self.ts.reindex_like(other)) # GH 7179 day1 = datetime(2013, 3, 5) day2 = datetime(2013, 5, 5) day3 = datetime(2014, 3, 5) series1 = Series([5, None, None], [day1, day2, day3]) series2 = Series([None, None], [day1, day3]) result = series1.reindex_like(series2, method='pad') expected = Series([5, np.nan], index=[day1, day3]) assert_series_equal(result, expected) def test_reindex_fill_value(self): # ----------------------------------------------------------- # floats floats = Series([1., 2., 3.]) result = floats.reindex([1, 2, 3]) expected = Series([2., 3., np.nan], index=[1, 2, 3]) assert_series_equal(result, expected) result = floats.reindex([1, 2, 3], fill_value=0) expected = Series([2., 3., 0], index=[1, 2, 3]) assert_series_equal(result, expected) # ----------------------------------------------------------- # ints ints = Series([1, 2, 3]) result = ints.reindex([1, 2, 3]) expected = Series([2., 3., np.nan], index=[1, 2, 3]) assert_series_equal(result, expected) # don't upcast result = ints.reindex([1, 2, 3], fill_value=0) expected = Series([2, 3, 0], index=[1, 2, 3]) assert issubclass(result.dtype.type, np.integer) assert_series_equal(result, expected) # ----------------------------------------------------------- # objects objects = Series([1, 2, 3], dtype=object) result = objects.reindex([1, 2, 3]) expected = Series([2, 3, np.nan], index=[1, 2, 3], dtype=object) assert_series_equal(result, expected) result = objects.reindex([1, 2, 3], fill_value='foo') expected = Series([2, 3, 'foo'], index=[1, 2, 3], dtype=object) assert_series_equal(result, expected) # ------------------------------------------------------------ # bools bools = Series([True, False, True]) result = bools.reindex([1, 2, 3]) expected = Series([False, True, np.nan], index=[1, 2, 3], dtype=object) assert_series_equal(result, expected) result = bools.reindex([1, 2, 3], fill_value=False) expected = Series([False, True, False], index=[1, 2, 3]) assert_series_equal(result, expected) def test_select(self): n = len(self.ts) result = self.ts.select(lambda x: x >= self.ts.index[n // 2]) expected = self.ts.reindex(self.ts.index[n // 2:]) assert_series_equal(result, expected) result = self.ts.select(lambda x: x.weekday() == 2) expected = self.ts[self.ts.index.weekday == 2] assert_series_equal(result, expected) def test_cast_on_putmask(self): # GH 2746 # need to upcast s = Series([1, 2], index=[1, 2], dtype='int64') s[[True, False]] = Series([0], index=[1], dtype='int64') expected = Series([0, 2], index=[1, 2], dtype='int64') assert_series_equal(s, expected) def test_type_promote_putmask(self): # GH8387: test that changing types does not break alignment ts = Series(np.random.randn(100), index=np.arange(100, 0, -1)).round(5) left, mask = ts.copy(), ts > 0 right = ts[mask].copy().map(str) left[mask] = right assert_series_equal(left, ts.map(lambda t: str(t) if t > 0 else t)) s = Series([0, 1, 2, 0]) mask = s > 0 s2 = s[mask].map(str) s[mask] = s2 assert_series_equal(s, Series([0, '1', '2', 0])) s = Series([0, 'foo', 'bar', 0]) mask = Series([False, True, True, False]) s2 = s[mask] s[mask] = s2 assert_series_equal(s, Series([0, 'foo', 'bar', 0])) def test_head_tail(self): assert_series_equal(self.series.head(), self.series[:5]) assert_series_equal(self.series.head(0), self.series[0:0]) assert_series_equal(self.series.tail(), self.series[-5:]) assert_series_equal(self.series.tail(0), self.series[0:0]) def test_multilevel_preserve_name(self): index = MultiIndex(levels=[['foo', 'bar', 'baz', 'qux'], ['one', 'two', 'three']], labels=[[0, 0, 0, 1, 1, 2, 2, 3, 3, 3], [0, 1, 2, 0, 1, 1, 2, 0, 1, 2]], names=['first', 'second']) s = Series(np.random.randn(len(index)), index=index, name='sth') result = s['foo'] result2 = s.loc['foo'] assert result.name == s.name assert result2.name == s.name def test_setitem_scalar_into_readonly_backing_data(self): # GH14359: test that you cannot mutate a read only buffer array = np.zeros(5) array.flags.writeable = False # make the array immutable series = Series(array) for n in range(len(series)): with pytest.raises(ValueError): series[n] = 1 assert array[n] == 0 def test_setitem_slice_into_readonly_backing_data(self): # GH14359: test that you cannot mutate a read only buffer array = np.zeros(5) array.flags.writeable = False # make the array immutable series = Series(array) with pytest.raises(ValueError): series[1:3] = 1 assert not array.any() class TestTimeSeriesDuplicates(object): def setup_method(self, method): dates = [datetime(2000, 1, 2), datetime(2000, 1, 2), datetime(2000, 1, 2), datetime(2000, 1, 3), datetime(2000, 1, 3), datetime(2000, 1, 3), datetime(2000, 1, 4), datetime(2000, 1, 4), datetime(2000, 1, 4), datetime(2000, 1, 5)] self.dups = Series(np.random.randn(len(dates)), index=dates) def test_constructor(self): assert isinstance(self.dups, Series) assert isinstance(self.dups.index, DatetimeIndex) def test_is_unique_monotonic(self): assert not self.dups.index.is_unique def test_index_unique(self): uniques = self.dups.index.unique() expected = DatetimeIndex([datetime(2000, 1, 2), datetime(2000, 1, 3), datetime(2000, 1, 4), datetime(2000, 1, 5)]) assert uniques.dtype == 'M8[ns]' # sanity tm.assert_index_equal(uniques, expected) assert self.dups.index.nunique() == 4 # #2563 assert isinstance(uniques, DatetimeIndex) dups_local = self.dups.index.tz_localize('US/Eastern') dups_local.name = 'foo' result = dups_local.unique() expected = DatetimeIndex(expected, name='foo') expected = expected.tz_localize('US/Eastern') assert result.tz is not None assert result.name == 'foo' tm.assert_index_equal(result, expected) # NaT, note this is excluded arr = [1370745748 + t for t in range(20)] + [tslib.iNaT] idx = DatetimeIndex(arr * 3) tm.assert_index_equal(idx.unique(), DatetimeIndex(arr)) assert idx.nunique() == 20 assert idx.nunique(dropna=False) == 21 arr = [Timestamp('2013-06-09 02:42:28') + timedelta(seconds=t) for t in range(20)] + [NaT] idx = DatetimeIndex(arr * 3) tm.assert_index_equal(idx.unique(), DatetimeIndex(arr)) assert idx.nunique() == 20 assert idx.nunique(dropna=False) == 21 def test_index_dupes_contains(self): d = datetime(2011, 12, 5, 20, 30) ix = DatetimeIndex([d, d]) assert d in ix def test_duplicate_dates_indexing(self): ts = self.dups uniques = ts.index.unique() for date in uniques: result = ts[date] mask = ts.index == date total = (ts.index == date).sum() expected = ts[mask] if total > 1: assert_series_equal(result, expected) else: assert_almost_equal(result, expected[0]) cp = ts.copy() cp[date] = 0 expected = Series(np.where(mask, 0, ts), index=ts.index) assert_series_equal(cp, expected) pytest.raises(KeyError, ts.__getitem__, datetime(2000, 1, 6)) # new index ts[datetime(2000, 1, 6)] = 0 assert ts[datetime(2000, 1, 6)] == 0 def test_range_slice(self): idx = DatetimeIndex(['1/1/2000', '1/2/2000', '1/2/2000', '1/3/2000', '1/4/2000']) ts = Series(np.random.randn(len(idx)), index=idx) result = ts['1/2/2000':] expected = ts[1:] assert_series_equal(result, expected) result = ts['1/2/2000':'1/3/2000'] expected = ts[1:4] assert_series_equal(result, expected) def test_groupby_average_dup_values(self): result = self.dups.groupby(level=0).mean() expected = self.dups.groupby(self.dups.index).mean() assert_series_equal(result, expected) def test_indexing_over_size_cutoff(self): import datetime # #1821 old_cutoff = _index._SIZE_CUTOFF try: _index._SIZE_CUTOFF = 1000 # create large list of non periodic datetime dates = [] sec = datetime.timedelta(seconds=1) half_sec = datetime.timedelta(microseconds=500000) d = datetime.datetime(2011, 12, 5, 20, 30) n = 1100 for i in range(n): dates.append(d) dates.append(d + sec) dates.append(d + sec + half_sec) dates.append(d + sec + sec + half_sec) d += 3 * sec # duplicate some values in the list duplicate_positions = np.random.randint(0, len(dates) - 1, 20) for p in duplicate_positions: dates[p + 1] = dates[p] df = DataFrame(np.random.randn(len(dates), 4), index=dates, columns=list('ABCD')) pos = n * 3 timestamp = df.index[pos] assert timestamp in df.index # it works! df.loc[timestamp] assert len(df.loc[[timestamp]]) > 0 finally: _index._SIZE_CUTOFF = old_cutoff def test_indexing_unordered(self): # GH 2437 rng = date_range(start='2011-01-01', end='2011-01-15') ts = Series(np.random.rand(len(rng)), index=rng) ts2 = pd.concat([ts[0:4], ts[-4:], ts[4:-4]]) for t in ts.index: # TODO: unused? s = str(t) # noqa expected = ts[t] result = ts2[t] assert expected == result # GH 3448 (ranges) def compare(slobj): result = ts2[slobj].copy() result = result.sort_index() expected = ts[slobj] assert_series_equal(result, expected) compare(slice('2011-01-01', '2011-01-15')) compare(slice('2010-12-30', '2011-01-15')) compare(slice('2011-01-01', '2011-01-16')) # partial ranges compare(slice('2011-01-01', '2011-01-6')) compare(slice('2011-01-06', '2011-01-8')) compare(slice('2011-01-06', '2011-01-12')) # single values result = ts2['2011'].sort_index() expected = ts['2011'] assert_series_equal(result, expected) # diff freq rng = date_range(datetime(2005, 1, 1), periods=20, freq='M') ts = Series(np.arange(len(rng)), index=rng) ts = ts.take(np.random.permutation(20)) result = ts['2005'] for t in result.index: assert t.year == 2005 def test_indexing(self): idx = date_range("2001-1-1", periods=20, freq='M') ts = Series(np.random.rand(len(idx)), index=idx) # getting # GH 3070, make sure semantics work on Series/Frame expected = ts['2001'] expected.name = 'A' df = DataFrame(dict(A=ts)) result = df['2001']['A'] assert_series_equal(expected, result) # setting ts['2001'] = 1 expected = ts['2001'] expected.name = 'A' df.loc['2001', 'A'] = 1 result = df['2001']['A'] assert_series_equal(expected, result) # GH3546 (not including times on the last day) idx = date_range(start='2013-05-31 00:00', end='2013-05-31 23:00', freq='H') ts = Series(lrange(len(idx)), index=idx) expected = ts['2013-05'] assert_series_equal(expected, ts) idx = date_range(start='2013-05-31 00:00', end='2013-05-31 23:59', freq='S') ts = Series(lrange(len(idx)), index=idx) expected = ts['2013-05'] assert_series_equal(expected, ts) idx = [Timestamp('2013-05-31 00:00'), Timestamp(datetime(2013, 5, 31, 23, 59, 59, 999999))] ts = Series(lrange(len(idx)), index=idx) expected = ts['2013'] assert_series_equal(expected, ts) # GH14826, indexing with a seconds resolution string / datetime object df = DataFrame(np.random.rand(5, 5), columns=['open', 'high', 'low', 'close', 'volume'], index=date_range('2012-01-02 18:01:00', periods=5, tz='US/Central', freq='s')) expected = df.loc[[df.index[2]]] # this is a single date, so will raise pytest.raises(KeyError, df.__getitem__, '2012-01-02 18:01:02', ) pytest.raises(KeyError, df.__getitem__, df.index[2], ) class TestDatetimeIndexing(object): """ Also test support for datetime64[ns] in Series / DataFrame """ def setup_method(self, method): dti = DatetimeIndex(start=datetime(2005, 1, 1), end=datetime(2005, 1, 10), freq='Min') self.series = Series(np.random.rand(len(dti)), dti) def test_fancy_getitem(self): dti = DatetimeIndex(freq='WOM-1FRI', start=datetime(2005, 1, 1), end=datetime(2010, 1, 1)) s = Series(np.arange(len(dti)), index=dti) assert s[48] == 48 assert s['1/2/2009'] == 48 assert s['2009-1-2'] == 48 assert s[datetime(2009, 1, 2)] == 48 assert s[lib.Timestamp(datetime(2009, 1, 2))] == 48 pytest.raises(KeyError, s.__getitem__, '2009-1-3') assert_series_equal(s['3/6/2009':'2009-06-05'], s[datetime(2009, 3, 6):datetime(2009, 6, 5)]) def test_fancy_setitem(self): dti = DatetimeIndex(freq='WOM-1FRI', start=datetime(2005, 1, 1), end=datetime(2010, 1, 1)) s = Series(np.arange(len(dti)), index=dti) s[48] = -1 assert s[48] == -1 s['1/2/2009'] = -2 assert s[48] == -2 s['1/2/2009':'2009-06-05'] = -3 assert (s[48:54] == -3).all() def test_dti_snap(self): dti = DatetimeIndex(['1/1/2002', '1/2/2002', '1/3/2002', '1/4/2002', '1/5/2002', '1/6/2002', '1/7/2002'], freq='D') res = dti.snap(freq='W-MON') exp = date_range('12/31/2001', '1/7/2002', freq='w-mon') exp = exp.repeat([3, 4]) assert (res == exp).all() res = dti.snap(freq='B') exp = date_range('1/1/2002', '1/7/2002', freq='b') exp = exp.repeat([1, 1, 1, 2, 2]) assert (res == exp).all() def test_dti_reset_index_round_trip(self): dti = DatetimeIndex(start='1/1/2001', end='6/1/2001', freq='D') d1 = DataFrame({'v': np.random.rand(len(dti))}, index=dti) d2 = d1.reset_index() assert d2.dtypes[0] == np.dtype('M8[ns]') d3 = d2.set_index('index') assert_frame_equal(d1, d3, check_names=False) # #2329 stamp = datetime(2012, 11, 22) df = DataFrame([[stamp, 12.1]], columns=['Date', 'Value']) df = df.set_index('Date') assert df.index[0] == stamp assert df.reset_index()['Date'][0] == stamp def test_series_set_value(self): # #1561 dates = [datetime(2001, 1, 1), datetime(2001, 1, 2)] index = DatetimeIndex(dates) s = Series().set_value(dates[0], 1.) s2 = s.set_value(dates[1], np.nan) exp = Series([1., np.nan], index=index) assert_series_equal(s2, exp) # s = Series(index[:1], index[:1]) # s2 = s.set_value(dates[1], index[1]) # assert s2.values.dtype == 'M8[ns]' @slow def test_slice_locs_indexerror(self): times = [datetime(2000, 1, 1) + timedelta(minutes=i * 10) for i in range(100000)] s = Series(lrange(100000), times) s.loc[datetime(1900, 1, 1):datetime(2100, 1, 1)] def test_slicing_datetimes(self): # GH 7523 # unique df = DataFrame(np.arange(4., dtype='float64'), index=[datetime(2001, 1, i, 10, 00) for i in [1, 2, 3, 4]]) result = df.loc[datetime(2001, 1, 1, 10):] assert_frame_equal(result, df) result = df.loc[:datetime(2001, 1, 4, 10)] assert_frame_equal(result, df) result = df.loc[datetime(2001, 1, 1, 10):datetime(2001, 1, 4, 10)] assert_frame_equal(result, df) result = df.loc[datetime(2001, 1, 1, 11):] expected = df.iloc[1:] assert_frame_equal(result, expected) result = df.loc['20010101 11':] assert_frame_equal(result, expected) # duplicates df = pd.DataFrame(np.arange(5., dtype='float64'), index=[datetime(2001, 1, i, 10, 00) for i in [1, 2, 2, 3, 4]]) result = df.loc[datetime(2001, 1, 1, 10):] assert_frame_equal(result, df) result = df.loc[:datetime(2001, 1, 4, 10)] assert_frame_equal(result, df) result = df.loc[datetime(2001, 1, 1, 10):datetime(2001, 1, 4, 10)] assert_frame_equal(result, df) result = df.loc[datetime(2001, 1, 1, 11):] expected = df.iloc[1:] assert_frame_equal(result, expected) result = df.loc['20010101 11':] assert_frame_equal(result, expected) def test_frame_datetime64_duplicated(self): dates = date_range('2010-07-01', end='2010-08-05') tst = DataFrame({'symbol': 'AAA', 'date': dates}) result = tst.duplicated(['date', 'symbol']) assert (-result).all() tst = DataFrame({'date': dates}) result = tst.duplicated() assert (-result).all() class TestNatIndexing(object): def setup_method(self, method): self.series = Series(date_range('1/1/2000', periods=10)) # --------------------------------------------------------------------- # NaT support def test_set_none_nan(self): self.series[3] = None assert self.series[3] is NaT self.series[3:5] = None assert self.series[4] is NaT self.series[5] = np.nan assert self.series[5] is NaT self.series[5:7] = np.nan assert self.series[6] is NaT def test_nat_operations(self): # GH 8617 s = Series([0, pd.NaT], dtype='m8[ns]') exp = s[0] assert s.median() == exp assert s.min() == exp assert s.max() == exp def test_round_nat(self): # GH14940 s = Series([pd.NaT]) expected = Series(pd.NaT) for method in ["round", "floor", "ceil"]: round_method = getattr(s.dt, method) for freq in ["s", "5s", "min", "5min", "h", "5h"]: assert_series_equal(round_method(freq), expected)
bsd-3-clause
-3,876,241,848,561,414,700
31.762737
79
0.525852
false
googlefonts/noto-emoji
materialize_emoji_images.py
1
4076
#!/usr/bin/env python3 # # Copyright 2016 Google Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Create a copy of the emoji images that instantiates aliases, etc. as symlinks.""" from __future__ import print_function import argparse import glob import os from os import path import re import shutil from nototools import tool_utils # copied from third_party/color_emoji/add_glyphs.py EXTRA_SEQUENCES = { 'u1F46A': '1F468_200D_1F469_200D_1F466', # MWB 'u1F491': '1F469_200D_2764_FE0F_200D_1F468', # WHM 'u1F48F': '1F469_200D_2764_FE0F_200D_1F48B_200D_1F468', # WHKM } # Flag aliases - from: to FLAG_ALIASES = { 'BV': 'NO', 'CP': 'FR', 'HM': 'AU', 'SJ': 'NO', 'UM': 'US', } OMITTED_FLAGS = set( 'BL BQ DG EA EH FK GF GP GS MF MQ NC PM RE TF WF XK YT'.split()) def _flag_str(ris_pair): return '_'.join('%04x' % (ord(cp) - ord('A') + 0x1f1e6) for cp in ris_pair) def _copy_files(src, dst): """Copies files named 'emoji_u*.png' from dst to src, and return a set of the names with 'emoji_u' and the extension stripped.""" code_strings = set() tool_utils.check_dir_exists(src) dst = tool_utils.ensure_dir_exists(dst, clean=True) for f in glob.glob(path.join(src, 'emoji_u*.png')): shutil.copy(f, dst) code_strings.add(path.splitext(path.basename(f))[0][7:]) return code_strings def _alias_people(code_strings, dst): """Create aliases for people in dst, based on code_strings.""" for src, ali in sorted(EXTRA_SEQUENCES.items()): if src[1:].lower() in code_strings: src_name = 'emoji_%s.png' % src.lower() ali_name = 'emoji_u%s.png' % ali.lower() print('creating symlink %s -> %s' % (ali_name, src_name)) os.symlink(path.join(dst, src_name), path.join(dst, ali_name)) else: print('people image %s not found' % src, file=os.stderr) def _alias_flags(code_strings, dst): for ali, src in sorted(FLAG_ALIASES.items()): src_str = _flag_str(src) if src_str in code_strings: src_name = 'emoji_u%s.png' % src_str ali_name = 'emoji_u%s.png' % _flag_str(ali) print('creating symlink %s (%s) -> %s (%s)' % (ali_name, ali, src_name, src)) os.symlink(path.join(dst, src_name), path.join(dst, ali_name)) else: print('flag image %s (%s) not found' % (src_name, src), file=os.stderr) def _alias_omitted_flags(code_strings, dst): UNKNOWN_FLAG = 'fe82b' if UNKNOWN_FLAG not in code_strings: print('unknown flag missing', file=os.stderr) return dst_name = 'emoji_u%s.png' % UNKNOWN_FLAG dst_path = path.join(dst, dst_name) for ali in sorted(OMITTED_FLAGS): ali_str = _flag_str(ali) if ali_str in code_strings: print('omitted flag %s has image %s' % (ali, ali_str), file=os.stderr) continue ali_name = 'emoji_u%s.png' % ali_str print('creating symlink %s (%s) -> unknown_flag (%s)' % ( ali_str, ali, dst_name)) os.symlink(dst_path, path.join(dst, ali_name)) def materialize_images(src, dst): code_strings = _copy_files(src, dst) _alias_people(code_strings, dst) _alias_flags(code_strings, dst) _alias_omitted_flags(code_strings, dst) def main(): parser = argparse.ArgumentParser() parser.add_argument( '-s', '--srcdir', help='path to input sources', metavar='dir', default = 'build/compressed_pngs') parser.add_argument( '-d', '--dstdir', help='destination for output images', metavar='dir') args = parser.parse_args() materialize_images(args.srcdir, args.dstdir) if __name__ == '__main__': main()
apache-2.0
7,824,723,636,050,095,000
31.349206
83
0.652601
false
esacosta/u-mooc
common/schema_fields.py
1
5958
# Copyright 2012 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS-IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Mapping from schema to backend properties.""" __author__ = 'Abhinav Khandelwal ([email protected])' import collections import json from models.property import Property from models.property import Registry class SchemaField(Property): """SchemaField defines a solo field in REST API.""" def get_json_schema(self): """Get the JSCON schema for this field.""" prop = {} prop['type'] = self._property_type if self._optional: prop['optional'] = self._optional if self._description: prop['description'] = self._description return prop def get_schema_dict_entry(self): """Get Schema annotation dictionary for this field.""" if self._extra_schema_dict_values: schema = self._extra_schema_dict_values else: schema = {} schema['label'] = self._label schema['_type'] = self._property_type if 'date' is self._property_type: schema['dateFormat'] = 'Y/m/d' schema['valueFormat'] = 'Y/m/d' elif 'select' is self._property_type: choices = [] for value, label in self._select_data: choices.append({'value': value, 'label': label}) schema['choices'] = choices if self._description: schema['description'] = self._description return schema class FieldRegistry(Registry): """FieldRegistry is a collection of SchemaField's for an API.""" def add_sub_registry( self, name, title=None, description=None, registry=None): """Add a sub registry to for this Registry.""" if not registry: registry = FieldRegistry(title, description) self._sub_registories[name] = registry return registry def get_json_schema_dict(self): schema_dict = dict(self._registry) schema_dict['properties'] = collections.OrderedDict() for schema_field in self._properties: schema_dict['properties'][schema_field.name] = ( schema_field.get_json_schema()) for key in self._sub_registories.keys(): schema_dict['properties'][key] = ( self._sub_registories[key].get_json_schema_dict()) return schema_dict def get_json_schema(self): """Get the json schema for this API.""" return json.dumps(self.get_json_schema_dict()) def _get_schema_dict(self, prefix_key): """Get schema dict for this API.""" title_key = list(prefix_key) title_key.append('title') schema_dict = [(title_key, self._title)] base_key = list(prefix_key) base_key.append('properties') for schema_field in self._properties: field_key = list(base_key) field_key.append(schema_field.name) field_key.append('_inputex') filed_tuple = field_key, schema_field.get_schema_dict_entry() schema_dict.append(filed_tuple) for key in self._sub_registories.keys(): sub_registry_key_prefix = list(base_key) sub_registry_key_prefix.append(key) sub_registry = self._sub_registories[key] # pylint: disable-msg=protected-access for entry in sub_registry._get_schema_dict(sub_registry_key_prefix): schema_dict.append(entry) # pylint: enable-msg=protected-access return schema_dict def get_schema_dict(self): """Get schema dict for this API.""" return self._get_schema_dict(list()) def _add_entry(self, key_part_list, value, entity): if len(key_part_list) == 1: entity[key_part_list[0]] = value return key = key_part_list.pop() if not entity.has_key(key): entity[key] = {} else: assert type(entity[key]) == type(dict()) self._add_entry(key_part_list, value, entity[key]) def convert_json_to_entity(self, json_entry, entity): assert type(json_entry) == type(dict()) for key in json_entry.keys(): if type(json_entry[key]) == type(dict()): self.convert_json_to_entity(json_entry[key], entity) else: key_parts = key.split(':') key_parts.reverse() self._add_entry(key_parts, json_entry[key], entity) def _get_field_value(self, key_part_list, entity): if len(key_part_list) == 1: if entity.has_key(key_part_list[0]): return entity[key_part_list[0]] return None key = key_part_list.pop() if entity.has_key(key): return self._get_field_value(key_part_list, entity[key]) return None def convert_entity_to_json_entity(self, entity, json_entry): for schema_field in self._properties: field_name = schema_field.name field_name_parts = field_name.split(':') field_name_parts.reverse() value = self._get_field_value(field_name_parts, entity) if type(value) != type(None): json_entry[field_name] = value for key in self._sub_registories.keys(): json_entry[key] = {} self._sub_registories[key].convert_entity_to_json_entity( entity, json_entry[key])
apache-2.0
-4,220,608,419,550,851,600
36.2375
80
0.596173
false
fedora-infra/the-new-hotness
hotness/exceptions/http_exception.py
1
1465
# -*- coding: utf-8 -*- # # Copyright (C) 2021 Red Hat, Inc. # # This program is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License # as published by the Free Software Foundation; either version 2 # of the License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. class HTTPException(Exception): """ Class representing HTTP exception. This exception should be returned by any wrapper receiving HTTP response when the error code is not 200. Attributes: error_code: Error code of the response message: Error message. """ def __init__(self, error_code: int, message: str): """ Class constructor. """ self.error_code = error_code self.message = message super(HTTPException, self).__init__(self.message) def __str__(self): """ String representation of error. """ return f"Error code: {self.error_code}\n" f"Error message: {self.message}"
lgpl-2.1
-8,487,426,483,306,750,000
35.625
97
0.679863
false
LCBRU/reporter
reporter/uhl_reports/fast/data_quality/screening_clinic_redcap_dq.py
1
3307
#!/usr/bin/env python3 from reporter.core import Schedule from reporter.connections import RedcapInstance from reporter.emailing import ( RECIPIENT_FAST_MANAGER, RECIPIENT_FAST_ADMIN, ) from reporter.application_abstract_reports.redcap.data_quality import ( RedcapMissingDataWhen, RedcapMissingAllWhen, RedcapInvalidNhsNumber, RedcapImpliesCheck, RedcapInvalidEmailAddress, RedcapInvalidDate, RedcapInvalidHeightInCm, RedcapInvalidHeightInFeetAndInches, RedcapInvalidWeightInKg, RedcapInvalidWeightInStonesAndPounds, RedcapInvalidPostCode, ) REDCAP_SCREENING_PROJECT_ID = 48 REDCAP_INSTANCE = RedcapInstance.internal class FastRedcapInvalidEmailAddress( RedcapInvalidEmailAddress): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['email_add'], recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastScreeningRedcapInvalidDate( RedcapInvalidDate): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastScreeningRedcapInvalidNhsNumber( RedcapInvalidNhsNumber): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['nhs_no'], recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastRedcapInvalidPostCode( RedcapInvalidPostCode): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['postcode'], recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastRedcapMissingDataWhenRecruited(RedcapMissingDataWhen): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=[ 'first_name', 'last_name', 'postcode', 'gp_practice', 'clinic_date', 'invitation_group', 'patient_attend', 'patient_agree_scan', ], indicator_field='patient_recruited', indicator_value='1', recipients=[RECIPIENT_FAST_MANAGER, RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastRedcapMissingAddressWhenRecruited(RedcapMissingAllWhen): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['add_1', 'add_2', 'add_3', 'add_4'], indicator_field='patient_recruited', indicator_value='1', recipients=[RECIPIENT_FAST_MANAGER, RECIPIENT_FAST_ADMIN], schedule=Schedule.never, )
mit
8,472,242,262,794,943,000
29.198113
71
0.589054
false
dholbach/snapcraft
snapcraft/_options.py
1
4962
# -*- Mode:Python; indent-tabs-mode:nil; tab-width:4 -*- # # Copyright (C) 2016 Canonical Ltd # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License version 3 as # published by the Free Software Foundation. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. import logging import multiprocessing import os import platform logger = logging.getLogger(__name__) _ARCH_TRANSLATIONS = { 'armv7l': { 'kernel': 'arm', 'deb': 'armhf', 'cross-compiler-prefix': 'arm-linux-gnueabihf-', 'cross-build-packages': ['gcc-arm-linux-gnueabihf'], 'triplet': 'arm-linux-gnueabihf', }, 'aarch64': { 'kernel': 'arm64', 'deb': 'arm64', 'cross-compiler-prefix': 'aarch64-linux-gnu-', 'cross-build-packages': ['gcc-aarch64-linux-gnu'], 'triplet': 'aarch64-linux-gnu', }, 'i686': { 'kernel': 'x86', 'deb': 'i386', 'triplet': 'i386-linux-gnu', }, 'ppc64le': { 'kernel': 'powerpc', 'deb': 'ppc64el', 'cross-compiler-prefix': 'powerpc64le-linux-gnu-', 'cross-build-packages': ['gcc-powerpc64le-linux-gnu'], 'triplet': 'powerpc64le-linux-gnu', }, 'x86_64': { 'kernel': 'x86', 'deb': 'amd64', 'triplet': 'x86_64-linux-gnu', }, 's390x': { 'kernel': 's390x', 'deb': 's390x', 'cross-compiler-prefix': 's390x-linux-gnu-', 'cross-build-packages': ['gcc-s390x-linux-gnu'], 'triplet': 's390x-linux-gnu', } } class ProjectOptions: @property def use_geoip(self): return self.__use_geoip @property def parallel_builds(self): return self.__parallel_builds @property def parallel_build_count(self): build_count = 1 if self.__parallel_builds: try: build_count = multiprocessing.cpu_count() except NotImplementedError: logger.warning( 'Unable to determine CPU count; disabling parallel builds') return build_count @property def is_cross_compiling(self): return self.__target_machine != self.__host_machine @property def cross_compiler_prefix(self): try: return self.__machine_info['cross-compiler-prefix'] except KeyError: raise EnvironmentError( 'Cross compilation not support for target arch {!}'.format( self.__machine_target)) @property def additional_build_packages(self): packages = [] if self.is_cross_compiling: packages.extend(self.__machine_info.get( 'cross-build-packages', [])) return packages @property def arch_triplet(self): return self.__machine_info['triplet'] @property def deb_arch(self): return self.__machine_info['deb'] @property def kernel_arch(self): return self.__machine_info['kernel'] @property def local_plugins_dir(self): return os.path.join(self.parts_dir, 'plugins') @property def parts_dir(self): return os.path.join(self.__project_dir, 'parts') @property def stage_dir(self): return os.path.join(self.__project_dir, 'stage') @property def snap_dir(self): return os.path.join(self.__project_dir, 'prime') @property def debug(self): return self.__debug def __init__(self, use_geoip=False, parallel_builds=True, target_deb_arch=None, debug=False): # TODO: allow setting a different project dir and check for # snapcraft.yaml self.__project_dir = os.getcwd() self.__use_geoip = use_geoip self.__parallel_builds = parallel_builds self._set_machine(target_deb_arch) self.__debug = debug def _set_machine(self, target_deb_arch): self.__host_machine = platform.machine() if not target_deb_arch: self.__target_machine = self.__host_machine else: self.__target_machine = _find_machine(target_deb_arch) logger.info('Setting target machine to {!r}'.format( target_deb_arch)) self.__machine_info = _ARCH_TRANSLATIONS[self.__target_machine] def _find_machine(deb_arch): for machine in _ARCH_TRANSLATIONS: if _ARCH_TRANSLATIONS[machine].get('deb', '') == deb_arch: return machine raise EnvironmentError( 'Cannot set machine from deb_arch {!r}'.format(deb_arch))
gpl-3.0
740,297,699,160,747,900
28.188235
79
0.592301
false
ekaakurniawan/Bioinformatics-Tools
DnC_LocalAlignment/DnC_LocalAlignment.py
1
6963
# Copyright (C) 2012 by Eka A. Kurniawan # eka.a.kurniawan(ta)gmail(tod)com # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; version 2 of the License. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the # Free Software Foundation, Inc., # 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. # Local Alignment in Linear Space - Divide and Conquer # References: # - Neil C. Jones, Pavel A. Pevzner. An Introduction to Bioinformatics Algorithms. Cambridge: The MIT Press, 2004. import copy # Seq1 = "CACCC" # Seq2 = "CATC" # Seq1 = "CAC" # Seq2 = "CATC" # Seq1 = "CTTGAT" # Seq2 = "GCAT" # Seq1 = "TCAAATCAACCAAGATGGAAGCAAAACTGTTTGTAC" # Seq2 = "ATGAAGGCAATACTATTAGTCTTGCTATATACATTC" # Seq1 = "MEAKLFVLFCTFTVLKADTICVGYHANNSTDTVDTVLEKNVTVTHSVNLLEDSHNGKLCSLNGIAPLQLGKCNVAGWLLGNPECDLLLTANSWSYIIETSNSENGTCYPGEFIDYEELREQLSSVSSFEKFEIFPKANSWPNHETTKGVTAACSYSGASSFYRNLLWITKKGTSYPKLSKSYTNNKGKEVLVLWGVHHPPTTSEQQSLYQNTDAYVSVGSSKYNRRFTPEIAARPKVRGQAGRMNYYWTLLDQGDTITFEATGNLIAPWYAFALNKGSDSGIITSDAPVHNCDTRCQTPHGALNSSLPFQNVHPITIGECPKYVKSTKLRMATGLRNVPSIQSRGLFGAIAGFIEGGWTGMIDGWYGYHHQNEQGSGYAADQKSTQNAIDGITNKVNSVIEKMNTQFTAVGKEFNNLERRIENLNKKVDDGFLDVWTYNAELLVLLENERTLDFHDSNVRNLYEKVRSQLRNNAKELGNGCFEFYHKCDDECMESVKNGTYDYPKYSEESKLNREEIDGVKLESMGVYQILAIYSTVASSLVLLVSLGAISFWMCSNGSLQCRICI" # Seq2 = "MKAILVVLLYTFATANADTLCIGYHANNSTDTVDTVLEKNVTVTHSVNLLEDKHNGKLCKLRGVAPLHLGKCNIAGWILGNPECESLSTASSWSYIVETSSSDNGTCYPGDFIDYEELREQLSSVSSFERFEIFPKTSSWPNHDSNKGVTAACPHAGAKSFYKNLIWLVKKGNSYPKLSKSYINDKGKEVLVLWGIHHPSTSADQQSLYQNADAYVFVGTSRYSKKFKPEIAIRPKVRDQEGRMNYYWTLVEPGDKITFEATGNLVVPRYAFAMERNAGSGIIISDTPVHDCNTTCQTPKGAINTSLPFQNIHPITIGKCPKYVKSTKLRLATGLRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADLKSTQNAIDEITNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDIWTYNAELLVLLENERTLDYHDSNVKNLYEKVRSQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSEEAKLNREEIDGVKLESTRIYQILAIYSTVASSLVLVVSLGAISFWMCSNGSLQCRICI" # Seq1 = "TTAAG" # Seq2 = "AAGT" Seq1 = "TCAAATCAAAAGCA" Seq2 = "ATGAAGGCAATACCCTA" mu = 1 sigma = 2 # ------------------------------------ Local Alignment - Dynamic Programming --- def getScoreLocalAlignment(i, j): if V[i] == W[j]: m = S[i-1][j-1] + 1 else: m = S[i-1][j-1] - mu return max([0, S[i-1][j] - sigma, S[i][j-1] - sigma, m]) def getMaxValue(M): maxVal = float("-inf") maxIndx = [None, None] for i, r in enumerate(M): curMax = max(r) if maxVal < curMax: maxVal = curMax maxIndx = [i, r.index(maxVal)] return maxVal, maxIndx V = "0" + Seq1 W = "0" + Seq2 lenV = len(V) lenW = len(W) S = [[0 for j in xrange(lenW)] for i in xrange(lenV)] for i in xrange(1, lenV): for j in range(1, lenW): S[i][j] = getScoreLocalAlignment(i, j) val, endPoint = getMaxValue(S) endPoint = [endPoint[0] - 1, endPoint[1] - 1] V = "0" + Seq1[::-1] W = "0" + Seq2[::-1] for i in xrange(1, lenV): for j in range(1, lenW): S[i][j] = getScoreLocalAlignment(i, j) val, startPoint = getMaxValue(S) startPoint = [lenV - startPoint[0] - 1, lenW - startPoint[1] - 1] # -------------------- Global Alignment in Linear Space - Divide and Conquer --- oriSeq1 = Seq1 oriSeq2 = Seq2 Seq1 = Seq1[startPoint[0]:endPoint[0]+1] Seq2 = Seq2[startPoint[1]:endPoint[1]+1] def getScoreGlobalAlignment(i, j): if V[i] == W[j]: m = S[i-1][j-1] + 1 else: m = S[i-1][j-1] - mu scores = [S[i-1][j] - sigma, S[i][j-1] - sigma, m] return max(scores) def calculatePrefix(source, sink, i): global V, W, S V = "0" + Seq1[source[0]:i + 1] W = "0" + Seq2[source[1]:sink[1]] lenV = len(V) lenW = len(W) S = [[0 for j in xrange(lenW)] for i in xrange(lenV)] for a in range(lenV): S[a][0] = a * -sigma for b in range(lenW): S[0][b] = b * -sigma for a in xrange(1, lenV): for b in range(1, lenW): S[a][b] = getScoreGlobalAlignment(a, b) return S[lenV - 1][1:lenW + 1] def calculateSuffix(source, sink, i): global V, W, S V = "0" + Seq1[i:sink[0]][::-1] W = "0" + Seq2[source[1]:sink[1]][::-1] lenV = len(V) lenW = len(W) S = [[0 for j in xrange(lenW)] for i in xrange(lenV)] for a in range(lenV): S[a][0] = a * -sigma for b in range(lenW): S[0][b] = b * -sigma for a in xrange(1, lenV): for b in range(1, lenW): S[a][b] = getScoreGlobalAlignment(a, b) return S[lenV - 1][1:lenW + 1][::-1] def getPath(source, sink): end = False if (sink[0] - source[0]) <= 2: if D[source[0]] == None: mid_i = source[0] elif D[source[0] + 1] == None: mid_i = source[0] + 1 else: return end = True else: mid_i = source[0] + ((sink[0] - source[0]) / 2) prefix = calculatePrefix(source, sink, mid_i) suffix = calculateSuffix(source, sink, mid_i) sumScore = [prefix[b] + suffix[b] for b in xrange(sink[1] - source[1])] maxScore = max(sumScore) mid_k = source[1] + sumScore.index(maxScore) D[mid_i] = maxScore K[mid_i] = mid_k if end: return getPath(source, [mid_i + 1, mid_k + 1]) getPath([mid_i, mid_k], sink) def generateSequence(): indx = 0 k_indx = 0 for i in xrange(0, n): if i in K[k_indx:]: total = sum([1 for j in K[k_indx:] if j == i]) if total > 1: R[0] += [indx + j + 1 for j in xrange(total)] startIndx = k_indx + K[k_indx:].index(i) maxVal = max(D[startIndx:startIndx+total]) R[1] += [indx + D[startIndx:startIndx+total].index(maxVal) + 1] indx += total k_indx += total else: R[0] += [indx + 1] R[1] += [indx + 1] indx += 1 k_indx += 1 else: R[1] += [indx + 1] indx += 1 def displaySequence(): V = "0" + Seq1 W = "0" + Seq2 Vseq = "" Wseq = "" for indx in xrange(max(R[0] + R[1])): indx += 1 if indx in R[0]: Vseq += V[R[0].index(indx)] else : Vseq += "-" if indx in R[1]: Wseq += W[R[1].index(indx)] else : Wseq += "-" print Vseq print Wseq print "" m = len(Seq1) n = len(Seq2) S = [] V = "" W = "" D = [None for i in xrange(m)] K = copy.deepcopy(D) R = [[0], [0]] getPath([0,0], [m,n]) generateSequence() print R #bar displaySequence()
gpl-2.0
-8,100,298,384,511,656,000
28.629787
577
0.60922
false
charman2/rsas
examples/unsteady.py
1
5254
# -*- coding: utf-8 -*- """Storage selection (SAS) functions: example with multiple fluxes out at steady state Runs the rSAS model for a synthetic dataset with one flux in and multiple fluxes out and steady state flow Theory is presented in: Harman, C. J. (2014), Time-variable transit time distributions and transport: Theory and application to storage-dependent transport of chloride in a watershed, Water Resour. Res., 51, doi:10.1002/2014WR015707. """ from __future__ import division import rsas import numpy as np import matplotlib.pyplot as plt import pandas as pd # Initializes the random number generator so we always get the same result np.random.seed(0) # ===================================== # Load the input data # ===================================== data = pd.read_csv('Q1.csv', index_col=0, parse_dates=[1]) # length of the dataset N = len(data) # The individual timeseries can be pulled out of the dataframe S = data['S'].values J = data['J'].values Q = data['Q1'].values C_J = data['C_J'].values-2 C_Q1 = data['C_Q1'].values ST_min = data['ST_min'].values ST_max = data['ST_max'].values # ========================= # Parameters needed by rsas # ========================= # The concentration of water older than the start of observations C_old = ((J*C_J)[J>0]).sum()/((J)[J>0]).sum() # ========================= # Create the rsas functions # ========================= S_dead = 10. #lam = 0. # Uniform # Parameters for the rSAS function Q_rSAS_fun_type = 'uniform' ST_min = np.zeros(N) ST_max = S + S_dead Q_rSAS_fun_parameters = np.c_[ST_min, ST_max] rSAS_fun_Q1 = rsas.create_function(Q_rSAS_fun_type, Q_rSAS_fun_parameters) rSAS_fun = [rSAS_fun_Q1] # Kumaraswami ## Parameters for the rSAS function #Q_rSAS_fun_type = 'kumaraswami' #ST_min = np.ones(N) * 0. #ST_max = S + S_dead #a = np.maximum(0.01, 2. + lam * (S - S.mean())/S.std()) #b = np.ones(N) * 5. #Q_rSAS_fun_parameters = np.c_[a, b, ST_min, ST_max] #rSAS_fun_Q1 = rsas.create_function(Q_rSAS_fun_type, Q_rSAS_fun_parameters) #rSAS_fun = [rSAS_fun_Q1] # ================= # Initial condition # ================= # Unknown initial age distribution, so just set this to zeros ST_init = np.zeros(N + 1) # ============= # Run the model # ============= # Run it outputs = rsas.solve(J, Q, rSAS_fun, ST_init=ST_init, mode='RK4', dt = 1., n_substeps=3, C_J=C_J, C_old=[C_old], verbose=False, debug=False) # Let's pull these out to make the outputs from rsas crystal clear # State variables: age-ranked storage of water and solutes # ROWS of ST, MS are T - ages # COLUMNS of ST, MS are t - times # LAYERS of MS are s - solutes ST = outputs['ST'] MS = outputs['MS'][:,:,0] # Timestep-averaged backwards TTD # ROWS of PQ are T - ages # COLUMNS of PQ are t - times # LAYERS of PQ are q - fluxes PQ1m = outputs['PQ'][:,:,0] # Timestep-averaged outflow concentration # ROWS of C_Q are t - times # COLUMNS of PQ are q - fluxes C_Q1m1 = outputs['C_Q'][:,0,0] # Timestep averaged solute load out # ROWS of MQ are T - ages # COLUMNS of MQ are t - times # LAYERS of MQ are q - fluxes # Last dimension of MS are s - solutes MQ1m = outputs['MQ'][:,:,0,0] #%% # ================================== # Plot the rSAS function # ================================== STx = np.linspace(0,S.max()+S_dead,100) Omega = np.r_[[rSAS_fun_Q1.cdf_i(STx,i) for i in range(N)]].T import matplotlib.cm as cm fig = plt.figure(0) plt.clf() for i in range(N): plt.plot(STx, Omega[:,i], lw=1, color=cm.jet((S[i]-S.min())/S.ptp())) plt.ylim((0,1)) plt.ylabel('$\Omega_Q(T)$') plt.xlabel('age-ranked storage $S_T$') plt.title('Cumulative rSAS function') #%% # ================================== # Plot the transit time distribution # ================================== fig = plt.figure(1) plt.clf() plt.plot(PQ1m, lw=1) plt.ylim((0,1)) plt.ylabel('$P_Q(T)$') plt.xlabel('age $T$') plt.title('Cumulative transit time distribution') #%% # ===================================================================== # Outflow concentration estimated using several different TTD # ===================================================================== # Lets get the instantaneous value of the TTD at the end of each timestep PQ1i = np.zeros((N+1, N+1)) PQ1i[:,0] = rSAS_fun_Q1.cdf_i(ST[:,0],0) PQ1i[:,1:] = np.r_[[rSAS_fun_Q1.cdf_i(ST[:,i+1],i) for i in range(N)]].T # Use the transit time distribution and input timeseries to estimate # the output timeseries for the instantaneous and timestep-averaged cases C_Q1i, C_Q1i_raw, Q1i_observed_fraction = rsas.transport(PQ1i, C_J, C_old) C_Q1m2, C_Q1m2_raw, Q1m2_observed_fraction = rsas.transport(PQ1m, C_J, C_old) # Plot the results fig = plt.figure(2) plt.clf() plt.step(data['datetime'], C_Q1m1, 'g', ls='--', label='mean rsas internal', lw=2, where='post') plt.step(data['datetime'], C_Q1m2, 'b', ls=':', label='mean rsas.transport', lw=2, where='post') plt.step(data['datetime'], C_Q1m2_raw, '0.5', ls=':', label='mean rsas.transport (obs part)', lw=2, where='post') plt.plot(data['datetime'], C_Q1i, 'b:o', label='inst. rsas.transport', lw=1) #plt.plot(data['datetime'], data['C_Q1'], 'r.', label='observed', lw=2) plt.ylim((-2, 0)) plt.legend(loc=0) plt.ylabel('Concentration [-]') plt.xlabel('time') plt.title('Outflow concentration') plt.show()
mit
1,715,018,500,754,261,800
35.234483
113
0.60906
false
Galarzaa90/NabBot
cogs/tracking.py
1
83628
# Copyright 2019 Allan Galarza # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import asyncio import datetime as dt import logging import pickle import re import time from collections import defaultdict from typing import List, NamedTuple, Union, Optional, Dict import asyncpg import discord import tibiapy from discord.ext import commands from tibiapy import Death, Guild, OnlineCharacter, OtherCharacter, World from nabbot import NabBot from .utils import CogUtils, EMBED_LIMIT, FIELD_VALUE_LIMIT, checks, config, get_user_avatar, is_numeric, join_list, \ online_characters, safe_delete_message, split_params from .utils.context import NabCtx from .utils.database import DbChar, DbDeath, DbLevelUp, get_affected_count, get_server_property, PoolConn from .utils.errors import CannotPaginate, NetworkError from .utils.messages import death_messages_monster, death_messages_player, format_message, level_messages, \ split_message, weighed_choice, DeathMessageCondition, LevelCondition, SIMPLE_LEVEL, SIMPLE_DEATH, SIMPLE_PVP_DEATH from .utils.pages import Pages, VocationPages from .utils.tibia import HIGHSCORE_CATEGORIES, NabChar, get_character, get_current_server_save_time, get_guild, \ get_highscores, get_share_range, get_voc_abb, get_voc_emoji, get_world, tibia_worlds, normalize_vocation log = logging.getLogger("nabbot") # Storage used to keep a cache of guilds for watchlists GUILD_CACHE = defaultdict(dict) # type: defaultdict[str, Dict[str, Guild]] WATCHLIST_SEPARATOR = "·" class CharactersResult(NamedTuple): skipped: List[OtherCharacter] no_user: List[DbChar] same_owner: List[DbChar] different_user: List[DbChar] new: List[NabChar] all_skipped: bool # region Database Helper classes class Watchlist: """Represents a Watchlist from the database""" def __init__(self, **kwargs): self.server_id: int = kwargs.get("server_id") self.channel_id: int = kwargs.get("channel_id") self.message_id: int = kwargs.get("message_id") self.user_id: int = kwargs.get("user_id") self.show_count: bool = kwargs.get("show_count", True) self.created: dt.datetime = kwargs.get("created") # Not columns self.entries: List['WatchlistEntry'] = [] self.world = None self.content = "" self.online_characters: List[OnlineCharacter] = [] self.online_guilds: List[Guild] = [] self.disbanded_guilds: List[str] = [] self.description = "" @property def online_count(self) -> int: """Total number of online characters across entries.""" return len(self.online_characters) + sum(g.online_count for g in self.online_guilds) def __repr__(self): return "<{0.__class__.__name__} server_id={0.server_id} channel_id={0.channel_id} message_id={0.message_id}>"\ .format(self) async def add_entry(self, conn: PoolConn, name: str, is_guild: bool, user_id: int, reason: Optional[str]) ->\ Optional['WatchlistEntry']: """ Adds an entry to the watchlist. :param conn: Connection to the database. :param name: Name of the character or guild. :param is_guild: Whether the entry is a guild or not. :param user_id: The user that created the entry. :param reason: The reason for the entry. :return: The new created entry or None if it already exists. """ try: return await WatchlistEntry.insert(conn, self.channel_id, name, is_guild, user_id, reason) except asyncpg.UniqueViolationError: return None async def get_entries(self, conn: PoolConn) -> List['WatchlistEntry']: """Gets all entries in this watchlist. :param conn: Connection to the database. :return: List of entries if any. """ return await WatchlistEntry.get_entries_by_channel(conn, self.channel_id) async def update_message_id(self, conn: PoolConn, message_id: int): """Update's the message id. :param conn: Connection to the database. :param message_id: The new message id. """ await conn.execute("UPDATE watchlist SET message_id = $1 WHERE channel_id = $2", message_id, self.channel_id) self.message_id = message_id async def update_show_count(self, conn: PoolConn, show_count: bool): """Update's the show_count property. If the property is True, the number of online entries will be shown in the channel's name. :param conn: Connection to the database. :param show_count: The property's new value. """ await conn.execute("UPDATE watchlist SET show_count = $1 WHERE channel_id = $2", show_count, self.channel_id) self.show_count = show_count @classmethod async def insert(cls, conn: PoolConn, server_id: int, channel_id: int, user_id: int) -> 'Watchlist': """Adds a new watchlist to the database. :param conn: Connection to the database. :param server_id: The discord guild's id. :param channel_id: The channel's id. :param user_id: The user that created the watchlist. :return: The created watchlist. """ row = await conn.fetchrow("INSERT INTO watchlist(server_id, channel_id, user_id) VALUES($1,$2,$3) RETURNING *", server_id, channel_id, user_id) return cls(**row) @classmethod async def get_by_channel_id(cls, conn: PoolConn, channel_id: int) -> Optional['Watchlist']: """Gets a watchlist corresponding to the channel id. :param conn: Connection to the database. :param channel_id: The id of the channel. :return: The found watchlist, if any.""" row = await conn.fetchrow("SELECT * FROM watchlist WHERE channel_id = $1", channel_id) if row is None: return None return cls(**row) @classmethod async def get_by_world(cls, conn: PoolConn, world: str) -> List['Watchlist']: """ Gets all watchlist from a Tibia world. :param conn: Connection to the database. :param world: The name of the world. :return: A list of watchlists from the world. """ query = """SELECT t0.* FROM watchlist t0 LEFT JOIN server_property t1 ON t1.server_id = t0.server_id AND key = 'world' WHERE value ? $1""" rows = await conn.fetch(query, world) return [cls(**row) for row in rows] @classmethod def sort_by_voc_and_level(cls): """Sorting function to order by vocation and then by level.""" return lambda char: (normalize_vocation(char.vocation), -char.level) class WatchlistEntry: """Represents a watchlist entry.""" def __init__(self, **kwargs): self.channel_id: int = kwargs.get("channel_id") self.name: str = kwargs.get("name") self.is_guild: bool = kwargs.get("is_guild", False) self.reason: Optional[str] = kwargs.get("reason") self.user_id: int = kwargs.get("user_id") self.created: dt.datetime = kwargs.get("created") async def remove(self, conn: PoolConn): """Removes a watchlist entry from the database. :param conn: Connection to the database. """ await self.delete(conn, self.channel_id, self.name, self.is_guild) @classmethod async def delete(cls, conn: PoolConn, channel_id: int, name: str, is_guild: bool): """ :param conn: Connection to the databse. :param channel_id: The id of the watchlist's channel. :param name: The name of the entry. :param is_guild: Whether the entry is a guild or a character. """ await conn.execute("DELETE FROM watchlist_entry WHERE channel_id = $1 AND lower(name) = $2 AND is_guild = $3", channel_id, name.lower().strip(), is_guild) @classmethod async def get_by_name(cls, conn: PoolConn, channel_id: int, name: str, is_guild: bool) -> \ Optional['WatchlistEntry']: """Gets an entry by its name. :param conn: Connection to the database. :param channel_id: The id of the channel. :param name: Name of the entry. :param is_guild: Whether the entry is a guild or a character. :return: The entry if found. """ row = await conn.fetchrow("SELECT * FROM watchlist_entry " "WHERE channel_id = $1 AND lower(name) = $2 AND is_guild = $3", channel_id, name.lower().strip(), is_guild) if row is None: return None return cls(**row) @classmethod async def get_entries_by_channel(cls, conn, channel_id) -> List['WatchlistEntry']: """Gets entries related to a watchlist channel. :param conn: Connection to the database. :param channel_id: Id of the channel. :return: A list of entries corresponding to the channel. """ rows = await conn.fetch("SELECT * FROM watchlist_entry WHERE channel_id = $1", channel_id) return [cls(**row) for row in rows] @classmethod async def insert(cls, conn: PoolConn, channel_id: int, name: str, is_guild: bool, user_id: int, reason=None)\ -> Optional['WatchlistEntry']: """Inserts a watchlist entry into the database. :param conn: Connection to the database. :param channel_id: The id of the watchlist's channel. :param name: Name of the entry. :param is_guild: Whether the entry is a guild or a character. :param user_id: The id of the user that added the entry. :param reason: The reason for the entry. :return: The inserted entry. """ row = await conn.fetchrow("INSERT INTO watchlist_entry(channel_id, name, is_guild, reason, user_id) " "VALUES($1, $2, $3, $4, $5) RETURNING *", channel_id, name, is_guild, reason, user_id) if row is None: return None return cls(**row) # endregion class Tracking(commands.Cog, CogUtils): """Commands related to NabBot's tracking system.""" def __init__(self, bot: NabBot): self.bot = bot self.scan_online_chars_task = bot.loop.create_task(self.scan_online_chars()) self.scan_highscores_task = bot.loop.create_task(self.scan_highscores()) self.world_tasks = {} self.world_times = {} # region Tasks async def scan_deaths(self, world): """Iterates through online characters, checking if they have new deaths. This task is created for every tracked world. On every iteration, the last element is checked and reinserted at the beginning.""" ################################################# # Nezune's cave # # Do not touch anything, enter at your own risk # ################################################# tag = f"{self.tag}[{world}][scan_deaths]" await self.bot.wait_until_ready() log.info(f"{tag} Started") while not self.bot.is_closed(): try: await asyncio.sleep(config.death_scan_interval) if len(online_characters[world]) == 0: await asyncio.sleep(0.5) continue skip = False # Pop last char in queue, reinsert it at the beginning current_char = online_characters[world].pop() if hasattr(current_char, "last_check") and time.time() - current_char.last_check < 45: skip = True current_char.last_check = time.time() online_characters[world].insert(0, current_char) if not skip: # Check for new death char = await get_character(self.bot, current_char.name) await self.compare_deaths(char) else: await asyncio.sleep(0.5) except NetworkError: await asyncio.sleep(0.3) continue except asyncio.CancelledError: # Task was cancelled, so this is fine break except KeyError: continue except Exception as e: log.exception(f"{tag} Exception: {e}") continue async def scan_highscores(self): """Scans the highscores, storing the results in the database. The task checks if the last stored data is from the current server save or not.""" ################################################# # Nezune's cave # # Do not touch anything, enter at your own risk # ################################################# tag = f"{self.tag}[scan_highscores]" await self.bot.wait_until_ready() log.info(f"{tag} Started") while not self.bot.is_closed(): if len(self.bot.tracked_worlds_list) == 0: # If no worlds are tracked, just sleep, worlds might get registered later await asyncio.sleep(10*60) continue for world in self.bot.tracked_worlds_list: tag = f"{self.tag}[{world}](scan_highscores)" world_count = 0 if world not in tibia_worlds: log.warning(f"{tag} Tracked world is no longer a valid world.") await asyncio.sleep(0.1) try: for key, values in HIGHSCORE_CATEGORIES.items(): # Check the last scan time, highscores are updated every server save last_scan = await self.bot.pool.fetchval( "SELECT last_scan FROM highscores WHERE world = $1 AND category = $2", world, key) if last_scan: last_scan_ss = get_current_server_save_time(last_scan) current_ss = get_current_server_save_time() # If the saved results are from the current server save, saving is skipped if last_scan_ss >= current_ss: log.debug(f"{tag} {values[0].name} | {values[1].name} | Already saved") await asyncio.sleep(0.1) continue try: highscores = await get_highscores(world, *values) except NetworkError: continue await self.save_highscores(world, key, highscores) except asyncio.CancelledError: # Task was cancelled, so this is fine break except Exception: log.exception(f"{tag}") continue if world_count: log.info(f"{tag} {world_count:,} entries saved.") await asyncio.sleep(5) await asyncio.sleep(60*30) async def scan_online_chars(self): """Scans tibia.com's character lists to store them locally. A online list per world is created, with the online registered characters. When a character enters the online list, their deaths are checked. On every cycle, their levels are compared. When a character leaves the online list, their levels and deaths are compared.""" ################################################# # Nezune's cave # # Do not touch anything, enter at your own risk # ################################################# await self.bot.wait_until_ready() tag = f"{self.tag}[scan_online_chars]" log.info(f"{tag} Task started") try: with open("data/online_list.dat", "rb") as f: saved_list, timestamp = pickle.load(f) if (time.time() - timestamp) < config.online_list_expiration: online_characters.clear() online_characters.update(saved_list) count = len([c for v in online_characters.values() for c in v]) log.info(f"{tag} Loaded cached online list | {count:,} players") else: log.info(f"{tag} Cached online list is too old, discarding") except FileNotFoundError: pass except (ValueError, pickle.PickleError): log.info(f"{tag} Couldn't read cached online list.") while not self.bot.is_closed(): try: # Pop last server in queue, reinsert it at the beginning current_world = tibia_worlds.pop() tibia_worlds.insert(0, current_world) if current_world.capitalize() not in self.bot.tracked_worlds_list: await asyncio.sleep(0.1) continue if time.time() - self.world_times.get(current_world.capitalize(), 0) < config.online_scan_interval: await asyncio.sleep(0.2) continue tag = f"{self.tag}[{current_world}][scan_online_chars]" log.debug(f"{tag} Checking online list") # Get online list for this server try: world = await get_world(current_world) if world is None: await asyncio.sleep(0.1) continue log.debug(f"{tag} {world.online_count} players online") except NetworkError: await asyncio.sleep(0.1) continue current_world_online = world.online_players if len(current_world_online) == 0: await asyncio.sleep(0.1) continue self.world_times[world.name] = time.time() self.bot.dispatch("world_scanned", world) # Save the online list in file with open("data/online_list.dat", "wb") as f: pickle.dump((online_characters, time.time()), f, protocol=pickle.HIGHEST_PROTOCOL) if current_world not in online_characters: online_characters[current_world] = [] # List of characters that are now offline offline_list = [c for c in online_characters[current_world] if c not in current_world_online] for offline_char in offline_list: # Check if characters got level ups when they went offline log.debug(f"{tag} Character no longer online | {offline_char.name}") online_characters[current_world].remove(offline_char) try: _char = await get_character(self.bot, offline_char.name) await self.compare_levels(_char) await self.compare_deaths(_char) except NetworkError: continue # Add new online chars and announce level differences for server_char in current_world_online: db_char = await DbChar.get_by_name(self.bot.pool, server_char.name) if db_char: try: if server_char not in online_characters[current_world]: # If the character wasn't in the online list we add them # (We insert them at the beginning of the list to avoid messing with the checks order) server_char.last_check = time.time() log.debug(f"{tag} Character added to online list | {server_char.name}") online_characters[current_world].insert(0, server_char) _char = await get_character(self.bot, server_char.name) await self.compare_deaths(_char) # Only update level up, but don't count it as a level up await self.compare_levels(_char, True) else: await self.compare_levels(server_char) # Update character in the list _char_index = online_characters[current_world].index(server_char) online_characters[current_world][_char_index].level = server_char.level except NetworkError: continue except (ValueError, IndexError): continue except asyncio.CancelledError: # Task was cancelled, so this is fine break except Exception: log.exception("scan_online_chars") continue # endregion # region Custom Events @commands.Cog.listener() async def on_world_scanned(self, scanned_world: World): """Event called each time a world is checked. Updates the watchlists :param scanned_world: The scanned world's information. """ # Schedule Scan Deaths task for this world if scanned_world.name not in self.world_tasks: self.world_tasks[scanned_world.name] = self.bot.loop.create_task(self.scan_deaths(scanned_world.name)) GUILD_CACHE[scanned_world.name].clear() await self._run_watchlist(scanned_world) async def _run_watchlist(self, scanned_world: World): watchlists = await Watchlist.get_by_world(self.bot.pool, scanned_world.name) for watchlist in watchlists: watchlist.world = scanned_world.name log.debug(f"{self.tag}[{scanned_world.name}] Checking entries for watchlist | " f"Guild ID: {watchlist.server_id} | Channel ID: {watchlist.channel_id} " f"| World: {scanned_world.name}") guild: discord.Guild = self.bot.get_guild(watchlist.server_id) if guild is None: await asyncio.sleep(0.01) continue discord_channel: discord.TextChannel = guild.get_channel(watchlist.channel_id) if discord_channel is None: await asyncio.sleep(0.1) continue watchlist.entries = await watchlist.get_entries(self.bot.pool) if not watchlist.entries: await asyncio.sleep(0.1) continue await self._watchlist_scan_entries(watchlist, scanned_world) await self._watchlist_build_content(watchlist) await self._watchlist_update_content(watchlist, discord_channel) async def _watchlist_scan_entries(self, watchlist: Watchlist, scanned_world: World): for entry in watchlist.entries: if entry.is_guild: await self._watchlist_check_guild(watchlist, entry) # If it is a character, check if he's in the online list else: self._watchlist_add_characters(watchlist, entry, scanned_world) watchlist.online_characters.sort(key=Watchlist.sort_by_voc_and_level()) @classmethod async def _watchlist_check_guild(cls, watchlist, watched_guild: WatchlistEntry): try: tibia_guild = await cls.cached_get_guild(watched_guild.name, watchlist.world) except NetworkError: return # Save disbanded guilds separately if tibia_guild is None: watchlist.disbanded_guilds.append(watched_guild.name) return # If there's at least one member online, add guild to list if tibia_guild.online_count: watchlist.online_guilds.append(tibia_guild) @staticmethod def _watchlist_add_characters(watchlist, watched_char: WatchlistEntry, scanned_world: World): for online_char in scanned_world.online_players: if online_char.name == watched_char.name: # Add to online list watchlist.online_characters.append(online_char) return @staticmethod def _watchlist_get_msg_entries(characters): return [f"\t{char.name} - Level {char.level} {get_voc_emoji(char.vocation)}" for char in characters] async def _watchlist_build_content(self, watchlist): if watchlist.online_count > 0: msg_entries = self._watchlist_get_msg_entries(watchlist.online_characters) watchlist.content = "\n".join(msg_entries) self._watchlist_build_guild_content(watchlist) else: watchlist.description = "There are no watched characters online." def _watchlist_build_guild_content(self, watchlist): for guild_name in watchlist.disbanded_guilds: watchlist.content += f"\n__Guild: **{guild_name}**__\n" watchlist.content += "\t*Guild was disbanded.*" for tibia_guild in watchlist.online_guilds: watchlist.content += f"\n__Guild: **{tibia_guild.name}**__\n" online_members = tibia_guild.online_members[:] online_members.sort(key=Watchlist.sort_by_voc_and_level()) watchlist.content += "\n".join(self._watchlist_get_msg_entries(online_members)) async def _watchlist_update_content(self, watchlist: Watchlist, channel: discord.TextChannel): # Send new watched message or edit last one embed = discord.Embed(description=watchlist.description, timestamp=dt.datetime.utcnow()) embed.set_footer(text="Last updated") if watchlist.content: if len(watchlist.content) >= EMBED_LIMIT - 50: watchlist.content = split_message(watchlist.content, EMBED_LIMIT - 50)[0] watchlist.content += "\n*And more...*" fields = split_message(watchlist.content, FIELD_VALUE_LIMIT) for s, split_field in enumerate(fields): name = "Watchlist" if s == 0 else "\u200F" embed.add_field(name=name, value=split_field, inline=False) try: await self._watchlist_update_message(self.bot.pool, watchlist, channel, embed) await self._watchlist_update_name(watchlist, channel) except discord.HTTPException: # log.exception(f"{self.tag}[_watchlist_update_content] {watchlist}") pass @staticmethod async def _watchlist_update_name(watchlist: Watchlist, channel: discord.TextChannel): try: original_name = channel.name.split(WATCHLIST_SEPARATOR, 1)[0] if original_name != channel.name and not watchlist.show_count: await channel.edit(name=original_name, reason="Removing online count") elif watchlist.show_count: new_name = f"{original_name}{WATCHLIST_SEPARATOR}{watchlist.online_count}" # Reduce unnecessary API calls and Audit log spam if new_name != channel.name: await channel.edit(name=new_name, reason="Online count changed") except discord.Forbidden: pass @staticmethod async def _watchlist_update_message(conn, watchlist, channel, embed): # We try to get the watched message, if the bot can't find it, we just create a new one # This may be because the old message was deleted or this is the first time the list is checked try: message = await channel.fetch_message(watchlist.message_id) except discord.HTTPException: message = None if message is None: new_message = await channel.send(embed=embed) await watchlist.update_message_id(conn, new_message.id) else: await message.edit(embed=embed) # endregion # region Discord Events @commands.Cog.listener() async def on_guild_channel_delete(self, channel: discord.abc.GuildChannel): """Called when a guild channel is deleted. Deletes associated watchlist and entries.""" if not isinstance(channel, discord.TextChannel): return result = await self.bot.pool.execute("DELETE FROM watchlist_entry WHERE channel_id = $1", channel.id) deleted_entries = get_affected_count(result) result = await self.bot.pool.execute("DELETE FROM watchlist WHERE channel_id = $1", channel.id) deleted = get_affected_count(result) if deleted: # Dispatch event so ServerLog cog can handle it. log.info(f"{self.tag} Watchlist channel deleted | Channel {channel.id} | Guild {channel.guild.id}") self.bot.dispatch("watchlist_deleted", channel, deleted_entries) # endregion # region Commands @checks.server_mod_only() @checks.tracking_world_only() @commands.command(name="addchar", aliases=["registerchar"], usage="<user>,<character>") async def add_char(self, ctx: NabCtx, *, params): """Register a character and optionally all other visible characters to a discord user. This command can only be used by server moderators. If a character is hidden, only that character will be added. Characters in other worlds are skipped.""" params = params.split(",") if len(params) != 2: raise commands.BadArgument() target_name, char_name = params target_name = target_name.strip() target = self.bot.get_member(target_name, ctx.guild) if target is None: return await ctx.error(f"I couldn't find any users named `{target_name}`") if target.bot: return await ctx.error("You can't register characters to discord bots!") msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: char = await get_character(ctx.bot, char_name) if char is None: return await msg.edit(content="That character doesn't exist.") except NetworkError: return await msg.edit(content="I couldn't fetch the character, please try again.") check_other = False if len(char.other_characters) > 1: message = await ctx.send("Do you want to attempt to add the other visible characters in this account?") check_other = await ctx.react_confirm(message, timeout=60, delete_after=True) if check_other is None: await safe_delete_message(msg) return await ctx.error("You ran out of time, try again." "Remember you have to react or click on the reactions.") if check_other: await safe_delete_message(msg) msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: results = await self.check_char_availability(ctx, ctx.author.id, char, [ctx.world], check_other) except NetworkError: return await msg.edit("I'm having network issues, please try again.") if results.all_skipped: await safe_delete_message(msg) await ctx.error(f"Sorry, I couldn't find any characters in **{ctx.world}**.") return reply = await self.process_character_assignment(ctx, results, target, ctx.author) await safe_delete_message(msg) await ctx.send(reply) @commands.command() @checks.tracking_world_somewhere() async def claim(self, ctx: NabCtx, *, char_name: str = None): """Claims a character registered as yours. Claims a character as yours, even if it is already registered to someone else. In order for this to work, you have to put a special code in the character's comment. You can see this code by using the command with no parameters. The code looks like this: `/NB-23FC13AC7400000/` Once you had set the code, you can use the command with that character, if the code matches, it will be reassigned to you. Note that it may take some time for the code to be visible to NabBot because of caching. This code is unique for your discord user, so the code will only work for your discord account and no one else. No one can claim a character of yours unless you put **their** code on your character's comment. """ user = ctx.author claim_pattern = re.compile(r"/NB-([^/]+)/") user_code = hex(user.id)[2:].upper() # List of Tibia worlds tracked in the servers the user is if ctx.is_private: user_tibia_worlds = [ctx.world] else: user_tibia_worlds = ctx.bot.get_user_worlds(user.id) if not ctx.is_private and self.bot.tracked_worlds.get(ctx.guild.id) is None: return await ctx.send("This server is not tracking any tibia worlds.") if len(user_tibia_worlds) == 0: return if char_name is None: await ctx.send(f"To use this command, add `/NB-{user_code}/` to the comment of the character you want to" f"claim, and then use `/claim character_name`.") return msg = await ctx.send(f"{config.loading_emoji} Fetching character...") try: char = await get_character(ctx.bot, char_name) if char is None: return await msg.edit(content=f"{ctx.tick(False)} That character doesn't exist.") except NetworkError: return await msg.edit(content=f"{ctx.tick(False)} I couldn't fetch the character, please try again.") match = claim_pattern.search(char.comment if char.comment is not None else "") if not match: await ctx.error(f"Couldn't find verification code on character's comment.\n" f"Add `/NB-{user_code}/` to the comment to authenticate.") return code = match.group(1) if code != user_code: await ctx.error(f"The verification code on the character's comment doesn't match yours.\n" f"Use `/NB-{user_code}/` to authenticate.") return check_other = False if len(char.other_characters) > 1: message = await ctx.send("Do you want to attempt to add the other visible characters in this account?") check_other = await ctx.react_confirm(message, timeout=60, delete_after=True) if check_other is None: await safe_delete_message(msg) return await ctx.send("You ran out of time, try again." "Remember you have to react or click on the reactions.") if check_other: await safe_delete_message(msg) msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: results = await self.check_char_availability(ctx, ctx.author.id, char, user_tibia_worlds, check_other) except NetworkError: return await msg.edit("I'm having network issues, please try again.") if results.all_skipped: reply = "Sorry, I couldn't find any characters from the worlds in the context ({0})." return await msg.edit(content=reply.format(join_list(user_tibia_worlds))) reply = await self.process_character_assignment(ctx, results, ctx.author, claim=True) await safe_delete_message(msg) await ctx.send(reply) @checks.tracking_world_somewhere() @commands.command(aliases=["i'm", "iam"]) async def im(self, ctx: NabCtx, *, char_name: str): """Lets you add your tibia character(s) for the bot to track. If there are other visible characters, the bot will ask for confirmation to add them too. Characters in other worlds other than the currently tracked world are skipped. If it finds a character owned by another user, the whole process will be stopped. If a character is already registered to someone else, `claim` can be used.""" # List of Tibia worlds tracked in the servers the user is if ctx.is_private: user_tibia_worlds = [ctx.world] else: user_tibia_worlds = ctx.bot.get_user_worlds(ctx.author.id) msg = await ctx.send(f"{config.loading_emoji} Fetching character...") try: char = await get_character(ctx.bot, char_name) if char is None: return await msg.edit(content=f"{ctx.tick(False)} That character doesn't exist.") except NetworkError: return await msg.edit(content=f"{ctx.tick(False)} I couldn't fetch the character, please try again.") check_other = False if len(char.other_characters) > 1: await msg.edit(content="Do you want to attempt to add the other visible characters in this account?") check_other = await ctx.react_confirm(msg, timeout=60, delete_after=True) if check_other is None: await safe_delete_message(msg) return await ctx.send("You didn't reply in time, try again." "Remember that you have to react or click on the icons.") if check_other: await safe_delete_message(msg) msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: results = await self.check_char_availability(ctx, ctx.author.id, char, user_tibia_worlds, check_other) except NetworkError: return await msg.edit("I'm having network issues, please try again.") if results.all_skipped: reply = "Sorry, I couldn't find any characters from the worlds in the context ({0})." return await msg.edit(content=reply.format(join_list(user_tibia_worlds))) reply = await self.process_character_assignment(ctx, results, ctx.author) await safe_delete_message(msg) await ctx.send(reply) @checks.tracking_world_somewhere() @commands.command(aliases=["i'mnot"]) async def imnot(self, ctx: NabCtx, *, name): """Removes a character assigned to you. All registered level ups and deaths will be lost forever.""" db_char = await DbChar.get_by_name(ctx.pool, name) if db_char is None or db_char.user_id == 0: return await ctx.error("There's no character registered with that name.") if db_char.user_id != ctx.author.id: return await ctx.error(f"The character **{db_char.name}** is not registered to you.") message = await ctx.send(f"Are you sure you want to unregister " f"**{db_char.name}** ({abs(db_char.level)} {db_char.vocation})?") confirm = await ctx.react_confirm(message, timeout=50) if confirm is None: return await ctx.send("I guess you changed your mind.") if not confirm: return await ctx.send("No then? Ok.") await db_char.update_user(ctx.pool, 0) await ctx.success(f"**{db_char.name}** is no longer registered to you.") self.bot.dispatch("character_change", ctx.author.id) self.bot.dispatch("character_unregistered", ctx.author, db_char) @checks.can_embed() @checks.tracking_world_only() @commands.command() async def online(self, ctx: NabCtx): """Tells you which users are online on Tibia. This list gets updated based on Tibia.com online list, so it takes a couple minutes to be updated.""" world = ctx.world per_page = 20 if await ctx.is_long() else 5 now = dt.datetime.utcnow() uptime = (now - self.bot.start_time).total_seconds() count = 0 entries = [] vocations = [] for char in online_characters.get(world, []): name = char.name db_char = await DbChar.get_by_name(ctx.pool, name) if not db_char: continue # Skip characters of members not in the server owner = ctx.guild.get_member(db_char.user_id) if owner is None: continue owner = owner.display_name emoji = get_voc_emoji(char.vocation) vocations.append(char.vocation.value) vocation = get_voc_abb(char.vocation) entries.append(f"{char.name} (Lvl {char.level} {vocation}{emoji}, **@{owner}**)") count += 1 if count == 0: if uptime < 90: await ctx.send("I just started, give me some time to check online lists...⌛") else: await ctx.send("There is no one online from Discord.") return pages = VocationPages(ctx, entries=entries, vocations=vocations, per_page=per_page) pages.embed.title = "Users online" try: await pages.paginate() except CannotPaginate as e: await ctx.send(e) @commands.command(name="searchteam", aliases=["whereteam", "findteam"], usage="<params>") @checks.tracking_world_only() @checks.can_embed() async def search_team(self, ctx: NabCtx, *, params=None): """Searches for a registered character that meets the criteria There are 3 ways to use this command: - Show characters in share range with a specific character. (`searchteam <name>`) - Show characters in share range with a specific level. (`searchteam <level>`) - Show characters in a level range. (`searchteam <min>,<max>`) Online characters are shown first on the list, they also have an icon.""" permissions = ctx.bot_permissions if not permissions.embed_links: await ctx.send("Sorry, I need `Embed Links` permission for this command.") return invalid_arguments = "Invalid arguments used, examples:\n" \ "```/searchteam charname\n" \ "/searchteam level\n" \ "/searchteam minlevel,maxlevel```" if ctx.world is None: await ctx.send("This server is not tracking any tibia worlds.") return if params is None: await ctx.send(invalid_arguments) return entries = [] vocations = [] online_entries = [] online_vocations = [] per_page = 20 if await ctx.is_long() else 5 char = None params = split_params(params) if len(params) < 1 or len(params) > 2: await ctx.send(invalid_arguments) return # params[0] could be a character's name, a character's level or one of the level ranges # If it's not a number, it should be a player's name if not is_numeric(params[0]): # We shouldn't have another parameter if a character name was specified if len(params) == 2: await ctx.send(invalid_arguments) return char = await get_character(ctx.bot, params[0]) if char is None: await ctx.send("I couldn't find a character with that name.") return low, high = get_share_range(char.level) title = f"Characters in share range with {char.name}({low}-{high}):" empty = f"I didn't find anyone in share range with **{char.name}**({low}-{high})" else: # Check if we have another parameter, meaning this is a level range if len(params) == 2: try: level1 = int(params[0]) level2 = int(params[1]) except ValueError: await ctx.send(invalid_arguments) return if level1 <= 0 or level2 <= 0: await ctx.send("You entered an invalid level.") return low = min(level1, level2) high = max(level1, level2) title = f"Characters between level {low} and {high}" empty = f"I didn't find anyone between levels **{low}** and **{high}**" # We only got a level, so we get the share range for it else: if int(params[0]) <= 0: await ctx.send("You entered an invalid level.") return low, high = get_share_range(int(params[0])) title = f"Characters in share range with level {params[0]} ({low}-{high})" empty = f"I didn't find anyone in share range with level **{params[0]}** ({low}-{high})" async with ctx.pool.acquire() as conn: count = 0 online_list = [x.name for v in online_characters.values() for x in v] async for db_char in DbChar.get_chars_in_range(conn, low, high, ctx.world): if char is not None and char.name == db_char.name: continue owner = ctx.guild.get_member(db_char.user_id) if owner is None: continue count += 1 owner = owner.display_name emoji = get_voc_emoji(db_char.vocation) voc_abb = get_voc_abb(db_char.vocation) entry = f"**{db_char.name}** - Level {abs(db_char.level)} {voc_abb}{emoji} - @**{owner}**" if db_char.name in online_list: entry = f"{config.online_emoji}{entry}" online_entries.append(entry) online_vocations.append(db_char.vocation) else: entries.append(entry) vocations.append(db_char.vocation) if count < 1: await ctx.send(empty) return pages = VocationPages(ctx, entries=online_entries + entries, per_page=per_page, vocations=online_vocations + vocations) pages.embed.title = title try: await pages.paginate() except CannotPaginate as e: await ctx.send(e) @checks.server_mod_only() @checks.tracking_world_only() @commands.command(name="removechar", aliases=["deletechar", "unregisterchar"]) async def remove_char(self, ctx: NabCtx, *, name): """Removes a registered character from someone. This can only be used by server moderators. Note that you can only remove chars if they are from users exclusively in your server. You can't remove any characters that would alter other servers NabBot is in.""" # This could be used to remove deleted chars so we don't need to check anything # Except if the char exists in the database... db_char = await DbChar.get_by_name(ctx.pool, name.strip()) if db_char is None or db_char.user_id == 0: return await ctx.error("There's no character with that name registered.") if db_char.world != ctx.world: return await ctx.error(f"The character **{db_char.name}** is in a different world.") user = self.bot.get_user(db_char.user_id) if user is not None: user_guilds = self.bot.get_user_guilds(user.id) # Iterating every world where the user is, to check if it wouldn't affect other admins. for guild in user_guilds: if guild == ctx.guild: continue if self.bot.tracked_worlds.get(guild.id, None) != ctx.world: continue author: discord.Member = guild.get_member(ctx.author.id) if author is None or not author.guild_permissions.manage_guild: await ctx.error(f"The user of this server is also in another server tracking " f"**{ctx.world}**, where you are not an admin. You can't alter other servers.") return username = "unknown" if user is None else user.display_name await db_char.update_user(ctx.pool, 0) await ctx.send("**{0}** was removed successfully from **@{1}**.".format(db_char.name, username)) self.bot.dispatch("character_unregistered", user, db_char, ctx.author) @checks.server_mod_only() @checks.tracking_world_only() @commands.group(invoke_without_command=True, case_insensitive=True, aliases=["huntedlist"]) async def watchlist(self, ctx: NabCtx): """Create or manage watchlists. Watchlists are channels where the online status of selected characters are shown. You can create multiple watchlists and characters and guilds to each one separately. Try the subcommands.""" await ctx.send("To manage watchlists, use one of the subcommands.\n" f"Try `{ctx.clean_prefix}help {ctx.invoked_with}`.") @checks.tracking_world_only() @checks.channel_mod_somewhere() @watchlist.command(name="add", aliases=["addplayer", "addchar"], usage="<channel> <name>[,reason]") async def watchlist_add(self, ctx: NabCtx, channel: discord.TextChannel, *, params): """Adds a character to a watchlist. A reason can be specified by adding it after the character's name, separated by a comma.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist channel.") if not channel.permissions_for(ctx.author).manage_channels: return await ctx.error(f"You need `Manage Channel` permissions in {channel.mention} to add entries.") params = params.split(",", 1) name = params[0] reason = None if len(params) > 1: reason = params[1] char = await get_character(ctx.bot, name) if char is None: await ctx.error("A character with that name doesn't exist.") return world = ctx.world if char.world != world: await ctx.error(f"This character is not in **{world}**.") return message = await ctx.send(f"Do you want to add **{char.name}** (Level {char.level} {char.vocation}) " f"to the watchlist {channel.mention}") confirm = await ctx.react_confirm(message, delete_after=True) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return entry = await watchlist.add_entry(ctx.pool, char.name, False, ctx.author.id, reason) if entry: await ctx.success(f"Character **{char.name}** added to the watchlist {channel.mention}.") else: await ctx.error(f"**{char.name}** is already registered in {channel.mention}") @checks.tracking_world_only() @checks.channel_mod_somewhere() @watchlist.command(name="addguild", usage="<channel> <name>[,reason]") async def watchlist_addguild(self, ctx: NabCtx, channel: discord.TextChannel, *, params): """Adds an entire guild to a watchlist. Guilds are displayed in the watchlist as a group.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist channel.") if not channel.permissions_for(ctx.author).manage_channels: return await ctx.error(f"You need `Manage Channel` permissions in {channel.mention} to add entries.") params = params.split(",", 1) name = params[0] reason = None if len(params) > 1: reason = params[1] guild = await get_guild(name) if guild is None: await ctx.error("There's no guild with that name.") return if guild.world != ctx.world: await ctx.error(f"This guild is not in **{ctx.world}**.") return message = await ctx.send(f"Do you want to add the guild **{guild.name}** to the watchlist {channel.mention}?") confirm = await ctx.react_confirm(message, delete_after=True) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return entry = await watchlist.add_entry(ctx.pool, guild.name, True, ctx.author.id, reason) if entry: await ctx.success(f"Guild **{guild.name}** added to the watchlist {channel.mention}.") else: await ctx.error(f"**{guild.name}** is already registered in {channel.mention}") @checks.tracking_world_only() @checks.channel_mod_somewhere() @watchlist.command(name="adduser", usage="<channel> <user>[,reason]") async def watchlist_adduser(self, ctx: NabCtx, channel: discord.TextChannel, *, params): """Adds the currently registered characters of a user to the watchlist. A reason can be specified by adding it after the character's name, separated by a comma.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist channel.") if not channel.permissions_for(ctx.author).manage_channels: return await ctx.error( f"You need `Manage Channel` permissions in {channel.mention} to add entries.") params = params.split(",", 1) name = params[0] reason = None if len(params) > 1: reason = params[1] user = ctx.bot.get_member(name, ctx.guild) if user is None: return await ctx.error("I don't see any users with that name or id.") characters = await DbChar.get_chars_by_user(ctx.pool, user.id, worlds=ctx.world) if not characters: await ctx.error(f"This user doesn't have any registered characters in {ctx.world}.") return char_list = "\n".join(f"• {c.name}" for c in characters) message = await ctx.send(f"Do you want to add currently registered characters of `{user}` to this watchlist?\n" f"{char_list}") confirm = await ctx.react_confirm(message) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return results = "" for char in characters: entry = await watchlist.add_entry(ctx.pool, char.name, False, ctx.author.id, reason) if entry: results += f"\n• {char.name}" if results: await ctx.success(f"I added the following characters to the list {channel.mention}, " f"duplicates where skipped:{results}") else: await ctx.error("No characters where added, as they were all duplicates.") @checks.server_mod_only() @checks.tracking_world_only() @watchlist.command(name="create") async def watchlist_create(self, ctx: NabCtx, *, name): """Creates a watchlist channel. Creates a new text channel for the watchlist to be posted. The watch list shows which characters from it are online. Entire guilds can be added too. The channel can be renamed at anytime. If the channel is deleted, all its entries are deleted too. """ if WATCHLIST_SEPARATOR in name: await ctx.error(f"Channel name cannot contain the special character **{WATCHLIST_SEPARATOR}**") return if not ctx.bot_permissions.manage_channels: return await ctx.error(f"I need `Manage Channels` permission in the server to use this command.") message = await ctx.send(f"Do you want to create a new watchlist named `{name}`?") confirm = await ctx.react_confirm(message, delete_after=True) if not confirm: return try: overwrites = { ctx.guild.default_role: discord.PermissionOverwrite(send_messages=False, read_messages=True), ctx.guild.me: discord.PermissionOverwrite(send_messages=True, read_messages=True, manage_channels=True) } channel = await ctx.guild.create_text_channel(name, overwrites=overwrites, category=ctx.channel.category) except discord.Forbidden: await ctx.error(f"Sorry, I don't have permissions to create channels.") except discord.HTTPException: await ctx.error(f"Something went wrong, the channel name you chose is probably invalid.") else: log.info(f"Watchlist created (Channel ID: {channel.id}, Guild ID: {channel.guild.id})") await ctx.success(f"Channel created successfully: {channel.mention}\n") await channel.send("This is where I will post a list of online watched characters.\n" "Edit this channel's permissions to allow the roles you want.\n" "This channel can be renamed freely.\n" "Anyone with `Manage Channel` permission here can add entries.\n" f"Example: {ctx.clean_prefix}{ctx.command.full_parent_name} add {channel.mention} " f"Galarzaa Fidera\n" "If this channel is deleted, all related entries will be lost.\n" "**It is important to not allow anyone to write in here**\n" "*This message can be deleted now.*") watchlist = await Watchlist.insert(ctx.pool, ctx.guild.id, channel.id, ctx.author.id) log.debug(f"{self.tag} Watchlist created | {watchlist}") @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="info", aliases=["details", "reason"]) async def watchlist_info(self, ctx: NabCtx, channel: discord.TextChannel, *, name: str): """Shows information about a watchlist entry. This shows who added the player, when, and if there's a reason why they were added.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, False) if not entry: return await ctx.error(f"There's no character with that name registered to {channel.mention}.") embed = discord.Embed(title=entry.name, url=tibiapy.Character.get_url(entry.name), timestamp=entry.created, description=f"**Reason:** {entry.reason}" if entry.reason else "No reason provided.") embed.set_author(name=f"In #{channel}") author = ctx.guild.get_member(entry.user_id) if author: embed.set_footer(text=f"Added by {author.name}#{author.discriminator}", icon_url=get_user_avatar(author)) await ctx.send(embed=embed) @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="infoguild", aliases=["detailsguild", "reasonguild"]) async def watchlist_infoguild(self, ctx: NabCtx, channel: discord.TextChannel, *, name: str): """"Shows details about a guild entry in a watchlist. This shows who added the player, when, and if there's a reason why they were added.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, True) if not entry: return await ctx.error(f"There's no guild with that name registered to {channel.mention}.") embed = discord.Embed(title=entry.name, timestamp=entry.created, url=tibiapy.Guild.get_url(entry.name), description=f"**Reason:** {entry.reason}" if entry.reason else "No reason provided.") embed.set_author(name=f"In #{channel}") author = ctx.guild.get_member(entry.user_id) if author: embed.set_footer(text=f"Added by {author.name}#{author.discriminator}", icon_url=get_user_avatar(author)) await ctx.send(embed=embed) @checks.tracking_world_only() @watchlist.command(name="list") async def watchlist_list(self, ctx: NabCtx, channel: discord.TextChannel): """Shows characters belonging to that watchlist. Note that this lists all characters, not just online characters.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") if not channel.permissions_for(ctx.author).read_messages: return await ctx.error("You can't see the list of a watchlist you can't see.") entries = await WatchlistEntry.get_entries_by_channel(ctx.pool, channel.id) entries = [entry for entry in entries if not entry.is_guild] if not entries: return await ctx.error(f"This watchlist has no registered characters.") pages = Pages(ctx, entries=[f"[{r.name}]({NabChar.get_url(r.name)})" for r in entries]) pages.embed.title = f"Watched Characters in #{channel.name}" try: await pages.paginate() except CannotPaginate as e: await ctx.error(e) @checks.tracking_world_only() @watchlist.command(name="listguilds", aliases=["guilds", "guildlist"]) async def watchlist_list_guild(self, ctx: NabCtx, channel: discord.TextChannel): """Shows a list of guilds in the watchlist.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entries = await WatchlistEntry.get_entries_by_channel(ctx.pool, channel.id) entries = [entry for entry in entries if entry.is_guild] if not channel.permissions_for(ctx.author).read_messages: return await ctx.error("You can't see the list of a watchlist you can't see.") if not entries: return await ctx.error(f"This watchlist has no registered characters.") pages = Pages(ctx, entries=[f"[{r.name}]({Guild.get_url(r.name)})" for r in entries]) pages.embed.title = f"Watched Guilds in #{channel.name}" try: await pages.paginate() except CannotPaginate as e: await ctx.error(e) @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="remove", aliases=["removeplayer", "removechar"]) async def watchlist_remove(self, ctx: NabCtx, channel: discord.TextChannel, *, name): """Removes a character from a watchlist.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, False) if entry is None: return await ctx.error(f"There's no character with that name registered in {channel.mention}.") message = await ctx.send(f"Do you want to remove **{name}** from this watchlist?") confirm = await ctx.react_confirm(message) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return await entry.remove(ctx.pool) await ctx.success("Character removed from the watchlist.") @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="removeguild") async def watchlist_removeguild(self, ctx: NabCtx, channel: discord.TextChannel, *, name): """Removes a guild from the watchlist.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, True) if entry is None: return await ctx.error(f"There's no guild with that name registered in {channel.mention}.") message = await ctx.send(f"Do you want to remove **{name}** from this watchlist?") confirm = await ctx.react_confirm(message) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return await entry.remove(ctx.pool) await ctx.success("Guild removed from the watchlist.") @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="showcount", usage="<channel> <yes|no>") async def watchlist_showcount(self, ctx: NabCtx, channel: discord.TextChannel, yes_no): """Changes whether the online count will be displayed in the watchlist's channel's name or not.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist.") if yes_no.lower().strip() in ["yes", "true"]: await watchlist.update_show_count(ctx.pool, True) await ctx.success("Showing online count is now enabled. The name will be updated on the next cycle.") elif yes_no.lower().strip() in ["no", "false"]: await watchlist.update_show_count(ctx.pool, False) await ctx.success("Showing online count is now disabled. The name will be updated on the next cycle.") else: await ctx.error("That's not a valid option, try `yes` or `no`.") # endregion # region Methods async def announce_death(self, char: NabChar, death: Death, levels_lost=0): """Announces a level up on the corresponding servers.""" log_msg = f"{self.tag}[{char.world}] announce_death: {char.name} | {death.level} | {death.killer.name}" # Find killer article (a/an) killer_article = "" if not death.by_player: killer_article = death.killer.name.split(" ", 1) if killer_article[0] in ["a", "an"] and len(killer_article) > 1: death.killer.name = killer_article[1] killer_article = killer_article[0] + " " else: killer_article = "" if death.killer.name.lower() in ["death", "energy", "earth", "fire", "pit battler", "pit berserker", "pit blackling", "pit brawler", "pit condemned", "pit demon", "pit destroyer", "pit fiend", "pit groveller", "pit grunt", "pit lord", "pit maimer", "pit overlord", "pit reaver", "pit scourge"] and levels_lost == 0: # Skip element damage deaths unless player lost a level to avoid spam from arena deaths # This will cause a small amount of deaths to not be announced but it's probably worth the tradeoff log.debug(f"{log_msg} | Skipping arena death") return guilds = [s for s, w in self.bot.tracked_worlds.items() if w == char.world] for guild_id in guilds: guild = self.bot.get_guild(guild_id) if guild is None: continue min_level = await get_server_property(self.bot.pool, guild_id, "announce_level", config.announce_threshold) if death.level < min_level: log.debug(f"{log_msg} | Guild skipped {guild_id} | Level under limit") continue if guild.get_member(char.owner_id) is None: log.debug(f"{log_msg} | Guild skipped {guild_id} | Owner not in server") continue simple_messages = await get_server_property(self.bot.pool, guild_id, "simple_messages", False) condition = DeathMessageCondition(char=char, death=death, levels_lost=levels_lost, min_level=min_level) # Select a message if death.by_player: message = weighed_choice(death_messages_player, condition) if not simple_messages else SIMPLE_DEATH else: message = weighed_choice(death_messages_monster, condition) if not simple_messages else SIMPLE_PVP_DEATH # Format message with death information message = message.format(**{'name': char.name, 'level': death.level, 'killer': death.killer.name, 'killer_article': killer_article, 'he_she': char.he_she.lower(), 'his_her': char.his_her.lower(), 'him_her': char.him_her.lower()}) # Format extra stylization message = f"{config.pvpdeath_emoji if death.by_player else config.death_emoji} {format_message(message)}" channel_id = await get_server_property(self.bot.pool, guild.id, "levels_channel") channel = self.bot.get_channel_or_top(guild, channel_id) try: await channel.send(message[:1].upper() + message[1:]) log.debug(f"{log_msg} | Announced in {guild_id}") except discord.Forbidden: log.warning(f"{log_msg} | Forbidden error | Channel {channel.id} | Server {guild.id}") except discord.HTTPException: log.exception(f"{log_msg}") async def announce_level(self, char: NabChar, level: int): """Announces a level up on corresponding servers.""" log_msg = f"{self.tag}[{char.world}] announce_level: : {char.name} | {level}" guilds = [s for s, w in self.bot.tracked_worlds.items() if w == char.world] for guild_id in guilds: guild: discord.Guild = self.bot.get_guild(guild_id) if guild is None: continue min_level = await get_server_property(self.bot.pool, guild_id, "announce_level", config.announce_threshold) if char.level < min_level: log.debug(f"{log_msg} | Guild skipped {guild_id} | Level under limit") continue if guild.get_member(char.owner_id) is None: log.debug(f"{log_msg} | Guild skipped {guild_id} | Owner not in server") continue channel_id = await get_server_property(self.bot.pool, guild.id, "levels_channel") simple_messages = await get_server_property(self.bot.pool, guild_id, "simple_messages", False) channel = self.bot.get_channel_or_top(guild, channel_id) try: # Select a message if not simple_messages: message = weighed_choice(level_messages, LevelCondition(char=char, level=level, min_level=min_level)) else: message = SIMPLE_LEVEL # Format message with level information message = message.format(**{'name': char.name, 'level': level, 'he_she': char.he_she.lower(), 'his_her': char.his_her.lower(), 'him_her': char.him_her.lower()}) # Format extra stylization message = f"{config.levelup_emoji} {format_message(message)}" await channel.send(message) log.debug(f"{log_msg} | Announced in {guild_id}") except discord.Forbidden: log.warning(f"{log_msg} | Forbidden error | Channel {channel.id} | Server {guild.id}") except discord.HTTPException: log.exception(f"{log_msg}") @staticmethod async def cached_get_guild(guild_name: str, world: str) -> Optional[Guild]: """ Used to cache guild info, to avoid fetching the same guild multiple times if they are in multiple lists """ if guild_name in GUILD_CACHE[world]: return GUILD_CACHE[world][guild_name] guild = await get_guild(guild_name) GUILD_CACHE[world][guild_name] = guild return guild @classmethod async def check_char_availability(cls, ctx: NabCtx, user_id: int, char: NabChar, worlds: List[str], check_other=False): """Checks the availability of a character and other visible characters optionally. :param ctx: The command context where this is called. :param user_id: The id of the user against which the characters will be checked for. :param char: The character to be checked. :param worlds: The worlds to filter characters from. :param check_other: Whether other characters in the same account should be processed to or not. :return: A named tuple containing the different categories of characters found. """ skipped = [] # type: List[OtherCharacter] """Characters that were skipped due to being in another world or scheduled for deletion.""" no_user = [] # type: List[DbChar] """Characters that belong to users no longer visible to NabBot, most of the time abandoned temporal users.""" same_owner = [] # type: List[DbChar] """Characters that already belong to the user.""" different_user = [] # type: List[DbChar] """Characters belonging to a different user.""" unregistered = [] # type: List[NabChar] """Characters that have never been registered.""" if check_other and not char.hidden: chars: List[Union[OtherCharacter, NabChar]] = char.other_characters _char = next((x for x in chars if x.name == char.name)) chars[chars.index(_char)] = char else: chars = [char] for char in chars: if char.world not in worlds or char.deleted: skipped.append(char) continue db_char = await DbChar.get_by_name(ctx.pool, char.name) if db_char: owner = ctx.bot.get_user(db_char.user_id) if owner is None: no_user.append(db_char) continue elif db_char.user_id == user_id: same_owner.append(db_char) continue different_user.append(db_char) continue if isinstance(char, OtherCharacter): char = await get_character(ctx.bot, char.name) unregistered.append(char) return CharactersResult._make((skipped, no_user, same_owner, different_user, unregistered, len(skipped) == len(chars))) async def compare_deaths(self, char: NabChar): """Checks if the player has new deaths. New deaths are announced if they are not older than 30 minutes.""" if char is None: return async with self.bot.pool.acquire() as conn: db_char = await DbChar.get_by_name(conn, char.name) if db_char is None: return pending_deaths = [] for death in char.deaths: # Check if we have a death that matches the time exists = await DbDeath.exists(conn, db_char.id, death.level, death.time) if exists: # We already have this death, we're assuming we already have older deaths break pending_deaths.append(death) # Announce and save deaths from older to new for death in reversed(pending_deaths): db_death = DbDeath.from_tibiapy(death) db_death.character_id = db_char.id await db_death.save(conn) log_msg = f"{self.tag}[{char.world}] Death detected: {char.name} | {death.level} |" \ f" {death.killer.name}" if (dt.datetime.now(dt.timezone.utc)- death.time) >= dt.timedelta(minutes=30): log.info(f"{log_msg} | Too old to announce.") # Only try to announce if character has an owner elif char.owner_id: log.info(log_msg) await self.announce_death(char, death, max(death.level - char.level, 0)) async def compare_levels(self, char: Union[NabChar, OnlineCharacter], update_only=False): """Compares the character's level with the stored level in database. This should only be used on online characters or characters that just became offline.""" if char is None: return async with self.bot.pool.acquire() as conn: db_char = await DbChar.get_by_name(conn, char.name) if not db_char: return # OnlineCharacter has no sex attribute, so we get it from database and convert to NabChar if isinstance(char, OnlineCharacter): char = NabChar.from_online(char, db_char.sex, db_char.user_id) level_before = db_char.level if level_before != char.level: await db_char.update_level(conn, char.level) log.debug(f"{self.tag}[{char.world}][compare_level] {char.name}'s level updated:" f" {level_before} -> {char.level}") if not (char.level > level_before > 0) or update_only: return # Saving level up date in database await DbLevelUp.insert(conn, db_char.id, char.level) # Announce the level up log.info(f"{self.tag}[{char.world}] Level up detected: {char.name} | {char.level}") # Only try to announce level if char has an owner. if char.owner_id: await self.announce_level(char, char.level) else: log.debug(f"{self.tag}[{char.world}] Character has no owner, skipping") @classmethod async def process_character_assignment(cls, ctx: NabCtx, results: CharactersResult, user: discord.User, author: discord.User = None, claim=False): """Processes the results of a character check and applies the changes :param ctx: The command context :param results: The character results :param user: The user that will get the characters assigned. :param author: The user that did the action, None if it was the same user. :param claim: Whether the operation is a claim. :return: A summary of the applied actions. """ recipient = f"**@{user.display_name}**" if author else "you" author_log = f"| By {author}" if author else "" reply = "" if results.different_user and not claim: first = results.different_user[0].name reply = f"{ctx.tick(False)} Sorry, a character in that account ({first}) is already registered to " \ f"someone else.\n" \ f"If the character really belongs to {recipient}, `{ctx.clean_prefix}claim {first}` should be used." return reply if results.same_owner: existent_names = [e.name for e in results.same_owner] reply += f"\n⚫ The following characters were already registered to {recipient}: {join_list(existent_names)}" if results.new: added_names = [a.name for a in results.new] reply += f"\n🔵 The following characters were added to {recipient}: {join_list(added_names)}" if results.no_user: updated_names = [r.name for r in results.no_user] reply += f"\n⚪ The following characters were reassigned to {recipient}: {join_list(updated_names)}" if results.different_user: reclaimed_chars = [c.name for c in results.different_user] reply += f"\n🔴 The following characters were reclaimed by you: {join_list(reclaimed_chars)}" async with ctx.pool.acquire() as conn: for char in results.different_user: await char.update_user(conn, user.id) log.info(f"{cls.get_tag()} Character Claimed | {char.name} | {user} ({user.id}){author_log}") for char in results.no_user: await char.update_user(conn, user.id) log.info(f"{cls.get_tag()} Character Reassigned | {char.name} | {user} ({user.id}){author_log}") for char in results.new: db_char = await DbChar.insert(conn, char.name, char.level, char.vocation.value, user.id, char.world, char.guild_name) char.id = db_char.id log.info(f"{cls.get_tag()} Character Registered | {char.name} | {user} ({user.id}){author_log}") # If we are claiming, different user characters are also passed if claim: results.no_user.extend(results.different_user) ctx.bot.dispatch("characters_registered", user, results.new, results.no_user, author) ctx.bot.dispatch("character_change", user.id) return reply async def save_highscores(self, world: str, key: str, highscores: tibiapy.Highscores) -> int: """Saves the highscores of a world and category to the database.""" if highscores is None: return 0 rows = [(e.rank, key, world, e.name, e.vocation.value, e.value) for e in highscores.entries] async with self.bot.pool.acquire() as conn: # type: asyncpg.Connection async with conn.transaction(): # Delete old records await conn.execute("DELETE FROM highscores_entry WHERE category = $1 AND world = $2", key, world) # Add current entries await conn.copy_records_to_table("highscores_entry", records=rows, columns=["rank", "category", "world", "name", "vocation", "value"]) log.debug(f"{self.tag}[{world}][save_highscores] {key} | {len(rows)} entries saved") # Update scan times await conn.execute("""INSERT INTO highscores(world, category, last_scan) VALUES($1, $2, $3) ON CONFLICT (world,category) DO UPDATE SET last_scan = EXCLUDED.last_scan""", world, key, dt.datetime.now(dt.timezone.utc)) return len(rows) # endregion def cog_unload(self): log.info(f"{self.tag} Unloading cog") self.scan_highscores_task.cancel() self.scan_online_chars_task.cancel() for k, v in self.world_tasks.items(): v.cancel() def setup(bot): bot.add_cog(Tracking(bot))
apache-2.0
2,001,326,355,620,940,500
47.838201
120
0.590449
false
Fiona/AreWeAlone
__main__.py
1
4157
########## # LD 22 # The theme is alone # it's a dumb theme # fiona wrote this ########## # System and Python lib imports import sys sys.path += ['.'] # Game engine imports from myrmidon.myrmidon import MyrmidonGame, MyrmidonProcess from myrmidon.consts import * from pygame.locals import * # Game imports from consts import * from media import Media from gui import GUI from galaxy import Galaxy from game_galaxy import Galaxy_background, Solar_system_star, Player_ship, Galaxy_player_ship class Game(MyrmidonProcess): # Current state game_state = 0 # Player state money = 2000000000 fuel = 0 crew = 0 current_system = "Sol" current_object = "Earth" fuel_cost = 1000000000 crew_cost = 500000000 actions_done = {} home_planet_result = [] first_time = True # Self explanitory object pointers and lists fps_text = None gui = None media = None solar_system_objects = [] player_ship = None background = None galaxy = None def execute(self): # Pre launch set-up MyrmidonGame.current_fps = 60 self.priority = PRIORITY_MAIN_GAME # Load all media self.media = Media() self.media.load_fonts() self.media.load_graphics() self.media.load_audio() # Debug display if DEBUG_SHOW_FPS: self.fps_text = MyrmidonGame.write_text(0.0, 0.0, font = self.media.fonts['basic'], text = 0) self.fps_text.colour = (1, 1, 1, 1) self.fps_text.z = -2000 # Set up starting game objects self.galaxy = Galaxy(self) self.gui = GUI(self) self.switch_game_state_to(GAME_STATE_SOLAR_SYSTEM) self.media.audio['ambient'].play(loops = -1) while True: # update debug display if DEBUG_SHOW_FPS: self.fps_text.text = "fps: " + str(MyrmidonGame.fps) yield def quit_game(self): sys.exit() def switch_game_state_to(self, state, gui_state = None): """ Pass in a state and this will switch to it. It will also clean up everying necessary to go out of the previous game state. """ # Undo and destroy everything in the current state self.gui.destroy_current_gui_state() col = (1.0, 1.0, 1.0) if self.game_state == GAME_STATE_SOLAR_SYSTEM: for x in self.solar_system_objects: x.signal(S_KILL) self.solar_system_objects = [] self.player_ship.signal(S_KILL) self.background.signal(S_KILL) elif self.game_state == GAME_STATE_GALAXY: self.player_ship.signal(S_KILL) self.background.signal(S_KILL) # Switch to new state self.game_state = state # Create everything we require if state == GAME_STATE_GALAXY: self.background = Galaxy_background(self) self.gui.fade_toggle() self.gui.switch_gui_state_to(GUI_STATE_GALAXY if gui_state is None else gui_state) self.player_ship = Galaxy_player_ship(self) elif state == GAME_STATE_SOLAR_SYSTEM: self.background = Galaxy_background(self) self.solar_system_objects = [] self.solar_system_objects.append(Solar_system_star(self, self.galaxy.solar_systems[self.current_system])) self.gui.fade_toggle() self.gui.switch_gui_state_to(GUI_STATE_SOLAR_SYSTEM if gui_state is None else gui_state) self.player_ship = Player_ship(self) def do_home_planet_results(self): if len(self.home_planet_result) > 0: result = self.home_planet_result.pop() result[0](self, *result[1]) if __name__ == '__main__': MyrmidonGame.screen_resolution = (1024, 768) MyrmidonGame.lowest_resolution = (1024, 768) MyrmidonGame.full_screen = False Game()
mit
1,547,291,332,813,934,600
27.06993
117
0.570604
false
BatedUrGonnaDie/salty_bot
modules/helpers/yt_video_link.py
1
1246
#! /usr/bin/env python3.7 import re import isodate import modules.extensions.regexes as regexes import modules.commands.helpers.time_formatter as time_formatter ON_ACTION = "PRIVMSG" def call(salty_inst, c_msg, balancer, **kwargs): video_ids = re.findall(regexes.YOUTUBE_URL, c_msg["message"]) if not video_ids: return False, "No video ids" seen_ids = set() seen_add = seen_ids.add video_ids = [x for x in video_ids if not (x in seen_ids or seen_add(x))] parts = ["snippet", "statistics", "contentDetails"] final_list = [] success, response = salty_inst.youtube_api.get_videos(video_ids, parts, **kwargs) if not success: return False, \ "Error retrieving info from youtube API ({0})".format(response.status_code) if len(response["items"]) == 0: return False, "No valid ID's found." for i in response["items"]: final_list.append("[{0}] {1} uploaded by {2}. Views: {3}".format( time_formatter.format_time(isodate.parse_duration(i["contentDetails"]["duration"]).seconds), i["snippet"]["title"], i["snippet"]["channelTitle"], i["statistics"]["viewCount"] )) return True, " | ".join(final_list)
mit
-6,777,776,183,059,641,000
32.675676
104
0.623596
false
google/tf_mesh_renderer
mesh_renderer/rasterize_triangles_test.py
1
7681
# Copyright 2017 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import absolute_import from __future__ import division from __future__ import print_function import os import numpy as np import tensorflow as tf import test_utils import camera_utils import rasterize_triangles class RenderTest(tf.test.TestCase): def setUp(self): self.test_data_directory = 'mesh_renderer/test_data/' tf.reset_default_graph() self.cube_vertex_positions = tf.constant( [[-1, -1, 1], [-1, -1, -1], [-1, 1, -1], [-1, 1, 1], [1, -1, 1], [1, -1, -1], [1, 1, -1], [1, 1, 1]], dtype=tf.float32) self.cube_triangles = tf.constant( [[0, 1, 2], [2, 3, 0], [3, 2, 6], [6, 7, 3], [7, 6, 5], [5, 4, 7], [4, 5, 1], [1, 0, 4], [5, 6, 2], [2, 1, 5], [7, 4, 0], [0, 3, 7]], dtype=tf.int32) self.tf_float = lambda x: tf.constant(x, dtype=tf.float32) self.image_width = 640 self.image_height = 480 self.perspective = camera_utils.perspective( self.image_width / self.image_height, self.tf_float([40.0]), self.tf_float([0.01]), self.tf_float([10.0])) def runTriangleTest(self, w_vector, target_image_name): """Directly renders a rasterized triangle's barycentric coordinates. Tests only the kernel (rasterize_triangles_module). Args: w_vector: 3 element vector of w components to scale triangle vertices. target_image_name: image file name to compare result against. """ clip_init = np.array( [[-0.5, -0.5, 0.8, 1.0], [0.0, 0.5, 0.3, 1.0], [0.5, -0.5, 0.3, 1.0]], dtype=np.float32) clip_init = clip_init * np.reshape( np.array(w_vector, dtype=np.float32), [3, 1]) clip_coordinates = tf.constant(clip_init) triangles = tf.constant([[0, 1, 2]], dtype=tf.int32) rendered_coordinates, _, _ = ( rasterize_triangles.rasterize_triangles_module.rasterize_triangles( clip_coordinates, triangles, self.image_width, self.image_height)) rendered_coordinates = tf.concat( [rendered_coordinates, tf.ones([self.image_height, self.image_width, 1])], axis=2) with self.test_session() as sess: image = rendered_coordinates.eval() baseline_image_path = os.path.join(self.test_data_directory, target_image_name) test_utils.expect_image_file_and_render_are_near( self, sess, baseline_image_path, image) def testRendersSimpleTriangle(self): self.runTriangleTest((1.0, 1.0, 1.0), 'Simple_Triangle.png') def testRendersPerspectiveCorrectTriangle(self): self.runTriangleTest((0.2, 0.5, 2.0), 'Perspective_Corrected_Triangle.png') def testRendersTwoCubesInBatch(self): """Renders a simple cube in two viewpoints to test the python wrapper.""" vertex_rgb = (self.cube_vertex_positions * 0.5 + 0.5) vertex_rgba = tf.concat([vertex_rgb, tf.ones([8, 1])], axis=1) center = self.tf_float([[0.0, 0.0, 0.0]]) world_up = self.tf_float([[0.0, 1.0, 0.0]]) look_at_1 = camera_utils.look_at(self.tf_float([[2.0, 3.0, 6.0]]), center, world_up) look_at_2 = camera_utils.look_at(self.tf_float([[-3.0, 1.0, 6.0]]), center, world_up) projection_1 = tf.matmul(self.perspective, look_at_1) projection_2 = tf.matmul(self.perspective, look_at_2) projection = tf.concat([projection_1, projection_2], axis=0) background_value = [0.0, 0.0, 0.0, 0.0] rendered = rasterize_triangles.rasterize( tf.stack([self.cube_vertex_positions, self.cube_vertex_positions]), tf.stack([vertex_rgba, vertex_rgba]), self.cube_triangles, projection, self.image_width, self.image_height, background_value) with self.test_session() as sess: images = sess.run(rendered, feed_dict={}) for i in (0, 1): image = images[i, :, :, :] baseline_image_name = 'Unlit_Cube_{}.png'.format(i) baseline_image_path = os.path.join(self.test_data_directory, baseline_image_name) test_utils.expect_image_file_and_render_are_near( self, sess, baseline_image_path, image) def testSimpleTriangleGradientComputation(self): """Verifies the Jacobian matrix for a single pixel. The pixel is in the center of a triangle facing the camera. This makes it easy to check which entries of the Jacobian might not make sense without worrying about corner cases. """ test_pixel_x = 325 test_pixel_y = 245 clip_coordinates = tf.placeholder(tf.float32, shape=[3, 4]) triangles = tf.constant([[0, 1, 2]], dtype=tf.int32) barycentric_coordinates, _, _ = ( rasterize_triangles.rasterize_triangles_module.rasterize_triangles( clip_coordinates, triangles, self.image_width, self.image_height)) pixels_to_compare = barycentric_coordinates[ test_pixel_y:test_pixel_y + 1, test_pixel_x:test_pixel_x + 1, :] with self.test_session(): ndc_init = np.array( [[-0.5, -0.5, 0.8, 1.0], [0.0, 0.5, 0.3, 1.0], [0.5, -0.5, 0.3, 1.0]], dtype=np.float32) theoretical, numerical = tf.test.compute_gradient( clip_coordinates, (3, 4), pixels_to_compare, (1, 1, 3), x_init_value=ndc_init, delta=4e-2) jacobians_match, message = ( test_utils.check_jacobians_are_nearly_equal( theoretical, numerical, 0.01, 0.0, True)) self.assertTrue(jacobians_match, message) def testInternalRenderGradientComputation(self): """Isolates and verifies the Jacobian matrix for the custom kernel.""" image_height = 21 image_width = 28 clip_coordinates = tf.placeholder(tf.float32, shape=[8, 4]) barycentric_coordinates, _, _ = ( rasterize_triangles.rasterize_triangles_module.rasterize_triangles( clip_coordinates, self.cube_triangles, image_width, image_height)) with self.test_session(): # Precomputed transformation of the simple cube to normalized device # coordinates, in order to isolate the rasterization gradient. # pyformat: disable ndc_init = np.array( [[-0.43889722, -0.53184521, 0.85293502, 1.0], [-0.37635487, 0.22206162, 0.90555805, 1.0], [-0.22849123, 0.76811147, 0.80993629, 1.0], [-0.2805393, -0.14092168, 0.71602166, 1.0], [0.18631913, -0.62634289, 0.88603103, 1.0], [0.16183566, 0.08129397, 0.93020856, 1.0], [0.44147962, 0.53497446, 0.85076219, 1.0], [0.53008741, -0.31276882, 0.77620775, 1.0]], dtype=np.float32) # pyformat: enable theoretical, numerical = tf.test.compute_gradient( clip_coordinates, (8, 4), barycentric_coordinates, (image_height, image_width, 3), x_init_value=ndc_init, delta=4e-2) jacobians_match, message = ( test_utils.check_jacobians_are_nearly_equal( theoretical, numerical, 0.01, 0.01)) self.assertTrue(jacobians_match, message) if __name__ == '__main__': tf.test.main()
apache-2.0
-5,375,903,968,414,628,000
38.188776
80
0.622836
false
crask/redisproxy
test/memcache/memcache.py
1
15420
# Copyright 2012 Mixpanel, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ''' a minimal, pure python client for memcached, kestrel, etc. Usage example:: import memcache mc = memcache.Client("127.0.0.1", 11211, timeout=1, connect_timeout=5) mc.set("some_key", "Some value") value = mc.get("some_key") mc.delete("another_key") ''' import errno import re import socket class ClientException(Exception): ''' Raised when the server does something we don't expect | This does not include `socket errors <http://docs.python.org/library/socket.html#socket.error>`_ | Note that ``ValidationException`` subclasses this so, technically, this is raised on any error ''' def __init__(self, msg, item=None): if item is not None: msg = '%s: %r' % (msg, item) # use repr() to better see special chars super(ClientException, self).__init__(msg) class ValidationException(ClientException): ''' Raised when an invalid parameter is passed to a ``Client`` function ''' def __init__(self, msg, item): super(ValidationException, self).__init__(msg, item) class Client(object): def __init__(self, host, port, timeout=None, connect_timeout=None): ''' If ``connect_timeout`` is None, ``timeout`` will be used instead (for connect and everything else) ''' self._addr = (host, port) self._timeout = timeout self._connect_timeout = connect_timeout self._socket = None def __del__(self): self.close() def _get_addr(self): return self._addr address = property(_get_addr) ''' A read-only (str, int) tuple representing the host operations are performed on ''' def _get_timeout(self): return self._timeout def _set_timeout(self, timeout): # presumably this should fail rarely # set locally before on socket # b/c if socket fails, it will probably be closed/reopened # and will want to use last intended value self._timeout = timeout if self._socket: self._socket.settimeout(timeout) timeout = property(_get_timeout, _set_timeout) ''' A float representing the timeout in seconds for reads and sends on the underlying socket (``connect_timeout`` cannot be changed once init) Setting a timeout can raise a ``TypeError`` (non-float) or a ``ValueError`` (negative) ''' def _connect(self): # buffer needed since we always ask for 4096 bytes at a time # thus, might read more than the current expected response # cleared on every reconnect since old bytes are part of old session and can't be reused self._buffer = '' self._socket = socket.socket(socket.AF_INET, socket.SOCK_STREAM) connect_timeout = self._connect_timeout if self._connect_timeout is not None else self._timeout self._socket.settimeout(connect_timeout) # passing None means blocking try: self._socket.connect(self._addr) self._socket.settimeout(self._timeout) except (socket.error, socket.timeout): self._socket = None # don't want to hang on to bad socket raise def _read(self, length=None): ''' Return the next length bytes from server Or, when length is None, Read a response delimited by \r\n and return it (including \r\n) (Use latter only when \r\n is unambiguous -- aka for control responses, not data) ''' result = None while result is None: if length: # length = 0 is ambiguous, so don't use if len(self._buffer) >= length: result = self._buffer[:length] self._buffer = self._buffer[length:] else: delim_index = self._buffer.find('\r\n') if delim_index != -1: result = self._buffer[:delim_index+2] self._buffer = self._buffer[delim_index+2:] if result is None: try: tmp = self._socket.recv(4096) except (socket.error, socket.timeout) as e: self.close() raise e if not tmp: # we handle common close/retry cases in _send_command # however, this can happen if server suddenly goes away # (e.g. restarting memcache under sufficient load) raise socket.error, 'unexpected socket close on recv' else: self._buffer += tmp return result def _send_command(self, command): ''' Send command to server and return initial response line Will reopen socket if it got closed (either locally or by server) ''' if self._socket: # try to find out if the socket is still open try: self._socket.settimeout(0) self._socket.recv(0) # if recv didn't raise, then the socket was closed or there is junk # in the read buffer, either way, close self.close() except socket.error as e: if e.errno == errno.EAGAIN: # this is expected if the socket is still open self._socket.settimeout(self._timeout) else: self.close() if not self._socket: self._connect() self._socket.sendall(command) return self._read() # key supports ascii sans space and control chars # \x21 is !, right after space, and \x7e is -, right before DEL # also 1 <= len <= 250 as per the spec _valid_key_re = re.compile('^[\x21-\x7e]{1,250}$') def _validate_key(self, key): if not isinstance(key, str): # avoid bugs subtle and otherwise raise ValidationException('key must be str', key) m = self._valid_key_re.match(key) if m: # in python re, $ matches either end of line or right before # \n at end of line. We can't allow latter case, so # making sure length matches is simplest way to detect if len(m.group(0)) != len(key): raise ValidationException('trailing newline', key) else: raise ValidationException('invalid key', key) return key def close(self): ''' Closes the socket if its open | Sockets are automatically closed when the ``Client`` object is garbage collected | Sockets are opened the first time a command is run (such as ``get`` or ``set``) | Raises socket errors ''' if self._socket: self._socket.close() self._socket = None def delete(self, key): ''' Deletes a key/value pair from the server Raises ``ClientException`` and socket errors ''' # req - delete <key> [noreply]\r\n # resp - DELETED\r\n # or # NOT_FOUND\r\n key = self._validate_key(key) command = 'delete %s\r\n' % key resp = self._send_command(command) if resp != 'DELETED\r\n' and resp != 'NOT_FOUND\r\n': raise ClientException('delete failed', resp) def get(self, key): ''' Gets a single value from the server; returns None if there is no value Raises ``ValidationException``, ``ClientException``, and socket errors ''' return self.multi_get([key])[0] def multi_get(self, keys): ''' Takes a list of keys and returns a list of values Raises ``ValidationException``, ``ClientException``, and socket errors ''' if len(keys) == 0: return [] # req - get <key> [<key> ...]\r\n # resp - VALUE <key> <flags> <bytes> [<cas unique>]\r\n # <data block>\r\n (if exists) # [...] # END\r\n keys = [self._validate_key(key) for key in keys] if len(set(keys)) != len(keys): raise ClientException('duplicate keys passed to multi_get') command = 'get %s\r\n' % ' '.join(keys) received = {} resp = self._send_command(command) error = None while resp != 'END\r\n': terms = resp.split() if len(terms) == 4 and terms[0] == 'VALUE': # exists key = terms[1] flags = int(terms[2]) length = int(terms[3]) if flags != 0: error = ClientException('received non zero flags') val = self._read(length+2)[:-2] if key in received: error = ClientException('duplicate results from server') received[key] = val else: raise ClientException('get failed', resp) resp = self._read() if error is not None: # this can happen if a memcached instance contains items set by a previous client # leads to subtle bugs, so fail fast raise error if len(received) > len(keys): raise ClientException('received too many responses') # memcache client is used by other servers besides memcached. # In the case of kestrel, responses coming back to not necessarily # match the requests going out. Thus we just ignore the key name # if there is only one key and return what we received. if len(keys) == 1 and len(received) == 1: response = received.values() else: response = [received.get(key) for key in keys] return response def getex(self, key): ''' Gets a single value from the server; returns None if there is no value Raises ``ValidationException``, ``ClientException``, and socket errors ''' return self.multi_getex([key])[0] def multi_getex(self, keys): ''' Takes a list of keys and returns a list of values Raises ``ValidationException``, ``ClientException``, and socket errors ''' if len(keys) == 0: return [] # req - getex <key> [<key> ...]\r\n # resp - VALUE <key> <flags> <bytes> <cas unique> <expire time>\r\n # <data block>\r\n (if exists) # [...] # END\r\n keys = [self._validate_key(key) for key in keys] if len(set(keys)) != len(keys): raise ClientException('duplicate keys passed to multi_get') command = 'getex %s\r\n' % ' '.join(keys) received = {} resp = self._send_command(command) error = None while resp != 'END\r\n': terms = resp.split() if len(terms) == 6 and terms[0] == 'VALUE': # exists key = terms[1] flags = int(terms[2]) length = int(terms[3]) if flags != 0: error = ClientException('received non zero flags') val = self._read(length+2)[:-2] if key in received: error = ClientException('duplicate results from server') received[key] = val else: raise ClientException('get failed', resp) resp = self._read() if error is not None: # this can happen if a memcached instance contains items set by a previous client # leads to subtle bugs, so fail fast raise error if len(received) > len(keys): raise ClientException('received too many responses') # memcache client is used by other servers besides memcached. # In the case of kestrel, responses coming back to not necessarily # match the requests going out. Thus we just ignore the key name # if there is only one key and return what we received. if len(keys) == 1 and len(received) == 1: response = received.values() else: response = [received.get(key) for key in keys] return response def set(self, key, val, exptime=0): ''' Sets a key to a value on the server with an optional exptime (0 means don't auto-expire) Raises ``ValidationException``, ``ClientException``, and socket errors ''' # req - set <key> <flags> <exptime> <bytes> [noreply]\r\n # <data block>\r\n # resp - STORED\r\n (or others) key = self._validate_key(key) # the problem with supporting types is it oftens leads to uneven and confused usage # some code sites use the type support, others do manual casting to/from str # worse yet, some sites don't even know what value they are putting in and mis-cast on get # by uniformly requiring str, the end-use code is much more uniform and legible if not isinstance(val, str): raise ValidationException('value must be str', val) # typically, if val is > 1024**2 bytes server returns: # SERVER_ERROR object too large for cache\r\n # however custom-compiled memcached can have different limit # so, we'll let the server decide what's too much if not isinstance(exptime, int): raise ValidationException('exptime not int', exptime) elif exptime < 0: raise ValidationException('exptime negative', exptime) command = 'set %s 0 %d %d\r\n%s\r\n' % (key, exptime, len(val), val) resp = self._send_command(command) if resp != 'STORED\r\n': raise ClientException('set failed', resp) def stats(self, additional_args=None): ''' Runs a stats command on the server. ``additional_args`` are passed verbatim to the server. See `the memcached wiki <http://code.google.com/p/memcached/wiki/NewCommands#Statistics>`_ for details or `the spec <https://github.com/memcached/memcached/blob/master/doc/protocol.txt>`_ for even more details Raises ``ClientException`` and socket errors ''' # req - stats [additional args]\r\n # resp - STAT <name> <value>\r\n (one per result) # END\r\n if additional_args is not None: command = 'stats %s\r\n' % additional_args else: command = 'stats\r\n' resp = self._send_command(command) result = {} while resp != 'END\r\n': terms = resp.split() if len(terms) == 2 and terms[0] == 'STAT': result[terms[1]] = None elif len(terms) == 3 and terms[0] == 'STAT': result[terms[1]] = terms[2] else: raise ClientException('stats failed', resp) resp = self._read() return result
apache-2.0
-2,465,647,685,932,409,000
37.074074
114
0.569455
false
sterlingbaldwin/acme_workbench
workbench-backend/index/tests.py
1
3781
import json from django.test import TestCase from django.test import Client class IndexViewTests(TestCase): fixtures = ['seed.json'] """ Tests for the Index app views """ def test_get_index(self): """ Test that the index page returns success """ client = Client() response = client.get('/') self.assertEqual(response.status_code, 200) def test_get_workbench_no_login(self): """ Test that the workbench redirects when not logged in """ client = Client() response = client.get('/workbench') self.assertEqual(response.status_code, 302) def test_get_workbench_with_login(self): """ Test that the workbench renders when logged in """ client = Client() self.assertTrue( client.login( username='test_user', password='qwertyuiop')) res = client.get('/workbench') self.assertEqual(res.status_code, 200) def test_valid_user_registration(self): """ test ability to register new users """ client = Client() res = client.get('/register') self.assertEqual(res.status_code, 200) post_data = { 'username': 'test_user1', 'password1': 'test_pass', 'password2': 'test_pass', 'firstname': 'test', 'lastname': 'test', 'email': '[email protected]' } res = client.post('/register', post_data) self.assertEqual(res.status_code, 200) def test_invalid_user_registration(self): """ test ability to register new users """ client = Client() res = client.get('/register') self.assertEqual(res.status_code, 200) post_data = { 'username': 'test_user1', 'password1': 'test_pass', 'password2': 'THIS IS NOT VALID', 'firstname': 'test', 'lastname': 'test', 'email': '[email protected]' } res = client.post('/register', post_data) self.assertNotEqual(res.status_code, 200) def test_valid_user_login(self): """ test users ability to login with valid credentials """ client = Client() post_data = { 'password': 'qwertyuiop', 'username': 'test_user' } res = client.post('/login', post_data) self.assertEqual(res.status_code, 200) def test_invalid_user_login(self): """ Test rejection of invalid credentials """ client = Client() post_data = { 'username': 'test_user', 'password': 'IM A LITTLE TEA POT' } res = client.post('/login', post_data) self.assertEqual(res.status_code, 401) def test_valid_user_logout(self): """ test users ability to logout """ client = Client() post_data = { 'password': 'qwertyuiop', 'username': 'test_user' } res = client.post('/login', post_data) self.assertEqual(res.status_code, 200) res = client.get('/logout') self.assertEqual(res.status_code, 200) self.assertFalse(res.context['request'].user.is_authenticated()) def test_get_user_list(self): """ test of the get user list view """ client = Client() url = '/get_user_list/' expected_result = ['test_user', 'baldwin32'] res = client.get(url) self.assertEqual(res.status_code, 200) data = json.loads(res.content) for user in data: self.assertTrue(user in expected_result)
bsd-2-clause
3,293,972,023,252,596,000
28.310078
72
0.530283
false
lixiangning888/whole_project
lib/cuckoo/common/demux.py
1
7192
# Copyright (C) 2015 Accuvant, Inc. ([email protected]) # This file is part of Cuckoo Sandbox - http://www.cuckoosandbox.org # See the file 'docs/LICENSE' for copying permission. import os import tempfile from zipfile import ZipFile try: from rarfile import RarFile HAS_RARFILE = True except ImportError: HAS_RARFILE = False from lib.cuckoo.common.config import Config from lib.cuckoo.common.objects import File from lib.cuckoo.common.email_utils import find_attachments_in_email from lib.cuckoo.common.office.msgextract import Message def demux_zip(filename, options): retlist = [] try: # don't try to extract from office docs magic = File(filename).get_type() if "Microsoft" in magic or "Java Jar" in magic: return retlist extracted = [] password="infected" fields = options.split(",") for field in fields: try: key, value = field.split("=", 1) if key == "password": password = value break except: pass with ZipFile(filename, "r") as archive: infolist = archive.infolist() for info in infolist: # avoid obvious bombs if info.file_size > 100 * 1024 * 1024 or not info.file_size: continue # ignore directories if info.filename.endswith("/"): continue base, ext = os.path.splitext(info.filename) basename = os.path.basename(info.filename) ext = ext.lower() if ext == "" and len(basename) and basename[0] == ".": continue extensions = ["", ".exe", ".dll", ".pdf", ".doc", ".ppt", ".pptx", ".docx", ".xls", ".msi", ".bin", ".scr"] for theext in extensions: if ext == theext: extracted.append(info.filename) break options = Config() tmp_path = options.cuckoo.get("tmppath", "/tmp") target_path = os.path.join(tmp_path, "cuckoo-zip-tmp") if not os.path.exists(target_path): os.mkdir(target_path) tmp_dir = tempfile.mkdtemp(prefix='cuckoozip_',dir=target_path) for extfile in extracted: try: retlist.append(archive.extract(extfile, path=tmp_dir, pwd=password)) except: retlist.append(archive.extract(extfile, path=tmp_dir)) except: pass return retlist def demux_rar(filename, options): retlist = [] if not HAS_RARFILE: return retlist try: # don't try to auto-extract RAR SFXes magic = File(filename).get_type() if "PE32" in magic or "MS-DOS executable" in magic: return retlist extracted = [] password="infected" fields = options.split(",") for field in fields: try: key, value = field.split("=", 1) if key == "password": password = value break except: pass with RarFile(filename, "r") as archive: infolist = archive.infolist() for info in infolist: # avoid obvious bombs if info.file_size > 100 * 1024 * 1024 or not info.file_size: continue # ignore directories if info.filename.endswith("\\"): continue # add some more sanity checking since RarFile invokes an external handler if "..\\" in info.filename: continue base, ext = os.path.splitext(info.filename) basename = os.path.basename(info.filename) ext = ext.lower() if ext == "" and len(basename) and basename[0] == ".": continue extensions = ["", ".exe", ".dll", ".pdf", ".doc", ".ppt", ".pptx", ".docx", ".xls", ".msi", ".bin", ".scr"] for theext in extensions: if ext == theext: extracted.append(info.filename) break options = Config() tmp_path = options.cuckoo.get("tmppath", "/tmp") target_path = os.path.join(tmp_path, "cuckoo-rar-tmp") if not os.path.exists(target_path): os.mkdir(target_path) tmp_dir = tempfile.mkdtemp(prefix='cuckoorar_',dir=target_path) for extfile in extracted: # RarFile differs from ZipFile in that extract() doesn't return the path of the extracted file # so we have to make it up ourselves try: archive.extract(extfile, path=tmp_dir, pwd=password) retlist.append(os.path.join(tmp_dir, extfile.replace("\\", "/"))) except: archive.extract(extfile, path=tmp_dir) retlist.append(os.path.join(tmp_dir, extfile.replace("\\", "/"))) except: pass return retlist def demux_email(filename, options): retlist = [] try: with open(filename, "rb") as openfile: buf = openfile.read() atts = find_attachments_in_email(buf, True) if atts and len(atts): for att in atts: retlist.append(att[0]) except: pass return retlist def demux_msg(filename, options): retlist = [] try: retlist = Message(filename).get_extracted_attachments() except: pass return retlist def demux_sample(filename, package, options): """ If file is a ZIP, extract its included files and return their file paths If file is an email, extracts its attachments and return their file paths (later we'll also extract URLs) """ # if a package was specified, then don't do anything special # this will allow for the ZIP package to be used to analyze binaries with included DLL dependencies if package: return [ filename ] retlist = demux_zip(filename, options) if not retlist: retlist = demux_rar(filename, options) if not retlist: retlist = demux_email(filename, options) if not retlist: retlist = demux_msg(filename, options) # handle ZIPs/RARs inside extracted files if retlist: newretlist = [] for item in retlist: zipext = demux_zip(item, options) if zipext: newretlist.extend(zipext) else: rarext = demux_rar(item, options) if rarext: newretlist.extend(rarext) else: newretlist.append(item) retlist = newretlist # if it wasn't a ZIP or an email or we weren't able to obtain anything interesting from either, then just submit the # original file if not retlist: retlist.append(filename) return retlist
lgpl-3.0
-6,092,322,796,231,694,000
33.411483
123
0.535595
false
jeromecc/doctoctocbot
src/customer/forms.py
1
3367
from django import forms from django.utils.translation import ugettext_lazy as _ from django_countries.fields import CountryField from crispy_forms.helper import FormHelper from crispy_forms.layout import Submit from customer.models import Customer from bootstrap_modal_forms.forms import BSModalForm, BSModalModelForm class CustomerReadOnlyForm(forms.Form): def __init__(self, *args, **kwargs): self.user = kwargs.pop('user', None) super(CustomerReadOnlyForm, self).__init__(*args, **kwargs) try: customer = Customer.objects.get(user=self.user) except Customer.DoesNotExist: return self.helper = FormHelper() self.helper.form_id = 'customer-form' self.helper.form_class = 'form-horizontal' self.helper.form_method = 'post' self.helper.form_action = '/customer/' self.helper.form_group_wrapper_class = 'row' self.helper.label_class = 'offset-md-1 col-md-1' self.helper.field_class = 'col-md-8' self.fields['country'].label = _('Country') self.helper.add_input(Submit('submit', 'Submit', css_class='btn-primary')) self.fields['id'].initial=customer.id self.fields['first_name'].initial=customer.first_name self.fields['last_name'].initial=customer.last_name self.fields['company'].initial=customer.company self.fields['address_1'].initial=customer.address_1 self.fields['address_2'].initial=customer.address_2 self.fields['country'].initial=customer.country self.fields['email'].initial=customer.email self.fields['city'].initial=customer.city #self.fields['state'].initial=customer.state self.fields['zip_code'].initial=customer.zip_code id = forms.CharField( disabled=True, widget=forms.HiddenInput(), ) first_name = forms.CharField( label=_('First name'), max_length=128, disabled=True, ) last_name = forms.CharField( label=_('Last name'), max_length=128, disabled=True, ) company = forms.CharField( label=_('Company'), max_length=128, disabled=True, ) address_1 = forms.CharField( label=_('Address'), max_length=128, disabled=True, ) address_2 = forms.CharField( label=_('Address'), max_length=128, required=False, disabled=True, ) country = CountryField( blank_label=_('(select country)') ).formfield(disabled=True,) phone = forms.CharField( label=_('Telephone'), max_length=32, required=False, disabled=True, ) email = forms.CharField( label=_('Email'), max_length=254, disabled=True, ) city = forms.CharField( label=_('City'), max_length=128, disabled=True, ) """ state = forms.CharField( label=_('State'), max_length=128, required=False, disabled=True, ) """ zip_code = forms.CharField( label=_('ZIP code'), max_length=32, disabled=True, ) class CustomerModelForm(BSModalModelForm): class Meta: model = Customer exclude = [ 'silver_id', 'user', 'state', ]
mpl-2.0
2,314,816,419,920,023,000
28.535088
82
0.591922
false
rain87/pc-health
create_graph.py
1
6855
#!/usr/bin/python # coding=utf8 import rrd_config as C import os import subprocess from collections import namedtuple import gzip import sys import itertools from smart_attributes import names as smart_names DataSource = namedtuple('DataSource', 'db_fname field legend is_area color stack') DataSource.__new__.__defaults__ = (False, None, False) Graph = namedtuple('Graph', 'fname title vlabel ds') graph_colors = [ '#396AB1', '#DA7C30', '#3E9651', '#CC2529', '#535154', '#6B4C9A', '#922428', '#948B3D', '#00adb5', '#f08a5d' ] def hdd_ds(field): return [ DataSource('hdd_' + d + '.rrd', field, d, False) for d in C.drives ] def traffic_ds(units, direction): color = itertools.cycle(graph_colors[:3]) field = '_{units}_{direction}'.format(units=units, direction=direction) return [ DataSource(db_fname='traffic_{dev}.rrd'.format(dev=dev), field=proto + field, legend='{}-{}'.format(dev, proto.upper()), is_area=True, color=color.next()) for dev, proto in itertools.product(C.network_devices[:-1], ['tcp', 'udp', 'all']) ] + [ DataSource('traffic_eth0.rrd', 'tcp' + field, '', False, ''), DataSource('traffic_eth0.rrd', 'udp' + field, '', False, '', True), DataSource('traffic_eth0.rrd', 'all' + field, 'eth0', False, '#000000', True) ] def connections_ds(direction): color = itertools.cycle(graph_colors[:2]) return [ DataSource(db_fname='traffic_{dev}.rrd'.format(dev=dev), field='{proto}_new_{direction}'.format(proto=proto, direction=direction), legend='{}-{}'.format(dev, proto), is_area=True, color=color.next()) for dev, proto in itertools.product(C.network_devices, ['tcp', 'udp']) ] def smart_graph(attr, field, label=None): sattr = str(attr).zfill(3) return Graph('smart_' + sattr, '{} ({}-{})'.format(smart_names[attr], sattr, field), label, [ DataSource('smart_' + hdd + '.rrd', 'a{}_{}'.format(sattr, field), hdd, False) for hdd in C.drives ]) graphs = [ Graph('hdd_rrqm_s', 'Read requests merged per second that were queued to the device', 'rrqm/s', hdd_ds('rrqm_s')), Graph('hdd_wrqm_s', 'Write requests merged per second that were queued to the device', 'wrqm/s ', hdd_ds('wrqm_s')), Graph('hdd_r_s', 'Read requests that were issued to the device per second', 'r/s', hdd_ds('r_s')), Graph('hdd_w_s', 'Write requests that were issued to the device per second', 'w/s', hdd_ds('w_s')), Graph('hdd_rkB_s', 'Kilobytes read from the device per second', 'rkB/s ', hdd_ds('rkB_s')), Graph('hdd_wkB_s', 'Kilobytes written to the device per second', 'wkB/s ', hdd_ds('wkB_s')), Graph('hdd_avgrq_sz', 'Avg size of the requests that were issued to the device', 'sectors', hdd_ds('avgrq_sz')), Graph('hdd_avgqu_sz', 'Avg queue length of the requests that were issued to the device', 'requests', hdd_ds('avgqu_sz')), Graph('hdd_await', 'Avg time for I/O requests issued to the device to be served', 'milliseconds', hdd_ds('await')), Graph('hdd_r_await', 'Avg time for READ requests issued to the device to be served', 'milliseconds', hdd_ds('r_await')), Graph('hdd_w_await', 'Avg time for WRITE requests issued to the device to be served', 'milliseconds', hdd_ds('w_await')), Graph('hdd_svctm', '(OBSOLETE) Avg service time for I/O requests that were issued to the device', 'milliseconds', hdd_ds('svctm')), Graph('hdd_util', 'Percentage of CPU time during which I/O requests were issued to the device', '%', hdd_ds('util')), Graph('cpu_load', 'CPU loads', '%', [ DataSource('cpu.rrd', field, field, True) for field in C.CpuStat._fields if field != 'idle']), Graph('cpu_la', 'CPU load averages', None, [ DataSource('cpu_la.rrd', field, field, False) for field in C.CpuLa._fields]), Graph('traffic_in_bytes', 'Incoming bytes', 'bytes/s', traffic_ds('bytes', 'in')), Graph('traffic_out_bytes', 'Outgoing bytes', 'bytes/s', traffic_ds('bytes', 'out')), Graph('traffic_in_pckts', 'Incoming packets', 'packets/s', traffic_ds('pckts', 'in')), Graph('traffic_out_pckts', 'Outgoing packets', 'packets/s', traffic_ds('pckts', 'out')), Graph('incoming_connections', 'Incoming connections', 'count', connections_ds('in')), Graph('outgoing_connections', 'Outgoing connections', 'count', connections_ds('out')), Graph('sockets', 'Sockets', 'sockets', [ DataSource('sockets.rrd', field, field, True) for field in 'estab closed orphaned synrecv tw tw2'.split(' ') ] +\ [ DataSource('sockets.rrd', field, field, False) for field in 'total tcp ports'.split(' ') ]), Graph('ups_v', 'Voltages', 'volts', [ DataSource('ups.rrd', 'LINEV', 'AC line', False), DataSource('ups.rrd', 'BATTV', 'UPS battery', False)]), Graph('ups_load', 'Load and charge', '%', [ DataSource('ups.rrd', 'LOADPCT', 'UPS load', False), DataSource('ups.rrd', 'BCHARGE', 'Battery charge', False) ]), Graph('ups_misc', 'Misc UPS stats', None, [ DataSource('ups.rrd', 'TIMELEFT', 'Time on battery left', False), DataSource('ups.rrd', 'NUMXFERS', 'Number of transfers', False), DataSource('ups.rrd', 'TONBATT', 'Time on battery', False), DataSource('ups.rrd', 'CUMONBATT', 'CUMONBATT', False) ]), smart_graph(194, 'raw', '°C'), smart_graph(1, 'cur'), smart_graph(3, 'raw', 'msec'), smart_graph(4, 'raw'), smart_graph(7, 'cur'), smart_graph(9, 'raw'), smart_graph(11, 'raw'), smart_graph(12, 'raw'), smart_graph(195, 'cur'), ] graph_intervals = { 'hourly': 'now-1h', 'optimal': 'now-400m', 'daily': 'now-1d', 'weekly': 'now-1w', 'monthly': 'now-30d', 'yearly': 'now-1y' } def plot(graph, interval): assert interval in graph_intervals cmd = ['rrdtool', 'graph', '-' , '--start', graph_intervals[interval], '--title', graph.title, '--imgformat', 'SVG', '--lower-limit', '0' ] if graph.vlabel: cmd += ['--vertical-label', graph.vlabel] ds_list = graph.ds if isinstance(graph.ds, list) else [graph.ds] color = itertools.cycle(graph_colors) for i in range(0, len(ds_list)): ds = ds_list[i] cmd.append('DEF:v{i}={db}:{field}:AVERAGE'.format(i=i, db=os.path.join(C.rrd_path, ds.db_fname), field=ds.field)) cmd.append('{type}:v{i}{color}:{legend}{stack}'.format( type='AREA' if ds.is_area else 'LINE1', i=i, color=color.next() if ds.color is None else ds.color, legend=ds.legend, stack=':STACK' if ds.is_area or ds.stack else '')) #print(' '.join(cmd)) rrd = subprocess.Popen(cmd, stdout=subprocess.PIPE) gz = gzip.open(os.path.join(C.graph_path, graph.fname + '_' + interval + '.svgz'), 'wb') while rrd.poll() is None: gz.write(rrd.stdout.read()) gz.close() assert rrd.poll() == 0 for graph in graphs: plot(graph, sys.argv[1])
mit
-2,728,556,869,338,496,500
54.723577
162
0.626204
false
dendory/chartjs
sample3.py
1
5887
# This script parses the CSV files gathered from the Canadian Weather Service and makes charts import chartjs import csv # We will cover these years startyear = 1981 endyear = 2012 # We will make charts for 3 major Canadian cities cities = [ {'name': "Montreal", 'fillColor': "rgba(100,50,200,0.25)", 'strokeColor': "rgba(100,50,200,0.75)", 'pointColor': "rgba(100,50,200,0.75)"}, {'name': "Toronto", 'fillColor': "rgba(200,100,100,0.25)", 'strokeColor': "rgba(200,100,100,0.75)", 'pointColor': "rgba(200,100,100,0.75)"}, {'name': "Vancouver", 'fillColor': "rgba(100,200,100,0.25)", 'strokeColor': "rgba(100,200,100,0.75)", 'pointColor': "rgba(100,200,100,0.75)"}, ] # 3 of the charts will cover all 12 months months = ["Jan", "Feb", "Mar", "Apr", "May", "Jun", "Jul", "Aug", "Sep", "Oct", "Nov", "Dec"] # The first chart will show median temperatures over the years global_chart = chartjs.chart("Temperature medians for 1981 - 2012 in Celsius<br><font color='#6432C8'>Montreal</font>, <font color='#B1846B'>Toronto</font>, <font color='#6CCB6C'>Vancouver</font>", "Line", 1200, 600) global_chart.set_params(JSinline = False) # Each city will have a chart showing each month's median temperature montreal_chart = chartjs.chart("Montreal temperatures for 2012 in Celsius", "Line", 390, 200) montreal_chart.canvas = "montreal" montreal_chart.set_labels(months) toronto_chart = chartjs.chart("Toronto temperatures for 2012 in Celsius", "Line", 390, 200) toronto_chart.canvas = "toronto" toronto_chart.set_labels(months) vancouver_chart = chartjs.chart("Vancouver temperatures for 2012 in Celsius", "Line", 390, 200) vancouver_chart.canvas = "vancouver" vancouver_chart.set_labels(months) _startyear = startyear # Loop one city at a time for city in cities: city_data = [] years = [] medians = [] # Loop one year at a time while startyear < endyear+1: # Open CSV file for the city and year f = open("data/" + city['name'] + "/" + str(startyear) + ".csv", 'r', newline='') next(f) csvreader = csv.reader(f, delimiter=',') totalvalues = 0 values = 0 monthly_values = 0 monthly_totalvalues = 0 current_month = '01' # Parse the CSV line by line for line in csvreader: try: # For each line, we add the value and the number of values values += float(line[9]) totalvalues += 1 except: pass try: # For year 2012, we also record monthly medians for the city charts if startyear == 2012: # If the month column changed, that means we must compute the median for last month if str(line[2]) != str(current_month): # All the added values, divided by the number of values median = "{0:.2f}".format(float(monthly_values / monthly_totalvalues)) # Append the median to the current city's list city_data.append(median) # Set the current month to the new value current_month = str(line[2]) # Reset variables to 0 monthly_values = 0 monthly_totalvalues = 0 # For each line in this month, add the value and add the number of values monthly_values += float(line[9]) monthly_totalvalues += 1 except: pass # For the last month, we need to calculate the median one last time if monthly_totalvalues > 0: median = "{0:.2f}".format(float(monthly_values / monthly_totalvalues)) city_data.append(median) # After reading all the lines in the file, calculate the median for the year if totalvalues > 0: median = "{0:.2f}".format(float(values / totalvalues)) medians.append(median) else: medians.append(0) # Append the current year to the labels years.append(startyear) # Create all of the city charts if startyear == 2012: if city['name'] == "Montreal": montreal_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) montreal_chart.add_dataset(city_data) if city['name'] == "Toronto": toronto_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) toronto_chart.add_dataset(city_data) if city['name'] == "Vancouver": vancouver_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) vancouver_chart.add_dataset(city_data) startyear += 1 # Create the global chart global_chart.set_labels(years) global_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) global_chart.add_dataset(medians) startyear = _startyear f.close() # Create the HTML page and the 4 charts individually f = open("sample3.html", 'w') output = """<!doctype html> <html> <head> <title>Temperature charts</title> {1} </head> <body> <div style="width: {2}px; height: {3}px; max-width: 99%" class="chartjs"> <center><h2>{0}</h2></center> """.format(global_chart.title, global_chart.js, str(global_chart.width), str(global_chart.height)) output += global_chart.make_chart_canvas() output += " <table width='99%'><tr><td><center><h4>" + montreal_chart.title + "</h4></center>" output += montreal_chart.make_chart_canvas() output += " </td><td><center><h4>" + toronto_chart.title + "</h4></center>" output += toronto_chart.make_chart_canvas() output += " </td><td><center><h4>" + vancouver_chart.title + "</h4></center>" output += vancouver_chart.make_chart_canvas() output += """ </td></tr></table> <script> window.onload = function() {""" output += global_chart.make_chart_onload() output += montreal_chart.make_chart_onload() output += toronto_chart.make_chart_onload() output += vancouver_chart.make_chart_onload() output += """ } </script> </div> </body> </html> """ f.write(output) f.close()
mit
831,402,048,602,100,100
39.167832
216
0.660608
false
MSHallOpenSoft/plotter
GUI_final.py
1
59129
# -*- coding: utf-8 -*- # Form implementation generated from reading ui file 'GUI_final.ui' # # Created: Thu Mar 19 22:03:17 2015 # by: PyQt4 UI code generator 4.11.3 # # WARNING! All changes made in this file will be lost! from PyQt4 import QtCore, QtGui try: _fromUtf8 = QtCore.QString.fromUtf8 except AttributeError: def _fromUtf8(s): return s try: _encoding = QtGui.QApplication.UnicodeUTF8 def _translate(context, text, disambig): return QtGui.QApplication.translate(context, text, disambig, _encoding) except AttributeError: def _translate(context, text, disambig): return QtGui.QApplication.translate(context, text, disambig) class Ui_MainWindow(object): def setupUi(self, MainWindow): MainWindow.setObjectName(_fromUtf8("MainWindow")) MainWindow.resize(1396, 727) MainWindow.setStyleSheet(_fromUtf8("QFrame{\n" "border:none;\n" "}\n" "QStatusBar{ \n" "background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.33, stop:0 rgba(255, 255, 255, 255), stop:0.125 rgba(155, 174, 198, 255), stop:0.318182 rgba(104, 117, 133, 255), stop:0.534091 rgba(65, 73, 83, 255), stop:0.875 rgba(42, 47, 54, 255)); }\n" " QMainWindow{\n" " background-image: url(:/img/Icons/rsz_back1.jpg); border:none;\n" " background-color:qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255));\n" " text-align: center; }\n" " QGroupBox{ \n" "background-color: qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255)); }\n" " QTabWidget{\n" " background-color: qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255)); }\n" " QDockWidget{\n" " background-color:#737373;\n" " border:none;\n" " padding:0px; \n" "}\n" " QSlider::groove:horizontal {\n" " background:red;\n" " height: 15px;\n" " position: absolute; \n" "left: 4px; \n" "right: 4px; }\n" " QSlider::handle:horizontal {\n" " height:20px;\n" " width: 10px; \n" "background: qlineargradient(spread:pad, x1:0, y1:0.477, x2:0, y2:0, stop:0.125 rgba(42, 47, 54, 255), stop:0.465909 rgba(65, 73, 83, 255), stop:0.681818 rgba(104, 117, 133, 255), stop:0.875 rgba(155, 174, 198, 255), stop:1 rgba(255, 255, 255, 255));\n" " margin: -4px; }\n" " QSlider::handle:hover:horizontal { \n" "height:20px;\n" " width: 10px;\n" " background:qlineargradient(spread:pad, x1:0, y1:0.477, x2:0, y2:0, stop:0.125 rgba(91, 95, 100, 255), stop:0.465909 rgba(122, 132, 146, 255), stop:0.681818 rgba(141, 153, 167, 255), stop:0.875 rgba(181, 195, 212, 255), stop:1 rgba(255, 255, 255, 255));\n" " margin: -4px;\n" " }\n" " QSlider::add-page:horizontal { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " }\n" " QSlider::sub-page:horizontal { \n" "background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255)) ;\n" " }\n" " QToolButton{ \n" "position: relative;\n" " border: none; \n" "outline:none;\n" " color: black;\n" " padding: 0px;\n" " border-radius: 2px;\n" " font-size: 22px;\n" " }\n" " QToolButton:hover:!pressed{ \n" "position: relative;\n" " border: none; \n" "outline:none; \n" "background-color:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " color: white;\n" " padding: 0px;\n" " border-radius: 2px;\n" " font-size: 22px; \n" "}\n" " QPushButton{ \n" "position: relative;\n" " border:none;\n" " outline:none; \n" "background-color: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " color: white;\n" " padding: 6px 20px; \n" "border-radius: 2px;\n" " font-size: 20px;\n" " }\n" " QPushButton:hover:!pressed{ \n" "position: relative;\n" " border: none; \n" "outline:none;\n" " background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " color: white; \n" "padding: 6px 20px; \n" "border-radius: 2px;\n" " font-size:20px; \n" "} \n" "QComboBox { \n" "border: none; \n" "padding: 1px 18px 1px 3px; \n" "min-width: 6em;\n" " }\n" " QComboBox, QComboBox:drop-down \n" "{\n" " background:qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " }\n" " QComboBox:on, QComboBox:drop-down:on { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255)); \n" "}\n" " QComboBox:on {\n" " padding-top: 3px;\n" " padding-left: 4px; \n" "} \n" "QComboBox::drop-down{\n" " subcontrol-origin: padding; \n" "subcontrol-position: top right;\n" " width: 15px; \n" "border-left-width: 1px; \n" "border-left-color: darkgray; \n" "border-left-style: solid;\n" " }\n" " QComboBox::down-arrow { \n" "image:url(:/arrow/Icons/arrow-new.png);\n" " } \n" "QComboBox::down-arrow:on {\n" " top: 1px;\n" " left: 1px;\n" " }\n" " QMenu {\n" " background-color: qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255)); \n" "border: none; \n" "}\n" " QMenu::item {\n" " background-color: transparent;\n" " }\n" " QMenu::item:selected {\n" " background-color:rgb(120, 255, 13);\n" " }\n" " QMenuBar { \n" "background-color:qlineargradient(spread:pad, x1:0, y1:0, x2:1, y2:1, stop:0 #DBDBDB, stop:1 rgba(255, 255, 255, 255)) } QMenuBar::item {\n" " spacing: 3px;\n" " padding: 1px 4px; \n" "background: transparent; \n" "border-radius: 2px;\n" " }\n" " QMenuBar::item:selected {\n" " background:#737373;\n" " }\n" " QMenuBar::item:pressed \n" "{ background: #414953; \n" "} \n" "QTableWidget{ \n" "background:qlineargradient(spread:pad, x1:1, y1:1, x2:0, y2:0, stop:0 #DBDBDB, stop:1 rgba(255, 255, 255, 255));\n" " border:1px solid rgb(171, 173, 179);\n" " }\n" " QTextEdit{ \n" "background:qlineargradient(spread:pad, x1:1, y1:1, x2:0, y2:0, stop:0 #DBDBDB, stop:1 rgba(255, 255, 255, 255)); \n" "}\n" " QScrollBar:horizontal {\n" " border: none; background: #DBDBDB; height: 15px; margin: 0px 20px 0 20px; \n" "}\n" " QScrollBar::handle:horizontal { background:qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " min-width: 20px;\n" " }\n" " QScrollBar::handle:horizontal:hover { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " min-width: 20px;\n" " } \n" "QScrollBar::add-line:horizontal {\n" " border: none;\n" " background:#DBDBDB; \n" "width: 20px;\n" " subcontrol-position: right;\n" " subcontrol-origin: margin;\n" " }\n" " QScrollBar::sub-line:horizontal {\n" " border:none; \n" "background:#DBDBDB; \n" "width: 20px;\n" " subcontrol-position: left;\n" " subcontrol-origin: margin;\n" " }\n" " QScrollBar::add-line:horizontal:hover:!pressed { \n" "border: none;\n" " background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255)); \n" "width: 20px;\n" " subcontrol-position: right; \n" "subcontrol-origin: margin; \n" "}\n" " QScrollBar::sub-line:horizontal:hover:!pressed { \n" "border:none;\n" " background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " width: 20px; \n" "subcontrol-position: left;\n" " subcontrol-origin: margin; \n" "}\n" " QScrollBar::left-arrow:horizontal{\n" " image: url(:/arrow/Icons/left-arrow.png);\n" " }\n" " QScrollBar::right-arrow:horizontal{\n" " image: url(:/arrow/Icons/right-arrow.png);\n" " }\n" " QScrollBar:vertical {\n" " border: none;\n" " background: #DBDBDB;\n" " width: 15px; \n" "margin: 0px 20px 0 20px; \n" "} \n" "QScrollBar::handle:vertical { background:qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " min-height: 20px; }\n" " QScrollBar::handle:vertical:hover { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " min-height: 15px;\n" " }\n" " QScrollBar::add-line:vertical {\n" " border: none;\n" " background:#DBDBDB; \n" "height: 20px;\n" " subcontrol-position: bottom; \n" "subcontrol-origin: margin; \n" "}\n" " QScrollBar::sub-line:vertical {\n" " border:none; \n" "background:#DBDBDB; \n" "height: 20px;\n" " subcontrol-position: top;\n" " subcontrol-origin: margin;\n" " } \n" "QScrollBar::add-line:vertical:hover:!pressed { \n" "border: none; \n" "background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " height: 20px;\n" " subcontrol-position:bottom; \n" "subcontrol-origin: margin;\n" " }\n" " QScrollBar::sub-line:vertical:hover:!pressed { b\n" "order:none; \n" "background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " height: 20px; \n" "subcontrol-position:top;\n" " subcontrol-origin: margin;\n" " }\n" " QScrollBar::up-arrow:vertical{ \n" "image: url(:/arrow/Icons/up-arrow.png); \n" "} \n" "QScrollBar::down-arrow:vertical{\n" " image: url(:/arrow/Icons/down-arrow.png);\n" " }")) self.centralwidget = QtGui.QWidget(MainWindow) self.centralwidget.setObjectName(_fromUtf8("centralwidget")) self.horizontalLayout_3 = QtGui.QHBoxLayout(self.centralwidget) self.horizontalLayout_3.setObjectName(_fromUtf8("horizontalLayout_3")) self.frame_2 = QtGui.QFrame(self.centralwidget) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Preferred) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.frame_2.sizePolicy().hasHeightForWidth()) self.frame_2.setSizePolicy(sizePolicy) self.frame_2.setMinimumSize(QtCore.QSize(20, 0)) self.frame_2.setStyleSheet(_fromUtf8("")) self.frame_2.setFrameShape(QtGui.QFrame.StyledPanel) self.frame_2.setFrameShadow(QtGui.QFrame.Raised) self.frame_2.setObjectName(_fromUtf8("frame_2")) self.horizontalLayout_4 = QtGui.QHBoxLayout(self.frame_2) self.horizontalLayout_4.setObjectName(_fromUtf8("horizontalLayout_4")) self.verticalLayout_5 = QtGui.QVBoxLayout() self.verticalLayout_5.setObjectName(_fromUtf8("verticalLayout_5")) self.pushButton = QtGui.QPushButton(self.frame_2) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.pushButton.sizePolicy().hasHeightForWidth()) self.pushButton.setSizePolicy(sizePolicy) self.pushButton.setMaximumSize(QtCore.QSize(20, 50)) self.pushButton.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton.setText(_fromUtf8("")) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(_fromUtf8(":/arrow/Icons/double-right.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.pushButton.setIcon(icon) self.pushButton.setObjectName(_fromUtf8("pushButton")) self.verticalLayout_5.addWidget(self.pushButton) self.horizontalLayout_4.addLayout(self.verticalLayout_5) self.horizontalLayout_3.addWidget(self.frame_2) self.frame = QtGui.QFrame(self.centralwidget) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Preferred) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.frame.sizePolicy().hasHeightForWidth()) self.frame.setSizePolicy(sizePolicy) self.frame.setMaximumSize(QtCore.QSize(320, 16777215)) self.frame.setFrameShape(QtGui.QFrame.StyledPanel) self.frame.setFrameShadow(QtGui.QFrame.Raised) self.frame.setObjectName(_fromUtf8("frame")) self.verticalLayout_3 = QtGui.QVBoxLayout(self.frame) self.verticalLayout_3.setObjectName(_fromUtf8("verticalLayout_3")) self.horizontalLayout_5 = QtGui.QHBoxLayout() self.horizontalLayout_5.setSpacing(6) self.horizontalLayout_5.setObjectName(_fromUtf8("horizontalLayout_5")) self.pushButton_3 = QtGui.QPushButton(self.frame) self.pushButton_3.setEnabled(True) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.pushButton_3.sizePolicy().hasHeightForWidth()) self.pushButton_3.setSizePolicy(sizePolicy) self.pushButton_3.setMinimumSize(QtCore.QSize(50, 0)) self.pushButton_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton_3.setStyleSheet(_fromUtf8("")) self.pushButton_3.setObjectName(_fromUtf8("pushButton_3")) self.horizontalLayout_5.addWidget(self.pushButton_3) self.toolButton_7 = QtGui.QToolButton(self.frame) self.toolButton_7.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_7.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_7.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_7.setStyleSheet(_fromUtf8("")) icon1 = QtGui.QIcon() icon1.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Add-New-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_7.setIcon(icon1) self.toolButton_7.setIconSize(QtCore.QSize(40, 30)) self.toolButton_7.setObjectName(_fromUtf8("toolButton_7")) self.horizontalLayout_5.addWidget(self.toolButton_7) self.toolButton_9 = QtGui.QToolButton(self.frame) self.toolButton_9.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_9.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_9.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_9.setStyleSheet(_fromUtf8("")) icon2 = QtGui.QIcon() icon2.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Minus-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_9.setIcon(icon2) self.toolButton_9.setIconSize(QtCore.QSize(40, 30)) self.toolButton_9.setObjectName(_fromUtf8("toolButton_9")) self.horizontalLayout_5.addWidget(self.toolButton_9) self.toolButton_8 = QtGui.QToolButton(self.frame) self.toolButton_8.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_8.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_8.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_8.setStyleSheet(_fromUtf8("")) icon3 = QtGui.QIcon() icon3.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Folder-Open-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_8.setIcon(icon3) self.toolButton_8.setIconSize(QtCore.QSize(40, 30)) self.toolButton_8.setObjectName(_fromUtf8("toolButton_8")) self.horizontalLayout_5.addWidget(self.toolButton_8) self.toolButton_5 = QtGui.QToolButton(self.frame) self.toolButton_5.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_5.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_5.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_5.setStyleSheet(_fromUtf8("")) icon4 = QtGui.QIcon() icon4.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Save-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_5.setIcon(icon4) self.toolButton_5.setIconSize(QtCore.QSize(40, 30)) self.toolButton_5.setObjectName(_fromUtf8("toolButton_5")) self.horizontalLayout_5.addWidget(self.toolButton_5) spacerItem = QtGui.QSpacerItem(20, 20, QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Minimum) self.horizontalLayout_5.addItem(spacerItem) self.verticalLayout_3.addLayout(self.horizontalLayout_5) self.tableWidget = QtGui.QTableWidget(self.frame) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Expanding) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.tableWidget.sizePolicy().hasHeightForWidth()) self.tableWidget.setSizePolicy(sizePolicy) self.tableWidget.setMinimumSize(QtCore.QSize(300, 0)) self.tableWidget.setStyleSheet(_fromUtf8("")) self.tableWidget.setObjectName(_fromUtf8("tableWidget")) self.tableWidget.setColumnCount(3) self.tableWidget.setRowCount(0) item = QtGui.QTableWidgetItem() self.tableWidget.setHorizontalHeaderItem(0, item) item = QtGui.QTableWidgetItem() self.tableWidget.setHorizontalHeaderItem(1, item) item = QtGui.QTableWidgetItem() self.tableWidget.setHorizontalHeaderItem(2, item) self.verticalLayout_3.addWidget(self.tableWidget) self.pushButton_21 = QtGui.QPushButton(self.frame) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.pushButton_21.sizePolicy().hasHeightForWidth()) self.pushButton_21.setSizePolicy(sizePolicy) self.pushButton_21.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton_21.setStyleSheet(_fromUtf8("")) self.pushButton_21.setObjectName(_fromUtf8("pushButton_21")) self.verticalLayout_3.addWidget(self.pushButton_21) self.horizontalLayout_3.addWidget(self.frame) self.verticalLayout_6 = QtGui.QVBoxLayout() self.verticalLayout_6.setObjectName(_fromUtf8("verticalLayout_6")) self.widget = QtGui.QWidget(self.centralwidget) self.widget.setStyleSheet(_fromUtf8("")) self.widget.setObjectName(_fromUtf8("widget")) self.verticalLayout_6.addWidget(self.widget) self.horizontalLayout_3.addLayout(self.verticalLayout_6) MainWindow.setCentralWidget(self.centralwidget) self.menubar = QtGui.QMenuBar(MainWindow) self.menubar.setGeometry(QtCore.QRect(0, 0, 1396, 21)) self.menubar.setObjectName(_fromUtf8("menubar")) self.menuFile = QtGui.QMenu(self.menubar) self.menuFile.setObjectName(_fromUtf8("menuFile")) self.menuEdit = QtGui.QMenu(self.menubar) self.menuEdit.setObjectName(_fromUtf8("menuEdit")) self.menuView = QtGui.QMenu(self.menubar) self.menuView.setObjectName(_fromUtf8("menuView")) self.menuAbout = QtGui.QMenu(self.menubar) self.menuAbout.setObjectName(_fromUtf8("menuAbout")) MainWindow.setMenuBar(self.menubar) self.statusbar = QtGui.QStatusBar(MainWindow) self.statusbar.setObjectName(_fromUtf8("statusbar")) MainWindow.setStatusBar(self.statusbar) self.dockWidget = QtGui.QDockWidget(MainWindow) self.dockWidget.setMinimumSize(QtCore.QSize(320, 91)) self.dockWidget.setObjectName(_fromUtf8("dockWidget")) self.dockWidgetContents = QtGui.QWidget() self.dockWidgetContents.setObjectName(_fromUtf8("dockWidgetContents")) self.gridLayout = QtGui.QGridLayout(self.dockWidgetContents) self.gridLayout.setObjectName(_fromUtf8("gridLayout")) self.comboBox_5 = QtGui.QComboBox(self.dockWidgetContents) self.comboBox_5.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_5.setObjectName(_fromUtf8("comboBox_5")) self.comboBox_5.addItem(_fromUtf8("")) self.comboBox_5.addItem(_fromUtf8("")) self.comboBox_5.addItem(_fromUtf8("")) self.gridLayout.addWidget(self.comboBox_5, 0, 0, 1, 1) self.textEdit = QtGui.QTextEdit(self.dockWidgetContents) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.textEdit.sizePolicy().hasHeightForWidth()) self.textEdit.setSizePolicy(sizePolicy) self.textEdit.setMinimumSize(QtCore.QSize(0, 20)) self.textEdit.setObjectName(_fromUtf8("textEdit")) self.gridLayout.addWidget(self.textEdit, 0, 1, 1, 1) self.comboBox_6 = QtGui.QComboBox(self.dockWidgetContents) self.comboBox_6.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_6.setObjectName(_fromUtf8("comboBox_6")) self.comboBox_6.addItem(_fromUtf8("")) self.comboBox_6.addItem(_fromUtf8("")) self.comboBox_6.addItem(_fromUtf8("")) self.gridLayout.addWidget(self.comboBox_6, 1, 0, 1, 1) self.textEdit_2 = QtGui.QTextEdit(self.dockWidgetContents) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.textEdit_2.sizePolicy().hasHeightForWidth()) self.textEdit_2.setSizePolicy(sizePolicy) self.textEdit_2.setMinimumSize(QtCore.QSize(0, 20)) self.textEdit_2.setObjectName(_fromUtf8("textEdit_2")) self.gridLayout.addWidget(self.textEdit_2, 1, 1, 1, 1) self.dockWidget.setWidget(self.dockWidgetContents) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(1), self.dockWidget) self.dockWidget_2 = QtGui.QDockWidget(MainWindow) self.dockWidget_2.setMinimumSize(QtCore.QSize(427, 324)) self.dockWidget_2.setStyleSheet(_fromUtf8("")) self.dockWidget_2.setObjectName(_fromUtf8("dockWidget_2")) self.dockWidgetContents_2 = QtGui.QWidget() self.dockWidgetContents_2.setObjectName(_fromUtf8("dockWidgetContents_2")) self.verticalLayout_4 = QtGui.QVBoxLayout(self.dockWidgetContents_2) self.verticalLayout_4.setObjectName(_fromUtf8("verticalLayout_4")) self.groupBox_2 = QtGui.QGroupBox(self.dockWidgetContents_2) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.groupBox_2.sizePolicy().hasHeightForWidth()) self.groupBox_2.setSizePolicy(sizePolicy) self.groupBox_2.setMinimumSize(QtCore.QSize(0, 50)) self.groupBox_2.setObjectName(_fromUtf8("groupBox_2")) self.horizontalLayout_12 = QtGui.QHBoxLayout(self.groupBox_2) self.horizontalLayout_12.setObjectName(_fromUtf8("horizontalLayout_12")) self.horizontalLayout_7 = QtGui.QHBoxLayout() self.horizontalLayout_7.setObjectName(_fromUtf8("horizontalLayout_7")) self.comboBox = QtGui.QComboBox(self.groupBox_2) self.comboBox.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox.setStyleSheet(_fromUtf8("")) self.comboBox.setObjectName(_fromUtf8("comboBox")) self.comboBox.addItem(_fromUtf8("")) self.comboBox.addItem(_fromUtf8("")) self.horizontalLayout_7.addWidget(self.comboBox) self.comboBox_3 = QtGui.QComboBox(self.groupBox_2) self.comboBox_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_3.setObjectName(_fromUtf8("comboBox_3")) self.comboBox_3.addItem(_fromUtf8("")) self.comboBox_3.addItem(_fromUtf8("")) self.comboBox_3.addItem(_fromUtf8("")) self.horizontalLayout_7.addWidget(self.comboBox_3) self.comboBox_2 = QtGui.QComboBox(self.groupBox_2) self.comboBox_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_2.setLayoutDirection(QtCore.Qt.LeftToRight) self.comboBox_2.setAutoFillBackground(False) self.comboBox_2.setFrame(True) self.comboBox_2.setObjectName(_fromUtf8("comboBox_2")) self.comboBox_2.addItem(_fromUtf8("")) self.comboBox_2.addItem(_fromUtf8("")) self.comboBox_2.addItem(_fromUtf8("")) self.horizontalLayout_7.addWidget(self.comboBox_2) self.horizontalLayout_12.addLayout(self.horizontalLayout_7) self.verticalLayout_4.addWidget(self.groupBox_2) self.verticalLayout_2 = QtGui.QVBoxLayout() self.verticalLayout_2.setObjectName(_fromUtf8("verticalLayout_2")) self.tabWidget_2 = QtGui.QTabWidget(self.dockWidgetContents_2) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Minimum, QtGui.QSizePolicy.Expanding) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.tabWidget_2.sizePolicy().hasHeightForWidth()) self.tabWidget_2.setSizePolicy(sizePolicy) self.tabWidget_2.setMinimumSize(QtCore.QSize(310, 0)) self.tabWidget_2.setCursor(QtGui.QCursor(QtCore.Qt.ArrowCursor)) self.tabWidget_2.setAutoFillBackground(False) self.tabWidget_2.setStyleSheet(_fromUtf8("")) self.tabWidget_2.setTabPosition(QtGui.QTabWidget.South) self.tabWidget_2.setTabShape(QtGui.QTabWidget.Rounded) self.tabWidget_2.setIconSize(QtCore.QSize(16, 25)) self.tabWidget_2.setElideMode(QtCore.Qt.ElideNone) self.tabWidget_2.setTabsClosable(False) self.tabWidget_2.setMovable(True) self.tabWidget_2.setObjectName(_fromUtf8("tabWidget_2")) self.tab_3 = QtGui.QWidget() self.tab_3.setObjectName(_fromUtf8("tab_3")) self.verticalLayout_8 = QtGui.QVBoxLayout(self.tab_3) self.verticalLayout_8.setObjectName(_fromUtf8("verticalLayout_8")) self.groupBox = QtGui.QGroupBox(self.tab_3) self.groupBox.setObjectName(_fromUtf8("groupBox")) self.verticalLayout_7 = QtGui.QVBoxLayout(self.groupBox) self.verticalLayout_7.setObjectName(_fromUtf8("verticalLayout_7")) self.horizontalLayout_8 = QtGui.QHBoxLayout() self.horizontalLayout_8.setObjectName(_fromUtf8("horizontalLayout_8")) self.label = QtGui.QLabel(self.groupBox) self.label.setObjectName(_fromUtf8("label")) self.horizontalLayout_8.amenuddWidget(self.label) self.horizontalSlider = QtGui.QSlider(self.groupBox) self.horizontalSlider.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.horizontalSlider.setStyleSheet(_fromUtf8("")) self.horizontalSlider.setOrientation(QtCore.Qt.Horizontal) self.horizontalSlider.setObjectName(_fromUtf8("horizontalSlider")) self.horizontalLayout_8.addWidget(self.horizontalSlider) self.verticalLayout_7.addLayout(self.horizontalLayout_8) self.horizontalLayout_9 = QtGui.QHBoxLayout() self.horizontalLayout_9.setSizeConstraint(QtGui.QLayout.SetNoConstraint) self.horizontalLayout_9.setObjectName(_fromUtf8("horizontalLayout_9")) self.label_2 = QtGui.QLabel(self.groupBox) self.label_2.setObjectName(_fromUtf8("label_2")) self.horizontalLayout_9.addWidget(self.label_2) self.label_3 = QtGui.QLabel(self.groupBox) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.label_3.sizePolicy().hasHeightForWidth()) self.label_3.setSizePolicy(sizePolicy) self.label_3.setMinimumSize(QtCore.QSize(20, 20)) self.label_3.setObjectName(_fromUtf8("label_3")) self.horizontalLayout_9.addWidget(self.label_3) self.label_4 = QtGui.QLabel(self.groupBox) self.label_4.setObjectName(_fromUtf8("label_4")) self.horizontalLayout_9.addWidget(self.label_4) self.radioButton = QtGui.QRadioButton(self.groupBox) self.radioButton.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.radioButton.setObjectName(_fromUtf8("radioButton")) self.horizontalLayout_9.addWidget(self.radioButton) self.radioButton_3 = QtGui.QRadioButton(self.groupBox) self.radioButton_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.radioButton_3.setObjectName(_fromUtf8("radioButton_3")) self.horizontalLayout_9.addWidget(self.radioButton_3) self.radioButton_2 = QtGui.QRadioButton(self.groupBox) self.radioButton_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.radioButton_2.setObjectName(_fromUtf8("radioButton_2")) self.horizontalLayout_9.addWidget(self.radioButton_2) self.verticalLayout_7.addLayout(self.horizontalLayout_9) self.horizontalLayout_10 = QtGui.QHBoxLayout() self.horizontalLayout_10.setObjectName(_fromUtf8("horizontalLayout_10")) self.label_5 = QtGui.QLabel(self.groupBox) self.label_5.setObjectName(_fromUtf8("label_5")) self.horizontalLayout_10.addWidget(self.label_5) self.comboBox_4 = QtGui.QComboBox(self.groupBox) self.comboBox_4.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_4.setObjectName(_fromUtf8("comboBox_4")) self.horizontalLayout_10.addWidget(self.comboBox_4) self.label_6 = QtGui.QLabel(self.groupBox) self.label_6.setObjectName(_fromUtf8("label_6")) self.horizontalLayout_10.addWidget(self.label_6) self.horizontalSlider_2 = QtGui.QSlider(self.groupBox) self.horizontalSlider_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.horizontalSlider_2.setOrientation(QtCore.Qt.Horizontal) self.horizontalSlider_2.setObjectName(_fromUtf8("horizontalSlider_2")) self.horizontalLayout_10.addWidget(self.horizontalSlider_2) self.verticalLayout_7.addLayout(self.horizontalLayout_10) self.horizontalLayout_11 = QtGui.QHBoxLayout() self.horizontalLayout_11.setObjectName(_fromUtf8("horizontalLayout_11")) self.label_7 = QtGui.QLabel(self.groupBox) self.label_7.setObjectName(_fromUtf8("label_7")) self.horizontalLayout_11.addWidget(self.label_7) self.horizontalSlider_3 = QtGui.QSlider(self.groupBox) self.horizontalSlider_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.horizontalSlider_3.setOrientation(QtCore.Qt.Horizontal) self.horizontalSlider_3.setObjectName(_fromUtf8("horizontalSlider_3")) self.horizontalLayout_11.addWidget(self.horizontalSlider_3) self.verticalLayout_7.addLayout(self.horizontalLayout_11) self.verticalLayout_8.addWidget(self.groupBox) self.tabWidget_2.addTab(self.tab_3, _fromUtf8("")) self.tab_4 = QtGui.QWidget() self.tab_4.setObjectName(_fromUtf8("tab_4")) self.horizontalLayout_13 = QtGui.QHBoxLayout(self.tab_4) self.horizontalLayout_13.setObjectName(_fromUtf8("horizontalLayout_13")) self.tabWidget_3 = QtGui.QTabWidget(self.tab_4) self.tabWidget_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.tabWidget_3.setStyleSheet(_fromUtf8("")) self.tabWidget_3.setUsesScrollButtons(False) self.tabWidget_3.setMovable(True) self.tabWidget_3.setObjectName(_fromUtf8("tabWidget_3")) self.tab_5 = QtGui.QWidget() self.tab_5.setObjectName(_fromUtf8("tab_5")) self.tabWidget_3.addTab(self.tab_5, _fromUtf8("")) self.tab_6 = QtGui.QWidget() self.tab_6.setObjectName(_fromUtf8("tab_6")) self.tabWidget_3.addTab(self.tab_6, _fromUtf8("")) self.horizontalLayout_13.addWidget(self.tabWidget_3) self.tabWidget_2.addTab(self.tab_4, _fromUtf8("")) self.verticalLayout_2.addWidget(self.tabWidget_2) self.verticalLayout_4.addLayout(self.verticalLayout_2) self.dockWidget_2.setWidget(self.dockWidgetContents_2) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(1), self.dockWidget_2) self.dockWidget_3 = QtGui.QDockWidget(MainWindow) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.dockWidget_3.sizePolicy().hasHeightForWidth()) self.dockWidget_3.setSizePolicy(sizePolicy) self.dockWidget_3.setMinimumSize(QtCore.QSize(489, 70)) self.dockWidget_3.setMaximumSize(QtCore.QSize(524287, 524287)) self.dockWidget_3.setObjectName(_fromUtf8("dockWidget_3")) self.dockWidgetContents_3 = QtGui.QWidget() self.dockWidgetContents_3.setObjectName(_fromUtf8("dockWidgetContents_3")) self.horizontalLayout = QtGui.QHBoxLayout(self.dockWidgetContents_3) self.horizontalLayout.setObjectName(_fromUtf8("horizontalLayout")) self.toolButton_17 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_17.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_17.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_17.setStyleSheet(_fromUtf8("")) icon5 = QtGui.QIcon() icon5.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Item-New-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_17.setIcon(icon5) self.toolButton_17.setIconSize(QtCore.QSize(30, 30)) self.toolButton_17.setObjectName(_fromUtf8("toolButton_17")) self.horizontalLayout.addWidget(self.toolButton_17) self.toolButton_10 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_10.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_10.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_10.setStyleSheet(_fromUtf8("")) self.toolButton_10.setIcon(icon3) self.toolButton_10.setIconSize(QtCore.QSize(30, 30)) self.toolButton_10.setObjectName(_fromUtf8("toolButton_10")) self.horizontalLayout.addWidget(self.toolButton_10) self.toolButton_20 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_20.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_20.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_20.setStyleSheet(_fromUtf8("")) self.toolButton_20.setIcon(icon4) self.toolButton_20.setIconSize(QtCore.QSize(30, 30)) self.toolButton_20.setObjectName(_fromUtf8("toolButton_20")) self.horizontalLayout.addWidget(self.toolButton_20) self.toolButton_18 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_18.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_18.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_18.setStyleSheet(_fromUtf8("")) icon6 = QtGui.QIcon() icon6.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Open-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_18.setIcon(icon6) self.toolButton_18.setIconSize(QtCore.QSize(30, 30)) self.toolButton_18.setObjectName(_fromUtf8("toolButton_18")) self.horizontalLayout.addWidget(self.toolButton_18) self.line_4 = QtGui.QFrame(self.dockWidgetContents_3) self.line_4.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_4.setFrameShape(QtGui.QFrame.VLine) self.line_4.setFrameShadow(QtGui.QFrame.Sunken) self.line_4.setObjectName(_fromUtf8("line_4")) self.horizontalLayout.addWidget(self.line_4) self.toolButton_4 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_4.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_4.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_4.setStyleSheet(_fromUtf8("")) self.toolButton_4.setIcon(icon1) self.toolButton_4.setIconSize(QtCore.QSize(30, 30)) self.toolButton_4.setObjectName(_fromUtf8("toolButton_4")) self.horizontalLayout.addWidget(self.toolButton_4) self.toolButton_3 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_3.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_3.setStyleSheet(_fromUtf8("")) self.toolButton_3.setIcon(icon2) self.toolButton_3.setIconSize(QtCore.QSize(30, 30)) self.toolButton_3.setObjectName(_fromUtf8("toolButton_3")) self.horizontalLayout.addWidget(self.toolButton_3) self.line_5 = QtGui.QFrame(self.dockWidgetContents_3) self.line_5.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_5.setFrameShape(QtGui.QFrame.VLine) self.line_5.setFrameShadow(QtGui.QFrame.Sunken) self.line_5.setObjectName(_fromUtf8("line_5")) self.horizontalLayout.addWidget(self.line_5) self.checkBox = QtGui.QCheckBox(self.dockWidgetContents_3) self.checkBox.setMaximumSize(QtCore.QSize(20, 25)) self.checkBox.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.checkBox.setLayoutDirection(QtCore.Qt.LeftToRight) self.checkBox.setText(_fromUtf8("")) self.checkBox.setObjectName(_fromUtf8("checkBox")) self.horizontalLayout.addWidget(self.checkBox) self.Example = QtGui.QToolButton(self.dockWidgetContents_3) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.Example.sizePolicy().hasHeightForWidth()) self.Example.setSizePolicy(sizePolicy) self.Example.setMaximumSize(QtCore.QSize(16777215, 25)) self.Example.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.Example.setStyleSheet(_fromUtf8("QToolButton{\n" "font-size: 15px;\n" "color:rgb(255, 255, 255);\n" "}")) self.Example.setIconSize(QtCore.QSize(24, 24)) self.Example.setObjectName(_fromUtf8("Example")) self.horizontalLayout.addWidget(self.Example) self.line_6 = QtGui.QFrame(self.dockWidgetContents_3) self.line_6.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_6.setFrameShape(QtGui.QFrame.VLine) self.line_6.setFrameShadow(QtGui.QFrame.Sunken) self.line_6.setObjectName(_fromUtf8("line_6")) self.horizontalLayout.addWidget(self.line_6) self.toolButton = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton.setStyleSheet(_fromUtf8("")) icon7 = QtGui.QIcon() icon7.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Board-Pin-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton.setIcon(icon7) self.toolButton.setIconSize(QtCore.QSize(30, 30)) self.toolButton.setObjectName(_fromUtf8("toolButton")) self.horizontalLayout.addWidget(self.toolButton) self.toolButton_25 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_25.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_25.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_25.setStyleSheet(_fromUtf8("")) icon8 = QtGui.QIcon() icon8.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Table-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_25.setIcon(icon8) self.toolButton_25.setIconSize(QtCore.QSize(30, 30)) self.toolButton_25.setObjectName(_fromUtf8("toolButton_25")) self.horizontalLayout.addWidget(self.toolButton_25) self.line_8 = QtGui.QFrame(self.dockWidgetContents_3) self.line_8.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_8.setFrameShape(QtGui.QFrame.VLine) self.line_8.setFrameShadow(QtGui.QFrame.Sunken) self.line_8.setObjectName(_fromUtf8("line_8")) self.horizontalLayout.addWidget(self.line_8) self.dockWidget_3.setWidget(self.dockWidgetContents_3) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(4), self.dockWidget_3) self.dockWidget_4 = QtGui.QDockWidget(MainWindow) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.dockWidget_4.sizePolicy().hasHeightForWidth()) self.dockWidget_4.setSizePolicy(sizePolicy) self.dockWidget_4.setMinimumSize(QtCore.QSize(624, 70)) self.dockWidget_4.setMaximumSize(QtCore.QSize(524287, 70)) self.dockWidget_4.setObjectName(_fromUtf8("dockWidget_4")) self.dockWidgetContents_4 = QtGui.QWidget() self.dockWidgetContents_4.setObjectName(_fromUtf8("dockWidgetContents_4")) self.horizontalLayout_2 = QtGui.QHBoxLayout(self.dockWidgetContents_4) self.horizontalLayout_2.setObjectName(_fromUtf8("horizontalLayout_2")) self.line_7 = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line_7.sizePolicy().hasHeightForWidth()) self.line_7.setSizePolicy(sizePolicy) self.line_7.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_7.setLineWidth(1) self.line_7.setMidLineWidth(1) self.line_7.setFrameShape(QtGui.QFrame.VLine) self.line_7.setFrameShadow(QtGui.QFrame.Sunken) self.line_7.setObjectName(_fromUtf8("line_7")) self.horizontalLayout_2.addWidget(self.line_7) self.toolButton_19 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_19.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_19.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_19.setStyleSheet(_fromUtf8("")) icon9 = QtGui.QIcon() icon9.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Keyboard-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_19.setIcon(icon9) self.toolButton_19.setIconSize(QtCore.QSize(35, 35)) self.toolButton_19.setObjectName(_fromUtf8("toolButton_19")) self.horizontalLayout_2.addWidget(self.toolButton_19) self.toolButton_23 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_23.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_23.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_23.setStyleSheet(_fromUtf8("")) icon10 = QtGui.QIcon() icon10.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Printer-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_23.setIcon(icon10) self.toolButton_23.setIconSize(QtCore.QSize(35, 35)) self.toolButton_23.setObjectName(_fromUtf8("toolButton_23")) self.horizontalLayout_2.addWidget(self.toolButton_23) self.toolButton_2 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_2.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_2.setIcon(icon4) self.toolButton_2.setIconSize(QtCore.QSize(35, 35)) self.toolButton_2.setObjectName(_fromUtf8("toolButton_2")) self.horizontalLayout_2.addWidget(self.toolButton_2) self.toolButton_24 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_24.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_24.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_24.setStyleSheet(_fromUtf8("")) icon11 = QtGui.QIcon() icon11.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Camera-02-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_24.setIcon(icon11) self.toolButton_24.setIconSize(QtCore.QSize(35, 35)) self.toolButton_24.setObjectName(_fromUtf8("toolButton_24")) self.horizontalLayout_2.addWidget(self.toolButton_24) self.toolButton_22 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_22.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_22.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_22.setStyleSheet(_fromUtf8("")) icon12 = QtGui.QIcon() icon12.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Facebook-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_22.setIcon(icon12) self.toolButton_22.setIconSize(QtCore.QSize(35, 35)) self.toolButton_22.setObjectName(_fromUtf8("toolButton_22")) self.horizontalLayout_2.addWidget(self.toolButton_22) self.line_3 = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line_3.sizePolicy().hasHeightForWidth()) self.line_3.setSizePolicy(sizePolicy) self.line_3.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_3.setFrameShape(QtGui.QFrame.VLine) self.line_3.setFrameShadow(QtGui.QFrame.Sunken) self.line_3.setObjectName(_fromUtf8("line_3")) self.horizontalLayout_2.addWidget(self.line_3) self.toolButton_21 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_21.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_21.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_21.setStyleSheet(_fromUtf8("")) icon13 = QtGui.QIcon() icon13.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Media-Play-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_21.setIcon(icon13) self.toolButton_21.setIconSize(QtCore.QSize(35, 35)) self.toolButton_21.setObjectName(_fromUtf8("toolButton_21")) self.horizontalLayout_2.addWidget(self.toolButton_21) self.toolButton_16 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_16.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_16.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_16.setStyleSheet(_fromUtf8("")) icon14 = QtGui.QIcon() icon14.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Stop-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_16.setIcon(icon14) self.toolButton_16.setIconSize(QtCore.QSize(35, 35)) self.toolButton_16.setObjectName(_fromUtf8("toolButton_16")) self.horizontalLayout_2.addWidget(self.toolButton_16) self.line_2 = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line_2.sizePolicy().hasHeightForWidth()) self.line_2.setSizePolicy(sizePolicy) self.line_2.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_2.setFrameShape(QtGui.QFrame.VLine) self.line_2.setFrameShadow(QtGui.QFrame.Sunken) self.line_2.setObjectName(_fromUtf8("line_2")) self.horizontalLayout_2.addWidget(self.line_2) self.toolButton_15 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_15.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_15.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_15.setStyleSheet(_fromUtf8("")) icon15 = QtGui.QIcon() icon15.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Column-Selection-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_15.setIcon(icon15) self.toolButton_15.setIconSize(QtCore.QSize(35, 35)) self.toolButton_15.setObjectName(_fromUtf8("toolButton_15")) self.horizontalLayout_2.addWidget(self.toolButton_15) self.toolButton_14 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_14.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_14.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_14.setStyleSheet(_fromUtf8("")) icon16 = QtGui.QIcon() icon16.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Slash-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_14.setIcon(icon16) self.toolButton_14.setIconSize(QtCore.QSize(35, 35)) self.toolButton_14.setObjectName(_fromUtf8("toolButton_14")) self.horizontalLayout_2.addWidget(self.toolButton_14) self.line = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line.sizePolicy().hasHeightForWidth()) self.line.setSizePolicy(sizePolicy) self.line.setMaximumSize(QtCore.QSize(16777215, 20)) self.line.setFrameShape(QtGui.QFrame.VLine) self.line.setFrameShadow(QtGui.QFrame.Sunken) self.line.setObjectName(_fromUtf8("line")) self.horizontalLayout_2.addWidget(self.line) self.toolButton_13 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_13.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_13.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_13.setStyleSheet(_fromUtf8("")) icon17 = QtGui.QIcon() icon17.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Magnifying-Glass-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_13.setIcon(icon17) self.toolButton_13.setIconSize(QtCore.QSize(35, 35)) self.toolButton_13.setObjectName(_fromUtf8("toolButton_13")) self.horizontalLayout_2.addWidget(self.toolButton_13) self.toolButton_12 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_12.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_12.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_12.setStyleSheet(_fromUtf8("")) icon18 = QtGui.QIcon() icon18.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Zoom-In-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_12.setIcon(icon18) self.toolButton_12.setIconSize(QtCore.QSize(35, 35)) self.toolButton_12.setObjectName(_fromUtf8("toolButton_12")) self.horizontalLayout_2.addWidget(self.toolButton_12) self.toolButton_11 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_11.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_11.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_11.setAutoFillBackground(False) self.toolButton_11.setStyleSheet(_fromUtf8("")) icon19 = QtGui.QIcon() icon19.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Zoom-Out-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_11.setIcon(icon19) self.toolButton_11.setIconSize(QtCore.QSize(35, 35)) self.toolButton_11.setObjectName(_fromUtf8("toolButton_11")) self.horizontalLayout_2.addWidget(self.toolButton_11) self.dockWidget_4.setWidget(self.dockWidgetContents_4) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(4), self.dockWidget_4) self.dockWidget_5 = QtGui.QDockWidget(MainWindow) self.dockWidget_5.setObjectName(_fromUtf8("dockWidget_5")) self.dockWidgetContents_5 = QtGui.QWidget() self.dockWidgetContents_5.setObjectName(_fromUtf8("dockWidgetContents_5")) self.verticalLayout = QtGui.QVBoxLayout(self.dockWidgetContents_5) self.verticalLayout.setObjectName(_fromUtf8("verticalLayout")) self.pushButton_2 = QtGui.QPushButton(self.dockWidgetContents_5) self.pushButton_2.setMinimumSize(QtCore.QSize(0, 0)) self.pushButton_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton_2.setObjectName(_fromUtf8("pushButton_2")) self.verticalLayout.addWidget(self.pushButton_2) self.dockWidget_5.setWidget(self.dockWidgetContents_5) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(1), self.dockWidget_5) self.retranslateUi(MainWindow) self.tabWidget_2.setCurrentIndex(1) self.tabWidget_3.setCurrentIndex(1) QtCore.QMetaObject.connectSlotsByName(MainWindow) def retranslateUi(self, MainWindow): MainWindow.setWindowTitle(_translate("MainWindow", "MainWindow", None)) self.pushButton_3.setText(_translate("MainWindow", "Hide", None)) self.toolButton_7.setToolTip(_translate("MainWindow", "Add", None)) self.toolButton_7.setText(_translate("MainWindow", "...", None)) self.toolButton_9.setToolTip(_translate("MainWindow", "Remove", None)) self.toolButton_9.setText(_translate("MainWindow", "...", None)) self.toolButton_8.setToolTip(_translate("MainWindow", "Import Coordinates", None)) self.toolButton_8.setText(_translate("MainWindow", "...", None)) self.toolButton_5.setToolTip(_translate("MainWindow", "Export Coordinates", None)) self.toolButton_5.setText(_translate("MainWindow", "...", None)) item = self.tableWidget.horizontalHeaderItem(0) item.setText(_translate("MainWindow", "x", None)) item = self.tableWidget.horizontalHeaderItem(1) item.setText(_translate("MainWindow", "y", None)) item = self.tableWidget.horizontalHeaderItem(2) item.setText(_translate("MainWindow", "z", None)) self.pushButton_21.setText(_translate("MainWindow", "Redraw", None)) self.toolButton_17.setToolTip(_translate("MainWindow", "Create New", None)) self.toolButton_17.setText(_translate("MainWindow", "...", None)) self.toolButton_10.setToolTip(_translate("MainWindow", "Open Existing", None)) self.toolButton_10.setText(_translate("MainWindow", "...", None)) self.toolButton_20.setToolTip(_translate("MainWindow", "Save to Drive", None)) self.toolButton_20.setText(_translate("MainWindow", "...", None)) self.toolButton_18.setToolTip(_translate("MainWindow", "Load New", None)) self.toolButton_18.setText(_translate("MainWindow", "...", None)) self.toolButton_4.setToolTip(_translate("MainWindow", "Add new Equation", None)) self.toolButton_4.setText(_translate("MainWindow", "...", None)) self.toolButton_3.setToolTip(_translate("MainWindow", "Remove this Equation", None)) self.toolButton_3.setText(_translate("MainWindow", "...", None)) self.checkBox.setToolTip(_translate("MainWindow", "Show on Graph", None)) self.Example.setToolTip(_translate("MainWindow", "Illustrate with an Example", None)) self.Example.setWhatsThis(_translate("MainWindow", "Example", None)) self.Example.setText(_translate("MainWindow", "Example", None)) self.toolButton.setToolTip(_translate("MainWindow", "Always on Top", None)) self.toolButton.setText(_translate("MainWindow", "...", None)) self.toolButton_25.setToolTip(_translate("MainWindow", "Show/Hide Table", None)) self.toolButton_25.setText(_translate("MainWindow", "...", None)) self.toolButton_19.setToolTip(_translate("MainWindow", "Keyboard", None)) self.toolButton_19.setText(_translate("MainWindow", "...", None)) self.toolButton_23.setToolTip(_translate("MainWindow", "Print graph", None)) self.toolButton_23.setText(_translate("MainWindow", "...", None)) self.toolButton_2.setToolTip(_translate("MainWindow", "Save Graph", None)) self.toolButton_2.setText(_translate("MainWindow", "...", None)) self.toolButton_24.setToolTip(_translate("MainWindow", "Take a screenshot", None)) self.toolButton_24.setText(_translate("MainWindow", "...", None)) self.toolButton_22.setToolTip(_translate("MainWindow", "Go to our FaceBook page", None)) self.toolButton_22.setText(_translate("MainWindow", "...", None)) self.toolButton_21.setToolTip(_translate("MainWindow", "Play", None)) self.toolButton_21.setText(_translate("MainWindow", "...", None)) self.toolButton_16.setToolTip(_translate("MainWindow", "Stop", None)) self.toolButton_16.setText(_translate("MainWindow", "...", None)) self.toolButton_15.setToolTip(_translate("MainWindow", "Disable Anti-Aliasing", None)) self.toolButton_15.setText(_translate("MainWindow", "...", None)) self.toolButton_14.setToolTip(_translate("MainWindow", "Enable Anti-Aliasing", None)) self.toolButton_14.setText(_translate("MainWindow", "...", None)) self.toolButton_13.setToolTip(_translate("MainWindow", "Zoom All", None)) self.toolButton_13.setText(_translate("MainWindow", "...", None)) self.toolButton_12.setToolTip(_translate("MainWindow", "Zoom in", None)) self.toolButton_12.setText(_translate("MainWindow", "...", None)) self.toolButton_11.setToolTip(_translate("MainWindow", "Zoom out", None)) self.toolButton_11.setText(_translate("MainWindow", "...", None)) self.pushButton_2.setText(_translate("MainWindow", "PushButton", None))
gpl-2.0
-4,134,462,761,231,112,000
56.969608
268
0.698557
false
ifp-uiuc/do-neural-networks-learn-faus-iccvw-2015
ck_plus/cnn_ad/train.py
1
3697
import argparse import os import sys sys.path.append('..') import numpy from anna import util from anna.datasets import supervised_dataset #from anna.datasets.supervised_data_loader import SupervisedDataLoaderCrossVal import data_fold_loader import data_paths from model import SupervisedModel parser = argparse.ArgumentParser(prog='train_cnn_with_dropout_\ data_augmentation', description='Script to train convolutional \ network from random initialization with \ dropout and data augmentation.') parser.add_argument("-s", "--split", default='0', help='Testing split of CK+ \ to use. (0-9)') parser.add_argument("--checkpoint_dir", default='./', help='Location to save \ model checkpoint files.') args = parser.parse_args() print('Start') test_split = int(args.split) if test_split < 0 or test_split > 9: raise Exception("Testing Split must be in range 0-9.") print('Using CK+ testing split: {}'.format(test_split)) checkpoint_dir = os.path.join(args.checkpoint_dir, 'checkpoints_'+str(test_split)) print 'Checkpoint dir: ', checkpoint_dir pid = os.getpid() print('PID: {}'.format(pid)) f = open('pid_'+str(test_split), 'wb') f.write(str(pid)+'\n') f.close() # Load model model = SupervisedModel('experiment', './', learning_rate=1e-2) monitor = util.Monitor(model, checkpoint_directory=checkpoint_dir, save_steps=1000) # Add dropout to fully-connected layer model.fc4.dropout = 0.5 model._compile() # Loading CK+ dataset print('Loading Data') #supervised_data_loader = SupervisedDataLoaderCrossVal( # data_paths.ck_plus_data_path) #train_data_container = supervised_data_loader.load('train', train_split) #test_data_container = supervised_data_loader.load('test', train_split) train_folds, val_fold, _ = data_fold_loader.load_fold_assignment(test_fold=test_split) X_train, y_train = data_fold_loader.load_folds(data_paths.ck_plus_data_path, train_folds) X_val, y_val = data_fold_loader.load_folds(data_paths.ck_plus_data_path, [val_fold]) X_test, y_test = data_fold_loader.load_folds(data_paths.ck_plus_data_path, [test_split]) X_train = numpy.float32(X_train) X_train /= 255.0 X_train *= 2.0 X_val = numpy.float32(X_val) X_val /= 255.0 X_val *= 2.0 X_test = numpy.float32(X_test) X_test /= 255.0 X_test *= 2.0 train_dataset = supervised_dataset.SupervisedDataset(X_train, y_train) val_dataset = supervised_dataset.SupervisedDataset(X_val, y_val) train_iterator = train_dataset.iterator( mode='random_uniform', batch_size=64, num_batches=31000) val_iterator = val_dataset.iterator( mode='random_uniform', batch_size=64, num_batches=31000) # Do data augmentation (crops, flips, rotations, scales, intensity) data_augmenter = util.DataAugmenter2(crop_shape=(96, 96), flip=True, gray_on=True) normer = util.Normer3(filter_size=5, num_channels=1) module_list_train = [data_augmenter, normer] module_list_val = [normer] preprocessor_train = util.Preprocessor(module_list_train) preprocessor_val = util.Preprocessor(module_list_val) print('Training Model') for x_batch, y_batch in train_iterator: x_batch = preprocessor_train.run(x_batch) monitor.start() log_prob, accuracy = model.train(x_batch, y_batch) monitor.stop(1-accuracy) if monitor.test: monitor.start() x_val_batch, y_val_batch = val_iterator.next() x_val_batch = preprocessor_val.run(x_val_batch) val_accuracy = model.eval(x_val_batch, y_val_batch) monitor.stop_test(1-val_accuracy)
bsd-3-clause
-8,914,378,663,641,386,000
33.551402
89
0.675683
false
all-of-us/raw-data-repository
tests/service_tests/consent_tests/test_consent_validation.py
1
12558
from datetime import datetime, timedelta import json import mock from typing import List, Type from rdr_service.model.consent_file import ConsentFile, ConsentSyncStatus, ConsentType from rdr_service.model.hpo import HPO from rdr_service.model.participant_summary import ParticipantSummary from rdr_service.services.consent import files from rdr_service.services.consent.validation import ConsentValidator from tests.helpers.unittest_base import BaseTestCase class ConsentValidationTesting(BaseTestCase): def __init__(self, *args, **kwargs): super(ConsentValidationTesting, self).__init__(*args, **kwargs) self.uses_database = False self.va_hpo = HPO(hpoId=4) self.another_hpo = HPO(hpoId=8) self._default_signature = 'Test' default_consent_timestamp = datetime(2019, 8, 27, 17, 9) self._default_signing_date = default_consent_timestamp.date() self.participant_summary = ParticipantSummary( consentForStudyEnrollmentFirstYesAuthored=default_consent_timestamp ) self.consent_factory_mock = mock.MagicMock(spec=files.ConsentFileAbstractFactory) self.validator = ConsentValidator( consent_factory=self.consent_factory_mock, participant_summary=self.participant_summary, va_hpo_id=self.va_hpo.hpoId ) def test_primary_file_ready_for_sync(self): """Test the defaults give a consent file ready for syncing""" self.consent_factory_mock.get_primary_consents.return_value = [ self._mock_consent(consent_class=files.PrimaryConsentFile) ] self.assertMatchesExpectedResults( [ { 'participant_id': self.participant_summary.participantId, 'file_exists': True, 'type': ConsentType.PRIMARY, 'is_signature_valid': True, 'signature_str': self._default_signature, 'is_signing_date_valid': True, 'signing_date': self._default_signing_date, 'sync_status': ConsentSyncStatus.READY_FOR_SYNC } ], self.validator.get_primary_validation_results() ) def test_primary_with_incorrect_date(self): incorrect_date_on_file = self._default_signing_date - timedelta(days=300) self.consent_factory_mock.get_primary_consents.return_value = [ self._mock_consent( consent_class=files.PrimaryConsentFile, get_signature_on_file='signed with wrong date', get_date_signed=incorrect_date_on_file ), self._mock_consent( consent_class=files.PrimaryConsentFile, get_signature_on_file='signed with no date', get_date_signed=None ) ] self.assertMatchesExpectedResults( [ { 'type': ConsentType.PRIMARY, 'signature_str': 'signed with wrong date', 'is_signing_date_valid': False, 'signing_date': incorrect_date_on_file, 'sync_status': ConsentSyncStatus.NEEDS_CORRECTING }, { 'type': ConsentType.PRIMARY, 'signature_str': 'signed with no date', 'is_signing_date_valid': False, 'signing_date': None, 'sync_status': ConsentSyncStatus.NEEDS_CORRECTING } ], self.validator.get_primary_validation_results() ) def test_primary_with_slightly_off_date(self): shifted_date_on_file = self._default_signing_date - timedelta(days=3) self.consent_factory_mock.get_primary_consents.return_value = [ self._mock_consent( consent_class=files.PrimaryConsentFile, get_signature_on_file='signed with slightly off date', get_date_signed=shifted_date_on_file ) ] self.assertMatchesExpectedResults( [ { 'type': ConsentType.PRIMARY, 'signature_str': 'signed with slightly off date', 'is_signing_date_valid': True, 'signing_date': shifted_date_on_file, 'sync_status': ConsentSyncStatus.READY_FOR_SYNC } ], self.validator.get_primary_validation_results() ) def test_primary_with_signature_image(self): self.consent_factory_mock.get_primary_consents.return_value = [ self._mock_consent( consent_class=files.PrimaryConsentFile, get_signature_on_file=True ) ] self.assertMatchesExpectedResults( [ { 'type': ConsentType.PRIMARY, 'is_signature_valid': True, 'signature_str': None, 'is_signature_image': True, 'sync_status': ConsentSyncStatus.READY_FOR_SYNC } ], self.validator.get_primary_validation_results() ) def test_va_primary_for_non_veteran(self): self.participant_summary.hpoId = self.another_hpo.hpoId self.consent_factory_mock.get_primary_consents.return_value = [ self._mock_consent( consent_class=files.PrimaryConsentFile, get_is_va_consent=True ) ] self.assertMatchesExpectedResults( [ { 'type': ConsentType.PRIMARY, 'other_errors': 'veteran consent for non-veteran participant', 'sync_status': ConsentSyncStatus.NEEDS_CORRECTING } ], self.validator.get_primary_validation_results() ) def test_non_va_primary_for_veteran(self): self.participant_summary.hpoId = self.va_hpo.hpoId self.consent_factory_mock.get_primary_consents.return_value = [ self._mock_consent( consent_class=files.PrimaryConsentFile, get_is_va_consent=False, ) ] self.assertMatchesExpectedResults( [ { 'type': ConsentType.PRIMARY, 'other_errors': 'non-veteran consent for veteran participant', 'sync_status': ConsentSyncStatus.NEEDS_CORRECTING } ], self.validator.get_primary_validation_results() ) def test_ehr_file_ready_for_sync(self): ehr_consent_timestamp = datetime(2020, 2, 5, 13, 9) self.participant_summary.consentForElectronicHealthRecordsAuthored = ehr_consent_timestamp self.consent_factory_mock.get_ehr_consents.return_value = [ self._mock_consent( consent_class=files.EhrConsentFile, get_date_signed=ehr_consent_timestamp.date() ) ] self.assertMatchesExpectedResults( [ { 'participant_id': self.participant_summary.participantId, 'type': ConsentType.EHR, 'is_signing_date_valid': True, 'signing_date': ehr_consent_timestamp.date(), 'sync_status': ConsentSyncStatus.READY_FOR_SYNC } ], self.validator.get_ehr_validation_results() ) def test_cabor_file_ready_for_sync(self): cabor_consent_timestamp = datetime(2020, 4, 21, 13, 9) self.participant_summary.consentForCABoRAuthored = cabor_consent_timestamp self.consent_factory_mock.get_cabor_consents.return_value = [ self._mock_consent( consent_class=files.CaborConsentFile, get_date_signed=cabor_consent_timestamp.date() ) ] self.assertMatchesExpectedResults( [ { 'participant_id': self.participant_summary.participantId, 'type': ConsentType.CABOR, 'is_signing_date_valid': True, 'signing_date': cabor_consent_timestamp.date(), 'sync_status': ConsentSyncStatus.READY_FOR_SYNC } ], self.validator.get_cabor_validation_results() ) def test_gror_file_ready_for_sync(self): gror_consent_timestamp = datetime(2020, 10, 21, 13, 9) self.participant_summary.consentForGenomicsRORAuthored = gror_consent_timestamp self.consent_factory_mock.get_gror_consents.return_value = [ self._mock_consent( consent_class=files.GrorConsentFile, get_date_signed=gror_consent_timestamp.date() ) ] self.assertMatchesExpectedResults( [ { 'participant_id': self.participant_summary.participantId, 'type': ConsentType.GROR, 'is_signing_date_valid': True, 'signing_date': gror_consent_timestamp.date(), 'sync_status': ConsentSyncStatus.READY_FOR_SYNC } ], self.validator.get_gror_validation_results() ) def test_gror_without_checkmark(self): self.participant_summary.consentForGenomicsRORAuthored = datetime.combine( self._default_signing_date, datetime.now().time() ) self.consent_factory_mock.get_gror_consents.return_value = [ self._mock_consent( consent_class=files.GrorConsentFile, is_confirmation_selected=False ) ] self.assertMatchesExpectedResults( [ { 'participant_id': self.participant_summary.participantId, 'type': ConsentType.GROR, 'other_errors': 'missing consent check mark', 'sync_status': ConsentSyncStatus.NEEDS_CORRECTING } ], self.validator.get_gror_validation_results() ) def test_gror_missing(self): self.participant_summary.consentForGenomicsRORAuthored = datetime.combine( self._default_signing_date, datetime.now().time() ) self.consent_factory_mock.get_gror_consents.return_value = [] self.assertMatchesExpectedResults( [ { 'participant_id': self.participant_summary.participantId, 'type': ConsentType.GROR, 'file_exists': False, 'sync_status': ConsentSyncStatus.NEEDS_CORRECTING } ], self.validator.get_gror_validation_results() ) def _mock_consent(self, consent_class: Type[files.ConsentFile], **kwargs): consent_args = { 'get_signature_on_file': self._default_signature, 'get_date_signed': self._default_signing_date, 'get_is_va_consent': False } consent_args.update(kwargs) consent_mock = mock.MagicMock(spec=consent_class) consent_mock.upload_time = datetime.now() consent_mock.file_path = '/test' for method_name, return_value in consent_args.items(): if hasattr(consent_mock, method_name): getattr(consent_mock, method_name).return_value = return_value return consent_mock def assertMatchesExpectedResults(self, expected_list, actual_list: List[ConsentFile]): self.assertEqual(len(expected_list), len(actual_list)) def expected_data_found_in_results(expected_result): for actual_result in actual_list: if all([getattr(actual_result, attr_name) == value for attr_name, value in expected_result.items()]): return True return False def json_print(data): return json.dumps(data, default=str, indent=4) for expected in expected_list: if not expected_data_found_in_results(expected): self.fail( f'{json_print(expected)} not found in results: ' f'{json_print([actual.asdict() for actual in actual_list])}' )
bsd-3-clause
-6,291,842,177,331,229,000
39.121406
117
0.558847
false
radjkarl/imgProcessor
imgProcessor/imgSignal.py
1
10847
from __future__ import division from __future__ import print_function import numpy as np import cv2 from imgProcessor.imgIO import imread from imgProcessor.measure.FitHistogramPeaks import FitHistogramPeaks from fancytools.math.findXAt import findXAt # from scipy.optimize.minpack import curve_fit MAX_SIZE = 700 def scaleSignalCut(img, ratio, nbins=100): ''' scaling img cutting x percent of top and bottom part of histogram ''' start, stop = scaleSignalCutParams(img, ratio, nbins) img = img - start img /= (stop - start) return img def _toSize(img): fac = MAX_SIZE / max(img.shape) if fac < 1: try: return cv2.resize(img, (0, 0), fx=fac, fy=fac, interpolation=cv2.INTER_AREA) except cv2.error: # cv2.error: ..\..\..\modules\imgproc\src\imgwarp.cpp:3235: error: # (-215) dsize.area() > 0 in function cv::resize return cv2.resize(img.T, (0, 0), fx=fac, fy=fac, interpolation=cv2.INTER_AREA).T return img def _histogramAndCorrBinPos(img, nbins=100): try: h, bins = np.histogram(img, nbins) except ValueError: # img contains NaN h, bins = np.histogram(img[np.isfinite(img)], nbins) b0 = bins[0] bins = bins[1:] bins += 0.5 * (bins[0] - b0) return h, bins def scaleSignalCutParams(img, ratio=0.01, nbins=100, return_img=False): img = _toSize(img) h, bins = _histogramAndCorrBinPos(img, nbins) h = np.cumsum(h).astype(float) h -= h.min() h /= h[-1] try: start = findXAt(bins, h, ratio) except IndexError: start = bins[0] try: stop = findXAt(bins, h, 1 - ratio) except IndexError: stop = bins[-1] if return_img: return start, stop, img return start, stop def scaleSignal(img, fitParams=None, backgroundToZero=False, reference=None): ''' scale the image between... backgroundToZero=True -> 0 (average background) and 1 (maximum signal) backgroundToZero=False -> signal+-3std reference -> reference image -- scale image to fit this one returns: scaled image ''' img = imread(img) if reference is not None: # def fn(ii, m,n): # return ii*m+n # curve_fit(fn, img[::10,::10], ref[::10,::10]) low, high = signalRange(img, fitParams) low2, high2 = signalRange(reference) img = np.asfarray(img) ampl = (high2 - low2) / (high - low) img -= low img *= ampl img += low2 return img else: offs, div = scaleParams(img, fitParams, backgroundToZero) img = np.asfarray(img) - offs img /= div print('offset: %s, divident: %s' % (offs, div)) return img def getBackgroundRange(fitParams): ''' return minimum, average, maximum of the background peak ''' smn, _, _ = getSignalParameters(fitParams) bg = fitParams[0] _, avg, std = bg bgmn = max(0, avg - 3 * std) if avg + 4 * std < smn: bgmx = avg + 4 * std if avg + 3 * std < smn: bgmx = avg + 3 * std if avg + 2 * std < smn: bgmx = avg + 2 * std else: bgmx = avg + std return bgmn, avg, bgmx def hasBackground(fitParams): ''' compare the height of putative bg and signal peak if ratio if too height assume there is no background ''' signal = getSignalPeak(fitParams) bg = getBackgroundPeak(fitParams) if signal == bg: return False r = signal[0] / bg[0] if r < 1: r = 1 / r return r < 100 def backgroundPeakValue(img, bins=500): f = FitHistogramPeaks(img, bins=bins, bins2=300) bgp = getBackgroundPeak(f.fitParams) ind = int(bgp[1]) if ind < 0: ind = 0 # y = f.yvals[ind:] # i = np.argmax(np.diff(y) > 0) # bgmaxpos = ind # + i # print(f.xvals[bgmaxpos], bgmaxpos) # import pylab as plt # plt.plot(f.xvals, f.yvals) # plt.show() return f.xvals[ind] def signalMinimum2(img, bins=None): ''' minimum position between signal and background peak ''' f = FitHistogramPeaks(img, bins=bins) i = signalPeakIndex(f.fitParams) spos = f.fitParams[i][1] # spos = getSignalPeak(f.fitParams)[1] # bpos = getBackgroundPeak(f.fitParams)[1] bpos = f.fitParams[i - 1][1] ind = np.logical_and(f.xvals > bpos, f.xvals < spos) try: i = np.argmin(f.yvals[ind]) return f.xvals[ind][i] except ValueError as e: if bins is None: return signalMinimum2(img, bins=400) else: raise e def signalMinimum(img, fitParams=None, n_std=3): ''' intersection between signal and background peak ''' if fitParams is None: fitParams = FitHistogramPeaks(img).fitParams assert len(fitParams) > 1, 'need 2 peaks so get minimum signal' i = signalPeakIndex(fitParams) signal = fitParams[i] bg = getBackgroundPeak(fitParams) smn = signal[1] - n_std * signal[2] bmx = bg[1] + n_std * bg[2] if smn > bmx: return smn # peaks are overlapping # define signal min. as intersection between both Gaussians def solve(p1, p2): s1, m1, std1 = p1 s2, m2, std2 = p2 a = (1 / (2 * std1**2)) - (1 / (2 * std2**2)) b = (m2 / (std2**2)) - (m1 / (std1**2)) c = (m1**2 / (2 * std1**2)) - (m2**2 / (2 * std2**2)) - \ np.log(((std2 * s1) / (std1 * s2))) return np.roots([a, b, c]) i = solve(bg, signal) try: return i[np.logical_and(i > bg[1], i < signal[1])][0] except IndexError: # this error shouldn't occur... well return max(smn, bmx) def getSignalMinimum(fitParams, n_std=3): assert len(fitParams) > 0, 'need min. 1 peak so get minimum signal' if len(fitParams) == 1: signal = fitParams[0] return signal[1] - n_std * signal[2] i = signalPeakIndex(fitParams) signal = fitParams[i] bg = fitParams[i - 1] #bg = getBackgroundPeak(fitParams) smn = signal[1] - n_std * signal[2] bmx = bg[1] + n_std * bg[2] if smn > bmx: return smn # peaks are overlapping # define signal min. as intersection between both Gaussians def solve(p1, p2): s1, m1, std1 = p1 s2, m2, std2 = p2 a = (1 / (2 * std1**2)) - (1 / (2 * std2**2)) b = (m2 / (std2**2)) - (m1 / (std1**2)) c = (m1**2 / (2 * std1**2)) - (m2**2 / (2 * std2**2)) - \ np.log(((std2 * s1) / (std1 * s2))) return np.roots([a, b, c]) i = solve(bg, signal) try: return i[np.logical_and(i > bg[1], i < signal[1])][0] except IndexError: # something didnt work out - fallback return smn def getSignalParameters(fitParams, n_std=3): ''' return minimum, average, maximum of the signal peak ''' signal = getSignalPeak(fitParams) mx = signal[1] + n_std * signal[2] mn = signal[1] - n_std * signal[2] if mn < fitParams[0][1]: mn = fitParams[0][1] # set to bg return mn, signal[1], mx def signalStd(img): fitParams = FitHistogramPeaks(img).fitParams signal = getSignalPeak(fitParams) return signal[2] def backgroundMean(img, fitParams=None): try: if fitParams is None: fitParams = FitHistogramPeaks(img).fitParams bg = getBackgroundPeak(fitParams) return bg[1] except Exception as e: print(e) # in case peaks were not found: return img.mean() def signalRange(img, fitParams=None, nSigma=3): try: if fitParams is None: fitParams = FitHistogramPeaks(img).fitParams signPeak = getSignalPeak(fitParams) return (signalMinimum(img, fitParams, nSigma), signPeak[1] + nSigma * signPeak[2]) # return (signPeak[1] - nSigma*signPeak[2],signPeak[1] + # nSigma*signPeak[2]) except Exception as e: print(e) # in case peaks were not found: s = img.std() m = img.mean() return m - nSigma * s, m + nSigma * s def scaleParamsFromReference(img, reference): # saving startup time: from scipy.optimize import curve_fit def ff(arr): arr = imread(arr, 'gray') if arr.size > 300000: arr = arr[::10, ::10] m = np.nanmean(arr) s = np.nanstd(arr) r = m - 3 * s, m + 3 * s b = (r[1] - r[0]) / 5 return arr, r, b img, imgr, imgb = ff(img) reference, refr, refb = ff(reference) nbins = np.clip(15, max(imgb, refb), 50) refh = np.histogram(reference, bins=nbins, range=refr)[ 0].astype(np.float32) imgh = np.histogram(img, bins=nbins, range=imgr)[0].astype(np.float32) import pylab as plt plt.figure(1) plt.plot(refh) plt.figure(2) plt.plot(imgh) plt.show() def fn(x, offs, div): return (x - offs) / div params, fitCovariances = curve_fit(fn, refh, imgh, p0=(0, 1)) perr = np.sqrt(np.diag(fitCovariances)) print('error scaling to reference image: %s' % perr[0]) # if perr[0] < 0.1: return params[0], params[1] def scaleParams(img, fitParams=None): low, high = signalRange(img, fitParams) offs = low div = high - low return offs, div def getBackgroundPeak(fitParams): return fitParams[0] def getSignalPeak(fitParams): i = signalPeakIndex(fitParams) return fitParams[i] def signalPeakIndex(fitParams): if len(fitParams) == 1: i = 0 else: # find categorical signal peak as max(peak height*standard deviation): sizes = [pi[0] * pi[2] for pi in fitParams[1:]] # signal peak has to have positive avg: for n, p in enumerate(fitParams[1:]): if p[1] < 0: sizes[n] = 0 i = np.argmax(sizes) + 1 return i if __name__ == '__main__': import sys import pylab as plt from fancytools.os.PathStr import PathStr import imgProcessor img = imread(PathStr(imgProcessor.__file__).dirname().join( 'media', 'electroluminescence', 'EL_module_orig.PNG'), 'gray') print('EL signal within range of %s' % str(signalRange(img))) print('EL signal minimum = %s' % signalMinimum(img)) if 'no_window' not in sys.argv: plt.imshow(img) plt.colorbar() plt.show()
gpl-3.0
7,949,265,973,686,205,000
26.028424
78
0.553425
false
fumitoh/modelx
modelx/tests/core/reference/relative/test_refmode.py
1
2034
import modelx as mx import pytest @pytest.fixture def refmode_model(): """ A---B---C---foo <-+ | | | | +---bar --+ D """ import modelx as mx m = mx.new_model() A = mx.new_space('A') B = A.new_space('B') C = B.new_space('C') @mx.defcells def foo(x): return x D = m.new_space('D') D.add_bases(B) return m def test_refmode_change(refmode_model): m = refmode_model m.A.B.C.bar = m.A.B.C.foo assert m.D.C.bar is m.D.C.foo m.A.B.C.absref(bar=m.A.B.C.foo) assert m.D.C.bar is m.A.B.C.foo m.A.B.C.relref(bar=m.A.B.C.foo) assert m.D.C.bar is m.D.C.foo m.A.B.C.absref(bar=m.A.B.C.foo) assert m.D.C.bar is m.A.B.C.foo @pytest.mark.parametrize("mode", ["relative", "auto"]) def test_refer_sibling(mode): """ A---B-------foo <-+ | | | | +---bar --+ D """ import modelx as mx m = mx.new_model() A = mx.new_space('A') B = A.new_space('B') @mx.defcells def foo(x): return x B.set_ref("bar", foo, mode) D = m.new_space('D', bases=B) assert D.bar is D.foo @pytest.mark.parametrize("mode", ["absolute", "auto"]) def test_refer_parent(mode): """ A---B-------foo | | | +---bar --> A D """ import modelx as mx m = mx.new_model() A = mx.new_space('A') B = A.new_space('B') @mx.defcells def foo(x): return x B.set_ref("bar", A, mode) D = m.new_space('D', bases=B) assert D.bar is A def test_refer_parent_error(): """ A---B-------foo | | | +---bar --> A D """ import modelx as mx m = mx.new_model() A = mx.new_space('A') B = A.new_space('B') @mx.defcells def foo(x): return x B.set_ref("bar", A, "relative") with pytest.raises(ValueError): D = m.new_space('D', bases=B)
gpl-3.0
-1,664,453,725,808,355,300
17
54
0.457227
false
Osmose/normandy
recipe-server/normandy/recipes/migrations/0021_migrate_to_single_actions.py
1
1111
# -*- coding: utf-8 -*- # Generated by Django 1.9 on 2016-03-16 19:55 # flake8: noqa from __future__ import unicode_literals from django.db import migrations def multiple_to_single(apps, schema_editor): """ Take the first action in a recipe and set it as the single action. """ Recipe = apps.get_model('recipes', 'Recipe') for recipe in Recipe.objects.all(): if recipe.recipeaction_set.count() < 1: raise ValueError('Cannot migrate recipe pk={0} as it has no actions. Delete it manually' ' or add an action and re-run this migration.'.format(recipe.pk)) recipe_action = recipe.recipeaction_set.order_by('order')[0] recipe.action = recipe_action.action recipe.arguments_json = recipe_action.arguments_json recipe.save() def noop(apps, schema_editor): pass # Not too concerned about going backwards here. class Migration(migrations.Migration): dependencies = [ ('recipes', '0020_auto_20160316_1947'), ] operations = [ migrations.RunPython(multiple_to_single, noop) ]
mpl-2.0
-8,590,091,028,667,492,000
30.742857
100
0.647165
false
HoussemCharf/FunUtils
pythonMergeSort.py
1
2025
""" This is a pure python implementation of the merge sort algorithm For doctests run following command: python -m doctest -v merge_sort.py or python3 -m doctest -v merge_sort.py For manual testing run: python merge_sort.py """ from __future__ import print_function def merge_sort(collection): """Pure implementation of the merge sort algorithm in Python :param collection: some mutable ordered collection with heterogeneous comparable items inside :return: the same collection ordered by ascending Examples: >>> merge_sort([0, 5, 3, 2, 2]) [0, 2, 2, 3, 5] >>> merge_sort([]) [] >>> merge_sort([-2, -5, -45]) [-45, -5, -2] """ length = len(collection) if length > 1: midpoint = length // 2 left_half = merge_sort(collection[:midpoint]) right_half = merge_sort(collection[midpoint:]) i = 0 j = 0 k = 0 left_length = len(left_half) right_length = len(right_half) while i < left_length and j < right_length: if left_half[i] < right_half[j]: collection[k] = left_half[i] i += 1 else: collection[k] = right_half[j] j += 1 k += 1 while i < left_length: collection[k] = left_half[i] i += 1 k += 1 while j < right_length: collection[k] = right_half[j] j += 1 k += 1 return collection if __name__ == '__main__': import sys # For python 2.x and 3.x compatibility: 3.x has no raw_input builtin # otherwise 2.x's input builtin function is too "smart" if sys.version_info.major < 3: input_function = raw_input else: input_function = input user_input = input_function('Enter numbers separated by a comma:\n') unsorted = [int(item) for item in user_input.split(',')] print(merge_sort(unsorted))
mit
-4,175,166,591,996,086,300
26.957143
73
0.545185
false
walterbender/locosugar
toolbar_utils.py
1
5547
# -*- coding: utf-8 -*- # Copyright (c) 2011, Walter Bender # Copyright (c) 2012, Ignacio Rodriguez # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 3 of the License, or # (at your option) any later version. # # You should have received a copy of the GNU General Public License # along with this library; if not, write to the Free Software # Foundation, 51 Franklin Street, Suite 500 Boston, MA 02110-1335 USA from gi.repository import Gtk from sugar3.graphics.radiotoolbutton import RadioToolButton from sugar3.graphics.toolbutton import ToolButton from sugar3.graphics.combobox import ComboBox def combo_factory(combo_array, toolbar, callback, cb_arg=None, tooltip=None, default=None): '''Factory for making a toolbar combo box''' combo = ComboBox() if tooltip is not None and hasattr(combo, 'set_tooltip_text'): combo.set_tooltip_text(tooltip) if cb_arg is not None: combo.connect('changed', callback, cb_arg) else: combo.connect('changed', callback) for i, selection in enumerate(combo_array): combo.append_item(i, selection, None) combo.show() toolitem = Gtk.ToolItem() toolitem.add(combo) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: # or a secondary toolbar toolbar.props.page.insert(toolitem, -1) toolitem.show() if default is not None: combo.set_active(combo_array.index(default)) return combo def entry_factory(default_string, toolbar, tooltip=None, max=3): ''' Factory for adding a text box to a toolbar ''' entry = Gtk.Entry() entry.set_text(default_string) if tooltip is not None and hasattr(entry, 'set_tooltip_text'): entry.set_tooltip_text(tooltip) entry.set_width_chars(max) entry.show() toolitem = Gtk.ToolItem() toolitem.add(entry) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: # or a secondary toolbar toolbar.props.page.insert(toolitem, -1) toolitem.show() return entry def button_factory(icon_name, toolbar, callback, cb_arg=None, tooltip=None, accelerator=None): '''Factory for making tooplbar buttons''' button = ToolButton(icon_name) if tooltip is not None: button.set_tooltip(tooltip) button.props.sensitive = True if accelerator is not None: button.props.accelerator = accelerator if cb_arg is not None: button.connect('clicked', callback, cb_arg) else: button.connect('clicked', callback) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(button, -1) else: # or a secondary toolbar toolbar.props.page.insert(button, -1) button.show() return button def radio_factory(name, toolbar, callback, cb_arg=None, tooltip=None, group=None): ''' Add a radio button to a toolbar ''' button = RadioToolButton(group=group) button.set_icon_name(name) if callback is not None: if cb_arg is None: button.connect('clicked', callback) else: button.connect('clicked', callback, cb_arg) if hasattr(toolbar, 'insert'): # Add button to the main toolbar... toolbar.insert(button, -1) else: # ...or a secondary toolbar. toolbar.props.page.insert(button, -1) button.show() if tooltip is not None: button.set_tooltip(tooltip) return button def label_factory(toolbar, label_text, width=None): ''' Factory for adding a label to a toolbar ''' label = Gtk.Label(label_text) label.set_line_wrap(True) if width is not None: label.set_size_request(width, -1) # doesn't work on XOs label.show() toolitem = Gtk.ToolItem() toolitem.add(label) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: # or a secondary toolbar toolbar.props.page.insert(toolitem, -1) toolitem.show() return label def separator_factory(toolbar, expand=False, visible=True): ''' add a separator to a toolbar ''' separator = Gtk.SeparatorToolItem() separator.props.draw = visible separator.set_expand(expand) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(separator, -1) else: # or a secondary toolbar toolbar.props.page.insert(separator, -1) separator.show() def image_factory(image, toolbar, tooltip=None): ''' Add an image to the toolbar ''' img = Gtk.Image() img.set_from_pixbuf(image) img_tool = Gtk.ToolItem() img_tool.add(img) if tooltip is not None: img.set_tooltip_text(tooltip) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(img_tool, -1) else: # or a secondary toolbar toolbar.props.page.insert(img_tool, -1) img_tool.show() return img def spin_factory(default, min, max, callback, toolbar): spin_adj = Gtk.Adjustment(default, min, max, 1, 32, 0) spin = Gtk.SpinButton(spin_adj, 0, 0) spin_id = spin.connect('value-changed', callback) spin.set_numeric(True) spin.show() toolitem = Gtk.ToolItem() toolitem.add(spin) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: toolbar.props.page.insert(toolitem, -1) toolitem.show() return spin
gpl-3.0
-9,041,999,313,022,829,000
33.240741
75
0.658194
false
ionux/bitforge
tests/unit.py
1
1117
from bitforge.unit import Unit class TestUnit: def test_btc_accessors(self): u = Unit(btc = 1.2) assert u.btc == 1.2 assert u.mbtc == 1200 assert u.bits == 1200000 assert u.satoshis == 120000000 def test_btc_conversion(self): u = Unit(btc = 1.3) assert u.mbtc == 1300 assert u.bits == 1300000 assert u.satoshis == 130000000 u = Unit(mbtc = 1.3) assert u.btc == 0.0013 assert u.bits == 1300 assert u.satoshis == 130000 u = Unit(bits = 1.3) assert u.btc == 0.0000013 assert u.mbtc == 0.0013 assert u.satoshis == 130 u = Unit(satoshis = 3) assert u.btc == 0.00000003 assert u.mbtc == 0.00003 assert u.bits == 0.03 # TODO: Review presition # def test_unit_rates(self): # u = Unit.from_fiat(1.3, 350) # assert u.at_rate(350) == 1.3 # u = Unit(btc = 0.0123) # assert u.at_rate(10) == 0.12 def test_repr(self): u = Unit(btc = 1.3) assert repr(u) == '<Unit: 130000000 satoshis>'
mit
5,227,069,257,949,842,000
24.386364
54
0.522829
false
markbenvenuto/buildbaron
bfg_analyzer.py
1
24487
#!/usr/bin/env python3 """ Script to analyze the Jira Build Baron Queue """ import argparse import binascii import datetime import dateutil import dateutil.relativedelta import hashlib import json import os import pprint import re import requests import stat import sys if __name__ == "__main__" and __package__ is None: sys.path.append(os.path.dirname(os.path.dirname(os.path.abspath(os.path.realpath(__file__))))) import buildbaron.analyzer.analyzer_config import buildbaron.analyzer.evergreen import buildbaron.analyzer.evg_log_file_analyzer import buildbaron.analyzer.faultinfo import buildbaron.analyzer.jira_client import buildbaron.analyzer.log_file_analyzer import buildbaron.analyzer.logkeeper import buildbaron.analyzer.mongo_client import buildbaron.analyzer.parallel_failure_analyzer import buildbaron.analyzer.timeout_file_analyzer # URL of the default Jira server. # If you use .com, it breaks horribly def ParseJiraTicket(issue, summary, description): # Parse summary if "System Failure:" in summary: type = "system_failure" elif "Timed Out:" in summary: type = "timed_out" elif "Failures" in summary: type = "test_failure" elif "Failure" in summary: type = "test_failure" elif "Failed" in summary: type = "task_failure" else: raise ValueError("Unknown summary " + str(summary)) suite, build_variant, project, githash = ("unknown", "unknown", "unknown", "unknown") summary_match = re.match(".*?: (.*) on (.*) \[(.*) @ ([a-zA-Z0-9]+)\]", summary) if summary_match: suite, build_variant, project, githash = summary_match.groups() # Parse Body of description lines = description.split("\n") tests = [] for line in lines: if line.startswith('h2.'): url_match = re.search("\|(.*)\]", line) task_url = url_match.group(1) elif "[Logs|" in line: log_line_match = re.match("\*(.*)\* - \[Logs\|(.*?)\]", line) if log_line_match: test_name = log_line_match.group(1) log_file = log_line_match.group(2) tests.append({'name': test_name, 'log_file': log_file}) else: pass return bfg_fault_description(issue, summary, type, project, githash, task_url, suite, build_variant, tests) class bfg_fault_description: """Parse a fault description into type""" def __init__(self, issue, summary, type, project, githash, task_url, suite, build_variant, tests): self.issue = issue self.summary = summary self.type = type self.project = project self.githash = githash self.task_url = task_url self.suite = suite self.build_variant = build_variant self.tests = tests def to_json(self): return json.dumps(self, cls=BFGCustomEncoder) class BFGCustomEncoder(json.JSONEncoder): def default(self, obj): if isinstance(obj, bfg_fault_description): return { "issue": obj.issue, "summary": obj.summary, "type": obj.type, "task_url": obj.task_url, "project": obj.project, "githash": obj.githash, "suite": obj.suite, "build_variant": obj.build_variant, "tests": obj.tests } # Let the base class default method raise the TypeError return json.JSONEncoder.default(self, obj) class BFGCustomDecoder(json.JSONDecoder): def __init__(self, *args, **kwargs): json.JSONDecoder.__init__(self, object_hook=self.object_hook, *args, **kwargs) def object_hook(self, obj): if 'task_url' not in obj and "project" not in obj: return obj return bfg_fault_description(obj['issue'], obj['summary'], obj['type'], obj['project'], obj['task_url'], obj['suite'], obj['build_variant'], obj['tests']) class bfg_analyzer(object): """description of class""" __STACK_FRAME_EXTRACTING_REGEX = re.compile( "([a-zA-Z0-9\./]*)@((?:[a-zA-Z0-9_()]+/?)+\.js):(\d+)(?::\d+)?$") def __init__(self, jira_client): self.jira_client = jira_client self.evg_client = buildbaron.analyzer.evergreen.client() self.pp = pprint.PrettyPrinter() def query(self, query_str): results = self.jira_client.search_issues(query_str, maxResults=100) print("Result Count %d" % len(results)) bfs = [] for result in results: bfs.append(ParseJiraTicket( result.key, result.fields.summary, result.fields.description )) # Save to disk to help investigation of bad results bfs_str = json.dumps(bfs, cls=BFGCustomEncoder, indent="\t") with open("bfs.json", "wb") as sjh: sjh.write(bfs_str.encode()) # Return a list of dictionaries instead of a list of bfg_fault_description return json.loads(bfs_str) def check_logs(self, bfs): summaries = [] for bf in bfs: summaries.append(self.process_bf(bf)) jira_issue = self.jira_client.get_bfg_issue(bf["issue"]) jira_issue.fields.labels.append("bot-analyzed") jira_issue.add_field_value("labels", "bot-analyzed") return summaries # TODO: parallelize the check_logs function with this since we are network bound # builds = thread_map( lambda item : process_bf(base_url, item), commits) def thread_map(func, items): # We can use a with statement to ensure threads are cleaned up promptly with concurrent.futures.ThreadPoolExecutor(max_workers=cpu_count() * 2) as executor: # Start the load operations and mark each future with its URL future_to_item = {executor.submit(func, item): item for item in items} results = [] for future in concurrent.futures.as_completed(future_to_item): item = future_to_item[future] try: nf = future.result() if nf: results += nf except Exception as exc: print('%r generated an exception: %s' % (item, exc)) return results def create_bf_cache(self, bf): """Create a directory to cache the log file in""" if not os.path.exists("cache"): os.mkdir("cache") if not os.path.exists(os.path.join("cache", "bf")): os.mkdir(os.path.join("cache", "bf")) m = hashlib.sha1() m.update(bf["task_url"].encode()) digest = m.digest() digest64 = binascii.b2a_hex(digest).decode() bf["hash"] = digest64 path = os.path.join("cache", "bf", digest64) bf["bf_cache"] = path if not os.path.exists(path): os.mkdir(path) def create_test_cache(self, bf, test): """Create a directory to cache the log file in""" m = hashlib.sha1() m.update(test["name"].encode()) digest = m.digest() digest64 = binascii.b2a_hex(digest).decode() test["hash"] = digest64 path = os.path.join(bf['bf_cache'], digest64) test["cache"] = path if not os.path.exists(path): os.mkdir(path) def process_bf(self, bf): """ Process a log through the log file analyzer Saves analysis information in cache\XXX\summary.json """ self.create_bf_cache(bf) print("BF: " + str(bf)) summary_json_file = os.path.join(bf["bf_cache"], "summary.json") # If we've already analyzed this failure, don't do it again. if os.path.exists(summary_json_file): with open(summary_json_file, "rb") as summary_file: return json.loads(summary_file.read().decode('utf-8')) system_log_url = buildbaron.analyzer.evergreen.task_get_system_raw_log(bf['task_url']) task_log_file_url = buildbaron.analyzer.evergreen.task_get_task_raw_log(bf["task_url"]) bf['system_log_url'] = system_log_url bf['task_log_file_url'] = task_log_file_url # Will be populated with objects like {"test": <test name>, "faults": [...]} tests_fault_info = [] # Will be populated with fault objects. extracted_faults = self.process_task_failure(bf) if bf['type'] == 'test_failure': # Go through each test for test in bf['tests']: tests_fault_info.append({ "test": test["name"], "faults": self.process_test(bf, test) }) elif bf['type'] == 'system_failure': extracted_faults.extend(self.process_system_failure(bf)) elif bf['type'] == 'timed_out': task_faults, test_faults = self.process_time_out(bf) extracted_faults.extend(task_faults) tests_fault_info.extend(test_faults) try: summary_obj = { "bfg_info": bf, "faults": [fault.to_json() for fault in extracted_faults], "test_faults": [ {"test": info["test"], "faults": [fault.to_json() for fault in info["faults"]]} for info in tests_fault_info ], "backtraces": [], } except TypeError: summary_obj = { "bfg_info": bf, "faults": [fault.to_json() for fault in extracted_faults], "backtraces": [], } summary_str = json.dumps(summary_obj) def flatten(a): flattened = [] for elem in a: if type(elem) == list: flattened.extend(elem) else: flattened.append(elem) return flattened # Update jira tickets to include new information. try: all_faults = (extracted_faults + flatten([testinfo["faults"] for testinfo in tests_fault_info])) except: all_faults = extracted_faults for fault in all_faults: self.jira_client.add_fault_comment(bf["issue"], fault) if fault.category == "js backtrace": backtrace = self.build_backtrace(fault, bf["githash"]) self.jira_client.add_github_backtrace_context(bf["issue"], backtrace) summary_obj["backtraces"].append(backtrace) with open(summary_json_file, "wb") as sjh: sjh.write(summary_str.encode()) return summary_obj def build_backtrace(self, fault, githash): """ returns a list of strings representing a backtrace, as well as a parsed version represented as a list of objects of the form { "github_url": "https://github.com/mongodb/mongo/blob/deadbeef/jstests/core/test.js#L42", "first_line_number": 37, "line_number": 42, "frame_number": 0, "file_path": "jstests/core/test.js", "file_name": "test.js", "lines": ["line 37", "line 38", ..., "line 47"] } """ trace = [] # Also populate a plain-text style backtrace, with github links to frames. n_lines_of_context = 5 stack_lines = fault.context.splitlines() # Traverse the stack frames in reverse. for i in range(len(stack_lines) - 1, -1, -1): line = stack_lines[i].replace("\\", "/") # Normalize separators. stack_match = bfg_analyzer.__STACK_FRAME_EXTRACTING_REGEX.search(line) if stack_match is None: if re.search("failed to load", line) is not None: continue # skip that line, it's expected. break # any other line should be the end of the backtrace (func_name, file_path, line_number) = stack_match.groups() gui_github_url = ( "https://github.com/mongodb/mongo/blob/{githash}/{file_path}#L{line_number}".format( githash=githash, file_path=file_path, line_number=line_number)) line_number = int(line_number) # add a {code} frame to the comment, showing the line involved in the stack trace, with # some context of surrounding lines. Don't do this for the stack frames within # src/mongo/shell, since they tend not to be as interesting. if "src/mongo/shell" in file_path: continue raw_github_url = ( "https://raw.githubusercontent.com/mongodb/mongo/{githash}/{file_path}".format( githash=githash, file_path=file_path)) raw_code = requests.get(raw_github_url).text start_line = max(0, line_number - n_lines_of_context) end_line = line_number + n_lines_of_context code_context = raw_code.splitlines()[start_line:end_line] file_name = file_path[file_path.rfind("/") + 1:] trace.append({ "github_url": gui_github_url, "first_line_number": start_line, "line_number": line_number, "frame_number": i, "file_path": file_path, "file_name": file_name, "lines": code_context }) return trace def process_system_failure(self, bf): cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") bf['log_file_url'] = bf['task_log_file_url'] bf['name'] = 'task' if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['task_log_file_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') analyzer = buildbaron.analyzer.evg_log_file_analyzer.EvgLogFileAnalyzer(log_file_str) analyzer.analyze() faults = analyzer.get_faults() if len(faults) == 0: print("===========================") print("No system failure faults detected: " + self.pp.pformat(bf)) print("To Debug: python analyzer" + os.path.sep + "log_file_analyzer.py " + log_file) print("===========================") return faults def process_task_failure(self, bf): cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") bf['log_file_url'] = bf['task_log_file_url'] bf['name'] = 'task' if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['task_log_file_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') extracted_faults = [] analyzer = buildbaron.analyzer.evg_log_file_analyzer.EvgLogFileAnalyzer(log_file_str) analyzer.analyze() extracted_faults.extend(analyzer.get_faults()) oom_analyzer = self.check_for_oom_killer(bf) if oom_analyzer is not None: extracted_faults.extend(oom_analyzer.get_faults()) return extracted_faults def process_time_out(self, bf): """ Returns a list of faults at the task level, and also a list of faults at the test level, which is populated with test faults if any are determined to have timed out. """ cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") bf['log_file_url'] = bf['task_log_file_url'] bf['name'] = 'task' if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['task_log_file_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') task_faults = [] test_faults = [] print("Checking " + log_file) analyzer = buildbaron.analyzer.timeout_file_analyzer.TimeOutAnalyzer(log_file_str) analyzer.analyze() task_faults.extend(analyzer.get_faults()) incomplete_tests = analyzer.get_incomplete_tests() if len(incomplete_tests) == 0: if len(task_faults) == 0: print("===========================") print("No faults found for task: " + self.pp.pformat(bf)) print("To Debug: python analyzer" + os.path.sep + "timeout_file_analyzer.py " + log_file) print("===========================") for incomplete_test in incomplete_tests: jira_issue = self.jira_client.get_bfg_issue(bf["issue"]) timeout_comment = ( "*" + incomplete_test["name"] + " timed out* - [Logs|" + incomplete_test["log_file"] + "]" ) try: if "bot-analyzed" not in jira_issue.fields.labels: jira_issue.update( description=jira_issue.fields.description + "\n{0}\n".format(timeout_comment)) except buildbaron.analyzer.jira_client.JIRAError as e: print("Error updating jira: " + str(e)) test_faults.extend(self.process_test(bf, incomplete_test)) return task_faults, test_faults def process_test(self, bf, test): self.create_test_cache(bf, test) cache_dir = test["cache"] log_file = os.path.join(cache_dir, "test.log") # TODO(CWS) what is this? nested_test = test for key in bf.keys(): if key != 'tests' and key != 'name': nested_test[key] = bf[key] faults = [] # If logkeeper is down, we will not have a log file :-( if test["log_file"] is not None and test["log_file"] != "" and "test/None" not in test[ "log_file"] and "log url not available" not in test["log_file"]: if not os.path.exists(log_file): buildbaron.analyzer.logkeeper.retieve_raw_log(test["log_file"], log_file) test["log_file_url"] = buildbaron.analyzer.logkeeper.get_raw_log_url( test["log_file"]) log_file_stat = os.stat(log_file) if log_file_stat[stat.ST_SIZE] > 50 * 1024 * 1024: print("Skipping Large File : " + str(log_file_stat[stat.ST_SIZE])) return [] else: test["log_file_url"] = "none" with open(log_file, "wb") as lfh: lfh.write("Logkeeper was down\n".encode()) log_file_stat = os.stat(log_file) if log_file_stat[stat.ST_SIZE] > 50 * 1024 * 1024: print("Skipping Large File : " + str(log_file_stat[stat.ST_SIZE]) + " at " + str( log_file)) return [] with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') print("Checking Log File") LFS = buildbaron.analyzer.log_file_analyzer.LogFileSplitter(log_file_str) analyzer = buildbaron.analyzer.log_file_analyzer.LogFileAnalyzer(LFS.get_streams()) analyzer.analyze() faults.extend(analyzer.get_faults()) if test["name"].startswith("basic") and test["name"].endswith(".js"): print("Anlyzing basic.js or basicPlus.js failure") parallel_analyzer = \ buildbaron.analyzer.parallel_failure_analyzer.ParallelTestFailureAnalyzer( log_file_str) parallel_analyzer.analyze() faults.extend(parallel_analyzer.get_faults()) if len(faults) == 0: print("===========================") print("No faults found for test: " + self.pp.pformat(bf)) print("To Debug: python analyzer" + os.path.sep + "log_file_analyzer.py " + log_file) print("===========================") return faults def check_for_oom_killer(self, bf): cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['system_log_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') analyzer = buildbaron.analyzer.evg_log_file_analyzer.EvgLogFileAnalyzer(log_file_str) analyzer.analyze_oom() if len(analyzer.get_faults()) > 0: return analyzer return None def query_bfg_str(start, end): # Dates should be formatted as 2017-01-25 return ('project = bfg' ' AND resolution is EMPTY' ' AND created > {createdStart}' ' AND created <= {createdEnd}' ' AND summary !~ "System Failure:"' ' ORDER BY created DESC'.format( createdStart=start.strftime("%Y-%m-%d"), createdEnd=end.strftime("%Y-%m-%d"))) def get_last_week_query(): today = datetime.date.today() # The start of build baron - if today is Wednesday, returns prior Wednesday otherwise return # prior x2 Wednesday last_wednesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(-2)) # The end of build baron last_tuesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(-1)) return query_bfg_str(last_wednesday, last_tuesday) def get_this_week_query(): today = datetime.date.today() # The start of build baron - last Wednesday (or today if today is Wednesday) next_wednesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(-1)) # The end of build baron - this Wednesday this_tuesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(2)) return query_bfg_str(next_wednesday, this_tuesday) def main(): parser = argparse.ArgumentParser(description='Analyze test failure in jira.') group = parser.add_argument_group("Jira options") group.add_argument( '--jira_server', type=str, help="Jira Server to query", default=buildbaron.analyzer.analyzer_config.jira_server()) group.add_argument( '--jira_user', type=str, help="Jira user name", default=buildbaron.analyzer.analyzer_config.jira_user()) group = parser.add_mutually_exclusive_group() group.add_argument( '--last_week', action='store_true', help="Query of Last week's build baron queue") group.add_argument( '--this_week', action='store_true', help="Query of This week's build baron queue") group.add_argument('--query_str', type=str, help="Any query against implicitly the BFG project") args = parser.parse_args() if args.query_str: query_str = "(PROJECT = BFG) AND (%s)" % args.query_str elif args.last_week: query_str = get_last_week_query() else: query_str = get_this_week_query() print("Query: %s" % query_str) # Connect to mongod print("Initializing local MongoDB server...") buildbaron.analyzer.mongo_client.reinit_db() # Connect to jira jira_client = buildbaron.analyzer.jira_client.jira_client(args.jira_server, args.jira_user) # Create our analyzer bfa = bfg_analyzer(jira_client) # Fetch desired BFG tickets bfs = bfa.query(query_str) # Analyze for failure failed_bfs = bfa.check_logs(bfs) print("Total BFs to investigate %d\n" % len(failed_bfs)) failed_bfs_root = { 'query': query_str, 'date': datetime.datetime.now().isoformat(' '), 'bfs': failed_bfs } with open("failed_bfs.json", "w", encoding="utf8") as sjh: json.dump(failed_bfs_root, sjh, indent="\t") buildbaron.analyzer.mongo_client.load_bfs(failed_bfs) if __name__ == '__main__': main()
apache-2.0
-1,692,208,233,766,159,000
34.283862
100
0.556663
false
jjscarafia/CUPS-Cloud-Print
reportissues.py
2
2412
#! /bin/sh "true" '''\' if command -v python2 > /dev/null; then exec python2 "$0" "$@" else exec python "$0" "$@" fi exit $? ''' # CUPS Cloudprint - Print via Google Cloud Print # Copyright (C) 2013 Simon Cadman # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. if __name__ == '__main__': # pragma: no cover import sys import os import subprocess libpath = "/usr/local/share/cloudprint-cups/" if not os.path.exists(libpath): libpath = "/usr/share/cloudprint-cups" sys.path.insert(0, libpath) from auth import Auth from printermanager import PrinterManager from ccputils import Utils Utils.SetupLogging() # line below is replaced on commit CCPVersion = "20140814.2 000000" Utils.ShowVersion(CCPVersion) requestors, storage = Auth.SetupAuth(True) printer_manager = PrinterManager(requestors) printers = printer_manager.getPrinters() if printers is None: print "ERROR: No Printers Found" sys.exit(1) for printer in printers: print printer.getCUPSDriverDescription() print "" print printer.getFields() print printer['capabilities'] print "\n" ppdname = printer.getPPDName() p1 = subprocess.Popen( (os.path.join(libpath, 'dynamicppd.py'), 'cat', ppdname.lstrip('-')), stdout=subprocess.PIPE) ppddata = p1.communicate()[0] p = subprocess.Popen(['cupstestppd', '-'], stdout=subprocess.PIPE, stdin=subprocess.PIPE) testdata = p.communicate(ppddata)[0] result = p.returncode print "Result of cupstestppd was " + str(result) print "".join(testdata) if result != 0: print "cupstestppd errored: " print ppddata print "\n"
gpl-3.0
-9,007,118,623,980,421,000
32.5
97
0.648425
false
gzamboni/sdnResilience
loxi/of14/queue_stats_prop.py
1
3603
# Copyright (c) 2008 The Board of Trustees of The Leland Stanford Junior University # Copyright (c) 2011, 2012 Open Networking Foundation # Copyright (c) 2012, 2013 Big Switch Networks, Inc. # See the file LICENSE.pyloxi which should have been included in the source distribution # Automatically generated by LOXI from template module.py # Do not modify import struct import loxi import util import loxi.generic_util import sys ofp = sys.modules['loxi.of14'] class queue_stats_prop(loxi.OFObject): subtypes = {} def __init__(self, type=None): if type != None: self.type = type else: self.type = 0 return def pack(self): packed = [] packed.append(struct.pack("!H", self.type)) packed.append(struct.pack("!H", 0)) # placeholder for length at index 1 length = sum([len(x) for x in packed]) packed[1] = struct.pack("!H", length) return ''.join(packed) @staticmethod def unpack(reader): subtype, = reader.peek('!H', 0) subclass = queue_stats_prop.subtypes.get(subtype) if subclass: return subclass.unpack(reader) obj = queue_stats_prop() obj.type = reader.read("!H")[0] _length = reader.read("!H")[0] orig_reader = reader reader = orig_reader.slice(_length, 4) return obj def __eq__(self, other): if type(self) != type(other): return False if self.type != other.type: return False return True def pretty_print(self, q): q.text("queue_stats_prop {") with q.group(): with q.indent(2): q.breakable() q.breakable() q.text('}') class experimenter(queue_stats_prop): subtypes = {} type = 65535 def __init__(self, experimenter=None, exp_type=None): if experimenter != None: self.experimenter = experimenter else: self.experimenter = 0 if exp_type != None: self.exp_type = exp_type else: self.exp_type = 0 return def pack(self): packed = [] packed.append(struct.pack("!H", self.type)) packed.append(struct.pack("!H", 0)) # placeholder for length at index 1 packed.append(struct.pack("!L", self.experimenter)) packed.append(struct.pack("!L", self.exp_type)) length = sum([len(x) for x in packed]) packed[1] = struct.pack("!H", length) return ''.join(packed) @staticmethod def unpack(reader): subtype, = reader.peek('!L', 4) subclass = experimenter.subtypes.get(subtype) if subclass: return subclass.unpack(reader) obj = experimenter() _type = reader.read("!H")[0] assert(_type == 65535) _length = reader.read("!H")[0] orig_reader = reader reader = orig_reader.slice(_length, 4) obj.experimenter = reader.read("!L")[0] obj.exp_type = reader.read("!L")[0] return obj def __eq__(self, other): if type(self) != type(other): return False if self.experimenter != other.experimenter: return False if self.exp_type != other.exp_type: return False return True def pretty_print(self, q): q.text("experimenter {") with q.group(): with q.indent(2): q.breakable() q.text("exp_type = "); q.text("%#x" % self.exp_type) q.breakable() q.text('}') queue_stats_prop.subtypes[65535] = experimenter
gpl-2.0
4,146,537,638,850,166,000
27.824
88
0.566472
false
googleapis/python-bigquery
samples/snippets/view_test.py
1
3789
# Copyright 2020 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import datetime import uuid from google.cloud import bigquery import pytest import view def temp_suffix(): now = datetime.datetime.now() return f"{now.strftime('%Y%m%d%H%M%S')}_{uuid.uuid4().hex[:8]}" @pytest.fixture(autouse=True) def bigquery_client_patch(monkeypatch, bigquery_client): monkeypatch.setattr(bigquery, "Client", lambda: bigquery_client) @pytest.fixture(scope="module") def view_dataset_id(bigquery_client, project_id): dataset_id = f"{project_id}.view_{temp_suffix()}" bigquery_client.create_dataset(dataset_id) yield dataset_id bigquery_client.delete_dataset(dataset_id, delete_contents=True) @pytest.fixture(scope="module") def view_id(bigquery_client, view_dataset_id): view_id = f"{view_dataset_id}.my_view" yield view_id bigquery_client.delete_table(view_id, not_found_ok=True) @pytest.fixture(scope="module") def source_dataset_id(bigquery_client, project_id): dataset_id = f"{project_id}.view_{temp_suffix()}" bigquery_client.create_dataset(dataset_id) yield dataset_id bigquery_client.delete_dataset(dataset_id, delete_contents=True) @pytest.fixture(scope="module") def source_table_id(bigquery_client, source_dataset_id): source_table_id = f"{source_dataset_id}.us_states" job_config = bigquery.LoadJobConfig( schema=[ bigquery.SchemaField("name", "STRING"), bigquery.SchemaField("post_abbr", "STRING"), ], skip_leading_rows=1, ) load_job = bigquery_client.load_table_from_uri( "gs://cloud-samples-data/bigquery/us-states/us-states.csv", source_table_id, job_config=job_config, ) load_job.result() yield source_table_id bigquery_client.delete_table(source_table_id, not_found_ok=True) def test_view(capsys, view_id, view_dataset_id, source_table_id, source_dataset_id): override_values = { "view_id": view_id, "source_id": source_table_id, } got = view.create_view(override_values) assert source_table_id in got.view_query out, _ = capsys.readouterr() assert view_id in out got = view.get_view(override_values) assert source_table_id in got.view_query assert "'W%'" in got.view_query out, _ = capsys.readouterr() assert view_id in out assert source_table_id in out assert "'W%'" in out got = view.update_view(override_values) assert source_table_id in got.view_query assert "'M%'" in got.view_query out, _ = capsys.readouterr() assert view_id in out project_id, dataset_id, table_id = view_id.split(".") override_values = { "analyst_group_email": "[email protected]", "view_dataset_id": view_dataset_id, "source_dataset_id": source_dataset_id, "view_reference": { "projectId": project_id, "datasetId": dataset_id, "tableId": table_id, }, } view_dataset, source_dataset = view.grant_access(override_values) assert len(view_dataset.access_entries) != 0 assert len(source_dataset.access_entries) != 0 out, _ = capsys.readouterr() assert "[email protected]" in out assert table_id in out
apache-2.0
-6,257,050,349,015,454,000
31.384615
84
0.676432
false
virtualopensystems/nova
nova/virt/hyperv/driver.py
1
9838
# Copyright (c) 2010 Cloud.com, Inc # Copyright (c) 2012 Cloudbase Solutions Srl # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ A Hyper-V Nova Compute driver. """ from nova.i18n import _ from nova.openstack.common import log as logging from nova.virt import driver from nova.virt.hyperv import hostops from nova.virt.hyperv import livemigrationops from nova.virt.hyperv import migrationops from nova.virt.hyperv import rdpconsoleops from nova.virt.hyperv import snapshotops from nova.virt.hyperv import vmops from nova.virt.hyperv import volumeops LOG = logging.getLogger(__name__) class HyperVDriver(driver.ComputeDriver): def __init__(self, virtapi): super(HyperVDriver, self).__init__(virtapi) self._hostops = hostops.HostOps() self._volumeops = volumeops.VolumeOps() self._vmops = vmops.VMOps() self._snapshotops = snapshotops.SnapshotOps() self._livemigrationops = livemigrationops.LiveMigrationOps() self._migrationops = migrationops.MigrationOps() self._rdpconsoleops = rdpconsoleops.RDPConsoleOps() def init_host(self, host): pass def list_instances(self): return self._vmops.list_instances() def spawn(self, context, instance, image_meta, injected_files, admin_password, network_info=None, block_device_info=None): self._vmops.spawn(context, instance, image_meta, injected_files, admin_password, network_info, block_device_info) def reboot(self, context, instance, network_info, reboot_type, block_device_info=None, bad_volumes_callback=None): self._vmops.reboot(instance, network_info, reboot_type) def destroy(self, context, instance, network_info, block_device_info=None, destroy_disks=True, migrate_data=None): self._vmops.destroy(instance, network_info, block_device_info, destroy_disks) def cleanup(self, context, instance, network_info, block_device_info=None, destroy_disks=True, migrate_data=None, destroy_vifs=True): """Cleanup after instance being destroyed by Hypervisor.""" pass def get_info(self, instance): return self._vmops.get_info(instance) def attach_volume(self, context, connection_info, instance, mountpoint, disk_bus=None, device_type=None, encryption=None): return self._volumeops.attach_volume(connection_info, instance['name']) def detach_volume(self, connection_info, instance, mountpoint, encryption=None): return self._volumeops.detach_volume(connection_info, instance['name']) def get_volume_connector(self, instance): return self._volumeops.get_volume_connector(instance) def get_available_resource(self, nodename): return self._hostops.get_available_resource() def get_host_stats(self, refresh=False): return self._hostops.get_host_stats(refresh) def host_power_action(self, host, action): return self._hostops.host_power_action(host, action) def snapshot(self, context, instance, image_id, update_task_state): self._snapshotops.snapshot(context, instance, image_id, update_task_state) def pause(self, instance): self._vmops.pause(instance) def unpause(self, instance): self._vmops.unpause(instance) def suspend(self, instance): self._vmops.suspend(instance) def resume(self, context, instance, network_info, block_device_info=None): self._vmops.resume(instance) def power_off(self, instance, timeout=0, retry_interval=0): # TODO(PhilDay): Add support for timeout (clean shutdown) self._vmops.power_off(instance) def power_on(self, context, instance, network_info, block_device_info=None): self._vmops.power_on(instance) def live_migration(self, context, instance, dest, post_method, recover_method, block_migration=False, migrate_data=None): self._livemigrationops.live_migration(context, instance, dest, post_method, recover_method, block_migration, migrate_data) def rollback_live_migration_at_destination(self, context, instance, network_info, block_device_info, destroy_disks=True, migrate_data=None): self.destroy(context, instance, network_info, block_device_info) def pre_live_migration(self, context, instance, block_device_info, network_info, disk_info, migrate_data=None): self._livemigrationops.pre_live_migration(context, instance, block_device_info, network_info) def post_live_migration_at_destination(self, context, instance, network_info, block_migration=False, block_device_info=None): self._livemigrationops.post_live_migration_at_destination( context, instance, network_info, block_migration) def check_can_live_migrate_destination(self, context, instance, src_compute_info, dst_compute_info, block_migration=False, disk_over_commit=False): return self._livemigrationops.check_can_live_migrate_destination( context, instance, src_compute_info, dst_compute_info, block_migration, disk_over_commit) def check_can_live_migrate_destination_cleanup(self, context, dest_check_data): self._livemigrationops.check_can_live_migrate_destination_cleanup( context, dest_check_data) def check_can_live_migrate_source(self, context, instance, dest_check_data): return self._livemigrationops.check_can_live_migrate_source( context, instance, dest_check_data) def get_instance_disk_info(self, instance_name, block_device_info=None): pass def plug_vifs(self, instance, network_info): """Plug VIFs into networks.""" msg = _("VIF plugging is not supported by the Hyper-V driver.") raise NotImplementedError(msg) def unplug_vifs(self, instance, network_info): """Unplug VIFs from networks.""" msg = _("VIF unplugging is not supported by the Hyper-V driver.") raise NotImplementedError(msg) def ensure_filtering_rules_for_instance(self, instance, network_info): LOG.debug("ensure_filtering_rules_for_instance called", instance=instance) def unfilter_instance(self, instance, network_info): LOG.debug("unfilter_instance called", instance=instance) def migrate_disk_and_power_off(self, context, instance, dest, flavor, network_info, block_device_info=None, timeout=0, retry_interval=0): # TODO(PhilDay): Add support for timeout (clean shutdown) return self._migrationops.migrate_disk_and_power_off(context, instance, dest, flavor, network_info, block_device_info) def confirm_migration(self, migration, instance, network_info): self._migrationops.confirm_migration(migration, instance, network_info) def finish_revert_migration(self, context, instance, network_info, block_device_info=None, power_on=True): self._migrationops.finish_revert_migration(context, instance, network_info, block_device_info, power_on) def finish_migration(self, context, migration, instance, disk_info, network_info, image_meta, resize_instance, block_device_info=None, power_on=True): self._migrationops.finish_migration(context, migration, instance, disk_info, network_info, image_meta, resize_instance, block_device_info, power_on) def get_host_ip_addr(self): return self._hostops.get_host_ip_addr() def get_host_uptime(self, host): return self._hostops.get_host_uptime() def get_rdp_console(self, context, instance): return self._rdpconsoleops.get_rdp_console(instance)
apache-2.0
4,809,147,517,281,367,000
43.116592
79
0.582639
false
MediaMath/qasino
lib/zmq_requestor.py
1
2310
# Copyright (C) 2014 MediaMath, Inc. <http://www.mediamath.com> # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from txzmq import ZmqFactory, ZmqEndpoint, ZmqEndpointType, ZmqREQConnection import logging import json from util import Identity class ZmqRequestor(ZmqREQConnection): def __init__(self, remote_host, port, zmq_factory, data_manager=None): self.data_manager = data_manager self.remote_host = remote_host endpoint = ZmqEndpoint(ZmqEndpointType.connect, "tcp://%s:%d" % (remote_host, port)) ZmqREQConnection.__init__(self, zmq_factory, endpoint) def request_metadata(self): msg = { "op" : "get_table_list", "identity" : Identity.get_identity() } #logging.info("ZmqRequestor: Requesting table list from %s.", self.remote_host) deferred = self.sendMsg(json.dumps(msg)) deferred.callback = self.message_received def send_table(self, table): deferred = self.sendMsg(table.get_json(op="add_table_data", identity=Identity.get_identity())) deferred.callback = self.message_received def message_received(self, msg): response_meta = json.loads(msg[0]) if response_meta == None or response_meta["response_op"] == None: logging.error("ZmqRequestor: bad message response received") elif response_meta["response_op"] == "tables_list": logging.info("ZmqRequestor: Table list response: %s", json.loads(msg[1])) elif response_meta["response_op"] == "ok": logging.info("ZmqRequestor: request OK") elif response_meta["response_op"] == "error": logging.info("ZmqRequestor: request ERROR: " + response_meta["error_message"]) else: logging.error("ZmqRequestor: unknown response: ", response_meta)
apache-2.0
5,312,493,586,066,515,000
38.827586
102
0.679654
false
scionrep/scioncc
src/pyon/util/containers.py
1
14330
""" General purpose util classes and functions """ __author__ = 'Adam R. Smith, Michael Meisinger' import collections import datetime import importlib import string import time import simplejson import base64 import uuid import os import re from types import NoneType from copy import deepcopy DICT_LOCKING_ATTR = "__locked__" class DotNotationGetItem(object): """ Drive the behavior for DotList and DotDict lookups by dot notation, JSON-style. """ def _convert(self, val): """ Convert the type if necessary and return if a conversion happened. """ if isinstance(val, dict) and not isinstance(val, DotDict): return DotDict(val), True elif isinstance(val, list) and not isinstance(val, DotList): return DotList(val), True return val, False def __getitem__(self, key): val = super(DotNotationGetItem, self).__getitem__(key) val, converted = self._convert(val) if converted: self[key] = val return val def __contains__(self, item): return hasattr(self, item) class DotList(DotNotationGetItem, list): """ Partner class for DotDict; see that for docs. Both are needed to fully support JSON/YAML blocks. """ #def DotListIterator(list.) def __iter__(self): """ Monkey-patch the "next" iterator method to return modified versions. This will be slow. """ #it = super(DotList, self).__iter__() #it_next = getattr(it, 'next') #setattr(it, 'next', lambda: it_next(it)) #return it for val in super(DotList, self).__iter__(): val, converted = self._convert(val) yield val class DotDict(DotNotationGetItem, dict): """ Subclass of dict that will recursively look up attributes with dot notation. This is primarily for working with JSON-style data in a cleaner way like javascript. Note that this will instantiate a number of child DotDicts when you first access attributes; do not use in performance-critical parts of your code. """ def __dir__(self): return [k for k in self.__dict__.keys() + self.keys() if k != DICT_LOCKING_ATTR] def __getattr__(self, key): """ Make attempts to lookup by nonexistent attributes also attempt key lookups. """ if self.has_key(key): return self[key] if not self.__dict__.has_key(DICT_LOCKING_ATTR): import sys import dis frame = sys._getframe(1) if '\x00%c' % dis.opmap['STORE_ATTR'] in frame.f_code.co_code: self[key] = DotDict() return self[key] raise AttributeError(key) def __setattr__(self, key, value): if key in dir(dict): raise AttributeError('%s conflicts with builtin.' % key) if self.__dict__.has_key(DICT_LOCKING_ATTR): raise AttributeError('Setting %s on a locked DotDict' % key) if isinstance(value, dict): self[key] = DotDict(value) else: self[key] = value def copy(self): return deepcopy(self) def get_safe(self, qual_key, default=None): """ @brief Returns value of qualified key, such as "system.name" or None if not exists. If default is given, returns the default. No exception thrown. """ value = get_safe(self, qual_key) if value is None: value = default return value def lock(self): self.__dict__[DICT_LOCKING_ATTR] = True def clear(self): if self.__dict__.has_key(DICT_LOCKING_ATTR): del self.__dict__[DICT_LOCKING_ATTR] super(DotDict, self).clear() def pop(self, *args, **kwargs): if self.__dict__.has_key(DICT_LOCKING_ATTR): raise AttributeError('Cannot pop on a locked DotDict') return super(DotDict, self).pop(*args, **kwargs) def popitem(self): if self.__dict__.has_key(DICT_LOCKING_ATTR): raise AttributeError('Cannot popitem on a locked DotDict') return super(DotDict, self).popitem() def as_dict(self): return simple_deepcopy(self) @classmethod def fromkeys(cls, seq, value=None): return DotDict(dict.fromkeys(seq, value)) class DictDiffer(object): """ Calculate the difference between two dictionaries as: (1) items added (2) items removed (3) keys same in both but changed values (4) keys same in both and unchanged values """ def __init__(self, current_dict, past_dict): self.current_dict, self.past_dict = current_dict, past_dict self.set_current, self.set_past = set(current_dict.keys()), set(past_dict.keys()) self.intersect = self.set_current.intersection(self.set_past) def added(self): return self.set_current - self.intersect def removed(self): return self.set_past - self.intersect def changed(self): return set(o for o in self.intersect if self.past_dict[o] != self.current_dict[o]) def unchanged(self): return set(o for o in self.intersect if self.past_dict[o] == self.current_dict[o]) def simple_deepcopy(coll): """ Performs a recursive deep copy on given collection, only using dict, list and set collection types and not checking for cycles. """ if isinstance(coll, dict): return {k: simple_deepcopy(v) for k, v in coll.iteritems()} elif isinstance(coll, set): return {simple_deepcopy(v) for v in coll} elif hasattr(coll, "__iter__"): return [simple_deepcopy(v) for v in coll] else: return coll # dict_merge from: http://appdelegateinc.com/blog/2011/01/12/merge-deeply-nested-dicts-in-python/ def quacks_like_dict(object): """ Check if object is dict-like """ return isinstance(object, collections.Mapping) def dict_merge(base, upd, inplace=False): """ Merge two deep dicts non-destructively. Uses a stack to avoid maximum recursion depth exceptions. @param base the dict to merge into @param upd the content to merge @param inplace change base if True, otherwise deepcopy base @retval the merged dict (base if inplace else a merged deepcopy) """ assert quacks_like_dict(base), quacks_like_dict(upd) dst = base if inplace else deepcopy(base) stack = [(dst, upd)] while stack: current_dst, current_src = stack.pop() for key in current_src: if key not in current_dst: current_dst[key] = current_src[key] else: if quacks_like_dict(current_src[key]) and quacks_like_dict(current_dst[key]) : stack.append((current_dst[key], current_src[key])) else: current_dst[key] = current_src[key] return dst def get_safe(dict_instance, keypath, default=None): """ Returns a value with in a nested dict structure from a dot separated path expression such as "system.server.host" or a list of key entries @retval Value if found or None """ try: obj = dict_instance keylist = keypath if type(keypath) is list else keypath.split('.') for key in keylist: obj = obj[key] return obj except Exception as ex: return default def named_any(name): """ Retrieve a Python object by its fully qualified name from the global Python module namespace. The first part of the name, that describes a module, will be discovered and imported. Each subsequent part of the name is treated as the name of an attribute of the object specified by all of the name which came before it. @param name: The name of the object to return. @return: the Python object identified by 'name'. """ if not name: raise Exception("Empty module name") names = name.split('.') module = None mod_mames = names[:] obj_names = [] while not module: if mod_mames: trialname = '.'.join(mod_mames) try: module = importlib.import_module(trialname) except Exception as ex: obj_names.append(mod_mames.pop()) else: if len(names) == 1: raise Exception("No module named %r" % (name,)) else: raise Exception('%r does not name an object' % (name,)) obj = module for n in reversed(obj_names): obj = getattr(obj, n) return obj def for_name(modpath, classname): """ Returns a class of "classname" from module "modname". """ module = __import__(modpath, fromlist=[classname]) classobj = getattr(module, classname) return classobj() def current_time_millis(): return int(round(time.time() * 1000)) get_ion_ts_millis = current_time_millis def get_ion_ts(): """ Returns standard ION representation of a global timestamp. It is defined as a str representing an integer number, the millis in UNIX epoch, which started 1970-01-01 midnight UTC """ return str(current_time_millis()) def get_datetime(ts, local_time=True): """ Returns a naive datetime object in either local time or UTC time based on the given ION timestamp @param ts ION timestamp (str with millis in epoch) @param local_time if True, returns local time (default), otherwise UTC @retval datetime instance, naive """ tsf = float(ts) / 1000 return datetime.datetime.fromtimestamp(tsf) if local_time else datetime.datetime.utcfromtimestamp(tsf) def get_datetime_str(ts, show_millis=False, local_time=True): """ Returns a string with date and time representation from an ION timestamp @param ts ION timestamp (str with millis in epoch) @param show_millis If True, appends the milli seconds @param local_time if True, returns local time (default), otherwise UTC @retval str with ION standard date and time representation """ dt = get_datetime(ts, local_time) dts = str(dt) period_idx = dts.rfind(".") if period_idx != -1: dts = dts[:period_idx+4] if show_millis else dts[:period_idx] return dts def parse_ion_ts(ts): """ Returns a Python timestamp from an ION ts """ return float(ts) / 1000 def is_valid_ts(ts): """ Check if given ts is string with only digits and length of 13 """ # We assume no timestamps before 2001-09 return isinstance(ts, basestring) and len(ts) == 13 and ts.isdigit() and ts[0] != "0" def itersubclasses(cls, _seen=None): """ itersubclasses(cls) http://code.activestate.com/recipes/576949-find-all-subclasses-of-a-given-class/ Generator over all subclasses of a given class, in depth first order. """ if not isinstance(cls, type): raise TypeError('itersubclasses must be called with ' 'new-style classes, not %.100r' % cls) if _seen is None: _seen = set() try: subs = cls.__subclasses__() except TypeError: # fails only when cls is type subs = cls.__subclasses__(cls) for sub in subs: if sub not in _seen: _seen.add(sub) yield sub for sub in itersubclasses(sub, _seen): yield sub def getleafsubclasses(cls): """ Returns all subclasses that have no further subclasses, for the given class """ scls = itersubclasses(cls) return [s for s in scls if not s.__subclasses__()] # _abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789 BASIC_VALID = "_%s%s" % (string.ascii_letters, string.digits) # -_.()abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789 NORMAL_VALID = "-_.() %s%s" % (string.ascii_letters, string.digits) def create_valid_identifier(name, valid_chars=BASIC_VALID, dot_sub=None, ws_sub=None): if dot_sub: name = name.replace('.', dot_sub) if ws_sub: name = name.replace(' ', ws_sub) return str(''.join(c for c in name if c in valid_chars)) def create_basic_identifier(name): return create_valid_identifier(name, dot_sub='_', ws_sub='_') def is_basic_identifier(name): return name == create_basic_identifier(name) def is_valid_identifier(name, valid_chars=BASIC_VALID, dot_sub=None, ws_sub=None): return name == create_valid_identifier(name, valid_chars=valid_chars, dot_sub=dot_sub, ws_sub=ws_sub) #Used by json encoder def ion_object_encoder(obj): return obj.__dict__ def make_json(data): result = simplejson.dumps(data, default=ion_object_encoder, indent=2) return result #Global utility functions for generating unique names and UUIDs # get a UUID - URL safe, Base64 def get_a_Uuid(): r_uuid = base64.urlsafe_b64encode(uuid.uuid4().bytes) return r_uuid.replace('=', '') # generate a unique identifier based on a UUID and optional information def create_unique_identifier(prefix=''): return prefix + '_' + get_a_Uuid() def get_default_sysname(): return 'ion_%s' % os.uname()[1].replace('.', '_') def get_default_container_id(): return string.replace('%s_%d' % (os.uname()[1], os.getpid()), ".", "_") BASIC_TYPE_SET = {str, bool, int, float, long, NoneType} def recursive_encode(obj, encoding="utf8"): """Recursively walks a dict/list collection and in-place encodes any unicode keys and values in dicts and lists to UTF-8 encoded str""" if isinstance(obj, dict): fix_list = None for k, v in obj.iteritems(): if type(k) is unicode: if fix_list is None: fix_list = [] fix_list.append(k) if type(v) in BASIC_TYPE_SET: continue if type(v) is unicode: obj[k] = v.encode(encoding) continue recursive_encode(v, encoding=encoding) if fix_list: for k in fix_list: v = obj.pop(k) newk = k.encode(encoding) obj[newk] = v elif isinstance(obj, list): for i, v in enumerate(obj): if type(v) in BASIC_TYPE_SET: continue if type(v) is unicode: obj[i] = v.encode(encoding) continue recursive_encode(v, encoding=encoding) else: raise RuntimeError("unknown type: %s" % type(obj)) return obj
bsd-2-clause
2,506,083,733,855,044,600
33.200477
108
0.625611
false
uweschmitt/emzed
libms/WebserviceClients/Metlin.py
1
3159
import pdb #encoding:latin-1 import requests import urllib2 import userConfig from collections import OrderedDict from ..DataStructures.Table import Table class MetlinMatcher(object): ws_col_names = [ "formula", "mass", "name", "molid"] ws_col_types = [ str, float, str, int] ws_col_formats = [ "%s", "%.5f", "%s", "%d" ] url = "http://metlin.scripps.edu/REST/search/index.php" info_url = "http://metlin.scripps.edu/metabo_info.php?molid=%d" batch_size = 90 # should be 500 as metlin promises, but this is false # the REST webserive of METLIN returns a result set which does not explain # which combination of theoretical mass and adduct results in a match, # which is not what we want. eg one gets the same result set for # masses=[195.0877, 194.07904], adducts=["M"] and for masses=[195.0877], # adducts = ["M", "M+H"] # so we start a separate query for mass and each adduct ! @staticmethod def _query(masses, adduct, ppm): token = userConfig.getMetlinToken() if not token: raise Exception("need metlin token in user config file") params = OrderedDict() params["token"] = token # "DqeN7qBNEAzVNm9n" params["mass[]"] = masses params["adduct[]"] = [adduct] params["tolunits"] = "ppm" params["tolerance"] = ppm r = requests.get(MetlinMatcher.url, params=params) if r.status_code != 200: raise Exception("matlin query %s failed: %s" % (urllib2.unquote(r.url), r.text)) try: j = r.json() except: raise Exception("invalid answer from %s" % r.url) ws_col_names = MetlinMatcher.ws_col_names ws_col_types = MetlinMatcher.ws_col_types ws_col_formats = MetlinMatcher.ws_col_formats info_url = MetlinMatcher.info_url tables = [] for m_z, ji in zip(masses, j): rows = [] if isinstance(ji, dict): ji = ji.values() for jii in ji: if jii: rows.append([t(jii[n])\ for t, n in zip(ws_col_types, ws_col_names)]) if rows: ti = Table(ws_col_names, ws_col_types, ws_col_formats, rows[:]) ti.addColumn("m_z", m_z, insertBefore=0) ti.addColumn("adduct", adduct, insertBefore=1) ti.addColumn("link", ti.molid.apply(lambda d: info_url % d)) tables.append(ti) return tables @staticmethod def query(masses, adducts, ppm): all_tables = [] for adduct in adducts: for i0 in range(0, len(masses), MetlinMatcher.batch_size): mass_slice = masses[i0:i0 + MetlinMatcher.batch_size] tables = MetlinMatcher._query(mass_slice, adduct, ppm) all_tables.extend(tables) result_table = all_tables[0] result_table.append(all_tables[1:]) return result_table if 0: t = MetlinMatcher.query(["282.222813", "292.229272"], 50, "-") t.info() t._print()
gpl-3.0
-3,001,720,266,134,262,300
32.967742
79
0.566318
false
KatiRG/flyingpigeon
flyingpigeon/processes/wps_subset_continents.py
1
5476
import os import tarfile from flyingpigeon.subset import clipping from flyingpigeon.subset import _CONTINENTS_ from pywps.Process import WPSProcess from flyingpigeon.log import init_process_logger import logging logger = logging.getLogger(__name__) class subset_continentsProcess(WPSProcess): def __init__(self): WPSProcess.__init__( self, identifier="subset_continents", title="Subset continents", version="0.9", abstract="Returns only the selected polygon for each input dataset", metadata=[ {"title": "LSCE", "href": "http://www.lsce.ipsl.fr/en/index.php"}, {"title": "Documentation", "href": "http://flyingpigeon.readthedocs.io/en/latest/"}, ], statusSupported=True, storeSupported=True ) self.resource = self.addComplexInput( identifier="resource", title="Resource", abstract="NetCDF Files or archive (tar/zip) containing netCDF files", minOccurs=1, maxOccurs=1000, maxmegabites=5000, formats=[{"mimeType": "application/x-netcdf"}, {"mimeType": "application/x-tar"}, {"mimeType": "application/zip"}], ) self.region = self.addLiteralInput( identifier="region", title="Region", default='Africa', type=type(''), minOccurs=1, maxOccurs=len(_CONTINENTS_), allowedValues=_CONTINENTS_ # REGION_EUROPE #COUNTRIES # ) # self.dimension_map = self.addLiteralInput( # identifier="dimension_map", # title="Dimension Map", # abstract= 'if not ordered in lon/lat a dimension map has to be provided', # type=type(''), # minOccurs=0, # maxOccurs=1 # ) self.mosaic = self.addLiteralInput( identifier="mosaic", title="Mosaic", abstract="If Mosaic is checked, selected polygons will be merged to one Mosaic for each input file", default=False, type=type(False), minOccurs=0, maxOccurs=1, ) # self.variable = self.addLiteralInput( # identifier="variable", # title="Variable", # abstract="Variable to be expected in the input files (Variable will be detected if not set)", # default=None, # type=type(''), # minOccurs=0, # maxOccurs=1, # ) self.output = self.addComplexOutput( title="Subsets", abstract="Tar archive containing the netCDF files", formats=[{"mimeType": "application/x-tar"}], asReference=True, identifier="output", ) self.output_netcdf = self.addComplexOutput( title="Subsets for one dataset", abstract="NetCDF file with subsets of one dataset.", formats=[{"mimeType": "application/x-netcdf"}], asReference=True, identifier="ncout", ) self.output_log = self.addComplexOutput( identifier="output_log", title="Logging information", abstract="Collected logs during process run.", formats=[{"mimeType": "text/plain"}], asReference=True, ) def execute(self): from ast import literal_eval from flyingpigeon.utils import archive, archiveextract init_process_logger('log.txt') self.output_log.setValue('log.txt') ncs = archiveextract(self.getInputValues(identifier='resource')) mosaic = self.mosaic.getValue() regions = self.region.getValue() # variable = self.variable.getValue() # logger.info('regions: %s' % regions) # dimension_map = self.dimension_map.getValue() # if dimension_map != None: # dimension_map = literal_eval(dimension_map) logger.info('ncs = %s', ncs) logger.info('regions = %s', regions) logger.info('mosaic = %s', mosaic) # logger.info('dimension_map = %s', dimension_map) self.status.set('Arguments set for subset process', 10) logger.debug('starting: regions=%s, num_files=%s' % (len(regions), len(ncs))) try: results = clipping( resource=ncs, polygons=regions, # self.region.getValue(), mosaic=mosaic, spatial_wrapping='wrap', # variable=variable, dir_output=os.path.abspath(os.curdir), # dimension_map=dimension_map, ) except Exception as e: msg = 'clipping failed' logger.exception(msg) raise Exception(msg) if not results: raise Exception('no results produced.') # prepare tar file try: tarf = archive(results) logger.info('Tar file prepared') except Exception as e: msg = 'Tar file preparation failed' logger.exception(msg) raise Exception(msg) self.output.setValue(tarf) i = next((i for i, x in enumerate(results) if x), None) self.output_netcdf.setValue(results[i]) self.status.set('done', 100)
apache-2.0
-3,787,420,159,431,396,400
33.658228
112
0.546567
false
dthain/cctools
chirp/src/bindings/python3/chirp.binding.py
1
22700
## @package ChirpPython # # Python Chirp bindings. # # The objects and methods provided by this package correspond to the native # C API in @ref chirp_reli.h and chirp_swig_wrap.h # # The SWIG-based Python bindings provide a higher-level interface that # revolves around: # # - @ref Chirp.Client # - @ref Chirp.Stat import os import time import json ## # \class Chirp.Client # Python Client object # # This class is used to create a chirp client class Client(object): ## # Create a new chirp client # # @param self Reference to the current task object. # @param hostport The host:port of the server. # @param timeout The time to wait for a server response on every request. # @param authentication A list of prefered authentications. E.g., ['tickets', 'unix'] # @param tickets A list of ticket filenames. # @param debug Generate client debug output. def __init__(self, hostport, timeout=60, authentication=None, tickets=None, debug=False): self.hostport = hostport self.timeout = timeout if debug: cctools_debug_config('chirp_python_client') cctools_debug_flags_set('chirp') if tickets and (authentication is None): authentication = ['ticket'] self.__set_tickets(tickets) if authentication is None: auth_register_all() else: for auth in authentication: auth_register_byname(auth) self.identity = self.whoami() if self.identity == '': raise AuthenticationFailure(authentication) def __exit__(self, exception_type, exception_value, traceback): chirp_reli_disconnect(self.hostport) def __del__(self): chirp_reli_disconnect(self.hostport) def __stoptime(self, absolute_stop_time=None, timeout=None): if timeout is None: timeout = self.timeout if absolute_stop_time is None: absolute_stop_time = time.time() + timeout return absolute_stop_time def __set_tickets(self, tickets): tickets_str = None if tickets is None: try: tickets_str = os.environ['CHIRP_CLIENT_TICKETS'] except KeyError: tickets_str = None else: tickets_str = ','.join(tickets) if tickets_str is not None: auth_ticket_load(tickets_str) ## # Returns a string with identity of the client according to the server. # # @param self Reference to the current task object. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def whoami(self, absolute_stop_time=None, timeout=None): return chirp_wrap_whoami(self.hostport, self.__stoptime(absolute_stop_time, timeout)) ## # Returns a string with the ACL of the given directory. # Throws an IOError on error (no such directory). # # @param self Reference to the current task object. # @param path Target directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def listacl(self, path='/', absolute_stop_time=None, timeout=None): acls = chirp_wrap_listacl(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) if acls is None: raise IOError(path) return acls.split('\n') ## # Returns a string with the ACL of the given directory. # Throws a GeneralError on error. # # @param self Reference to the current task object. # @param path Target directory. # @param subject Target subject. # @param rights Permissions to be granted. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def setacl(self, path, subject, rights, absolute_stop_time=None, timeout=None): result = chirp_reli_setacl(self.hostport, path, subject, rights, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise GeneralFailure('setacl', result, [path, subject, rights]) return result ## # Set the ACL for the given directory to be only for the rights to the calling user. # Throws a GeneralError on error. # # @param self Reference to the current task object. # @param path Target directory. # @param rights Permissions to be granted. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def resetacl(self, path, rights, absolute_stop_time=None, timeout=None): result = chirp_wrap_resetacl(self.hostport, path, rights, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise GeneralFailure('resetacl', result, [path, rights]) return result ## # Returns a list with the names of the files in the path. # Throws an IOError on error (no such directory). # # @param self Reference to the current task object. # @param path Target file/directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def ls(self, path, absolute_stop_time=None, timeout=None): dr = chirp_reli_opendir(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) files = [] if dir is None: raise IOError(path) while True: d = chirp_reli_readdir(dr) if d is None: break files.append(Stat(d.name, d.info)) return files ## # Returns a Chirp.Stat object with information on path. # Throws an IOError on error (e.g., no such path or insufficient permissions). # # @param self Reference to the current task object. # @param path Target file/directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def stat(self, path, absolute_stop_time=None, timeout=None): info = chirp_wrap_stat(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) if info is None: raise IOError(path) return Stat(path, info) ## # Changes permissions on path. # Throws a GeneralFailure on error (e.g., no such path or insufficient permissions). # # @param self Reference to the current task object. # @param path Target file/directory. # @param mode Desired permissions (e.g., 0755) # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def chmod(self, path, mode, absolute_stop_time=None, timeout=None): result = chirp_reli_chmod(self.hostport, path, mode, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise GeneralFailure('chmod', result, [path, mode]) return result ## # Copies local file/directory source to the chirp server as file/directory destination. # If destination is not given, source name is used. # Raises Chirp.TransferFailure on error. # # @param self Reference to the current task object. # @param source A local file or directory. # @param destination File or directory name to use in the server (defaults to source). # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def put(self, source, destination=None, absolute_stop_time=None, timeout=None): if destination is None: destination = source result = chirp_recursive_put(self.hostport, source, destination, self.__stoptime(absolute_stop_time, timeout)) if result > -1: return result raise TransferFailure('put', result, source, destination) ## # Copies server file/directory source to the local file/directory destination. # If destination is not given, source name is used. # Raises Chirp.TransferFailure on error. # # @param self Reference to the current task object. # @param source A server file or directory. # @param destination File or directory name to be used locally (defaults to source). # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def get(self, source, destination=None, absolute_stop_time=None, timeout=None): if destination is None: destination = source result = chirp_recursive_get(self.hostport, source, destination, self.__stoptime(absolute_stop_time, timeout)) if result > -1: return result raise TransferFailure('get', result, source, destination) ## # Removes the given file or directory from the server. # Raises OSError on error. # # @param self Reference to the current task object. # @param path Target file/directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def rm(self, path, absolute_stop_time=None, timeout=None): status = chirp_reli_rmall(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) if status < 0: raise OSError ## # Recursively create the directories in path. # Raises OSError on error. # # @param self Reference to the current task object. # @param path Target file/directory. # @param mode Unix permissions for the created directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def mkdir(self, path, mode=493, absolute_stop_time=None, timeout=None): result = chirp_reli_mkdir_recursive(self.hostport, path, mode, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise OSError return result ## # Computes the checksum of path. # Raises IOError on error. # # @param self Reference to the current task object. # @param path Target file. # @param algorithm One of 'md5' or 'sha1' (default). # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def hash(self, path, algorithm='sha1', absolute_stop_time=None, timeout=None): hash_hex = chirp_wrap_hash(self.hostport, path, algorithm, self.__stoptime(absolute_stop_time, timeout)) if hash_hex is None: raise IOError return hash_hex ## # Creates a chirp job. See http://ccl.cse.nd.edu/software/manuals/chirp.html for details. # # @param job_description A dictionary with a job chirp description. # # @code # job_description = { # 'executable': "/bin/tar", # 'arguments': [ 'tar', '-cf', 'archive.tar', 'a', 'b' ], # 'files': { 'task_path': 'a', # 'serv_path': '/users/magrat/a.txt' # 'type': 'INPUT' }, # { 'task_path': 'b', # 'serv_path': '/users/magrat/b.txt' # 'type': 'INPUT' }, # { 'task_path': 'archive.tar', # 'serv_path': '/users/magrat/archive.tar' # 'type': 'OUTPUT' } # } # job_id = client.job_create(job_description); # @endcode def job_create(self, job_description): job_json = json.dumps(job_description) job_id = chirp_wrap_job_create(self.hostport, job_json, self.__stoptime()) if job_id < 0: raise ChirpJobError('create', job_id, job_json) return job_id ## # Kills the jobs identified with the different job ids. # # @param job_ids Job ids of the chirp jobs to be killed. # def job_kill(self, *job_ids): ids_str = json.dumps(job_ids) result = chirp_wrap_job_kill(self.hostport, ids_str, self.__stoptime()) if result < 0: raise ChirpJobError('kill', result, ids_str) return result ## # Commits (starts running) the jobs identified with the different job ids. # # @param job_ids Job ids of the chirp jobs to be committed. # def job_commit(self, *job_ids): ids_str = json.dumps(job_ids) result = chirp_wrap_job_commit(self.hostport, ids_str, self.__stoptime()) if result < 0: raise ChirpJobError('commit', result, ids_str) return result ## # Reaps the jobs identified with the different job ids. # # @param job_ids Job ids of the chirp jobs to be reaped. # def job_reap(self, *job_ids): ids_str = json.dumps(job_ids) result = chirp_wrap_job_reap(self.hostport, ids_str, self.__stoptime()) if result < 0: raise ChirpJobError('reap', result, ids_str) return result ## # Obtains the current status for each job id. The value returned is a # list which contains a dictionary reference per job id. # # @param job_ids Job ids of the chirp jobs to be reaped. # def job_status(self, *job_ids): ids_str = json.dumps(job_ids) status = chirp_wrap_job_status(self.hostport, ids_str, self.__stoptime()) if status is None: raise ChirpJobError('status', None, ids_str) return json.loads(status) ## # Waits waiting_time seconds for the job_id to terminate. Return value is # the same as job_status. If the call timesout, an empty string is # returned. If job_id is missing, `<job_wait>` waits for any of the user's job. # # @param waiting_time maximum number of seconds to wait for a job to finish. # @param job_id id of the job to wait. def job_wait(self, waiting_time, job_id=0): status = chirp_wrap_job_wait(self.hostport, job_id, waiting_time, self.__stoptime()) if status is None: raise ChirpJobError('status', None, job_id) return json.loads(status) ## # Python Stat object # # This class is used to record stat information for files/directories of a chirp server. class Stat(object): def __init__(self, path, cstat): self._path = path self._info = cstat ## # Target path. # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.path # @endcode @property def path(self): return self._path ## # ID of device containing file. # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.device # @endcode @property def device(self): return self._info.cst_dev ## # inode number # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.inode # @endcode @property def inode(self): return self._info.cst_ino ## # file mode permissions # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.mode # @endcode @property def mode(self): return self._info.cst_mode ## # number of hard links # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.nlink # @endcode @property def nlink(self): return self._info.cst_nlink ## # user ID of owner # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.uid # @endcode @property def uid(self): return self._info.cst_uid ## # group ID of owner # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.gid # @endcode @property def gid(self): return self._info.cst_gid ## # device ID if special file # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.rdev # @endcode @property def rdev(self): return self._info.cst_rdev ## # total size, in bytes # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.size # @endcode @property def size(self): return self._info.cst_size ## # block size for file system I/O # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.block_size # @endcode @property def block_size(self): return self._info.cst_blksize ## # number of 512B blocks allocated # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.blocks # @endcode @property def blocks(self): return self._info.cst_blocks ## # number of seconds since epoch since last access # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.atime # @endcode @property def atime(self): return self._info.cst_atime ## # number of seconds since epoch since last modification # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.mtime # @endcode @property def mtime(self): return self._info.cst_mtime ## # number of seconds since epoch since last status change # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.ctime # @endcode @property def ctime(self): return self._info.cst_ctime def __repr__(self): return "%s uid:%d gid:%d size:%d" % (self.path, self.uid, self.gid, self.size) class AuthenticationFailure(Exception): pass class GeneralFailure(Exception): def __init__(self, action, status, value): message = "Error with %s(%s) %s" % (action, status, value) super(GeneralFailure, self).__init__(message) self.action = action self.status = status self.value = value class TransferFailure(Exception): def __init__(self, action, status, source, dest): message = "Error with %s(%s) %s %s" % (action, status, source, dest) super(TransferFailure, self).__init__(message) self.action = action self.status = status self.source = source self.dest = dest class ChirpJobError(Exception): def __init__(self, action, status, value): message = "Error with %s(%s) %s" % (action, status, value) super(ChirpJobError, self).__init__(message) self.action = action self.status = status self.value = value # @endcode
gpl-2.0
-854,934,521,074,259,500
33.869432
118
0.574758
false
windskyer/nova
nova/tests/unit/virt/xenapi/test_xenapi.py
1
177617
# Copyright (c) 2010 Citrix Systems, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """Test suite for XenAPI.""" import ast import base64 import contextlib import copy import functools import os import re import uuid import mock from mox3 import mox from oslo_concurrency import lockutils from oslo_config import cfg from oslo_config import fixture as config_fixture from oslo_log import log as logging from oslo_serialization import jsonutils from oslo_utils import importutils import six import testtools from nova.compute import api as compute_api from nova.compute import arch from nova.compute import hv_type from nova.compute import power_state from nova.compute import task_states from nova.compute import utils as compute_utils from nova.compute import vm_states from nova import context from nova import crypto from nova import db from nova import exception from nova import objects from nova.objects import base from nova import test from nova.tests.unit.db import fakes as db_fakes from nova.tests.unit import fake_flavor from nova.tests.unit import fake_instance from nova.tests.unit import fake_network from nova.tests.unit import fake_processutils import nova.tests.unit.image.fake as fake_image from nova.tests.unit import matchers from nova.tests.unit.objects import test_aggregate from nova.tests.unit import utils as test_utils from nova.tests.unit.virt.xenapi import stubs from nova.virt import fake from nova.virt.xenapi import agent from nova.virt.xenapi.client import session as xenapi_session from nova.virt.xenapi import driver as xenapi_conn from nova.virt.xenapi import fake as xenapi_fake from nova.virt.xenapi import host from nova.virt.xenapi.image import glance from nova.virt.xenapi import pool from nova.virt.xenapi import pool_states from nova.virt.xenapi import vm_utils from nova.virt.xenapi import vmops from nova.virt.xenapi import volume_utils LOG = logging.getLogger(__name__) CONF = cfg.CONF CONF.import_opt('compute_manager', 'nova.service') CONF.import_opt('network_manager', 'nova.service') CONF.import_opt('compute_driver', 'nova.virt.driver') CONF.import_opt('host', 'nova.netconf') CONF.import_opt('default_availability_zone', 'nova.availability_zones') CONF.import_opt('login_timeout', 'nova.virt.xenapi.client.session', group="xenserver") IMAGE_MACHINE = '1' IMAGE_KERNEL = '2' IMAGE_RAMDISK = '3' IMAGE_RAW = '4' IMAGE_VHD = '5' IMAGE_ISO = '6' IMAGE_IPXE_ISO = '7' IMAGE_FROM_VOLUME = '8' IMAGE_FIXTURES = { IMAGE_MACHINE: { 'image_meta': {'name': 'fakemachine', 'size': 0, 'disk_format': 'ami', 'container_format': 'ami', 'id': 'fake-image'}, }, IMAGE_KERNEL: { 'image_meta': {'name': 'fakekernel', 'size': 0, 'disk_format': 'aki', 'container_format': 'aki', 'id': 'fake-kernel'}, }, IMAGE_RAMDISK: { 'image_meta': {'name': 'fakeramdisk', 'size': 0, 'disk_format': 'ari', 'container_format': 'ari', 'id': 'fake-ramdisk'}, }, IMAGE_RAW: { 'image_meta': {'name': 'fakeraw', 'size': 0, 'disk_format': 'raw', 'container_format': 'bare', 'id': 'fake-image-raw'}, }, IMAGE_VHD: { 'image_meta': {'name': 'fakevhd', 'size': 0, 'disk_format': 'vhd', 'container_format': 'ovf', 'id': 'fake-image-vhd'}, }, IMAGE_ISO: { 'image_meta': {'name': 'fakeiso', 'size': 0, 'disk_format': 'iso', 'container_format': 'bare', 'id': 'fake-image-iso'}, }, IMAGE_IPXE_ISO: { 'image_meta': {'name': 'fake_ipxe_iso', 'size': 0, 'disk_format': 'iso', 'container_format': 'bare', 'id': 'fake-image-pxe', 'properties': {'ipxe_boot': 'true'}}, }, IMAGE_FROM_VOLUME: { 'image_meta': {'name': 'fake_ipxe_iso', 'id': 'fake-image-volume', 'properties': {'foo': 'bar'}}, }, } def get_session(): return xenapi_session.XenAPISession('test_url', 'root', 'test_pass') def set_image_fixtures(): image_service = fake_image.FakeImageService() image_service.images.clear() for image_id, image_meta in IMAGE_FIXTURES.items(): image_meta = image_meta['image_meta'] image_meta['id'] = image_id image_service.create(None, image_meta) def get_fake_device_info(): # FIXME: 'sr_uuid', 'introduce_sr_keys', sr_type and vdi_uuid # can be removed from the dict when LP bug #1087308 is fixed fake_vdi_ref = xenapi_fake.create_vdi('fake-vdi', None) fake_vdi_uuid = xenapi_fake.get_record('VDI', fake_vdi_ref)['uuid'] fake = {'block_device_mapping': [{'connection_info': {'driver_volume_type': 'iscsi', 'data': {'sr_uuid': 'falseSR', 'introduce_sr_keys': ['sr_type'], 'sr_type': 'iscsi', 'vdi_uuid': fake_vdi_uuid, 'target_discovered': False, 'target_iqn': 'foo_iqn:foo_volid', 'target_portal': 'localhost:3260', 'volume_id': 'foo_volid', 'target_lun': 1, 'auth_password': 'my-p@55w0rd', 'auth_username': 'johndoe', 'auth_method': u'CHAP'}, }, 'mount_device': 'vda', 'delete_on_termination': False}, ], 'root_device_name': '/dev/sda', 'ephemerals': [], 'swap': None, } return fake def stub_vm_utils_with_vdi_attached_here(function): """vm_utils.with_vdi_attached_here needs to be stubbed out because it calls down to the filesystem to attach a vdi. This provides a decorator to handle that. """ @functools.wraps(function) def decorated_function(self, *args, **kwargs): @contextlib.contextmanager def fake_vdi_attached_here(*args, **kwargs): fake_dev = 'fakedev' yield fake_dev def fake_image_download(*args, **kwargs): pass orig_vdi_attached_here = vm_utils.vdi_attached_here orig_image_download = fake_image._FakeImageService.download try: vm_utils.vdi_attached_here = fake_vdi_attached_here fake_image._FakeImageService.download = fake_image_download return function(self, *args, **kwargs) finally: fake_image._FakeImageService.download = orig_image_download vm_utils.vdi_attached_here = orig_vdi_attached_here return decorated_function def create_instance_with_system_metadata(context, instance_values): inst = objects.Instance(context=context, system_metadata={}) for k, v in instance_values.items(): setattr(inst, k, v) inst.flavor = objects.Flavor.get_by_id(context, instance_values['instance_type_id']) inst.old_flavor = None inst.new_flavor = None inst.create() inst.pci_devices = objects.PciDeviceList(objects=[]) return inst class XenAPIVolumeTestCase(stubs.XenAPITestBaseNoDB): """Unit tests for Volume operations.""" def setUp(self): super(XenAPIVolumeTestCase, self).setUp() self.fixture = self.useFixture(config_fixture.Config(lockutils.CONF)) self.fixture.config(disable_process_locking=True, group='oslo_concurrency') self.flags(firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.instance = fake_instance.fake_db_instance(name='foo') @classmethod def _make_connection_info(cls): target_iqn = 'iqn.2010-10.org.openstack:volume-00000001' return {'driver_volume_type': 'iscsi', 'data': {'volume_id': 1, 'target_iqn': target_iqn, 'target_portal': '127.0.0.1:3260,fake', 'target_lun': None, 'auth_method': 'CHAP', 'auth_username': 'username', 'auth_password': 'password'}} def test_attach_volume(self): # This shows how to test Ops classes' methods. stubs.stubout_session(self.stubs, stubs.FakeSessionForVolumeTests) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vm = xenapi_fake.create_vm(self.instance['name'], 'Running') conn_info = self._make_connection_info() self.assertIsNone( conn.attach_volume(None, conn_info, self.instance, '/dev/sdc')) # check that the VM has a VBD attached to it # Get XenAPI record for VBD vbds = xenapi_fake.get_all('VBD') vbd = xenapi_fake.get_record('VBD', vbds[0]) vm_ref = vbd['VM'] self.assertEqual(vm_ref, vm) def test_attach_volume_raise_exception(self): # This shows how to test when exceptions are raised. stubs.stubout_session(self.stubs, stubs.FakeSessionForVolumeFailedTests) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) xenapi_fake.create_vm(self.instance['name'], 'Running') self.assertRaises(exception.VolumeDriverNotFound, conn.attach_volume, None, {'driver_volume_type': 'nonexist'}, self.instance, '/dev/sdc') # FIXME(sirp): convert this to use XenAPITestBaseNoDB class XenAPIVMTestCase(stubs.XenAPITestBase): """Unit tests for VM operations.""" def setUp(self): super(XenAPIVMTestCase, self).setUp() self.useFixture(test.SampleNetworks()) self.network = importutils.import_object(CONF.network_manager) self.fixture = self.useFixture(config_fixture.Config(lockutils.CONF)) self.fixture.config(disable_process_locking=True, group='oslo_concurrency') self.flags(instance_name_template='%d', firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') db_fakes.stub_out_db_instance_api(self.stubs) xenapi_fake.create_network('fake', 'fake_br1') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) stubs.stubout_get_this_vm_uuid(self.stubs) stubs.stub_out_vm_methods(self.stubs) fake_processutils.stub_out_processutils_execute(self.stubs) self.user_id = 'fake' self.project_id = 'fake' self.context = context.RequestContext(self.user_id, self.project_id) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.conn._session.is_local_connection = False fake_image.stub_out_image_service(self.stubs) set_image_fixtures() stubs.stubout_image_service_download(self.stubs) stubs.stubout_stream_disk(self.stubs) def fake_inject_instance_metadata(self, instance, vm): pass self.stubs.Set(vmops.VMOps, '_inject_instance_metadata', fake_inject_instance_metadata) def fake_safe_copy_vdi(session, sr_ref, instance, vdi_to_copy_ref): name_label = "fakenamelabel" disk_type = "fakedisktype" virtual_size = 777 return vm_utils.create_vdi( session, sr_ref, instance, name_label, disk_type, virtual_size) self.stubs.Set(vm_utils, '_safe_copy_vdi', fake_safe_copy_vdi) def tearDown(self): fake_image.FakeImageService_reset() super(XenAPIVMTestCase, self).tearDown() def test_init_host(self): session = get_session() vm = vm_utils._get_this_vm_ref(session) # Local root disk vdi0 = xenapi_fake.create_vdi('compute', None) vbd0 = xenapi_fake.create_vbd(vm, vdi0) # Instance VDI vdi1 = xenapi_fake.create_vdi('instance-aaaa', None, other_config={'nova_instance_uuid': 'aaaa'}) xenapi_fake.create_vbd(vm, vdi1) # Only looks like instance VDI vdi2 = xenapi_fake.create_vdi('instance-bbbb', None) vbd2 = xenapi_fake.create_vbd(vm, vdi2) self.conn.init_host(None) self.assertEqual(set(xenapi_fake.get_all('VBD')), set([vbd0, vbd2])) def test_instance_exists(self): self.mox.StubOutWithMock(vm_utils, 'lookup') vm_utils.lookup(mox.IgnoreArg(), 'foo').AndReturn(True) self.mox.ReplayAll() self.stubs.Set(objects.Instance, 'name', 'foo') instance = objects.Instance(uuid='fake-uuid') self.assertTrue(self.conn.instance_exists(instance)) def test_instance_not_exists(self): self.mox.StubOutWithMock(vm_utils, 'lookup') vm_utils.lookup(mox.IgnoreArg(), 'bar').AndReturn(None) self.mox.ReplayAll() self.stubs.Set(objects.Instance, 'name', 'bar') instance = objects.Instance(uuid='fake-uuid') self.assertFalse(self.conn.instance_exists(instance)) def test_list_instances_0(self): instances = self.conn.list_instances() self.assertEqual(instances, []) def test_list_instance_uuids_0(self): instance_uuids = self.conn.list_instance_uuids() self.assertEqual(instance_uuids, []) def test_list_instance_uuids(self): uuids = [] for x in range(1, 4): instance = self._create_instance() uuids.append(instance['uuid']) instance_uuids = self.conn.list_instance_uuids() self.assertEqual(len(uuids), len(instance_uuids)) self.assertEqual(set(uuids), set(instance_uuids)) def test_get_rrd_server(self): self.flags(connection_url='myscheme://myaddress/', group='xenserver') server_info = vm_utils._get_rrd_server() self.assertEqual(server_info[0], 'myscheme') self.assertEqual(server_info[1], 'myaddress') expected_raw_diagnostics = { 'vbd_xvdb_write': '0.0', 'memory_target': '4294967296.0000', 'memory_internal_free': '1415564.0000', 'memory': '4294967296.0000', 'vbd_xvda_write': '0.0', 'cpu0': '0.0042', 'vif_0_tx': '287.4134', 'vbd_xvda_read': '0.0', 'vif_0_rx': '1816.0144', 'vif_2_rx': '0.0', 'vif_2_tx': '0.0', 'vbd_xvdb_read': '0.0', 'last_update': '1328795567', } def test_get_diagnostics(self): def fake_get_rrd(host, vm_uuid): path = os.path.dirname(os.path.realpath(__file__)) with open(os.path.join(path, 'vm_rrd.xml')) as f: return re.sub(r'\s', '', f.read()) self.stubs.Set(vm_utils, '_get_rrd', fake_get_rrd) expected = self.expected_raw_diagnostics instance = self._create_instance() actual = self.conn.get_diagnostics(instance) self.assertThat(actual, matchers.DictMatches(expected)) def test_get_instance_diagnostics(self): def fake_get_rrd(host, vm_uuid): path = os.path.dirname(os.path.realpath(__file__)) with open(os.path.join(path, 'vm_rrd.xml')) as f: return re.sub(r'\s', '', f.read()) self.stubs.Set(vm_utils, '_get_rrd', fake_get_rrd) expected = { 'config_drive': False, 'state': 'running', 'driver': 'xenapi', 'version': '1.0', 'uptime': 0, 'hypervisor_os': None, 'cpu_details': [{'time': 0}, {'time': 0}, {'time': 0}, {'time': 0}], 'nic_details': [{'mac_address': '00:00:00:00:00:00', 'rx_drop': 0, 'rx_errors': 0, 'rx_octets': 0, 'rx_packets': 0, 'tx_drop': 0, 'tx_errors': 0, 'tx_octets': 0, 'tx_packets': 0}], 'disk_details': [{'errors_count': 0, 'id': '', 'read_bytes': 0, 'read_requests': 0, 'write_bytes': 0, 'write_requests': 0}], 'memory_details': {'maximum': 8192, 'used': 0}} instance = self._create_instance(obj=True) actual = self.conn.get_instance_diagnostics(instance) self.assertEqual(expected, actual.serialize()) def test_get_vnc_console(self): instance = self._create_instance(obj=True) session = get_session() conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vm_ref = vm_utils.lookup(session, instance['name']) console = conn.get_vnc_console(self.context, instance) # Note(sulo): We don't care about session id in test # they will always differ so strip that out actual_path = console.internal_access_path.split('&')[0] expected_path = "/console?ref=%s" % str(vm_ref) self.assertEqual(expected_path, actual_path) def test_get_vnc_console_for_rescue(self): instance = self._create_instance(obj=True) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) rescue_vm = xenapi_fake.create_vm(instance['name'] + '-rescue', 'Running') # Set instance state to rescued instance['vm_state'] = 'rescued' console = conn.get_vnc_console(self.context, instance) # Note(sulo): We don't care about session id in test # they will always differ so strip that out actual_path = console.internal_access_path.split('&')[0] expected_path = "/console?ref=%s" % str(rescue_vm) self.assertEqual(expected_path, actual_path) def test_get_vnc_console_instance_not_ready(self): instance = self._create_instance(obj=True, spawn=False) instance.vm_state = 'building' conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.assertRaises(exception.InstanceNotFound, conn.get_vnc_console, self.context, instance) def test_get_vnc_console_rescue_not_ready(self): instance = self._create_instance(obj=True, spawn=False) instance.vm_state = 'rescued' conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.assertRaises(exception.InstanceNotReady, conn.get_vnc_console, self.context, instance) def test_instance_snapshot_fails_with_no_primary_vdi(self): def create_bad_vbd(session, vm_ref, vdi_ref, userdevice, vbd_type='disk', read_only=False, bootable=False, osvol=False): vbd_rec = {'VM': vm_ref, 'VDI': vdi_ref, 'userdevice': 'fake', 'currently_attached': False} vbd_ref = xenapi_fake._create_object('VBD', vbd_rec) xenapi_fake.after_VBD_create(vbd_ref, vbd_rec) return vbd_ref self.stubs.Set(vm_utils, 'create_vbd', create_bad_vbd) stubs.stubout_instance_snapshot(self.stubs) # Stubbing out firewall driver as previous stub sets alters # xml rpc result parsing stubs.stubout_firewall_driver(self.stubs, self.conn) instance = self._create_instance() image_id = "my_snapshot_id" self.assertRaises(exception.NovaException, self.conn.snapshot, self.context, instance, image_id, lambda *args, **kwargs: None) def test_instance_snapshot(self): expected_calls = [ {'args': (), 'kwargs': {'task_state': task_states.IMAGE_PENDING_UPLOAD}}, {'args': (), 'kwargs': {'task_state': task_states.IMAGE_UPLOADING, 'expected_state': task_states.IMAGE_PENDING_UPLOAD}}] func_call_matcher = matchers.FunctionCallMatcher(expected_calls) image_id = "my_snapshot_id" stubs.stubout_instance_snapshot(self.stubs) stubs.stubout_is_snapshot(self.stubs) # Stubbing out firewall driver as previous stub sets alters # xml rpc result parsing stubs.stubout_firewall_driver(self.stubs, self.conn) instance = self._create_instance() self.fake_upload_called = False def fake_image_upload(_self, ctx, session, inst, img_id, vdi_uuids): self.fake_upload_called = True self.assertEqual(ctx, self.context) self.assertEqual(inst, instance) self.assertIsInstance(vdi_uuids, list) self.assertEqual(img_id, image_id) self.stubs.Set(glance.GlanceStore, 'upload_image', fake_image_upload) self.conn.snapshot(self.context, instance, image_id, func_call_matcher.call) # Ensure VM was torn down vm_labels = [] for vm_ref in xenapi_fake.get_all('VM'): vm_rec = xenapi_fake.get_record('VM', vm_ref) if not vm_rec["is_control_domain"]: vm_labels.append(vm_rec["name_label"]) self.assertEqual(vm_labels, [instance['name']]) # Ensure VBDs were torn down vbd_labels = [] for vbd_ref in xenapi_fake.get_all('VBD'): vbd_rec = xenapi_fake.get_record('VBD', vbd_ref) vbd_labels.append(vbd_rec["vm_name_label"]) self.assertEqual(vbd_labels, [instance['name']]) # Ensure task states changed in correct order self.assertIsNone(func_call_matcher.match()) # Ensure VDIs were torn down for vdi_ref in xenapi_fake.get_all('VDI'): vdi_rec = xenapi_fake.get_record('VDI', vdi_ref) name_label = vdi_rec["name_label"] self.assertFalse(name_label.endswith('snapshot')) self.assertTrue(self.fake_upload_called) def create_vm_record(self, conn, os_type, name): instances = conn.list_instances() self.assertEqual(instances, [name]) # Get Nova record for VM vm_info = conn.get_info({'name': name}) # Get XenAPI record for VM vms = [rec for ref, rec in six.iteritems(xenapi_fake.get_all_records('VM')) if not rec['is_control_domain']] vm = vms[0] self.vm_info = vm_info self.vm = vm def check_vm_record(self, conn, instance_type_id, check_injection): flavor = db.flavor_get(conn, instance_type_id) mem_kib = int(flavor['memory_mb']) << 10 mem_bytes = str(mem_kib << 10) vcpus = flavor['vcpus'] vcpu_weight = flavor['vcpu_weight'] self.assertEqual(self.vm_info.max_mem_kb, mem_kib) self.assertEqual(self.vm_info.mem_kb, mem_kib) self.assertEqual(self.vm['memory_static_max'], mem_bytes) self.assertEqual(self.vm['memory_dynamic_max'], mem_bytes) self.assertEqual(self.vm['memory_dynamic_min'], mem_bytes) self.assertEqual(self.vm['VCPUs_max'], str(vcpus)) self.assertEqual(self.vm['VCPUs_at_startup'], str(vcpus)) if vcpu_weight is None: self.assertEqual(self.vm['VCPUs_params'], {}) else: self.assertEqual(self.vm['VCPUs_params'], {'weight': str(vcpu_weight), 'cap': '0'}) # Check that the VM is running according to Nova self.assertEqual(self.vm_info.state, power_state.RUNNING) # Check that the VM is running according to XenAPI. self.assertEqual(self.vm['power_state'], 'Running') if check_injection: xenstore_data = self.vm['xenstore_data'] self.assertNotIn('vm-data/hostname', xenstore_data) key = 'vm-data/networking/DEADBEEF0001' xenstore_value = xenstore_data[key] tcpip_data = ast.literal_eval(xenstore_value) self.assertJsonEqual({'broadcast': '192.168.1.255', 'dns': ['192.168.1.4', '192.168.1.3'], 'gateway': '192.168.1.1', 'gateway_v6': '2001:db8:0:1::1', 'ip6s': [{'enabled': '1', 'ip': '2001:db8:0:1:dcad:beff:feef:1', 'netmask': 64, 'gateway': '2001:db8:0:1::1'}], 'ips': [{'enabled': '1', 'ip': '192.168.1.100', 'netmask': '255.255.255.0', 'gateway': '192.168.1.1'}, {'enabled': '1', 'ip': '192.168.1.101', 'netmask': '255.255.255.0', 'gateway': '192.168.1.1'}], 'label': 'test1', 'mac': 'DE:AD:BE:EF:00:01'}, tcpip_data) def check_vm_params_for_windows(self): self.assertEqual(self.vm['platform']['nx'], 'true') self.assertEqual(self.vm['HVM_boot_params'], {'order': 'dc'}) self.assertEqual(self.vm['HVM_boot_policy'], 'BIOS order') # check that these are not set self.assertEqual(self.vm['PV_args'], '') self.assertEqual(self.vm['PV_bootloader'], '') self.assertEqual(self.vm['PV_kernel'], '') self.assertEqual(self.vm['PV_ramdisk'], '') def check_vm_params_for_linux(self): self.assertEqual(self.vm['platform']['nx'], 'false') self.assertEqual(self.vm['PV_args'], '') self.assertEqual(self.vm['PV_bootloader'], 'pygrub') # check that these are not set self.assertEqual(self.vm['PV_kernel'], '') self.assertEqual(self.vm['PV_ramdisk'], '') self.assertEqual(self.vm['HVM_boot_params'], {}) self.assertEqual(self.vm['HVM_boot_policy'], '') def check_vm_params_for_linux_with_external_kernel(self): self.assertEqual(self.vm['platform']['nx'], 'false') self.assertEqual(self.vm['PV_args'], 'root=/dev/xvda1') self.assertNotEqual(self.vm['PV_kernel'], '') self.assertNotEqual(self.vm['PV_ramdisk'], '') # check that these are not set self.assertEqual(self.vm['HVM_boot_params'], {}) self.assertEqual(self.vm['HVM_boot_policy'], '') def _list_vdis(self): session = get_session() return session.call_xenapi('VDI.get_all') def _list_vms(self): session = get_session() return session.call_xenapi('VM.get_all') def _check_vdis(self, start_list, end_list): for vdi_ref in end_list: if vdi_ref not in start_list: vdi_rec = xenapi_fake.get_record('VDI', vdi_ref) # If the cache is turned on then the base disk will be # there even after the cleanup if 'other_config' in vdi_rec: if 'image-id' not in vdi_rec['other_config']: self.fail('Found unexpected VDI:%s' % vdi_ref) else: self.fail('Found unexpected VDI:%s' % vdi_ref) def _test_spawn(self, image_ref, kernel_id, ramdisk_id, instance_type_id="3", os_type="linux", hostname="test", architecture="x86-64", instance_id=1, injected_files=None, check_injection=False, create_record=True, empty_dns=False, block_device_info=None, key_data=None): if injected_files is None: injected_files = [] # Fake out inject_instance_metadata def fake_inject_instance_metadata(self, instance, vm): pass self.stubs.Set(vmops.VMOps, '_inject_instance_metadata', fake_inject_instance_metadata) if create_record: instance = objects.Instance(context=self.context) instance.project_id = self.project_id instance.user_id = self.user_id instance.image_ref = image_ref instance.kernel_id = kernel_id instance.ramdisk_id = ramdisk_id instance.root_gb = 20 instance.ephemeral_gb = 0 instance.instance_type_id = instance_type_id instance.os_type = os_type instance.hostname = hostname instance.key_data = key_data instance.architecture = architecture instance.system_metadata = {} flavor = objects.Flavor.get_by_id(self.context, instance_type_id) if instance_type_id == 5: # NOTE(danms): xenapi test stubs have flavor 5 with no # vcpu_weight flavor.vcpu_weight = None instance.flavor = flavor instance.create() else: instance = objects.Instance.get_by_id(self.context, instance_id, expected_attrs=['flavor']) network_info = fake_network.fake_get_instance_nw_info(self.stubs) if empty_dns: # NOTE(tr3buchet): this is a terrible way to do this... network_info[0]['network']['subnets'][0]['dns'] = [] image_meta = IMAGE_FIXTURES[image_ref]["image_meta"] self.conn.spawn(self.context, instance, image_meta, injected_files, 'herp', network_info, block_device_info) self.create_vm_record(self.conn, os_type, instance['name']) self.check_vm_record(self.conn, instance_type_id, check_injection) self.assertEqual(instance['os_type'], os_type) self.assertEqual(instance['architecture'], architecture) def test_spawn_ipxe_iso_success(self): self.mox.StubOutWithMock(vm_utils, 'get_sr_path') vm_utils.get_sr_path(mox.IgnoreArg()).AndReturn('/sr/path') self.flags(ipxe_network_name='test1', ipxe_boot_menu_url='http://boot.example.com', ipxe_mkisofs_cmd='/root/mkisofs', group='xenserver') self.mox.StubOutWithMock(self.conn._session, 'call_plugin_serialized') self.conn._session.call_plugin_serialized( 'ipxe', 'inject', '/sr/path', mox.IgnoreArg(), 'http://boot.example.com', '192.168.1.100', '255.255.255.0', '192.168.1.1', '192.168.1.3', '/root/mkisofs') self.mox.ReplayAll() self._test_spawn(IMAGE_IPXE_ISO, None, None) def test_spawn_ipxe_iso_no_network_name(self): self.flags(ipxe_network_name=None, ipxe_boot_menu_url='http://boot.example.com', group='xenserver') # call_plugin_serialized shouldn't be called self.mox.StubOutWithMock(self.conn._session, 'call_plugin_serialized') self.mox.ReplayAll() self._test_spawn(IMAGE_IPXE_ISO, None, None) def test_spawn_ipxe_iso_no_boot_menu_url(self): self.flags(ipxe_network_name='test1', ipxe_boot_menu_url=None, group='xenserver') # call_plugin_serialized shouldn't be called self.mox.StubOutWithMock(self.conn._session, 'call_plugin_serialized') self.mox.ReplayAll() self._test_spawn(IMAGE_IPXE_ISO, None, None) def test_spawn_ipxe_iso_unknown_network_name(self): self.flags(ipxe_network_name='test2', ipxe_boot_menu_url='http://boot.example.com', group='xenserver') # call_plugin_serialized shouldn't be called self.mox.StubOutWithMock(self.conn._session, 'call_plugin_serialized') self.mox.ReplayAll() self._test_spawn(IMAGE_IPXE_ISO, None, None) def test_spawn_empty_dns(self): # Test spawning with an empty dns list. self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64", empty_dns=True) self.check_vm_params_for_linux() def test_spawn_not_enough_memory(self): self.assertRaises(exception.InsufficientFreeMemory, self._test_spawn, '1', 2, 3, "4") # m1.xlarge def test_spawn_fail_cleanup_1(self): """Simulates an error while downloading an image. Verifies that the VM and VDIs created are properly cleaned up. """ vdi_recs_start = self._list_vdis() start_vms = self._list_vms() stubs.stubout_fetch_disk_image(self.stubs, raise_failure=True) self.assertRaises(xenapi_fake.Failure, self._test_spawn, '1', 2, 3) # No additional VDI should be found. vdi_recs_end = self._list_vdis() end_vms = self._list_vms() self._check_vdis(vdi_recs_start, vdi_recs_end) # No additional VMs should be found. self.assertEqual(start_vms, end_vms) def test_spawn_fail_cleanup_2(self): """Simulates an error while creating VM record. Verifies that the VM and VDIs created are properly cleaned up. """ vdi_recs_start = self._list_vdis() start_vms = self._list_vms() stubs.stubout_create_vm(self.stubs) self.assertRaises(xenapi_fake.Failure, self._test_spawn, '1', 2, 3) # No additional VDI should be found. vdi_recs_end = self._list_vdis() end_vms = self._list_vms() self._check_vdis(vdi_recs_start, vdi_recs_end) # No additional VMs should be found. self.assertEqual(start_vms, end_vms) def test_spawn_fail_cleanup_3(self): """Simulates an error while attaching disks. Verifies that the VM and VDIs created are properly cleaned up. """ stubs.stubout_attach_disks(self.stubs) vdi_recs_start = self._list_vdis() start_vms = self._list_vms() self.assertRaises(xenapi_fake.Failure, self._test_spawn, '1', 2, 3) # No additional VDI should be found. vdi_recs_end = self._list_vdis() end_vms = self._list_vms() self._check_vdis(vdi_recs_start, vdi_recs_end) # No additional VMs should be found. self.assertEqual(start_vms, end_vms) def test_spawn_raw_glance(self): self._test_spawn(IMAGE_RAW, None, None, os_type=None) self.check_vm_params_for_windows() def test_spawn_vhd_glance_linux(self): self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64") self.check_vm_params_for_linux() def test_spawn_vhd_glance_windows(self): self._test_spawn(IMAGE_VHD, None, None, os_type="windows", architecture="i386", instance_type_id=5) self.check_vm_params_for_windows() def test_spawn_iso_glance(self): self._test_spawn(IMAGE_ISO, None, None, os_type="windows", architecture="i386") self.check_vm_params_for_windows() def test_spawn_glance(self): def fake_fetch_disk_image(context, session, instance, name_label, image_id, image_type): sr_ref = vm_utils.safe_find_sr(session) image_type_str = vm_utils.ImageType.to_string(image_type) vdi_ref = vm_utils.create_vdi(session, sr_ref, instance, name_label, image_type_str, "20") vdi_role = vm_utils.ImageType.get_role(image_type) vdi_uuid = session.call_xenapi("VDI.get_uuid", vdi_ref) return {vdi_role: dict(uuid=vdi_uuid, file=None)} self.stubs.Set(vm_utils, '_fetch_disk_image', fake_fetch_disk_image) self._test_spawn(IMAGE_MACHINE, IMAGE_KERNEL, IMAGE_RAMDISK) self.check_vm_params_for_linux_with_external_kernel() def test_spawn_boot_from_volume_no_glance_image_meta(self): dev_info = get_fake_device_info() self._test_spawn(IMAGE_FROM_VOLUME, None, None, block_device_info=dev_info) def test_spawn_boot_from_volume_with_image_meta(self): dev_info = get_fake_device_info() self._test_spawn(IMAGE_VHD, None, None, block_device_info=dev_info) @testtools.skipIf(test_utils.is_osx(), 'IPv6 pretty-printing broken on OSX, see bug 1409135') def test_spawn_netinject_file(self): self.flags(flat_injected=True) db_fakes.stub_out_db_instance_api(self.stubs, injected=True) self._tee_executed = False def _tee_handler(cmd, **kwargs): actual = kwargs.get('process_input', None) expected = """\ # Injected by Nova on instance boot # # This file describes the network interfaces available on your system # and how to activate them. For more information, see interfaces(5). # The loopback network interface auto lo iface lo inet loopback auto eth0 iface eth0 inet static hwaddress ether DE:AD:BE:EF:00:01 address 192.168.1.100 netmask 255.255.255.0 broadcast 192.168.1.255 gateway 192.168.1.1 dns-nameservers 192.168.1.3 192.168.1.4 iface eth0 inet6 static hwaddress ether DE:AD:BE:EF:00:01 address 2001:db8:0:1:dcad:beff:feef:1 netmask 64 gateway 2001:db8:0:1::1 """ self.assertEqual(expected, actual) self._tee_executed = True return '', '' def _readlink_handler(cmd_parts, **kwargs): return os.path.realpath(cmd_parts[2]), '' fake_processutils.fake_execute_set_repliers([ # Capture the tee .../etc/network/interfaces command (r'tee.*interfaces', _tee_handler), (r'readlink -nm.*', _readlink_handler), ]) self._test_spawn(IMAGE_MACHINE, IMAGE_KERNEL, IMAGE_RAMDISK, check_injection=True) self.assertTrue(self._tee_executed) @testtools.skipIf(test_utils.is_osx(), 'IPv6 pretty-printing broken on OSX, see bug 1409135') def test_spawn_netinject_xenstore(self): db_fakes.stub_out_db_instance_api(self.stubs, injected=True) self._tee_executed = False def _mount_handler(cmd, *ignore_args, **ignore_kwargs): # When mounting, create real files under the mountpoint to simulate # files in the mounted filesystem # mount point will be the last item of the command list self._tmpdir = cmd[len(cmd) - 1] LOG.debug('Creating files in %s to simulate guest agent', self._tmpdir) os.makedirs(os.path.join(self._tmpdir, 'usr', 'sbin')) # Touch the file using open open(os.path.join(self._tmpdir, 'usr', 'sbin', 'xe-update-networking'), 'w').close() return '', '' def _umount_handler(cmd, *ignore_args, **ignore_kwargs): # Umount would normally make files in the mounted filesystem # disappear, so do that here LOG.debug('Removing simulated guest agent files in %s', self._tmpdir) os.remove(os.path.join(self._tmpdir, 'usr', 'sbin', 'xe-update-networking')) os.rmdir(os.path.join(self._tmpdir, 'usr', 'sbin')) os.rmdir(os.path.join(self._tmpdir, 'usr')) return '', '' def _tee_handler(cmd, *ignore_args, **ignore_kwargs): self._tee_executed = True return '', '' fake_processutils.fake_execute_set_repliers([ (r'mount', _mount_handler), (r'umount', _umount_handler), (r'tee.*interfaces', _tee_handler)]) self._test_spawn('1', 2, 3, check_injection=True) # tee must not run in this case, where an injection-capable # guest agent is detected self.assertFalse(self._tee_executed) def test_spawn_injects_auto_disk_config_to_xenstore(self): instance = self._create_instance(spawn=False, obj=True) self.mox.StubOutWithMock(self.conn._vmops, '_inject_auto_disk_config') self.conn._vmops._inject_auto_disk_config(instance, mox.IgnoreArg()) self.mox.ReplayAll() self.conn.spawn(self.context, instance, IMAGE_FIXTURES['1']["image_meta"], [], 'herp', '') def test_spawn_vlanmanager(self): self.flags(network_manager='nova.network.manager.VlanManager', vlan_interface='fake0') def dummy(*args, **kwargs): pass self.stubs.Set(vmops.VMOps, '_create_vifs', dummy) # Reset network table xenapi_fake.reset_table('network') # Instance 2 will use vlan network (see db/fakes.py) ctxt = self.context.elevated() inst2 = self._create_instance(False, obj=True) networks = self.network.db.network_get_all(ctxt) with mock.patch('nova.objects.network.Network._from_db_object'): for network in networks: self.network.set_network_host(ctxt, network) self.network.allocate_for_instance(ctxt, instance_id=inst2.id, instance_uuid=inst2.uuid, host=CONF.host, vpn=None, rxtx_factor=3, project_id=self.project_id, macs=None) self._test_spawn(IMAGE_MACHINE, IMAGE_KERNEL, IMAGE_RAMDISK, instance_id=inst2.id, create_record=False) # TODO(salvatore-orlando): a complete test here would require # a check for making sure the bridge for the VM's VIF is # consistent with bridge specified in nova db def test_spawn_with_network_qos(self): self._create_instance() for vif_ref in xenapi_fake.get_all('VIF'): vif_rec = xenapi_fake.get_record('VIF', vif_ref) self.assertEqual(vif_rec['qos_algorithm_type'], 'ratelimit') self.assertEqual(vif_rec['qos_algorithm_params']['kbps'], str(3 * 10 * 1024)) def test_spawn_ssh_key_injection(self): # Test spawning with key_data on an instance. Should use # agent file injection. self.flags(use_agent_default=True, group='xenserver') actual_injected_files = [] def fake_inject_file(self, method, args): path = base64.b64decode(args['b64_path']) contents = base64.b64decode(args['b64_contents']) actual_injected_files.append((path, contents)) return jsonutils.dumps({'returncode': '0', 'message': 'success'}) self.stubs.Set(stubs.FakeSessionForVMTests, '_plugin_agent_inject_file', fake_inject_file) def fake_encrypt_text(sshkey, new_pass): self.assertEqual("ssh-rsa fake_keydata", sshkey) return "fake" self.stubs.Set(crypto, 'ssh_encrypt_text', fake_encrypt_text) expected_data = ('\n# The following ssh key was injected by ' 'Nova\nssh-rsa fake_keydata\n') injected_files = [('/root/.ssh/authorized_keys', expected_data)] self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64", key_data='ssh-rsa fake_keydata') self.assertEqual(actual_injected_files, injected_files) def test_spawn_ssh_key_injection_non_rsa(self): # Test spawning with key_data on an instance. Should use # agent file injection. self.flags(use_agent_default=True, group='xenserver') actual_injected_files = [] def fake_inject_file(self, method, args): path = base64.b64decode(args['b64_path']) contents = base64.b64decode(args['b64_contents']) actual_injected_files.append((path, contents)) return jsonutils.dumps({'returncode': '0', 'message': 'success'}) self.stubs.Set(stubs.FakeSessionForVMTests, '_plugin_agent_inject_file', fake_inject_file) def fake_encrypt_text(sshkey, new_pass): raise NotImplementedError("Should not be called") self.stubs.Set(crypto, 'ssh_encrypt_text', fake_encrypt_text) expected_data = ('\n# The following ssh key was injected by ' 'Nova\nssh-dsa fake_keydata\n') injected_files = [('/root/.ssh/authorized_keys', expected_data)] self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64", key_data='ssh-dsa fake_keydata') self.assertEqual(actual_injected_files, injected_files) def test_spawn_injected_files(self): # Test spawning with injected_files. self.flags(use_agent_default=True, group='xenserver') actual_injected_files = [] def fake_inject_file(self, method, args): path = base64.b64decode(args['b64_path']) contents = base64.b64decode(args['b64_contents']) actual_injected_files.append((path, contents)) return jsonutils.dumps({'returncode': '0', 'message': 'success'}) self.stubs.Set(stubs.FakeSessionForVMTests, '_plugin_agent_inject_file', fake_inject_file) injected_files = [('/tmp/foo', 'foobar')] self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64", injected_files=injected_files) self.check_vm_params_for_linux() self.assertEqual(actual_injected_files, injected_files) @mock.patch('nova.db.agent_build_get_by_triple') def test_spawn_agent_upgrade(self, mock_get): self.flags(use_agent_default=True, group='xenserver') mock_get.return_value = {"version": "1.1.0", "architecture": "x86-64", "hypervisor": "xen", "os": "windows", "url": "url", "md5hash": "asdf", 'created_at': None, 'updated_at': None, 'deleted_at': None, 'deleted': False, 'id': 1} self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64") @mock.patch('nova.db.agent_build_get_by_triple') def test_spawn_agent_upgrade_fails_silently(self, mock_get): mock_get.return_value = {"version": "1.1.0", "architecture": "x86-64", "hypervisor": "xen", "os": "windows", "url": "url", "md5hash": "asdf", 'created_at': None, 'updated_at': None, 'deleted_at': None, 'deleted': False, 'id': 1} self._test_spawn_fails_silently_with(exception.AgentError, method="_plugin_agent_agentupdate", failure="fake_error") def test_spawn_with_resetnetwork_alternative_returncode(self): self.flags(use_agent_default=True, group='xenserver') def fake_resetnetwork(self, method, args): fake_resetnetwork.called = True # NOTE(johngarbutt): as returned by FreeBSD and Gentoo return jsonutils.dumps({'returncode': '500', 'message': 'success'}) self.stubs.Set(stubs.FakeSessionForVMTests, '_plugin_agent_resetnetwork', fake_resetnetwork) fake_resetnetwork.called = False self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64") self.assertTrue(fake_resetnetwork.called) def _test_spawn_fails_silently_with(self, expected_exception_cls, method="_plugin_agent_version", failure=None, value=None): self.flags(use_agent_default=True, agent_version_timeout=0, group='xenserver') def fake_agent_call(self, method, args): if failure: raise xenapi_fake.Failure([failure]) else: return value self.stubs.Set(stubs.FakeSessionForVMTests, method, fake_agent_call) called = {} def fake_add_instance_fault(*args, **kwargs): called["fake_add_instance_fault"] = args[2] self.stubs.Set(compute_utils, 'add_instance_fault_from_exc', fake_add_instance_fault) self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64") actual_exception = called["fake_add_instance_fault"] self.assertIsInstance(actual_exception, expected_exception_cls) def test_spawn_fails_silently_with_agent_timeout(self): self._test_spawn_fails_silently_with(exception.AgentTimeout, failure="TIMEOUT:fake") def test_spawn_fails_silently_with_agent_not_implemented(self): self._test_spawn_fails_silently_with(exception.AgentNotImplemented, failure="NOT IMPLEMENTED:fake") def test_spawn_fails_silently_with_agent_error(self): self._test_spawn_fails_silently_with(exception.AgentError, failure="fake_error") def test_spawn_fails_silently_with_agent_bad_return(self): error = jsonutils.dumps({'returncode': -1, 'message': 'fake'}) self._test_spawn_fails_silently_with(exception.AgentError, value=error) def test_spawn_sets_last_dom_id(self): self._test_spawn(IMAGE_VHD, None, None, os_type="linux", architecture="x86-64") self.assertEqual(self.vm['domid'], self.vm['other_config']['last_dom_id']) def test_rescue(self): instance = self._create_instance(spawn=False, obj=True) xenapi_fake.create_vm(instance['name'], 'Running') session = get_session() vm_ref = vm_utils.lookup(session, instance['name']) swap_vdi_ref = xenapi_fake.create_vdi('swap', None) root_vdi_ref = xenapi_fake.create_vdi('root', None) eph1_vdi_ref = xenapi_fake.create_vdi('eph', None) eph2_vdi_ref = xenapi_fake.create_vdi('eph', None) vol_vdi_ref = xenapi_fake.create_vdi('volume', None) xenapi_fake.create_vbd(vm_ref, swap_vdi_ref, userdevice=2) xenapi_fake.create_vbd(vm_ref, root_vdi_ref, userdevice=0) xenapi_fake.create_vbd(vm_ref, eph1_vdi_ref, userdevice=4) xenapi_fake.create_vbd(vm_ref, eph2_vdi_ref, userdevice=5) xenapi_fake.create_vbd(vm_ref, vol_vdi_ref, userdevice=6, other_config={'osvol': True}) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) image_meta = {'id': IMAGE_VHD, 'disk_format': 'vhd', 'properties': {'vm_mode': 'xen'}} conn.rescue(self.context, instance, [], image_meta, '') vm = xenapi_fake.get_record('VM', vm_ref) rescue_name = "%s-rescue" % vm["name_label"] rescue_ref = vm_utils.lookup(session, rescue_name) rescue_vm = xenapi_fake.get_record('VM', rescue_ref) vdi_refs = {} for vbd_ref in rescue_vm['VBDs']: vbd = xenapi_fake.get_record('VBD', vbd_ref) vdi_refs[vbd['VDI']] = vbd['userdevice'] self.assertEqual('1', vdi_refs[root_vdi_ref]) self.assertEqual('2', vdi_refs[swap_vdi_ref]) self.assertEqual('4', vdi_refs[eph1_vdi_ref]) self.assertEqual('5', vdi_refs[eph2_vdi_ref]) self.assertNotIn(vol_vdi_ref, vdi_refs) def test_rescue_preserve_disk_on_failure(self): # test that the original disk is preserved if rescue setup fails # bug #1227898 instance = self._create_instance(obj=True) session = get_session() image_meta = {'id': IMAGE_VHD, 'disk_format': 'vhd', 'properties': {'vm_mode': 'xen'}} vm_ref = vm_utils.lookup(session, instance['name']) vdi_ref, vdi_rec = vm_utils.get_vdi_for_vm_safely(session, vm_ref) # raise an error in the spawn setup process and trigger the # undo manager logic: def fake_start(*args, **kwargs): raise test.TestingException('Start Error') self.stubs.Set(self.conn._vmops, '_start', fake_start) self.assertRaises(test.TestingException, self.conn.rescue, self.context, instance, [], image_meta, '') # confirm original disk still exists: vdi_ref2, vdi_rec2 = vm_utils.get_vdi_for_vm_safely(session, vm_ref) self.assertEqual(vdi_ref, vdi_ref2) self.assertEqual(vdi_rec['uuid'], vdi_rec2['uuid']) def test_unrescue(self): instance = self._create_instance(obj=True) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) # Unrescue expects the original instance to be powered off conn.power_off(instance) xenapi_fake.create_vm(instance['name'] + '-rescue', 'Running') conn.unrescue(instance, None) def test_unrescue_not_in_rescue(self): instance = self._create_instance(obj=True) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) # Ensure that it will not unrescue a non-rescued instance. self.assertRaises(exception.InstanceNotInRescueMode, conn.unrescue, instance, None) def test_finish_revert_migration(self): instance = self._create_instance() class VMOpsMock(object): def __init__(self): self.finish_revert_migration_called = False def finish_revert_migration(self, context, instance, block_info, power_on): self.finish_revert_migration_called = True conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) conn._vmops = VMOpsMock() conn.finish_revert_migration(self.context, instance, None) self.assertTrue(conn._vmops.finish_revert_migration_called) def test_reboot_hard(self): instance = self._create_instance() conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) conn.reboot(self.context, instance, None, "HARD") def test_poll_rebooting_instances(self): self.mox.StubOutWithMock(compute_api.API, 'reboot') compute_api.API.reboot(mox.IgnoreArg(), mox.IgnoreArg(), mox.IgnoreArg()) self.mox.ReplayAll() instance = self._create_instance() instances = [instance] conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) conn.poll_rebooting_instances(60, instances) def test_reboot_soft(self): instance = self._create_instance() conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) conn.reboot(self.context, instance, None, "SOFT") def test_reboot_halted(self): session = get_session() instance = self._create_instance(spawn=False) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) xenapi_fake.create_vm(instance['name'], 'Halted') conn.reboot(self.context, instance, None, "SOFT") vm_ref = vm_utils.lookup(session, instance['name']) vm = xenapi_fake.get_record('VM', vm_ref) self.assertEqual(vm['power_state'], 'Running') def test_reboot_unknown_state(self): instance = self._create_instance(spawn=False) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) xenapi_fake.create_vm(instance['name'], 'Unknown') self.assertRaises(xenapi_fake.Failure, conn.reboot, self.context, instance, None, "SOFT") def test_reboot_rescued(self): instance = self._create_instance() instance['vm_state'] = vm_states.RESCUED conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) real_result = vm_utils.lookup(conn._session, instance['name']) self.mox.StubOutWithMock(vm_utils, 'lookup') vm_utils.lookup(conn._session, instance['name'], True).AndReturn(real_result) self.mox.ReplayAll() conn.reboot(self.context, instance, None, "SOFT") def test_get_console_output_succeeds(self): def fake_get_console_output(instance): self.assertEqual("instance", instance) return "console_log" self.stubs.Set(self.conn._vmops, 'get_console_output', fake_get_console_output) self.assertEqual(self.conn.get_console_output('context', "instance"), "console_log") def _test_maintenance_mode(self, find_host, find_aggregate): real_call_xenapi = self.conn._session.call_xenapi instance = self._create_instance(spawn=True) api_calls = {} # Record all the xenapi calls, and return a fake list of hosts # for the host.get_all call def fake_call_xenapi(method, *args): api_calls[method] = args if method == 'host.get_all': return ['foo', 'bar', 'baz'] return real_call_xenapi(method, *args) self.stubs.Set(self.conn._session, 'call_xenapi', fake_call_xenapi) def fake_aggregate_get(context, host, key): if find_aggregate: return [test_aggregate.fake_aggregate] else: return [] self.stubs.Set(db, 'aggregate_get_by_host', fake_aggregate_get) def fake_host_find(context, session, src, dst): if find_host: return 'bar' else: raise exception.NoValidHost("I saw this one coming...") self.stubs.Set(host, '_host_find', fake_host_find) result = self.conn.host_maintenance_mode('bar', 'on_maintenance') self.assertEqual(result, 'on_maintenance') # We expect the VM.pool_migrate call to have been called to # migrate our instance to the 'bar' host vm_ref = vm_utils.lookup(self.conn._session, instance['name']) host_ref = "foo" expected = (vm_ref, host_ref, {"live": "true"}) self.assertEqual(api_calls.get('VM.pool_migrate'), expected) instance = db.instance_get_by_uuid(self.context, instance['uuid']) self.assertEqual(instance['vm_state'], vm_states.ACTIVE) self.assertEqual(instance['task_state'], task_states.MIGRATING) def test_maintenance_mode(self): self._test_maintenance_mode(True, True) def test_maintenance_mode_no_host(self): self.assertRaises(exception.NoValidHost, self._test_maintenance_mode, False, True) def test_maintenance_mode_no_aggregate(self): self.assertRaises(exception.NotFound, self._test_maintenance_mode, True, False) def test_uuid_find(self): self.mox.StubOutWithMock(db, 'instance_get_all_by_host') fake_inst = fake_instance.fake_db_instance(id=123) fake_inst2 = fake_instance.fake_db_instance(id=456) db.instance_get_all_by_host(self.context, fake_inst['host'], columns_to_join=None, use_slave=False ).AndReturn([fake_inst, fake_inst2]) self.mox.ReplayAll() expected_name = CONF.instance_name_template % fake_inst['id'] inst_uuid = host._uuid_find(self.context, fake_inst['host'], expected_name) self.assertEqual(inst_uuid, fake_inst['uuid']) def test_session_virtapi(self): was = {'called': False} def fake_aggregate_get_by_host(self, *args, **kwargs): was['called'] = True raise test.TestingException() self.stubs.Set(db, "aggregate_get_by_host", fake_aggregate_get_by_host) self.stubs.Set(self.conn._session, "is_slave", True) self.assertRaises(test.TestingException, self.conn._session._get_host_uuid) self.assertTrue(was['called']) def test_session_handles_aggregate_metadata(self): def fake_aggregate_get(context, host, key): agg = copy.copy(test_aggregate.fake_aggregate) agg['metadetails'][CONF.host] = 'this_should_be_metadata' return [agg] self.stubs.Set(db, 'aggregate_get_by_host', fake_aggregate_get) self.stubs.Set(self.conn._session, "is_slave", True) self.assertEqual('this_should_be_metadata', self.conn._session._get_host_uuid()) def test_per_instance_usage_running(self): instance = self._create_instance(spawn=True) flavor = objects.Flavor.get_by_id(self.context, 3) expected = {instance['uuid']: {'memory_mb': flavor['memory_mb'], 'uuid': instance['uuid']}} actual = self.conn.get_per_instance_usage() self.assertEqual(expected, actual) # Paused instances still consume resources: self.conn.pause(instance) actual = self.conn.get_per_instance_usage() self.assertEqual(expected, actual) def test_per_instance_usage_suspended(self): # Suspended instances do not consume memory: instance = self._create_instance(spawn=True) self.conn.suspend(self.context, instance) actual = self.conn.get_per_instance_usage() self.assertEqual({}, actual) def test_per_instance_usage_halted(self): instance = self._create_instance(spawn=True, obj=True) self.conn.power_off(instance) actual = self.conn.get_per_instance_usage() self.assertEqual({}, actual) def _create_instance(self, spawn=True, obj=False, **attrs): """Creates and spawns a test instance.""" instance_values = { 'uuid': str(uuid.uuid4()), 'display_name': 'host-', 'project_id': self.project_id, 'user_id': self.user_id, 'image_ref': 1, 'kernel_id': 2, 'ramdisk_id': 3, 'root_gb': 80, 'ephemeral_gb': 0, 'instance_type_id': '3', # m1.large 'os_type': 'linux', 'vm_mode': 'hvm', 'architecture': 'x86-64'} instance_values.update(attrs) instance = create_instance_with_system_metadata(self.context, instance_values) network_info = fake_network.fake_get_instance_nw_info(self.stubs) image_meta = {'id': IMAGE_VHD, 'disk_format': 'vhd'} if spawn: self.conn.spawn(self.context, instance, image_meta, [], 'herp', network_info) if obj: return instance return base.obj_to_primitive(instance) def test_destroy_clean_up_kernel_and_ramdisk(self): def fake_lookup_kernel_ramdisk(session, vm_ref): return "kernel", "ramdisk" self.stubs.Set(vm_utils, "lookup_kernel_ramdisk", fake_lookup_kernel_ramdisk) def fake_destroy_kernel_ramdisk(session, instance, kernel, ramdisk): fake_destroy_kernel_ramdisk.called = True self.assertEqual("kernel", kernel) self.assertEqual("ramdisk", ramdisk) fake_destroy_kernel_ramdisk.called = False self.stubs.Set(vm_utils, "destroy_kernel_ramdisk", fake_destroy_kernel_ramdisk) instance = self._create_instance(spawn=True, obj=True) network_info = fake_network.fake_get_instance_nw_info(self.stubs) self.conn.destroy(self.context, instance, network_info) vm_ref = vm_utils.lookup(self.conn._session, instance['name']) self.assertIsNone(vm_ref) self.assertTrue(fake_destroy_kernel_ramdisk.called) class XenAPIDiffieHellmanTestCase(test.NoDBTestCase): """Unit tests for Diffie-Hellman code.""" def setUp(self): super(XenAPIDiffieHellmanTestCase, self).setUp() self.alice = agent.SimpleDH() self.bob = agent.SimpleDH() def test_shared(self): alice_pub = self.alice.get_public() bob_pub = self.bob.get_public() alice_shared = self.alice.compute_shared(bob_pub) bob_shared = self.bob.compute_shared(alice_pub) self.assertEqual(alice_shared, bob_shared) def _test_encryption(self, message): enc = self.alice.encrypt(message) self.assertFalse(enc.endswith('\n')) dec = self.bob.decrypt(enc) self.assertEqual(dec, message) def test_encrypt_simple_message(self): self._test_encryption('This is a simple message.') def test_encrypt_message_with_newlines_at_end(self): self._test_encryption('This message has a newline at the end.\n') def test_encrypt_many_newlines_at_end(self): self._test_encryption('Message with lotsa newlines.\n\n\n') def test_encrypt_newlines_inside_message(self): self._test_encryption('Message\nwith\ninterior\nnewlines.') def test_encrypt_with_leading_newlines(self): self._test_encryption('\n\nMessage with leading newlines.') def test_encrypt_really_long_message(self): self._test_encryption(''.join(['abcd' for i in range(1024)])) # FIXME(sirp): convert this to use XenAPITestBaseNoDB class XenAPIMigrateInstance(stubs.XenAPITestBase): """Unit test for verifying migration-related actions.""" REQUIRES_LOCKING = True def setUp(self): super(XenAPIMigrateInstance, self).setUp() self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.flags(firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) db_fakes.stub_out_db_instance_api(self.stubs) xenapi_fake.create_network('fake', 'fake_br1') self.user_id = 'fake' self.project_id = 'fake' self.context = context.RequestContext(self.user_id, self.project_id) self.instance_values = { 'project_id': self.project_id, 'user_id': self.user_id, 'image_ref': 1, 'kernel_id': None, 'ramdisk_id': None, 'root_gb': 80, 'ephemeral_gb': 0, 'instance_type_id': '3', # m1.large 'os_type': 'linux', 'architecture': 'x86-64'} migration_values = { 'source_compute': 'nova-compute', 'dest_compute': 'nova-compute', 'dest_host': '10.127.5.114', 'status': 'post-migrating', 'instance_uuid': '15f23e6a-cc6e-4d22-b651-d9bdaac316f7', 'old_instance_type_id': 5, 'new_instance_type_id': 1 } self.migration = db.migration_create( context.get_admin_context(), migration_values) fake_processutils.stub_out_processutils_execute(self.stubs) stubs.stub_out_migration_methods(self.stubs) stubs.stubout_get_this_vm_uuid(self.stubs) def fake_inject_instance_metadata(self, instance, vm): pass self.stubs.Set(vmops.VMOps, '_inject_instance_metadata', fake_inject_instance_metadata) def test_migrate_disk_and_power_off(self): instance = db.instance_create(self.context, self.instance_values) xenapi_fake.create_vm(instance['name'], 'Running') flavor = fake_flavor.fake_flavor_obj(self.context, root_gb=80, ephemeral_gb=0) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vm_ref = vm_utils.lookup(conn._session, instance['name']) self.mox.StubOutWithMock(volume_utils, 'is_booted_from_volume') volume_utils.is_booted_from_volume(conn._session, vm_ref) self.mox.ReplayAll() conn.migrate_disk_and_power_off(self.context, instance, '127.0.0.1', flavor, None) def test_migrate_disk_and_power_off_passes_exceptions(self): instance = db.instance_create(self.context, self.instance_values) xenapi_fake.create_vm(instance['name'], 'Running') flavor = fake_flavor.fake_flavor_obj(self.context, root_gb=80, ephemeral_gb=0) def fake_raise(*args, **kwargs): raise exception.MigrationError(reason='test failure') self.stubs.Set(vmops.VMOps, "_migrate_disk_resizing_up", fake_raise) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.assertRaises(exception.MigrationError, conn.migrate_disk_and_power_off, self.context, instance, '127.0.0.1', flavor, None) def test_migrate_disk_and_power_off_throws_on_zero_gb_resize_down(self): instance = db.instance_create(self.context, self.instance_values) flavor = fake_flavor.fake_flavor_obj(self.context, root_gb=0, ephemeral_gb=0) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.assertRaises(exception.ResizeError, conn.migrate_disk_and_power_off, self.context, instance, 'fake_dest', flavor, None) def test_migrate_disk_and_power_off_with_zero_gb_old_and_new_works(self): flavor = fake_flavor.fake_flavor_obj(self.context, root_gb=0, ephemeral_gb=0) values = copy.copy(self.instance_values) values["root_gb"] = 0 values["ephemeral_gb"] = 0 instance = db.instance_create(self.context, values) xenapi_fake.create_vm(instance['name'], 'Running') conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vm_ref = vm_utils.lookup(conn._session, instance['name']) self.mox.StubOutWithMock(volume_utils, 'is_booted_from_volume') volume_utils.is_booted_from_volume(conn._session, vm_ref) self.mox.ReplayAll() conn.migrate_disk_and_power_off(self.context, instance, '127.0.0.1', flavor, None) def _test_revert_migrate(self, power_on): instance = create_instance_with_system_metadata(self.context, self.instance_values) self.called = False self.fake_vm_start_called = False self.fake_finish_revert_migration_called = False context = 'fake_context' def fake_vm_start(*args, **kwargs): self.fake_vm_start_called = True def fake_vdi_resize(*args, **kwargs): self.called = True def fake_finish_revert_migration(*args, **kwargs): self.fake_finish_revert_migration_called = True self.stubs.Set(stubs.FakeSessionForVMTests, "VDI_resize_online", fake_vdi_resize) self.stubs.Set(vmops.VMOps, '_start', fake_vm_start) self.stubs.Set(vmops.VMOps, 'finish_revert_migration', fake_finish_revert_migration) stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests, product_version=(4, 0, 0), product_brand='XenServer') self.mox.StubOutWithMock(volume_utils, 'is_booted_from_volume') conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) network_info = fake_network.fake_get_instance_nw_info(self.stubs) image_meta = {'id': instance['image_ref'], 'disk_format': 'vhd'} base = xenapi_fake.create_vdi('hurr', 'fake') base_uuid = xenapi_fake.get_record('VDI', base)['uuid'] cow = xenapi_fake.create_vdi('durr', 'fake') cow_uuid = xenapi_fake.get_record('VDI', cow)['uuid'] conn.finish_migration(self.context, self.migration, instance, dict(base_copy=base_uuid, cow=cow_uuid), network_info, image_meta, resize_instance=True, block_device_info=None, power_on=power_on) self.assertEqual(self.called, True) self.assertEqual(self.fake_vm_start_called, power_on) conn.finish_revert_migration(context, instance, network_info) self.assertEqual(self.fake_finish_revert_migration_called, True) def test_revert_migrate_power_on(self): self._test_revert_migrate(True) def test_revert_migrate_power_off(self): self._test_revert_migrate(False) def _test_finish_migrate(self, power_on): instance = create_instance_with_system_metadata(self.context, self.instance_values) self.called = False self.fake_vm_start_called = False def fake_vm_start(*args, **kwargs): self.fake_vm_start_called = True def fake_vdi_resize(*args, **kwargs): self.called = True self.stubs.Set(vmops.VMOps, '_start', fake_vm_start) self.stubs.Set(stubs.FakeSessionForVMTests, "VDI_resize_online", fake_vdi_resize) stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests, product_version=(4, 0, 0), product_brand='XenServer') conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) network_info = fake_network.fake_get_instance_nw_info(self.stubs) image_meta = {'id': instance['image_ref'], 'disk_format': 'vhd'} conn.finish_migration(self.context, self.migration, instance, dict(base_copy='hurr', cow='durr'), network_info, image_meta, resize_instance=True, block_device_info=None, power_on=power_on) self.assertEqual(self.called, True) self.assertEqual(self.fake_vm_start_called, power_on) def test_finish_migrate_power_on(self): self._test_finish_migrate(True) def test_finish_migrate_power_off(self): self._test_finish_migrate(False) def test_finish_migrate_no_local_storage(self): values = copy.copy(self.instance_values) values["root_gb"] = 0 values["ephemeral_gb"] = 0 instance = create_instance_with_system_metadata(self.context, values) def fake_vdi_resize(*args, **kwargs): raise Exception("This shouldn't be called") self.stubs.Set(stubs.FakeSessionForVMTests, "VDI_resize_online", fake_vdi_resize) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) network_info = fake_network.fake_get_instance_nw_info(self.stubs) image_meta = {'id': instance['image_ref'], 'disk_format': 'vhd'} conn.finish_migration(self.context, self.migration, instance, dict(base_copy='hurr', cow='durr'), network_info, image_meta, resize_instance=True) def test_finish_migrate_no_resize_vdi(self): instance = create_instance_with_system_metadata(self.context, self.instance_values) def fake_vdi_resize(*args, **kwargs): raise Exception("This shouldn't be called") self.stubs.Set(stubs.FakeSessionForVMTests, "VDI_resize_online", fake_vdi_resize) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) network_info = fake_network.fake_get_instance_nw_info(self.stubs) # Resize instance would be determined by the compute call image_meta = {'id': instance['image_ref'], 'disk_format': 'vhd'} conn.finish_migration(self.context, self.migration, instance, dict(base_copy='hurr', cow='durr'), network_info, image_meta, resize_instance=False) @stub_vm_utils_with_vdi_attached_here def test_migrate_too_many_partitions_no_resize_down(self): instance_values = self.instance_values instance = db.instance_create(self.context, instance_values) xenapi_fake.create_vm(instance['name'], 'Running') flavor = db.flavor_get_by_name(self.context, 'm1.small') flavor = fake_flavor.fake_flavor_obj(self.context, **flavor) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def fake_get_partitions(partition): return [(1, 2, 3, 4, "", ""), (1, 2, 3, 4, "", "")] self.stubs.Set(vm_utils, '_get_partitions', fake_get_partitions) self.assertRaises(exception.InstanceFaultRollback, conn.migrate_disk_and_power_off, self.context, instance, '127.0.0.1', flavor, None) @stub_vm_utils_with_vdi_attached_here def test_migrate_bad_fs_type_no_resize_down(self): instance_values = self.instance_values instance = db.instance_create(self.context, instance_values) xenapi_fake.create_vm(instance['name'], 'Running') flavor = db.flavor_get_by_name(self.context, 'm1.small') flavor = fake_flavor.fake_flavor_obj(self.context, **flavor) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def fake_get_partitions(partition): return [(1, 2, 3, "ext2", "", "boot")] self.stubs.Set(vm_utils, '_get_partitions', fake_get_partitions) self.assertRaises(exception.InstanceFaultRollback, conn.migrate_disk_and_power_off, self.context, instance, '127.0.0.1', flavor, None) def test_migrate_rollback_when_resize_down_fs_fails(self): conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vmops = conn._vmops self.mox.StubOutWithMock(vmops, '_resize_ensure_vm_is_shutdown') self.mox.StubOutWithMock(vmops, '_apply_orig_vm_name_label') self.mox.StubOutWithMock(vm_utils, 'resize_disk') self.mox.StubOutWithMock(vm_utils, 'migrate_vhd') self.mox.StubOutWithMock(vm_utils, 'destroy_vdi') self.mox.StubOutWithMock(vm_utils, 'get_vdi_for_vm_safely') self.mox.StubOutWithMock(vmops, '_restore_orig_vm_and_cleanup_orphan') instance = objects.Instance(context=self.context, auto_disk_config=True, uuid='uuid') instance.obj_reset_changes() vm_ref = "vm_ref" dest = "dest" flavor = "type" sr_path = "sr_path" vmops._resize_ensure_vm_is_shutdown(instance, vm_ref) vmops._apply_orig_vm_name_label(instance, vm_ref) old_vdi_ref = "old_ref" vm_utils.get_vdi_for_vm_safely(vmops._session, vm_ref).AndReturn( (old_vdi_ref, None)) new_vdi_ref = "new_ref" new_vdi_uuid = "new_uuid" vm_utils.resize_disk(vmops._session, instance, old_vdi_ref, flavor).AndReturn((new_vdi_ref, new_vdi_uuid)) vm_utils.migrate_vhd(vmops._session, instance, new_vdi_uuid, dest, sr_path, 0).AndRaise( exception.ResizeError(reason="asdf")) vm_utils.destroy_vdi(vmops._session, new_vdi_ref) vmops._restore_orig_vm_and_cleanup_orphan(instance) self.mox.ReplayAll() with mock.patch.object(instance, 'save') as mock_save: self.assertRaises(exception.InstanceFaultRollback, vmops._migrate_disk_resizing_down, self.context, instance, dest, flavor, vm_ref, sr_path) self.assertEqual(3, mock_save.call_count) self.assertEqual(60.0, instance.progress) def test_resize_ensure_vm_is_shutdown_cleanly(self): conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vmops = conn._vmops fake_instance = {'uuid': 'uuid'} self.mox.StubOutWithMock(vm_utils, 'is_vm_shutdown') self.mox.StubOutWithMock(vm_utils, 'clean_shutdown_vm') self.mox.StubOutWithMock(vm_utils, 'hard_shutdown_vm') vm_utils.is_vm_shutdown(vmops._session, "ref").AndReturn(False) vm_utils.clean_shutdown_vm(vmops._session, fake_instance, "ref").AndReturn(True) self.mox.ReplayAll() vmops._resize_ensure_vm_is_shutdown(fake_instance, "ref") def test_resize_ensure_vm_is_shutdown_forced(self): conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vmops = conn._vmops fake_instance = {'uuid': 'uuid'} self.mox.StubOutWithMock(vm_utils, 'is_vm_shutdown') self.mox.StubOutWithMock(vm_utils, 'clean_shutdown_vm') self.mox.StubOutWithMock(vm_utils, 'hard_shutdown_vm') vm_utils.is_vm_shutdown(vmops._session, "ref").AndReturn(False) vm_utils.clean_shutdown_vm(vmops._session, fake_instance, "ref").AndReturn(False) vm_utils.hard_shutdown_vm(vmops._session, fake_instance, "ref").AndReturn(True) self.mox.ReplayAll() vmops._resize_ensure_vm_is_shutdown(fake_instance, "ref") def test_resize_ensure_vm_is_shutdown_fails(self): conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vmops = conn._vmops fake_instance = {'uuid': 'uuid'} self.mox.StubOutWithMock(vm_utils, 'is_vm_shutdown') self.mox.StubOutWithMock(vm_utils, 'clean_shutdown_vm') self.mox.StubOutWithMock(vm_utils, 'hard_shutdown_vm') vm_utils.is_vm_shutdown(vmops._session, "ref").AndReturn(False) vm_utils.clean_shutdown_vm(vmops._session, fake_instance, "ref").AndReturn(False) vm_utils.hard_shutdown_vm(vmops._session, fake_instance, "ref").AndReturn(False) self.mox.ReplayAll() self.assertRaises(exception.ResizeError, vmops._resize_ensure_vm_is_shutdown, fake_instance, "ref") def test_resize_ensure_vm_is_shutdown_already_shutdown(self): conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vmops = conn._vmops fake_instance = {'uuid': 'uuid'} self.mox.StubOutWithMock(vm_utils, 'is_vm_shutdown') self.mox.StubOutWithMock(vm_utils, 'clean_shutdown_vm') self.mox.StubOutWithMock(vm_utils, 'hard_shutdown_vm') vm_utils.is_vm_shutdown(vmops._session, "ref").AndReturn(True) self.mox.ReplayAll() vmops._resize_ensure_vm_is_shutdown(fake_instance, "ref") class XenAPIImageTypeTestCase(test.NoDBTestCase): """Test ImageType class.""" def test_to_string(self): # Can convert from type id to type string. self.assertEqual( vm_utils.ImageType.to_string(vm_utils.ImageType.KERNEL), vm_utils.ImageType.KERNEL_STR) def _assert_role(self, expected_role, image_type_id): self.assertEqual( expected_role, vm_utils.ImageType.get_role(image_type_id)) def test_get_image_role_kernel(self): self._assert_role('kernel', vm_utils.ImageType.KERNEL) def test_get_image_role_ramdisk(self): self._assert_role('ramdisk', vm_utils.ImageType.RAMDISK) def test_get_image_role_disk(self): self._assert_role('root', vm_utils.ImageType.DISK) def test_get_image_role_disk_raw(self): self._assert_role('root', vm_utils.ImageType.DISK_RAW) def test_get_image_role_disk_vhd(self): self._assert_role('root', vm_utils.ImageType.DISK_VHD) class XenAPIDetermineDiskImageTestCase(test.NoDBTestCase): """Unit tests for code that detects the ImageType.""" def assert_disk_type(self, image_meta, expected_disk_type): actual = vm_utils.determine_disk_image_type(image_meta) self.assertEqual(expected_disk_type, actual) def test_machine(self): image_meta = objects.ImageMeta.from_dict( {'disk_format': 'ami'}) self.assert_disk_type(image_meta, vm_utils.ImageType.DISK) def test_raw(self): image_meta = objects.ImageMeta.from_dict( {'disk_format': 'raw'}) self.assert_disk_type(image_meta, vm_utils.ImageType.DISK_RAW) def test_vhd(self): image_meta = objects.ImageMeta.from_dict( {'disk_format': 'vhd'}) self.assert_disk_type(image_meta, vm_utils.ImageType.DISK_VHD) # FIXME(sirp): convert this to use XenAPITestBaseNoDB class XenAPIHostTestCase(stubs.XenAPITestBase): """Tests HostState, which holds metrics from XenServer that get reported back to the Schedulers. """ def setUp(self): super(XenAPIHostTestCase, self).setUp() self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.context = context.get_admin_context() self.flags(use_local=True, group='conductor') self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.instance = fake_instance.fake_db_instance(name='foo') def test_host_state(self): stats = self.conn.host_state.get_host_stats(False) # Values from fake.create_local_srs (ext SR) self.assertEqual(stats['disk_total'], 40000) self.assertEqual(stats['disk_used'], 20000) # Values from fake._plugin_xenhost_host_data self.assertEqual(stats['host_memory_total'], 10) self.assertEqual(stats['host_memory_overhead'], 20) self.assertEqual(stats['host_memory_free'], 30) self.assertEqual(stats['host_memory_free_computed'], 40) self.assertEqual(stats['hypervisor_hostname'], 'fake-xenhost') self.assertEqual(stats['host_cpu_info']['cpu_count'], 4) self.assertThat({ 'vendor': 'GenuineIntel', 'model': 'Intel(R) Xeon(R) CPU X3430 @ 2.40GHz', 'topology': { 'sockets': 1, 'cores': 4, 'threads': 1, }, 'features': [ 'fpu', 'de', 'tsc', 'msr', 'pae', 'mce', 'cx8', 'apic', 'sep', 'mtrr', 'mca', 'cmov', 'pat', 'clflush', 'acpi', 'mmx', 'fxsr', 'sse', 'sse2', 'ss', 'ht', 'nx', 'constant_tsc', 'nonstop_tsc', 'aperfmperf', 'pni', 'vmx', 'est', 'ssse3', 'sse4_1', 'sse4_2', 'popcnt', 'hypervisor', 'ida', 'tpr_shadow', 'vnmi', 'flexpriority', 'ept', 'vpid', ]}, matchers.DictMatches(stats['cpu_model'])) # No VMs running self.assertEqual(stats['vcpus_used'], 0) def test_host_state_vcpus_used(self): stats = self.conn.host_state.get_host_stats(True) self.assertEqual(stats['vcpus_used'], 0) xenapi_fake.create_vm(self.instance['name'], 'Running') stats = self.conn.host_state.get_host_stats(True) self.assertEqual(stats['vcpus_used'], 4) def test_pci_passthrough_devices(self): stats = self.conn.host_state.get_host_stats(False) self.assertEqual(len(stats['pci_passthrough_devices']), 2) def test_host_state_missing_sr(self): # Must trigger construction of 'host_state' property # before introducing the stub which raises the error hs = self.conn.host_state def fake_safe_find_sr(session): raise exception.StorageRepositoryNotFound('not there') self.stubs.Set(vm_utils, 'safe_find_sr', fake_safe_find_sr) self.assertRaises(exception.StorageRepositoryNotFound, hs.get_host_stats, refresh=True) def _test_host_action(self, method, action, expected=None): result = method('host', action) if not expected: expected = action self.assertEqual(result, expected) def _test_host_action_no_param(self, method, action, expected=None): result = method(action) if not expected: expected = action self.assertEqual(result, expected) def test_host_reboot(self): self._test_host_action_no_param(self.conn.host_power_action, 'reboot') def test_host_shutdown(self): self._test_host_action_no_param(self.conn.host_power_action, 'shutdown') def test_host_startup(self): self.assertRaises(NotImplementedError, self.conn.host_power_action, 'startup') def test_host_maintenance_on(self): self._test_host_action(self.conn.host_maintenance_mode, True, 'on_maintenance') def test_host_maintenance_off(self): self._test_host_action(self.conn.host_maintenance_mode, False, 'off_maintenance') def test_set_enable_host_enable(self): _create_service_entries(self.context, values={'nova': ['fake-mini']}) self._test_host_action_no_param(self.conn.set_host_enabled, True, 'enabled') service = db.service_get_by_host_and_binary(self.context, 'fake-mini', 'nova-compute') self.assertEqual(service.disabled, False) def test_set_enable_host_disable(self): _create_service_entries(self.context, values={'nova': ['fake-mini']}) self._test_host_action_no_param(self.conn.set_host_enabled, False, 'disabled') service = db.service_get_by_host_and_binary(self.context, 'fake-mini', 'nova-compute') self.assertEqual(service.disabled, True) def test_get_host_uptime(self): result = self.conn.get_host_uptime() self.assertEqual(result, 'fake uptime') def test_supported_instances_is_included_in_host_state(self): stats = self.conn.host_state.get_host_stats(False) self.assertIn('supported_instances', stats) def test_supported_instances_is_calculated_by_to_supported_instances(self): def to_supported_instances(somedata): return "SOMERETURNVALUE" self.stubs.Set(host, 'to_supported_instances', to_supported_instances) stats = self.conn.host_state.get_host_stats(False) self.assertEqual("SOMERETURNVALUE", stats['supported_instances']) def test_update_stats_caches_hostname(self): self.mox.StubOutWithMock(host, 'call_xenhost') self.mox.StubOutWithMock(vm_utils, 'scan_default_sr') self.mox.StubOutWithMock(vm_utils, 'list_vms') self.mox.StubOutWithMock(self.conn._session, 'call_xenapi') data = {'disk_total': 0, 'disk_used': 0, 'disk_available': 0, 'supported_instances': 0, 'host_capabilities': [], 'host_hostname': 'foo', 'vcpus_used': 0, } sr_rec = { 'physical_size': 0, 'physical_utilisation': 0, 'virtual_allocation': 0, } for i in range(3): host.call_xenhost(mox.IgnoreArg(), 'host_data', {}).AndReturn(data) vm_utils.scan_default_sr(self.conn._session).AndReturn("ref") vm_utils.list_vms(self.conn._session).AndReturn([]) self.conn._session.call_xenapi('SR.get_record', "ref").AndReturn( sr_rec) if i == 2: # On the third call (the second below) change the hostname data = dict(data, host_hostname='bar') self.mox.ReplayAll() stats = self.conn.host_state.get_host_stats(refresh=True) self.assertEqual('foo', stats['hypervisor_hostname']) stats = self.conn.host_state.get_host_stats(refresh=True) self.assertEqual('foo', stats['hypervisor_hostname']) class ToSupportedInstancesTestCase(test.NoDBTestCase): def test_default_return_value(self): self.assertEqual([], host.to_supported_instances(None)) def test_return_value(self): self.assertEqual([(arch.X86_64, hv_type.XEN, 'xen')], host.to_supported_instances([u'xen-3.0-x86_64'])) def test_invalid_values_do_not_break(self): self.assertEqual([(arch.X86_64, hv_type.XEN, 'xen')], host.to_supported_instances([u'xen-3.0-x86_64', 'spam'])) def test_multiple_values(self): self.assertEqual( [ (arch.X86_64, hv_type.XEN, 'xen'), (arch.I686, hv_type.XEN, 'hvm') ], host.to_supported_instances([u'xen-3.0-x86_64', 'hvm-3.0-x86_32']) ) # FIXME(sirp): convert this to use XenAPITestBaseNoDB class XenAPIAutoDiskConfigTestCase(stubs.XenAPITestBase): def setUp(self): super(XenAPIAutoDiskConfigTestCase, self).setUp() self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.flags(firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.user_id = 'fake' self.project_id = 'fake' self.instance_values = { 'project_id': self.project_id, 'user_id': self.user_id, 'image_ref': 1, 'kernel_id': 2, 'ramdisk_id': 3, 'root_gb': 80, 'ephemeral_gb': 0, 'instance_type_id': '3', # m1.large 'os_type': 'linux', 'architecture': 'x86-64'} self.context = context.RequestContext(self.user_id, self.project_id) def fake_create_vbd(session, vm_ref, vdi_ref, userdevice, vbd_type='disk', read_only=False, bootable=True, osvol=False): pass self.stubs.Set(vm_utils, 'create_vbd', fake_create_vbd) def assertIsPartitionCalled(self, called): marker = {"partition_called": False} def fake_resize_part_and_fs(dev, start, old_sectors, new_sectors, flags): marker["partition_called"] = True self.stubs.Set(vm_utils, "_resize_part_and_fs", fake_resize_part_and_fs) context.RequestContext(self.user_id, self.project_id) session = get_session() disk_image_type = vm_utils.ImageType.DISK_VHD instance = create_instance_with_system_metadata(self.context, self.instance_values) vm_ref = xenapi_fake.create_vm(instance['name'], 'Halted') vdi_ref = xenapi_fake.create_vdi(instance['name'], 'fake') vdi_uuid = session.call_xenapi('VDI.get_record', vdi_ref)['uuid'] vdis = {'root': {'uuid': vdi_uuid, 'ref': vdi_ref}} image_meta = {'id': 'null', 'disk_format': 'vhd', 'properties': {'vm_mode': 'xen'}} self.conn._vmops._attach_disks(instance, image_meta, vm_ref, instance['name'], vdis, disk_image_type, "fake_nw_inf") self.assertEqual(marker["partition_called"], called) def test_instance_not_auto_disk_config(self): """Should not partition unless instance is marked as auto_disk_config. """ self.instance_values['auto_disk_config'] = False self.assertIsPartitionCalled(False) @stub_vm_utils_with_vdi_attached_here def test_instance_auto_disk_config_fails_safe_two_partitions(self): # Should not partition unless fail safes pass. self.instance_values['auto_disk_config'] = True def fake_get_partitions(dev): return [(1, 0, 100, 'ext4', "", ""), (2, 100, 200, 'ext4' "", "")] self.stubs.Set(vm_utils, "_get_partitions", fake_get_partitions) self.assertIsPartitionCalled(False) @stub_vm_utils_with_vdi_attached_here def test_instance_auto_disk_config_fails_safe_badly_numbered(self): # Should not partition unless fail safes pass. self.instance_values['auto_disk_config'] = True def fake_get_partitions(dev): return [(2, 100, 200, 'ext4', "", "")] self.stubs.Set(vm_utils, "_get_partitions", fake_get_partitions) self.assertIsPartitionCalled(False) @stub_vm_utils_with_vdi_attached_here def test_instance_auto_disk_config_fails_safe_bad_fstype(self): # Should not partition unless fail safes pass. self.instance_values['auto_disk_config'] = True def fake_get_partitions(dev): return [(1, 100, 200, 'asdf', "", "")] self.stubs.Set(vm_utils, "_get_partitions", fake_get_partitions) self.assertIsPartitionCalled(False) @stub_vm_utils_with_vdi_attached_here def test_instance_auto_disk_config_passes_fail_safes(self): """Should partition if instance is marked as auto_disk_config=True and virt-layer specific fail-safe checks pass. """ self.instance_values['auto_disk_config'] = True def fake_get_partitions(dev): return [(1, 0, 100, 'ext4', "", "boot")] self.stubs.Set(vm_utils, "_get_partitions", fake_get_partitions) self.assertIsPartitionCalled(True) # FIXME(sirp): convert this to use XenAPITestBaseNoDB class XenAPIGenerateLocal(stubs.XenAPITestBase): """Test generating of local disks, like swap and ephemeral.""" def setUp(self): super(XenAPIGenerateLocal, self).setUp() self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.flags(firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) db_fakes.stub_out_db_instance_api(self.stubs) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.user_id = 'fake' self.project_id = 'fake' self.instance_values = { 'project_id': self.project_id, 'user_id': self.user_id, 'image_ref': 1, 'kernel_id': 2, 'ramdisk_id': 3, 'root_gb': 80, 'ephemeral_gb': 0, 'instance_type_id': '3', # m1.large 'os_type': 'linux', 'architecture': 'x86-64'} self.context = context.RequestContext(self.user_id, self.project_id) def fake_create_vbd(session, vm_ref, vdi_ref, userdevice, vbd_type='disk', read_only=False, bootable=True, osvol=False, empty=False, unpluggable=True): return session.call_xenapi('VBD.create', {'VM': vm_ref, 'VDI': vdi_ref}) self.stubs.Set(vm_utils, 'create_vbd', fake_create_vbd) def assertCalled(self, instance, disk_image_type=vm_utils.ImageType.DISK_VHD): context.RequestContext(self.user_id, self.project_id) session = get_session() vm_ref = xenapi_fake.create_vm(instance['name'], 'Halted') vdi_ref = xenapi_fake.create_vdi(instance['name'], 'fake') vdi_uuid = session.call_xenapi('VDI.get_record', vdi_ref)['uuid'] vdi_key = 'root' if disk_image_type == vm_utils.ImageType.DISK_ISO: vdi_key = 'iso' vdis = {vdi_key: {'uuid': vdi_uuid, 'ref': vdi_ref}} self.called = False image_meta = {'id': 'null', 'disk_format': 'vhd', 'properties': {'vm_mode': 'xen'}} self.conn._vmops._attach_disks(instance, image_meta, vm_ref, instance['name'], vdis, disk_image_type, "fake_nw_inf") self.assertTrue(self.called) def test_generate_swap(self): # Test swap disk generation. instance_values = dict(self.instance_values, instance_type_id=5) instance = create_instance_with_system_metadata(self.context, instance_values) def fake_generate_swap(*args, **kwargs): self.called = True self.stubs.Set(vm_utils, 'generate_swap', fake_generate_swap) self.assertCalled(instance) def test_generate_ephemeral(self): # Test ephemeral disk generation. instance_values = dict(self.instance_values, instance_type_id=4) instance = create_instance_with_system_metadata(self.context, instance_values) def fake_generate_ephemeral(*args): self.called = True self.stubs.Set(vm_utils, 'generate_ephemeral', fake_generate_ephemeral) self.assertCalled(instance) def test_generate_iso_blank_root_disk(self): instance_values = dict(self.instance_values, instance_type_id=4) instance_values.pop('kernel_id') instance_values.pop('ramdisk_id') instance = create_instance_with_system_metadata(self.context, instance_values) def fake_generate_ephemeral(*args): pass self.stubs.Set(vm_utils, 'generate_ephemeral', fake_generate_ephemeral) def fake_generate_iso(*args): self.called = True self.stubs.Set(vm_utils, 'generate_iso_blank_root_disk', fake_generate_iso) self.assertCalled(instance, vm_utils.ImageType.DISK_ISO) class XenAPIBWCountersTestCase(stubs.XenAPITestBaseNoDB): FAKE_VMS = {'test1:ref': dict(name_label='test1', other_config=dict(nova_uuid='hash'), domid='12', _vifmap={'0': "a:b:c:d...", '1': "e:f:12:q..."}), 'test2:ref': dict(name_label='test2', other_config=dict(nova_uuid='hash'), domid='42', _vifmap={'0': "a:3:c:d...", '1': "e:f:42:q..."}), } def setUp(self): super(XenAPIBWCountersTestCase, self).setUp() self.stubs.Set(vm_utils, 'list_vms', XenAPIBWCountersTestCase._fake_list_vms) self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.flags(firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def _fake_get_vif_device_map(vm_rec): return vm_rec['_vifmap'] self.stubs.Set(self.conn._vmops, "_get_vif_device_map", _fake_get_vif_device_map) @classmethod def _fake_list_vms(cls, session): return six.iteritems(cls.FAKE_VMS) @staticmethod def _fake_fetch_bandwidth_mt(session): return {} @staticmethod def _fake_fetch_bandwidth(session): return {'42': {'0': {'bw_in': 21024, 'bw_out': 22048}, '1': {'bw_in': 231337, 'bw_out': 221212121}}, '12': {'0': {'bw_in': 1024, 'bw_out': 2048}, '1': {'bw_in': 31337, 'bw_out': 21212121}}, } def test_get_all_bw_counters(self): instances = [dict(name='test1', uuid='1-2-3'), dict(name='test2', uuid='4-5-6')] self.stubs.Set(vm_utils, 'fetch_bandwidth', self._fake_fetch_bandwidth) result = self.conn.get_all_bw_counters(instances) self.assertEqual(len(result), 4) self.assertIn(dict(uuid='1-2-3', mac_address="a:b:c:d...", bw_in=1024, bw_out=2048), result) self.assertIn(dict(uuid='1-2-3', mac_address="e:f:12:q...", bw_in=31337, bw_out=21212121), result) self.assertIn(dict(uuid='4-5-6', mac_address="a:3:c:d...", bw_in=21024, bw_out=22048), result) self.assertIn(dict(uuid='4-5-6', mac_address="e:f:42:q...", bw_in=231337, bw_out=221212121), result) def test_get_all_bw_counters_in_failure_case(self): """Test that get_all_bw_conters returns an empty list when no data returned from Xenserver. c.f. bug #910045. """ instances = [dict(name='instance-0001', uuid='1-2-3-4-5')] self.stubs.Set(vm_utils, 'fetch_bandwidth', self._fake_fetch_bandwidth_mt) result = self.conn.get_all_bw_counters(instances) self.assertEqual(result, []) # TODO(salvatore-orlando): this class and # nova.tests.unit.virt.test_libvirt.IPTablesFirewallDriverTestCase # share a lot of code. Consider abstracting common code in a base # class for firewall driver testing. # # FIXME(sirp): convert this to use XenAPITestBaseNoDB class XenAPIDom0IptablesFirewallTestCase(stubs.XenAPITestBase): REQUIRES_LOCKING = True _in_rules = [ '# Generated by iptables-save v1.4.10 on Sat Feb 19 00:03:19 2011', '*nat', ':PREROUTING ACCEPT [1170:189210]', ':INPUT ACCEPT [844:71028]', ':OUTPUT ACCEPT [5149:405186]', ':POSTROUTING ACCEPT [5063:386098]', '# Completed on Mon Dec 6 11:54:13 2010', '# Generated by iptables-save v1.4.4 on Mon Dec 6 11:54:13 2010', '*mangle', ':INPUT ACCEPT [969615:281627771]', ':FORWARD ACCEPT [0:0]', ':OUTPUT ACCEPT [915599:63811649]', ':nova-block-ipv4 - [0:0]', '[0:0] -A INPUT -i virbr0 -p tcp -m tcp --dport 67 -j ACCEPT ', '[0:0] -A FORWARD -d 192.168.122.0/24 -o virbr0 -m state --state RELATED' ',ESTABLISHED -j ACCEPT ', '[0:0] -A FORWARD -s 192.168.122.0/24 -i virbr0 -j ACCEPT ', '[0:0] -A FORWARD -i virbr0 -o virbr0 -j ACCEPT ', '[0:0] -A FORWARD -o virbr0 -j REJECT ' '--reject-with icmp-port-unreachable ', '[0:0] -A FORWARD -i virbr0 -j REJECT ' '--reject-with icmp-port-unreachable ', 'COMMIT', '# Completed on Mon Dec 6 11:54:13 2010', '# Generated by iptables-save v1.4.4 on Mon Dec 6 11:54:13 2010', '*filter', ':INPUT ACCEPT [969615:281627771]', ':FORWARD ACCEPT [0:0]', ':OUTPUT ACCEPT [915599:63811649]', ':nova-block-ipv4 - [0:0]', '[0:0] -A INPUT -i virbr0 -p tcp -m tcp --dport 67 -j ACCEPT ', '[0:0] -A FORWARD -d 192.168.122.0/24 -o virbr0 -m state --state RELATED' ',ESTABLISHED -j ACCEPT ', '[0:0] -A FORWARD -s 192.168.122.0/24 -i virbr0 -j ACCEPT ', '[0:0] -A FORWARD -i virbr0 -o virbr0 -j ACCEPT ', '[0:0] -A FORWARD -o virbr0 -j REJECT ' '--reject-with icmp-port-unreachable ', '[0:0] -A FORWARD -i virbr0 -j REJECT ' '--reject-with icmp-port-unreachable ', 'COMMIT', '# Completed on Mon Dec 6 11:54:13 2010', ] _in6_filter_rules = [ '# Generated by ip6tables-save v1.4.4 on Tue Jan 18 23:47:56 2011', '*filter', ':INPUT ACCEPT [349155:75810423]', ':FORWARD ACCEPT [0:0]', ':OUTPUT ACCEPT [349256:75777230]', 'COMMIT', '# Completed on Tue Jan 18 23:47:56 2011', ] def setUp(self): super(XenAPIDom0IptablesFirewallTestCase, self).setUp() self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.flags(instance_name_template='%d', firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') self.user_id = 'mappin' self.project_id = 'fake' stubs.stubout_session(self.stubs, stubs.FakeSessionForFirewallTests, test_case=self) self.context = context.RequestContext(self.user_id, self.project_id) self.network = importutils.import_object(CONF.network_manager) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.fw = self.conn._vmops.firewall_driver def _create_instance_ref(self): return db.instance_create(self.context, {'user_id': self.user_id, 'project_id': self.project_id, 'instance_type_id': 1}) def _create_test_security_group(self): admin_ctxt = context.get_admin_context() secgroup = db.security_group_create(admin_ctxt, {'user_id': self.user_id, 'project_id': self.project_id, 'name': 'testgroup', 'description': 'test group'}) db.security_group_rule_create(admin_ctxt, {'parent_group_id': secgroup['id'], 'protocol': 'icmp', 'from_port': -1, 'to_port': -1, 'cidr': '192.168.11.0/24'}) db.security_group_rule_create(admin_ctxt, {'parent_group_id': secgroup['id'], 'protocol': 'icmp', 'from_port': 8, 'to_port': -1, 'cidr': '192.168.11.0/24'}) db.security_group_rule_create(admin_ctxt, {'parent_group_id': secgroup['id'], 'protocol': 'tcp', 'from_port': 80, 'to_port': 81, 'cidr': '192.168.10.0/24'}) return secgroup def _validate_security_group(self): in_rules = filter(lambda l: not l.startswith('#'), self._in_rules) for rule in in_rules: if 'nova' not in rule: self.assertIn(rule, self._out_rules, 'Rule went missing: %s' % rule) instance_chain = None for rule in self._out_rules: # This is pretty crude, but it'll do for now # last two octets change if re.search('-d 192.168.[0-9]{1,3}.[0-9]{1,3} -j', rule): instance_chain = rule.split(' ')[-1] break self.assertTrue(instance_chain, "The instance chain wasn't added") security_group_chain = None for rule in self._out_rules: # This is pretty crude, but it'll do for now if '-A %s -j' % instance_chain in rule: security_group_chain = rule.split(' ')[-1] break self.assertTrue(security_group_chain, "The security group chain wasn't added") regex = re.compile('\[0\:0\] -A .* -j ACCEPT -p icmp' ' -s 192.168.11.0/24') self.assertTrue(len(filter(regex.match, self._out_rules)) > 0, "ICMP acceptance rule wasn't added") regex = re.compile('\[0\:0\] -A .* -j ACCEPT -p icmp -m icmp' ' --icmp-type 8 -s 192.168.11.0/24') self.assertTrue(len(filter(regex.match, self._out_rules)) > 0, "ICMP Echo Request acceptance rule wasn't added") regex = re.compile('\[0\:0\] -A .* -j ACCEPT -p tcp --dport 80:81' ' -s 192.168.10.0/24') self.assertTrue(len(filter(regex.match, self._out_rules)) > 0, "TCP port 80/81 acceptance rule wasn't added") def test_static_filters(self): instance_ref = self._create_instance_ref() src_instance_ref = self._create_instance_ref() admin_ctxt = context.get_admin_context() secgroup = self._create_test_security_group() src_secgroup = db.security_group_create(admin_ctxt, {'user_id': self.user_id, 'project_id': self.project_id, 'name': 'testsourcegroup', 'description': 'src group'}) db.security_group_rule_create(admin_ctxt, {'parent_group_id': secgroup['id'], 'protocol': 'tcp', 'from_port': 80, 'to_port': 81, 'group_id': src_secgroup['id']}) db.instance_add_security_group(admin_ctxt, instance_ref['uuid'], secgroup['id']) db.instance_add_security_group(admin_ctxt, src_instance_ref['uuid'], src_secgroup['id']) instance_ref = db.instance_get(admin_ctxt, instance_ref['id']) src_instance_ref = db.instance_get(admin_ctxt, src_instance_ref['id']) network_model = fake_network.fake_get_instance_nw_info(self.stubs, 1) from nova.compute import utils as compute_utils # noqa self.stubs.Set(compute_utils, 'get_nw_info_for_instance', lambda instance: network_model) self.fw.prepare_instance_filter(instance_ref, network_model) self.fw.apply_instance_filter(instance_ref, network_model) self._validate_security_group() # Extra test for TCP acceptance rules for ip in network_model.fixed_ips(): if ip['version'] != 4: continue regex = re.compile('\[0\:0\] -A .* -j ACCEPT -p tcp' ' --dport 80:81 -s %s' % ip['address']) self.assertTrue(len(filter(regex.match, self._out_rules)) > 0, "TCP port 80/81 acceptance rule wasn't added") db.instance_destroy(admin_ctxt, instance_ref['uuid']) def test_filters_for_instance_with_ip_v6(self): self.flags(use_ipv6=True) network_info = fake_network.fake_get_instance_nw_info(self.stubs, 1) rulesv4, rulesv6 = self.fw._filters_for_instance("fake", network_info) self.assertEqual(len(rulesv4), 2) self.assertEqual(len(rulesv6), 1) def test_filters_for_instance_without_ip_v6(self): self.flags(use_ipv6=False) network_info = fake_network.fake_get_instance_nw_info(self.stubs, 1) rulesv4, rulesv6 = self.fw._filters_for_instance("fake", network_info) self.assertEqual(len(rulesv4), 2) self.assertEqual(len(rulesv6), 0) def test_multinic_iptables(self): ipv4_rules_per_addr = 1 ipv4_addr_per_network = 2 ipv6_rules_per_addr = 1 ipv6_addr_per_network = 1 networks_count = 5 instance_ref = self._create_instance_ref() _get_instance_nw_info = fake_network.fake_get_instance_nw_info network_info = _get_instance_nw_info(self.stubs, networks_count, ipv4_addr_per_network) network_info[0]['network']['subnets'][0]['meta']['dhcp_server'] = \ '1.1.1.1' ipv4_len = len(self.fw.iptables.ipv4['filter'].rules) ipv6_len = len(self.fw.iptables.ipv6['filter'].rules) inst_ipv4, inst_ipv6 = self.fw.instance_rules(instance_ref, network_info) self.fw.prepare_instance_filter(instance_ref, network_info) ipv4 = self.fw.iptables.ipv4['filter'].rules ipv6 = self.fw.iptables.ipv6['filter'].rules ipv4_network_rules = len(ipv4) - len(inst_ipv4) - ipv4_len ipv6_network_rules = len(ipv6) - len(inst_ipv6) - ipv6_len # Extra rules are for the DHCP request rules = (ipv4_rules_per_addr * ipv4_addr_per_network * networks_count) + 2 self.assertEqual(ipv4_network_rules, rules) self.assertEqual(ipv6_network_rules, ipv6_rules_per_addr * ipv6_addr_per_network * networks_count) def test_do_refresh_security_group_rules(self): admin_ctxt = context.get_admin_context() instance_ref = self._create_instance_ref() network_info = fake_network.fake_get_instance_nw_info(self.stubs, 1, 1) secgroup = self._create_test_security_group() db.instance_add_security_group(admin_ctxt, instance_ref['uuid'], secgroup['id']) self.fw.prepare_instance_filter(instance_ref, network_info) self.fw.instance_info[instance_ref['id']] = (instance_ref, network_info) self._validate_security_group() # add a rule to the security group db.security_group_rule_create(admin_ctxt, {'parent_group_id': secgroup['id'], 'protocol': 'udp', 'from_port': 200, 'to_port': 299, 'cidr': '192.168.99.0/24'}) # validate the extra rule self.fw.refresh_security_group_rules(secgroup) regex = re.compile('\[0\:0\] -A .* -j ACCEPT -p udp --dport 200:299' ' -s 192.168.99.0/24') self.assertTrue(len(filter(regex.match, self._out_rules)) > 0, "Rules were not updated properly. " "The rule for UDP acceptance is missing") def test_provider_firewall_rules(self): # setup basic instance data instance_ref = self._create_instance_ref() # FRAGILE: as in libvirt tests # peeks at how the firewall names chains chain_name = 'inst-%s' % instance_ref['id'] network_info = fake_network.fake_get_instance_nw_info(self.stubs, 1, 1) self.fw.prepare_instance_filter(instance_ref, network_info) self.assertIn('provider', self.fw.iptables.ipv4['filter'].chains) rules = [rule for rule in self.fw.iptables.ipv4['filter'].rules if rule.chain == 'provider'] self.assertEqual(0, len(rules)) admin_ctxt = context.get_admin_context() # add a rule and send the update message, check for 1 rule db.provider_fw_rule_create(admin_ctxt, {'protocol': 'tcp', 'cidr': '10.99.99.99/32', 'from_port': 1, 'to_port': 65535}) self.fw.refresh_provider_fw_rules() rules = [rule for rule in self.fw.iptables.ipv4['filter'].rules if rule.chain == 'provider'] self.assertEqual(1, len(rules)) # Add another, refresh, and make sure number of rules goes to two provider_fw1 = db.provider_fw_rule_create(admin_ctxt, {'protocol': 'udp', 'cidr': '10.99.99.99/32', 'from_port': 1, 'to_port': 65535}) self.fw.refresh_provider_fw_rules() rules = [rule for rule in self.fw.iptables.ipv4['filter'].rules if rule.chain == 'provider'] self.assertEqual(2, len(rules)) # create the instance filter and make sure it has a jump rule self.fw.prepare_instance_filter(instance_ref, network_info) self.fw.apply_instance_filter(instance_ref, network_info) inst_rules = [rule for rule in self.fw.iptables.ipv4['filter'].rules if rule.chain == chain_name] jump_rules = [rule for rule in inst_rules if '-j' in rule.rule] provjump_rules = [] # IptablesTable doesn't make rules unique internally for rule in jump_rules: if 'provider' in rule.rule and rule not in provjump_rules: provjump_rules.append(rule) self.assertEqual(1, len(provjump_rules)) # remove a rule from the db, cast to compute to refresh rule db.provider_fw_rule_destroy(admin_ctxt, provider_fw1['id']) self.fw.refresh_provider_fw_rules() rules = [rule for rule in self.fw.iptables.ipv4['filter'].rules if rule.chain == 'provider'] self.assertEqual(1, len(rules)) class XenAPISRSelectionTestCase(stubs.XenAPITestBaseNoDB): """Unit tests for testing we find the right SR.""" def test_safe_find_sr_raise_exception(self): # Ensure StorageRepositoryNotFound is raise when wrong filter. self.flags(sr_matching_filter='yadayadayada', group='xenserver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) session = get_session() self.assertRaises(exception.StorageRepositoryNotFound, vm_utils.safe_find_sr, session) def test_safe_find_sr_local_storage(self): # Ensure the default local-storage is found. self.flags(sr_matching_filter='other-config:i18n-key=local-storage', group='xenserver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) session = get_session() # This test is only guaranteed if there is one host in the pool self.assertEqual(len(xenapi_fake.get_all('host')), 1) host_ref = xenapi_fake.get_all('host')[0] pbd_refs = xenapi_fake.get_all('PBD') for pbd_ref in pbd_refs: pbd_rec = xenapi_fake.get_record('PBD', pbd_ref) if pbd_rec['host'] != host_ref: continue sr_rec = xenapi_fake.get_record('SR', pbd_rec['SR']) if sr_rec['other_config']['i18n-key'] == 'local-storage': local_sr = pbd_rec['SR'] expected = vm_utils.safe_find_sr(session) self.assertEqual(local_sr, expected) def test_safe_find_sr_by_other_criteria(self): # Ensure the SR is found when using a different filter. self.flags(sr_matching_filter='other-config:my_fake_sr=true', group='xenserver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) session = get_session() host_ref = xenapi_fake.get_all('host')[0] local_sr = xenapi_fake.create_sr(name_label='Fake Storage', type='lvm', other_config={'my_fake_sr': 'true'}, host_ref=host_ref) expected = vm_utils.safe_find_sr(session) self.assertEqual(local_sr, expected) def test_safe_find_sr_default(self): # Ensure the default SR is found regardless of other-config. self.flags(sr_matching_filter='default-sr:true', group='xenserver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) session = get_session() pool_ref = session.call_xenapi('pool.get_all')[0] expected = vm_utils.safe_find_sr(session) self.assertEqual(session.call_xenapi('pool.get_default_SR', pool_ref), expected) def _create_service_entries(context, values={'avail_zone1': ['fake_host1', 'fake_host2'], 'avail_zone2': ['fake_host3'], }): for avail_zone, hosts in six.iteritems(values): for service_host in hosts: db.service_create(context, {'host': service_host, 'binary': 'nova-compute', 'topic': 'compute', 'report_count': 0}) return values # FIXME(sirp): convert this to use XenAPITestBaseNoDB class XenAPIAggregateTestCase(stubs.XenAPITestBase): """Unit tests for aggregate operations.""" def setUp(self): super(XenAPIAggregateTestCase, self).setUp() self.flags(connection_url='http://test_url', connection_username='test_user', connection_password='test_pass', group='xenserver') self.flags(instance_name_template='%d', firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver', host='host', compute_driver='xenapi.XenAPIDriver', default_availability_zone='avail_zone1') self.flags(use_local=True, group='conductor') host_ref = xenapi_fake.get_all('host')[0] stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.context = context.get_admin_context() self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.compute = importutils.import_object(CONF.compute_manager) self.api = compute_api.AggregateAPI() values = {'name': 'test_aggr', 'metadata': {'availability_zone': 'test_zone', pool_states.POOL_FLAG: 'XenAPI'}} self.aggr = objects.Aggregate(context=self.context, id=1, **values) self.fake_metadata = {pool_states.POOL_FLAG: 'XenAPI', 'master_compute': 'host', 'availability_zone': 'fake_zone', pool_states.KEY: pool_states.ACTIVE, 'host': xenapi_fake.get_record('host', host_ref)['uuid']} def test_pool_add_to_aggregate_called_by_driver(self): calls = [] def pool_add_to_aggregate(context, aggregate, host, slave_info=None): self.assertEqual("CONTEXT", context) self.assertEqual("AGGREGATE", aggregate) self.assertEqual("HOST", host) self.assertEqual("SLAVEINFO", slave_info) calls.append(pool_add_to_aggregate) self.stubs.Set(self.conn._pool, "add_to_aggregate", pool_add_to_aggregate) self.conn.add_to_aggregate("CONTEXT", "AGGREGATE", "HOST", slave_info="SLAVEINFO") self.assertIn(pool_add_to_aggregate, calls) def test_pool_remove_from_aggregate_called_by_driver(self): calls = [] def pool_remove_from_aggregate(context, aggregate, host, slave_info=None): self.assertEqual("CONTEXT", context) self.assertEqual("AGGREGATE", aggregate) self.assertEqual("HOST", host) self.assertEqual("SLAVEINFO", slave_info) calls.append(pool_remove_from_aggregate) self.stubs.Set(self.conn._pool, "remove_from_aggregate", pool_remove_from_aggregate) self.conn.remove_from_aggregate("CONTEXT", "AGGREGATE", "HOST", slave_info="SLAVEINFO") self.assertIn(pool_remove_from_aggregate, calls) def test_add_to_aggregate_for_first_host_sets_metadata(self): def fake_init_pool(id, name): fake_init_pool.called = True self.stubs.Set(self.conn._pool, "_init_pool", fake_init_pool) aggregate = self._aggregate_setup() self.conn._pool.add_to_aggregate(self.context, aggregate, "host") result = db.aggregate_get(self.context, aggregate['id']) self.assertTrue(fake_init_pool.called) self.assertThat(self.fake_metadata, matchers.DictMatches(result['metadetails'])) def test_join_slave(self): # Ensure join_slave gets called when the request gets to master. def fake_join_slave(id, compute_uuid, host, url, user, password): fake_join_slave.called = True self.stubs.Set(self.conn._pool, "_join_slave", fake_join_slave) aggregate = self._aggregate_setup(hosts=['host', 'host2'], metadata=self.fake_metadata) self.conn._pool.add_to_aggregate(self.context, aggregate, "host2", dict(compute_uuid='fake_uuid', url='fake_url', user='fake_user', passwd='fake_pass', xenhost_uuid='fake_uuid')) self.assertTrue(fake_join_slave.called) def test_add_to_aggregate_first_host(self): def fake_pool_set_name_label(self, session, pool_ref, name): fake_pool_set_name_label.called = True self.stubs.Set(xenapi_fake.SessionBase, "pool_set_name_label", fake_pool_set_name_label) self.conn._session.call_xenapi("pool.create", {"name": "asdf"}) metadata = {'availability_zone': 'fake_zone', pool_states.POOL_FLAG: "XenAPI", pool_states.KEY: pool_states.CREATED} aggregate = objects.Aggregate(context=self.context) aggregate.name = 'fake_aggregate' aggregate.metadata = dict(metadata) aggregate.create() aggregate.add_host('host') self.assertEqual(["host"], aggregate.hosts) self.assertEqual(metadata, aggregate.metadata) self.conn._pool.add_to_aggregate(self.context, aggregate, "host") self.assertTrue(fake_pool_set_name_label.called) def test_remove_from_aggregate_called(self): def fake_remove_from_aggregate(context, aggregate, host): fake_remove_from_aggregate.called = True self.stubs.Set(self.conn._pool, "remove_from_aggregate", fake_remove_from_aggregate) self.conn.remove_from_aggregate(None, None, None) self.assertTrue(fake_remove_from_aggregate.called) def test_remove_from_empty_aggregate(self): result = self._aggregate_setup() self.assertRaises(exception.InvalidAggregateActionDelete, self.conn._pool.remove_from_aggregate, self.context, result, "test_host") def test_remove_slave(self): # Ensure eject slave gets called. def fake_eject_slave(id, compute_uuid, host_uuid): fake_eject_slave.called = True self.stubs.Set(self.conn._pool, "_eject_slave", fake_eject_slave) self.fake_metadata['host2'] = 'fake_host2_uuid' aggregate = self._aggregate_setup(hosts=['host', 'host2'], metadata=self.fake_metadata, aggr_state=pool_states.ACTIVE) self.conn._pool.remove_from_aggregate(self.context, aggregate, "host2") self.assertTrue(fake_eject_slave.called) def test_remove_master_solo(self): # Ensure metadata are cleared after removal. def fake_clear_pool(id): fake_clear_pool.called = True self.stubs.Set(self.conn._pool, "_clear_pool", fake_clear_pool) aggregate = self._aggregate_setup(metadata=self.fake_metadata) self.conn._pool.remove_from_aggregate(self.context, aggregate, "host") result = db.aggregate_get(self.context, aggregate['id']) self.assertTrue(fake_clear_pool.called) self.assertThat({'availability_zone': 'fake_zone', pool_states.POOL_FLAG: 'XenAPI', pool_states.KEY: pool_states.ACTIVE}, matchers.DictMatches(result['metadetails'])) def test_remote_master_non_empty_pool(self): # Ensure AggregateError is raised if removing the master. aggregate = self._aggregate_setup(hosts=['host', 'host2'], metadata=self.fake_metadata) self.assertRaises(exception.InvalidAggregateActionDelete, self.conn._pool.remove_from_aggregate, self.context, aggregate, "host") def _aggregate_setup(self, aggr_name='fake_aggregate', aggr_zone='fake_zone', aggr_state=pool_states.CREATED, hosts=['host'], metadata=None): aggregate = objects.Aggregate(context=self.context) aggregate.name = aggr_name aggregate.metadata = {'availability_zone': aggr_zone, pool_states.POOL_FLAG: 'XenAPI', pool_states.KEY: aggr_state, } if metadata: aggregate.metadata.update(metadata) aggregate.create() for aggregate_host in hosts: aggregate.add_host(aggregate_host) return aggregate def test_add_host_to_aggregate_invalid_changing_status(self): """Ensure InvalidAggregateActionAdd is raised when adding host while aggregate is not ready. """ aggregate = self._aggregate_setup(aggr_state=pool_states.CHANGING) ex = self.assertRaises(exception.InvalidAggregateActionAdd, self.conn.add_to_aggregate, self.context, aggregate, 'host') self.assertIn('setup in progress', str(ex)) def test_add_host_to_aggregate_invalid_dismissed_status(self): """Ensure InvalidAggregateActionAdd is raised when aggregate is deleted. """ aggregate = self._aggregate_setup(aggr_state=pool_states.DISMISSED) ex = self.assertRaises(exception.InvalidAggregateActionAdd, self.conn.add_to_aggregate, self.context, aggregate, 'fake_host') self.assertIn('aggregate deleted', str(ex)) def test_add_host_to_aggregate_invalid_error_status(self): """Ensure InvalidAggregateActionAdd is raised when aggregate is in error. """ aggregate = self._aggregate_setup(aggr_state=pool_states.ERROR) ex = self.assertRaises(exception.InvalidAggregateActionAdd, self.conn.add_to_aggregate, self.context, aggregate, 'fake_host') self.assertIn('aggregate in error', str(ex)) def test_remove_host_from_aggregate_error(self): # Ensure we can remove a host from an aggregate even if in error. values = _create_service_entries(self.context) fake_zone = list(values.keys())[0] aggr = self.api.create_aggregate(self.context, 'fake_aggregate', fake_zone) # let's mock the fact that the aggregate is ready! metadata = {pool_states.POOL_FLAG: "XenAPI", pool_states.KEY: pool_states.ACTIVE} db.aggregate_metadata_add(self.context, aggr['id'], metadata) for aggregate_host in values[fake_zone]: aggr = self.api.add_host_to_aggregate(self.context, aggr['id'], aggregate_host) # let's mock the fact that the aggregate is in error! expected = self.api.remove_host_from_aggregate(self.context, aggr['id'], values[fake_zone][0]) self.assertEqual(len(aggr['hosts']) - 1, len(expected['hosts'])) self.assertEqual(expected['metadata'][pool_states.KEY], pool_states.ACTIVE) def test_remove_host_from_aggregate_invalid_dismissed_status(self): """Ensure InvalidAggregateActionDelete is raised when aggregate is deleted. """ aggregate = self._aggregate_setup(aggr_state=pool_states.DISMISSED) self.assertRaises(exception.InvalidAggregateActionDelete, self.conn.remove_from_aggregate, self.context, aggregate, 'fake_host') def test_remove_host_from_aggregate_invalid_changing_status(self): """Ensure InvalidAggregateActionDelete is raised when aggregate is changing. """ aggregate = self._aggregate_setup(aggr_state=pool_states.CHANGING) self.assertRaises(exception.InvalidAggregateActionDelete, self.conn.remove_from_aggregate, self.context, aggregate, 'fake_host') def test_add_aggregate_host_raise_err(self): # Ensure the undo operation works correctly on add. def fake_driver_add_to_aggregate(context, aggregate, host, **_ignore): raise exception.AggregateError( aggregate_id='', action='', reason='') self.stubs.Set(self.compute.driver, "add_to_aggregate", fake_driver_add_to_aggregate) metadata = {pool_states.POOL_FLAG: "XenAPI", pool_states.KEY: pool_states.ACTIVE} self.aggr.metadata = metadata self.aggr.hosts = ['fake_host'] self.assertRaises(exception.AggregateError, self.compute.add_aggregate_host, self.context, host="fake_host", aggregate=self.aggr, slave_info=None) self.assertEqual(self.aggr.metadata[pool_states.KEY], pool_states.ERROR) self.assertEqual(self.aggr.hosts, ['fake_host']) class MockComputeAPI(object): def __init__(self): self._mock_calls = [] def add_aggregate_host(self, ctxt, aggregate, host_param, host, slave_info): self._mock_calls.append(( self.add_aggregate_host, ctxt, aggregate, host_param, host, slave_info)) def remove_aggregate_host(self, ctxt, aggregate_id, host_param, host, slave_info): self._mock_calls.append(( self.remove_aggregate_host, ctxt, aggregate_id, host_param, host, slave_info)) class StubDependencies(object): """Stub dependencies for ResourcePool.""" def __init__(self): self.compute_rpcapi = MockComputeAPI() def _is_hv_pool(self, *_ignore): return True def _get_metadata(self, *_ignore): return { pool_states.KEY: {}, 'master_compute': 'master' } def _create_slave_info(self, *ignore): return "SLAVE_INFO" class ResourcePoolWithStubs(StubDependencies, pool.ResourcePool): """A ResourcePool, use stub dependencies.""" class HypervisorPoolTestCase(test.NoDBTestCase): fake_aggregate = { 'id': 98, 'hosts': [], 'metadata': { 'master_compute': 'master', pool_states.POOL_FLAG: {}, pool_states.KEY: {} } } def test_slave_asks_master_to_add_slave_to_pool(self): slave = ResourcePoolWithStubs() slave.add_to_aggregate("CONTEXT", self.fake_aggregate, "slave") self.assertIn( (slave.compute_rpcapi.add_aggregate_host, "CONTEXT", jsonutils.to_primitive(self.fake_aggregate), "slave", "master", "SLAVE_INFO"), slave.compute_rpcapi._mock_calls) def test_slave_asks_master_to_remove_slave_from_pool(self): slave = ResourcePoolWithStubs() slave.remove_from_aggregate("CONTEXT", self.fake_aggregate, "slave") self.assertIn( (slave.compute_rpcapi.remove_aggregate_host, "CONTEXT", 98, "slave", "master", "SLAVE_INFO"), slave.compute_rpcapi._mock_calls) class SwapXapiHostTestCase(test.NoDBTestCase): def test_swapping(self): self.assertEqual( "http://otherserver:8765/somepath", pool.swap_xapi_host( "http://someserver:8765/somepath", 'otherserver')) def test_no_port(self): self.assertEqual( "http://otherserver/somepath", pool.swap_xapi_host( "http://someserver/somepath", 'otherserver')) def test_no_path(self): self.assertEqual( "http://otherserver", pool.swap_xapi_host( "http://someserver", 'otherserver')) class XenAPILiveMigrateTestCase(stubs.XenAPITestBaseNoDB): """Unit tests for live_migration.""" def setUp(self): super(XenAPILiveMigrateTestCase, self).setUp() self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.flags(firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver', host='host') db_fakes.stub_out_db_instance_api(self.stubs) self.context = context.get_admin_context() def test_live_migration_calls_vmops(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def fake_live_migrate(context, instance_ref, dest, post_method, recover_method, block_migration, migrate_data): fake_live_migrate.called = True self.stubs.Set(self.conn._vmops, "live_migrate", fake_live_migrate) self.conn.live_migration(None, None, None, None, None) self.assertTrue(fake_live_migrate.called) def test_pre_live_migration(self): # ensure method is present stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.conn.pre_live_migration(None, None, None, None, None) def test_post_live_migration_at_destination(self): # ensure method is present stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) fake_instance = {"name": "name"} fake_network_info = "network_info" def fake_fw(instance, network_info): self.assertEqual(instance, fake_instance) self.assertEqual(network_info, fake_network_info) fake_fw.call_count += 1 def fake_create_kernel_and_ramdisk(context, session, instance, name_label): return "fake-kernel-file", "fake-ramdisk-file" fake_fw.call_count = 0 _vmops = self.conn._vmops self.stubs.Set(_vmops.firewall_driver, 'setup_basic_filtering', fake_fw) self.stubs.Set(_vmops.firewall_driver, 'prepare_instance_filter', fake_fw) self.stubs.Set(_vmops.firewall_driver, 'apply_instance_filter', fake_fw) self.stubs.Set(vm_utils, "create_kernel_and_ramdisk", fake_create_kernel_and_ramdisk) def fake_get_vm_opaque_ref(instance): fake_get_vm_opaque_ref.called = True self.stubs.Set(_vmops, "_get_vm_opaque_ref", fake_get_vm_opaque_ref) fake_get_vm_opaque_ref.called = False def fake_strip_base_mirror_from_vdis(session, vm_ref): fake_strip_base_mirror_from_vdis.called = True self.stubs.Set(vm_utils, "strip_base_mirror_from_vdis", fake_strip_base_mirror_from_vdis) fake_strip_base_mirror_from_vdis.called = False self.conn.post_live_migration_at_destination(None, fake_instance, fake_network_info, None) self.assertEqual(fake_fw.call_count, 3) self.assertTrue(fake_get_vm_opaque_ref.called) self.assertTrue(fake_strip_base_mirror_from_vdis.called) def test_check_can_live_migrate_destination_with_block_migration(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.stubs.Set(vm_utils, "safe_find_sr", lambda _x: "asdf") expected = {'block_migration': True, 'migrate_data': { 'migrate_send_data': "fake_migrate_data", 'destination_sr_ref': 'asdf' } } result = self.conn.check_can_live_migrate_destination(self.context, {'host': 'host'}, {}, {}, True, False) self.assertEqual(expected, result) def test_check_live_migrate_destination_verifies_ip(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) for pif_ref in xenapi_fake.get_all('PIF'): pif_rec = xenapi_fake.get_record('PIF', pif_ref) pif_rec['IP'] = '' pif_rec['IPv6'] = '' self.stubs.Set(vm_utils, "safe_find_sr", lambda _x: "asdf") self.assertRaises(exception.MigrationError, self.conn.check_can_live_migrate_destination, self.context, {'host': 'host'}, {}, {}, True, False) def test_check_can_live_migrate_destination_block_migration_fails(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForFailedMigrateTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.assertRaises(exception.MigrationError, self.conn.check_can_live_migrate_destination, self.context, {'host': 'host'}, {}, {}, True, False) def _add_default_live_migrate_stubs(self, conn): def fake_generate_vdi_map(destination_sr_ref, _vm_ref): pass def fake_get_iscsi_srs(destination_sr_ref, _vm_ref): return [] def fake_get_vm_opaque_ref(instance): return "fake_vm" def fake_lookup_kernel_ramdisk(session, vm): return ("fake_PV_kernel", "fake_PV_ramdisk") self.stubs.Set(conn._vmops, "_generate_vdi_map", fake_generate_vdi_map) self.stubs.Set(conn._vmops, "_get_iscsi_srs", fake_get_iscsi_srs) self.stubs.Set(conn._vmops, "_get_vm_opaque_ref", fake_get_vm_opaque_ref) self.stubs.Set(vm_utils, "lookup_kernel_ramdisk", fake_lookup_kernel_ramdisk) def test_check_can_live_migrate_source_with_block_migrate(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) dest_check_data = {'block_migration': True, 'migrate_data': { 'destination_sr_ref': None, 'migrate_send_data': None }} result = self.conn.check_can_live_migrate_source(self.context, {'host': 'host'}, dest_check_data) self.assertEqual(dest_check_data, result) def test_check_can_live_migrate_source_with_block_migrate_iscsi(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) def fake_get_iscsi_srs(destination_sr_ref, _vm_ref): return ['sr_ref'] self.stubs.Set(self.conn._vmops, "_get_iscsi_srs", fake_get_iscsi_srs) def fake_make_plugin_call(plugin, method, **args): return "true" self.stubs.Set(self.conn._vmops, "_make_plugin_call", fake_make_plugin_call) dest_check_data = {'block_migration': True, 'migrate_data': { 'destination_sr_ref': None, 'migrate_send_data': None }} result = self.conn.check_can_live_migrate_source(self.context, {'host': 'host'}, dest_check_data) self.assertEqual(dest_check_data, result) def test_check_can_live_migrate_source_with_block_iscsi_fails(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) def fake_get_iscsi_srs(destination_sr_ref, _vm_ref): return ['sr_ref'] self.stubs.Set(self.conn._vmops, "_get_iscsi_srs", fake_get_iscsi_srs) def fake_make_plugin_call(plugin, method, **args): return {'returncode': 'error', 'message': 'Plugin not found'} self.stubs.Set(self.conn._vmops, "_make_plugin_call", fake_make_plugin_call) self.assertRaises(exception.MigrationError, self.conn.check_can_live_migrate_source, self.context, {'host': 'host'}, {}) def test_check_can_live_migrate_source_with_block_migrate_fails(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForFailedMigrateTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) dest_check_data = {'block_migration': True, 'migrate_data': { 'destination_sr_ref': None, 'migrate_send_data': None }} self.assertRaises(exception.MigrationError, self.conn.check_can_live_migrate_source, self.context, {'host': 'host'}, dest_check_data) def test_check_can_live_migrate_works(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def fake_aggregate_get_by_host(context, host, key=None): self.assertEqual(CONF.host, host) return [dict(test_aggregate.fake_aggregate, metadetails={"host": "test_host_uuid"})] self.stubs.Set(db, "aggregate_get_by_host", fake_aggregate_get_by_host) self.conn.check_can_live_migrate_destination(self.context, {'host': 'host'}, False, False) def test_check_can_live_migrate_fails(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def fake_aggregate_get_by_host(context, host, key=None): self.assertEqual(CONF.host, host) return [dict(test_aggregate.fake_aggregate, metadetails={"dest_other": "test_host_uuid"})] self.stubs.Set(db, "aggregate_get_by_host", fake_aggregate_get_by_host) self.assertRaises(exception.MigrationError, self.conn.check_can_live_migrate_destination, self.context, {'host': 'host'}, None, None) def test_live_migration(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def fake_get_vm_opaque_ref(instance): return "fake_vm" self.stubs.Set(self.conn._vmops, "_get_vm_opaque_ref", fake_get_vm_opaque_ref) def fake_get_host_opaque_ref(context, destination_hostname): return "fake_host" self.stubs.Set(self.conn._vmops, "_get_host_opaque_ref", fake_get_host_opaque_ref) def post_method(context, instance, destination_hostname, block_migration, migrate_data): post_method.called = True self.conn.live_migration(self.conn, None, None, post_method, None) self.assertTrue(post_method.called, "post_method.called") def test_live_migration_on_failure(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) def fake_get_vm_opaque_ref(instance): return "fake_vm" self.stubs.Set(self.conn._vmops, "_get_vm_opaque_ref", fake_get_vm_opaque_ref) def fake_get_host_opaque_ref(context, destination_hostname): return "fake_host" self.stubs.Set(self.conn._vmops, "_get_host_opaque_ref", fake_get_host_opaque_ref) def fake_call_xenapi(*args): raise NotImplementedError() self.stubs.Set(self.conn._vmops._session, "call_xenapi", fake_call_xenapi) def recover_method(context, instance, destination_hostname, block_migration): recover_method.called = True self.assertRaises(NotImplementedError, self.conn.live_migration, self.conn, None, None, None, recover_method) self.assertTrue(recover_method.called, "recover_method.called") def test_live_migration_calls_post_migration(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) def post_method(context, instance, destination_hostname, block_migration, migrate_data): post_method.called = True # pass block_migration = True and migrate data migrate_data = {"destination_sr_ref": "foo", "migrate_send_data": "bar"} self.conn.live_migration(self.conn, None, None, post_method, None, True, migrate_data) self.assertTrue(post_method.called, "post_method.called") def test_live_migration_block_cleans_srs(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) def fake_get_iscsi_srs(context, instance): return ['sr_ref'] self.stubs.Set(self.conn._vmops, "_get_iscsi_srs", fake_get_iscsi_srs) def fake_forget_sr(context, instance): fake_forget_sr.called = True self.stubs.Set(volume_utils, "forget_sr", fake_forget_sr) def post_method(context, instance, destination_hostname, block_migration, migrate_data): post_method.called = True migrate_data = {"destination_sr_ref": "foo", "migrate_send_data": "bar"} self.conn.live_migration(self.conn, None, None, post_method, None, True, migrate_data) self.assertTrue(post_method.called, "post_method.called") self.assertTrue(fake_forget_sr.called, "forget_sr.called") def test_live_migration_with_block_migration_raises_invalid_param(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) def recover_method(context, instance, destination_hostname, block_migration): recover_method.called = True # pass block_migration = True and no migrate data self.assertRaises(exception.InvalidParameterValue, self.conn.live_migration, self.conn, None, None, None, recover_method, True, None) self.assertTrue(recover_method.called, "recover_method.called") def test_live_migration_with_block_migration_fails_migrate_send(self): stubs.stubout_session(self.stubs, stubs.FakeSessionForFailedMigrateTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(self.conn) def recover_method(context, instance, destination_hostname, block_migration): recover_method.called = True # pass block_migration = True and migrate data migrate_data = dict(destination_sr_ref='foo', migrate_send_data='bar') self.assertRaises(exception.MigrationError, self.conn.live_migration, self.conn, None, None, None, recover_method, True, migrate_data) self.assertTrue(recover_method.called, "recover_method.called") def test_live_migrate_block_migration_xapi_call_parameters(self): fake_vdi_map = object() class Session(xenapi_fake.SessionBase): def VM_migrate_send(self_, session, vmref, migrate_data, islive, vdi_map, vif_map, options): self.assertEqual('SOMEDATA', migrate_data) self.assertEqual(fake_vdi_map, vdi_map) stubs.stubout_session(self.stubs, Session) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(conn) def fake_generate_vdi_map(destination_sr_ref, _vm_ref): return fake_vdi_map self.stubs.Set(conn._vmops, "_generate_vdi_map", fake_generate_vdi_map) def dummy_callback(*args, **kwargs): pass conn.live_migration( self.context, instance=dict(name='ignore'), dest=None, post_method=dummy_callback, recover_method=dummy_callback, block_migration="SOMEDATA", migrate_data=dict(migrate_send_data='SOMEDATA', destination_sr_ref="TARGET_SR_OPAQUE_REF")) def test_live_migrate_pool_migration_xapi_call_parameters(self): class Session(xenapi_fake.SessionBase): def VM_pool_migrate(self_, session, vm_ref, host_ref, options): self.assertEqual("fake_ref", host_ref) self.assertEqual({"live": "true"}, options) raise IOError() stubs.stubout_session(self.stubs, Session) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self._add_default_live_migrate_stubs(conn) def fake_get_host_opaque_ref(context, destination): return "fake_ref" self.stubs.Set(conn._vmops, "_get_host_opaque_ref", fake_get_host_opaque_ref) def dummy_callback(*args, **kwargs): pass self.assertRaises(IOError, conn.live_migration, self.context, instance=dict(name='ignore'), dest=None, post_method=dummy_callback, recover_method=dummy_callback, block_migration=False, migrate_data={}) def test_generate_vdi_map(self): stubs.stubout_session(self.stubs, xenapi_fake.SessionBase) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) vm_ref = "fake_vm_ref" def fake_find_sr(_session): self.assertEqual(conn._session, _session) return "source_sr_ref" self.stubs.Set(vm_utils, "safe_find_sr", fake_find_sr) def fake_get_instance_vdis_for_sr(_session, _vm_ref, _sr_ref): self.assertEqual(conn._session, _session) self.assertEqual(vm_ref, _vm_ref) self.assertEqual("source_sr_ref", _sr_ref) return ["vdi0", "vdi1"] self.stubs.Set(vm_utils, "get_instance_vdis_for_sr", fake_get_instance_vdis_for_sr) result = conn._vmops._generate_vdi_map("dest_sr_ref", vm_ref) self.assertEqual({"vdi0": "dest_sr_ref", "vdi1": "dest_sr_ref"}, result) def test_rollback_live_migration_at_destination(self): stubs.stubout_session(self.stubs, xenapi_fake.SessionBase) conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) with mock.patch.object(conn, "destroy") as mock_destroy: conn.rollback_live_migration_at_destination("context", "instance", [], {'block_device_mapping': []}) self.assertFalse(mock_destroy.called) class XenAPIInjectMetadataTestCase(stubs.XenAPITestBaseNoDB): def setUp(self): super(XenAPIInjectMetadataTestCase, self).setUp() self.flags(connection_url='test_url', connection_password='test_pass', group='xenserver') self.flags(firewall_driver='nova.virt.xenapi.firewall.' 'Dom0IptablesFirewallDriver') stubs.stubout_session(self.stubs, stubs.FakeSessionForVMTests) self.conn = xenapi_conn.XenAPIDriver(fake.FakeVirtAPI(), False) self.xenstore = dict(persist={}, ephem={}) self.called_fake_get_vm_opaque_ref = False def fake_get_vm_opaque_ref(inst, instance): self.called_fake_get_vm_opaque_ref = True if instance["uuid"] == "not_found": raise exception.NotFound self.assertEqual(instance, {'uuid': 'fake'}) return 'vm_ref' def fake_add_to_param_xenstore(inst, vm_ref, key, val): self.assertEqual(vm_ref, 'vm_ref') self.xenstore['persist'][key] = val def fake_remove_from_param_xenstore(inst, vm_ref, key): self.assertEqual(vm_ref, 'vm_ref') if key in self.xenstore['persist']: del self.xenstore['persist'][key] def fake_write_to_xenstore(inst, instance, path, value, vm_ref=None): self.assertEqual(instance, {'uuid': 'fake'}) self.assertEqual(vm_ref, 'vm_ref') self.xenstore['ephem'][path] = jsonutils.dumps(value) def fake_delete_from_xenstore(inst, instance, path, vm_ref=None): self.assertEqual(instance, {'uuid': 'fake'}) self.assertEqual(vm_ref, 'vm_ref') if path in self.xenstore['ephem']: del self.xenstore['ephem'][path] self.stubs.Set(vmops.VMOps, '_get_vm_opaque_ref', fake_get_vm_opaque_ref) self.stubs.Set(vmops.VMOps, '_add_to_param_xenstore', fake_add_to_param_xenstore) self.stubs.Set(vmops.VMOps, '_remove_from_param_xenstore', fake_remove_from_param_xenstore) self.stubs.Set(vmops.VMOps, '_write_to_xenstore', fake_write_to_xenstore) self.stubs.Set(vmops.VMOps, '_delete_from_xenstore', fake_delete_from_xenstore) def test_inject_instance_metadata(self): # Add some system_metadata to ensure it doesn't get added # to xenstore instance = dict(metadata=[{'key': 'a', 'value': 1}, {'key': 'b', 'value': 2}, {'key': 'c', 'value': 3}, # Check xenstore key sanitizing {'key': 'hi.there', 'value': 4}, {'key': 'hi!t.e/e', 'value': 5}], # Check xenstore key sanitizing system_metadata=[{'key': 'sys_a', 'value': 1}, {'key': 'sys_b', 'value': 2}, {'key': 'sys_c', 'value': 3}], uuid='fake') self.conn._vmops._inject_instance_metadata(instance, 'vm_ref') self.assertEqual(self.xenstore, { 'persist': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', 'vm-data/user-metadata/hi_there': '4', 'vm-data/user-metadata/hi_t_e_e': '5', }, 'ephem': {}, }) def test_change_instance_metadata_add(self): # Test XenStore key sanitizing here, too. diff = {'test.key': ['+', 4]} instance = {'uuid': 'fake'} self.xenstore = { 'persist': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', }, 'ephem': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', }, } self.conn._vmops.change_instance_metadata(instance, diff) self.assertEqual(self.xenstore, { 'persist': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', 'vm-data/user-metadata/test_key': '4', }, 'ephem': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', 'vm-data/user-metadata/test_key': '4', }, }) def test_change_instance_metadata_update(self): diff = dict(b=['+', 4]) instance = {'uuid': 'fake'} self.xenstore = { 'persist': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', }, 'ephem': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', }, } self.conn._vmops.change_instance_metadata(instance, diff) self.assertEqual(self.xenstore, { 'persist': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '4', 'vm-data/user-metadata/c': '3', }, 'ephem': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '4', 'vm-data/user-metadata/c': '3', }, }) def test_change_instance_metadata_delete(self): diff = dict(b=['-']) instance = {'uuid': 'fake'} self.xenstore = { 'persist': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', }, 'ephem': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/b': '2', 'vm-data/user-metadata/c': '3', }, } self.conn._vmops.change_instance_metadata(instance, diff) self.assertEqual(self.xenstore, { 'persist': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/c': '3', }, 'ephem': { 'vm-data/user-metadata/a': '1', 'vm-data/user-metadata/c': '3', }, }) def test_change_instance_metadata_not_found(self): instance = {'uuid': 'not_found'} self.conn._vmops.change_instance_metadata(instance, "fake_diff") self.assertTrue(self.called_fake_get_vm_opaque_ref) class XenAPISessionTestCase(test.NoDBTestCase): def _get_mock_xapisession(self, software_version): class MockXapiSession(xenapi_session.XenAPISession): def __init__(_ignore): "Skip the superclass's dirty init" def _get_software_version(_ignore): return software_version return MockXapiSession() def test_local_session(self): session = self._get_mock_xapisession({}) session.is_local_connection = True session.XenAPI = self.mox.CreateMockAnything() session.XenAPI.xapi_local().AndReturn("local_connection") self.mox.ReplayAll() self.assertEqual("local_connection", session._create_session("unix://local")) def test_remote_session(self): session = self._get_mock_xapisession({}) session.is_local_connection = False session.XenAPI = self.mox.CreateMockAnything() session.XenAPI.Session("url").AndReturn("remote_connection") self.mox.ReplayAll() self.assertEqual("remote_connection", session._create_session("url")) def test_get_product_version_product_brand_does_not_fail(self): session = self._get_mock_xapisession({ 'build_number': '0', 'date': '2012-08-03', 'hostname': 'komainu', 'linux': '3.2.0-27-generic', 'network_backend': 'bridge', 'platform_name': 'XCP_Kronos', 'platform_version': '1.6.0', 'xapi': '1.3', 'xen': '4.1.2', 'xencenter_max': '1.10', 'xencenter_min': '1.10' }) self.assertEqual( ((1, 6, 0), None), session._get_product_version_and_brand() ) def test_get_product_version_product_brand_xs_6(self): session = self._get_mock_xapisession({ 'product_brand': 'XenServer', 'product_version': '6.0.50', 'platform_version': '0.0.1' }) self.assertEqual( ((6, 0, 50), 'XenServer'), session._get_product_version_and_brand() ) def test_verify_plugin_version_same(self): session = self._get_mock_xapisession({}) session.PLUGIN_REQUIRED_VERSION = '2.4' self.mox.StubOutWithMock(session, 'call_plugin_serialized') session.call_plugin_serialized('nova_plugin_version', 'get_version', ).AndReturn("2.4") self.mox.ReplayAll() session._verify_plugin_version() def test_verify_plugin_version_compatible(self): session = self._get_mock_xapisession({}) session.XenAPI = xenapi_fake.FakeXenAPI() session.PLUGIN_REQUIRED_VERSION = '2.4' self.mox.StubOutWithMock(session, 'call_plugin_serialized') session.call_plugin_serialized('nova_plugin_version', 'get_version', ).AndReturn("2.5") self.mox.ReplayAll() session._verify_plugin_version() def test_verify_plugin_version_bad_maj(self): session = self._get_mock_xapisession({}) session.XenAPI = xenapi_fake.FakeXenAPI() session.PLUGIN_REQUIRED_VERSION = '2.4' self.mox.StubOutWithMock(session, 'call_plugin_serialized') session.call_plugin_serialized('nova_plugin_version', 'get_version', ).AndReturn("3.0") self.mox.ReplayAll() self.assertRaises(xenapi_fake.Failure, session._verify_plugin_version) def test_verify_plugin_version_bad_min(self): session = self._get_mock_xapisession({}) session.XenAPI = xenapi_fake.FakeXenAPI() session.PLUGIN_REQUIRED_VERSION = '2.4' self.mox.StubOutWithMock(session, 'call_plugin_serialized') session.call_plugin_serialized('nova_plugin_version', 'get_version', ).AndReturn("2.3") self.mox.ReplayAll() self.assertRaises(xenapi_fake.Failure, session._verify_plugin_version) def test_verify_current_version_matches(self): session = self._get_mock_xapisession({}) # Import the plugin to extract its version path = os.path.dirname(__file__) rel_path_elem = "../../../../../plugins/xenserver/xenapi/etc/xapi.d/" \ "plugins/nova_plugin_version" for elem in rel_path_elem.split('/'): path = os.path.join(path, elem) path = os.path.realpath(path) plugin_version = None with open(path) as plugin_file: for line in plugin_file: if "PLUGIN_VERSION = " in line: plugin_version = line.strip()[17:].strip('"') self.assertEqual(session.PLUGIN_REQUIRED_VERSION, plugin_version) class XenAPIFakeTestCase(test.NoDBTestCase): def test_query_matches(self): record = {'a': '1', 'b': '2', 'c_d': '3'} tests = {'field "a"="1"': True, 'field "b"="2"': True, 'field "b"="4"': False, 'not field "b"="4"': True, 'field "a"="1" and field "b"="4"': False, 'field "a"="1" or field "b"="4"': True, 'field "c__d"="3"': True, 'field \'b\'=\'2\'': True, } for query in tests.keys(): expected = tests[query] fail_msg = "for test '%s'" % query self.assertEqual(xenapi_fake._query_matches(record, query), expected, fail_msg) def test_query_bad_format(self): record = {'a': '1', 'b': '2', 'c': '3'} tests = ['"a"="1" or "b"="4"', 'a=1', ] for query in tests: fail_msg = "for test '%s'" % query self.assertFalse(xenapi_fake._query_matches(record, query), fail_msg)
gpl-2.0
8,827,661,696,526,691,000
41.512446
79
0.562598
false
RudolfCardinal/crate
crate_anon/nlp_manager/cloud_request_sender.py
1
12012
#!/usr/bin/env python """ crate_anon/nlp_manager/cloud_request_sender.py =============================================================================== Copyright (C) 2015-2021 Rudolf Cardinal ([email protected]). This file is part of CRATE. CRATE is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. CRATE is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with CRATE. If not, see <http://www.gnu.org/licenses/>. =============================================================================== **CloudRequestSender class.** """ # ============================================================================= # Imports # ============================================================================= from enum import auto, Enum import logging from typing import ( Any, Dict, List, Optional, Tuple, Generator, TYPE_CHECKING, ) from crate_anon.nlp_manager.constants import ( DEFAULT_REPORT_EVERY_NLP, ) from crate_anon.nlp_manager.input_field_config import ( InputFieldConfig, FN_SRCDB, FN_SRCTABLE, FN_SRCPKFIELD, FN_SRCPKVAL, FN_SRCPKSTR, FN_SRCFIELD, ) from crate_anon.nlp_manager.models import FN_SRCHASH from crate_anon.nlp_manager.cloud_request import ( CloudRequestProcess, RecordNotPrintable, RecordsPerRequestExceeded, RequestTooLong, ) from crate_anon.nlp_manager.cloud_run_info import CloudRunInfo if TYPE_CHECKING: from http.cookiejar import CookieJar log = logging.getLogger(__name__) # ============================================================================= # CloudRequestSender # ============================================================================= class CloudRequestSender(object): """ Class to encapsulate a NLP request outbound to a cloud NLP server. """ class State(Enum): """ Request state. """ BUILDING_REQUEST = auto() SENDING_REQUEST = auto() FINISHED = auto() def __init__( self, text_generator: Generator[Tuple[str, Dict[str, Any]], None, None], crinfo: CloudRunInfo, ifconfig: InputFieldConfig, report_every: int = DEFAULT_REPORT_EVERY_NLP, incremental: bool = False, queue: bool = True) -> None: """ Args: text_generator: Generator that generates text strings from the source database. See :meth:`crate_anon.nlp_manager.input_field_config.InputFieldConfig.gen_text`. crinfo: A :class:`crate_anon.nlp_manager.cloud_run_info.CloudRunInfo` object. ifconfig: An :class:`crate_anon.nlp_manager.input_field_config.InputFieldConfig` object. report_every: Report to the log every *n* requests. incremental: Process in incremental mode (ignoring source records that have not changed since last time)? queue: Queue the requests for back-end processing (rather than waiting for an immediate reply)? """ self._text_generator = text_generator self._crinfo = crinfo self._ifconfig = ifconfig self._report_every = report_every self._incremental = incremental self._queue = queue self._global_recnum = -1 self._requests = [] # type: List[CloudRequestProcess] self._cookies = None # type: Optional[CookieJar] self._request_count = 0 # number of requests sent self._text = None # type: Optional[str] self._other_values = None # type: Optional[Dict[str, Any]] self._request_is_empty = True self._need_new_record = True self._need_new_request = True self._num_recs_processed = 0 self._state = self.State.BUILDING_REQUEST self._request = None # type: Optional[CloudRequestProcess] def send_requests( self, global_recnum: int) -> Tuple[List[CloudRequestProcess], bool, int]: """ Sends off a series of cloud requests and returns them as a list. ``self._queue`` determines whether these are queued requests or not. Also returns whether the generator for the text is empty. Return tuple is: ``requests, some_records_processed, global_recnum``. """ self._global_recnum = global_recnum self._requests = [] self._cookies = None self._request_count = 1 self._text = None self._other_values = None self._request_is_empty = True self._need_new_record = True self._need_new_request = True # Check processors are available available_procs = self._crinfo.get_remote_processors() if not available_procs: return [], False, self._global_recnum self._num_recs_processed = 0 self._state = self.State.BUILDING_REQUEST # If we've reached the limit of records before commit, return to # outer function in order to process and commit (or write to file if # it's a queued request) while self._state != self.State.FINISHED: if self._state == self.State.BUILDING_REQUEST: self._build_request() if self._state == self.State.SENDING_REQUEST: self._send_request() return self._requests, self._num_recs_processed > 0, self._global_recnum # noqa def _build_request(self) -> None: """ Adds another record to the outbound request, until the request is fully built. Updates our state to reflect what needs to happen next. """ if self._need_new_record: try: self._get_next_record() except StopIteration: self._update_state_for_no_more_records() return hasher = self._crinfo.nlpdef.hash srchash = hasher(self._text) if self._incremental and self._record_already_processed(srchash): return self._num_recs_processed += 1 self._other_values[FN_SRCHASH] = srchash if self._need_new_request: self._request = self._get_new_cloud_request() self._request_is_empty = True self._need_new_request = False self._need_new_record = True # Add the text to the cloud request with the appropriate metadata try: self._request.add_text( self._text, self._other_values ) # added OK, request now has some text self._request_is_empty = False except RecordNotPrintable: # Text contained no printable characters. Skip it. pass except (RecordsPerRequestExceeded, RequestTooLong) as e: if isinstance(e, RequestTooLong) and self._request_is_empty: # Get some new text next time log.warning("Skipping text that's too long to send") else: # Try same text again with a fresh request self._need_new_record = False self._state = self.State.SENDING_REQUEST if self._record_limit_reached(): self._state = self.State.SENDING_REQUEST def _get_new_cloud_request(self) -> CloudRequestProcess: """ Creates and returns a new :class:`crate_anon.nlp_manager.cloud_request.CloudRequestProcess` object. """ return CloudRequestProcess(self._crinfo) def _update_state_for_no_more_records(self) -> None: """ No more input records are available. This means either (a) we've sent all our requests and have finished, or (b) we're building our last request and we need to send it. Set the state accordingly. """ if self._request_is_empty or self._need_new_request: # Nothing more to send self._state = self.State.FINISHED return # Send last request self._state = self.State.SENDING_REQUEST def _record_already_processed(self, srchash: str) -> bool: """ Has this source record (identified by its PK and its hash) already been processed? (If so, then in incremental mode, we can skip it.) """ pkval = self._other_values[FN_SRCPKVAL] pkstr = self._other_values[FN_SRCPKSTR] progrec = self._ifconfig.get_progress_record(pkval, pkstr) if progrec is not None: if progrec.srchash == srchash: log.debug("Record previously processed; skipping") return True log.debug("Record has changed") else: log.debug("Record is new") return False def _record_limit_reached(self) -> bool: """ Have we processed as many records as we're allowed before we should COMMIT to the database? """ limit_before_commit = self._crinfo.cloudcfg.limit_before_commit return self._num_recs_processed >= limit_before_commit def _get_next_record(self) -> None: """ Reads the next text record and metadata into ``self._text`` and ``self._other_values``. Raises: :exc:`StopIteration` if there are no more records """ self._text, self._other_values = next(self._text_generator) self._global_recnum += 1 pkval = self._other_values[FN_SRCPKVAL] pkstr = self._other_values[FN_SRCPKSTR] # 'ifconfig.get_progress_record' expects pkstr to be None if it's # empty if not pkstr: pkstr = None if self._report_every and self._global_recnum % self._report_every == 0: # noqa # total number of records in table totalcount = self._ifconfig.get_count() log.info( "Processing {db}.{t}.{c}, PK: {pkf}={pkv} " "(record {g_recnum}/{totalcount})".format( db=self._other_values[FN_SRCDB], t=self._other_values[FN_SRCTABLE], c=self._other_values[FN_SRCFIELD], pkf=self._other_values[FN_SRCPKFIELD], pkv=pkstr if pkstr else pkval, g_recnum=self._global_recnum, totalcount=totalcount ) ) def _send_request(self) -> None: """ Send a pending request to the remote NLP server. Update the state afterwards. """ self._request.send_process_request( queue=self._queue, cookies=self._cookies, include_text_in_reply=self._crinfo.cloudcfg.has_gate_processors ) # If there's a connection error, we only get this far if we # didn't choose to stop at failure if self._request.request_failed: log.warning("Continuing after failed request.") else: if self._request.cookies: self._cookies = self._request.cookies log.info(f"Sent request to be processed: #{self._request_count} " f"of this block") self._request_count += 1 self._requests.append(self._request) if self._record_limit_reached(): self._state = self.State.FINISHED return self._state = self.State.BUILDING_REQUEST self._need_new_request = True
gpl-3.0
-5,249,729,148,744,573,000
34.75
93
0.565851
false
tchellomello/home-assistant
homeassistant/components/vesync/switch.py
1
3309
"""Support for VeSync switches.""" import logging from homeassistant.components.switch import SwitchEntity from homeassistant.core import callback from homeassistant.helpers.dispatcher import async_dispatcher_connect from .common import VeSyncDevice from .const import DOMAIN, VS_DISCOVERY, VS_DISPATCHERS, VS_SWITCHES _LOGGER = logging.getLogger(__name__) DEV_TYPE_TO_HA = { "wifi-switch-1.3": "outlet", "ESW03-USA": "outlet", "ESW01-EU": "outlet", "ESW15-USA": "outlet", "ESWL01": "switch", "ESWL03": "switch", "ESO15-TB": "outlet", } async def async_setup_entry(hass, config_entry, async_add_entities): """Set up switches.""" async def async_discover(devices): """Add new devices to platform.""" _async_setup_entities(devices, async_add_entities) disp = async_dispatcher_connect( hass, VS_DISCOVERY.format(VS_SWITCHES), async_discover ) hass.data[DOMAIN][VS_DISPATCHERS].append(disp) _async_setup_entities(hass.data[DOMAIN][VS_SWITCHES], async_add_entities) return True @callback def _async_setup_entities(devices, async_add_entities): """Check if device is online and add entity.""" dev_list = [] for dev in devices: if DEV_TYPE_TO_HA.get(dev.device_type) == "outlet": dev_list.append(VeSyncSwitchHA(dev)) elif DEV_TYPE_TO_HA.get(dev.device_type) == "switch": dev_list.append(VeSyncLightSwitch(dev)) else: _LOGGER.warning( "%s - Unknown device type - %s", dev.device_name, dev.device_type ) continue async_add_entities(dev_list, update_before_add=True) class VeSyncBaseSwitch(VeSyncDevice, SwitchEntity): """Base class for VeSync switch Device Representations.""" def turn_on(self, **kwargs): """Turn the device on.""" self.device.turn_on() class VeSyncSwitchHA(VeSyncBaseSwitch, SwitchEntity): """Representation of a VeSync switch.""" def __init__(self, plug): """Initialize the VeSync switch device.""" super().__init__(plug) self.smartplug = plug @property def device_state_attributes(self): """Return the state attributes of the device.""" attr = {} if hasattr(self.smartplug, "weekly_energy_total"): attr["voltage"] = self.smartplug.voltage attr["weekly_energy_total"] = self.smartplug.weekly_energy_total attr["monthly_energy_total"] = self.smartplug.monthly_energy_total attr["yearly_energy_total"] = self.smartplug.yearly_energy_total return attr @property def current_power_w(self): """Return the current power usage in W.""" return self.smartplug.power @property def today_energy_kwh(self): """Return the today total energy usage in kWh.""" return self.smartplug.energy_today def update(self): """Update outlet details and energy usage.""" self.smartplug.update() self.smartplug.update_energy() class VeSyncLightSwitch(VeSyncBaseSwitch, SwitchEntity): """Handle representation of VeSync Light Switch.""" def __init__(self, switch): """Initialize Light Switch device class.""" super().__init__(switch) self.switch = switch
apache-2.0
-3,332,572,542,167,740,000
29.925234
81
0.642188
false
openqt/algorithms
projecteuler/pe368-a-kempner-like-series.py
1
1219
#!/usr/bin/env python # coding=utf-8 """368. A Kempner-like series https://projecteuler.net/problem=368 The **harmonic series** $1 + \dfrac{1}{2} + \dfrac{1}{3} + \dfrac{1}{4} + ...$ is well known to be divergent. If we however omit from this series every term where the denominator has a 9 in it, the series remarkably enough converges to approximately 22.9206766193. This modified harmonic series is called the **Kempner** series. Let us now consider another modified harmonic series by omitting from the harmonic series every term where the denominator has 3 or more equal consecutive digits. One can verify that out of the first 1200 terms of the harmonic series, only 20 terms will be omitted. These 20 omitted terms are: $$\dfrac{1}{111}, \dfrac{1}{222}, \dfrac{1}{333}, \dfrac{1}{444}, \dfrac{1}{555}, \dfrac{1}{666}, \dfrac{1}{777}, \dfrac{1}{888}, \dfrac{1}{999}, \dfrac{1}{1000}, \dfrac{1}{1110}, \\\\\ \dfrac{1}{1111}, \dfrac{1}{1112}, \dfrac{1}{1113}, \dfrac{1}{1114}, \dfrac{1}{1115}, \dfrac{1}{1116}, \dfrac{1}{1117}, \dfrac{1}{1118}, \dfrac{1}{1119}$$ This series converges as well. Find the value the series converges to. Give your answer rounded to 10 digits behind the decimal point. """
gpl-3.0
5,967,106,988,400,226,000
39.633333
79
0.701395
false