content
stringlengths 7
1.05M
|
|---|
class Token(object):
def __init__(self, access_token, refresh_token, lifetime):
self.access_token = access_token # Access token value
self.refresh_token = refresh_token # Token needed for refreshing access token
self.lifetime = lifetime # Access token lifetime
|
def main():
print(hi)
if __name__ == '__main__': main()
|
"""
- Sção pequenas partes de código que realizam tarefas específicas
- Pode ou nõa receber entrada de dados e retornar uma saída de dados
- Muito úteis para para executar procedimentos similares por repetidas vezes
OBS.: Se a função realiza várias tarefas dentro dela, é bom fazer uma verificação para que a função seja simplificada
Exemplos.: print('Olá mundo')
# função
lista = []
lista.append(1)
# função
Funções integradas do Python são chamadas de Built-in, Ex.: print(), lem)(), append() e outras...
Conceito DRY -> Don't repeat yourself (não repita voçe mesmo / não repita seu código)
DEFINIÇÃO DE FUNÇÕES:
def nome_da_função(parâmetro_de_entrada)
bloco da função
ONDE:
Nome da função: sempre minúsculo, se for composto separar com underline (_)
Parâmetro de entrada: Opcional, se for mais de um separar com vírgula (,), podendo ser opcional ou não
Bloco da função: Onde o processamento acontece, pode ter ou não retorno da função. Identado com 4 espaços
Abre-se a função com a palavra reservada "def"
def diz_oi():
print('Oi!')
diz_oi()
---------------------------------------------------------------------------------------------------------------------
# FUNÇÕES COM RETORNO
# Exemplo de função com retorno
lista = [1, 2, 3]
lista.pop()
ret_pop = lista.pop()
print(f'O retorno de pop é: {ret_pop}')
# Exemplo de função sem retorno
lista = [1, 2, 3]
ret_print = print(lista)
print(f'O retorno do print é: {ret_print}') # Retorno é none
# OBS.: Em python, quando a funçao não tem retorno, o valor é none
# OBS.: Funções python que retornam valores, devem retornar esses valores com a palavras reservada "return"
---------------------------------------------------------------------------------------------------------------------
# Exemplo - Sem retorno
def quadrado_de_7():
print(7 * 7)
ret = quadrado_de_7
print(ret)
---------------------------------------------------------------------------------------------------------------------
# Exemplo - Com retorno
def quadrado_de_sete():
return 7 * 7
quadrado_de_7()
print(quadrado_de_sete())
OBS.: Não é obriatório criar variável para receber o retorno, pode-se passar a execução da função para outra
função
---------------------------------------------------------------------------------------------------------------------
# Return é bom para se juntar o retorno com outras partes do código
alguem = 'Paulo Fernando'
def oi():
return 'Oi '
print(oi() + alguem)
---------------------------------------------------------------------------------------------------------------------
# Observações sobre a palavras "return"
1 - Ela finaliza a função
2 - Pode-se ter vários return em uma função
3 - Pode-se, em uma função, retornar qualquer tipo de dado e até mesmo multiplicar valores
# Exemplo 1 - return finaliza a função
def oi():
return 'Oi'
print('Olá') # não vai exexutar, porque finalizou no return
print(oi())
---------------------------------------------------------------------------------------------------------------------
# Exemplo 2 - vários return
def nova():
variavel = False
if variavel:
return 4
elif variavel is None:
return 3.2
return 'B'
print(nova())
---------------------------------------------------------------------------------------------------------------------
# Exemplo 3 - retornar qualquer tipo de dado
def outra():
return 2, 3, 4, 5
num1, num2, num3, num4 = outra()
print(num1, num2, num3, num4)
---------------------------------------------------------------------------------------------------------------------
# Função jogar CARA OU COROA
from random import random
def jogar_moeda():
valor = random()
if valor > 0.5:
return 'Cara'
return 'Coroa'
print(jogar_moeda())
---------------------------------------------------------------------------------------------------------------------
"""
|
class Node:
def __init__(self, data):
self.data = data
self.next = None
def __repr__(self):
return self.data
class LinkedList:
def __init__(self):
self.front = None
self.rear = None
def __repr__(self):
current = self.front
nodes = []
while (current is not None):
nodes.append(current.data)
current = current.next
nodes.append('None')
return '->'.join(nodes)
def __iter__(self):
current = self.front
while (current is not None):
yield current
current = current.next
def add_front(self, data):
node = Node(data)
node.next = self.front
if (self.front is None and self.rear is None):
self.front = node
self.rear = node
else:
self.front = node
def add_rear(self, data):
node = Node(data)
if (self.front is None and self.rear is None):
self.front = node
self.rear = node
else:
self.rear.next = node
self.rear = node
def add_after(self, target_node_data, new_node_data):
if self.front is None:
raise('Linked List is empty !!!')
for node in self:
if node.data == target_node_data:
if node.next is None:
return self.add_rear(new_node_data)
else:
new_node = Node(new_node_data)
new_node.next = node.next
node.next = new_node
return
raise Exception('Node with data {} not found in linked list'
.format(target_node_data))
def add_before(self, target_node_data, new_node_data):
if self.front == None:
raise Exception('Linked List is empty')
if self.front.data == target_node_data:
return self.add_front(new_node_data)
previous_node = self.front
for node in self:
if node.data == target_node_data:
new_node = Node(new_node_data)
new_node.next = node
previous_node.next = new_node
return
previous_node = node
raise Exception('Node with data {} not found in linked list'
.format(target_node_data))
def remove_node(self, target_node_data):
if self.front is None:
raise Exception('Linked List is empty')
if self.front.data == target_node_data:
self.front = self.front.next
return
previous_node = self.front
for node in self:
if node.data == target_node_data:
previous_node.next = node.next
return
previous_node = node
raise Exception('Node with data {} not found in linked list'
.format(target_node_data))
def reverse(self):
if self.front is None:
raise Exception('Linked list is empty')
# self.rear = self.front
prev_node = None
current_node = self.front
while (current_node is not None):
next_node = current_node.next
current_node.next = prev_node
prev_node = current_node
current_node = next_node
self.front = prev_node
def sort(self):
if self.front is None:
raise Exception('Linked list is empty')
for node in self:
next_node = node.next
while next_node is not None:
if node.data > next_node.data:
node.data, next_node.data = next_node.data, node.data
next_node = next_node.next
def singly_single_list():
llist = LinkedList()
foo = 0
for item in ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j']:
if foo % 2 == 0:
llist.add_front(item)
else:
llist.add_rear(item)
foo += 1
print(llist)
llist.add_after('j', 'o')
llist.add_after('a', 'k')
llist.add_after('f', 'f')
llist.add_after('i', 'n')
llist.add_rear('m')
print(llist)
llist.add_before('i', 'z')
llist.add_before('z', 'y')
llist.add_before('n', 'p')
llist.add_before('m', 'q')
# llist.add_before('x', 'u')
print(llist)
llist.remove_node('y')
llist.remove_node('m')
llist.remove_node('a')
print(llist)
print('*** Reversing linked list ***')
llist.reverse()
print(llist)
llist.sort()
print('*** Sorted linked list ***')
print(llist)
if __name__ == '__main__':
singly_single_list()
|
def f():
a = 10
result = 0
result = sum_squares(a, result)
print("Sum of squares: " + result)
def sum_squares(a_new, result_new):
while a_new < 10:
result_new += a_new * a_new
a_new += 1
return result_new
|
m = float(input('Digite um tamanho (em metros): '))
dm = m * 10
cm = m * 100
mm = m * 1000
dam = m / 10
hm = m / 100
km = m / 1000
print('convertendo...')
print('[dm] =', dm)
print('[cm] =', cm)
print('[mm] =', mm)
print('[dam] =', dam)
print('[hm] =', hm)
print('[km] =', km)
|
'''
NAME
Busqueda del Codón inicial y secuencia transcrita
VERSION
1.0
AUTHOR
Rodrigo Daniel Hernández Barrera
DESCRIPTION
Find the start codon and the transcribed sequence
CATEGORY
Genomic sequence
INPUT
Read a DNA sequence entered by the user
OUTPUT
Returns as output the start and end positions of the sequence
to be transcribed and its nucleotide sequence
EXAMPLES
Input
dna = 'AAGGTACGTCGCGCGTTATTAGCCTAAT'
Output
El codon AUG empieza en la posicion 4 y termina en 19, tomando en cuenta el 0 como
la posicion del primer nucleotido.
Fragmento de RNA que es transcrito representado en DNA es: TACGTCGCGCGTTAT
Fragmento de RNA que es transcrito representado en RNA es: UACGUCGCGCGUUAU
'''
print('Introduzca la secuencia de DNA de interes:')
dna = input() # La secuencia input se almacena en la variable dna
codon_inicio = 'TAC'
codon_termino = 'ATT'
'''El metodo str.find() devuelve el índice más bajo en el que se encuentre
el codon de inicio, aplicado tambien para encontrar la posicion del codon de termino'''
inicio = dna.find(codon_inicio)
final = dna.find(codon_termino)
'''Se corta la secuencia para obtener la secuencia transcrita y se suma 2 para
incluir el codon de paro completo en el output'''
transcrito = dna[inicio:final + 2]
print('El codon AUG empieza en la posicion ' + str(inicio) + ' y termina en ' + str(final + 2) + ', tomando en cuenta el 0 como la posicion del primer nucleotido.')
print('Fragmento de RNA que es transcrito representado en DNA es: ' + transcrito)
print('Fragmento de RNA que es transcrito representado en RNA es: ' + transcrito.replace('T', 'U'))
|
#Input, arguments
def add(x,y):
z = x + y
b = 'I am here'
a = 'hello'
return z,b,a
x = 20
y = 5
# Calling function
print(add(x,y))
z = add(x,y) #same thing
print(z)
print(add(10,5)) #same thing |
n1 = float(input('Insira o primeiro valor desejado: '))
n2 = float(input('Insira o segundo valor desejado: '))
n3 = float(input('Insira o terceiro valor desejado: '))
if n1 > n2 != n3 and n1 > n3:
n4 = (n2 + n3)
if n4 > n1:
print('É possivel formar um triangulo com esses valores.')
else:
print('Não é possivel formar um triangulo com esses valores.')
if n2 > n1 != n3 and n2 > n3:
n4 = (n1 + n3)
if n4 > n2:
print('É possivel formar um triangulo com esses valores.')
else:
print('Esse triangulo não pode existir!!')
if n3 > n1 != n2 and n3 > n2:
n4 = (n1 + n2)
if n4 > n3:
print('A existencia desse triangulo é possivel, Vamos produzir !')
else:
print('A existencia desse triangulo não é possivel, tente novamente! ')
if n3 == n1 or n3 == n2 or n2 == n1:
print('Não é possivel formar um triangulo com esses valores.')
|
def main(request, response):
referrer = request.headers.get("referer", "")
response_headers = [("Content-Type", "text/javascript")];
return (200, response_headers, "window.referrer = '" + referrer + "'")
|
#!/usr/bin/python
#coding=utf-8
'''
@author: sheng
@license:
'''
SPELL=u'qūzé'
CN=u'曲泽'
NAME=u'quze12'
CHANNEL='pericardium'
CHANNEL_FULLNAME='PericardiumChannelofHand-Jueyin'
SEQ='PC3'
if __name__ == '__main__':
pass
|
#
# PySNMP MIB module IANA-ADDRESS-FAMILY-NUMBERS-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/IANA-ADDRESS-FAMILY-NUMBERS-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 16:50:53 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, OctetString, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "Integer", "OctetString", "ObjectIdentifier")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ConstraintsIntersection, ValueRangeConstraint, SingleValueConstraint, ConstraintsUnion = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ConstraintsIntersection", "ValueRangeConstraint", "SingleValueConstraint", "ConstraintsUnion")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
ObjectIdentity, ModuleIdentity, NotificationType, TimeTicks, Counter32, Gauge32, iso, Counter64, Unsigned32, MibScalar, MibTable, MibTableRow, MibTableColumn, MibIdentifier, Bits, Integer32, IpAddress, mib_2 = mibBuilder.importSymbols("SNMPv2-SMI", "ObjectIdentity", "ModuleIdentity", "NotificationType", "TimeTicks", "Counter32", "Gauge32", "iso", "Counter64", "Unsigned32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "MibIdentifier", "Bits", "Integer32", "IpAddress", "mib-2")
TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString")
ianaAddressFamilyNumbers = ModuleIdentity((1, 3, 6, 1, 2, 1, 72))
ianaAddressFamilyNumbers.setRevisions(('2014-09-02 00:00', '2013-09-25 00:00', '2013-07-16 00:00', '2013-06-26 00:00', '2013-06-18 00:00', '2002-03-14 00:00', '2000-09-08 00:00', '2000-03-01 00:00', '2000-02-04 00:00', '1999-08-26 00:00',))
if mibBuilder.loadTexts: ianaAddressFamilyNumbers.setLastUpdated('201409020000Z')
if mibBuilder.loadTexts: ianaAddressFamilyNumbers.setOrganization('IANA')
class AddressFamilyNumbers(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 16384, 16385, 16386, 16387, 16388, 16389, 16390, 16391, 16392, 16393, 16394, 16395, 16396, 65535))
namedValues = NamedValues(("other", 0), ("ipV4", 1), ("ipV6", 2), ("nsap", 3), ("hdlc", 4), ("bbn1822", 5), ("all802", 6), ("e163", 7), ("e164", 8), ("f69", 9), ("x121", 10), ("ipx", 11), ("appleTalk", 12), ("decnetIV", 13), ("banyanVines", 14), ("e164withNsap", 15), ("dns", 16), ("distinguishedName", 17), ("asNumber", 18), ("xtpOverIpv4", 19), ("xtpOverIpv6", 20), ("xtpNativeModeXTP", 21), ("fibreChannelWWPN", 22), ("fibreChannelWWNN", 23), ("gwid", 24), ("afi", 25), ("mplsTpSectionEndpointIdentifier", 26), ("mplsTpLspEndpointIdentifier", 27), ("mplsTpPseudowireEndpointIdentifier", 28), ("eigrpCommonServiceFamily", 16384), ("eigrpIpv4ServiceFamily", 16385), ("eigrpIpv6ServiceFamily", 16386), ("lispCanonicalAddressFormat", 16387), ("bgpLs", 16388), ("fortyeightBitMac", 16389), ("sixtyfourBitMac", 16390), ("oui", 16391), ("mac24", 16392), ("mac40", 16393), ("ipv664", 16394), ("rBridgePortID", 16395), ("trillNickname", 16396), ("reserved", 65535))
mibBuilder.exportSymbols("IANA-ADDRESS-FAMILY-NUMBERS-MIB", PYSNMP_MODULE_ID=ianaAddressFamilyNumbers, AddressFamilyNumbers=AddressFamilyNumbers, ianaAddressFamilyNumbers=ianaAddressFamilyNumbers)
|
# regular assignment
foo = 7
print(foo)
# annotated assignmnet
bar: number = 9
print(bar)
|
VERSION = "0.7.0"
LICENSE = "MIT - Copyright (c) 2021 Alex Vellone"
MOTORS_CHECK_PER_SECOND = 20
MOTORS_POINT_TO_POINT_CHECK_PER_SECOND = 10
WEB_SOCKET_SEND_PER_SECOND = 10
SOCKET_SEND_PER_SECOND = 20
SOCKET_INCOMING_LIMIT = 5
SLEEP_AVOID_CPU_WASTE = 0.80
|
def sumoftwo(a, b):
"""
This is an sumoftwo function to add two number
:param int a: first number to add
:param int b: first number to add
:return: return addition of the integer
:rtype: int
:example:
>>> r = sumoftwo(2, 3)
>>> r
5
"""
return a + b
|
model_fn = model_fn_builder(
bert_config=bert_config,
init_checkpoint=init_checkpoint,
layer_indexes=layer_indexes,
use_tpu=False,
use_one_hot_embeddings=False)
# If TPU is not available, this will fall back to normal Estimator on CPU
# or GPU.
estimator = tf.contrib.tpu.TPUEstimator(
use_tpu=False,
model_fn=model_fn,
config=run_config,
predict_batch_size=batch_size)
input_fn = input_fn_builder(
features=features, seq_length=max_seq_length)
vectorized_text_segments = []
for result in estimator.predict(input_fn, yield_single_examples=True):
layer_output = result["layer_output_0"]
feature_vec = [
round(float(x), 6) for x in layer_output[0].flat
]
vectorized_text_segments.append(feature_vec) |
# Exercico 1 - listas
# Escreva program que leia a nome de 10 alunos
# Armezene os nomes em uma lista
# Imprema a lista
nomes =[]
for i in range(1,11):
nome = [input(f'Informe o {i} Nome')]
nomes.append(nome)
for d in nomes:
print(f' Nomes informados {d}') |
"""
We consider a string programmer string if some subset of its letters can be rearranged to form the word programmer.
They are anagrams.
Given a long string determine the number of indices within the string that are in between two programmer strings.
The character 'x' inside an anagram are considered redundant and not counted. But they are counted normally as characters outside
an anagram of programmer type substring.
This question came in Cognizant Mock Test 2019
"""
def getVector(w):
w = w.lower()
fv = [0]*26
for ch in w:
fv[ord(ch)-97] += 1
return fv
def getsVector(w):
w = w.lower()
fv = [0]*26
for ch in w:
fv[ord(ch)-97] += 1
return stringifyWindow(fv)
def stringifyWindow(arr):
arr[23] = 0
fvs = [str(i) for i in arr]
return ''.join(fvs)
def addToWindow(fv, ch):
fv[ord(ch)-97] += 1
return fv
def remFromWindow(fv, ch):
fv[ord(ch)-97] -= 1
return fv
def program(string, word):
end1, start2 = 0, 0
if len(string) < len(word):
return -1
n = len(string)
found = 0
targethashstr = getsVector(word)
left = 0
right = len(word)-1
window = string[:len(word)]
windowhash = getVector(window)
while right < n:
#print(left, right, string[left:right+1])
# x is present
while len(word) > sum(windowhash)-windowhash[23]:
#print("Window Lengthening Due To Presence Of X")
right += 1
if right == n:
right = n-1
break
windowhash = addToWindow(windowhash, string[right])
#print(string[left:right+1])
windowhashstr = stringifyWindow(windowhash)
if windowhashstr == targethashstr and found == 0:
found = 1
while string[left] == 'x':
left += 1
#print("First ",left,right)
end1 = right
elif windowhashstr == targethashstr and found == 1:
found = 2
while string[left] == 'x':
left += 1
start2 = left
#print("Second ",left,right, string[left: right+1])
break
else:
#print("Sliding")
left += 1
right = left + len(word) - 1
windowhash = getVector(string[left : right+1])
continue
left = right + 1
right = left + len(word) - 1
windowhash = getVector(string[left : right+1])
if found == 2:
return start2 - end1 - 1
else:
return -1
print(program('programmerrxprogxxermram','programmer'))
print(program('xprogrxammerprogrammer','programmer'))
print(program('rammerxprogrammer','programmer'))
print(program('progamemrrgramxprgom', 'programmer'))
print(program('progamemrrgramxprergom', 'programmer'))
print(program('progamemrrramxprergom', 'programmer')) |
# -*- coding: utf-8 -*-
# Scrapy settings for MavenScrapy project
#
# For simplicity, this file contains only settings considered important or
# commonly used. You can find more settings consulting the documentation:
#
# https://doc.scrapy.org/en/latest/topics/settings.html
# https://doc.scrapy.org/en/latest/topics/downloader-middleware.html
# https://doc.scrapy.org/en/latest/topics/spider-middleware.html
BOT_NAME = 'MavenScrapy'
FEED_EXPORT_ENCODING = 'utf-8'
SCHEDULER = "scrapy_redis.scheduler.Scheduler"
DUPEFILTER_CLASS = "scrapy_redis.dupefilter.RFPDupeFilter"
#REDIS_HOST = '192.168.22.106'
REDIS_HOST = '127.0.0.1'
REDIS_PORT = 6379
REDIS_PASSWORD = 'root'
SPIDER_MODULES = ['MavenScrapy.spiders']
NEWSPIDER_MODULE = 'MavenScrapy.spiders'
# Crawl responsibly by identifying yourself (and your website) on the user-agent
# USER_AGENT = 'MavenScrapy (+http://www.yourdomain.com)'
# Obey robots.txt rules
ROBOTSTXT_OBEY = False
# Configure maximum concurrent requests performed by Scrapy (default: 16)
# CONCURRENT_REQUESTS = 128
# Configure a delay for requests for the same website (default: 0)
# See https://doc.scrapy.org/en/latest/topics/settings.html#download-delay
# See also autothrottle settings and docs
DOWNLOAD_DELAY = 1
# The download delay setting will honor only one of:
# CONCURRENT_REQUESTS_PER_DOMAIN = 16
# CONCURRENT_REQUESTS_PER_IP = 16
# Disable cookies (enabled by default)
# COOKIES_ENABLED = False
# Disable Telnet Console (enabled by default)
# TELNETCONSOLE_ENABLED = False
# Override the default request headers:
DEFAULT_REQUEST_HEADERS = {
'Accept': 'text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8',
'Accept-Language': 'en',
}
USER_AGENT = "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:47.0) Gecko/20100101 Firefox/47.0"
# Enable or disable spider middlewares
# See https://doc.scrapy.org/en/latest/topics/spider-middleware.html
# SPIDER_MIDDLEWARES = {
# 'MavenScrapy.middlewares.MavenscrapySpiderMiddleware': 543,
# }
# Enable or disable downloader middlewares
# See https://doc.scrapy.org/en/latest/topics/downloader-middleware.html
DOWNLOADER_MIDDLEWARES = {
'MavenScrapy.middlewares.ProxyMiddleware': 543,
}
# Enable or disable extensions
# See https://doc.scrapy.org/en/latest/topics/extensions.html
# EXTENSIONS = {
# 'scrapy.extensions.telnet.TelnetConsole': None,
# }
# Configure item pipelines
# See https://doc.scrapy.org/en/latest/topics/item-pipeline.html
ITEM_PIPELINES = {
'MavenScrapy.pipelines.MavenscrapyPipeline': 300,
}
# MySQL 数据库参数配置
MYSQL_HOST = '127.0.0.1'
MYSQL_PORT = 3306
MYSQL_USER = 'root'
MYSQL_PASSWORD = 'root'
MYSQL_DBNAME = 'test'
RETRY_ENABLED = True # 打开重试开关
RETRY_TIMES = 30 # 重试次数
DOWNLOAD_TIMEOUT = 60 # 60s超时
RETRY_HTTP_CODES = [429, 404, 403] # 重试
# 爬取网站最大允许的深度(depth)值。如果为0，则没有限制。
DEPTH_LIMIT = 0
# 爬取时，0表示深度优先Lifo(默认)；1表示广度优先FiFo
# 后进先出，深度优先
DEPTH_PRIORITY = 0
SCHEDULER_DISK_QUEUE = 'scrapy.squeues.PickleLifoDiskQueue'
SCHEDULER_MEMORY_QUEUE = 'scrapy.squeues.LifoMemoryQueue'
# 先进先出，广度优先
# DEPTH_PRIORITY = 1
# SCHEDULER_DISK_QUEUE = 'scrapy.squeues.PickleFifoDiskQueue'
# SCHEDULER_MEMORY_QUEUE = 'scrapy.squeues.FifoMemoryQueue'
# Enable and configure the AutoThrottle extension (disabled by default)
# See https://doc.scrapy.org/en/latest/topics/autothrottle.html
# AUTOTHROTTLE_ENABLED = True
# The initial download delay
# AUTOTHROTTLE_START_DELAY = 5
# The maximum download delay to be set in case of high latencies
# AUTOTHROTTLE_MAX_DELAY = 60
# The average number of requests Scrapy should be sending in parallel to
# each remote server
# AUTOTHROTTLE_TARGET_CONCURRENCY = 1.0
# Enable showing throttling stats for every response received:
# AUTOTHROTTLE_DEBUG = False
# Enable and configure HTTP caching (disabled by default)
# See https://doc.scrapy.org/en/latest/topics/downloader-middleware.html#httpcache-middleware-settings
# HTTPCACHE_ENABLED = True
# HTTPCACHE_EXPIRATION_SECS = 0
# HTTPCACHE_DIR = 'httpcache'
# HTTPCACHE_IGNORE_HTTP_CODES = []
# HTTPCACHE_STORAGE = 'scrapy.extensions.httpcache.FilesystemCacheStorage'
|
pesos = []
for p in range(1,6):
peso = int(input("Digite o peso: "))
pesos.append(peso)
print("o menor peso é {} e o menor peso é {}".format(min(pesos), max(pesos))) |
class Solution:
def XXX(self, x: int) -> int:
if x == 0:
return 0
res = str(x)
sign = 1
if res[0] == '-':
res = res[1:]
sign = -1
res = res[::-1]
if res[0] == '0':
res = res[1:]
resint = int(res)*sign
if(resint<-2147483648 or resint>2147483647):
return 0
else:
return resint
|
#Making a nice litte x o o o x o o o x tic tac toe board
def printer(board):
for i in range(3):
for j in range (3):
print(board[i][j], end="")
if j<2:
print(" | ", end="")
print()
if i<2:
print("--+----+--")
def main():
tictactoe=[[" " for i in range (3)] for j in range (3)]
for i in range (3):
for j in range(3):
if i==j:
tictactoe[i][j]="X"
else:
tictactoe[i][j]="O"
printer(tictactoe)
main() |
#!/usr/bin/python
# create_dict.py
weekend = { "Sun": "Sunday", "Mon": "Monday" }
vals = dict(one=1, two=2)
capitals = {}
capitals["svk"] = "Bratislava"
capitals["deu"] = "Berlin"
capitals["dnk"] = "Copenhagen"
d = { i: object() for i in range(4) }
print (weekend)
print (vals)
print (capitals)
print (d)
|
# to jest komentarz
WIDTH = 550
HEIGHT = 550
|
#
# @lc app=leetcode.cn id=617 lang=python3
#
# [617] merge-two-binary-trees
#
None
# @lc code=end |
class Solution:
def generatePossibleNextMoves(self, s: str) -> List[str]:
results = []
for i in range(len(s) - 1):
if s[i: i + 2] == "++":
results.append(s[:i] + "--" + s[i + 2:])
return results |
class MyStack(object):
def __init__(self):
"""
Initialize your data structure here.
"""
self.data = []
def push(self, x):
"""
Push element x onto stack.
:type x: int
:rtype: None
"""
q = [x]
while self.data:
q.append(self.data.pop(0))
self.data = q
def pop(self):
"""
Removes the element on top of the stack and returns that element.
:rtype: int
"""
return self.data.pop(0)
def top(self):
"""
Get the top element.
:rtype: int
"""
return self.data[0]
def empty(self):
"""
Returns whether the stack is empty.
:rtype: bool
"""
return len(self.data) == 0
def test_mystack():
stack = MyStack()
stack.push(1)
stack.push(2)
assert 2 == stack.top()
assert 2 == stack.pop()
assert stack.empty() is False
|
heatmap_1_r = imresize(heatmap_1, (50,80)).astype("float32")
heatmap_2_r = imresize(heatmap_2, (50,80)).astype("float32")
heatmap_3_r = imresize(heatmap_3, (50,80)).astype("float32")
heatmap_geom_avg = np.power(heatmap_1_r * heatmap_2_r * heatmap_3_r, 0.333)
display_img_and_heatmap("dog.jpg", heatmap_geom_avg)
|
quantidade, menor, maior, soma = 0,0,0,0
quantidade = int(input())
while(quantidade>0):
menor, maior, soma, final= 10,0,0,0
nome = input()
dificuldade = float(input())
notas = input().split()
notas = list(notas)
for i in range(len(notas)):
notas[i] = float(notas[i])
notas.sort()
cont = 0
for i in range(len(notas)-1):
if(cont != 0):
soma +=notas[i]
else:
cont+=1
final = soma*dificuldade
print(nome + " {:.2f}".format(final))
quantidade-=1 |
ALLERGIES_SCORE = ['eggs', 'peanuts', 'shellfish', 'strawberries',
'tomatoes', 'chocolate', 'pollen', 'cats']
class Allergies:
def __init__(self, score: int):
self.score = score
self.lst = self.list_of_allergies()
def allergic_to(self, item: str) -> bool:
return item in self.lst
def list_of_allergies(self) -> list[str]:
score = self.score
mask = 1 # This mask starts as 0b1, which stands for eggs.
# The idea is if we do a bitwise AND (&) with a score of, for example, 3, which is 0b11.
# This will return 0b01, which would be True, that is, you are allergic to eggs.
allergy_list = []
for allergen in ALLERGIES_SCORE:
if score & mask: # Bitwise AND can be done in ints!
allergy_list.append(allergen)
# Shift the bit on the mask to the left for the next allergen
mask <<= 1
return allergy_list
|
class Number:
def __init__(self, start):
self.data = start
def __sub__(self, other):
return Number(self.data - other)
class Indexer:
data = [5, 6, 7, 8, 9]
def __getitem__(self, item):
print('getitem:', item)
return self.data[item]
def __setitem__(self, index, value):
self.data[index] = value
class Stepper:
def __getitem__(self, item):
return self.data[item]
class Squares:
def __init__(self, start, stop):
self.value = start - 1
self.stop = stop
def __iter__(self):
print('call __iter__')
return self
def __next__(self):
if self.value == self.stop:
raise StopIteration
self.value += 1
return self.value ** 2
'''
for i in Squares(1, 5):
print(i, end=' ')
'''
class SkipIterator:
def __init__(self, wrapped):
self.wrapped = wrapped
self.offset = 0
def __next__(self):
if self.offset >= len(self.wrapped):
raise StopIteration
else:
item = self.wrapped[self.offset]
self.offset += 2
return item
class SkipObject:
def __init__(self, wrapped):
self.wrapped = wrapped
def __iter__(self):
return StopIteration(self.wrapped)
'''
if __name__ == '__main__':
alpha = 'abcdef'
skipper = SkipObject(alpha)
I = iter(skipper)
print(next((I), next(I), next(I)))
for x in skipper:
for y in skipper:
print(x + y, end=' ')
'''
class Iters:
def __init__(self, value):
self.data = value
def __getitem__(self, item):
print('get[%s]:' % item, end='')
return self.data[item]
def __iter__(self):
print('iter=>', end='')
self.ix = 0
return self
def __next__(self):
print('next:', end='')
if self.ix == len(self.data):
raise StopIteration
item = self.data[self.ix]
self.ix += 1
return item
def __contains__(self, item):
print('contains: ', end='')
return item in self.data
x = Iters([1, 2, 3, 4, 5])
print(3 in x)
for i in x:
print(i, end=' | ')
print()
print([i ** 2 for i in x])
print(list(map(bin, x)))
I = iter(x)
while True:
try:
print(next(I), end='@')
except StopIteration:
break
class Empty:
def __getattr__(self, item):
if item == 'age':
return 40
else:
raise AttributeError
x = Empty()
print(x.age)
class AccessControl:
def __setattr__(self, attr, value):
if attr == 'age':
self.__dict__[attr] = value
else:
raise AttributeError
class PrivateExc(Exception):
pass
class Privacy:
def __setattr__(self, attrname, value):
if attrname in self.privates:
raise PrivateExc(attrname, self)
else:
self.__dict__[attrname] = value
class Test1(Privacy):
privates = ['age']
class Test2(Privacy):
privates = ['name', 'pay']
def __init__(self):
self.__dict__['name'] = 'Tom'
class Adder:
def __init__(self, value):
self.data = value
def __add__(self, other):
self.data += other
def __repr__(self):
return 'Adder(%s)' % self.data
class Printer:
def __init__(self, value):
self.value = value
def __str__(self):
return str(self.value)
class Commuter:
def __init__(self, value):
self.value = value
def __add__(self, other):
print('add', self.value, other)
return self.value + other
def __radd__(self, other):
print('radd', self.value, other)
return other + self.value
class Commuter:
def __init__(self, value):
self.value = value
def __add__(self, other):
if isinstance(other, Commuter):
other = other.value
return Commuter(self.value + other)
class Number:
def __init__(self, value):
self.value = value
def __iadd__(self, other):
self.value += other
return self
class Callee:
def __call__(self, *args, **kwargs):
print('Called:', args, kwargs)
def __init__(self):
print('init')
class C:
data = 'spam'
def __gt__(self, other):
return self.data > other
def __lt__(self, other):
return self.data < other
class Life:
def __init__(self, name='unknown'):
print('Hello', name)
self.name = name
def __del__(self):
print('Goodbye', self.name)
class C:
def meth(self, *args):
if len(args) == 1:
...
elif type(args[0]) == int:
...
|
# This helper file, setups the rules and rewards for the mouse grid system
# State = 1, start point
# Action - 1: Top, 2:Left, 3:Right, 4:Down
def transition_rules(state, action):
# For state 1
if state == 1 and (action == 3 or action == 4):
state = 1
elif state == 1 and action == 1:
state = 5
elif state == 1 and action == 2:
state = 2
# For state 2
elif state == 2 and action == 4:
state = 2
elif state == 2 and action == 1:
state = 5
elif state == 2 and action == 2:
state = 3
elif state == 2 and action == 3:
state = 1
# For state 3
elif state == 3 and action == 4:
state = 3
elif state == 3 and action == 1:
state = 7
elif state == 3 and action == 2:
state = 4
elif state == 3 and action == 3:
state = 2
# For state 4
elif state == 4 and (action == 4 or action == 2):
state = 4
elif state == 4 and action == 1:
state = 8
elif state == 4 and action == 3:
state = 3
# For state 5
elif state == 5:
state = 1
# For state 6
elif state == 6 and action == 1:
state = 10
elif state == 6 and action == 2:
state = 7
elif state == 6 and action == 3:
state = 5
elif state == 6 and action == 4:
state = 2
# For state 7
elif state == 7:
state = 1
# For state 8
elif state == 8 and action == 1:
state = 12
elif state == 8 and action == 2:
state = 8
elif state == 8 and action == 3:
state = 7
elif state == 8 and action == 4:
state = 3
# For state 9
elif state == 9 and action == 1:
state = 13
elif state == 9 and action == 2:
state = 10
elif state == 9 and action == 3:
state = 9
elif state == 9 and action == 4:
state = 5
# For state 10
elif state == 10 and action == 1:
state = 14
elif state == 10 and action == 2:
state = 11
elif state == 10 and action == 3:
state = 9
elif state == 10 and action == 4:
state = 6
# For state 11
elif state == 11 and action == 1:
state = 15
elif state == 11 and action == 2:
state = 12
elif state == 11 and action == 3:
state = 10
elif state == 11 and action == 4:
state = 7
# For state 12
elif state == 12 and action == 1:
state = 16
elif state == 12 and action == 2:
state = 12
elif state == 12 and action == 3:
state = 11
elif state == 12 and action == 4:
state = 8
# For state 13
elif state == 13:
state = 1
# For state 14
elif state == 14 and action == 1:
state = 14
elif state == 14 and action == 2:
state = 15
elif state == 14 and action == 3:
state = 13
elif state == 14 and action == 4:
state = 10
# For state 15
elif state == 15 and action == 1:
state = 15
elif state == 15 and action == 2:
state = 16
elif state == 15 and action == 3:
state = 14
elif state == 15 and action == 4:
state = 11
# For state 16
elif state == 16:
state = 16
return state
def reward_rules(state, prev_state):
if state == 16:
reward = 100
elif state == 5 or state == 7 or state == 13 or state == 14:
reward = -10
elif prev_state > state:
reward = -1
elif prev_state == state:
reward = 0
else:
reward = 1
return reward
|
#
# PySNMP MIB module HUAWEI-BRAS-SBC-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/HUAWEI-BRAS-SBC-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 19:31:26 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
OctetString, Integer, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "OctetString", "Integer", "ObjectIdentifier")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueRangeConstraint, SingleValueConstraint, ConstraintsIntersection, ValueSizeConstraint, ConstraintsUnion = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "SingleValueConstraint", "ConstraintsIntersection", "ValueSizeConstraint", "ConstraintsUnion")
entPhysicalIndex, = mibBuilder.importSymbols("ENTITY-MIB", "entPhysicalIndex")
hwBRASMib, = mibBuilder.importSymbols("HUAWEI-MIB", "hwBRASMib")
ObjectGroup, ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ObjectGroup", "ModuleCompliance", "NotificationGroup")
ModuleIdentity, Counter64, iso, Integer32, Gauge32, ObjectIdentity, MibIdentifier, IpAddress, MibScalar, MibTable, MibTableRow, MibTableColumn, Bits, Unsigned32, NotificationType, TimeTicks, Counter32 = mibBuilder.importSymbols("SNMPv2-SMI", "ModuleIdentity", "Counter64", "iso", "Integer32", "Gauge32", "ObjectIdentity", "MibIdentifier", "IpAddress", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Bits", "Unsigned32", "NotificationType", "TimeTicks", "Counter32")
TruthValue, DisplayString, RowStatus, TextualConvention, DateAndTime = mibBuilder.importSymbols("SNMPv2-TC", "TruthValue", "DisplayString", "RowStatus", "TextualConvention", "DateAndTime")
hwBrasSbcMgmt = ModuleIdentity((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25))
hwBrasSbcMgmt.setRevisions(('2007-08-14 09:00',))
if mibBuilder.loadTexts: hwBrasSbcMgmt.setLastUpdated('200711210900Z')
if mibBuilder.loadTexts: hwBrasSbcMgmt.setOrganization('Huawei Technologies Co., Ltd.')
class HWBrasEnabledStatus(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2))
namedValues = NamedValues(("enabled", 1), ("disabled", 2))
class HWBrasPermitStatus(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2))
namedValues = NamedValues(("deny", 1), ("permit", 2))
class HWBrasSecurityProtocol(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("sip", 1), ("mgcp", 2), ("h323", 3), ("signaling", 4))
class HWBrasSbcBaseProtocol(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6, 7, 8))
namedValues = NamedValues(("sip", 1), ("mgcp", 2), ("snmp", 3), ("ras", 4), ("upath", 5), ("h248", 6), ("ido", 7), ("q931", 8))
class HwBrasAppMode(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2))
namedValues = NamedValues(("singleDomain", 1), ("multiDomain", 2))
class HwBrasBWLimitType(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2))
namedValues = NamedValues(("be", 1), ("qos", 2))
hwBrasSbcModule = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2))
hwBrasSbcObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1))
hwBrasSbcGeneral = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1))
hwBrasSbcBase = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1))
hwBrasSbcBaseLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 1))
hwBrasSbcStatisticEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcStatisticEnable.setStatus('current')
hwBrasSbcStatisticSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 1, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcStatisticSyslogEnable.setStatus('current')
hwBrasSbcAppMode = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 1, 3), HwBrasAppMode().clone()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcAppMode.setStatus('current')
hwBrasSbcMediaDetectValidityEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 1, 4), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMediaDetectValidityEnable.setStatus('current')
hwBrasSbcMediaDetectSsrcEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 1, 5), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMediaDetectSsrcEnable.setStatus('current')
hwBrasSbcMediaDetectPacketLength = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 1, 6), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(28, 65535)).clone(1500)).setUnits('byte').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMediaDetectPacketLength.setStatus('current')
hwBrasSbcBaseTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2))
hwBrasSbcSignalAddrMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcSignalAddrMapTable.setStatus('current')
hwBrasSbcSignalAddrMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalAddrMapClientAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalAddrMapServerAddr"))
if mibBuilder.loadTexts: hwBrasSbcSignalAddrMapEntry.setStatus('current')
hwBrasSbcSignalAddrMapClientAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 1, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSignalAddrMapClientAddr.setStatus('current')
hwBrasSbcSignalAddrMapServerAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 1, 1, 2), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSignalAddrMapServerAddr.setStatus('current')
hwBrasSbcSignalAddrMapSoftAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 1, 1, 3), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSignalAddrMapSoftAddr.setStatus('current')
hwBrasSbcSignalAddrMapIadmsAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 1, 1, 4), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSignalAddrMapIadmsAddr.setStatus('current')
hwBrasSbcSignalAddrMapRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSignalAddrMapRowStatus.setStatus('current')
hwBrasSbcMediaAddrMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcMediaAddrMapTable.setStatus('current')
hwBrasSbcMediaAddrMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaAddrMapClientAddr"))
if mibBuilder.loadTexts: hwBrasSbcMediaAddrMapEntry.setStatus('current')
hwBrasSbcMediaAddrMapClientAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 2, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcMediaAddrMapClientAddr.setStatus('current')
hwBrasSbcMediaAddrMapServerAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 2, 1, 2), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaAddrMapServerAddr.setStatus('current')
hwBrasSbcMediaAddrMapWeight = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 2, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(10, 100)).clone(50)).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaAddrMapWeight.setStatus('current')
hwBrasSbcMediaAddrMapRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 2, 1, 4), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaAddrMapRowStatus.setStatus('current')
hwBrasSbcPortrangeTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcPortrangeTable.setStatus('current')
hwBrasSbcPortrangeEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcPortrangeIndex"))
if mibBuilder.loadTexts: hwBrasSbcPortrangeEntry.setStatus('current')
hwBrasSbcPortrangeIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 3, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6))).clone(namedValues=NamedValues(("signal", 1), ("media", 2), ("nat", 3), ("tcp", 4), ("udp", 5), ("mediacur", 6))))
if mibBuilder.loadTexts: hwBrasSbcPortrangeIndex.setStatus('current')
hwBrasSbcPortrangeBegin = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 3, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(10001, 65535))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcPortrangeBegin.setStatus('current')
hwBrasSbcPortrangeEnd = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 3, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(10001, 65535))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcPortrangeEnd.setStatus('current')
hwBrasSbcPortrangeRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 3, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcPortrangeRowStatus.setStatus('current')
hwBrasSbcStatMediaPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcStatMediaPacketTable.setStatus('current')
hwBrasSbcStatMediaPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatMediaPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcStatMediaPacketEntry.setStatus('current')
hwBrasSbcStatMediaPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 4, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("rtp", 1), ("rtcp", 2))))
if mibBuilder.loadTexts: hwBrasSbcStatMediaPacketIndex.setStatus('current')
hwBrasSbcStatMediaPacketNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 4, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcStatMediaPacketNumber.setStatus('current')
hwBrasSbcStatMediaPacketOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 4, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcStatMediaPacketOctet.setStatus('current')
hwBrasSbcStatMediaPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 4, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcStatMediaPacketRowStatus.setStatus('current')
hwBrasSbcClientPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcClientPortTable.setStatus('current')
hwBrasSbcClientPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortVPN"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortIP"))
if mibBuilder.loadTexts: hwBrasSbcClientPortEntry.setStatus('current')
hwBrasSbcClientPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6, 7))).clone(namedValues=NamedValues(("sip", 1), ("mgcp", 2), ("snmp", 3), ("ras", 4), ("upath", 5), ("h248", 6), ("ido", 7))))
if mibBuilder.loadTexts: hwBrasSbcClientPortProtocol.setStatus('current')
hwBrasSbcClientPortVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023)))
if mibBuilder.loadTexts: hwBrasSbcClientPortVPN.setStatus('current')
hwBrasSbcClientPortIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcClientPortIP.setStatus('current')
hwBrasSbcClientPortPort01 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort01.setStatus('current')
hwBrasSbcClientPortPort02 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 12), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort02.setStatus('current')
hwBrasSbcClientPortPort03 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 13), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort03.setStatus('current')
hwBrasSbcClientPortPort04 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 14), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort04.setStatus('current')
hwBrasSbcClientPortPort05 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 15), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort05.setStatus('current')
hwBrasSbcClientPortPort06 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 16), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort06.setStatus('current')
hwBrasSbcClientPortPort07 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 17), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort07.setStatus('current')
hwBrasSbcClientPortPort08 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 18), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort08.setStatus('current')
hwBrasSbcClientPortPort09 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 19), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort09.setStatus('current')
hwBrasSbcClientPortPort10 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 20), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort10.setStatus('current')
hwBrasSbcClientPortPort11 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 21), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort11.setStatus('current')
hwBrasSbcClientPortPort12 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 22), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort12.setStatus('current')
hwBrasSbcClientPortPort13 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 23), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort13.setStatus('current')
hwBrasSbcClientPortPort14 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 24), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort14.setStatus('current')
hwBrasSbcClientPortPort15 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 25), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort15.setStatus('current')
hwBrasSbcClientPortPort16 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 26), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortPort16.setStatus('current')
hwBrasSbcClientPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 5, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcClientPortRowStatus.setStatus('current')
hwBrasSbcSoftswitchPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcSoftswitchPortTable.setStatus('current')
hwBrasSbcSoftswitchPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSoftswitchPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSoftswitchPortVPN"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSoftswitchPortIP"))
if mibBuilder.loadTexts: hwBrasSbcSoftswitchPortEntry.setStatus('current')
hwBrasSbcSoftswitchPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 6, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 4, 5, 6, 7, 8))).clone(namedValues=NamedValues(("sip", 1), ("mgcp", 2), ("ras", 4), ("upath", 5), ("h248", 6), ("ido", 7), ("q931", 8))))
if mibBuilder.loadTexts: hwBrasSbcSoftswitchPortProtocol.setStatus('current')
hwBrasSbcSoftswitchPortVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 6, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023)))
if mibBuilder.loadTexts: hwBrasSbcSoftswitchPortVPN.setStatus('current')
hwBrasSbcSoftswitchPortIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 6, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSoftswitchPortIP.setStatus('current')
hwBrasSbcSoftswitchPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 6, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSoftswitchPortPort.setStatus('current')
hwBrasSbcSoftswitchPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 6, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSoftswitchPortRowStatus.setStatus('current')
hwBrasSbcIadmsPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 7), )
if mibBuilder.loadTexts: hwBrasSbcIadmsPortTable.setStatus('current')
hwBrasSbcIadmsPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 7, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsPortVPN"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsPortIP"))
if mibBuilder.loadTexts: hwBrasSbcIadmsPortEntry.setStatus('current')
hwBrasSbcIadmsPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 7, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(3))).clone(namedValues=NamedValues(("snmp", 3))))
if mibBuilder.loadTexts: hwBrasSbcIadmsPortProtocol.setStatus('current')
hwBrasSbcIadmsPortVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 7, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023)))
if mibBuilder.loadTexts: hwBrasSbcIadmsPortVPN.setStatus('current')
hwBrasSbcIadmsPortIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 7, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIadmsPortIP.setStatus('current')
hwBrasSbcIadmsPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 7, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIadmsPortPort.setStatus('current')
hwBrasSbcIadmsPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 7, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIadmsPortRowStatus.setStatus('current')
hwBrasSbcInstanceTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 8), )
if mibBuilder.loadTexts: hwBrasSbcInstanceTable.setStatus('current')
hwBrasSbcInstanceEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 8, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcInstanceName"))
if mibBuilder.loadTexts: hwBrasSbcInstanceEntry.setStatus('current')
hwBrasSbcInstanceName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 8, 1, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcInstanceName.setStatus('current')
hwBrasSbcInstanceRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 2, 8, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcInstanceRowStatus.setStatus('current')
hwBrasSbcMapGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3))
hwBrasSbcMapGroupLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 1))
hwBrasSbcMapGroupTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2))
hwBrasSbcMapGroupsTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcMapGroupsTable.setStatus('current')
hwBrasSbcMapGroupsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMapGroupsIndex"))
if mibBuilder.loadTexts: hwBrasSbcMapGroupsEntry.setStatus('current')
hwBrasSbcMapGroupsIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMapGroupsIndex.setStatus('current')
hwBrasSbcMapGroupsType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("proxy", 1), ("intercomIP", 2), ("intercomPrefix", 3), ("bgf", 4)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMapGroupsType.setStatus('current')
hwBrasSbcMapGroupsStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1, 1, 12), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMapGroupsStatus.setStatus('current')
hwBrasSbcMapGroupInstanceName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1, 1, 13), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMapGroupInstanceName.setStatus('current')
hwBrasSbcMapGroupSessionLimit = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1, 1, 14), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 40000)).clone(40000)).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMapGroupSessionLimit.setStatus('current')
hwBrasSbcMapGroupsRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 1, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMapGroupsRowStatus.setStatus('current')
hwBrasSbcMGCliAddrTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcMGCliAddrTable.setStatus('current')
hwBrasSbcMGCliAddrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGCliAddrIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGCliAddrEntry.setStatus('current')
hwBrasSbcMGCliAddrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 2, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGCliAddrIndex.setStatus('current')
hwBrasSbcMGCliAddrVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 2, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGCliAddrVPN.setStatus('current')
hwBrasSbcMGCliAddrIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 2, 1, 12), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGCliAddrIP.setStatus('current')
hwBrasSbcMGCliAddrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 2, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGCliAddrRowStatus.setStatus('current')
hwBrasSbcMGServAddrTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcMGServAddrTable.setStatus('current')
hwBrasSbcMGServAddrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGServAddrIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGServAddrEntry.setStatus('current')
hwBrasSbcMGServAddrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGServAddrIndex.setStatus('current')
hwBrasSbcMGServAddrVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGServAddrVPN.setStatus('current')
hwBrasSbcMGServAddrIP1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1, 12), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGServAddrIP1.setStatus('current')
hwBrasSbcMGServAddrIP2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1, 13), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGServAddrIP2.setStatus('current')
hwBrasSbcMGServAddrIP3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1, 14), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGServAddrIP3.setStatus('current')
hwBrasSbcMGServAddrIP4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1, 15), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGServAddrIP4.setStatus('current')
hwBrasSbcMGServAddrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 3, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGServAddrRowStatus.setStatus('current')
hwBrasSbcMGSofxAddrTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrTable.setStatus('current')
hwBrasSbcMGSofxAddrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGSofxAddrIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrEntry.setStatus('current')
hwBrasSbcMGSofxAddrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrIndex.setStatus('current')
hwBrasSbcMGSofxAddrVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrVPN.setStatus('current')
hwBrasSbcMGSofxAddrIP1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1, 12), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrIP1.setStatus('current')
hwBrasSbcMGSofxAddrIP2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1, 13), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrIP2.setStatus('current')
hwBrasSbcMGSofxAddrIP3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1, 14), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrIP3.setStatus('current')
hwBrasSbcMGSofxAddrIP4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1, 15), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrIP4.setStatus('current')
hwBrasSbcMGSofxAddrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 4, 1, 51), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGSofxAddrRowStatus.setStatus('current')
hwBrasSbcMGIadmsAddrTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrTable.setStatus('current')
hwBrasSbcMGIadmsAddrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGIadmsAddrIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrEntry.setStatus('current')
hwBrasSbcMGIadmsAddrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrIndex.setStatus('current')
hwBrasSbcMGIadmsAddrVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrVPN.setStatus('current')
hwBrasSbcMGIadmsAddrIP1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1, 12), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrIP1.setStatus('current')
hwBrasSbcMGIadmsAddrIP2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1, 13), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrIP2.setStatus('current')
hwBrasSbcMGIadmsAddrIP3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1, 14), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrIP3.setStatus('current')
hwBrasSbcMGIadmsAddrIP4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1, 15), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrIP4.setStatus('current')
hwBrasSbcMGIadmsAddrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 5, 1, 51), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGIadmsAddrRowStatus.setStatus('current')
hwBrasSbcMGProtocolTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcMGProtocolTable.setStatus('current')
hwBrasSbcMGProtocolEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGProtocolEntry.setStatus('current')
hwBrasSbcMGProtocolIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGProtocolIndex.setStatus('current')
hwBrasSbcMGProtocolSip = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 11), HWBrasEnabledStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGProtocolSip.setStatus('current')
hwBrasSbcMGProtocolMgcp = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 12), HWBrasEnabledStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGProtocolMgcp.setStatus('current')
hwBrasSbcMGProtocolH323 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 13), HWBrasEnabledStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGProtocolH323.setStatus('current')
hwBrasSbcMGProtocolIadms = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 14), HWBrasEnabledStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGProtocolIadms.setStatus('current')
hwBrasSbcMGProtocolUpath = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 15), HWBrasEnabledStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGProtocolUpath.setStatus('current')
hwBrasSbcMGProtocolH248 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 16), HWBrasEnabledStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGProtocolH248.setStatus('current')
hwBrasSbcMGProtocolRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 6, 1, 51), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGProtocolRowStatus.setStatus('current')
hwBrasSbcMGPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 7), )
if mibBuilder.loadTexts: hwBrasSbcMGPortTable.setStatus('current')
hwBrasSbcMGPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 7, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGPortIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGPortEntry.setStatus('current')
hwBrasSbcMGPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 7, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGPortIndex.setStatus('current')
hwBrasSbcMGPortNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 7, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGPortNumber.setStatus('current')
hwBrasSbcMGPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 7, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGPortRowStatus.setStatus('current')
hwBrasSbcMGPrefixTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 8), )
if mibBuilder.loadTexts: hwBrasSbcMGPrefixTable.setStatus('current')
hwBrasSbcMGPrefixEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 8, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGPrefixIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGPrefixEntry.setStatus('current')
hwBrasSbcMGPrefixIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 8, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGPrefixIndex.setStatus('current')
hwBrasSbcMGPrefixID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 8, 1, 11), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGPrefixID.setStatus('current')
hwBrasSbcMGPrefixRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 8, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGPrefixRowStatus.setStatus('current')
hwBrasSbcMGMdCliAddrTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9), )
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrTable.setStatus('current')
hwBrasSbcMGMdCliAddrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrEntry.setStatus('current')
hwBrasSbcMGMdCliAddrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIndex.setStatus('current')
hwBrasSbcMGMdCliAddrVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrVPN.setStatus('current')
hwBrasSbcMGMdCliAddrIP1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 12), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIP1.setStatus('current')
hwBrasSbcMGMdCliAddrIP2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 13), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIP2.setStatus('current')
hwBrasSbcMGMdCliAddrIP3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 14), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIP3.setStatus('current')
hwBrasSbcMGMdCliAddrIP4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 15), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIP4.setStatus('current')
hwBrasSbcMGMdCliAddrVPNName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 16), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 31))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrVPNName.setStatus('current')
hwBrasSbcMGMdCliAddrIf1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 17), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIf1.setStatus('current')
hwBrasSbcMGMdCliAddrSlotID1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 18), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrSlotID1.setStatus('current')
hwBrasSbcMGMdCliAddrIf2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 19), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIf2.setStatus('current')
hwBrasSbcMGMdCliAddrSlotID2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 20), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrSlotID2.setStatus('current')
hwBrasSbcMGMdCliAddrIf3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 21), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIf3.setStatus('current')
hwBrasSbcMGMdCliAddrSlotID3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 22), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrSlotID3.setStatus('current')
hwBrasSbcMGMdCliAddrIf4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 23), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrIf4.setStatus('current')
hwBrasSbcMGMdCliAddrSlotID4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 24), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrSlotID4.setStatus('current')
hwBrasSbcMGMdCliAddrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 9, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdCliAddrRowStatus.setStatus('current')
hwBrasSbcMGMdServAddrTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10), )
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrTable.setStatus('current')
hwBrasSbcMGMdServAddrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrEntry.setStatus('current')
hwBrasSbcMGMdServAddrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIndex.setStatus('current')
hwBrasSbcMGMdServAddrVPN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrVPN.setStatus('current')
hwBrasSbcMGMdServAddrIP1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 12), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIP1.setStatus('current')
hwBrasSbcMGMdServAddrIP2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 13), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIP2.setStatus('current')
hwBrasSbcMGMdServAddrIP3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 14), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIP3.setStatus('current')
hwBrasSbcMGMdServAddrIP4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 15), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIP4.setStatus('current')
hwBrasSbcMGMdServAddrVPNName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 16), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 31))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrVPNName.setStatus('current')
hwBrasSbcMGMdServAddrIf1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 17), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIf1.setStatus('current')
hwBrasSbcMGMdServAddrSlotID1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 18), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrSlotID1.setStatus('current')
hwBrasSbcMGMdServAddrIf2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 19), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIf2.setStatus('current')
hwBrasSbcMGMdServAddrSlotID2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 20), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrSlotID2.setStatus('current')
hwBrasSbcMGMdServAddrIf3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 21), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIf3.setStatus('current')
hwBrasSbcMGMdServAddrSlotID3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 22), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrSlotID3.setStatus('current')
hwBrasSbcMGMdServAddrIf4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 23), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 47))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrIf4.setStatus('current')
hwBrasSbcMGMdServAddrSlotID4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 24), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrSlotID4.setStatus('current')
hwBrasSbcMGMdServAddrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 10, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMdServAddrRowStatus.setStatus('current')
hwBrasSbcMGMatchTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 11), )
if mibBuilder.loadTexts: hwBrasSbcMGMatchTable.setStatus('current')
hwBrasSbcMGMatchEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 11, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMatchIndex"))
if mibBuilder.loadTexts: hwBrasSbcMGMatchEntry.setStatus('current')
hwBrasSbcMGMatchIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 11, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2999)))
if mibBuilder.loadTexts: hwBrasSbcMGMatchIndex.setStatus('current')
hwBrasSbcMGMatchAcl = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 11, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(2000, 3999))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMatchAcl.setStatus('current')
hwBrasSbcMGMatchRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 3, 2, 11, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMGMatchRowStatus.setStatus('current')
hwBrasSbcAdmModuleTable = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4))
hwBrasSbcBackupGroupsTable = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1))
hwBrasSbcBackupGroupTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 1), )
if mibBuilder.loadTexts: hwBrasSbcBackupGroupTable.setStatus('current')
hwBrasSbcBackupGroupEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcBackupGroupID"))
if mibBuilder.loadTexts: hwBrasSbcBackupGroupEntry.setStatus('current')
hwBrasSbcBackupGroupID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 14)))
if mibBuilder.loadTexts: hwBrasSbcBackupGroupID.setStatus('current')
hwBrasSbcBackupGroupType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("signal", 1), ("media", 2)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcBackupGroupType.setStatus('current')
hwBrasSbcBackupGroupInstanceName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 1, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcBackupGroupInstanceName.setStatus('current')
hwBrasSbcBackupGroupRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 1, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcBackupGroupRowStatus.setStatus('current')
hwBrasSbcSlotInforTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 2), )
if mibBuilder.loadTexts: hwBrasSbcSlotInforTable.setStatus('current')
hwBrasSbcSlotInforEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcBackupGroupIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSlotIndex"))
if mibBuilder.loadTexts: hwBrasSbcSlotInforEntry.setStatus('current')
hwBrasSbcBackupGroupIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 14)))
if mibBuilder.loadTexts: hwBrasSbcBackupGroupIndex.setStatus('current')
hwBrasSbcSlotIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 2, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 7)))
if mibBuilder.loadTexts: hwBrasSbcSlotIndex.setStatus('current')
hwBrasSbcCurrentSlotID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 2, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcCurrentSlotID.setStatus('current')
hwBrasSbcSlotCfgState = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("master", 1), ("slave", 2)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSlotCfgState.setStatus('current')
hwBrasSbcSlotInforRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 1, 4, 1, 2, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSlotInforRowStatus.setStatus('current')
hwBrasSbcAdvance = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2))
hwBrasSbcAdvanceLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1))
hwBrasSbcMediaPassEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMediaPassEnable.setStatus('current')
hwBrasSbcMediaPassSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMediaPassSyslogEnable.setStatus('current')
hwBrasSbcIntMediaPassEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 3), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIntMediaPassEnable.setStatus('current')
hwBrasSbcRoamlimitEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 4), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcRoamlimitEnable.setStatus('current')
hwBrasSbcRoamlimitDefault = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 5), HWBrasPermitStatus().clone('deny')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcRoamlimitDefault.setStatus('current')
hwBrasSbcRoamlimitSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 6), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcRoamlimitSyslogEnable.setStatus('current')
hwBrasSbcRoamlimitExtendEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 7), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcRoamlimitExtendEnable.setStatus('current')
hwBrasSbcHrpSynchronization = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 1, 8), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("reserve", 1), ("synchronize", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcHrpSynchronization.setStatus('current')
hwBrasSbcAdvanceTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2))
hwBrasSbcMediaPassTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcMediaPassTable.setStatus('current')
hwBrasSbcMediaPassEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaPassIndex"))
if mibBuilder.loadTexts: hwBrasSbcMediaPassEntry.setStatus('current')
hwBrasSbcMediaPassIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 1000)))
if mibBuilder.loadTexts: hwBrasSbcMediaPassIndex.setStatus('current')
hwBrasSbcMediaPassAclNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(ValueRangeConstraint(0, 0), ValueRangeConstraint(2000, 2999), ))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaPassAclNumber.setStatus('current')
hwBrasSbcMediaPassRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 1, 1, 3), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaPassRowStatus.setStatus('current')
hwBrasSbcUsergroupTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcUsergroupTable.setStatus('current')
hwBrasSbcUsergroupEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUsergroupIndex"))
if mibBuilder.loadTexts: hwBrasSbcUsergroupEntry.setStatus('current')
hwBrasSbcUsergroupIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 1000)))
if mibBuilder.loadTexts: hwBrasSbcUsergroupIndex.setStatus('current')
hwBrasSbcUsergroupRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 2, 1, 2), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUsergroupRowStatus.setStatus('current')
hwBrasSbcUsergroupRuleTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcUsergroupRuleTable.setStatus('current')
hwBrasSbcUsergroupRuleEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUsergroupIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUsergroupRuleIndex"))
if mibBuilder.loadTexts: hwBrasSbcUsergroupRuleEntry.setStatus('current')
hwBrasSbcUsergroupRuleIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 3, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 100)))
if mibBuilder.loadTexts: hwBrasSbcUsergroupRuleIndex.setStatus('current')
hwBrasSbcUsergroupRuleType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 3, 1, 2), HWBrasPermitStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUsergroupRuleType.setStatus('current')
hwBrasSbcUsergroupRuleUserName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 3, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUsergroupRuleUserName.setStatus('current')
hwBrasSbcUsergroupRuleRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 3, 1, 4), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUsergroupRuleRowStatus.setStatus('current')
hwBrasSbcRtpSpecialAddrTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcRtpSpecialAddrTable.setStatus('current')
hwBrasSbcRtpSpecialAddrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRtpSpecialAddrIndex"))
if mibBuilder.loadTexts: hwBrasSbcRtpSpecialAddrEntry.setStatus('current')
hwBrasSbcRtpSpecialAddrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 4, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 10)))
if mibBuilder.loadTexts: hwBrasSbcRtpSpecialAddrIndex.setStatus('current')
hwBrasSbcRtpSpecialAddrAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 4, 1, 2), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcRtpSpecialAddrAddr.setStatus('current')
hwBrasSbcRtpSpecialAddrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 4, 1, 3), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcRtpSpecialAddrRowStatus.setStatus('current')
hwBrasSbcRoamlimitTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcRoamlimitTable.setStatus('current')
hwBrasSbcRoamlimitEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRoamlimitIndex"))
if mibBuilder.loadTexts: hwBrasSbcRoamlimitEntry.setStatus('current')
hwBrasSbcRoamlimitIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 5, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 1000)))
if mibBuilder.loadTexts: hwBrasSbcRoamlimitIndex.setStatus('current')
hwBrasSbcRoamlimitAclNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 5, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(2000, 2999))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcRoamlimitAclNumber.setStatus('current')
hwBrasSbcRoamlimitRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 5, 1, 3), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcRoamlimitRowStatus.setStatus('current')
hwBrasSbcMediaUsersTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcMediaUsersTable.setStatus('current')
hwBrasSbcMediaUsersEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersIndex"))
if mibBuilder.loadTexts: hwBrasSbcMediaUsersEntry.setStatus('current')
hwBrasSbcMediaUsersIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 255)))
if mibBuilder.loadTexts: hwBrasSbcMediaUsersIndex.setStatus('current')
hwBrasSbcMediaUsersType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("media", 1), ("audio", 2), ("video", 3), ("data", 4)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersType.setStatus('current')
hwBrasSbcMediaUsersCallerID1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCallerID1.setStatus('current')
hwBrasSbcMediaUsersCallerID2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 4), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCallerID2.setStatus('current')
hwBrasSbcMediaUsersCallerID3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 5), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCallerID3.setStatus('current')
hwBrasSbcMediaUsersCallerID4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 6), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCallerID4.setStatus('current')
hwBrasSbcMediaUsersCalleeID1 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 7), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCalleeID1.setStatus('current')
hwBrasSbcMediaUsersCalleeID2 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 8), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCalleeID2.setStatus('current')
hwBrasSbcMediaUsersCalleeID3 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 9), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCalleeID3.setStatus('current')
hwBrasSbcMediaUsersCalleeID4 = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 10), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersCalleeID4.setStatus('current')
hwBrasSbcMediaUsersRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 2, 6, 1, 11), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMediaUsersRowStatus.setStatus('current')
hwBrasSbcIntercom = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3))
hwBrasSbcIntercomLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 1))
hwBrasSbcIntercomEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIntercomEnable.setStatus('current')
hwBrasSbcIntercomStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("disabled", 1), ("iproute", 2), ("prefixroute", 3))).clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIntercomStatus.setStatus('current')
hwBrasSbcIntercomTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 2))
hwBrasSbcIntercomPrefixTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcIntercomPrefixTable.setStatus('current')
hwBrasSbcIntercomPrefixEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIntercomPrefixIndex"))
if mibBuilder.loadTexts: hwBrasSbcIntercomPrefixEntry.setStatus('current')
hwBrasSbcIntercomPrefixIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 2, 1, 1, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 63)))
if mibBuilder.loadTexts: hwBrasSbcIntercomPrefixIndex.setStatus('current')
hwBrasSbcIntercomPrefixDestAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 2, 1, 1, 2), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIntercomPrefixDestAddr.setStatus('current')
hwBrasSbcIntercomPrefixSrcAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 2, 1, 1, 3), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIntercomPrefixSrcAddr.setStatus('current')
hwBrasSbcIntercomPrefixRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 3, 2, 1, 1, 4), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIntercomPrefixRowStatus.setStatus('current')
hwBrasSbcSessionCar = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4))
hwBrasSbcSessionCarLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 1))
hwBrasSbcSessionCarEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSessionCarEnable.setStatus('current')
hwBrasSbcSessionCarTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2))
hwBrasSbcSessionCarDegreeTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcSessionCarDegreeTable.setStatus('current')
hwBrasSbcSessionCarDegreeEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarDegreeID"))
if mibBuilder.loadTexts: hwBrasSbcSessionCarDegreeEntry.setStatus('current')
hwBrasSbcSessionCarDegreeID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 16)))
if mibBuilder.loadTexts: hwBrasSbcSessionCarDegreeID.setStatus('current')
hwBrasSbcSessionCarDegreeBandWidth = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 1, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(8, 131071))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSessionCarDegreeBandWidth.setStatus('current')
hwBrasSbcSessionCarDegreeDscp = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 1, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 64))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSessionCarDegreeDscp.setStatus('current')
hwBrasSbcSessionCarDegreeRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 1, 1, 4), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSessionCarDegreeRowStatus.setStatus('current')
hwBrasSbcSessionCarRuleTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleTable.setStatus('current')
hwBrasSbcSessionCarRuleEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarRuleID"))
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleEntry.setStatus('current')
hwBrasSbcSessionCarRuleID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 255)))
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleID.setStatus('current')
hwBrasSbcSessionCarRuleName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2, 1, 2), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleName.setStatus('current')
hwBrasSbcSessionCarRuleDegreeID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleDegreeID.setStatus('current')
hwBrasSbcSessionCarRuleDegreeBandWidth = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(8, 131071))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleDegreeBandWidth.setStatus('current')
hwBrasSbcSessionCarRuleDegreeDscp = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2, 1, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleDegreeDscp.setStatus('current')
hwBrasSbcSessionCarRuleRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 4, 2, 2, 1, 6), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSessionCarRuleRowStatus.setStatus('current')
hwBrasSbcSecurity = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5))
hwBrasSbcSecurityLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1))
hwBrasSbcDefendEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendEnable.setStatus('current')
hwBrasSbcDefendMode = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("auto", 1), ("manual", 2))).clone('auto')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendMode.setStatus('current')
hwBrasSbcDefendActionLogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 3), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendActionLogEnable.setStatus('current')
hwBrasSbcCacEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 4), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacEnable.setStatus('current')
hwBrasSbcCacActionLogStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("denyAndNoLog", 1), ("permitAndNoLog", 2), ("denyAndLog", 3), ("permitAndLog", 4))).clone('denyAndNoLog')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacActionLogStatus.setStatus('current')
hwBrasSbcDefendExtStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 6), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendExtStatus.setStatus('current')
hwBrasSbcSignalingCarStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 7), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSignalingCarStatus.setStatus('current')
hwBrasSbcIPCarStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 8), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIPCarStatus.setStatus('current')
hwBrasSbcDynamicStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 1, 9), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDynamicStatus.setStatus('current')
hwBrasSbcSecurityTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2))
hwBrasSbcDefendConnectRateTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcDefendConnectRateTable.setStatus('current')
hwBrasSbcDefendConnectRateEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendConnectRateProtocol"))
if mibBuilder.loadTexts: hwBrasSbcDefendConnectRateEntry.setStatus('current')
hwBrasSbcDefendConnectRateProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 1, 1, 1), HWBrasSecurityProtocol())
if mibBuilder.loadTexts: hwBrasSbcDefendConnectRateProtocol.setStatus('current')
hwBrasSbcDefendConnectRateThreshold = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 1, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(6, 60000))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendConnectRateThreshold.setStatus('current')
hwBrasSbcDefendConnectRatePercent = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 1, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(60, 100)).clone(80)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendConnectRatePercent.setStatus('current')
hwBrasSbcDefendConnectRateRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 1, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendConnectRateRowStatus.setStatus('current')
hwBrasSbcDefendUserConnectRateTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcDefendUserConnectRateTable.setStatus('current')
hwBrasSbcDefendUserConnectRateEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendUserConnectRateProtocol"))
if mibBuilder.loadTexts: hwBrasSbcDefendUserConnectRateEntry.setStatus('current')
hwBrasSbcDefendUserConnectRateProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 2, 1, 1), HWBrasSecurityProtocol())
if mibBuilder.loadTexts: hwBrasSbcDefendUserConnectRateProtocol.setStatus('current')
hwBrasSbcDefendUserConnectRateThreshold = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 2, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(6, 60000))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendUserConnectRateThreshold.setStatus('current')
hwBrasSbcDefendUserConnectRatePercent = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 2, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(60, 100)).clone(80)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendUserConnectRatePercent.setStatus('current')
hwBrasSbcDefendUserConnectRateRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 2, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDefendUserConnectRateRowStatus.setStatus('current')
hwBrasSbcCacCallTotalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcCacCallTotalTable.setStatus('current')
hwBrasSbcCacCallTotalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallTotalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcCacCallTotalEntry.setStatus('current')
hwBrasSbcCacCallTotalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 3, 1, 1), HWBrasSecurityProtocol())
if mibBuilder.loadTexts: hwBrasSbcCacCallTotalProtocol.setStatus('current')
hwBrasSbcCacCallTotalThreshold = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 3, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(60, 60000))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacCallTotalThreshold.setStatus('current')
hwBrasSbcCacCallTotalPercent = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 3, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(60, 100)).clone(80)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacCallTotalPercent.setStatus('current')
hwBrasSbcCacCallTotalRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 3, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacCallTotalRowStatus.setStatus('current')
hwBrasSbcCacCallRateTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcCacCallRateTable.setStatus('current')
hwBrasSbcCacCallRateEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallRateProtocol"))
if mibBuilder.loadTexts: hwBrasSbcCacCallRateEntry.setStatus('current')
hwBrasSbcCacCallRateProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 4, 1, 1), HWBrasSecurityProtocol())
if mibBuilder.loadTexts: hwBrasSbcCacCallRateProtocol.setStatus('current')
hwBrasSbcCacCallRateThreshold = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 4, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(6, 600))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacCallRateThreshold.setStatus('current')
hwBrasSbcCacCallRatePercent = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 4, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(60, 100)).clone(80)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacCallRatePercent.setStatus('current')
hwBrasSbcCacCallRateRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 4, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacCallRateRowStatus.setStatus('current')
hwBrasSbcCacRegTotalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcCacRegTotalTable.setStatus('current')
hwBrasSbcCacRegTotalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegTotalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcCacRegTotalEntry.setStatus('current')
hwBrasSbcCacRegTotalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 5, 1, 1), HWBrasSecurityProtocol())
if mibBuilder.loadTexts: hwBrasSbcCacRegTotalProtocol.setStatus('current')
hwBrasSbcCacRegTotalThreshold = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 5, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(100, 60000))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacRegTotalThreshold.setStatus('current')
hwBrasSbcCacRegTotalPercent = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 5, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(60, 100)).clone(80)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacRegTotalPercent.setStatus('current')
hwBrasSbcCacRegTotalRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 5, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacRegTotalRowStatus.setStatus('current')
hwBrasSbcCacRegRateTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcCacRegRateTable.setStatus('current')
hwBrasSbcCacRegRateEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegRateProtocol"))
if mibBuilder.loadTexts: hwBrasSbcCacRegRateEntry.setStatus('current')
hwBrasSbcCacRegRateProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 6, 1, 1), HWBrasSecurityProtocol())
if mibBuilder.loadTexts: hwBrasSbcCacRegRateProtocol.setStatus('current')
hwBrasSbcCacRegRateThreshold = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 6, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(6, 600))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacRegRateThreshold.setStatus('current')
hwBrasSbcCacRegRatePercent = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 6, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(60, 100)).clone(80)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacRegRatePercent.setStatus('current')
hwBrasSbcCacRegRateRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 6, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcCacRegRateRowStatus.setStatus('current')
hwBrasSbcIPCarBandwidthTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 7), )
if mibBuilder.loadTexts: hwBrasSbcIPCarBandwidthTable.setStatus('current')
hwBrasSbcIPCarBandwidthEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 7, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIPCarBWVpn"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIPCarBWAddress"))
if mibBuilder.loadTexts: hwBrasSbcIPCarBandwidthEntry.setStatus('current')
hwBrasSbcIPCarBWVpn = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 7, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 1023)))
if mibBuilder.loadTexts: hwBrasSbcIPCarBWVpn.setStatus('current')
hwBrasSbcIPCarBWAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 7, 1, 2), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIPCarBWAddress.setStatus('current')
hwBrasSbcIPCarBWValue = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 7, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(8, 1000000000)).clone(1000000000)).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIPCarBWValue.setStatus('current')
hwBrasSbcIPCarBWRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 5, 2, 7, 1, 4), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIPCarBWRowStatus.setStatus('current')
hwBrasSbcUdpTunnel = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6))
hwBrasSbcUdpTunnelLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 1))
hwBrasSbcUdpTunnelEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelEnable.setStatus('current')
hwBrasSbcUdpTunnelType = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("notype", 1), ("server", 2), ("client", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelType.setStatus('current')
hwBrasSbcUdpTunnelSctpAddr = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 1, 3), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelSctpAddr.setStatus('current')
hwBrasSbcUdpTunnelTunnelTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535)).clone(900)).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelTunnelTimer.setStatus('current')
hwBrasSbcUdpTunnelTransportTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535)).clone(900)).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelTransportTimer.setStatus('current')
hwBrasSbcUdpTunnelTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2))
hwBrasSbcUdpTunnelPoolTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPoolTable.setStatus('current')
hwBrasSbcUdpTunnelPoolEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelPoolIndex"))
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPoolEntry.setStatus('current')
hwBrasSbcUdpTunnelPoolIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 1)))
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPoolIndex.setStatus('current')
hwBrasSbcUdpTunnelPoolStartIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 1, 1, 2), IpAddress().clone(hexValue="7FA8B501")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPoolStartIP.setStatus('current')
hwBrasSbcUdpTunnelPoolEndIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 1, 1, 3), IpAddress().clone(hexValue="7FA8EF98")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPoolEndIP.setStatus('current')
hwBrasSbcUdpTunnelPoolRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 1, 1, 4), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPoolRowStatus.setStatus('current')
hwBrasSbcUdpTunnelPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPortTable.setStatus('current')
hwBrasSbcUdpTunnelPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelPortPort"))
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPortEntry.setStatus('current')
hwBrasSbcUdpTunnelPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 2, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("udp", 1), ("tcp", 2))))
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPortProtocol.setStatus('current')
hwBrasSbcUdpTunnelPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 2, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535)))
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPortPort.setStatus('current')
hwBrasSbcUdpTunnelPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 2, 1, 3), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelPortRowStatus.setStatus('current')
hwBrasSbcUdpTunnelIfPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelIfPortTable.setStatus('current')
hwBrasSbcUdpTunnelIfPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 3, 1), ).setIndexNames((0, "ENTITY-MIB", "entPhysicalIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelIfPortAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelIfPortPort"))
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelIfPortEntry.setStatus('current')
hwBrasSbcUdpTunnelIfPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 3, 1, 2), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelIfPortAddr.setStatus('current')
hwBrasSbcUdpTunnelIfPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 3, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 9999)))
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelIfPortPort.setStatus('current')
hwBrasSbcUdpTunnelIfPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 6, 2, 3, 1, 4), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUdpTunnelIfPortRowStatus.setStatus('current')
hwBrasSbcIms = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7))
hwBrasSbcImsLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1))
hwBrasSbcImsQosEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsQosEnable.setStatus('current')
hwBrasSbcImsMediaProxyEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 2), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMediaProxyEnable.setStatus('current')
hwBrasSbcImsQosLogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 3), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsQosLogEnable.setStatus('current')
hwBrasSbcImsMediaProxyLogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 4), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMediaProxyLogEnable.setStatus('current')
hwBrasSbcImsMGStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 5), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMGStatus.setStatus('current')
hwBrasSbcImsMGConnectTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 6), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(100, 3600000)).clone(1000)).setUnits('ms').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMGConnectTimer.setStatus('current')
hwBrasSbcImsMGAgingTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 7), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 36000)).clone(120)).setUnits('s').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMGAgingTimer.setStatus('current')
hwBrasSbcImsMGCallSessionTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 8), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 14400)).clone(30)).setUnits('m').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMGCallSessionTimer.setStatus('current')
hwBrasSbcSctpStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 9), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSctpStatus.setStatus('current')
hwBrasSbcIdlecutRtcpTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 10), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(5, 3600)).clone(300)).setUnits('s').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIdlecutRtcpTimer.setStatus('current')
hwBrasSbcIdlecutRtpTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(5, 3600)).clone(30)).setUnits('s').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIdlecutRtpTimer.setStatus('current')
hwBrasSbcMediaDetectStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 12), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMediaDetectStatus.setStatus('current')
hwBrasSbcMediaOnewayStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 13), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMediaOnewayStatus.setStatus('current')
hwBrasSbcImsMgLogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 14), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMgLogEnable.setStatus('current')
hwBrasSbcImsStatisticsEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 15), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsStatisticsEnable.setStatus('current')
hwBrasSbcTimerMediaAging = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 1, 16), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(5, 3600)).clone(300)).setUnits('s').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcTimerMediaAging.setStatus('current')
hwBrasSbcImsTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2))
hwBrasSbcImsConnectTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcImsConnectTable.setStatus('current')
hwBrasSbcImsConnectEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectIndex"))
if mibBuilder.loadTexts: hwBrasSbcImsConnectEntry.setStatus('current')
hwBrasSbcImsConnectIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 9)))
if mibBuilder.loadTexts: hwBrasSbcImsConnectIndex.setStatus('current')
hwBrasSbcImsConnectPepID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 11), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsConnectPepID.setStatus('current')
hwBrasSbcImsConnectCliType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 12), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("unknown", 1), ("brasSbci", 2), ("goi", 3)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsConnectCliType.setStatus('current')
hwBrasSbcImsConnectCliIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 13), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsConnectCliIP.setStatus('current')
hwBrasSbcImsConnectCliPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 14), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 50000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsConnectCliPort.setStatus('current')
hwBrasSbcImsConnectServIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 15), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsConnectServIP.setStatus('current')
hwBrasSbcImsConnectServPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 16), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 50000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsConnectServPort.setStatus('current')
hwBrasSbcImsConnectRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 1, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsConnectRowStatus.setStatus('current')
hwBrasSbcImsBandTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcImsBandTable.setStatus('current')
hwBrasSbcImsBandEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsBandIndex"))
if mibBuilder.loadTexts: hwBrasSbcImsBandEntry.setStatus('current')
hwBrasSbcImsBandIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 64)))
if mibBuilder.loadTexts: hwBrasSbcImsBandIndex.setStatus('current')
hwBrasSbcImsBandIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2, 1, 11), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcImsBandIfIndex.setStatus('current')
hwBrasSbcImsBandIfName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2, 1, 12), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcImsBandIfName.setStatus('current')
hwBrasSbcImsBandIfType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2, 1, 13), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("fe", 1), ("ge", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcImsBandIfType.setStatus('current')
hwBrasSbcImsBandValue = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2, 1, 14), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsBandValue.setStatus('current')
hwBrasSbcImsBandRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 2, 1, 51), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsBandRowStatus.setStatus('current')
hwBrasSbcImsActiveTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcImsActiveTable.setStatus('current')
hwBrasSbcImsActiveEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsActiveConnectId"))
if mibBuilder.loadTexts: hwBrasSbcImsActiveEntry.setStatus('current')
hwBrasSbcImsActiveConnectId = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 3, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 9)))
if mibBuilder.loadTexts: hwBrasSbcImsActiveConnectId.setStatus('current')
hwBrasSbcImsActiveStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 3, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("sleep", 1), ("active", 2), ("online", 3))).clone('sleep')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsActiveStatus.setStatus('current')
hwBrasSbcImsActiveRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 3, 1, 51), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsActiveRowStatus.setStatus('current')
hwBrasSbcImsMGTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcImsMGTable.setStatus('current')
hwBrasSbcImsMGEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIndex"))
if mibBuilder.loadTexts: hwBrasSbcImsMGEntry.setStatus('current')
hwBrasSbcImsMGIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 14)))
if mibBuilder.loadTexts: hwBrasSbcImsMGIndex.setStatus('current')
hwBrasSbcImsMGDescription = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1, 11), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGDescription.setStatus('current')
hwBrasSbcImsMGTableStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1, 12), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGTableStatus.setStatus('current')
hwBrasSbcImsMGProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1, 13), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("sctp", 1), ("udp", 2), ("tcp", 3))).clone('udp')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGProtocol.setStatus('current')
hwBrasSbcImsMGMidString = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1, 14), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 64))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGMidString.setStatus('current')
hwBrasSbcImsMGInstanceName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1, 15), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGInstanceName.setStatus('current')
hwBrasSbcImsMGRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 4, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGRowStatus.setStatus('current')
hwBrasSbcImsMGIPTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcImsMGIPTable.setStatus('current')
hwBrasSbcImsMGIPEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIPType"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIPSN"))
if mibBuilder.loadTexts: hwBrasSbcImsMGIPEntry.setStatus('current')
hwBrasSbcImsMGIPType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("mg", 1), ("mgc", 2))))
if mibBuilder.loadTexts: hwBrasSbcImsMGIPType.setStatus('current')
hwBrasSbcImsMGIPSN = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 4)))
if mibBuilder.loadTexts: hwBrasSbcImsMGIPSN.setStatus('current')
hwBrasSbcImsMGIPVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(4, 6))).clone(namedValues=NamedValues(("ipv4", 4), ("ipv6", 6)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMGIPVersion.setStatus('current')
hwBrasSbcImsMGIPAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1, 12), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGIPAddr.setStatus('current')
hwBrasSbcImsMGIPInterface = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1, 15), OctetString().subtype(subtypeSpec=ValueSizeConstraint(1, 47))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcImsMGIPInterface.setStatus('current')
hwBrasSbcImsMGIPPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1, 13), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 10000))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGIPPort.setStatus('current')
hwBrasSbcImsMGIPRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 5, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGIPRowStatus.setStatus('current')
hwBrasSbcImsMGDomainTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcImsMGDomainTable.setStatus('current')
hwBrasSbcImsMGDomainEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGDomainType"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGDomainName"))
if mibBuilder.loadTexts: hwBrasSbcImsMGDomainEntry.setStatus('current')
hwBrasSbcImsMGDomainType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 6, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("inner", 1), ("outter", 2))))
if mibBuilder.loadTexts: hwBrasSbcImsMGDomainType.setStatus('current')
hwBrasSbcImsMGDomainName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 6, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 64)))
if mibBuilder.loadTexts: hwBrasSbcImsMGDomainName.setStatus('current')
hwBrasSbcImsMGDomainMapIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 6, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(2501, 2999))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGDomainMapIndex.setStatus('current')
hwBrasSbcImsMGDomainRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 7, 2, 6, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcImsMGDomainRowStatus.setStatus('current')
hwBrasSbcDualHoming = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 8))
hwBrasSbcDHLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 8, 1))
hwBrasSbcDHSIPDetectStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 8, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDHSIPDetectStatus.setStatus('current')
hwBrasSbcDHSIPDetectTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 8, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 7200)).clone(10)).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDHSIPDetectTimer.setStatus('current')
hwBrasSbcDHSIPDetectSourcePort = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 8, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1024, 10000)).clone(5060)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDHSIPDetectSourcePort.setStatus('current')
hwBrasSbcDHSIPDetectFailCount = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 8, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 100)).clone(3)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcDHSIPDetectFailCount.setStatus('current')
hwBrasSbcQoSReport = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 9))
hwBrasSbcQRLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 9, 1))
hwBrasSbcQRStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 9, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcQRStatus.setStatus('current')
hwBrasSbcQRBandWidth = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 9, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 40960)).clone(1024)).setUnits('packetspersecond').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcQRBandWidth.setStatus('current')
hwBrasSbcQRTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 9, 2))
hwBrasSbcMediaDefend = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11))
hwBrasSbcMediaDefendLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 1))
hwBrasSbcMDStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMDStatus.setStatus('current')
hwBrasSbcMediaDefendTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2))
hwBrasSbcMDLengthTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcMDLengthTable.setStatus('current')
hwBrasSbcMDLengthEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDLengthIndex"))
if mibBuilder.loadTexts: hwBrasSbcMDLengthEntry.setStatus('current')
hwBrasSbcMDLengthIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("rtp", 1), ("rtcp", 2))))
if mibBuilder.loadTexts: hwBrasSbcMDLengthIndex.setStatus('current')
hwBrasSbcMDLengthMin = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 1, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(28, 65535)).clone(28)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMDLengthMin.setStatus('current')
hwBrasSbcMDLengthMax = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 1, 1, 12), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(28, 65535)).clone(1500)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMDLengthMax.setStatus('current')
hwBrasSbcMDLengthRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 1, 1, 51), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMDLengthRowStatus.setStatus('current')
hwBrasSbcMDStatisticTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcMDStatisticTable.setStatus('current')
hwBrasSbcMDStatisticEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDStatisticIndex"))
if mibBuilder.loadTexts: hwBrasSbcMDStatisticEntry.setStatus('current')
hwBrasSbcMDStatisticIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("rtp", 1), ("rtcp", 2))))
if mibBuilder.loadTexts: hwBrasSbcMDStatisticIndex.setStatus('current')
hwBrasSbcMDStatisticMinDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2, 1, 11), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMDStatisticMinDrop.setStatus('current')
hwBrasSbcMDStatisticMaxDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2, 1, 12), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMDStatisticMaxDrop.setStatus('current')
hwBrasSbcMDStatisticFragDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2, 1, 13), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMDStatisticFragDrop.setStatus('current')
hwBrasSbcMDStatisticFlowDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2, 1, 14), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMDStatisticFlowDrop.setStatus('current')
hwBrasSbcMDStatisticRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 11, 2, 2, 1, 51), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMDStatisticRowStatus.setStatus('current')
hwBrasSbcSignalingNat = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12))
hwBrasSbcSignalingNatLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 1))
hwBrasSbcNatSessionAgingTime = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 40000)).clone(20)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcNatSessionAgingTime.setStatus('current')
hwBrasSbcSignalingNatTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2))
hwBrasSbcNatCfgTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcNatCfgTable.setStatus('current')
hwBrasSbcNatCfgEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcNatGroupIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcNatVpnNameIndex"))
if mibBuilder.loadTexts: hwBrasSbcNatCfgEntry.setStatus('current')
hwBrasSbcNatGroupIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 127))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcNatGroupIndex.setStatus('current')
hwBrasSbcNatVpnNameIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 1, 1, 2), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 31))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcNatVpnNameIndex.setStatus('current')
hwBrasSbcNatInstanceName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 1, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcNatInstanceName.setStatus('current')
hwBrasSbcNatCfgRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 1, 1, 51), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcNatCfgRowStatus.setStatus('current')
hwBrasSbcNatAddressGroupTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcNatAddressGroupTable.setStatus('current')
hwBrasSbcNatAddressGroupEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwNatAddrGrpIndex"))
if mibBuilder.loadTexts: hwBrasSbcNatAddressGroupEntry.setStatus('current')
hwNatAddrGrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 127)))
if mibBuilder.loadTexts: hwNatAddrGrpIndex.setStatus('current')
hwNatAddrGrpBeginningIpAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2, 1, 2), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwNatAddrGrpBeginningIpAddr.setStatus('current')
hwNatAddrGrpEndingIpAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2, 1, 3), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwNatAddrGrpEndingIpAddr.setStatus('current')
hwNatAddrGrpRefCount = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2, 1, 4), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwNatAddrGrpRefCount.setStatus('current')
hwNatAddrGrpVpnName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2, 1, 5), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 31))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwNatAddrGrpVpnName.setStatus('current')
hwNatAddrGrpRowstatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 12, 2, 2, 1, 6), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwNatAddrGrpRowstatus.setStatus('current')
hwBrasSbcBandwidthLimit = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 13))
hwBrasSbcBWLimitLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 13, 1))
hwBrasSbcBWLimitType = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 13, 1, 1), HwBrasBWLimitType().clone('qos')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcBWLimitType.setStatus('current')
hwBrasSbcBWLimitValue = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 2, 13, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 10485760)).clone(6291456)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcBWLimitValue.setStatus('current')
hwBrasSbcView = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3))
hwBrasSbcViewLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 1))
hwBrasSbcSoftVersion = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 1, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSoftVersion.setStatus('current')
hwBrasSbcCpuUsage = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 100))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcCpuUsage.setStatus('current')
hwBrasSbcUmsVersion = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(8, 63))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUmsVersion.setStatus('current')
hwBrasSbcViewTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2))
hwBrasSbcStatisticTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcStatisticTable.setStatus('current')
hwBrasSbcStatisticEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatisticIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatisticOffset"))
if mibBuilder.loadTexts: hwBrasSbcStatisticEntry.setStatus('current')
hwBrasSbcStatisticIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647)))
if mibBuilder.loadTexts: hwBrasSbcStatisticIndex.setStatus('current')
hwBrasSbcStatisticOffset = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2, 1, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 143))).setUnits('hours')
if mibBuilder.loadTexts: hwBrasSbcStatisticOffset.setStatus('current')
hwBrasSbcStatisticDesc = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2, 1, 1, 3), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcStatisticDesc.setStatus('current')
hwBrasSbcStatisticValue = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2, 1, 1, 4), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcStatisticValue.setStatus('current')
hwBrasSbcStatisticTime = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 1, 3, 2, 1, 1, 5), DateAndTime().subtype(subtypeSpec=ValueSizeConstraint(8, 8)).setFixedLength(8)).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcStatisticTime.setStatus('current')
hwBrasSbcSip = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2))
hwBrasSbcSipLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1))
hwBrasSbcSipEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipEnable.setStatus('current')
hwBrasSbcSipSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipSyslogEnable.setStatus('current')
hwBrasSbcSipAnonymity = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 63))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipAnonymity.setStatus('current')
hwBrasSbcSipCheckheartEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 4), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipCheckheartEnable.setStatus('current')
hwBrasSbcSipCallsessionTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 14400)).clone(720)).setUnits('minutes').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipCallsessionTimer.setStatus('current')
hwBrasSbcSipPDHCountLimit = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 6), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 100)).clone(6)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipPDHCountLimit.setStatus('current')
hwBrasSbcSipRegReduceStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 7), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipRegReduceStatus.setStatus('current')
hwBrasSbcSipRegReduceTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 1, 8), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 600)).clone(60)).setUnits('minutes').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipRegReduceTimer.setStatus('current')
hwBrasSbcSipTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2))
hwBrasSbcSipWellknownPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcSipWellknownPortTable.setStatus('current')
hwBrasSbcSipWellknownPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipWellknownPortIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipWellknownPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipWellknownPortAddr"))
if mibBuilder.loadTexts: hwBrasSbcSipWellknownPortEntry.setStatus('current')
hwBrasSbcSipWellknownPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("clientaddr", 1), ("softxaddr", 2))))
if mibBuilder.loadTexts: hwBrasSbcSipWellknownPortIndex.setStatus('current')
hwBrasSbcSipWellknownPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("sip", 1))))
if mibBuilder.loadTexts: hwBrasSbcSipWellknownPortProtocol.setStatus('current')
hwBrasSbcSipWellknownPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 1, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSipWellknownPortAddr.setStatus('current')
hwBrasSbcSipWellknownPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSipWellknownPortPort.setStatus('current')
hwBrasSbcSipWellknownPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcSipWellknownPortRowStatus.setStatus('current')
hwBrasSbcSipSignalMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcSipSignalMapTable.setStatus('current')
hwBrasSbcSipSignalMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipSignalMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipSignalMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcSipSignalMapEntry.setStatus('current')
hwBrasSbcSipSignalMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 2, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSipSignalMapAddr.setStatus('current')
hwBrasSbcSipSignalMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("sip", 1))))
if mibBuilder.loadTexts: hwBrasSbcSipSignalMapProtocol.setStatus('current')
hwBrasSbcSipSignalMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 2, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipSignalMapNumber.setStatus('current')
hwBrasSbcSipSignalMapAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("client", 1), ("server", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipSignalMapAddrType.setStatus('current')
hwBrasSbcSipMediaMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcSipMediaMapTable.setStatus('current')
hwBrasSbcSipMediaMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipMediaMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipMediaMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcSipMediaMapEntry.setStatus('current')
hwBrasSbcSipMediaMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 3, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSipMediaMapAddr.setStatus('current')
hwBrasSbcSipMediaMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("sip", 1))))
if mibBuilder.loadTexts: hwBrasSbcSipMediaMapProtocol.setStatus('current')
hwBrasSbcSipMediaMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 3, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipMediaMapNumber.setStatus('current')
hwBrasSbcSipIntercomMapSignalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapSignalTable.setStatus('current')
hwBrasSbcSipIntercomMapSignalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipIntercomMapSignalAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipIntercomMapSignalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapSignalEntry.setStatus('current')
hwBrasSbcSipIntercomMapSignalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 4, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapSignalAddr.setStatus('current')
hwBrasSbcSipIntercomMapSignalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("sip", 1))))
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapSignalProtocol.setStatus('current')
hwBrasSbcSipIntercomMapSignalNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapSignalNumber.setStatus('current')
hwBrasSbcSipIntercomMapMediaTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapMediaTable.setStatus('current')
hwBrasSbcSipIntercomMapMediaEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipIntercomMapMediaAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipIntercomMapMediaProtocol"))
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapMediaEntry.setStatus('current')
hwBrasSbcSipIntercomMapMediaAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 5, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapMediaAddr.setStatus('current')
hwBrasSbcSipIntercomMapMediaProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("sip", 1))))
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapMediaProtocol.setStatus('current')
hwBrasSbcSipIntercomMapMediaNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 5, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipIntercomMapMediaNumber.setStatus('current')
hwBrasSbcSipStatSignalPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketTable.setStatus('current')
hwBrasSbcSipStatSignalPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipStatSignalPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketEntry.setStatus('current')
hwBrasSbcSipStatSignalPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("sip", 1))))
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketIndex.setStatus('current')
hwBrasSbcSipStatSignalPacketInNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketInNumber.setStatus('current')
hwBrasSbcSipStatSignalPacketInOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketInOctet.setStatus('current')
hwBrasSbcSipStatSignalPacketOutNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketOutNumber.setStatus('current')
hwBrasSbcSipStatSignalPacketOutOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketOutOctet.setStatus('current')
hwBrasSbcSipStatSignalPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 2, 2, 6, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcSipStatSignalPacketRowStatus.setStatus('current')
hwBrasSbcMgcp = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3))
hwBrasSbcMgcpLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 1))
hwBrasSbcMgcpSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMgcpSyslogEnable.setStatus('current')
hwBrasSbcMgcpAuepTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 3600)).clone(600)).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMgcpAuepTimer.setStatus('current')
hwBrasSbcMgcpCcbTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(10, 14400)).clone(30)).setUnits('minutes').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMgcpCcbTimer.setStatus('current')
hwBrasSbcMgcpTxTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(6, 60)).clone(6)).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMgcpTxTimer.setStatus('current')
hwBrasSbcMgcpEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 1, 5), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMgcpEnable.setStatus('current')
hwBrasSbcMgcpPDHCountLimit = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 1, 6), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 100)).clone(6)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMgcpPDHCountLimit.setStatus('current')
hwBrasSbcMgcpTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3))
hwBrasSbcMgcpWellknownPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 1), )
if mibBuilder.loadTexts: hwBrasSbcMgcpWellknownPortTable.setStatus('current')
hwBrasSbcMgcpWellknownPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpWellknownPortIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpWellknownPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpWellknownPortAddr"))
if mibBuilder.loadTexts: hwBrasSbcMgcpWellknownPortEntry.setStatus('current')
hwBrasSbcMgcpWellknownPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("clientaddr", 1), ("softxaddr", 2))))
if mibBuilder.loadTexts: hwBrasSbcMgcpWellknownPortIndex.setStatus('current')
hwBrasSbcMgcpWellknownPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("mgcp", 1))))
if mibBuilder.loadTexts: hwBrasSbcMgcpWellknownPortProtocol.setStatus('current')
hwBrasSbcMgcpWellknownPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 1, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcMgcpWellknownPortAddr.setStatus('current')
hwBrasSbcMgcpWellknownPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMgcpWellknownPortPort.setStatus('current')
hwBrasSbcMgcpWellknownPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcMgcpWellknownPortRowStatus.setStatus('current')
hwBrasSbcMgcpSignalMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 2), )
if mibBuilder.loadTexts: hwBrasSbcMgcpSignalMapTable.setStatus('current')
hwBrasSbcMgcpSignalMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpSignalMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpSignalMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcMgcpSignalMapEntry.setStatus('current')
hwBrasSbcMgcpSignalMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 2, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcMgcpSignalMapAddr.setStatus('current')
hwBrasSbcMgcpSignalMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("mgcp", 1))))
if mibBuilder.loadTexts: hwBrasSbcMgcpSignalMapProtocol.setStatus('current')
hwBrasSbcMgcpSignalMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 2, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpSignalMapNumber.setStatus('current')
hwBrasSbcMgcpSignalMapAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("client", 1), ("server", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpSignalMapAddrType.setStatus('current')
hwBrasSbcMgcpMediaMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 3), )
if mibBuilder.loadTexts: hwBrasSbcMgcpMediaMapTable.setStatus('current')
hwBrasSbcMgcpMediaMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpMediaMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpMediaMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcMgcpMediaMapEntry.setStatus('current')
hwBrasSbcMgcpMediaMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 3, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcMgcpMediaMapAddr.setStatus('current')
hwBrasSbcMgcpMediaMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("mgcp", 1))))
if mibBuilder.loadTexts: hwBrasSbcMgcpMediaMapProtocol.setStatus('current')
hwBrasSbcMgcpMediaMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 3, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpMediaMapNumber.setStatus('current')
hwBrasSbcMgcpIntercomMapSignalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 4), )
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapSignalTable.setStatus('current')
hwBrasSbcMgcpIntercomMapSignalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpIntercomMapSignalAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpIntercomMapSignalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapSignalEntry.setStatus('current')
hwBrasSbcMgcpIntercomMapSignalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 4, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapSignalAddr.setStatus('current')
hwBrasSbcMgcpIntercomMapSignalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("mgcp", 1))))
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapSignalProtocol.setStatus('current')
hwBrasSbcMgcpIntercomMapSignalNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapSignalNumber.setStatus('current')
hwBrasSbcMgcpIntercomMapMediaTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 5), )
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapMediaTable.setStatus('current')
hwBrasSbcMgcpIntercomMapMediaEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpIntercomMapMediaAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpIntercomMapMediaProtocol"))
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapMediaEntry.setStatus('current')
hwBrasSbcMgcpIntercomMapMediaAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 5, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapMediaAddr.setStatus('current')
hwBrasSbcMgcpIntercomMapMediaProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("mgcp", 1))))
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapMediaProtocol.setStatus('current')
hwBrasSbcMgcpIntercomMapMediaNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 5, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpIntercomMapMediaNumber.setStatus('current')
hwBrasSbcMgcpStatSignalPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6), )
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketTable.setStatus('current')
hwBrasSbcMgcpStatSignalPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpStatSignalPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketEntry.setStatus('current')
hwBrasSbcMgcpStatSignalPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("mgcp", 1))))
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketIndex.setStatus('current')
hwBrasSbcMgcpStatSignalPacketInNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketInNumber.setStatus('current')
hwBrasSbcMgcpStatSignalPacketInOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketInOctet.setStatus('current')
hwBrasSbcMgcpStatSignalPacketOutNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketOutNumber.setStatus('current')
hwBrasSbcMgcpStatSignalPacketOutOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketOutOctet.setStatus('current')
hwBrasSbcMgcpStatSignalPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 3, 3, 6, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcMgcpStatSignalPacketRowStatus.setStatus('current')
hwBrasSbcIadms = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4))
hwBrasSbcIadmsLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 1))
hwBrasSbcIadmsEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIadmsEnable.setStatus('current')
hwBrasSbcIadmsSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 1, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIadmsSyslogEnable.setStatus('current')
hwBrasSbcIadmsRegRefreshEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 1, 3), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIadmsRegRefreshEnable.setStatus('current')
hwBrasSbcIadmsTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 30)).clone(20)).setUnits('minutes').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIadmsTimer.setStatus('current')
hwBrasSbcIadmsTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2))
hwBrasSbcIadmsWellknownPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcIadmsWellknownPortTable.setStatus('current')
hwBrasSbcIadmsWellknownPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsWellknownPortIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsWellknownPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsWellknownPortAddr"))
if mibBuilder.loadTexts: hwBrasSbcIadmsWellknownPortEntry.setStatus('current')
hwBrasSbcIadmsWellknownPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("clientaddr", 1), ("iadmsaddr", 2))))
if mibBuilder.loadTexts: hwBrasSbcIadmsWellknownPortIndex.setStatus('current')
hwBrasSbcIadmsWellknownPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("snmp", 1))))
if mibBuilder.loadTexts: hwBrasSbcIadmsWellknownPortProtocol.setStatus('current')
hwBrasSbcIadmsWellknownPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 1, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIadmsWellknownPortAddr.setStatus('current')
hwBrasSbcIadmsWellknownPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIadmsWellknownPortPort.setStatus('current')
hwBrasSbcIadmsWellknownPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIadmsWellknownPortRowStatus.setStatus('current')
hwBrasSbcIadmsMibRegTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcIadmsMibRegTable.setStatus('current')
hwBrasSbcIadmsMibRegEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsMibRegVersion"))
if mibBuilder.loadTexts: hwBrasSbcIadmsMibRegEntry.setStatus('current')
hwBrasSbcIadmsMibRegVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 2, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5))).clone(namedValues=NamedValues(("amend", 1), ("v150", 2), ("v152", 3), ("v160", 4), ("v210", 5))))
if mibBuilder.loadTexts: hwBrasSbcIadmsMibRegVersion.setStatus('current')
hwBrasSbcIadmsMibRegRegister = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 2, 1, 2), TruthValue().clone('true')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIadmsMibRegRegister.setStatus('current')
hwBrasSbcIadmsMibRegRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 2, 1, 3), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIadmsMibRegRowStatus.setStatus('current')
hwBrasSbcIadmsSignalMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcIadmsSignalMapTable.setStatus('current')
hwBrasSbcIadmsSignalMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsSignalMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsSignalMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcIadmsSignalMapEntry.setStatus('current')
hwBrasSbcIadmsSignalMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 3, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIadmsSignalMapAddr.setStatus('current')
hwBrasSbcIadmsSignalMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("snmp", 1))))
if mibBuilder.loadTexts: hwBrasSbcIadmsSignalMapProtocol.setStatus('current')
hwBrasSbcIadmsSignalMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 3, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsSignalMapNumber.setStatus('current')
hwBrasSbcIadmsSignalMapAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 3, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("client", 1), ("server", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsSignalMapAddrType.setStatus('current')
hwBrasSbcIadmsMediaMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcIadmsMediaMapTable.setStatus('current')
hwBrasSbcIadmsMediaMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsMediaMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsMediaMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcIadmsMediaMapEntry.setStatus('current')
hwBrasSbcIadmsMediaMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 4, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIadmsMediaMapAddr.setStatus('current')
hwBrasSbcIadmsMediaMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("snmp", 1))))
if mibBuilder.loadTexts: hwBrasSbcIadmsMediaMapProtocol.setStatus('current')
hwBrasSbcIadmsMediaMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsMediaMapNumber.setStatus('current')
hwBrasSbcIadmsIntercomMapSignalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapSignalTable.setStatus('current')
hwBrasSbcIadmsIntercomMapSignalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsIntercomMapSignalAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsIntercomMapSignalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapSignalEntry.setStatus('current')
hwBrasSbcIadmsIntercomMapSignalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 5, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapSignalAddr.setStatus('current')
hwBrasSbcIadmsIntercomMapSignalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("snmp", 1))))
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapSignalProtocol.setStatus('current')
hwBrasSbcIadmsIntercomMapSignalNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 5, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapSignalNumber.setStatus('current')
hwBrasSbcIadmsIntercomMapMediaTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapMediaTable.setStatus('current')
hwBrasSbcIadmsIntercomMapMediaEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsIntercomMapMediaAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsIntercomMapMediaProtocol"))
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapMediaEntry.setStatus('current')
hwBrasSbcIadmsIntercomMapMediaAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 6, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapMediaAddr.setStatus('current')
hwBrasSbcIadmsIntercomMapMediaProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 6, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("snmp", 1))))
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapMediaProtocol.setStatus('current')
hwBrasSbcIadmsIntercomMapMediaNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 6, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsIntercomMapMediaNumber.setStatus('current')
hwBrasSbcIadmsStatSignalPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7), )
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketTable.setStatus('current')
hwBrasSbcIadmsStatSignalPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsStatSignalPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketEntry.setStatus('current')
hwBrasSbcIadmsStatSignalPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("iadms", 1))))
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketIndex.setStatus('current')
hwBrasSbcIadmsStatSignalPacketInNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketInNumber.setStatus('current')
hwBrasSbcIadmsStatSignalPacketInOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketInOctet.setStatus('current')
hwBrasSbcIadmsStatSignalPacketOutNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketOutNumber.setStatus('current')
hwBrasSbcIadmsStatSignalPacketOutOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketOutOctet.setStatus('current')
hwBrasSbcIadmsStatSignalPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 4, 2, 7, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIadmsStatSignalPacketRowStatus.setStatus('current')
hwBrasSbcH323 = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5))
hwBrasSbcH323Leaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 1))
hwBrasSbcH323Enable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH323Enable.setStatus('current')
hwBrasSbcH323SyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 1, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH323SyslogEnable.setStatus('current')
hwBrasSbcH323CallsessionTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(3, 24)).clone(24)).setUnits('hours').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH323CallsessionTimer.setStatus('current')
hwBrasSbcH323Q931WellknownPort = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 49999)).clone(1720)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH323Q931WellknownPort.setStatus('current')
hwBrasSbcH323PDHCountLimit = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 100)).clone(6)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH323PDHCountLimit.setStatus('current')
hwBrasSbcH323Tables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2))
hwBrasSbcH323WellknownPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcH323WellknownPortTable.setStatus('current')
hwBrasSbcH323WellknownPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323WellknownPortIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323WellknownPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323WellknownPortAddr"))
if mibBuilder.loadTexts: hwBrasSbcH323WellknownPortEntry.setStatus('current')
hwBrasSbcH323WellknownPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("clientaddr", 1), ("softxaddr", 2))))
if mibBuilder.loadTexts: hwBrasSbcH323WellknownPortIndex.setStatus('current')
hwBrasSbcH323WellknownPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("ras", 1), ("q931", 2))))
if mibBuilder.loadTexts: hwBrasSbcH323WellknownPortProtocol.setStatus('current')
hwBrasSbcH323WellknownPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 1, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH323WellknownPortAddr.setStatus('current')
hwBrasSbcH323WellknownPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcH323WellknownPortPort.setStatus('current')
hwBrasSbcH323WellknownPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcH323WellknownPortRowStatus.setStatus('current')
hwBrasSbcH323SignalMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcH323SignalMapTable.setStatus('current')
hwBrasSbcH323SignalMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323SignalMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323SignalMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH323SignalMapEntry.setStatus('current')
hwBrasSbcH323SignalMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 2, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH323SignalMapAddr.setStatus('current')
hwBrasSbcH323SignalMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("ras", 1), ("q931", 2), ("h245", 3))))
if mibBuilder.loadTexts: hwBrasSbcH323SignalMapProtocol.setStatus('current')
hwBrasSbcH323SignalMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 2, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323SignalMapNumber.setStatus('current')
hwBrasSbcH323SignalMapAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("client", 1), ("server", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323SignalMapAddrType.setStatus('current')
hwBrasSbcH323MediaMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcH323MediaMapTable.setStatus('current')
hwBrasSbcH323MediaMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323MediaMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323MediaMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH323MediaMapEntry.setStatus('current')
hwBrasSbcH323MediaMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 3, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH323MediaMapAddr.setStatus('current')
hwBrasSbcH323MediaMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h323", 1))))
if mibBuilder.loadTexts: hwBrasSbcH323MediaMapProtocol.setStatus('current')
hwBrasSbcH323MediaMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 3, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323MediaMapNumber.setStatus('current')
hwBrasSbcH323IntercomMapSignalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapSignalTable.setStatus('current')
hwBrasSbcH323IntercomMapSignalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323IntercomMapSignalAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323IntercomMapSignalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapSignalEntry.setStatus('current')
hwBrasSbcH323IntercomMapSignalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 4, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapSignalAddr.setStatus('current')
hwBrasSbcH323IntercomMapSignalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("ras", 1), ("q931", 2), ("h245", 3))))
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapSignalProtocol.setStatus('current')
hwBrasSbcH323IntercomMapSignalNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapSignalNumber.setStatus('current')
hwBrasSbcH323IntercomMapMediaTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapMediaTable.setStatus('current')
hwBrasSbcH323IntercomMapMediaEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323IntercomMapMediaAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323IntercomMapMediaProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapMediaEntry.setStatus('current')
hwBrasSbcH323IntercomMapMediaAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 5, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapMediaAddr.setStatus('current')
hwBrasSbcH323IntercomMapMediaProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h323", 1))))
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapMediaProtocol.setStatus('current')
hwBrasSbcH323IntercomMapMediaNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 5, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323IntercomMapMediaNumber.setStatus('current')
hwBrasSbcH323StatSignalPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketTable.setStatus('current')
hwBrasSbcH323StatSignalPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323StatSignalPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketEntry.setStatus('current')
hwBrasSbcH323StatSignalPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h323", 1))))
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketIndex.setStatus('current')
hwBrasSbcH323StatSignalPacketInNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketInNumber.setStatus('current')
hwBrasSbcH323StatSignalPacketInOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketInOctet.setStatus('current')
hwBrasSbcH323StatSignalPacketOutNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketOutNumber.setStatus('current')
hwBrasSbcH323StatSignalPacketOutOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketOutOctet.setStatus('current')
hwBrasSbcH323StatSignalPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 5, 2, 6, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH323StatSignalPacketRowStatus.setStatus('current')
hwBrasSbcIdo = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6))
hwBrasSbcIdoLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 1))
hwBrasSbcIdoEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIdoEnable.setStatus('current')
hwBrasSbcIdoSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 1, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIdoSyslogEnable.setStatus('current')
hwBrasSbcIdoTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2))
hwBrasSbcIdoWellknownPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcIdoWellknownPortTable.setStatus('current')
hwBrasSbcIdoWellknownPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoWellknownPortIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoWellknownPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoWellknownPortAddr"))
if mibBuilder.loadTexts: hwBrasSbcIdoWellknownPortEntry.setStatus('current')
hwBrasSbcIdoWellknownPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("clientaddr", 1), ("softxaddr", 2))))
if mibBuilder.loadTexts: hwBrasSbcIdoWellknownPortIndex.setStatus('current')
hwBrasSbcIdoWellknownPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("ido", 1))))
if mibBuilder.loadTexts: hwBrasSbcIdoWellknownPortProtocol.setStatus('current')
hwBrasSbcIdoWellknownPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 1, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIdoWellknownPortAddr.setStatus('current')
hwBrasSbcIdoWellknownPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIdoWellknownPortPort.setStatus('current')
hwBrasSbcIdoWellknownPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcIdoWellknownPortRowStatus.setStatus('current')
hwBrasSbcIdoSignalMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcIdoSignalMapTable.setStatus('current')
hwBrasSbcIdoSignalMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoSignalMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoSignalMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcIdoSignalMapEntry.setStatus('current')
hwBrasSbcIdoSignalMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 2, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIdoSignalMapAddr.setStatus('current')
hwBrasSbcIdoSignalMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("ido", 1))))
if mibBuilder.loadTexts: hwBrasSbcIdoSignalMapProtocol.setStatus('current')
hwBrasSbcIdoSignalMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 2, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIdoSignalMapNumber.setStatus('current')
hwBrasSbcIdoSignalMapAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("client", 1), ("server", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIdoSignalMapAddrType.setStatus('current')
hwBrasSbcIdoIntercomMapSignalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcIdoIntercomMapSignalTable.setStatus('current')
hwBrasSbcIdoIntercomMapSignalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoIntercomMapSignalAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoIntercomMapSignalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcIdoIntercomMapSignalEntry.setStatus('current')
hwBrasSbcIdoIntercomMapSignalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 3, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcIdoIntercomMapSignalAddr.setStatus('current')
hwBrasSbcIdoIntercomMapSignalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("ido", 1))))
if mibBuilder.loadTexts: hwBrasSbcIdoIntercomMapSignalProtocol.setStatus('current')
hwBrasSbcIdoIntercomMapSignalNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 3, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIdoIntercomMapSignalNumber.setStatus('current')
hwBrasSbcIdoStatSignalPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketTable.setStatus('current')
hwBrasSbcIdoStatSignalPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoStatSignalPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketEntry.setStatus('current')
hwBrasSbcIdoStatSignalPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("ido", 1))))
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketIndex.setStatus('current')
hwBrasSbcIdoStatSignalPacketInNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketInNumber.setStatus('current')
hwBrasSbcIdoStatSignalPacketInOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketInOctet.setStatus('current')
hwBrasSbcIdoStatSignalPacketOutNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketOutNumber.setStatus('current')
hwBrasSbcIdoStatSignalPacketOutOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketOutOctet.setStatus('current')
hwBrasSbcIdoStatSignalPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 6, 2, 4, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcIdoStatSignalPacketRowStatus.setStatus('current')
hwBrasSbcH248 = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7))
hwBrasSbcH248Leaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 1))
hwBrasSbcH248Enable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 1, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH248Enable.setStatus('current')
hwBrasSbcH248SyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 1, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH248SyslogEnable.setStatus('current')
hwBrasSbcH248CcbTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(10, 14400))).setUnits('minutes').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH248CcbTimer.setStatus('current')
hwBrasSbcH248UserAgeTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 3600))).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH248UserAgeTimer.setStatus('current')
hwBrasSbcH248PDHCountLimit = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 100)).clone(6)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH248PDHCountLimit.setStatus('current')
hwBrasSbcH248Tables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2))
hwBrasSbcH248WellknownPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcH248WellknownPortTable.setStatus('current')
hwBrasSbcH248WellknownPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248WellknownPortIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248WellknownPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248WellknownPortAddr"))
if mibBuilder.loadTexts: hwBrasSbcH248WellknownPortEntry.setStatus('current')
hwBrasSbcH248WellknownPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("clientaddr", 1), ("softxaddr", 2))))
if mibBuilder.loadTexts: hwBrasSbcH248WellknownPortIndex.setStatus('current')
hwBrasSbcH248WellknownPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h248", 1))))
if mibBuilder.loadTexts: hwBrasSbcH248WellknownPortProtocol.setStatus('current')
hwBrasSbcH248WellknownPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 1, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH248WellknownPortAddr.setStatus('current')
hwBrasSbcH248WellknownPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcH248WellknownPortPort.setStatus('current')
hwBrasSbcH248WellknownPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcH248WellknownPortRowStatus.setStatus('current')
hwBrasSbcH248SignalMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcH248SignalMapTable.setStatus('current')
hwBrasSbcH248SignalMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248SignalMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248SignalMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH248SignalMapEntry.setStatus('current')
hwBrasSbcH248SignalMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 2, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH248SignalMapAddr.setStatus('current')
hwBrasSbcH248SignalMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h248", 1))))
if mibBuilder.loadTexts: hwBrasSbcH248SignalMapProtocol.setStatus('current')
hwBrasSbcH248SignalMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 2, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248SignalMapNumber.setStatus('current')
hwBrasSbcH248SignalMapAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("client", 1), ("server", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248SignalMapAddrType.setStatus('current')
hwBrasSbcH248MediaMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 3), )
if mibBuilder.loadTexts: hwBrasSbcH248MediaMapTable.setStatus('current')
hwBrasSbcH248MediaMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248MediaMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248MediaMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH248MediaMapEntry.setStatus('current')
hwBrasSbcH248MediaMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 3, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH248MediaMapAddr.setStatus('current')
hwBrasSbcH248MediaMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h248", 1))))
if mibBuilder.loadTexts: hwBrasSbcH248MediaMapProtocol.setStatus('current')
hwBrasSbcH248MediaMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 3, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248MediaMapNumber.setStatus('current')
hwBrasSbcH248IntercomMapSignalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 4), )
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapSignalTable.setStatus('current')
hwBrasSbcH248IntercomMapSignalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248IntercomMapSignalAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248IntercomMapSignalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapSignalEntry.setStatus('current')
hwBrasSbcH248IntercomMapSignalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 4, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapSignalAddr.setStatus('current')
hwBrasSbcH248IntercomMapSignalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h248", 1))))
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapSignalProtocol.setStatus('current')
hwBrasSbcH248IntercomMapSignalNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapSignalNumber.setStatus('current')
hwBrasSbcH248IntercomMapMediaTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 5), )
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapMediaTable.setStatus('current')
hwBrasSbcH248IntercomMapMediaEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248IntercomMapMediaAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248IntercomMapMediaProtocol"))
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapMediaEntry.setStatus('current')
hwBrasSbcH248IntercomMapMediaAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 5, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapMediaAddr.setStatus('current')
hwBrasSbcH248IntercomMapMediaProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h248", 1))))
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapMediaProtocol.setStatus('current')
hwBrasSbcH248IntercomMapMediaNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 5, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248IntercomMapMediaNumber.setStatus('current')
hwBrasSbcH248StatSignalPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6), )
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketTable.setStatus('current')
hwBrasSbcH248StatSignalPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248StatSignalPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketEntry.setStatus('current')
hwBrasSbcH248StatSignalPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("h248", 1))))
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketIndex.setStatus('current')
hwBrasSbcH248StatSignalPacketInNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketInNumber.setStatus('current')
hwBrasSbcH248StatSignalPacketInOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketInOctet.setStatus('current')
hwBrasSbcH248StatSignalPacketOutNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketOutNumber.setStatus('current')
hwBrasSbcH248StatSignalPacketOutOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketOutOctet.setStatus('current')
hwBrasSbcH248StatSignalPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 7, 2, 6, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcH248StatSignalPacketRowStatus.setStatus('current')
hwBrasSbcUpath = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8))
hwBrasSbcUpathLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 2))
hwBrasSbcUpathEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 2, 1), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUpathEnable.setStatus('current')
hwBrasSbcUpathSyslogEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 2, 2), HWBrasEnabledStatus().clone('enabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUpathSyslogEnable.setStatus('current')
hwBrasSbcUpathCallsessionTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 2, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 24)).clone(12)).setUnits('hours').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUpathCallsessionTimer.setStatus('current')
hwBrasSbcUpathHeartbeatTimer = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 2, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(10, 30)).clone(10)).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUpathHeartbeatTimer.setStatus('current')
hwBrasSbcUpathTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3))
hwBrasSbcUpathWellknownPortTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 1), )
if mibBuilder.loadTexts: hwBrasSbcUpathWellknownPortTable.setStatus('current')
hwBrasSbcUpathWellknownPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathWellknownPortIndex"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathWellknownPortProtocol"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathWellknownPortAddr"))
if mibBuilder.loadTexts: hwBrasSbcUpathWellknownPortEntry.setStatus('current')
hwBrasSbcUpathWellknownPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("clientaddr", 1), ("softxaddr", 2))))
if mibBuilder.loadTexts: hwBrasSbcUpathWellknownPortIndex.setStatus('current')
hwBrasSbcUpathWellknownPortProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("upath", 1))))
if mibBuilder.loadTexts: hwBrasSbcUpathWellknownPortProtocol.setStatus('current')
hwBrasSbcUpathWellknownPortAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 1, 1, 3), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcUpathWellknownPortAddr.setStatus('current')
hwBrasSbcUpathWellknownPortPort = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUpathWellknownPortPort.setStatus('current')
hwBrasSbcUpathWellknownPortRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 1, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hwBrasSbcUpathWellknownPortRowStatus.setStatus('current')
hwBrasSbcUpathSignalMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 2), )
if mibBuilder.loadTexts: hwBrasSbcUpathSignalMapTable.setStatus('current')
hwBrasSbcUpathSignalMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathSignalMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathSignalMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcUpathSignalMapEntry.setStatus('current')
hwBrasSbcUpathSignalMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 2, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcUpathSignalMapAddr.setStatus('current')
hwBrasSbcUpathSignalMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("upath", 1))))
if mibBuilder.loadTexts: hwBrasSbcUpathSignalMapProtocol.setStatus('current')
hwBrasSbcUpathSignalMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 2, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathSignalMapNumber.setStatus('current')
hwBrasSbcUpathSignalMapAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("client", 1), ("server", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathSignalMapAddrType.setStatus('current')
hwBrasSbcUpathMediaMapTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 3), )
if mibBuilder.loadTexts: hwBrasSbcUpathMediaMapTable.setStatus('current')
hwBrasSbcUpathMediaMapEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 3, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathMediaMapAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathMediaMapProtocol"))
if mibBuilder.loadTexts: hwBrasSbcUpathMediaMapEntry.setStatus('current')
hwBrasSbcUpathMediaMapAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 3, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcUpathMediaMapAddr.setStatus('current')
hwBrasSbcUpathMediaMapProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("upath", 1))))
if mibBuilder.loadTexts: hwBrasSbcUpathMediaMapProtocol.setStatus('current')
hwBrasSbcUpathMediaMapNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 3, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathMediaMapNumber.setStatus('current')
hwBrasSbcUpathIntercomMapSignalTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 4), )
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapSignalTable.setStatus('current')
hwBrasSbcUpathIntercomMapSignalEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 4, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathIntercomMapSignalAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathIntercomMapSignalProtocol"))
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapSignalEntry.setStatus('current')
hwBrasSbcUpathIntercomMapSignalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 4, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapSignalAddr.setStatus('current')
hwBrasSbcUpathIntercomMapSignalProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("upath", 1))))
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapSignalProtocol.setStatus('current')
hwBrasSbcUpathIntercomMapSignalNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapSignalNumber.setStatus('current')
hwBrasSbcUpathIntercomMapMediaTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 5), )
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapMediaTable.setStatus('current')
hwBrasSbcUpathIntercomMapMediaEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 5, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathIntercomMapMediaAddr"), (0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathIntercomMapMediaProtocol"))
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapMediaEntry.setStatus('current')
hwBrasSbcUpathIntercomMapMediaAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 5, 1, 1), IpAddress())
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapMediaAddr.setStatus('current')
hwBrasSbcUpathIntercomMapMediaProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("upath", 1))))
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapMediaProtocol.setStatus('current')
hwBrasSbcUpathIntercomMapMediaNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 5, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathIntercomMapMediaNumber.setStatus('current')
hwBrasSbcUpathStatSignalPacketTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6), )
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketTable.setStatus('current')
hwBrasSbcUpathStatSignalPacketEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathStatSignalPacketIndex"))
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketEntry.setStatus('current')
hwBrasSbcUpathStatSignalPacketIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("upath", 1))))
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketIndex.setStatus('current')
hwBrasSbcUpathStatSignalPacketInNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketInNumber.setStatus('current')
hwBrasSbcUpathStatSignalPacketInOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketInOctet.setStatus('current')
hwBrasSbcUpathStatSignalPacketOutNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketOutNumber.setStatus('current')
hwBrasSbcUpathStatSignalPacketOutOctet = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketOutOctet.setStatus('current')
hwBrasSbcUpathStatSignalPacketRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 8, 3, 6, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcUpathStatSignalPacketRowStatus.setStatus('current')
hwBrasSbcOm = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 21))
hwBrasSbcOmLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 21, 1))
hwBrasSbcRestartEnable = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 21, 1, 1), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcRestartEnable.setStatus('current')
hwBrasSbcRestartButton = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 21, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 101))).clone(namedValues=NamedValues(("notready", 1), ("restart", 101)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcRestartButton.setStatus('current')
hwBrasSbcPatchLoadStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 21, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("unknown", 1), ("loaded", 2))).clone('unknown')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcPatchLoadStatus.setStatus('current')
hwBrasSbcLocalizationStatus = MibScalar((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 21, 1, 4), HWBrasEnabledStatus().clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hwBrasSbcLocalizationStatus.setStatus('current')
hwBrasSbcOmTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 1, 21, 2))
hwBrasSbcTrapBind = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2))
hwBrasSbcTrapBindLeaves = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 1))
hwBrasSbcTrapBindTables = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2))
hwBrasSbcTrapBindTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1), )
if mibBuilder.loadTexts: hwBrasSbcTrapBindTable.setStatus('current')
hwBrasSbcTrapBindEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindIndex"))
if mibBuilder.loadTexts: hwBrasSbcTrapBindEntry.setStatus('current')
hwBrasSbcTrapBindIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("trapbind", 1))))
if mibBuilder.loadTexts: hwBrasSbcTrapBindIndex.setStatus('current')
hwBrasSbcTrapBindID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(100, 299))).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapBindID.setStatus('current')
hwBrasSbcTrapBindTime = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1, 1, 3), DateAndTime()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapBindTime.setStatus('current')
hwBrasSbcTrapBindFluID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1, 1, 4), Unsigned32()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapBindFluID.setStatus('current')
hwBrasSbcTrapBindReason = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(100, 299))).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapBindReason.setStatus('current')
hwBrasSbcTrapBindType = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 1, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3))).clone(namedValues=NamedValues(("notify", 0), ("alarm", 1), ("resume", 2), ("sync", 3)))).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapBindType.setStatus('current')
hwBrasSbcTrapInfoTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2), )
if mibBuilder.loadTexts: hwBrasSbcTrapInfoTable.setStatus('current')
hwBrasSbcTrapInfoEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1), ).setIndexNames((0, "HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoIndex"))
if mibBuilder.loadTexts: hwBrasSbcTrapInfoEntry.setStatus('current')
hwBrasSbcTrapInfoIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("trap", 1))))
if mibBuilder.loadTexts: hwBrasSbcTrapInfoIndex.setStatus('current')
hwBrasSbcTrapInfoCpu = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 100))).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoCpu.setStatus('current')
hwBrasSbcTrapInfoHrp = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("action", 1)))).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoHrp.setStatus('current')
hwBrasSbcTrapInfoSignalingFlood = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 4), Unsigned32()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoSignalingFlood.setStatus('current')
hwBrasSbcTrapInfoCac = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 5), Unsigned32()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoCac.setStatus('current')
hwBrasSbcTrapInfoStatistic = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("action", 1)))).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoStatistic.setStatus('current')
hwBrasSbcTrapInfoPortStatistic = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 7), Unsigned32()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoPortStatistic.setStatus('current')
hwBrasSbcTrapInfoOldSSIP = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 8), IpAddress()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoOldSSIP.setStatus('current')
hwBrasSbcTrapInfoImsConID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 9), Unsigned32()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoImsConID.setStatus('current')
hwBrasSbcTrapInfoImsCcbID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 2, 2, 2, 1, 10), Unsigned32()).setMaxAccess("accessiblefornotify")
if mibBuilder.loadTexts: hwBrasSbcTrapInfoImsCcbID.setStatus('current')
hwBrasSbcComformance = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 3))
hwBrasSbcGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 3, 1))
hwBrasSbcGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 3, 1, 1))
for _hwBrasSbcGroup_obj in [[("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalAddrMapRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcPortrangeBegin"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcPortrangeEnd"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcPortrangeRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipWellknownPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSoftVersion"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCpuUsage"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsWellknownPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsWellknownPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323WellknownPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323WellknownPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoWellknownPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoWellknownPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248WellknownPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248WellknownPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsMibRegRegister"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsMibRegRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipWellknownPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipAnonymity"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipCheckheartEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipCallsessionTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpAuepTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpCcbTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpTxTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpWellknownPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpWellknownPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsRegRefreshEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatisticDesc"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatisticValue"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatisticTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248Enable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248CcbTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248UserAgeTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323Enable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323CallsessionTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248SyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323SyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathCallsessionTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathHeartbeatTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323Q931WellknownPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIntercomPrefixDestAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIntercomPrefixSrcAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIntercomPrefixRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatisticEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatisticSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcAppMode"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaDetectValidityEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaDetectSsrcEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaDetectPacketLength"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcInstanceName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcInstanceRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMapGroupInstanceName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMapGroupSessionLimit"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrVPNName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIf1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrSlotID1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIf2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrSlotID2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIf3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrSlotID3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIf4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrSlotID4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrVPNName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIf1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrSlotID1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIf2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrSlotID2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIf3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrSlotID3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIf4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrSlotID4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcBackupGroupType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcBackupGroupInstanceName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcBackupGroupRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCurrentSlotID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSlotCfgState"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSlotInforRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMgLogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsStatisticsEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTimerMediaAging"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGInstanceName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcNatSessionAgingTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcNatGroupIndex"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcNatVpnNameIndex"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcNatInstanceName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcNatCfgRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwNatAddrGrpBeginningIpAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwNatAddrGrpEndingIpAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwNatAddrGrpRefCount"), ("HUAWEI-BRAS-SBC-MIB", "hwNatAddrGrpVpnName"), ("HUAWEI-BRAS-SBC-MIB", "hwNatAddrGrpRowstatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcBWLimitType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcBWLimitValue"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarDegreeBandWidth"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarDegreeDscp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarDegreeRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarRuleName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarRuleDegreeID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarRuleRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarRuleDegreeBandWidth"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSessionCarRuleDegreeDscp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipMediaMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpMediaMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323MediaMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsMediaMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathMediaMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248MediaMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCallerID1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCallerID2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCallerID3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCallerID4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCalleeID1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCalleeID2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCalleeID3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersCalleeID4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaUsersRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaPassEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaPassRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUsergroupRuleType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUsergroupRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaPassSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaAddrMapServerAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaAddrMapWeight"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaAddrMapRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRoamlimitRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRoamlimitEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRoamlimitDefault"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRoamlimitSyslogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaPassAclNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRtpSpecialAddrRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRtpSpecialAddrAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipSignalMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipIntercomMapSignalNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpIntercomMapSignalNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpIntercomMapMediaNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsIntercomMapSignalNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsIntercomMapMediaNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323IntercomMapSignalNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323IntercomMapMediaNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoIntercomMapSignalNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248IntercomMapSignalNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248IntercomMapMediaNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathIntercomMapSignalNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathIntercomMapMediaNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRoamlimitExtendEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipIntercomMapMediaNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipSignalMapAddrType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpSignalMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpSignalMapAddrType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsSignalMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsSignalMapAddrType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323SignalMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323SignalMapAddrType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoSignalMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoSignalMapAddrType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248SignalMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248SignalMapAddrType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathSignalMapNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRoamlimitAclNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathSignalMapAddrType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathWellknownPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathStatSignalPacketInNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathStatSignalPacketInOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathStatSignalPacketOutNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathStatSignalPacketOutOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathStatSignalPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248StatSignalPacketInNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248StatSignalPacketInOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248StatSignalPacketOutNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248StatSignalPacketOutOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248StatSignalPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoStatSignalPacketInNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoStatSignalPacketInOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoStatSignalPacketOutNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoStatSignalPacketOutOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdoStatSignalPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323StatSignalPacketInNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323StatSignalPacketInOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323StatSignalPacketOutNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323StatSignalPacketOutOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323StatSignalPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsStatSignalPacketInNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsStatSignalPacketInOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsStatSignalPacketOutNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsStatSignalPacketOutOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsStatSignalPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpStatSignalPacketInNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpStatSignalPacketInOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpStatSignalPacketOutNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpStatSignalPacketOutOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpStatSignalPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipStatSignalPacketInNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipStatSignalPacketInOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipStatSignalPacketOutNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipStatSignalPacketOutOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipStatSignalPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatMediaPacketNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatMediaPacketOctet"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatMediaPacketRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegRateThreshold"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegRatePercent"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegRateRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegTotalThreshold"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegTotalPercent"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacRegTotalRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallRateThreshold"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallRatePercent"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallRateRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallTotalThreshold"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallTotalPercent"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacCallTotalRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendUserConnectRateThreshold"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendUserConnectRatePercent"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendUserConnectRateRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendConnectRateThreshold"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendConnectRatePercent"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendConnectRateRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendMode"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendActionLogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUpathWellknownPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUsergroupRuleUserName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUsergroupRuleRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelIfPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelSctpAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelTunnelTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelTransportTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelPoolRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelPoolStartIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUdpTunnelPoolEndIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIntMediaPassEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalAddrMapSoftAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalAddrMapIadmsAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRestartEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcRestartButton"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcUmsVersion"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMapGroupsType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMapGroupsStatus")], [("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMapGroupsRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGCliAddrVPN"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGCliAddrIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGCliAddrRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGServAddrVPN"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGServAddrRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGSofxAddrVPN"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGSofxAddrRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGIadmsAddrVPN"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGIadmsAddrRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGPrefixID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGPrefixRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrVPN"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrVPN"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMatchAcl"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMatchRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcHrpSynchronization"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGIadmsAddrIP1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGIadmsAddrIP2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGIadmsAddrIP3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGIadmsAddrIP4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGSofxAddrIP1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGSofxAddrIP2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGSofxAddrIP3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGSofxAddrIP4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIP1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIP2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIP3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdServAddrIP4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIP1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIP2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIP3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGMdCliAddrIP4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGServAddrIP1"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGServAddrIP2"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGServAddrIP3"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGServAddrIP4"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolSip"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolMgcp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolH323"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolIadms"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolUpath"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGProtocolH248"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcPatchLoadStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsActiveStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsActiveRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsBandIfIndex"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsBandIfName"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsBandIfType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsBandValue"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsBandRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectPepID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectCliType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectServIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectServPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsQosEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMediaProxyEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsQosLogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMediaProxyLogEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacActionLogStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectCliIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH248PDHCountLimit"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcH323PDHCountLimit"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMgcpPDHCountLimit"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipPDHCountLimit"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipRegReduceStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSipRegReduceTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSIPDetectStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSIPDetectTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSIPDetectSourcePort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSIPDetectFailCount"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSoftswitchPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSoftswitchPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsPortPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIadmsPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort01"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort02"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort03"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort04"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort05"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort06"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort07"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort08"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort09"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort10"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort11"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort12"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort13"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort14"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort15"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortPort16"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcClientPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIntercomStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcQRStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcQRBandWidth"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIPCarBWValue"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIPCarBWRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDynamicStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalingCarStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIPCarStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGDomainMapIndex"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGDomainRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIPVersion"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIPAddr"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIPInterface"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIPPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGIPRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGDescription"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGTableStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGProtocol"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGMidString"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGConnectTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGAgingTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsMGCallSessionTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSctpStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdlecutRtcpTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIdlecutRtpTimer"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaDetectStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMediaOnewayStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDStatisticMinDrop"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDStatisticMaxDrop"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDStatisticFragDrop"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDStatisticFlowDrop"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDStatisticRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDLengthMin"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDLengthMax"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDLengthRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMDStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDefendExtStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsConnectCliPort"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGPortNumber"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcMGPortRowStatus"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIntercomEnable"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcLocalizationStatus")]]:
if getattr(mibBuilder, 'version', 0) < (4, 4, 2):
# WARNING: leading objects get lost here!
hwBrasSbcGroup = hwBrasSbcGroup.setObjects(*_hwBrasSbcGroup_obj)
else:
hwBrasSbcGroup = hwBrasSbcGroup.setObjects(*_hwBrasSbcGroup_obj, **dict(append=True))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hwBrasSbcGroup = hwBrasSbcGroup.setStatus('current')
hwBrasSbcTrapGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 3, 1, 2)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoCpu"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoHrp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoSignalingFlood"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoCac"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoStatistic"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoPortStatistic"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsConID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsCcbID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoOldSSIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSIPDetectFailCount"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hwBrasSbcTrapGroup = hwBrasSbcTrapGroup.setStatus('current')
hwBrasSbcCapabilities = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 3, 2))
hwBrasSbcNotification = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4))
hwBrasSbcCpu = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 1)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoCpu"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcCpu.setStatus('current')
hwBrasSbcCpuNormal = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 2)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoCpu"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcCpuNormal.setStatus('current')
hwBrasSbcHrp = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 3)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoHrp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcHrp.setStatus('current')
hwBrasSbcSignalingFlood = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 4)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoSignalingFlood"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcSignalingFlood.setStatus('current')
hwBrasSbcSignalingFloodNormal = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 5)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoSignalingFlood"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcSignalingFloodNormal.setStatus('current')
hwBrasSbcCac = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 6)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoCac"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcCac.setStatus('current')
hwBrasSbcCacNormal = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 7)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoCac"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcCacNormal.setStatus('current')
hwBrasSbcStatistic = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 8)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoStatistic"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcStatistic.setStatus('current')
hwBrasSbcPortStatistic = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 9)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoPortStatistic"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcPortStatistic.setStatus('current')
hwBrasSbcPortStatisticNormal = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 10)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoPortStatistic"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcPortStatisticNormal.setStatus('current')
hwBrasSbcDHSwitch = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 11)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSIPDetectFailCount"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoOldSSIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcDHSwitch.setStatus('current')
hwBrasSbcDHSwitchNormal = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 12)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoOldSSIP"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcDHSwitchNormal.setStatus('current')
hwBrasSbcImsRptFail = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 13)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsConID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcImsRptFail.setStatus('current')
hwBrasSbcImsRptDrq = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 14)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsConID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcImsRptDrq.setStatus('current')
hwBrasSbcImsTimeOut = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 15)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsCcbID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcImsTimeOut.setStatus('current')
hwBrasSbcImsSessCreate = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 16)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsCcbID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcImsSessCreate.setStatus('current')
hwBrasSbcImsSessDelete = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 17)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsCcbID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcImsSessDelete.setStatus('current')
hwBrasSbcCopsLinkUp = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 18)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsConID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcCopsLinkUp.setStatus('current')
hwBrasSbcCopsLinkDown = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 19)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsConID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcCopsLinkDown.setStatus('current')
hwBrasSbcIaLinkUp = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 20)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsConID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcIaLinkUp.setStatus('current')
hwBrasSbcIaLinkDown = NotificationType((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 4, 21)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapInfoImsConID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindTime"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindFluID"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindReason"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcTrapBindType"))
if mibBuilder.loadTexts: hwBrasSbcIaLinkDown.setStatus('current')
hwBrasSbcNotificationGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 5))
hwBrasSbcNotificationGroup = NotificationGroup((1, 3, 6, 1, 4, 1, 2011, 5, 25, 40, 25, 2, 5, 1)).setObjects(("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCpu"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCpuNormal"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcHrp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalingFlood"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcSignalingFloodNormal"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCac"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCacNormal"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcStatistic"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcPortStatistic"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcPortStatisticNormal"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSwitch"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcDHSwitchNormal"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsRptFail"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsRptDrq"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsTimeOut"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsSessCreate"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcImsSessDelete"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCopsLinkUp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcCopsLinkDown"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIaLinkUp"), ("HUAWEI-BRAS-SBC-MIB", "hwBrasSbcIaLinkDown"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hwBrasSbcNotificationGroup = hwBrasSbcNotificationGroup.setStatus('current')
mibBuilder.exportSymbols("HUAWEI-BRAS-SBC-MIB", hwBrasSbcMgcpMediaMapProtocol=hwBrasSbcMgcpMediaMapProtocol, hwBrasSbcIdoWellknownPortRowStatus=hwBrasSbcIdoWellknownPortRowStatus, hwBrasSbcIdoLeaves=hwBrasSbcIdoLeaves, hwBrasSbcMapGroupsType=hwBrasSbcMapGroupsType, hwBrasSbcUdpTunnelPortPort=hwBrasSbcUdpTunnelPortPort, hwBrasSbcMGSofxAddrRowStatus=hwBrasSbcMGSofxAddrRowStatus, hwBrasSbcH248MediaMapProtocol=hwBrasSbcH248MediaMapProtocol, hwBrasSbcIadmsMibRegRegister=hwBrasSbcIadmsMibRegRegister, hwBrasSbcSessionCarDegreeID=hwBrasSbcSessionCarDegreeID, hwBrasSbcClientPortPort03=hwBrasSbcClientPortPort03, hwBrasSbcCopsLinkUp=hwBrasSbcCopsLinkUp, hwBrasSbcStatisticOffset=hwBrasSbcStatisticOffset, hwBrasSbcCacCallRatePercent=hwBrasSbcCacCallRatePercent, hwBrasSbcUsergroupRowStatus=hwBrasSbcUsergroupRowStatus, hwBrasSbcUdpTunnelTunnelTimer=hwBrasSbcUdpTunnelTunnelTimer, hwBrasSbcSipIntercomMapSignalTable=hwBrasSbcSipIntercomMapSignalTable, hwBrasSbcMgcpLeaves=hwBrasSbcMgcpLeaves, hwBrasSbcMGMdServAddrIf1=hwBrasSbcMGMdServAddrIf1, hwBrasSbcImsConnectTable=hwBrasSbcImsConnectTable, hwBrasSbcClientPortPort02=hwBrasSbcClientPortPort02, hwBrasSbcMDLengthRowStatus=hwBrasSbcMDLengthRowStatus, hwBrasSbcIntercomPrefixSrcAddr=hwBrasSbcIntercomPrefixSrcAddr, hwBrasSbcViewTables=hwBrasSbcViewTables, hwBrasSbcIdlecutRtcpTimer=hwBrasSbcIdlecutRtcpTimer, hwBrasSbcPortrangeTable=hwBrasSbcPortrangeTable, hwBrasSbcMediaAddrMapRowStatus=hwBrasSbcMediaAddrMapRowStatus, hwBrasSbcClientPortRowStatus=hwBrasSbcClientPortRowStatus, hwBrasSbcMGSofxAddrIP1=hwBrasSbcMGSofxAddrIP1, hwBrasSbcIadmsSignalMapTable=hwBrasSbcIadmsSignalMapTable, hwBrasSbcSoftswitchPortEntry=hwBrasSbcSoftswitchPortEntry, hwBrasSbcUdpTunnelPoolStartIP=hwBrasSbcUdpTunnelPoolStartIP, hwBrasSbcH248IntercomMapSignalEntry=hwBrasSbcH248IntercomMapSignalEntry, hwBrasSbcUpathIntercomMapSignalNumber=hwBrasSbcUpathIntercomMapSignalNumber, hwBrasSbcIadmsSignalMapNumber=hwBrasSbcIadmsSignalMapNumber, hwBrasSbcMgcpSignalMapEntry=hwBrasSbcMgcpSignalMapEntry, hwBrasSbcH248WellknownPortTable=hwBrasSbcH248WellknownPortTable, hwBrasSbcImsMGMidString=hwBrasSbcImsMGMidString, hwBrasSbcIadmsTimer=hwBrasSbcIadmsTimer, hwBrasSbcRoamlimitAclNumber=hwBrasSbcRoamlimitAclNumber, hwBrasSbcSessionCarEnable=hwBrasSbcSessionCarEnable, hwBrasSbcH248MediaMapTable=hwBrasSbcH248MediaMapTable, hwBrasSbcSoftswitchPortRowStatus=hwBrasSbcSoftswitchPortRowStatus, hwBrasSbcBWLimitType=hwBrasSbcBWLimitType, hwBrasSbcClientPortPort01=hwBrasSbcClientPortPort01, hwBrasSbcMGIadmsAddrVPN=hwBrasSbcMGIadmsAddrVPN, hwBrasSbcImsMGIPType=hwBrasSbcImsMGIPType, hwBrasSbcSessionCarRuleRowStatus=hwBrasSbcSessionCarRuleRowStatus, hwBrasSbcMgcpWellknownPortEntry=hwBrasSbcMgcpWellknownPortEntry, hwBrasSbcDHLeaves=hwBrasSbcDHLeaves, hwBrasSbcSessionCarTables=hwBrasSbcSessionCarTables, hwBrasSbcSessionCarRuleEntry=hwBrasSbcSessionCarRuleEntry, hwBrasSbcMDStatus=hwBrasSbcMDStatus, hwBrasSbcClientPortPort11=hwBrasSbcClientPortPort11, hwBrasSbcUdpTunnelPortEntry=hwBrasSbcUdpTunnelPortEntry, hwBrasSbcImsBandIfName=hwBrasSbcImsBandIfName, hwBrasSbcH248StatSignalPacketIndex=hwBrasSbcH248StatSignalPacketIndex, hwBrasSbcImsMGIPPort=hwBrasSbcImsMGIPPort, hwBrasSbcUsergroupRuleTable=hwBrasSbcUsergroupRuleTable, hwBrasSbcMGPrefixIndex=hwBrasSbcMGPrefixIndex, hwBrasSbcRestartButton=hwBrasSbcRestartButton, hwBrasSbcSipWellknownPortProtocol=hwBrasSbcSipWellknownPortProtocol, hwBrasSbcMGProtocolRowStatus=hwBrasSbcMGProtocolRowStatus, hwBrasSbcGeneral=hwBrasSbcGeneral, hwBrasSbcCacCallRateEntry=hwBrasSbcCacCallRateEntry, hwBrasSbcH323CallsessionTimer=hwBrasSbcH323CallsessionTimer, hwBrasSbcUpathWellknownPortRowStatus=hwBrasSbcUpathWellknownPortRowStatus, hwBrasSbcStatisticValue=hwBrasSbcStatisticValue, hwBrasSbcIPCarBWVpn=hwBrasSbcIPCarBWVpn, hwBrasSbcIaLinkUp=hwBrasSbcIaLinkUp, hwBrasSbcNotificationGroups=hwBrasSbcNotificationGroups, hwBrasSbcOmLeaves=hwBrasSbcOmLeaves, hwBrasSbcClientPortPort08=hwBrasSbcClientPortPort08, hwBrasSbcMGMdCliAddrIP4=hwBrasSbcMGMdCliAddrIP4, hwBrasSbcH248IntercomMapSignalTable=hwBrasSbcH248IntercomMapSignalTable, hwBrasSbcCacCallTotalPercent=hwBrasSbcCacCallTotalPercent, hwBrasSbcIdoStatSignalPacketOutNumber=hwBrasSbcIdoStatSignalPacketOutNumber, hwBrasSbcH323WellknownPortTable=hwBrasSbcH323WellknownPortTable, hwBrasSbcMGServAddrVPN=hwBrasSbcMGServAddrVPN, hwBrasSbcIntercomPrefixRowStatus=hwBrasSbcIntercomPrefixRowStatus, hwBrasSbcMGCliAddrTable=hwBrasSbcMGCliAddrTable, hwBrasSbcMgcpSignalMapAddrType=hwBrasSbcMgcpSignalMapAddrType, hwBrasSbcMGPrefixID=hwBrasSbcMGPrefixID, hwBrasSbcIadmsSignalMapEntry=hwBrasSbcIadmsSignalMapEntry, hwBrasSbcAdmModuleTable=hwBrasSbcAdmModuleTable, hwBrasSbcMapGroupSessionLimit=hwBrasSbcMapGroupSessionLimit, hwBrasSbcIms=hwBrasSbcIms, hwBrasSbcH248IntercomMapSignalProtocol=hwBrasSbcH248IntercomMapSignalProtocol, hwBrasSbcIadmsWellknownPortPort=hwBrasSbcIadmsWellknownPortPort, hwBrasSbcCpuUsage=hwBrasSbcCpuUsage, hwBrasSbcPortrangeIndex=hwBrasSbcPortrangeIndex, hwBrasSbcImsStatisticsEnable=hwBrasSbcImsStatisticsEnable, hwBrasSbcH248WellknownPortProtocol=hwBrasSbcH248WellknownPortProtocol, hwBrasSbcIntercomPrefixIndex=hwBrasSbcIntercomPrefixIndex, hwBrasSbcImsMgLogEnable=hwBrasSbcImsMgLogEnable, hwBrasSbcIadmsMibRegRowStatus=hwBrasSbcIadmsMibRegRowStatus, hwBrasSbcIadmsStatSignalPacketOutNumber=hwBrasSbcIadmsStatSignalPacketOutNumber, hwBrasSbcIdoWellknownPortIndex=hwBrasSbcIdoWellknownPortIndex, hwBrasSbcIadmsWellknownPortIndex=hwBrasSbcIadmsWellknownPortIndex, hwBrasSbcImsSessDelete=hwBrasSbcImsSessDelete, hwBrasSbcSipIntercomMapSignalAddr=hwBrasSbcSipIntercomMapSignalAddr, hwBrasSbcClientPortPort09=hwBrasSbcClientPortPort09, hwBrasSbcSecurityLeaves=hwBrasSbcSecurityLeaves, hwBrasSbcSoftswitchPortIP=hwBrasSbcSoftswitchPortIP, hwBrasSbcImsConnectPepID=hwBrasSbcImsConnectPepID, hwBrasSbcMGMdCliAddrEntry=hwBrasSbcMGMdCliAddrEntry, hwBrasSbcUmsVersion=hwBrasSbcUmsVersion, hwBrasSbcUpathIntercomMapMediaProtocol=hwBrasSbcUpathIntercomMapMediaProtocol, hwBrasSbcImsMGAgingTimer=hwBrasSbcImsMGAgingTimer, hwBrasSbcIntMediaPassEnable=hwBrasSbcIntMediaPassEnable, hwBrasSbcH323StatSignalPacketEntry=hwBrasSbcH323StatSignalPacketEntry, hwBrasSbcImsBandEntry=hwBrasSbcImsBandEntry, hwBrasSbcUpathWellknownPortTable=hwBrasSbcUpathWellknownPortTable, hwBrasSbcBaseTables=hwBrasSbcBaseTables, hwBrasSbcMGServAddrIP2=hwBrasSbcMGServAddrIP2, hwBrasSbcMGMdCliAddrTable=hwBrasSbcMGMdCliAddrTable, hwBrasSbcSecurityTables=hwBrasSbcSecurityTables, hwBrasSbcSessionCarRuleDegreeID=hwBrasSbcSessionCarRuleDegreeID, hwBrasSbcMGIadmsAddrIP4=hwBrasSbcMGIadmsAddrIP4, hwBrasSbcMDStatisticRowStatus=hwBrasSbcMDStatisticRowStatus, hwBrasSbcIadmsStatSignalPacketRowStatus=hwBrasSbcIadmsStatSignalPacketRowStatus, hwBrasSbcTrapInfoSignalingFlood=hwBrasSbcTrapInfoSignalingFlood, hwBrasSbcMGMdCliAddrSlotID2=hwBrasSbcMGMdCliAddrSlotID2, hwBrasSbcMgcpStatSignalPacketInOctet=hwBrasSbcMgcpStatSignalPacketInOctet, hwBrasSbcH323StatSignalPacketOutNumber=hwBrasSbcH323StatSignalPacketOutNumber, hwBrasSbcUsergroupRuleEntry=hwBrasSbcUsergroupRuleEntry, hwBrasSbcH323WellknownPortEntry=hwBrasSbcH323WellknownPortEntry, hwBrasSbcUdpTunnelLeaves=hwBrasSbcUdpTunnelLeaves, hwBrasSbcImsConnectEntry=hwBrasSbcImsConnectEntry, hwBrasSbcSipIntercomMapSignalEntry=hwBrasSbcSipIntercomMapSignalEntry, hwBrasSbcTrapBindTable=hwBrasSbcTrapBindTable, hwBrasSbcMGMatchIndex=hwBrasSbcMGMatchIndex, hwBrasSbcMGSofxAddrVPN=hwBrasSbcMGSofxAddrVPN, hwBrasSbcClientPortPort10=hwBrasSbcClientPortPort10, hwBrasSbcMGMdCliAddrSlotID1=hwBrasSbcMGMdCliAddrSlotID1, hwBrasSbcTrapBindTime=hwBrasSbcTrapBindTime, hwBrasSbcIadmsStatSignalPacketIndex=hwBrasSbcIadmsStatSignalPacketIndex, hwBrasSbcSessionCarLeaves=hwBrasSbcSessionCarLeaves, hwBrasSbcImsConnectServPort=hwBrasSbcImsConnectServPort, hwBrasSbcMDLengthIndex=hwBrasSbcMDLengthIndex, hwBrasSbcH323WellknownPortPort=hwBrasSbcH323WellknownPortPort, hwBrasSbcClientPortPort15=hwBrasSbcClientPortPort15, hwBrasSbcIadmsStatSignalPacketInNumber=hwBrasSbcIadmsStatSignalPacketInNumber, hwBrasSbcIadmsWellknownPortRowStatus=hwBrasSbcIadmsWellknownPortRowStatus, hwBrasSbcCpu=hwBrasSbcCpu, hwBrasSbcImsRptDrq=hwBrasSbcImsRptDrq, hwBrasSbcIadmsMediaMapProtocol=hwBrasSbcIadmsMediaMapProtocol, hwBrasSbcMGMdServAddrIf4=hwBrasSbcMGMdServAddrIf4, hwBrasSbcImsMGIPAddr=hwBrasSbcImsMGIPAddr, hwBrasSbcMediaUsersEntry=hwBrasSbcMediaUsersEntry, hwBrasSbcSessionCarDegreeEntry=hwBrasSbcSessionCarDegreeEntry, hwBrasSbcSipStatSignalPacketRowStatus=hwBrasSbcSipStatSignalPacketRowStatus, hwBrasSbcIadmsSignalMapAddrType=hwBrasSbcIadmsSignalMapAddrType, hwBrasSbcH323StatSignalPacketIndex=hwBrasSbcH323StatSignalPacketIndex, hwBrasSbcMediaAddrMapTable=hwBrasSbcMediaAddrMapTable, hwBrasSbcMGMdCliAddrIP2=hwBrasSbcMGMdCliAddrIP2, hwBrasSbcIdoStatSignalPacketRowStatus=hwBrasSbcIdoStatSignalPacketRowStatus, hwBrasSbcImsBandIfType=hwBrasSbcImsBandIfType, hwBrasSbcMGMdServAddrIndex=hwBrasSbcMGMdServAddrIndex, hwBrasSbcMgcp=hwBrasSbcMgcp, hwBrasSbcSignalingFloodNormal=hwBrasSbcSignalingFloodNormal, hwBrasSbcMgcpIntercomMapMediaTable=hwBrasSbcMgcpIntercomMapMediaTable, hwBrasSbcMGServAddrIP3=hwBrasSbcMGServAddrIP3, hwBrasSbcSecurity=hwBrasSbcSecurity, hwBrasSbcMGMatchTable=hwBrasSbcMGMatchTable, hwNatAddrGrpIndex=hwNatAddrGrpIndex, hwBrasSbcIdoEnable=hwBrasSbcIdoEnable, hwBrasSbcIadmsLeaves=hwBrasSbcIadmsLeaves, hwBrasSbcImsQosEnable=hwBrasSbcImsQosEnable, hwBrasSbcLocalizationStatus=hwBrasSbcLocalizationStatus, hwBrasSbcUpathStatSignalPacketInOctet=hwBrasSbcUpathStatSignalPacketInOctet, hwBrasSbcRoamlimitIndex=hwBrasSbcRoamlimitIndex, hwBrasSbcTrapInfoCpu=hwBrasSbcTrapInfoCpu, hwBrasSbcQoSReport=hwBrasSbcQoSReport, hwBrasSbcSipSignalMapEntry=hwBrasSbcSipSignalMapEntry, hwBrasSbcSipStatSignalPacketInNumber=hwBrasSbcSipStatSignalPacketInNumber, hwBrasSbcH248MediaMapEntry=hwBrasSbcH248MediaMapEntry, hwNatAddrGrpRefCount=hwNatAddrGrpRefCount, hwBrasSbcTrapBindType=hwBrasSbcTrapBindType, hwBrasSbcDHSIPDetectSourcePort=hwBrasSbcDHSIPDetectSourcePort, hwBrasSbcUpathWellknownPortProtocol=hwBrasSbcUpathWellknownPortProtocol, hwBrasSbcDefendUserConnectRateRowStatus=hwBrasSbcDefendUserConnectRateRowStatus, hwBrasSbcMGSofxAddrTable=hwBrasSbcMGSofxAddrTable, hwBrasSbcDefendUserConnectRatePercent=hwBrasSbcDefendUserConnectRatePercent, hwBrasSbcClientPortPort06=hwBrasSbcClientPortPort06, hwBrasSbcRoamlimitTable=hwBrasSbcRoamlimitTable, hwBrasSbcStatisticTime=hwBrasSbcStatisticTime, hwBrasSbcClientPortPort14=hwBrasSbcClientPortPort14, hwBrasSbcIadmsMediaMapNumber=hwBrasSbcIadmsMediaMapNumber, hwBrasSbcClientPortEntry=hwBrasSbcClientPortEntry, hwBrasSbcMGServAddrIndex=hwBrasSbcMGServAddrIndex, hwBrasSbcUdpTunnelTransportTimer=hwBrasSbcUdpTunnelTransportTimer, hwBrasSbcNatCfgEntry=hwBrasSbcNatCfgEntry, hwBrasSbcStatisticDesc=hwBrasSbcStatisticDesc, hwBrasSbcSoftswitchPortPort=hwBrasSbcSoftswitchPortPort, hwBrasSbcIdoIntercomMapSignalProtocol=hwBrasSbcIdoIntercomMapSignalProtocol, hwBrasSbcUpathLeaves=hwBrasSbcUpathLeaves, hwBrasSbcMapGroupsTable=hwBrasSbcMapGroupsTable, hwBrasSbcMGIadmsAddrIP2=hwBrasSbcMGIadmsAddrIP2, hwBrasSbcSipRegReduceTimer=hwBrasSbcSipRegReduceTimer, hwBrasSbcMediaDetectPacketLength=hwBrasSbcMediaDetectPacketLength, hwBrasSbcMediaUsersCallerID2=hwBrasSbcMediaUsersCallerID2, hwBrasSbcUsergroupRuleIndex=hwBrasSbcUsergroupRuleIndex, hwBrasSbcRtpSpecialAddrTable=hwBrasSbcRtpSpecialAddrTable, hwBrasSbcCacRegRateProtocol=hwBrasSbcCacRegRateProtocol, hwBrasSbcSipWellknownPortTable=hwBrasSbcSipWellknownPortTable, hwBrasSbcIadmsSyslogEnable=hwBrasSbcIadmsSyslogEnable, hwBrasSbcIadmsIntercomMapSignalProtocol=hwBrasSbcIadmsIntercomMapSignalProtocol, hwBrasSbcH248SignalMapProtocol=hwBrasSbcH248SignalMapProtocol, hwBrasSbcMGServAddrTable=hwBrasSbcMGServAddrTable, hwBrasSbcUdpTunnelPoolEndIP=hwBrasSbcUdpTunnelPoolEndIP, hwBrasSbcSipIntercomMapMediaNumber=hwBrasSbcSipIntercomMapMediaNumber, hwBrasSbcMGSofxAddrIP2=hwBrasSbcMGSofxAddrIP2, hwBrasSbcMgcpIntercomMapMediaNumber=hwBrasSbcMgcpIntercomMapMediaNumber, hwBrasSbcStatMediaPacketTable=hwBrasSbcStatMediaPacketTable, hwBrasSbcSignalingFlood=hwBrasSbcSignalingFlood, hwBrasSbcH323PDHCountLimit=hwBrasSbcH323PDHCountLimit, hwBrasSbcMGMdCliAddrSlotID3=hwBrasSbcMGMdCliAddrSlotID3, hwBrasSbcDefendActionLogEnable=hwBrasSbcDefendActionLogEnable, hwBrasSbcBackupGroupEntry=hwBrasSbcBackupGroupEntry, hwBrasSbcH323WellknownPortIndex=hwBrasSbcH323WellknownPortIndex, hwBrasSbcSoftswitchPortVPN=hwBrasSbcSoftswitchPortVPN, hwBrasSbcClientPortTable=hwBrasSbcClientPortTable, hwBrasSbcH248StatSignalPacketInNumber=hwBrasSbcH248StatSignalPacketInNumber, hwBrasSbcTrapBindReason=hwBrasSbcTrapBindReason, hwBrasSbcImsSessCreate=hwBrasSbcImsSessCreate, hwBrasSbcPortrangeBegin=hwBrasSbcPortrangeBegin, hwBrasSbcMgcpStatSignalPacketOutOctet=hwBrasSbcMgcpStatSignalPacketOutOctet, hwBrasSbcH323SignalMapAddr=hwBrasSbcH323SignalMapAddr, hwBrasSbcIaLinkDown=hwBrasSbcIaLinkDown, hwBrasSbcMediaPassIndex=hwBrasSbcMediaPassIndex, hwBrasSbcUsergroupRuleUserName=hwBrasSbcUsergroupRuleUserName, hwBrasSbcMGMdServAddrIP4=hwBrasSbcMGMdServAddrIP4, hwBrasSbcMgcpPDHCountLimit=hwBrasSbcMgcpPDHCountLimit, hwBrasSbcSipLeaves=hwBrasSbcSipLeaves, hwBrasSbcTrapInfoTable=hwBrasSbcTrapInfoTable, hwBrasSbcUdpTunnelTables=hwBrasSbcUdpTunnelTables, hwBrasSbcSctpStatus=hwBrasSbcSctpStatus, hwBrasSbcImsMGDescription=hwBrasSbcImsMGDescription, hwBrasSbcH323MediaMapEntry=hwBrasSbcH323MediaMapEntry, hwBrasSbcClientPortIP=hwBrasSbcClientPortIP, hwBrasSbcMGMdCliAddrIf4=hwBrasSbcMGMdCliAddrIf4, hwBrasSbcSipIntercomMapMediaEntry=hwBrasSbcSipIntercomMapMediaEntry, hwBrasSbcIadmsIntercomMapSignalTable=hwBrasSbcIadmsIntercomMapSignalTable, hwBrasSbcH248WellknownPortRowStatus=hwBrasSbcH248WellknownPortRowStatus, hwBrasSbcNotificationGroup=hwBrasSbcNotificationGroup, hwBrasSbcCacCallTotalTable=hwBrasSbcCacCallTotalTable, hwBrasSbcSipWellknownPortIndex=hwBrasSbcSipWellknownPortIndex, hwBrasSbcSipMediaMapAddr=hwBrasSbcSipMediaMapAddr, hwBrasSbcH323MediaMapAddr=hwBrasSbcH323MediaMapAddr, hwBrasSbcUpathStatSignalPacketTable=hwBrasSbcUpathStatSignalPacketTable, hwBrasSbcUdpTunnel=hwBrasSbcUdpTunnel, hwBrasSbcMGPortRowStatus=hwBrasSbcMGPortRowStatus, hwBrasSbcDefendUserConnectRateThreshold=hwBrasSbcDefendUserConnectRateThreshold, hwBrasSbcImsConnectCliIP=hwBrasSbcImsConnectCliIP)
mibBuilder.exportSymbols("HUAWEI-BRAS-SBC-MIB", hwBrasSbcMediaDefendTables=hwBrasSbcMediaDefendTables, hwBrasSbcH323IntercomMapSignalEntry=hwBrasSbcH323IntercomMapSignalEntry, hwBrasSbcMGProtocolEntry=hwBrasSbcMGProtocolEntry, hwBrasSbcH248IntercomMapSignalAddr=hwBrasSbcH248IntercomMapSignalAddr, hwBrasSbcComformance=hwBrasSbcComformance, hwBrasSbcMgcpSignalMapNumber=hwBrasSbcMgcpSignalMapNumber, hwBrasSbcImsQosLogEnable=hwBrasSbcImsQosLogEnable, hwBrasSbcImsMGCallSessionTimer=hwBrasSbcImsMGCallSessionTimer, hwBrasSbcMgcpIntercomMapSignalAddr=hwBrasSbcMgcpIntercomMapSignalAddr, hwBrasSbcSipIntercomMapSignalProtocol=hwBrasSbcSipIntercomMapSignalProtocol, hwBrasSbcMediaDetectStatus=hwBrasSbcMediaDetectStatus, hwBrasSbcIntercomPrefixTable=hwBrasSbcIntercomPrefixTable, hwBrasSbcSipAnonymity=hwBrasSbcSipAnonymity, hwBrasSbcSignalingCarStatus=hwBrasSbcSignalingCarStatus, hwBrasSbcMGSofxAddrIndex=hwBrasSbcMGSofxAddrIndex, hwBrasSbcMDStatisticFlowDrop=hwBrasSbcMDStatisticFlowDrop, hwBrasSbcIadmsWellknownPortTable=hwBrasSbcIadmsWellknownPortTable, hwBrasSbcCacCallTotalThreshold=hwBrasSbcCacCallTotalThreshold, hwBrasSbcImsMGIPSN=hwBrasSbcImsMGIPSN, hwBrasSbcSipStatSignalPacketOutNumber=hwBrasSbcSipStatSignalPacketOutNumber, hwBrasSbcCacCallRateThreshold=hwBrasSbcCacCallRateThreshold, hwBrasSbcIPCarBWRowStatus=hwBrasSbcIPCarBWRowStatus, hwBrasSbcSipMediaMapProtocol=hwBrasSbcSipMediaMapProtocol, hwBrasSbcRoamlimitEntry=hwBrasSbcRoamlimitEntry, hwBrasSbcMgcpCcbTimer=hwBrasSbcMgcpCcbTimer, hwBrasSbcImsConnectIndex=hwBrasSbcImsConnectIndex, hwBrasSbcQRLeaves=hwBrasSbcQRLeaves, hwBrasSbcMgcpIntercomMapSignalProtocol=hwBrasSbcMgcpIntercomMapSignalProtocol, hwBrasSbcUdpTunnelIfPortAddr=hwBrasSbcUdpTunnelIfPortAddr, hwBrasSbcMGPortNumber=hwBrasSbcMGPortNumber, hwBrasSbcRoamlimitSyslogEnable=hwBrasSbcRoamlimitSyslogEnable, hwBrasSbcH248IntercomMapMediaTable=hwBrasSbcH248IntercomMapMediaTable, hwBrasSbcUpathSignalMapEntry=hwBrasSbcUpathSignalMapEntry, hwBrasSbcMDLengthMin=hwBrasSbcMDLengthMin, hwBrasSbcSignalingNatTables=hwBrasSbcSignalingNatTables, hwBrasSbcMgcpStatSignalPacketOutNumber=hwBrasSbcMgcpStatSignalPacketOutNumber, hwBrasSbcStatMediaPacketIndex=hwBrasSbcStatMediaPacketIndex, hwBrasSbcH248Leaves=hwBrasSbcH248Leaves, hwBrasSbcTrapBind=hwBrasSbcTrapBind, hwBrasSbcImsBandRowStatus=hwBrasSbcImsBandRowStatus, hwBrasSbcIdoWellknownPortAddr=hwBrasSbcIdoWellknownPortAddr, hwBrasSbcIadmsPortEntry=hwBrasSbcIadmsPortEntry, hwBrasSbcIadmsMediaMapEntry=hwBrasSbcIadmsMediaMapEntry, HWBrasPermitStatus=HWBrasPermitStatus, hwBrasSbcMGMdCliAddrRowStatus=hwBrasSbcMGMdCliAddrRowStatus, hwBrasSbcDHSIPDetectFailCount=hwBrasSbcDHSIPDetectFailCount, hwBrasSbcSignalAddrMapSoftAddr=hwBrasSbcSignalAddrMapSoftAddr, hwBrasSbcImsMGProtocol=hwBrasSbcImsMGProtocol, hwBrasSbcH323SignalMapEntry=hwBrasSbcH323SignalMapEntry, hwBrasSbcBackupGroupID=hwBrasSbcBackupGroupID, hwBrasSbcMgcpStatSignalPacketRowStatus=hwBrasSbcMgcpStatSignalPacketRowStatus, hwBrasSbcMGProtocolSip=hwBrasSbcMGProtocolSip, hwBrasSbcIdoStatSignalPacketOutOctet=hwBrasSbcIdoStatSignalPacketOutOctet, hwBrasSbcSlotInforRowStatus=hwBrasSbcSlotInforRowStatus, hwBrasSbcH323IntercomMapSignalAddr=hwBrasSbcH323IntercomMapSignalAddr, hwBrasSbcIdoIntercomMapSignalEntry=hwBrasSbcIdoIntercomMapSignalEntry, hwBrasSbcMediaPassEnable=hwBrasSbcMediaPassEnable, hwNatAddrGrpEndingIpAddr=hwNatAddrGrpEndingIpAddr, hwBrasSbcDefendConnectRateEntry=hwBrasSbcDefendConnectRateEntry, hwBrasSbcH248IntercomMapMediaProtocol=hwBrasSbcH248IntercomMapMediaProtocol, hwBrasSbcIntercomStatus=hwBrasSbcIntercomStatus, hwBrasSbcMGCliAddrRowStatus=hwBrasSbcMGCliAddrRowStatus, hwBrasSbcImsActiveTable=hwBrasSbcImsActiveTable, hwBrasSbcImsMGDomainEntry=hwBrasSbcImsMGDomainEntry, hwBrasSbcSipStatSignalPacketEntry=hwBrasSbcSipStatSignalPacketEntry, hwBrasSbcMgcpWellknownPortPort=hwBrasSbcMgcpWellknownPortPort, hwBrasSbcDefendConnectRateThreshold=hwBrasSbcDefendConnectRateThreshold, hwBrasSbcH323Q931WellknownPort=hwBrasSbcH323Q931WellknownPort, hwBrasSbcUpathHeartbeatTimer=hwBrasSbcUpathHeartbeatTimer, hwBrasSbcH248SignalMapNumber=hwBrasSbcH248SignalMapNumber, hwBrasSbcH323SyslogEnable=hwBrasSbcH323SyslogEnable, hwBrasSbcTimerMediaAging=hwBrasSbcTimerMediaAging, hwBrasSbcH323IntercomMapSignalProtocol=hwBrasSbcH323IntercomMapSignalProtocol, hwBrasSbcH248WellknownPortPort=hwBrasSbcH248WellknownPortPort, hwBrasSbcH248IntercomMapMediaAddr=hwBrasSbcH248IntercomMapMediaAddr, hwBrasSbcSignalAddrMapServerAddr=hwBrasSbcSignalAddrMapServerAddr, hwBrasSbcH323MediaMapNumber=hwBrasSbcH323MediaMapNumber, hwBrasSbcNatAddressGroupTable=hwBrasSbcNatAddressGroupTable, hwBrasSbcTrapInfoImsConID=hwBrasSbcTrapInfoImsConID, hwBrasSbcMGCliAddrIP=hwBrasSbcMGCliAddrIP, hwBrasSbcH248SignalMapAddrType=hwBrasSbcH248SignalMapAddrType, hwBrasSbcMGIadmsAddrIndex=hwBrasSbcMGIadmsAddrIndex, hwBrasSbcTrapInfoIndex=hwBrasSbcTrapInfoIndex, hwBrasSbcMDStatisticMaxDrop=hwBrasSbcMDStatisticMaxDrop, hwBrasSbcAppMode=hwBrasSbcAppMode, hwBrasSbcSignalingNatLeaves=hwBrasSbcSignalingNatLeaves, hwBrasSbcImsMGTable=hwBrasSbcImsMGTable, hwBrasSbcBackupGroupTable=hwBrasSbcBackupGroupTable, hwBrasSbcMDLengthEntry=hwBrasSbcMDLengthEntry, hwBrasSbcRestartEnable=hwBrasSbcRestartEnable, hwBrasSbcPatchLoadStatus=hwBrasSbcPatchLoadStatus, hwBrasSbcMediaPassRowStatus=hwBrasSbcMediaPassRowStatus, hwBrasSbcIadmsRegRefreshEnable=hwBrasSbcIadmsRegRefreshEnable, hwBrasSbcMgcpMediaMapAddr=hwBrasSbcMgcpMediaMapAddr, hwBrasSbcSlotInforTable=hwBrasSbcSlotInforTable, hwBrasSbcUdpTunnelIfPortEntry=hwBrasSbcUdpTunnelIfPortEntry, hwBrasSbcIadmsStatSignalPacketEntry=hwBrasSbcIadmsStatSignalPacketEntry, PYSNMP_MODULE_ID=hwBrasSbcMgmt, hwBrasSbcSessionCarDegreeBandWidth=hwBrasSbcSessionCarDegreeBandWidth, hwBrasSbcUpathTables=hwBrasSbcUpathTables, hwBrasSbcIadmsStatSignalPacketOutOctet=hwBrasSbcIadmsStatSignalPacketOutOctet, hwBrasSbcSipWellknownPortAddr=hwBrasSbcSipWellknownPortAddr, hwBrasSbcMgcpWellknownPortTable=hwBrasSbcMgcpWellknownPortTable, hwNatAddrGrpRowstatus=hwNatAddrGrpRowstatus, hwBrasSbcIadmsStatSignalPacketInOctet=hwBrasSbcIadmsStatSignalPacketInOctet, hwBrasSbcUpath=hwBrasSbcUpath, hwBrasSbcSipWellknownPortRowStatus=hwBrasSbcSipWellknownPortRowStatus, hwBrasSbcClientPortPort12=hwBrasSbcClientPortPort12, hwBrasSbcDefendUserConnectRateProtocol=hwBrasSbcDefendUserConnectRateProtocol, hwBrasSbcMGMdCliAddrVPNName=hwBrasSbcMGMdCliAddrVPNName, hwBrasSbcIntercomPrefixDestAddr=hwBrasSbcIntercomPrefixDestAddr, hwBrasSbcSoftswitchPortProtocol=hwBrasSbcSoftswitchPortProtocol, hwBrasSbcMediaAddrMapServerAddr=hwBrasSbcMediaAddrMapServerAddr, hwBrasSbcMgcpIntercomMapSignalEntry=hwBrasSbcMgcpIntercomMapSignalEntry, hwBrasSbcH248MediaMapAddr=hwBrasSbcH248MediaMapAddr, hwBrasSbcOm=hwBrasSbcOm, hwBrasSbcIdlecutRtpTimer=hwBrasSbcIdlecutRtpTimer, hwBrasSbcUpathCallsessionTimer=hwBrasSbcUpathCallsessionTimer, hwBrasSbcHrp=hwBrasSbcHrp, hwBrasSbcQRStatus=hwBrasSbcQRStatus, hwBrasSbcUpathSignalMapProtocol=hwBrasSbcUpathSignalMapProtocol, hwBrasSbcH248WellknownPortIndex=hwBrasSbcH248WellknownPortIndex, hwBrasSbcMGPortEntry=hwBrasSbcMGPortEntry, hwBrasSbcMapGroup=hwBrasSbcMapGroup, hwBrasSbcDefendUserConnectRateEntry=hwBrasSbcDefendUserConnectRateEntry, hwBrasSbcImsMGIPRowStatus=hwBrasSbcImsMGIPRowStatus, hwBrasSbcUpathSignalMapNumber=hwBrasSbcUpathSignalMapNumber, hwBrasSbcH323WellknownPortRowStatus=hwBrasSbcH323WellknownPortRowStatus, hwBrasSbcSessionCarRuleName=hwBrasSbcSessionCarRuleName, hwBrasSbcUdpTunnelIfPortPort=hwBrasSbcUdpTunnelIfPortPort, hwBrasSbcIPCarBWAddress=hwBrasSbcIPCarBWAddress, hwBrasSbcH248=hwBrasSbcH248, hwBrasSbcUpathStatSignalPacketIndex=hwBrasSbcUpathStatSignalPacketIndex, hwBrasSbcCacRegRateEntry=hwBrasSbcCacRegRateEntry, hwBrasSbcViewLeaves=hwBrasSbcViewLeaves, hwBrasSbcH323StatSignalPacketRowStatus=hwBrasSbcH323StatSignalPacketRowStatus, hwBrasSbcIdoStatSignalPacketInNumber=hwBrasSbcIdoStatSignalPacketInNumber, hwBrasSbcMediaUsersTable=hwBrasSbcMediaUsersTable, hwBrasSbcH323SignalMapProtocol=hwBrasSbcH323SignalMapProtocol, hwBrasSbcH248SignalMapEntry=hwBrasSbcH248SignalMapEntry, hwBrasSbcSignalAddrMapEntry=hwBrasSbcSignalAddrMapEntry, hwBrasSbcUpathSignalMapAddrType=hwBrasSbcUpathSignalMapAddrType, hwBrasSbcUpathMediaMapTable=hwBrasSbcUpathMediaMapTable, hwBrasSbcH248PDHCountLimit=hwBrasSbcH248PDHCountLimit, hwBrasSbcNotification=hwBrasSbcNotification, hwBrasSbcCac=hwBrasSbcCac, hwBrasSbcCurrentSlotID=hwBrasSbcCurrentSlotID, hwBrasSbcBandwidthLimit=hwBrasSbcBandwidthLimit, hwBrasSbcUpathStatSignalPacketOutOctet=hwBrasSbcUpathStatSignalPacketOutOctet, hwBrasSbcIdoSignalMapTable=hwBrasSbcIdoSignalMapTable, hwBrasSbcUdpTunnelType=hwBrasSbcUdpTunnelType, hwBrasSbcMediaAddrMapWeight=hwBrasSbcMediaAddrMapWeight, hwBrasSbcMGMdCliAddrIf3=hwBrasSbcMGMdCliAddrIf3, hwBrasSbcH323IntercomMapMediaAddr=hwBrasSbcH323IntercomMapMediaAddr, hwBrasSbcH248IntercomMapMediaEntry=hwBrasSbcH248IntercomMapMediaEntry, hwBrasSbcUpathIntercomMapMediaAddr=hwBrasSbcUpathIntercomMapMediaAddr, hwNatAddrGrpBeginningIpAddr=hwNatAddrGrpBeginningIpAddr, hwBrasSbcNatVpnNameIndex=hwBrasSbcNatVpnNameIndex, hwBrasSbcMgcpMediaMapTable=hwBrasSbcMgcpMediaMapTable, hwBrasSbcImsMediaProxyEnable=hwBrasSbcImsMediaProxyEnable, hwBrasSbcImsActiveRowStatus=hwBrasSbcImsActiveRowStatus, hwBrasSbcCacRegTotalPercent=hwBrasSbcCacRegTotalPercent, hwBrasSbcH323SignalMapAddrType=hwBrasSbcH323SignalMapAddrType, hwBrasSbcMGIadmsAddrIP1=hwBrasSbcMGIadmsAddrIP1, HWBrasSbcBaseProtocol=HWBrasSbcBaseProtocol, hwBrasSbcUsergroupTable=hwBrasSbcUsergroupTable, hwBrasSbcMGServAddrEntry=hwBrasSbcMGServAddrEntry, hwBrasSbcMgcpWellknownPortAddr=hwBrasSbcMgcpWellknownPortAddr, hwBrasSbcClientPortPort04=hwBrasSbcClientPortPort04, hwBrasSbcSipSignalMapAddrType=hwBrasSbcSipSignalMapAddrType, hwBrasSbcIdoWellknownPortPort=hwBrasSbcIdoWellknownPortPort, hwBrasSbcImsMGDomainType=hwBrasSbcImsMGDomainType, hwBrasSbcMgcpStatSignalPacketInNumber=hwBrasSbcMgcpStatSignalPacketInNumber, hwBrasSbcMediaPassTable=hwBrasSbcMediaPassTable, hwBrasSbcSessionCarRuleID=hwBrasSbcSessionCarRuleID, hwBrasSbcImsMGIPEntry=hwBrasSbcImsMGIPEntry, hwBrasSbcBaseLeaves=hwBrasSbcBaseLeaves, hwBrasSbcMediaUsersCalleeID3=hwBrasSbcMediaUsersCalleeID3, hwBrasSbcIdoWellknownPortProtocol=hwBrasSbcIdoWellknownPortProtocol, hwBrasSbcMgcpEnable=hwBrasSbcMgcpEnable, hwBrasSbcSipCheckheartEnable=hwBrasSbcSipCheckheartEnable, hwBrasSbcMediaDetectSsrcEnable=hwBrasSbcMediaDetectSsrcEnable, hwBrasSbcMediaUsersType=hwBrasSbcMediaUsersType, HwBrasAppMode=HwBrasAppMode, hwBrasSbcCacRegTotalEntry=hwBrasSbcCacRegTotalEntry, hwBrasSbcMDStatisticFragDrop=hwBrasSbcMDStatisticFragDrop, hwBrasSbcIdoSyslogEnable=hwBrasSbcIdoSyslogEnable, hwBrasSbcOmTables=hwBrasSbcOmTables, hwBrasSbcH323IntercomMapMediaEntry=hwBrasSbcH323IntercomMapMediaEntry, hwBrasSbcIntercomPrefixEntry=hwBrasSbcIntercomPrefixEntry, hwBrasSbcMGIadmsAddrIP3=hwBrasSbcMGIadmsAddrIP3, hwBrasSbcSipIntercomMapMediaTable=hwBrasSbcSipIntercomMapMediaTable, hwBrasSbcTrapBindTables=hwBrasSbcTrapBindTables, hwBrasSbcUpathIntercomMapMediaEntry=hwBrasSbcUpathIntercomMapMediaEntry, hwBrasSbcIadmsPortPort=hwBrasSbcIadmsPortPort, hwBrasSbcCacCallTotalEntry=hwBrasSbcCacCallTotalEntry, hwBrasSbcSignalAddrMapIadmsAddr=hwBrasSbcSignalAddrMapIadmsAddr, hwBrasSbcUdpTunnelSctpAddr=hwBrasSbcUdpTunnelSctpAddr, hwBrasSbcMGProtocolTable=hwBrasSbcMGProtocolTable, hwBrasSbcSipEnable=hwBrasSbcSipEnable, hwBrasSbcSipCallsessionTimer=hwBrasSbcSipCallsessionTimer, hwBrasSbcMGPortIndex=hwBrasSbcMGPortIndex, hwBrasSbcImsConnectServIP=hwBrasSbcImsConnectServIP, hwBrasSbcIadms=hwBrasSbcIadms, hwBrasSbcIadmsMediaMapTable=hwBrasSbcIadmsMediaMapTable, HwBrasBWLimitType=HwBrasBWLimitType, hwBrasSbcMGServAddrRowStatus=hwBrasSbcMGServAddrRowStatus, hwBrasSbcHrpSynchronization=hwBrasSbcHrpSynchronization, hwBrasSbcH323IntercomMapSignalNumber=hwBrasSbcH323IntercomMapSignalNumber, hwBrasSbcMapGroupsIndex=hwBrasSbcMapGroupsIndex, hwBrasSbcMediaUsersCallerID1=hwBrasSbcMediaUsersCallerID1, hwBrasSbcSip=hwBrasSbcSip, hwBrasSbcIadmsPortProtocol=hwBrasSbcIadmsPortProtocol, hwBrasSbcTrapInfoStatistic=hwBrasSbcTrapInfoStatistic, hwBrasSbcH323IntercomMapSignalTable=hwBrasSbcH323IntercomMapSignalTable, hwBrasSbcMGProtocolMgcp=hwBrasSbcMGProtocolMgcp, hwBrasSbcIadmsTables=hwBrasSbcIadmsTables, hwBrasSbcH323Enable=hwBrasSbcH323Enable, hwBrasSbcModule=hwBrasSbcModule, hwBrasSbcUpathIntercomMapSignalAddr=hwBrasSbcUpathIntercomMapSignalAddr, hwBrasSbcIdoSignalMapAddrType=hwBrasSbcIdoSignalMapAddrType, hwBrasSbcUpathStatSignalPacketEntry=hwBrasSbcUpathStatSignalPacketEntry, hwBrasSbcDefendMode=hwBrasSbcDefendMode, hwBrasSbcImsMGDomainRowStatus=hwBrasSbcImsMGDomainRowStatus, hwBrasSbcObjects=hwBrasSbcObjects, hwBrasSbcMgcpStatSignalPacketTable=hwBrasSbcMgcpStatSignalPacketTable, hwBrasSbcMediaPassAclNumber=hwBrasSbcMediaPassAclNumber, hwBrasSbcUpathSignalMapTable=hwBrasSbcUpathSignalMapTable, hwBrasSbcMediaOnewayStatus=hwBrasSbcMediaOnewayStatus, hwBrasSbcTrapInfoImsCcbID=hwBrasSbcTrapInfoImsCcbID, hwBrasSbcMediaAddrMapEntry=hwBrasSbcMediaAddrMapEntry, hwBrasSbcMGMdServAddrRowStatus=hwBrasSbcMGMdServAddrRowStatus, hwBrasSbcSipPDHCountLimit=hwBrasSbcSipPDHCountLimit, hwBrasSbcUdpTunnelPoolEntry=hwBrasSbcUdpTunnelPoolEntry, hwBrasSbcIdoSignalMapProtocol=hwBrasSbcIdoSignalMapProtocol, hwBrasSbcMediaUsersCallerID4=hwBrasSbcMediaUsersCallerID4, hwBrasSbcImsMGDomainMapIndex=hwBrasSbcImsMGDomainMapIndex, hwBrasSbcH248SignalMapAddr=hwBrasSbcH248SignalMapAddr, hwBrasSbcMgmt=hwBrasSbcMgmt, hwBrasSbcMDStatisticMinDrop=hwBrasSbcMDStatisticMinDrop, hwBrasSbcH323WellknownPortAddr=hwBrasSbcH323WellknownPortAddr, hwBrasSbcUpathStatSignalPacketInNumber=hwBrasSbcUpathStatSignalPacketInNumber, hwBrasSbcMGMdServAddrIf2=hwBrasSbcMGMdServAddrIf2, hwBrasSbcMGPrefixEntry=hwBrasSbcMGPrefixEntry, hwBrasSbcUpathMediaMapEntry=hwBrasSbcUpathMediaMapEntry, hwBrasSbcCacCallRateProtocol=hwBrasSbcCacCallRateProtocol, hwBrasSbcIadmsWellknownPortEntry=hwBrasSbcIadmsWellknownPortEntry, hwBrasSbcAdvance=hwBrasSbcAdvance, hwBrasSbcH323=hwBrasSbcH323, hwBrasSbcUpathMediaMapNumber=hwBrasSbcUpathMediaMapNumber, hwBrasSbcMapGroupLeaves=hwBrasSbcMapGroupLeaves, hwBrasSbcSipSignalMapTable=hwBrasSbcSipSignalMapTable, hwBrasSbcUsergroupRuleRowStatus=hwBrasSbcUsergroupRuleRowStatus, hwBrasSbcMgcpWellknownPortIndex=hwBrasSbcMgcpWellknownPortIndex)
mibBuilder.exportSymbols("HUAWEI-BRAS-SBC-MIB", hwBrasSbcUsergroupIndex=hwBrasSbcUsergroupIndex, hwBrasSbcCacRegTotalThreshold=hwBrasSbcCacRegTotalThreshold, hwBrasSbcSipStatSignalPacketInOctet=hwBrasSbcSipStatSignalPacketInOctet, hwBrasSbcDHSIPDetectTimer=hwBrasSbcDHSIPDetectTimer, hwBrasSbcSipMediaMapEntry=hwBrasSbcSipMediaMapEntry, hwBrasSbcMGMdCliAddrVPN=hwBrasSbcMGMdCliAddrVPN, hwBrasSbcIadmsWellknownPortProtocol=hwBrasSbcIadmsWellknownPortProtocol, hwBrasSbcSignalAddrMapTable=hwBrasSbcSignalAddrMapTable, hwBrasSbcCacCallTotalProtocol=hwBrasSbcCacCallTotalProtocol, hwBrasSbcSipMediaMapTable=hwBrasSbcSipMediaMapTable, hwBrasSbcCacEnable=hwBrasSbcCacEnable, hwBrasSbcMgcpTxTimer=hwBrasSbcMgcpTxTimer, hwBrasSbcImsMGStatus=hwBrasSbcImsMGStatus, hwBrasSbcImsMGIPTable=hwBrasSbcImsMGIPTable, hwBrasSbcBackupGroupType=hwBrasSbcBackupGroupType, hwBrasSbcDefendConnectRateRowStatus=hwBrasSbcDefendConnectRateRowStatus, hwBrasSbcH323StatSignalPacketInNumber=hwBrasSbcH323StatSignalPacketInNumber, hwBrasSbcH248CcbTimer=hwBrasSbcH248CcbTimer, hwBrasSbcH248StatSignalPacketOutNumber=hwBrasSbcH248StatSignalPacketOutNumber, hwBrasSbcH323Tables=hwBrasSbcH323Tables, hwBrasSbcBackupGroupInstanceName=hwBrasSbcBackupGroupInstanceName, hwBrasSbcMapGroupTables=hwBrasSbcMapGroupTables, hwBrasSbcImsActiveConnectId=hwBrasSbcImsActiveConnectId, hwBrasSbcRtpSpecialAddrRowStatus=hwBrasSbcRtpSpecialAddrRowStatus, hwBrasSbcMapGroupsStatus=hwBrasSbcMapGroupsStatus, hwBrasSbcMDStatisticTable=hwBrasSbcMDStatisticTable, hwBrasSbcH323StatSignalPacketInOctet=hwBrasSbcH323StatSignalPacketInOctet, hwBrasSbcMapGroupsEntry=hwBrasSbcMapGroupsEntry, hwBrasSbcSipWellknownPortPort=hwBrasSbcSipWellknownPortPort, hwBrasSbcSipTables=hwBrasSbcSipTables, hwBrasSbcNatInstanceName=hwBrasSbcNatInstanceName, hwBrasSbcH248Tables=hwBrasSbcH248Tables, hwBrasSbcSlotIndex=hwBrasSbcSlotIndex, hwBrasSbcMGMdCliAddrIndex=hwBrasSbcMGMdCliAddrIndex, hwBrasSbcMGMdServAddrEntry=hwBrasSbcMGMdServAddrEntry, hwBrasSbcMgcpIntercomMapSignalTable=hwBrasSbcMgcpIntercomMapSignalTable, hwBrasSbcMgcpSyslogEnable=hwBrasSbcMgcpSyslogEnable, hwBrasSbcQRTables=hwBrasSbcQRTables, hwBrasSbcH248WellknownPortEntry=hwBrasSbcH248WellknownPortEntry, hwBrasSbcSlotInforEntry=hwBrasSbcSlotInforEntry, hwBrasSbcSipRegReduceStatus=hwBrasSbcSipRegReduceStatus, hwBrasSbcTrapBindFluID=hwBrasSbcTrapBindFluID, hwBrasSbcMGCliAddrVPN=hwBrasSbcMGCliAddrVPN, hwBrasSbcIdoStatSignalPacketEntry=hwBrasSbcIdoStatSignalPacketEntry, hwBrasSbcStatMediaPacketEntry=hwBrasSbcStatMediaPacketEntry, hwBrasSbcIadmsMibRegTable=hwBrasSbcIadmsMibRegTable, hwBrasSbcUpathSyslogEnable=hwBrasSbcUpathSyslogEnable, hwBrasSbcCacRegTotalRowStatus=hwBrasSbcCacRegTotalRowStatus, hwBrasSbcIdoTables=hwBrasSbcIdoTables, hwBrasSbcMGMdServAddrSlotID1=hwBrasSbcMGMdServAddrSlotID1, hwBrasSbcBWLimitValue=hwBrasSbcBWLimitValue, hwBrasSbcH248Enable=hwBrasSbcH248Enable, hwBrasSbcImsConnectCliPort=hwBrasSbcImsConnectCliPort, hwBrasSbcMGMdCliAddrIf2=hwBrasSbcMGMdCliAddrIf2, hwBrasSbcH248StatSignalPacketTable=hwBrasSbcH248StatSignalPacketTable, hwBrasSbcBWLimitLeaves=hwBrasSbcBWLimitLeaves, hwBrasSbcMediaUsersIndex=hwBrasSbcMediaUsersIndex, hwBrasSbcPortrangeEntry=hwBrasSbcPortrangeEntry, hwBrasSbcCacRegRatePercent=hwBrasSbcCacRegRatePercent, hwBrasSbcH248IntercomMapSignalNumber=hwBrasSbcH248IntercomMapSignalNumber, hwBrasSbcSipSyslogEnable=hwBrasSbcSipSyslogEnable, hwBrasSbcIPCarBWValue=hwBrasSbcIPCarBWValue, hwBrasSbcPortStatisticNormal=hwBrasSbcPortStatisticNormal, hwBrasSbcIntercom=hwBrasSbcIntercom, hwBrasSbcMgcpMediaMapNumber=hwBrasSbcMgcpMediaMapNumber, hwBrasSbcMediaUsersCallerID3=hwBrasSbcMediaUsersCallerID3, hwBrasSbcH323IntercomMapMediaTable=hwBrasSbcH323IntercomMapMediaTable, hwBrasSbcMGSofxAddrIP3=hwBrasSbcMGSofxAddrIP3, hwBrasSbcNatCfgRowStatus=hwBrasSbcNatCfgRowStatus, hwBrasSbcSessionCarRuleDegreeBandWidth=hwBrasSbcSessionCarRuleDegreeBandWidth, hwBrasSbcIdoSignalMapNumber=hwBrasSbcIdoSignalMapNumber, hwBrasSbcMGMdServAddrVPNName=hwBrasSbcMGMdServAddrVPNName, hwBrasSbcCopsLinkDown=hwBrasSbcCopsLinkDown, hwBrasSbcIadmsIntercomMapMediaProtocol=hwBrasSbcIadmsIntercomMapMediaProtocol, hwBrasSbcIdoWellknownPortEntry=hwBrasSbcIdoWellknownPortEntry, hwBrasSbcDHSwitch=hwBrasSbcDHSwitch, hwBrasSbcUsergroupRuleType=hwBrasSbcUsergroupRuleType, hwBrasSbcClientPortPort16=hwBrasSbcClientPortPort16, hwBrasSbcCpuNormal=hwBrasSbcCpuNormal, hwBrasSbcTrapInfoEntry=hwBrasSbcTrapInfoEntry, hwBrasSbcMgcpWellknownPortProtocol=hwBrasSbcMgcpWellknownPortProtocol, hwBrasSbcSipStatSignalPacketTable=hwBrasSbcSipStatSignalPacketTable, hwBrasSbcImsTables=hwBrasSbcImsTables, hwBrasSbcIadmsPortIP=hwBrasSbcIadmsPortIP, hwBrasSbcMGSofxAddrIP4=hwBrasSbcMGSofxAddrIP4, hwBrasSbcMediaPassEntry=hwBrasSbcMediaPassEntry, hwBrasSbcUsergroupEntry=hwBrasSbcUsergroupEntry, hwBrasSbcImsMediaProxyLogEnable=hwBrasSbcImsMediaProxyLogEnable, hwBrasSbcUpathWellknownPortPort=hwBrasSbcUpathWellknownPortPort, hwNatAddrGrpVpnName=hwNatAddrGrpVpnName, hwBrasSbcSipIntercomMapMediaAddr=hwBrasSbcSipIntercomMapMediaAddr, hwBrasSbcSipIntercomMapSignalNumber=hwBrasSbcSipIntercomMapSignalNumber, hwBrasSbcMediaUsersCalleeID2=hwBrasSbcMediaUsersCalleeID2, hwBrasSbcSipSignalMapProtocol=hwBrasSbcSipSignalMapProtocol, hwBrasSbcImsActiveEntry=hwBrasSbcImsActiveEntry, hwBrasSbcMapGroupInstanceName=hwBrasSbcMapGroupInstanceName, hwBrasSbcCacRegTotalProtocol=hwBrasSbcCacRegTotalProtocol, hwBrasSbcMGProtocolH323=hwBrasSbcMGProtocolH323, hwBrasSbcMgcpWellknownPortRowStatus=hwBrasSbcMgcpWellknownPortRowStatus, hwBrasSbcIadmsIntercomMapMediaNumber=hwBrasSbcIadmsIntercomMapMediaNumber, hwBrasSbcInstanceEntry=hwBrasSbcInstanceEntry, hwBrasSbcUpathSignalMapAddr=hwBrasSbcUpathSignalMapAddr, hwBrasSbcMgcpIntercomMapMediaProtocol=hwBrasSbcMgcpIntercomMapMediaProtocol, hwBrasSbcGroups=hwBrasSbcGroups, hwBrasSbcIntercomLeaves=hwBrasSbcIntercomLeaves, hwBrasSbcClientPortPort07=hwBrasSbcClientPortPort07, hwBrasSbcSignalingNat=hwBrasSbcSignalingNat, hwBrasSbcIadmsIntercomMapMediaTable=hwBrasSbcIadmsIntercomMapMediaTable, hwBrasSbcCacRegRateTable=hwBrasSbcCacRegRateTable, hwBrasSbcAdvanceLeaves=hwBrasSbcAdvanceLeaves, hwBrasSbcIadmsEnable=hwBrasSbcIadmsEnable, hwBrasSbcCacActionLogStatus=hwBrasSbcCacActionLogStatus, hwBrasSbcH248SyslogEnable=hwBrasSbcH248SyslogEnable, hwBrasSbcMGMatchAcl=hwBrasSbcMGMatchAcl, hwBrasSbcMGIadmsAddrRowStatus=hwBrasSbcMGIadmsAddrRowStatus, hwBrasSbcMGMatchRowStatus=hwBrasSbcMGMatchRowStatus, hwBrasSbcH323MediaMapProtocol=hwBrasSbcH323MediaMapProtocol, hwBrasSbcMGProtocolIndex=hwBrasSbcMGProtocolIndex, hwBrasSbcIdoStatSignalPacketInOctet=hwBrasSbcIdoStatSignalPacketInOctet, hwBrasSbcH248StatSignalPacketRowStatus=hwBrasSbcH248StatSignalPacketRowStatus, hwBrasSbcH248UserAgeTimer=hwBrasSbcH248UserAgeTimer, hwBrasSbcPortStatistic=hwBrasSbcPortStatistic, hwBrasSbcH323Leaves=hwBrasSbcH323Leaves, hwBrasSbcIPCarBandwidthTable=hwBrasSbcIPCarBandwidthTable, hwBrasSbcH323WellknownPortProtocol=hwBrasSbcH323WellknownPortProtocol, hwBrasSbcCapabilities=hwBrasSbcCapabilities, hwBrasSbcMediaAddrMapClientAddr=hwBrasSbcMediaAddrMapClientAddr, hwBrasSbcMGMdCliAddrSlotID4=hwBrasSbcMGMdCliAddrSlotID4, hwBrasSbcTrapBindLeaves=hwBrasSbcTrapBindLeaves, hwBrasSbcIadmsIntercomMapMediaAddr=hwBrasSbcIadmsIntercomMapMediaAddr, hwBrasSbcSessionCarDegreeRowStatus=hwBrasSbcSessionCarDegreeRowStatus, hwBrasSbcSipWellknownPortEntry=hwBrasSbcSipWellknownPortEntry, hwBrasSbcUdpTunnelPoolRowStatus=hwBrasSbcUdpTunnelPoolRowStatus, hwBrasSbcDualHoming=hwBrasSbcDualHoming, hwBrasSbcImsConnectCliType=hwBrasSbcImsConnectCliType, hwBrasSbcMgcpSignalMapProtocol=hwBrasSbcMgcpSignalMapProtocol, hwBrasSbcInstanceRowStatus=hwBrasSbcInstanceRowStatus, hwBrasSbcMGMdCliAddrIf1=hwBrasSbcMGMdCliAddrIf1, hwBrasSbcIadmsWellknownPortAddr=hwBrasSbcIadmsWellknownPortAddr, hwBrasSbcH248IntercomMapMediaNumber=hwBrasSbcH248IntercomMapMediaNumber, hwBrasSbcStatisticSyslogEnable=hwBrasSbcStatisticSyslogEnable, hwBrasSbcH323IntercomMapMediaProtocol=hwBrasSbcH323IntercomMapMediaProtocol, hwBrasSbcImsMGConnectTimer=hwBrasSbcImsMGConnectTimer, hwBrasSbcSipMediaMapNumber=hwBrasSbcSipMediaMapNumber, hwBrasSbcMGMatchEntry=hwBrasSbcMGMatchEntry, hwBrasSbcIdoSignalMapEntry=hwBrasSbcIdoSignalMapEntry, hwBrasSbcMGSofxAddrEntry=hwBrasSbcMGSofxAddrEntry, hwBrasSbcSignalAddrMapClientAddr=hwBrasSbcSignalAddrMapClientAddr, hwBrasSbcImsMGEntry=hwBrasSbcImsMGEntry, hwBrasSbcMDStatisticEntry=hwBrasSbcMDStatisticEntry, hwBrasSbcIntercomTables=hwBrasSbcIntercomTables, hwBrasSbcNatSessionAgingTime=hwBrasSbcNatSessionAgingTime, hwBrasSbcH323IntercomMapMediaNumber=hwBrasSbcH323IntercomMapMediaNumber, hwBrasSbcSessionCarDegreeDscp=hwBrasSbcSessionCarDegreeDscp, hwBrasSbcMediaPassSyslogEnable=hwBrasSbcMediaPassSyslogEnable, hwBrasSbcMGMdServAddrIP3=hwBrasSbcMGMdServAddrIP3, hwBrasSbcTrapInfoOldSSIP=hwBrasSbcTrapInfoOldSSIP, hwBrasSbcIadmsIntercomMapSignalAddr=hwBrasSbcIadmsIntercomMapSignalAddr, hwBrasSbcMGCliAddrEntry=hwBrasSbcMGCliAddrEntry, hwBrasSbcSlotCfgState=hwBrasSbcSlotCfgState, hwBrasSbcIntercomEnable=hwBrasSbcIntercomEnable, hwBrasSbcUdpTunnelPortRowStatus=hwBrasSbcUdpTunnelPortRowStatus, hwBrasSbcImsBandValue=hwBrasSbcImsBandValue, hwBrasSbcNatCfgTable=hwBrasSbcNatCfgTable, hwBrasSbcUdpTunnelPortTable=hwBrasSbcUdpTunnelPortTable, hwBrasSbcIadmsIntercomMapSignalNumber=hwBrasSbcIadmsIntercomMapSignalNumber, hwBrasSbcBackupGroupIndex=hwBrasSbcBackupGroupIndex, hwBrasSbcMGServAddrIP4=hwBrasSbcMGServAddrIP4, hwBrasSbcMGMdServAddrIP2=hwBrasSbcMGMdServAddrIP2, hwBrasSbcUdpTunnelPoolIndex=hwBrasSbcUdpTunnelPoolIndex, hwBrasSbcCacCallRateRowStatus=hwBrasSbcCacCallRateRowStatus, hwBrasSbcIadmsPortVPN=hwBrasSbcIadmsPortVPN, hwBrasSbcPortrangeRowStatus=hwBrasSbcPortrangeRowStatus, hwBrasSbcMediaUsersCalleeID4=hwBrasSbcMediaUsersCalleeID4, hwBrasSbcDHSwitchNormal=hwBrasSbcDHSwitchNormal, hwBrasSbcClientPortPort05=hwBrasSbcClientPortPort05, hwBrasSbcStatMediaPacketRowStatus=hwBrasSbcStatMediaPacketRowStatus, hwBrasSbcRoamlimitExtendEnable=hwBrasSbcRoamlimitExtendEnable, HWBrasEnabledStatus=HWBrasEnabledStatus, hwBrasSbcStatisticEnable=hwBrasSbcStatisticEnable, hwBrasSbcMediaUsersRowStatus=hwBrasSbcMediaUsersRowStatus, hwBrasSbcIadmsIntercomMapSignalEntry=hwBrasSbcIadmsIntercomMapSignalEntry, hwBrasSbcStatMediaPacketNumber=hwBrasSbcStatMediaPacketNumber, hwBrasSbcImsMGDomainTable=hwBrasSbcImsMGDomainTable, hwBrasSbcTrapBindID=hwBrasSbcTrapBindID, hwBrasSbcImsMGIPVersion=hwBrasSbcImsMGIPVersion, hwBrasSbcRtpSpecialAddrIndex=hwBrasSbcRtpSpecialAddrIndex, hwBrasSbcUpathWellknownPortEntry=hwBrasSbcUpathWellknownPortEntry, hwBrasSbcIdoIntercomMapSignalNumber=hwBrasSbcIdoIntercomMapSignalNumber, hwBrasSbcMgcpSignalMapTable=hwBrasSbcMgcpSignalMapTable, hwBrasSbcIadmsIntercomMapMediaEntry=hwBrasSbcIadmsIntercomMapMediaEntry, hwBrasSbcView=hwBrasSbcView, hwBrasSbcStatisticIndex=hwBrasSbcStatisticIndex, hwBrasSbcCacRegRateRowStatus=hwBrasSbcCacRegRateRowStatus, hwBrasSbcMGMdServAddrSlotID3=hwBrasSbcMGMdServAddrSlotID3, hwBrasSbcIdoStatSignalPacketTable=hwBrasSbcIdoStatSignalPacketTable, hwBrasSbcMGCliAddrIndex=hwBrasSbcMGCliAddrIndex, hwBrasSbcMgcpMediaMapEntry=hwBrasSbcMgcpMediaMapEntry, hwBrasSbcTrapBindEntry=hwBrasSbcTrapBindEntry, hwBrasSbcGroup=hwBrasSbcGroup, hwBrasSbcUdpTunnelPoolTable=hwBrasSbcUdpTunnelPoolTable, hwBrasSbcPortrangeEnd=hwBrasSbcPortrangeEnd, hwBrasSbcIPCarStatus=hwBrasSbcIPCarStatus, hwBrasSbcUpathIntercomMapSignalEntry=hwBrasSbcUpathIntercomMapSignalEntry, hwBrasSbcStatisticTable=hwBrasSbcStatisticTable, hwBrasSbcUpathMediaMapProtocol=hwBrasSbcUpathMediaMapProtocol, hwBrasSbcSipSignalMapNumber=hwBrasSbcSipSignalMapNumber, hwBrasSbcMGIadmsAddrTable=hwBrasSbcMGIadmsAddrTable, hwBrasSbcBackupGroupsTable=hwBrasSbcBackupGroupsTable, hwBrasSbcImsMGDomainName=hwBrasSbcImsMGDomainName, hwBrasSbcClientPortVPN=hwBrasSbcClientPortVPN, hwBrasSbcImsConnectRowStatus=hwBrasSbcImsConnectRowStatus, hwBrasSbcMDLengthMax=hwBrasSbcMDLengthMax, hwBrasSbcMgcpStatSignalPacketIndex=hwBrasSbcMgcpStatSignalPacketIndex, hwBrasSbcH323SignalMapTable=hwBrasSbcH323SignalMapTable, hwBrasSbcMgcpIntercomMapMediaAddr=hwBrasSbcMgcpIntercomMapMediaAddr, hwBrasSbcH248StatSignalPacketOutOctet=hwBrasSbcH248StatSignalPacketOutOctet, hwBrasSbcMediaDetectValidityEnable=hwBrasSbcMediaDetectValidityEnable, hwBrasSbcImsBandTable=hwBrasSbcImsBandTable, hwBrasSbcMgcpSignalMapAddr=hwBrasSbcMgcpSignalMapAddr, hwBrasSbcMGProtocolIadms=hwBrasSbcMGProtocolIadms, hwBrasSbcClientPortProtocol=hwBrasSbcClientPortProtocol, hwBrasSbcMGMdCliAddrIP1=hwBrasSbcMGMdCliAddrIP1, hwBrasSbcUdpTunnelIfPortTable=hwBrasSbcUdpTunnelIfPortTable, hwBrasSbcMGMdServAddrSlotID4=hwBrasSbcMGMdServAddrSlotID4, hwBrasSbcImsLeaves=hwBrasSbcImsLeaves, hwBrasSbcIdoIntercomMapSignalTable=hwBrasSbcIdoIntercomMapSignalTable, hwBrasSbcMGProtocolUpath=hwBrasSbcMGProtocolUpath, hwBrasSbcMGMdCliAddrIP3=hwBrasSbcMGMdCliAddrIP3, hwBrasSbcImsBandIfIndex=hwBrasSbcImsBandIfIndex, hwBrasSbcIadmsMibRegEntry=hwBrasSbcIadmsMibRegEntry, hwBrasSbcMGIadmsAddrEntry=hwBrasSbcMGIadmsAddrEntry, hwBrasSbcBackupGroupRowStatus=hwBrasSbcBackupGroupRowStatus, hwBrasSbcMediaDefend=hwBrasSbcMediaDefend, hwBrasSbcAdvanceTables=hwBrasSbcAdvanceTables, hwBrasSbcImsBandIndex=hwBrasSbcImsBandIndex, hwBrasSbcIdo=hwBrasSbcIdo, hwBrasSbcNatAddressGroupEntry=hwBrasSbcNatAddressGroupEntry, hwBrasSbcIadmsSignalMapAddr=hwBrasSbcIadmsSignalMapAddr, hwBrasSbcImsMGInstanceName=hwBrasSbcImsMGInstanceName, hwBrasSbcUpathEnable=hwBrasSbcUpathEnable, hwBrasSbcMDLengthTable=hwBrasSbcMDLengthTable, hwBrasSbcUpathIntercomMapMediaNumber=hwBrasSbcUpathIntercomMapMediaNumber, hwBrasSbcCacRegTotalTable=hwBrasSbcCacRegTotalTable, hwBrasSbcMGMdServAddrVPN=hwBrasSbcMGMdServAddrVPN, hwBrasSbcRtpSpecialAddrEntry=hwBrasSbcRtpSpecialAddrEntry, hwBrasSbcIdoStatSignalPacketIndex=hwBrasSbcIdoStatSignalPacketIndex, hwBrasSbcSoftVersion=hwBrasSbcSoftVersion, hwBrasSbcH323SignalMapNumber=hwBrasSbcH323SignalMapNumber, hwBrasSbcSipSignalMapAddr=hwBrasSbcSipSignalMapAddr, hwBrasSbcSessionCarDegreeTable=hwBrasSbcSessionCarDegreeTable, hwBrasSbcUdpTunnelEnable=hwBrasSbcUdpTunnelEnable, hwBrasSbcMDStatisticIndex=hwBrasSbcMDStatisticIndex, hwBrasSbcIadmsMediaMapAddr=hwBrasSbcIadmsMediaMapAddr)
mibBuilder.exportSymbols("HUAWEI-BRAS-SBC-MIB", hwBrasSbcTrapInfoCac=hwBrasSbcTrapInfoCac, hwBrasSbcCacRegRateThreshold=hwBrasSbcCacRegRateThreshold, hwBrasSbcIadmsStatSignalPacketTable=hwBrasSbcIadmsStatSignalPacketTable, hwBrasSbcTrapGroup=hwBrasSbcTrapGroup, hwBrasSbcDynamicStatus=hwBrasSbcDynamicStatus, hwBrasSbcUpathIntercomMapSignalTable=hwBrasSbcUpathIntercomMapSignalTable, HWBrasSecurityProtocol=HWBrasSecurityProtocol, hwBrasSbcIdoSignalMapAddr=hwBrasSbcIdoSignalMapAddr, hwBrasSbcRtpSpecialAddrAddr=hwBrasSbcRtpSpecialAddrAddr, hwBrasSbcBase=hwBrasSbcBase, hwBrasSbcImsActiveStatus=hwBrasSbcImsActiveStatus, hwBrasSbcImsMGTableStatus=hwBrasSbcImsMGTableStatus, hwBrasSbcSipStatSignalPacketIndex=hwBrasSbcSipStatSignalPacketIndex, hwBrasSbcUpathIntercomMapMediaTable=hwBrasSbcUpathIntercomMapMediaTable, hwBrasSbcSessionCarRuleDegreeDscp=hwBrasSbcSessionCarRuleDegreeDscp, hwBrasSbcMediaUsersCalleeID1=hwBrasSbcMediaUsersCalleeID1, hwBrasSbcStatisticEntry=hwBrasSbcStatisticEntry, hwBrasSbcUpathMediaMapAddr=hwBrasSbcUpathMediaMapAddr, hwBrasSbcTrapBindIndex=hwBrasSbcTrapBindIndex, hwBrasSbcIadmsSignalMapProtocol=hwBrasSbcIadmsSignalMapProtocol, hwBrasSbcRoamlimitDefault=hwBrasSbcRoamlimitDefault, hwBrasSbcImsTimeOut=hwBrasSbcImsTimeOut, hwBrasSbcMediaDefendLeaves=hwBrasSbcMediaDefendLeaves, hwBrasSbcInstanceName=hwBrasSbcInstanceName, hwBrasSbcMgcpTables=hwBrasSbcMgcpTables, hwBrasSbcCacNormal=hwBrasSbcCacNormal, hwBrasSbcMgcpStatSignalPacketEntry=hwBrasSbcMgcpStatSignalPacketEntry, hwBrasSbcMGProtocolH248=hwBrasSbcMGProtocolH248, hwBrasSbcIPCarBandwidthEntry=hwBrasSbcIPCarBandwidthEntry, hwBrasSbcUpathStatSignalPacketRowStatus=hwBrasSbcUpathStatSignalPacketRowStatus, hwBrasSbcMGServAddrIP1=hwBrasSbcMGServAddrIP1, hwBrasSbcRoamlimitRowStatus=hwBrasSbcRoamlimitRowStatus, hwBrasSbcCacCallRateTable=hwBrasSbcCacCallRateTable, hwBrasSbcUdpTunnelIfPortRowStatus=hwBrasSbcUdpTunnelIfPortRowStatus, hwBrasSbcSipStatSignalPacketOutOctet=hwBrasSbcSipStatSignalPacketOutOctet, hwBrasSbcUpathIntercomMapSignalProtocol=hwBrasSbcUpathIntercomMapSignalProtocol, hwBrasSbcIadmsPortTable=hwBrasSbcIadmsPortTable, hwBrasSbcMGMdServAddrIP1=hwBrasSbcMGMdServAddrIP1, hwBrasSbcSessionCar=hwBrasSbcSessionCar, hwBrasSbcNatGroupIndex=hwBrasSbcNatGroupIndex, hwBrasSbcMGMdServAddrSlotID2=hwBrasSbcMGMdServAddrSlotID2, hwBrasSbcDHSIPDetectStatus=hwBrasSbcDHSIPDetectStatus, hwBrasSbcIadmsPortRowStatus=hwBrasSbcIadmsPortRowStatus, hwBrasSbcDefendUserConnectRateTable=hwBrasSbcDefendUserConnectRateTable, hwBrasSbcUdpTunnelPortProtocol=hwBrasSbcUdpTunnelPortProtocol, hwBrasSbcMgcpIntercomMapSignalNumber=hwBrasSbcMgcpIntercomMapSignalNumber, hwBrasSbcCacCallTotalRowStatus=hwBrasSbcCacCallTotalRowStatus, hwBrasSbcMgcpAuepTimer=hwBrasSbcMgcpAuepTimer, hwBrasSbcIdoIntercomMapSignalAddr=hwBrasSbcIdoIntercomMapSignalAddr, hwBrasSbcDefendEnable=hwBrasSbcDefendEnable, hwBrasSbcDefendConnectRateTable=hwBrasSbcDefendConnectRateTable, hwBrasSbcMGMdServAddrIf3=hwBrasSbcMGMdServAddrIf3, hwBrasSbcDefendConnectRatePercent=hwBrasSbcDefendConnectRatePercent, hwBrasSbcMgcpIntercomMapMediaEntry=hwBrasSbcMgcpIntercomMapMediaEntry, hwBrasSbcMapGroupsRowStatus=hwBrasSbcMapGroupsRowStatus, hwBrasSbcUpathWellknownPortIndex=hwBrasSbcUpathWellknownPortIndex, hwBrasSbcClientPortPort13=hwBrasSbcClientPortPort13, hwBrasSbcQRBandWidth=hwBrasSbcQRBandWidth, hwBrasSbcSignalAddrMapRowStatus=hwBrasSbcSignalAddrMapRowStatus, hwBrasSbcStatMediaPacketOctet=hwBrasSbcStatMediaPacketOctet, hwBrasSbcH248StatSignalPacketInOctet=hwBrasSbcH248StatSignalPacketInOctet, hwBrasSbcImsRptFail=hwBrasSbcImsRptFail, hwBrasSbcTrapInfoPortStatistic=hwBrasSbcTrapInfoPortStatistic, hwBrasSbcH248WellknownPortAddr=hwBrasSbcH248WellknownPortAddr, hwBrasSbcSipIntercomMapMediaProtocol=hwBrasSbcSipIntercomMapMediaProtocol, hwBrasSbcH323StatSignalPacketOutOctet=hwBrasSbcH323StatSignalPacketOutOctet, hwBrasSbcUpathStatSignalPacketOutNumber=hwBrasSbcUpathStatSignalPacketOutNumber, hwBrasSbcUpathWellknownPortAddr=hwBrasSbcUpathWellknownPortAddr, hwBrasSbcH248MediaMapNumber=hwBrasSbcH248MediaMapNumber, hwBrasSbcH323MediaMapTable=hwBrasSbcH323MediaMapTable, hwBrasSbcMGPrefixTable=hwBrasSbcMGPrefixTable, hwBrasSbcImsMGRowStatus=hwBrasSbcImsMGRowStatus, hwBrasSbcDefendConnectRateProtocol=hwBrasSbcDefendConnectRateProtocol, hwBrasSbcIadmsMibRegVersion=hwBrasSbcIadmsMibRegVersion, hwBrasSbcInstanceTable=hwBrasSbcInstanceTable, hwBrasSbcMGPortTable=hwBrasSbcMGPortTable, hwBrasSbcImsMGIndex=hwBrasSbcImsMGIndex, hwBrasSbcDefendExtStatus=hwBrasSbcDefendExtStatus, hwBrasSbcSoftswitchPortTable=hwBrasSbcSoftswitchPortTable, hwBrasSbcH248SignalMapTable=hwBrasSbcH248SignalMapTable, hwBrasSbcH323StatSignalPacketTable=hwBrasSbcH323StatSignalPacketTable, hwBrasSbcImsMGIPInterface=hwBrasSbcImsMGIPInterface, hwBrasSbcMGMdServAddrTable=hwBrasSbcMGMdServAddrTable, hwBrasSbcTrapInfoHrp=hwBrasSbcTrapInfoHrp, hwBrasSbcStatistic=hwBrasSbcStatistic, hwBrasSbcMGPrefixRowStatus=hwBrasSbcMGPrefixRowStatus, hwBrasSbcIdoWellknownPortTable=hwBrasSbcIdoWellknownPortTable, hwBrasSbcSessionCarRuleTable=hwBrasSbcSessionCarRuleTable, hwBrasSbcH248StatSignalPacketEntry=hwBrasSbcH248StatSignalPacketEntry, hwBrasSbcRoamlimitEnable=hwBrasSbcRoamlimitEnable)
|
# A variável "oi" recebe o valor "Hi" em bytes
oi = b'Hi'
# Retorna o valor da variável
print(oi) # b'Hi'
# Retorna o tipo
print(type(oi)) # <class 'bytes'> |
description = 'Aircontrol PLC devices'
group = 'optional'
tango_base = 'tango://kompasshw.kompass.frm2:10000/kompass/aircontrol/plc_'
devices = dict(
spare_motor_x2 = device('nicos.devices.entangle.Motor',
description = 'spare motor',
tangodevice = tango_base + 'spare_mot_x2',
fmtstr = '%.4f',
visibility = (),
),
shutter = device('nicos.devices.entangle.NamedDigitalOutput',
description = 'neutron shutter',
tangodevice = tango_base + 'shutter',
mapping = dict(closed=0, open=1),
),
key = device('nicos.devices.entangle.NamedDigitalOutput',
description = 'supervisor mode key',
tangodevice = tango_base + 'key',
mapping = dict(normal=0, super_visor_mode=1),
requires = dict(level='admin'),
),
)
for key in ('analyser', 'detector', 'sampletable'):
devices['airpad_' + key] = device('nicos.devices.entangle.NamedDigitalOutput',
description = 'switches the airpads at %s' % key,
tangodevice = tango_base + 'airpads_%s' % key,
mapping = dict(on=1, off=0),
)
devices['p_%s' % key] = device('nicos.devices.entangle.Sensor',
description = 'supply pressure for %s airpads',
tangodevice = tango_base + 'p_%s' % key,
unit = 'bar',
visibility = (),
)
for key in ('ana', 'arm', 'det', 'st'):
for idx in (1, 2, 3):
devices['p_airpad_%s_%d' % (key, idx)] = device('nicos.devices.entangle.Sensor',
description = 'actual pressure in airpad %d of %s' % (idx, key),
tangodevice = tango_base + 'p_airpad_%s_%d' % (key, idx),
unit = 'bar',
visibility = (),
)
for key in (1, 2, 3, 4):
devices['aircontrol_t%d' % key] = device('nicos.devices.entangle.Sensor',
description = 'aux temperatures sensor %d' % key,
tangodevice = tango_base + 'temperature_%d' % key,
unit = 'degC',
)
#for key in range(1, 52+1):
# devices['msb%d' % key] = device('nicos.devices.entangle.NamedDigitalOutput',
# description = 'mono shielding block %d' % key,
# tangodevice = tango_base + 'plc_msb%d' % key,
# mapping = dict(up=1, down=0),
# )
|
#8 - LISTA DE COMPONENTES -> PC GAMER
comp = ["Nvidia GeForce GTX 2080Ti", "Gabinete Cooler Master", "Kit RAM GSkill DDR4 3.6GHz 8x2GB",
"Placa Mãe ASUSTeK ROG MAXIMUS XI EXTREME", "Processador Intel i9", "SSD NVMe Samsung 970 1TB"]
del comp[0]
del comp[0]
print(comp)
|
# 4. Faça um programa que calcule o salário de um colaborador na empresa XYZ. O salário
# é pago conforme a quantidade de horas trabalhadas. Quando um funcionário trabalha
# mais de 40 horas ele recebe um adicional de 1.5 nas horas extras trabalhadas.
def calcSalario(salario:float, horaExtra:float):
if horaExtra > 40:
return round(salario + (salario * 1.5/100) * (horaExtra - 40), 2)
else:
return round(salario, 2)
salario = float(input('Informeo salário do funcionário: '))
horasExtas = float(input('Informe a quantidade de horas trabalhadas: '))
print(calcSalario(salario, horasExtas))
|
def make_prime_table(n):
sieve = list(range(n + 1))
sieve[0] = -1
sieve[1] = -1
for i in range(4, n + 1, 2):
sieve[i] = 2
for i in range(3, int(n ** 0.5) + 1, 2):
if sieve[i] != i:
continue
for j in range(i * i, n + 1, i * 2):
if sieve[j] == j:
sieve[j] = i
return sieve
def prime_factorize(n):
result = []
while n != 1:
p = prime_table[n]
e = 0
while n % p == 0:
n //= p
e += 1
result.append((p, e))
return result
N, M, *A = map(int, open(0).read().split())
prime_table = make_prime_table(10 ** 5)
s = set()
for a in A:
for p, _ in prime_factorize(a):
s.add(p)
result = []
for k in range(1, M + 1):
if any(p in s for p, _ in prime_factorize(k)):
continue
result.append(k)
print(len(result))
print(*result, sep='\n')
|
DATABASES = {
'default': {
'ENGINE': 'django.db.backends.postgresql_psycopg2',
'NAME': 'publics',
'USER': 'publics_read_only',
'PASSWORD': r'read-only',
'HOST': '5.153.9.51',
'PORT': '5432',
}
}
INSTALLED_APPS = (
'contracts',
'law',
'deputies'
)
# Mandatory in Django, doesn't make a difference for our case.
SECRET_KEY = 'not-secret'
|
body_max_width = 15
body_max_height = 15
def validate_body_str_profile(body: str):
body_lines = body.splitlines()
width = len(body_lines[0])
height = len(body_lines)
if width > body_max_width or height > body_max_height:
raise ValueError("Body string is too big")
|
# -*- coding: utf-8 -*-
def userinfo( authority, otherwise='' ):
"""Extracts the user info (user:pass)."""
end = authority.find('@')
if -1 == end:
return otherwise
return authority[0:end]
def location( authority ):
"""Extracts the location (host:port)."""
end = authority.find('@')
if -1 == end:
return authority
return authority[1+end:]
|
class TrieNode:
def __init__(self):
self.children = {}
self.isEnd = False
class WordDictionary:
def __init__(self):
"""
Initialize your data structure here.
"""
self.root = TrieNode()
def addWord(self, word: str) -> None:
"""
Adds a word into the data structure.
"""
currNode = self.root
for char in word:
if char not in currNode.children:
currNode.children[char] = TrieNode()
currNode = currNode.children[char]
currNode.isEnd = True
def search(self, word: str) -> bool:
"""
Returns if the word is in the data structure. A word could contain the dot character '.' to represent any one letter.
"""
currNode = self.root
stack = [(currNode, word)]
while stack:
currNode, word = stack.pop()
if not word:
if currNode.isEnd:
return True
elif word[0] in currNode.children:
child = currNode.children[word[0]]
stack.append((child, word[1:]))
elif word[0] == '.':
for child in currNode.children.values():
stack.append((child, word[1:]))
return False
# Your WordDictionary object will be instantiated and called as such:
# obj = WordDictionary()
# obj.addWord(word)
# param_2 = obj.search(word)
|
user_info = {
"ok": 1,
"data": {
"avatar_guide": [],
"isStarStyle": 0,
"userInfo": {
"id": 3112824195,
"screen_name": "琪琪琪咩Sickey",
"profile_image_url": "https:\/\/tvax3.sinaimg.cn\/crop.0.0.996.996.180\/b989ed83ly8gcdemg2y21j20ro0rotas.jpg?KID=imgbed,tva&Expires=1594729063&ssig=6+Ph+Rvab8",
"profile_url": "https:\/\/m.weibo.cn\/u\/3112824195?uid=3112824195&luicode=10000011&lfid=1005053112824195",
"statuses_count": 12,
"verified": False,
"verified_type": -1,
"close_blue_v": False,
"description": "为未来的我而努力💚",
"gender": "f",
"mbtype": 0,
"urank": 14,
"mbrank": 0,
"follow_me": False,
"following": False,
"followers_count": 51,
"follow_count": 158,
"cover_image_phone": "https:\/\/tva2.sinaimg.cn\/crop.0.0.640.640.640\/a1d3feabjw1ecasunmkncj20hs0hsq4j.jpg",
"avatar_hd": "https:\/\/wx3.sinaimg.cn\/orj480\/b989ed83ly8gcdemg2y21j20ro0rotas.jpg",
"like": False,
"like_me": False,
"toolbar_menus": [
{
"type": "profile_follow",
"name": "关注",
"pic": "",
"params": {
"uid": 3112824195
}
},
{
"type": "link",
"name": "聊天",
"pic": "http:\/\/h5.sinaimg.cn\/upload\/2015\/06\/12\/2\/toolbar_icon_discuss_default.png",
"params": {
"scheme": "sinaweibo:\/\/messagelist?uid=3112824195&nick=琪琪琪咩Sickey"
},
"scheme": "https:\/\/passport.weibo.cn\/signin\/welcome?entry=mweibo&r=https://m.weibo.cn/api/container/getIndex?type=uid&value=3112824195"
},
{
"type": "link",
"name": "文章",
"pic": "",
"params": {
"scheme": "sinaweibo:\/\/cardlist?containerid=2303190002_445_3112824195_WEIBO_ARTICLE_LIST_DETAIL&count=20"
},
"scheme": "https:\/\/m.weibo.cn\/p\/index?containerid=2303190002_445_3112824195_WEIBO_ARTICLE_LIST_DETAIL&count=20&luicode=10000011&lfid=1005053112824195"
}
]
},
"fans_scheme": "https:\/\/m.weibo.cn\/p\/index?containerid=231051_-_fans_intimacy_-_3112824195&luicode=10000011&lfid=1005053112824195",
"follow_scheme": "https:\/\/m.weibo.cn\/p\/index?containerid=231051_-_followersrecomm_-_3112824195&luicode=10000011&lfid=1005053112824195",
"tabsInfo": {
"selectedTab": 1,
"tabs": [
{
"id": 1,
"tabKey": "profile",
"must_show": 1,
"hidden": 0,
"title": "主页",
"tab_type": "profile",
"containerid": "2302833112824195"
},
{
"id": 2,
"tabKey": "weibo",
"must_show": 1,
"hidden": 0,
"title": "微博",
"tab_type": "weibo",
"containerid": "1076033112824195",
"apipath": "\/profile\/statuses",
"url": "\/index\/my"
},
{
"id": 10,
"tabKey": "album",
"must_show": 0,
"hidden": 0,
"title": "相册",
"tab_type": "album",
"containerid": "1078033112824195"
}
]
},
"scheme": "sinaweibo:\/\/userinfo?uid=3112824195&type=uid&value=3112824195&luicode=10000011&lfid=1005051005051004933462&v_p=42",
"showAppTips": 0
}
}
|
n, x = map(int, input().split())
if (x > n // 2 and n % 2 == 0) or (x > (n + 1) // 2 and n % 2 == 1):
x = n - x
A = n - x
B = x
k = 0
m = -1
ans = n
while m != 0:
k = A // B
m = A % B
ans += B * k * 2
if m == 0:
ans -= B
A = B
B = m
print(ans) |
string_1 = input("String 1? ")
string_2 = input("String 2? ")
string_3 = input("String 3? ")
print(string_1 + string_2 + string_3)
|
'''
URL: https://leetcode.com/problems/slowest-key/
Difficulty: Easy
Description: Slowest Key
A newly designed keypad was tested, where a tester pressed a sequence of n keys, one at a time.
You are given a string keysPressed of length n, where keysPressed[i] was the ith key pressed in the testing sequence, and a sorted list releaseTimes, where releaseTimes[i] was the time the ith key was released. Both arrays are 0-indexed. The 0th key was pressed at the time 0, and every subsequent key was pressed at the exact time the previous key was released.
The tester wants to know the key of the keypress that had the longest duration. The ith keypress had a duration of releaseTimes[i] - releaseTimes[i - 1], and the 0th keypress had a duration of releaseTimes[0].
Note that the same key could have been pressed multiple times during the test, and these multiple presses of the same key may not have had the same duration.
Return the key of the keypress that had the longest duration. If there are multiple such keypresses, return the lexicographically largest key of the keypresses.
Example 1:
Input: releaseTimes = [9,29,49,50], keysPressed = "cbcd"
Output: "c"
Explanation: The keypresses were as follows:
Keypress for 'c' had a duration of 9 (pressed at time 0 and released at time 9).
Keypress for 'b' had a duration of 29 - 9 = 20 (pressed at time 9 right after the release of the previous character and released at time 29).
Keypress for 'c' had a duration of 49 - 29 = 20 (pressed at time 29 right after the release of the previous character and released at time 49).
Keypress for 'd' had a duration of 50 - 49 = 1 (pressed at time 49 right after the release of the previous character and released at time 50).
The longest of these was the keypress for 'b' and the second keypress for 'c', both with duration 20.
'c' is lexicographically larger than 'b', so the answer is 'c'.
Example 2:
Input: releaseTimes = [12,23,36,46,62], keysPressed = "spuda"
Output: "a"
Explanation: The keypresses were as follows:
Keypress for 's' had a duration of 12.
Keypress for 'p' had a duration of 23 - 12 = 11.
Keypress for 'u' had a duration of 36 - 23 = 13.
Keypress for 'd' had a duration of 46 - 36 = 10.
Keypress for 'a' had a duration of 62 - 46 = 16.
The longest of these was the keypress for 'a' with duration 16.
Constraints:
releaseTimes.length == n
keysPressed.length == n
2 <= n <= 1000
1 <= releaseTimes[i] <= 109
releaseTimes[i] < releaseTimes[i+1]
keysPressed contains only lowercase English letters.
'''
class Solution:
def slowestKey(self, releaseTimes, keysPressed):
maxDur = releaseTimes[0]
answers = set(keysPressed[0])
for i in range(1, len(releaseTimes)):
if releaseTimes[i] - releaseTimes[i-1] > maxDur:
answers = set(keysPressed[i])
maxDur = releaseTimes[i] - releaseTimes[i-1]
elif releaseTimes[i] - releaseTimes[i-1] == maxDur:
answers.add(keysPressed[i])
return max(answers)
|
'''
Faça um Programa que peça um número e então mostre a mensagem: O número informado foi [número].
'''
numero = input('Digite um número: ')
print('O número informado foi: {}'.format(numero))
|
# Copyright 2015 The Chromium Authors. All rights reserved.
# Use of this source code is governed by a BSD-style license that can be
# found in the LICENSE file.
class Shell(object):
"""Represents an abstract Mojo shell."""
def serve_local_directories(self, mappings, port, reuse_servers=False):
"""Serves the content of the local (host) directories, making it available
to the shell under the url returned by the function.
The server will run on a separate thread until the program terminates. The
call returns immediately.
Args:
mappings: List of tuples (prefix, local_base_path_list) mapping URLs that
start with |prefix| to one or more local directories enumerated in
|local_base_path_list|. The prefixes should skip the leading slash.
The first matching prefix and the first location that contains the
requested file will be used each time.
port: port at which the server will be available to the shell. On Android
this can be different from the port on which the server runs on the
host.
reuse_servers: don't actually spawn the server. Instead assume that the
server is already running on |port|, and only set up forwarding if
needed.
Returns:
The url that the shell can use to access the server.
"""
raise NotImplementedError()
def forward_host_port_to_shell(self, host_port):
"""Forwards a port on the host machine to the same port wherever the shell
is running.
This is a no-op if the shell is running locally.
"""
raise NotImplementedError()
def run(self, arguments):
"""Runs the shell with given arguments until shell exits, passing the stdout
mingled with stderr produced by the shell onto the stdout.
Returns:
Exit code retured by the shell or None if the exit code cannot be
retrieved.
"""
raise NotImplementedError()
def run_and_get_output(self, arguments, timeout=None):
"""Runs the shell with given arguments until shell exits and returns the
output.
Args:
arguments: list of arguments for the shell
timeout: maximum running time in seconds, after which the shell will be
terminated
Returns:
A tuple of (return_code, output, did_time_out). |return_code| is the exit
code returned by the shell or None if the exit code cannot be retrieved.
|output| is the stdout mingled with the stderr produced by the shell.
|did_time_out| is True iff the shell was terminated because it exceeded
the |timeout| and False otherwise.
"""
raise NotImplementedError()
|
# LeetCode #437 - Path Sum III
# https://leetcode.com/problems/path-sum-iii/
# Prefix-sum hashing solution. Runs in linear time.
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
@staticmethod
def pathSum(root: TreeNode, targetSum: int) -> int:
history = collections.Counter((0,))
def dfs(node, acc):
if not node:
return 0
acc += node.val
count = history[acc - targetSum]
history[acc] += 1
count += dfs(node.left, acc)
count += dfs(node.right, acc)
history[acc] -= 1
return count
return dfs(root, 0)
|
class SearchToursData:
def __init__(self, destination, tour_type, start_year, start_month, start_day, adults_num):
self.destination = destination
self.tour_type = tour_type
self.start_year = start_year
self.start_month = start_month
self.start_day = start_day
self.adults_num = adults_num
|
def first_non_repeating_letter(string):
lowercase_string = string.lower()
result = []
for i in lowercase_string:
if (lowercase_string.count(i) == 1):
result.append(i)
if (len(result) == 0):
return ""
else:
if (string.find(result[0]) == -1 ):
return result[0].upper()
else:
return result[0]
def test_first_non_repeating_letter():
assert first_non_repeating_letter("stress") == 't'
assert first_non_repeating_letter("") == ''
assert first_non_repeating_letter("aabb") == ''
assert first_non_repeating_letter("sTreSS") == 'T'
|
datasets = ('source',)
def synthesis(job):
d = {}
agg = 0
for dt, x in datasets.source.iterate('roundrobin', ('DATE_OF_INTEREST', 'CASE_COUNT')):
agg += x
d[dt] = agg
return d
|
'''
Created on 16 ago 2017
@author: Hamza
'''
class MyClass(object):
'''
classdocs
'''
def __init__(self, params):
'''
Constructor
'''
|
class Solution:
def busyStudent(self, startTime: List[int], endTime: List[int], queryTime: int) -> int:
working = 0
for i, stu in enumerate(startTime):
if stu <= queryTime and endTime[i] >= queryTime:
working += 1
return working |
#!/usr/bin/python
# -*-coding:utf-8-*-
"""
@author: smartgang
@contact: [email protected]
@file: data_analyse_nba.py
@time: 2017/12/5 11:02
""" |
class Solution:
def makeEqual(self, words: List[str]) -> bool:
n = len(words)
words = ''.join(words)
letterCounter = Counter(words)
print(letterCounter )
for letter in letterCounter:
if letterCounter[letter] % n !=0:
return False
return True
|
"""
File: complement.py
Name:鄭凱元
----------------------------
This program uses string manipulation to
tackle a real world problem - finding the
complement strand of a DNA sequence.
THe program asks uses for a DNA sequence as
a python string that is case-insensitive.
Your job is to output the complement of it.
"""
def main():
"""
Converts characters to uppercase,
then output the complementary sequence through the newly created function (build_complement())
"""
dna = input('Please give me a DNA strand and I\'ll find the complement: ')
# Converts characters to uppercase
dna = dna.upper
ans = build_complement(dna)
print('The complement of ' + str(dna) + ' is ' + str(ans))
def build_complement(dna):
# start from an empty string
ans = ''
# For loop: return complementary sequences
for dna_fragment in dna:
if dna_fragment == 'A':
ans += 'T'
elif dna_fragment == 'T':
ans += 'A'
elif dna_fragment == 'C':
ans += 'G'
elif dna_fragment == 'G':
ans += 'C'
return ans
###### DO NOT EDIT CODE BELOW THIS LINE ######
if __name__ == '__main__':
main()
|
EARTH = 6371000
MOON = 1737100
MARS = 3389500
JUPITER = 69911000
|
# -*- coding: utf-8 -*-
# @File : constants.py
# @Author : Xie
# @Date : 9/15/18
# @Desc :
# email验证的过期时间
VERIFY_EMAIL_TOKEN_EXPIRES = 24 * 60 * 60
# 每个用户收货地址界面显示的最大地址数量
USER_ADDRESS_COUNTS_LIMIT = 20
# 用户浏览记录最大展示数量
USER_BROWSING_HISTORY_COUNTS_LIMIT = 5
|
#===============================================================================
# Created: 22 May 2019
# @author: AP (adapated from Jesse Wilson)
# Description: Class to contain Anaplan connection details required for all API calls
# Input: Authorization header string, workspace ID string, and model ID string
# Output: None
#===============================================================================
class AnaplanConnection(object):
'''
classdocs
'''
def __init__(self, authorization, workspaceGuid, modelGuid):
'''
:param authorization: Authorization header string
:param workspaceGuid: ID of the Anaplan workspace
:param modelGuid: ID of the Anaplan model
'''
self.authorization = authorization
self.workspaceGuid = workspaceGuid
self.modelGuid = modelGuid
|
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, x):
# self.val = x
# self.left = None
# self.right = None
class Solution:
def sumRootToLeaf(self, root: TreeNode) -> int:
if root is None:
return 0
sum = 0
def plusAllLeaves(node, parentPath):
nonlocal sum
currPath = parentPath + str(node.val)
if node.left is None and node.right is None:
sum += int(currPath, 2)
return
if node.left is not None:
plusAllLeaves(node.left, currPath)
if node.right is not None:
plusAllLeaves(node.right, currPath)
plusAllLeaves(root, '')
return sum |
"""Utility module that defines the :class:`Singleton` class."""
class Singleton:
"""
Singleton class.
The :class:`Singleton` class is used to force a unique instantiation.
"""
_instance = None
def __new__(cls, *args) -> "Singleton":
"""Control single instance creation."""
if cls._instance is None:
cls._instance = super().__new__(cls, *args)
return cls._instance
def __hash__(self) -> int:
"""Return hash(self)."""
return id(self)
|
DEFAULT_POSTGREST_CLIENT_HEADERS = {
"Accept": "application/json",
"Content-Type": "application/json",
}
DEFAULT_POSTGREST_CLIENT_TIMEOUT = 5
|
# https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-tree/
class TreeNode:
def __init__(self, x, left=None, right=None):
self.val = x
self.left = left
self.right = right
class Solution:
def lowestCommonAncestor(self, root: 'TreeNode', p: 'TreeNode', q: 'TreeNode') -> 'TreeNode':
res = None
def findLCA(node):
if node is None:
return 0
count = 0
if node == p or node == q:
count += 1
count += findLCA(node.left)
count += findLCA(node.right)
if count == 2:
nonlocal res
if res is not None:
return
res = node
return count
findLCA(root)
return res
|
# buildifier: disable=module-docstring
def _provider_text(symbols):
return """
WRAPPER = provider(
doc = "Wrapper to hold imported methods",
fields = [{}]
)
""".format(", ".join(["\"%s\"" % symbol_ for symbol_ in symbols]))
def _getter_text():
return """
def id_from_file(file_name):
(before, middle, after) = file_name.partition(".")
return before
def get(file_name):
id = id_from_file(file_name)
return WRAPPER(**_MAPPING[id])
"""
def _mapping_text(ids):
data_ = []
for id in ids:
data_.append("{id} = wrapper_{id}".format(id = id))
return "_MAPPING = dict(\n{data}\n)".format(data = ",\n".join(data_))
def _load_and_wrapper_text(id, file_path, symbols):
load_list = ", ".join(["{id}_{symbol} = \"{symbol}\"".format(id = id, symbol = symbol_) for symbol_ in symbols])
load_statement = "load(\":{file}\", {list})".format(file = file_path, list = load_list)
data = ", ".join(["{symbol} = {id}_{symbol}".format(id = id, symbol = symbol_) for symbol_ in symbols])
wrapper_statement = "wrapper_{id} = dict({data})".format(id = id, data = data)
return struct(
load_ = load_statement,
wrapper = wrapper_statement,
)
def id_from_file(file_name):
(before, middle, after) = file_name.partition(".")
return before
def get_file_name(file_label):
(before, separator, after) = file_label.partition(":")
return id_from_file(after)
def _copy_file(rctx, src):
src_path = rctx.path(src)
copy_path = src_path.basename
rctx.template(copy_path, src_path)
return copy_path
_BUILD_FILE = """\
exports_files(
[
"toolchain_data_defs.bzl",
],
visibility = ["//visibility:public"],
)
"""
def _generate_overloads(rctx):
symbols = rctx.attr.symbols
ids = []
lines = ["# Generated overload mappings"]
loads = []
wrappers = []
for file_ in rctx.attr.files:
id = id_from_file(file_.name)
ids.append(id)
copy = _copy_file(rctx, file_)
load_and_wrapper = _load_and_wrapper_text(id, copy, symbols)
loads.append(load_and_wrapper.load_)
wrappers.append(load_and_wrapper.wrapper)
lines += loads
lines += wrappers
lines.append(_mapping_text(ids))
lines.append(_provider_text(symbols))
lines.append(_getter_text())
rctx.file("toolchain_data_defs.bzl", "\n".join(lines))
rctx.file("BUILD", _BUILD_FILE)
generate_overloads = repository_rule(
implementation = _generate_overloads,
attrs = {
"symbols": attr.string_list(),
"files": attr.label_list(),
},
)
|
class Solution(object):
def searchMatrix(self, matrix, target):
if not matrix or target is None:
return False
rows, cols = len(matrix), len(matrix[0])
low, high = 0, rows* cols - 1
while low <= high:
mid = (low + high) / 2
num = matrix[mid / cols][mid % cols]
if num == target:
return True
elif num < target:
low = mid + 1
else:
high = mid - 1
matrix = [[1,3,5,7],[10,11,16,20],[23,30,34,50]]
target = 3
res = Solution().searchMatrix(matrix, target)
print(res) |
class SWTestCase:
def __init__(self):
pass
@classmethod
def configure(cls):
pass
def setUp(self):
pass
def tearDown(self):
pass
def run_all_test_case(self):
for test in self.test_to_run:
self.setUp()
test()
self.tearDown()
test_to_run = [] |
def even_odd(*args):
args = list(args)
command = args.pop()
if command == "even":
return [x for x in args if x % 2 == 0]
return [x for x in args if not x % 2 == 0]
print(even_odd(1, 2, 3, 4, 5, 6, "even"))
print(even_odd(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, "odd"))
|
"""werf_chart_repo_doit_tasks - Doit Tasks for managing Werf chart repo"""
__version__ = '1.0.6'
__author__ = 'Ilya Lesikov <[email protected]>'
__all__ = []
|
class UnionFind():
def __init__(self, n) -> None:
self.par = [-1] * n
self.siz = [1] * n
# return root of x
def root(self, x):
if self.par[x] == -1:
return x
else:
self.par[x] = self.root(self.par[x])
return self.par[x]
# return if x and y are in the same group
def issame(self, x, y):
return self.root(x) == self.root(y)
# combine group with x and one with y
def unite(self, x, y):
x = self.root(x)
y = self.root(y)
if x == y:
return False
if self.siz[x] < self.siz[y]:
x, y = y, x
# make y child of x
self.par[y] = x
self.siz[x] += self.siz[y]
return True
def size(self, x):
return self.siz[self.root(x)]
def kruskal(edges, n, id_ommit = -1):
uf = UnionFind(len(edges))
edges_used = []
cost = 0
for i in range(len(edges)):
s, t, w = edges[i][0], edges[i][1], edges[i][2]
if (i != id_ommit) & (not uf.issame(s, t)):
uf.unite(s, t)
edges_used.append(i)
cost += w
if len(edges_used) < n - 1:
cost = 10**13 # INF
return edges_used, cost
def main():
N, M = map(int, input().split())
edges = []
for _ in range(M):
s, t, w = map(int, input().split())
edges.append([s-1, t-1, w])
edges = sorted(edges, key=lambda x: x[2])
mst, cost_mst = kruskal(edges, N)
cnt = 0
cost = 0
for id in mst:
st, cost_st = kruskal(edges, N, id)
if cost_st > cost_mst:
cnt += 1
cost += edges[id][2]
print(str(cnt) + " " + str(cost))
if __name__=='__main__':
main()
|
"""
A custom immutable dictionary data structure
"""
class CustomImmutableDict(dict):
def __getattr__(self, key):
try:
return self[key]
except KeyError as k:
raise AttributeError(k)
def __setattr__(self, key, value):
# self[key] = value
return self._immutable()
def __delattr__(self, key):
return self._immutable()
# try:
# del self[key]
# except KeyError as k:
# raise AttributeError(k)
def __repr__(self):
return '<CustomImmutableDict ' + dict.__repr__(self) + '>'
def __hash__(self):
return id(self)
def _immutable(self, *args, **kws):
raise TypeError('This object is immutable')
__setitem__ = _immutable
__delitem__ = _immutable
clear = _immutable
update = _immutable
setdefault = _immutable
pop = _immutable
popitem = _immutable
|
# Attribute Critter
# Demonstrates creating and accessing object attributes
# Зверюшка с атрибутами
# Демонстрирует создание атрибутов объекта и доступ к ним
class Critter(object):
"""Виртуальный питомец"""
# """A virtual pet"""
def __init__(self, name):
# print("A new critter has been born!")
print("Появилась на свет новая зверюшка!")
self.name = name
def __str__(self):
# rep = "Critter object\n"
# rep += "name: " + self.name + "\n"
rep = "Объект класса Critter\n"
rep += "имя: " + self.name + "\n"
return rep
def talk(self):
# print("Hi. I'm", self.name, "\n")
print("Привет. Меня зовут", self.name, "\n")
# main
crit1 = Critter("Бобик")
crit1.talk()
crit2 = Critter("Мурзик")
crit2.talk()
print("Вывод объекта crit1 на экран:")
print(crit1)
print("Непосредственный доступ к атрибуту crit1.name:")
print(crit1.name)
crit1.years = 10
print("years =", crit1.years)
# input("\n\nPress the enter key to exit.")
|
class Node:
def __init__(self, k, v):
self.key = k
self.val = v
self.pre = None
self.nxt = None
class LRUCache:
def __init__(self, capacity: int):
self.store = {}
self.curCap = 0
self.cap = capacity
self.tail = Node(0, 0)
self.head = Node(0, 0)
self.head.nxt = self.tail
self.tail.pre = self.head
def get(self, key: int) -> int:
if key not in self.store:
return -1
val = self.store[key].val
self._remove(self.store[key])
self._add(Node(key, val))
return val
def put(self, key: int, value: int) -> None:
# remove the original if exists
if key in self.store:
self._remove(self.store[key])
if self.curCap == self.cap:
self._remove(self.tail.pre)
self._add(Node(key, value))
def _remove(self, Node):
p, n = Node.pre, Node.nxt
p.nxt, n.pre = n, p
assert(Node.key in self.store)
del self.store[Node.key]
self.curCap -= 1
def _add(self, Node):
# add a node to the beginning
tmp = self.head.nxt
self.head.nxt = Node
Node.nxt = tmp
tmp.pre = Node
Node.pre = self.head
assert(Node.key not in self.store)
self.store[Node.key] = Node
self.curCap += 1
# Your LRUCache object will be instantiated and called as such:
# obj = LRUCache(capacity)
# param_1 = obj.get(key)
# obj.put(key,value)
|
# Lab 5
'''
G=(V,E)
Let V be the set v0,v1,v2,...
(i.e., with ascending non-negative indices)
and E be the set e0,e1,e2,...
(i.e., with ascending non-negative indices)
'''
class stack:
def __init__(self):
self.lifo = []
def push(self,ele):
self.lifo = self.lifo + [ele]
return True
def pop(self):
if self.lifo == []:
return False
else:
pop_ele = self.lifo[-1]
self.lifo = self.lifo[0:-1]
return pop_ele
def isEmpty(self):
if self.lifo == []:
return True
else:
return False
class queue:
def __init__(self):
self.fifo = []
def push(self,ele):
self.fifo = self.fifo + [ele]
return True
def pop(self):
if self.fifo == []:
return False
else:
pop_ele = self.fifo[0]
self.fifo = self.fifo[1:len(self.fifo)]
return pop_ele
def isEmpty(self):
if self.fifo == []:
return True
else:
return False
class graph:
# create an empty store for the graph, which will be an adjacency list
def __init__(self):
self.store = []
# add "n" vertices to the graph
# return the value of the final number of vertices in the graph
# if there is an error return -1
def addVertex(self,n):
if (n <= 0):
return -1
for i in range (0,n):
self.store = self.store + [[]]
return len(self.store)
# from_idx and to_idx are nonnegative integers
# directed is either True or False
# weight is any integer other than 0
# this function adds an edge (a directed edge if directed==True, otherwise an undirected edge) from vertex<from_idx> to vertex<to_idx> with "weight"
# if there is an error return False, else True
def addEdge(self,from_idx,to_idx,directed,weight):
if (from_idx not in range (0,len(self.store))) or (to_idx not in range (0,len(self.store))) or type(directed) != bool or weight == 0:
return False
self.store[from_idx] = self.store[from_idx] + [[to_idx,weight]]
if directed == False:
self.store[to_idx] = self.store[to_idx] + [[from_idx,weight]]
return True
# return a list obtained from a breadth (typeBreadth==True) or depth (typeBreadth==False) traversal of the graph
# breadth traversal uses queue
# depth traversal uses stack
# if there is an error, return an empty list
# return a list consisting of all nodes visited via the traversal
# if start is set, this will be one list
# if start is not set, this will be a list of lists
def traverse(self,start,typeBreadth):
# initialize C to empty
if typeBreadth == True: # breadth traversal
C = queue()
elif typeBreadth == False: # depth traversal
C = stack()
else:
return []
while C.isEmpty == False:
C.pop()
# initialize Discovered and Processed to have as many slots as there are v in V
# set all slots of Discovered and Processed to be False
Discovered = []
Processed = []
for i in range (0,len(self.store)):
Discovered += [False]
Processed += [False]
rlist = []
V = []
# if start==None->traversal must traverse the entire graph
if start == None:
V = list(range(0,len(self.store)))
# if start is integer in range of graph vertices indices, traversal is only to vertices that are connected to it
elif type(start) == int:
if start not in range (0,len(self.store)):
return []
V = [start]
else:
return []
for v in V:
sublist = []
if Discovered[v] == False:
C.push(v)
Discovered[v] = True
w = C.pop()
while (type(w) == int):
if (Processed[w] == False):
sublist = sublist + [w]
Processed[w] = True
# for x = all vertices adjacent to w
for x in self.store[w]:
if Discovered[x[0]] == False:
C.push(x[0])
Discovered[x[0]] = True
w = C.pop()
if start == None:
rlist = rlist + [sublist]
else:
rlist = rlist + sublist
return rlist
# return a 2-list
# element[0] is True if there is a path from vx to vy, else False
# element[1] is True if there is a path from vy to vx, else False
def connectivity(self,vx,vy):
rlist = [False,False]
for i in self.traverse(vx,False):
if (i == vy):
rlist[0] = True
for i in self.traverse(vy,False):
if (i == vx):
rlist[1] = True
return rlist
# return a 2-list
# element[0] is a list of vertices from vx to vy, if there is a path, otherwise []
# element[1] is a list of vertices from vy to vx, if there is a path, otherwise []
# include endpoints
def path(self,vx,vy):
rlist = [[],[]]
if (self.connectivity(vx,vy)[0] == True):
rlist[0] = self.helper_path(vx,vy,[])
if (self.connectivity(vx,vy)[1] == True):
rlist[1] = self.helper_path(vy,vx,[])
return rlist
def helper_path(self,vx,vy,temp_list):
found = False
if (vx == vy):
temp_list += [vx]
return temp_list
vy_idx = -1
cnt = 0
for i in self.traverse(vx,False):
if (i == vy):
found = True
vy_idx = cnt
break
cnt+=1
# find the last directly connected vertex to vx on path to vy
last_idx = -1
for i in range(0,len(self.traverse(vx,False))):
for j in range(0,len(self.store[vx])):
if (self.traverse(vx,False)[i] == self.store[vx][j]) and (i<vy_idx):
if (i > last_idx):
last_idx = i
else:
break
# add all elements in depth search from last directly connected to vy to vy to path
for i in range(last_idx+1,vy_idx):
if (self.connectivity(self.traverse(vx,False)[i],vy)[0] == True):
temp_list += [self.traverse(vx,False)[i]]
temp_list += [self.traverse(vx,False)[vy_idx]]
return temp_list
|
# omnibool.py
# https://www.codewars.com/kata/5a5f9f80f5dc3f942b002309/train/python
class Omnibool():
def __eq__(self, x):
return True
if __name__ == "__main__":
omnibool = Omnibool()
print(omnibool == True and omnibool == False)
|
def get_test_accounts() -> dict:
return {
'development': {
'color': '#388E3C',
'team': 'awesome-team',
'region': 'us-east-1',
'profiles': [
{
'profile': 'developer',
'account': '123495678901',
'role': 'developer',
'default': 'true',
},
{
'profile': 'readonly',
'account': '012349567890',
'role': 'readonly',
}
]
},
'live': {
'color': '#388E3C',
'team': 'awesome-team',
'region': 'us-east-1',
'profiles': [
{
'profile': 'developer',
'account': '123456789012',
'role': 'developer',
'default': 'true',
},
{
'profile': 'readonly',
'account': '012345678901',
'role': 'readonly',
}
]
}
}
def get_test_group():
return {
'color': '#388E3C',
'team': 'awesome-team',
'region': 'us-east-1',
'profiles': [
{
'profile': 'developer',
'account': '123456789012',
'role': 'developer',
},
{
'profile': 'readonly',
'account': '012345678901',
'role': 'readonly',
'default': 'true',
}
]
}
def get_test_group_no_default():
return {
'color': '#388E3C',
'team': 'awesome-team',
'region': 'us-east-1',
'profiles': [
{
'profile': 'developer',
'account': '123456789012',
'role': 'developer',
},
{
'profile': 'readonly',
'account': '012345678901',
'role': 'readonly'
}
]
}
def get_test_group_chain_assume():
return {
'color': '#388E3C',
'team': 'awesome-team',
'region': 'us-east-1',
'profiles': [
{
'profile': 'developer',
'account': '123456789012',
'role': 'developer',
},
{
'profile': 'service',
'account': '012345678901',
'role': 'service',
'source': 'developer'
}
]
}
def get_test_profile():
return {
'profile': 'readonly',
'account': '123456789012',
'role': 'readonly-role',
'default': 'true',
}
def get_test_profile_no_default():
return {
'profile': 'readonly',
'account': '123456789012',
'role': 'readonly-role',
}
|
'''
Created on 2016年7月27日
@author: Administrator
元组：tuple。tuple和list非常类似，但是tuple一旦初始化就不能修改
'''
classmates = ('Michael', 'Bob', 'Tracy')
print(classmates)
print(len(classmates))
print(classmates[0])
print(classmates[-1])
#只有1个元素的tuple定义时必须加一个逗号,，来消除歧义
t = (1,)
print(t)
t = ('a', 'b', ['A', 'B'])
t[2][0] = 'X'
t[2][1] = 'Y'
print(t) |
def NoC():
paid = int(input())
moneyL = [500, 100, 50, 10, 5, 1]
count = 0
leftOver = 1000 - paid
for each in moneyL:
n = leftOver//each
if n > 0:
count += n
leftOver -= n * each
elif n == 0:
pass
return count
print(NoC()) |
class SourceDto:
"""Data transfer object class for Source-type Airbyte abstractions"""
def __init__(self):
self.source_definition_id = None
self.source_id = None
self.workspace_id = None
self.connection_configuration = {}
self.name = None
self.source_name = None
self.tag = None
def to_payload(self):
"""sends this dto object to a dict formatted as a payload"""
r = {}
r['sourceDefinitionId'] = self.source_definition_id
r['sourceId'] = self.source_id
r['workspaceId'] = self.workspace_id
r['connectionConfiguration'] = self.connection_configuration
r['name'] = self.name
r['sourceName'] = self.source_name
return r
class DestinationDto:
"""Data transfer object class for Destination-type Airbyte abstractions"""
def __init__(self):
self.destination_definition_id = None
self.destination_id = None
self.workspace_id = None
self.connection_configuration = {}
self.name = None
self.destination_name = None
self.tag = None
def to_payload(self):
"""sends this dto object to a dict formatted as a payload"""
r = {}
r['destinationDefinitionId'] = self.destination_definition_id
r['destinationId'] = self.destination_id
r['workspaceId'] = self.workspace_id
r['connectionConfiguration'] = self.connection_configuration
r['name'] = self.name
r['destinationName'] = self.destination_name
return r
class ConnectionDto:
"""Data transfer object class for Connection-type Airbyte abstractions"""
def __init__(self):
self.connection_id = None
self.name = None
self.prefix = None
self.source_id = None
self.destination_id = None
self.sync_catalog = {} # sync_catalog['streams'] is a list of dicts {stream:, config:}
self.schedule = {}
self.status = None
def to_payload(self):
pass # TODO: implement the to_payload method
class StreamDto:
"""Data transfer object class for the stream, belongs to the connection abstraction"""
def __init__(self):
self.name = None
self.json_schema = {}
self.supported_sync_modes = []
self.source_defined_cursor = None
self.default_cursor_field = []
self.source_defined_primary_key = []
self.namespace = None
class StreamConfigDto:
"""Data transfer object class for the stream configuration, belongs to the connection abstraction"""
def __init__(self):
self.sync_mode = None
self.cursor_field = []
self.destination_sync_mode = None
self.primary_key = []
self.alias_name = None
self.selected = None
class WorkspaaceDto:
"""Data transfer object class for Workspace-type Airbyte abstractions"""
def __init__(self):
pass
class AirbyteDtoFactory:
"""
Builds data transfer objects, each representing an abstraction inside the Airbyte architecture
"""
def __init__(self, source_definitions, destination_definitions):
self.source_definitions = source_definitions
self.destination_definitions = destination_definitions
def populate_secrets(self, secrets, new_dtos):
# TODO: Find a better way to deal with unpredictably named secrets
if 'sources' in new_dtos:
for source in new_dtos['sources']:
if source.source_name in secrets['sources']:
if 'access_token' in source.connection_configuration:
source.connection_configuration['access_token'] = secrets['sources'][source.source_name]['access_token']
elif 'token' in source.connection_configuration:
source.connection_configuration['token'] = secrets['sources'][source.source_name]['token']
if 'destinations' in new_dtos:
for destination in new_dtos['destinations']:
if destination.destination_name in secrets['destinations']:
if 'password' in destination.connection_configuration:
destination.connection_configuration['password'] = secrets['destinations'][destination.destination_name]['password']
def build_source_dto(self, source: dict) -> SourceDto:
"""
Builds a SourceDto object from a dict representing a source
"""
r = SourceDto()
r.connection_configuration = source['connectionConfiguration']
r.name = source['name']
r.source_name = source['sourceName']
if 'sourceDefinitionId' in source:
r.source_definition_id = source['sourceDefinitionId']
else:
for definition in self.source_definitions['sourceDefinitions']:
if r.source_name == definition['name']:
r.source_definition_id = definition['sourceDefinitionId']
if 'sourceId' in source:
r.source_id = source['sourceId']
if 'workspaceId' in source:
r.workspace_id = source['workspaceId']
if 'tag' in source:
r.tag = source['tag']
# TODO: check for validity?
return r
def build_destination_dto(self, destination):
r = DestinationDto()
r.connection_configuration = destination['connectionConfiguration']
r.destination_name = destination['destinationName']
r.name = destination['name']
if 'destinationDefinitionId' in destination:
r.destination_definition_id = destination['destinationDefinitionId']
else:
for definition in self.destination_definitions['destinationDefinitions']:
if r.destination_name == definition['name']:
r.destination_definition_id = definition['destinationDefinitionId']
if 'destinationId' in destination:
r.destination_id = destination['destinationId']
if 'workspaceId' in destination:
r.workspace_id = destination['workspaceId']
if 'tag' in destination:
r.tag = destination['tag']
# TODO: check for validity?
return r
def build_connection_dto(self, connection):
r = ConnectionDto()
r.connection_id = connection['connectionId']
r.name = connection['name']
r.prefix = connection['prefix']
r.source_id = connection['sourceId']
r.destination_id = connection['destinationId']
r.sync_catalog = connection['syncCatalog']
r.schedule = connection['schedule']
r.status = connection['status']
# TODO: check for validity?
return r |
def get_average(g):
return sum(g) / len(g)
n = int(input())
students_record = {}
for _ in range(n):
student, grade = input().split()
if student not in students_record:
students_record[student] = []
students_record[student].append(float(grade))
for s, g in students_record.items():
average = get_average(g)
grades = ' '.join(f"{x:.2f}" for x in g)
print(f"{s} -> {grades} (avg: {average:.2f})")
|
names = ["Alan", "Bruce", "Carlos", "David", "Emma"]
scores = [90, 80, 85, 92, 81]
for name in names:
print("hello, %s!" % name)
|
"""
This module takes an adapter as data supplier, pack data and provide data for data iterators
"""
class ProviderBaseclass(object):
"""
This is the baseclass of packer. Any other detailed packer must inherit this class.
"""
def __init__(self):
pass
def __str__(self):
return self.__class__.__name__
def __del__(self):
pass
def write(self):
"""
Write a single sample to the files
:return:
"""
raise NotImplementedError()
def read_by_index(self, index):
"""
Read a single sample
:return:
"""
raise NotImplementedError()
if __name__ == '__main__':
provider = ProviderBaseclass()
print(provider)
|
def insertShiftArray(arr, num):
count = len(arr)
middle = len(arr) // 2
shift_arr = []
for i in range(count):
if i != middle:
shift_arr.append(arr[i])
else:
if count % 2 == 0:
shift_arr.append(num)
shift_arr.append(arr[i])
else:
shift_arr.append(arr[i])
shift_arr.append(num)
return shift_arr
|
"""Reusable unique item gatherer. Returns unique values with optional list_in and blacklists"""
class GatherUnique:
"""
Reusable unique item gatherer. Returns unique values with optional list_in and blacklists
"""
def __init__(self):
self._header = ''
"""Optional header to display to user when gathering entries stdin"""
self._list_in = []
"""optional input parameter, in lieu of stdin prompting"""
self._gathered = []
"""Unique items reconciled against potential blacklist(s)"""
self._black_lists = []
"""Optional list(s) of items to verify against"""
def _reset(self):
"""
Reset attributes
"""
self._header = ''
self._list_in.clear()
self._black_lists.clear()
self._gathered.clear()
def _not_in_args(self, item) -> bool:
"""
Check given item against black lists
"""
for black_list in self._black_lists:
if item in black_list:
return False
return True
def _gather_from_stdin(self) -> None:
"""
Gathers input from user, split by newline. Runs until blank line submitted.
Sorts against blacklists into _gathered
"""
print("\n" + self._header + "\n")
prompt: str = None
while prompt != '':
prompt = input('> ').lower().strip()
if prompt != '' and prompt not in self._gathered and self._not_in_args(prompt):
self._gathered.append(prompt)
def _gather_from_list_in(self):
"""
Gathers items from given list_in, sorts against blacklists into _gathered
"""
for item in self._list_in:
if item not in self._gathered and self._not_in_args(item):
self._gathered.append(item)
def _return_gathered(self) -> list:
"""
Returns gathered list, resets working attributes
"""
# Save gathered, clear attributes, return
to_return = self._gathered.copy()
self._reset()
return to_return
def run(self,
header: str = '', list_in: list = None,
**blacklists) -> list:
"""
Gathers a list of unique entries from user, with optional blacklists and header prompt
Note: Item type depends on gathering method. If using stdin, anticipate string returns.
Otherwise, use list_in
Args:
header: Header prompt to display to user on startup.
list_in: An optional input parameter. Feeding a list bypasses stdin, and straight to
unique list generation. If black lists are provided, reconciles against them.
blacklists: Optional *kwargs for one or more blacklists to check entires against.
Returned list will not contain any blacklisted entries. (Note: kwargs used only for
flexible positioning. Arg names literally do not matter)
Returns:
Unique list of values, either from stdin or list_in arg
"""
# Assign running attributes
self._header = header
self._list_in = list_in
for blist in blacklists.values():
self._black_lists.append(blist)
if list_in:
self._gather_from_list_in()
else:
self._gather_from_stdin()
return self._return_gathered()
|
"""
consensys_utils.flask.config
~~~~~~~~~~~~~~~~~~~~~~~~~~~~
App configuration
:copyright: Copyright 2017 by ConsenSys France.
:license: BSD, see :ref:`license` for more details.
"""
def set_app_config(app, config=None):
"""Set application configuration
:param app: Flask application
:type app: :class:`flask.Flask`
:param config: Optional Application configuration
:type config: dict
"""
if config:
app.config.update(config)
|
# Carve
# sigs = [255,214,124,179,233]
# msks = [0,9,3,12,6]
# Door
# sigs = [192,48]
# msks = [15,15]
# Freestanding
# sigs=[0,0,0,0,16,64,32,128,161,104,84,146]
# msks=[8,4,2,1,6,12,9,3,10,5,10,5]
# Walls
sigs=[251,233,253,84,146,80,16,144,112,208,241,248,210,177,225,120,179,0,124,104,161,64,240,128,224,176,242,244,116,232,178,212,247,214,254,192,48,96,32,160,245,250,243,249,246,252]
msks=[0,6,0,11,13,11,15,13,3,9,0,0,9,12,6,3,12,15,3,7,14,15,0,15,6,12,0,0,3,6,12,9,0,9,0,15,15,7,15,14,0,0,0,0,0,0]
l = len(sigs)
rows = [[0, 5, 3], [7, 8, 6], [1, 4, 2]]
for i in range(len(sigs)):
s = f'{sigs[i]}/{msks[i]}'
s += ' ' * (8 - len(s))
print(s, end='')
print('\n' + '-----' * l + '---' * (l-1))
for row in rows:
s = ''
for i in range(len(sigs)):
for col in row:
sig = sigs[i]
msk = msks[i]
if msk & (1<<col):
s += '* '
elif sig & (1<<col):
s += '1 '
else:
s += '0 '
s += ' '
print(s)
for i in range(len(sigs)):
sigs[i] |= msks[i]
print(sigs)
|
# -*- coding: utf-8 -*-
"""
authors: Dawud Hage, Joost Meulenbeld, Joost Dorscheidt and Dennis van der Hoff
written for the NN course IN4015 of the TUDelft
"""
##### SETTINGS: #####
# Number of epochs to train the network over
n_epoch = 0
# Folder where the training superbatches are stored
training_folder= 'selection'
# Folder where the validation superbatches are stored
validation_folder= 'selection'
# The colorspace to run the NN in
colorspace= 'CIELab'
# Parameter folder where the parameter files are stored
param_folder = 'params_final_final'
# Parameter file to initialize the network with (do not add .npy), None for no file
param_file = 'params_fruit_Compact_more_end_fmaps_dilation_k10_T02_sigma5_nbins20_labda_03_gridsize10_epoch_25.0'
# Parameter file to save the trained parameters to every epoch (do not add .npy), None for no file
param_save_file = 'params_fruit_Compact_more_end_fmaps_dilation_k10_T02_sigma5_nbins20_labda_03_gridsize10_epoch_25.0'
# error folder where the error files are stored
error_folder = 'errors_final'
# Error file to append with the new training and validation errors (do not add .npy), None dont save
error_file = 'errors_fruit_Compact_more_end_fmaps_classifier_k10_T02_sigma5_nbins20_labda_03_gridsize10_epoch22'
# The architecture to use, can be 'Dahl' or 'Compact' or 'Compact_more_end_fmaps' or 'Dahl_classifier' or 'Dahl_Zhang' or 'Dahl_Zhang_NO_VGG16' or 'Compact_more_end_fmaps_classifier'
architecture= 'Compact_more_end_fmaps_dilation'
# Blur radius
sigma = 3;
# Turn on classification
classification=True
# Colorbin settings:
colorbins_k = 10 # k nearers neughbours
colorbins_T = 0.4 # Temperature
colorbins_sigma = 5 # K nearest neighbour sigma (blur the distance to the bin)
colorbins_nbins = 20 # Number of colorbins
colorbins_labda = 0.5 # Uniform distributie mix factor
colorbins_gridsize=10
|
#
# PySNMP MIB module ZONE-DEFENSE-MGMT-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/ZONE-DEFENSE-MGMT-MIB
# Produced by pysmi-0.3.4 at Wed May 1 15:48:06 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsUnion, ConstraintsIntersection, SingleValueConstraint, ValueSizeConstraint, ValueRangeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ConstraintsIntersection", "SingleValueConstraint", "ValueSizeConstraint", "ValueRangeConstraint")
dlink_common_mgmt, = mibBuilder.importSymbols("DLINK-ID-REC-MIB", "dlink-common-mgmt")
NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ModuleCompliance")
iso, ObjectIdentity, Integer32, MibIdentifier, Counter64, ModuleIdentity, Counter32, TimeTicks, IpAddress, Gauge32, Unsigned32, MibScalar, MibTable, MibTableRow, MibTableColumn, Bits, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "iso", "ObjectIdentity", "Integer32", "MibIdentifier", "Counter64", "ModuleIdentity", "Counter32", "TimeTicks", "IpAddress", "Gauge32", "Unsigned32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Bits", "NotificationType")
DisplayString, RowStatus, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "RowStatus", "TextualConvention")
swZoneDefenseMIB = ModuleIdentity((1, 3, 6, 1, 4, 1, 171, 12, 92))
if mibBuilder.loadTexts: swZoneDefenseMIB.setLastUpdated('1004120000Z')
if mibBuilder.loadTexts: swZoneDefenseMIB.setOrganization('D-Link Corp.')
if mibBuilder.loadTexts: swZoneDefenseMIB.setContactInfo('http://support.dlink.com')
if mibBuilder.loadTexts: swZoneDefenseMIB.setDescription('The Structure of Zone Defense management for the proprietary enterprise.')
swZoneDefenseMIBObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 171, 12, 92, 1))
swZoneDefenseTable = MibTable((1, 3, 6, 1, 4, 1, 171, 12, 92, 1, 1), )
if mibBuilder.loadTexts: swZoneDefenseTable.setStatus('current')
if mibBuilder.loadTexts: swZoneDefenseTable.setDescription('This table is used to create or delete Zone Defense ACL rules. The rules for Zone Defense should have the highest priority of all ACL rules.')
swZoneDefenseEntry = MibTableRow((1, 3, 6, 1, 4, 1, 171, 12, 92, 1, 1, 1), ).setIndexNames((0, "ZONE-DEFENSE-MGMT-MIB", "swZoneDefenseAddress"))
if mibBuilder.loadTexts: swZoneDefenseEntry.setStatus('current')
if mibBuilder.loadTexts: swZoneDefenseEntry.setDescription('Information about the Zone Defense ACL rule.')
swZoneDefenseAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 171, 12, 92, 1, 1, 1, 1), IpAddress())
if mibBuilder.loadTexts: swZoneDefenseAddress.setStatus('current')
if mibBuilder.loadTexts: swZoneDefenseAddress.setDescription('The IP address which will be blocked by the ACL.')
swZoneDefenseRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 171, 12, 92, 1, 1, 1, 2), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: swZoneDefenseRowStatus.setStatus('current')
if mibBuilder.loadTexts: swZoneDefenseRowStatus.setDescription('This object indicates the status of this entry.')
mibBuilder.exportSymbols("ZONE-DEFENSE-MGMT-MIB", PYSNMP_MODULE_ID=swZoneDefenseMIB, swZoneDefenseMIBObjects=swZoneDefenseMIBObjects, swZoneDefenseTable=swZoneDefenseTable, swZoneDefenseEntry=swZoneDefenseEntry, swZoneDefenseRowStatus=swZoneDefenseRowStatus, swZoneDefenseMIB=swZoneDefenseMIB, swZoneDefenseAddress=swZoneDefenseAddress)
|
class ToolStripItemEventArgs(EventArgs):
"""
Provides data for System.Windows.Forms.ToolStripItem events.
ToolStripItemEventArgs(item: ToolStripItem)
"""
def __getitem__(self, *args):
""" x.__getitem__(y) <==> x[y] """
pass
@staticmethod
def __new__(self, item):
""" __new__(cls: type,item: ToolStripItem) """
pass
Item = property(lambda self: object(), lambda self, v: None, lambda self: None)
"""Gets a System.Windows.Forms.ToolStripItem for which to handle events.
Get: Item(self: ToolStripItemEventArgs) -> ToolStripItem
"""
|
#!/usr/bin/env python3
# Copyright (c) Facebook, Inc. and its affiliates. All rights reserved.
class ClassPropertyDescriptor:
def __init__(self, fget):
self.fget = fget
def __get__(self, obj, klass=None):
if klass is None:
klass = type(obj)
return self.fget.__get__(obj, klass)()
def classproperty(func):
"""
Allow for getter property usage on classmethods
cf: https://stackoverflow.com/questions/5189699/how-to-make-a-class-property
"""
if not isinstance(func, (classmethod, staticmethod)):
func = classmethod(func)
return ClassPropertyDescriptor(func)
|
print('4. testing integrated scan functions:')
print('testing xanes')
xanes(erange = [7112-30, 7112-20, 7112+30],
estep = [2, 5],
harmonic = None,
acqtime=0.2, roinum=1, i0scale = 1e8, itscale = 1e8,samplename='test',filename='test')
|
class CouldNotConfigureException(BaseException):
def __str__(self):
return "Could not configure the repository."
class NotABinaryExecutableException(BaseException):
def __str__(self):
return "The file given is not a binary executable"
class ParametersNotAcceptedException(BaseException):
def __str__(self):
return "The search parameters given were not accepted by the github api"
class NoCoverageInformation(BaseException):
def __init__(self, binary_path):
self.binary_path = binary_path
def __str__(self):
return "Could not get any coverage information for " + str(self.binary_path)
|
'''
8-10. Sending Messages: Start with a copy of your program from Exercise 8-9.
Write a function called send_messages() that prints each text message and moves each message to a new list called sent_messages as it’s printed.
After calling the function, print both of your lists to make sure the messages were moved correctly.
'''
def send_messages(short_message):
sent_messages=[]
while short_message:
current_message = short_message.pop()
sent_messages.append(current_message)
print(f'Original list {short_message}')
print(f'Updated List {sent_messages}')
messages = ['apple','mango','guava']
print(send_messages(messages))
'''
def send_messages(short_list,sent_messages):
while short_list:
curent_message = short_list.pop()
print(f'THe item {curent_message} is now removed from short_list')
sent_messages.append(curent_message)
def printitng_messages(sent_messages):
for sent_message in sent_messages:
print(sent_message)
messages = ['monitor','mouse','laptop','keyboard']
sent_messages = []
send_messages(messages,sent_messages)
printitng_messages(sent_messages)
''' |
class Solution:
def maxProfit(self, prices):
"""
:type prices: List[int]
:rtype: int
"""
n = len(prices) #从图像上来看更好解决，最大盈利是吃到每一个波谷到波峰
if n <= 1:
return 0
count = 0
i = 1
while i != n:
diff = max((prices[i] - prices[i - 1]),0)
count += diff
i += 1
return count
|
#
# PySNMP MIB module Nortel-MsCarrier-MscPassport-BaseSnmpMIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/Nortel-MsCarrier-MscPassport-BaseSnmpMIB
# Produced by pysmi-0.3.4 at Mon Apr 29 20:19:57 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, ObjectIdentifier, OctetString = mibBuilder.importSymbols("ASN1", "Integer", "ObjectIdentifier", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueRangeConstraint, SingleValueConstraint, ConstraintsUnion, ValueSizeConstraint, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "SingleValueConstraint", "ConstraintsUnion", "ValueSizeConstraint", "ConstraintsIntersection")
DisplayString, TruthValue, RowStatus, Status, StorageType, Integer32, Unsigned32 = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-StandardTextualConventionsMIB", "DisplayString", "TruthValue", "RowStatus", "Status", "StorageType", "Integer32", "Unsigned32")
AsciiString, HexString, NonReplicated = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-TextualConventionsMIB", "AsciiString", "HexString", "NonReplicated")
mscPassportMIBs, = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-UsefulDefinitionsMIB", "mscPassportMIBs")
mscVr, mscVrIndex = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVr", "mscVrIndex")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
ObjectIdentity, iso, IpAddress, Counter32, Gauge32, ModuleIdentity, Counter64, TimeTicks, Unsigned32, MibIdentifier, Bits, Integer32, MibScalar, MibTable, MibTableRow, MibTableColumn, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "ObjectIdentity", "iso", "IpAddress", "Counter32", "Gauge32", "ModuleIdentity", "Counter64", "TimeTicks", "Unsigned32", "MibIdentifier", "Bits", "Integer32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "NotificationType")
TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString")
baseSnmpMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36))
mscVrSnmp = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8))
mscVrSnmpRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 1), )
if mibBuilder.loadTexts: mscVrSnmpRowStatusTable.setStatus('mandatory')
mscVrSnmpRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"))
if mibBuilder.loadTexts: mscVrSnmpRowStatusEntry.setStatus('mandatory')
mscVrSnmpRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpRowStatus.setStatus('mandatory')
mscVrSnmpComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpComponentName.setStatus('mandatory')
mscVrSnmpStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpStorageType.setStatus('mandatory')
mscVrSnmpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscVrSnmpIndex.setStatus('mandatory')
mscVrSnmpProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 20), )
if mibBuilder.loadTexts: mscVrSnmpProvTable.setStatus('mandatory')
mscVrSnmpProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 20, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"))
if mibBuilder.loadTexts: mscVrSnmpProvEntry.setStatus('mandatory')
mscVrSnmpV1EnableAuthenTraps = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 20, 1, 1), Status()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpV1EnableAuthenTraps.setStatus('mandatory')
mscVrSnmpV2EnableAuthenTraps = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 20, 1, 2), Status()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpV2EnableAuthenTraps.setStatus('mandatory')
mscVrSnmpAlarmsAsTraps = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 20, 1, 3), Status()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpAlarmsAsTraps.setStatus('mandatory')
mscVrSnmpIpStack = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 20, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("vrIp", 1), ("ipiFrIpiVc", 2))).clone('vrIp')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpIpStack.setStatus('mandatory')
mscVrSnmpCidInEntTraps = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 20, 1, 5), Status()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpCidInEntTraps.setStatus('mandatory')
mscVrSnmpStateTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21), )
if mibBuilder.loadTexts: mscVrSnmpStateTable.setStatus('mandatory')
mscVrSnmpStateEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"))
if mibBuilder.loadTexts: mscVrSnmpStateEntry.setStatus('mandatory')
mscVrSnmpAdminState = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("locked", 0), ("unlocked", 1), ("shuttingDown", 2))).clone('unlocked')).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpAdminState.setStatus('mandatory')
mscVrSnmpOperationalState = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("disabled", 0), ("enabled", 1))).clone('disabled')).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpOperationalState.setStatus('mandatory')
mscVrSnmpUsageState = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("idle", 0), ("active", 1), ("busy", 2))).clone('idle')).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpUsageState.setStatus('mandatory')
mscVrSnmpAvailabilityStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 4), OctetString().subtype(subtypeSpec=ValueSizeConstraint(2, 2)).setFixedLength(2)).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpAvailabilityStatus.setStatus('mandatory')
mscVrSnmpProceduralStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 5), OctetString().subtype(subtypeSpec=ValueSizeConstraint(1, 1)).setFixedLength(1)).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpProceduralStatus.setStatus('mandatory')
mscVrSnmpControlStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 6), OctetString().subtype(subtypeSpec=ValueSizeConstraint(1, 1)).setFixedLength(1)).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpControlStatus.setStatus('mandatory')
mscVrSnmpAlarmStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 7), OctetString().subtype(subtypeSpec=ValueSizeConstraint(1, 1)).setFixedLength(1)).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpAlarmStatus.setStatus('mandatory')
mscVrSnmpStandbyStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 8), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 15))).clone(namedValues=NamedValues(("hotStandby", 0), ("coldStandby", 1), ("providingService", 2), ("notSet", 15))).clone('notSet')).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpStandbyStatus.setStatus('mandatory')
mscVrSnmpUnknownStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 21, 1, 9), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("false", 0), ("true", 1))).clone('false')).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpUnknownStatus.setStatus('mandatory')
mscVrSnmpStatsTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 22), )
if mibBuilder.loadTexts: mscVrSnmpStatsTable.setStatus('mandatory')
mscVrSnmpStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 22, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"))
if mibBuilder.loadTexts: mscVrSnmpStatsEntry.setStatus('mandatory')
mscVrSnmpLastOrChange = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 22, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpLastOrChange.setStatus('mandatory')
mscVrSnmpTrapsProcessed = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 22, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpTrapsProcessed.setStatus('mandatory')
mscVrSnmpTrapsDiscarded = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 22, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpTrapsDiscarded.setStatus('mandatory')
mscVrSnmpLastAuthFailure = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 22, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpLastAuthFailure.setStatus('mandatory')
mscVrSnmpMgrOfLastAuthFailure = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 22, 1, 5), IpAddress().clone(hexValue="00000000")).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMgrOfLastAuthFailure.setStatus('mandatory')
mscVrSnmpSys = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2))
mscVrSnmpSysRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 1), )
if mibBuilder.loadTexts: mscVrSnmpSysRowStatusTable.setStatus('mandatory')
mscVrSnmpSysRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpSysIndex"))
if mibBuilder.loadTexts: mscVrSnmpSysRowStatusEntry.setStatus('mandatory')
mscVrSnmpSysRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 1, 1, 1), RowStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpSysRowStatus.setStatus('mandatory')
mscVrSnmpSysComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpSysComponentName.setStatus('mandatory')
mscVrSnmpSysStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpSysStorageType.setStatus('mandatory')
mscVrSnmpSysIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscVrSnmpSysIndex.setStatus('mandatory')
mscVrSnmpSysProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 10), )
if mibBuilder.loadTexts: mscVrSnmpSysProvTable.setStatus('mandatory')
mscVrSnmpSysProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpSysIndex"))
if mibBuilder.loadTexts: mscVrSnmpSysProvEntry.setStatus('mandatory')
mscVrSnmpSysContact = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 10, 1, 1), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpSysContact.setStatus('mandatory')
mscVrSnmpSysName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 10, 1, 2), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpSysName.setStatus('mandatory')
mscVrSnmpSysLocation = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 10, 1, 3), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpSysLocation.setStatus('mandatory')
mscVrSnmpSysOpTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 11), )
if mibBuilder.loadTexts: mscVrSnmpSysOpTable.setStatus('mandatory')
mscVrSnmpSysOpEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 11, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpSysIndex"))
if mibBuilder.loadTexts: mscVrSnmpSysOpEntry.setStatus('mandatory')
mscVrSnmpSysDescription = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 11, 1, 1), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpSysDescription.setStatus('mandatory')
mscVrSnmpSysObjectId = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 11, 1, 2), ObjectIdentifier()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpSysObjectId.setStatus('mandatory')
mscVrSnmpSysUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 11, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpSysUpTime.setStatus('mandatory')
mscVrSnmpSysServices = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 2, 11, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 127)).clone(6)).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpSysServices.setStatus('mandatory')
mscVrSnmpCom = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3))
mscVrSnmpComRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 1), )
if mibBuilder.loadTexts: mscVrSnmpComRowStatusTable.setStatus('mandatory')
mscVrSnmpComRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpComIndex"))
if mibBuilder.loadTexts: mscVrSnmpComRowStatusEntry.setStatus('mandatory')
mscVrSnmpComRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComRowStatus.setStatus('mandatory')
mscVrSnmpComComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpComComponentName.setStatus('mandatory')
mscVrSnmpComStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpComStorageType.setStatus('mandatory')
mscVrSnmpComIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 1, 1, 10), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024)))
if mibBuilder.loadTexts: mscVrSnmpComIndex.setStatus('mandatory')
mscVrSnmpComProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 10), )
if mibBuilder.loadTexts: mscVrSnmpComProvTable.setStatus('mandatory')
mscVrSnmpComProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpComIndex"))
if mibBuilder.loadTexts: mscVrSnmpComProvEntry.setStatus('mandatory')
mscVrSnmpComCommunityString = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 10, 1, 1), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(1, 255)).clone(hexValue="7075626c6963")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComCommunityString.setStatus('mandatory')
mscVrSnmpComAccessMode = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 10, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("readOnly", 1), ("readWrite", 2))).clone('readOnly')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComAccessMode.setStatus('mandatory')
mscVrSnmpComViewIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 10, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComViewIndex.setStatus('mandatory')
mscVrSnmpComTDomain = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 10, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("snmpUdpDomain", 1))).clone('snmpUdpDomain')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComTDomain.setStatus('mandatory')
mscVrSnmpComMan = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2))
mscVrSnmpComManRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 1), )
if mibBuilder.loadTexts: mscVrSnmpComManRowStatusTable.setStatus('mandatory')
mscVrSnmpComManRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpComIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpComManIndex"))
if mibBuilder.loadTexts: mscVrSnmpComManRowStatusEntry.setStatus('mandatory')
mscVrSnmpComManRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComManRowStatus.setStatus('mandatory')
mscVrSnmpComManComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpComManComponentName.setStatus('mandatory')
mscVrSnmpComManStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpComManStorageType.setStatus('mandatory')
mscVrSnmpComManIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 1, 1, 10), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 100)))
if mibBuilder.loadTexts: mscVrSnmpComManIndex.setStatus('mandatory')
mscVrSnmpComManProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 10), )
if mibBuilder.loadTexts: mscVrSnmpComManProvTable.setStatus('mandatory')
mscVrSnmpComManProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpComIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpComManIndex"))
if mibBuilder.loadTexts: mscVrSnmpComManProvEntry.setStatus('mandatory')
mscVrSnmpComManTransportAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 10, 1, 1), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(1, 100))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComManTransportAddress.setStatus('mandatory')
mscVrSnmpComManPrivileges = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 3, 2, 10, 1, 2), OctetString().subtype(subtypeSpec=ValueSizeConstraint(1, 1)).setFixedLength(1).clone(hexValue="40")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpComManPrivileges.setStatus('mandatory')
mscVrSnmpAcl = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4))
mscVrSnmpAclRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1), )
if mibBuilder.loadTexts: mscVrSnmpAclRowStatusTable.setStatus('obsolete')
mscVrSnmpAclRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpAclTargetIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpAclSubjectIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpAclResourcesIndex"))
if mibBuilder.loadTexts: mscVrSnmpAclRowStatusEntry.setStatus('obsolete')
mscVrSnmpAclRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpAclRowStatus.setStatus('obsolete')
mscVrSnmpAclComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpAclComponentName.setStatus('obsolete')
mscVrSnmpAclStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpAclStorageType.setStatus('obsolete')
mscVrSnmpAclTargetIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1, 1, 10), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2048)))
if mibBuilder.loadTexts: mscVrSnmpAclTargetIndex.setStatus('obsolete')
mscVrSnmpAclSubjectIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1, 1, 11), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2048)))
if mibBuilder.loadTexts: mscVrSnmpAclSubjectIndex.setStatus('obsolete')
mscVrSnmpAclResourcesIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 1, 1, 12), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2048)))
if mibBuilder.loadTexts: mscVrSnmpAclResourcesIndex.setStatus('obsolete')
mscVrSnmpAclProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 10), )
if mibBuilder.loadTexts: mscVrSnmpAclProvTable.setStatus('obsolete')
mscVrSnmpAclProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpAclTargetIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpAclSubjectIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpAclResourcesIndex"))
if mibBuilder.loadTexts: mscVrSnmpAclProvEntry.setStatus('obsolete')
mscVrSnmpAclPrivileges = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 10, 1, 1), OctetString().subtype(subtypeSpec=ValueSizeConstraint(1, 1)).setFixedLength(1).clone(hexValue="60")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpAclPrivileges.setStatus('obsolete')
mscVrSnmpAclRowStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 10, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(3))).clone(namedValues=NamedValues(("nonVolatile", 3))).clone('nonVolatile')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpAclRowStorageType.setStatus('obsolete')
mscVrSnmpAclStdRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 4, 10, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("active", 1))).clone('active')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpAclStdRowStatus.setStatus('obsolete')
mscVrSnmpParty = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5))
mscVrSnmpPartyRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 1), )
if mibBuilder.loadTexts: mscVrSnmpPartyRowStatusTable.setStatus('obsolete')
mscVrSnmpPartyRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpPartyIdentityIndex"))
if mibBuilder.loadTexts: mscVrSnmpPartyRowStatusEntry.setStatus('obsolete')
mscVrSnmpPartyRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyRowStatus.setStatus('obsolete')
mscVrSnmpPartyComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpPartyComponentName.setStatus('obsolete')
mscVrSnmpPartyStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpPartyStorageType.setStatus('obsolete')
mscVrSnmpPartyIdentityIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 1, 1, 10), ObjectIdentifier())
if mibBuilder.loadTexts: mscVrSnmpPartyIdentityIndex.setStatus('obsolete')
mscVrSnmpPartyProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10), )
if mibBuilder.loadTexts: mscVrSnmpPartyProvTable.setStatus('obsolete')
mscVrSnmpPartyProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpPartyIdentityIndex"))
if mibBuilder.loadTexts: mscVrSnmpPartyProvEntry.setStatus('obsolete')
mscVrSnmpPartyStdIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2048))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpPartyStdIndex.setStatus('obsolete')
mscVrSnmpPartyTDomain = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("snmpUdpDomain", 1))).clone('snmpUdpDomain')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyTDomain.setStatus('obsolete')
mscVrSnmpPartyTransportAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 3), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(1, 100))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyTransportAddress.setStatus('obsolete')
mscVrSnmpPartyMaxMessageSize = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(484, 65507)).clone(1400)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyMaxMessageSize.setStatus('obsolete')
mscVrSnmpPartyLocal = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 5), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyLocal.setStatus('obsolete')
mscVrSnmpPartyAuthProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 4))).clone(namedValues=NamedValues(("noAuth", 1), ("v2Md5AuthProtocol", 4))).clone('noAuth')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyAuthProtocol.setStatus('obsolete')
mscVrSnmpPartyAuthPrivate = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 7), HexString().subtype(subtypeSpec=ValueSizeConstraint(0, 16)).clone(hexValue="")).setMaxAccess("writeonly")
if mibBuilder.loadTexts: mscVrSnmpPartyAuthPrivate.setStatus('obsolete')
mscVrSnmpPartyAuthPublic = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 8), HexString().subtype(subtypeSpec=ValueSizeConstraint(0, 16)).clone(hexValue="")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyAuthPublic.setStatus('obsolete')
mscVrSnmpPartyAuthLifetime = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 9), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 2147483647)).clone(300)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyAuthLifetime.setStatus('obsolete')
mscVrSnmpPartyPrivProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 10), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(2))).clone(namedValues=NamedValues(("noPriv", 2))).clone('noPriv')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyPrivProtocol.setStatus('obsolete')
mscVrSnmpPartyRowStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(3))).clone(namedValues=NamedValues(("nonVolatile", 3))).clone('nonVolatile')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyRowStorageType.setStatus('obsolete')
mscVrSnmpPartyStdRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 10, 1, 12), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("active", 1))).clone('active')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyStdRowStatus.setStatus('obsolete')
mscVrSnmpPartyOpTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 11), )
if mibBuilder.loadTexts: mscVrSnmpPartyOpTable.setStatus('obsolete')
mscVrSnmpPartyOpEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 11, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpPartyIdentityIndex"))
if mibBuilder.loadTexts: mscVrSnmpPartyOpEntry.setStatus('obsolete')
mscVrSnmpPartyTrapNumbers = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 11, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpPartyTrapNumbers.setStatus('obsolete')
mscVrSnmpPartyAuthClock = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 5, 11, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpPartyAuthClock.setStatus('obsolete')
mscVrSnmpCon = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6))
mscVrSnmpConRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 1), )
if mibBuilder.loadTexts: mscVrSnmpConRowStatusTable.setStatus('obsolete')
mscVrSnmpConRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpConIdentityIndex"))
if mibBuilder.loadTexts: mscVrSnmpConRowStatusEntry.setStatus('obsolete')
mscVrSnmpConRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpConRowStatus.setStatus('obsolete')
mscVrSnmpConComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpConComponentName.setStatus('obsolete')
mscVrSnmpConStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpConStorageType.setStatus('obsolete')
mscVrSnmpConIdentityIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 1, 1, 10), ObjectIdentifier())
if mibBuilder.loadTexts: mscVrSnmpConIdentityIndex.setStatus('obsolete')
mscVrSnmpConProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10), )
if mibBuilder.loadTexts: mscVrSnmpConProvTable.setStatus('obsolete')
mscVrSnmpConProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpConIdentityIndex"))
if mibBuilder.loadTexts: mscVrSnmpConProvEntry.setStatus('obsolete')
mscVrSnmpConStdIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpConStdIndex.setStatus('obsolete')
mscVrSnmpConLocal = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("true", 1))).clone('true')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpConLocal.setStatus('obsolete')
mscVrSnmpConViewIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpConViewIndex.setStatus('obsolete')
mscVrSnmpConLocalTime = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("currentTime", 1))).clone('currentTime')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpConLocalTime.setStatus('obsolete')
mscVrSnmpConRowStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(3))).clone(namedValues=NamedValues(("nonVolatile", 3))).clone('nonVolatile')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpConRowStorageType.setStatus('obsolete')
mscVrSnmpConStdRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 6, 10, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("active", 1))).clone('active')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpConStdRowStatus.setStatus('obsolete')
mscVrSnmpView = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7))
mscVrSnmpViewRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 1), )
if mibBuilder.loadTexts: mscVrSnmpViewRowStatusTable.setStatus('mandatory')
mscVrSnmpViewRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpViewIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpViewSubtreeIndex"))
if mibBuilder.loadTexts: mscVrSnmpViewRowStatusEntry.setStatus('mandatory')
mscVrSnmpViewRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpViewRowStatus.setStatus('mandatory')
mscVrSnmpViewComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpViewComponentName.setStatus('mandatory')
mscVrSnmpViewStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpViewStorageType.setStatus('mandatory')
mscVrSnmpViewIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 1, 1, 10), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024)))
if mibBuilder.loadTexts: mscVrSnmpViewIndex.setStatus('mandatory')
mscVrSnmpViewSubtreeIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 1, 1, 11), ObjectIdentifier())
if mibBuilder.loadTexts: mscVrSnmpViewSubtreeIndex.setStatus('mandatory')
mscVrSnmpViewProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 10), )
if mibBuilder.loadTexts: mscVrSnmpViewProvTable.setStatus('mandatory')
mscVrSnmpViewProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpViewIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpViewSubtreeIndex"))
if mibBuilder.loadTexts: mscVrSnmpViewProvEntry.setStatus('mandatory')
mscVrSnmpViewMask = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 10, 1, 1), HexString().subtype(subtypeSpec=ValueSizeConstraint(0, 16)).clone(hexValue="")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpViewMask.setStatus('mandatory')
mscVrSnmpViewType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 10, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("includedSubtree", 1), ("excludedSubtree", 2))).clone('includedSubtree')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpViewType.setStatus('mandatory')
mscVrSnmpViewRowStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 10, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(3))).clone(namedValues=NamedValues(("nonVolatile", 3))).clone('nonVolatile')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpViewRowStorageType.setStatus('mandatory')
mscVrSnmpViewStdRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 7, 10, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("active", 1))).clone('active')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrSnmpViewStdRowStatus.setStatus('mandatory')
mscVrSnmpOr = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8))
mscVrSnmpOrRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 1), )
if mibBuilder.loadTexts: mscVrSnmpOrRowStatusTable.setStatus('mandatory')
mscVrSnmpOrRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpOrIndex"))
if mibBuilder.loadTexts: mscVrSnmpOrRowStatusEntry.setStatus('mandatory')
mscVrSnmpOrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 1, 1, 1), RowStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpOrRowStatus.setStatus('mandatory')
mscVrSnmpOrComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpOrComponentName.setStatus('mandatory')
mscVrSnmpOrStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpOrStorageType.setStatus('mandatory')
mscVrSnmpOrIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 1, 1, 10), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024)))
if mibBuilder.loadTexts: mscVrSnmpOrIndex.setStatus('mandatory')
mscVrSnmpOrOrTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 10), )
if mibBuilder.loadTexts: mscVrSnmpOrOrTable.setStatus('mandatory')
mscVrSnmpOrOrEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpOrIndex"))
if mibBuilder.loadTexts: mscVrSnmpOrOrEntry.setStatus('mandatory')
mscVrSnmpOrId = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 10, 1, 2), ObjectIdentifier()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpOrId.setStatus('mandatory')
mscVrSnmpOrDescr = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 8, 10, 1, 3), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpOrDescr.setStatus('mandatory')
mscVrSnmpV2Stats = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9))
mscVrSnmpV2StatsRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 1), )
if mibBuilder.loadTexts: mscVrSnmpV2StatsRowStatusTable.setStatus('obsolete')
mscVrSnmpV2StatsRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpV2StatsIndex"))
if mibBuilder.loadTexts: mscVrSnmpV2StatsRowStatusEntry.setStatus('obsolete')
mscVrSnmpV2StatsRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 1, 1, 1), RowStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsRowStatus.setStatus('obsolete')
mscVrSnmpV2StatsComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsComponentName.setStatus('obsolete')
mscVrSnmpV2StatsStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsStorageType.setStatus('obsolete')
mscVrSnmpV2StatsIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscVrSnmpV2StatsIndex.setStatus('obsolete')
mscVrSnmpV2StatsStatsTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10), )
if mibBuilder.loadTexts: mscVrSnmpV2StatsStatsTable.setStatus('obsolete')
mscVrSnmpV2StatsStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpV2StatsIndex"))
if mibBuilder.loadTexts: mscVrSnmpV2StatsStatsEntry.setStatus('obsolete')
mscVrSnmpV2StatsPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsPackets.setStatus('obsolete')
mscVrSnmpV2StatsEncodingErrors = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsEncodingErrors.setStatus('obsolete')
mscVrSnmpV2StatsUnknownSrcParties = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsUnknownSrcParties.setStatus('obsolete')
mscVrSnmpV2StatsBadAuths = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsBadAuths.setStatus('obsolete')
mscVrSnmpV2StatsNotInLifetime = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsNotInLifetime.setStatus('obsolete')
mscVrSnmpV2StatsWrongDigestValues = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 6), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsWrongDigestValues.setStatus('obsolete')
mscVrSnmpV2StatsUnknownContexts = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 7), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsUnknownContexts.setStatus('obsolete')
mscVrSnmpV2StatsBadOperations = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 8), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsBadOperations.setStatus('obsolete')
mscVrSnmpV2StatsSilentDrops = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 9, 10, 1, 9), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV2StatsSilentDrops.setStatus('obsolete')
mscVrSnmpV1Stats = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10))
mscVrSnmpV1StatsRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 1), )
if mibBuilder.loadTexts: mscVrSnmpV1StatsRowStatusTable.setStatus('mandatory')
mscVrSnmpV1StatsRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpV1StatsIndex"))
if mibBuilder.loadTexts: mscVrSnmpV1StatsRowStatusEntry.setStatus('mandatory')
mscVrSnmpV1StatsRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 1, 1, 1), RowStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV1StatsRowStatus.setStatus('mandatory')
mscVrSnmpV1StatsComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV1StatsComponentName.setStatus('mandatory')
mscVrSnmpV1StatsStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV1StatsStorageType.setStatus('mandatory')
mscVrSnmpV1StatsIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscVrSnmpV1StatsIndex.setStatus('mandatory')
mscVrSnmpV1StatsStatsTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 10), )
if mibBuilder.loadTexts: mscVrSnmpV1StatsStatsTable.setStatus('mandatory')
mscVrSnmpV1StatsStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpV1StatsIndex"))
if mibBuilder.loadTexts: mscVrSnmpV1StatsStatsEntry.setStatus('mandatory')
mscVrSnmpV1StatsBadCommunityNames = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 10, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV1StatsBadCommunityNames.setStatus('mandatory')
mscVrSnmpV1StatsBadCommunityUses = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 10, 10, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpV1StatsBadCommunityUses.setStatus('mandatory')
mscVrSnmpMibIIStats = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11))
mscVrSnmpMibIIStatsRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 1), )
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsRowStatusTable.setStatus('mandatory')
mscVrSnmpMibIIStatsRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpMibIIStatsIndex"))
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsRowStatusEntry.setStatus('mandatory')
mscVrSnmpMibIIStatsRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 1, 1, 1), RowStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsRowStatus.setStatus('mandatory')
mscVrSnmpMibIIStatsComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsComponentName.setStatus('mandatory')
mscVrSnmpMibIIStatsStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsStorageType.setStatus('mandatory')
mscVrSnmpMibIIStatsIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsIndex.setStatus('mandatory')
mscVrSnmpMibIIStatsStatsTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10), )
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsStatsTable.setStatus('mandatory')
mscVrSnmpMibIIStatsStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrSnmpMibIIStatsIndex"))
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsStatsEntry.setStatus('mandatory')
mscVrSnmpMibIIStatsInPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInPackets.setStatus('mandatory')
mscVrSnmpMibIIStatsInBadCommunityNames = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInBadCommunityNames.setStatus('mandatory')
mscVrSnmpMibIIStatsInBadCommunityUses = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInBadCommunityUses.setStatus('mandatory')
mscVrSnmpMibIIStatsInAsnParseErrs = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInAsnParseErrs.setStatus('mandatory')
mscVrSnmpMibIIStatsOutPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsOutPackets.setStatus('mandatory')
mscVrSnmpMibIIStatsInBadVersions = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 6), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInBadVersions.setStatus('mandatory')
mscVrSnmpMibIIStatsInTotalReqVars = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 7), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInTotalReqVars.setStatus('mandatory')
mscVrSnmpMibIIStatsInTotalSetVars = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 8), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInTotalSetVars.setStatus('mandatory')
mscVrSnmpMibIIStatsInGetRequests = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 9), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInGetRequests.setStatus('mandatory')
mscVrSnmpMibIIStatsInGetNexts = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 10), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInGetNexts.setStatus('mandatory')
mscVrSnmpMibIIStatsInSetRequests = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 11), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsInSetRequests.setStatus('mandatory')
mscVrSnmpMibIIStatsOutTooBigs = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 12), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsOutTooBigs.setStatus('mandatory')
mscVrSnmpMibIIStatsOutNoSuchNames = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 13), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsOutNoSuchNames.setStatus('mandatory')
mscVrSnmpMibIIStatsOutBadValues = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 14), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsOutBadValues.setStatus('mandatory')
mscVrSnmpMibIIStatsOutGenErrs = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 15), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsOutGenErrs.setStatus('mandatory')
mscVrSnmpMibIIStatsOutGetResponses = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 16), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsOutGetResponses.setStatus('mandatory')
mscVrSnmpMibIIStatsOutTraps = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 8, 11, 10, 1, 17), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrSnmpMibIIStatsOutTraps.setStatus('mandatory')
mscVrInitSnmpConfig = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9))
mscVrInitSnmpConfigRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 1), )
if mibBuilder.loadTexts: mscVrInitSnmpConfigRowStatusTable.setStatus('obsolete')
mscVrInitSnmpConfigRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrInitSnmpConfigIndex"))
if mibBuilder.loadTexts: mscVrInitSnmpConfigRowStatusEntry.setStatus('obsolete')
mscVrInitSnmpConfigRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrInitSnmpConfigRowStatus.setStatus('obsolete')
mscVrInitSnmpConfigComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrInitSnmpConfigComponentName.setStatus('obsolete')
mscVrInitSnmpConfigStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscVrInitSnmpConfigStorageType.setStatus('obsolete')
mscVrInitSnmpConfigIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscVrInitSnmpConfigIndex.setStatus('obsolete')
mscVrInitSnmpConfigProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 10), )
if mibBuilder.loadTexts: mscVrInitSnmpConfigProvTable.setStatus('obsolete')
mscVrInitSnmpConfigProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 10, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-VirtualRouterMIB", "mscVrIndex"), (0, "Nortel-MsCarrier-MscPassport-BaseSnmpMIB", "mscVrInitSnmpConfigIndex"))
if mibBuilder.loadTexts: mscVrInitSnmpConfigProvEntry.setStatus('obsolete')
mscVrInitSnmpConfigAgentAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 10, 1, 1), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(1, 80))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrInitSnmpConfigAgentAddress.setStatus('obsolete')
mscVrInitSnmpConfigManagerAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 100, 9, 10, 1, 2), AsciiString().subtype(subtypeSpec=ValueSizeConstraint(1, 80))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscVrInitSnmpConfigManagerAddress.setStatus('obsolete')
baseSnmpGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 1))
baseSnmpGroupCA = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 1, 1))
baseSnmpGroupCA02 = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 1, 1, 3))
baseSnmpGroupCA02A = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 1, 1, 3, 2))
baseSnmpCapabilities = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 3))
baseSnmpCapabilitiesCA = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 3, 1))
baseSnmpCapabilitiesCA02 = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 3, 1, 3))
baseSnmpCapabilitiesCA02A = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 36, 3, 1, 3, 2))
mibBuilder.exportSymbols("Nortel-MsCarrier-MscPassport-BaseSnmpMIB", mscVrSnmpPartyAuthPublic=mscVrSnmpPartyAuthPublic, mscVrSnmpV2StatsNotInLifetime=mscVrSnmpV2StatsNotInLifetime, mscVrSnmpStatsTable=mscVrSnmpStatsTable, mscVrSnmpComManStorageType=mscVrSnmpComManStorageType, mscVrSnmpComManTransportAddress=mscVrSnmpComManTransportAddress, mscVrSnmpPartyProvTable=mscVrSnmpPartyProvTable, mscVrSnmpMibIIStatsOutBadValues=mscVrSnmpMibIIStatsOutBadValues, mscVrSnmpSysRowStatusTable=mscVrSnmpSysRowStatusTable, mscVrSnmpOrRowStatusTable=mscVrSnmpOrRowStatusTable, mscVrSnmpMibIIStatsStatsEntry=mscVrSnmpMibIIStatsStatsEntry, baseSnmpMIB=baseSnmpMIB, mscVrSnmpLastOrChange=mscVrSnmpLastOrChange, mscVrSnmpComMan=mscVrSnmpComMan, mscVrSnmpPartyAuthClock=mscVrSnmpPartyAuthClock, mscVrSnmpComAccessMode=mscVrSnmpComAccessMode, baseSnmpCapabilitiesCA=baseSnmpCapabilitiesCA, mscVrSnmpAclStorageType=mscVrSnmpAclStorageType, mscVrSnmpConStdIndex=mscVrSnmpConStdIndex, mscVrSnmpMibIIStatsRowStatusEntry=mscVrSnmpMibIIStatsRowStatusEntry, mscVrSnmpStateEntry=mscVrSnmpStateEntry, mscVrSnmpSysIndex=mscVrSnmpSysIndex, mscVrSnmpOrOrTable=mscVrSnmpOrOrTable, mscVrSnmpOrDescr=mscVrSnmpOrDescr, mscVrSnmpViewIndex=mscVrSnmpViewIndex, mscVrSnmp=mscVrSnmp, mscVrSnmpAclStdRowStatus=mscVrSnmpAclStdRowStatus, mscVrSnmpRowStatusEntry=mscVrSnmpRowStatusEntry, mscVrSnmpSysProvEntry=mscVrSnmpSysProvEntry, mscVrSnmpMibIIStatsOutGetResponses=mscVrSnmpMibIIStatsOutGetResponses, mscVrSnmpAdminState=mscVrSnmpAdminState, mscVrInitSnmpConfigRowStatusEntry=mscVrInitSnmpConfigRowStatusEntry, baseSnmpGroupCA=baseSnmpGroupCA, mscVrSnmpAclProvTable=mscVrSnmpAclProvTable, mscVrSnmpV1StatsComponentName=mscVrSnmpV1StatsComponentName, mscVrSnmpMibIIStatsStatsTable=mscVrSnmpMibIIStatsStatsTable, mscVrSnmpV2StatsStatsEntry=mscVrSnmpV2StatsStatsEntry, mscVrSnmpStandbyStatus=mscVrSnmpStandbyStatus, mscVrSnmpPartyStdRowStatus=mscVrSnmpPartyStdRowStatus, mscVrSnmpPartyAuthProtocol=mscVrSnmpPartyAuthProtocol, mscVrSnmpMibIIStatsInBadCommunityNames=mscVrSnmpMibIIStatsInBadCommunityNames, mscVrSnmpComComponentName=mscVrSnmpComComponentName, mscVrSnmpAclResourcesIndex=mscVrSnmpAclResourcesIndex, mscVrSnmpConProvTable=mscVrSnmpConProvTable, mscVrSnmpComponentName=mscVrSnmpComponentName, mscVrSnmpPartyLocal=mscVrSnmpPartyLocal, mscVrSnmpComRowStatusTable=mscVrSnmpComRowStatusTable, mscVrSnmpComManRowStatusTable=mscVrSnmpComManRowStatusTable, mscVrSnmpOrStorageType=mscVrSnmpOrStorageType, mscVrSnmpPartyOpTable=mscVrSnmpPartyOpTable, mscVrSnmpV2StatsSilentDrops=mscVrSnmpV2StatsSilentDrops, mscVrSnmpCidInEntTraps=mscVrSnmpCidInEntTraps, mscVrSnmpV1StatsRowStatus=mscVrSnmpV1StatsRowStatus, mscVrSnmpMibIIStatsInGetRequests=mscVrSnmpMibIIStatsInGetRequests, mscVrSnmpStorageType=mscVrSnmpStorageType, mscVrSnmpV1StatsBadCommunityNames=mscVrSnmpV1StatsBadCommunityNames, mscVrInitSnmpConfigIndex=mscVrInitSnmpConfigIndex, baseSnmpGroupCA02=baseSnmpGroupCA02, mscVrSnmpConRowStorageType=mscVrSnmpConRowStorageType, baseSnmpCapabilitiesCA02A=baseSnmpCapabilitiesCA02A, mscVrSnmpConRowStatusEntry=mscVrSnmpConRowStatusEntry, mscVrSnmpViewRowStatus=mscVrSnmpViewRowStatus, mscVrSnmpSysProvTable=mscVrSnmpSysProvTable, mscVrSnmpSysComponentName=mscVrSnmpSysComponentName, mscVrSnmpComManIndex=mscVrSnmpComManIndex, mscVrSnmpPartyIdentityIndex=mscVrSnmpPartyIdentityIndex, mscVrSnmpOperationalState=mscVrSnmpOperationalState, mscVrSnmpV2StatsComponentName=mscVrSnmpV2StatsComponentName, mscVrSnmpV2StatsIndex=mscVrSnmpV2StatsIndex, mscVrSnmpV2StatsWrongDigestValues=mscVrSnmpV2StatsWrongDigestValues, mscVrSnmpV1StatsStatsEntry=mscVrSnmpV1StatsStatsEntry, mscVrSnmpSysContact=mscVrSnmpSysContact, mscVrInitSnmpConfigProvTable=mscVrInitSnmpConfigProvTable, mscVrInitSnmpConfigManagerAddress=mscVrInitSnmpConfigManagerAddress, mscVrSnmpAclPrivileges=mscVrSnmpAclPrivileges, mscVrSnmpView=mscVrSnmpView, mscVrSnmpMibIIStatsOutGenErrs=mscVrSnmpMibIIStatsOutGenErrs, mscVrSnmpConStorageType=mscVrSnmpConStorageType, mscVrSnmpAclRowStatusEntry=mscVrSnmpAclRowStatusEntry, mscVrSnmpAclRowStatusTable=mscVrSnmpAclRowStatusTable, mscVrSnmpV2StatsStatsTable=mscVrSnmpV2StatsStatsTable, mscVrSnmpMibIIStatsOutNoSuchNames=mscVrSnmpMibIIStatsOutNoSuchNames, mscVrSnmpV2StatsPackets=mscVrSnmpV2StatsPackets, mscVrSnmpTrapsDiscarded=mscVrSnmpTrapsDiscarded, mscVrSnmpOrRowStatusEntry=mscVrSnmpOrRowStatusEntry, mscVrSnmpAclSubjectIndex=mscVrSnmpAclSubjectIndex, mscVrSnmpRowStatus=mscVrSnmpRowStatus, mscVrSnmpViewSubtreeIndex=mscVrSnmpViewSubtreeIndex, mscVrSnmpV2StatsRowStatusEntry=mscVrSnmpV2StatsRowStatusEntry, mscVrInitSnmpConfig=mscVrInitSnmpConfig, mscVrSnmpAclProvEntry=mscVrSnmpAclProvEntry, mscVrSnmpViewStdRowStatus=mscVrSnmpViewStdRowStatus, mscVrSnmpSysName=mscVrSnmpSysName, mscVrSnmpPartyMaxMessageSize=mscVrSnmpPartyMaxMessageSize, mscVrSnmpV2StatsEncodingErrors=mscVrSnmpV2StatsEncodingErrors, mscVrSnmpLastAuthFailure=mscVrSnmpLastAuthFailure, mscVrSnmpAlarmStatus=mscVrSnmpAlarmStatus, mscVrSnmpSysStorageType=mscVrSnmpSysStorageType, mscVrSnmpAclRowStorageType=mscVrSnmpAclRowStorageType, mscVrSnmpV1StatsIndex=mscVrSnmpV1StatsIndex, mscVrSnmpSysUpTime=mscVrSnmpSysUpTime, mscVrSnmpAvailabilityStatus=mscVrSnmpAvailabilityStatus, mscVrSnmpMibIIStatsRowStatus=mscVrSnmpMibIIStatsRowStatus, mscVrSnmpV1Stats=mscVrSnmpV1Stats, mscVrSnmpRowStatusTable=mscVrSnmpRowStatusTable, mscVrSnmpV2StatsUnknownContexts=mscVrSnmpV2StatsUnknownContexts, mscVrSnmpAclComponentName=mscVrSnmpAclComponentName, mscVrSnmpConComponentName=mscVrSnmpConComponentName, mscVrInitSnmpConfigRowStatusTable=mscVrInitSnmpConfigRowStatusTable, mscVrInitSnmpConfigProvEntry=mscVrInitSnmpConfigProvEntry, mscVrSnmpCon=mscVrSnmpCon, baseSnmpGroupCA02A=baseSnmpGroupCA02A, mscVrSnmpProvTable=mscVrSnmpProvTable, mscVrSnmpViewProvTable=mscVrSnmpViewProvTable, mscVrSnmpControlStatus=mscVrSnmpControlStatus, mscVrSnmpMibIIStatsInGetNexts=mscVrSnmpMibIIStatsInGetNexts, mscVrSnmpViewType=mscVrSnmpViewType, mscVrSnmpMibIIStatsComponentName=mscVrSnmpMibIIStatsComponentName, mscVrSnmpAclTargetIndex=mscVrSnmpAclTargetIndex, mscVrSnmpMibIIStatsIndex=mscVrSnmpMibIIStatsIndex, mscVrSnmpMibIIStats=mscVrSnmpMibIIStats, mscVrSnmpPartyRowStatusTable=mscVrSnmpPartyRowStatusTable, mscVrSnmpV1StatsRowStatusEntry=mscVrSnmpV1StatsRowStatusEntry, mscVrSnmpTrapsProcessed=mscVrSnmpTrapsProcessed, mscVrSnmpV2StatsBadOperations=mscVrSnmpV2StatsBadOperations, mscVrSnmpComIndex=mscVrSnmpComIndex, mscVrSnmpV2StatsStorageType=mscVrSnmpV2StatsStorageType, mscVrSnmpComCommunityString=mscVrSnmpComCommunityString, mscVrSnmpViewMask=mscVrSnmpViewMask, mscVrInitSnmpConfigAgentAddress=mscVrInitSnmpConfigAgentAddress, mscVrSnmpV1StatsStorageType=mscVrSnmpV1StatsStorageType, mscVrSnmpComTDomain=mscVrSnmpComTDomain, mscVrSnmpOrIndex=mscVrSnmpOrIndex, mscVrSnmpPartyRowStatusEntry=mscVrSnmpPartyRowStatusEntry, mscVrSnmpMibIIStatsInBadCommunityUses=mscVrSnmpMibIIStatsInBadCommunityUses, mscVrSnmpSysOpTable=mscVrSnmpSysOpTable, mscVrSnmpComManRowStatusEntry=mscVrSnmpComManRowStatusEntry, mscVrSnmpPartyTrapNumbers=mscVrSnmpPartyTrapNumbers, mscVrSnmpMibIIStatsInTotalSetVars=mscVrSnmpMibIIStatsInTotalSetVars, mscVrInitSnmpConfigComponentName=mscVrInitSnmpConfigComponentName, mscVrSnmpUsageState=mscVrSnmpUsageState, mscVrSnmpComRowStatusEntry=mscVrSnmpComRowStatusEntry, mscVrSnmpConProvEntry=mscVrSnmpConProvEntry, mscVrSnmpAcl=mscVrSnmpAcl, mscVrSnmpPartyTransportAddress=mscVrSnmpPartyTransportAddress, mscVrSnmpPartyAuthPrivate=mscVrSnmpPartyAuthPrivate, mscVrSnmpComRowStatus=mscVrSnmpComRowStatus, mscVrSnmpConRowStatusTable=mscVrSnmpConRowStatusTable, mscVrSnmpMibIIStatsRowStatusTable=mscVrSnmpMibIIStatsRowStatusTable, mscVrSnmpMibIIStatsOutTooBigs=mscVrSnmpMibIIStatsOutTooBigs, mscVrSnmpV1EnableAuthenTraps=mscVrSnmpV1EnableAuthenTraps, mscVrSnmpCom=mscVrSnmpCom, baseSnmpCapabilities=baseSnmpCapabilities, mscVrSnmpPartyComponentName=mscVrSnmpPartyComponentName, mscVrSnmpConIdentityIndex=mscVrSnmpConIdentityIndex, mscVrSnmpOrId=mscVrSnmpOrId, mscVrSnmpPartyAuthLifetime=mscVrSnmpPartyAuthLifetime, mscVrSnmpPartyProvEntry=mscVrSnmpPartyProvEntry, mscVrSnmpComStorageType=mscVrSnmpComStorageType, mscVrSnmpSysDescription=mscVrSnmpSysDescription, mscVrSnmpSysObjectId=mscVrSnmpSysObjectId, mscVrSnmpV2StatsRowStatus=mscVrSnmpV2StatsRowStatus, mscVrSnmpMibIIStatsInSetRequests=mscVrSnmpMibIIStatsInSetRequests, mscVrSnmpIndex=mscVrSnmpIndex, mscVrSnmpMgrOfLastAuthFailure=mscVrSnmpMgrOfLastAuthFailure, mscVrSnmpComManProvEntry=mscVrSnmpComManProvEntry, mscVrSnmpV2StatsUnknownSrcParties=mscVrSnmpV2StatsUnknownSrcParties, mscVrSnmpConLocalTime=mscVrSnmpConLocalTime, mscVrSnmpSys=mscVrSnmpSys, mscVrSnmpUnknownStatus=mscVrSnmpUnknownStatus, mscVrSnmpSysRowStatus=mscVrSnmpSysRowStatus, mscVrSnmpViewRowStatusTable=mscVrSnmpViewRowStatusTable, mscVrSnmpViewRowStorageType=mscVrSnmpViewRowStorageType, mscVrSnmpMibIIStatsInBadVersions=mscVrSnmpMibIIStatsInBadVersions, mscVrSnmpStateTable=mscVrSnmpStateTable, mscVrSnmpViewRowStatusEntry=mscVrSnmpViewRowStatusEntry, mscVrSnmpMibIIStatsStorageType=mscVrSnmpMibIIStatsStorageType, mscVrSnmpSysRowStatusEntry=mscVrSnmpSysRowStatusEntry, mscVrSnmpV2EnableAuthenTraps=mscVrSnmpV2EnableAuthenTraps, mscVrSnmpMibIIStatsOutPackets=mscVrSnmpMibIIStatsOutPackets, mscVrSnmpV2StatsBadAuths=mscVrSnmpV2StatsBadAuths, mscVrSnmpPartyOpEntry=mscVrSnmpPartyOpEntry, mscVrSnmpViewStorageType=mscVrSnmpViewStorageType, mscVrSnmpOrComponentName=mscVrSnmpOrComponentName, baseSnmpGroup=baseSnmpGroup, mscVrSnmpOrRowStatus=mscVrSnmpOrRowStatus, mscVrSnmpPartyTDomain=mscVrSnmpPartyTDomain, mscVrSnmpConLocal=mscVrSnmpConLocal, mscVrSnmpV1StatsStatsTable=mscVrSnmpV1StatsStatsTable, mscVrSnmpComProvTable=mscVrSnmpComProvTable, mscVrSnmpProceduralStatus=mscVrSnmpProceduralStatus, mscVrSnmpComManPrivileges=mscVrSnmpComManPrivileges, mscVrSnmpIpStack=mscVrSnmpIpStack, mscVrSnmpPartyPrivProtocol=mscVrSnmpPartyPrivProtocol, mscVrInitSnmpConfigStorageType=mscVrInitSnmpConfigStorageType, mscVrSnmpConViewIndex=mscVrSnmpConViewIndex, mscVrSnmpAclRowStatus=mscVrSnmpAclRowStatus, mscVrSnmpComManProvTable=mscVrSnmpComManProvTable, mscVrSnmpConStdRowStatus=mscVrSnmpConStdRowStatus, mscVrSnmpParty=mscVrSnmpParty, mscVrSnmpMibIIStatsOutTraps=mscVrSnmpMibIIStatsOutTraps, mscVrSnmpV1StatsBadCommunityUses=mscVrSnmpV1StatsBadCommunityUses, mscVrSnmpSysOpEntry=mscVrSnmpSysOpEntry, mscVrSnmpSysLocation=mscVrSnmpSysLocation, mscVrSnmpViewComponentName=mscVrSnmpViewComponentName, mscVrSnmpMibIIStatsInAsnParseErrs=mscVrSnmpMibIIStatsInAsnParseErrs, mscVrInitSnmpConfigRowStatus=mscVrInitSnmpConfigRowStatus, mscVrSnmpComProvEntry=mscVrSnmpComProvEntry, mscVrSnmpConRowStatus=mscVrSnmpConRowStatus, mscVrSnmpMibIIStatsInTotalReqVars=mscVrSnmpMibIIStatsInTotalReqVars, mscVrSnmpProvEntry=mscVrSnmpProvEntry, mscVrSnmpV2StatsRowStatusTable=mscVrSnmpV2StatsRowStatusTable, mscVrSnmpPartyRowStorageType=mscVrSnmpPartyRowStorageType, mscVrSnmpSysServices=mscVrSnmpSysServices, mscVrSnmpV2Stats=mscVrSnmpV2Stats, mscVrSnmpComManRowStatus=mscVrSnmpComManRowStatus, mscVrSnmpPartyRowStatus=mscVrSnmpPartyRowStatus, mscVrSnmpPartyStdIndex=mscVrSnmpPartyStdIndex, mscVrSnmpStatsEntry=mscVrSnmpStatsEntry, mscVrSnmpPartyStorageType=mscVrSnmpPartyStorageType, mscVrSnmpComManComponentName=mscVrSnmpComManComponentName, mscVrSnmpV1StatsRowStatusTable=mscVrSnmpV1StatsRowStatusTable, mscVrSnmpOrOrEntry=mscVrSnmpOrOrEntry, baseSnmpCapabilitiesCA02=baseSnmpCapabilitiesCA02, mscVrSnmpOr=mscVrSnmpOr, mscVrSnmpMibIIStatsInPackets=mscVrSnmpMibIIStatsInPackets, mscVrSnmpAlarmsAsTraps=mscVrSnmpAlarmsAsTraps, mscVrSnmpViewProvEntry=mscVrSnmpViewProvEntry, mscVrSnmpComViewIndex=mscVrSnmpComViewIndex)
|
c = open("__21_d03.txt")
lin = c.readlines()
## Part 1
klin = [list([lin[i].split("\n")[0] for i in range(len(lin))][j]) for j in range(len(lin))]
k2 = [1 if [klin[jj][len(klin[0])-ii-1] for jj in range(len(lin))].count('1') > [klin[jj][len(klin[0])-ii-1] for jj in range(len(lin))].count('0') else 0 for ii in range(len(klin[0]))]
prod = sum([k2[ii]*2**ii for ii in range(len(k2))])*sum([abs(k2[ii]-1)*2**ii for ii in range(len(k2))])
print(prod)
## Part 2
ii = 0
klin22 = klin.copy()
while len(klin) > 1:
klin2 = '1' if [klin[jj][ii] for jj in range(len(klin))].count('1') >= [klin[jj][ii] for jj in range(len(klin))].count('0') else '0'
klin = [klin[jj] for jj in range(len(klin)) if klin[jj][ii] == klin2]
ii += 1
k_1 = klin
klin = klin22.copy()
ii = 0
while len(klin) > 1:
klin3 = '1' if [klin[jj][ii] for jj in range(len(klin))].count('1') < [klin[jj][ii] for jj in range(len(klin))].count(
'0') else '0'
klin = [klin[jj] for jj in range(len(klin)) if klin[jj][ii] == klin3]
ii += 1
k_1 = k_1[0]
k_2 = klin[0]
i3 = sum([int(k_1[ii])*2**(len(k_1)-ii-1) for ii in range(len(k_1))])
j3 = sum([int(k_2[ii])*2**(len(k_2)-ii-1) for ii in range(len(k_2))])
print(i3*j3)
|
# config.py
# encoding:utf-8
DEBUG = True
JSON_AS_ASCII = False
|
num = 42
list_of_numbers = []
for i in range(1, num+1):
list_of_numbers.append(i)
print(list_of_numbers)
death = 3
for i in list_of_numbers:
if i == num:
if i == death:
print("XX")
else:
print(i)
elif i < 10:
if i == death:
print(f"XX", end=" - ")
else:
print(f"0{i}", end=" - ")
elif i % 10 == 0:
if i == death:
print("XX")
else:
print(i)
else:
if i == death:
print("XX")
else:
print(f"{i}", end=" - ")
|
def FizzBuzz(n):
if (n % 5) == 0 and (n % 3) == 0:
return f'{n} FizzBuzz'
if (n % 3) == 0:
return f'{n} é fizz'
if (n % 5) == 0:
return f'{n} buzz'
return n
print(FizzBuzz(25))
|
class Solution:
def numMovesStonesII(self, stones: List[int]) -> List[int]:
def helper():
n = len(stones)
if (stones[-2] - stones[0] == n - 2 and stones[-1] - stones[-2] > 2) or (stones[-1] - stones[1] == n - 2 and stones[1] - stones[0] > 2):
return 2
dq = collections.deque()
ans = 0
for num in stones:
dq.append(num)
while dq[-1] - dq[0] + 1 > n:
dq.popleft()
ans = max(ans, len(dq))
return n - ans
stones.sort()
n = len(stones)
mx = 0
for i in range(n - 1):
a, b = stones[i], stones[i + 1]
mx += max(b - a - 1, 0)
mx -= max(min(stones[1] - stones[0] - 1, stones[-1] - stones[-2] - 1), 0)
return helper(), mx
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.