content
stringlengths 7
1.05M
| fixed_cases
stringlengths 1
1.28M
|
|---|---|
# Write your solution here
def double_items(numbers):
double_numbers = []
for item in numbers:
double_numbers.append(item*2)
return double_numbers
if __name__ == "__main__":
numbers = [2, 4, 5, 3, 11, -4]
numbers_doubled = double_items(numbers)
print("original:", numbers)
print("doubled:", numbers_doubled)
|
def double_items(numbers):
double_numbers = []
for item in numbers:
double_numbers.append(item * 2)
return double_numbers
if __name__ == '__main__':
numbers = [2, 4, 5, 3, 11, -4]
numbers_doubled = double_items(numbers)
print('original:', numbers)
print('doubled:', numbers_doubled)
|
# -*- coding: utf-8 -*-
TOILET_CHOICES = (
('F', 'Flush'),
('PT', 'Pit toilet'),
('TPT', 'Traditional Pit toilet'),
('L', 'Latrine'),
('BF', 'Bush /Field'),
('R', 'River'),
('O', 'Others'),
)
COOKING_FACILITIES = (
('Electricity', 'Electricity'),
('Gas', 'Gas'),
('Biomass', 'Biomass'),
('Kerosene', 'Kerosene'),
('Coal', 'Coal'),
('Charcoal', 'Charcoal'),
('Firewood', 'Firewood'),
('Others', 'Others'),
)
SEX_CHOICES = (
("M","Male"),
("F","Female"),
("O","Others"),
)
MARITAL_CHOICES = (
('SG', 'Single'),
('MR', 'Married'),
('DV', 'Divorced'),
('WD', 'Widowed'),
)
FREQUENCY_CHOICES = (
('AL', 'Always'),
('US', 'Usually'),
('OF', 'Often'),
('SO', 'Sometimes'),
('SE', 'Seldom'),
('RA', 'Rarely'),
('NV', 'Never'),
)
LITERATE_CHOICES = (
('LT', 'Literate'),
('SL', 'Semiliterate'),
('IL', 'Iliterate'),
)
LEVEL_CHOICES = (
('No', 'No'),
('Mi', 'Mild'),
('Mo', 'Moderate'),
('S', 'Severe'),
)
EDUCATIONAL_LEVEL_CHOICES = (
('KD', 'Kindergarden'),
('PR', 'Primary'),
('SC', 'Secondary'),
('UN', 'University'),
('NV', 'Never'),
)
RELATIONSHIP_CHOICES = (
('HS', 'Husband'),
('FA', 'Father'),
('MO', 'Mother'),
('GF', 'Grandfather'),
('GM', 'Grandmother'),
('UN', 'Uncle'),
('AU', 'Aunt'),
('FR', 'Friend'),
)
MENSTRUAL_CYCLE_CHOICES = (
('28', '28days'),
('30', '30days'),
('OT', 'Others'),
)
HAVE_BEEN_PREGNANT_CHOICES = (
(0, '0'),
(1, '1'),
(2, '2'),
(3, '3'),
(4, '4'),
(5, '5'),
(6, '6'),
(7, '7'),
(8, '8'),
(9, '9'),
(10, '10'),
(11, '11'),
(12, '12'),
(13, '13'),
(14, '14'),
(15, '15'),
(16, '16'),
(17, '17'),
(18, '18'),
(19, '19'),
(20, '20'),
)
TYPES_OF_DELIVERY_CHOICES = (
('LB', 'Live Birth'),
('SB', 'Still Birth'),
('AB', 'Abortion'),
('EC', 'Ectopic'),
('HM', 'Hydatidiform Model'),
('OT', 'Others'),
)
PROBLEMS_CHOICES = (
('NO', 'None'),
('PL','PretermLabor'),
('DB','Diabetes'),
('HB','High Blood Pressure'),
('TH','Thrombosis'),
('EM','Embolus'),
('HT','Hypertension'),
('PE','Pre-Eclampsia'),
('EC','Eclampsia'),
('OT','Others'),
)
OBSTETRICALOPERATION_CHOICES = (
('NO', 'None'),
('CS', 'Caesarian Section'),
('FO','Forceps'),
('VE','Vacuum Extraction'),
('MI','Manual instrumental help in vaginal breech delivery'),
('MR','Manual Removal Of The Placenta'),
('OT','Others'),
)
METHOD_OF_BIRTH_CONTROL_CHOICES = (
('CO', 'Condoms'),
('PI', 'Pills'),
('PA', 'Patch'),
('VR', 'Vaginal Ring'),
('TU', 'Tubal/Essure'),
('IU', 'IUD'),
('PV', 'Partner with vasectomy'),
('NA', 'Natural Family Planning'),
('IM', 'Implanon'),
('NO', 'None'),
('OT', 'Other'),
)
NORMAL_CHOICES = (
('NR', 'Normal'),
('AB', 'Abnormal'),
)
VACCINATION_CHOICES= (
('RU', 'Rubella'),
('TT', 'Tetanus Toxoid'),
('OT', 'Other'),
)
VISIT_CHOICES = (
('FT', 'First trimester'),
('ST', 'Second Trimester'),
('TT', 'Third Trimester'),
('OT', 'Other visit'),
)
BLOOD_PRESSURE_CHOICES = (
('BE','140/90'),
('AB','>= 140/90'),
)
URINALYSIS_CHOICES = (
('BE', '<0.3g/24h'),
('AB', '>0.3g/24h'),
)
HEMOGLOBIN_CHOICES = (
('A', '9-10'),
('B', '7-8'),
('C', '<7'),
('D', '>=11'),
)
MATERNAL_COMPLICATIONS_CHOICES = (
('NO','No complication'),
('RA', 'Recurrent early abortion'),
('IA','Induced abortion and any associated complications'),
('TH','Thrombosis'),
('EM','Embolus'),
('HY','Hypertension'),
('PE','Pre-Eclampsia'),
('EC','Eclampsia'),
('PA','Placental abruption'),
('OT','Others'),
)
PERINATAL_COMPLICATIONS_CHOICES = (
('NO','No complication'),
('TW', 'Twins or higher order multiples'),
('LO', 'Low birth weight (<2500g)'),
('IG','Intrauterine growth retardation'),
('RA','Rhesus antibody(erytroblastosis,hydrops)'),
('MC','Malformed or chromosomally abnormal child'),
('MA','macrosomic(>4500g) newborn'),
('RE','Resuscitation or other treatment of newborn'),
('PE','Perinatal,neonatal or infant death'),
('OT','Others'),
)
|
toilet_choices = (('F', 'Flush'), ('PT', 'Pit toilet'), ('TPT', 'Traditional Pit toilet'), ('L', 'Latrine'), ('BF', 'Bush /Field'), ('R', 'River'), ('O', 'Others'))
cooking_facilities = (('Electricity', 'Electricity'), ('Gas', 'Gas'), ('Biomass', 'Biomass'), ('Kerosene', 'Kerosene'), ('Coal', 'Coal'), ('Charcoal', 'Charcoal'), ('Firewood', 'Firewood'), ('Others', 'Others'))
sex_choices = (('M', 'Male'), ('F', 'Female'), ('O', 'Others'))
marital_choices = (('SG', 'Single'), ('MR', 'Married'), ('DV', 'Divorced'), ('WD', 'Widowed'))
frequency_choices = (('AL', 'Always'), ('US', 'Usually'), ('OF', 'Often'), ('SO', 'Sometimes'), ('SE', 'Seldom'), ('RA', 'Rarely'), ('NV', 'Never'))
literate_choices = (('LT', 'Literate'), ('SL', 'Semiliterate'), ('IL', 'Iliterate'))
level_choices = (('No', 'No'), ('Mi', 'Mild'), ('Mo', 'Moderate'), ('S', 'Severe'))
educational_level_choices = (('KD', 'Kindergarden'), ('PR', 'Primary'), ('SC', 'Secondary'), ('UN', 'University'), ('NV', 'Never'))
relationship_choices = (('HS', 'Husband'), ('FA', 'Father'), ('MO', 'Mother'), ('GF', 'Grandfather'), ('GM', 'Grandmother'), ('UN', 'Uncle'), ('AU', 'Aunt'), ('FR', 'Friend'))
menstrual_cycle_choices = (('28', '28days'), ('30', '30days'), ('OT', 'Others'))
have_been_pregnant_choices = ((0, '0'), (1, '1'), (2, '2'), (3, '3'), (4, '4'), (5, '5'), (6, '6'), (7, '7'), (8, '8'), (9, '9'), (10, '10'), (11, '11'), (12, '12'), (13, '13'), (14, '14'), (15, '15'), (16, '16'), (17, '17'), (18, '18'), (19, '19'), (20, '20'))
types_of_delivery_choices = (('LB', 'Live Birth'), ('SB', 'Still Birth'), ('AB', 'Abortion'), ('EC', 'Ectopic'), ('HM', 'Hydatidiform Model'), ('OT', 'Others'))
problems_choices = (('NO', 'None'), ('PL', 'PretermLabor'), ('DB', 'Diabetes'), ('HB', 'High Blood Pressure'), ('TH', 'Thrombosis'), ('EM', 'Embolus'), ('HT', 'Hypertension'), ('PE', 'Pre-Eclampsia'), ('EC', 'Eclampsia'), ('OT', 'Others'))
obstetricaloperation_choices = (('NO', 'None'), ('CS', 'Caesarian Section'), ('FO', 'Forceps'), ('VE', 'Vacuum Extraction'), ('MI', 'Manual instrumental help in vaginal breech delivery'), ('MR', 'Manual Removal Of The Placenta'), ('OT', 'Others'))
method_of_birth_control_choices = (('CO', 'Condoms'), ('PI', 'Pills'), ('PA', 'Patch'), ('VR', 'Vaginal Ring'), ('TU', 'Tubal/Essure'), ('IU', 'IUD'), ('PV', 'Partner with vasectomy'), ('NA', 'Natural Family Planning'), ('IM', 'Implanon'), ('NO', 'None'), ('OT', 'Other'))
normal_choices = (('NR', 'Normal'), ('AB', 'Abnormal'))
vaccination_choices = (('RU', 'Rubella'), ('TT', 'Tetanus Toxoid'), ('OT', 'Other'))
visit_choices = (('FT', 'First trimester'), ('ST', 'Second Trimester'), ('TT', 'Third Trimester'), ('OT', 'Other visit'))
blood_pressure_choices = (('BE', '140/90'), ('AB', '>= 140/90'))
urinalysis_choices = (('BE', '<0.3g/24h'), ('AB', '>0.3g/24h'))
hemoglobin_choices = (('A', '9-10'), ('B', '7-8'), ('C', '<7'), ('D', '>=11'))
maternal_complications_choices = (('NO', 'No complication'), ('RA', 'Recurrent early abortion'), ('IA', 'Induced abortion and any associated complications'), ('TH', 'Thrombosis'), ('EM', 'Embolus'), ('HY', 'Hypertension'), ('PE', 'Pre-Eclampsia'), ('EC', 'Eclampsia'), ('PA', 'Placental abruption'), ('OT', 'Others'))
perinatal_complications_choices = (('NO', 'No complication'), ('TW', 'Twins or higher order multiples'), ('LO', 'Low birth weight (<2500g)'), ('IG', 'Intrauterine growth retardation'), ('RA', 'Rhesus antibody(erytroblastosis,hydrops)'), ('MC', 'Malformed or chromosomally abnormal child'), ('MA', 'macrosomic(>4500g) newborn'), ('RE', 'Resuscitation or other treatment of newborn'), ('PE', 'Perinatal,neonatal or infant death'), ('OT', 'Others'))
|
#
# PySNMP MIB module ZHONE-COM-IP-ZEDGE-NAT-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/ZHONE-COM-IP-ZEDGE-NAT-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 21:41:01 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, Integer, OctetString = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "Integer", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsUnion, ConstraintsIntersection, ValueRangeConstraint, SingleValueConstraint, ValueSizeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ConstraintsIntersection", "ValueRangeConstraint", "SingleValueConstraint", "ValueSizeConstraint")
InterfaceIndex, = mibBuilder.importSymbols("IF-MIB", "InterfaceIndex")
NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ModuleCompliance")
NotificationType, Gauge32, iso, Counter32, IpAddress, Bits, Unsigned32, ObjectIdentity, ModuleIdentity, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn, Integer32, Counter64, TimeTicks = mibBuilder.importSymbols("SNMPv2-SMI", "NotificationType", "Gauge32", "iso", "Counter32", "IpAddress", "Bits", "Unsigned32", "ObjectIdentity", "ModuleIdentity", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Integer32", "Counter64", "TimeTicks")
TruthValue, DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "TruthValue", "DisplayString", "TextualConvention")
zhoneModules, zhoneIp = mibBuilder.importSymbols("Zhone", "zhoneModules", "zhoneIp")
ZhoneRowStatus, = mibBuilder.importSymbols("Zhone-TC", "ZhoneRowStatus")
comIpZEdgeNat = ModuleIdentity((1, 3, 6, 1, 4, 1, 5504, 6, 66))
comIpZEdgeNat.setRevisions(('2010-10-20 05:52', '2008-07-22 07:28', '2003-12-11 02:58', '2003-03-19 09:02', '2000-10-04 15:30',))
if mibBuilder.loadTexts: comIpZEdgeNat.setLastUpdated('201010200727Z')
if mibBuilder.loadTexts: comIpZEdgeNat.setOrganization('Zhone Technologies, Inc.')
zedgeNat = ObjectIdentity((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16))
if mibBuilder.loadTexts: zedgeNat.setStatus('current')
natConfigGroup = ObjectIdentity((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1))
if mibBuilder.loadTexts: natConfigGroup.setStatus('current')
natTcpTimeout = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 604800))).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: natTcpTimeout.setStatus('current')
natUdpTimeout = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 604800))).setUnits('seconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: natUdpTimeout.setStatus('current')
natClearBindings = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1, 3), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: natClearBindings.setStatus('current')
natStatsGroup = ObjectIdentity((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2))
if mibBuilder.loadTexts: natStatsGroup.setStatus('current')
natNumCurrentBindings = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 1), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: natNumCurrentBindings.setStatus('current')
natNumExpiredBindings = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 2), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: natNumExpiredBindings.setStatus('current')
natTotalPkts = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 3), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: natTotalPkts.setStatus('current')
natDroppedPkts = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 4), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: natDroppedPkts.setStatus('current')
natBindingsTable = MibTable((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3), )
if mibBuilder.loadTexts: natBindingsTable.setStatus('current')
natBindingsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1), ).setIndexNames((0, "ZHONE-COM-IP-ZEDGE-NAT-MIB", "natBindingsIfIndex"), (0, "ZHONE-COM-IP-ZEDGE-NAT-MIB", "natBindingLocalAddr"), (0, "ZHONE-COM-IP-ZEDGE-NAT-MIB", "natBindingLocalPort"), (0, "ZHONE-COM-IP-ZEDGE-NAT-MIB", "natBindingPublicAddr"), (0, "ZHONE-COM-IP-ZEDGE-NAT-MIB", "natBindingPublicPort"))
if mibBuilder.loadTexts: natBindingsEntry.setStatus('current')
natBindingsIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 1), InterfaceIndex())
if mibBuilder.loadTexts: natBindingsIfIndex.setStatus('current')
natBindingLocalAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 2), IpAddress())
if mibBuilder.loadTexts: natBindingLocalAddr.setStatus('current')
natBindingLocalPort = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 3), Unsigned32())
if mibBuilder.loadTexts: natBindingLocalPort.setStatus('current')
natBindingPublicAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 4), IpAddress()).setMaxAccess("readonly")
if mibBuilder.loadTexts: natBindingPublicAddr.setStatus('current')
natBindingPublicPort = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 5), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: natBindingPublicPort.setStatus('current')
zhonePATBindings = MibIdentifier((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4))
patBindNextIndex = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: patBindNextIndex.setStatus('current')
patTable = MibTable((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2), )
if mibBuilder.loadTexts: patTable.setStatus('current')
patEntry = MibTableRow((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1), ).setIndexNames((0, "ZHONE-COM-IP-ZEDGE-NAT-MIB", "zhonePATBindIndex"))
if mibBuilder.loadTexts: patEntry.setStatus('current')
zhonePATBindIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 4320)))
if mibBuilder.loadTexts: zhonePATBindIndex.setStatus('current')
zhonePATBindRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 2), ZhoneRowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: zhonePATBindRowStatus.setStatus('current')
publicAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 3), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: publicAddr.setStatus('current')
publicPort = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(51921, 56250))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: publicPort.setStatus('current')
localAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 5), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: localAddr.setStatus('current')
localPort = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 6), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 49151))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: localPort.setStatus('current')
portType = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("tcp", 1), ("udp", 2), ("cpemgr", 3), ("cpemgrsecure", 4))).clone('tcp')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: portType.setStatus('current')
zhoneNATExclusion = MibIdentifier((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5))
natExcludeNextIndex = MibScalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: natExcludeNextIndex.setStatus('current')
natExcludeTable = MibTable((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2), )
if mibBuilder.loadTexts: natExcludeTable.setStatus('current')
natExcludeEntry = MibTableRow((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1), ).setIndexNames((0, "ZHONE-COM-IP-ZEDGE-NAT-MIB", "zhoneNATExcludeIndex"))
if mibBuilder.loadTexts: natExcludeEntry.setStatus('current')
zhoneNATExcludeIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 20)))
if mibBuilder.loadTexts: zhoneNATExcludeIndex.setStatus('current')
zhoneNATExcludeRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 2), ZhoneRowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: zhoneNATExcludeRowStatus.setStatus('current')
ipStartAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 3), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ipStartAddr.setStatus('current')
ipEndAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 4), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ipEndAddr.setStatus('current')
mibBuilder.exportSymbols("ZHONE-COM-IP-ZEDGE-NAT-MIB", portType=portType, natBindingLocalAddr=natBindingLocalAddr, zedgeNat=zedgeNat, natBindingsIfIndex=natBindingsIfIndex, patEntry=patEntry, publicPort=publicPort, natClearBindings=natClearBindings, natNumExpiredBindings=natNumExpiredBindings, natBindingPublicPort=natBindingPublicPort, natTcpTimeout=natTcpTimeout, natBindingLocalPort=natBindingLocalPort, natStatsGroup=natStatsGroup, natExcludeTable=natExcludeTable, natBindingsTable=natBindingsTable, natExcludeNextIndex=natExcludeNextIndex, natBindingPublicAddr=natBindingPublicAddr, zhonePATBindings=zhonePATBindings, natDroppedPkts=natDroppedPkts, localPort=localPort, comIpZEdgeNat=comIpZEdgeNat, natExcludeEntry=natExcludeEntry, patTable=patTable, zhoneNATExclusion=zhoneNATExclusion, natConfigGroup=natConfigGroup, natUdpTimeout=natUdpTimeout, natBindingsEntry=natBindingsEntry, PYSNMP_MODULE_ID=comIpZEdgeNat, zhonePATBindRowStatus=zhonePATBindRowStatus, patBindNextIndex=patBindNextIndex, zhonePATBindIndex=zhonePATBindIndex, zhoneNATExcludeRowStatus=zhoneNATExcludeRowStatus, zhoneNATExcludeIndex=zhoneNATExcludeIndex, natNumCurrentBindings=natNumCurrentBindings, ipStartAddr=ipStartAddr, natTotalPkts=natTotalPkts, ipEndAddr=ipEndAddr, localAddr=localAddr, publicAddr=publicAddr)
|
(object_identifier, integer, octet_string) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'Integer', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_union, constraints_intersection, value_range_constraint, single_value_constraint, value_size_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'ConstraintsIntersection', 'ValueRangeConstraint', 'SingleValueConstraint', 'ValueSizeConstraint')
(interface_index,) = mibBuilder.importSymbols('IF-MIB', 'InterfaceIndex')
(notification_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ModuleCompliance')
(notification_type, gauge32, iso, counter32, ip_address, bits, unsigned32, object_identity, module_identity, mib_identifier, mib_scalar, mib_table, mib_table_row, mib_table_column, integer32, counter64, time_ticks) = mibBuilder.importSymbols('SNMPv2-SMI', 'NotificationType', 'Gauge32', 'iso', 'Counter32', 'IpAddress', 'Bits', 'Unsigned32', 'ObjectIdentity', 'ModuleIdentity', 'MibIdentifier', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Integer32', 'Counter64', 'TimeTicks')
(truth_value, display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'TruthValue', 'DisplayString', 'TextualConvention')
(zhone_modules, zhone_ip) = mibBuilder.importSymbols('Zhone', 'zhoneModules', 'zhoneIp')
(zhone_row_status,) = mibBuilder.importSymbols('Zhone-TC', 'ZhoneRowStatus')
com_ip_z_edge_nat = module_identity((1, 3, 6, 1, 4, 1, 5504, 6, 66))
comIpZEdgeNat.setRevisions(('2010-10-20 05:52', '2008-07-22 07:28', '2003-12-11 02:58', '2003-03-19 09:02', '2000-10-04 15:30'))
if mibBuilder.loadTexts:
comIpZEdgeNat.setLastUpdated('201010200727Z')
if mibBuilder.loadTexts:
comIpZEdgeNat.setOrganization('Zhone Technologies, Inc.')
zedge_nat = object_identity((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16))
if mibBuilder.loadTexts:
zedgeNat.setStatus('current')
nat_config_group = object_identity((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1))
if mibBuilder.loadTexts:
natConfigGroup.setStatus('current')
nat_tcp_timeout = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 604800))).setUnits('seconds').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
natTcpTimeout.setStatus('current')
nat_udp_timeout = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1, 2), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 604800))).setUnits('seconds').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
natUdpTimeout.setStatus('current')
nat_clear_bindings = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 1, 3), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
natClearBindings.setStatus('current')
nat_stats_group = object_identity((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2))
if mibBuilder.loadTexts:
natStatsGroup.setStatus('current')
nat_num_current_bindings = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 1), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
natNumCurrentBindings.setStatus('current')
nat_num_expired_bindings = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 2), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
natNumExpiredBindings.setStatus('current')
nat_total_pkts = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 3), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
natTotalPkts.setStatus('current')
nat_dropped_pkts = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 2, 4), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
natDroppedPkts.setStatus('current')
nat_bindings_table = mib_table((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3))
if mibBuilder.loadTexts:
natBindingsTable.setStatus('current')
nat_bindings_entry = mib_table_row((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1)).setIndexNames((0, 'ZHONE-COM-IP-ZEDGE-NAT-MIB', 'natBindingsIfIndex'), (0, 'ZHONE-COM-IP-ZEDGE-NAT-MIB', 'natBindingLocalAddr'), (0, 'ZHONE-COM-IP-ZEDGE-NAT-MIB', 'natBindingLocalPort'), (0, 'ZHONE-COM-IP-ZEDGE-NAT-MIB', 'natBindingPublicAddr'), (0, 'ZHONE-COM-IP-ZEDGE-NAT-MIB', 'natBindingPublicPort'))
if mibBuilder.loadTexts:
natBindingsEntry.setStatus('current')
nat_bindings_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 1), interface_index())
if mibBuilder.loadTexts:
natBindingsIfIndex.setStatus('current')
nat_binding_local_addr = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 2), ip_address())
if mibBuilder.loadTexts:
natBindingLocalAddr.setStatus('current')
nat_binding_local_port = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 3), unsigned32())
if mibBuilder.loadTexts:
natBindingLocalPort.setStatus('current')
nat_binding_public_addr = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 4), ip_address()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
natBindingPublicAddr.setStatus('current')
nat_binding_public_port = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 3, 1, 5), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
natBindingPublicPort.setStatus('current')
zhone_pat_bindings = mib_identifier((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4))
pat_bind_next_index = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
patBindNextIndex.setStatus('current')
pat_table = mib_table((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2))
if mibBuilder.loadTexts:
patTable.setStatus('current')
pat_entry = mib_table_row((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1)).setIndexNames((0, 'ZHONE-COM-IP-ZEDGE-NAT-MIB', 'zhonePATBindIndex'))
if mibBuilder.loadTexts:
patEntry.setStatus('current')
zhone_pat_bind_index = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 4320)))
if mibBuilder.loadTexts:
zhonePATBindIndex.setStatus('current')
zhone_pat_bind_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 2), zhone_row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
zhonePATBindRowStatus.setStatus('current')
public_addr = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 3), ip_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
publicAddr.setStatus('current')
public_port = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(51921, 56250))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
publicPort.setStatus('current')
local_addr = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 5), ip_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
localAddr.setStatus('current')
local_port = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 6), integer32().subtype(subtypeSpec=value_range_constraint(1, 49151))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
localPort.setStatus('current')
port_type = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 4, 2, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('tcp', 1), ('udp', 2), ('cpemgr', 3), ('cpemgrsecure', 4))).clone('tcp')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
portType.setStatus('current')
zhone_nat_exclusion = mib_identifier((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5))
nat_exclude_next_index = mib_scalar((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
natExcludeNextIndex.setStatus('current')
nat_exclude_table = mib_table((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2))
if mibBuilder.loadTexts:
natExcludeTable.setStatus('current')
nat_exclude_entry = mib_table_row((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1)).setIndexNames((0, 'ZHONE-COM-IP-ZEDGE-NAT-MIB', 'zhoneNATExcludeIndex'))
if mibBuilder.loadTexts:
natExcludeEntry.setStatus('current')
zhone_nat_exclude_index = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 20)))
if mibBuilder.loadTexts:
zhoneNATExcludeIndex.setStatus('current')
zhone_nat_exclude_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 2), zhone_row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
zhoneNATExcludeRowStatus.setStatus('current')
ip_start_addr = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 3), ip_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ipStartAddr.setStatus('current')
ip_end_addr = mib_table_column((1, 3, 6, 1, 4, 1, 5504, 4, 1, 16, 5, 2, 1, 4), ip_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ipEndAddr.setStatus('current')
mibBuilder.exportSymbols('ZHONE-COM-IP-ZEDGE-NAT-MIB', portType=portType, natBindingLocalAddr=natBindingLocalAddr, zedgeNat=zedgeNat, natBindingsIfIndex=natBindingsIfIndex, patEntry=patEntry, publicPort=publicPort, natClearBindings=natClearBindings, natNumExpiredBindings=natNumExpiredBindings, natBindingPublicPort=natBindingPublicPort, natTcpTimeout=natTcpTimeout, natBindingLocalPort=natBindingLocalPort, natStatsGroup=natStatsGroup, natExcludeTable=natExcludeTable, natBindingsTable=natBindingsTable, natExcludeNextIndex=natExcludeNextIndex, natBindingPublicAddr=natBindingPublicAddr, zhonePATBindings=zhonePATBindings, natDroppedPkts=natDroppedPkts, localPort=localPort, comIpZEdgeNat=comIpZEdgeNat, natExcludeEntry=natExcludeEntry, patTable=patTable, zhoneNATExclusion=zhoneNATExclusion, natConfigGroup=natConfigGroup, natUdpTimeout=natUdpTimeout, natBindingsEntry=natBindingsEntry, PYSNMP_MODULE_ID=comIpZEdgeNat, zhonePATBindRowStatus=zhonePATBindRowStatus, patBindNextIndex=patBindNextIndex, zhonePATBindIndex=zhonePATBindIndex, zhoneNATExcludeRowStatus=zhoneNATExcludeRowStatus, zhoneNATExcludeIndex=zhoneNATExcludeIndex, natNumCurrentBindings=natNumCurrentBindings, ipStartAddr=ipStartAddr, natTotalPkts=natTotalPkts, ipEndAddr=ipEndAddr, localAddr=localAddr, publicAddr=publicAddr)
|
# Data paths
DATA_BACKGROUND_FOLDER = "../data/background/"
DATA_GENERATED_FOLDER = "../data/generated_data/"
# General settings
IMAGES_TO_GENERATE = 500
COIN_RESIZE_RATIO_MIN = 0.4
COIN_RESIZE_RATIO_MAX = 0.6
# Background settings
BACKGROUND_RESIZE_RATIO = 400
BACKGROUND_MAX_N_COINS = 25
# Coin crop settings
MAX_COIN_OVERLAP_PERCENTAGE = 0.33
INDIVIDUAL_COIN_CROP_NOISE = 0.05
|
data_background_folder = '../data/background/'
data_generated_folder = '../data/generated_data/'
images_to_generate = 500
coin_resize_ratio_min = 0.4
coin_resize_ratio_max = 0.6
background_resize_ratio = 400
background_max_n_coins = 25
max_coin_overlap_percentage = 0.33
individual_coin_crop_noise = 0.05
|
# Test values must be in the form [(text_input, expected_output), (text_input, expected_output), ...]
test_values = [
(
"president",
{
"n": {
"president",
"presidentship",
"presidencies",
"presidency",
"presidentships",
"presidents",
},
"r": {"presidentially"},
"a": {"presidential"},
"v": {"presiding", "presides", "preside", "presided"},
},
),
(
"elect",
{
"n": {
"elector",
"elects",
"electors",
"elective",
"electorates",
"elect",
"electives",
"elections",
"electorate",
"eligibility",
"election",
"eligibilities",
},
"r": set(),
"a": {"elect", "electoral", "elective", "eligible"},
"v": {"elect", "elects", "electing", "elected"},
},
),
(
"running",
{
"n": {
"runninesses",
"runnings",
"runs",
"running",
"runniness",
"runners",
"runner",
"run",
},
"a": {"running", "runny"},
"v": {"running", "ran", "runs", "run"},
"r": set(),
},
),
(
"run",
{
"n": {
"runninesses",
"runnings",
"runs",
"running",
"runniness",
"runners",
"runner",
"run",
},
"a": {"running", "runny"},
"v": {"running", "ran", "runs", "run"},
"r": set(),
},
),
(
"operations",
{
"n": {
"operators",
"operations",
"operation",
"operative",
"operator",
"operatives",
},
"a": {"operant", "operative"},
"v": {"operated", "operating", "operate", "operates"},
"r": {"operatively"},
},
),
(
"operate",
{
"n": {
"operators",
"operations",
"operation",
"operative",
"operator",
"operatives",
},
"a": {"operant", "operative"},
"v": {"operated", "operating", "operate", "operates"},
"r": {"operatively"},
},
),
(
"invest",
{
"n": {
"investitures",
"investors",
"investiture",
"investor",
"investments",
"investings",
"investment",
"investing",
},
"a": set(),
"v": {"invested", "invests", "invest", "investing"},
"r": set(),
},
),
(
"investments",
{
"n": {
"investitures",
"investors",
"investiture",
"investor",
"investments",
"investings",
"investment",
"investing",
},
"a": set(),
"v": {"invested", "invests", "invest", "investing"},
"r": set(),
},
),
(
"conjugation",
{
"n": {"conjugate", "conjugation", "conjugates", "conjugations"},
"a": {"conjugate"},
"v": {"conjugating", "conjugated", "conjugate", "conjugates"},
"r": set(),
},
),
(
"do",
{
"n": {"does", "doer", "doers", "do"},
"a": set(),
"v": {
"doing",
"don't",
"does",
"didn't",
"do",
"doesn't",
"done",
"did",
},
"r": set(),
},
),
(
"word",
{
"n": {"words", "word", "wordings", "wording"},
"a": set(),
"v": {"words", "word", "worded", "wording"},
"r": set(),
},
),
(
"love",
{
"a": {"lovable", "loveable"},
"n": {"love", "lover", "lovers", "loves"},
"r": set(),
"v": {"love", "loved", "loves", "loving"},
},
),
(
"word",
{
"n": {"words", "word", "wordings", "wording"},
"a": set(),
"v": {"words", "word", "worded", "wording"},
"r": set(),
},
),
(
"verb",
{
"n": {"verbs", "verb"},
"a": {"verbal"},
"v": {"verbifying", "verbified", "verbify", "verbifies"},
"r": {"verbally"},
},
),
(
"genetic",
{
"n": {"geneticist", "genetics", "geneticists", "genes", "gene"},
"a": {"genic", "genetic", "genetical"},
"v": set(),
"r": {"genetically"},
},
),
(
"politician",
{
"r": {"politically"},
"a": {"political"},
"n": {"politician", "politicians", "politics"},
"v": set(),
},
),
(
"death",
{
"n": {"death", "dying", "deaths", "die", "dyings", "dice"},
"a": {"dying", "deathly"},
"v": {"died", "die", "dying", "dies"},
"r": {"deathly"},
},
),
(
"attitude",
{
"n": {"attitudes", "attitude"},
"a": set(),
"v": {
"attitudinise",
"attitudinized",
"attitudinize",
"attitudinizes",
"attitudinizing",
},
"r": set(),
},
),
(
"cheek",
{
"n": {"cheek", "cheekinesses", "cheeks", "cheekiness"},
"a": {"cheeky"},
"v": {"cheek", "cheeks", "cheeked", "cheeking"},
"r": {"cheekily"},
},
),
(
"world",
{
"n": {"worldliness", "world", "worldlinesses", "worlds"},
"a": {"worldly", "world"},
"v": set(),
"r": set(),
},
),
("lake", {"n": {"lake", "lakes"}, "a": set(), "v": set(), "r": set()}),
(
"guitar",
{
"n": {"guitarist", "guitarists", "guitar", "guitars"},
"a": set(),
"v": set(),
"r": set(),
},
),
(
"presence",
{
"n": {
"presenter",
"present",
"presents",
"presentness",
"presenters",
"presentnesses",
"presentments",
"presentations",
"presences",
"presence",
"presentment",
"presentation",
},
"a": {"present"},
"v": {"present", "presents", "presenting", "presented"},
"r": {"presently"},
},
),
(
"enthusiasm",
{
"n": {"enthusiasm", "enthusiasms"},
"a": {"enthusiastic"},
"v": set(),
"r": {"enthusiastically"},
},
),
(
"organization",
{
"n": {"organizers", "organization", "organizations", "organizer"},
"a": set(),
"v": {"organize", "organized", "organizing", "organizes"},
"r": set(),
},
),
(
"player",
{
"n": {
"plays",
"playlet",
"playings",
"players",
"playing",
"playlets",
"play",
"player",
},
"a": set(),
"v": {"plays", "play", "playing", "played"},
"r": set(),
},
),
(
"transportation",
{
"n": {
"transporters",
"transportation",
"transportations",
"transporter",
"transport",
"transports",
},
"a": set(),
"v": {"transport", "transporting", "transports", "transported"},
"r": set(),
},
),
(
"television",
{
"n": {"televisions", "television"},
"a": set(),
"v": {"televising", "televise", "televises", "televised"},
"r": set(),
},
),
(
"cousin",
{"n": {"cousins", "cousin"}, "a": {"cousinly"}, "v": set(), "r": set()},
),
(
"ability",
{"n": {"abilities", "ability"}, "a": {"able"}, "v": set(), "r": {"ably"}},
),
("chapter", {"n": {"chapters", "chapter"}, "a": set(), "v": set(), "r": set()}),
(
"appearance",
{
"n": {
"appearances",
"apparitions",
"appearance",
"apparencies",
"apparentness",
"apparentnesses",
"apparition",
"apparency",
},
"a": {"apparent"},
"v": {"appears", "appeared", "appear", "appearing"},
"r": {"apparently"},
},
),
(
"drawing",
{
"n": {
"drawings",
"drawers",
"draws",
"drawer",
"drawees",
"drawee",
"draw",
"drawing",
},
"a": set(),
"v": {"draws", "drew", "drawn", "draw", "drawing"},
"r": set(),
},
),
(
"university",
{"n": {"university", "universities"}, "a": set(), "v": set(), "r": set()},
),
(
"performance",
{
"n": {
"performings",
"performing",
"performances",
"performance",
"performer",
"performers",
},
"a": set(),
"v": {"performs", "performing", "performed", "perform"},
"r": set(),
},
),
("revenue", {"n": {"revenue", "revenues"}, "a": set(), "v": set(), "r": set()}),
# Some Verbs
(
"cling",
{
"n": {"cling", "clings"},
"a": set(),
"v": {"clung", "cling", "clinging", "clings"},
"r": set(),
},
),
(
"decrease",
{
"n": {"decrease", "decreases"},
"a": set(),
"v": {"decrease", "decreases", "decreased", "decreasing"},
"r": set(),
},
),
(
"wonder",
{
"n": {
"wonder",
"wonderment",
"wonderments",
"wonders",
"wonderers",
"wonderer",
},
"a": {"wondrous"},
"v": {"wondering", "wonder", "wonders", "wondered"},
"r": {"wondrous", "wondrously"},
},
),
(
"rest",
{
"n": {"rest", "rests", "resters", "rester"},
"a": set(),
"v": {"rest", "rests", "resting", "rested"},
"r": set(),
},
),
(
"mutter",
{
"n": {
"mutterer",
"mutterers",
"muttering",
"mutter",
"mutterings",
"mutters",
},
"a": set(),
"v": {"muttering", "muttered", "mutters", "mutter"},
"r": set(),
},
),
(
"implement",
{
"n": {"implementations", "implement", "implements", "implementation"},
"a": {"implemental"},
"v": {"implemented", "implement", "implements", "implementing"},
"r": set(),
},
),
(
"evolve",
{
"n": {"evolution", "evolutions"},
"a": {"evolutionary"},
"v": {"evolved", "evolve", "evolves", "evolving"},
"r": {"evolutionarily"},
},
),
(
"allocate",
{
"n": {"allocations", "allocators", "allocation", "allocator"},
"a": {"allocable", "allocatable"},
"v": {"allocating", "allocates", "allocated", "allocate"},
"r": set(),
},
),
(
"flood",
{
"n": {"flood", "flooding", "floodings", "floods"},
"a": set(),
"v": {"flooding", "flooded", "flood", "floods"},
"r": set(),
},
), # Should there be `flooded` in 'a' here?
(
"bow",
{
"n": {"bows", "bow"},
"a": set(),
"v": {"bows", "bowing", "bowed", "bow"},
"r": set(),
},
),
(
"advocate",
{
"n": {
"advocates",
"advocator",
"advocacy",
"advocacies",
"advocators",
"advocate",
},
"a": set(),
"v": {"advocates", "advocating", "advocated", "advocate"},
"r": set(),
},
),
(
"divert",
{
"n": {"diversions", "diversionists", "diversionist", "diversion"},
"a": {"diversionary"},
"v": {"diverted", "diverts", "divert", "diverting"},
"r": set(),
},
),
# Some adjectives
(
"sweet",
{
"n": {"sweetnesses", "sweets", "sweetness", "sweet"},
"a": {"sweet"},
"v": set(),
"r": {"sweet", "sweetly"},
},
),
(
"glossy",
{
"n": {"glossiness", "glossy", "glossies", "glossinesses"},
"a": {"glossy"},
"v": set(),
"r": {"glossily"},
},
),
(
"relevant",
{
"n": {"relevancies", "relevance", "relevancy", "relevances"},
"a": {"relevant"},
"v": set(),
"r": {"relevantly"},
},
),
(
"aloof",
{"n": {"aloofnesses", "aloofness"}, "a": {"aloof"}, "v": set(), "r": {"aloof"}},
),
(
"therapeutic",
{
"n": {
"therapists",
"therapies",
"therapy",
"therapist",
"therapeutic",
"therapeutics",
},
"a": {"therapeutical", "therapeutic"},
"v": set(),
"r": {"therapeutically"},
},
),
(
"obviously",
{
"n": {"obviousnesses", "obviousness"},
"a": {"obvious"},
"v": set(),
"r": {"obviously"},
},
),
(
"jumpy",
{
"n": {"jumpings", "jumpiness", "jumpinesses", "jump", "jumping", "jumps"},
"a": {"jumpy"},
"v": {"jump", "jumping", "jumped", "jumps"},
"r": set(),
},
),
(
"venomous",
{"n": {"venom", "venoms"}, "a": {"venomous"}, "v": set(), "r": {"venomously"}},
),
(
"laughable",
{
"n": {"laugher", "laughs", "laughers", "laugh"},
"a": {"laughable"},
"v": {"laughing", "laughs", "laughed", "laugh"},
"r": {"laughably"},
},
),
(
"demonic",
{
"n": {"demons", "demon", "demonizations", "demonization"},
"a": {"demonic"},
"v": {"demonized", "demonizing", "demonizes", "demonize"},
"r": set(),
},
),
(
"knotty",
{
"n": {"knot", "knottiness", "knots", "knottinesses"},
"a": {"knotty"},
"v": {"knotted", "knotting", "knots", "knot"},
"r": set(),
},
), # Is `knottinesses` a valid plural?
(
"little",
{
"n": {"little", "littlenesses", "littles", "littleness"},
"a": {"little"},
"v": set(),
"r": {"little"},
},
), # Is `littlenesses` a valid plural?
(
"puzzling",
{
"n": {
"puzzle",
"puzzlers",
"puzzler",
"puzzlement",
"puzzlements",
"puzzles",
},
"a": {"puzzling"},
"v": {"puzzle", "puzzled", "puzzles", "puzzling"},
"r": set(),
},
),
(
"overrated",
{
"n": {"overratings", "overrating"},
"a": set(),
"v": {"overrated", "overrating", "overrate", "overrates"},
"r": set(),
},
),
(
"walk",
{
"n": {"walking", "walks", "walkings", "walker", "walk", "walkers"},
"a": {"walking"},
"v": {"walked", "walking", "walk", "walks"},
"r": set(),
},
),
(
"walking",
{
"n": {"walking", "walks", "walkings", "walker", "walk", "walkers"},
"a": {"walking"},
"v": {"walked", "walking", "walk", "walks"},
"r": set(),
},
),
(
"be",
{
"n": {"beings", "being"},
"a": set(),
"v": {
"wasn't",
"being",
"be",
"are",
"was",
"am",
"isn't",
"is",
"aren't",
"been",
"weren't",
"were",
"am not",
},
"r": set(),
},
),
(
"am",
{
"n": {"beings", "being"},
"a": set(),
"v": {
"wasn't",
"being",
"be",
"are",
"was",
"am",
"isn't",
"is",
"aren't",
"been",
"weren't",
"were",
"am not",
},
"r": set(),
},
),
(
"run",
{
"n": {
"runnings",
"run",
"runninesses",
"runner",
"runniness",
"running",
"runs",
"runners",
},
"a": {"running", "runny"},
"v": {"running", "ran", "run", "runs"},
"r": set(),
},
),
(
"ran",
{
"n": {
"runnings",
"run",
"runninesses",
"runner",
"runniness",
"running",
"runs",
"runners",
},
"a": {"running", "runny"},
"v": {"running", "ran", "run", "runs"},
"r": set(),
},
),
(
"blanket",
{
"n": {"blanket", "blankets"},
"a": {"blanket"},
"v": {"blankets", "blanketed", "blanketing", "blanket"},
"r": set(),
},
),
]
|
test_values = [('president', {'n': {'president', 'presidentship', 'presidencies', 'presidency', 'presidentships', 'presidents'}, 'r': {'presidentially'}, 'a': {'presidential'}, 'v': {'presiding', 'presides', 'preside', 'presided'}}), ('elect', {'n': {'elector', 'elects', 'electors', 'elective', 'electorates', 'elect', 'electives', 'elections', 'electorate', 'eligibility', 'election', 'eligibilities'}, 'r': set(), 'a': {'elect', 'electoral', 'elective', 'eligible'}, 'v': {'elect', 'elects', 'electing', 'elected'}}), ('running', {'n': {'runninesses', 'runnings', 'runs', 'running', 'runniness', 'runners', 'runner', 'run'}, 'a': {'running', 'runny'}, 'v': {'running', 'ran', 'runs', 'run'}, 'r': set()}), ('run', {'n': {'runninesses', 'runnings', 'runs', 'running', 'runniness', 'runners', 'runner', 'run'}, 'a': {'running', 'runny'}, 'v': {'running', 'ran', 'runs', 'run'}, 'r': set()}), ('operations', {'n': {'operators', 'operations', 'operation', 'operative', 'operator', 'operatives'}, 'a': {'operant', 'operative'}, 'v': {'operated', 'operating', 'operate', 'operates'}, 'r': {'operatively'}}), ('operate', {'n': {'operators', 'operations', 'operation', 'operative', 'operator', 'operatives'}, 'a': {'operant', 'operative'}, 'v': {'operated', 'operating', 'operate', 'operates'}, 'r': {'operatively'}}), ('invest', {'n': {'investitures', 'investors', 'investiture', 'investor', 'investments', 'investings', 'investment', 'investing'}, 'a': set(), 'v': {'invested', 'invests', 'invest', 'investing'}, 'r': set()}), ('investments', {'n': {'investitures', 'investors', 'investiture', 'investor', 'investments', 'investings', 'investment', 'investing'}, 'a': set(), 'v': {'invested', 'invests', 'invest', 'investing'}, 'r': set()}), ('conjugation', {'n': {'conjugate', 'conjugation', 'conjugates', 'conjugations'}, 'a': {'conjugate'}, 'v': {'conjugating', 'conjugated', 'conjugate', 'conjugates'}, 'r': set()}), ('do', {'n': {'does', 'doer', 'doers', 'do'}, 'a': set(), 'v': {'doing', "don't", 'does', "didn't", 'do', "doesn't", 'done', 'did'}, 'r': set()}), ('word', {'n': {'words', 'word', 'wordings', 'wording'}, 'a': set(), 'v': {'words', 'word', 'worded', 'wording'}, 'r': set()}), ('love', {'a': {'lovable', 'loveable'}, 'n': {'love', 'lover', 'lovers', 'loves'}, 'r': set(), 'v': {'love', 'loved', 'loves', 'loving'}}), ('word', {'n': {'words', 'word', 'wordings', 'wording'}, 'a': set(), 'v': {'words', 'word', 'worded', 'wording'}, 'r': set()}), ('verb', {'n': {'verbs', 'verb'}, 'a': {'verbal'}, 'v': {'verbifying', 'verbified', 'verbify', 'verbifies'}, 'r': {'verbally'}}), ('genetic', {'n': {'geneticist', 'genetics', 'geneticists', 'genes', 'gene'}, 'a': {'genic', 'genetic', 'genetical'}, 'v': set(), 'r': {'genetically'}}), ('politician', {'r': {'politically'}, 'a': {'political'}, 'n': {'politician', 'politicians', 'politics'}, 'v': set()}), ('death', {'n': {'death', 'dying', 'deaths', 'die', 'dyings', 'dice'}, 'a': {'dying', 'deathly'}, 'v': {'died', 'die', 'dying', 'dies'}, 'r': {'deathly'}}), ('attitude', {'n': {'attitudes', 'attitude'}, 'a': set(), 'v': {'attitudinise', 'attitudinized', 'attitudinize', 'attitudinizes', 'attitudinizing'}, 'r': set()}), ('cheek', {'n': {'cheek', 'cheekinesses', 'cheeks', 'cheekiness'}, 'a': {'cheeky'}, 'v': {'cheek', 'cheeks', 'cheeked', 'cheeking'}, 'r': {'cheekily'}}), ('world', {'n': {'worldliness', 'world', 'worldlinesses', 'worlds'}, 'a': {'worldly', 'world'}, 'v': set(), 'r': set()}), ('lake', {'n': {'lake', 'lakes'}, 'a': set(), 'v': set(), 'r': set()}), ('guitar', {'n': {'guitarist', 'guitarists', 'guitar', 'guitars'}, 'a': set(), 'v': set(), 'r': set()}), ('presence', {'n': {'presenter', 'present', 'presents', 'presentness', 'presenters', 'presentnesses', 'presentments', 'presentations', 'presences', 'presence', 'presentment', 'presentation'}, 'a': {'present'}, 'v': {'present', 'presents', 'presenting', 'presented'}, 'r': {'presently'}}), ('enthusiasm', {'n': {'enthusiasm', 'enthusiasms'}, 'a': {'enthusiastic'}, 'v': set(), 'r': {'enthusiastically'}}), ('organization', {'n': {'organizers', 'organization', 'organizations', 'organizer'}, 'a': set(), 'v': {'organize', 'organized', 'organizing', 'organizes'}, 'r': set()}), ('player', {'n': {'plays', 'playlet', 'playings', 'players', 'playing', 'playlets', 'play', 'player'}, 'a': set(), 'v': {'plays', 'play', 'playing', 'played'}, 'r': set()}), ('transportation', {'n': {'transporters', 'transportation', 'transportations', 'transporter', 'transport', 'transports'}, 'a': set(), 'v': {'transport', 'transporting', 'transports', 'transported'}, 'r': set()}), ('television', {'n': {'televisions', 'television'}, 'a': set(), 'v': {'televising', 'televise', 'televises', 'televised'}, 'r': set()}), ('cousin', {'n': {'cousins', 'cousin'}, 'a': {'cousinly'}, 'v': set(), 'r': set()}), ('ability', {'n': {'abilities', 'ability'}, 'a': {'able'}, 'v': set(), 'r': {'ably'}}), ('chapter', {'n': {'chapters', 'chapter'}, 'a': set(), 'v': set(), 'r': set()}), ('appearance', {'n': {'appearances', 'apparitions', 'appearance', 'apparencies', 'apparentness', 'apparentnesses', 'apparition', 'apparency'}, 'a': {'apparent'}, 'v': {'appears', 'appeared', 'appear', 'appearing'}, 'r': {'apparently'}}), ('drawing', {'n': {'drawings', 'drawers', 'draws', 'drawer', 'drawees', 'drawee', 'draw', 'drawing'}, 'a': set(), 'v': {'draws', 'drew', 'drawn', 'draw', 'drawing'}, 'r': set()}), ('university', {'n': {'university', 'universities'}, 'a': set(), 'v': set(), 'r': set()}), ('performance', {'n': {'performings', 'performing', 'performances', 'performance', 'performer', 'performers'}, 'a': set(), 'v': {'performs', 'performing', 'performed', 'perform'}, 'r': set()}), ('revenue', {'n': {'revenue', 'revenues'}, 'a': set(), 'v': set(), 'r': set()}), ('cling', {'n': {'cling', 'clings'}, 'a': set(), 'v': {'clung', 'cling', 'clinging', 'clings'}, 'r': set()}), ('decrease', {'n': {'decrease', 'decreases'}, 'a': set(), 'v': {'decrease', 'decreases', 'decreased', 'decreasing'}, 'r': set()}), ('wonder', {'n': {'wonder', 'wonderment', 'wonderments', 'wonders', 'wonderers', 'wonderer'}, 'a': {'wondrous'}, 'v': {'wondering', 'wonder', 'wonders', 'wondered'}, 'r': {'wondrous', 'wondrously'}}), ('rest', {'n': {'rest', 'rests', 'resters', 'rester'}, 'a': set(), 'v': {'rest', 'rests', 'resting', 'rested'}, 'r': set()}), ('mutter', {'n': {'mutterer', 'mutterers', 'muttering', 'mutter', 'mutterings', 'mutters'}, 'a': set(), 'v': {'muttering', 'muttered', 'mutters', 'mutter'}, 'r': set()}), ('implement', {'n': {'implementations', 'implement', 'implements', 'implementation'}, 'a': {'implemental'}, 'v': {'implemented', 'implement', 'implements', 'implementing'}, 'r': set()}), ('evolve', {'n': {'evolution', 'evolutions'}, 'a': {'evolutionary'}, 'v': {'evolved', 'evolve', 'evolves', 'evolving'}, 'r': {'evolutionarily'}}), ('allocate', {'n': {'allocations', 'allocators', 'allocation', 'allocator'}, 'a': {'allocable', 'allocatable'}, 'v': {'allocating', 'allocates', 'allocated', 'allocate'}, 'r': set()}), ('flood', {'n': {'flood', 'flooding', 'floodings', 'floods'}, 'a': set(), 'v': {'flooding', 'flooded', 'flood', 'floods'}, 'r': set()}), ('bow', {'n': {'bows', 'bow'}, 'a': set(), 'v': {'bows', 'bowing', 'bowed', 'bow'}, 'r': set()}), ('advocate', {'n': {'advocates', 'advocator', 'advocacy', 'advocacies', 'advocators', 'advocate'}, 'a': set(), 'v': {'advocates', 'advocating', 'advocated', 'advocate'}, 'r': set()}), ('divert', {'n': {'diversions', 'diversionists', 'diversionist', 'diversion'}, 'a': {'diversionary'}, 'v': {'diverted', 'diverts', 'divert', 'diverting'}, 'r': set()}), ('sweet', {'n': {'sweetnesses', 'sweets', 'sweetness', 'sweet'}, 'a': {'sweet'}, 'v': set(), 'r': {'sweet', 'sweetly'}}), ('glossy', {'n': {'glossiness', 'glossy', 'glossies', 'glossinesses'}, 'a': {'glossy'}, 'v': set(), 'r': {'glossily'}}), ('relevant', {'n': {'relevancies', 'relevance', 'relevancy', 'relevances'}, 'a': {'relevant'}, 'v': set(), 'r': {'relevantly'}}), ('aloof', {'n': {'aloofnesses', 'aloofness'}, 'a': {'aloof'}, 'v': set(), 'r': {'aloof'}}), ('therapeutic', {'n': {'therapists', 'therapies', 'therapy', 'therapist', 'therapeutic', 'therapeutics'}, 'a': {'therapeutical', 'therapeutic'}, 'v': set(), 'r': {'therapeutically'}}), ('obviously', {'n': {'obviousnesses', 'obviousness'}, 'a': {'obvious'}, 'v': set(), 'r': {'obviously'}}), ('jumpy', {'n': {'jumpings', 'jumpiness', 'jumpinesses', 'jump', 'jumping', 'jumps'}, 'a': {'jumpy'}, 'v': {'jump', 'jumping', 'jumped', 'jumps'}, 'r': set()}), ('venomous', {'n': {'venom', 'venoms'}, 'a': {'venomous'}, 'v': set(), 'r': {'venomously'}}), ('laughable', {'n': {'laugher', 'laughs', 'laughers', 'laugh'}, 'a': {'laughable'}, 'v': {'laughing', 'laughs', 'laughed', 'laugh'}, 'r': {'laughably'}}), ('demonic', {'n': {'demons', 'demon', 'demonizations', 'demonization'}, 'a': {'demonic'}, 'v': {'demonized', 'demonizing', 'demonizes', 'demonize'}, 'r': set()}), ('knotty', {'n': {'knot', 'knottiness', 'knots', 'knottinesses'}, 'a': {'knotty'}, 'v': {'knotted', 'knotting', 'knots', 'knot'}, 'r': set()}), ('little', {'n': {'little', 'littlenesses', 'littles', 'littleness'}, 'a': {'little'}, 'v': set(), 'r': {'little'}}), ('puzzling', {'n': {'puzzle', 'puzzlers', 'puzzler', 'puzzlement', 'puzzlements', 'puzzles'}, 'a': {'puzzling'}, 'v': {'puzzle', 'puzzled', 'puzzles', 'puzzling'}, 'r': set()}), ('overrated', {'n': {'overratings', 'overrating'}, 'a': set(), 'v': {'overrated', 'overrating', 'overrate', 'overrates'}, 'r': set()}), ('walk', {'n': {'walking', 'walks', 'walkings', 'walker', 'walk', 'walkers'}, 'a': {'walking'}, 'v': {'walked', 'walking', 'walk', 'walks'}, 'r': set()}), ('walking', {'n': {'walking', 'walks', 'walkings', 'walker', 'walk', 'walkers'}, 'a': {'walking'}, 'v': {'walked', 'walking', 'walk', 'walks'}, 'r': set()}), ('be', {'n': {'beings', 'being'}, 'a': set(), 'v': {"wasn't", 'being', 'be', 'are', 'was', 'am', "isn't", 'is', "aren't", 'been', "weren't", 'were', 'am not'}, 'r': set()}), ('am', {'n': {'beings', 'being'}, 'a': set(), 'v': {"wasn't", 'being', 'be', 'are', 'was', 'am', "isn't", 'is', "aren't", 'been', "weren't", 'were', 'am not'}, 'r': set()}), ('run', {'n': {'runnings', 'run', 'runninesses', 'runner', 'runniness', 'running', 'runs', 'runners'}, 'a': {'running', 'runny'}, 'v': {'running', 'ran', 'run', 'runs'}, 'r': set()}), ('ran', {'n': {'runnings', 'run', 'runninesses', 'runner', 'runniness', 'running', 'runs', 'runners'}, 'a': {'running', 'runny'}, 'v': {'running', 'ran', 'run', 'runs'}, 'r': set()}), ('blanket', {'n': {'blanket', 'blankets'}, 'a': {'blanket'}, 'v': {'blankets', 'blanketed', 'blanketing', 'blanket'}, 'r': set()})]
|
def myfunc(str):
print(str)
nstr = str.lower()
for i in range(len(str)):
nstr[i+1].upper()
return nstr
print(myfunc("SlseJbKWdOEuhB"))
|
def myfunc(str):
print(str)
nstr = str.lower()
for i in range(len(str)):
nstr[i + 1].upper()
return nstr
print(myfunc('SlseJbKWdOEuhB'))
|
'''
@Coded by TSG, 2021
Problem:
FizzBuzz is a well known programming assignment, asked during interviews.
The given code solves the FizzBuzz problem and uses the words "Solo" and "Learn" instead of "Fizz" and "Buzz".
It takes an input n and outputs the numbers from 1 to n.
For each multiple of 3, print "Solo" instead of the number.
For each multiple of 5, prints "Learn" instead of the number.
For numbers which are multiples of both 3 and 5, output "SoloLearn".
You need to change the code to skip the even numbers, so that the logic only applies to odd numbers in the range.
'''
# your code goes here
for x in range(1, int(input())):
if x % 2 == 0: continue
if x % 3 == 0 and x % 5 == 0: print("SoloLearn")
elif x % 3 == 0: print("Solo")
elif x % 5 == 0: print("Learn")
else: print(x)
|
"""
@Coded by TSG, 2021
Problem:
FizzBuzz is a well known programming assignment, asked during interviews.
The given code solves the FizzBuzz problem and uses the words "Solo" and "Learn" instead of "Fizz" and "Buzz".
It takes an input n and outputs the numbers from 1 to n.
For each multiple of 3, print "Solo" instead of the number.
For each multiple of 5, prints "Learn" instead of the number.
For numbers which are multiples of both 3 and 5, output "SoloLearn".
You need to change the code to skip the even numbers, so that the logic only applies to odd numbers in the range.
"""
for x in range(1, int(input())):
if x % 2 == 0:
continue
if x % 3 == 0 and x % 5 == 0:
print('SoloLearn')
elif x % 3 == 0:
print('Solo')
elif x % 5 == 0:
print('Learn')
else:
print(x)
|
#
# PySNMP MIB module HP-ICF-MLD-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/HP-ICF-MLD-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 19:22:09 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
OctetString, ObjectIdentifier, Integer = mibBuilder.importSymbols("ASN1", "OctetString", "ObjectIdentifier", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsUnion, ConstraintsIntersection, SingleValueConstraint, ValueSizeConstraint, ValueRangeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ConstraintsIntersection", "SingleValueConstraint", "ValueSizeConstraint", "ValueRangeConstraint")
hpSwitch, = mibBuilder.importSymbols("HP-ICF-OID", "hpSwitch")
InterfaceIndex, = mibBuilder.importSymbols("IF-MIB", "InterfaceIndex")
InetAddressIPv6, = mibBuilder.importSymbols("INET-ADDRESS-MIB", "InetAddressIPv6")
mldInterfaceEntry, = mibBuilder.importSymbols("IPV6-MLD-MIB", "mldInterfaceEntry")
PortList, = mibBuilder.importSymbols("Q-BRIDGE-MIB", "PortList")
ModuleCompliance, NotificationGroup, ObjectGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup", "ObjectGroup")
Counter64, Integer32, Gauge32, Counter32, ModuleIdentity, Unsigned32, ObjectIdentity, NotificationType, IpAddress, TimeTicks, MibIdentifier, iso, MibScalar, MibTable, MibTableRow, MibTableColumn, Bits = mibBuilder.importSymbols("SNMPv2-SMI", "Counter64", "Integer32", "Gauge32", "Counter32", "ModuleIdentity", "Unsigned32", "ObjectIdentity", "NotificationType", "IpAddress", "TimeTicks", "MibIdentifier", "iso", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Bits")
RowStatus, TextualConvention, DisplayString, TruthValue = mibBuilder.importSymbols("SNMPv2-TC", "RowStatus", "TextualConvention", "DisplayString", "TruthValue")
hpicfMldMIB = ModuleIdentity((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48))
hpicfMldMIB.setRevisions(('2015-09-11 00:00', '2013-02-10 00:00', '2011-03-10 00:00', '2011-01-11 00:00', '2010-09-09 00:00', '2007-07-02 00:00',))
if mibBuilder.loadTexts: hpicfMldMIB.setLastUpdated('201509110000Z')
if mibBuilder.loadTexts: hpicfMldMIB.setOrganization('HP Networking')
class HpicfMcastGroupTypeDefinition(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3))
namedValues = NamedValues(("standard", 1), ("filtered", 2), ("mini", 3))
class HpicfMldIfEntryState(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("initialWait", 1), ("querierElection", 2), ("querier", 3), ("nonQuerier", 4))
hpicfMldObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1))
hpicfMld = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1))
hpicfMldConformance = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2))
hpicfMldGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1))
hpicfMldCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2))
hpicfMldControlUnknownMulticast = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 1), TruthValue().clone('true')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldControlUnknownMulticast.setStatus('current')
hpicfMldConfigForcedLeaveInterval = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldConfigForcedLeaveInterval.setStatus('current')
hpicfMldEnabledCount = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldEnabledCount.setStatus('current')
hpicfMldMcastGroupJoinsCount = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldMcastGroupJoinsCount.setStatus('current')
hpicfMldIfTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5), )
if mibBuilder.loadTexts: hpicfMldIfTable.setStatus('current')
hpicfMldIfEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1), )
mldInterfaceEntry.registerAugmentions(("HP-ICF-MLD-MIB", "hpicfMldIfEntry"))
hpicfMldIfEntry.setIndexNames(*mldInterfaceEntry.getIndexNames())
if mibBuilder.loadTexts: hpicfMldIfEntry.setStatus('current')
hpicfMldIfEntryQuerierFeature = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 1), TruthValue().clone('true')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldIfEntryQuerierFeature.setStatus('current')
hpicfMldIfEntrySnoopingFeature = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 2), TruthValue().clone('true')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldIfEntrySnoopingFeature.setStatus('current')
hpicfMldIfEntryQuerierPort = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryQuerierPort.setStatus('current')
hpicfMldIfEntryFilteredJoins = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryFilteredJoins.setStatus('current')
hpicfMldIfEntryStandardJoins = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 5), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStandardJoins.setStatus('current')
hpicfMldIfEntryPortsWithMcastRouter = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 6), PortList()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryPortsWithMcastRouter.setStatus('current')
hpicfMldIfEntryStatGeneralQueryRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 7), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatGeneralQueryRx.setStatus('current')
hpicfMldIfEntryStatQueryTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 8), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatQueryTx.setStatus('current')
hpicfMldIfEntryStatGSQRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 9), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatGSQRx.setStatus('current')
hpicfMldIfEntryStatGSQTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 10), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatGSQTx.setStatus('current')
hpicfMldIfEntryStatMldV1ReportRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 11), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatMldV1ReportRx.setStatus('current')
hpicfMldIfEntryStatMldV2ReportRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 12), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatMldV2ReportRx.setStatus('current')
hpicfMldIfEntryStatMldV1LeaveRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 13), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatMldV1LeaveRx.setStatus('current')
hpicfMldIfEntryStatUnknownMldTypeRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 14), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatUnknownMldTypeRx.setStatus('current')
hpicfMldIfEntryStatUnknownPktRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 15), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatUnknownPktRx.setStatus('current')
hpicfMldIfEntryStatForwardToRoutersTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 16), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatForwardToRoutersTx.setStatus('current')
hpicfMldIfEntryStatForwardToAllPortsTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 17), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatForwardToAllPortsTx.setStatus('current')
hpicfMldIfEntryStatFastLeaves = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 18), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatFastLeaves.setStatus('current')
hpicfMldIfEntryStatForcedFastLeaves = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 19), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatForcedFastLeaves.setStatus('current')
hpicfMldIfEntryStatJoinTimeouts = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 20), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatJoinTimeouts.setStatus('current')
hpicfMldIfEntryStatWrongVersionQueries = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 21), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatWrongVersionQueries.setStatus('current')
hpicfMldIfEntryLastMemberQueryCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 22), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryLastMemberQueryCount.setStatus('current')
hpicfMldIfEntryStartupQueryCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 23), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStartupQueryCount.setStatus('current')
hpicfMldIfEntryStartupQueryInterval = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 24), Unsigned32()).setUnits('seconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStartupQueryInterval.setStatus('current')
hpicfMldIfEntryStatExcludeGroupJoinsCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 25), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatExcludeGroupJoinsCount.setStatus('current')
hpicfMldIfEntryStatIncludeGroupJoinsCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 26), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatIncludeGroupJoinsCount.setStatus('current')
hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 27), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount.setStatus('current')
hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 28), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount.setStatus('current')
hpicfMldIfEntryStatStandardExcludeGroupJoinsCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 29), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatStandardExcludeGroupJoinsCount.setStatus('current')
hpicfMldIfEntryStatStandardIncludeGroupJoinsCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 30), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatStandardIncludeGroupJoinsCount.setStatus('current')
hpicfMldIfEntryStatV1QueryTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 31), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV1QueryTx.setStatus('current')
hpicfMldIfEntryStatV1QueryRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 32), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV1QueryRx.setStatus('current')
hpicfMldIfEntryStatV2QueryTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 33), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV2QueryTx.setStatus('current')
hpicfMldIfEntryStatV2QueryRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 34), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV2QueryRx.setStatus('current')
hpicfMldIfEntryStatGSSQTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 35), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatGSSQTx.setStatus('current')
hpicfMldIfEntryStatGSSQRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 36), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatGSSQRx.setStatus('current')
hpicfMldIfEntryStatMalformedPktRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 37), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatMalformedPktRx.setStatus('current')
hpicfMldIfEntryStatBadCheckSumRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 38), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatBadCheckSumRx.setStatus('current')
hpicfMldIfEntryStatMartianSourceRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 39), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatMartianSourceRx.setStatus('current')
hpicfMldIfEntryStatPacketsRxOnDisabled = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 40), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatPacketsRxOnDisabled.setStatus('current')
hpicfMldIfEntryStrictVersionMode = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 41), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldIfEntryStrictVersionMode.setStatus('current')
hpicfMldIfEntryStatMldV1ReportTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 42), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatMldV1ReportTx.setStatus('current')
hpicfMldIfEntryStatMldV2ReportTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 43), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatMldV2ReportTx.setStatus('current')
hpicfMldIfEntryState = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 44), HpicfMldIfEntryState()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryState.setStatus('current')
hpicfMldIfEntryStatV1GSQRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 45), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV1GSQRx.setStatus('current')
hpicfMldIfEntryStatV1GSQTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 46), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV1GSQTx.setStatus('current')
hpicfMldIfEntryStatV2GSQRx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 47), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV2GSQRx.setStatus('current')
hpicfMldIfEntryStatV2GSQTx = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 48), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStatV2GSQTx.setStatus('current')
hpicfMldIfEntryStartupQueryExpiryTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 49), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryStartupQueryExpiryTime.setStatus('current')
hpicfMldIfEntryOtherQuerierInterval = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 50), Unsigned32()).setUnits('seconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryOtherQuerierInterval.setStatus('current')
hpicfMldIfEntryOtherQuerierExpiryTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 51), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldIfEntryOtherQuerierExpiryTime.setStatus('current')
hpicfMldCacheTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6), )
if mibBuilder.loadTexts: hpicfMldCacheTable.setStatus('current')
hpicfMldCacheEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1), ).setIndexNames((0, "HP-ICF-MLD-MIB", "hpicfMldCacheIfIndex"), (0, "HP-ICF-MLD-MIB", "hpicfMldCacheAddress"))
if mibBuilder.loadTexts: hpicfMldCacheEntry.setStatus('current')
hpicfMldCacheIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 1), InterfaceIndex())
if mibBuilder.loadTexts: hpicfMldCacheIfIndex.setStatus('current')
hpicfMldCacheAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 2), InetAddressIPv6().subtype(subtypeSpec=ValueSizeConstraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts: hpicfMldCacheAddress.setStatus('current')
hpicfMldCacheSelf = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 3), TruthValue().clone('true')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpicfMldCacheSelf.setStatus('current')
hpicfMldCacheLastReporter = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 4), InetAddressIPv6().subtype(subtypeSpec=ValueSizeConstraint(16, 16)).setFixedLength(16)).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldCacheLastReporter.setStatus('current')
hpicfMldCacheUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 5), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldCacheUpTime.setStatus('current')
hpicfMldCacheExpiryTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 6), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldCacheExpiryTime.setStatus('current')
hpicfMldGroupType = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 7), HpicfMcastGroupTypeDefinition()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupType.setStatus('current')
hpicfJoinedPorts = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 8), PortList()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfJoinedPorts.setStatus('current')
hpicfMldCacheStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 9), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpicfMldCacheStatus.setStatus('current')
hpicfMldCacheFilterMode = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 10), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("include", 1), ("exclude", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldCacheFilterMode.setStatus('current')
hpicfMldCacheExcludeModeExpiryTimer = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 11), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldCacheExcludeModeExpiryTimer.setStatus('current')
hpicfMldCacheVersion1HostTimer = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 12), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldCacheVersion1HostTimer.setStatus('current')
hpicfMldCacheSrcCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 13), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldCacheSrcCount.setStatus('current')
class HpicfMldConfigPortModeType(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3))
namedValues = NamedValues(("auto", 1), ("blocked", 2), ("forward", 3))
hpicfMldPortConfigTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7), )
if mibBuilder.loadTexts: hpicfMldPortConfigTable.setStatus('current')
hpicfMldPortConfigEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1), ).setIndexNames((0, "HP-ICF-MLD-MIB", "hpicfMldPortConfigEntryInterfaceIfIndex"), (0, "HP-ICF-MLD-MIB", "hpicfMldPortConfigEntryIndex"))
if mibBuilder.loadTexts: hpicfMldPortConfigEntry.setStatus('current')
hpicfMldPortConfigEntryInterfaceIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 1), InterfaceIndex())
if mibBuilder.loadTexts: hpicfMldPortConfigEntryInterfaceIfIndex.setStatus('current')
hpicfMldPortConfigEntryIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535)))
if mibBuilder.loadTexts: hpicfMldPortConfigEntryIndex.setStatus('current')
hpicfMldPortConfigEntryPortModeFeature = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 3), HpicfMldConfigPortModeType()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldPortConfigEntryPortModeFeature.setStatus('current')
hpicfMldPortConfigEntryForcedLeaveFeature = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 4), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldPortConfigEntryForcedLeaveFeature.setStatus('current')
hpicfMldPortConfigEntryFastLeaveFeature = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 5), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldPortConfigEntryFastLeaveFeature.setStatus('current')
hpicfMldFilteredGroupPortCacheTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8), )
if mibBuilder.loadTexts: hpicfMldFilteredGroupPortCacheTable.setStatus('current')
hpicfMldFilteredGroupPortCacheEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1), ).setIndexNames((0, "HP-ICF-MLD-MIB", "hpicfMldFilteredGroupPortCacheIfIndex"), (0, "HP-ICF-MLD-MIB", "hpicfMldFilteredGroupPortCacheGroupAddress"), (0, "HP-ICF-MLD-MIB", "hpicfMldFilteredGroupPortCachePortIndex"))
if mibBuilder.loadTexts: hpicfMldFilteredGroupPortCacheEntry.setStatus('current')
hpicfMldFilteredGroupPortCacheIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 1), InterfaceIndex())
if mibBuilder.loadTexts: hpicfMldFilteredGroupPortCacheIfIndex.setStatus('current')
hpicfMldFilteredGroupPortCacheGroupAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 2), InetAddressIPv6())
if mibBuilder.loadTexts: hpicfMldFilteredGroupPortCacheGroupAddress.setStatus('current')
hpicfMldFilteredGroupPortCachePortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535)))
if mibBuilder.loadTexts: hpicfMldFilteredGroupPortCachePortIndex.setStatus('current')
hpicfMldFilteredGroupPortCacheExpiryTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 4), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldFilteredGroupPortCacheExpiryTime.setStatus('current')
hpicfMldSrcListTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9), )
if mibBuilder.loadTexts: hpicfMldSrcListTable.setStatus('current')
hpicfMldSrcListEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1), ).setIndexNames((0, "HP-ICF-MLD-MIB", "hpicfMldSrcListIfIndex"), (0, "HP-ICF-MLD-MIB", "hpicfMldSrcListAddress"), (0, "HP-ICF-MLD-MIB", "hpicfMldSrcListHostAddress"))
if mibBuilder.loadTexts: hpicfMldSrcListEntry.setStatus('current')
hpicfMldSrcListIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 1), InterfaceIndex())
if mibBuilder.loadTexts: hpicfMldSrcListIfIndex.setStatus('current')
hpicfMldSrcListAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 2), InetAddressIPv6().subtype(subtypeSpec=ValueSizeConstraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts: hpicfMldSrcListAddress.setStatus('current')
hpicfMldSrcListHostAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 3), InetAddressIPv6().subtype(subtypeSpec=ValueSizeConstraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts: hpicfMldSrcListHostAddress.setStatus('current')
hpicfMldSrcListPorts = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 4), PortList()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldSrcListPorts.setStatus('current')
hpicfMldSrcListExpiry = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 5), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldSrcListExpiry.setStatus('current')
hpicfMldSrcListUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 6), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldSrcListUpTime.setStatus('current')
hpicfMldSrcListType = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 7), HpicfMcastGroupTypeDefinition()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldSrcListType.setStatus('current')
hpicfMldPortSrcTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10), )
if mibBuilder.loadTexts: hpicfMldPortSrcTable.setStatus('current')
hpicfMldPortSrcEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1), ).setIndexNames((0, "HP-ICF-MLD-MIB", "hpicfMldPortSrcIfIndex"), (0, "HP-ICF-MLD-MIB", "hpicfMldPortSrcAddress"), (0, "HP-ICF-MLD-MIB", "hpicfMldPortSrcHostAddress"), (0, "HP-ICF-MLD-MIB", "hpicfMldPortSrcPortIndex"))
if mibBuilder.loadTexts: hpicfMldPortSrcEntry.setStatus('current')
hpicfMldPortSrcIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 1), InterfaceIndex())
if mibBuilder.loadTexts: hpicfMldPortSrcIfIndex.setStatus('current')
hpicfMldPortSrcAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 2), InetAddressIPv6().subtype(subtypeSpec=ValueSizeConstraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts: hpicfMldPortSrcAddress.setStatus('current')
hpicfMldPortSrcHostAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 3), InetAddressIPv6().subtype(subtypeSpec=ValueSizeConstraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts: hpicfMldPortSrcHostAddress.setStatus('current')
hpicfMldPortSrcPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535)))
if mibBuilder.loadTexts: hpicfMldPortSrcPortIndex.setStatus('current')
hpicfMldPortSrcExpiry = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 5), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldPortSrcExpiry.setStatus('current')
hpicfMldPortSrcUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 6), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldPortSrcUpTime.setStatus('current')
hpicfMldPortSrcFilterMode = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("include", 1), ("exclude", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldPortSrcFilterMode.setStatus('current')
hpicfMldMcastExcludeGroupJoinsCount = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 11), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldMcastExcludeGroupJoinsCount.setStatus('current')
hpicfMldMcastIncludeGroupJoinsCount = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 12), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldMcastIncludeGroupJoinsCount.setStatus('current')
hpicfMldMcastPortFastLearn = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 13), PortList()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldMcastPortFastLearn.setStatus('current')
hpicfMldGroupPortCacheTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14), )
if mibBuilder.loadTexts: hpicfMldGroupPortCacheTable.setStatus('current')
hpicfMldGroupPortCacheEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1), ).setIndexNames((0, "HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheIfIndex"), (0, "HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheGroupAddress"), (0, "HP-ICF-MLD-MIB", "hpicfMldGroupPortCachePortIndex"))
if mibBuilder.loadTexts: hpicfMldGroupPortCacheEntry.setStatus('current')
hpicfMldGroupPortCacheIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 1), InterfaceIndex())
if mibBuilder.loadTexts: hpicfMldGroupPortCacheIfIndex.setStatus('current')
hpicfMldGroupPortCacheGroupAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 2), InetAddressIPv6())
if mibBuilder.loadTexts: hpicfMldGroupPortCacheGroupAddress.setStatus('current')
hpicfMldGroupPortCachePortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 65535)))
if mibBuilder.loadTexts: hpicfMldGroupPortCachePortIndex.setStatus('current')
hpicfMldGroupPortCacheExpiryTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 4), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupPortCacheExpiryTime.setStatus('current')
hpicfMldGroupPortCacheUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 5), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupPortCacheUpTime.setStatus('current')
hpicfMldGroupPortCacheVersion1Timer = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 6), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupPortCacheVersion1Timer.setStatus('current')
hpicfMldGroupPortCacheFilterTimer = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 7), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupPortCacheFilterTimer.setStatus('current')
hpicfMldGroupPortCacheFilterMode = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 8), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("include", 1), ("exclude", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupPortCacheFilterMode.setStatus('current')
hpicfMldGroupPortCacheExcludeSrcCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 9), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupPortCacheExcludeSrcCount.setStatus('current')
hpicfMldGroupPortCacheRequestedSrcCount = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 10), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpicfMldGroupPortCacheRequestedSrcCount.setStatus('current')
hpicfMldReload = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 15), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpicfMldReload.setStatus('current')
hpicfMldBaseGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 1)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldControlUnknownMulticast"), ("HP-ICF-MLD-MIB", "hpicfMldConfigForcedLeaveInterval"), ("HP-ICF-MLD-MIB", "hpicfMldEnabledCount"), ("HP-ICF-MLD-MIB", "hpicfMldMcastGroupJoinsCount"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldBaseGroup = hpicfMldBaseGroup.setStatus('current')
hpicfMldIfGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 2)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldIfEntryQuerierFeature"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntrySnoopingFeature"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryQuerierPort"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryFilteredJoins"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStandardJoins"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryPortsWithMcastRouter"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGeneralQueryRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatQueryTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1ReportRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV2ReportRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1LeaveRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatUnknownMldTypeRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatUnknownPktRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForwardToRoutersTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForwardToAllPortsTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatFastLeaves"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForcedFastLeaves"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatJoinTimeouts"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldIfGroup = hpicfMldIfGroup.setStatus('current')
hpicfMldCacheGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 3)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldCacheSelf"), ("HP-ICF-MLD-MIB", "hpicfMldCacheLastReporter"), ("HP-ICF-MLD-MIB", "hpicfMldCacheUpTime"), ("HP-ICF-MLD-MIB", "hpicfMldCacheExpiryTime"), ("HP-ICF-MLD-MIB", "hpicfMldGroupType"), ("HP-ICF-MLD-MIB", "hpicfJoinedPorts"), ("HP-ICF-MLD-MIB", "hpicfMldCacheStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldCacheGroup = hpicfMldCacheGroup.setStatus('current')
hpicfMldPortGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 4)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldPortConfigEntryPortModeFeature"), ("HP-ICF-MLD-MIB", "hpicfMldPortConfigEntryForcedLeaveFeature"), ("HP-ICF-MLD-MIB", "hpicfMldPortConfigEntryFastLeaveFeature"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldPortGroup = hpicfMldPortGroup.setStatus('current')
hpicfMldFilteredGroupPortCacheGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 5)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldFilteredGroupPortCacheExpiryTime"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldFilteredGroupPortCacheGroup = hpicfMldFilteredGroupPortCacheGroup.setStatus('current')
hpicfMldBaseGroupV2 = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 6)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldControlUnknownMulticast"), ("HP-ICF-MLD-MIB", "hpicfMldConfigForcedLeaveInterval"), ("HP-ICF-MLD-MIB", "hpicfMldEnabledCount"), ("HP-ICF-MLD-MIB", "hpicfMldMcastGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldMcastExcludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldMcastIncludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldMcastPortFastLearn"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldBaseGroupV2 = hpicfMldBaseGroupV2.setStatus('current')
hpicfMldIfGroupV2 = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 7)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldIfEntryQuerierFeature"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntrySnoopingFeature"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryQuerierPort"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryFilteredJoins"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStandardJoins"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryPortsWithMcastRouter"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGeneralQueryRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatQueryTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1ReportRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV2ReportRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1LeaveRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatUnknownMldTypeRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatUnknownPktRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForwardToRoutersTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForwardToAllPortsTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatFastLeaves"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForcedFastLeaves"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatJoinTimeouts"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatWrongVersionQueries"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryLastMemberQueryCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStartupQueryCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStartupQueryInterval"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatExcludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatIncludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatStandardExcludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatStandardIncludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1QueryTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1QueryRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2QueryTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2QueryRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMalformedPktRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatBadCheckSumRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMartianSourceRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatPacketsRxOnDisabled"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStrictVersionMode"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1ReportTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV2ReportTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryState"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1GSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1GSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2GSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2GSQTx"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldIfGroupV2 = hpicfMldIfGroupV2.setStatus('current')
hpicfMldCacheGroupV2 = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 8)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldCacheSelf"), ("HP-ICF-MLD-MIB", "hpicfMldCacheLastReporter"), ("HP-ICF-MLD-MIB", "hpicfMldCacheUpTime"), ("HP-ICF-MLD-MIB", "hpicfMldCacheExpiryTime"), ("HP-ICF-MLD-MIB", "hpicfMldGroupType"), ("HP-ICF-MLD-MIB", "hpicfJoinedPorts"), ("HP-ICF-MLD-MIB", "hpicfMldCacheStatus"), ("HP-ICF-MLD-MIB", "hpicfMldCacheFilterMode"), ("HP-ICF-MLD-MIB", "hpicfMldCacheExcludeModeExpiryTimer"), ("HP-ICF-MLD-MIB", "hpicfMldCacheVersion1HostTimer"), ("HP-ICF-MLD-MIB", "hpicfMldCacheSrcCount"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldCacheGroupV2 = hpicfMldCacheGroupV2.setStatus('current')
hpicfMldSrcListGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 9)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldSrcListPorts"), ("HP-ICF-MLD-MIB", "hpicfMldSrcListExpiry"), ("HP-ICF-MLD-MIB", "hpicfMldSrcListUpTime"), ("HP-ICF-MLD-MIB", "hpicfMldSrcListType"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldSrcListGroup = hpicfMldSrcListGroup.setStatus('current')
hpicfMldPortSrcGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 10)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldPortSrcExpiry"), ("HP-ICF-MLD-MIB", "hpicfMldPortSrcUpTime"), ("HP-ICF-MLD-MIB", "hpicfMldPortSrcFilterMode"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldPortSrcGroup = hpicfMldPortSrcGroup.setStatus('current')
hpicfMldGroupPortCacheGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 11)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheExpiryTime"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheUpTime"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheVersion1Timer"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheFilterTimer"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheFilterMode"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheExcludeSrcCount"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheRequestedSrcCount"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldGroupPortCacheGroup = hpicfMldGroupPortCacheGroup.setStatus('current')
hpicfMldIfGroupV3 = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 12)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldIfEntryQuerierFeature"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntrySnoopingFeature"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryQuerierPort"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryFilteredJoins"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStandardJoins"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryPortsWithMcastRouter"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGeneralQueryRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatQueryTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1ReportRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV2ReportRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1LeaveRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatUnknownMldTypeRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatUnknownPktRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForwardToRoutersTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForwardToAllPortsTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatFastLeaves"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatForcedFastLeaves"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatJoinTimeouts"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatWrongVersionQueries"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryLastMemberQueryCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStartupQueryCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStartupQueryInterval"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatExcludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatIncludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatStandardExcludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatStandardIncludeGroupJoinsCount"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1QueryTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1QueryRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2QueryTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2QueryRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatGSSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMalformedPktRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatBadCheckSumRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMartianSourceRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatPacketsRxOnDisabled"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStrictVersionMode"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV1ReportTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatMldV2ReportTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryState"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1GSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV1GSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2GSQRx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStatV2GSQTx"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryStartupQueryExpiryTime"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryOtherQuerierInterval"), ("HP-ICF-MLD-MIB", "hpicfMldIfEntryOtherQuerierExpiryTime"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldIfGroupV3 = hpicfMldIfGroupV3.setStatus('current')
hpicfMldReloadModeGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 13)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldReload"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldReloadModeGroup = hpicfMldReloadModeGroup.setStatus('current')
hpicfMldMIBCompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2, 1)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldBaseGroup"), ("HP-ICF-MLD-MIB", "hpicfMldIfGroup"), ("HP-ICF-MLD-MIB", "hpicfMldCacheGroup"), ("HP-ICF-MLD-MIB", "hpicfMldPortGroup"), ("HP-ICF-MLD-MIB", "hpicfMldFilteredGroupPortCacheGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldMIBCompliance = hpicfMldMIBCompliance.setStatus('current')
hpicfMldMIBComplianceV2 = ModuleCompliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2, 2)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldBaseGroupV2"), ("HP-ICF-MLD-MIB", "hpicfMldIfGroupV2"), ("HP-ICF-MLD-MIB", "hpicfMldCacheGroupV2"), ("HP-ICF-MLD-MIB", "hpicfMldPortGroup"), ("HP-ICF-MLD-MIB", "hpicfMldFilteredGroupPortCacheGroup"), ("HP-ICF-MLD-MIB", "hpicfMldSrcListGroup"), ("HP-ICF-MLD-MIB", "hpicfMldPortSrcGroup"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldMIBComplianceV2 = hpicfMldMIBComplianceV2.setStatus('current')
hpicfMldMIBComplianceV3 = ModuleCompliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2, 3)).setObjects(("HP-ICF-MLD-MIB", "hpicfMldBaseGroupV2"), ("HP-ICF-MLD-MIB", "hpicfMldIfGroupV3"), ("HP-ICF-MLD-MIB", "hpicfMldCacheGroupV2"), ("HP-ICF-MLD-MIB", "hpicfMldPortGroup"), ("HP-ICF-MLD-MIB", "hpicfMldFilteredGroupPortCacheGroup"), ("HP-ICF-MLD-MIB", "hpicfMldSrcListGroup"), ("HP-ICF-MLD-MIB", "hpicfMldPortSrcGroup"), ("HP-ICF-MLD-MIB", "hpicfMldGroupPortCacheGroup"), ("HP-ICF-MLD-MIB", "hpicfMldReloadModeGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicfMldMIBComplianceV3 = hpicfMldMIBComplianceV3.setStatus('current')
mibBuilder.exportSymbols("HP-ICF-MLD-MIB", hpicfMldPortSrcExpiry=hpicfMldPortSrcExpiry, hpicfMldPortSrcAddress=hpicfMldPortSrcAddress, hpicfMldCacheAddress=hpicfMldCacheAddress, hpicfMldSrcListEntry=hpicfMldSrcListEntry, hpicfMldPortConfigTable=hpicfMldPortConfigTable, hpicfMldIfEntryPortsWithMcastRouter=hpicfMldIfEntryPortsWithMcastRouter, hpicfMldFilteredGroupPortCacheGroup=hpicfMldFilteredGroupPortCacheGroup, hpicfMldBaseGroupV2=hpicfMldBaseGroupV2, hpicfMldIfEntryStatGSSQRx=hpicfMldIfEntryStatGSSQRx, hpicfMldCacheTable=hpicfMldCacheTable, hpicfJoinedPorts=hpicfJoinedPorts, hpicfMldCacheSelf=hpicfMldCacheSelf, hpicfMldMIBComplianceV3=hpicfMldMIBComplianceV3, hpicfMldIfEntryStandardJoins=hpicfMldIfEntryStandardJoins, hpicfMldIfEntryStatV1GSQRx=hpicfMldIfEntryStatV1GSQRx, hpicfMldIfEntryStartupQueryExpiryTime=hpicfMldIfEntryStartupQueryExpiryTime, hpicfMldIfEntryStatUnknownMldTypeRx=hpicfMldIfEntryStatUnknownMldTypeRx, hpicfMldIfEntryQuerierPort=hpicfMldIfEntryQuerierPort, hpicfMldMcastExcludeGroupJoinsCount=hpicfMldMcastExcludeGroupJoinsCount, hpicfMldIfGroupV3=hpicfMldIfGroupV3, hpicfMldPortConfigEntryInterfaceIfIndex=hpicfMldPortConfigEntryInterfaceIfIndex, hpicfMldSrcListAddress=hpicfMldSrcListAddress, hpicfMldFilteredGroupPortCachePortIndex=hpicfMldFilteredGroupPortCachePortIndex, hpicfMldGroupPortCacheFilterTimer=hpicfMldGroupPortCacheFilterTimer, hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount=hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount, hpicfMldConformance=hpicfMldConformance, hpicfMldIfEntryStatGSSQTx=hpicfMldIfEntryStatGSSQTx, hpicfMldIfEntryStatExcludeGroupJoinsCount=hpicfMldIfEntryStatExcludeGroupJoinsCount, hpicfMldIfEntryLastMemberQueryCount=hpicfMldIfEntryLastMemberQueryCount, hpicfMldIfEntryStatForwardToAllPortsTx=hpicfMldIfEntryStatForwardToAllPortsTx, hpicfMldCacheSrcCount=hpicfMldCacheSrcCount, hpicfMldFilteredGroupPortCacheExpiryTime=hpicfMldFilteredGroupPortCacheExpiryTime, hpicfMldCacheFilterMode=hpicfMldCacheFilterMode, hpicfMldSrcListExpiry=hpicfMldSrcListExpiry, hpicfMldCacheGroupV2=hpicfMldCacheGroupV2, hpicfMldCacheExcludeModeExpiryTimer=hpicfMldCacheExcludeModeExpiryTimer, hpicfMldPortConfigEntryIndex=hpicfMldPortConfigEntryIndex, hpicfMldGroupPortCacheUpTime=hpicfMldGroupPortCacheUpTime, hpicfMldCacheGroup=hpicfMldCacheGroup, PYSNMP_MODULE_ID=hpicfMldMIB, hpicfMldIfEntryStatV2GSQTx=hpicfMldIfEntryStatV2GSQTx, hpicfMldCacheIfIndex=hpicfMldCacheIfIndex, hpicfMldGroupPortCacheEntry=hpicfMldGroupPortCacheEntry, hpicfMldIfEntryState=hpicfMldIfEntryState, hpicfMldGroupPortCacheRequestedSrcCount=hpicfMldGroupPortCacheRequestedSrcCount, hpicfMldIfTable=hpicfMldIfTable, hpicfMldMcastPortFastLearn=hpicfMldMcastPortFastLearn, hpicfMldIfEntryStatV2GSQRx=hpicfMldIfEntryStatV2GSQRx, hpicfMldReloadModeGroup=hpicfMldReloadModeGroup, hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount=hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount, hpicfMldIfEntryStatFastLeaves=hpicfMldIfEntryStatFastLeaves, hpicfMldIfEntrySnoopingFeature=hpicfMldIfEntrySnoopingFeature, HpicfMcastGroupTypeDefinition=HpicfMcastGroupTypeDefinition, hpicfMldSrcListType=hpicfMldSrcListType, hpicfMldPortConfigEntryFastLeaveFeature=hpicfMldPortConfigEntryFastLeaveFeature, hpicfMldIfEntryStatMldV1ReportTx=hpicfMldIfEntryStatMldV1ReportTx, hpicfMldCacheUpTime=hpicfMldCacheUpTime, hpicfMldMIBCompliance=hpicfMldMIBCompliance, hpicfMldPortGroup=hpicfMldPortGroup, hpicfMldIfEntryStatBadCheckSumRx=hpicfMldIfEntryStatBadCheckSumRx, hpicfMldIfEntryStatForcedFastLeaves=hpicfMldIfEntryStatForcedFastLeaves, hpicfMldGroups=hpicfMldGroups, hpicfMldPortSrcFilterMode=hpicfMldPortSrcFilterMode, hpicfMldEnabledCount=hpicfMldEnabledCount, hpicfMldIfEntryStatMldV1ReportRx=hpicfMldIfEntryStatMldV1ReportRx, hpicfMldCacheExpiryTime=hpicfMldCacheExpiryTime, hpicfMldMIBComplianceV2=hpicfMldMIBComplianceV2, hpicfMldCacheVersion1HostTimer=hpicfMldCacheVersion1HostTimer, hpicfMldCompliances=hpicfMldCompliances, hpicfMldSrcListHostAddress=hpicfMldSrcListHostAddress, hpicfMldFilteredGroupPortCacheIfIndex=hpicfMldFilteredGroupPortCacheIfIndex, hpicfMldCacheLastReporter=hpicfMldCacheLastReporter, hpicfMldGroupPortCacheTable=hpicfMldGroupPortCacheTable, hpicfMldCacheStatus=hpicfMldCacheStatus, hpicfMldGroupPortCacheGroup=hpicfMldGroupPortCacheGroup, hpicfMldControlUnknownMulticast=hpicfMldControlUnknownMulticast, hpicfMldIfEntryStatPacketsRxOnDisabled=hpicfMldIfEntryStatPacketsRxOnDisabled, hpicfMldPortSrcIfIndex=hpicfMldPortSrcIfIndex, hpicfMldIfEntryStatGSQRx=hpicfMldIfEntryStatGSQRx, hpicfMldMcastGroupJoinsCount=hpicfMldMcastGroupJoinsCount, hpicfMldSrcListIfIndex=hpicfMldSrcListIfIndex, hpicfMldGroupPortCachePortIndex=hpicfMldGroupPortCachePortIndex, hpicfMldPortSrcHostAddress=hpicfMldPortSrcHostAddress, hpicfMldPortSrcGroup=hpicfMldPortSrcGroup, hpicfMldIfEntryStatForwardToRoutersTx=hpicfMldIfEntryStatForwardToRoutersTx, hpicfMldGroupPortCacheFilterMode=hpicfMldGroupPortCacheFilterMode, hpicfMldIfEntryStatStandardExcludeGroupJoinsCount=hpicfMldIfEntryStatStandardExcludeGroupJoinsCount, hpicfMldIfEntryOtherQuerierInterval=hpicfMldIfEntryOtherQuerierInterval, hpicfMldFilteredGroupPortCacheGroupAddress=hpicfMldFilteredGroupPortCacheGroupAddress, hpicfMldMIB=hpicfMldMIB, hpicfMldSrcListUpTime=hpicfMldSrcListUpTime, hpicfMldConfigForcedLeaveInterval=hpicfMldConfigForcedLeaveInterval, hpicfMldGroupPortCacheExcludeSrcCount=hpicfMldGroupPortCacheExcludeSrcCount, hpicfMldIfEntryStatMldV2ReportTx=hpicfMldIfEntryStatMldV2ReportTx, hpicfMldIfEntryStatUnknownPktRx=hpicfMldIfEntryStatUnknownPktRx, hpicfMldIfEntryStatStandardIncludeGroupJoinsCount=hpicfMldIfEntryStatStandardIncludeGroupJoinsCount, hpicfMldIfGroupV2=hpicfMldIfGroupV2, hpicfMldIfEntryStatMldV1LeaveRx=hpicfMldIfEntryStatMldV1LeaveRx, hpicfMldIfEntryStartupQueryInterval=hpicfMldIfEntryStartupQueryInterval, hpicfMldIfEntryStatMalformedPktRx=hpicfMldIfEntryStatMalformedPktRx, hpicfMldReload=hpicfMldReload, HpicfMldIfEntryState=HpicfMldIfEntryState, hpicfMldIfEntryStatWrongVersionQueries=hpicfMldIfEntryStatWrongVersionQueries, hpicfMldMcastIncludeGroupJoinsCount=hpicfMldMcastIncludeGroupJoinsCount, hpicfMldIfEntryStatV1QueryRx=hpicfMldIfEntryStatV1QueryRx, hpicfMldIfEntryQuerierFeature=hpicfMldIfEntryQuerierFeature, hpicfMldIfEntryStrictVersionMode=hpicfMldIfEntryStrictVersionMode, hpicfMldGroupPortCacheExpiryTime=hpicfMldGroupPortCacheExpiryTime, hpicfMldIfEntryStatQueryTx=hpicfMldIfEntryStatQueryTx, hpicfMldIfEntryStatIncludeGroupJoinsCount=hpicfMldIfEntryStatIncludeGroupJoinsCount, hpicfMldPortConfigEntryPortModeFeature=hpicfMldPortConfigEntryPortModeFeature, hpicfMldIfEntry=hpicfMldIfEntry, hpicfMldSrcListGroup=hpicfMldSrcListGroup, hpicfMldIfEntryStatV1GSQTx=hpicfMldIfEntryStatV1GSQTx, hpicfMldCacheEntry=hpicfMldCacheEntry, hpicfMldIfEntryStatGeneralQueryRx=hpicfMldIfEntryStatGeneralQueryRx, hpicfMldIfEntryStatV2QueryTx=hpicfMldIfEntryStatV2QueryTx, hpicfMldSrcListTable=hpicfMldSrcListTable, hpicfMldPortSrcEntry=hpicfMldPortSrcEntry, hpicfMldPortSrcUpTime=hpicfMldPortSrcUpTime, hpicfMldPortSrcPortIndex=hpicfMldPortSrcPortIndex, hpicfMldIfEntryStatV2QueryRx=hpicfMldIfEntryStatV2QueryRx, hpicfMldGroupType=hpicfMldGroupType, hpicfMldIfEntryFilteredJoins=hpicfMldIfEntryFilteredJoins, hpicfMldFilteredGroupPortCacheEntry=hpicfMldFilteredGroupPortCacheEntry, hpicfMldIfEntryStatMartianSourceRx=hpicfMldIfEntryStatMartianSourceRx, hpicfMldIfEntryStatJoinTimeouts=hpicfMldIfEntryStatJoinTimeouts, hpicfMldIfEntryStatGSQTx=hpicfMldIfEntryStatGSQTx, hpicfMldIfEntryStatV1QueryTx=hpicfMldIfEntryStatV1QueryTx, hpicfMldGroupPortCacheIfIndex=hpicfMldGroupPortCacheIfIndex, hpicfMldGroupPortCacheGroupAddress=hpicfMldGroupPortCacheGroupAddress, hpicfMldPortConfigEntry=hpicfMldPortConfigEntry, HpicfMldConfigPortModeType=HpicfMldConfigPortModeType, hpicfMldObjects=hpicfMldObjects, hpicfMld=hpicfMld, hpicfMldIfEntryStartupQueryCount=hpicfMldIfEntryStartupQueryCount, hpicfMldPortConfigEntryForcedLeaveFeature=hpicfMldPortConfigEntryForcedLeaveFeature, hpicfMldPortSrcTable=hpicfMldPortSrcTable, hpicfMldBaseGroup=hpicfMldBaseGroup, hpicfMldIfGroup=hpicfMldIfGroup, hpicfMldFilteredGroupPortCacheTable=hpicfMldFilteredGroupPortCacheTable, hpicfMldGroupPortCacheVersion1Timer=hpicfMldGroupPortCacheVersion1Timer, hpicfMldIfEntryOtherQuerierExpiryTime=hpicfMldIfEntryOtherQuerierExpiryTime, hpicfMldSrcListPorts=hpicfMldSrcListPorts, hpicfMldIfEntryStatMldV2ReportRx=hpicfMldIfEntryStatMldV2ReportRx)
|
(octet_string, object_identifier, integer) = mibBuilder.importSymbols('ASN1', 'OctetString', 'ObjectIdentifier', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_union, constraints_intersection, single_value_constraint, value_size_constraint, value_range_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'ConstraintsIntersection', 'SingleValueConstraint', 'ValueSizeConstraint', 'ValueRangeConstraint')
(hp_switch,) = mibBuilder.importSymbols('HP-ICF-OID', 'hpSwitch')
(interface_index,) = mibBuilder.importSymbols('IF-MIB', 'InterfaceIndex')
(inet_address_i_pv6,) = mibBuilder.importSymbols('INET-ADDRESS-MIB', 'InetAddressIPv6')
(mld_interface_entry,) = mibBuilder.importSymbols('IPV6-MLD-MIB', 'mldInterfaceEntry')
(port_list,) = mibBuilder.importSymbols('Q-BRIDGE-MIB', 'PortList')
(module_compliance, notification_group, object_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup', 'ObjectGroup')
(counter64, integer32, gauge32, counter32, module_identity, unsigned32, object_identity, notification_type, ip_address, time_ticks, mib_identifier, iso, mib_scalar, mib_table, mib_table_row, mib_table_column, bits) = mibBuilder.importSymbols('SNMPv2-SMI', 'Counter64', 'Integer32', 'Gauge32', 'Counter32', 'ModuleIdentity', 'Unsigned32', 'ObjectIdentity', 'NotificationType', 'IpAddress', 'TimeTicks', 'MibIdentifier', 'iso', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Bits')
(row_status, textual_convention, display_string, truth_value) = mibBuilder.importSymbols('SNMPv2-TC', 'RowStatus', 'TextualConvention', 'DisplayString', 'TruthValue')
hpicf_mld_mib = module_identity((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48))
hpicfMldMIB.setRevisions(('2015-09-11 00:00', '2013-02-10 00:00', '2011-03-10 00:00', '2011-01-11 00:00', '2010-09-09 00:00', '2007-07-02 00:00'))
if mibBuilder.loadTexts:
hpicfMldMIB.setLastUpdated('201509110000Z')
if mibBuilder.loadTexts:
hpicfMldMIB.setOrganization('HP Networking')
class Hpicfmcastgrouptypedefinition(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3))
named_values = named_values(('standard', 1), ('filtered', 2), ('mini', 3))
class Hpicfmldifentrystate(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4))
named_values = named_values(('initialWait', 1), ('querierElection', 2), ('querier', 3), ('nonQuerier', 4))
hpicf_mld_objects = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1))
hpicf_mld = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1))
hpicf_mld_conformance = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2))
hpicf_mld_groups = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1))
hpicf_mld_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2))
hpicf_mld_control_unknown_multicast = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 1), truth_value().clone('true')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldControlUnknownMulticast.setStatus('current')
hpicf_mld_config_forced_leave_interval = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(1, 65535))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldConfigForcedLeaveInterval.setStatus('current')
hpicf_mld_enabled_count = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 3), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldEnabledCount.setStatus('current')
hpicf_mld_mcast_group_joins_count = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldMcastGroupJoinsCount.setStatus('current')
hpicf_mld_if_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5))
if mibBuilder.loadTexts:
hpicfMldIfTable.setStatus('current')
hpicf_mld_if_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1))
mldInterfaceEntry.registerAugmentions(('HP-ICF-MLD-MIB', 'hpicfMldIfEntry'))
hpicfMldIfEntry.setIndexNames(*mldInterfaceEntry.getIndexNames())
if mibBuilder.loadTexts:
hpicfMldIfEntry.setStatus('current')
hpicf_mld_if_entry_querier_feature = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 1), truth_value().clone('true')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldIfEntryQuerierFeature.setStatus('current')
hpicf_mld_if_entry_snooping_feature = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 2), truth_value().clone('true')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldIfEntrySnoopingFeature.setStatus('current')
hpicf_mld_if_entry_querier_port = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 3), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryQuerierPort.setStatus('current')
hpicf_mld_if_entry_filtered_joins = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryFilteredJoins.setStatus('current')
hpicf_mld_if_entry_standard_joins = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 5), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStandardJoins.setStatus('current')
hpicf_mld_if_entry_ports_with_mcast_router = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 6), port_list()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryPortsWithMcastRouter.setStatus('current')
hpicf_mld_if_entry_stat_general_query_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 7), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatGeneralQueryRx.setStatus('current')
hpicf_mld_if_entry_stat_query_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 8), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatQueryTx.setStatus('current')
hpicf_mld_if_entry_stat_gsq_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 9), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatGSQRx.setStatus('current')
hpicf_mld_if_entry_stat_gsq_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 10), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatGSQTx.setStatus('current')
hpicf_mld_if_entry_stat_mld_v1_report_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 11), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatMldV1ReportRx.setStatus('current')
hpicf_mld_if_entry_stat_mld_v2_report_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 12), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatMldV2ReportRx.setStatus('current')
hpicf_mld_if_entry_stat_mld_v1_leave_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 13), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatMldV1LeaveRx.setStatus('current')
hpicf_mld_if_entry_stat_unknown_mld_type_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 14), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatUnknownMldTypeRx.setStatus('current')
hpicf_mld_if_entry_stat_unknown_pkt_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 15), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatUnknownPktRx.setStatus('current')
hpicf_mld_if_entry_stat_forward_to_routers_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 16), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatForwardToRoutersTx.setStatus('current')
hpicf_mld_if_entry_stat_forward_to_all_ports_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 17), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatForwardToAllPortsTx.setStatus('current')
hpicf_mld_if_entry_stat_fast_leaves = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 18), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatFastLeaves.setStatus('current')
hpicf_mld_if_entry_stat_forced_fast_leaves = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 19), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatForcedFastLeaves.setStatus('current')
hpicf_mld_if_entry_stat_join_timeouts = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 20), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatJoinTimeouts.setStatus('current')
hpicf_mld_if_entry_stat_wrong_version_queries = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 21), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatWrongVersionQueries.setStatus('current')
hpicf_mld_if_entry_last_member_query_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 22), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryLastMemberQueryCount.setStatus('current')
hpicf_mld_if_entry_startup_query_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 23), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStartupQueryCount.setStatus('current')
hpicf_mld_if_entry_startup_query_interval = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 24), unsigned32()).setUnits('seconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStartupQueryInterval.setStatus('current')
hpicf_mld_if_entry_stat_exclude_group_joins_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 25), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatExcludeGroupJoinsCount.setStatus('current')
hpicf_mld_if_entry_stat_include_group_joins_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 26), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatIncludeGroupJoinsCount.setStatus('current')
hpicf_mld_if_entry_stat_filtered_exclude_group_joins_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 27), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount.setStatus('current')
hpicf_mld_if_entry_stat_filtered_include_group_joins_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 28), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount.setStatus('current')
hpicf_mld_if_entry_stat_standard_exclude_group_joins_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 29), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatStandardExcludeGroupJoinsCount.setStatus('current')
hpicf_mld_if_entry_stat_standard_include_group_joins_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 30), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatStandardIncludeGroupJoinsCount.setStatus('current')
hpicf_mld_if_entry_stat_v1_query_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 31), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV1QueryTx.setStatus('current')
hpicf_mld_if_entry_stat_v1_query_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 32), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV1QueryRx.setStatus('current')
hpicf_mld_if_entry_stat_v2_query_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 33), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV2QueryTx.setStatus('current')
hpicf_mld_if_entry_stat_v2_query_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 34), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV2QueryRx.setStatus('current')
hpicf_mld_if_entry_stat_gssq_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 35), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatGSSQTx.setStatus('current')
hpicf_mld_if_entry_stat_gssq_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 36), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatGSSQRx.setStatus('current')
hpicf_mld_if_entry_stat_malformed_pkt_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 37), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatMalformedPktRx.setStatus('current')
hpicf_mld_if_entry_stat_bad_check_sum_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 38), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatBadCheckSumRx.setStatus('current')
hpicf_mld_if_entry_stat_martian_source_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 39), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatMartianSourceRx.setStatus('current')
hpicf_mld_if_entry_stat_packets_rx_on_disabled = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 40), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatPacketsRxOnDisabled.setStatus('current')
hpicf_mld_if_entry_strict_version_mode = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 41), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldIfEntryStrictVersionMode.setStatus('current')
hpicf_mld_if_entry_stat_mld_v1_report_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 42), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatMldV1ReportTx.setStatus('current')
hpicf_mld_if_entry_stat_mld_v2_report_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 43), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatMldV2ReportTx.setStatus('current')
hpicf_mld_if_entry_state = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 44), hpicf_mld_if_entry_state()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryState.setStatus('current')
hpicf_mld_if_entry_stat_v1_gsq_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 45), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV1GSQRx.setStatus('current')
hpicf_mld_if_entry_stat_v1_gsq_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 46), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV1GSQTx.setStatus('current')
hpicf_mld_if_entry_stat_v2_gsq_rx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 47), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV2GSQRx.setStatus('current')
hpicf_mld_if_entry_stat_v2_gsq_tx = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 48), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStatV2GSQTx.setStatus('current')
hpicf_mld_if_entry_startup_query_expiry_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 49), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryStartupQueryExpiryTime.setStatus('current')
hpicf_mld_if_entry_other_querier_interval = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 50), unsigned32()).setUnits('seconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryOtherQuerierInterval.setStatus('current')
hpicf_mld_if_entry_other_querier_expiry_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 5, 1, 51), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldIfEntryOtherQuerierExpiryTime.setStatus('current')
hpicf_mld_cache_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6))
if mibBuilder.loadTexts:
hpicfMldCacheTable.setStatus('current')
hpicf_mld_cache_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1)).setIndexNames((0, 'HP-ICF-MLD-MIB', 'hpicfMldCacheIfIndex'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldCacheAddress'))
if mibBuilder.loadTexts:
hpicfMldCacheEntry.setStatus('current')
hpicf_mld_cache_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 1), interface_index())
if mibBuilder.loadTexts:
hpicfMldCacheIfIndex.setStatus('current')
hpicf_mld_cache_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 2), inet_address_i_pv6().subtype(subtypeSpec=value_size_constraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts:
hpicfMldCacheAddress.setStatus('current')
hpicf_mld_cache_self = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 3), truth_value().clone('true')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpicfMldCacheSelf.setStatus('current')
hpicf_mld_cache_last_reporter = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 4), inet_address_i_pv6().subtype(subtypeSpec=value_size_constraint(16, 16)).setFixedLength(16)).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldCacheLastReporter.setStatus('current')
hpicf_mld_cache_up_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 5), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldCacheUpTime.setStatus('current')
hpicf_mld_cache_expiry_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 6), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldCacheExpiryTime.setStatus('current')
hpicf_mld_group_type = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 7), hpicf_mcast_group_type_definition()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupType.setStatus('current')
hpicf_joined_ports = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 8), port_list()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfJoinedPorts.setStatus('current')
hpicf_mld_cache_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 9), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpicfMldCacheStatus.setStatus('current')
hpicf_mld_cache_filter_mode = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 10), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('include', 1), ('exclude', 2)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldCacheFilterMode.setStatus('current')
hpicf_mld_cache_exclude_mode_expiry_timer = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 11), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldCacheExcludeModeExpiryTimer.setStatus('current')
hpicf_mld_cache_version1_host_timer = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 12), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldCacheVersion1HostTimer.setStatus('current')
hpicf_mld_cache_src_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 6, 1, 13), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldCacheSrcCount.setStatus('current')
class Hpicfmldconfigportmodetype(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3))
named_values = named_values(('auto', 1), ('blocked', 2), ('forward', 3))
hpicf_mld_port_config_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7))
if mibBuilder.loadTexts:
hpicfMldPortConfigTable.setStatus('current')
hpicf_mld_port_config_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1)).setIndexNames((0, 'HP-ICF-MLD-MIB', 'hpicfMldPortConfigEntryInterfaceIfIndex'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldPortConfigEntryIndex'))
if mibBuilder.loadTexts:
hpicfMldPortConfigEntry.setStatus('current')
hpicf_mld_port_config_entry_interface_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 1), interface_index())
if mibBuilder.loadTexts:
hpicfMldPortConfigEntryInterfaceIfIndex.setStatus('current')
hpicf_mld_port_config_entry_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(1, 65535)))
if mibBuilder.loadTexts:
hpicfMldPortConfigEntryIndex.setStatus('current')
hpicf_mld_port_config_entry_port_mode_feature = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 3), hpicf_mld_config_port_mode_type()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldPortConfigEntryPortModeFeature.setStatus('current')
hpicf_mld_port_config_entry_forced_leave_feature = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 4), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldPortConfigEntryForcedLeaveFeature.setStatus('current')
hpicf_mld_port_config_entry_fast_leave_feature = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 7, 1, 5), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldPortConfigEntryFastLeaveFeature.setStatus('current')
hpicf_mld_filtered_group_port_cache_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8))
if mibBuilder.loadTexts:
hpicfMldFilteredGroupPortCacheTable.setStatus('current')
hpicf_mld_filtered_group_port_cache_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1)).setIndexNames((0, 'HP-ICF-MLD-MIB', 'hpicfMldFilteredGroupPortCacheIfIndex'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldFilteredGroupPortCacheGroupAddress'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldFilteredGroupPortCachePortIndex'))
if mibBuilder.loadTexts:
hpicfMldFilteredGroupPortCacheEntry.setStatus('current')
hpicf_mld_filtered_group_port_cache_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 1), interface_index())
if mibBuilder.loadTexts:
hpicfMldFilteredGroupPortCacheIfIndex.setStatus('current')
hpicf_mld_filtered_group_port_cache_group_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 2), inet_address_i_pv6())
if mibBuilder.loadTexts:
hpicfMldFilteredGroupPortCacheGroupAddress.setStatus('current')
hpicf_mld_filtered_group_port_cache_port_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(1, 65535)))
if mibBuilder.loadTexts:
hpicfMldFilteredGroupPortCachePortIndex.setStatus('current')
hpicf_mld_filtered_group_port_cache_expiry_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 8, 1, 4), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldFilteredGroupPortCacheExpiryTime.setStatus('current')
hpicf_mld_src_list_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9))
if mibBuilder.loadTexts:
hpicfMldSrcListTable.setStatus('current')
hpicf_mld_src_list_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1)).setIndexNames((0, 'HP-ICF-MLD-MIB', 'hpicfMldSrcListIfIndex'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldSrcListAddress'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldSrcListHostAddress'))
if mibBuilder.loadTexts:
hpicfMldSrcListEntry.setStatus('current')
hpicf_mld_src_list_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 1), interface_index())
if mibBuilder.loadTexts:
hpicfMldSrcListIfIndex.setStatus('current')
hpicf_mld_src_list_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 2), inet_address_i_pv6().subtype(subtypeSpec=value_size_constraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts:
hpicfMldSrcListAddress.setStatus('current')
hpicf_mld_src_list_host_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 3), inet_address_i_pv6().subtype(subtypeSpec=value_size_constraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts:
hpicfMldSrcListHostAddress.setStatus('current')
hpicf_mld_src_list_ports = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 4), port_list()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldSrcListPorts.setStatus('current')
hpicf_mld_src_list_expiry = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 5), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldSrcListExpiry.setStatus('current')
hpicf_mld_src_list_up_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 6), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldSrcListUpTime.setStatus('current')
hpicf_mld_src_list_type = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 9, 1, 7), hpicf_mcast_group_type_definition()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldSrcListType.setStatus('current')
hpicf_mld_port_src_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10))
if mibBuilder.loadTexts:
hpicfMldPortSrcTable.setStatus('current')
hpicf_mld_port_src_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1)).setIndexNames((0, 'HP-ICF-MLD-MIB', 'hpicfMldPortSrcIfIndex'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldPortSrcAddress'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldPortSrcHostAddress'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldPortSrcPortIndex'))
if mibBuilder.loadTexts:
hpicfMldPortSrcEntry.setStatus('current')
hpicf_mld_port_src_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 1), interface_index())
if mibBuilder.loadTexts:
hpicfMldPortSrcIfIndex.setStatus('current')
hpicf_mld_port_src_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 2), inet_address_i_pv6().subtype(subtypeSpec=value_size_constraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts:
hpicfMldPortSrcAddress.setStatus('current')
hpicf_mld_port_src_host_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 3), inet_address_i_pv6().subtype(subtypeSpec=value_size_constraint(16, 16)).setFixedLength(16))
if mibBuilder.loadTexts:
hpicfMldPortSrcHostAddress.setStatus('current')
hpicf_mld_port_src_port_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(1, 65535)))
if mibBuilder.loadTexts:
hpicfMldPortSrcPortIndex.setStatus('current')
hpicf_mld_port_src_expiry = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 5), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldPortSrcExpiry.setStatus('current')
hpicf_mld_port_src_up_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 6), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldPortSrcUpTime.setStatus('current')
hpicf_mld_port_src_filter_mode = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 10, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('include', 1), ('exclude', 2)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldPortSrcFilterMode.setStatus('current')
hpicf_mld_mcast_exclude_group_joins_count = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 11), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldMcastExcludeGroupJoinsCount.setStatus('current')
hpicf_mld_mcast_include_group_joins_count = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 12), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldMcastIncludeGroupJoinsCount.setStatus('current')
hpicf_mld_mcast_port_fast_learn = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 13), port_list()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldMcastPortFastLearn.setStatus('current')
hpicf_mld_group_port_cache_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14))
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheTable.setStatus('current')
hpicf_mld_group_port_cache_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1)).setIndexNames((0, 'HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheIfIndex'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheGroupAddress'), (0, 'HP-ICF-MLD-MIB', 'hpicfMldGroupPortCachePortIndex'))
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheEntry.setStatus('current')
hpicf_mld_group_port_cache_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 1), interface_index())
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheIfIndex.setStatus('current')
hpicf_mld_group_port_cache_group_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 2), inet_address_i_pv6())
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheGroupAddress.setStatus('current')
hpicf_mld_group_port_cache_port_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(1, 65535)))
if mibBuilder.loadTexts:
hpicfMldGroupPortCachePortIndex.setStatus('current')
hpicf_mld_group_port_cache_expiry_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 4), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheExpiryTime.setStatus('current')
hpicf_mld_group_port_cache_up_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 5), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheUpTime.setStatus('current')
hpicf_mld_group_port_cache_version1_timer = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 6), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheVersion1Timer.setStatus('current')
hpicf_mld_group_port_cache_filter_timer = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 7), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheFilterTimer.setStatus('current')
hpicf_mld_group_port_cache_filter_mode = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 8), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('include', 1), ('exclude', 2)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheFilterMode.setStatus('current')
hpicf_mld_group_port_cache_exclude_src_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 9), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheExcludeSrcCount.setStatus('current')
hpicf_mld_group_port_cache_requested_src_count = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 14, 1, 10), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpicfMldGroupPortCacheRequestedSrcCount.setStatus('current')
hpicf_mld_reload = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 1, 1, 15), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpicfMldReload.setStatus('current')
hpicf_mld_base_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 1)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldControlUnknownMulticast'), ('HP-ICF-MLD-MIB', 'hpicfMldConfigForcedLeaveInterval'), ('HP-ICF-MLD-MIB', 'hpicfMldEnabledCount'), ('HP-ICF-MLD-MIB', 'hpicfMldMcastGroupJoinsCount'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_base_group = hpicfMldBaseGroup.setStatus('current')
hpicf_mld_if_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 2)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldIfEntryQuerierFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntrySnoopingFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryQuerierPort'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryFilteredJoins'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStandardJoins'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryPortsWithMcastRouter'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGeneralQueryRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatQueryTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1ReportRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV2ReportRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1LeaveRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatUnknownMldTypeRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatUnknownPktRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForwardToRoutersTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForwardToAllPortsTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatFastLeaves'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForcedFastLeaves'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatJoinTimeouts'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_if_group = hpicfMldIfGroup.setStatus('current')
hpicf_mld_cache_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 3)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldCacheSelf'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheLastReporter'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheUpTime'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheExpiryTime'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupType'), ('HP-ICF-MLD-MIB', 'hpicfJoinedPorts'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_cache_group = hpicfMldCacheGroup.setStatus('current')
hpicf_mld_port_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 4)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldPortConfigEntryPortModeFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldPortConfigEntryForcedLeaveFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldPortConfigEntryFastLeaveFeature'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_port_group = hpicfMldPortGroup.setStatus('current')
hpicf_mld_filtered_group_port_cache_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 5)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldFilteredGroupPortCacheExpiryTime'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_filtered_group_port_cache_group = hpicfMldFilteredGroupPortCacheGroup.setStatus('current')
hpicf_mld_base_group_v2 = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 6)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldControlUnknownMulticast'), ('HP-ICF-MLD-MIB', 'hpicfMldConfigForcedLeaveInterval'), ('HP-ICF-MLD-MIB', 'hpicfMldEnabledCount'), ('HP-ICF-MLD-MIB', 'hpicfMldMcastGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldMcastExcludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldMcastIncludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldMcastPortFastLearn'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_base_group_v2 = hpicfMldBaseGroupV2.setStatus('current')
hpicf_mld_if_group_v2 = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 7)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldIfEntryQuerierFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntrySnoopingFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryQuerierPort'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryFilteredJoins'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStandardJoins'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryPortsWithMcastRouter'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGeneralQueryRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatQueryTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1ReportRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV2ReportRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1LeaveRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatUnknownMldTypeRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatUnknownPktRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForwardToRoutersTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForwardToAllPortsTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatFastLeaves'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForcedFastLeaves'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatJoinTimeouts'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatWrongVersionQueries'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryLastMemberQueryCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStartupQueryCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStartupQueryInterval'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatExcludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatIncludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatStandardExcludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatStandardIncludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1QueryTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1QueryRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2QueryTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2QueryRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMalformedPktRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatBadCheckSumRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMartianSourceRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatPacketsRxOnDisabled'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStrictVersionMode'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1ReportTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV2ReportTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryState'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1GSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1GSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2GSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2GSQTx'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_if_group_v2 = hpicfMldIfGroupV2.setStatus('current')
hpicf_mld_cache_group_v2 = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 8)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldCacheSelf'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheLastReporter'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheUpTime'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheExpiryTime'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupType'), ('HP-ICF-MLD-MIB', 'hpicfJoinedPorts'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheStatus'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheFilterMode'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheExcludeModeExpiryTimer'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheVersion1HostTimer'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheSrcCount'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_cache_group_v2 = hpicfMldCacheGroupV2.setStatus('current')
hpicf_mld_src_list_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 9)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldSrcListPorts'), ('HP-ICF-MLD-MIB', 'hpicfMldSrcListExpiry'), ('HP-ICF-MLD-MIB', 'hpicfMldSrcListUpTime'), ('HP-ICF-MLD-MIB', 'hpicfMldSrcListType'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_src_list_group = hpicfMldSrcListGroup.setStatus('current')
hpicf_mld_port_src_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 10)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldPortSrcExpiry'), ('HP-ICF-MLD-MIB', 'hpicfMldPortSrcUpTime'), ('HP-ICF-MLD-MIB', 'hpicfMldPortSrcFilterMode'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_port_src_group = hpicfMldPortSrcGroup.setStatus('current')
hpicf_mld_group_port_cache_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 11)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheExpiryTime'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheUpTime'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheVersion1Timer'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheFilterTimer'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheFilterMode'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheExcludeSrcCount'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheRequestedSrcCount'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_group_port_cache_group = hpicfMldGroupPortCacheGroup.setStatus('current')
hpicf_mld_if_group_v3 = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 12)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldIfEntryQuerierFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntrySnoopingFeature'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryQuerierPort'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryFilteredJoins'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStandardJoins'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryPortsWithMcastRouter'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGeneralQueryRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatQueryTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1ReportRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV2ReportRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1LeaveRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatUnknownMldTypeRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatUnknownPktRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForwardToRoutersTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForwardToAllPortsTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatFastLeaves'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatForcedFastLeaves'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatJoinTimeouts'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatWrongVersionQueries'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryLastMemberQueryCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStartupQueryCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStartupQueryInterval'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatExcludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatIncludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatStandardExcludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatStandardIncludeGroupJoinsCount'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1QueryTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1QueryRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2QueryTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2QueryRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatGSSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMalformedPktRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatBadCheckSumRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMartianSourceRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatPacketsRxOnDisabled'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStrictVersionMode'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV1ReportTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatMldV2ReportTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryState'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1GSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV1GSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2GSQRx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStatV2GSQTx'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryStartupQueryExpiryTime'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryOtherQuerierInterval'), ('HP-ICF-MLD-MIB', 'hpicfMldIfEntryOtherQuerierExpiryTime'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_if_group_v3 = hpicfMldIfGroupV3.setStatus('current')
hpicf_mld_reload_mode_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 1, 13)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldReload'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_reload_mode_group = hpicfMldReloadModeGroup.setStatus('current')
hpicf_mld_mib_compliance = module_compliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2, 1)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldBaseGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldIfGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldPortGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldFilteredGroupPortCacheGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_mib_compliance = hpicfMldMIBCompliance.setStatus('current')
hpicf_mld_mib_compliance_v2 = module_compliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2, 2)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldBaseGroupV2'), ('HP-ICF-MLD-MIB', 'hpicfMldIfGroupV2'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheGroupV2'), ('HP-ICF-MLD-MIB', 'hpicfMldPortGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldFilteredGroupPortCacheGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldSrcListGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldPortSrcGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_mib_compliance_v2 = hpicfMldMIBComplianceV2.setStatus('current')
hpicf_mld_mib_compliance_v3 = module_compliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 5, 1, 48, 2, 2, 3)).setObjects(('HP-ICF-MLD-MIB', 'hpicfMldBaseGroupV2'), ('HP-ICF-MLD-MIB', 'hpicfMldIfGroupV3'), ('HP-ICF-MLD-MIB', 'hpicfMldCacheGroupV2'), ('HP-ICF-MLD-MIB', 'hpicfMldPortGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldFilteredGroupPortCacheGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldSrcListGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldPortSrcGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldGroupPortCacheGroup'), ('HP-ICF-MLD-MIB', 'hpicfMldReloadModeGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpicf_mld_mib_compliance_v3 = hpicfMldMIBComplianceV3.setStatus('current')
mibBuilder.exportSymbols('HP-ICF-MLD-MIB', hpicfMldPortSrcExpiry=hpicfMldPortSrcExpiry, hpicfMldPortSrcAddress=hpicfMldPortSrcAddress, hpicfMldCacheAddress=hpicfMldCacheAddress, hpicfMldSrcListEntry=hpicfMldSrcListEntry, hpicfMldPortConfigTable=hpicfMldPortConfigTable, hpicfMldIfEntryPortsWithMcastRouter=hpicfMldIfEntryPortsWithMcastRouter, hpicfMldFilteredGroupPortCacheGroup=hpicfMldFilteredGroupPortCacheGroup, hpicfMldBaseGroupV2=hpicfMldBaseGroupV2, hpicfMldIfEntryStatGSSQRx=hpicfMldIfEntryStatGSSQRx, hpicfMldCacheTable=hpicfMldCacheTable, hpicfJoinedPorts=hpicfJoinedPorts, hpicfMldCacheSelf=hpicfMldCacheSelf, hpicfMldMIBComplianceV3=hpicfMldMIBComplianceV3, hpicfMldIfEntryStandardJoins=hpicfMldIfEntryStandardJoins, hpicfMldIfEntryStatV1GSQRx=hpicfMldIfEntryStatV1GSQRx, hpicfMldIfEntryStartupQueryExpiryTime=hpicfMldIfEntryStartupQueryExpiryTime, hpicfMldIfEntryStatUnknownMldTypeRx=hpicfMldIfEntryStatUnknownMldTypeRx, hpicfMldIfEntryQuerierPort=hpicfMldIfEntryQuerierPort, hpicfMldMcastExcludeGroupJoinsCount=hpicfMldMcastExcludeGroupJoinsCount, hpicfMldIfGroupV3=hpicfMldIfGroupV3, hpicfMldPortConfigEntryInterfaceIfIndex=hpicfMldPortConfigEntryInterfaceIfIndex, hpicfMldSrcListAddress=hpicfMldSrcListAddress, hpicfMldFilteredGroupPortCachePortIndex=hpicfMldFilteredGroupPortCachePortIndex, hpicfMldGroupPortCacheFilterTimer=hpicfMldGroupPortCacheFilterTimer, hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount=hpicfMldIfEntryStatFilteredIncludeGroupJoinsCount, hpicfMldConformance=hpicfMldConformance, hpicfMldIfEntryStatGSSQTx=hpicfMldIfEntryStatGSSQTx, hpicfMldIfEntryStatExcludeGroupJoinsCount=hpicfMldIfEntryStatExcludeGroupJoinsCount, hpicfMldIfEntryLastMemberQueryCount=hpicfMldIfEntryLastMemberQueryCount, hpicfMldIfEntryStatForwardToAllPortsTx=hpicfMldIfEntryStatForwardToAllPortsTx, hpicfMldCacheSrcCount=hpicfMldCacheSrcCount, hpicfMldFilteredGroupPortCacheExpiryTime=hpicfMldFilteredGroupPortCacheExpiryTime, hpicfMldCacheFilterMode=hpicfMldCacheFilterMode, hpicfMldSrcListExpiry=hpicfMldSrcListExpiry, hpicfMldCacheGroupV2=hpicfMldCacheGroupV2, hpicfMldCacheExcludeModeExpiryTimer=hpicfMldCacheExcludeModeExpiryTimer, hpicfMldPortConfigEntryIndex=hpicfMldPortConfigEntryIndex, hpicfMldGroupPortCacheUpTime=hpicfMldGroupPortCacheUpTime, hpicfMldCacheGroup=hpicfMldCacheGroup, PYSNMP_MODULE_ID=hpicfMldMIB, hpicfMldIfEntryStatV2GSQTx=hpicfMldIfEntryStatV2GSQTx, hpicfMldCacheIfIndex=hpicfMldCacheIfIndex, hpicfMldGroupPortCacheEntry=hpicfMldGroupPortCacheEntry, hpicfMldIfEntryState=hpicfMldIfEntryState, hpicfMldGroupPortCacheRequestedSrcCount=hpicfMldGroupPortCacheRequestedSrcCount, hpicfMldIfTable=hpicfMldIfTable, hpicfMldMcastPortFastLearn=hpicfMldMcastPortFastLearn, hpicfMldIfEntryStatV2GSQRx=hpicfMldIfEntryStatV2GSQRx, hpicfMldReloadModeGroup=hpicfMldReloadModeGroup, hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount=hpicfMldIfEntryStatFilteredExcludeGroupJoinsCount, hpicfMldIfEntryStatFastLeaves=hpicfMldIfEntryStatFastLeaves, hpicfMldIfEntrySnoopingFeature=hpicfMldIfEntrySnoopingFeature, HpicfMcastGroupTypeDefinition=HpicfMcastGroupTypeDefinition, hpicfMldSrcListType=hpicfMldSrcListType, hpicfMldPortConfigEntryFastLeaveFeature=hpicfMldPortConfigEntryFastLeaveFeature, hpicfMldIfEntryStatMldV1ReportTx=hpicfMldIfEntryStatMldV1ReportTx, hpicfMldCacheUpTime=hpicfMldCacheUpTime, hpicfMldMIBCompliance=hpicfMldMIBCompliance, hpicfMldPortGroup=hpicfMldPortGroup, hpicfMldIfEntryStatBadCheckSumRx=hpicfMldIfEntryStatBadCheckSumRx, hpicfMldIfEntryStatForcedFastLeaves=hpicfMldIfEntryStatForcedFastLeaves, hpicfMldGroups=hpicfMldGroups, hpicfMldPortSrcFilterMode=hpicfMldPortSrcFilterMode, hpicfMldEnabledCount=hpicfMldEnabledCount, hpicfMldIfEntryStatMldV1ReportRx=hpicfMldIfEntryStatMldV1ReportRx, hpicfMldCacheExpiryTime=hpicfMldCacheExpiryTime, hpicfMldMIBComplianceV2=hpicfMldMIBComplianceV2, hpicfMldCacheVersion1HostTimer=hpicfMldCacheVersion1HostTimer, hpicfMldCompliances=hpicfMldCompliances, hpicfMldSrcListHostAddress=hpicfMldSrcListHostAddress, hpicfMldFilteredGroupPortCacheIfIndex=hpicfMldFilteredGroupPortCacheIfIndex, hpicfMldCacheLastReporter=hpicfMldCacheLastReporter, hpicfMldGroupPortCacheTable=hpicfMldGroupPortCacheTable, hpicfMldCacheStatus=hpicfMldCacheStatus, hpicfMldGroupPortCacheGroup=hpicfMldGroupPortCacheGroup, hpicfMldControlUnknownMulticast=hpicfMldControlUnknownMulticast, hpicfMldIfEntryStatPacketsRxOnDisabled=hpicfMldIfEntryStatPacketsRxOnDisabled, hpicfMldPortSrcIfIndex=hpicfMldPortSrcIfIndex, hpicfMldIfEntryStatGSQRx=hpicfMldIfEntryStatGSQRx, hpicfMldMcastGroupJoinsCount=hpicfMldMcastGroupJoinsCount, hpicfMldSrcListIfIndex=hpicfMldSrcListIfIndex, hpicfMldGroupPortCachePortIndex=hpicfMldGroupPortCachePortIndex, hpicfMldPortSrcHostAddress=hpicfMldPortSrcHostAddress, hpicfMldPortSrcGroup=hpicfMldPortSrcGroup, hpicfMldIfEntryStatForwardToRoutersTx=hpicfMldIfEntryStatForwardToRoutersTx, hpicfMldGroupPortCacheFilterMode=hpicfMldGroupPortCacheFilterMode, hpicfMldIfEntryStatStandardExcludeGroupJoinsCount=hpicfMldIfEntryStatStandardExcludeGroupJoinsCount, hpicfMldIfEntryOtherQuerierInterval=hpicfMldIfEntryOtherQuerierInterval, hpicfMldFilteredGroupPortCacheGroupAddress=hpicfMldFilteredGroupPortCacheGroupAddress, hpicfMldMIB=hpicfMldMIB, hpicfMldSrcListUpTime=hpicfMldSrcListUpTime, hpicfMldConfigForcedLeaveInterval=hpicfMldConfigForcedLeaveInterval, hpicfMldGroupPortCacheExcludeSrcCount=hpicfMldGroupPortCacheExcludeSrcCount, hpicfMldIfEntryStatMldV2ReportTx=hpicfMldIfEntryStatMldV2ReportTx, hpicfMldIfEntryStatUnknownPktRx=hpicfMldIfEntryStatUnknownPktRx, hpicfMldIfEntryStatStandardIncludeGroupJoinsCount=hpicfMldIfEntryStatStandardIncludeGroupJoinsCount, hpicfMldIfGroupV2=hpicfMldIfGroupV2, hpicfMldIfEntryStatMldV1LeaveRx=hpicfMldIfEntryStatMldV1LeaveRx, hpicfMldIfEntryStartupQueryInterval=hpicfMldIfEntryStartupQueryInterval, hpicfMldIfEntryStatMalformedPktRx=hpicfMldIfEntryStatMalformedPktRx, hpicfMldReload=hpicfMldReload, HpicfMldIfEntryState=HpicfMldIfEntryState, hpicfMldIfEntryStatWrongVersionQueries=hpicfMldIfEntryStatWrongVersionQueries, hpicfMldMcastIncludeGroupJoinsCount=hpicfMldMcastIncludeGroupJoinsCount, hpicfMldIfEntryStatV1QueryRx=hpicfMldIfEntryStatV1QueryRx, hpicfMldIfEntryQuerierFeature=hpicfMldIfEntryQuerierFeature, hpicfMldIfEntryStrictVersionMode=hpicfMldIfEntryStrictVersionMode, hpicfMldGroupPortCacheExpiryTime=hpicfMldGroupPortCacheExpiryTime, hpicfMldIfEntryStatQueryTx=hpicfMldIfEntryStatQueryTx, hpicfMldIfEntryStatIncludeGroupJoinsCount=hpicfMldIfEntryStatIncludeGroupJoinsCount, hpicfMldPortConfigEntryPortModeFeature=hpicfMldPortConfigEntryPortModeFeature, hpicfMldIfEntry=hpicfMldIfEntry, hpicfMldSrcListGroup=hpicfMldSrcListGroup, hpicfMldIfEntryStatV1GSQTx=hpicfMldIfEntryStatV1GSQTx, hpicfMldCacheEntry=hpicfMldCacheEntry, hpicfMldIfEntryStatGeneralQueryRx=hpicfMldIfEntryStatGeneralQueryRx, hpicfMldIfEntryStatV2QueryTx=hpicfMldIfEntryStatV2QueryTx, hpicfMldSrcListTable=hpicfMldSrcListTable, hpicfMldPortSrcEntry=hpicfMldPortSrcEntry, hpicfMldPortSrcUpTime=hpicfMldPortSrcUpTime, hpicfMldPortSrcPortIndex=hpicfMldPortSrcPortIndex, hpicfMldIfEntryStatV2QueryRx=hpicfMldIfEntryStatV2QueryRx, hpicfMldGroupType=hpicfMldGroupType, hpicfMldIfEntryFilteredJoins=hpicfMldIfEntryFilteredJoins, hpicfMldFilteredGroupPortCacheEntry=hpicfMldFilteredGroupPortCacheEntry, hpicfMldIfEntryStatMartianSourceRx=hpicfMldIfEntryStatMartianSourceRx, hpicfMldIfEntryStatJoinTimeouts=hpicfMldIfEntryStatJoinTimeouts, hpicfMldIfEntryStatGSQTx=hpicfMldIfEntryStatGSQTx, hpicfMldIfEntryStatV1QueryTx=hpicfMldIfEntryStatV1QueryTx, hpicfMldGroupPortCacheIfIndex=hpicfMldGroupPortCacheIfIndex, hpicfMldGroupPortCacheGroupAddress=hpicfMldGroupPortCacheGroupAddress, hpicfMldPortConfigEntry=hpicfMldPortConfigEntry, HpicfMldConfigPortModeType=HpicfMldConfigPortModeType, hpicfMldObjects=hpicfMldObjects, hpicfMld=hpicfMld, hpicfMldIfEntryStartupQueryCount=hpicfMldIfEntryStartupQueryCount, hpicfMldPortConfigEntryForcedLeaveFeature=hpicfMldPortConfigEntryForcedLeaveFeature, hpicfMldPortSrcTable=hpicfMldPortSrcTable, hpicfMldBaseGroup=hpicfMldBaseGroup, hpicfMldIfGroup=hpicfMldIfGroup, hpicfMldFilteredGroupPortCacheTable=hpicfMldFilteredGroupPortCacheTable, hpicfMldGroupPortCacheVersion1Timer=hpicfMldGroupPortCacheVersion1Timer, hpicfMldIfEntryOtherQuerierExpiryTime=hpicfMldIfEntryOtherQuerierExpiryTime, hpicfMldSrcListPorts=hpicfMldSrcListPorts, hpicfMldIfEntryStatMldV2ReportRx=hpicfMldIfEntryStatMldV2ReportRx)
|
# Author: Nic Wolfe <[email protected]>
# URL: http://code.google.com/p/sickbeard/
#
# This file is part of Sick Beard.
#
# Sick Beard is free software: you can redistribute it and/or modify
# it under the terms of the GNU General Public License as published by
# the Free Software Foundation, either version 3 of the License, or
# (at your option) any later version.
#
# Sick Beard is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
#
# You should have received a copy of the GNU General Public License
# along with Sick Beard. If not, see <http://www.gnu.org/licenses/>.
__all__ = ["mainDB", "cache"]
|
__all__ = ['mainDB', 'cache']
|
def read_passphrases():
with open("day_04/input.txt", "r") as f:
return [line.split() for line in f.readlines()]
def part1():
return sum(len(phrase) == len(set(phrase)) for phrase in read_passphrases())
print(part1())
def anagram(passphrase):
return len(passphrase) == len(set("".join(sorted(phrase)) for phrase in passphrase))
def part2():
return sum(anagram(phrase) for phrase in read_passphrases())
print(part2())
|
def read_passphrases():
with open('day_04/input.txt', 'r') as f:
return [line.split() for line in f.readlines()]
def part1():
return sum((len(phrase) == len(set(phrase)) for phrase in read_passphrases()))
print(part1())
def anagram(passphrase):
return len(passphrase) == len(set((''.join(sorted(phrase)) for phrase in passphrase)))
def part2():
return sum((anagram(phrase) for phrase in read_passphrases()))
print(part2())
|
n = int(input())
a = sorted(list(map(int, input().split())))
if n % 2 == 1 and a[0] != 0:
print(0)
exit()
for i in range(n % 2, n, 2):
if a[i] != a[i + 1] or a[i] != i + 1:
print(0)
exit()
print(2 ** (n // 2) % (10 ** 9 + 7))
|
n = int(input())
a = sorted(list(map(int, input().split())))
if n % 2 == 1 and a[0] != 0:
print(0)
exit()
for i in range(n % 2, n, 2):
if a[i] != a[i + 1] or a[i] != i + 1:
print(0)
exit()
print(2 ** (n // 2) % (10 ** 9 + 7))
|
#-------------------------------------------------------------------------
# Copyright (c) Microsoft Corporation. All rights reserved.
# Licensed under the MIT License.
#--------------------------------------------------------------------------
# This is a placeholder file. It is deployed with inference only wheel.
print("An inference only version of ONNX Runtime is installed. Training functionalities are unavailable.")
|
print('An inference only version of ONNX Runtime is installed. Training functionalities are unavailable.')
|
'''
Basic Info
'''
__version__ = '0.1'
|
"""
Basic Info
"""
__version__ = '0.1'
|
def maprange( a, b, s):
(a1, a2), (b1, b2) = a, b
return b1 + ((s - a1) * (b2 - b1) / (a2 - a1))
for s in range(11):
print("%2g maps to %g" % (s, maprange( (0, 10), (-1, 0), s)))
|
def maprange(a, b, s):
((a1, a2), (b1, b2)) = (a, b)
return b1 + (s - a1) * (b2 - b1) / (a2 - a1)
for s in range(11):
print('%2g maps to %g' % (s, maprange((0, 10), (-1, 0), s)))
|
strings = {
'str NaN': 'NaN',
'str none': 'None',
'str true': 'True',
'str false': 'False',
'str 0': '0',
'str -1': '-1',
'str -1.5': '-1.5',
'str 0.42': '0.42',
'str .42': '.42',
'str 1.2E+9': '1.2E+9',
'str 1.2e8': '1.2e8',
'str 0xFF': '0xFF',
'str Inf..': 'Infinity',
'str empty': '',
'str space': ' ',
'str [Ob]': '[object Object]',
'str dot': '.',
'str +': '+',
'str -': '-',
'str 99,999': '99,999',
'str date': '2077-09-08',
'str #abcdef': '#abcdef',
'str 1.2.3': '1.2.3',
'str blah': 'blah',
}
|
strings = {'str NaN': 'NaN', 'str none': 'None', 'str true': 'True', 'str false': 'False', 'str 0': '0', 'str -1': '-1', 'str -1.5': '-1.5', 'str 0.42': '0.42', 'str .42': '.42', 'str 1.2E+9': '1.2E+9', 'str 1.2e8': '1.2e8', 'str 0xFF': '0xFF', 'str Inf..': 'Infinity', 'str empty': '', 'str space': ' ', 'str [Ob]': '[object Object]', 'str dot': '.', 'str +': '+', 'str -': '-', 'str 99,999': '99,999', 'str date': '2077-09-08', 'str #abcdef': '#abcdef', 'str 1.2.3': '1.2.3', 'str blah': 'blah'}
|
# coding: utf8
#!/usr/bin/python2
def directorymaker():
pass
|
def directorymaker():
pass
|
ZALORA_URLS = ['https://www.zalora.co.id/women/pakaian/atasan/?from=header']
def get_start_urls():
return ZALORA_URLS
|
zalora_urls = ['https://www.zalora.co.id/women/pakaian/atasan/?from=header']
def get_start_urls():
return ZALORA_URLS
|
name0_0_0_1_0_1_0 = None
name0_0_0_1_0_1_1 = None
name0_0_0_1_0_1_2 = None
name0_0_0_1_0_1_3 = None
name0_0_0_1_0_1_4 = None
|
name0_0_0_1_0_1_0 = None
name0_0_0_1_0_1_1 = None
name0_0_0_1_0_1_2 = None
name0_0_0_1_0_1_3 = None
name0_0_0_1_0_1_4 = None
|
email_info = { 'recepient' : '[email protected]',
'messages' : {'TOO_LOW' : 'Hi, the temperature is too low',
'TOO_HIGH' : 'Hi, the temperature is too high'
}
}
def DefineCoolingtype_limits(coolingType):
coolingtype_limits = { 'PASSIVE_COOLING' : {"lowerLimit" : 0, "upperLimit" : 35},
'HI_ACTIVE_COOLING' : {"lowerLimit" : 0, "upperLimit" : 45},
'MED_ACTIVE_COOLING' : {"lowerLimit" : 0, "upperLimit" : 40}
}
if coolingType in coolingtype_limits.keys():
return(coolingtype_limits[coolingType])
else:
return({"lowerLimit" : 'NA', "upperLimit" : 'NA'})
def infer_breach(value, lowerLimit, upperLimit):
if value < lowerLimit:
return 'TOO_LOW'
if value > upperLimit:
return 'TOO_HIGH'
return 'NORMAL'
def classify_temperature_breach(coolingType, temperatureInC):
limits = DefineCoolingtype_limits(coolingType)
if 'NA' not in limits.values():
return infer_breach(temperatureInC, limits['lowerLimit'], limits['upperLimit'])
else:
return "Invalid cooling type"
def IsbatteryCharValid(batteryChar):
batteryChar_types = ['PASSIVE_COOLING', 'HI_ACTIVE_COOLING', 'MED_ACTIVE_COOLING']
if batteryChar in batteryChar_types:
return True
return False
def GetBreachType(batteryChar, temperatureInC):
breachType = classify_temperature_breach(batteryChar, temperatureInC) if IsbatteryCharValid(batteryChar) else False
return breachType if breachType!=False else 'Invalid_Param'
def check_and_alert(alertTarget, batteryChar, temperatureInC):
breachType = GetBreachType(batteryChar, temperatureInC)
alert_status = alertTarget(breachType) if breachType!='Invalid_Param' else False
return(breachType)
def send_to_controller(breachType):
header = 0xfeed
command_to_controller = (f'{header}, {breachType}')
PrintMessageONConsole(command_to_controller)
return(command_to_controller)
def Generate_email_content(breachtype, email_messages):
return email_messages[breachtype]
def PrintMessageONConsole(message):
print(message)
return True
def send_to_email(breachType):
mail_content = Generate_email_content(breachType, email_info['messages'])
sent_email = f"To: {email_info['recepient']} : {mail_content}"
PrintMessageONConsole(sent_email)
return(sent_email)
|
email_info = {'recepient': '[email protected]', 'messages': {'TOO_LOW': 'Hi, the temperature is too low', 'TOO_HIGH': 'Hi, the temperature is too high'}}
def define_coolingtype_limits(coolingType):
coolingtype_limits = {'PASSIVE_COOLING': {'lowerLimit': 0, 'upperLimit': 35}, 'HI_ACTIVE_COOLING': {'lowerLimit': 0, 'upperLimit': 45}, 'MED_ACTIVE_COOLING': {'lowerLimit': 0, 'upperLimit': 40}}
if coolingType in coolingtype_limits.keys():
return coolingtype_limits[coolingType]
else:
return {'lowerLimit': 'NA', 'upperLimit': 'NA'}
def infer_breach(value, lowerLimit, upperLimit):
if value < lowerLimit:
return 'TOO_LOW'
if value > upperLimit:
return 'TOO_HIGH'
return 'NORMAL'
def classify_temperature_breach(coolingType, temperatureInC):
limits = define_coolingtype_limits(coolingType)
if 'NA' not in limits.values():
return infer_breach(temperatureInC, limits['lowerLimit'], limits['upperLimit'])
else:
return 'Invalid cooling type'
def isbattery_char_valid(batteryChar):
battery_char_types = ['PASSIVE_COOLING', 'HI_ACTIVE_COOLING', 'MED_ACTIVE_COOLING']
if batteryChar in batteryChar_types:
return True
return False
def get_breach_type(batteryChar, temperatureInC):
breach_type = classify_temperature_breach(batteryChar, temperatureInC) if isbattery_char_valid(batteryChar) else False
return breachType if breachType != False else 'Invalid_Param'
def check_and_alert(alertTarget, batteryChar, temperatureInC):
breach_type = get_breach_type(batteryChar, temperatureInC)
alert_status = alert_target(breachType) if breachType != 'Invalid_Param' else False
return breachType
def send_to_controller(breachType):
header = 65261
command_to_controller = f'{header}, {breachType}'
print_message_on_console(command_to_controller)
return command_to_controller
def generate_email_content(breachtype, email_messages):
return email_messages[breachtype]
def print_message_on_console(message):
print(message)
return True
def send_to_email(breachType):
mail_content = generate_email_content(breachType, email_info['messages'])
sent_email = f"To: {email_info['recepient']} : {mail_content}"
print_message_on_console(sent_email)
return sent_email
|
# -*- coding: utf-8 -*-
# vim: set sw=4 ts=4 expandtab :
class ArgError(Exception):
def __init__(self, message):
if message == None:
self.message = 'node error'
else:
self.message = message
|
class Argerror(Exception):
def __init__(self, message):
if message == None:
self.message = 'node error'
else:
self.message = message
|
# Definition for singly-linked list.
class ListNode:
def __init__(self, x):
self.val = x
self.next = None
class Solution:
def rotateRight(self, head: ListNode, k: int) -> ListNode:
if head is None:
return head
l = 1
tail = head
while tail.next:
tail = tail.next
l += 1
k %= l
p = head
for _ in range(l - 1 - k):
p = p.next
tail.next = head
head = p.next
p.next = None
return head
|
class Listnode:
def __init__(self, x):
self.val = x
self.next = None
class Solution:
def rotate_right(self, head: ListNode, k: int) -> ListNode:
if head is None:
return head
l = 1
tail = head
while tail.next:
tail = tail.next
l += 1
k %= l
p = head
for _ in range(l - 1 - k):
p = p.next
tail.next = head
head = p.next
p.next = None
return head
|
class ApiException(Exception):
def __init__(self, response):
if response.status_code == 404:
self._rollbar_ignore = True
message = response.text
super(ApiException, self).__init__(message)
|
class Apiexception(Exception):
def __init__(self, response):
if response.status_code == 404:
self._rollbar_ignore = True
message = response.text
super(ApiException, self).__init__(message)
|
__author__ = 'Chirag'
x = {"Tom", 2.71, 36, 36} # is a set. REPETITION NOT ALLOWED
y = ["Tom", 2.71, 36, 36] # is a list. MUTABLE
print("x is a SET : ", x)
print("y is a LIST : ", y)
print()
#===========================================
# CREATE sets
s = {1,2,3,4,5} # direct declare
print(s)
s = set()
for i in range(1,6):
s.add(i) # using .add() method
print(s)
s = set([x for x in range(1,6)])
print(s) # list comprehension + conversion
print()
#===========================================
# SETS don't have order. Therefore no
# indexing access is available
list1 = [1,1,2,2,3,4,5,6,1,1]
print(f"list1 = {list1}")
s = set(list1)
print(f"s = set(list1) = {s}")
print()
#===========================================
# METHODS for sets include .intersection()
# .union() .issubset() etc.
print(f"len(s) = {len(s)}")
#===========================================
|
__author__ = 'Chirag'
x = {'Tom', 2.71, 36, 36}
y = ['Tom', 2.71, 36, 36]
print('x is a SET : ', x)
print('y is a LIST : ', y)
print()
s = {1, 2, 3, 4, 5}
print(s)
s = set()
for i in range(1, 6):
s.add(i)
print(s)
s = set([x for x in range(1, 6)])
print(s)
print()
list1 = [1, 1, 2, 2, 3, 4, 5, 6, 1, 1]
print(f'list1 = {list1}')
s = set(list1)
print(f's = set(list1) = {s}')
print()
print(f'len(s) = {len(s)}')
|
# Python3 program to Merge Two Binary Trees
# Helper class that allocates a new node
# with the given data and None left and
# right pointers.
class newNode:
def __init__(self, data):
self.data = data
self.left = self.right = None
# Given a binary tree, prints nodes
# in inorder
def inorder(node):
if not node:
return
# first recur on left child
inorder(node.left)
# then print the data of node
print(node.data, end=" ")
# now recur on right child
inorder(node.right)
# Function to merge given two
# binary trees
def MergeTrees(t1, t2):
if not t1:
return t2
if not t2:
return t1
t1.data += t2.data
t1.left = MergeTrees(t1.left, t2.left)
t1.right = MergeTrees(t1.right, t2.right)
return t1
# Driver code
if __name__ == "__main__":
# Let us construct the first Binary Tree
# 1
# / \
# 2 3
# / \ \
# 4 5 6
root1 = newNode(1)
root1.left = newNode(2)
root1.right = newNode(3)
root1.left.left = newNode(4)
root1.left.right = newNode(5)
root1.right.right = newNode(6)
# Let us construct the second Binary Tree
# 4
# / \
# 1 7
# / / \
# 3 2 6
root2 = newNode(4)
root2.left = newNode(1)
root2.right = newNode(7)
root2.left.left = newNode(3)
root2.right.left = newNode(2)
root2.right.right = newNode(6)
root3 = MergeTrees(root1, root2)
print("The Merged Binary Tree is:")
inorder(root3)
# This code is contributed by PranchalK
|
class Newnode:
def __init__(self, data):
self.data = data
self.left = self.right = None
def inorder(node):
if not node:
return
inorder(node.left)
print(node.data, end=' ')
inorder(node.right)
def merge_trees(t1, t2):
if not t1:
return t2
if not t2:
return t1
t1.data += t2.data
t1.left = merge_trees(t1.left, t2.left)
t1.right = merge_trees(t1.right, t2.right)
return t1
if __name__ == '__main__':
root1 = new_node(1)
root1.left = new_node(2)
root1.right = new_node(3)
root1.left.left = new_node(4)
root1.left.right = new_node(5)
root1.right.right = new_node(6)
root2 = new_node(4)
root2.left = new_node(1)
root2.right = new_node(7)
root2.left.left = new_node(3)
root2.right.left = new_node(2)
root2.right.right = new_node(6)
root3 = merge_trees(root1, root2)
print('The Merged Binary Tree is:')
inorder(root3)
|
def find_lis(a):
T = [None]*len(a)
prev = [None]*len(a)
for i in range(len(a)):
T[i] = 1
prev[i] = -1
for j in range(i):
if a[j] <= a[i] and T[i]< T[j]+1:
T[i] = T[j]+1
prev[i] = j
longest =max(T)
i = 0
for i in range( len(a)):
if T[i] == longest:
break
store = []
while i > 0:
store.append(a[i])
i = prev[i]
return store
if __name__ =='__main__':
a= [7, 2, 1, 3, 8, 4, 9, 1, 2, 6]
# a= [1, 7,2, 3, 8, 4, 9 ]
print(find_lis(a))
|
def find_lis(a):
t = [None] * len(a)
prev = [None] * len(a)
for i in range(len(a)):
T[i] = 1
prev[i] = -1
for j in range(i):
if a[j] <= a[i] and T[i] < T[j] + 1:
T[i] = T[j] + 1
prev[i] = j
longest = max(T)
i = 0
for i in range(len(a)):
if T[i] == longest:
break
store = []
while i > 0:
store.append(a[i])
i = prev[i]
return store
if __name__ == '__main__':
a = [7, 2, 1, 3, 8, 4, 9, 1, 2, 6]
print(find_lis(a))
|
# Problem 3
# Largest prime factor
# The prime factors of 13195 are 5, 7, 13 and 29.
# What is the largest prime factor of the number 600851475143 ?
def is_prime(num):
if num == 1:
return False
i = 2
while i*i <= num:
if num % i == 0:
return False
i += 1
return True
huge = 600851475143
# 600851475143 / 71 = 8462696833 / 839 = 10086647 / 1471 = 6857
for x in reversed(range(1,10000)):
if is_prime(x):
if huge % x == 0:
print(x)
# result is 6857
# 6857
# 1471
# 839
# 71
|
def is_prime(num):
if num == 1:
return False
i = 2
while i * i <= num:
if num % i == 0:
return False
i += 1
return True
huge = 600851475143
for x in reversed(range(1, 10000)):
if is_prime(x):
if huge % x == 0:
print(x)
|
# defines a mutable class
class Mutable():
def __init__(self):
self.layers = []
def getGen(self):
gen = []
for layer in self.layers:
gen += layer.getWeights()
return gen
def mutateWith(self, lover):
genSelf = self.getGen()
genLover = lover.getGen()
self.setGen(self.mutationFunction(genSelf, genLover))
def setGen(self, gen):
for layer in self.layers:
layer.setWeights(gen[:layer.size])
del gen[:layer.size]
print("Layer added")
if len(gen) > 0:
print("error, some genes were not used")
|
class Mutable:
def __init__(self):
self.layers = []
def get_gen(self):
gen = []
for layer in self.layers:
gen += layer.getWeights()
return gen
def mutate_with(self, lover):
gen_self = self.getGen()
gen_lover = lover.getGen()
self.setGen(self.mutationFunction(genSelf, genLover))
def set_gen(self, gen):
for layer in self.layers:
layer.setWeights(gen[:layer.size])
del gen[:layer.size]
print('Layer added')
if len(gen) > 0:
print('error, some genes were not used')
|
#!/usr/bin/env python3
# -*- encoding: utf-8 -*-
__author__ = 'Florents Tselai'
REDIS_URI = '127.0.0.1'
REDIS_CAR_KEYSPACE = 'pycargr:car:{}'
SEARCH_BASE_URL = 'https://www.car.gr/classifieds/cars/'
CACHE_EXPIRE_IN = 24 * 3600
|
__author__ = 'Florents Tselai'
redis_uri = '127.0.0.1'
redis_car_keyspace = 'pycargr:car:{}'
search_base_url = 'https://www.car.gr/classifieds/cars/'
cache_expire_in = 24 * 3600
|
a = 28
b = 1.5
c = 'hello'
d = True
e = None
print(a,b,c,d,e)
|
a = 28
b = 1.5
c = 'hello'
d = True
e = None
print(a, b, c, d, e)
|
# -*- coding: utf-8 -*-
class Fila:
def __init__(self):
self.element = list()
def inserir(self,name):
self.element.append(name)
print(f'Inserindo o elemento {name}: ' + ' '.join(self.element))
def remover(self):
self.element.pop(0)
print(f'Removendo o primeiro elemento: ' + ' '.join(self.element))
def exibir(self):
print('Fila: ' + ' '.join(self.element))
fila = Fila()
fila.inserir('apple')
fila.inserir('grape')
fila.inserir('lemon')
fila.remover()
fila.exibir()
|
class Fila:
def __init__(self):
self.element = list()
def inserir(self, name):
self.element.append(name)
print(f'Inserindo o elemento {name}: ' + ' '.join(self.element))
def remover(self):
self.element.pop(0)
print(f'Removendo o primeiro elemento: ' + ' '.join(self.element))
def exibir(self):
print('Fila: ' + ' '.join(self.element))
fila = fila()
fila.inserir('apple')
fila.inserir('grape')
fila.inserir('lemon')
fila.remover()
fila.exibir()
|
load("@bazel_skylib//lib:shell.bzl", "shell")
load("@bazel_skylib//lib:paths.bzl", "paths")
AsciidocInfo = provider(
doc = "Information about the asciidoc-generated files.",
fields = {
"primary_output_path": "Path of the primary output file beneath {resource_dir}.",
"resource_dir": "File for the directory containing all of the generated resources.",
},
)
_toolchain_type = "//tools/build_rules/external_tools:external_tools_toolchain_type"
def _asciidoc_impl(ctx):
resource_dir = ctx.actions.declare_directory(ctx.label.name + ".d")
primary_output = "{name}.html".format(name = ctx.label.name)
# Declared as an output, but not saved as part of the default output group.
# Build with --output_groups=+asciidoc_logfile to retain.
logfile = ctx.actions.declare_file(ctx.label.name + ".logfile")
# Locate the asciidoc binary from the toolchain and construct its args.
asciidoc = ctx.toolchains[_toolchain_type].asciidoc
args = ["--backend", "html", "--no-header-footer"]
for key, value in ctx.attr.attrs.items():
if value:
args.append("--attribute=%s=%s" % (key, value))
else:
args.append("--attribute=%s!" % (key,))
if ctx.attr.example_script:
args.append("--attribute=example_script=" + ctx.file.example_script.path)
args += ["--conf-file=%s" % c.path for c in ctx.files.confs]
args += ["-o", paths.join(resource_dir.path, primary_output)]
args.append(ctx.file.src.path)
# Get the path where all our necessary tools are located so it can be set
# to PATH in our run_shell command.
tool_path = ctx.toolchains[_toolchain_type].path
# Resolve data targets to get input files and runfiles manifests.
data, _, manifests = ctx.resolve_command(tools = ctx.attr.data)
# Run asciidoc and capture stderr to logfile. If it succeeds, look in the
# captured log for error messages and fail if we find any.
ctx.actions.run_shell(
inputs = ([ctx.file.src] +
ctx.files.confs +
([ctx.file.example_script] if ctx.file.example_script else []) +
data),
input_manifests = manifests,
outputs = [resource_dir, logfile],
arguments = args,
command = "\n".join([
"set -e",
"mkdir -p {resource_dir}".format(resource_dir = shell.quote(resource_dir.path)),
# Run asciidoc itself, and fail if it returns nonzero.
"{asciidoc} \"$@\" 2> >(tee -a {logfile} >&2)".format(
logfile = shell.quote(logfile.path),
asciidoc = shell.quote(asciidoc),
),
# The tool succeeded, but now check for error diagnostics.
'if grep -q -e "filter non-zero exit code" -e "no output from filter" {logfile}; then'.format(
logfile = shell.quote(logfile.path),
),
"exit 1",
"fi",
# Move SVGs to the appropriate directory.
"find . -name '*.svg' -maxdepth 1 -exec mv '{{}}' {out}/ \\;".format(out = shell.quote(resource_dir.path)),
]),
env = {"PATH": tool_path},
mnemonic = "RunAsciidoc",
)
return [
DefaultInfo(files = depset([resource_dir])),
OutputGroupInfo(asciidoc_logfile = depset([logfile])),
AsciidocInfo(primary_output_path = primary_output, resource_dir = resource_dir),
]
asciidoc = rule(
implementation = _asciidoc_impl,
toolchains = ["//tools/build_rules/external_tools:external_tools_toolchain_type"],
attrs = {
"src": attr.label(
doc = "asciidoc file to process",
allow_single_file = True,
),
"attrs": attr.string_dict(
doc = "Dict of attributes to pass to asciidoc as --attribute=KEY=VALUE",
),
"confs": attr.label_list(
doc = "`conf-file`s to pass to asciidoc",
allow_files = True,
),
"data": attr.label_list(
doc = "Files/targets used during asciidoc generation. Only needed for tools used in example_script.",
allow_files = True,
),
"example_script": attr.label(
doc = "Script to pass to asciidoc as --attribute=example_script=VALUE.",
allow_single_file = True,
),
},
doc = "Generate asciidoc",
)
|
load('@bazel_skylib//lib:shell.bzl', 'shell')
load('@bazel_skylib//lib:paths.bzl', 'paths')
asciidoc_info = provider(doc='Information about the asciidoc-generated files.', fields={'primary_output_path': 'Path of the primary output file beneath {resource_dir}.', 'resource_dir': 'File for the directory containing all of the generated resources.'})
_toolchain_type = '//tools/build_rules/external_tools:external_tools_toolchain_type'
def _asciidoc_impl(ctx):
resource_dir = ctx.actions.declare_directory(ctx.label.name + '.d')
primary_output = '{name}.html'.format(name=ctx.label.name)
logfile = ctx.actions.declare_file(ctx.label.name + '.logfile')
asciidoc = ctx.toolchains[_toolchain_type].asciidoc
args = ['--backend', 'html', '--no-header-footer']
for (key, value) in ctx.attr.attrs.items():
if value:
args.append('--attribute=%s=%s' % (key, value))
else:
args.append('--attribute=%s!' % (key,))
if ctx.attr.example_script:
args.append('--attribute=example_script=' + ctx.file.example_script.path)
args += ['--conf-file=%s' % c.path for c in ctx.files.confs]
args += ['-o', paths.join(resource_dir.path, primary_output)]
args.append(ctx.file.src.path)
tool_path = ctx.toolchains[_toolchain_type].path
(data, _, manifests) = ctx.resolve_command(tools=ctx.attr.data)
ctx.actions.run_shell(inputs=[ctx.file.src] + ctx.files.confs + ([ctx.file.example_script] if ctx.file.example_script else []) + data, input_manifests=manifests, outputs=[resource_dir, logfile], arguments=args, command='\n'.join(['set -e', 'mkdir -p {resource_dir}'.format(resource_dir=shell.quote(resource_dir.path)), '{asciidoc} "$@" 2> >(tee -a {logfile} >&2)'.format(logfile=shell.quote(logfile.path), asciidoc=shell.quote(asciidoc)), 'if grep -q -e "filter non-zero exit code" -e "no output from filter" {logfile}; then'.format(logfile=shell.quote(logfile.path)), 'exit 1', 'fi', "find . -name '*.svg' -maxdepth 1 -exec mv '{{}}' {out}/ \\;".format(out=shell.quote(resource_dir.path))]), env={'PATH': tool_path}, mnemonic='RunAsciidoc')
return [default_info(files=depset([resource_dir])), output_group_info(asciidoc_logfile=depset([logfile])), asciidoc_info(primary_output_path=primary_output, resource_dir=resource_dir)]
asciidoc = rule(implementation=_asciidoc_impl, toolchains=['//tools/build_rules/external_tools:external_tools_toolchain_type'], attrs={'src': attr.label(doc='asciidoc file to process', allow_single_file=True), 'attrs': attr.string_dict(doc='Dict of attributes to pass to asciidoc as --attribute=KEY=VALUE'), 'confs': attr.label_list(doc='`conf-file`s to pass to asciidoc', allow_files=True), 'data': attr.label_list(doc='Files/targets used during asciidoc generation. Only needed for tools used in example_script.', allow_files=True), 'example_script': attr.label(doc='Script to pass to asciidoc as --attribute=example_script=VALUE.', allow_single_file=True)}, doc='Generate asciidoc')
|
# return the keys of a dictionary
def keys(dictionary):
return dictionary.keys()
# return the values of a dictionary
def values(dictionary):
return dictionary.values()
# return the string representation of a dictionary
def dict_to_string(d):
return str(d)
# merge two dictionaries
def merge(d1, d2):
for k, v in d2.iteritems():
if k in d1.keys():
if type(v) is dict:
if type(d1[k]) is dict:
merge(d1[k], v)
elif d1[k] == 'none' or d1[k] is None:
d1[k] = v
else:
n = [v, d1[k]]
d1[k] = n
elif type(v) is list:
if type(d1[k]) is list:
d1[k].extend(v)
elif d1[k] == 'none' or d1[k] is None:
d1[k] = v
else:
n = [v, d1[k]]
d1[k] = n
elif v == 'none' or v is None:
pass
else:
n = [v, d1[k]]
d1[k] = n
else:
d1.update({
k: v
})
return d1
|
def keys(dictionary):
return dictionary.keys()
def values(dictionary):
return dictionary.values()
def dict_to_string(d):
return str(d)
def merge(d1, d2):
for (k, v) in d2.iteritems():
if k in d1.keys():
if type(v) is dict:
if type(d1[k]) is dict:
merge(d1[k], v)
elif d1[k] == 'none' or d1[k] is None:
d1[k] = v
else:
n = [v, d1[k]]
d1[k] = n
elif type(v) is list:
if type(d1[k]) is list:
d1[k].extend(v)
elif d1[k] == 'none' or d1[k] is None:
d1[k] = v
else:
n = [v, d1[k]]
d1[k] = n
elif v == 'none' or v is None:
pass
else:
n = [v, d1[k]]
d1[k] = n
else:
d1.update({k: v})
return d1
|
class Data:
def __init__(self):
self.__dia = 0
self.__mes = 0
self.__ano = 0
def le_data(self):
self.dia = int(input('Digite o dia: '))
self.mes = int(input('Digite o mes: '))
self.ano = int(input('Digite o ano: '))
def formatada(self):
print(f'{self.dia}/{self.mes}/{self.ano}')
|
class Data:
def __init__(self):
self.__dia = 0
self.__mes = 0
self.__ano = 0
def le_data(self):
self.dia = int(input('Digite o dia: '))
self.mes = int(input('Digite o mes: '))
self.ano = int(input('Digite o ano: '))
def formatada(self):
print(f'{self.dia}/{self.mes}/{self.ano}')
|
#este es el ejercicio 3.1
def ejercicio01():
print ("Como saber si puedes votar por tu edad")
mensaje=""
#Ingreso de datos
edadP=int(input("ingrese la edad que tiene:"))
#Proceso
if edadP>=18:
mensaje="Usted tiene la edad necesaria para votar"
else:
mensaje="Usted no cumple con la edad minima para votar"
print(mensaje)
ejercicio01()
|
def ejercicio01():
print('Como saber si puedes votar por tu edad')
mensaje = ''
edad_p = int(input('ingrese la edad que tiene:'))
if edadP >= 18:
mensaje = 'Usted tiene la edad necesaria para votar'
else:
mensaje = 'Usted no cumple con la edad minima para votar'
print(mensaje)
ejercicio01()
|
spam = {'name': 'Pooka', 'age': 5}
print("Before:")
print(spam)
#Traditional
if 'color' not in spam:
spam['color'] = 'black'
print("After:")
print(spam)
#With setDefault()
spam.setdefault("color", "white")
print(spam)
message = 'It was a bright cold day in April, and the clocks were striking thirteen.'
count = {}
for character in message:
count.setdefault(character, 0)
count[character] = count[character] + 1
print(count)
|
spam = {'name': 'Pooka', 'age': 5}
print('Before:')
print(spam)
if 'color' not in spam:
spam['color'] = 'black'
print('After:')
print(spam)
spam.setdefault('color', 'white')
print(spam)
message = 'It was a bright cold day in April, and the clocks were striking thirteen.'
count = {}
for character in message:
count.setdefault(character, 0)
count[character] = count[character] + 1
print(count)
|
# Problem 2.
# Write the function subStringMatchExact. This function takes two arguments: a target string,
# and a key string. It should return a tuple of the starting points of matches of the key
# string in the target string, when indexing starts at 0. Complete the definition for
#
# def subStringMatchExact(target,key):
#
# For example,
# subStringMatchExact("atgacatgcacaagtatgcat","atgc")
# would return the tuple (5, 15).
def subStringMatchExact(target, key):
position_list = []
begin_point = 0
temp_position = 0
while temp_position >= 0:
temp_position = target.find(key, begin_point)
if temp_position >= 0:
begin_point = temp_position + 1
position_list.append(temp_position)
position_tuple = tuple(position_list)
return position_tuple
target1 = 'atgacatgcacaagtatgcat'
key1 = 'atgc'
print(subStringMatchExact(target1, key1))
|
def sub_string_match_exact(target, key):
position_list = []
begin_point = 0
temp_position = 0
while temp_position >= 0:
temp_position = target.find(key, begin_point)
if temp_position >= 0:
begin_point = temp_position + 1
position_list.append(temp_position)
position_tuple = tuple(position_list)
return position_tuple
target1 = 'atgacatgcacaagtatgcat'
key1 = 'atgc'
print(sub_string_match_exact(target1, key1))
|
'''
Palindrome checker by python
'''
#Palindrome check for String inputs.
def palindrome (s):
r=s[::-1]
if(r==s):
print("Yes It is a palindrome")
else:
print("No It is not a palindrome")
s = input("Enter a String to check whether it is palindrome or not")
palindrome(s)
#Palindrome check for Number (Integer) inputs.
num=int(input("Enter a number:"))
temp=num
rev=0
while(num>0):
dig=num%10
rev=rev*10+dig
num=num//10
if(temp==rev):
print("The number is Palindrome!")
else:
print("The number is Not a palindrome!")
|
"""
Palindrome checker by python
"""
def palindrome(s):
r = s[::-1]
if r == s:
print('Yes It is a palindrome')
else:
print('No It is not a palindrome')
s = input('Enter a String to check whether it is palindrome or not')
palindrome(s)
num = int(input('Enter a number:'))
temp = num
rev = 0
while num > 0:
dig = num % 10
rev = rev * 10 + dig
num = num // 10
if temp == rev:
print('The number is Palindrome!')
else:
print('The number is Not a palindrome!')
|
class BaseError(Exception):
...
class InternalError(BaseError):
_default = "An internal error has occurred."
def __init__(self):
super().__init__(self._default)
|
class Baseerror(Exception):
...
class Internalerror(BaseError):
_default = 'An internal error has occurred.'
def __init__(self):
super().__init__(self._default)
|
class Solution:
def hammingDistance(self, x: int, y: int) -> int:
dis = 0
while x != 0 or y !=0:
x,resx = x //2, x%2
y,resy = y//2, y%2
if resx!= resy:
dis +=1
return dis
class Solution:
def hammingDistance(self, x: int, y: int) -> int:
return bin(x^y).count('1')
|
class Solution:
def hamming_distance(self, x: int, y: int) -> int:
dis = 0
while x != 0 or y != 0:
(x, resx) = (x // 2, x % 2)
(y, resy) = (y // 2, y % 2)
if resx != resy:
dis += 1
return dis
class Solution:
def hamming_distance(self, x: int, y: int) -> int:
return bin(x ^ y).count('1')
|
QUERIES = {
'average_movies_per_user': (
'select avg(movies_watched) '
'from ( '
'select count(movie_id) as movies_watched '
'from views '
'group by user_id '
' ) as movies_count;'
),
'average_view_times': 'select avg(viewed_frame) from views;',
'top_20_users_by_total_view_time': (
'select user_id, sum(viewed_frame) as view_time '
'from views '
'group by user_id '
'order by view_time desc '
'limit 20;'
),
'top_20_movies_by_view_time': (
'select movie_id, max(viewed_frame) as view_time '
'from views '
'group by movie_id '
'order by view_time desc '
'limit 20;'
),
'unique_movies_count': 'select count(distinct movie_id) from views;',
'unique_users_count': 'select count(distinct user_id) from views;'
}
|
queries = {'average_movies_per_user': 'select avg(movies_watched) from ( select count(movie_id) as movies_watched from views group by user_id ) as movies_count;', 'average_view_times': 'select avg(viewed_frame) from views;', 'top_20_users_by_total_view_time': 'select user_id, sum(viewed_frame) as view_time from views group by user_id order by view_time desc limit 20;', 'top_20_movies_by_view_time': 'select movie_id, max(viewed_frame) as view_time from views group by movie_id order by view_time desc limit 20;', 'unique_movies_count': 'select count(distinct movie_id) from views;', 'unique_users_count': 'select count(distinct user_id) from views;'}
|
# Logic: Write a program that find the maximum positive integer from user input.
# Algorithm: append all the numbers to a list and use the built-in method 'max()' to get the highest number in the list.
num_int = int(input("Input a number: "))
num_list = []
while num_int >= 0:
num_int = int(input("Input a number: "))
num_list.append(num_int)
print("The maximum is",max(num_list))
|
num_int = int(input('Input a number: '))
num_list = []
while num_int >= 0:
num_int = int(input('Input a number: '))
num_list.append(num_int)
print('The maximum is', max(num_list))
|
def _print_aspect_impl(target, ctx):
# Make sure the rule has a srcs attribute.
if hasattr(ctx.rule.attr, 'srcs'):
# Iterate through the files that make up the sources and
# print their paths.
for src in ctx.rule.attr.srcs:
for f in src.files.to_list():
print(f.path)
return []
print_aspect = aspect(
implementation = _print_aspect_impl,
attr_aspects = ['deps'],
)
|
def _print_aspect_impl(target, ctx):
if hasattr(ctx.rule.attr, 'srcs'):
for src in ctx.rule.attr.srcs:
for f in src.files.to_list():
print(f.path)
return []
print_aspect = aspect(implementation=_print_aspect_impl, attr_aspects=['deps'])
|
for t in range(int(input())):
n=int(input())
k = 3 + 5**(1/2)
s = str(int(k**n))
if len(s) <3:
s = "0"*(3-len(s)) +s
print("Case #{}: {}".format(t+1,s[-3:]))
|
for t in range(int(input())):
n = int(input())
k = 3 + 5 ** (1 / 2)
s = str(int(k ** n))
if len(s) < 3:
s = '0' * (3 - len(s)) + s
print('Case #{}: {}'.format(t + 1, s[-3:]))
|
load(
"@rules_scala3//rules:providers.bzl",
_ScalaConfiguration = "ScalaConfiguration",
_ScalaRulePhase = "ScalaRulePhase",
)
def run_phases(ctx, phases):
phase_providers = [
p[_ScalaRulePhase]
for p in [ctx.attr.scala] + ctx.attr.plugins + ctx.attr._phase_providers
if _ScalaRulePhase in p
]
if phase_providers != []:
phases = adjust_phases(phases, [p for pp in phase_providers for p in pp.phases])
gd = {
"init": struct(
scala_configuration = ctx.attr.scala[_ScalaConfiguration],
),
"out": struct(
output_groups = {},
providers = [],
),
}
g = struct(**gd)
for (name, function) in phases:
p = function(ctx, g)
if p != None:
gd[name] = p
g = struct(**gd)
return g
def adjust_phases(phases, adjustments):
if len(adjustments) == 0:
return phases
phases = phases[:]
for (relation, peer_name, name, function) in adjustments:
for idx, (needle, _) in enumerate(phases):
if needle == peer_name:
if relation in ["-", "before"]:
phases.insert(idx, (name, function))
elif relation in ["+", "after"]:
phases.insert(idx + 1, (name, function))
elif relation in ["=", "replace"]:
phases[idx] = (name, function)
return phases
|
load('@rules_scala3//rules:providers.bzl', _ScalaConfiguration='ScalaConfiguration', _ScalaRulePhase='ScalaRulePhase')
def run_phases(ctx, phases):
phase_providers = [p[_ScalaRulePhase] for p in [ctx.attr.scala] + ctx.attr.plugins + ctx.attr._phase_providers if _ScalaRulePhase in p]
if phase_providers != []:
phases = adjust_phases(phases, [p for pp in phase_providers for p in pp.phases])
gd = {'init': struct(scala_configuration=ctx.attr.scala[_ScalaConfiguration]), 'out': struct(output_groups={}, providers=[])}
g = struct(**gd)
for (name, function) in phases:
p = function(ctx, g)
if p != None:
gd[name] = p
g = struct(**gd)
return g
def adjust_phases(phases, adjustments):
if len(adjustments) == 0:
return phases
phases = phases[:]
for (relation, peer_name, name, function) in adjustments:
for (idx, (needle, _)) in enumerate(phases):
if needle == peer_name:
if relation in ['-', 'before']:
phases.insert(idx, (name, function))
elif relation in ['+', 'after']:
phases.insert(idx + 1, (name, function))
elif relation in ['=', 'replace']:
phases[idx] = (name, function)
return phases
|
# Copyright 2017-2020 EPAM Systems, Inc. (https://www.epam.com/)
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
class ShareMountModel(object):
def __init__(self):
self.identifier = None
self.region_id = None
self.mount_root = None
self.mount_type = None
self.mount_options = None
@classmethod
def load(cls, json):
instance = ShareMountModel()
if not json:
return None
instance.identifier = json['id']
instance.region_id = json['regionId']
instance.mount_root = json['mountRoot']
instance.mount_type = json['mountType']
instance.mount_options = json['mountOptions'] if 'mountOptions' in json else None
return instance
|
class Sharemountmodel(object):
def __init__(self):
self.identifier = None
self.region_id = None
self.mount_root = None
self.mount_type = None
self.mount_options = None
@classmethod
def load(cls, json):
instance = share_mount_model()
if not json:
return None
instance.identifier = json['id']
instance.region_id = json['regionId']
instance.mount_root = json['mountRoot']
instance.mount_type = json['mountType']
instance.mount_options = json['mountOptions'] if 'mountOptions' in json else None
return instance
|
X, Y, N = map(int, input().split())
grid = []
win = ''
for i in range(X):
grid.append([])
for j, val in enumerate(input().split()):
grid[i].append({'R':0,'B':0, 'dir':'none'})
if val != 'O':
grid[i][j][val] = 1
up, left, upleft, upright = 0, 0, 0, 0
if i > 0: up = grid[i-1][j][val] if grid[i-1][j]['dir']=='up' or grid[i-1][j]['dir']=='none' else 0
if j > 0: left = grid[i][j-1][val] if grid[i][j-1]['dir']=='left' or grid[i][j-1]['dir']=='none' else 0
if i*j > 0: upleft = grid[i-1][j-1][val] if grid[i-1][j-1]['dir']=='upleft' or grid[i-1][j-1]['dir']=='none' else 0
if i > 0 and j < Y-1: upright = grid[i-1][j+1][val] if grid[i-1][j+1]['dir']=='upright' or grid[i-1][j+1]['dir']=='none' else 0
grid[i][j][val] += max(up, left, upleft, upright)
if max(up, left, upleft, upright)==up: grid[i][j]['dir']='up'
if max(up, left, upleft, upright)==left: grid[i][j]['dir']='left'
if max(up, left, upleft, upright)==upleft: grid[i][j]['dir']='upleft'
if max(up, left, upleft, upright)==upright: grid[i][j]['dir']='upright'
if max(up, left, upleft, upright)==0: grid[i][j]['dir']='none'
if grid[i][j][val] == N:
win = {'B':'BLUE', 'R':'RED'}[val]
break
if win: break
if win: print(win, 'WINS')
else: print('NONE')
|
(x, y, n) = map(int, input().split())
grid = []
win = ''
for i in range(X):
grid.append([])
for (j, val) in enumerate(input().split()):
grid[i].append({'R': 0, 'B': 0, 'dir': 'none'})
if val != 'O':
grid[i][j][val] = 1
(up, left, upleft, upright) = (0, 0, 0, 0)
if i > 0:
up = grid[i - 1][j][val] if grid[i - 1][j]['dir'] == 'up' or grid[i - 1][j]['dir'] == 'none' else 0
if j > 0:
left = grid[i][j - 1][val] if grid[i][j - 1]['dir'] == 'left' or grid[i][j - 1]['dir'] == 'none' else 0
if i * j > 0:
upleft = grid[i - 1][j - 1][val] if grid[i - 1][j - 1]['dir'] == 'upleft' or grid[i - 1][j - 1]['dir'] == 'none' else 0
if i > 0 and j < Y - 1:
upright = grid[i - 1][j + 1][val] if grid[i - 1][j + 1]['dir'] == 'upright' or grid[i - 1][j + 1]['dir'] == 'none' else 0
grid[i][j][val] += max(up, left, upleft, upright)
if max(up, left, upleft, upright) == up:
grid[i][j]['dir'] = 'up'
if max(up, left, upleft, upright) == left:
grid[i][j]['dir'] = 'left'
if max(up, left, upleft, upright) == upleft:
grid[i][j]['dir'] = 'upleft'
if max(up, left, upleft, upright) == upright:
grid[i][j]['dir'] = 'upright'
if max(up, left, upleft, upright) == 0:
grid[i][j]['dir'] = 'none'
if grid[i][j][val] == N:
win = {'B': 'BLUE', 'R': 'RED'}[val]
break
if win:
break
if win:
print(win, 'WINS')
else:
print('NONE')
|
# Copied from https://rosettacode.org/wiki/Shortest_common_supersequence#Python
# Use the Longest Common Subsequence algorithm
def shortest_common_supersequence(a, b):
lcs = longest_common_subsequence(a, b)
scs = ""
# Consume lcs
while len(lcs) > 0:
if a[0]==lcs[0] and b[0]==lcs[0]:
# Part of the LCS, so consume from all strings
scs += lcs[0]
lcs = lcs[1:]
a = a[1:]
b = b[1:]
elif a[0]==lcs[0]:
scs += b[0]
b = b[1:]
else:
scs += a[0]
a = a[1:]
# append remaining characters
return scs + a + b
|
def shortest_common_supersequence(a, b):
lcs = longest_common_subsequence(a, b)
scs = ''
while len(lcs) > 0:
if a[0] == lcs[0] and b[0] == lcs[0]:
scs += lcs[0]
lcs = lcs[1:]
a = a[1:]
b = b[1:]
elif a[0] == lcs[0]:
scs += b[0]
b = b[1:]
else:
scs += a[0]
a = a[1:]
return scs + a + b
|
def extract_tib_only(csv_dump):
lines = csv_dump.strip().split('\n') # cut dump in lines
lines = [l.split(',')[1] for l in lines] # only keep the text
lines = [lines[i] for i in range(0, len(lines), 2)] # only keep the tibetan
return ''.join(lines)
def extract_all(csv_dump):
lines = csv_dump.strip().split('\n') # cut dump in lines
lines = [l.split(',')[1] for l in lines] # only keep the text
return ''.join(lines)
|
def extract_tib_only(csv_dump):
lines = csv_dump.strip().split('\n')
lines = [l.split(',')[1] for l in lines]
lines = [lines[i] for i in range(0, len(lines), 2)]
return ''.join(lines)
def extract_all(csv_dump):
lines = csv_dump.strip().split('\n')
lines = [l.split(',')[1] for l in lines]
return ''.join(lines)
|
# 26.05.2019
# Tuples vs Lists
# Tuples are read only
# Tuples have ( ) brackets
# Example with a List:
awesomeList= ['hello', 45, 'Marc', 89.4]
awesomeList[3] = 6
# List can be updated
print(awesomeList)
# now a tuple
awesomeTuple = ('MarcTuple', 1, 213.2, 'Hello')
print(awesomeTuple)
print(awesomeTuple[2])
# ERROR awesomeTuple[2] = 3
# Tuple object does not support item assignment
# ERROR awesomeTuple[1] +=3
# but slicing is working
print(awesomeTuple[0][2:5])
var7 = awesomeTuple[0][2:5]
var8 = awesomeTuple[2]
print(var7*3)
print(var8*3)
|
awesome_list = ['hello', 45, 'Marc', 89.4]
awesomeList[3] = 6
print(awesomeList)
awesome_tuple = ('MarcTuple', 1, 213.2, 'Hello')
print(awesomeTuple)
print(awesomeTuple[2])
print(awesomeTuple[0][2:5])
var7 = awesomeTuple[0][2:5]
var8 = awesomeTuple[2]
print(var7 * 3)
print(var8 * 3)
|
def dfCheckAvailability(df, baseTrackingMap):
#####
# step number -- iStep
bIStep = False if not ("iStep" in df.columns) else True
print("scan step number (iStep) availability: %s \n--" % str(bIStep))
#####
# Unix time -- epoch
bEpoch = False if not ("epoch" in df.columns) else True
print("Unix time (epoch) availability: %s \n--" % str(bEpoch))
#####
# goniometer DOF -- xGonioRaw...
lsGonio = [s.replace("xGonioRaw", "") for s in df.columns if "xGonioRaw" in s] # list of the full raw goniometer DOF names -- without prefix
bXGonio = False if len(lsGonio) == 0 else True
printNr = ("(%d)" % len(lsGonio)) if bXGonio else ""
print("goniometer DOF availability: %s %s" % (str(bXGonio), printNr))
print("xGonioRaw + %s" % str(lsGonio))
print("--")
#####
# input (all 4) & output (both 2) tracking data...
print("input modules should be: %s" % str(baseTrackingMap[0]))
print("output modules should be: %s" % str(baseTrackingMap[1]))
#####
# positions -- xRaw...
bXRaw = {"in": True, "out": True}
for iLayer in baseTrackingMap[0]:
if not ("xRaw"+iLayer in df.columns):
bXRaw["in"] = False # input
for iLayer in baseTrackingMap[1]:
if not ("xRaw"+iLayer in df.columns):
bXRaw["out"] = False # output
print("input tracking availability (xRaw...): %s" % str(bXRaw["in"]))
print("output tracking availability (xRaw...): %s" % str(bXRaw["out"]))
#####
# multiplicities -- nHit...
bNHit = {"in": True, "out": True}
for iLayer in baseTrackingMap[0]:
if not ("nHit"+iLayer in df.columns):
bNHit["in"] = False # input
for iLayer in baseTrackingMap[1]:
if not ("nHit"+iLayer in df.columns):
bNHit["out"] = False # output
print("input multiplicity availability (nHit...): %s" % str(bNHit["in"]))
print("output multiplicity availability (nHit...): %s" % str(bNHit["out"]))
print("--")
#####
# digitizer data -- digiPHRaw... & digiTime...
lsDigiRawCh = [s for s in sorted(df.columns) if "digiPHRaw" in s] # list of the full raw digitizer PH names
lsDigiCh = [s.replace("digiPHRaw", "") for s in lsDigiRawCh] # list of the digitizer channel names -- without any prefix
bDigiPHAny = False if len(lsDigiCh) == 0 else True # global PH availability -- single channels listed in lsDigiRawCh
print("digitizer channel availability: %s" % str(bDigiPHAny))
bDigiTime = {}
if bDigiPHAny:
print("%d channels: digiPHRaw + %s" % (len(lsDigiCh), str(lsDigiCh)))
for i, iCh in enumerate(lsDigiRawCh):
# digitizer time availability for each of the available PH (listed in lsDigiRawCh)
bDigiTime.update({iCh.replace("digiPHRaw", ""): True if iCh.replace("PHRaw", "Time") in df.columns else False})
print("%d with time: digiTime + %s" % (len([s for s in bDigiTime if bDigiTime[s]]), str([s for s in bDigiTime if bDigiTime[s]])))
print("--")
#####
# forward calorimeter total PH & energy in GeV -- PHCaloFwd & EFwd
bPHCaloFwd = False if not ("PHCaloFwd" in df.columns) else True
print("forward calorimeter total signal (PHCaloFwd) availability a priori: %s" % str(bPHCaloFwd))
bEFwd = False if not ("EFwd" in df.columns) else True
print("forward calorimeter total in GeV (EFwd) availability a priori: %s" % str(bEFwd))
return df, bIStep, bEpoch, bXGonio, bXRaw, bNHit, bDigiPHAny, lsDigiCh, bDigiTime, bPHCaloFwd, bEFwd
###############################################################################
###############################################################################
def zBaseCheckAvailability(z, lsRun, baseTrackingMap):
for iRun in lsRun:
if iRun in z:
bGlobalAvailability = True
else:
bGlobalAvailability = False
z.update({iRun: {}})
# goniometer
if not ("gonio" in z[iRun]):
bGlobalAvailability = False
print("z[%s][\"gonio\"] unavailable --> setting 0" % iRun)
z[iRun].update({"gonio": 0})
# forward calorimeter
if not ("caloFwd" in z[iRun]):
bGlobalAvailability = False
print("z[%s][\"caloFwd\"] unavailable --> setting 0" % iRun)
z[iRun].update({"caloFwd": 0})
# input/output base tracking layers
for iLayer in baseTrackingMap[0]+baseTrackingMap[1]:
if not (iLayer in z[iRun]):
bGlobalAvailability = False
print("z[%s][\"%s\"] unavailable --> setting 0" % (iRun, iLayer))
z[iRun].update({iLayer: 0})
if bGlobalAvailability:
print("all mandatory z[%s] available" % iRun)
return z
|
def df_check_availability(df, baseTrackingMap):
b_i_step = False if not 'iStep' in df.columns else True
print('scan step number (iStep) availability: %s \n--' % str(bIStep))
b_epoch = False if not 'epoch' in df.columns else True
print('Unix time (epoch) availability: %s \n--' % str(bEpoch))
ls_gonio = [s.replace('xGonioRaw', '') for s in df.columns if 'xGonioRaw' in s]
b_x_gonio = False if len(lsGonio) == 0 else True
print_nr = '(%d)' % len(lsGonio) if bXGonio else ''
print('goniometer DOF availability: %s %s' % (str(bXGonio), printNr))
print('xGonioRaw + %s' % str(lsGonio))
print('--')
print('input modules should be: %s' % str(baseTrackingMap[0]))
print('output modules should be: %s' % str(baseTrackingMap[1]))
b_x_raw = {'in': True, 'out': True}
for i_layer in baseTrackingMap[0]:
if not 'xRaw' + iLayer in df.columns:
bXRaw['in'] = False
for i_layer in baseTrackingMap[1]:
if not 'xRaw' + iLayer in df.columns:
bXRaw['out'] = False
print('input tracking availability (xRaw...): %s' % str(bXRaw['in']))
print('output tracking availability (xRaw...): %s' % str(bXRaw['out']))
b_n_hit = {'in': True, 'out': True}
for i_layer in baseTrackingMap[0]:
if not 'nHit' + iLayer in df.columns:
bNHit['in'] = False
for i_layer in baseTrackingMap[1]:
if not 'nHit' + iLayer in df.columns:
bNHit['out'] = False
print('input multiplicity availability (nHit...): %s' % str(bNHit['in']))
print('output multiplicity availability (nHit...): %s' % str(bNHit['out']))
print('--')
ls_digi_raw_ch = [s for s in sorted(df.columns) if 'digiPHRaw' in s]
ls_digi_ch = [s.replace('digiPHRaw', '') for s in lsDigiRawCh]
b_digi_ph_any = False if len(lsDigiCh) == 0 else True
print('digitizer channel availability: %s' % str(bDigiPHAny))
b_digi_time = {}
if bDigiPHAny:
print('%d channels: digiPHRaw + %s' % (len(lsDigiCh), str(lsDigiCh)))
for (i, i_ch) in enumerate(lsDigiRawCh):
bDigiTime.update({iCh.replace('digiPHRaw', ''): True if iCh.replace('PHRaw', 'Time') in df.columns else False})
print('%d with time: digiTime + %s' % (len([s for s in bDigiTime if bDigiTime[s]]), str([s for s in bDigiTime if bDigiTime[s]])))
print('--')
b_ph_calo_fwd = False if not 'PHCaloFwd' in df.columns else True
print('forward calorimeter total signal (PHCaloFwd) availability a priori: %s' % str(bPHCaloFwd))
b_e_fwd = False if not 'EFwd' in df.columns else True
print('forward calorimeter total in GeV (EFwd) availability a priori: %s' % str(bEFwd))
return (df, bIStep, bEpoch, bXGonio, bXRaw, bNHit, bDigiPHAny, lsDigiCh, bDigiTime, bPHCaloFwd, bEFwd)
def z_base_check_availability(z, lsRun, baseTrackingMap):
for i_run in lsRun:
if iRun in z:
b_global_availability = True
else:
b_global_availability = False
z.update({iRun: {}})
if not 'gonio' in z[iRun]:
b_global_availability = False
print('z[%s]["gonio"] unavailable --> setting 0' % iRun)
z[iRun].update({'gonio': 0})
if not 'caloFwd' in z[iRun]:
b_global_availability = False
print('z[%s]["caloFwd"] unavailable --> setting 0' % iRun)
z[iRun].update({'caloFwd': 0})
for i_layer in baseTrackingMap[0] + baseTrackingMap[1]:
if not iLayer in z[iRun]:
b_global_availability = False
print('z[%s]["%s"] unavailable --> setting 0' % (iRun, iLayer))
z[iRun].update({iLayer: 0})
if bGlobalAvailability:
print('all mandatory z[%s] available' % iRun)
return z
|
list1 = [1, 7, 16, 11, 14, 19, 20, 18]
list2 = [85, 111, 117, 43, 104, 127, 117, 117, 33, 110, 99, 43, 72, 95, 85, 85, 94, 66, 120, 98, 79, 117, 68, 83, 64, 94, 39, 65, 73, 32, 65, 72, 51]
ans = ''
for i in range(len(list2)):
ans += chr(list2[i] ^ list1[i % len(list1)])
print(ans)
|
list1 = [1, 7, 16, 11, 14, 19, 20, 18]
list2 = [85, 111, 117, 43, 104, 127, 117, 117, 33, 110, 99, 43, 72, 95, 85, 85, 94, 66, 120, 98, 79, 117, 68, 83, 64, 94, 39, 65, 73, 32, 65, 72, 51]
ans = ''
for i in range(len(list2)):
ans += chr(list2[i] ^ list1[i % len(list1)])
print(ans)
|
f = open("Street_Centrelines.csv",'r')
def tup():
for v in f:
v = v.split(",")
t = (v[2], v[4], v[6], v[7])
print(t)
def maintenance():
h = dict()
for f2 in f:
f2 = f2.split(",")
if f2[12] not in h:
h[f2[12]] = 1
else:
h[f[12]] += 1
print(h)
def street_owner():
owner_list = f[11]
final_list = []
for a in f:
a = a.split(",")
if a[11] not in final_list:
final_list.append(a[11])
print(final_list)
tup()
maintenance()
street_owner()
|
f = open('Street_Centrelines.csv', 'r')
def tup():
for v in f:
v = v.split(',')
t = (v[2], v[4], v[6], v[7])
print(t)
def maintenance():
h = dict()
for f2 in f:
f2 = f2.split(',')
if f2[12] not in h:
h[f2[12]] = 1
else:
h[f[12]] += 1
print(h)
def street_owner():
owner_list = f[11]
final_list = []
for a in f:
a = a.split(',')
if a[11] not in final_list:
final_list.append(a[11])
print(final_list)
tup()
maintenance()
street_owner()
|
words = ['one', 'fish', 'two', 'fish', 'red', 'fish', 'blue', 'fish']
words2 = ['have', 'you', 'seen', 'a', 'blue', 'fish']
# what if we did the first example as a generator?
def get_word_lengths(word_list):
for word in word_list:
yield len(word)
for length in get_word_lengths(words):
print(length)
print('--------------------')
for length in (len(word) for word in words):
print(length)
|
words = ['one', 'fish', 'two', 'fish', 'red', 'fish', 'blue', 'fish']
words2 = ['have', 'you', 'seen', 'a', 'blue', 'fish']
def get_word_lengths(word_list):
for word in word_list:
yield len(word)
for length in get_word_lengths(words):
print(length)
print('--------------------')
for length in (len(word) for word in words):
print(length)
|
# Data processing
with open('input') as f:
in_data = [line.rstrip() for line in f]
for i in range(25, len(in_data)):
pre_i = in_data[i-25:i]
summed_pair_found = False
for a in pre_i:
for b in pre_i:
if a != b:
if int(a)+int(b) == int(in_data[i]):
summed_pair_found = True
if not summed_pair_found:
print(in_data[i])
exit()
|
with open('input') as f:
in_data = [line.rstrip() for line in f]
for i in range(25, len(in_data)):
pre_i = in_data[i - 25:i]
summed_pair_found = False
for a in pre_i:
for b in pre_i:
if a != b:
if int(a) + int(b) == int(in_data[i]):
summed_pair_found = True
if not summed_pair_found:
print(in_data[i])
exit()
|
#! python3
pessoas = [
{'nome': 'Pedro', 'idade': 11},
{'nome': 'Mariana', 'idade': 18},
{'nome': 'Arthur', 'idade': 26},
{'nome': 'Rebeca', 'idade': 6},
{'nome': 'Tiago', 'idade': 19},
{'nome': 'Gabriela', 'idade': 17},
]
menores = filter(lambda p: p['idade'] < 18, pessoas)
print(list(menores))
nomeMaiorede6caracteres = filter(lambda p: len(p['nome']) > 6, pessoas)
print(list(nomeMaiorede6caracteres))
|
pessoas = [{'nome': 'Pedro', 'idade': 11}, {'nome': 'Mariana', 'idade': 18}, {'nome': 'Arthur', 'idade': 26}, {'nome': 'Rebeca', 'idade': 6}, {'nome': 'Tiago', 'idade': 19}, {'nome': 'Gabriela', 'idade': 17}]
menores = filter(lambda p: p['idade'] < 18, pessoas)
print(list(menores))
nome_maiorede6caracteres = filter(lambda p: len(p['nome']) > 6, pessoas)
print(list(nomeMaiorede6caracteres))
|
line = input()
a, b = line.split()
a = int(a)
b = int(b)
print(a + b)
|
line = input()
(a, b) = line.split()
a = int(a)
b = int(b)
print(a + b)
|
employees_happiness = [int(happiness) for happiness in input().split()]
factor = int(input())
factored_employees_happiness = list(map(lambda h: h * factor, employees_happiness))
find_average_happiness = sum(factored_employees_happiness) / len(factored_employees_happiness)
happy_employees = [e for e in factored_employees_happiness if e >= find_average_happiness]
unhappy_employees = [e for e in factored_employees_happiness if e < find_average_happiness]
if len(happy_employees) >= len(unhappy_employees):
print(f'Score: {len(happy_employees)}/{len(employees_happiness)}. Employees are happy!')
else:
print(f'Score: {len(happy_employees)}/{len(employees_happiness)}. Employees are not happy!')
|
employees_happiness = [int(happiness) for happiness in input().split()]
factor = int(input())
factored_employees_happiness = list(map(lambda h: h * factor, employees_happiness))
find_average_happiness = sum(factored_employees_happiness) / len(factored_employees_happiness)
happy_employees = [e for e in factored_employees_happiness if e >= find_average_happiness]
unhappy_employees = [e for e in factored_employees_happiness if e < find_average_happiness]
if len(happy_employees) >= len(unhappy_employees):
print(f'Score: {len(happy_employees)}/{len(employees_happiness)}. Employees are happy!')
else:
print(f'Score: {len(happy_employees)}/{len(employees_happiness)}. Employees are not happy!')
|
db_config = {
'user': 'user',
'password': 'password',
'host': 'host.com',
'port': 12345,
'database': 'db-name',
"autocommit": True
}
|
db_config = {'user': 'user', 'password': 'password', 'host': 'host.com', 'port': 12345, 'database': 'db-name', 'autocommit': True}
|
VALUE_TYPES = {
'short', 'int', 'long',
'uchar', 'ushort', 'uint', 'ulong',
'bool', 'float', 'double', 'size_t',
'uint8', 'int8', 'int16', 'uint16', 'int32', 'uint32', 'int64', 'uint64',
}
VALA_TYPES = VALUE_TYPES | {
'char', 'string', 'void*', 'void**', 'time_t',
}
VALA_ALIASES = {
'unsigned int': 'uint',
'short unsigned int': 'ushort',
'unsigned long': 'ulong',
'int64_t': 'int64',
'uint64_t': 'uint64',
'long long': 'int64',
}
GLIB_TYPES = {
"GData": "GLib.Datalist",
}
|
value_types = {'short', 'int', 'long', 'uchar', 'ushort', 'uint', 'ulong', 'bool', 'float', 'double', 'size_t', 'uint8', 'int8', 'int16', 'uint16', 'int32', 'uint32', 'int64', 'uint64'}
vala_types = VALUE_TYPES | {'char', 'string', 'void*', 'void**', 'time_t'}
vala_aliases = {'unsigned int': 'uint', 'short unsigned int': 'ushort', 'unsigned long': 'ulong', 'int64_t': 'int64', 'uint64_t': 'uint64', 'long long': 'int64'}
glib_types = {'GData': 'GLib.Datalist'}
|
num = float(input("Enter a Number: "))
if num > 0:
print("This is a Positive Number")
elif num == 0:
print("Zero")
else:
print("This is a Negative Number")
|
num = float(input('Enter a Number: '))
if num > 0:
print('This is a Positive Number')
elif num == 0:
print('Zero')
else:
print('This is a Negative Number')
|
# Copyright (c) Microsoft Corporation. All rights reserved.
# Licensed under the MIT License.
class ContentType:
O365_CONNECTOR_CARD = "application/vnd.microsoft.teams.card.o365connector"
FILE_CONSENT_CARD = "application/vnd.microsoft.teams.card.file.consent"
FILE_DOWNLOAD_INFO = "application/vnd.microsoft.teams.file.download.info"
FILE_INFO_CARD = "application/vnd.microsoft.teams.card.file.info"
class Type:
O365_CONNECTOR_CARD_VIEWACTION = "ViewAction"
O365_CONNECTOR_CARD_OPEN_URI = "OpenUri"
O365_CONNECTOR_CARD_HTTP_POST = "HttpPOST"
O365_CONNECTOR_CARD_ACTION_CARD = "ActionCard"
O365_CONNECTOR_CARD_TEXT_INPUT = "TextInput"
O365_CONNECTOR_CARD_DATE_INPUT = "DateInput"
O365_CONNECTOR_CARD_MULTICHOICE_INPUT = "MultichoiceInput"
|
class Contenttype:
o365_connector_card = 'application/vnd.microsoft.teams.card.o365connector'
file_consent_card = 'application/vnd.microsoft.teams.card.file.consent'
file_download_info = 'application/vnd.microsoft.teams.file.download.info'
file_info_card = 'application/vnd.microsoft.teams.card.file.info'
class Type:
o365_connector_card_viewaction = 'ViewAction'
o365_connector_card_open_uri = 'OpenUri'
o365_connector_card_http_post = 'HttpPOST'
o365_connector_card_action_card = 'ActionCard'
o365_connector_card_text_input = 'TextInput'
o365_connector_card_date_input = 'DateInput'
o365_connector_card_multichoice_input = 'MultichoiceInput'
|
class Log:
lines = []
def __init__(self):
self.lines = []
def add(self, line):
self.lines.append(line)
def flush(self):
for line in self.lines:
print(line)
self.lines = []
battle_log = Log()
general_log = Log()
|
class Log:
lines = []
def __init__(self):
self.lines = []
def add(self, line):
self.lines.append(line)
def flush(self):
for line in self.lines:
print(line)
self.lines = []
battle_log = log()
general_log = log()
|
num1 = 111
num2 = 222
num3 = 333333
num3 = 333
num4 = 4444
|
num1 = 111
num2 = 222
num3 = 333333
num3 = 333
num4 = 4444
|
class MaterialPropertyMap:
def __init__(self):
self._lowCutoffs = []
self._highCutoffs = []
self._properties = []
def error_check(self, cutoff, conductivity):
if not isinstance(cutoff, tuple) or len(cutoff) != 2:
raise Exception("Cutoff has to be a tuple(int,int) specifying the low and high cutoffs")
for i in range(len(self._lowCutoffs)):
if (self._highCutoffs[i] >= cutoff[0] >= self._lowCutoffs[i]) \
or (self._highCutoffs[i] >= cutoff[1] >= self._lowCutoffs[i]):
raise Exception("Invalid material range. The range overlaps an existing material range")
check = False
if isinstance(conductivity, tuple):
if any(i < 0 for i in conductivity):
check = True
else:
if conductivity < 0:
check = True
if check:
raise Exception("Invalid conductivity. Must be positive")
return conductivity
def _append_inputs(self, cutoff, conductivity):
self._lowCutoffs.append(cutoff[0])
self._highCutoffs.append(cutoff[1])
self._properties.append(conductivity)
def get_size(self):
return len(self._lowCutoffs)
def get_material(self, i):
if i >= len(self._lowCutoffs):
raise Exception("Invalid index. Maximum size: " + str(self.get_size()))
if i < 0:
raise Exception("Invalid index. Must be >= 0")
return self._lowCutoffs[i], self._highCutoffs[i], self._properties[i]
def show(self):
print("Material conductivity as [low-high cutoffs] = conductivity:")
for i in range(len(self._lowCutoffs)):
print('[{} - {}] = {}'.format(self._lowCutoffs[i], self._highCutoffs[i], self._properties[i]))
class IsotropicConductivityMap(MaterialPropertyMap):
def __init__(self):
super().__init__()
def add_material(self, cutoff, conductivity):
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
class AnisotropicConductivityMap(MaterialPropertyMap):
def __init__(self):
super().__init__()
def add_material(self, cutoff, kxx, kyy, kzz, kxy, kxz, kyz):
conductivity = (kxx, kyy, kzz, kxy, kxz, kyz)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
def add_isotropic_material(self, cutoff, k):
conductivity = (k, k, k, 0., 0., 0.)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
def add_orthotropic_material(self, cutoff, kxx, kyy, kzz):
conductivity = (kxx, kyy, kzz, 0., 0., 0.)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
def add_material_to_orient(self, cutoff, k_axial, k_radial):
conductivity = (k_axial, k_radial)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
class ElasticityMap(MaterialPropertyMap):
def __init__(self):
super().__init__()
def add_material(self, cutoff, C11, C12, C13, C14, C15, C16, C22, C23, C24, C25, C26,
C33, C34, C35, C36, C44, C45, C46, C55, C56, C66):
elasticity = (C11, C12, C13, C14, C15, C16,
C22, C23, C24, C25, C26,
C33, C34, C35, C36,
C44, C45, C46,
C55, C56,
C66)
elasticity = self.error_check(cutoff, elasticity)
if isinstance(elasticity, bool):
return
self._append_inputs(cutoff, elasticity)
def add_isotropic_material(self, cutoff, E_youngmod, nu_poissrat):
Lambda = (nu_poissrat * E_youngmod) / ((1 + nu_poissrat) * (1 - 2 * nu_poissrat))
mu = E_youngmod / (2 * (1 + nu_poissrat))
elasticity = (Lambda + 2 * mu, Lambda, Lambda, 0., 0., 0.,
Lambda + 2 * mu, Lambda, 0., 0., 0.,
Lambda + 2 * mu, 0., 0., 0.,
2 * mu, 0., 0.,
2 * mu, 0.,
2 * mu)
elasticity = self.error_check(cutoff, elasticity)
if isinstance(elasticity, bool):
return
self._append_inputs(cutoff, elasticity)
def add_material_to_orient(self, cutoff, E_axial, E_radial, nu_poissrat_12, nu_poissrat_23, G12):
elasticity = (E_axial, E_radial, nu_poissrat_12, nu_poissrat_23, G12)
elasticity = self.error_check(cutoff, elasticity)
if isinstance(elasticity, bool):
return
self._append_inputs(cutoff, elasticity)
def show(self):
print("Material elasticity as [low-high cutoffs] = elasticity:")
for i in range(len(self._lowCutoffs)):
print('[{} - {}] = '.format(self._lowCutoffs[i], self._highCutoffs[i], self._properties[i]))
if len(self._properties[i]) == 5:
print('{}'.format(self._properties[i]))
else:
first_elast, last_elast = (0, 6)
for i2 in range(6):
print('{}'.format(self._properties[i][first_elast:last_elast]))
first_elast = last_elast
last_elast += 5 - i2
|
class Materialpropertymap:
def __init__(self):
self._lowCutoffs = []
self._highCutoffs = []
self._properties = []
def error_check(self, cutoff, conductivity):
if not isinstance(cutoff, tuple) or len(cutoff) != 2:
raise exception('Cutoff has to be a tuple(int,int) specifying the low and high cutoffs')
for i in range(len(self._lowCutoffs)):
if self._highCutoffs[i] >= cutoff[0] >= self._lowCutoffs[i] or self._highCutoffs[i] >= cutoff[1] >= self._lowCutoffs[i]:
raise exception('Invalid material range. The range overlaps an existing material range')
check = False
if isinstance(conductivity, tuple):
if any((i < 0 for i in conductivity)):
check = True
elif conductivity < 0:
check = True
if check:
raise exception('Invalid conductivity. Must be positive')
return conductivity
def _append_inputs(self, cutoff, conductivity):
self._lowCutoffs.append(cutoff[0])
self._highCutoffs.append(cutoff[1])
self._properties.append(conductivity)
def get_size(self):
return len(self._lowCutoffs)
def get_material(self, i):
if i >= len(self._lowCutoffs):
raise exception('Invalid index. Maximum size: ' + str(self.get_size()))
if i < 0:
raise exception('Invalid index. Must be >= 0')
return (self._lowCutoffs[i], self._highCutoffs[i], self._properties[i])
def show(self):
print('Material conductivity as [low-high cutoffs] = conductivity:')
for i in range(len(self._lowCutoffs)):
print('[{} - {}] = {}'.format(self._lowCutoffs[i], self._highCutoffs[i], self._properties[i]))
class Isotropicconductivitymap(MaterialPropertyMap):
def __init__(self):
super().__init__()
def add_material(self, cutoff, conductivity):
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
class Anisotropicconductivitymap(MaterialPropertyMap):
def __init__(self):
super().__init__()
def add_material(self, cutoff, kxx, kyy, kzz, kxy, kxz, kyz):
conductivity = (kxx, kyy, kzz, kxy, kxz, kyz)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
def add_isotropic_material(self, cutoff, k):
conductivity = (k, k, k, 0.0, 0.0, 0.0)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
def add_orthotropic_material(self, cutoff, kxx, kyy, kzz):
conductivity = (kxx, kyy, kzz, 0.0, 0.0, 0.0)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
def add_material_to_orient(self, cutoff, k_axial, k_radial):
conductivity = (k_axial, k_radial)
conductivity = self.error_check(cutoff, conductivity)
if isinstance(conductivity, bool):
return
self._append_inputs(cutoff, conductivity)
class Elasticitymap(MaterialPropertyMap):
def __init__(self):
super().__init__()
def add_material(self, cutoff, C11, C12, C13, C14, C15, C16, C22, C23, C24, C25, C26, C33, C34, C35, C36, C44, C45, C46, C55, C56, C66):
elasticity = (C11, C12, C13, C14, C15, C16, C22, C23, C24, C25, C26, C33, C34, C35, C36, C44, C45, C46, C55, C56, C66)
elasticity = self.error_check(cutoff, elasticity)
if isinstance(elasticity, bool):
return
self._append_inputs(cutoff, elasticity)
def add_isotropic_material(self, cutoff, E_youngmod, nu_poissrat):
lambda = nu_poissrat * E_youngmod / ((1 + nu_poissrat) * (1 - 2 * nu_poissrat))
mu = E_youngmod / (2 * (1 + nu_poissrat))
elasticity = (Lambda + 2 * mu, Lambda, Lambda, 0.0, 0.0, 0.0, Lambda + 2 * mu, Lambda, 0.0, 0.0, 0.0, Lambda + 2 * mu, 0.0, 0.0, 0.0, 2 * mu, 0.0, 0.0, 2 * mu, 0.0, 2 * mu)
elasticity = self.error_check(cutoff, elasticity)
if isinstance(elasticity, bool):
return
self._append_inputs(cutoff, elasticity)
def add_material_to_orient(self, cutoff, E_axial, E_radial, nu_poissrat_12, nu_poissrat_23, G12):
elasticity = (E_axial, E_radial, nu_poissrat_12, nu_poissrat_23, G12)
elasticity = self.error_check(cutoff, elasticity)
if isinstance(elasticity, bool):
return
self._append_inputs(cutoff, elasticity)
def show(self):
print('Material elasticity as [low-high cutoffs] = elasticity:')
for i in range(len(self._lowCutoffs)):
print('[{} - {}] = '.format(self._lowCutoffs[i], self._highCutoffs[i], self._properties[i]))
if len(self._properties[i]) == 5:
print('{}'.format(self._properties[i]))
else:
(first_elast, last_elast) = (0, 6)
for i2 in range(6):
print('{}'.format(self._properties[i][first_elast:last_elast]))
first_elast = last_elast
last_elast += 5 - i2
|
class EncodingApiCommunicator(object):
def __init__(self, inner):
self.inner = inner
def call(self, path, command, arguments=None, queries=None,
additional_queries=()):
path = path.encode()
command = command.encode()
arguments = self.transform_dictionary(arguments or {})
queries = self.transform_dictionary(queries or {})
promise = self.inner.call(
path, command, arguments, queries, additional_queries)
return self.decorate_promise(promise)
def transform_dictionary(self, dictionary):
return dict(self.transform_item(item) for item in dictionary.items())
def transform_item(self, item):
key, value = item
return (key.encode(), value)
def decorate_promise(self, promise):
return EncodedPromiseDecorator(promise)
class EncodedPromiseDecorator(object):
def __init__(self, inner):
self.inner = inner
def get(self):
response = self.inner.get()
return response.map(self.transform_row)
def __iter__(self):
return map(self.transform_row, self.inner)
def transform_row(self, row):
return dict(self.transform_item(item) for item in row.items())
def transform_item(self, item):
key, value = item
return (key.decode(), value)
|
class Encodingapicommunicator(object):
def __init__(self, inner):
self.inner = inner
def call(self, path, command, arguments=None, queries=None, additional_queries=()):
path = path.encode()
command = command.encode()
arguments = self.transform_dictionary(arguments or {})
queries = self.transform_dictionary(queries or {})
promise = self.inner.call(path, command, arguments, queries, additional_queries)
return self.decorate_promise(promise)
def transform_dictionary(self, dictionary):
return dict((self.transform_item(item) for item in dictionary.items()))
def transform_item(self, item):
(key, value) = item
return (key.encode(), value)
def decorate_promise(self, promise):
return encoded_promise_decorator(promise)
class Encodedpromisedecorator(object):
def __init__(self, inner):
self.inner = inner
def get(self):
response = self.inner.get()
return response.map(self.transform_row)
def __iter__(self):
return map(self.transform_row, self.inner)
def transform_row(self, row):
return dict((self.transform_item(item) for item in row.items()))
def transform_item(self, item):
(key, value) = item
return (key.decode(), value)
|
class Person:
def __init__(self, first_name, last_name):
self.first_name = first_name
self.last_name = last_name
self.age = 0
def full_name(self):
return self.first_name + " " + self.last_name
def record_info(self):
return self.last_name + ", " + self.first_name
person = Person("Bob", "Smith")
person2 = Person("Sally", "Smith")
Person.record_info = record_info
myfn = Person.full_name
print(myfn(person2))
# print(Person)
# print(person)
# print(person.full_name())
# print(person.record_info())
# print(person.first_name)
# print(person.age)
# person.age = 34
# print(person.age)
# del person.first_name
# print(person.first_name)
|
class Person:
def __init__(self, first_name, last_name):
self.first_name = first_name
self.last_name = last_name
self.age = 0
def full_name(self):
return self.first_name + ' ' + self.last_name
def record_info(self):
return self.last_name + ', ' + self.first_name
person = person('Bob', 'Smith')
person2 = person('Sally', 'Smith')
Person.record_info = record_info
myfn = Person.full_name
print(myfn(person2))
|
class Node:
def __init__(self, data) -> None:
self.data = data
self.nextNode = None
class LinkedList:
def __init__(self):
self.head = None
self.numOfNodes = 0
def insert_new(self, data):
self.numOfNodes += 1
new_node = Node(data)
if not self.head:
self.head = new_node
else:
new_node.nextNode = self.head
self.head = new_node
def insert_to_end(self, data):
self.numOfNodes += 1
new_node = Node(data)
actual_node = self.head
while actual_node.nextNode is not None:
actual_node = actual_node.nextNode
actual_node.nextNode = new_node
def remove(self, data):
if self.head is None:
return
actual_node = self.head
previous = None
while actual_node is not None and actual_node.data != data:
previous = actual_node
actual_node = actual_node.nextNode
if actual_node is None:
return
if previous is None:
self.head = actual_node.nextNode
else:
previous.nextNode = actual_node.nextNode
@property
def get_size(self):
return self.numOfNodes
def traverse(self):
actual = self.head
while actual is not None:
print(actual.data)
actual = actual.nextNode
if __name__ == "__main__":
t = LinkedList()
t.insert_new(1)
t.insert_new(10)
print(t.get_size)
t.traverse()
|
class Node:
def __init__(self, data) -> None:
self.data = data
self.nextNode = None
class Linkedlist:
def __init__(self):
self.head = None
self.numOfNodes = 0
def insert_new(self, data):
self.numOfNodes += 1
new_node = node(data)
if not self.head:
self.head = new_node
else:
new_node.nextNode = self.head
self.head = new_node
def insert_to_end(self, data):
self.numOfNodes += 1
new_node = node(data)
actual_node = self.head
while actual_node.nextNode is not None:
actual_node = actual_node.nextNode
actual_node.nextNode = new_node
def remove(self, data):
if self.head is None:
return
actual_node = self.head
previous = None
while actual_node is not None and actual_node.data != data:
previous = actual_node
actual_node = actual_node.nextNode
if actual_node is None:
return
if previous is None:
self.head = actual_node.nextNode
else:
previous.nextNode = actual_node.nextNode
@property
def get_size(self):
return self.numOfNodes
def traverse(self):
actual = self.head
while actual is not None:
print(actual.data)
actual = actual.nextNode
if __name__ == '__main__':
t = linked_list()
t.insert_new(1)
t.insert_new(10)
print(t.get_size)
t.traverse()
|
adventures = [
{"id": 1, "name": "Test Location"},
{"id": 12, "name": "The Sewer"},
{"id": 15, "name": "The Spooky Forest"},
{"id": 16, "name": "The Haiku Dungeon"},
{"id": 17, "name": "The Hidden Temple"},
{"id": 18, "name": "Degrassi Knoll"},
{"id": 19, "name": "The Limerick Dungeon"},
{"id": 20, "name": 'The "Fun" House'},
{"id": 21, "name": "The Misspelled Cemetary (Pre-Cyrpt)"},
{"id": 22, "name": "Tower Ruins"},
{"id": 23, "name": "Drunken Stupor"},
{"id": 24, "name": "The Typical Tavern Rats"},
{"id": 25, "name": "The Typical Tavern Booze"},
{"id": 26, "name": "The Hippy Camp"},
{"id": 27, "name": "Orcish Frat House"},
{"id": 29, "name": "Orcish Frat House (In Disguise)"},
{"id": 30, "name": "The Bat Hole Entryway"},
{"id": 31, "name": "Guano Junction"},
{"id": 32, "name": "Batrat and Ratbat Burrow"},
{"id": 33, "name": "Beanbat Chamber"},
{"id": 34, "name": "The Boss Bat's Lair"},
{"id": 37, "name": "The Spectral Pickle Factory"},
{"id": 38, "name": "The Enormous Greater-Then Sign"},
{"id": 39, "name": "The Dungeons of Doom"},
{"id": 40, "name": "Cobb's Knob Kitchens"},
{"id": 41, "name": "Cobb's Knob Treasury"},
{"id": 42, "name": "Cobb's Knob Harem"},
{"id": 43, "name": "Outskirts of Camp Logging Camp"},
{"id": 44, "name": "Camp Logging Camp"},
{"id": 45, "name": "South of the Border"},
{"id": 46, "name": "Thugnderdome"},
{"id": 47, "name": "The Bugbear Pens (Pre-Quest)"},
{"id": 48, "name": "The Spooky Gravy Barrow"},
{"id": 49, "name": "The Bugbear Pens (Post-Quest)"},
{"id": 50, "name": "Knob Goblin Laboratory"},
{"id": 51, "name": "Cobb's Knob Menagerie, Level 1"},
{"id": 52, "name": "Cobb's Knob Menagerie, Level 2"},
{"id": 53, "name": "Cobb's Knob Menagerie, Level 3"},
{"id": 54, "name": "The Defiled Nook"},
{"id": 55, "name": "The Defiled Cranny"},
{"id": 56, "name": "The Defiled Alcove"},
{"id": 57, "name": "The Defiled Niche"},
{"id": 58, "name": "The Misspelled Cemetary (Post-Cyrpt)"},
{"id": 59, "name": "The Icy Peak in The Recent Past"},
{"id": 60, "name": "The Goatlet"},
{"id": 61, "name": "Itznotyerzitz Mine"},
{"id": 62, "name": "Lair of the Ninja Snowmen"},
{"id": 63, "name": "The eXtreme Slope"},
{"id": 65, "name": "The Hippy Camp"},
{"id": 66, "name": "The Obligatory Pirate's Cove"},
{"id": 67, "name": "The Obligatory Pirate's Cove (In Disguise)"},
{"id": 70, "name": "The Roulette Tables"},
{"id": 71, "name": "The Poker Room"},
{"id": 73, "name": "The Inexplicable Door"},
{"id": 75, "name": "The Dark Neck of the Woods"},
{"id": 76, "name": "The Dark Heart of the Woods"},
{"id": 77, "name": "The Dark Elbow of the Woods"},
{"id": 79, "name": "The Deep Fat Friar's Gate"},
{"id": 80, "name": "The Valley Beyond the Orc Chasm"},
{"id": 81, "name": "The Penultimate Fantasy Airship"},
{"id": 82, "name": "The Castle in the Clouds in the Sky"},
{"id": 83, "name": "The Hole in the Sky"},
{"id": 84, "name": "St. Sneaky Pete's Day Stupor"},
{"id": 85, "name": "A Battlefield (No Uniform)"},
{"id": 86, "name": "A BattleField (In Cloaca-Cola Uniform)"},
{"id": 87, "name": "A Battlefield (In Dyspepsi-Cola Uniform)"},
{"id": 88, "name": "Market Square, 28 Days Later"},
{"id": 89, "name": "The Mall of Loathing, 28 Days Later"},
{"id": 90, "name": "Wrong Side of the Tracks, 28 Days Later"},
{"id": 91, "name": "Noob Cave"},
{"id": 92, "name": "The Dire Warren"},
{"id": 93, "name": "Crimbo Town Toy Factory (2005)"},
{"id": 94, "name": "Crimbo Toy Town Factory (2005) (Protesting)"},
{"id": 96, "name": "An Incredibly Strange Place (Bad Trip)"},
{"id": 97, "name": "An Incredibly Strange Place (Great Trip)"},
{"id": 98, "name": "An Incredibly Strange Place (Mediocre Trip)"},
{"id": 99, "name": "The Road to White Citadel"},
{"id": 100, "name": "Whitey's Grove"},
{"id": 101, "name": "The Knob Shaft"},
{"id": 102, "name": "The Haunted Kitchen"},
{"id": 103, "name": "The Haunted Conservatory"},
{"id": 104, "name": "The Haunted Library"},
{"id": 105, "name": "The Haunted Billiards Room"},
{"id": 106, "name": "The Haunted Gallery"},
{"id": 107, "name": "The Haunted Bathroom"},
{"id": 108, "name": "The Haunted Bedroom"},
{"id": 109, "name": "The Haunted Ballroom"},
{"id": 110, "name": "The Icy Peak"},
{"id": 111, "name": "The Black Forest"},
{"id": 112, "name": "The Sleazy Back Alley"},
{"id": 113, "name": "The Haunted Pantry"},
{"id": 114, "name": "Outskirts of Cobb's Knob"},
{"id": 115, "name": "Simple Tool-Making Cave"},
{"id": 116, "name": "The Spooky Fright Factory"},
{"id": 117, "name": "The Crimborg Collective Factory"},
{"id": 118, "name": "The Hidden City"},
{"id": 119, "name": "The Palindome"},
{"id": 121, "name": "The Arid, Extra-Dry Desert (without Ultrahydrated)"},
{"id": 122, "name": "An Oasis"},
{"id": 123, "name": "The Arid, Extra-Dry Desert (with Ultrahydrated)"},
{"id": 124, "name": "The Upper Chamber"},
{"id": 125, "name": "The Middle Chamber"},
{"id": 126, "name": "The Themthar Hills"},
{"id": 127, "name": "The Hatching Chamber"},
{"id": 128, "name": "The Feeding Chamber"},
{"id": 129, "name": "The Guards' Chamber"},
{"id": 130, "name": "The Queen's Chamber"},
{"id": 131, "name": "Wartime Hippy Camp (In Frat Boy Ensemble)"},
{"id": 132, "name": "The Battlefield (In Frat Warrior Fatigues)"},
{"id": 133, "name": "Wartime Hippy Camp"},
{"id": 134, "name": "Wartime Frat House (In Filthy Hippy Disguise)"},
{"id": 135, "name": "Wartime Frat House"},
{"id": 136, "name": "Sonofa Beach"},
{"id": 137, "name": "McMillicancuddy's Barn"},
{"id": 139, "name": "The Junkyard"},
{"id": 140, "name": "The Battlefield (In War Hippy Fatigues)"},
{"id": 141, "name": "The Pond"},
{"id": 142, "name": "The Back 40"},
{"id": 143, "name": "The Other Back 40"},
{"id": 144, "name": "The Granary"},
{"id": 145, "name": "The Bog"},
{"id": 146, "name": "The Family Plot"},
{"id": 147, "name": "The Shady Thicket"},
{"id": 148, "name": "Heartbreaker's Hotel"},
{"id": 149, "name": "The Hippy Camp (Bombed Back to the Stone Age)"},
{"id": 150, "name": "The Orcish Frat House (Bombed Back to the Stone Age)"},
{"id": 151, "name": "The Stately Pleasure Dome"},
{"id": 152, "name": "The Mouldering Mansion"},
{"id": 153, "name": "The Rogue Windmill"},
{"id": 154, "name": "The Junkyard (Post-War)"},
{"id": 155, "name": "McMillicancuddy's Farm (Post-War)"},
{"id": 156, "name": "The Grim Grimacite Site"},
{"id": 157, "name": "Barrrney's Barrr"},
{"id": 158, "name": "The F'c'le"},
{"id": 159, "name": "The Poop Deck"},
{"id": 160, "name": "Belowdecks"},
{"id": 161, "name": "A Sinister Dodecahedron"},
{"id": 162, "name": "Crimbo Town Toy Factory (2007)"},
{"id": 163, "name": "A Yuletide Bonfire"},
{"id": 164, "name": "A Shimmering Portal"},
{"id": 166, "name": "A Maze of Sewer Tunnels"},
{"id": 167, "name": "Hobopolis Town Square"},
{"id": 168, "name": "Burnbarrel Blvd."},
{"id": 169, "name": "Exposure Esplanade"},
{"id": 170, "name": "The Heap"},
{"id": 171, "name": "The Ancient Hobo Burial Ground"},
{"id": 172, "name": "The Purple Light District"},
{"id": 173, "name": "Go for a Swim"},
{"id": 174, "name": "The Arrrboretum"},
{"id": 175, "name": "The Spectral Salad Factory"},
{"id": 177, "name": "Mt. Molehill"},
{"id": 178, "name": "Wine Racks (Northwest)"},
{"id": 179, "name": "Wine Racks (Northeast)"},
{"id": 180, "name": "Wine Racks (Southwest)"},
{"id": 181, "name": "Wine Racks (Southeast)"},
{"id": 182, "name": "Next to that Barrel with Something Burning in it"},
{"id": 183, "name": "Near an Abandoned Refrigerator"},
{"id": 184, "name": "Over Where the Old Tires Are"},
{"id": 185, "name": "Out By that Rusted-Out Car"},
]
|
adventures = [{'id': 1, 'name': 'Test Location'}, {'id': 12, 'name': 'The Sewer'}, {'id': 15, 'name': 'The Spooky Forest'}, {'id': 16, 'name': 'The Haiku Dungeon'}, {'id': 17, 'name': 'The Hidden Temple'}, {'id': 18, 'name': 'Degrassi Knoll'}, {'id': 19, 'name': 'The Limerick Dungeon'}, {'id': 20, 'name': 'The "Fun" House'}, {'id': 21, 'name': 'The Misspelled Cemetary (Pre-Cyrpt)'}, {'id': 22, 'name': 'Tower Ruins'}, {'id': 23, 'name': 'Drunken Stupor'}, {'id': 24, 'name': 'The Typical Tavern Rats'}, {'id': 25, 'name': 'The Typical Tavern Booze'}, {'id': 26, 'name': 'The Hippy Camp'}, {'id': 27, 'name': 'Orcish Frat House'}, {'id': 29, 'name': 'Orcish Frat House (In Disguise)'}, {'id': 30, 'name': 'The Bat Hole Entryway'}, {'id': 31, 'name': 'Guano Junction'}, {'id': 32, 'name': 'Batrat and Ratbat Burrow'}, {'id': 33, 'name': 'Beanbat Chamber'}, {'id': 34, 'name': "The Boss Bat's Lair"}, {'id': 37, 'name': 'The Spectral Pickle Factory'}, {'id': 38, 'name': 'The Enormous Greater-Then Sign'}, {'id': 39, 'name': 'The Dungeons of Doom'}, {'id': 40, 'name': "Cobb's Knob Kitchens"}, {'id': 41, 'name': "Cobb's Knob Treasury"}, {'id': 42, 'name': "Cobb's Knob Harem"}, {'id': 43, 'name': 'Outskirts of Camp Logging Camp'}, {'id': 44, 'name': 'Camp Logging Camp'}, {'id': 45, 'name': 'South of the Border'}, {'id': 46, 'name': 'Thugnderdome'}, {'id': 47, 'name': 'The Bugbear Pens (Pre-Quest)'}, {'id': 48, 'name': 'The Spooky Gravy Barrow'}, {'id': 49, 'name': 'The Bugbear Pens (Post-Quest)'}, {'id': 50, 'name': 'Knob Goblin Laboratory'}, {'id': 51, 'name': "Cobb's Knob Menagerie, Level 1"}, {'id': 52, 'name': "Cobb's Knob Menagerie, Level 2"}, {'id': 53, 'name': "Cobb's Knob Menagerie, Level 3"}, {'id': 54, 'name': 'The Defiled Nook'}, {'id': 55, 'name': 'The Defiled Cranny'}, {'id': 56, 'name': 'The Defiled Alcove'}, {'id': 57, 'name': 'The Defiled Niche'}, {'id': 58, 'name': 'The Misspelled Cemetary (Post-Cyrpt)'}, {'id': 59, 'name': 'The Icy Peak in The Recent Past'}, {'id': 60, 'name': 'The Goatlet'}, {'id': 61, 'name': 'Itznotyerzitz Mine'}, {'id': 62, 'name': 'Lair of the Ninja Snowmen'}, {'id': 63, 'name': 'The eXtreme Slope'}, {'id': 65, 'name': 'The Hippy Camp'}, {'id': 66, 'name': "The Obligatory Pirate's Cove"}, {'id': 67, 'name': "The Obligatory Pirate's Cove (In Disguise)"}, {'id': 70, 'name': 'The Roulette Tables'}, {'id': 71, 'name': 'The Poker Room'}, {'id': 73, 'name': 'The Inexplicable Door'}, {'id': 75, 'name': 'The Dark Neck of the Woods'}, {'id': 76, 'name': 'The Dark Heart of the Woods'}, {'id': 77, 'name': 'The Dark Elbow of the Woods'}, {'id': 79, 'name': "The Deep Fat Friar's Gate"}, {'id': 80, 'name': 'The Valley Beyond the Orc Chasm'}, {'id': 81, 'name': 'The Penultimate Fantasy Airship'}, {'id': 82, 'name': 'The Castle in the Clouds in the Sky'}, {'id': 83, 'name': 'The Hole in the Sky'}, {'id': 84, 'name': "St. Sneaky Pete's Day Stupor"}, {'id': 85, 'name': 'A Battlefield (No Uniform)'}, {'id': 86, 'name': 'A BattleField (In Cloaca-Cola Uniform)'}, {'id': 87, 'name': 'A Battlefield (In Dyspepsi-Cola Uniform)'}, {'id': 88, 'name': 'Market Square, 28 Days Later'}, {'id': 89, 'name': 'The Mall of Loathing, 28 Days Later'}, {'id': 90, 'name': 'Wrong Side of the Tracks, 28 Days Later'}, {'id': 91, 'name': 'Noob Cave'}, {'id': 92, 'name': 'The Dire Warren'}, {'id': 93, 'name': 'Crimbo Town Toy Factory (2005)'}, {'id': 94, 'name': 'Crimbo Toy Town Factory (2005) (Protesting)'}, {'id': 96, 'name': 'An Incredibly Strange Place (Bad Trip)'}, {'id': 97, 'name': 'An Incredibly Strange Place (Great Trip)'}, {'id': 98, 'name': 'An Incredibly Strange Place (Mediocre Trip)'}, {'id': 99, 'name': 'The Road to White Citadel'}, {'id': 100, 'name': "Whitey's Grove"}, {'id': 101, 'name': 'The Knob Shaft'}, {'id': 102, 'name': 'The Haunted Kitchen'}, {'id': 103, 'name': 'The Haunted Conservatory'}, {'id': 104, 'name': 'The Haunted Library'}, {'id': 105, 'name': 'The Haunted Billiards Room'}, {'id': 106, 'name': 'The Haunted Gallery'}, {'id': 107, 'name': 'The Haunted Bathroom'}, {'id': 108, 'name': 'The Haunted Bedroom'}, {'id': 109, 'name': 'The Haunted Ballroom'}, {'id': 110, 'name': 'The Icy Peak'}, {'id': 111, 'name': 'The Black Forest'}, {'id': 112, 'name': 'The Sleazy Back Alley'}, {'id': 113, 'name': 'The Haunted Pantry'}, {'id': 114, 'name': "Outskirts of Cobb's Knob"}, {'id': 115, 'name': 'Simple Tool-Making Cave'}, {'id': 116, 'name': 'The Spooky Fright Factory'}, {'id': 117, 'name': 'The Crimborg Collective Factory'}, {'id': 118, 'name': 'The Hidden City'}, {'id': 119, 'name': 'The Palindome'}, {'id': 121, 'name': 'The Arid, Extra-Dry Desert (without Ultrahydrated)'}, {'id': 122, 'name': 'An Oasis'}, {'id': 123, 'name': 'The Arid, Extra-Dry Desert (with Ultrahydrated)'}, {'id': 124, 'name': 'The Upper Chamber'}, {'id': 125, 'name': 'The Middle Chamber'}, {'id': 126, 'name': 'The Themthar Hills'}, {'id': 127, 'name': 'The Hatching Chamber'}, {'id': 128, 'name': 'The Feeding Chamber'}, {'id': 129, 'name': "The Guards' Chamber"}, {'id': 130, 'name': "The Queen's Chamber"}, {'id': 131, 'name': 'Wartime Hippy Camp (In Frat Boy Ensemble)'}, {'id': 132, 'name': 'The Battlefield (In Frat Warrior Fatigues)'}, {'id': 133, 'name': 'Wartime Hippy Camp'}, {'id': 134, 'name': 'Wartime Frat House (In Filthy Hippy Disguise)'}, {'id': 135, 'name': 'Wartime Frat House'}, {'id': 136, 'name': 'Sonofa Beach'}, {'id': 137, 'name': "McMillicancuddy's Barn"}, {'id': 139, 'name': 'The Junkyard'}, {'id': 140, 'name': 'The Battlefield (In War Hippy Fatigues)'}, {'id': 141, 'name': 'The Pond'}, {'id': 142, 'name': 'The Back 40'}, {'id': 143, 'name': 'The Other Back 40'}, {'id': 144, 'name': 'The Granary'}, {'id': 145, 'name': 'The Bog'}, {'id': 146, 'name': 'The Family Plot'}, {'id': 147, 'name': 'The Shady Thicket'}, {'id': 148, 'name': "Heartbreaker's Hotel"}, {'id': 149, 'name': 'The Hippy Camp (Bombed Back to the Stone Age)'}, {'id': 150, 'name': 'The Orcish Frat House (Bombed Back to the Stone Age)'}, {'id': 151, 'name': 'The Stately Pleasure Dome'}, {'id': 152, 'name': 'The Mouldering Mansion'}, {'id': 153, 'name': 'The Rogue Windmill'}, {'id': 154, 'name': 'The Junkyard (Post-War)'}, {'id': 155, 'name': "McMillicancuddy's Farm (Post-War)"}, {'id': 156, 'name': 'The Grim Grimacite Site'}, {'id': 157, 'name': "Barrrney's Barrr"}, {'id': 158, 'name': "The F'c'le"}, {'id': 159, 'name': 'The Poop Deck'}, {'id': 160, 'name': 'Belowdecks'}, {'id': 161, 'name': 'A Sinister Dodecahedron'}, {'id': 162, 'name': 'Crimbo Town Toy Factory (2007)'}, {'id': 163, 'name': 'A Yuletide Bonfire'}, {'id': 164, 'name': 'A Shimmering Portal'}, {'id': 166, 'name': 'A Maze of Sewer Tunnels'}, {'id': 167, 'name': 'Hobopolis Town Square'}, {'id': 168, 'name': 'Burnbarrel Blvd.'}, {'id': 169, 'name': 'Exposure Esplanade'}, {'id': 170, 'name': 'The Heap'}, {'id': 171, 'name': 'The Ancient Hobo Burial Ground'}, {'id': 172, 'name': 'The Purple Light District'}, {'id': 173, 'name': 'Go for a Swim'}, {'id': 174, 'name': 'The Arrrboretum'}, {'id': 175, 'name': 'The Spectral Salad Factory'}, {'id': 177, 'name': 'Mt. Molehill'}, {'id': 178, 'name': 'Wine Racks (Northwest)'}, {'id': 179, 'name': 'Wine Racks (Northeast)'}, {'id': 180, 'name': 'Wine Racks (Southwest)'}, {'id': 181, 'name': 'Wine Racks (Southeast)'}, {'id': 182, 'name': 'Next to that Barrel with Something Burning in it'}, {'id': 183, 'name': 'Near an Abandoned Refrigerator'}, {'id': 184, 'name': 'Over Where the Old Tires Are'}, {'id': 185, 'name': 'Out By that Rusted-Out Car'}]
|
class Solution:
def amendSentence(self, s):
# code here
ans = ""
string = ""
for i in range(len(s)):
if 97 <= ord(s[i]) <= 122:
string += s[i]
else:
if string:
ans += string
ans += " "
string = ""
string += s[i].lower()
ans += string
return ans
#{
# Driver Code Starts
#Initial Template for Python 3
if __name__ == '__main__':
t = int(input())
for _ in range(t):
s = input()
solObj = Solution()
print(solObj.amendSentence(s))
# } Driver Code Ends
|
class Solution:
def amend_sentence(self, s):
ans = ''
string = ''
for i in range(len(s)):
if 97 <= ord(s[i]) <= 122:
string += s[i]
else:
if string:
ans += string
ans += ' '
string = ''
string += s[i].lower()
ans += string
return ans
if __name__ == '__main__':
t = int(input())
for _ in range(t):
s = input()
sol_obj = solution()
print(solObj.amendSentence(s))
|
# Copyright (c) 2021 Qualcomm Technologies, Inc.
# All Rights Reserved.
def _tb_advance_global_step(module):
if hasattr(module, 'global_step'):
module.global_step += 1
return module
def _tb_advance_token_counters(module, tensor, verbose=False):
token_count = getattr(module, 'tb_token_count', None)
if token_count is not None:
T = tensor.size(1)
if token_count.last != T:
if token_count.last != 0:
token_count.total += token_count.last
token_count.sample_idx += 1
token_count.last = T
if verbose:
print(f'>>> T={T}\tlast_T={token_count.last}\tcumsum_T={token_count.total}')
return module
def _tb_hist(module, tensor, name, verbose=False):
hist_kw = dict(bins='auto')
tb_writer = getattr(module, 'tb_writer', None)
if tb_writer is not None:
if module.layer_idx == module.num_layers - 1:
tensor = tensor[:, 0]
# per-tensor
layer_s = str(1 + module.layer_idx).zfill(2)
full_name = f'{layer_s}/layer/{name}'
global_step = module.global_step
if verbose:
stats = f'min={tensor.min():.1f}, max={tensor.max():.1f}'
info = (
f'TB logging {full_name}\t{tuple(tensor.size())}\t({stats})\t'
f'[global_step={global_step}] ...'
)
print(info)
tb_writer.add_histogram(full_name, tensor, global_step=global_step, **hist_kw)
# per-token
sample_idx_s = str(module.tb_token_count.sample_idx + 1).zfill(2)
T = tensor.size(1)
full_name = f'{layer_s}/token/{sample_idx_s}/{name}'
for i in range(T):
tb_writer.add_histogram(full_name, tensor[0, i], global_step=i, **hist_kw)
|
def _tb_advance_global_step(module):
if hasattr(module, 'global_step'):
module.global_step += 1
return module
def _tb_advance_token_counters(module, tensor, verbose=False):
token_count = getattr(module, 'tb_token_count', None)
if token_count is not None:
t = tensor.size(1)
if token_count.last != T:
if token_count.last != 0:
token_count.total += token_count.last
token_count.sample_idx += 1
token_count.last = T
if verbose:
print(f'>>> T={T}\tlast_T={token_count.last}\tcumsum_T={token_count.total}')
return module
def _tb_hist(module, tensor, name, verbose=False):
hist_kw = dict(bins='auto')
tb_writer = getattr(module, 'tb_writer', None)
if tb_writer is not None:
if module.layer_idx == module.num_layers - 1:
tensor = tensor[:, 0]
layer_s = str(1 + module.layer_idx).zfill(2)
full_name = f'{layer_s}/layer/{name}'
global_step = module.global_step
if verbose:
stats = f'min={tensor.min():.1f}, max={tensor.max():.1f}'
info = f'TB logging {full_name}\t{tuple(tensor.size())}\t({stats})\t[global_step={global_step}] ...'
print(info)
tb_writer.add_histogram(full_name, tensor, global_step=global_step, **hist_kw)
sample_idx_s = str(module.tb_token_count.sample_idx + 1).zfill(2)
t = tensor.size(1)
full_name = f'{layer_s}/token/{sample_idx_s}/{name}'
for i in range(T):
tb_writer.add_histogram(full_name, tensor[0, i], global_step=i, **hist_kw)
|
class ExpressionReader:
priorityComparision = ['=']
andOrComparision = ['OR']
operations = []
operations.extend(priorityComparision)
operations.extend(andOrComparision)
def read(expression):
lst = ExpressionReader.__split(expression)
#lst = ExpressionReader.__parsePriorityExpression(lst, ExpressionReader.priorityComparision)
#lst = ExpressionReader.__parseExpression(lst)
return lst
def __split(expression):
lst = []
chars = ''
acceptSpace = False
for char in expression:
if char == '(' or char == ')':
if chars != '':
lst.append(chars)
chars = ''
lst.append(char)
continue
if char == '\'' or char == '\"':
acceptSpace = not acceptSpace
if char == ' ' and acceptSpace == False:
if chars != '':
lst.append(chars)
chars = ''
continue
else:
chars = chars + char
if chars != '':
lst.append(chars)
return lst
def __parsePriorityExpression(lst, operations):
newLst = []
for i in range(0, len(lst) - 1):
if lst[i] in operations:
arguments = []
arguments.append(lst[i-1])
operation = lst[i]
arguments.append(lst[i+1])
dataDriven = ExpressionReader.toDataDrivenStyle(operation, arguments)
if dataDriven is None:
return None
newLst.append(dataDriven)
elif lst[i] in ExpressionReader.operations:
newLst.append(lst[i])
return newLst
def __parseExpression(lst):
if lst is None:
return None
while len(lst) > 1:
arguments = []
arguments.append(lst.pop(0))
operation = lst.pop(0)
arguments.append(lst.pop(0))
dataDriven = ExpressionReader.toDataDrivenStyle(operation, arguments)
if dataDriven is None:
return None
lst.insert(0, dataDriven)
return lst
def toDataDrivenStyle(operation, arguments):
if operation == '=':
return '[\"==\",[\"get\",\"' + arguments[0] + '\"],' + arguments[1] + ']'
if operation == 'OR':
return '[\"any\",' + arguments[0] + ',' + arguments[1] + ']'
return None
# subset = 'loaiDatHT = \'CAN\' OR loaiDatHT = \'COC\' OR loaiDatHT = \'CQP\' OR loaiDatHT = \'DBV\' OR loaiDatHT = \'DCK\' OR loaiDatHT = \'DCH\' OR loaiDatHT = \'DDT\' OR loaiDatHT = \'DGD\' OR loaiDatHT = \'DKH\' OR loaiDatHT = \'DNL\' OR loaiDatHT = \'DSH\' OR loaiDatHT = \'DSN\' OR loaiDatHT = \'DTS\' OR loaiDatHT = \'DTT\' OR loaiDatHT = \'DVH\' OR loaiDatHT = \'DXH\' OR loaiDatHT = \'DYT\' OR loaiDatHT = \'SKC\' OR loaiDatHT = \'SKK\' OR loaiDatHT = \'SKN\' OR loaiDatHT = \'SKX\' OR loaiDatHT = \'TIN\' OR loaiDatHT = \'TMD\' OR loaiDatHT = \'TON\' OR loaiDatHT = \'TSC\' OR loaiDatHT = \'TSN\' OR loaiDatHT = \'SKX\' OR loaiDatHT = \'DRA\' OR loaiDatHT = \'NTD\''
# print(ExpressionReader.read(subset))
testIn = '\"loaiDatHT\" in (\'DGT\')'
print(ExpressionReader.read(testIn))
|
class Expressionreader:
priority_comparision = ['=']
and_or_comparision = ['OR']
operations = []
operations.extend(priorityComparision)
operations.extend(andOrComparision)
def read(expression):
lst = ExpressionReader.__split(expression)
return lst
def __split(expression):
lst = []
chars = ''
accept_space = False
for char in expression:
if char == '(' or char == ')':
if chars != '':
lst.append(chars)
chars = ''
lst.append(char)
continue
if char == "'" or char == '"':
accept_space = not acceptSpace
if char == ' ' and acceptSpace == False:
if chars != '':
lst.append(chars)
chars = ''
continue
else:
chars = chars + char
if chars != '':
lst.append(chars)
return lst
def __parse_priority_expression(lst, operations):
new_lst = []
for i in range(0, len(lst) - 1):
if lst[i] in operations:
arguments = []
arguments.append(lst[i - 1])
operation = lst[i]
arguments.append(lst[i + 1])
data_driven = ExpressionReader.toDataDrivenStyle(operation, arguments)
if dataDriven is None:
return None
newLst.append(dataDriven)
elif lst[i] in ExpressionReader.operations:
newLst.append(lst[i])
return newLst
def __parse_expression(lst):
if lst is None:
return None
while len(lst) > 1:
arguments = []
arguments.append(lst.pop(0))
operation = lst.pop(0)
arguments.append(lst.pop(0))
data_driven = ExpressionReader.toDataDrivenStyle(operation, arguments)
if dataDriven is None:
return None
lst.insert(0, dataDriven)
return lst
def to_data_driven_style(operation, arguments):
if operation == '=':
return '["==",["get","' + arguments[0] + '"],' + arguments[1] + ']'
if operation == 'OR':
return '["any",' + arguments[0] + ',' + arguments[1] + ']'
return None
test_in = '"loaiDatHT" in (\'DGT\')'
print(ExpressionReader.read(testIn))
|
'''A large FizzBuzz as an output using small FizzBuzz numbers.(FizzBuzz=FizBuz for better alignment
and make sure your output terminal covers the entire length of the screen to avoid automatic newlines)'''
# Author: @AmanMatrix
def iCheck(i):
if i%15==0:
i='FizBuz'
elif i%3==0:
i='Fizz'
elif i%5==0:
i='Buzz'
else:i=i
return i
for i in range(1,101):
if(i==1):
print("\n",iCheck(i),end=" ")
elif(i<=5):
print(iCheck(i),end=" ")
elif(i==6):
print(" ",iCheck(i),end=" ")
elif(i<=9):
print(iCheck(i),end=" ")
elif(i==10):
print(f"\n {iCheck(i)}",end=" ")
elif(i<=12):
print(iCheck(i),end="")
elif(i==13):
print(" ",iCheck(i),end=" ")
elif(i==14):
print(iCheck(i))
elif(i==15):
print(iCheck(i),end=" ")
elif(i==16):
print(iCheck(i),end=" ")
elif(i<=18):
print(iCheck(i),end=" ")
elif(i==19):
print(f"\n {iCheck(i)}",end=" ")
elif(i<=21):
print(iCheck(i),end=" ")
elif(i==22):
print(f"\n {iCheck(i)}",end=" ")
elif(i<=25):
print(iCheck(i),end=" ")
elif(i==26):
print(" ",iCheck(i),end="")
elif(i<=27):
print(iCheck(i),end=" ")
elif(i==28):
print(iCheck(i),end=" ")
elif(i<=30):
print(iCheck(i),end=" ")
elif(i==31):
print(" ",iCheck(i),end=" ")
elif(i<=33):
print(iCheck(i),end=" ")
elif(i==34):
print(" ",iCheck(i),end=" ")
elif(i<=36):
print(iCheck(i),end="")
elif(i<=37):
print(" ",iCheck(i),end="")
elif(i<=38):
print(" ",iCheck(i),end="")
elif(i==39):
print(" ",iCheck(i),end=" ")
elif(i<=41):
print(iCheck(i),end=" ")
elif(i==42):
print(" ",iCheck(i),end=" ")
elif(i<=44):
print(iCheck(i),end=" ")
elif(i==45):
print(f"\n{iCheck(i)}",end=" ")
elif(i<=47):
print(iCheck(i),end=" ")
elif(i<=49):
print(" ",iCheck(i),end=" ")
elif(i==50):
print(" ",iCheck(i),end=" ")
elif(i==51):
print(" ",iCheck(i),end=" ")
elif(i==52):
print(iCheck(i),end=" ")
elif(i==53):
print(iCheck(i),end=" ")
elif(i<=55):
print(iCheck(i),end=" ")
elif(i==56):
print(f"\n {iCheck(i)}",end=" ")
elif(i<=58):
print(iCheck(i),end="")
elif(i<=60):
print(" ",iCheck(i),end=" ")
elif(i<=61):
print(" ",iCheck(i),end=" ")
elif(i<=62):
print(iCheck(i),end=" ")
elif(i<=64):
print(iCheck(i),end=" ")
elif(i<=66):
print(iCheck(i),end=" ")
elif(i<=67):
print(f"\n {iCheck(i)}",end=" ")
elif(i<=69):
print(iCheck(i),end="")
elif(i<=71):
print(" ",iCheck(i),end=" ")
elif(i<=72):
print(" ",iCheck(i),end=" ")
elif(i<=73):
print(iCheck(i),end=" ")
elif(i<=74):
print(iCheck(i),end=" ")
elif(i<=75):
print(iCheck(i),end=" ")
elif(i<=76):
print(iCheck(i),end=" ")
elif(i<=77):
print(iCheck(i),end=" ")
elif(i<=78):
print(f"\n {iCheck(i)}",end=" ")
elif(i<=80):
print(iCheck(i),end="")
elif(i==81):
print(" ",iCheck(i),end=" ")
elif(i<=83):
print("",iCheck(i),end="")
elif(i<=84):
print(" ",iCheck(i),end=" ")
elif(i<=86):
print(iCheck(i),end="")
elif(i<=87):
print(" ",iCheck(i),end=" ")
elif(i<=89):
print(iCheck(i),end=" ")
elif(i<=90):
print(" ",iCheck(i),end="")
elif(i<=92):
print(iCheck(i),end="")
elif(i<=93):
print(" ",iCheck(i),end="")
elif(i<=95):
print("",iCheck(i),end="")
elif(i<=96):
print(" ",iCheck(i),end="")
elif(i<=99):
print(iCheck(i),end="")
else:
print(" ",iCheck(i))
|
"""A large FizzBuzz as an output using small FizzBuzz numbers.(FizzBuzz=FizBuz for better alignment
and make sure your output terminal covers the entire length of the screen to avoid automatic newlines)"""
def i_check(i):
if i % 15 == 0:
i = 'FizBuz'
elif i % 3 == 0:
i = 'Fizz'
elif i % 5 == 0:
i = 'Buzz'
else:
i = i
return i
for i in range(1, 101):
if i == 1:
print('\n', i_check(i), end=' ')
elif i <= 5:
print(i_check(i), end=' ')
elif i == 6:
print(' ', i_check(i), end=' ')
elif i <= 9:
print(i_check(i), end=' ')
elif i == 10:
print(f'\n {i_check(i)}', end=' ')
elif i <= 12:
print(i_check(i), end='')
elif i == 13:
print(' ', i_check(i), end=' ')
elif i == 14:
print(i_check(i))
elif i == 15:
print(i_check(i), end=' ')
elif i == 16:
print(i_check(i), end=' ')
elif i <= 18:
print(i_check(i), end=' ')
elif i == 19:
print(f'\n {i_check(i)}', end=' ')
elif i <= 21:
print(i_check(i), end=' ')
elif i == 22:
print(f'\n {i_check(i)}', end=' ')
elif i <= 25:
print(i_check(i), end=' ')
elif i == 26:
print(' ', i_check(i), end='')
elif i <= 27:
print(i_check(i), end=' ')
elif i == 28:
print(i_check(i), end=' ')
elif i <= 30:
print(i_check(i), end=' ')
elif i == 31:
print(' ', i_check(i), end=' ')
elif i <= 33:
print(i_check(i), end=' ')
elif i == 34:
print(' ', i_check(i), end=' ')
elif i <= 36:
print(i_check(i), end='')
elif i <= 37:
print(' ', i_check(i), end='')
elif i <= 38:
print(' ', i_check(i), end='')
elif i == 39:
print(' ', i_check(i), end=' ')
elif i <= 41:
print(i_check(i), end=' ')
elif i == 42:
print(' ', i_check(i), end=' ')
elif i <= 44:
print(i_check(i), end=' ')
elif i == 45:
print(f'\n{i_check(i)}', end=' ')
elif i <= 47:
print(i_check(i), end=' ')
elif i <= 49:
print(' ', i_check(i), end=' ')
elif i == 50:
print(' ', i_check(i), end=' ')
elif i == 51:
print(' ', i_check(i), end=' ')
elif i == 52:
print(i_check(i), end=' ')
elif i == 53:
print(i_check(i), end=' ')
elif i <= 55:
print(i_check(i), end=' ')
elif i == 56:
print(f'\n {i_check(i)}', end=' ')
elif i <= 58:
print(i_check(i), end='')
elif i <= 60:
print(' ', i_check(i), end=' ')
elif i <= 61:
print(' ', i_check(i), end=' ')
elif i <= 62:
print(i_check(i), end=' ')
elif i <= 64:
print(i_check(i), end=' ')
elif i <= 66:
print(i_check(i), end=' ')
elif i <= 67:
print(f'\n {i_check(i)}', end=' ')
elif i <= 69:
print(i_check(i), end='')
elif i <= 71:
print(' ', i_check(i), end=' ')
elif i <= 72:
print(' ', i_check(i), end=' ')
elif i <= 73:
print(i_check(i), end=' ')
elif i <= 74:
print(i_check(i), end=' ')
elif i <= 75:
print(i_check(i), end=' ')
elif i <= 76:
print(i_check(i), end=' ')
elif i <= 77:
print(i_check(i), end=' ')
elif i <= 78:
print(f'\n {i_check(i)}', end=' ')
elif i <= 80:
print(i_check(i), end='')
elif i == 81:
print(' ', i_check(i), end=' ')
elif i <= 83:
print('', i_check(i), end='')
elif i <= 84:
print(' ', i_check(i), end=' ')
elif i <= 86:
print(i_check(i), end='')
elif i <= 87:
print(' ', i_check(i), end=' ')
elif i <= 89:
print(i_check(i), end=' ')
elif i <= 90:
print(' ', i_check(i), end='')
elif i <= 92:
print(i_check(i), end='')
elif i <= 93:
print(' ', i_check(i), end='')
elif i <= 95:
print('', i_check(i), end='')
elif i <= 96:
print(' ', i_check(i), end='')
elif i <= 99:
print(i_check(i), end='')
else:
print(' ', i_check(i))
|
i = 1.0
print(i)
print("Hello world!")
print(type(i))
a = "Hello"
print(type(a))
# print(a+i) <-Error!
a += "world!"
print(a)
print("this is string: {}, {}".format(3, "ala bala"))
print("pi = %f" % 3.14)
|
i = 1.0
print(i)
print('Hello world!')
print(type(i))
a = 'Hello'
print(type(a))
a += 'world!'
print(a)
print('this is string: {}, {}'.format(3, 'ala bala'))
print('pi = %f' % 3.14)
|
MACHINE_A = 'MachineA'
MACHINE_B = 'MachineB'
INIT = 'Init'
E_STOP = 'stop'
E_INCREASE = 'increase'
E_DECREASE = 'decrease'
|
machine_a = 'MachineA'
machine_b = 'MachineB'
init = 'Init'
e_stop = 'stop'
e_increase = 'increase'
e_decrease = 'decrease'
|
#=============================================================================
## Automatic Repository Version Generation Utility
## Author: Zhenyu Wu
## Revision 1: Apr 28. 2016 - Initial Implementation
#=============================================================================
__all__ = [ 'VersionLint' ]
|
__all__ = ['VersionLint']
|
def fun(f): #string
# Some functions need zero or more
# arguements then we have to use
# *args & **kwargs
def wrapper(*args, **kwargs):
print("Start")
#print(string)
# to return the values that are passed
values = f(*args, **kwargs)
print("End")
return values
# return the wrapper function being called use --> ()
#return wrapper()
return wrapper
@fun
def fun2(x):
print("Funtion 2")
return x
@fun
def fun3():
print("Function 3")
### x = fun(fun2)
##fun(fun2)
##print()
##fun(fun3)
##fun2 = fun(fun2)
##fun3 = fun(fun3)
A = fun2('a')
print()
print(A)
print()
fun3()
|
def fun(f):
def wrapper(*args, **kwargs):
print('Start')
values = f(*args, **kwargs)
print('End')
return values
return wrapper
@fun
def fun2(x):
print('Funtion 2')
return x
@fun
def fun3():
print('Function 3')
a = fun2('a')
print()
print(A)
print()
fun3()
|
symbols = [
'TSLA',
'GOOG',
'FB',
'NFLX',
'PFE',
'KO',
'AAPL',
'MSFT',
'DIS',
'UBER',
'AMZN',
'TWTR',
'SBUX',
'F',
'XOM',
'GFINBURO.MX',
'BIMBOA.MX',
'GFNORTEO.MX',
'TLEVISACPO.MX',
'AZTECACPO.MX',
'ALSEA.MX',
'ORBIA.MX',
'POSADASA.MX',
'VOLARA.MX',
'LIVEPOLC-1.MX',
'AEROMEX.MX',
'WALMEX.MX',
'PE&OLES.MX',
'BBVA.MX',
'GAPB.MX',
]
|
symbols = ['TSLA', 'GOOG', 'FB', 'NFLX', 'PFE', 'KO', 'AAPL', 'MSFT', 'DIS', 'UBER', 'AMZN', 'TWTR', 'SBUX', 'F', 'XOM', 'GFINBURO.MX', 'BIMBOA.MX', 'GFNORTEO.MX', 'TLEVISACPO.MX', 'AZTECACPO.MX', 'ALSEA.MX', 'ORBIA.MX', 'POSADASA.MX', 'VOLARA.MX', 'LIVEPOLC-1.MX', 'AEROMEX.MX', 'WALMEX.MX', 'PE&OLES.MX', 'BBVA.MX', 'GAPB.MX']
|
# ADD BINARY LEETCODE SOLUTION:
# creating a class.
class Solution(object):
# creating a function to solve the problem.
def addBinary(self, a, b):
# using the 'bin' function to convert each integer into its binary format.
sum = bin(int(a, 2) + int(b, 2))
# returning the value of the sum, while truncating the '0b' prefix.
return sum[2:]
|
class Solution(object):
def add_binary(self, a, b):
sum = bin(int(a, 2) + int(b, 2))
return sum[2:]
|
mywords = ['Krishna', 'Rameshwar Dass', 'Usha', 'Ramesh']
for w in mywords:
print(w, end='')
#Krishna Rameshwar Dass Usha Ramesh
|
mywords = ['Krishna', 'Rameshwar Dass', 'Usha', 'Ramesh']
for w in mywords:
print(w, end='')
|
#!/usr/bin/env python3
SQL92_reserved = [
"ABSOLUTE", "ACTION", "ADD", "ALL", "ALLOCATE", "ALTER", "AND", "ANY", "ARE", "AS", "ASC", "ASSERTION", "AT", "AUTHORIZATION", "AVG",
"BEGIN", "BETWEEN", "BIT", "BIT_LENGTH", "BOTH", "BY",
"CASCADE", "CASCADED", "CASE", "CAST", "CATALOG", "CHAR", "CHARACTER", "CHAR_LENGTH", "CHARACTER_LENGTH", "CHECK", "CLOSE", "COALESCE", "COLLATE", "COLLATION", "COLUMN", "COMMIT", "CONNECT", "CONNECTION", "CONSTRAINT", "CONSTRAINTS", "CONTINUE", "CONVERT", "CORRESPONDING", "COUNT", "CREATE", "CROSS", "CURRENT", "CURRENT_DATE", "CURRENT_TIME", "CURRENT_TIMESTAMP", "CURRENT_USER", "CURSOR",
"DATE", "DAY", "DEALLOCATE", "DEC", "DECIMAL", "DECLARE", "DEFAULT", "DEFERRABLE", "DEFERRED", "DELETE", "DESC", "DESCRIBE", "DESCRIPTOR", "DIAGNOSTICS", "DISCONNECT", "DISTINCT", "DOMAIN", "DOUBLE", "DROP",
"ELSE", "END", "END-EXEC", "ESCAPE", "EXCEPT", "EXCEPTION", "EXEC", "EXECUTE", "EXISTS", "EXTERNAL", "EXTRACT",
"FALSE", "FETCH", "FIRST", "FLOAT", "FOR", "FOREIGN", "FOUND", "FROM", "FULL",
"GET", "GLOBAL", "GO", "GOTO", "GRANT", "GROUP",
"HAVING", "HOUR",
"IDENTITY", "IMMEDIATE", "IN", "INDICATOR", "INITIALLY", "INNER", "INPUT", "INSENSITIVE", "INSERT", "INT", "INTEGER", "INTERSECT", "INTERVAL", "INTO", "IS", "ISOLATION",
"JOIN",
"KEY",
"LANGUAGE", "LAST", "LEADING", "LEFT", "LEVEL", "LIKE", "LOCAL", "LOWER",
"MATCH", "MAX", "MIN", "MINUTE", "MODULE", "MONTH",
"NAMES", "NATIONAL", "NATURAL", "NCHAR", "NEXT", "NO", "NOT", "NULL", "NULLIF", "NUMERIC",
"OCTET_LENGTH", "OF", "ON", "ONLY", "OPEN", "OPTION", "OR", "ORDER", "OUTER", "OUTPUT", "OVERLAPS",
"PAD", "PARTIAL", "POSITION", "PRECISION", "PREPARE", "PRESERVE", "PRIMARY", "PRIOR", "PRIVILEGES",
"PROCEDURE", "PUBLIC",
"READ", "REAL", "REFERENCES", "RELATIVE", "RESTRICT", "REVOKE", "RIGHT", "ROLLBACK", "ROWS",
"SCHEMA", "SCROLL", "SECOND", "SECTION", "SELECT", "SESSION", "SESSION_USER", "SET", "SIZE", "SMALLINT", "SOME", "SPACE", "SQL", "SQLCODE", "SQLERROR", "SQLSTATE", "SUBSTRING", "SUM", "SYSTEM_USER",
"TABLE", "TEMPORARY", "THEN", "TIME", "TIMESTAMP", "TIMEZONE_HOUR", "TIMEZONE_MINUTE", "TO", "TRAILING", "TRANSACTION", "TRANSLATE", "TRANSLATION", "TRIM", "TRUE",
"UNION", "UNIQUE", "UNKNOWN",
"UPDATE", "UPPER", "USAGE", "USER", "USING",
"VALUE", "VALUES", "VARCHAR", "VARYING", "VIEW",
"WHEN", "WHENEVER", "WHERE", "WITH", "WORK", "WRITE",
"YEAR",
"ZONE",
]
SQL92_non_reserved = [
"ADA",
"C", "CATALOG_NAME", "CHARACTER_SET_CATALOG", "CHARACTER_SET_NAME", "CHARACTER_SET_SCHEMA", "CLASS_ORIGIN", "COBOL", "COLLATION_CATALOG", "COLLATION_NAME", "COLLATION_SCHEMA", "COLUMN_NAME", "COMMAND_FUNCTION", "COMMITTED", "CONDITION_NUMBER", "CONNECTION_NAME", "CONSTRAINT_CATALOG", "CONSTRAINT_NAME", "CONSTRAINT_SCHEMA", "CURSOR_NAME",
"DATA", "DATETIME_INTERVAL_CODE", "DATETIME_INTERVAL_PRECISION", "DYNAMIC_FUNCTION",
"FORTRAN", "LENGTH",
"MESSAGE_LENGTH", "MESSAGE_OCTET_LENGTH", "MESSAGE_TEXT", "MORE", "MUMPS",
"NAME", "NULLABLE", "NUMBER",
"PASCAL", "PLI",
"REPEATABLE", "RETURNED_LENGTH", "RETURNED_OCTET_LENGTH", "RETURNED_SQLSTATE", "ROW_COUNT",
"SCALE", "SCHEMA_NAME", "SERIALIZABLE", "SERVER_NAME", "SUBCLASS_ORIGIN",
"TABLE_NAME", "TYPE",
"UNCOMMITTED", "UNNAMED",
]
if __name__ == '__main__':
print("\t // Reserved Keyword")
for k in SQL92_reserved:
print("\t KEYWORD_{}_TOKEN = \"{}\"".format(k.replace('-', '_'), k))
print("\n")
print("\t // Non Reserved Keyword\n")
for k in SQL92_non_reserved:
print("\t KEYWORD_{}_TOKEN = \"{}\"".format(k.replace('-', '_'), k))
print("\n")
print("---------")
print("\n")
for k in SQL92_reserved:
print("\t \"{}\": KEYWORD_{}_TOKEN,".format(k, k.replace('-', '_')))
print("\n")
print("---------")
print("\n")
for k in SQL92_non_reserved:
print("\t \"{}\": KEYWORD_{}_TOKEN,".format(k, k.replace('-', '_')))
print()
print("\n")
print("---------")
print("\n")
for k in SQL92_reserved:
print("{{\"{}\", token.KEYWORD_{}_TOKEN, \"{}\"}}, ".format(k, k.replace('-', '_'), k))
for k in SQL92_non_reserved:
print("{{\"{}\", token.KEYWORD_{}_TOKEN, \"{}\"}}, ".format(k, k.replace('-', '_'), k))
print()
|
sql92_reserved = ['ABSOLUTE', 'ACTION', 'ADD', 'ALL', 'ALLOCATE', 'ALTER', 'AND', 'ANY', 'ARE', 'AS', 'ASC', 'ASSERTION', 'AT', 'AUTHORIZATION', 'AVG', 'BEGIN', 'BETWEEN', 'BIT', 'BIT_LENGTH', 'BOTH', 'BY', 'CASCADE', 'CASCADED', 'CASE', 'CAST', 'CATALOG', 'CHAR', 'CHARACTER', 'CHAR_LENGTH', 'CHARACTER_LENGTH', 'CHECK', 'CLOSE', 'COALESCE', 'COLLATE', 'COLLATION', 'COLUMN', 'COMMIT', 'CONNECT', 'CONNECTION', 'CONSTRAINT', 'CONSTRAINTS', 'CONTINUE', 'CONVERT', 'CORRESPONDING', 'COUNT', 'CREATE', 'CROSS', 'CURRENT', 'CURRENT_DATE', 'CURRENT_TIME', 'CURRENT_TIMESTAMP', 'CURRENT_USER', 'CURSOR', 'DATE', 'DAY', 'DEALLOCATE', 'DEC', 'DECIMAL', 'DECLARE', 'DEFAULT', 'DEFERRABLE', 'DEFERRED', 'DELETE', 'DESC', 'DESCRIBE', 'DESCRIPTOR', 'DIAGNOSTICS', 'DISCONNECT', 'DISTINCT', 'DOMAIN', 'DOUBLE', 'DROP', 'ELSE', 'END', 'END-EXEC', 'ESCAPE', 'EXCEPT', 'EXCEPTION', 'EXEC', 'EXECUTE', 'EXISTS', 'EXTERNAL', 'EXTRACT', 'FALSE', 'FETCH', 'FIRST', 'FLOAT', 'FOR', 'FOREIGN', 'FOUND', 'FROM', 'FULL', 'GET', 'GLOBAL', 'GO', 'GOTO', 'GRANT', 'GROUP', 'HAVING', 'HOUR', 'IDENTITY', 'IMMEDIATE', 'IN', 'INDICATOR', 'INITIALLY', 'INNER', 'INPUT', 'INSENSITIVE', 'INSERT', 'INT', 'INTEGER', 'INTERSECT', 'INTERVAL', 'INTO', 'IS', 'ISOLATION', 'JOIN', 'KEY', 'LANGUAGE', 'LAST', 'LEADING', 'LEFT', 'LEVEL', 'LIKE', 'LOCAL', 'LOWER', 'MATCH', 'MAX', 'MIN', 'MINUTE', 'MODULE', 'MONTH', 'NAMES', 'NATIONAL', 'NATURAL', 'NCHAR', 'NEXT', 'NO', 'NOT', 'NULL', 'NULLIF', 'NUMERIC', 'OCTET_LENGTH', 'OF', 'ON', 'ONLY', 'OPEN', 'OPTION', 'OR', 'ORDER', 'OUTER', 'OUTPUT', 'OVERLAPS', 'PAD', 'PARTIAL', 'POSITION', 'PRECISION', 'PREPARE', 'PRESERVE', 'PRIMARY', 'PRIOR', 'PRIVILEGES', 'PROCEDURE', 'PUBLIC', 'READ', 'REAL', 'REFERENCES', 'RELATIVE', 'RESTRICT', 'REVOKE', 'RIGHT', 'ROLLBACK', 'ROWS', 'SCHEMA', 'SCROLL', 'SECOND', 'SECTION', 'SELECT', 'SESSION', 'SESSION_USER', 'SET', 'SIZE', 'SMALLINT', 'SOME', 'SPACE', 'SQL', 'SQLCODE', 'SQLERROR', 'SQLSTATE', 'SUBSTRING', 'SUM', 'SYSTEM_USER', 'TABLE', 'TEMPORARY', 'THEN', 'TIME', 'TIMESTAMP', 'TIMEZONE_HOUR', 'TIMEZONE_MINUTE', 'TO', 'TRAILING', 'TRANSACTION', 'TRANSLATE', 'TRANSLATION', 'TRIM', 'TRUE', 'UNION', 'UNIQUE', 'UNKNOWN', 'UPDATE', 'UPPER', 'USAGE', 'USER', 'USING', 'VALUE', 'VALUES', 'VARCHAR', 'VARYING', 'VIEW', 'WHEN', 'WHENEVER', 'WHERE', 'WITH', 'WORK', 'WRITE', 'YEAR', 'ZONE']
sql92_non_reserved = ['ADA', 'C', 'CATALOG_NAME', 'CHARACTER_SET_CATALOG', 'CHARACTER_SET_NAME', 'CHARACTER_SET_SCHEMA', 'CLASS_ORIGIN', 'COBOL', 'COLLATION_CATALOG', 'COLLATION_NAME', 'COLLATION_SCHEMA', 'COLUMN_NAME', 'COMMAND_FUNCTION', 'COMMITTED', 'CONDITION_NUMBER', 'CONNECTION_NAME', 'CONSTRAINT_CATALOG', 'CONSTRAINT_NAME', 'CONSTRAINT_SCHEMA', 'CURSOR_NAME', 'DATA', 'DATETIME_INTERVAL_CODE', 'DATETIME_INTERVAL_PRECISION', 'DYNAMIC_FUNCTION', 'FORTRAN', 'LENGTH', 'MESSAGE_LENGTH', 'MESSAGE_OCTET_LENGTH', 'MESSAGE_TEXT', 'MORE', 'MUMPS', 'NAME', 'NULLABLE', 'NUMBER', 'PASCAL', 'PLI', 'REPEATABLE', 'RETURNED_LENGTH', 'RETURNED_OCTET_LENGTH', 'RETURNED_SQLSTATE', 'ROW_COUNT', 'SCALE', 'SCHEMA_NAME', 'SERIALIZABLE', 'SERVER_NAME', 'SUBCLASS_ORIGIN', 'TABLE_NAME', 'TYPE', 'UNCOMMITTED', 'UNNAMED']
if __name__ == '__main__':
print('\t // Reserved Keyword')
for k in SQL92_reserved:
print('\t KEYWORD_{}_TOKEN = "{}"'.format(k.replace('-', '_'), k))
print('\n')
print('\t // Non Reserved Keyword\n')
for k in SQL92_non_reserved:
print('\t KEYWORD_{}_TOKEN = "{}"'.format(k.replace('-', '_'), k))
print('\n')
print('---------')
print('\n')
for k in SQL92_reserved:
print('\t "{}": KEYWORD_{}_TOKEN,'.format(k, k.replace('-', '_')))
print('\n')
print('---------')
print('\n')
for k in SQL92_non_reserved:
print('\t "{}": KEYWORD_{}_TOKEN,'.format(k, k.replace('-', '_')))
print()
print('\n')
print('---------')
print('\n')
for k in SQL92_reserved:
print('{{"{}", token.KEYWORD_{}_TOKEN, "{}"}}, '.format(k, k.replace('-', '_'), k))
for k in SQL92_non_reserved:
print('{{"{}", token.KEYWORD_{}_TOKEN, "{}"}}, '.format(k, k.replace('-', '_'), k))
print()
|
def can_build(env, platform):
return True
def configure(env):
pass
def is_enabled():
# Disabled by default being experimental at the moment.
# Enable manually with `module_gdscript_transpiler_enabled=yes` option.
return False
|
def can_build(env, platform):
return True
def configure(env):
pass
def is_enabled():
return False
|
class PERIOD:
DAILY = "daily"
WEEKLY = "weekly"
MONTHLY = "monthly"
# Converting BYTES to KB, MB, GB
BYTES_TO_KBYTES = 1024
BYTES_TO_MBYTES = 1048576
BYTES_TO_GBYTES = 1073741824
|
class Period:
daily = 'daily'
weekly = 'weekly'
monthly = 'monthly'
bytes_to_kbytes = 1024
bytes_to_mbytes = 1048576
bytes_to_gbytes = 1073741824
|
class MyClass:
'''This is the docstring for this class'''
def __init__(self):
# setup per-instance variables
self.x = 1
self.y = 2
self.z = 3
class MySecondClass:
'''This is the docstring for this second class'''
def __init__(self):
# setup per-instance variables
self.p = 1
self.d = 2
self.q = 3
|
class Myclass:
"""This is the docstring for this class"""
def __init__(self):
self.x = 1
self.y = 2
self.z = 3
class Mysecondclass:
"""This is the docstring for this second class"""
def __init__(self):
self.p = 1
self.d = 2
self.q = 3
|
# coding: utf8
class InvalidUnitToDXAException(Exception):
def __init__(self, value):
self.value = value
def __str__(self):
return repr(self.value)
class Unit(object):
@classmethod
def to_dxa(cls, val):
if len(val) < 2:
return 0
else:
unit = val[-2:]
val = int(val.rstrip(unit))
if val == 0:
return 0
if unit == 'cm':
return cls.cm_to_dxa(val)
elif unit == 'in':
return cls.in_to_dxa(val)
elif unit == 'pt':
return cls.pt_to_dxa(val)
else:
raise InvalidUnitToDXAException("Unit to DXA should be " +
"Centimeters(cm), " +
"Inches(in) or " +
"Points(pt)")
@classmethod
def pixel_to_emu(cls, pixel):
return int(round(pixel * 12700))
@classmethod
def cm_to_dxa(cls, centimeters):
inches = centimeters / 2.54
points = inches * 72
dxa = points * 20
return dxa
@classmethod
def in_to_dxa(cls, inches):
points = inches * 72
dxa = cls.pt_to_dxa(points)
return dxa
@classmethod
def pt_to_dxa(cls, points):
dxa = points * 20
return dxa
|
class Invalidunittodxaexception(Exception):
def __init__(self, value):
self.value = value
def __str__(self):
return repr(self.value)
class Unit(object):
@classmethod
def to_dxa(cls, val):
if len(val) < 2:
return 0
else:
unit = val[-2:]
val = int(val.rstrip(unit))
if val == 0:
return 0
if unit == 'cm':
return cls.cm_to_dxa(val)
elif unit == 'in':
return cls.in_to_dxa(val)
elif unit == 'pt':
return cls.pt_to_dxa(val)
else:
raise invalid_unit_to_dxa_exception('Unit to DXA should be ' + 'Centimeters(cm), ' + 'Inches(in) or ' + 'Points(pt)')
@classmethod
def pixel_to_emu(cls, pixel):
return int(round(pixel * 12700))
@classmethod
def cm_to_dxa(cls, centimeters):
inches = centimeters / 2.54
points = inches * 72
dxa = points * 20
return dxa
@classmethod
def in_to_dxa(cls, inches):
points = inches * 72
dxa = cls.pt_to_dxa(points)
return dxa
@classmethod
def pt_to_dxa(cls, points):
dxa = points * 20
return dxa
|
def count(word, letter):
count = 0
for i in word:
if i == letter:
count = count + 1
return count
word = input('Enter a word:')
letter = input('Enter a letter to count in word:')
print("There are {} {}'s in your word".format(count(word,letter), letter))
|
def count(word, letter):
count = 0
for i in word:
if i == letter:
count = count + 1
return count
word = input('Enter a word:')
letter = input('Enter a letter to count in word:')
print("There are {} {}'s in your word".format(count(word, letter), letter))
|
class Square:
def __init__(self, side):
self.side = side
def perimeter(self):
return self.side * 4
def area(self):
return self.side ** 2
pass
class Rectangle:
def __init__(self, width, height):
self.width, self.height = width, height
def perimeter(self):
return self.width * 2 + self.height * 2
def area(self):
return self.width * self.height
q = Square(5)
print(q.perimeter())
print(q.area())
r = Rectangle(5, 10)
print(r.perimeter(), r.area())
|
class Square:
def __init__(self, side):
self.side = side
def perimeter(self):
return self.side * 4
def area(self):
return self.side ** 2
pass
class Rectangle:
def __init__(self, width, height):
(self.width, self.height) = (width, height)
def perimeter(self):
return self.width * 2 + self.height * 2
def area(self):
return self.width * self.height
q = square(5)
print(q.perimeter())
print(q.area())
r = rectangle(5, 10)
print(r.perimeter(), r.area())
|
def first_function(values):
''' (list of int) -> NoneType
'''
for i in range(len(values)):
if values[i] % 2 == 1:
values[i] += 1
def second_function(value):
''' (int) -> int
'''
if value % 2 == 1:
value += 1
return value
def snippet_1():
a = [1, 2, 3]
b = 1
first_function(a)
second_function(b)
print(a)
print(b)
# output: (2 MARKS)
# [2, 2, 4]
# 1
# why? second_function(1) will not return 2 if we don't print it.
def snippet_2():
a = [1, 2, 3]
b = 1
print(first_function(a))
print(second_function(b))
# output: (2 MARKS)
# None
# 2
|
def first_function(values):
""" (list of int) -> NoneType
"""
for i in range(len(values)):
if values[i] % 2 == 1:
values[i] += 1
def second_function(value):
""" (int) -> int
"""
if value % 2 == 1:
value += 1
return value
def snippet_1():
a = [1, 2, 3]
b = 1
first_function(a)
second_function(b)
print(a)
print(b)
def snippet_2():
a = [1, 2, 3]
b = 1
print(first_function(a))
print(second_function(b))
|
# -*- coding: utf-8 -*-
vagrant = 'vagrant'
def up():
return '{} up'.format(vagrant)
def ssh():
return '{} ssh'.format(vagrant)
def suspend():
return '{} suspend'.format(vagrant)
def status():
return '{} status'.format(vagrant)
def halt():
return '{} halt'.format(vagrant)
def destroy(force=False):
options = ''
if force:
options += '--force'
return '{} destroy {}'.format(vagrant, options)
def share(**kwargs):
options = ''
name = kwargs.get('name')
if name:
options += '--name {}'.format(name)
if options != '':
options = ' ' + options
return '{} share{}'.format(vagrant, options)
|
vagrant = 'vagrant'
def up():
return '{} up'.format(vagrant)
def ssh():
return '{} ssh'.format(vagrant)
def suspend():
return '{} suspend'.format(vagrant)
def status():
return '{} status'.format(vagrant)
def halt():
return '{} halt'.format(vagrant)
def destroy(force=False):
options = ''
if force:
options += '--force'
return '{} destroy {}'.format(vagrant, options)
def share(**kwargs):
options = ''
name = kwargs.get('name')
if name:
options += '--name {}'.format(name)
if options != '':
options = ' ' + options
return '{} share{}'.format(vagrant, options)
|
def split_block (string:str, seps:(str, str)) -> str:
_, content = string.split (seps[0])
block, _ = content.split (seps[1])
return block
def is_not_empty (value):
return value != ''
def contens_colons (value:str) -> bool:
return value.count(":") == 0
content = ""
with open ("examples/add.asm") as f:
content = f.read()
code, data = [*map (lambda x: split_block (content, x), [(".code", ".endcode"), (".data", ".enddata")])]
code = [*filter (is_not_empty, code.split ('\n'))]
data = [*filter (is_not_empty, data.split ('\n'))]
print (code)
print (data)
instructions = [*filter (contens_colons, code)]
markings = [*filter (lambda x: not contens_colons (x), code)]
there_is_instruction = [*map ( lambda x: len (x.split (":")[1].replace (" ", "")) != 0, markings)]
print (instructions)
print (markings)
print (there_is_instruction)
|
def split_block(string: str, seps: (str, str)) -> str:
(_, content) = string.split(seps[0])
(block, _) = content.split(seps[1])
return block
def is_not_empty(value):
return value != ''
def contens_colons(value: str) -> bool:
return value.count(':') == 0
content = ''
with open('examples/add.asm') as f:
content = f.read()
(code, data) = [*map(lambda x: split_block(content, x), [('.code', '.endcode'), ('.data', '.enddata')])]
code = [*filter(is_not_empty, code.split('\n'))]
data = [*filter(is_not_empty, data.split('\n'))]
print(code)
print(data)
instructions = [*filter(contens_colons, code)]
markings = [*filter(lambda x: not contens_colons(x), code)]
there_is_instruction = [*map(lambda x: len(x.split(':')[1].replace(' ', '')) != 0, markings)]
print(instructions)
print(markings)
print(there_is_instruction)
|
class Solution:
# @return an integer
def threeSumClosest(self, num, target):
num.sort()
res = sum(num[:3])
if res > target:
diff = res-target
elif res < target:
diff = target-res
else:
return res
n = len(num)
for i in xrange(n):
j, k = i+1, n-1
while j < k:
s = num[i]+num[j]+num[k]
if s > target:
n_diff = s-target
k -= 1
elif s < target:
n_diff = target-s
j += 1
else:
return s
if n_diff < diff:
res, diff = s, n_diff
return res
|
class Solution:
def three_sum_closest(self, num, target):
num.sort()
res = sum(num[:3])
if res > target:
diff = res - target
elif res < target:
diff = target - res
else:
return res
n = len(num)
for i in xrange(n):
(j, k) = (i + 1, n - 1)
while j < k:
s = num[i] + num[j] + num[k]
if s > target:
n_diff = s - target
k -= 1
elif s < target:
n_diff = target - s
j += 1
else:
return s
if n_diff < diff:
(res, diff) = (s, n_diff)
return res
|
'''
Prompt:
Given two strings, s1 and s2, write code to check if s2 is a rotation of s1.
(e.g., "waterbottle" is a rotation of "erbottlewat").
Follow up:
What if you could use one call of a helper method isSubstring?
'''
# Time: O(n), Space: O(n)
def isStringRotation(s1, s2):
if len(s1) != len(s2):
return False
strLength = len(s1) or len(s2)
s1Prefix = []
s1Suffix = [c for c in s1]
s2Prefix = [c for c in s2]
s2Suffix = []
for idx in range(strLength):
if s1Suffix == s2Prefix and s1Prefix == s2Suffix:
return True
s1Prefix.append(s1Suffix.pop(0))
s2Suffix.insert(0, s2Prefix.pop())
return False
'''
Follow up:
Notice that if isStringRotation(s1, s2) == True
Let `p` be the prefix of the string and `s` the suffix.
Then s1 can be broken down into s1=`ps` and s2=`sp`
Therefore, notice that s1s1 = `psps`, so s2 must be a substring.
So: return isSubstring(s1+s1, s2)
'''
print(isStringRotation("waterbottle", "erbottlewat"))
print(isStringRotation("waterbottle", "erbottlewqt"))
print(isStringRotation("waterbottle", "eniottlewdt"))
print(isStringRotation("lucas", "sluca"))
print(isStringRotation("lucas", "wluca"))
|
"""
Prompt:
Given two strings, s1 and s2, write code to check if s2 is a rotation of s1.
(e.g., "waterbottle" is a rotation of "erbottlewat").
Follow up:
What if you could use one call of a helper method isSubstring?
"""
def is_string_rotation(s1, s2):
if len(s1) != len(s2):
return False
str_length = len(s1) or len(s2)
s1_prefix = []
s1_suffix = [c for c in s1]
s2_prefix = [c for c in s2]
s2_suffix = []
for idx in range(strLength):
if s1Suffix == s2Prefix and s1Prefix == s2Suffix:
return True
s1Prefix.append(s1Suffix.pop(0))
s2Suffix.insert(0, s2Prefix.pop())
return False
'\nFollow up:\nNotice that if isStringRotation(s1, s2) == True\nLet `p` be the prefix of the string and `s` the suffix.\nThen s1 can be broken down into s1=`ps` and s2=`sp`\n\nTherefore, notice that s1s1 = `psps`, so s2 must be a substring.\nSo: return isSubstring(s1+s1, s2)\n'
print(is_string_rotation('waterbottle', 'erbottlewat'))
print(is_string_rotation('waterbottle', 'erbottlewqt'))
print(is_string_rotation('waterbottle', 'eniottlewdt'))
print(is_string_rotation('lucas', 'sluca'))
print(is_string_rotation('lucas', 'wluca'))
|
# Instantiate Cache information
n = 10
cache = [None] * (n + 1)
def fib_dyn(n):
# Base Case
if n == 0 or n == 1:
return n
# Check cache
if cache[n] != None:
return cache[n]
# Keep setting cache
cache[n] = fib_dyn(n-1) + fib_dyn(n-2)
return cache[n]
fib_dyn(10)
|
n = 10
cache = [None] * (n + 1)
def fib_dyn(n):
if n == 0 or n == 1:
return n
if cache[n] != None:
return cache[n]
cache[n] = fib_dyn(n - 1) + fib_dyn(n - 2)
return cache[n]
fib_dyn(10)
|
# -*- coding: utf-8 -*-
# TODO: datetime support
###
### DO NOT CHANGE THIS FILE
###
### The code is auto generated, your change will be overwritten by
### code generating.
###
DefinitionsNewrun = {'required': ['name'], 'type': 'object', 'properties': {'count': {'type': 'boolean'}, 'prePro': {'type': 'boolean'}, 'fqRegex': {'type': 'string'}, 'star': {'type': 'boolean'}, 'name': {'type': 'string'}, 'fastqc': {'type': 'boolean'}, 'genomeInddex': {'type': 'string'}, 'gtfFile': {'type': 'string'}, 'rnaseqqc': {'type': 'boolean'}, 'fqDirs': {'type': 'string'}, 'sampleNames': {'type': 'string'}, 'fastaRef': {'type': 'string'}, 'extn': {'type': 'string'}, 'fqDir': {'type': 'string'}, 'makeIndices': {'type': 'boolean'}}}
DefinitionsRun = {'required': ['name'], 'type': 'object', 'properties': {'count': {'type': 'boolean'}, 'prePro': {'type': 'boolean'}, 'fqRegex': {'type': 'string'}, 'star': {'type': 'boolean'}, 'name': {'type': 'string'}, 'fastqc': {'type': 'boolean'}, 'genomeInddex': {'type': 'string'}, 'gtfFile': {'type': 'string'}, 'rnaseqqc': {'type': 'boolean'}, 'fqDirs': {'type': 'string'}, 'sampleNames': {'type': 'string'}, 'fastaRef': {'type': 'string'}, 'extn': {'type': 'string'}, 'fqDir': {'type': 'string'}, 'makeIndices': {'type': 'boolean'}}}
DefinitionsErrormodel = {'required': ['code', 'message'], 'type': 'object', 'properties': {'message': {'type': 'string'}, 'code': {'type': 'integer', 'format': 'int32'}}}
validators = {
('runs', 'POST'): {'json': DefinitionsNewrun},
}
filters = {
('runs', 'POST'): {200: {'headers': None, 'schema': DefinitionsRun}},
('runs', 'GET'): {200: {'headers': None, 'schema': {'items': DefinitionsRun, 'type': 'array'}}},
}
scopes = {
}
class Security(object):
def __init__(self):
super(Security, self).__init__()
self._loader = lambda: []
@property
def scopes(self):
return self._loader()
def scopes_loader(self, func):
self._loader = func
return func
security = Security()
def merge_default(schema, value):
# TODO: more types support
type_defaults = {
'integer': 9573,
'string': 'something',
'object': {},
'array': [],
'boolean': False
}
return normalize(schema, value, type_defaults)[0]
def normalize(schema, data, required_defaults=None):
if required_defaults is None:
required_defaults = {}
errors = []
class DataWrapper(object):
def __init__(self, data):
super(DataWrapper, self).__init__()
self.data = data
def get(self, key, default=None):
if isinstance(self.data, dict):
return self.data.get(key, default)
if hasattr(self.data, key):
return getattr(self.data, key)
else:
return default
def has(self, key):
if isinstance(self.data, dict):
return key in self.data
return hasattr(self.data, key)
def _normalize_dict(schema, data):
result = {}
data = DataWrapper(data)
for key, _schema in schema.get('properties', {}).iteritems():
# set default
type_ = _schema.get('type', 'object')
if ('default' not in _schema
and key in schema.get('required', [])
and type_ in required_defaults):
_schema['default'] = required_defaults[type_]
# get value
if data.has(key):
result[key] = _normalize(_schema, data.get(key))
elif 'default' in _schema:
result[key] = _schema['default']
elif key in schema.get('required', []):
errors.append(dict(name='property_missing',
message='`%s` is required' % key))
return result
def _normalize_list(schema, data):
result = []
if isinstance(data, (list, tuple)):
for item in data:
result.append(_normalize(schema.get('items'), item))
elif 'default' in schema:
result = schema['default']
return result
def _normalize_default(schema, data):
if data is None:
return schema.get('default')
else:
return data
def _normalize(schema, data):
if not schema:
return None
funcs = {
'object': _normalize_dict,
'array': _normalize_list,
'default': _normalize_default,
}
type_ = schema.get('type', 'object')
if not type_ in funcs:
type_ = 'default'
return funcs[type_](schema, data)
return _normalize(schema, data), errors
|
definitions_newrun = {'required': ['name'], 'type': 'object', 'properties': {'count': {'type': 'boolean'}, 'prePro': {'type': 'boolean'}, 'fqRegex': {'type': 'string'}, 'star': {'type': 'boolean'}, 'name': {'type': 'string'}, 'fastqc': {'type': 'boolean'}, 'genomeInddex': {'type': 'string'}, 'gtfFile': {'type': 'string'}, 'rnaseqqc': {'type': 'boolean'}, 'fqDirs': {'type': 'string'}, 'sampleNames': {'type': 'string'}, 'fastaRef': {'type': 'string'}, 'extn': {'type': 'string'}, 'fqDir': {'type': 'string'}, 'makeIndices': {'type': 'boolean'}}}
definitions_run = {'required': ['name'], 'type': 'object', 'properties': {'count': {'type': 'boolean'}, 'prePro': {'type': 'boolean'}, 'fqRegex': {'type': 'string'}, 'star': {'type': 'boolean'}, 'name': {'type': 'string'}, 'fastqc': {'type': 'boolean'}, 'genomeInddex': {'type': 'string'}, 'gtfFile': {'type': 'string'}, 'rnaseqqc': {'type': 'boolean'}, 'fqDirs': {'type': 'string'}, 'sampleNames': {'type': 'string'}, 'fastaRef': {'type': 'string'}, 'extn': {'type': 'string'}, 'fqDir': {'type': 'string'}, 'makeIndices': {'type': 'boolean'}}}
definitions_errormodel = {'required': ['code', 'message'], 'type': 'object', 'properties': {'message': {'type': 'string'}, 'code': {'type': 'integer', 'format': 'int32'}}}
validators = {('runs', 'POST'): {'json': DefinitionsNewrun}}
filters = {('runs', 'POST'): {200: {'headers': None, 'schema': DefinitionsRun}}, ('runs', 'GET'): {200: {'headers': None, 'schema': {'items': DefinitionsRun, 'type': 'array'}}}}
scopes = {}
class Security(object):
def __init__(self):
super(Security, self).__init__()
self._loader = lambda : []
@property
def scopes(self):
return self._loader()
def scopes_loader(self, func):
self._loader = func
return func
security = security()
def merge_default(schema, value):
type_defaults = {'integer': 9573, 'string': 'something', 'object': {}, 'array': [], 'boolean': False}
return normalize(schema, value, type_defaults)[0]
def normalize(schema, data, required_defaults=None):
if required_defaults is None:
required_defaults = {}
errors = []
class Datawrapper(object):
def __init__(self, data):
super(DataWrapper, self).__init__()
self.data = data
def get(self, key, default=None):
if isinstance(self.data, dict):
return self.data.get(key, default)
if hasattr(self.data, key):
return getattr(self.data, key)
else:
return default
def has(self, key):
if isinstance(self.data, dict):
return key in self.data
return hasattr(self.data, key)
def _normalize_dict(schema, data):
result = {}
data = data_wrapper(data)
for (key, _schema) in schema.get('properties', {}).iteritems():
type_ = _schema.get('type', 'object')
if 'default' not in _schema and key in schema.get('required', []) and (type_ in required_defaults):
_schema['default'] = required_defaults[type_]
if data.has(key):
result[key] = _normalize(_schema, data.get(key))
elif 'default' in _schema:
result[key] = _schema['default']
elif key in schema.get('required', []):
errors.append(dict(name='property_missing', message='`%s` is required' % key))
return result
def _normalize_list(schema, data):
result = []
if isinstance(data, (list, tuple)):
for item in data:
result.append(_normalize(schema.get('items'), item))
elif 'default' in schema:
result = schema['default']
return result
def _normalize_default(schema, data):
if data is None:
return schema.get('default')
else:
return data
def _normalize(schema, data):
if not schema:
return None
funcs = {'object': _normalize_dict, 'array': _normalize_list, 'default': _normalize_default}
type_ = schema.get('type', 'object')
if not type_ in funcs:
type_ = 'default'
return funcs[type_](schema, data)
return (_normalize(schema, data), errors)
|
class Callback(object):
def __init__(self, fire_rate=1.0, fire_interval=None):
self.FireRate = fire_rate
self.NextFire = self.FireInterval = fire_interval
self.FireLevel = 0.0
self.FireCount = 0
def __call__(self, event, *params, **args):
self.FireCount += 1
self.FireLevel += self.FireRate
if self.FireInterval is not None and self.FireCount < self.NextFire:
return
if self.FireLevel < 1.0:
return
if hasattr(self, event):
getattr(self, event)(*params, **args)
self.FireLevel -= 1.0
if self.FireInterval is not None:
self.NextFire += self.FireInterval
class CallbackList(object):
#
# Sends event data to list of Callback objects and to list of callback functions
#
def __init__(self, *callbacks):
self.Callbacks = list(callbacks)
def add(self, *callbacks):
self.Callbacks += list(callbacks)
def __call__(self, event, *params, **args):
for cb in self.Callbacks:
cb(event, *params, **args)
@staticmethod
def convert(arg):
if isinstance(arg, CallbackList):
return arg
elif isinstance(arg, (list, tuple)):
return CallbackList(*arg)
elif arg is None:
return CallbackList() # empty
else:
raise ValueError("Can not convert %s to CallbackList" % (arg,))
|
class Callback(object):
def __init__(self, fire_rate=1.0, fire_interval=None):
self.FireRate = fire_rate
self.NextFire = self.FireInterval = fire_interval
self.FireLevel = 0.0
self.FireCount = 0
def __call__(self, event, *params, **args):
self.FireCount += 1
self.FireLevel += self.FireRate
if self.FireInterval is not None and self.FireCount < self.NextFire:
return
if self.FireLevel < 1.0:
return
if hasattr(self, event):
getattr(self, event)(*params, **args)
self.FireLevel -= 1.0
if self.FireInterval is not None:
self.NextFire += self.FireInterval
class Callbacklist(object):
def __init__(self, *callbacks):
self.Callbacks = list(callbacks)
def add(self, *callbacks):
self.Callbacks += list(callbacks)
def __call__(self, event, *params, **args):
for cb in self.Callbacks:
cb(event, *params, **args)
@staticmethod
def convert(arg):
if isinstance(arg, CallbackList):
return arg
elif isinstance(arg, (list, tuple)):
return callback_list(*arg)
elif arg is None:
return callback_list()
else:
raise value_error('Can not convert %s to CallbackList' % (arg,))
|
class A(Exception):
def __init__(s, err, *args):
s.err = err
s.d = 2323
@property
def message(s):
return 'kawabunga'
def __str__(s):
return s.message
class B(A):
pass
try:
raise A('hh', 89)
except B as e:
print(1)
|
class A(Exception):
def __init__(s, err, *args):
s.err = err
s.d = 2323
@property
def message(s):
return 'kawabunga'
def __str__(s):
return s.message
class B(A):
pass
try:
raise a('hh', 89)
except B as e:
print(1)
|
string = input()
for i in range(len(string)):
emoticon = ''
if string[i] == ':':
emoticon += string[i] + string[i + 1]
print(emoticon)
|
string = input()
for i in range(len(string)):
emoticon = ''
if string[i] == ':':
emoticon += string[i] + string[i + 1]
print(emoticon)
|
# -*- encoding: utf-8 -*-
#######################################################################################################################
# DESCRIPTION:
#######################################################################################################################
# TODO
#######################################################################################################################
# AUTHORS:
#######################################################################################################################
# Carlos Serrada, 13-11347, <[email protected]>
# Juan Ortiz, 13-11021 <[email protected]>
#######################################################################################################################
# CLASS DECLARATION:
#######################################################################################################################
class CNF:
def __init__(self):
self.clauses = []
self.variables = []
self.map = {}
def add(self, clause):
for term in clause.terms:
name = term.name
if not (name in self.map):
self.map[name] = len(self.variables)
self.variables.append(name)
self.clauses.append(clause)
def __str__(self):
header = "p cnf " + str(len(self.variables)) + " " + str(len(self.clauses)) + "\n"
cnf = ""
for clause in self.clauses:
for term in clause.terms:
cnf += ("-" if term.negative else "") + str(self.map[term.name] + 1) + " "
cnf += "0\n"
return header + cnf
def parse(self, file_path):
variables = []
with open(file_path) as file:
for index, line in enumerate(file):
if index == 1:
variables = [x > 0 for x in list(map(int, line.split(' ')))[:-1]]
return variables
def solve(self, file_path):
values = self.parse(file_path)
solution = {}
for i in range(len(values)):
solution[self.variables[i]] = values[i]
return solution
#######################################################################################################################
# :)
#######################################################################################################################
|
class Cnf:
def __init__(self):
self.clauses = []
self.variables = []
self.map = {}
def add(self, clause):
for term in clause.terms:
name = term.name
if not name in self.map:
self.map[name] = len(self.variables)
self.variables.append(name)
self.clauses.append(clause)
def __str__(self):
header = 'p cnf ' + str(len(self.variables)) + ' ' + str(len(self.clauses)) + '\n'
cnf = ''
for clause in self.clauses:
for term in clause.terms:
cnf += ('-' if term.negative else '') + str(self.map[term.name] + 1) + ' '
cnf += '0\n'
return header + cnf
def parse(self, file_path):
variables = []
with open(file_path) as file:
for (index, line) in enumerate(file):
if index == 1:
variables = [x > 0 for x in list(map(int, line.split(' ')))[:-1]]
return variables
def solve(self, file_path):
values = self.parse(file_path)
solution = {}
for i in range(len(values)):
solution[self.variables[i]] = values[i]
return solution
|
'''
For a string sequence, a string word is k-repeating if word
concatenated k times is a substring of sequence. The word's
maximum k-repeating value is the highest value k where word
is k-repeating in sequence. If word is not a substring of
sequence, word's maximum k-repeating value is 0.
Given strings sequence and word, return the maximum
k-repeating value of word in sequence.
Example:
Input: sequence = "ababc", word = "ab"
Output: 2
Explanation: "abab" is a substring in "ababc".
Example:
Input: sequence = "ababc", word = "ba"
Output: 1
Explanation: "ba" is a substring in "ababc". "baba" is not
a substring in "ababc".
Example:
Input: sequence = "ababc", word = "ac"
Output: 0
Explanation: "ac" is not a substring in "ababc".
Constraints:
- 1 <= sequence.length <= 100
- 1 <= word.length <= 100
- sequence and word contains only lowercase English
letters.
'''
#Difficulty: Easy
#211 / 211 test cases passed.
#Runtime: 24 ms
#Memory Usage: 14.2 MB
#Runtime: 24 ms, faster than 96.10% of Python3 online submissions for Maximum Repeating Substring.
#Memory Usage: 14.2 MB, less than 75.28% of Python3 online submissions for Maximum Repeating Substring.
class Solution:
def maxRepeating(self, sequence: str, word: str) -> int:
x = 1
while word*x in sequence:
x += 1
return x-1
|
"""
For a string sequence, a string word is k-repeating if word
concatenated k times is a substring of sequence. The word's
maximum k-repeating value is the highest value k where word
is k-repeating in sequence. If word is not a substring of
sequence, word's maximum k-repeating value is 0.
Given strings sequence and word, return the maximum
k-repeating value of word in sequence.
Example:
Input: sequence = "ababc", word = "ab"
Output: 2
Explanation: "abab" is a substring in "ababc".
Example:
Input: sequence = "ababc", word = "ba"
Output: 1
Explanation: "ba" is a substring in "ababc". "baba" is not
a substring in "ababc".
Example:
Input: sequence = "ababc", word = "ac"
Output: 0
Explanation: "ac" is not a substring in "ababc".
Constraints:
- 1 <= sequence.length <= 100
- 1 <= word.length <= 100
- sequence and word contains only lowercase English
letters.
"""
class Solution:
def max_repeating(self, sequence: str, word: str) -> int:
x = 1
while word * x in sequence:
x += 1
return x - 1
|
altPulo, qntdCano = map(int, input().split())
canos = list(map(int, input().split()))
atual = canos.pop(0)
for cano in canos:
if max([cano, atual]) - min([cano, atual]) > altPulo:
print('GAME OVER')
quit()
atual = cano
print('YOU WIN')
|
(alt_pulo, qntd_cano) = map(int, input().split())
canos = list(map(int, input().split()))
atual = canos.pop(0)
for cano in canos:
if max([cano, atual]) - min([cano, atual]) > altPulo:
print('GAME OVER')
quit()
atual = cano
print('YOU WIN')
|
# this graph to check the algorithm
graph={
'S':['B','D','A'],
'A':['C'],
'B':['D'],
'C':['G','D'],
'S':['G'],
}
#function of BFS
def BFS(graph,start,goal):
Visited=[]
queue=[[start]]
while queue:
path=queue.pop(0)
node=path[-1]
if node in Visited:
continue
Visited.append(node)
if node==goal:
return path
else:
adjecent_nodes=graph.get(node,[])
for node2 in adjecent_nodes:
new_path=path.copy()
new_path.append(node2)
queue.append(new_path)
Solution=BFS(graph,'S','G')
print('Solution is ',Solution)
|
graph = {'S': ['B', 'D', 'A'], 'A': ['C'], 'B': ['D'], 'C': ['G', 'D'], 'S': ['G']}
def bfs(graph, start, goal):
visited = []
queue = [[start]]
while queue:
path = queue.pop(0)
node = path[-1]
if node in Visited:
continue
Visited.append(node)
if node == goal:
return path
else:
adjecent_nodes = graph.get(node, [])
for node2 in adjecent_nodes:
new_path = path.copy()
new_path.append(node2)
queue.append(new_path)
solution = bfs(graph, 'S', 'G')
print('Solution is ', Solution)
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.