text
stringlengths 297
230k
| title
stringlengths 4
145
| cui
stringlengths 4
10
| idx
int64 0
30.7k
| source
stringclasses 6
values | source_url
stringlengths 33
155
| retrieved_date
timestamp[s] | classification_map
stringlengths 2
1.45k
|
|---|---|---|---|---|---|---|---|
A number sign (#) is used with this entry because of evidence that Leri-Weill dyschondrosteosis (LWD) is caused by heterozygous defects in the pseudoautosomal genes SHOX (312865) or SHOXY (400020) or by deletion of the SHOX downstream regulatory domain.
Because the mutation occurs in the pseudoautosomal region of the sex chromosomes, the inheritance of this disorder follows an autosomal (pseudoautosomal) dominant pattern.
Description
Leri-Weill dyschondrosteosis (LWD) is a dominantly inherited skeletal dysplasia characterized by short stature, mesomelia, and Madelung wrist deformity. Although the disorder occurs in both sexes, it is usually more severe in females, perhaps due to sex difference in estrogen levels. However, pubertal development and fertility are generally normal in both sexes with the disorder (summary by Ross et al., 2005). The Madelung wrist deformity includes deformity of the distal radius and ulna and proximal carpal bones (Langer, 1965).
See also Langer mesomelic dysplasia (LMD; 249700), a more severe phenotype that results from homozygous defect in the SHOX or SHOXY genes.
Clinical Features
The disorder was first described by Leri and Weill (1929). Lamy and Bienenfeld (1954) described affected mother and son. The fibula was absent in both.
Langer (1965) reported 3 families. The deformity of the forearm consists of bowing of the radius and dorsal dislocation of the distal ulna, resulting in limited motion at the elbow and wrist. Rullier et al. (1968) observed dyschondrosteosis in mother and 2 daughters. Nassif and Harboyan (1970) described 2 brothers with Leri dyschondrosteosis, who also had middle ear deformities and conductive hearing loss. Three sisters had the skeletal deformity with normal hearing.
Dawe et al. (1982) reviewed 13 patients with dyschondrosteosis from 8 families. Stature was moderately reduced due to shortening of the bones of the leg. Radioulnar shortening could involve either both bones equally or the radius predominantly, in which case a typical Madelung deformity was seen. Tibiofibular disproportion was present in half the patients, 2 of them having severe deformity associated with tibia varum and a long fibula. The authors recommended that patients with dyschondrosteosis be kept under surveillance during the growing period, since problems in the limbs, especially the legs, may require operations to equalize the length of the 2 bones.
Ross et al. (2001) studied 21 LWD families (43 affected LWD subjects, including 32 females and 11 males, aged 3 to 56 years) with confirmed SHOX gene abnormalities. In the LWD subjects, height deficits ranged from -4.6 to +0.6 SD (mean +/- SD = -2.2 +/- 1.0). There were no statistically significant effects on age, gender, pubertal status, or parental origin of SHOX mutations on height z-score. The height deficit in LWD was approximately two-thirds that of Turner syndrome. Madelung deformity was present in 74% of LWD children and adults and was more frequent and severe in females than males. The prevalence of Madelung deformity was higher in the LWD versus a Turner syndrome population. The prevalence of increased carrying angle, high-arched palate, and scoliosis was similar in the 2 populations. SHOX deletions were present in affected individuals from 17 families (81%), and point mutations were detected in 4 families (19%).
Among 34 prepubertal genetically confirmed patients with LWD (ages 1 to 10), including 20 girls and 14 boys, Ross et al. (2005) found a decreased height SD score (SDS) compared to controls for both sexes (-2.3 for girls and -1.8 for boys). Arm spans were also decreased (SDS -3.2 for girls and -2.3 for boys), indicating early development of mesomelia in the arms. Tibial bowing was seen in 8 (40%) of 20 girls and 4 (29%) of 14 boys. Wrist changes related to Madelung deformity were present in 18 (53%) of 34 LWD individuals. Bone age was not significantly decreased in either girls or boys. A separate comparison of 24 girls with LWD aged 1 to 15 years and 76 girls with Turner syndrome showed similar mean height deficits (SDS -2.7 for both groups). This suggested that SHOX haploinsufficiency is responsible for most of the height deficit observed in Turner syndrome. There was evidence for mesomelia in the LWD group, which was not present in the Turner group. Overall, Madelung deformity, increased carrying angle, tibial bowing, and scoliosis were more prevalent in the LWD population, whereas high arched-palate was similarly prevalent in both LWD and Turner syndrome. Ross et al. (2005) concluded that short stature is common in both LWD girls and boys before puberty, and Turner syndrome girls. Clinical clues to the diagnosis of SHOX haploinsufficiency in childhood thus include short stature, short limbs, wrist changes, and tibial bowing. None of the patients had been treated with growth hormone, and some of the patients had previously been reported (Ross et al., 2001).
### Madelung Deformity
A complete review of Madelung deformity was provided by Anton et al. (1938). Langer (1965) suggested that most of all cases of Madelung deformity indicate dyschondrosteosis. In a review, however, Felman and Kirkpatrick (1969) concluded that patients taller than the 25th percentile for height probably do not have dyschondrosteosis, that a hereditary entity of Madelung deformity distinct from dyschondrosteosis exists, that patients with the isolated Madelung deformity may be short, and that marked shortening of the tibia relative to the femur suggests dyschondrosteosis.
Inheritance
Goepp et al. (1978) traced LWS through 5 generations and observed male-to-male transmission in 14 instances. In all, 34 persons were affected.
Lichtenstein et al. (1980) reported male-to-male transmission. They commented that females showed dyschondrosteosis and Madelung deformity; males showed only the latter. Dawe et al. (1982) reviewed 13 patients with dyschondrosteosis from 8 families and concluded that inheritance is likely to be autosomal dominant, but with only 50% penetrance. Jackson (1985) traced this disorder through 6 generations of a family, with 39 affected persons and 12 instances of male-to-male transmission. Several members belied the impression that females are always more severely affected than males. He suggested that the disorder is more frequent than generally realized and that an abnormally low ratio of forearm to upper arm length may be a valuable diagnostic clue.
Fryns and Van den Berghe (1979) presented a male newborn with the typical Langer type of mesomelic dwarfism (249700). The finding of a variable degree of Madelung deformity and mesomelic shortening in both parents and in the maternal family supported the hypothesis that this type of mesomelic dwarfism may be the clinical manifestation of a homozygous state for dyschondrosteosis.
Roubicek et al. (2003) suggested that since the SHOX gene is located in the pseudoautosomal region of the sex chromosomes, the correct term for the type of hereditary transmission of the associated phenotype should be a 'pseudoautosomal dominant,' 'sex chromosomal dominant,' or 'gonosomal dominant' form of mesomelic dysplasia. They stated that the genetics literature should be corrected accordingly.
Molecular Genetics
Leri-Weill dyschondrosteosis can be defined genetically by haploinsufficiency of the SHOX gene. Belin et al. (1998) and Shears et al. (1998) showed that Leri-Weill dyschondrosteosis is linked to DNA markers in the pseudoautosomal region (PAR1) on the X and Y chromosomes. In patients with the disorder, mutations were identified in the SHOX gene (312865.0002-312865.0003). Belin et al. (1998) demonstrated homozygous absence of the SHOX gene in a fetus with Langer-type mesomelic dysplasia (249700), which had previously been postulated to be the homozygous form of Leri-Weill dyschondrosteosis.
Grigelioniene et al. (2000) performed mutation analysis of the coding region of the SHOX gene in 5 LWD patients and identified 3 novel mutations (312865.0004-312865.0006), including 2 missense mutations.
Huber et al. (2001) studied 8 families with dyschondrosteosis and found point mutations in the SHOX gene in 5 families and deletions in 3 (see, e.g., 312865.0007). Combined with the results of their previous work (Belin et al., 1998), 10 of 16 families with this phenotype had deletions of the SHOX gene, while 6 of 16 had point mutations.
Ross et al. (2003) studied 2 children with combined genetic skeletal disorders. A brother and sister with LWD due to heterozygosity for deletion in the SHOX gene and possible heterozygosity for another SHOX mutation were married to, respectively, a woman with achondroplasia due to the G380R mutation in FGFR3 (134934.0001) and a man with hypochondroplasia due to the N540K mutation in the FGFR3 gene (134934.0010). All 4 of their children had LWD. The woman had a son who was heterozygous for the SHOX deletion and a daughter who was a double heterozygote for the SHOX deletion and the N540K achondroplasia mutation. This child had both mesomelic and rhizomelic short stature. The man had a daughter who was a double heterozygote for the hypochondroplasia G380R mutation and a presumed mutation in the SHOX gene. She likewise had both mesomelic and rhizomelic short stature.
In affected individuals with LWD or LMD from 12 Spanish multiplex families, 2 of which had previously been studied (Sabherwal et al. (2004, 2004)), Barca-Tierno et al. (2011) identified heterozygosity or homozygosity, respectively, for an A170P mutation (312865.0014) in the SHOX gene. In all families, A170P cosegregated with the fully penetrant phenotype of mesomelic limb shortening and Madelung deformity. Microsatellite analysis revealed a shared haplotype around SHOX, confirming the presence of a common ancestor, probably of Gypsy origin, as 11 of the 12 families were of that ethnic group. Another mutation at the same location, A170D (312865.0015), was identified in 2 unrelated non-Gypsy Spanish families with LWD.
### Deletions of the SHOX Downstream Regulatory Domain
Sabherwal et al. (2007) analyzed the DNA of 122 patients with clinical manifestations of LWD, and identified an intragenic mutation in 17 and deletion of the entire gene in 47; further screening identified 4 families with an intact SHOX coding region who had microdeletions in the 3-prime pseudoautosomal region, with a common deletion interval of approximately 200 kb that segregated with disease in each family. Comparative genetic analysis revealed 8 highly conserved noncoding DNA elements (CNE2 to CNE9) within this interval, located between 48 and 215 kb downstream of the SHOX gene, and functional analysis showed that CNE4, CNE5, and CNE9 had cis-regulatory activity in the developing limbs of chicken embryos. Sabherwal et al. (2007) stated that their findings indicated that the deleted region in the affected families contains several distinct elements that regulate SHOX expression in the developing limb, and noted that deletion of these elements in humans with both SHOX genes intact generates a phenotype apparently indistinguishable from that of patients with mutations in the SHOX coding region.
Chen et al. (2009) analyzed copy number variation in the pseudoautosomal region of the sex chromosomes in 735 individuals with idiopathic short stature (ISS) and in 58 patients with Leri-Weill syndrome. They identified 31 microdeletions in the pseudoautosomal region in ISS patients, 8 of which involved only enhancer CNEs (CNE7, CNE8, and CNE9) residing at least 150 kb centromeric to the SHOX gene. In the Leri-Weill patients, 29 microdeletions were identified, 13 of which involved CNEs and left the SHOX gene intact. These deletions were not found in 100 controls. Chen et al. (2009) concluded that enhancer deletions in the SHOX downstream region are a relatively frequent cause of growth failure in patients with idiopathic short stature and Leri-Weill syndrome.
Benito-Sanz et al. (2012) identified a recurrent 47.5-kb deletion in the pseudoautosomal region 1 (PAR1) downstream of the SHOX gene (312865.0016) in 19 of 124 probands with Leri-Weill dyschondrosteosis (15.3%) and 11 of 576 probands with idiopathic short stature (300582) (1.9%). The deletion did not include any of the SHOX enhancer elements known at that time. Conservation analysis of the deleted region followed by chromosome conformation capture and luciferase reporter assays demonstrated the presence of an evolutionarily conserved region (ECR1) that acted as a novel orientation- and position-independent SHOX enhancer.
Cytogenetics
Calabrese et al. (1999) described an X/Y translocation as the apparent basis of Leri-Weill dyschondrosteosis in a boy and his mother. FISH analysis with specific probes for SHOX and SRY (480000) displayed no signal on the derivative X, while one signal for SHOX was detected on the normal X chromosome in the mother and one signal each for SHOX and SRY was detected on the normal Y chromosome in the proband. The boy was first evaluated at the age of 7 years because of skeletal dysplasia. He showed short lower limbs. Radiologic studies showed enlargement of the ulna and radius and bowing of the knees. One year later, bowing of the radius and distal ulnar dislocation was found. The 34-year-old mother had short stature (150 cm), bowing of the radius, and bilateral subluxation of the distal ulna.
Stuppia et al. (1999) reported a phenotypically male child with a 45,X karyotype who had dyschondrosteosis. FISH analysis with SHOX and SRY probes detected hemizygosity for SHOX and the presence of SRY on Xp. Molecular analysis suggested that the 45,X karyotype arose as a result of unequal crossing-over at paternal meiosis, translocating SRY onto Xp, and a separate event at maternal meiosis or in the early stages of zygote formation leading to the loss of the maternal X chromosome.
Genotype/Phenotype Correlations
Schiller et al. (2000) studied 32 patients with Leri-Weill dyschondrosteosis from 18 different German and Dutch families and presented clinical, radiologic, and molecular data. Phenotypic manifestations were generally more severe in females. In males, muscular hypertrophy was a frequent finding. The authors identified submicroscopic deletions encompassing the SHOX gene in 10 of 18 families investigated; deletion sizes varied between 100 kb and 9 Mb and did not correlate with the severity of the phenotype. Schiller et al. (2000) did not detect SHOX mutations in almost half (41%) of the LWD families studied.
Benito-Sanz et al. (2005) identified 12 LWD patients who presented with a novel class of PAR1 deletions that did not include the SHOX gene. No apparent phenotypic differences were observed between patients with SHOX deletions and those with this new class of PAR1 deletions. The findings indicated the presence of distal regulatory elements of SHOX transcription in PAR1 or, alternatively, the existence of an additional locus apparently involved in the control of skeletal development.
Diagnosis
Ogata et al. (2001) reviewed the clinical features and diagnostic and therapeutic implications of SHOX haploinsufficiency and overdosage. They suggested that identification of Madelung deformity is important in the clinical diagnosis of SHOX haploinsufficiency and that gonadal suppression therapy may mitigate the clinical features, including mesomelic short stature. Ogata et al. (2001) also suggested that SHOX overdosage leads to long limbs and tall stature resulting from continued growth into late teens in individuals with gonadal dysgenesis. Thus, tall stature with poor pubertal development is suggestive of SHOX overdosage and may be ameliorated by estrogen therapy. Ogata et al. (2001) concluded that studies to that time indicated that SHOX functions as a repressor of growth plate fusion and skeletal maturation in the distal limbs, counteracting the effects of estrogens.
In a study of 140 children with idiopathic short stature, Binder et al. (2003) sought to determine the prevalence of SHOX mutations and to give an unbiased characterization of the haploinsufficiency phenotype of such children. SHOX haploinsufficiency caused by a SHOX deletion was confirmed in 3 probands (2%), all females, who carried a de novo deletion through loss of the paternal allele. Their auxologic data revealed a significant shortening of arms and legs in the presence of a low-normal sitting height when compared with the other 137 children tested. Therefore, the extremities-trunk ratio (sum of leg length and arm span, divided by sitting height) for total height was significantly lower in the 3 SHOX haploinsufficient probands in comparison with the whole group. All children with SHOX haploinsufficiency exhibited at least 1 characteristic radiologic sign of Leri-Weill dyschondrosteosis in their left-hand radiography, namely, triangularization of the distal radial epiphysis, pyramidalization of the distal carpal row, or lucency of the distal ulnar border of the radius. Binder et al. (2003) concluded that it is rational to limit SHOX mutation screening to children with an extremities-trunk ratio less than 1.95 +/- 0.5 height (m) and to add a critical judgment of the hand radiography.
For the identification and characterization of SHOX deletions in 15 patients with Leri-Weill dyschondrosteosis, Gatta et al. (2007) used multiple ligation probe amplification (MLPA) assay. Heterozygous deletion of SHOX was demonstrated in 7 patients, and 2 different proximal breakpoints were disclosed. In 3 of the patients who carried chromosome abnormalities, MLPA analysis identified the chromosomal rearrangement, showing, in addition to the SHOX deletions, the gain or loss of other genes mapped on the X and Y chromosomes. Gatta et al. (2007) pointed out that the MLPA analysis can be carried out on a buccal swab, and that this technique represents a fast, simple, and high throughput approach in the screening of SHOX deletions. It may provide more information than FISH or microsatellite analysis of intragenic CA repeats.
History
### Exclusion Mapping
Lisker et al. (1972) found a Mexican family with dyschondrosteosis informative for Rhesus and haptoglobin. However, no indication of close linkage was provided.
Ventruto et al. (1983) described a syndrome of skeletal dysplasia in 2 generations of a family. The affected persons had a balanced t(2;8)(q32;p23) translocation that was not found in 2 skeletally normal sibs. The affected persons were of normal intelligence. The proposita had short forearms with a short, bowed radius, cubitus valgus with limited motion at the elbows, fusion of C1 and C2 vertebrae, and other skeletal anomalies. Many of the features suggested dyschondrosteosis. Whatever the precise diagnosis, the findings implicated one of the breakpoints as causative (Hecht and Hecht, 1984). In a Thai family with an autosomal dominant skeletal dysplasia with similarities to dyschondrosteosis, referred to as the Kantaputra type of mesomelic dysplasia (MDK; 156232), Fujimoto et al. (1998) demonstrated linkage to markers in the 2q24-q32 region. They were prompted to study this region because of similarities of the phenotype in the Thai family to that in the family reported by Ventruto et al. (1983).
Gokhale et al. (1995) described a family in which 2 sisters with Leri-Weill dyschondrosteosis developed Hodgkin disease (236000) in late adolescence. Using HLA molecular typing, both sisters were found to have inherited a variant of the Hodgkin disease susceptibility allele, DPB1*0301, known as DPB1*2001. Because of the report by Ventruto et al. (1983) of a constitutional balanced reciprocal translocation between chromosomes 2 and 8 in LWD, Gokhale et al. (1995) conducted linkage studies of these 2 regions and excluded them as the site of the LWD gene in this family. A second cousin once removed of the 2 sisters developed Hodgkin disease at the age of 34 years; he apparently did not have LWD. The mother, the maternal grandmother, and her sister (the mother of the second cousin once removed), did have LWD. Gokhale et al. (1995) suggested that the LWD gene may be a predisposing factor to Hodgkin disease, which was also contributed to by the HLA susceptibility allele.
Spitz et al. (2002) cloned and sequenced the breakpoints of the balanced translocation t(2;8)(q31;p21) reported by Ventruto et al. (1983). They found that no gene was disrupted, but the breakpoint occurred in close proximity to the HOXD gene cluster (see HOXD1; 142987) on 2q31-q32. They pointed to other evidence that this cluster of genes has an important role in the development of both the vertebral column and the limbs. They presented radiographs from the family indicating shortened forearms with Madelung deformity and cubitus valgus with limited elbow motion. Hands and feet were normal. There was fusion between the first and second cervical vertebrae and a cleft in the vertebrae in the lumbosacral region.
INHERITANCE \- Pseudoautosomal dominant GROWTH Height \- Short stature, disproportionate \- Adult height 135cm to normal HEAD & NECK Mouth \- High-arched palate SKELETAL Spine \- Scoliosis Limbs \- Mesomelia \- Increased carrying angle \- Limited elbow mobility \- Bowing of the radius \- Dorsal subluxation of ulna \- Short, mildly curved tibia Hands \- Madelung wrist deformity (74% of LWD patients) \- Limited wrist mobility MISCELLANEOUS \- Female preponderance \- Madelung deformity more frequent and more severe in females \- SHOX is located in the pseudoautosomal region of the X and Y chromosomes MOLECULAR BASIS \- Caused by mutation in the short stature homeo box gene (SHOX, 312865.0002 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
LERI-WEILL DYSCHONDROSTEOSIS
|
c0265309
| 8,500 |
omim
|
https://www.omim.org/entry/127300
| 2019-09-22T16:42:06 |
{"doid": ["0060847"], "mesh": ["C537119"], "omim": ["127300"], "icd-9": ["755.54"], "icd-10": ["Q74.0"], "orphanet": ["240", "35688"], "synonyms": ["Alternative titles", "DYSCHONDROSTEOSIS"], "genereviews": ["NBK1215"]}
|
Abnormal sensation that bugs are crawling on or under the skin
Not to be confused with Fornication.
Formication
SpecialtyPsychiatry, neurology
Formication is the sensation that resembles that of small insects crawling on (or under) the skin when there is nothing there. It is one specific form of a set of sensations known as paresthesias, which also include the more common prickling, tingling sensation known as "pins and needles". Formication is a well documented symptom, which has numerous possible causes. The word is derived from formica, the Latin word for ant.
Formication may sometimes be experienced as feelings of itchiness, tingling, pins and needles, burning, or even pain. When formication is perceived as itchiness, it may trigger the scratch reflex, and because of this, some people who experience the sensation are at risk of causing skin damage through excessive scratching.
In some instances, static electricity can attract particulates to the skin and can also cause body hair to move, giving a sensation like insects crawling over the skin.[1] However, in many cases no external trigger creates the sensation.
In rare cases, individuals become convinced that the sensation is due to the presence of real insects on or under the skin. In these cases, patients have what is known as delusional parasitosis. They believe that their skin is inhabited by, or under attack by, small insects or similar parasites, despite repeated reassurances from physicians, pest control experts, and entomologists.[2]
## Contents
* 1 Causes
* 2 History
* 3 See also
* 4 References
* 5 External links
## Causes[edit]
Causes of formication include normal states such as onset of menopause (i.e. hormone withdrawal). Other causes are medical conditions such as pesticide exposure,[3] mercury poisoning, diabetic neuropathy, skin cancer, syphilis, Lyme disease, hypocalcaemia, or herpes zoster (shingles) and neurocysticercosis.[2] Formication can be a result of stimulant intoxication or withdrawal (methamphetamine, cocaine,[4] MDMA aka ecstasy[5]) or alcohol withdrawal in alcoholics (i.e. delirium tremens), and is often accompanied by visual hallucinations of insects (formicanopia).[2] It can also occur as a symptom of benzodiazepine withdrawal, withdrawal from medication such as SSRI/SNRI antidepressants and tramadol; and as a side effect of opioid analgesics.[citation needed]
## History[edit]
Formication is etymologically derived from the Latin word formica, meaning "ant", precisely because of this similarity in sensation to that of crawling insects. The term has been in use for several hundred years. In the 1797 edition of the Encyclopædia Britannica, a description of the condition raphania includes the symptom:
> ...a formication, or sensation as of ants or other small insects creeping on the parts.[6]
Described again in an instructional text from 1890:
> A variety of itching, often encountered in the eczema of elderly people, is formication; this is described as exactly like the crawling of myriads of animals over the skin. It is probably due to the successive irritation of nerve fibrils in the skin. At times patients who suffer from it will scarcely be persuaded that it is not due to insects. Yielding to the temptation to scratch invariably makes the disease worse.[7]
## See also[edit]
* Antipruritics – anti-itch drugs
* Morgellons
## References[edit]
1. ^ Potter, Mike. "INVISIBLE ITCHES: Insect and Non-Insect Causes". ENTFACT-58. University of Kentucky. Retrieved 2013-12-13.
2. ^ a b c Hinkle, Nancy C (2000). "Delusory Parasitosis" (PDF). American Entomologist. 46 (1): 17–25. doi:10.1093/ae/46.1.17. Archived from the original (PDF) on 2012-10-21.
3. ^ Vijverberg, H. P.; Van Den Bercken, J (1990). "Neurotoxicological effects and the mode of action of pyrethroid insecticides" (PDF). Critical Reviews in Toxicology. 21 (2): 105–126. doi:10.3109/10408449009089875. PMID 1964560.
4. ^ Rusyniak, Daniel E. (2011). "Neurologic manifestations of chronic methamphetamine abuse". Neurologic Clinics. 29 (3): 641–655. doi:10.1016/j.ncl.2011.05.004. PMC 3148451. PMID 21803215.
5. ^ https://www.healthline.com/health/formication#diagnosis. Missing or empty `|title=` (help)
6. ^ Encyclopædia Britannica, 1797, p. 260
7. ^ Jamieson, William Allan (1894) Diseases of the Skin: A Manual for Practitioners and Students. Pentland
## External links[edit]
Classification
D
* ICD-10: R20.2
* ICD-9-CM: 782.0
* DiseasesDB: 24182
* v
* t
* e
Symptoms and signs relating to skin and subcutaneous tissue
Disturbances of
skin sensation
* Hypoesthesia
* Paresthesia
* Formication
* Hyperesthesia
* Hypoalgesia
* Hyperalgesia
Circulation
* Cyanosis
* Pallor
* Livedo
* Livedo reticularis
* Flushing
* Petechia
* Blanching
Edema
* Peripheral edema
* Anasarca
Other
* Rash
* Desquamation
* Induration
* Diaphoresis
* Mass
* Neck mass
Skin
* Asboe-Hansen sign
* Auspitz's sign
* Borsari's sign
* Braverman's sign
* Crowe sign
* Dennie–Morgan fold
* Darier's sign
* Fitzpatrick's sign
* Florid cutaneous papillomatosis
* Gottron's sign
* Hutchinson's sign
* Janeway lesion
* Kerr's sign
* Koebner's phenomenon
* Koplik's spots
* Leser-Trelat sign
* Nikolsky's sign
* Pastia's sign
* Russell's sign
* Wickham striae
* Wolf's isotopic response
* Munro's microabscess
Nails
* Aldrich-Mees' lines
* Beau's lines
* Muehrcke's lines
* Terry's nails
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Formication
|
c0016579
| 8,501 |
wikipedia
|
https://en.wikipedia.org/wiki/Formication
| 2021-01-18T18:55:09 |
{"mesh": ["D010292"], "umls": ["C0016579"], "wikidata": ["Q5470185"]}
|
A number sign (#) is used with this entry because of evidence that fetal akinesia deformation sequence-1 (FADS1) is caused by homozygous mutation in the MUSK gene (601296) on chromosome 9q31.
Mutation in the MUSK gene can also cause a form of congenital myasthenic syndrome (CMS9; 616325).
Description
The fetal akinesia deformation sequence (FADS) refers to a clinically and genetically heterogeneous constellation of features including fetal akinesia, intrauterine growth retardation, arthrogryposis, and developmental anomalies, including lung hypoplasia, cleft palate, and cryptorchidism (Vogt et al., 2009). It shows phenotypic overlap with the lethal form of multiple pterygium syndrome (see 253290).
### Genetic Heterogeneity of Fetal Akinesia Deformation Sequence
FADS2 (618388) is caused by mutation in the RAPSN gene (601592), FADS3 (618389) is caused by mutation in the DOK7 gene (618389), and FADS4 (618393) is caused by mutation in the NUP88 gene (602552).
As mutations in the MUSK, RAPSN, and DOK7 genes have been associated with congenital myasthenic syndromes (see, e.g., CMS1A, 601462), the disorders in these patients likely represent extreme phenotypes of CMS (Vogt et al., 2009).
Nomenclature
Although early descriptions by Pena and Shokeir (1974, 1976) resulted in the eponym, Moessinger (1983), Hall (1986), and Hageman et al. (1987) noted that Pena-Shokeir is not a specific unitary diagnosis or syndrome, but rather a description of a clinically and genetically heterogeneous phenotype resulting from fetal akinesia or decreased in utero movement; hence the term 'fetal akinesia deformation sequence.'
See also type II Pena-Shokeir syndrome, which is also known as COFS syndrome (214150); the separate delineation of types I and II was given by Shokeir (1982) and Houston and Shokeir (1981).
Clinical Features
### Patients with Mutations in the MUSK Gene
Tan-Sindhunata et al. (2015) reported 14 affected fetuses from a Dutch genetic isolate with FADS associated with a homozygous missense mutation in the MUSK gene (see MOLECULAR GENETICS). All died in utero or shortly after birth. Clinical features included polyhydramnios, decreased fetal movements, joint contractures, and pulmonary hypoplasia. Dysmorphic features included hypertelorism, low-set ears, micrognathia, and reduced muscle bulk. All males had undescended testes, but most were born prematurely. Muscle biopsies showed myopathic features associated with denervation, such as variation in muscle fiber diameter, rounded and atrophic fibers, and internal nuclei. AChR clusters and tyrosine kinase activity at motor endplates were significantly decreased compared to controls, suggesting a defect in synaptogenesis.
Wilbe et al. (2015) reported 5 fetuses, born of Swedish parents, with FADS associated with a homozygous truncating mutation in the MUSK gene (see MOLECULAR GENETICS). All fetuses showed akinesia and joint contractures on prenatal ultrasound, and all died in utero or in the perinatal period. Autopsy confirmed muscle atrophy and multiple joint contractures. Additional features included polyhydramnios, micrognathia, low-set ears, and lung hypoplasia. Muscle biopsy showed a large variation in fiber size, fiber atrophy, and a predominance of type II fibers.
### Early Reports of Patients with FADS
Pena and Shokeir (1974, 1976) described patients with a lethal congenital syndrome comprising camptodactyly, multiple ankyloses, facial anomalies, and pulmonary hypoplasia. Affected sibs born of consanguineous parents indicated autosomal recessive inheritance. Punnett et al. (1974) and Mease et al. (1976) observed cases with this sequence, and noted that the features were secondary to fetal neuromuscular dysfunction.
Chen et al. (1983) reported 5 cases, including 3 sibs. The other 2 cases had a history of affected sibs including a pair of concordant twins. In addition to multiple ankyloses, camptodactyly, facial anomalies, and pulmonary hypoplasia, one fetus had pterygia of the neck and axillae and cardiac hypoplasia. Chen et al. (1983) suggested that pterygium may be a feature of the Pena-Shokeir syndrome, and that the lethal form of a recessively inherited syndrome described by Chen et al. (1980) and Hall et al. (1982) may represent a severe form of the Pena-Shokeir syndrome.
Moerman et al. (1983) reported 2 unrelated infants who died perinatally with severe arthrogryposis multiplex congenita, pulmonary hypoplasia, and characteristic facies. They counted a total of 15 reported cases. They confirmed the suggestion of Smith (1982) that the Pena-Shokeir syndrome I is a primary motor neuropathy. Postmortem examination showed a marked paucity of anterior horn cells in the spinal cord and diffuse muscle atrophy. Pulmonary hypoplasia resulted from involvement of the respiratory muscles. In addition, both patients showed adrenal hypoplasia of the 'miniature' type; the histologic appearance was that of 'miniature' adult glands with atrophy of the fetal cortex, as seen in anencephaly. Polyhydramnios was due to impaired swallowing of amniotic fluid.
Lindhout et al. (1985) reported 9 cases in 7 sibships. The parents were consanguineous in all but 1 of the 7. Toriello et al. (1985) reported 2 female infant sibs.
Bisceglia et al. (1987) described the pathologic findings in affected male and female sibs. Hageman et al. (1987) observed a variety of brain pathology in 6 unrelated new cases and in a review of 28 previously reported cases.
Katzenstein and Goodman (1988) reported a case of survival to the age of 20 months. Out of about 60 reported cases, only 5 others surviving beyond 28 days were found.
Lammer et al. (1989) described affected brothers who were unusual because they had macrocephaly and normal intrauterine growth. Autopsy, performed only in the second sib, showed no detectable neuromuscular abnormalities underlying the contractures. Abnormalities were detected by ultrasonography during the 18th week of gestation of the second fetus.
Erdl et al. (1989) described 2 sibs with the Pena-Shokeir phenotype and major malformations of the central nervous system. The cases illustrated again the heterogeneity of this phenotype.
Gyr et al. (1992) described a consanguineous family in which 3 male sibs were affected; 2 died antepartum and the third shortly after delivery.
Chen et al. (1995) described 2 unrelated infants with fetal akinesia sequence who as newborns were noted to have multiple perinatal fractures of the long bones. Radiographs showed gracile ribs and thin long bones with multiple diaphyseal fractures. Osseous hypoplasia associated with decreased use was thought to predispose to fracture.
Diagnosis
Vogt et al. (2012) proposed a diagnostic pathway for the molecular investigation of FADS.
### Prenatal Diagnosis
Muller and de Jong (1986) commented on the similarities in prenatal ultrasonographic features between Pena-Shokeir syndrome type I and the trisomy 18 syndrome. They studied 2 cases of each, referred because of polyhydramnios. All had multiple ankyloses, camptodactyly, and rocker-bottom feet. Distinguishing sonographic features were scalp edema and lung hypoplasia in Pena-Shokeir syndrome, and cardiac arrhythmias, prominent occiput, micrognathia, and omphalocele in trisomy 18.
Ohlsson et al. (1988) reviewed the ultrasonographic prenatal diagnosis of this disorder. They reported a pregnancy in which the diagnosis was made by this means, having been suspected antenatally because the first-cousin parents had normal chromosomes and had had 2 previously affected offspring with a clinical picture compatible with the diagnosis. Furthermore, ultrasound had shown hydramnios, ankyloses, and decreased chest movements in the fetus.
Davis and Kalousek (1988) presented the morphologic findings in 16 previable fetuses with the fetal akinesia deformation sequence.
Pathogenesis
Moessinger (1983) suggested that the Pena-Shokeir I phenotype is not specific but rather the result of a deformation sequence caused by fetal akinesia; hence the term 'fetal akinesia deformation sequence.' The work of Moessinger (1983) was an extension of that of Drachman and Coulombre (1962), which focused on the essentiality of fetal (and probably embryonic) movement to joint development.
Hall (1986) suggested that at least 5 specific subgroups of Pena-Shokeir syndrome could be distinguished among 16 multiplex families. She noted that the original description by Pena and Shokeir (1974) was general in character and did not include unique features permitting identification with 1 of the 5 subtypes. In relation to pathogenesis, Hall (1986) stated: 'The 'use' of a structure in utero is necessary for its continuing and normal development. The old adage 'use it or lose it' seems to apply just as appropriately to prenatal normal development as it does in the crusty adult world of politics, business, and academia.'
### Possible Relation to Maternal Myasthenia Gravis
Brueton et al. (1994) reported 8 cases (5 males and 3 females) of the Pena-Shokeir phenotype from 2 sibships. Antiacetylcholine receptor (AChR) (see ACHRA; 100690) antibody titers were increased in both mothers, although neither of them had any neurologic symptoms of myasthenia gravis (254200). The authors noted that several infants born of mothers with clinically evident myasthenia gravis have had a Pena-Shokeir phenotype. In the case of maternal myasthenia gravis, the recurrence risk for Pena-Shokeir syndrome is high; there has been no instance of a normal child being born following the affected pregnancy.
Vincent et al. (1995) and Riemersma et al. (1996), respectively, reported high levels of antibodies against human muscle AChR in 5 women with histories of arthrogryposis multiplex congenita recurring in successive pregnancies. The fetuses, which were mostly stillborn or terminated for fetal anomalies, showed dysmorphic facies and lung hypoplasia as well as joint contractures, consistent with the Pena-Shokeir syndrome. Anti-AChR antibodies are usually associated with acquired myasthenia gravis, and transient neonatal myasthenia gravis sometimes occurs in neonates born to mothers with this disorder due to placental transfer of the antibodies. However, 3 of the 5 mothers reported by Vincent et al. (1995) and Riemersma et al. (1996) were asymptomatic or had mild or unrecognized myasthenia gravis at the time that their babies were affected, suggesting that the anti-AChR antibodies were different from those usually associated with myasthenia gravis. Indeed, the serum and IgG from these women blocked, by more than 90%, the function of fetal AChR expressed in the human muscle-like cell line and in Xenopus oocytes. They did not, however, block the function of adult AChR, explaining the marked effects on the fetus and the relative sparing of their mothers. In humans, fetal AChR is replaced by the adult form by 33 weeks' gestation (Hesselmans et al., 1993). To investigate the pathogenesis further, Jacobson et al. (1999) injected pregnant mice with plasma from 4 anti-AChR antibody-positive women whose fetuses had severe AMC. They found that human antibodies could can be transferred efficiently to the mouse fetus during the last few days of fetal life. Many of the fetuses of dams injected with maternal plasmas or immunoglobulin were stillborn and showed fixed joints and other deformities. Moreover, similar changes were found in mice after injection of a serum from one anti-AChR antibody-negative woman who had had 4 AMC fetuses.
Brueton et al. (2000) reported a family in which 6 of 7 sibs had arthrogryposis multiplex congenita and a Pena-Shokeir phenotype; the healthy mother was found to have asymptomatic myasthenia gravis. They claimed that this was the first report of anti-AChR antibodies causing fetal akinesia/hypokinesia sequence in the offspring of an asymptomatic mother. The seventh child, the first born, may have been mildly affected.
Molecular Genetics
In affected fetuses from a Dutch genetic isolate with FADS, Tan-Sindhunata et al. (2015) identified a homozygous missense mutation in the MUSK gene (I575T; 601296.0006).
In 5 affected fetuses, born of Swedish parents, with FADS, Wilbe et al. (2015) identified a homozygous truncating mutation in the MUSK gene (601296.0007). The mutation was found by whole-exome sequencing and confirmed by Sanger sequencing. The severe phenotype was similar to that observed in mice with homozygous knockdown of the MuSK gene (DeChiara et al., 1996) (see ANIMAL MODEL).
Animal Model
DeChiara et al. (1996) generated mice with a targeted disruption for the gene encoding MuSK. Neuromuscular synapses did not form in these mice, suggesting a failure in the induction of synapse formation. In connection with other findings, DeChiara et al. (1996) interpreted this to indicate that MuSK responds to a critical signal by agrin (103320) and that it, in turn, activates signaling cascades responsible for all aspects of synapse formation, including organization of the postsynaptic membrane, synapse-specific transcription, and presynaptic differentiation.
INHERITANCE \- Autosomal recessive GROWTH Other \- Small for gestational age \- Intrauterine growth retardation HEAD & NECK Face \- Rigid, expressionless face \- Long philtrum \- Micrognathia Ears \- Small, posteriorly rotated ears \- Poorly folded ears Eyes \- Prominent eyes \- Hypertelorism \- Telecanthus \- Short palpebral fissures \- Ptosis Nose \- Depressed nasal tip Mouth \- Small mouth \- High arched palate \- Cleft palate Neck \- Short neck RESPIRATORY Lung \- Pulmonary hypoplasia CHEST External Features \- Small thorax Ribs Sternum Clavicles & Scapulae \- Thin ribs ABDOMEN Gastrointestinal \- Short-gut syndrome GENITOURINARY Internal Genitalia (Male) \- Cryptorchidism SKELETAL Pelvis \- Hip ankylosis Limbs \- Elbow ankylosis \- Knee ankylosis \- Thin, gracile long bones Hands \- Ulnar deviation of hands \- Camptodactyly \- Absent or sparse dermal ridges Feet \- Ankle ankylosis \- Rocker-bottom feet \- Talipes equinovarus MUSCLE, SOFT TISSUES \- Neurogenic muscle atrophy NEUROLOGIC Central Nervous System \- Hydrocephalus \- Microgyria \- Cerebellar hypoplasia \- Absent septum pellucidum \- Cavum septum pellucidum PRENATAL MANIFESTATIONS Amniotic Fluid \- Polyhydramnios Placenta & Umbilical Cord \- Small or abnormal placenta \- Short umbilical cord Delivery \- Premature birth \- Stillborn (30%) MOLECULAR BASIS \- Caused by mutation in the 43-kD receptor-association protein of the synapse, gene (RAPSN, 601592.0013 ) \- Caused by mutation in the downstream of tyrosine kinase 7 gene (DOK7, 610285.0009 ) \- Caused by mutation in the skeletal muscle receptor tyrosine kinase gene (MUSK, 601296.0006 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
FETAL AKINESIA DEFORMATION SEQUENCE 1
|
c1276035
| 8,502 |
omim
|
https://www.omim.org/entry/208150
| 2019-09-22T16:30:44 |
{"mesh": ["C536647"], "omim": ["208150"], "orphanet": ["994"], "synonyms": ["Alternative titles", "FETAL AKINESIA DEFORMATION SEQUENCE", "PENA-SHOKEIR SYNDROME, TYPE I", "FETAL AKINESIA SEQUENCE", "ARTHROGRYPOSIS MULTIPLEX CONGENITA WITH PULMONARY HYPOPLASIA"]}
|
IgA nephropathy is a kidney disorder that occurs when IgA (immunoglobulin A), a protein that helps the body fight infections, settles in the kidneys. IgA nephropathy can occur at any age, even in childhood. After many years, deposits of IgA may cause the kidneys to leak blood and sometimes protein in the urine. In the early stages, IgA nephropathy has no symptoms. The first sign of this condition may be blood in the urine. After 10 to 20 years, the kidneys may show signs of damage and 20-40% of adults develop end-stage kidney disease.
In most instances, the cause of this condition is unknown; however, certain disorders have been linked with IgA nephropathy, such as cirrhosis of the liver, celiac disease, and HIV infection. Although IgA nephropathy usually occurs in a family with no other affected members, several cases of familial IgA nephropathy have been reported. Familial IgA nephropathy is suspected to run through families in an autosomal dominant manner and is linked to genetic material on the long arm of chromosome 6 (6q22-23). There is no cure for this condition. Treatment focuses on slowing the disease and preventing complications.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
IgA nephropathy
|
c0017661
| 8,503 |
gard
|
https://rarediseases.info.nih.gov/diseases/863/iga-nephropathy
| 2021-01-18T17:59:49 |
{"mesh": ["D005922"], "omim": ["161950"], "umls": ["C0017661"], "orphanet": ["34145"], "synonyms": ["Nephritis, IGA type", "IGAN", "Glomerulonephritis, IGA", "Berger's disease", "Berger disease"]}
|
Punctate inner choroiditis
SpecialtyOphthalmology
Punctate inner choroiditis (PIC) is an inflammatory choroiditis which occurs mainly in young women. Symptoms include blurred vision and scotomata. Yellow lesions are mainly present in the posterior pole and are between 100 and 300 micrometres in size. PIC is one of the so-called White Dot Syndromes. PIC has only been recognised as a distinct condition as recently as 1984 when Watzke identified 10 patients who appeared to make up a distinct group within the White Dot Syndromes.
## Contents
* 1 Signs and symptoms
* 2 Cause
* 3 Diagnosis
* 3.1 Natural course of the condition
* 4 Treatment
* 5 Prognosis
* 6 References
## Signs and symptoms[edit]
• Typically affects short sighted (myopic) women. (90% of cases are female).
• The average age of patients with PIC is 27 years with a range of 16–40 years.
• Patients are otherwise healthy and there is usually no illness, which triggers the condition or precedes it.
• The inflammation is confined to the back of the eye (posterior). There is no inflammation in the front of the eye (anterior chamber) or vitreous (the clear jelly inside the eye). This is an important distinguishing feature of PIC.
• It usually affects both eyes.
• The appearance of gray-white or yellow punctate (punched out) areas (lesions) at the level of the inner choroid. These lesions are typically located centrally at the back of the eye (posterior pole).
Symptoms typically include:
1. Blurring of vision
2. Partial ‘blind spots’ or scotoma. These areas of diminished or lost areas of the visual field are typically near the centre of vision but occasionally can be peripheral. These may be temporary or permanent.
3. Seeing flashing lights. This is known as photopsia.
The PIC lesions, which form scars deep in the choroid layer of the eye, may result in new blood vessels forming. These can be seen as the body’s attempts at repair, but these new blood vessels (neovascularisation) are weak, can spread to form a membrane and can threaten the vision. It is suspected that at least 40% of patients with PIC develop CNV (choroidal neovascularization). This is a complication, which can occur in other white dot syndromes and other eye conditions such as macular degeneration but occurs rarely in other forms of uveitis.
CNV is a sight threatening complication and so must be picked up early and always treated. It may occur whether the uveitis is active or not. CNV, if not treated, may lead to subretinal fibrosis (scarring), a further complication, which is more difficult to treat, and which leads to poor vision.
Good monitoring for patients with PIC is therefore very important.
## Cause[edit]
There are no known causes of PIC, but may represent an autoimmune type of uveitis.
## Diagnosis[edit]
Diagnosis of PIC can be difficult because the appearance may be similar to other conditions and types of posterior uveitis, especially other forms of the so-called white dot syndromes. The diagnosis is made by eliminating all the other possibilities by careful examination by an experienced ophthalmologist, aided with visual field testing and Fluorescein angiography (an intravenous dye used to show the blood vessels at the back of the eye).
It is important that the correct diagnosis is made because treatment may be quite different for apparently similar conditions.
### Natural course of the condition[edit]
What happens with PIC depends a lot on the presence or absence of an important complication, Choroidal neovascularization (known as CNV).
Often, the inflammation in PIC is self-limiting, not always requiring treatment.
However treatment is advised if there are many active or central lesions, or if there are signs of CNV.
## Treatment[edit]
It is important to distinguish between treatment of the underlying inflammation (PIC) and the treatment of CNV.
2-pronged approach:
Treatment is not always necessary and observation may be appropriate for lesions if they are found in non-sight threatening areas (that is not centrally).
Active lesions of PIC can be treated with corticosteroids taken systemically (tablets) or regionally by injections around the eye (periorbital). It has been argued that treating lesions in this way may help minimise the development of CNV.
The treatment of CNV:
Early treatment is required for this complication. There are several possible treatment methods, but none of these treatments appears to be singly effective for the treatment of CNV.
1. Corticosteroids: systemic or intraocular
2. ‘Second line’ immunosuppressants: There is evidence that combined therapies of steroids and second line immunosuppressants may be important.
3. Surgical excision of the affected area in well selected cases.
4. Intravitreal anti-VEGF agents. Examples are bevacizumab (avastin) and ranibizumab. These relatively new drugs are injected into the eye.
5. Photodynamic therapy (PDT): A photosensitive drug is ‘activated’ by strong light. Consideration may be given to combined therapy of PDT and anti VEGF.
6. Laser photocoagulation: This is occasionally used unless the CNV is subfoveal (affecting the central or macular part of the vision). The laser treatment can damage the vision.
The use of the intravitreal anti VEGF agents namely bevacizumab and ranibizumab have been described recently. The current evidence supporting the use of anti-VEGF agents is based on retrospective case studies and could not be described as strong. However, further data from prospective controlled trials are needed before the therapeutic role of anti-VEGF therapy in the uveitis treatment regimen can be fully determined. The anti VEGF agents furthermore have not been shown to have an anti-inflammatory effect.
Thus, treatment of the underlying inflammatory disease should play a central role in the management of uveitic CNV. A two-pronged treatment that focuses on achieving control of inflammation through the use of corticosteroids and/or immunosuppressive agents, while treating complications that arise despite adequate disease control with intravitreal anti-VEGF agents, may be useful.
Regular monitoring is essential to achieve a good outcome. This is because even if there is no active inflammation, there may still be occult CNV which requires treatment to avoid suffering vision loss.
## Prognosis[edit]
The visual prognosis of eyes with PIC that do not develop subfoveal CNV is good. If CNV is picked up early and treated appropriately then the visual outcome can also be good. Frequent monitoring is important to ensure a good outcome. Poor vision occurs mostly with subfoveal CNV or if subretinal fibrosis (scarring) has formed.
The above information comes from a Fact sheet produced by the Uveitis Information Group May 2011. It has been factually checked by a member of the charity's Professional Medical Panel.
## References[edit]
1. ^ Goldstein DA, Ulanski L. Multifocal choroiditis vs. PIC: Variations on a Theme? Review of Ophthalmology. 2004;11(6).
2. ^ Polk TD, Goldman EJ. Chorioretinal Inflammatory Syndromes. International Ophthalmology Clinics. 1999;39(4):33-53.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Punctate inner choroiditis
|
c0730321
| 8,504 |
wikipedia
|
https://en.wikipedia.org/wiki/Punctate_inner_choroiditis
| 2021-01-18T19:00:08 |
{"gard": ["7503"], "umls": ["C0730321"], "wikidata": ["Q7260022"]}
|
For a discussion of the genetic heterogeneity in age at natural menopause, see MENOQ1 (300488).
Mapping
In a genomewide association study of 17,438 women, He et al. (2009) found significant association with age at natural menopause for 5 SNPs on chromosome 5q35.2: rs365132 (p = 8.4 x 10(-14)), rs7718874 (p = 1.3 x 10(-13)), rs402511 (p = 1.4 x 10(-13)), rs691141 (p = 3.9 x 10(-12)), and rs2278493 (p = 7.2 x 10(-8)). He et al. (2009) stated that nearby genes include UIMC1 (609433) for 4 of the SNPs, HK3 (142570) for 2, and UNC5A (607869) for 1.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
MENOPAUSE, NATURAL, AGE AT, QUANTITATIVE TRAIT LOCUS 4
|
c2752066
| 8,505 |
omim
|
https://www.omim.org/entry/612886
| 2019-09-22T16:00:24 |
{"omim": ["612886"]}
|
Familial omphalocele syndrome with facial dysmorphism is a rare genetic developmental defect during embryogenesis characterized by omphalocele associated with facial dysmorphism including flat face, short, upturned nose, long and wide philtrum and flattened maxillary arch and abnormalities of hands.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Familial omphalocele syndrome with facial dysmorphism
|
None
| 8,506 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=280403
| 2021-01-23T18:45:36 |
{}
|
Anopsia
Other namesAnopia
Scheme showing central connections of the optic nerves and optic tracts. (Lesions at different locations relate to different types of anopsias.)
SpecialtyNeurology
An anopsia is a defect in the visual field. If the defect is only partial, then the portion of the field with the defect can be used to isolate the underlying cause.
Types of partial anopsia:
* Hemianopsia
* Homonymous hemianopsia
* Heteronymous hemianopsia
* Binasal hemianopsia
* Bitemporal hemianopsia
* Superior hemianopia
* Inferior hemianopia
* Quadrantanopia
## Etymology[edit]
The term anopsia comes from the Ancient Greek ἀν- (an-), "un-" and ὄψις (opsis) "sight".
## References[edit]
## External links[edit]
Classification
D
* ICD-10: H53.4
* ICD-9-CM: 368.4
* v
* t
* e
* Diseases of the human eye
Adnexa
Eyelid
Inflammation
* Stye
* Chalazion
* Blepharitis
* Entropion
* Ectropion
* Lagophthalmos
* Blepharochalasis
* Ptosis
* Blepharophimosis
* Xanthelasma
* Ankyloblepharon
Eyelash
* Trichiasis
* Madarosis
Lacrimal apparatus
* Dacryoadenitis
* Epiphora
* Dacryocystitis
* Xerophthalmia
Orbit
* Exophthalmos
* Enophthalmos
* Orbital cellulitis
* Orbital lymphoma
* Periorbital cellulitis
Conjunctiva
* Conjunctivitis
* allergic
* Pterygium
* Pseudopterygium
* Pinguecula
* Subconjunctival hemorrhage
Globe
Fibrous tunic
Sclera
* Scleritis
* Episcleritis
Cornea
* Keratitis
* herpetic
* acanthamoebic
* fungal
* Exposure
* Photokeratitis
* Corneal ulcer
* Thygeson's superficial punctate keratopathy
* Corneal dystrophy
* Fuchs'
* Meesmann
* Corneal ectasia
* Keratoconus
* Pellucid marginal degeneration
* Keratoglobus
* Terrien's marginal degeneration
* Post-LASIK ectasia
* Keratoconjunctivitis
* sicca
* Corneal opacity
* Corneal neovascularization
* Kayser–Fleischer ring
* Haab's striae
* Arcus senilis
* Band keratopathy
Vascular tunic
* Iris
* Ciliary body
* Uveitis
* Intermediate uveitis
* Hyphema
* Rubeosis iridis
* Persistent pupillary membrane
* Iridodialysis
* Synechia
Choroid
* Choroideremia
* Choroiditis
* Chorioretinitis
Lens
* Cataract
* Congenital cataract
* Childhood cataract
* Aphakia
* Ectopia lentis
Retina
* Retinitis
* Chorioretinitis
* Cytomegalovirus retinitis
* Retinal detachment
* Retinoschisis
* Ocular ischemic syndrome / Central retinal vein occlusion
* Central retinal artery occlusion
* Branch retinal artery occlusion
* Retinopathy
* diabetic
* hypertensive
* Purtscher's
* of prematurity
* Bietti's crystalline dystrophy
* Coats' disease
* Sickle cell
* Macular degeneration
* Retinitis pigmentosa
* Retinal haemorrhage
* Central serous retinopathy
* Macular edema
* Epiretinal membrane (Macular pucker)
* Vitelliform macular dystrophy
* Leber's congenital amaurosis
* Birdshot chorioretinopathy
Other
* Glaucoma / Ocular hypertension / Primary juvenile glaucoma
* Floater
* Leber's hereditary optic neuropathy
* Red eye
* Globe rupture
* Keratomycosis
* Phthisis bulbi
* Persistent fetal vasculature / Persistent hyperplastic primary vitreous
* Persistent tunica vasculosa lentis
* Familial exudative vitreoretinopathy
Pathways
Optic nerve
Optic disc
* Optic neuritis
* optic papillitis
* Papilledema
* Foster Kennedy syndrome
* Optic atrophy
* Optic disc drusen
Optic neuropathy
* Ischemic
* anterior (AION)
* posterior (PION)
* Kjer's
* Leber's hereditary
* Toxic and nutritional
Strabismus
Extraocular muscles
Binocular vision
Accommodation
Paralytic strabismus
* Ophthalmoparesis
* Chronic progressive external ophthalmoplegia
* Kearns–Sayre syndrome
palsies
* Oculomotor (III)
* Fourth-nerve (IV)
* Sixth-nerve (VI)
Other strabismus
* Esotropia / Exotropia
* Hypertropia
* Heterophoria
* Esophoria
* Exophoria
* Cyclotropia
* Brown's syndrome
* Duane syndrome
Other binocular
* Conjugate gaze palsy
* Convergence insufficiency
* Internuclear ophthalmoplegia
* One and a half syndrome
Refraction
* Refractive error
* Hyperopia
* Myopia
* Astigmatism
* Anisometropia / Aniseikonia
* Presbyopia
Vision disorders
Blindness
* Amblyopia
* Leber's congenital amaurosis
* Diplopia
* Scotoma
* Color blindness
* Achromatopsia
* Dichromacy
* Monochromacy
* Nyctalopia
* Oguchi disease
* Blindness / Vision loss / Visual impairment
Anopsia
* Hemianopsia
* binasal
* bitemporal
* homonymous
* Quadrantanopia
subjective
* Asthenopia
* Hemeralopia
* Photophobia
* Scintillating scotoma
Pupil
* Anisocoria
* Argyll Robertson pupil
* Marcus Gunn pupil
* Adie syndrome
* Miosis
* Mydriasis
* Cycloplegia
* Parinaud's syndrome
Other
* Nystagmus
* Childhood blindness
Infections
* Trachoma
* Onchocerciasis
This article about the eye is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Anopsia
|
c3887875
| 8,507 |
wikipedia
|
https://en.wikipedia.org/wiki/Anopsia
| 2021-01-18T18:29:39 |
{"umls": ["C3887875"], "icd-9": ["368.4"], "icd-10": ["H53.4"], "wikidata": ["Q4770152"]}
|
A drug-related embryofetopathy that can occur when an embryo/fetus is exposed to the anticonvulsant drug phenytoin, characterized by distinct craniofacial anomalies (hypertelorism and epicanthal folds, short nose and deep nasal bridge, malformed and low set ears, short neck) as well as hypoplastic distal phalanges and underdevelopment of nails of fingers and toes, prenatal and postnatal growth retardation, and neurological impairment (at a 2-3 times higher risk than that of the general population) including cognitive deficits and motor developmental delay. Less commonly, microcephaly, ocular defects, oral clefts, umbilical and inguinal hernias, hypospadias and cardiac anomalies have also been reported.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Fetal hydantoin syndrome
|
c0265372
| 8,508 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=1912
| 2021-01-23T18:31:53 |
{"gard": ["6435"], "mesh": ["C537922"], "umls": ["C0265372"], "icd-10": ["Q86.1"], "synonyms": ["Fetal dihydantoin syndrome", "Phenytoin embryofetopathy"]}
|
Primary intraosseous venous malformation is a rare, genetic vascular anomaly characterized by severe blood vessel expansion (most frequently within the craniofacial bones) with painless bone enlargement (usually of mandibule, maxilla and/or orbital, nasal, and frontal bones), typically resulting in facial asymmetry and contour deformation. Midline abnormalities, such as diastasis recti, supraumbilical raphe, and hiatus hernia, are commonly associated. Additional features reported include gingival bleeding, ectopic tooth eruption, exophthalmos, loss of vision, nausea, and vomiting.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Primary intraosseous venous malformation
|
c1847197
| 8,509 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=140436
| 2021-01-23T17:56:42 |
{"mesh": ["C564648"], "omim": ["606893"], "umls": ["C1847197"], "icd-10": ["D18.0"], "synonyms": ["Intraosseous hemangioma", "Osseous venous malformation"]}
|
A rare non-amyloid monoclonal immunoglobulin deposition disease characterized by secretion of abnormal light and heavy chains, which are deposited in tissues and cause organ dysfunction, but do not form amyloid beta-pleated sheets or contain an amyloid P component. The condition most frequently occurs in association with multiple myeloma. The kidneys are most commonly affected (clinically manifesting as nephrotic syndrome and renal failure), but liver, heart, peripheral nerves, blood vessels, and joints may also be involved.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Light and heavy chain deposition disease
|
None
| 8,510 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=93557
| 2021-01-23T17:49:29 |
{"icd-10": ["D89.8"], "synonyms": ["LHCDD"]}
|
This article is an orphan, as no other articles link to it. Please introduce links to this page from related articles; try the Find link tool for suggestions. (November 2019)
Bone malrotation
Other namesBone malalignment
SpecialtyOrthopedics
ComplicationsOsteoarthritis
TypesMain occurrences are femoral and tibial malrotation
CausesSurgical Complication after fracture
TreatmentCompensatory methods or Osteotomy
Bone malrotation refers to the situation that results when a bone heals out of rotational alignment from another bone, or part of bone. It often occurs as the result of a surgical complication after a fracture where intramedullary nailing (IMN) occurs,[1] especially in the femur and tibial bones, but can also occur genetically at birth. The severity of this complication is often neglected due to its complexity to detect and treat,[1] yet if left untreated, bone malrotation can significantly impact regular bodily functioning, and even lead to severe arthritis. Detection throughout history has become more advanced and accurate, ranging from clinical assessment to ultrasounds to CT (computed tomography) scans. Treatment can include an osteotomy, a major surgical procedure where bones are cut and realigned correctly, or compensatory methods, where individuals learn to externally or internally rotate their limb to compensate for the rotation. Further research is currently being examined in this area to reduce occurrences of malrotation, including detailed computer navigation to improve visual accuracy during surgery.[2]
## Contents
* 1 Cause
* 2 Diagnosis
* 2.1 Clinical assessment
* 2.2 Radiography
* 2.3 Ultrasounds
* 2.4 MRI scans
* 2.5 CT scans
* 3 Impacts
* 4 Treatment
* 4.1 Compensatory methods
* 4.2 Osteotomy
* 5 Further research
* 6 References
## Cause[edit]
Bone malrotation predominantly occurs after an injury where a bone is fractured, however malrotation can genetically occur during foetal development. It usually occurs during a surgery which involves intramedullary nailing, which is the insertion of metal rods and nails to stabilise bones. Nailing is used as it requires minimal surgical dissection, less disruption of the fracture hematoma and allows faster functionality to a patient post-surgery.[1][3] However, due to the semi-closed nature of IM, it is impossible to correct under direct vision, so there is less rotational control compared to traditional open methods such as plate fixation.[3] As a result, in many cases of intramedullary nailing, the bone is misaligned which causes malrotated regrowth. This torsional error is a major problem for femoral and tibial fractures, and occurs in 17 to 35% of patients who receive these surgeries,[4] and up to 40% of femur fracture patients.[1]
An x-ray of intramedullary nailing in a tibial fracture
Femoral malrotation is the most significant bone malrotation issue, and these errors cause cosmetic problems but can also cause drastic physical problems.[4]
Historically, bone malrotation occurred due to a lack of adequate treatment measures, where fixation methods such as traction, casting and non-locked nails provided poor torsional stability. Currently, the utilisation of locked intramedullary nailing, has reduced the occurrence of rotational malalignment during fracture healing, yet femoral malrotation continues to remain very prevalent due to surgeon's inability to reliably restore the pre-injury alignment during operation.[1] A high attention to detail is necessary intra-operatively to avoid this complication when locking the intramedullary device.[5] The utilisation of both radiological and clinical assessment techniques to compare with an injured limb would also help prevent bone malrotation, however these can be difficult and inexact methods of assessment, which is why complications are so common.[1]
## Diagnosis[edit]
It is difficult to assess and diagnose the rotational malalignment of a bone after an operation, and many methodologies have been developed.
### Clinical assessment[edit]
Clinical assessment and observation is one methodology, however it is unreliable, and can lead to complications. For femoral or tibial malrotation, many surgeons use the patient's ankle or patella to symmetrically align them with the injured side or to the floor but this method does not consider the position of the proximal fragment and could be moved during reduction attempts.[5] In order to measure femoral malalignment, many doctors will compare the internal and external rotation of both hips, while the patient is supine or prone, and a change in a patient's range of movement indicates malrotation. However, while clinical assessment can indicate the direction of malrotation, it often reports inaccurate measurements of the degree of malalignment, so it is unreliable in determining the potential impacts and necessary treatment methods.[3]
### Radiography[edit]
Another diagnosis methodology sometimes utilised are radiographs; however, they are unreliable as they require difficult patient positioning to quantify the rotational deformity.[5] This difficulty is due to a patient's restriction in movement, as they may exhibit post-traumatic deformities and severe pain. To determine the level of femoral malrotation, with this method, two radiographs of the pelvis and upper legs must be made. Firstly, an anteroposterior (AP) perspective which shows the degree of difference between the femoral neck and femur, and another view where the hips and knees are both flexed to a right angle, which determines antetorsion. Both of these radiographs are utilised to calculate the angle of anteversion of the femoral neck.[3]
### Ultrasounds[edit]
Ultrasounds can also be used to measure bone malrotation, and are considered highly reliable. The main issue with utilising ultrasound measurement is that it relies largely on the skills of an ultrasound technician, and consequently is not widely used. When measuring femoral malrotation with ultrasounds, a patient's thighs are fixed symmetrically while the degree of rotation of the femoral shaft is measured. This methodology requires exact positioning of a patient to correctly measure any deformity.[3]
### MRI scans[edit]
MRI scans can be utilised and are proven to be reliable and effective at determining malrotation of bones. However, they are not as readily available as CT scanners, and are also time consuming and very expensive.[5]
### CT scans[edit]
A person getting a CT scan.
The standard bone malrotation detection practice utilised are computed tomography scans, which are able to exactly quantify the amount of rotational malalignment.[5] It is also considered highly reliable and utilised because of its reproducibility. For femoral malrotation, the scan involves doctors measuring the angle between a line through the axis of the femoral neck and a line tangential to the femoral condyles. The angle difference between the uninjured and injured sides determines the degree of malrotation. An increase in the anteversion of the femoral neck of the injured side denotes internal rotation, and a decrease means external rotation has occurred. Another advantage of CT scans is that patient positioning does not impact the measurement accuracy of femoral torsion, which is unlike radiographs and ultrasounds. However, inaccurate measurements of malrotation can still occur in CT scans, but are mostly related difficulty in drawing clear and accurate lines along the femoral neck within the image. To avoid this inaccuracy, there needs to be improved accuracy of the line drawn, and this can be fixed by the utilisation of multi-image superimposed projection of the CT images so a more accurate measurement can be drawn.[3]
## Impacts[edit]
Whilst malrotation of a bone can be tolerated for most cases, it can still cause severe impacts on functional outcome for some patients. Whilst tibial fractures are the most common long bone fractures, it is malrotation of the femur which can cause the most significant impacts on regular functioning.[6]
If untreated, femoral malrotation can cause considerable gait disturbance and abnormal hip joint pressures.[2] Malrotation of the femur in the setting of a mid-shaft fracture has an impact on the axis of the entire leg, which shifts the centre of force in the knee away from its neutral position. Consequently, femoral malrotation has significant impacts on the mechanical axis and force vectors within the knee. This can cause pain in the hip and knee, and patients may be limited in their movement, which can impair their function, especially in physically demanding activities such as walking up stairs and running.[3] This can impact a person's satisfaction in life, as they may be physically unable to do things they want and need to, such as for laborious work, leisure activities, or raising a family, which can have significant impacts on their psychological health. Femoral malrotation can also cause an abnormally rotated foot, as the angle of a person's foot is directly related to the angle of the femur.[7]
Another significant long term consequence of femoral malrotation if untreated is degenerative arthritis of the hip and knee.[3] This joint arthrosis occurs as there is a proven correlation between rotational error, axis deviation and arthrosis of the knee and hip joints. However, the severity of the arthrosis is dependent on the percentage of malrotation.[4]
Whilst most malrotation problems occurred during surgery, patients with 10° or less difference of malrotation compared with the uninjured side rarely complained of any issues.[8] However, patients with differences greater than 15° found noticeable issues, and above 30° malrotation difference resulted in serious complaints.[5] External femoral malrotation is usually much better tolerated than internal malrotation.[1] However, older studies have found that external rotational deformities are more poorly tolerated,[9] which shows the need for more research in this area.
## Treatment[edit]
There are two main treatment methods; corrective surgery to fix the malrotation, or compensatory methods where patients learn to compensate for any malrotation when walking.
### Compensatory methods[edit]
Many people with bone malrotation, such as femoral malrotation are able to functionally tolerate and learn compensatory methods, such as externally or internally adjusting their limb. Patients will compensate for even considerable rotational malalignment when they are active. However, femoral malrotation is more difficult to compensate for and maintain with non-operative treatment methods.[5] Patients with femoral malrotation of less than 15 degrees give less complaints than those with higher amounts of malalignment, yet many patients are able to tolerate the deformity well.[3]
### Osteotomy[edit]
In extreme cases, the malalignment can be treated by means of a derotational osteotomy which is a major surgical procedure.[3] It can be conducted around the existing intramedullary fixtures, but it usually requires a subtrochanteric osteotomy, which is an invasive surgical approach where bone is cut and realigned. As this is a major procedure, it is beneficial if discovered early, before callus has set, and consequently, patients should be assessed for malrotation in the early post-operative period and a CT scan should occur if abnormalities are found.[5] Correct measurement of bone malalignment with a CT scan is vital when considering an osteotomies in fixing rotational deformities, as torsional differences below 15 degrees are often easily compensated for with non surgical treatment.[3] Revision surgery should be avoided, if not necessary, as implementing femoral nails for a second time leads to higher rates of problems such as infection, nonunion, or nail destabilisation due to overlapping holes for the interlocking screws.[10]
## Further research[edit]
See also: Fluoroscopy
There is currently limited clinical attention in the area of bone malrotation and research into more accurate methods, likely due to the complexity of the issue.[1] Whilst computed tomography scans are useful in determining the degree of bone malrotation after a surgery has occurred, research is being conducted into how to prevent this deformity occurring at all during surgery. CT scans are impractical intraoperatively due to high cost, lack of equipment portability and increased exposure to radiation.[10]
Consequently, one area being researched is that of computer navigation, which could be utilised during these surgeries to avoid malalignment issues. Computer assisted surgery (CAS) matches a patient's anatomy with pre or intraoperatively generated fluoroscopic image data, by using camera detected infrared signals. The computer then calculates the positioning of each component and creates a visual of their position on the monitor. As a result, the surgeon can monitor in real time the position of the surgical instruments in relation to the patient's anatomy and conducts the procedure accordingly.[11] The surgeon can plan the torsional adjustment and control the fracture reduction and nail insertion on a touchscreen of the navigation module.
Currently, this navigation may add extra time during surgery, so it is sometimes considered unnecessary in an urgent surgery. However, without computer navigation, the risk of bone malrotation is significantly increased. The benefit of computer navigation means that surgeons are able to view more clearly and restore axial alignment, but also ensure the injured limb and matches the alignment and length of the uninjured limb.[2] CAS provides increased surgical accuracy and safety for both patients and surgeons, radiation time is reduced, and it utilises minimally invasive techniques which means less tissue damage, improved wound healing, and reduced infections and scarring for patients.[11]
## References[edit]
1. ^ a b c d e f g h Gugala, Z., Qaisi, Y., Hipp, J., & Lindsey, R. (2011). "Long-term functional implications of the iatrogenic rotational malalignment of healed diaphyseal femur fractures following intramedullary nailing". Clinical Biomechanics, 26(3), 274–277.
2. ^ a b c Kahler, D. (2017). "Computer-assisted surgery: The use of stored intraoperative images for accurate restoration of femoral length and rotational alignment after fracture". Injury, 48(s1), S35–S40.
3. ^ a b c d e f g h i j k Jaarsma, R, van Kampen, A. (2004). "Rotational malalignment after fractures of the femur". The Journal of Bone and Joint Surgery, 86(8), 1100–1104.
4. ^ a b c Bretin, P., O'Loughlin, P., Suero, E., Kendoff, D., Ostermeier, S., Hüfner, T., Krettek, C & Citak, M. (2011). "Influence of femoral malrotation on knee joint alignment and intra-articular contract pressures". Archives of Orthopaedic and Trauma Surgery, 131(8), 1115–1120.
5. ^ a b c d e f g h Kent, E, Arora, A, Owen, J & Khanduja, V. (2010). "Assessment and correction of femoral malrotation following intramedullary nailing of the femur". Acta Orthopaedica. 76, 580–584.
6. ^ Theriault, B, Turgeon, A & Pelet, S. (2012). "Functional Impact of Tibial Malrotation Following Intramedullary Nailing of Tibial Shaft Fractures". The Journal of Bone and Joint Surgery. 94, 2033–2039.
7. ^ Staheli LT, Corbett M, Wyss C, King H. (1985). "Lower-extremity rotational problems in children: normal values to guide management". Journal of Bone and Joint Surgery. 67-A,39–47.
8. ^ Yves Vetter S, Swartman B, Beisemann N, Schnetzke M, Keil H, et al. (2016). "Malrotation After Closed Reduction and Intramedullary Nailing of Femoral Shaft Fractures", Journal of Orthopedic and Spine Trauma. 2, 2.
9. ^ Johnson KD, Greenberg M. (1987). "Comminuted femoral shaft fractures". Orthopaedics Clinic of North America. 18:133–47.
10. ^ a b Lieberman, G, Jansen, K, Mast, L, Brady, J, Yoo, B. (2018). "Comparison of fluoroscopic techniques for assessment of femoral rotational alignment". Orthopaedic Trauma Association International. 1, 1, 4.
11. ^ a b Dirhold, B, Citak, M, Al-Khateeb, H, Haasper, C, Kendoff, D, Krettek, C, Citak, M. (2012). "Current state of computer-assisted trauma surgery". Musculoskeletal Medical Journal. 5,3, 184–191.
This article needs additional or more specific categories. Please help out by adding categories to it so that it can be listed with similar articles. (November 2019)
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Bone malrotation
|
None
| 8,511 |
wikipedia
|
https://en.wikipedia.org/wiki/Bone_malrotation
| 2021-01-18T18:59:25 |
{"wikidata": ["Q85748175"]}
|
Blood cancer characterised by overproduction of lymphoblasts
Acute lymphoblastic leukemia
Other namesAcute lymphocytic leukemia, acute lymphoid leukemia
Bone marrow aspirate smear from a person with precursor B-cell ALL. The large purple cells are lymphoblasts.
SpecialtyHematology, oncology
SymptomsFeeling tired, pale color, fever, easy bleeding or bruising, bone pain, enlarged lymph nodes[1]
ComplicationsInfection, tumor lysis syndrome[2][3]
Usual onset2–5 years old[4]
TypesB-cell ALL, T-cell ALL[2]
CausesUsually unknown[5]
Risk factorsIdentical twin with ALL, Down syndrome, Fanconi anemia, ataxia telangiectasia, Klinefelter syndrome, high birth weight, significant radiation exposure[6][5][1]
Diagnostic methodBlood tests and bone marrow examination[3]
Differential diagnosisInfectious mononucleosis, acute myeloid leukemia, lymphoblastic lymphoma, aplastic anemia[3]
TreatmentChemotherapy, stem cell transplantation, radiation therapy, targeted therapy[1]
PrognosisChildren: 90% five-year survival rate[2]
Adults: 35% five-year survival[7]
Frequency1 in 1,750 children[4][8]
Deaths111,000 (2015)[9]
Acute lymphoblastic leukemia (ALL) is a cancer of the lymphoid line of blood cells characterized by the development of large numbers of immature lymphocytes.[1] Symptoms may include feeling tired, pale skin color, fever, easy bleeding or bruising, enlarged lymph nodes, or bone pain.[1] As an acute leukemia, ALL progresses rapidly and is typically fatal within weeks or months if left untreated.[10]
In most cases, the cause is unknown.[2] Genetic risk factors may include Down syndrome, Li-Fraumeni syndrome, or neurofibromatosis type 1.[1] Environmental risk factors may include significant radiation exposure or prior chemotherapy.[1] Evidence regarding electromagnetic fields or pesticides is unclear.[4][6] Some hypothesize that an abnormal immune response to a common infection may be a trigger.[4] The underlying mechanism involves multiple genetic mutations that results in rapid cell division.[2] The excessive immature lymphocytes in the bone marrow interfere with the production of new red blood cells, white blood cells, and platelets.[1] Diagnosis is typically based on blood tests and bone marrow examination.[3]
ALL is typically treated initially with chemotherapy aimed at bringing about remission.[2] This is then followed by further chemotherapy typically over a number of years.[2] Additional treatments may include intrathecal chemotherapy or radiation therapy if spread to the brain has occurred.[2] Stem cell transplantation may be used if the disease recurs following standard treatment.[2] Additional treatments such as Chimeric antigen receptor T cell immunotherapy are being used and further studied.[2]
ALL affected about 876,000 people globally in 2015 and resulted in about 111,000 deaths.[11][9] It occurs most commonly in children, particularly those between the ages of two and five.[12][4] In the United States it is the most common cause of cancer and death from cancer among children.[2] ALL is notable for being the first disseminated cancer to be cured.[13] Survival for children increased from under 10% in the 1960s to 90% in 2015.[2] Survival rates remain lower for babies (50%)[14] and adults (35%).[7]
## Contents
* 1 Signs and symptoms
* 2 Cause
* 2.1 Risk factors
* 2.1.1 Genetics
* 2.1.2 Environmental
* 2.1.2.1 Infections
* 3 Mechanism
* 4 Diagnosis
* 4.1 Immunophenotyping
* 4.2 Cytogenetics
* 4.3 Classification
* 5 Treatment
* 5.1 Chemotherapy
* 5.2 Radiation therapy
* 5.3 Biological therapy
* 5.4 Immunotherapy
* 5.5 Relapsed ALL
* 5.6 Side effects
* 5.7 Supportive therapy
* 6 Prognosis
* 7 Epidemiology
* 8 Pregnancy
* 9 References
* 10 External links
## Signs and symptoms[edit]
Initial symptoms can be nonspecific, particularly in children. Over 50% of children with leukemia had one or more of five features: a liver one can feel (64%), a spleen one can feel (61%), pale complexion (54%), fever (53%), and bruising (52%).[15] Additionally, recurrent infections, feeling tired, arm or leg pain, and enlarged lymph nodes can be prominent features. The B symptoms, such as fever, night sweats, and weight loss, are often present as well.[citation needed]
Central nervous system (CNS) symptoms such as cranial neuropathies due to meningeal infiltration are identified in less than 10% of adults and less than 5% of children, particularly mature B-cell ALL (Burkitt leukemia) at presentation.[16]
The signs and symptoms of ALL are variable and include:[17]
* Generalized weakness and feeling tired
* Anemia
* Dizziness
* Headache, vomiting, lethargy, neck stiffness,[18] or cranial nerve palsies[19] (CNS involvement)
* Frequent or unexplained fever and infection
* Weight loss and/or loss of appetite
* Excessive and unexplained bruising
* Bone pain, joint pain (caused by the spread of "blast" cells to the surface of the bone or into the joint from the marrow cavity)
* Breathlessness
* Enlarged lymph nodes, liver and/or spleen
* Pitting edema (swelling) in the lower limbs and/or abdomen
* Petechiae, which are tiny red spots or lines in the skin due to low platelet levels
* Testicular enlargement
* Mediastinal mass
## Cause[edit]
In ALL, lymphoid cell development stops at the lymphoblast (arrow), which are also overproduced
The cancerous cell in ALL is the lymphoblast. Normal lymphoblasts develop into mature, infection-fighting B-cells or T-cells, also called lymphocytes. Signals in the body control the number of lymphocytes so neither too few nor too many are made. In ALL, both the normal development of some lymphocytes and the control over the number of lymphoid cells become defective.[4][20]
ALL emerges when a single lymphoblast gains many mutations to genes that affect blood cell development and proliferation. In childhood ALL, this process begins at conception with the inheritance of some of these genes. These genes, in turn, increase the risk that more mutations will occur in developing lymphoid cells. Certain genetic syndromes, like Down Syndrome, have the same effect. Environmental risk factors are also needed to help create enough genetic mutations to cause disease. Evidence for the role of the environment is seen in childhood ALL among twins, where only 10–15% of both genetically identical twins get ALL. Since they have the same genes, different environmental exposures explain why one twin gets ALL and the other does not.[4]
Infant ALL is a rare variant that occurs in babies less than one year old. KMT2A (formerly MLL) gene rearrangements are most common and occur in the embryo or fetus before birth.[4] These rearrangements result in increased expression of blood cell development genes by promoting gene transcription and through epigenetic changes.[21][22] In contrast to childhood ALL, environmental factors are not thought to play a significant role. Aside from the KMT2A rearrangement, only one extra mutation is typically found.[4] Environmental exposures are not needed to help create more mutations.
### Risk factors[edit]
#### Genetics[edit]
Common inherited risk factors include mutations in ARID5B, CDKN2A/2B, CEBPE, IKZF1, GATA3, PIP4K2A and, more rarely, TP53. These genes play important roles in cellular development, proliferation, and differentiation.[6][4][2] Individually, most of these mutations are low risk for ALL. Significant risk of disease occurs when a person inherits several of these mutations together.[4]
The uneven distribution of genetic risk factors may help explain differences in disease rate among ethnic groups. For instance, the ARID5B mutation is less common in ethnic African populations.[4]
Several genetic syndrome also carry increased risk of ALL. These include: Down syndrome, Fanconi anemia, Bloom syndrome, X-linked agammaglobulinemia, severe combined immunodeficiency, Shwachman-Diamond syndrome, Kostmann syndrome, neurofibromatosis type 1, ataxia-telangiectasia, paroxysmal nocturnal hemoglobinuria, and Li-Fraumeni syndrome.[13] Fewer than 5% of cases are associated with a known genetic syndrome.[7]
Rare mutations in ETV6 and PAX5 are associated with a familial form of ALL with autosomal dominant patterns of inheritance.[2]
#### Environmental[edit]
The environmental exposures that contribute to emergence of ALL is contentious and a subject of ongoing debate.[6][4]
High levels of radiation exposure from nuclear fallout is a known risk factor for developing leukemia.[23] Evidence whether lesser radiation, as from x-ray imaging during pregnancy, increases risk of disease remains inconclusive.[6] Studies that have identified an association between x-ray imaging during pregnancy and ALL found only a slightly increased risk.[4] Exposure to strong electromagnetic radiation from power lines has also been associated with a slightly increased risk of ALL. This result is questioned as no causal mechanism linking electromagnetic radiation with cancer is known.[6][4]
High birth weight (greater than 4000g or 8.8lbs) is also associated with a small increased risk. The mechanism connecting high birth weight to ALL is also not known.[6]
Evidence suggests that secondary leukemia can develop in individuals treated with certain types of chemotherapy, such as epipodophyllotoxins and cyclophosphamide.[6][24]
##### Infections[edit]
There is some evidence that a common infection, such as influenza, may indirectly promote emergence of ALL.[6][4] The delayed-infection hypothesis states that ALL results from an abnormal immune response to infection in a person with genetic risk factors. Delayed development of the immune system due to limited disease exposure may result in excessive production of lymphocytes and increased mutation rate during an illness. Several studies have identified lower rates of ALL among children with greater exposure to illness early in life. Very young children who attend daycare have lower rates of ALL. Evidence from many other studies looking at disease exposure and ALL is inconclusive.[6] Some researchers have linked the hygiene hypothesis.[25]
## Mechanism[edit]
Several characteristic genetic changes lead to the creation of a leukemic lymphoblast. These changes include chromosomal translocations, intrachromosomal rearrangements, changes in the number of chromosomes in leukemic cells, and additional mutations in individual genes.[2] Chromosomal translocations involve moving a large region of DNA from one chromosome to another. This move can result in placing a gene from one chromosome that promotes cell division to a more actively transcribed area on another chromosome. The result is a cell that divides more often. An example of this includes the translocation of C-MYC, a gene that encodes a transcription factor that leads to increased cell division, next to the immunoglobulin heavy\- or light-chain gene enhancers, leading to increased C-MYC expression and increased cell division.[2] Other large changes in chromosomal structure can result in placement of two genes directly next to each other. The result is the combination of two usually separate proteins into a new fusion protein. This protein can have a new function that promotes the development of cancer. Examples of this include the ETV6-RUNX1 fusion gene that combines two factors that promote blood cell development and the BCR-ABL1 fusion gene of the Philadelphia chromosome. BCR-ABL1 encodes an always-activated tyrosine kinase that causes frequent cell division. These mutations produce a cell that divides more often, even in the absence of growth factors.[4][2]
Other genetic changes in B-cell ALL include changes to the number of chromosomes within the leukemic cells. Gaining at least five additional chromosomes, called high hyperdiploidy, occurs more commonly. Less often, chromosomes are lost, called hypodiploidy, which is associated with a poorer prognosis. Additional common genetic changes in B-cell ALL involve non-inherited mutations to PAX5 and IKZF1.[2] In T-cell ALL, LYL1, TAL1, TLX1, and TLX3 rearrangements can occur.[4]
ALL results when enough of these genetic changes are present in a single lymphoblast. In childhood ALL, for example, one fusion gene translocation is often found along with six to eight other ALL-related genetic changes.[4] The initial leukemic lymphoblast copies itself into an excessive number of new lymphoblasts, none of which can develop into functioning lymphocytes. These lymphoblasts build up in the bone marrow and may spread to other sites in the body, such as lymph nodes, the mediastinum, the spleen, the testicles, and the brain, leading to the common symptoms of disease.[2]
## Diagnosis[edit]
Diagnosing ALL begins with a thorough medical history, physical examination, complete blood count, and blood smears. While many symptoms of ALL can be found in common illnesses, persistent or unexplained symptoms raise suspicion of cancer. Because many features on the medical history and exam are not specific to ALL, further testing is often needed. A large number of white blood cells and lymphoblasts in the circulating blood can be suspicious for ALL because they indicate a rapid production of lymphoid cells in the marrow. The higher these numbers typically points to a worse prognosis.[26] While white blood cell counts at initial presentation can vary significantly, circulating lymphoblast cells are seen on peripheral blood smears in the majority of cases.[5]
A bone marrow biopsy provides conclusive proof of ALL, typically with >20% of all cells being leukemic lymphoblasts.[27] A lumbar puncture (also known as a spinal tap) can determine whether the spinal column and brain have been invaded. Brain and spinal column involvement can be diagnosed either through confirmation of leukemic cells in the lumbar puncture or through clinical signs of CNS leukemia as described above. Laboratory tests that might show abnormalities include blood count, kidney function, electrolyte, and liver enzyme tests.[17]
Pathological examination, cytogenetics (in particular the presence of Philadelphia chromosome), and immunophenotyping establish whether the leukemic cells are myeloblastic (neutrophils, eosinophils, or basophils) or lymphoblastic (B lymphocytes or T lymphocytes). Cytogenetic testing on the marrow samples can help classify disease and predict how aggressive the disease course will be. Different mutations have been associated with shorter or longer survival. Immunohistochemical testing may reveal TdT or CALLA antigens on the surface of leukemic cells. TdT is a protein expressed early in the development of pre-T and pre-B cells, whereas CALLA is an antigen found in 80% of ALL cases and also in the "blast crisis" of CML.
Medical imaging (such as ultrasound or CT scanning) can find invasion of other organs commonly the lung, liver, spleen, lymph nodes, brain, kidneys, and reproductive organs.[28]
* acute lymphoblastic leukemia (ALL), peripheral blood of a child, Pappenheim stain, magnification x100
* bone marrow smear (large magnification) from a person with acute lymphoblastic leukemia
* bone marrow smear from a person with acute lymphoblastic leukemia
### Immunophenotyping[edit]
In addition to cell morphology and cytogenetics, immunophenotyping, a laboratory technique used to identify proteins that are expressed on their cell surface, is a key component in the diagnosis of ALL. The preferred method of immunophenotyping is through flow cytometry. In the malignant lymphoblasts of ALL, expression of terminal deoxynucleotidyl transferase (TdT) on the cell surface can help differentiate malignant lymphocyte cells from reactive lymphocytes, white blood cells that are reacting normally to an infection in the body. On the other hand, myeloperoxidase (MPO), a marker for the myeloid lineage, is typically not expressed. Because precursor B cell and precursor T cells look the same, immunophenotyping can help differentiate the subtype of ALL and the level of maturity of the malignant white blood cells. The subtypes of ALL as determined by immunophenotype and according to the stages of maturation.[5]
B cell Lineage T cell Lineage
pre-pre-B ALL (pro-B-ALL) precursor T- ALL
common ALL mature T-cell ALL
pre-B ALL
mature B-cell ALL (Burkitt leukemia - FAB L3)
An extensive panel of monoclonal antibodies to cell surface markers, particularly CD or cluster of differentiation markers, are used to classify cells by lineage. Below are immunological markers associated with B cell and T cell ALL.[29]
Immunological Markers B cell Lineage T cell Lineage
B cell Lineage
CD19, CD22, CD79a \+ \-
CD10 \- or + (common ALL)
cytoplasmic Ig \- or + (pre-B ALL)
surface Ig \- or + (mature B-cell ALL)
TdT \+ \+
T cell Lineage
CD2, CD3, CD4, CD5, CD7, CD8 \- \+
TdT \+ \+
### Cytogenetics[edit]
Cytogenetic analysis has shown different proportions and frequencies of genetic abnormalities in cases of ALL from different age groups. This information is particularly valuable for classification and can in part explain different prognosis of these groups. In regards to genetic analysis, cases can be stratified according to ploidy, number of sets of chromosomes in the cell, and specific genetic abnormalities, such as translocations. Hyperdiploid cells are defined as cells with more than 50 chromosomes, while hypodiploid is defined as cells with less than 44 chromosomes. Hyperdiploid cases tend to carry good prognosis while hypodiploid cases do not.[29] For example, the most common specific abnormality in childhood B-ALL is the t(12;21) ETV6-RUNX1 translocation, in which the RUNX1 gene, encoding a protein involved in transcriptional control of hemopoiesis, has been translocated and repressed by the ETV6-RUNX1 fusion protein.[30]
Below is a table with the frequencies of some cytogenetic translocations and molecular genetic abnormalities in ALL.
Cytogenetic translocation Molecular genetic abnormality %
cryptic t(12;21) TEL–AML1 fusion[31] 25.4%[32]
t(1;19)(q23;p13) E2A–PBX (PBX1) fusion[33] 4.8%[32]
t(9;22)(q34;q11) BCR-ABL fusion(P185)[34] 1.6%[32]
t(4;11)(q21;q23) MLL–AF4 fusion[35] 1.6%[32]
t(8;14)(q24;q32) IGH-MYC fusion[36]
t(11;14)(p13;q11) TCR–RBTN2 fusion[37]
### Classification[edit]
French-American-British
Historically, prior to 2008, ALL was classified morphologically using the French-American-British (FAB) system that heavily relied on morphological assessment. The FAB system takes into account information on size, cytoplasm, nucleoli, basophilia (color of cytoplasm), and vacuolation (bubble-like properties).[38][39]
FAB Subtype Cell Type Characteristics Comments
ALL - L1 T cell or pre-B cell Small and homogeneous (uniform) cells
ALL - L2 T cell or pre-B cell Large and heterogeneous (varied) cells
ALL - L3 B cell Large and varied cells with vacuoles Mature B-cell ALL also named Burkitt leukemia. Typically, poor prognosis with standard therapy
While some clinicians still use the FAB scheme to describe tumor cell appearance, much of this classification has been abandoned because of limited impact on treatment choice and prognostic value.[40]:491
World Health Organization
In 2008, the World Health Organization classification of acute lymphoblastic leukemia was developed in an attempt to create a classification system that was more clinically relevant and could produce meaningful prognostic and treatment decisions. This system recognized differences in genetic, immunophenotype, molecular, and morphological features found through cytogenetic and molecular diagnostics tests.[41]:1531–1535[29] This subtyping helps determine the prognosis and the most appropriate treatment for each specific case of ALL.
The WHO subtypes related to ALL are:[42]
* B-lymphoblastic leukemia/lymphoma
* Not otherwise specified (NOS)
* with recurrent genetic abnormalities
* with t(9;22)(q34.1;q11.2);BCR-ABL1
* with t(v;11q23.3);KMT2A rearranged
* with t(12;21)(p13.2;q22.1); ETV6-RUNX1
* with t(5;14)(q31.1;q32.3) IL3-IGH
* with t(1;19)(q23;p13.3);TCF3-PBX1
* with hyperdiploidy
* with hypodiploidy
* T-lymphoblastic leukemia/lymphoma
* Acute leukemias of ambiguous lineage
* Acute undifferentiated leukemia
* Mixed phenotype acute leukemia (MPAL) with t(9;22)(q34.1;q11.2); BCR-ABL1
* MPAL with t(v;11q23.3); KMT2A rearranged
* MPAL, B/myeloid, NOS
* MPAL, T/myeloid, NOS
## Treatment[edit]
Two girls with ALL demonstrating intravenous access for chemotherapy
The aim of treatment is to induce a lasting remission, defined as the absence of detectable cancer cells in the body (usually less than 5% blast cells in the bone marrow).
Over the past several decades, there have been strides to increase the efficacy of treatment regimens, resulting in increased survival rates. Possible treatments for acute leukemia include chemotherapy, steroids, radiation therapy, intensive combined treatments (including bone marrow or stem cell transplants), and/or growth factors.[43]
### Chemotherapy[edit]
Chemotherapy is the initial treatment of choice, and most people with ALL receive a combination of medications. There are no surgical options because of the body-wide distribution of the malignant cells. In general, cytotoxic chemotherapy for ALL combines multiple antileukemic drugs tailored to each person. Chemotherapy for ALL consists of three phases: remission induction, intensification, and maintenance therapy.
Phase Description[44][45] Agents[44][45]
Remission induction Aim to:
* Rapidly kill most tumor cells
* Reduce leukemic blasts in the bone marrow to <5% and eliminate tumor cells from blood
* Induce absence of other signs and symptoms of the disease.
Must monitor closely for tumor lysis syndrome after initiating therapy
Monitoring initial response to treatment is important as failure to show clearance of blood or bone marrow blasts within the first 2 weeks of therapy has been associated with higher risk of relapse
* May need to intensify treatment if remission is not induced
Start CNS prophylaxis and administer intrathecal chemotherapy via Ommaya reservoir or multiple lumbar punctures
Combination of:
* steroids - prednisolone or dexamethasone
* vincristine
* asparaginase (better tolerance in people in pediatric care)
* daunorubicin (used in Adult ALL)
Central nervous system prophylaxis can be achieved via:[46]
* cranio-spinal irradiation
* cytarabine \+ methotrexate
* or liposomal cytarabine
In Philadelphia chromosome-positive ALL, the intensity of initial induction treatment may be less than has been traditionally given.[47][48]
Consolidation/intensification Use high doses of chemotherapy to further reduce tumor burden Typical protocols use the following given as blocks (varies from 1-3 blocks depending on person's risk category) in different multi-drug combinations:
* vincristine
* cyclophosphamide
* cytarabine
* daunorubicin
* etoposide
* thioguanine
* mercaptopurine
Central nervous system relapse is treated with intrathecal administration of hydrocortisone, methotrexate, and cytarabine.
Maintenance therapy Kill any residual cell that was not killed by remission induction and intensification regimens
* Can sometimes start immediately after remission induction and be interrupted by bursts of consolidation/intensification therapy
* Although such residual cells are few, they will cause relapse if not eradicated
* Length of maintenance therapy is 3 years for boys, 2 years for girls and adults
Typical protocol would include:
* daily oral mercaptopurine
* weekly oral methotrexate
* monthly 5-day course of intravenous vincristine and oral corticosteroids
Due to presence of CNS involvement in 10–40% of adult with ALL at diagnosis, most providers start Central nervous system (CNS) prophylaxis and treatment during the induction phase, and continue it during the consolidation/intensification period.
Adult chemotherapy regimens mimic those of childhood ALL; however, are linked with a higher risk of disease relapse with chemotherapy alone. It should be known that 2 subtypes of ALL (B-cell ALL and T-cell ALL) require special considerations when it comes to selecting an appropriate treatment regimen in adult with ALL. B-cell ALL is often associated with cytogenetic abnormalities (specifically, t(8;14), t (2;8) and t(8;22)), which require aggressive therapy consisting of brief, high-intensity regimens. T-cell ALL responds to cyclophosphamide-containing agents the most.[45]
As the chemotherapy regimens can be intensive and protracted, many people have an intravenous catheter inserted into a large vein (termed a central venous catheter or a Hickman line), or a Portacath, usually placed near the collar bone, for lower infection risks and the long-term viability of the device.Males usually endure a longer course of treatment than females as the testicles can act as a reservoir for the cancer.[citation needed]
### Radiation therapy[edit]
Radiation therapy (or radiotherapy) is used on painful bony areas, in high disease burdens, or as part of the preparations for a bone marrow transplant (total body irradiation). In the past, physicians commonly utilized radiation in the form of whole-brain radiation for central nervous system prophylaxis, to prevent occurrence and/or recurrence of leukemia in the brain. Recent studies showed that CNS chemotherapy provided results as favorable but with less developmental side-effects. As a result, the use of whole-brain radiation has been more limited. Most specialists in adult leukemia have abandoned the use of radiation therapy for CNS prophylaxis, instead using intrathecal chemotherapy.[49][7]
### Biological therapy[edit]
Selection of biological targets on the basis of their combinatorial effects on the leukemic lymphoblasts can lead to clinical trials for improvement in the effects of ALL treatment.[50] Tyrosine-kinase inhibitors (TKIs), such as imatinib, are often incorporated into the treatment plan for people with Bcr-Abl1+ (Ph+) ALL. However, this subtype of ALL is frequently resistant to the combination of chemotherapy and TKIs and allogeneic stem cell transplantation is often recommended upon relapse.[49]
Blinatumomab, a CD19-CD3 bi-specific monoclonal murine antibody, currently shows promise as a novel pharmacotherapy. By engaging the CD3 T-cell with the CD19 receptor on B cells, it triggers a response to induce the release of inflammatory cytokines, cytotoxic proteins and proliferation of T cells to kill CD19 B cells.[7][45]
### Immunotherapy[edit]
Chimeric antigen receptors (CARs) have been developed as a promising immunotherapy for ALL. This technology uses a single chain variable fragment (scFv) designed to recognize the cell surface marker CD19 as a method of treating ALL.
CD19 is a molecule found on all B-cells and can be used as a means of distinguishing the potentially malignant B-cell population. In this therapy, mice are immunized with the CD19 antigen and produce anti-CD19 antibodies. Hybridomas developed from mouse spleen cells fused to a myeloma cell line can be developed as a source for the cDNA encoding the CD19 specific antibody.[51] The cDNA is sequenced and the sequence encoding the variable heavy and variable light chains of these antibodies are cloned together using a small peptide linker. This resulting sequence encodes the scFv. This can be cloned into a transgene, encoding what will become the endodomain of the CAR. Varying arrangements of subunits serve as the endodomain, but they generally consist of the hinge region that attaches to the scFv, a transmembrane region, the intracellular region of a costimulatory molecule such as CD28, and the intracellular domain of CD3-zeta containing ITAM repeats. Other sequences frequently included are: 4-1bb and OX40.[52] The final transgene sequence, containing the scFv and endodomain sequences is then inserted into immune effector cells that are obtained from the person and expanded in vitro. In trials these have been a type of T-cell capable of cytotoxicity.[53]
Inserting the DNA into the effector cell can be accomplished by several methods. Most commonly, this is done using a lentivirus that encodes the transgene. Pseudotyped, self-inactivating lentiviruses are an effective method for the stable insertion of a desired transgene into the target cell.[54] Other methods include electroporation and transfection, but these are limited in their efficacy as transgene expression diminishes over time.
The gene-modified effector cells are then transplanted back into the person. Typically this process is done in conjunction with a conditioning regimen such as cyclophosphamide, which has been shown to potentiate the effects of infused T-cells. This effect has been attributed to making an immunologic space within which the cells populate.[52] The process as a whole results in an effector cell, typically a T-cell, that can recognize a tumor cell antigen in a manner that is independent of the major histocompatibility complex and which can initiate a cytotoxic response.
In 2017 tisagenlecleucel was approved by the FDA as a CAR-T therapy for people with acute B-cell lymphoblastic leukaemia who did not respond adequately to other treatments or have relapsed.[55] In a 22-day process, the "drug" is customized for each person. T cells purified from each person are modified by a virus that inserts genes that encode a chimaeric antigen receptor into their DNA, one that recognizes leukemia cells.[56]
### Relapsed ALL[edit]
Typically, people who experience a relapse in their ALL after initial treatment have a poorer prognosis than those who remain in complete remission after induction therapy. It is unlikely that the recurrent leukemia will respond favorably to the standard chemotherapy regimen that was initially implemented, and instead these people should be trialed on reinduction chemotherapy followed by allogeneic bone marrow transplantation. These people in relapse may also receive blinatumomab, as it has shown to increase remission rates and overall survival rates, without increased toxic effects.[57]
Low dose palliative radiation may also help reduce the burden of tumor inside or outside the central nervous system and alleviate some symptoms.
Recently, there has also been evidence and approval of use for dasatinib, a tyrosine kinase inhibitor. It has shown efficacy in cases of people with Ph1-positive and imatinib-resistant ALL, but more research needs to be done on long term survival and time to relapse.[45]
### Side effects[edit]
Chemotherapies or stem cell transplantations may require a platelet transfusion to prevent bleeding.[58][59] Moreover, patients undergoing a stem cell transplantation can develop a graft-versus-host disease (GvHD). It was evaluated whether mesenchymal stromal cells can be used to prevent a GvHD. The evidence is very uncertain about the therapeutic effect of mesenchymal stromal cells to treat graft-versus-host diseases after a stem cell transplantation on the all-cause mortality and complete disappear of chronic acute graft-versus-host diseases. Mesenchymal stromal cells may results in little to no difference in the all-cause mortality, relapse of malignant disease and incidence of acute and chronic graft-versus-host diseases if they are used for prophylactic reason.[60]
### Supportive therapy[edit]
Adding physical exercises to the standard treatment for adult patients with haematologicl malignancies like ALL may result in little to no difference in the mortality, the quality of life and the physical functioning. These exercises may result in a slight reduction in depression. Furthermore, aerobic physical exercises probably reduce fatigue. The evidence is very uncertain about the effect on anxiety and serious adverse events.[61]
## Prognosis[edit]
Prior to the development of chemotherapy regimens and hematopoietic stem cell transplant, children were surviving a median length of 3 months, largely due to either infection or bleeding. Since the advent of chemotherapy, prognosis for childhood leukemia has improved greatly and children with ALL are estimated to have a 95% probability of achieving a successful remission after 4 weeks of initiating treatment. People in pediatric care with ALL in developed countries have a greater than 80% five-year-survival rate. It is estimated that 60–80% of adults undergoing induction chemotherapy achieve complete remission after 4 weeks, and those over the age of 70 have a cure rate of 5%.[44]Hutter JJ (June 2010). "Childhood leukemia". Pediatrics in Review. 31 (6): 234–41. doi:10.1542/pir.31-6-234. PMID 20516235.</ref>
Graphs of overall survival rates at 5 years and 10 years in people in pediatric care and adults with ALL
However, there are differing prognoses for ALL among individuals depending on a variety of factors:
* Gender: Females tend to fare better than males.
* Ethnicity: Caucasians are more likely to develop acute leukemia than African-Americans, Asians, or Hispanics. However, they also tend to have a better prognosis than non-Caucasians.
* Age at diagnosis: children 1–10 years of age are most likely to develop ALL and to be cured of it. Cases in older people are more likely to result from chromosomal abnormalities (e.g., the Philadelphia chromosome) that make treatment more difficult and prognoses poorer. Older people are also likely to have co-morbid medical conditions that make it even more difficult to tolerate ALL treatment.
* White blood cell count at diagnosis of greater than 30,000 (B-ALL) or 100,000 (T-ALL) is associated with worse outcomes
* Cancer spreading into the Central nervous system (brain or spinal cord) has worse outcomes.
* Morphological, immunological, and genetic subtypes
* Person's response to initial treatment and longer length of time required (greater than 4 weeks) to reach complete remission
* Early relapse of ALL
* Minimal residual disease
* Genetic disorders, such as Down syndrome, and other chromosomal abnormalities (aneuoploidy and translocations)[62]
In children[63][64][65] Factor Unfavorable Favorable
Age <2 or >10 years 3–5 years
Sex Male Female
Race Black Caucasian
Organomegaly Present Absent
Mediastinal mass Present Absent
CVS involvement Present Absent
Leukocyte count B-ALL >30,000mm3 T-ALL >100,000mm3 Low
Hemogblobin concentration >10g/dl <10g/dl
Cell type Non Lymphoid Lymphoid
Cell lineage Pre B cell +
T-ALL (children)
Early Pre B cell
Karyotype Translocation Hyperdiploidy
Response to treatment Slow
>1 week to clear blasts from blood
Rapid
<1 week to clear blasts from blood
Time to remission >4 weeks <4 weeks
Minimal residual disease Positive at 3 – 6 months Negative at 1 month (children) or 3 months (adults)
Cytogenetics, the study of characteristic large changes in the chromosomes of cancer cells, is an important predictor of outcome.[66] Some cytogenetic subtypes have a worse prognosis than others. These include:[17]
* Person with t(9,22) positive-ALL (30% of adult ALL cases) and other Bcr-abl-rearranged leukemias are more likely to have a poor prognosis, but survival rates may rise with treatment consisting of chemotherapy and Bcr-abl tyrosine kinase inhibitors.[45]
* A translocation between chromosomes 4 and 11 occurs in about 4% of cases and is most common in infants under 12 months.
Cytogenetic change Risk category
Philadelphia chromosome Poor prognosis
t(4;11)(q21;q23) Poor prognosis
t(8;14)(q24.1;q32) Poor prognosis
Complex karyotype (more than four abnormalities) Poor prognosis
Low hypodiploidy or near triploidy Poor prognosis
Deletion of chromosome 7 Poor prognosis
Trisomy 8 Poor prognosis
High hyperdiploidy (trisomy 4, 10, 17) Good prognosis
del(9p) Good prognosis
* Hyperdiploidy (>50 chromosomes) and t(12;21) are good prognostic factors and also make up 50% of pediatric ALL cases.
Based on bone marrow cytogenetics Prognosis Cytogenetic findings
Favorable Hyperdiploidy > 50 ; t (12;21)
Intermediate Hyperdiploidy 47–50; Normal(diploidy); del (6q); Rearrangements of 8q24
Unfavorable Hypodiploidy-near haploidy; Near tetraploidy; del (17p); t (9;22); t (11q23)
Unclassified ALL is considered to have an intermediate prognosis risk,[67] somewhere in-between the good and poor risk categories.
## Epidemiology[edit]
ALL affected about 876,000 people and resulted in 111,000 deaths globally in 2015.[11][9] It occurs in both children and adults with highest rates seen between the ages three and seven years. Around 75% of cases occur before the age of 6 with a secondary rise after the age of 40.[44] It is estimated to affect 1 in 1500 children.[8]
Accounting for the broad age profiles of those affected, ALL newly occurs in about 1.7 per 100,000 people per year.[5] ALL represents approximately 20% of adult and 80% of childhood leukemias, making it the most common childhood cancer.[5] Although 80 to 90% of children will have a long term complete response with treatment,[41]:1527 it remains the leading cause of cancer-related deaths among children.[68] 85% of cases are of B-cell lineage and have equal number of cases in both males and females. The remaining 15% of T-cell lineage have a male predominance.
Globally, ALL typically occurs more often in Caucasians, Hispanics, and Latin Americans than in Africans.[69]:1617[70] In the US, ALL is more common in children from Caucasian (36 cases/million) and Hispanic (41 cases/million) descent when compared to those from African (15 cases/million) descent.[71]
## Pregnancy[edit]
Leukemia is rarely associated with pregnancy, affecting only about 1 in 10,000 pregnant women.[72] The management of leukemia in a pregnant person depends primarily on the type of leukemia. Acute leukemias normally require prompt, aggressive treatment, despite significant risks of pregnancy loss and birth defects, especially if chemotherapy is given during the developmentally sensitive first trimester.[72]
## References[edit]
1. ^ a b c d e f g h "Childhood Acute Lymphoblastic Leukemia Treatment". National Cancer Institute. 8 December 2017. Retrieved 20 December 2017.
2. ^ a b c d e f g h i j k l m n o p q r s Hunger SP, Mullighan CG (October 2015). "Acute Lymphoblastic Leukemia in Children". The New England Journal of Medicine. 373 (16): 1541–52. doi:10.1056/nejmra1400972. PMID 26465987. S2CID 609394.
3. ^ a b c d Ferri, Fred F. (2017). Ferri's Clinical Advisor 2018 E-Book: 5 Books in 1. Elsevier Health Sciences. p. 743. ISBN 9780323529570.
4. ^ a b c d e f g h i j k l m n o p q r s Inaba H, Greaves M, Mullighan CG (June 2013). "Acute lymphoblastic leukaemia". Lancet. 381 (9881): 1943–55. doi:10.1016/S0140-6736(12)62187-4. PMC 3816716. PMID 23523389.
5. ^ a b c d e f Baljevic M, Jabbour E, O'Brien S, Kantarjian HM (2016). "Acute Lymphoblastic Leukemia". In Kantarjian HM, Wolff RA (eds.). The MD Anderson Manual of Medical Oncology (3 ed.). New York: McGraw-Hill Education. Retrieved 22 November 2017.
6. ^ a b c d e f g h i j Childhood acute lymphoblastic leukemia. Vora, Ajay (editor). Cham, Switzerland: Springer International Publishing. 2017. pp. 1–44, 61–86. ISBN 9783319397078. OCLC 984342596.CS1 maint: others (link)
7. ^ a b c d e Paul S, Kantarjian H, Jabbour EJ (November 2016). "Adult Acute Lymphoblastic Leukemia". Mayo Clinic Proceedings. 91 (11): 1645–1666. doi:10.1016/j.mayocp.2016.09.010. PMID 27814839.
8. ^ a b Boer JM, den Boer ML (September 2017). "BCR-ABL1-like acute lymphoblastic leukaemia: From bench to bedside". European Journal of Cancer. 82: 203–218. doi:10.1016/j.ejca.2017.06.012. PMID 28709134.
9. ^ a b c Wang, Haidong; Naghavi, Mohsen; Allen, Christine; Barber, Ryan M.; Bhutta, Zulfiqar A.; Carter, Austin; Casey, Daniel C.; Charlson, Fiona J.; Chen, Alan Zian; Coates, Matthew M.; Coggeshall, Megan; Dandona, Lalit; Dicker, Daniel J.; Erskine, Holly E.; Ferrari, Alize J.; Fitzmaurice, Christina; Foreman, Kyle; Forouzanfar, Mohammad H.; Fraser, Maya S.; Fullman, Nancy; Gething, Peter W.; Goldberg, Ellen M.; Graetz, Nicholas; Haagsma, Juanita A.; Hay, Simon I.; Huynh, Chantal; Johnson, Catherine O.; Kassebaum, Nicholas J.; Kinfu, Yohannes; et al. (October 2016). "Global, regional, and national life expectancy, all-cause mortality, and cause-specific mortality for 249 causes of death, 1980-2015: a systematic analysis for the Global Burden of Disease Study 2015". Lancet. 388 (10053): 1459–1544. doi:10.1016/s0140-6736(16)31012-1. PMC 5388903. PMID 27733281.
10. ^ Marino BS, Fine KS (2013). Blueprints Pediatrics. Lippincott Williams & Wilkins. p. 205. ISBN 9781451116045.
11. ^ a b Vos, Theo; Allen, Christine; Arora, Megha; Barber, Ryan M.; Bhutta, Zulfiqar A.; Brown, Alexandria; Carter, Austin; Casey, Daniel C.; Charlson, Fiona J.; Chen, Alan Z.; Coggeshall, Megan; Cornaby, Leslie; Dandona, Lalit; Dicker, Daniel J.; Dilegge, Tina; Erskine, Holly E.; Ferrari, Alize J.; Fitzmaurice, Christina; Fleming, Tom; Forouzanfar, Mohammad H.; Fullman, Nancy; Gething, Peter W.; Goldberg, Ellen M.; Graetz, Nicholas; Haagsma, Juanita A.; Hay, Simon I.; Johnson, Catherine O.; Kassebaum, Nicholas J.; Kawashima, Toana; et al. (October 2016). "Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015". Lancet. 388 (10053): 1545–1602. doi:10.1016/S0140-6736(16)31678-6. PMC 5055577. PMID 27733282.
12. ^ "Acute Lymphocytic Leukemia - Cancer Stat Facts". SEER. Retrieved 20 December 2017.
13. ^ a b Tubergen DG, Bleyer A, Ritchey AK (2011). "Acute Lymphoblastic Leukemia". In Kliegman RM, Stanton BM, Geme J, Schor NF, Behrman RE (eds.). Nelson Textbook of Pediatrics (19th ed.). Philadelphia, PA: Elsevier/Saunders. pp. 1732–1737. ISBN 978-1437707557. OCLC 706780860.
14. ^ Brown P (6 December 2013). "Treatment of infant leukemias: challenge and promise". Hematology. American Society of Hematology. Education Program. 2013 (1): 596–600. doi:10.1182/asheducation-2013.1.596. PMC 4729208. PMID 24319237.
15. ^ Clarke RT, Van den Bruel A, Bankhead C, Mitchell CD, Phillips B, Thompson MJ (October 2016). "Clinical presentation of childhood leukaemia: a systematic review and meta-analysis". Archives of Disease in Childhood. 101 (10): 894–901. doi:10.1136/archdischild-2016-311251. PMID 27647842.
16. ^ Cortes J (February 2001). "Central nervous system involvement in adult acute lymphocytic leukemia". Hematology/Oncology Clinics of North America. 15 (1): 145–62. doi:10.1016/s0889-8588(05)70203-3. PMID 11253605.
17. ^ a b c Acute Lymphoblastic Leukemia at eMedicine
18. ^ Bleyer WA (August 1988). "Central nervous system leukemia". Pediatric Clinics of North America. 35 (4): 789–814. doi:10.1016/s0031-3955(16)36510-5. PMID 3047654.
19. ^ Ingram LC, Fairclough DL, Furman WL, Sandlund JT, Kun LE, Rivera GK, Pui CH (May 1991). "Cranial nerve palsy in childhood acute lymphoblastic leukemia and non-Hodgkin's lymphoma". Cancer. 67 (9): 2262–8. doi:10.1002/1097-0142(19910501)67:9<2262::aid-cncr2820670909>3.0.co;2-u. PMID 2013032.
20. ^ Terwilliger T, Abdul-Hay M (June 2017). "Acute lymphoblastic leukemia: a comprehensive review and 2017 update". Blood Cancer Journal. 7 (6): e577. doi:10.1038/bcj.2017.53. PMC 5520400. PMID 28665419.
21. ^ Meyer C, Hofmann J, Burmeister T, Gröger D, Park TS, Emerenciano M, et al. (November 2013). "The MLL recombinome of acute leukemias in 2013". Leukemia. 27 (11): 2165–76. doi:10.1038/leu.2013.135. PMC 3826032. PMID 23628958.
22. ^ Benedikt A, Baltruschat S, Scholz B, Bursen A, Arrey TN, Meyer B, et al. (January 2011). "The leukemogenic AF4-MLL fusion protein causes P-TEFb kinase activation and altered epigenetic signatures". Leukemia. 25 (1): 135–44. doi:10.1038/leu.2010.249. PMID 21030982.
23. ^ Preston DL, Kusumi S, Tomonaga M, Izumi S, Ron E, Kuramoto A, et al. (February 1994). "Cancer incidence in atomic bomb survivors. Part III. Leukemia, lymphoma and multiple myeloma, 1950-1987". Radiation Research. 137 (2 Suppl): S68-97. Bibcode:1994RadR..137S..68P. doi:10.2307/3578893. JSTOR 3578893. PMID 8127953.
24. ^ Smith MA, Rubinstein L, Anderson JR, Arthur D, Catalano PJ, Freidlin B, et al. (February 1999). "Secondary leukemia or myelodysplastic syndrome after treatment with epipodophyllotoxins". Journal of Clinical Oncology. 17 (2): 569–77. doi:10.1200/JCO.1999.17.2.569. PMID 10080601.
25. ^ Greaves M (August 2018). "A causal mechanism for childhood acute lymphoblastic leukaemia". Nature Reviews. Cancer. 18 (8): 471–484. doi:10.1038/s41568-018-0015-6. PMC 6986894. PMID 29784935.
26. ^ Collier, J.A.B (1991). Oxford Handbook of Clinical Specialties, Third Edition. Oxford. p. 810. ISBN 978-0-19-262116-0.
27. ^ Longo, D (2011). "Chapter 110: Malignancies of Lymphoid Cells". Harrison's Principles of Internal Medicine (18 ed.). New York: McGraw-Hill Professional. ISBN 978-0-07-174889-6.
28. ^ Rytting, ME, ed. (November 2013). "Acute Leukemia". Merck Manual Professional. Merck Sharp & Dohme Corp. Archived from the original on 15 July 2014. Retrieved 17 April 2014.
29. ^ a b c Hoffbrand AV, Moss PA (6 October 2015). Hoffbrand's essential haematology (Seventh ed.). Chichester, West Sussex. ISBN 9781118408636. OCLC 910009732.[page needed]
30. ^ Bhojwani D, Pei D, Sandlund JT, Jeha S, Ribeiro RC, Rubnitz JE, et al. (February 2012). "ETV6-RUNX1-positive childhood acute lymphoblastic leukemia: improved outcome with contemporary therapy". Leukemia. 26 (2): 265–70. doi:10.1038/leu.2011.227. PMC 3345278. PMID 21869842.
31. ^ Stams WA, den Boer ML, Beverloo HB, Meijerink JP, van Wering ER, Janka-Schaub GE, Pieters R (April 2005). "Expression levels of TEL, AML1, and the fusion products TEL-AML1 and AML1-TEL versus drug sensitivity and clinical outcome in t(12;21)-positive pediatric acute lymphoblastic leukemia". Clinical Cancer Research. 11 (8): 2974–80. doi:10.1158/1078-0432.CCR-04-1829. PMID 15837750.
32. ^ a b c d Pakakasama S, Kajanachumpol S, Kanjanapongkul S, Sirachainan N, Meekaewkunchorn A, Ningsanond V, Hongeng S (August 2008). "Simple multiplex RT-PCR for identifying common fusion transcripts in childhood acute leukemia". International Journal of Laboratory Hematology. 30 (4): 286–91. doi:10.1111/j.1751-553X.2007.00954.x. PMID 18665825.
33. ^ McWhirter JR, Neuteboom ST, Wancewicz EV, Monia BP, Downing JR, Murre C (September 1999). "Oncogenic homeodomain transcription factor E2A-Pbx1 activates a novel WNT gene in pre-B acute lymphoblastoid leukemia". Proceedings of the National Academy of Sciences of the United States of America. 96 (20): 11464–9. Bibcode:1999PNAS...9611464M. doi:10.1073/pnas.96.20.11464. PMC 18056. PMID 10500199.
34. ^ Rudolph C, Hegazy AN, von Neuhoff N, Steinemann D, Schröck E, Stripecke R, et al. (August 2005). "Cytogenetic characterization of a BCR-ABL transduced mouse cell line". Cancer Genetics and Cytogenetics. 161 (1): 51–6. doi:10.1016/j.cancergencyto.2004.12.021. PMID 16080957.
35. ^ Caslini C, Serna A, Rossi V, Introna M, Biondi A (June 2004). "Modulation of cell cycle by graded expression of MLL-AF4 fusion oncoprotein". Leukemia. 18 (6): 1064–71. doi:10.1038/sj.leu.2403321. PMID 14990976.
36. ^ Martín-Subero JI, Odero MD, Hernandez R, Cigudosa JC, Agirre X, Saez B, et al. (August 2005). "Amplification of IGH/MYC fusion in clinically aggressive IGH/BCL2-positive germinal center B-cell lymphomas". Genes, Chromosomes & Cancer. 43 (4): 414–23. doi:10.1002/gcc.20187. PMID 15852472.
37. ^ Zalcberg IQ, Silva ML, Abdelhay E, Tabak DG, Ornellas MH, Simões FV, et al. (October 1995). "Translocation 11;14 in three children with acute lymphoblastic leukemia of T-cell origin". Cancer Genetics and Cytogenetics. 84 (1): 32–8. doi:10.1016/0165-4608(95)00062-3. PMID 7497440.
38. ^ Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C (August 1976). "Proposals for the classification of the acute leukaemias. French-American-British (FAB) co-operative group". British Journal of Haematology. 33 (4): 451–8. doi:10.1111/j.1365-2141.1976.tb03563.x. PMID 188440.
39. ^ "ACS :: How Is Acute Lymphocytic Leukemia Classified?". Archived from the original on 23 March 2008.
40. ^ DeAngelo DJ, Pui C. Acute lymphoblastic leukemia and lymphoblastic lymphoma. Chapter 19 of American Society of Hematology Self-Assessment Program. 2013. ISBN 9780982843512
41. ^ a b Orkin SH, Nathan DG, Ginsburg D, et al. (2014). Nathan and Oski's Hematology and Oncology of Infancy and Childhood (8th ed.). Saunders. ISBN 978-1-4557-5414-4.
42. ^ Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, et al. (May 2016). "The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia". Blood. 127 (20): 2391–405. doi:10.1182/blood-2016-03-643544. PMID 27069254. S2CID 18338178.
43. ^ "Acute lymphoblastic leukemia (ALL) Information – Mount Sinai – New York". Mount Sinai Health System. Archived from the original on 3 August 2016. Retrieved 18 November 2017.
44. ^ a b c d Hoffbrand V, Moss P, Pettit J (31 October 2006). Essential Haematology. Wiley. pp. 192–196. ISBN 978-1-4051-3649-5. Archived from the original on 21 March 2015. Retrieved 14 September 2013.
45. ^ a b c d e f "Adult Acute Lymphoblastic Leukemia Treatment". National Cancer Institute. Retrieved 6 December 2017.
46. ^ Jabbour E, Thomas D, Cortes J, Kantarjian HM, O'Brien S (May 2010). "Central nervous system prophylaxis in adults with acute lymphoblastic leukemia: current and emerging therapies". Cancer. 116 (10): 2290–300. doi:10.1002/cncr.25008. PMID 20209620.
47. ^ Yanada M (June 2015). "Time to tune the treatment of Ph+ ALL". Blood. 125 (24): 3674–5. doi:10.1182/blood-2015-04-641704. PMID 26069331.
48. ^ Seiter K, Harris JE. Acute Lymphoblastic Leukemia Treatment Protocols. emedicine; Medscape. "Archived copy". Archived from the original on 1 September 2015. Retrieved 16 August 2015.CS1 maint: archived copy as title (link)
49. ^ a b Hoffbrand AV, Moss PA (26 October 2015). Hoffbrand's essential haematology (Seventh ed.). Chichester, West Sussex. ISBN 9781118408674. OCLC 909538759.
50. ^ Lambrou GI, Papadimitriou L, Chrousos GP, Vlahopoulos SA (April 2012). "Glucocorticoid and proteasome inhibitor impact on the leukemic lymphoblast: multiple, diverse signals converging on a few key downstream regulators". Molecular and Cellular Endocrinology. 351 (2): 142–51. doi:10.1016/j.mce.2012.01.003. PMID 22273806. S2CID 28749125.
51. ^ Grupp SA, Kalos M, Barrett D, Aplenc R, Porter DL, Rheingold SR, et al. (April 2013). "Chimeric antigen receptor-modified T cells for acute lymphoid leukemia". The New England Journal of Medicine. 368 (16): 1509–1518. doi:10.1056/NEJMoa1215134. PMC 4058440. PMID 23527958.
52. ^ a b Barrett DM, Singh N, Porter DL, Grupp SA, June CH (2014). "Chimeric antigen receptor therapy for cancer". Annual Review of Medicine. 65: 333–47. doi:10.1146/annurev-med-060512-150254. PMC 4120077. PMID 24274181.
53. ^ Alonso-Camino V, Sánchez-Martín D, Compte M, Nuñez-Prado N, Diaz RM, Vile R, Alvarez-Vallina L (May 2013). "CARbodies: Human Antibodies Against Cell Surface Tumor Antigens Selected From Repertoires Displayed on T Cell Chimeric Antigen Receptors". Molecular Therapy. Nucleic Acids. 2: e93. doi:10.1038/mtna.2013.19. PMC 4817937. PMID 23695536.
54. ^ Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, Trono D (December 1998). "Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery". Journal of Virology. 72 (12): 9873–80. doi:10.1128/JVI.72.12.9873-9880.1998. PMC 110499. PMID 9811723.
55. ^ Office of the Commissioner. "Press Announcements—FDA approval brings first gene therapy to the United States". www.fda.gov. Archived from the original on 3 September 2017. Retrieved 12 September 2017.
56. ^ Ledford H (July 2017). "Engineered cell therapy for cancer gets thumbs up from FDA advisers". Nature. 547 (7663): 270. Bibcode:2017Natur.547..270L. doi:10.1038/nature.2017.22304. PMID 28726836.
57. ^ Kantarjian H, Stein A, Gökbuget N, Fielding AK, Schuh AC, Ribera JM, et al. (March 2017). "Blinatumomab versus Chemotherapy for Advanced Acute Lymphoblastic Leukemia". The New England Journal of Medicine. 376 (9): 836–847. doi:10.1056/nejmoa1609783. PMC 5881572. PMID 28249141.
58. ^ Estcourt L, Stanworth S, Doree C, Hopewell S, Murphy MF, Tinmouth A, Heddle N (May 2012). Cochrane Haematological Malignancies Group (ed.). "Prophylactic platelet transfusion for prevention of bleeding in patients with haematological disorders after chemotherapy and stem cell transplantation". The Cochrane Database of Systematic Reviews (5): CD004269. doi:10.1002/14651858.CD004269.pub3. PMID 22592695.
59. ^ Estcourt LJ, Stanworth SJ, Doree C, Hopewell S, Trivella M, Murphy MF (November 2015). Cochrane Haematological Malignancies Group (ed.). "Comparison of different platelet count thresholds to guide administration of prophylactic platelet transfusion for preventing bleeding in people with haematological disorders after myelosuppressive chemotherapy or stem cell transplantation". The Cochrane Database of Systematic Reviews (11): CD010983. doi:10.1002/14651858.CD010983.pub2. PMC 4717525. PMID 26576687.
60. ^ Fisher SA, Cutler A, Doree C, Brunskill SJ, Stanworth SJ, Navarrete C, Girdlestone J (January 2019). Cochrane Haematological Malignancies Group (ed.). "Mesenchymal stromal cells as treatment or prophylaxis for acute or chronic graft-versus-host disease in haematopoietic stem cell transplant (HSCT) recipients with a haematological condition". The Cochrane Database of Systematic Reviews. 1: CD009768. doi:10.1002/14651858.CD009768.pub2. PMC 6353308. PMID 30697701.
61. ^ Knips L, Bergenthal N, Streckmann F, Monsef I, Elter T, Skoetz N (January 2019). Cochrane Haematological Malignancies Group (ed.). "Aerobic physical exercise for adult patients with haematological malignancies". The Cochrane Database of Systematic Reviews. 1: CD009075. doi:10.1002/14651858.CD009075.pub3. PMC 6354325. PMID 30702150.
62. ^ "Prognosis and survival for acute lymphocytic leukemia - Canadian Cance". www.cancer.ca. Retrieved 6 December 2017.
63. ^ Nelson Essentials of Pediatrics By Karen Marcdante, Robert M. Kliegman, Richard E. Behrman, Hal B. Jenson p597
64. ^ The Guide Paediatrics. ISBN 978-978-917-9909. p51
65. ^ Hoffbrand AV, Moss PA (26 October 2015). Hoffbrand's essential haematology (Seventh ed.). Chichester, West Sussex. p. 194. ISBN 9781118408674. OCLC 909538759.
66. ^ Moorman AV, Harrison CJ, Buck GA, Richards SM, Secker-Walker LM, Martineau M, et al. (April 2007). "Karyotype is an independent prognostic factor in adult acute lymphoblastic leukemia (ALL): analysis of cytogenetic data from patients treated on the Medical Research Council (MRC) UKALLXII/Eastern Cooperative Oncology Group (ECOG) 2993 trial". Blood. 109 (8): 3189–97. doi:10.1182/blood-2006-10-051912. PMID 17170120. S2CID 1038016.
67. ^ Den Boer ML, van Slegtenhorst M, De Menezes RX, Cheok MH, Buijs-Gladdines JG, Peters ST, et al. (February 2009). "A subtype of childhood acute lymphoblastic leukaemia with poor treatment outcome: a genome-wide classification study". The Lancet. Oncology. 10 (2): 125–34. doi:10.1016/S1470-2045(08)70339-5. PMC 2707020. PMID 19138562.
68. ^ Guo LM, Xi JS, Ma Y, Shao L, Nie CL, Wang GJ (January 2014). "ARID5B gene rs10821936 polymorphism is associated with childhood acute lymphoblastic leukemia: a meta-analysis based on 39,116 subjects". Tumour Biology. 35 (1): 709–13. doi:10.1007/s13277-013-1097-0. PMID 23975371. S2CID 12601034.
69. ^ Greer JP, Arber DA, Glader B, et al. (2013). Wintrobe's Clinical Hematology (13th ed.). Lippincott Williams & Wilkins. ISBN 978-1-4511-7268-3.
70. ^ Urayama KY, Manabe A (October 2014). "Genomic evaluations of childhood acute lymphoblastic leukemia susceptibility across race/ethnicities". [Rinsho Ketsueki] the Japanese Journal of Clinical Hematology. 55 (10): 2242–8. PMID 25297793.
71. ^ Ries LA, Smith MA, Gurney JG, Linet M, Tamra T, Young JL, Bunin GR (1999). Cancer Incidence and Survival among Children and Adolescents: United States SEER Program 1975-1995. Bethesda, MD: National Cancer Institute, SEER Program.
72. ^ a b Shapira T, Pereg D, Lishner M (September 2008). "How I treat acute and chronic leukemia in pregnancy". Blood Reviews. 22 (5): 247–59. doi:10.1016/j.blre.2008.03.006. PMID 18472198.
## External links[edit]
* Acute Lymphocytic Leukemia at the American Cancer Society
* Childhood ALL Treatment at the National Cancer Institute
Classification
D
* ICD-10: C91.0
* ICD-9-CM: 204.0
* ICD-O: M9835/3
* MeSH: D054198
* DiseasesDB: 195
External resources
* eMedicine: med/3146 ped/2587
* Medicine portal
* v
* t
* e
Chromosome abnormalities
Autosomal
Trisomies/Tetrasomies
* Down syndrome
* 21
* Edwards syndrome
* 18
* Patau syndrome
* 13
* Trisomy 9
* Tetrasomy 9p
* Warkany syndrome 2
* 8
* Cat eye syndrome/Trisomy 22
* 22
* Trisomy 16
Monosomies/deletions
* (1q21.1 copy number variations/1q21.1 deletion syndrome/1q21.1 duplication syndrome/TAR syndrome/1p36 deletion syndrome)
* 1
* Wolf–Hirschhorn syndrome
* 4
* Cri du chat syndrome/Chromosome 5q deletion syndrome
* 5
* Williams syndrome
* 7
* Jacobsen syndrome
* 11
* Miller–Dieker syndrome/Smith–Magenis syndrome
* 17
* DiGeorge syndrome
* 22
* 22q11.2 distal deletion syndrome
* 22
* 22q13 deletion syndrome
* 22
* genomic imprinting
* Angelman syndrome/Prader–Willi syndrome (15)
* Distal 18q-/Proximal 18q-
X/Y linked
Monosomy
* Turner syndrome (45,X)
Trisomy/tetrasomy,
other karyotypes/mosaics
* Klinefelter syndrome (47,XXY)
* XXYY syndrome (48,XXYY)
* XXXY syndrome (48,XXXY)
* 49,XXXYY
* 49,XXXXY
* Triple X syndrome (47,XXX)
* Tetrasomy X (48,XXXX)
* 49,XXXXX
* Jacobs syndrome (47,XYY)
* 48,XYYY
* 49,XYYYY
* 45,X/46,XY
* 46,XX/46,XY
Translocations
Leukemia/lymphoma
Lymphoid
* Burkitt's lymphoma t(8 MYC;14 IGH)
* Follicular lymphoma t(14 IGH;18 BCL2)
* Mantle cell lymphoma/Multiple myeloma t(11 CCND1:14 IGH)
* Anaplastic large-cell lymphoma t(2 ALK;5 NPM1)
* Acute lymphoblastic leukemia
Myeloid
* Philadelphia chromosome t(9 ABL; 22 BCR)
* Acute myeloblastic leukemia with maturation t(8 RUNX1T1;21 RUNX1)
* Acute promyelocytic leukemia t(15 PML,17 RARA)
* Acute megakaryoblastic leukemia t(1 RBM15;22 MKL1)
Other
* Ewing's sarcoma t(11 FLI1; 22 EWS)
* Synovial sarcoma t(x SYT;18 SSX)
* Dermatofibrosarcoma protuberans t(17 COL1A1;22 PDGFB)
* Myxoid liposarcoma t(12 DDIT3; 16 FUS)
* Desmoplastic small-round-cell tumor t(11 WT1; 22 EWS)
* Alveolar rhabdomyosarcoma t(2 PAX3; 13 FOXO1) t (1 PAX7; 13 FOXO1)
Other
* Fragile X syndrome
* Uniparental disomy
* XX male syndrome/46,XX testicular disorders of sex development
* Marker chromosome
* Ring chromosome
* 6; 9; 14; 15; 18; 20; 21, 22
* v
* t
* e
Leukaemias, lymphomas and related disease
B cell
(lymphoma,
leukemia)
(most CD19
* CD20)
By
development/
marker
TdT+
* ALL (Precursor B acute lymphoblastic leukemia/lymphoma)
CD5+
* naive B cell (CLL/SLL)
* mantle zone (Mantle cell)
CD22+
* Prolymphocytic
* CD11c+ (Hairy cell leukemia)
CD79a+
* germinal center/follicular B cell (Follicular
* Burkitt's
* GCB DLBCL
* Primary cutaneous follicle center lymphoma)
* marginal zone/marginal zone B-cell (Splenic marginal zone
* MALT
* Nodal marginal zone
* Primary cutaneous marginal zone lymphoma)
RS (CD15+, CD30+)
* Classic Hodgkin lymphoma (Nodular sclerosis)
* CD20+ (Nodular lymphocyte predominant Hodgkin lymphoma)
PCDs/PP
(CD38+/CD138+)
* see immunoproliferative immunoglobulin disorders
By infection
* KSHV (Primary effusion)
* EBV
* Lymphomatoid granulomatosis
* Post-transplant lymphoproliferative disorder
* Classic Hodgkin lymphoma
* Burkitt's lymphoma
* HCV
* Splenic marginal zone lymphoma
* HIV (AIDS-related lymphoma)
* Helicobacter pylori (MALT lymphoma)
Cutaneous
* Diffuse large B-cell lymphoma
* Intravascular large B-cell lymphoma
* Primary cutaneous marginal zone lymphoma
* Primary cutaneous immunocytoma
* Plasmacytoma
* Plasmacytosis
* Primary cutaneous follicle center lymphoma
T/NK
T cell
(lymphoma,
leukemia)
(most CD3
* CD4
* CD8)
By
development/
marker
* TdT+: ALL (Precursor T acute lymphoblastic leukemia/lymphoma)
* prolymphocyte (Prolymphocytic)
* CD30+ (Anaplastic large-cell lymphoma
* Lymphomatoid papulosis type A)
Cutaneous
MF+variants
* indolent: Mycosis fungoides
* Pagetoid reticulosis
* Granulomatous slack skin
aggressive: Sézary disease
* Adult T-cell leukemia/lymphoma
Non-MF
* CD30-: Non-mycosis fungoides CD30− cutaneous large T-cell lymphoma
* Pleomorphic T-cell lymphoma
* Lymphomatoid papulosis type B
* CD30+: CD30+ cutaneous T-cell lymphoma
* Secondary cutaneous CD30+ large-cell lymphoma
* Lymphomatoid papulosis type A
Other
peripheral
* Hepatosplenic
* Angioimmunoblastic
* Enteropathy-associated T-cell lymphoma
* Peripheral T-cell lymphoma not otherwise specified (Lennert lymphoma)
* Subcutaneous T-cell lymphoma
By infection
* HTLV-1 (Adult T-cell leukemia/lymphoma)
NK cell/
(most CD56)
* Aggressive NK-cell leukemia
* Blastic NK cell lymphoma
T or NK
* EBV (Extranodal NK-T-cell lymphoma/Angiocentric lymphoma)
* Large granular lymphocytic leukemia
Lymphoid+
myeloid
* Acute biphenotypic leukaemia
Lymphocytosis
* Lymphoproliferative disorders (X-linked lymphoproliferative disease
* Autoimmune lymphoproliferative syndrome)
* Leukemoid reaction
* Diffuse infiltrative lymphocytosis syndrome
Cutaneous lymphoid hyperplasia
* Cutaneous lymphoid hyperplasia
* with bandlike and perivascular patterns
* with nodular pattern
* Jessner lymphocytic infiltrate of the skin
General
* Hematological malignancy
* leukemia
* Lymphoproliferative disorders
* Lymphoid leukemias
Authority control
* LCCN: sh85079143
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Acute lymphoblastic leukemia
|
c0023449
| 8,512 |
wikipedia
|
https://en.wikipedia.org/wiki/Acute_lymphoblastic_leukemia
| 2021-01-18T18:30:17 |
{"gard": ["522"], "umls": ["C0023449"], "orphanet": ["513"], "wikidata": ["Q180664"]}
|
An extremely rare lethal autosomal recessive disorder characterized by massive birth weight, swollen globular body, generalized edema, short limbs, postaxial polydactyly, thick skin, facial dysmorphism (slanted palpebral fissures, hypertelorism, epicanthic folds, dysplastic ears), excessive connective tissue, renal dysplasia, and in some patients, organomegaly, craniosynostosis with acrocephaly, omphalocele, cleft palate, and cryptorchidism. Fewer than 10 cases have been reported to date.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Acrocephalopolydactyly
|
c1860157
| 8,513 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=221054
| 2021-01-23T18:51:20 |
{"gard": ["2096"], "mesh": ["C536203"], "omim": ["200995"], "umls": ["C1860157", "C3495588"], "icd-10": ["Q87.0"], "synonyms": ["Acrocephalopolydactylous dysplasia", "Elejalde syndrome"]}
|
Oldest conjoined twins
Ronnie and Donnie Galyon
Born
Ronald Galyon
Donald Galyon
(1951-10-28)October 28, 1951
Dayton, Ohio
DiedJuly 4, 2020(2020-07-04) (aged 68)
Dayton, Ohio
OccupationSideshow attractions, reality TV personalities
Known forOldest living set of conjoined twins
Ronnie and Donnie Galyon (October 28, 1951 – July 4, 2020)[1] were American conjoined twins. According to the 2009 Guinness World Records, the Galyons were the oldest living set of conjoined twins in the world, and, as of 29 October 2014, possessed the world record for the longest-lived conjoined twins in history when they surpassed prior record holders Giacomo and Giovanni Battista Tocci.[2]
## Contents
* 1 Early life and career
* 2 Later life
* 3 Death
* 4 References
## Early life and career[edit]
They were born at St. Elizabeth Hospital in Dayton, Ohio, on October 28, 1951, to Wesley and Eileen Galyon. Eileen was not expecting twins. They were joined from the sternum to the groin and shared a set of organs.[1] After a two-year stay in the hospital, it was determined that they could not be safely separated. Local schools deemed the twins a distraction, so they were not formally educated, resulting in their lifelong functional illiteracy.[3]
With nine children to support, their father Wesley decided to take the twins on the road as a sideshow attraction. The boys were exhibited in sideshows throughout the U.S. and later in Latin America.[4] Their tours made them celebrities and provided an income with which they supported their family.[3] The twins also tried to join the Army, but were ranked 4-F.
## Later life[edit]
In 1991, after three decades in entertainment, the pair retired[2] and moved into their first independent home in Dayton, Ohio, in a house purchased with sideshow earnings. They were active in the community and lived a largely normal life by means of a custom double wheelchair. Although retired from show business, the twins made numerous television appearances. They appeared on The Jerry Springer Show in 1997, a Discovery Channel documentary in 1998 and a Channel Five documentary in 2009.[5][6]
In 2009, Ronnie developed a life-threatening infection in his lungs, which quickly endangered both twins. After their hospitalization, they required round-the-clock care. Their younger brother Jim and his wife Mary, who lived in the same city, were unable to bring the twins into their home as it was not handicap accessible, until an outpouring of donations and volunteers from the local community assisted in building a special addition to the home.[7] On December 22, 2010, TLC premiered "The World's Oldest Conjoined Twins Move Home", which documented the building process as well as the twins' recovery and their return to the community.[8]
## Death[edit]
The twins died of congestive heart failure in hospice surrounded by their family in their native Dayton, Ohio, on July 4, 2020.[9][10]
## References[edit]
1. ^ a b Franks, Sarah (4 July 2020). "Galyon brothers, world's longest-living conjoined twins from Dayton, die at 68". Dayton Daily News. Retrieved 5 July 2020.
2. ^ a b Engel, Meredith (2014-12-30). "Ronnie and Donnie Galyon become oldest living conjoined twins". New York Daily News. Retrieved 27 June 2018.
3. ^ a b Thoms, Sue (2014-07-03). "Life as conjoined twins: 'You see the warmest of hearts, and you see the coldest of hearts'". Grand Rapids News. Retrieved June 27, 2018.
4. ^ Anderson, Elizabeth. "A collection of historic Images - Ronnie & Donnie Galyon". SideShow World. Retrieved 27 June 2018.
5. ^ Frohlik, Cornelius (2010-06-21). "BBC camera crew films conjoined Galyon twins". Dayton Daily News. Retrieved 6 July 2020.
6. ^ Leibovich-Dar, Sara (2003-07-15). "Till Death Do Us Part". Haaretz. Retrieved 6 July 2020.
7. ^ "Longest-Surviving Conjoined Twins Die at 68: 'They Couldn't Ask for Anything More,' Says Brother". PEOPLE.com. Retrieved 2020-07-09.
8. ^ ""World's Oldest Conjoined Twins Move Home" Premieres Wednesday, December 22 at 8/7c on TLC". The Futon Critic. Retrieved June 27, 2018.
9. ^ Hackworth, Franchesca (July 4, 2020). "Conjoined twins, Ronnie and Donnie Galyon of Beavercreek, passed away". WHIO. Retrieved July 5, 2020.
10. ^ "Brother of Longest-Surviving Conjoined Twins: 'They Made 68'". Associated Press. 7 July 2020. Retrieved 12 July 2020.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Ronnie and Donnie Galyon
|
None
| 8,514 |
wikipedia
|
https://en.wikipedia.org/wiki/Ronnie_and_Donnie_Galyon
| 2021-01-18T19:06:48 |
{"wikidata": ["Q1987602"]}
|
Small intestine adenocarcinoma is one type of small bowel cancer, usually occurring in the duodenum or jejunum, that begins in the gland cells. The small intestine is part of the body’s digestive system, which also includes the esophagus, stomach, and large intestine. The exact cause is still unknown, but it may be due to DNA changes in the small intestine adenocarcinoma cells. The symptoms of small bowel tumors are often vague. The most common symptoms are pain in the belly (which may be the first symptom), weight loss, weakness, fatigue and low red blood cell counts (anemia). The treatment and prognosis for small intestine cancer depends on its stage (tumor size and site) and the presence of metastases. For early stage cancer, surgery may be all that is needed. For more advanced cancer chemotherapy or radiation therapy may be required.
Please visit the National Cancer Institute website for additional information:
Small Intestine Cancer Treatment (PDQ®)–Patient Version
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Small Intestinal Adenocarcinoma
|
c0278803
| 8,515 |
gard
|
https://rarediseases.info.nih.gov/diseases/13090/small-intestinal-adenocarcinoma
| 2021-01-18T17:57:40 |
{"orphanet": ["104075"], "synonyms": ["Adenocarcinoma of small instestine", "Adenocarcinoma of the small bowel", "Adenocarcinoma of the small instestine", "Adenocarcinoma of Small Bowel", "Small bowel adenocarcinoma"]}
|
A number sign (#) is used with this entry because of evidence that neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements (NEDNEH) is caused by homozygous or compound heterozygous mutation in the CACNA1B gene (601012) on chromosome 9q34.
Description
Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements (NEDNEH) is an autosomal recessive severe neurologic disorder characterized by delayed psychomotor development with inability to walk or speak, early-onset refractory seizures, and nonepileptic hyperkinetic movement disorders, including myoclonus dystonia and dyskinesias. Patients require tube feeding and may die of respiratory failure in childhood or in the second decade (summary by Gorman et al., 2019).
Clinical Features
Gorman et al. (2019) reported 6 patients from 3 unrelated families with a similar neurodevelopmental disorder. A consanguineous family from Pakistan contained 3 affected sibs, a nonconsanguineous European family contained 2 affected sibs, and a single patient, of Bulgarian descent, was adopted with unknown family history. All patients died between 3 and 17 years of age, mainly from respiratory failure, except the adopted girl who was alive at 6 years of age. The 3 sibs reportedly had normal early development, with the ability to sit and babble before 1 year of age, whereas another patient had mildly delayed development and the remaining 2 never achieved independent sitting or words. All had onset of refractory focal, generalized, or myoclonic seizures consistent with epileptic encephalopathy between 9 and 30 months, and thereafter showed developmental regression. EEG showed hypsarrhythmia in some patients. All patients also developed nonepileptic hyperkinetic movements, including myoclonus dystonia, dyskinesias, oromotor dyskinesias, and choreoathetosis. Additional features consisted of axial hypotonia, peripheral hypertonia with brisk reflexes, postnatal microcephaly, tube feeding, strabismus, nystagmus, poor visual fixation or cortical visual impairment, and recurrent respiratory infections. A few had mild nonspecific dysmorphic features, such as anteverted nares, talipes, hip dislocation, and/or small testes. Brain imaging showed cerebral atrophy in 3 patients, but was normal in 1; 1 patient had no imaging studies.
Inheritance
The transmission pattern of NEDNEH in the families reported by Gorman et al. (2019) was consistent with autosomal recessive inheritance.
Molecular Genetics
In 6 patients from 3 unrelated families with NEDNEH, Gorman et al. (2019) identified biallelic mutations in the CACNA1B gene (601012.0002-601012.0005). The mutations, which were found by exome sequencing and confirmed by Sanger sequencing, segregated in the families from whom parental DNA was available. Functional studies of the variants and studies of patient cells were not performed, but all mutations were predicted to cause a loss of function through nonsense-mediated mRNA decay and/or premature protein termination. Gorman et al. (2019) postulated a defect in neuronal calcium flux and synaptic transmission. The authors also noted that the CaV2.2 channel, of which CACNA1B is a subunit, is highly expressed throughout the brain, including in the basal ganglia and cerebellum, which may underlie the hyperkinetic movement abnormalities. In addition, CaV2.2 is postulated to play a role in brain development in the early postnatal period. The first family was identified from a cohort of 41 cases with a similar phenotype; subsequent patients were identified through collaborative efforts, such as GeneMatcher.
INHERITANCE \- Autosomal recessive HEAD & NECK Head \- Microcephaly, postnatal Face \- Oromotor dyskinesia Eyes \- Strabismus \- Nystagmus \- Poor visual fixation \- Cortical visual impairment RESPIRATORY \- Respiratory infections, recurrent ABDOMEN Gastrointestinal \- Tube feeding MUSCLE, SOFT TISSUES \- Central hypotonia \- Peripheral hypertonia NEUROLOGIC Central Nervous System \- Global developmental delay \- Epileptic encephalopathy \- Developmental regression \- Inability to walk \- Absent speech \- Seizures, refractory \- Hypsarrhythmia seen on EEG \- Hyperkinetic movements \- Myoclonus \- Dystonia \- Oromotor dyskinesia \- Choreoathetosis \- Cerebral atrophy (in some patients) \- White matter signal changes (in some patients) MISCELLANEOUS \- Some patients may have early normal development \- Onset in infancy or first years of life \- Early death may occur MOLECULAR BASIS \- Caused by mutation in the calcium channel, voltage-dependent, N type, alpha-1B subunit gene (CACNA1B, 601012.0002 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
NEURODEVELOPMENTAL DISORDER WITH SEIZURES AND NONEPILEPTIC HYPERKINETIC MOVEMENTS
|
None
| 8,516 |
omim
|
https://www.omim.org/entry/618497
| 2019-09-22T15:41:39 |
{"omim": ["618497"]}
|
Pleural empyema
Other namesPyothorax, purulent pleuritis, lung empyema
CT chest showing large right sided hydro-pneumothorax from pleural empyema. Arrows A: air, B: fluid
SpecialtyPulmonology, cardiothoracic surgery
SymptomsFever, chest pain with breathing in, cough, shortness of breath
CausesBacteria (often Strep. pneumonia)
Diagnostic methodChest X-ray, Ultrasound, CT scan, thoracentesis
Differential diagnosisPneumonia, pleural effusion, pulmonary embolism
TreatmentSupportive care, antibiotics, surgery, chest tube
Pleural empyema is a collection of pus in the pleural cavity caused by microorganisms, usually bacteria.[1] Often it happens in the context of a pneumonia, injury, or chest surgery.[1] It is one of the various kinds of pleural effusion. There are three stages: exudative, when there is an increase in pleural fluid with or without the presence of pus; fibrinopurulent, when fibrous septa form localized pus pockets; and the final organizing stage, when there is scarring of the pleura membranes with possible inability of the lung to expand. Simple pleural effusions occur in up to 40% of bacterial pneumonias. They are usually small and resolve with appropriate antibiotic therapy. If however an empyema develops additional intervention is required.
## Contents
* 1 Signs and symptoms
* 2 Diagnosis
* 3 Treatment
* 3.1 Pleural fluid drainage
* 3.2 Antibiotics
* 4 Prognosis
* 5 Epidemiology
* 6 References
* 7 External links
## Signs and symptoms[edit]
The clinical presentation of both the adult and pediatric patient with pleural empyema depends upon several factors, including the causative micro-organism. Most cases present themselves in the setting of a pneumonia, although up to one third of patients do not have clinical signs of pneumonia and as many as 25% of cases are associated with trauma (including surgery).[2] Typical symptoms include cough, chest pain, shortness of breath and fever.[citation needed]
## Diagnosis[edit]
The initial investigations for suspected empyema remains chest X-ray, although it cannot differentiate an empyema from uninfected parapneumonic effusion.[3] Ultrasound must be used to confirm the presence of a pleural fluid collection and can be used to estimate the size of the effusion, differentiate between free and loculated pleural fluid and guide thoracocentesis if necessary. Chest CT and MRI do not provide additional information in most cases and should therefore not be performed routinely.[4] On a CT scan, empyema fluid most often has a radiodensity of about 0-20 Hounsfield units (HU),[5] but gets over 30 HU when becoming more thickened with time.[6]
The most often used "golden" criteria for empyema are pleural effusion with macroscopic presence of pus, a positive Gram stain or culture of pleural fluid, or a pleural fluid pH under 7.2 with normal peripheral blood pH.[7][8] Clinical guidelines for adult patients therefore advocate diagnostic pleural fluid aspiration in patients with pleural effusion in association with sepsis or pneumonic illness.[9] Because pleural effusion in the pediatric population is almost always parapneumonic and the need for chest tube drainage can be made on clinical grounds, British guidelines for the management of pleural infection in children do not recommend diagnostic pleural fluid sampling.[4]
Blood and sputum culture has often already been performed in the setting of community acquired pneumonia needing hospitalization. It should however be noted that the micro-organism responsible for development of empyema is not necessarily the same as the organism causing the pneumonia, especially in adults. As already mentioned before, sensitivity of pleural fluid culture is generally low, often partly due to prior administration of antibiotics. It has been shown that culture yield can be increased from 44% to 69% if pleural fluid is injected into blood culture bottles (aerobic and anaerobic) immediately after aspiration.[8] Furthermore, diagnostic rates can be improved for specific pathogens using polymerase chain reaction or antigen detection, especially for Streptococcus pneumoniae, Streptococcus pyogenes and Staphylococcus aureus. In a study including 78 children with pleural empyema, the causative micro-organism could be identified using direct culture of fresh pleural fluid in 45% of patients, with an additional 28% using PCR on pleural fluid of negative cultures.[10] Pneumococcal antigen detection in pleural fluid samples by latex agglutination can also be useful for rapid diagnosis of pneumococcal empyema. In the previously noted study, positive and negative predictive value of pneumococcal antigen detection was 95% and 90%, respectively.[10] However, despite the additional diagnostic value of these tests, PCR and antigen detection have limited value in determining treatment choice because of the lack of information on antibiotic resistance.[citation needed]
* Play media
Pleural empyema as seen on ultrasound[11]
* Play media
Pleural empyema as seen on ultrasound[11]
* Play media
Pleural empyema as seen on ultrasound[11]
* Pleural empyema as seen on ultrasound[11]
## Treatment[edit]
### Pleural fluid drainage[edit]
Proven empyema (as defined by the "golden" criteria mentioned earlier) is an indication for prompt chest tube drainage.[9] This has been shown to improve resolution of the infection and shorten hospital admission.[12] Data from a meta-analysis has shown that a pleural fluid pH of <7.2 is the most powerful indicator to predict the need for chest tube drainage in patients with non-purulent, culture negative fluid.[13] Other indications for drainage include poor clinical progress during treatment with antibiotics alone and patients with a loculated pleural collection.[citation needed]
Because of the viscous, lumpy nature of infected pleural fluid, in combination with possible septation and loculation, it has been proposed that intrapleural fibrinolytic or mucolytic therapy might improve drainage and therefore might have a positive effect on the clinical outcome.[14] Intrapleural fibrinolysis with urokinase decreased the need for surgery but there is a trend to increased serious side effects.[15]
Approximately 15 to 40 percent of people require surgical drainage of the infected pleural space because of inadequate drainage due to clogging of the chest tube or loculated empyema.[16] Patients should thus be considered for surgery if they have ongoing signs of sepsis in association with a persistent pleural collection despite drainage and antibiotics.[9] Video-assisted thoracoscopic surgery (VATS) is used as a first-line therapy in many hospitals, although open thoracic drainage remains a frequently used alternative technique.[citation needed]
### Antibiotics[edit]
There is no readily available evidence on the route of administration and duration of antibiotics in patients with pleural empyema. Experts agree that all patients should be hospitalized and treated with antibiotics intravenously.[4][9] The specific antimicrobial agent should be chosen based on Gram stain and culture, or on local epidemiologic data when these are not available. Anaerobic coverage must be included in all adults, and in children if aspiration is likely. Good pleural fluid and empyema penetration has been reported in adults for penicillins, ceftriaxone, metronidazole, clindamycin, vancomycin, gentamycin and ciprofloxacin.[17][18] Aminoglycosides should typically be avoided as they have poor penetration into the pleural space. There is no clear consensus on duration of intravenous and oral therapy. Switching to oral antibiotics can be considered upon clinical and objective improvement (adequate drainage and removal of chest tube, declining CRP, temperature normalization). Oral antibiotic treatment should then be continued for another 1–4 weeks, again based on clinical, biochemical and radiological response.[4][9]
## Prognosis[edit]
All patients with empyema require outpatient follow-up with a repeat chest X-ray and inflammatory biochemistry analysis within 4 weeks following discharge. Chest radiograph returns to normal in the majority of patients by 6 months. Patients should, of course, be advised to return sooner if symptoms redevelop. Long-term sequelae of pleural empyema are rare but include bronchopleural fistula formation, recurrent empyema and pleural thickening, which may lead to functional lung impairment needing surgical decortication.[9]
Approximately 15% of adult patients with pleural infection die within 1 year of the event, although deaths are usually due to comorbid conditions and not directly due to sepsis from the empyema.[citation needed] Mortality in children is generally reported to be less than 3%.[4] No reliable clinical, radiological or pleural fluid characteristics accurately determine patients’ prognosis at initial presentation.[19]
## Epidemiology[edit]
The incidence of pleural empyema and the prevalence of specific causative microorganisms varies depending on the source of infection (community acquired vs. hospital acquired pneumonia), the age of the patient and host immune status. Risk factors include alcoholism, drug use, HIV infection, neoplasm and pre-existent pulmonary disease.[20] Pleural empyema was found in 0.7% of 3675 patients needing hospitalization for a community acquired pneumonia in a recent Canadian single-center prospective study.[7] A multi-center study from the UK including 430 adult patients with community acquired pleural empyema found negative pleural-fluid cultures in 54% of patients, Streptococcus milleri group in 16%, Staphylococcus aureus in 12%, Streptococcus pneumoniae in 8%, other Streptococci in 7% and anaerobic bacteria in 8%.[14] Given the difficulties in culturing anaerobic bacteria the frequency of the latter (including mixed infections) might be underestimated.
The risk of empyema in children seems to be comparable to adults. Using the United States Kids’ Inpatient Database the incidence is calculated to be around 1.5% in children hospitalized for community acquired pneumonia,[21] although percentages up to 30% have been reported in individual hospitals,[22] a difference which may be explained by an transient endemic of highly invasive serotype or overdiagnosis of small parapneumonic effusions. The distribution of causative organisms does differ greatly from that in adults: in an analysis of 78 children with community acquired pleural empyema, no micro-organism was found in 27% of patients, Streptococcus pneumoniae in 51%, Streptococcus pyogenes in 9% and Staphylococcus aureus in 8%.[10]
Although pneumococcal vaccination dramatically decreased the incidence of pneumonia in children, it did not have this effect on the incidence of complicated pneumonia. It has been shown that the incidence of empyema in children was already on the rise at the end of the 20th century, and that the widespread use of pneumococcal vaccination did not slow down this trend.[23] This might in part be explained by a change in prevalence of (more invasive) pneumococcal serotypes, some of which are not covered by the vaccine, as well a rise in incidence of pneumonia caused by other streptococci and staphylococci.[24] The incidence of empyema seems to be rising in the adult population as well, albeit at a slower rate.
## References[edit]
1. ^ a b Redden MD, Chin TY, van Driel ML (March 2017). "Surgical versus non-surgical management for pleural empyema". Cochrane Database Syst Rev. 3: CD010651. doi:10.1002/14651858.CD010651.pub2. ISSN 1469-493X. PMC 6464687. PMID 28304084.
2. ^ Fernández-Cotarelo MJ, López-Medrano F, San Juan R, Díaz-Pedroche C, Lizasoain M, Chaves F, Aguado JM (March 2007). "Protean manifestations of pleural empyema caused by Streptococcus pneumoniae in adults". Eur. J. Intern. Med. 18 (2): 141–5. doi:10.1016/j.ejim.2006.09.017. PMID 17338967.
3. ^ King S, Thomson A (2002). "Radiological perspectives in empyema". British Medical Bulletin. 61: 203–14. doi:10.1093/bmb/61.1.203. PMID 11997307.
4. ^ a b c d e Balfour-Lynn IM, Abrahamson E, Cohen G, Hartley J, King S, Parikh D, Spencer D, Thomson AH, Urquhart D (2005). "BTS guidelines for the management of pleural infection in children". Thorax. 60 (Suppl 1): 1–21. doi:10.1136/thx.2004.030676. PMC 1766040. PMID 15681514.
5. ^ Yildiz S, Cece H, Turksoy O (October 2010). "Discriminative role of CT in exudative and transudative pleural effusions". AJR Am J Roentgenol. 195 (4): W305, author reply W306. doi:10.2214/AJR.10.4437. ISSN 0361-803X. PMID 20858794.
6. ^ Moshe Schein, John C. Marshall (2013). Source Control: A Guide to the Management of Surgical Infections. Springer Science & Business Media. ISBN 9783642559143.
7. ^ a b Ahmed R, Marri T, Huang J (2006). "Thoracic empyema in patients with community-acquired pneumonia". American Journal of Medicine. 119 (10): 877–83. doi:10.1016/j.amjmed.2006.03.042. PMID 17000220.
8. ^ a b Ferrer A, Osset J, Alegre J, Suriñach JM, Crespo E, Fernández de Sevilla T, Fernández F (April 1999). "Prospective clinical and microbiological study of pleural effusions". Eur. J. Clin. Microbiol. Infect. Dis. 18 (4): 237–41. doi:10.1007/s100960050270. PMID 10385010.
9. ^ a b c d e f Davies H, Davies R, Davies C (2010). "Management of pleural infection in adults: British Thoracic Society Pleural Disease Guideline 2010". Thorax. 65 (Suppl 2): 41–53. doi:10.1136/thx.2010.137000. PMID 20696693.
10. ^ a b c Le Monnier A, Carbonnelle E, Zahar JR, Le Bourgeois M, Abachin E, Quesne G, Varon E, Descamps P, De Blic J, Scheinmann P, Berche P, Ferroni A (2006). "Microbiological diagnosis of empyema in children: comparative evaluations by culture, polymerase chain reaction, and pneumococcal antigen detection in pleural fluids". Clinical Infectious Diseases. 42 (8): 1135–40. doi:10.1086/502680. PMID 16575731.
11. ^ a b c d "UOTW #28 - Ultrasound of the Week". Ultrasound of the Week. 3 December 2014. Retrieved 27 May 2017.
12. ^ Sasse S, Nguyen TK, Mulligan M, Wang NS, Mahutte CK, Light RW (June 1997). "The effects of early chest tube placement on empyema resolution". Chest. 111 (6): 1679–83. doi:10.1378/chest.111.6.1679. PMID 9187193.
13. ^ Heffner JE, Brown LK, Barbieri C, DeLeo JM (June 1995). "Pleural fluid chemical analysis in parapneumonic effusions. A meta-analysis". Am. J. Respir. Crit. Care Med. 151 (6): 1700–8. doi:10.1164/ajrccm.151.6.7767510. PMID 7767510.
14. ^ a b Maskell NA, Davies CW, Nunn AJ, Hedley EL, Gleeson FV, Miller R, Gabe R, Rees GL, Peto TE, Woodhead MA, Lane DJ, Darbyshire JH, Davies RJ (2005). "U.K. controlled trial of intrapleural streptokinase for pleural infection". New England Journal of Medicine. 352 (9): 865–74. doi:10.1056/nejmoa042473. PMID 15745977.
15. ^ Nie W, Liu Y, Ye J, Shi L, Shao F, Ying K, Zhang R (July 2014). "Efficacy of intrapleural instillation of fibrinolytics for treating pleural empyema and parapneumonic effusion: a meta-analysis of randomized control trials". Clin Respir J. 8 (3): 281–91. doi:10.1111/crj.12068. PMID 24428897.
16. ^ Ferguson AD, Prescott RJ, Selkon JB, Watson D, Swinburn CR (April 1996). "The clinical course and management of thoracic empyema". QJM. 89 (4): 285–9. doi:10.1093/qjmed/89.4.285. PMID 8733515.
17. ^ Teixeira LR, Sasse SA, Villarino MA, Nguyen T, Mulligan ME, Light RW (June 2000). "Antibiotic levels in empyemic pleural fluid". Chest. 117 (6): 1734–9. doi:10.1378/chest.117.6.1734. PMID 10858410.
18. ^ Umut S, Demir T, Akkan G, Keskiner N, Yilmaz V, Yildirim N, Sipahioğlu B, Hasan A, Barlas A, Sözer K (April 1993). "Penetration of ciprofloxacin into pleural fluid". J Chemother. 5 (2): 110–2. doi:10.1080/1120009X.1993.11739217. PMID 8515292.
19. ^ Davies CW, Kearney SE, Gleeson FV, Davies RJ (November 1999). "Predictors of outcome and long-term survival in patients with pleural infection". Am. J. Respir. Crit. Care Med. 160 (5 Pt 1): 1682–7. doi:10.1164/ajrccm.160.5.9903002. PMID 10556140.
20. ^ Alfageme I, Muñoz F, Peña N, Umbría S (March 1993). "Empyema of the thorax in adults. Etiology, microbiologic findings, and management". Chest. 103 (3): 839–43. doi:10.1378/chest.103.3.839. PMID 8449078.
21. ^ Li S, Tancredi D (2010). "Empyema hospitalizations increased in US children despite pneumococcal conjugate vaccine". Pediatrics. 125 (1): 26–33. doi:10.1542/peds.2009-0184. PMID 19948570.
22. ^ Byington CL, Spencer LY, Johnson TA, Pavia AT, Allen D, Mason EO, Kaplan S, Carroll KC, Daly JA, Christenson JC, Samore MH (2002). "An epidemiological investigation of a sustained high rate of pediatric parapneumonic empyema: risk factors and microbiological associations". Clinical Infectious Diseases. 34 (4): 434–40. doi:10.1086/338460. PMID 11797168.
23. ^ Grijalva CG, Nuorti JP, Zhu Y, Griffin MR (2010). "Increasing incidence of empyema complicating childhood community-acquired pneumonia in the United States". Clinical Infectious Diseases. 50 (6): 805–13. doi:10.1086/650573. PMC 4696869. PMID 20166818.
24. ^ Obando I, Camacho-Lovillo MS, Porras A, Gandía-González MA, Molinos A, Vazquez-Barba I, Morillo-Gutierrez B, Neth OW, Tarrago D (August 2012). "Sustained high prevalence of pneumococcal serotype 1 in paediatric parapneumonic empyema in southern Spain from 2005 to 2009". Clin. Microbiol. Infect. 18 (8): 763–8. doi:10.1111/j.1469-0691.2011.03632.x. PMID 21910779.
## External links[edit]
Classification
D
* ICD-10: J86
* ICD-9-CM: 510
* MeSH: D016724
* DiseasesDB: 4200
External resources
* MedlinePlus: 000123
* eMedicine: med/659
* Empyema, Pleuropulmonary at eMedicine
* v
* t
* e
Diseases of the respiratory system
Upper RT
(including URTIs,
common cold)
Head
sinuses
Sinusitis
nose
Rhinitis
Vasomotor rhinitis
Atrophic rhinitis
Hay fever
Nasal polyp
Rhinorrhea
nasal septum
Nasal septum deviation
Nasal septum perforation
Nasal septal hematoma
tonsil
Tonsillitis
Adenoid hypertrophy
Peritonsillar abscess
Neck
pharynx
Pharyngitis
Strep throat
Laryngopharyngeal reflux (LPR)
Retropharyngeal abscess
larynx
Croup
Laryngomalacia
Laryngeal cyst
Laryngitis
Laryngopharyngeal reflux (LPR)
Laryngospasm
vocal cords
Laryngopharyngeal reflux (LPR)
Vocal fold nodule
Vocal fold paresis
Vocal cord dysfunction
epiglottis
Epiglottitis
trachea
Tracheitis
Laryngotracheal stenosis
Lower RT/lung disease
(including LRTIs)
Bronchial/
obstructive
acute
Acute bronchitis
chronic
COPD
Chronic bronchitis
Acute exacerbation of COPD)
Asthma (Status asthmaticus
Aspirin-induced
Exercise-induced
Bronchiectasis
Cystic fibrosis
unspecified
Bronchitis
Bronchiolitis
Bronchiolitis obliterans
Diffuse panbronchiolitis
Interstitial/
restrictive
(fibrosis)
External agents/
occupational
lung disease
Pneumoconiosis
Aluminosis
Asbestosis
Baritosis
Bauxite fibrosis
Berylliosis
Caplan's syndrome
Chalicosis
Coalworker's pneumoconiosis
Siderosis
Silicosis
Talcosis
Byssinosis
Hypersensitivity pneumonitis
Bagassosis
Bird fancier's lung
Farmer's lung
Lycoperdonosis
Other
* ARDS
* Combined pulmonary fibrosis and emphysema
* Pulmonary edema
* Löffler's syndrome/Eosinophilic pneumonia
* Respiratory hypersensitivity
* Allergic bronchopulmonary aspergillosis
* Hamman-Rich syndrome
* Idiopathic pulmonary fibrosis
* Sarcoidosis
* Vaping-associated pulmonary injury
Obstructive / Restrictive
Pneumonia/
pneumonitis
By pathogen
* Viral
* Bacterial
* Pneumococcal
* Klebsiella
* Atypical bacterial
* Mycoplasma
* Legionnaires' disease
* Chlamydiae
* Fungal
* Pneumocystis
* Parasitic
* noninfectious
* Chemical/Mendelson's syndrome
* Aspiration/Lipid
By vector/route
* Community-acquired
* Healthcare-associated
* Hospital-acquired
By distribution
* Broncho-
* Lobar
IIP
* UIP
* DIP
* BOOP-COP
* NSIP
* RB
Other
* Atelectasis
* circulatory
* Pulmonary hypertension
* Pulmonary embolism
* Lung abscess
Pleural cavity/
mediastinum
Pleural disease
* Pleuritis/pleurisy
* Pneumothorax/Hemopneumothorax
Pleural effusion
Hemothorax
Hydrothorax
Chylothorax
Empyema/pyothorax
Malignant
Fibrothorax
Mediastinal disease
* Mediastinitis
* Mediastinal emphysema
Other/general
* Respiratory failure
* Influenza
* Common cold
* SARS
* Coronavirus disease 2019
* Idiopathic pulmonary haemosiderosis
* Pulmonary alveolar proteinosis
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Pleural empyema
|
c0014013
| 8,517 |
wikipedia
|
https://en.wikipedia.org/wiki/Pleural_empyema
| 2021-01-18T18:33:40 |
{"mesh": ["D016724"], "umls": ["C0014013"], "orphanet": ["449266"], "wikidata": ["Q200781"]}
|
A number sign (#) is used with this entry because of evidence that microcephaly, short stature, and impaired glucose metabolism-2 (MSSGM2) is caused by homozygous mutation in the PPP1R15B gene (613257) on chromosome 1q32.
Another syndrome involving microcephaly, short stature, and impaired glucose metabolism (MSSGM1; 616033) is caused by mutation in the TRMT10A gene (616013) on chromosome 4q23.
Clinical Features
Abdulkarim et al. (2015) studied a brother and sister from a consanguineous Algerian family who had microcephaly, short stature, and insulin-dependent diabetes mellitus. The 28-year-old brother had acute onset of polyuria and polydipsia at age 15 years and was diagnosed with diabetes. Type I diabetes-specific autoantibodies were negative, and there was evidence for residual beta-cell mass. Diabetes was initially well-controlled with relatively low doses of insulin, but evolved to significant glucose variability with severe hypoglycemic episodes and seizures. He also exhibited growth retardation, delayed puberty, and undescended right testis, but had normal growth hormone, testosterone, luteinizing hormone, and follicle-stimulating hormone levels. He eventually achieved full pubertal development, with adult genitalia and complete epiphyseal closure. He had microcephaly, severe intellectual disability, and neurogenic deafness. Brain MRI showed rarefaction of white matter. Other features included kyphoscoliosis, pectus excavatum, mild abnormalities of vertebral bodies, oligodontia and dental hypoplasia, sparse hair, and a high-pitched voice. Eye fundus was normal. Ultrasound showed small kidneys, with mild dilation of calyces. The proband's 31-year-old sister was similarly affected, with growth retardation, microcephaly, intellectual disability, and diabetes presenting with acute hyperglycemia and ketoacidosis at age 28 years. She also had dental hypoplasia and a high-pitched voice. She underwent menarche at 14 years of age. Both sibs were small for gestational age at birth. Their first-cousin parents had normal fasting glucose values, and the mother was not known to have had gestational diabetes.
Kernohan et al. (2015) reported a Canadian sister and brother, born to second-cousin parents, who had severe microcephaly, short stature, intellectual disability, and hypoplastic brainstem and cord with delayed myelination. The 5-year-old sister and 3.75-year-old brother shared similar dysmorphic features that included round face, full cheeks, hypotelorism, downslanting palpebral fissures, epicanthal folds, small mouth with downturned corners, micrognathia, large ears, fine sparse hair, and shoulders that were rounded and sloping. The sister had a small vocabulary and her speech was dysarthric; her brother could mimic sounds but had no clear words. Neurologic evaluation showed decreased axial tone with spasticity that was greater in the lower than upper extremities and weak distal strength. Plantar reflexes were downgoing with brisk reflexes in the sister, whereas the brother had upgoing plantar reflexes. Sensation appeared intact. Both sibs had a wide-based ataxic gait with truncal instability and everted feet. The sister also had a low amplitude/high frequency kinetic tremor in both hands and mild dysmetria. Brain MRI in both sibs showed delayed myelination, small brainstem, decreased cerebellar volume, thin corpus callosum, and diminished volume of the cervical cord. The brother also had pectus excavatum with strikingly visible veins.
Molecular Genetics
By whole-exome sequencing in an Algerian man from a consanguineous family with microcephaly, short stature, intellectual disability, and diabetes, Abdulkarim et al. (2015) identified homozygosity for a missense mutation in the PP1R15B gene (R658C; 613257.0001). His affected sister was also homozygous for the mutation, but parental DNA was unavailable for study. Analysis of PP1R15B in 50 additional patients with a similar clinical presentation did not reveal any mutations.
In a 5-year-old Canadian girl and her 3.75-year-old brother with severe microcephaly, short stature, hypoplastic brainstem and cord, delayed myelination, and intellectual disability, Kernohan et al. (2015) performed whole-exome sequencing and identified homozygosity for the R658C missense mutation in the PP1R15B gene.
INHERITANCE \- Autosomal recessive GROWTH Height \- Short stature Other \- Intrauterine growth retardation HEAD & NECK Head \- Severe microcephaly Face \- Full cheeks (in some patients) \- Micrognathia (in some patients) Ears \- Large ears (in some patients) \- Sensorineural deafness (rare) Eyes \- Hypotelorism (in some patients) \- Epicanthal folds (in some patients) \- Downslanting palpebral fissures (in some patients) \- Blue sclerae (rare) Mouth \- Small mouth (in some patients) \- Downturned corners of mouth (in some patients) Teeth \- Dental hypoplasia (in some patients) \- Oligodontia (in some patients) CHEST External Features \- Pectus excavatum \- Prominent veins (in some patients) Ribs Sternum Clavicles & Scapulae \- Rounded shoulders (in some patients) \- Sloping shoulders (in some patients) ABDOMEN Pancreas \- Young-onset diabetes GENITOURINARY Internal Genitalia (Male) \- Undescended testis (in some patients) Kidneys \- Small kidneys (in some patients) \- Dilated calyces (in some patients) SKELETAL \- Delayed bone age (in some patients) Skull \- Severe microcephaly Spine \- Kyphoscoliosis (in some patients) \- Tall vertebral bodies (in some patients) \- Hyperlordosis (in some patients) \- Loss of lumbar lordosis (in some patients) Feet \- Everted feet (in some patients) SKIN, NAILS, & HAIR Hair \- Thin hair \- Sparse hair NEUROLOGIC Central Nervous System \- Mental retardation, severe \- Hypoglycemia-related seizures (rare) \- Decreased axial tone (in some patients) \- Decreased distal strength (in some patients) \- Ataxic gait (in some patients) \- Truncal ataxia (in some patients) \- Low-amplitude high-frequency kinetic tremor of hands (rare) \- Mild dysmetria (rare) \- Rarefaction of white matter (in some patients) \- Small brainstem (in some patients) \- Delayed myelination (in some patients) \- Decreased cerebellar volume (in some patients) \- Thin corpus callosum (in some patients) \- Decreased volume of cervical cord (in some patients) VOICE \- High-pitched voice (in some patients) \- Dysarthric speech (rare) ENDOCRINE FEATURES \- Young-onset diabetes \- Residual beta-cell mass present \- Insulin administration required for glucose control \- Delayed puberty (in some patients) \- Hypothyroidism (rare) MISCELLANEOUS \- Variable phenotype \- Two consanguineous families with two affected sibs each have been reported (last curated February 2016) \- Diabetes diagnosed in second or third decade of life MOLECULAR BASIS \- Caused by mutation in the protein phosphatase-1, regulatory subunit-15B gene (PPP1R15B, 613257.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
MICROCEPHALY, SHORT STATURE, AND IMPAIRED GLUCOSE METABOLISM 2
|
c4225195
| 8,518 |
omim
|
https://www.omim.org/entry/616817
| 2019-09-22T15:47:49 |
{"omim": ["616817"], "orphanet": ["391408"], "synonyms": []}
|
Common and highly contagious viral infection of the eye
Acute phase with conjunctival inflammation
Adenoviral keratoconjunctivitis, also known as Keratoconjunctivitis epidemica is a common and highly contagious viral infection of the eye.
The clinical course of (AKC) should be divided into an acute phase with conjunctival inflammation of varying intensity with or without corneal involvement and a chronic phase with corneal opacities. AKC is caused by many different serotypes and is highly contagious during the acute phase.
## Contents
* 1 Epidemiology
* 2 Clinical signs
* 3 Treatment
* 4 Prevention
* 5 References
## Epidemiology[edit]
The economic and social price of AKC as a community epidemic is high.
## Clinical signs[edit]
Corneal opacities, the hallmark of the chronic phase, are usually self-limited. They may occur as numular keratitis.
## Treatment[edit]
Topical steroids should be avoided because they prolong viral replication, frequently lead to long-lasting dry eye symptoms, and corneal opacities almost always recur after discontinuation of topical steroids. There is currently no effective and clinically applicable topical antiviral agent for the treatment of the acute phase of AKC. Topical cidofovir is the first antiviral agent which has effectively reduced the incidence of corneal opacities, but local toxicity rules out its clinical application. Recently, NMSO3, a sulfated sialyl lipid, has demonstrated a greater antiviral potency against adenovirus in vitro than cidofovir exhibiting minimal cytotoxicity.[1] Topical cyclosporin A (CsA) appears to be effective in the treatment of persistent corneal opacities. Topical interferon might be effective as a prophylaxis of infection. Topical interferon is currently not commercially available due to unsettled patent issues.
## Prevention[edit]
Adequate infection control measures should be followed as prevention and to reduce epidemic AKC outbreaks.[2]
## References[edit]
1. ^ Kaneko H; et al. (2001). "Antiviral activity of NMSO3 against adenovirus in vitro". Antiviral Res. 52 (3): 281–8. doi:10.1016/s0166-3542(01)00167-x. PMID 11675145.
2. ^ Reinhard, Thomas; Larkin, Frank (28 January 2006). Cornea and External Eye Disease. google.com.au. ISBN 9783540312260. Retrieved 22 March 2015.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Adenoviral keratoconjunctivitis
|
c0014493
| 8,519 |
wikipedia
|
https://en.wikipedia.org/wiki/Adenoviral_keratoconjunctivitis
| 2021-01-18T19:05:11 |
{"umls": ["C0014493"], "icd-10": ["B30.0"], "wikidata": ["Q769741"]}
|
Blue Diaper syndrome is a hereditary metabolic disorder characterised by hypercalcaemia with nephrocalcinosis and indicanuria.
## Epidemiology
The prevalence is unknown.
## Clinical description
Affected infants present with digestive problems, fever and periodic irritability. Visual disturbances have also been reported. The disease is associated with a defect in intestinal tryptophan absorption that leads to a bluish discoloration of the urine when it comes into contact with the air.
## Etiology
The defect in tryptophan absorption may be associated with mutations in the LAT2 and TAT1 genes, encoding two amino acid transporters.
## Genetic counseling
Transmission may be autosomal recessive or X-linked.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Blue diaper syndrome
|
c0268478
| 8,520 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=94086
| 2021-01-23T18:54:47 |
{"gard": ["5939"], "mesh": ["C536239"], "omim": ["211000"], "umls": ["C0268478"], "icd-10": ["E70.8"], "synonyms": ["Drummond syndrome", "Familial hypercalcemia-nephrocalcinosis-indicanuria syndrome"]}
|
Allan-Herndon-Dudley syndrome is a disorder of brain development that causes moderate to severe intellectual disability and problems with movement. This condition, which occurs exclusively in males, disrupts development from before birth. Although affected males have speech and a limited ability to communicate, they seem to enjoy interaction with others. Allan-Herndon-Dudley syndrome is caused by mutations in the SLC16A2 gene. It is inherited in an X-linked recessive manner.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Allan-Herndon-Dudley syndrome
|
c0795889
| 8,521 |
gard
|
https://rarediseases.info.nih.gov/diseases/5617/allan-herndon-dudley-syndrome
| 2021-01-18T18:02:12 |
{"mesh": ["C537047"], "omim": ["300523"], "umls": ["C0795889"], "orphanet": ["59"], "synonyms": ["AHDS", "Allan-Herndon syndrome", "Monocarboxylate transporter-8 deficiency", "Triiodothyronine resistence", "T3 resisitence", "Intellectual disability and muscular atrophy", "X-linked intellectual disability with hypotonia"]}
|
A number sign (#) is used with this entry because of evidence that pretibial dystrophic epidermolysis bullosa (DEB) is caused by heterozygous or compound heterozygous mutation in the type VII collagen gene (COL7A1; 120120) on chromosome 3p21.
Pretibial epidermolysis bullosa is allelic to autosomal dominant (DDEB; 131750) and recessive (RDEB; 226600) dystrophic epidermolysis bullosa.
Clinical Features
Pretibial EB is characterized by recurrent blistering and scarring, mainly in the pretibial area. The lesions often show lichenoid features (Naeyaert et al., 1995).
Portugal and Jacintho (1956) observed pretibial dystrophic epidermolysis bullosa in father and son. Kuske (1946) observed it in males of 3 successive generations.
Garcia-Perez and Carapeto (1975) reported 2 kindreds with pretibial epidermolysis bullosa inherited in an autosomal dominant pattern. Onset occurred between 11 and 24 years of age. One affected individual in 1 family had albopapuloid skin lesions similar to those of the Pasini form of DEB (see 131750).
Lee et al. (1993) reported 19 patients from 13 Taiwanese families with dystrophic epidermolysis bullosa characterized by blisters and scars that primarily involved the pretibial area. Inheritance was autosomal dominant in 10 families, there was sib involvement in 2 families, and 1 family had a sporadic case. Nail dystrophy was noted in all patients, and pruritus was a common feature. Extensive prurigo occurred in 4 patients. Eight patients had skin lesions that exclusively affected the legs, whereas the remaining patients also showed some albopapuloid or hypertrophic scars at sites other than the leg, features seen in the albopapuloid or Cockayne-Touraine types of DEB. Compared with normal controls, the anchoring fibrils were rudimentary and sparser in both lesional and normal skin and were not clearly distinguishable from those observed in other types of DEB. Christiano et al. (1995) provided follow-up on 1 of the families reported by Lee et al. (1993). The clinical phenotype was characterized by pretibial blisters that developed into prurigo-like hyperkeratotic lesions. The lesions were present predominantly on the pretibial areas, sparing the knees and other parts of the skin. Other clinical features included nail dystrophy, albopapuloid skin lesions, and hypertrophic scars without pretibial predominance. There was considerable variability.
Naeyaert et al. (1995) described a large Belgian family with pretibial DEB. The clinical presentation in the proband strongly resembled keratosis lichenoides chronica, which delayed proper diagnosis. Affected members of this family had onset after 10 years of age, and the lesions were strikingly lichenoid.
Mapping
By linkage analysis of a large Belgian family with pretibial DEB, Naeyaert et al. (1995) found linkage to the COL7A1 gene on chromosome 3p (2-point lod score of 4.45).
Molecular Genetics
In a family of Taiwanese descent in which 12 living individuals in 3 generations had pretibial DEB (Lee et al., 1993), Christiano et al. (1995) identified a heterozygous mutation in the COL7A1 gene (G2623C; 120120.0007).
Betts et al. (1999) described pretibial dystrophic epidermolysis bullosa due apparently to a recessively inherited COL7A1 splice site mutation affecting procollagen VII processing (120120.0021).
In an Italian patient with autosomal recessive pretibial epidermolysis bullosa, Gardella et al. (2002) identified compound heterozygous mutations in the COL7A1 gene (P1699L, 120120.0029; IVSAS2-1G-C, 120120.0030).
INHERITANCE \- Autosomal dominant \- Autosomal recessive SKIN, NAILS, & HAIR Skin \- Dystrophic epidermolysis bullosa (predominantly but not restricted to the pretibial area) \- Blistering, recurrent \- Lichenoid lesions \- Hyperkeratosis \- Erythematous indurated plaques on the shins \- Hypertrophic scars \- Prurigo \- Pruritis \- Albopapuloid lesions may occur Electron Microscopy \- Sublamina densa level of tissue separation beneath basal membrane \- Decreased number of anchoring fibrils at dermal-epidermal junction \- Hypotrophic anchoring fibrils \- Decreased staining for collagen VII Nails \- Dystrophic nails MISCELLANEOUS \- Onset in late childhood (after age 10 years) \- Blisters are precipitated by minor skin trauma \- Intrafamilial variability \- Both autosomal dominant and recessive inheritance can occur \- Allelic disorder to dominant epidermolysis bullosa (DDEB, 131750 ) MOLECULAR BASIS \- Caused by mutation in the collagen type VII, alpha-1 gene (COL7A1, 120120.0007 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
EPIDERMOLYSIS BULLOSA DYSTROPHICA, PRETIBIAL
|
c0432321
| 8,522 |
omim
|
https://www.omim.org/entry/131850
| 2019-09-22T16:41:32 |
{"mesh": ["C535494"], "omim": ["131850"], "orphanet": ["79410"], "synonyms": ["Alternative titles", "DYSTROPHIC EPIDERMOLYSIS BULLOSA, PRETIBIAL", "DEB, PRETIBIAL", "EPIDERMOLYSIS BULLOSA, PRETIBIAL"], "genereviews": ["NBK1304"]}
|
## Description
Restless legs syndrome (RLS) is a neurologic sleep/wake disorder characterized by uncomfortable and unpleasant sensations in the legs that appear at rest, usually at night, inducing an irresistible desire to move the legs. The disorder results in nocturnal insomnia and chronic sleep deprivation (Bonati et al., 2003).
### Genetic Heterogeneity of Restless Legs Syndrome
RLS1 has been mapped to chromosome 12q. Other susceptibility loci for RLS include RLS2 (608831) on chromosome 14q13-q31; RLS3 (610438) on chromosome 9p24-p22; RLS4 (610439) on chromosome 2q33; RLS5 (611242) on chromosome 20p13; RLS6 (611185) on chromosome 6p21; RLS7 (612853) on chromosome 2p14; and RLS8 (615197) on chromosome 5q31.
Clinical Features
Ekbom (1945) first described restless legs syndrome. Affected persons experience paresthesias in the legs when first going to bed or sitting still for a time and cannot resist fidgeting with their feet. Huizinga (1957) described a family with affected persons in 5 generations. The condition, which began in adolescence, was relieved by cold. Ekbom (1960) and Bornstein (1961) also described familial aggregation. Autosomal dominant inheritance was particularly well documented by Boghen and Peyronnard (1976), who furthermore described myoclonic jerks in 10 of 18 affected persons. The jerks occurred at night before sleep and severely interfered with it. The authors referred to the 'painful-legs--moving-toes syndrome' in a patient whose relatives had the restless legs syndrome and proposed that the disorders are the same. Sudden bodily jerking on falling asleep is a frequent finding in normal persons (Oswald, 1959).
Ondo et al. (2000) noted the phenotypic variation in genetic RLS. They reported 12 pairs of monozygotic twins in which both members of 10 pairs had definite restless legs syndrome based on criteria proposed by the International Restless Legs Syndrome Study Group (IRLSSG) including the desire to move the extremities associated with paresthesia/dysesthesia; motor restlessness; worsening of symptoms at rest with temporary relief by activity; and worsening of symptoms in the evening or night. Despite the high concordance rate and high penetrance, the symptom descriptions and age at onset varied markedly.
Earley (2003) gave a clinical review of the restless legs syndrome and its management. Earley (2003) stated that a familial association seems to be most obvious in the family members of female patients whose symptoms start early in life.
Manconi et al. (2004) found that 161 (26.6%) of 606 Italian pregnant women had symptoms of RLS during pregnancy. Sixty (9.9%) of these women experienced symptoms before pregnancy. Of those with preexisting RLS, 11% reported an improvement of RLS during pregnancy, 28% observed no change, and 61% had a significant worsening of symptoms after pregnancy began, particularly during the third trimester. RLS symptoms dramatically decreased around the time of delivery and were present in only 8 women (5%) 6 months after delivery. Despite similar amounts of iron and folate supplements, women with RLS had evidence of decreased plasma iron stores, as indicated by decreased hemoglobin and decreased mean corpuscular volume (MCV) compared to the women without RLS. Manconi et al. (2004) suggested that hormonal changes contribute to the pathogenesis of RLS during pregnancy. In a follow-up study involving 207 previously pregnant women, including 74 who experienced RLS during pregnancy and 133 who did not, Cesnik et al. (2010) found that patients with transient RLS during pregnancy were at increased risk of having recurrence of RLS during pregnancy and at 4-fold increased risk of developing the chronic form of RLS compared to women who did not have RLS during pregnancy.
Kotagal and Silber (2004) reported that 32 (5.9%) of 538 patients under the age of 18 years with sleep disorders in their clinic had features consistent with RLS. Sleep onset or sleep maintenance insomnia was the most common symptom (87.5%). Serum ferritin (see 134770) levels were decreased in 20 (83%) of 24 patients tested, suggesting that iron deficiency is a characteristic of the disorder. A family history of RLS was present in 72%, with mothers almost 3 times more likely to be affected than fathers. Kotagal and Silber (2004) concluded that RLS in childhood is similar to that seen in adults. Konofal and Cortese (2005) commented on the observed association between RLS and attention deficit-hyperactivity disorder (ADHD; 143465) in some children, and postulated a common alteration in dopaminergic function.
In a cross-sectional community-based study of 701 individuals aged 50 to 89 years in Northern Italy, Hogl et al. (2005) found that 10.6% of individuals had symptoms consistent with RLS. The prevalence was over twice as high in women (14.2%) than in men (6.6%). Although two-thirds of patients reported moderate to severe disease, none had received dopaminergic therapy. Free serum iron, transferrin (TF; 190000), and ferritin concentrations were similar in individuals with and without RLS, but those with RLS had higher serum concentrations of soluble transferrin receptor (TFRC; 190010).
Other Features
Earley et al. (2000) found that 16 patients with RLS had significantly lower CSF ferritin and higher CSF transferrin levels compared to controls. There was no difference in serum ferritin and transferrin levels between the 2 groups. The findings suggested that RLS patients have low stores of iron in the brain.
Using a special MRI measurement to assess regional brain iron concentrations, Allen et al. (2001) found that 5 patients with RLS had decreased iron levels in the substantia nigra and putamen compared to 5 controls. The iron decreases were more pronounced in those patients with more severe RLS.
By postmortem examination and immunohistochemical analysis, Connor et al. (2003) found a dramatic decrease in iron and ferritin heavy chain and an increase in transferrin in the substantia nigra of 7 RLS brains compared to controls. Staining for transferrin receptors was not increased, as would be expected with iron deficiency. In addition, RLS brains had decreased staining for the divalent metal transporter-1 (DMT1; 600523), which is important for iron uptake into cells, and the iron transport protein MTP1 (156360). Tyrosine hydroxylase (TH; 191290) staining of dopaminergic neurons was normal in RLS brains. Connor et al. (2003) hypothesized that the defect in RLS involves a defect in iron acquisition in neuromelanin cells, which could lead to other changes, including impaired dopaminergic activity.
Connor et al. (2004) isolated neuromelanin cells from the substantia nigra of 4 patients with RLS using laser capture microdissection. Protein isolation and immunoblotting techniques showed that cells from the RLS patients had a 40% decrease in ferritin heavy chain, whereas ferritin light chain was similar to controls. The 2 iron transport proteins DMT1 and ferroportin (604653) and the transferrin receptor were also decreased in RLS neuromelanin cells. Transferrin was increased by 72% compared to controls. Iron regulatory protein-1 (IRP1; 100880) was decreased and IRP2 (147582) was increased in RLS brains compared to controls. Connor et al. (2004) suggested that a decrease in IRP1 in neuromelanin cells in RLS may result in instability of the transferrin receptor mRNA, leading to cellular iron deficiency.
Approximately 80% of RLS patients experience periodic limb movements in sleep (PLMS), which are rhythmic extensions of the big toe and dorsiflexion of the ankle, with occasional flexion at the knee and hip. Although PLMS is more common in RLS patients, it can occur in other sleep disorders as well. In a polysomnographic study of 10 patients with RLS who also had PLMS, Pennestri et al. (2007) found that blood pressure increased significantly with all periodic limb movements in sleep, particularly those associated with microarousals. Changes in blood pressure increased with age and duration of the illness. Transient tachycardia was also observed in association with PLMS. Pennestri et al. (2007) suggested that these changes could contribute to increased risk for cardiovascular events and disease in RLS patients.
Della Marca et al. (2009) reported 7 patients with myalgia in the lower limbs and increased serum creatine kinase (hyperCKemia; 123320) who were found to have severe restless legs syndrome with severe periodic limb movements in sleep. Treatment of RLS resulted in improved serum creatine kinase levels in 6 patient who underwent treatment. The authors concluded that some severe cases of RLS can result in increased serum CK, and discussed the possible overlap of the 2 disorders.
Diagnosis
Allen et al. (2003) reported the revised diagnostic criteria developed by the International Restless Legs Syndrome Study Group. Patients must have (1) an urge to move the legs, usually accompanied by uncomfortable or unpleasant sensations in the legs; (2) the urge to move or unpleasant sensations begin or worsen during periods of rest or inactivity such as lying or sitting; (3) the urge to move or unpleasant sensations are partially or totally relieved by movement; (4) the urge to move or unpleasant sensations are worse in the evening or at night than during the day. Most patients experience sleep disturbances. Allen et al. (2003) noted that the diagnosis may be difficult to determine in elderly patients with cognitive impairment and in children and suggested additional methods of evaluating these patients.
Clinical Management
Most patients with RLS have a favorable response to dopaminergic drugs (Allen et al., 2003).
Allen and Earley (1996) reported that 82% of 30 RLS patients treated with dopaminergic agents experienced 'augmentation' of their symptoms in the afternoon and evening prior to taking the next nightly dose. This phenomenon was distinct from 'rebound,' in which RLS symptoms worsen in the early morning. Augmentation was greater for those with more severe symptoms and for patients on higher doses, but was unrelated to age or gender.
Allen et al. (2003) defined augmentation as a shift of RLS symptoms to a time period that is 2 or more hours earlier than was typical of the time of symptom onset before starting treatment. Augmentation typically presents within 6 months after treatment begins.
In a prospective randomized clinical trial of 85 patients with RLS, Stiasny-Kolster et al. (2004) found that the dopamine agonist cabergoline was an effective treatment. The beneficial effects lasted for 1 year, with 6 patients experiencing mild augmentation.
Tippmann-Peikert et al. (2007) reported 3 patients with RLS who developed pathologic gambling (see 606349) after treatment with dopamine agonists. The behavior was dose-dependent, and there were no other compulsive behaviors. Pathologic gambling resolved in all 3 patients after discontinuation of the medication. In 1 patient, treatment with gabapentin led to resolution of RLS symptoms without side effects.
Inheritance
Pedigree analysis in families of 12 pairs of monozygotic twins suggested autosomal dominant inheritance (Ondo et al., 2000). Trenkwalder et al. (1996) found evidence of anticipation in restless legs syndrome in 1 large German pedigree. The disorder had a 30-year age-at-onset difference between generations.
Winkelmann et al. (2002) performed a complex segregation analysis of RLS in 2 groups of families: those with mean age at onset up to 30 years, and those older than 30 years. In the former, they demonstrated the action of a single major gene behaving as an autosomal dominant with a multifactorial component, and found no evidence for a major gene in the latter.
In a review of several studies, Allen et al. (2003) found that more than 50% of patients with RLS had a positive family history of RLS and that a person with RLS is 3 to 6 times more likely to have a family history of RLS than is a person who does not have RLS.
A family history of RLS was described in 40 to 90% of patients (Winkelmann and Ferini-Strambi, 2006), and the high concordance rate of 83.3% between identical twins (Ondo et al., 2000) supports a genetic basis.
Xiong et al. (2007) reported the results of an RLS questionnaire completed by 272 twin pairs in Canada, including 140 monozygotic (MZ)and 132 dizygotic (DZ) pairs. Eleven MZ twins pairs were concordant for RLS, compared to only 2 DZ pairs. Heritability was estimated at 69.4%. There was a high correlation of age at onset and severity scores among the affected twin pairs. There was also a strong associations between RLS and arthritis and between RLS and anemia. The findings confirmed a significant genetic component in RLS.
Among 249 Canadian probands with RLS, Xiong et al. (2010) reported that 192 (77.1%) had a family history of the disorder and 57 (22.9%) had sporadic disease. Among the familial cases, the relative risk was 3.6 for sibs and 1.8 for offspring. Most inheritance patterns were consistent with autosomal dominant, although autosomal recessive and bilineal inheritance were also observed. RLS was more common in women, and was associated with iron-deficiency anemia, arthritis, and pregnancy. The mean age of onset was 28 years, and there was some evidence for genetic anticipation within families. Overall, the findings indicated a significant familial component to RLS.
Mapping
To map genes that may play a role in the vulnerability to restless legs syndrome, Desautels et al. (2001) conducted a genomewide scan in a large French Canadian family. Significant linkage was established on chromosome 12q for a series of adjacent microsatellite markers with a maximum 2-point lod score of 3.42 at recombination fraction 0.05, assuming an autosomal recessive mode of inheritance, whereas multipoint linkage calculations yielded a lod score of 3.59. Haplotype analysis refined the genetic interval, positioning the RLS-predisposing gene in a 14.71-cM region between D12S1044 and D12S78. Several plausible candidate genes map to this region, including the homolog of timeless (TIM1; 603887), which maps to 12q12-q13, and neurotensin (NTS; 162650), which maps to 12q21. Kock et al. (2002) could not confirm the susceptibility locus for RLS on chromosome 12q in either of the families they studied. They questioned certain parameters used in the recessive model by Desautels et al. (2001). Winkelmann et al. (2002) noted that the study of the single French Canadian family by Desautels et al. (2001) used an autosomal recessive model with very high allele frequency (q = 0.75).
Desautels et al. (2005) performed linkage analysis using an autosomal recessive model on the family reported by Desautels et al. (2001) and 5 additional families with RLS; all of the families were of French Canadian origin. A maximum 2-point lod score of 5.67 was obtained at marker D12S1636; a maximum multipoint lod score of 8.84 was obtained between D12S326 and D12S304, thus confirming the presence of an RLS susceptibility locus on chromosome 12q. Desautels et al. (2005) noted that autosomal dominant inheritance is suggested clinically in RLS but stated that their lod scores were higher under a recessive model. Possible reasons included pseudodominant inheritance, particularly for a disorder with features of a founder effect in the French Canadian population, or ascertainment bias. Clinically, probands from the families linked to 12q showed increased periodic leg movements during sleep compared to those from families not linked to 12q.
Winkelmann et al. (2006) confirmed the assignment of RLS1 to chromosome 12q.
Heterogeneity
In a genomewide association study of 393 patients with restless legs syndrome and 1,602 controls, Winkelmann et al. (2007) found evidence for an association with several SNPs within a region on chromosome 15q that contains the LBXCOR1 (611273) and MAP2K5 (602520) genes.
In a study including 649 RLS patients and 1,230 controls from the Czech Republic, Austria, and Finland, Kemlink et al. (2009) identified an association between RLS and rs6494696 at chromosome 15q near the MAP2K5 and LBXCOR1 genes (p = 0.04; OR of 1.27). The association was found only in familial and not sporadic cases.
Molecular Genetics
Pichler et al. (2008) provided a detailed review of the genetics of RLS.
### Modifier Genes
Pharmacotherapy and brain imaging studies have suggested that the dopaminergic system plays a role in the pathogenesis of RLS. In 96 unrelated patients, Desautels et al. (2002) found that females with the high activity alleles of the MAOA gene (309850) promoter polymorphism (3.5, 4, and 5 repeats), which resulted in lower levels of synaptic dopamine, had a greater risk (odds ratio = 2.0) of being affected with RLS than females carrying the low activity allele (3 repeats). The affected females showed longer sleep latency and a higher movement index. The association was not observed in males, and there were no differences for either group regarding the MAOB gene (309860). Desautels et al. (2002) suggested that the MAOA gene may modulate the pathogenesis of RLS and that estrogen may interact with specific MAOA alleles.
INHERITANCE \- Autosomal dominant MUSCLE, SOFT TISSUES \- Leg cramps may occur with exercise NEUROLOGIC Central Nervous System \- Irresistible desire to move the legs \- Upper extremities may be involved \- Associated with paresthesias and dysesthesias \- Relief with motor activation \- Myoclonus \- Symptoms occur at rest \- Usually occurs at night \- Symptoms are exacerbated during pregnancy \- Results in nocturnal insomnia and chronic sleep deprivation \- Decreased iron content in the substantia nigra LABORATORY ABNORMALITIES \- Decreased CSF ferritin despite normal serum ferritin levels \- Increased CSF transferrin despite normal serum transferrin levels MISCELLANEOUS \- Onset in childhood, adolescence, and adulthood \- Usually progressive \- Affects up to 10% of the population \- Associated with iron deficiency anemia \- Associated with hemodialysis \- Genetic heterogeneity (see RLS2, 608831 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
RESTLESS LEGS SYNDROME, SUSCEPTIBILITY TO, 1
|
c1876177
| 8,523 |
omim
|
https://www.omim.org/entry/102300
| 2019-09-22T16:45:26 |
{"omim": ["102300"], "synonyms": ["Alternative titles", "ACROMELALGIA, HEREDITARY", "EKBOM SYNDROME"]}
|
Acute severe asthma
Other namesStatus asthmaticus, asthmatic status
SpecialtyRespirology
SymptomsAnxiety, panic, laboring to breath, tightened neck and chest muscles, difficulty performing normal daily activities[1]
Usual onsetSilent chest, worsening symptoms despite use of medication.[1]
Acute severe asthma, also known as status asthmaticus, is an acute exacerbation of asthma that does not respond to standard treatments of bronchodilators (inhalers) and corticosteroids. [2] Asthma is caused by multiple genes, some having protective effect, with each gene having its own tendency to be influenced by the environment although a genetic link leading to acute severe asthma is still unknown.[citation needed] Symptoms include chest tightness, rapidly progressive dyspnea(shortness of breath), dry cough, use of accessory respiratory muscles, fast and/or labored breathing, and extreme wheezing. It is a life-threatening episode of airway obstruction and is considered a medical emergency. Complications include cardiac and/or respiratory arrest. The increasing prevalence of atopy and asthma remains unexplained but may be due to infection with respiratory viruses. [3]
## Contents
* 1 Signs and symptoms
* 2 Cause
* 3 Mechanism
* 4 Diagnosis
* 4.1 Extrinsic compression
* 4.2 Congestive heart failure
* 4.3 Differential diagnoses
* 5 Treatment
* 6 Recent Research
* 7 Epidemiology
* 8 See also
* 9 References
* 10 External links
## Signs and symptoms[edit]
An exacerbation (attack) of asthma is experienced as a worsening of asthma symptoms with breathlessness and cough (often worse at night). In acute severe asthma, breathlessness may be so severe that it is impossible to speak more than a few words (inability to complete sentences).[4][5]
On examination, the respiratory rate may be elevated (more than 25 breaths per minute), and the heart rate may be rapid (110 beats per minute or faster). Reduced oxygen saturation levels (but above 92%) are often encountered. Examination of the lungs with a stethoscope may reveal reduced air entry and/or widespread wheeze.[5] The peak expiratory flow can be measured at the bedside; in acute severe asthma the flow is less than 50% a person's normal or predicted flow.[5]
Very severe acute asthma (termed "near-fatal" as there is an immediate risk to life) is characterised by a peak flow of less than 33% predicted, oxygen saturations below 92% or cyanosis (blue discoloration, usually of the lips), absence of audible breath sounds over the chest ("silent chest"), reduced respiratory effort and visible exhaustion or drowsiness. Irregularities in the heart beat and abnormal lowering of the blood pressure may be observed.[5]
Severe asthma attack can cause symptoms such as: [6]
* Shortness of breath
* Can't speak in full sentences
* Feel breathless even when lying down
* Chest feels tight
* Bluish tint to the lips
* Feeling agitated, confused, and unable to concentrate[7]
* Hunched shoulders, and strained muscles in stomach and neck
* Feeling the need to sit or stand up to breathe more easily
## Cause[edit]
The cause for Acute Severe Asthma attacks is still unknown and experts are also unsure of why its developed and why it doesn't respond to typical asthma treatments,[7] although there are some speculations: [6]
* Not seeing a doctor regularly, therefore asthma is not under good control
* Coming in contact with asthma triggers
* Allergies or severe allergic reactions
* Not using the peak flow meter and not taking asthma medication as directed by a primary care physician (PCP) correctly
* Not following an asthma action plan correctly
* respiratory infections[7]
* severe stress
* cold weather
* air pollution
* exposure to chemicals and other irritants
* smoking
## Mechanism[edit]
Inflammation in asthma is characterized by an influx of eosinophils during the early-phase reaction and a mixed cellular infiltrate composed of eosinophils, mast cells, lymphocytes, and neutrophils during the late-phase (or chronic) reaction. The simple explanation for allergic inflammation in asthma begins with the development of a predominantly helper T2 lymphocyte–driven, as opposed to helper T1 lymphocyte–driven, immune milieu, perhaps caused by certain types of immune stimulation early in life. This is followed by allergen exposure in a genetically susceptible individual.
Specific allergen exposure (e.g., dust mites) under the influence of helper Th2 helper T cells leads to B-lymphocyteelaboration of immunoglobulin E (IgE) antibodies specific to that allergen. The IgE antibody attaches to surface receptors on airway mucosal mast cells. One important question is whether atopic individuals with asthma, in contrast to atopic persons without asthma, have a defect in mucosal integrity that makes them susceptible to penetration of allergens into the mucosa.
Subsequent specific allergen exposure leads to cross-bridging of IgE molecules and activation of mast cells, with elaboration and release of a vast array of mediators. These mediators include histamine; leukotrienes C4, D4, and E4; and a host of cytokines. Together, these mediators cause bronchial smooth muscle constriction, vascular leakage, inflammatory cell recruitment (with further mediator release), and mucous gland secretion. These processes lead to airway obstruction by constriction of the smooth muscles, edema of the airways, influx of inflammatory cells, and formation of intraluminal mucus. In addition, ongoing airway inflammation is thought to cause the airway hyperreactivity characteristic of asthma. The more severe the airway obstruction, the more likely ventilation-perfusion mismatching will result in impaired gas exchange and low levels of oxygen in the blood.
## Diagnosis[edit]
Severe Acute Asthma can be diagnosed by a primary care physician (PCP). A PCP will ask questions in regards to symptoms and breathing; they will also ask if fatigue or wheezing has been experience when breathing in or out; and also test using a peak expiratory flow and an oxygen saturation.
Status asthmaticus can be misdiagnosed when wheezing occurs from an acute cause other than asthma. Some of these alternative causes of wheezing are discussed below.
### Extrinsic compression[edit]
Airways can be compressed from vascular structures, such as vascular rings, lymphadenopathy, or tumors.
### Congestive heart failure[edit]
Airway edema may cause wheezing in CHF. In addition, vascular compression may compress the airways during systole with cardiac ejection, resulting in a pulsatile wheeze that corresponds to the heart rate. This is sometimes erroneously referred to as cardiac asthma.
### Differential diagnoses[edit]
* Allergic bronchopulmonary aspergillosis
* Aspiration Syndromes
* Bronchiectasis
* Bronchiolitis
* Bronchiolitis obliterans
* Chronic bronchitis
* Chronic Obstructive Pulmonary Disease (COPD)
* Eosinophilic Granulomatosis with Polyangiitis (Churg-Strauss Syndrome)
* Croup
* Cystic Fibrosis
* Emphysema
* Foreign Bodies of the Airway
* Gastroesophageal Reflux Disease
* Heart Failure
* Idiopathic Pulmonary Arterial Hypertension
* Inhalation injury
* Pulmonary Artery Sling
* Vocal Cord Dysfunction
## Treatment[edit]
Interventions include intravenous (IV) medications (e.g. magnesium sulfate), aerosolized medications to dilate the airways (bronchodilation) (e.g., albuterol or ipratropium bromide/salbutamol), and positive-pressure therapy, including mechanical ventilation. Multiple therapies may be used simultaneously to rapidly reverse the effects of status asthmaticus and reduce permanent damage of the airways. Intravenous corticosteroids[8] and methylxanthines are often given. If the person with a severe asthma exacerbation is on a mechanical ventilator, certain sedating medications such as ketamine or propofol, have bronchodilating properties. According to a new randomized control trial ketamine and aminophylline are also effective in children with acute asthma who responds poorly to standard therapy.[9]
Status asthmaticus is slightly more common in males and is more common among people of African and Hispanic origin. The gene locus glutathione dependent S-nitrosoglutathione (GSNOR) has been suggested as one possible correlation to the development of status asthmaticus.
## Recent Research[edit]
A recent study proposed that the interaction between host airway epithelial cells and respiratory viruses is another aspect of innate immunity that is also a critical determination of asthma.[10] It was also proposed that a rationale for how antiviral performance at the epithelial cell level might be improved to prevent acute infectious illness and chronic inflammatory disease caused by respiratory viruses.
Another study aimed to show that experimental asthma after viral infection inmate depended on Type I IFN-driven up-regulation of the high-affinity receptor for IgE (FcεRI) on conventional dendritic cells (cDCs) in the lungs.[3] The study found that a Novell PMN-cDc interaction in the lung that is necessary of viral infection to induce atopic disease.
## Epidemiology[edit]
Status asthmaticus is slightly more common in males and is more common among people of African and Hispanic origin. The gene locus glutathione dependent S-nitrosoglutathione (GSNOR) has been suggested as one possible correlation to development of status asthmaticus.[11]
## See also[edit]
* Status epilepticus
* Status angiotensus
## References[edit]
1. ^ a b "What Is an Asthma Attack?". WebMD. 2019-01-30. Retrieved 2020-03-24.
2. ^ Shah, Rachna; Saltoun, Carol A. (May–June 2012). "Chapter 14: Acute severe asthma (status asthmaticus)". www.ingentaconnect.com. PMID 22794687. Retrieved 2019-11-06.
3. ^ a b Cheung, Dorothy S.; Ehlenbach, Sarah J.; Kitchens, Robert T.; Riley, Desiré A.; Thomas, Larry L.; Holtzman, Michael J.; Grayson, Mitchell H. (2010-11-01). "CD49d+ neutrophils induce FcεRI expression on lung dendritic cells in a mouse model of postviral asthma". Journal of Immunology. 185 (9): 4983–4987. doi:10.4049/jimmunol.1002456. ISSN 0022-1767. PMC 2959147. PMID 20876348.
4. ^ Kumar, Varun (2020-10-15). "Asthma". Bibo. Retrieved 2020-11-04.
5. ^ a b c d "SIGN 141 • British guideline on the management of asthma". Clinical guideline: asthma. London: British Thoracic Society and Scottish Intercollegiate Guidelines Network (BTS/SIGN). October 2014. Archived from the original on 12 September 2017. Retrieved 19 October 2014.
6. ^ a b "Status Asthmaticus (Severe Acute Asthma)". WebMD. Retrieved 2019-11-06.
7. ^ a b c "Status Asthmaticus: Symptoms, Causes, Diagnosis, and Treatment". Healthline. Retrieved 2019-11-06.
8. ^ Ratto, David; Alfaro, Carlos; Sipsey, Jeff; Glovsky, M. Michael; Sharma, Om P. (1988-07-22). "Are Intravenous Corticosteroids Required in Status Asthmaticus?". JAMA. 260 (4): 527–529. doi:10.1001/jama.1988.03410040099036. ISSN 0098-7484.
9. ^ Jat, KanaRam; Tiwari, Abhimanyu; Guglani, Vishal (2016). "Ketamine versus aminophylline for acute asthma in children: A randomized, controlled trial". Annals of Thoracic Medicine. 11 (4): 283–288. doi:10.4103/1817-1737.191874. ISSN 1817-1737. PMC 5070438. PMID 27803755.
10. ^ Holtzman, Michael J.; Patel, Dhara; Zhang, Yong; Patel, Anand C. (August 2011). "Host epithelial-viral interactions as cause and cure for asthma". Current Opinion in Immunology. 23 (4): 487–494. doi:10.1016/j.coi.2011.05.010. ISSN 0952-7915. PMC 3163712. PMID 21703838.
11. ^ Moore PE, Ryckman KK, Williams SM, Patel N, Summar ML, Sheller JR (9 July 2009). "Genetic variants of GSNOR and ADRB2 influence response to albuterol in African-American children with severe asthma". Pediatric Pulmonology. 44 (7): 649–654. doi:10.1002/ppul.21033. PMID 19514054.
## External links[edit]
Classification
D
* ICD-10: J46
* ICD-9-CM: 493.01, 493.91
* MeSH: D013224
External resources
* eMedicine: article/302238
* v
* t
* e
Diseases of the respiratory system
Upper RT
(including URTIs,
common cold)
Head
sinuses
Sinusitis
nose
Rhinitis
Vasomotor rhinitis
Atrophic rhinitis
Hay fever
Nasal polyp
Rhinorrhea
nasal septum
Nasal septum deviation
Nasal septum perforation
Nasal septal hematoma
tonsil
Tonsillitis
Adenoid hypertrophy
Peritonsillar abscess
Neck
pharynx
Pharyngitis
Strep throat
Laryngopharyngeal reflux (LPR)
Retropharyngeal abscess
larynx
Croup
Laryngomalacia
Laryngeal cyst
Laryngitis
Laryngopharyngeal reflux (LPR)
Laryngospasm
vocal cords
Laryngopharyngeal reflux (LPR)
Vocal fold nodule
Vocal fold paresis
Vocal cord dysfunction
epiglottis
Epiglottitis
trachea
Tracheitis
Laryngotracheal stenosis
Lower RT/lung disease
(including LRTIs)
Bronchial/
obstructive
acute
Acute bronchitis
chronic
COPD
Chronic bronchitis
Acute exacerbation of COPD)
Asthma (Status asthmaticus
Aspirin-induced
Exercise-induced
Bronchiectasis
Cystic fibrosis
unspecified
Bronchitis
Bronchiolitis
Bronchiolitis obliterans
Diffuse panbronchiolitis
Interstitial/
restrictive
(fibrosis)
External agents/
occupational
lung disease
Pneumoconiosis
Aluminosis
Asbestosis
Baritosis
Bauxite fibrosis
Berylliosis
Caplan's syndrome
Chalicosis
Coalworker's pneumoconiosis
Siderosis
Silicosis
Talcosis
Byssinosis
Hypersensitivity pneumonitis
Bagassosis
Bird fancier's lung
Farmer's lung
Lycoperdonosis
Other
* ARDS
* Combined pulmonary fibrosis and emphysema
* Pulmonary edema
* Löffler's syndrome/Eosinophilic pneumonia
* Respiratory hypersensitivity
* Allergic bronchopulmonary aspergillosis
* Hamman-Rich syndrome
* Idiopathic pulmonary fibrosis
* Sarcoidosis
* Vaping-associated pulmonary injury
Obstructive / Restrictive
Pneumonia/
pneumonitis
By pathogen
* Viral
* Bacterial
* Pneumococcal
* Klebsiella
* Atypical bacterial
* Mycoplasma
* Legionnaires' disease
* Chlamydiae
* Fungal
* Pneumocystis
* Parasitic
* noninfectious
* Chemical/Mendelson's syndrome
* Aspiration/Lipid
By vector/route
* Community-acquired
* Healthcare-associated
* Hospital-acquired
By distribution
* Broncho-
* Lobar
IIP
* UIP
* DIP
* BOOP-COP
* NSIP
* RB
Other
* Atelectasis
* circulatory
* Pulmonary hypertension
* Pulmonary embolism
* Lung abscess
Pleural cavity/
mediastinum
Pleural disease
* Pleuritis/pleurisy
* Pneumothorax/Hemopneumothorax
Pleural effusion
Hemothorax
Hydrothorax
Chylothorax
Empyema/pyothorax
Malignant
Fibrothorax
Mediastinal disease
* Mediastinitis
* Mediastinal emphysema
Other/general
* Respiratory failure
* Influenza
* Common cold
* SARS
* Coronavirus disease 2019
* Idiopathic pulmonary haemosiderosis
* Pulmonary alveolar proteinosis
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Acute severe asthma
|
c0038218
| 8,524 |
wikipedia
|
https://en.wikipedia.org/wiki/Acute_severe_asthma
| 2021-01-18T18:54:28 |
{"mesh": ["D013224"], "umls": ["C0038218"], "icd-10": ["J46"], "wikidata": ["Q826759"]}
|
A number sign (#) is used with this entry because of evidence that Steel syndrome (STLS) is caused by homozygous or compound heterozygous mutation in the COL27A1 gene (608461) on chromosome 9q32.
Description
Steel syndrome is characterized by characteristic facies, dislocated hips and radial heads, carpal coalition (fusion of carpal bones), short stature, scoliosis, and cervical spine anomalies. The dislocated hips are resistant to surgical intervention (summary by Flynn et al., 2010).
Clinical Features
Steel et al. (1993) reported 23 children from Puerto Rico with dislocated hips and radial heads, carpal coalition (fusion of carpal bones), and short stature. Carpal coalition was identified radiographically and did not interfere with hand or wrist function. Eight of 23 patients had bilateral talipes cavus, and 3 patients had anomalies of the cervical spine.
Flynn et al. (2010) reported 32 patients with this condition, including 18 patients previously reported by Steel et al. (1993). Congenital hip dislocations were present in all patients. Nearly all patients (29/32) had radial head dislocation, and carpal coalition was seen in 73% of wrists. Scoliosis was seen in over half (17/32), and cavus was seen in 34% of feet. All patients had short stature. Most patients had a characteristic facies including long and oval-shaped face, prominent forehead, hypertelorism, and broad nasal bridge.
Gonzaga-Jauregui et al. (2015) studied a family of Puerto Rican ancestry in which a brother and sister and their female cousin had Steel syndrome. The proband had bilateral congenital hip dysplasia and coxa vara and had undergone 6 unsuccessful surgical procedures to correct the hip dislocation. Radiography showed dislocated femoral heads, underossification of the capital femoral epiphysis, and coxa vara deformity; in addition, the cervical spine was significant for odontoid hypoplasia. His younger sister also had bilateral hip dysplasia, with similar x-ray findings, including poorly ossified femoral heads and bilateral shallow acetabula. Examination at 14 and 12 years of age, respectively, showed short stature, mild midface hypoplasia with slightly anteverted nares, bilateral fifth finger clinodactyly, decreased adduction of the hips bilaterally, and pes planus. The boy had decreased elbow extension bilaterally and thoracic levoscoliosis, with unilateral radial head dislocation, whereas the girl had lumbar lordosis and mild thoracic scoliosis. Both had bilateral capitate/hamate bone coalitions. Family history revealed a maternal female first cousin, who was born in Puerto Rico, with dislocated hips and leg length discrepancy.
Kotabagi et al. (2017) reported a 5-year-old girl, born to nonconsanguineous Indian parents, with features of Steel syndrome, including dysmorphic facies (broad forehead, broad nasal bridge), short stature, partial syndactyly of fingers and toes, bilateral clubfoot, and genu valgum. Radiographs showed carpal coalition, dislocation of radial heads, bilateral hip dislocation, scoliosis of the thoracolumbar region, and vertical talus. The child also had developmental delay and hearing loss.
Gariballa et al. (2017) reported a child, born to first-cousin parents from the United Arab Emirates, with features of Steel syndrome, including bilateral hip dislocations, short upper limbs, and dysmorphic facial features (flat midface, short upturned nose, and thin lips). She also had mild rhizomelic shortening of upper limbs with contractures at the right elbow, genu valgum, and mild bowing of the femur. Radiographic examination showed right hip dislocation with bilateral irregularity of acetabula and coxa vara and a dislocation of the right elbow. She had delayed speech, and hearing assessment at age 2.5 years revealed severe bilateral sensorineural hearing loss.
Belbin et al. (2017) used genomic data linked to health records of individuals living in New York city and identified a locus shared identical by descent (IBD) underlying extreme short stature in persons of Puerto Rican ancestry. In discovery and replication cohorts of Puerto Rican ancestry (4,397 persons), Belbin et al. (2017) identified 5 homozygotes (age 34 to 74 years) and 105 heterozygotes for the G697R (608461.0001) mutation. The 3 homozygotes from the discovery cohort were more than 2.5 standard deviations (SD) below the population mean for height (height reduction of 6 to 10 inches), and the 2 from the replication cohort were 2 or more standard deviations below. All had short stature and bilateral hip dislocation (4 congenital dislocation and 1 leg length discrepancy). One had radial head dislocation, 2 had carpal coalition, and 2 had scoliosis. Four had cervical spine anomalies which in 3 cases required surgery; 1 underwent lumbar spine surgery, and 2 underwent thoracic spine surgery. Three required hip replacement, and 2, both younger than 50 years of age, required knee replacement. There was no evidence that any of these 5 individuals had received a clinical diagnosis of Steel syndrome. Among the 34 heterozygous individuals below the age of 55 years (mean 41.8 years), none had short stature, and none had hip or radial head dislocations. Five (15%) had carpal coalition, 8 (24%) had scoliosis, 7 (21%) had cervical spine anomalies, and 15 (44%) had other spine anomalies. Thirteen (38%) showed evidence of spinal degeneration ranging from severe (multiple level cord compression and neurologic symptoms necessitating surgery) to moderate (lower back pain managed with physical therapy or medication), compared to 4 (13%) of 31 noncarriers. Scoliosis was present in 24% of carriers; arthritis in 38%; lumbar spine degeneration in 29%; and cervical stenosis in 15%.
Inheritance
No parents were affected in the families reported by Steel et al. (1993), but 3 patients had affected sibs, suggesting autosomal recessive inheritance. However, one pair of affected sibs reportedly had the same mother but a different father. No consanguineous parents were identified.
The pedigrees reported by Flynn et al. (2010) were consistent with autosomal recessive inheritance except for 1 family with an affected parent and child. No consanguinity was seen among parents of affected children.
Population Genetics
Belbin et al. (2017) estimated the carrier rate of the COL27A1 G697R mutation (608461.0001) to be 1 in 51 Puerto Rican-born individuals, 1 in 9 individuals born on the island of St. Thomas, and 1 in 346 individuals from the American Hispanic/Latino population. Haplotype analysis suggested that the G697R mutation arose on a Native American haplotype, and IBD tract length analysis found evidence of a population bottleneck in the Puerto Rican population 9 to 14 generations ago, coincident with European immigration and slave trading on the island.
Clinical Management
In the patients reported by Steel et al. (1993), the hip dislocations were resistant to surgical treatment, with poor results in nearly all patients. Better outcomes were reported in patients without surgical treatment, leading the authors to advise that hip surgery not be performed.
Flynn et al. (2010) also reported that patients whose hips were not treated surgically had fewer complaints and less limitation in daily activities than those who underwent surgery.
Molecular Genetics
In a family of Puerto Rican ancestry in which a brother and sister and their female cousin had bilateral hip dislocations, Gonzaga-Jauregui et al. (2015) performed exome sequencing and identified homozygosity for a missense mutation in the COL27A1 gene (G697R; 608461.0001) that segregated completely with disease in the family. There was no evidence for parental consanguinity, suggesting that the variant arose as a founder mutation event that segregates in the Puerto Rican population.
By exome sequencing in a 5-year-old girl, born to nonconsanguineous Indian parents, with Steel syndrome, Kotabagi et al. (2017) identified compound heterozygosity for a nonsense (R707X; 608461.0002) and a frameshift (608461.0003) mutation in the COL27A1 gene. The mutations segregated with the disorder in the family.
By exome sequencing in a 3-year-old girl with Steel syndrome, who was born to first-cousin parents from the United Arab Emirates, Gariballa et al. (2017) identified a homozygous splice site mutation (608461.0004) in the COL27A1 gene. The mutation segregated with the disorder in the family.
INHERITANCE \- Autosomal recessive GROWTH Height \- Short stature HEAD & NECK Face \- Prominent forehead \- Long, oval-shaped face Ears \- Hearing loss, sensorineural (in some patients) Eyes \- Hypertelorism Nose \- Broad nasal bridge SKELETAL Spine \- Scoliosis \- Cervical spine anomalies Pelvis \- Congenital hip dislocations, resistant to surgical treatment Limbs \- Dislocated radial heads Hands \- Carpal coalition (fusion of carpal bones) Feet \- Bilateral talipes cavus NEUROLOGIC Central Nervous System \- Developmental delay (in some patients) MOLECULAR BASIS \- Caused by mutation in the collagen, type XXVII, alpha-1 gene (COL27A1, 608461.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
STEEL SYNDROME
|
c3554594
| 8,525 |
omim
|
https://www.omim.org/entry/615155
| 2019-09-22T15:53:01 |
{"omim": ["615155"], "orphanet": ["438117"], "synonyms": ["DISLOCATED HIPS AND RADIAL HEADS, CARPAL COALITION, SCOLIOSIS, AND SHORT STATURE", "Alternative titles", "Bilateral hip and radial head dislocations-short stature-scoliosis-carpal coalitions-pes cavus-facial dysmorphism syndrome"]}
|
A gemistocyte (/dʒɛˈmɪstəsaɪt/ jem-ISS-tə-syte; from Greek γέμιζω (gemizo) 'to fill up') is a swollen, reactive astrocyte.[1] These cells usually appear during acute injury; after that, they gradually shrink in size.
Astrocytes participating in gliosis are referred to as reactive astrocytes. They have a large cytoplasmic mass, long, branching processes, and increased cytoplasmic filaments. Such astrocytes are also known as gemistocytic astrocytes. Gemistocytes are also found in some chronic diseases and within certain brain tumors, which suggests the presence of a long-lasting pathological reaction.[2] In the context of cancer (gemistocytic astrocytomas), gemistocytes are known to dedifferentiate to a high grade (III or IV) glioma (i.e. glioblastoma multiforme) at a rapid pace, usually indicative of a poor prognosis.
## References[edit]
1. ^ "gemistocyte", The Free Dictionary, retrieved 2020-07-27
2. ^ "gemistocyte". Adventures in Neuropathology. Retrieved 2020-07-27.
This cell biology article is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Gemistocyte
|
c0334581
| 8,526 |
wikipedia
|
https://en.wikipedia.org/wiki/Gemistocyte
| 2021-01-18T19:05:01 |
{"mesh": ["D001254"], "umls": ["C0334581"], "orphanet": ["251604"], "wikidata": ["Q5530682"]}
|
This article needs more medical references for verification or relies too heavily on primary sources. Please review the contents of the article and add the appropriate references if you can. Unsourced or poorly sourced material may be challenged and removed.
Find sources: "Adipose tissue neoplasm" – news · newspapers · books · scholar · JSTOR (July 2019)
Adipose tissue neoplasm
SpecialtyOncology
An adipose tissue neoplasm is a neoplasm derived from adipose tissue.
An example is lipoma.
## References[edit]
## External links[edit]
Classification
D
* ICD-O: 8850-8889
* MeSH: D018205
* v
* t
* e
Connective/soft tissue tumors and sarcomas
Not otherwise specified
* Soft-tissue sarcoma
* Desmoplastic small-round-cell tumor
Connective tissue neoplasm
Fibromatous
Fibroma/fibrosarcoma:
* Dermatofibrosarcoma protuberans
* Desmoplastic fibroma
Fibroma/fibromatosis:
* Aggressive infantile fibromatosis
* Aponeurotic fibroma
* Collagenous fibroma
* Diffuse infantile fibromatosis
* Familial myxovascular fibromas
* Fibroma of tendon sheath
* Fibromatosis colli
* Infantile digital fibromatosis
* Juvenile hyaline fibromatosis
* Plantar fibromatosis
* Pleomorphic fibroma
* Oral submucous fibrosis
Histiocytoma/histiocytic sarcoma:
* Benign fibrous histiocytoma
* Malignant fibrous histiocytoma
* Atypical fibroxanthoma
* Solitary fibrous tumor
Myxomatous
* Myxoma/myxosarcoma
* Cutaneous myxoma
* Superficial acral fibromyxoma
* Angiomyxoma
* Ossifying fibromyxoid tumour
Fibroepithelial
* Brenner tumour
* Fibroadenoma
* Phyllodes tumor
Synovial-like
* Synovial sarcoma
* Clear-cell sarcoma
Lipomatous
* Lipoma/liposarcoma
* Myelolipoma
* Myxoid liposarcoma
* PEComa
* Angiomyolipoma
* Chondroid lipoma
* Intradermal spindle cell lipoma
* Pleomorphic lipoma
* Lipoblastomatosis
* Spindle cell lipoma
* Hibernoma
Myomatous
general:
* Myoma/myosarcoma
smooth muscle:
* Leiomyoma/leiomyosarcoma
skeletal muscle:
* Rhabdomyoma/rhabdomyosarcoma: Embryonal rhabdomyosarcoma
* Sarcoma botryoides
* Alveolar rhabdomyosarcoma
* Leiomyoma
* Angioleiomyoma
* Angiolipoleiomyoma
* Genital leiomyoma
* Leiomyosarcoma
* Multiple cutaneous and uterine leiomyomatosis syndrome
* Multiple cutaneous leiomyoma
* Neural fibrolipoma
* Solitary cutaneous leiomyoma
* STUMP
Complex mixed and stromal
* Adenomyoma
* Pleomorphic adenoma
* Mixed Müllerian tumor
* Mesoblastic nephroma
* Wilms' tumor
* Malignant rhabdoid tumour
* Clear-cell sarcoma of the kidney
* Hepatoblastoma
* Pancreatoblastoma
* Carcinosarcoma
Mesothelial
* Mesothelioma
* Adenomatoid tumor
This oncology article is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Adipose tissue neoplasm
|
c0206631
| 8,527 |
wikipedia
|
https://en.wikipedia.org/wiki/Adipose_tissue_neoplasm
| 2021-01-18T18:56:30 |
{"mesh": ["D018205"], "umls": ["C0206631"], "wikidata": ["Q4682941"]}
|
A number sign (#) is used with this entry because Marinesco-Sjogren syndrome (MSS) is caused by homozygous or compound heterozygous mutation in the SIL1 gene (608005) on chromosome 5q31.
Description
Marinesco-Sjogren syndrome is an autosomal recessive disorder characterized primarily by congenital cataracts, cerebellar ataxia, progressive muscle weakness due to myopathy, and delayed psychomotor development. Other features include short stature, hypergonadotropic hypogonadism, and skeletal deformities due to muscle weakness. MSS is genetically distinct from congenital cataracts, facial dysmorphism, and neuropathy (CCFDN; 604168), which is caused by mutation in the CTDP1 gene (604927) on chromosome 18q23, although the 2 disorders share some overlapping features, including congenital cataracts, delayed psychomotor development, and ataxia. The major distinguishing features are the presence of peripheral neuropathy, facial dysmorphism, and microcornea in CCFDN (Lagier-Tourenne et al., 2003).
Clinical Features
Cerebellar ataxia, congenital cataracts, and retarded somatic and mental maturation are the cardinal features of MSS. Alter et al. (1962) suggested the designation 'hereditary oligophrenic cerebellolental degeneration.' Garland and Moorhouse (1953) published a striking pedigree. In a boy almost 5 years old, Todorov (1965) found the brain lesions limited almost exclusively to the cerebellum, which showed massive cortical atrophy. Many of the Purkinje cells that remained were vacuolated or binucleated.
Skre and Berg (1977) observed 10 persons with Marinesco-Sjogren syndrome in 2 kindreds, 9 of whom also had hypogonadism.
The observations of Wertelecki (1986) also suggested that the association of hypergonadotropic hypogonadism is a pleiotropic manifestation of the MSS gene.
In an inbred triracial (Indian, black, white) isolate in southwestern Alabama, Wertelecki (1986) found hypergonadotropic hypogonadism as a frequent feature among the many cases observed. In the same inbred group, Superneau et al. (1987) found progressive muscular weakness, hypotonia and atrophy to be among the cardinal signs. Most of the 17 patients studied had elevated serum creatine kinase (CK) levels and muscle biopsies showed myopathic changes. Conspicuous myopathy was present in 2 young children, indicating that myopathy is an early sign.
Walker et al. (1985) suggested that MSS may be a lysosomal storage disorder. In 4 patients from 2 different families and ethnic groups, they found, by electron microscopy, numerous enlarged lysosomes containing whorled lamellar or amorphous inclusion bodies.
Komiyama et al. (1989) reported that 3 of 4 adult patients in 2 families became 'nonambulant' because of slowly progressive muscular weakness rather than cerebellar ataxia. Other clinical features in these 4 patients were typical of MSS: bilateral cataracts from infancy, mental retardation, severe cerebellar atrophy, multiple skeletal abnormalities (pigeon chest, kyphoscoliosis, pes planovalgus), and hypergonadotropic hypogonadism. Electromyography showed a myopathic pattern, and serum creatine kinase was mildly elevated. Muscle biopsy showed chronic dystrophic changes. Tachi et al. (1991) described the histologic changes in muscle in an affected 2-year-old girl.
Zimmer et al. (1992) described the light- and electron-microscopic findings in skeletal muscle and conjunctiva of 6 related patients. Extensive neurogenic atrophy with conspicuous groups of atrophic muscle fibers was the most prominent feature in skeletal muscle of 4 patients. Conjunctival biopsies demonstrated a marked increase in the number of lysosomes in fibroblasts. Sasaki et al. (1996) described light- and electron-microscopic findings in the skeletal muscle of an 11-year-old boy. Electron microscopy demonstrated autophagic vacuoles with myeloid bodies and also a unique dense membranous structure associated with the nucleus which appeared not to be derived from the nuclear membrane. The authors suggested that it may be derived from the dense sarcoplasmic reticulum because of its thickness in electron density.
Farah et al. (1997) found MSS in 2 brothers in a consanguineous Bedouin family in Kuwait. The brothers were in their twenties. Both had abnormally short lateral 3 metatarsals, a feature not present in other healthy members of the family. Both showed features of hypergonadotropic hypogonadism.
Lagier-Tourenne et al. (2003) reported 2 consanguineous families, of Turkish and Norwegian origin, respectively, with MSS. The sister and brother in the Turkish family were referred to a neural pediatric clinic for failure to thrive, reduced head circumference, psychomotor delay, hypotonia, and a pronounced ataxic gait and limb ataxia. Disease progression was characterized by the occurrence of bilateral cataracts operated on at 4.5 and 6.5 years of age, respectively, and of skeletal deformities secondary to severe hypotonia and muscle weakness. MRI of the brain showed isolated marked cerebellar atrophy predominantly affecting the vermis. Muscle biopsy in each case showed myopathic changes.
Slavotinek et al. (2005) reported the case of a 5-year-old male with cataracts, ataxia, progressive cerebellar atrophy, developmental delay, seizures, hypotonia, and sensorimotor neuropathy consistent with the diagnosis of MSS. He also had mild craniofacial dysmorphism consisting of hypertrichosis and synophrys, deep-set eyes with epicanthic folds, flat philtrum, high palate, short thumbs, and wide sandal gap between the first and second toes.
In 4 members of 2 Finnish families, Herva et al. (1987) described a cerebrooculomuscular syndrome that the authors considered to be distinct from MSS. All patients had infantile hypotonia as the presenting sign. At school age, ataxia, cataract, and mental retardation became evident. CT scan showed cerebellar atrophy. Muscle biopsy showed myopathic changes with vacuolar degeneration and marked adipose tissue proliferation. Electron microscopy showed myelin bodies and autophagic vacuoles. These patients were later reported by Anttonen et al. (2005) to have MSS (Anttonen, 2006).
Anttonen et al. (2005) summarized the clinical features of typical MSS. Cerebellar ataxia due to cerebellar atrophy with Purkinje and granule cell loss is a hallmark of MSS. The myopathy is characterized by marked muscle replacement with fat and connective tissue, variation in fiber size, atrophic and necrotic myofibers, rimmed vacuoles, and autophagic vacuoles with membranous whorls on electron microscopy. Other cardinal features include bilateral cataracts, hypergonadotropic hypogonadism, and mild to severe mental retardation. Skeletal abnormalities, short stature, dysarthria, strabismus, and nystagmus are frequent findings.
Hasegawa et al. (2014) reported a 14-month-old Japanese boy with MSS. He had mild global developmental delay, nystagmus, cerebellar atrophy, and low serum IgG and IgA in the absence of opportunistic or recurrent infections. Whole-exome sequencing identified a homozygous truncating mutation in the SIL1 gene (608005.0008). Studies of patient-derived lymphoblastoid cells showed markedly decreased SIL1 expression as well as increased phosphorylation of EIF2A (609234), indicating increased ER stress, which Hasegawa et al. (2014) postulated may have hampered proper assembly of immunoglobulins in the ER. The patient was part of a cohort of 9 individuals with neurodegenerative features and hypogammaglobulinemia who underwent whole-exome sequencing. The report illustrated that whole-exome sequencing can lead to unpredictable molecular diagnoses and unexpected clinical features.
Mapping
By homozygosity mapping in 2 large consanguineous families with MSS, 1 of Turkish and 1 of Norwegian origin, Lagier-Tourenne et al. (2003) localized the MSS locus to chromosome 5q31. A maximum lod score of 2.9 for the Turkish pedigree and 5.6 for the Norwegian pedigree at theta = 0.0 was obtained for linkage with the D5S1995-D5S436 haplotype spanning a 9.3-cM interval.
Molecular Genetics
In a Finnish family, Anttonen et al. (2005) confirmed linkage of the disease phenotype to 5q31; meiotic and historical recombinations defined a 3.52-Mb region with a shared haplotype in Finnish individuals with MSS. Further studies narrowed the region to 1.98 Mb, which excluded the gene SAR1B, also called SARA2 (607690), which had been suggested as a candidate. Anttonen et al. (2005) selected genes from the 1.98-Mb region for sequencing on the basis of tissue expression or predicted function. They identified a homozygous 4-nucleotide duplication, 506_509dupAAGA, in exon 6 of the SIL1 gene (608005.0001) in all Finnish individuals with MSS. Three of the Finnish patients had previously been reported by Herva et al. (1987) (Anttonen, 2006). Two Swedish individuals with MSS and a Finnish paternal ancestor were compound heterozygous with respect to the 506_509dupAAGA mutation and a donor splice site mutation in intron 6 (608005.0003). In all, 4 disease-associated, predicted loss-of-function mutations were found in SIL1, which encodes a nucleotide exchange factor for the heat-shock protein 70 (HSP70) chaperone HSPA5 (138120). These data, together with a similar spatial and temporal patterns of tissue expression of SIL1 and HSPA5, suggested that disturbed SIL1-HSPA5 interaction and protein folding is the primary pathology in Marinesco-Sjogren syndrome.
Senderek et al. (2005) likewise used homozygosity mapping in 3 small consanguineous families with typical MSS to narrow a critical linkage region on 5q31 and identified 9 distinct mutations in SIL1 in individuals with Marinesco-Sjogren syndrome. Genetic heterogeneity in MSS was demonstrated by their failure to observe SIL1 mutations in 4 other individuals with typical MSS. No mutations were detected in 5 patients presenting with nonclassic MSS without myopathy but presenting with rarely described features such as peripheral neuropathy, microcornea, optic atrophy, and cerebral white matter changes. Senderek et al. (2005) defined Marinesco-Sjogren syndrome as a disease of endoplasmic reticulum dysfunction and suggested that this organelle has a role in multisystem disorders.
Aguglia et al. (2000) reported 2 Italian brothers who had MSS and chylomicron retention disease (CMRD; 246700). In these patients, Jones et al. (2003) identified a mutation in the SAR1B gene (607690.0006), responsible for CMRD, and Annesi et al. (2007) identified a mutation in the SIL1 gene (608005.0004), responsible for MSS. The findings indicated that the patients had 2 distinct diseases due to mutations in 2 different genes, rather than defects in a single gene leading to both disorders.
In affected members of 5 families with Marinesco-Sjogren syndrome. Anttonen et al. (2008) identified 4 novel homozygous mutations in the SIL1 gene (see, e.g., 608005.0007 and 608005.0008). All had the classic features of cerebellar atrophy and ataxia, cataracts, mental retardation, and some form of myopathy though severity varied somewhat. In SIL1-negative patients with a similar phenotype, Anttonen et al. (2008) excluded mutations in the HSPA5 (138120), HYOU1 (601746), and AARS (601065) genes.
In 3 Japanese sibs with Marinesco-Sjogren syndrome, Takahata et al. (2010) identified compound heterozygosity for 2 deletions in the SIL1 gene: a 5-bp deletion (598delGAAGA; 608005.0009) and a 58-kb deletion (608005.0010), both in exon 6. Each unaffected parent was heterozygous for 1 of the deletions. The 58-kb deletion was not detected by the standard PCR sequencing protocol and was only found after array comparative genomic hybridization and quantitative PCR analysis. Takahata et al. (2010) suggested that some MSS patients in whom mutations are not found should be screened for larger deletions in the SIL1 gene. All 3 patients had cataracts, ataxia, hypotonia, myopathy, spasticity, mental retardation, and skeletal deformities.
Population Genetics
Anheim et al. (2010) found that MSS was the fourth most common form of autosomal recessive cerebellar ataxia in a cohort of 102 patients from Alsace, France. Of 57 patients in whom a molecular diagnosis could be determined, 3 were affected by MSS. FRDA (229300) was the most common diagnosis, found in 36 of 57 patients, AOA2 (606002) was the second most common diagnosis, found in 7 patients, and ataxia-telangiectasia (AT; 208900) was the third most common diagnosis, found in 4 patients. Ataxia-oculomotor apraxia-1 (AOA1; 208920) was found in 3 patients.
History
Superneau et al. (1985) pointed to a description of this syndrome reported in the Hungarian medical literature in 1904.
Chudley (2003) provided a biographic sketch of Georges Marinesco (1863-1938).
INHERITANCE \- Autosomal recessive GROWTH Height \- Short stature Other \- Growth retardation \- Failure to thrive HEAD & NECK Head \- Microcephaly Eyes \- Congenital cataracts \- Nystagmus \- Strabismus SKELETAL \- Skeletal deformities due to severe myopathy and hypotonia Spine \- Kyphosis \- Scoliosis Limbs \- Cubitus valgus \- Coxa valga Hands \- Short metacarpals Feet \- Pes planovalgus \- Short metatarsals MUSCLE, SOFT TISSUES \- Muscle weakness, progressive \- Muscle atrophy \- Hypotonia \- EMG shows myopathic changes \- Muscle biopsy shows myopathic changes \- Vacuolar degeneration \- Fatty infiltration \- Autophagic rimmed vacuoles \- Variation in fiber size \- Centralized nuclei \- Necrotic and regenerating fibers \- Type 1 fiber predominance \- Dense membranous structure surrounding nuclei on electron microscopy NEUROLOGIC Central Nervous System \- Psychomotor retardation \- Mental retardation, mild to moderate \- Cerebellar ataxia \- Gait ataxia \- Limb ataxia \- Dysarthria \- Spasticity \- Cerebellar atrophy ENDOCRINE FEATURES \- Hypergonadotrophic hypogonadism LABORATORY ABNORMALITIES \- Increased serum creatine kinase MISCELLANEOUS \- Onset in infancy MOLECULAR BASIS \- Caused by mutation in the SIL1 nucleotide exchange factor gene (SIL1, 608005.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
MARINESCO-SJOGREN SYNDROME
|
c0024814
| 8,528 |
omim
|
https://www.omim.org/entry/248800
| 2019-09-22T16:25:32 |
{"doid": ["0080195"], "mesh": ["D013132"], "omim": ["248800"], "orphanet": ["559"], "genereviews": ["NBK1192"]}
|
Anticonvulsant hypersensitivity syndrome
Anticonvulsant/sulfonamide hypersensitivity syndrome is a potentially serious hypersensitivity reaction that can be seen with medications with an aromatic amine chemical structure, such as aromatic anticonvulsants (e.g. diphenylhydantoin, phenobarbital, phenytoin, carbamazepine, lamotrigine), sulfonamides, or other medications with an aromatic amine (e.g., procainamide). Cross-reactivity should not occur between medications with an aromatic amine and medications without an aromatic amine (e.g., sulfonylureas, thiazide diuretics, furosemide, and acetazolamide); therefore, these medications can be safely used in the future.[1]
The hypersensitivity syndrome is characterized by a rash that is initially rash that appears similar to measles (morbilliform).[2]:118 The rash may also be one of the potentially lethal severe cutaneous adverse reactions, the DRESS syndrome, Stevens–Johnson syndrome, or toxic epidermal necrolysis.[3][4] Systemic manifestations occur at the time of skin manifestations and include a high number of eosinophils in the blood, liver inflammation, and interstitial nephritis. However, a subgroup of patients may become hypothyroid as part of an autoimmune thyroiditis up to 2 months after the initiation of symptoms.[1]
This kind of adverse drug reaction is caused by the accumulation of toxic metabolites; it is not the result of an IgE-mediated reaction. The risk of first-degree relatives developing the same hypersensitivity reaction is higher than in the general population.[1]
As this syndrome can present secondary to multiple anticonvulsants, the general term "anticonvulsant hypersensitivity syndrome" (AHS) is favored over the original descriptive term "dilantin hypersensitivity syndrome."[2]:118 As of 2015, two cases of AHS have been reported that manifested during long-term treatment with multiple anti-seizure medications. Death due to multiple organ failure can occur; symptoms also mimic lymphoma and AHS has been called "pseudolymphoma" as a result. Changing the medications involved to those in a different class can avoid further problems.[5]
## See also[edit]
* Severe cutaneous adverse reactions (i.e. SCARs)
* Skin lesion
* List of cutaneous conditions
## References[edit]
1. ^ a b c ACP Medicine Board Review from Medscape (2005)
2. ^ a b James, William; Berger, Timothy; Elston, Dirk (2005). Andrews' Diseases of the Skin: Clinical Dermatology. (10th ed.). Saunders. ISBN 0-7216-2921-0.
3. ^ Cho YT, Yang CW, Chu CY (2017). "Drug Reaction with Eosinophilia and Systemic Symptoms (DRESS): An Interplay among Drugs, Viruses, and Immune System". International Journal of Molecular Sciences. 18 (6): 1243. doi:10.3390/ijms18061243. PMC 5486066. PMID 28598363.
4. ^ Lerch M, Mainetti C, Terziroli Beretta-Piccoli B, Harr T (February 2018). "Current Perspectives on Stevens–Johnson Syndrome and Toxic Epidermal Necrolysis". Clinical Reviews in Allergy & Immunology. 54 (1): 147–176. doi:10.1007/s12016-017-8654-z. PMID 29188475. S2CID 46796285.
5. ^ Geyduk, Ayfer; et al. (2015). "Late-onset Anticonvulsant Hypersensitivity Syndrome Mimicking Lymphoma". Internal Medicine. 54 (24): 3201–3204. doi:10.2169/internalmedicine.54.5111. ISSN 1349-7235. PMID 26666613.
## External links[edit]
Classification
D
* ICD-10: Y46
* ICD-9-CM: E936
* v
* t
* e
Adverse drug reactions
Antibiotics
* Penicillin drug reaction
* Sulfonamide hypersensitivity syndrome
* Urticarial erythema multiforme
* Adverse effects of fluoroquinolones
* Red man syndrome
* Jarisch–Herxheimer reaction
Hormones
* Steroid acne
* Steroid folliculitis
Chemotherapy
* Chemotherapy-induced acral erythema
* Chemotherapy-induced hyperpigmentation
* Scleroderma-like reaction to taxanes
* Hydroxyurea dermopathy
* Exudative hyponychial dermatitis
Anticoagulants
* Anticoagulant-induced skin necrosis
* Warfarin necrosis
* Vitamin K reaction
* Texier's disease
Immunologics
* Adverse reaction to biologic agents
* Leukotriene receptor antagonist-associated Churg–Strauss syndrome
* Methotrexate-induced papular eruption
* Adverse reaction to cytokines
Other drugs
* Anticonvulsant hypersensitivity syndrome
* Allopurinol hypersensitivity syndrome
* Vaccine adverse event
* Eczema vaccinatum
* Bromoderma
* Halogenoderma
* Iododerma
General
Skin and body membranes
* Acute generalized exanthematous pustulosis
* Bullous drug reaction
* Drug-induced acne
* Drug-induced angioedema
* Drug-related gingival hyperplasia
* Drug-induced lichenoid reaction
* Drug-induced lupus erythematosus
* Drug-induced nail changes
* Drug-induced pigmentation
* Drug-induced urticaria
* Stevens–Johnson syndrome
* Injection site reaction
* Linear IgA bullous dermatosis
* Toxic epidermal necrolysis
* HIV disease-related drug reaction
* Photosensitive drug reaction
Other
* Drug-induced pseudolymphoma
* Fixed drug reaction
* Serum sickness-like reaction
This cutaneous condition article is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Anticonvulsant hypersensitivity syndrome
|
c3810813
| 8,529 |
wikipedia
|
https://en.wikipedia.org/wiki/Anticonvulsant_hypersensitivity_syndrome
| 2021-01-18T18:34:42 |
{"icd-9": ["E936"], "icd-10": ["Y46"], "wikidata": ["Q4774650"]}
|
Hysteria
This article is about the alleged poisoning. For the Tito & Tarantula album, see Tarantism (album).
Lycosa tarantula carrying her offspring
Tarantism is a form of hysteric behaviour, popularly believed to result from the bite of the wolf spider Lycosa tarantula (distinct from the broad class of spiders also called tarantulas). A better candidate cause is Latrodectus tredecimguttatus, commonly known as the Mediterranean black widow or steppe spider, although no link between such bites and the behaviour of tarantism has ever been demonstrated.[1] However, the term historically is used to refer to a dancing mania – characteristic of southern Italy – which likely had little to do with spider bites. The tarantella dance supposedly evolved from a therapy for tarantism.
## Contents
* 1 History
* 2 Interpretation and controversy
* 3 Cultural references
* 4 See also
* 5 References
## History[edit]
It was originally described in the 11th century.[2] The condition was common in southern Italy, especially in the province of Taranto, during the 16th and 17th centuries. There were strong suggestions that there is no organic cause for the heightened excitability and restlessness that gripped the victims. The stated belief of the time was that victims needed to engage in frenzied dancing to prevent death from tarantism. Supposedly a particular kind of dance, called the tarantella, evolved from this therapy. A prime location for such outbursts was the church at Galatina, particularly at the time of the Feast of Saints Peter and Paul on 29 June.[3] "The dancing is placed under the sign of Saint Paul, whose chapel serves as a "theatre" for the tarantulees' public meetings. The spider seems constantly interchangeable with Saint Paul; the female tarantulees dress as "brides of Saint Paul".[4] As a climax, "the tarantulees, after having danced for a long time, meet together in the chapel of Saint Paul and communally attain the paroxysm of their trance, ... the general and desperate agitation was dominated by the stylised cry of the tarantulees, the 'crisis cry', an ahiii uttered with various modulations".[5]
Antidotum tarantulae, a curative musical score from Athanasius Kircher (c. 1660)
Francesco Cancellieri, in his exhaustive treatise on Tarantism, takes note of semi-scientific, literary, and popular observations, both recent and ancient, giving each similar weight.[6] He notes a report that in August 1693, a doctor in Naples had himself bitten by two tarantulas with six witnesses and a notary, but did not suffer the dancing illness. Cancellieri in part attributes this illness not only to the spiders but to the locale, since Tarantism was mainly seen in Basilicata, Apulia, and Calabria. He states:
> Quando uno è punto da questa mal augurata bestia, si fanno cento diverse mosse in un momento. Si piange, si balla, si vomita, si trema, si ride, s'impallidisce, si grida, si sviene, si soffre gran dolore, e finalmente dopo qualche giorno si muore, se uno non è soccorso. Il sudore, e gli antidoti sollevano l'ammalato; ma il sovrano, ed unico rimedio è la Musica.
> When one is in the hold of this ill-wished beast, one has a hundred different feelings at a time. One cries, dances, vomits, trembles, laughs, pales, cries, faints, and one will suffer great pain, and finally after a few days, if unaided, you die. Sweat and antidotes relieve the sick, but the sovereign and the only remedy is Music.[7]
He goes on to describe some specific observations of the malady, typically afflicting peasants, alone or in groups. The malady typically affected peasants on hot summer days, causing indolence. Then he describes how only treatment through dancing music could restore them to vitality; for example:
> [...] e trovammo il misero contadino oppresso da difficile respirazione, ed osservammo inoltre, che la faccia, e le mani erano incominciate a divenir nere. E perchè il suo male era a tutti noto, si portò la Chitarra, la cui armonìa subito, che da lui fu intesa, cominciò a mover prima li piedi, poco dipoi le gambe. Si reggeva appresso sulle ginocchia. Indi a poco intervallo s'alzò passenggiando. Finalmente fra lo spazio di un quarto d'ora saltava si, che si sollevava ben tre palmi da terra. Sospirava, ma con empito sì grande, che portava terrore a' circostanti; e prima d'un'ora se gli tolse il nero dalle mani, e dal viso, riacquistando il suo natio colore.
> [...] and we found the poor peasant oppressed with difficult breathing, and we observed also that the face and hands had started to be become black. And 'cause his illness was known to all, a guitar was brought, whose harmony immediately that he was understood, began first moving the feet, legs shortly afterwards. He stood on his knees. Soon after an interval he arose swaying. Finally, in the space of a quarter of an hour he was leaping, nearly three palms from the ground. Sighed, but with such great impetus, that it terrorised bystanders, and before an hour, the black was gone from his hands and face, and he regained his native colour.[8]
## Interpretation and controversy[edit]
John Crompton proposed that ancient Bacchanalian rites that had been suppressed by the Roman Senate in 186 BC went underground, reappearing under the guise of emergency therapy for bite victims.[9]
The phenomenon of tarantism is consistent with mass psychogenic illness.[citation needed]
Although the popular belief persists that tarantism results from a spider bite, it remains scientifically unsubstantiated. Donaldson, Cavanagh, and Rankin (1997)[10] conclude that the actual cause or causes of tarantism remain unknown.
## Cultural references[edit]
Many historical and cultural references are associated with this disease and the ensuing "cure" – the tarantella. It is, for example, a key image in Henrik Ibsen's A Doll's House and the spell "Tarantallegra" from the Harry Potter series. It was also mentioned in the novel 39 Clues: Superspecial Outbreak. The mention of the spider "tarantula" and description of its venom and the associated addiction has been depicted in the Indian television show "Byomkesh Bakshi" in episode 4 titled "Makdi ka Ras".[citation needed]
## See also[edit]
* Dancing mania
* Ergot
* Spider bite
## References[edit]
Notes
1. ^ Anon (1968), p. 175.
2. ^ Russell (1979)
3. ^ Anon (1968), pp. 173–4.
4. ^ Hanna (2006) p. 29. See Anon (1968), passim, for a more detailed description of this custom.
5. ^ Rouget (1985) p. 39
6. ^ Cancellieri, Francesco (1817). Lettera sopra il Tarantismo, l'aria di Roma, e della sua campagna.CS1 maint: ref=harv (link)
7. ^ Cancellieri 1817, p. 6.
8. ^ Cancellieri 1817, p. 11.
9. ^ Crompton (1954), p. 56f.
10. ^ Donaldson (1997)
Sources
* Anon (1968). Tarantism: St. Paul and the Spider, in Essays and Reviews form the Times Literary Supplement. London: Oxford University Press, pp.172–183. Originally published in the Times Literary Supplement, 27 April 1967.
* Cancellieri, Francesco (1817). Letters of Francesco Cancellieri to the ch. Signore Dottore Koreff, Professor of Medicine of the University of Berlin, about Tarantism, the airs of Roma, and of its countryside, and the Papal palaces inside, and outside, Rome: with the description of the Pontifical Castel Gandolfo, and surrounding countryside. (in Italian). Rome: Presso Francesco Bourlie.
* Crompton, John (1954). The Life of the Spider. Mentor Books.
* Donaldson, L.J.; Rankin, J. (July 1997). "The Dancing Plague: a public health conundrum". Public Health. 111 (4): 201–204. doi:10.1016/S0033-3506(97)00034-6. PMID 9242030.
* Hanna, Judith Lynne (2006) . Dancing for Health. Rowman Altamira. ISBN 0-7591-0859-5, ISBN 978-0-7591-0859-2.
* Rouget, Gilbert (1985) Music and Trance : a Theory of the Relations between Music and Possession. University of Chicago Press. ISBN 0-226-73006-9
* Russell JF (October 1979). "Tarantism". Med Hist. 23 (4): 404–25. doi:10.1017/s0025727300052054. PMC 1082580. PMID 390267.
Look up tarantism in Wiktionary, the free dictionary.
Authority control
* BNE: XX547656
* BNF: cb120998689 (data)
* GND: 4396934-3
* LCCN: sh88003247
* SUDOC: 029354331
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Tarantism
|
None
| 8,530 |
wikipedia
|
https://en.wikipedia.org/wiki/Tarantism
| 2021-01-18T18:41:24 |
{"wikidata": ["Q2754884"]}
|
Agrammatism is a characteristic of non-fluent aphasia. Individuals with agrammatism present with speech that is characterized by containing mainly content words, with a lack of function words. For example, when asked to describe a picture of children playing in the park, the affected individual responds with, "trees..children..run."[1] People with agrammatism may have telegraphic speech,[2] a unique speech pattern with simplified formation of sentences (in which many or all function words are omitted), akin to that found in telegraph messages. Deficits in agrammaticism are often language-specific, however—in other words, "agrammaticism" in speakers of one language may present differently from in speakers of another.[3]
Errors made in agrammatism depend on the severity of aphasia. In severe forms language production is severely telegraphic and in more mild to moderate cases necessary elements for sentence construction are missing. Common errors include errors in tense, number, and gender.[4] Patients also find it very hard to produce sentences involving "movement" of elements, such as passive sentences, wh-questions or complex sentences.
Agrammatism is seen in many brain disease syndromes, including expressive aphasia and traumatic brain injury.
## Contents
* 1 History
* 1.1 Verb Inflection
* 2 See also
* 3 Notes
* 4 References
## History[edit]
Agrammatism was first coined by Adolf Kussmaul in 1887 to explain the inability to form words grammatically and to syntactically order them into a sentence. Later on, Harold Goodglass defined the term as the omission of connective words, auxiliaries and inflectional morphemes, all of these generating a speech production with extremely rudimentary grammar. Agrammatism, today seen as a symptom of the Broca's syndrome (Tesak & Code, 2008), has been also referred as 'motor aphasia' (Goldstein, 1948), 'syntactic aphasia' (Wepman & Jones, 1964), 'efferent motor aphasia' (Luria, 1970), and 'non-fluent aphasia' (Goodglass et al., 1964).
The early accounts of agrammatism involved cases of German and French participants. The greater sophistication of the German school of aphasiology at the turn of the 20th century and also the fact that both German and French are highly inflected languages, might have been triggers for that situation (Code, 1991). Nowadays, the image has slightly changed: grammatical impairment has been found to be selective rather than complete, and a cross-linguistic perspective under the framework of Universal Grammar (UG) together with a shift from morphosyntax to morphosemantics is à la page. Now the focus of study in agrammatism embraces all natural languages and the idiosyncrasies scholars think a specific language has are put in relation to other languages so as to better understand agrammatism, help its treatment, and review and advance in the field of theoretical linguistics.
There is little written about agrammatism in Catalan. The beginnings of the field should be encountered in the work of Peña-Casanova & Bagunyà-Durich (1998), and Junque et al. (1989). These papers do not describe case reports, they are rather dealing with more general topics such as lesion localization or rehabilitation of agrammatic patients. The most updated studies could be found in the work of Martínez-Ferreiro (2009). The work of Martínez-Ferreiro is under the so-called Tree Pruning Hypothesis (TPH) of Friedmann & Grodzinsky (2007). Such a hypothesis is somewhat lagging behind after the findings in Bastiaanse (2008) have been proved by means of a re-analysis of data from Nanousi et al. (2006) and Lee et al. (2008), and the work of Yarbay Duman & Bastiaanse (2009). Other rather updated work for agrammatism in Catalan should be found in Martínez-Ferreiro et Gavarró (2007), in Gavarró (2008, 2003a, 2003b, 2002), Balaguer et al. (2004), in Peña-Casanova et al. (2001), and in Sánchez-Casas (2001).
From a cross-linguistic perspective under the framework of Universal Grammar (UG), grammatical impairment in agrammatism has been found to be selective rather than complete. Under this line of thought, the impairment in tense production for agrammatic speakers is currently being approached in different natural languages by means of the study of verb inflection for tense in contrast to agreement (a morphosyntactic approach) and also, more recently, by means of the study of time reference (which, in a sense, should be seen closer to morphosemantics). The type of studies this paper should be related with are those dealing with tense impairment under the framework of time reference. Prior to explaining that, to help understand the goals of such research, it is good to give a taste of the shift from morphosyntax to morphosemantics the study of agrammatism is undergoing.
### Verb Inflection[edit]
Verb inflection for tense has been found to be problematic in several languages. Different scholars have come up with different theories to explain it: Friedman & Grodzinsky (1997) introduced the so-called Tree Pruning Hypothesis (TPH) from the study of Hebrew, Arabic, and English; the same hypothesis has been proved by Gavarró & Martínez-Ferreiro (2007) for what they called Ibero-Romance (that is, Catalan, Galician, and Castilian); Wenzlaff & Clahsen (2004; 2005) introduced the Tense Underespecification Hypothesis (TUH) for German, and by the same time Bruchert et al. (2005) introduced the Tense and Agreement Underespecification Hypothesis (TAUH) for the same language; and Lee et al. (2008), and Faroqi-Shah & Dickey (2009) introduced a morphosemantic hypothesis, arguing that the diacritic tense features are affected in English agrammatism.
Bastiaanse (2008) did not find such dissociation for Dutch but rather that reference to the past is more impaired regardless of verb inflection or agreement. Her research found that finite verbs are more difficult than non-finite verbs, but both within the finite verbs and within the nonfinite verbs, the forms referring to the past (third person singular past tense and participle respectively) are more difficult than their counterparts referring to the present (third person singular present tense and infinitives). None of the hypotheses on verb forms aforementioned (TPH, TUH, and TAUH) can account for these results, ever since participles in Dutch are not inflected for tense and agreement nor do they check their features in the left periphery. Similar findings have been also reported for Greek and for English respectively in a re-analysis of Nanousi et al.'s (2006) and Lee et al.'s (2008) data, and also for Turkish in Yarbay, Duman & Bastiaanse (2009). In any case, the conclusion of Bastiaanse (2008) was that an additional hypothesis expressing that agrammatic speakers have difficulty making reference to the past was needed. In that same paper she unveiled two possible answers: (a) it could be that representations of events in the past are semantically more complex, possibly because there are two time periods of relevance. (b) It might also be the case that it is not so much reference to the past as such that is difficult for agrammatic speakers, but to express this reference by verb inflection.
Probably Bastiaanse et al. (subm.) hold the key. In their study, one reads that both tense and aspect are impaired and, most importantly, that reference to the past is selectively impaired both through simple verb forms (such as simple present in English) and through periphrastic verb forms (such as the present perfect in English). Bastiaanse et al. (subm.) argued that reference to the past is discourse linked and reference to the present and future is not. This is in line with Avrutin (2000) who suggests discourse linking is impaired in Broca’s aphasia.
The notion of discourse linking is originally due to Pesetsky (1987) and should be seen in regard to discourse presupposition which is a basic notion in linguistics and, more concretely, in semantics and pragmatics (for further information: Stalnaker, 1973). To the extent it involves language, discourse linking should be seen in contrast to a local (i.e., internal) binding relation. A clear example of a local binding relation can be found in a sentence like 'The boy is washing himself', in which the pronoun 'himself' refers to 'the boy' within the same sentence. An example of discourse linking is found in a sentence like 'The boy is washing him', in which the pronoun 'him' refers to someone not mentioned in the sentence (in technical terms, the identity of its antecedent is "extra-sentential information") and, therefore, access to previously provided information is a prerequisite for understanding of the pronoun's meaning. Similar examples of such relations can be found in which-questions and, with relevance to this study, in tense and agreement. Avrutin (2000) argued that agreement is a purely morphosyntactic system, with no discourse operations involved and, therefore, it establishes a binding relation whereas tense requires access to the discourse representation and, therefore, it establishes a discourse linking relation. Zagona (2003) reasoned that present tense indicates simultaneity between evaluation time and event time (binding relation). Past tense, on the other hand, lacks this simultaneity and indicates a need for establishing a relation between speech time and an earlier event (discourse linking).
Although Bastiaanse's et al. (subm.) conclusions are not as broad as Avruitin's (2000) and do not strictly look at tense but at time reference, they are supported by several findings: Bastiaanse et al., (2009) and Faroqi-Shah & Dickey (2009) found more problems with verb forms and aspectual adverbs referring to the past in agrammatic aphasic individuals; Jonkers et al., (2007) and Faroqi-Shah & Dickey (2009) reflected longer RTs in non-brain-damaged individuals; and Dragoy et al. (in preparation) are about to present an ERP and an RT experiment of tense violations in Dutch where they have found higher error rates and longer reaction times for the violations by a past tense verb in contrast with present tense.
Bastiaanse et al. (subm.), formulated the PAst DIscourse LInking Hypothesis (PADILIH) with the aim of testing three predictions: (1) selective impairment of grammatical morphology is used for reference to the past, while reference to the present and future are relatively spared (2) this impairment is language–independent; (3) this impairment will occur in both production and comprehension. In order to do so, their research puts into practice the Test for Assessing Reference of Time (TART; Bastiaanse et al., unpublished) in Chinese, English and Turkish agrammatic speakers. The results demonstrate that both English and Turkish agrammatic speakers show the hypothesized selective deficit for reference to the past, despite the great typological difference between the languages. The Chinese agrammatic speakers are poor in producing reference to the past as well by producing grammatical morphology, but reference to the present and future are also severely affected. The results on the subtest for comprehension are strikingly similar for the three languages: reference to the past is impaired. These results confirm the PADILIH: reference to the past is discourse linked and, therefore, grammatical morphology used for reference to the past is impaired in agrammatic aphasia, whether this is done through tense and / or aspect markers.
## See also[edit]
* Lists of language disorders
## Notes[edit]
1. ^ Treatment Resource Manual for Speech-Language Pathology 5th Edition
2. ^ Goodglass H (1997). "Agrammatism in aphasiology". Clin. Neurosci. 4 (2): 51–6. PMID 9059753.
3. ^ Tzeng, Ovid J.L.; Chen, Sylvia; Hung, Daisy L. (1991). "The classifier problem in Chinese aphasia". Brain and Language. 41 (2): 184–202. doi:10.1016/0093-934X(91)90152-Q. PMID 1933258.
4. ^ Dick, F; Bates, E; Wulfeck, B; Utman, JA; Dronkers, N; Gernsbacher, MA (2001). "Language deficits, localization, and grammar: evidence for a distributive model of language breakdown in aphasic patients and neurologically intact individuals" (PDF). Psychological Review. 108 (4): 759–88. doi:10.1037/0033-295x.108.4.759. PMC 4301444. PMID 11699116.
## References[edit]
* Avrutin, S. (2000). Comprehension of discourse‐linked and non-discourse-linked questions by children and Broca’s aphasics. In Grodzinsky, Y., Shapiro, L. & Swinney, D. (eds.) Language and the Brain: Representation and Processing. San Diego: Academic Press.
* Balaguer, R.D.; Costa, A.; Sebastián-Galles, N.; Juncadella, M. & Caramazza, A. (2004). Regular and irregular morphology and its relationship with agrammatism: Evidence from two Spanish-Catalan bilinguals. Brain and Language, (Article in press).
* Bastiaanse R (2008). "Production of verbs in base position by Dutch agrammatic speakers:Inflection versus finiteness". Journal of Neurolinguistics. 21 (2): 104–119. doi:10.1016/j.jneuroling.2006.10.006.
* Bastiaanse, R., Bamyaci, E., Chien, J.H, Lee, J., Thompson, C.K., & Yarbay Duman, T., (subm.). Time reference in agrammatic aphasia: a cross-linguistic study.
* Bastiaanse R.; Bouma G.; Post W. (2009). "Linguistic complexity and frequency in agrammatic speech production" (PDF). Brain and Language. 109: 18–28. doi:10.1016/j.bandl.2008.12.004.
* Bastiaanse, R., Jonkers, R. & Thompson, C.K. (unpublished) Test for Assessment of Reference of Time (TART). University of Groningen.
* Burchert F.; Swoboda-Moll M.; de Bleser R. (2005). "Tense and agreement dissociations in German agrammatic speakers: underspecification vs. hierarchy". Brain and Language. 94 (2): 188–199. doi:10.1016/j.bandl.2004.12.006.
* Code, C. (1991). The characteristics of aphasia. Hove: Lawrence Erlbaum Associates Ltd.
* Dragoy, O., Bos, L. S., Stowe, L.A. & Bastiaanse, R. (in preparation). Time reference processing studied with ERP. To appear in NeuroImage.
* Faroqi-Shah Y.; Dickey M.W. (2009). "On-line processing of tense and temporality inagrammatic aphasia". Brain and Language. 108 (2): 97–111. doi:10.1016/j.bandl.2008.10.003.
* Friedmann N.; Grodzinsky Y. (1997). "Tense and agreement in agrammatic production: Pruning the syntactic tree". Brain and Language. 56 (3): 397–425. CiteSeerX 10.1.1.5.8838. doi:10.1006/brln.1997.1795.
* Gavarró, Anna (2003a). Modals and aspectuals as functional projections: implications for acquisition and agrammatism. In C. Pusch (ed.) Verbal periphrases in the (Ibero-) Romance languages, Romanistik in Geschichte und Gegenwart; Beihefte 9, Hamburgo: Buske Verlag, 231-244.
* Gavarró, Anna (2003b). Move and Agree in Agrammatic comprehension, Research report GGT-03-07, Bellaterra, Barcelona. Available at: http://seneca.uab.cat/clt/publicacions/reports/index.html[permanent dead link]
* Gavarró, A. (2008). Binding and co-reference in Catalan agrammatism, The Academy of Aphasia Meeting, Turku, 20 October.
* Gavarró, A. and B. Laca (2002). ‘Les perífrasis temporals, aspectuals i modals.’ In J. Solà, M. R. Lloret, J. Mascaró and M. Pérez-Saldanya (eds.) Gramàtica del català contemporani, Vol. 3, Barcelona: Empúries, 2663-2726.
* Gavarró, A. and S. Martínez-Ferreiro (2007). Tense and Agreement impairment in Ibero-romance, Journal of Psycholinguistic Research, 36, 25-46.
* Goldstein, K. (1948). Language and language disturbances: Aphasic symptom complexes and their significance for medicine and theory of language. New York: Grune & Stratton.
* Goodglass, H. (1976). Agrammatism. In H. Whitaker & H. A. Whitaker (Eds), Studies in neurolinguistics, Vol. 1. New York: Academic Press.
* Goodglass H.; Quadfasel F.A.; Timberlake W.H. (1964). "Phrase length and the type and severity of aphasia". Cortex. 1 (2): 133–155. doi:10.1016/s0010-9452(64)80018-6.
* Jonkers, R., Boers, J, Koopmans, F, Menninga, A., & Zoodsma, J. (2007). (Reactie)tijd.[Reaction time] TABU, 36, 117-126.
* Junque C. Vendrell; Vendrell-Brucet J.M; Tobeña A. (1989). "Differential recovery in naming in bilingual aphasics". Brain and Language. 36 (1): 16–22. doi:10.1016/0093-934x(89)90049-7. PMID 2465055.
* Kussmaul, A. (1877). Die Störungen der Sprache: Versuch einer Pathologie der Sprache. Leipzig: Vogel.
* Lee J.; Milman L.; Thompson C.K. (2008). "Functional category production in English agrammatism". Aphasiology. 22 (7–8): 239–264. doi:10.1080/02687030701865670. PMC 2474807. PMID 18641791.
* Luria, A. R. (1970). Traumatic aphasia: Its syndromes, psychology and treatment. The Hague: Mouton.
* Martínez-Ferreiro, S. (2003). Verbal Inflectional Morphology in Broca’s Aphasia. M.A. Thesis. Available at https://web.archive.org/web/20070521100340/http://seneca.uab.cat/ggt/tesis.htm.
* Martínez-Ferreiro, S. (2009). Towards a Characterization of Agrammatism in Ibero-Romance. Doctoral Thesis. Available at https://web.archive.org/web/20100921210714/http://webs2002.uab.cat/clt/publicacions/tesis/pdf/Martinez_Ferreiro.pdf
* Nanousi V.; Masterson J; Druks J.; Atkinson M. (2006). "Interpretable vs. uninterpretable features: Evidence from six Greek‐speaking agrammatic patients". Journal of Neurolinguistics. 19 (3): 209–238. doi:10.1016/j.jneuroling.2005.11.003.
* Peña-Casanova J.; Bagunyà-Durich J. (1988). "Bases anatomo-funcionals del llenguatge: Un model avançat". Limits. 4: 19–37.
* Peña-Casanova J.; Diéguez-Vide F.; Lluent R.; Bohm P. (2001). "On Manifestation of Aphasia in Catalan: A Case Study of Broca's Aphasia". Journal of Neurolinguistics. 14 (2–4): 159–177. doi:10.1016/s0911-6044(01)00013-6.
* Pesetsky, D. (1987). Wh-in-Situ: Movement and Unselective Binding. E. Reuland & A. ter Meulen (eds.) The representation of (in)defniteness, Cambridge, MA: MIT Press.
* Sánchez-Casas. R. M. (2001). Estudio del componente léxico y morfosintáctico en pacientes afásicos bilingües del catalán y del castellano. Tesis doctoral. Universitat Rovira i Virgili.
* Stalnaker R (1973). "Presuppositions". Journal of Philosophical Logic. 2 (4): 447–457. doi:10.1007/BF00262951.
* Tesak, J. & Code, C. (2008). Milestones in the history of aphasia: Theories and protagonists. Hove, UK: Psychology Press.
* Wenzlaff M.; Clahsen H. (2004). "Tense and agreement in German agrammatism". Brain and Language. 89: 57–68. CiteSeerX 10.1.1.305.706. doi:10.1016/s0093-934x(03)00298-0.
* Wenzlaff M.; Clahsen H. (2005). "Finiteness and verb‐second in German agrammatism". Brain and Language. 92 (1): 33–44. doi:10.1016/j.bandl.2004.05.006. PMID 15582034.
* Wepman J.; Jones L. (1964). "Five aphasias: a commentary on aphasia as a regressive linguistic phenomenon". Research Publications of the Association for Research in Nervous and Mental Disease. 42: 190–203.
* Yarbay Duman T; Bastiaanse R (2009). "Time reference through verb inflection in Turkish agrammatic aphasia". Brain and Language. 108 (1): 30–39. doi:10.1016/j.bandl.2008.09.009. PMID 18977024.
* Zagona, K. (2003). Tense and anaphora: Is there a tense‐specific theory of coreference. In Barrs, A. (ed.) Anaphora: A Reference Guide. (pp 140‐171). Oxford: Blackwell.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Agrammatism
|
c0003550
| 8,531 |
wikipedia
|
https://en.wikipedia.org/wiki/Agrammatism
| 2021-01-18T18:47:17 |
{"mesh": ["D001039"], "wikidata": ["Q2423084"]}
|
A number sign (#) is used with this entry because of evidence that permanent neonatal diabetes mellitus can be caused by homozygous mutation in the glucokinase gene (GCK; 138079), by heterozygous mutation in the KCNJ11 (600937) gene, or by heterozygous or homozygous mutation in the ABCC8 (600509) and INS (176730) genes.
Pancreatic agenesis, which results in exocrine pancreatic deficiency as well as permanent neonatal-onset diabetes mellitus, can be caused by mutation in the PDX1 gene (600733). Pancreatic agenesis associated with cerebellar agenesis (609069) can be caused by mutation in the PTF1A gene (607194). Pancreatic agenesis associated with congenital cardiac defects (600001) can be caused by mutation in the GATA6 gene (601656).
Description
Neonatal diabetes mellitus (NDM), defined as insulin-requiring hyperglycemia within the first 3 months of life, is a rare entity, with an estimated incidence of 1 in 400,000 neonates (Shield, 2000). In about half of the neonates, diabetes is transient (see 601410) and resolves at a median age of 3 months, whereas the rest have a permanent insulin-dependent form of diabetes (PNDM). In a significant number of patients with transient neonatal diabetes mellitus, type II diabetes (see 125853) appears later in life (Arthur et al., 1997). PNDM is distinct from childhood-onset autoimmune diabetes mellitus type I (IDDM; 222100).
Massa et al. (2005) noted that the diagnostic time limit for PNDM has changed over the years, ranging from onset within 30 days of birth to 3 months of age. However, as patients with the clinical phenotype caused by mutation in the KCNJ11 gene have been identified with onset up to 6 months of age, Massa et al. (2005) suggested that the term 'permanent diabetes mellitus of infancy' (PDMI) replace PNDM as a more accurate description, and include those who present up to 6 months of age. The authors suggested that the new acronym be linked to the gene product (e.g., GCK-PDMI, KCNJ11-PDMI) to avoid confusion with patients with early-onset, autoimmune type I diabetes.
Colombo et al. (2008) proposed that, because individuals with INS gene mutations may present with diabetes well beyond 6 months of age and cannot be distinguished from patients with type 1 diabetes except for the absence of type 1 diabetes autoantibodies, the term PNDM should be replaced with 'monogenic diabetes of infancy (MDI),' a broad definition including any form of diabetes, permanent or transient, with onset during the first years of life and caused by a single gene defect.
Clinical Features
Permanent diabetes of infancy is primarily characterized by onset of hyperglycemia within the first 6 months of life. Among 12 patients with PNDI, Gloyn et al. (2004) reported a mean age of 7 weeks at diagnosis (range birth to 26 weeks). All affected patients had hyperglycemia (270 to 972 mg/dl), and 3 had ketoacidosis. None of the patients had pancreatic autoantibodies associated with IDDM. Patients did not secrete insulin in response to glucose or glucagon but did secrete insulin in response to tolbutamide. All patients had low birth weight. Three of 12 patients had similar neurologic abnormalities, including developmental delay, muscle weakness, and epilepsy. All 3 patients with neurologic abnormalities had dysmorphic features, including prominent metopic suture, a downturned mouth, bilateral ptosis, and limb contractures.
Gloyn et al. (2006) reported 4 unrelated patients with developmental delay, epilepsy, and neonatal diabetes (DEND) associated with mutations in the KCNJ11 gene. All had infantile-onset of diabetes without pancreatic autoantibodies (diagnosed from day 1 of life to 3 months) with hyperglycemia, polydipsia, polyuria, and ketoacidosis in some. The most severely affected child had seizures with hypsarrhythmia, neurologic deterioration with social withdrawal, and mild dysmorphic features, including prominent metopic suture, downturned mouth, and bilateral ptosis. She died from aspiration pneumonia at age 6 months; genetic analysis revealed a novel mutation in the KCNJ11 gene (C166F; 600937.0015). Two other patients had developmental delay and axial hypotonia, but only 1 of these also had dysmorphic features and seizures. The fourth child, who had no dysmorphic or neurologic features, had a diabetic mother who also had no neurologic involvement. Gloyn et al. (2006) noted the phenotypic variability between patients, even between those with the same mutation.
Clinical Management
Zung et al. (2004) reported an infant with PNDM due to a mutation in the KCNJ11 gene (R201H; 600937.0002) who showed a better response to oral sulfonylurea (glibenclamide) treatment than to insulin pump therapy.
Pearson et al. (2006) assessed glycemic control in 49 diabetic patients with known heterozygous mutations in the KCNJ11 gene; 44 (90%) successfully discontinued insulin after receiving appropriate doses of sulfonylureas. The extent of tolbutamide blockade of K(ATP) channels in vitro reflected the response seen in patients. Glycosylated hemoglobin levels improved significantly in patients who switched to sulfonylurea therapy, and improved glycemic control was sustained at 1 year.
Stanik et al. (2007) also reported patients with PNMD due to mutation in the KCNJ11 or ABCC8 gene who were successfully transferred from insulin to sulfonylurea therapy with dramatic improvement in diabetes control and quality of life.
Shimomura et al. (2007) reported an Italian boy with severe neonatal diabetes with neurologic features caused by a de novo mutation in the KCNJ11 gene (I167L; 600937.0016). He had persistent hyperglycemia from birth and developed refractory neonatal seizures with hypsarrhythmia. By age 3.5 years, psychomotor retardation was severe, with hypotonia, athetotic movements, inability to roll over or sit without support, decreased eye contact, and inability to speak. The patient showed a good response to sulfonylurea treatment, with both improved glycemic control without insulin and neurologic improvement. Shimomura et al. (2007) noted that this was the first report of a child with severe DEND who had clinical improvement of both diabetes as well as neurologic features after sulfonylurea therapy.
Mapping
Stoy et al. (2007) studied a family in which neonatal diabetes segregated as an autosomal dominant trait and affected family members were negative for mutation in the KCNJ11 and ABCC8 genes. Linkage analysis led to the identification of INS on chromosome 11p15 as a candidate gene.
Molecular Genetics
### Mutation in GCK
Njolstad et al. (2001) described 2 patients in whom complete deficiency of glucokinase caused permanent neonatal-onset diabetes mellitus. Both patients showed total absence of basal insulin release, and both had homozygous missense mutations in the GCK gene (138079.0010 and 138079.0011).
Gloyn et al. (2002) concluded that complete glucokinase deficiency is not a common cause of permanent neonatal diabetes.
### Mutation in KCNJ11
In 10 of 29 patients with permanent neonatal diabetes, Gloyn et al. (2004) identified 6 novel, heterozygous missense mutations in the KCNJ11 gene (see, e.g., 600937.0002-600937.0003). In 2 patients the diabetes was familial, and in 8 it arose from a spontaneous mutation. In 4 of the 10 families, the mutation was an arg201-to-his substitution (R201H; 600937.0002). When the most common mutation, R201H, was coexpressed with SUR in Xenopus oocytes, the ability of ATP to block mutant ATP-sensitive potassium channels was greatly reduced.
Edghill et al. (2007) noted that the majority of KCNJ11 mutations resulting in neonatal diabetes mellitus occur de novo. They found that germline mosaicism was indicated by pedigree analysis in 2 of 18 families in which neither parent was affected and in 1 of 12 additional parents tested for somatic mosaicism. Edghill et al. (2007) concluded that de novo KCNJ11 mutations can arise during gametogenesis or embryogenesis, thus increasing the risk of neonatal diabetes for subsequent sibs.
Mannikko et al. (2010) reported 2 novel mutations on the same haplotype (cis), F60Y (600937.0023) and V64L, in the slide helix of Kir6.2 (KCNJ11) in a patient with neonatal diabetes, developmental delay, and epilepsy. Functional analysis revealed that the F60Y mutation increased the intrinsic channel open probability, thereby indirectly producing a marked decrease in channel inhibition by ATP and an increase in whole-cell potassium-ATP currents. When expressed alone, the V64L mutation caused a small reduction in apparent ATP inhibition, by enhancing the ability of MgATP to stimulate channel activity. The V64L mutation also ameliorated the deleterious effects on the F60Y mutation when it was expressed on the same, but not a different, subunit. The authors concluded that F60Y is the pathogenic mutation and that interactions between slide helix residues may influence KATP channel gating.
### Mutation in ABCC8
In a 27-year-old man who had permanent neonatal diabetes, severe developmental delay, and generalized epileptiform activity on EEG, Proks et al. (2006) identified heterozygosity for a de novo missense mutation (F132L; 600509.0016) in the ABCC8 gene. Functional studies showed that F132L markedly reduced the sensitivity of the K(ATP) channel to inhibition by MgATP, thereby increasing the whole-cell K(ATP) current; the authors noted that the functional consequence of the F132L mutation mirrors that of KCNJ11 mutations causing neonatal diabetes.
From a group of 73 patients with neonatal diabetes, Babenko et al. (2006) screened the ABCC8 gene in 34 who did not have alterations in chromosome 6q or mutations in the KCNJ11 or GCK genes. In 2 PNDM patients, they identified heterozygosity for a mutation (600509.0017 and 600509.0018, respectively). They also identified heterozygosity for 5 different mutations (see, e.g., 600509.0019 and 600509.0020) in 7 patients with transient neonatal diabetes (TNDM2; 610374). Mutant channels in intact cells and in physiologic concentrations of magnesium ATP had markedly higher activity than did wildtype channels. These overactive channels remained sensitive to sulfonylurea, and treatment with sulfonylureas resulted in euglycemia. The mutation-positive fathers of 5 of the probands with transient neonatal diabetes developed type II diabetes mellitus (125853) in adulthood; Babenko et al. (2006) proposed that mutations of the ABCC8 gene may give rise to a monogenic form of type II diabetes with variable expression and age at onset. The authors noted that dominant mutations in ABCC8 accounted for 12% of cases of neonatal diabetes in the study group.
### Mutation in INS
In affected members of a 3-generation family with autosomal dominant neonatal diabetes, who did not have mutations in the KCNJ11 and ABCC8 genes, Stoy et al. (2007) identified heterozygosity for a missense mutation in the INS gene (176730.0008). The authors then sequenced the INS gene in 83 probands with PNDM without a known genetic cause and identified 9 additional heterozygous missense mutations in the INS gene in 15 families (see, e.g., 176730.0009-176730.0011). PNDM patients with mutations in the INS gene presented at a median age of 9 weeks, usually with diabetic ketoacidosis or marked hyperglycemia, did not have beta-cell autoantibodies, and were treated from diagnosis with insulin. C-peptide values where measured were very low or undetectable, with all values less than 200 pmol/liter.
Edghill et al. (2008) screened the INS gene in a series of 1,044 patients with permanent diabetes diagnosed during infancy, childhood, and adulthood and identified 16 different heterozygous INS mutations in 35 PNDM probands (see, e.g., 176730.0010-176730.0013), 12 of whom had been previously reported by Stoy et al. (2007). The median age at diagnosis for the INS mutation carriers was 11 weeks, and they presented with either symptomatic hyperglycemia (41%) or diabetic ketoacidosis (59%). All patients were treated with insulin replacement therapy. Autoantibodies, when measured, were not detected. Birth weights were reduced (median, 2.7 kg, corresponding to the sixth percentile), consistent with in utero growth retardation due to reduced insulin secretion.
Polak et al. (2008) analyzed the INS gene in 38 patients with PNDM and 1 with nonautoimmune early-infancy diabetes who were negative for mutations in the GCK, KCNJ11, and ABCC8 genes, and identified heterozygosity for 3 different missense mutations in critical regions of the preproinsulin molecule (see 176730.0010-176730.0012) in 4 probands with marked variability in age of diagnosis and disease progression. The authors stated that in their cohort, INS mutations represented approximately 10% of all PNDM cases, and patients with INS mutations had a later presentation of diabetes and no associated symptoms, compared to patients with K(ATP) channel mutations.
In 9 probands with PNDM who were known to be negative for mutations in the KCNJ11 gene (600937), Colombo et al. (2008) identified heterozygosity for 7 different mutations in the INS gene (see, e.g., 176730.0010). Expression of the mutant proinsulins in HEK93 cells demonstrated defects in insulin protein folding and secretion. The authors noted that 9 of 11 patients studied showed near-normal weight at birth, a finding clearly different from the low birth weight in patients with KCNJ11 mutations; they suggested that the beta-cell insufficiency in patients with INS mutations may occur primarily after birth, and noted that the observed postpartum decline in C-peptide was consistent with the hypothesis that a postnatal failure to maintain beta-cell mass due to proteotoxic proinsulin misfolding is a primary cause of PNDM in these patients.
Carmody et al. (2015) studied a male infant, born to first-cousin Southeast Asian parents, who had severe hyperglycemia at birth and required subcutaneous insulin thereafter, who also displayed a structurally normal pancreas on ultrasound but had undetectable C-peptide. The proband was negative for mutation in 36 known monogenic diabetes-associated genes, including INS; however, examination of low-coverage intronic regions revealed homozygosity for a deep intronic INS variant (176730.0017). The mutation was present in heterozygosity in his parents and 1 brother, none of whom had diabetes, although his mother had required insulin to treat gestational diabetes in all 3 of her pregnancies. In addition, the proband's maternal grandmother, who was heterozygous for the mutation, developed insulin-requiring diabetes mellitus at age 45, and a maternal aunt and uncle, for whom DNA was not available, were diagnosed with insulin-requiring diabetes mellitus at 28 and 36 years of age, respectively. The nondiabetic paternal grandmother also carried the mutation. Noting that 20 to 30% of neonatal monogenic diabetes cases have no known etiology, the authors suggested that mutations within deep noncoding regions might be the cause.
### Heterogeneity
Of 31 Japanese patients with NDM, including 15 with PNDM and 16 with transient NDM (TNDM), Suzuki et al. (2007) identified a 6q24 abnormality (see 601410) in 11, a KCNJ11 mutation in 9, and an ABCC8 mutation in 2. Seven patients with a KCNJ11 mutation, including 2 with DEND and the 2 with an ABCC8 mutation, had PNDM. All of the patients with the 6q24 abnormality and 2 patients with a KCNJ11 mutation had TNDM. Suzuki et al. (2007) concluded that the 6q abnormality and KCNJ11 mutations are major causes of NDM in Japanese.
INHERITANCE \- Autosomal dominant \- Autosomal recessive GROWTH Weight \- Low birth weight Other \- Intrauterine growth retardation \- Postnatal growth catch-up occurs in treated patients without neurologic abnormalities HEAD & NECK Head \- Prominent metopic suture Face \- Long philtrum Ears \- Thick ears Eyes \- Ptosis Nose \- Small, short nose \- Anteverted nostrils Mouth \- Downturned mouth ABDOMEN Pancreas \- Beta-cell dysfunction SKELETAL \- Limb contractures Hands \- Clinodactyly MUSCLE, SOFT TISSUES \- Muscle weakness NEUROLOGIC Central Nervous System \- Developmental delay \- Motor delay \- Axial hypotonia \- Diffuse hypotonia \- Seizures \- Hypsarrhythmia \- EEG shows epileptiform activity Peripheral Nervous System \- Diabetic peripheral neuropathy in long-standing cases ENDOCRINE FEATURES \- Diabetes mellitus IMMUNOLOGY \- Absence of pancreatic autoantibodies LABORATORY ABNORMALITIES \- Hyperglycemia \- Ketoacidosis MISCELLANEOUS \- Diagnosis within the first 3 months of life \- Some patients do not show neurologic abnormalities or dysmorphic features \- Some patients show a favorable response to sulfonylurea treatment MOLECULAR BASIS \- Caused by mutation in the glucokinase gene (GCK, 138079.0011 ) \- Caused by mutation in the potassium channel, inwardly rectifying, subfamily J, member 11 gene (KCNJ11, 600937.0002 ) \- Caused by mutation in the ATP-binding cassette, subfamily C, member 8 gene (ABCC8, 600509.0016 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
DIABETES MELLITUS, PERMANENT NEONATAL
|
c1853564
| 8,532 |
omim
|
https://www.omim.org/entry/606176
| 2019-09-22T16:10:36 |
{"doid": ["0060639"], "mesh": ["C565253"], "omim": ["606176"], "orphanet": ["79134", "99885"], "synonyms": ["Alternative titles", "DIABETES MELLITUS, PERMANENT, OF INFANCY"], "genereviews": ["NBK1447"]}
|
Chilaiditi syndrome is a medical condition in which a portion of the colon is abnormally positioned between the liver and the diaphragm. Symptoms vary, but may include abdominal pain, nausea, vomiting, and small bowel obstruction. In many cases, there are no symptoms and the interposition is an incidental finding. When no symptoms are present, the clinical finding is called Chilaiditi's sign.. The underlying cause of Chilaiditi syndrome is unknown. Treatment is symptomatic and supportive.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Chilaiditi syndrome
|
c0267494
| 8,533 |
gard
|
https://rarediseases.info.nih.gov/diseases/10685/chilaiditi-syndrome
| 2021-01-18T18:01:29 |
{"mesh": ["D059269"], "umls": ["C0267494"], "synonyms": []}
|
A number sign (#) is used with this entry because of evidence that Parkinson disease-17 (PARK17) is caused by heterozygous mutation in the VPS35 gene (601501) on chromosome 16q11.
Description
Parkinson disease-17 is an autosomal dominant, adult-onset form of the disorder. It is phenotypically similar to idiopathic Parkinson disease (summary by Wider et al., 2008).
For a general phenotypic description and a discussion of genetic heterogeneity of Parkinson disease (PD), see 168600.
Clinical Features
Wider et al. (2008) reported a large family of Swiss origin with autosomal dominant levodopa-responsive Parkinson disease. Age at onset ranged from 42 to 64 years (mean of 52), and most presented with resting tremor. Other features included akinesia, tremor, rigidity, and cramps. Most had severe motor fluctuations with dyskinesia and dystonia. Three of 11 affected individuals had learning difficulties, and 1 with mental retardation and schizophrenia became demented at the end of her life. Brain fluorodopa PET scan of 1 patient showed marked asymmetric tracer uptake deficiency. Brain MRIs of 3 patients were normal. Limited neuropathologic examination of 1 patient showed no Lewy bodies and negative staining for alpha-synuclein. The phenotype could not be distinguished from idiopathic Parkinson disease. Known genetic causes of autosomal dominant PD were excluded.
Zimprich et al. (2011) reported a large Austrian family with autosomal dominant adult-onset Parkinson disease. The mean age at onset was 53 years (range, 40-68 years), and presenting symptoms included postural instability, resting tremor, and bradykinesia. All showed clinical improvement after dopaminergic treatment. Age-dependent incomplete penetrance was observed.
Kumar et al. (2012) reported a German man with tremor-dominant levodopa-responsive PARK17 with onset at age 45 years. The disorder was progressive, and he later developed impulse control behaviors, likely due to dopamine-agonist therapy, hyperhidrosis, impaired smell, and mild memory impairment. His deceased father developed PD in his late forties, and a deceased paternal grandfather, deceased paternal uncle, and living paternal aunt were also affected.
Inheritance
The transmission pattern of PARK17 in the family reported by Kumar et al. (2012) was consistent with autosomal dominant inheritance and incomplete penetrance.
Molecular Genetics
By exome sequencing of affected members of the Swiss family with Parkinson disease reported by Wider et al. (2008), Vilarino-Guell et al. (2011) identified a heterozygous mutation in the VPS35 gene (D620N; 601501.0001). Subsequent sequencing of this gene in 4,326 PD patients identified 4 with the same mutation: 3 familial cases and 1 with sporadic disease. Haplotype analysis indicated independent mutational events, suggesting a mutational hotspot.
Simultaneously and independently and by the same method, Zimprich et al. (2011) identified the D620N mutation in affected members of a large Austrian family with autosomal dominant parkinsonism. Two additional carriers of this mutation were found among 486 PD patients in Austria. Zimprich et al. (2011) identified several other possibly pathogenic VPS35 variants in patients with PD, but the evidence was inconclusive.
By targeted sequencing, Kumar et al. (2012) identified heterozygosity for the D620N mutation in 1 of 1,774 patients with Parkinson disease. The patients were ascertained from several tertiary referral centers in Germany, Serbia, Chile, and the United States. Family history of the German mutation carrier revealed an affected paternal aunt who carried the mutation, as well as 3 reportedly unaffected sibs in their fifties and sixties who also carried the mutation, indicating incomplete penetrance. Kumar et al. (2012) concluded that VPS35 mutations are a rare cause of PD, and they estimated a carrier frequency for the D620N mutation of 0.1% among patients with PD.
By whole-exome sequencing targeting the VPS35 gene in 213 patients with Parkinson disease, Nuytemans et al. (2013) found no significant evidence for a major contribution of genetic variability in VPS35 to development of the disorder.
Population Genetics
By specific screening for the D620N mutation (601501.0001) among Japanese patients with Parkinson disease, Ando et al. (2012) identified the heterozygous mutation in 3 (1.0%) of 330 patients with autosomal dominant PD and in 1 (0.23%) of 433 patients with sporadic PD. Haplotype analysis suggested at least 3 independent founders in this population, indicating that it may be a mutation hotspot. Patients with this mutation showed typical adult-onset, tremor-predominant PD, with good response to levodopa treatment. The mutation was not found in 1,158 control chromosomes.
Nomenclature
Parkinson disease caused by mutation in the VPS35 gene on chromosome 16q12 is designated here as PARK17. Although PARK17 had been used in the literature to refer to a possible locus on chromosome 4p (Hamza et al., 2010), validation for this locus had not yet been achieved (Mata et al., 2011).
INHERITANCE \- Autosomal dominant NEUROLOGIC Central Nervous System \- Parkinsonism \- Resting tremor \- Tremor \- Bradykinesia \- Akinesia \- Rigidity \- Postural instability \- Cramps \- Dyskinesias MISCELLANEOUS \- Mean age of onset 50 to 52 years \- Incomplete, age-associated penetrance \- Motor fluctuation \- Levodopa-responsive MOLECULAR BASIS \- Caused by mutation in the homolog of the yeast vacuolar protein sorting 35 gene (VPS35, 601501.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
PARKINSON DISEASE 17
|
c3280133
| 8,534 |
omim
|
https://www.omim.org/entry/614203
| 2019-09-22T15:56:11 |
{"doid": ["0060897"], "omim": ["614203"], "orphanet": ["411602"], "synonyms": ["Autosomal dominant late-onset Parkinson disease", "LOPD"], "genereviews": ["NBK447258", "NBK1223"]}
|
A number sign (#) is used with this entry because Papillon-Lefevre syndrome (PALS) is caused by homozygous or compound heterozygous mutation in the cathepsin C gene (CTSC, or DPPI; 602365) on chromosome 11q14.
Mutations in the CTSC gene also cause Haim-Munk syndrome (HMS; 245010) and aggressive periodontitis-1 (170650).
Description
Papillion-Lefevre syndrome is an autosomal recessive disorder characterized by palmoplantar keratoderma, periodontitis, and premature loss of dentition (summary by Lefevre et al., 2001).
Clinical Features
Both the milk teeth and the permanent teeth are lost prematurely. The skin lesions are very similar or identical to those of mal de Meleda (248300). Gorlin et al. (1964) suggested that calcification of the dura mater is a third component of the syndrome.
Nazzaro et al. (1988) reported 4 sibs with Papillon-Lefevre syndrome, ranging in age from 2 to 11 years. The parents were double first cousins.
Hattab et al. (1995) reported 4 cases of PLS affecting 2 Jordanian families with a total of 8 children. The patients were between 4.5 and 12 years of age and their parents, who were first cousins, were not affected. In all patients, there was a relationship between increased severity of skin lesions and seasonal variations and intensified periodontal destruction. There was an early eruption of the permanent teeth. The teeth were caries-free with no sign of root resorption.
Laass (1997) stated that the primary teeth in patients with PLS are usually lost by age 4 and permanent teeth by age 17; that periodontitis is gone after the teeth are lost; and that retinoid therapy is valuable for both the keratitis and the periodontitis.
In a study that included 47 patients with Papillon-Lefevre syndrome, Ullbro et al. (2003) ranked the severity of dermatologic and oral affections using a semiquantitative scoring system, and evaluated whether the severity of the dermatologic changes were correlated with age, degree of periodontal infection, or both. They found, with no exception, that both skin and oral changes developed early in life. The dermatologic involvement showed no correlation with age, whereas the periodontal infection was significantly worse in young children with deciduous teeth. A strong correlation was found between the condition of feet and hands, although the scores for the feet were significantly higher. No significant correlation could be demonstrated between the level of periodontal infection and severity of skin affections, supporting the concept that these 2 major components of Papillon-Lefevre syndrome are unrelated to each other.
Almuneef et al. (2003) described a Saudi male with pyogenic liver abscesses, born to consanguineous parents, who was found to have Papillon-Lefevre syndrome. They found several other reports of this association and concluded that liver abscess is an important complication of neutrophil dysfunction in PLS.
Toomes et al. (1999) summarized the clinical features of Papillon-Lefevre syndrome. The disorder is ascertained mainly by dentists because of the severe periodontitis that afflicts patients. Both the deciduous and permanent dentitions are affected, resulting in premature tooth loss. Palmoplantar keratosis, varying from mild psoriasiform scaly skin to overt hyperkeratosis, typically develops within the first 3 years of life. Keratosis also affects other sites such as the elbows and knees. Most PLS patients display both periodontitis and hyperkeratosis. Some patients have only one or the other, and in rare individuals the periodontitis is mild or of late onset.
Murthy et al. (2005) reported ocular surface squamous neoplasia (carcinoma in situ) in a 14-year-old boy with Papillon-Lefevre syndrome.
Population Genetics
Laass (1997) stated that the frequency of PLS is approximately 1 to 4 per million.
Clinical Management
Nazzaro et al. (1988) reported that histologic abnormalities improved markedly during treatment with acitretin, the free acid of etretinate. They suggested that if treatment is started at an early age, patients with PLS should be able to have normal adult dentition.
Mapping
In 2 consanguineous families of Turkish origin and 3 multiplex families, 1 Ethiopian and 2 German, with altogether 10 affected and 5 unaffected sibs, Laass et al. (1997) demonstrated linkage of PLS with D11S937 on 11q13-q14 (maximum lod = 5.1 at theta = 0.0). The affected members of the Turkish and Ethiopian families were homozygous by descent for markers from an 18-cM interval to the gene for ultra-high-sulfur keratin (KRN1; 148021) between marker loci D11S937 and D11S4120.
Laass et al. (1997) did homozygosity mapping of PLS on the basis of 3 consanguineous families, 2 of Turkish and 1 of German origin. A traditional linkage analysis was also performed in these and 3 multiplex families. Linkage was obtained with marker D11S937 with a maximum 2-point lod score of 6.1 at recombination fraction theta = 0.00 on 11q14-q21 near the metalloproteinase gene cluster (e.g., MMP7; 178990). Multipoint likelihood calculations gave a maximum lod score of 7.35 between D11S901 and D11S1358. A 9.2-cM region homozygous by descent in the affected members of the 3 consanguineous families was positioned between markers D11S1989 and D11S4176. Haplotype analyses in all the families studied supported this localization.
Fischer et al. (1997) likewise conducted a primary genomewide search by homozygosity mapping in a large consanguineous family with 4 affected sibs. Homozygosity and linkage were demonstrated in the region 11q14. Linkage was confirmed in 4 additional families with diverse ethnic and geographic backgrounds, 2 of which were consanguineous. A maximum 2-point lod score of 8.19 was obtained for marker D11S901 at theta = 0.0. The analysis of recombination events placed the gene within a 7-cM interval between D11S901 and D11S4175. No shared haplotype was found in the 5 families analyzed.
Molecular Genetics
Based on the previous mapping of the PLS locus to 11q14-q21, Toomes et al. (1999) used homozygosity mapping in 8 small consanguineous families to narrow the candidate region to a 1.2-cM interval between D11S4082 and D11S931. The gene for cathepsin C (CTSC; 602365), a lysosomal protease, was known to lie within this interval. Toomes et al. (1999) defined the genomic structure of the CTSC gene and found mutations in all 8 families. In 2 of these families, a functional assay demonstrated an almost total loss of cathepsin C activity in PLS patients and reduced activity in obligate carriers.
Hart et al. (1999) found 4 mutations in the CTSC gene in 5 consanguineous Turkish families. All affected individuals were homozygous for CTSC mutations from a common ancestor. Clinical features were not seen in any of the obligate carriers. RT-PCR studies showed CTSC expression in the epithelium of the palms, soles, knees and oral keratinized gingiva.
Gorlin et al. (1976) had suggested that PLS and Haim-Munk syndrome (HMS; 245010) were clinical variants. Hart et al. (2000) found a nonsense mutation (602365.0007) in a Turkish family with PLS. They also found a missense mutation at the same codon (602365.0006) in 4 sibships of the Cochin isolate with HMS, confirming that PLS and HMS are allelic.
Hart et al. (2000) reported mutations in the CTSC gene in patients with PLS from Australia, England, Iran, Turkey, and the US. Mutations were identified in 14 of 20 families studied.
Pathogenesis
Pham et al. (2004) found that, unlike mice lacking Dppi, cytotoxic lymphocytes from humans with PLS maintained lymphocyte-activated killer cell function and significant granzyme A (GZMA; 140050) and granzyme B (GZMB; 123910) activity. Loss of DPPI activity was associated with a severe reduction in the activity and stability of neutrophil-derived serine proteases, but neutrophils from PLS patients did not uniformly have a defect in their ability to kill Staphylococcus aureus and Escherichia coli, suggesting that alternative mechanisms to serine proteases exist in humans for killing these bacteria. Pham et al. (2004) proposed that these observations provide a molecular explanation for the lack of a generalized T-cell immunodeficiency phenotype in patients with PLS.
Meade et al. (2006) found that resting natural killer (NK) cells from 2 sibs with PLS from a consanguineous family reported by Toomes et al. (1999) lacked active CTSC and GZMB. However, in the presence of IL2 (147680), GZMB activity and cytolytic function were restored in a CTSC-independent manner.
INHERITANCE \- Autosomal recessive HEAD & NECK Mouth \- Severe, early-onset periodontitis Teeth \- Premature tooth loss (both primary and secondary dentition) \- Atrophy of alveolar ridges SKIN, NAILS, & HAIR Skin \- Hyperkeratosis of palms and soles NEUROLOGIC Central Nervous System \- Dural and choroid plexus calcifications MOLECULAR BASIS \- Caused by mutation in the cathepsin C gene (CTSC, 602365.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
PAPILLON-LEFEVRE SYNDROME
|
c0030360
| 8,535 |
omim
|
https://www.omim.org/entry/245000
| 2019-09-22T16:26:05 |
{"doid": ["3389"], "mesh": ["D010214"], "omim": ["245000"], "orphanet": ["678"], "synonyms": ["Alternative titles", "PLS", "KERATOSIS PALMOPLANTARIS WITH PERIODONTOPATHIA"]}
|
Pontocerebellar hypoplasia type 1 (PCH1) is a genetic disease that affects the development of the brain. Babies and children with this disease have an unusually small and underdeveloped cerebellum, which is the part of the brain that coordinates movement. A region of the brain called the pons also fails to develop properly. The pons, which is located at the base of the brain in an area called the brainstem, sends signals between the cerebellum and the rest of the brain. Individuals with PCH1 also experience a degeneration of the anterior horn cells, which are responsible for helping the spinal cord send signals to the muscles. Problems with the anterior horn cells cause severe muscle weakness.
PCH1 is caused by mutations to EXOSC3, TSEN54, RARS2, and VRK1. The disease is inherited in an autosomal recessive manner. Diagnosis of PCH1 is based on brain imaging and tests to rule out other causes of problems with brain development. Treatment for PCH1 is aimed at relieving the symptoms of the disease. Most children with PCH1 pass away in infancy or early childhood.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Pontocerebellar hypoplasia type 1
|
c1843504
| 8,536 |
gard
|
https://rarediseases.info.nih.gov/diseases/10704/pontocerebellar-hypoplasia-type-1
| 2021-01-18T17:58:15 |
{"mesh": ["C548069"], "omim": ["607596"], "umls": ["C1843504"], "orphanet": ["2254"], "synonyms": ["Pontocerebellar hypoplasia with infantile spinal muscular atrophy", "Pontocerebellar hypoplasia with anterior horn cell disease"]}
|
Self and Matthews (1968) described a family in which multiple members in 5 generations showed hyperextensible skin and a defect in fibrinolytic activity as indicated clinically by excessive bruising on minor trauma and spontaneous hematomas. Joints were not excessively mobile. The fibrinolytic defect was demonstrated by short euglobulin clot lysis time and decreased factor XIII activity. Male-to-male transmission occurred.
See plasminogen activator inhibitor-1 (PAI1) deficiency (613329) and alpha-2 plasmin inhibitor deficiency (262850), which also show increased fibrinolysis with short euglobin lysis time and bleeding tendency.
Skin \- Hyperextensible skin \- Excessive bruising \- Spontaneous hematomas Inheritance \- Autosomal dominant Lab \- Defect in fibrinolytic activity Heme \- Bleeding diathesis ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
FIBRINOLYTIC DEFECT
|
c1851184
| 8,537 |
omim
|
https://www.omim.org/entry/134900
| 2019-09-22T16:41:12 |
{"mesh": ["C565017"], "omim": ["134900"]}
|
Congenital stationary night blindness
Malfunction in transmission from the photoreceptors in the outer nuclear layer to bipolar cells in the inner nuclear layer underlies CSNB.
SpecialtyOphthalmology
Congenital stationary night blindness (CSNB) is a rare non-progressive retinal disorder. People with CSNB often have difficulty adapting to low light situations due to impaired photoreceptor transmission. These patients may also have reduced visual acuity, myopia, nystagmus, and strabismus. CSNB has two forms -- complete, also known as type-1 (CSNB1), and incomplete, also known as type-2 (CSNB2), which are distinguished by the involvement of different retinal pathways. In CSNB1, downstream neurons called bipolar cells are unable to detect neurotransmission from photoreceptor cells. CSNB1 can be caused by mutations in various genes involved in neurotransmitter detection, including NYX, GRM6, and TRPM1. In CSNB2, the photoreceptors themselves have impaired neurotransmission function; this is caused primarily by mutations in the gene CACNA1F, which encodes a voltage-gated calcium channel important for neurotransmitter release.
Congenital stationary night blindness (CSNB) can be inherited in an X-linked, autosomal dominant, or autosomal recessive pattern, depending on the genes involved.
## Contents
* 1 Symptoms
* 2 Cause
* 3 Pathophysiology
* 3.1 CSNB1
* 3.2 CSNB2
* 4 Genetics
* 5 Footnotes
* 6 External links
## Symptoms[edit]
The X-linked varieties of congenital stationary night blindness (CSNB) can be differentiated from the autosomal forms by the presence of myopia, which is typically absent in the autosomal forms. Patients with CSNB often have impaired night vision, myopia, reduced visual acuity, strabismus and nystagmus. Individuals with the complete form of CSNB (CSNB1) have highly impaired rod sensitivity (reduced ~300x) as well as cone dysfunction. Patients with the incomplete form can present with either myopia or hyperopia.[1]
## Cause[edit]
CSNB is caused by malfunctions in neurotransmission from rod and cone photoreceptors to bipolar cells in the retina.[2] At this first synapse, information from photoreceptors is divided into two channels: ON and OFF. The ON pathway detects light onset, while the OFF pathway detects light offset.[3] The malfunctions in CSNB1 specifically affect the ON pathway, by hindering the ability of ON-type bipolar cells to detect neurotransmitter released from photoreceptors.[2] Rods, which are responsible for low-light vision, make contacts with ON-type bipolar cells only, while, cones, which are responsible for bright-light vision, make contacts with bipolar cells of both ON an OFF subtypes.[4] Because the low-light sensing rods feed only into the ON pathway, individuals with CSNB1 typically have problems with night vision, while vision in well-lit conditions is spared.[2] In CSNB2, release of neurotransmitter from photoreceptors is impaired, leading to involvement of both ON and OFF pathways.
The electroretinogram (ERG) is an important tool for diagnosing CSNB. The ERG a-wave, which reflects the function of the phototransduction cascade in response to a light flashes, is typically normal in CSNB patients, although in some cases phototransduction is also affected, leading to a reduced a-wave. The ERG b-wave, which primarily reflects the function of ON-bipolar cells, is greatly reduced in CSNB2 cases, and completely absent in CSNB1 cases.[2][5]
## Pathophysiology[edit]
### CSNB1[edit]
The complete form of X-linked congenital stationary night blindness, also known as nyctalopia, is caused by mutations in the NYX gene (Nyctalopin on X-chromosome), which encodes a small leucine-rich repeat (LRR) family protein of unknown function.[6][7] This protein consists of an N-terminal signal peptide and 11 LRRs (LRR1-11) flanked by cysteine-rich LRRs (LRRNT and LRRCT). At the C-terminus of the protein there is a putative GPI anchor site. Although the function of NYX is yet to be fully understood, it is believed to be located extracellularly. A naturally occurring deletion of 85 bases in NYX in some mice leads to the "nob" (no b-wave) phenotype, which is highly similar to that seen in CSNB1 patients.[8] NYX is expressed primarily in the rod and cone cells of the retina. There are currently almost 40 known mutations in NYX associated with CSNB1, Table 1., located throughout the protein. As the function of the nyctalopin protein is unknown, these mutations have not been further characterized. However, many of them are predicted to lead to truncated proteins that, presumably, are non-functional.
Table 1. Mutations in NYX associated with CSNB1 Mutation Position References
Nucleotide Amino acid
c.?-1_?-61del 1_20del Signal sequence [7]
Splicing Intron 1 [9]
c.?-63_1443-?del 21_481del [7]
c.48_64del L18RfsX108 Signal sequence [9]
c.85_108del R29_A36del N-terminal LRR [6]
c.G91C C31S LRRNT [7]
c.C105A C35X LRRNT [7]
c.C169A P57T LRRNT [10]
c.C191A A64E LRR1 [10]
c.G281C R94P LRR2 [11]
c.301_303del I101del LRR2 [7]
c.T302C I101T LRR2 [11]
c.340_351del E114_A118del LRR3 [7][9]
c.G427C A143P LRR4 [7]
c.C452T P151L LRR4 [6]
c.464_465insAGCGTGCCCGAGCGCCTCCTG S149_V150dup+P151_L155dup LRR4 [6]
c.C524G P175R LRR5 [7]
c.T551C L184P LRR6 [6]
c.556_618delins H186?fsX260 LRR6 [6]
c.559_560delinsAA A187K LRR6 [7]
c.613_621dup 205_207dup LRR7 [6][7]
c.628_629ins R209_S210insCLR LRR7 [6]
c.T638A L213Q LRR7 [6]
c.A647G N216S LRR7 [6][9]
c.T695C L232P LRR8 [6]
c.727_738del 243_246del LRR8 [7]
c.C792G N264K LRR9 [6]
c.T854C L285P LRR10 [6]
c.T893C F298S LRR10 [6]
c.C895T Q299X LRR10 [9]
c.T920C L307P LRR11 [7]
c.A935G N312S LRR11 [7]
c.T1040C L347P LRRCT [7]
c.G1049A W350X LRRCT [6]
c.G1109T G370V LRRCT [7]
c.1122_1457del S374RfsX383 LRRCT [7][9]
c.1306del L437WfsX559 C-terminus [9]
LRR: leucine-rich repeat, LRRNT and LRRCT: N- and C-terminal cysteine-rich LRRs.
### CSNB2[edit]
Figure 1. Schematic structure of CaV1.4 with the domains and subunits labeled.
The incomplete form of X-linked congenital stationary night blindness (CSNB2) is caused by mutations in the CACNA1F gene, which encodes the voltage-gated calcium channel CaV1.4 expressed heavily in retina.[12][13] One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca2+ entry upon depolarization. As photoreceptors depolarize in the absence of light, CaV1.4 channels operate to provide sustained neurotransmitter release upon depolarization.[14] This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals.[15] There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.
Table 2. Mutations in CACNA1F associated with CSNB2 Mutation Position Effect References
Nucleotide Amino Acid
c.C148T R50X N-terminus [16]
c.151_155delAGAAA R51PfsX115 N-terminus [17]
c.T220C C74R N-terminus [17]
c.C244T R82X N-terminus [16][17]
c.466_469delinsGTAGGGGTGCT
CCACCCCGTAGGGGTGCTCCACC S156VdelPinsGVKHOVGVLH D1S2-3 [16][18][19]
Splicing Intron 4 [16]
c.T685C S229P D1S4-5 [17]
c.G781A G261R D1-pore [17]
c.G832T E278X D1-pore [9][20]
c.904insG R302AfsX314 D1-pore [18]
c.951_953delCTT F318del D1-pore [16]
c.G1106A G369D D1S6 Activates ~20mV more negative than wild-type, increases time to peak current and decreases inactivation, increased Ca2+ permeability. [12][14][16][17][21]
c.1218delC W407GfsX443 D1-2 [13][16][20]
c.C1315T Q439X D1-2 [17]
c.G1556A R519Q D1-2 Decreased expression [12][22]
c.C1873T R625X D2S4 [16][17]
c.G2021A G674D D2S5 [14][16][18]
c.C2071T R691X D2-pore [10]
c.T2258G F753C D2S6 [17]
c.T2267C I756T D2S6 Activates ~35mV more negative than wild-type, inactivates more slowly [23]
Splicing Intron 19 [17]
c.T2579C L860P D2-3 [17]
c.C2683T R895X D3S1-2 [9][10][13][16]
Splicing Intron 22 [17][18]
Splicing Intron 22 [17]
c.C2783A A928D D3S2-3 [14][16]
c.C2905T R969X D3S4 [12][17]
c.C2914T R972X D3S4 [20]
Splicing Intron24 [16]
c.C2932T R978X D3S4 [18]
c.3006_3008delCAT I1003del D3S4-5 [16]
c.G3052A G1018R D3S5 [17]
c.3125delG G1042AfsX1076 D3-pore [16]
c.3166insC L1056PfsX1066 D3-pore [12][13][16][17]
c.C3178T R1060W D3-pore [12][17]
c.T3236C L1079P D3-pore Does not open without BayK, activates ~5mV more negative than wild-type [17][21]
c.3672delC L1225SfsX1266 D4S2 [13][16]
c.3691_3702del G1231_T1234del D4S2 [12][17]
c.G3794T S1265I D4S3 [10]
c.C3886A R1296S D4S4 [10]
c.C3895T R1299X D4S4 [13][16][17]
Splicing Intron 32 [17]
c.C4075T Q1359X D4-pore [12][17]
c.T4124A L1375H D4-pore Decreased expression [12][17][22]
Splicing Intron 35 [17]
c.G4353A W1451X C-terminus Non-functional [13][14][16][21]
c.T4495C C1499R C-terminus [17]
c.C4499G P1500R C-terminus [17]
c.T4523C L1508P C-terminus [17]
Splicing intron 40 [16]
c.4581delC F1528LfsX1535 C-terminus [24]
c.A4804T K1602X C-terminus [12][17]
c.C5479T R1827X C-terminus [17]
c.5663delG S1888TfsX1931 C-terminus [16]
c.G5789A R1930H C-terminus [10]
## Genetics[edit]
Only three rhodopsin mutations have been found associated with congenital stationary night blindness (CSNB).[25] Two of these mutations are found in the second transmembrane helix of rhodopsin at Gly-90 and Thr-94. Specifically, these mutations are the Gly90Asp [26] and the Thr94Ile, which has been the most recent one reported.[27] The third mutation is Ala292Glu, and it is located in the seventh transmembrane helix, in proximity to the site of retinal attachment at Lys-296.[28] Mutations associated with CSNB affect amino acid residues near the protonated Schiff base (PSB) linkage. They are associated with changes in conformational stability and the protonated status of the PSB nitrogen.[29]
## Footnotes[edit]
1. ^ Boycott K, Pearce W, Musarella M, Weleber R, Maybaum T, Birch D, Miyake Y, Young R, Bech-Hansen N (1998). "Evidence for genetic heterogeneity in X-linked congenital stationary night blindness". Am J Hum Genet. 62 (4): 865–875. doi:10.1086/301781. PMC 1377021. PMID 9529339.
2. ^ a b c d Zeitz C, Robson AG, Audo I (2015). "Congenital stationary night blindness: an analysis and update of genotype-phenotype correlations and pathogenic mechanisms". Prog Retin Eye Res. 45: 58–110. doi:10.1016/j.preteyeres.2014.09.001. PMID 25307992.
3. ^ Euler T, Haverkamp S, Schubert T, Baden T (2014). "Retinal bipolar cells: elementary building blocks of vision". Nat Rev Neurosci. 15 (8): 507–519. doi:10.1038/nrn3783. PMID 25158357.
4. ^ Dunn FA, Wong RO (2014). "Wiring patterns in the mouse retina: collecting evidence across the connectome, physiology and light microscopy". J Physiol. 592 (22): 4809–4823. doi:10.1113/jphysiol.2014.277228. PMC 4259528. PMID 25172948.
5. ^ Audo I, Robson AG, Holder GE, Moore AT (2008). "The negative ERG: clinical phenotypes and disease mechanisms of inner retinal dysfunction". Surv Ophthalmol. 53 (1): 16–40. doi:10.1016/j.survophthal.2007.10.010. PMID 18191655.
6. ^ a b c d e f g h i j k l m n o Bech-Hansen N, Naylor M, Maybaum T, Sparkes R, Koop B, Birch D, Bergen A, Prinsen C, Polomeno R, Gal A, Drack A, Musarella M, Jacobson S, Young R, Weleber R (2000). "Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness". Nat Genet. 26 (3): 319–323. doi:10.1038/81619. PMID 11062471.
7. ^ a b c d e f g h i j k l m n o p q Pusch C, Zeitz C, Brandau O, Pesch K, Achatz H, Feil S, Scharfe C, Maurer J, Jacobi F, Pinckers A, Andreasson S, Hardcastle A, Wissinger B, Berger W, Meindl A (2000). "The complete form of X-linked congenital stationary night blindness is caused by mutations in a gene encoding a leucine-rich repeat protein". Nat Genet. 26 (3): 324–327. doi:10.1038/81627. PMID 11062472.
8. ^ Gregg R, Mukhopadhyay S, Candille S, Ball S, Pardue M, McCall M, Peachey N (2003). "Identification of the gene and the mutation responsible for the mouse nob phenotype". Invest Ophthalmol Vis Sci. 44 (1): 378–384. doi:10.1167/iovs.02-0501. PMID 12506099.
9. ^ a b c d e f g h i Zito I, Allen L, Patel R, Meindl A, Bradshaw K, Yates J, Bird A, Erskine L, Cheetham M, Webster A, Poopalasundaram S, Moore A, Trump D, Hardcastle A (2003). "Mutations in the CACNA1F and NYX genes in British CSNBX families". Hum Mutat. 21 (2): 169. doi:10.1002/humu.9106. PMID 12552565.
10. ^ a b c d e f g Zeitz C, Minotti R, Feil S, Mátyás G, Cremers F, Hoyng C, Berger W (2005). "Novel mutations in CACNA1F and NYX in Dutch families with X-linked congenital stationary night blindness". Mol Vis. 11: 179–83. PMID 15761389.
11. ^ a b Xiao X, Jia X, Guo X, Li S, Yang Z, Zhang Q (2006). "CSNB1 in Chinese families associated with novel mutations in NYX". J Hum Genet. 51 (7): 634–640. doi:10.1007/s10038-006-0406-5. PMID 16670814.
12. ^ a b c d e f g h i j Strom T, Nyakatura G, Apfelstedt-Sylla E, Hellebrand H, Lorenz B, Weber B, Wutz K, Gutwillinger N, Rüther K, Drescher B, Sauer C, Zrenner E, Meitinger T, Rosenthal A, Meindl A (1998). "An L-type calcium-channel gene mutated in incomplete X-linked congenital stationary night blindness". Nat Genet. 19 (3): 260–263. doi:10.1038/940. PMID 9662399.
13. ^ a b c d e f g Bech-Hansen N, Naylor M, Maybaum T, Pearce W, Koop B, Fishman G, Mets M, Musarella M, Boycott K (1998). "Loss-of-function mutations in a calcium-channel alpha1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness". Nat Genet. 19 (3): 264–267. doi:10.1038/947. PMID 9662400.
14. ^ a b c d e McRory J, Hamid J, Doering C, Garcia E, Parker R, Hamming K, Chen L, Hildebrand M, Beedle A, Feldcamp L, Zamponi G, Snutch T (2004). "The CACNA1F gene encodes an L-type calcium channel with unique biophysical properties and tissue distribution". J Neurosci. 24 (7): 1707–1718. doi:10.1523/JNEUROSCI.4846-03.2004. PMID 14973233.
15. ^ Mansergh F, Orton N, Vessey J, Lalonde M, Stell W, Tremblay F, Barnes S, Rancourt D, Bech-Hansen N (2005). "Mutation of the calcium channel gene Cacna1f disrupts calcium signaling, synaptic transmission and cellular organization in mouse retina". Hum Mol Genet. 14 (20): 3035–3046. doi:10.1093/hmg/ddi336. PMID 16155113.
16. ^ a b c d e f g h i j k l m n o p q r s t Boycott K, Maybaum T, Naylor M, Weleber R, Robitaille J, Miyake Y, Bergen A, Pierpont M, Pearce W, Bech-Hansen N (2001). "A summary of 20 CACNA1F mutations identified in 36 families with incomplete X-linked congenital stationary night blindness, and characterization of splice variants". Hum Genet. 108 (2): 91–97. doi:10.1007/s004390100461. PMID 11281458.
17. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac Wutz K, Sauer C, Zrenner E, Lorenz B, Alitalo T, Broghammer M, Hergersberg M, de la Chapelle A, Weber B, Wissinger B, Meindl A, Pusch C (2002). "Thirty distinct CACNA1F mutations in 33 families with incomplete type of XLCSNB and Cacna1f expression profiling in mouse retina". Eur J Hum Genet. 10 (8): 449–456. doi:10.1038/sj.ejhg.5200828. PMID 12111638.
18. ^ a b c d e Nakamura M, Ito S, Terasaki H, Miyake Y (2001). "Novel CACNA1F mutations in Japanese patients with incomplete congenital stationary night blindness". Invest Ophthalmol Vis Sci. 42 (7): 1610–6. PMID 11381068.
19. ^ Nakamura M, Ito S, Piao C, Terasaki H, Miyake Y (2003). "Retinal and optic disc atrophy associated with a CACNA1F mutation in a Japanese family". Arch Ophthalmol. 121 (7): 1028–1033. doi:10.1001/archopht.121.7.1028. PMID 12860808.
20. ^ a b c Allen L, Zito I, Bradshaw K, Patel R, Bird A, Fitzke F, Yates J, Trump D, Hardcastle A, Moore A (2003). "Genotype-phenotype correlation in British families with X linked congenital stationary night blindness". Br J Ophthalmol. 87 (11): 1413–1420. doi:10.1136/bjo.87.11.1413. PMC 1771890. PMID 14609846.
21. ^ a b c Hoda J, Zaghetto F, Koschak A, Striessnig J (2005). "Congenital stationary night blindness type 2 mutations S229P, G369D, L1068P, and W1440X alter channel gating or functional expression of Ca(v)1.4 L-type Ca2+ channels". J Neurosci. 25 (1): 252–259. doi:10.1523/JNEUROSCI.3054-04.2005. PMID 15634789.
22. ^ a b Hoda J, Zaghetto F, Singh A, Koschak A, Striessnig J (2006). "Effects of congenital stationary night blindness type 2 mutations R508Q and L1364H on Cav1.4 L-type Ca2+ channel function and expression". J Neurochem. 96 (6): 1648–1658. doi:10.1111/j.1471-4159.2006.03678.x. PMID 16476079.
23. ^ Hemara-Wahanui A, Berjukow S, Hope C, Dearden P, Wu S, Wilson-Wheeler J, Sharp D, Lundon-Treweek P, Clover G, Hoda J, Striessnig J, Marksteiner R, Hering S, Maw M (2005). "A CACNA1F mutation identified in an X-linked retinal disorder shifts the voltage dependence of Cav1.4 channel activation". Proc Natl Acad Sci USA. 102 (21): 7553–7558. doi:10.1073/pnas.0501907102. PMC 1140436. PMID 15897456.
24. ^ Jacobi F, Hamel C, Arnaud B, Blin N, Broghammer M, Jacobi P, Apfelstedt-Sylla E, Pusch C (2003). "A novel CACNA1F mutation in a french family with the incomplete type of X-linked congenital stationary night blindness". Am J Ophthalmol. 135 (5): 733–736. doi:10.1016/S0002-9394(02)02109-8. PMID 12719097.
25. ^ Pere Garriga, and Joan Manyosa. The eye photoreceptor protein rhodopsin. Structural implications for retinal disease. Volume 528, Issues 1–3, 25 September 2002, Pages 17–22.
26. ^ V.R. Rao, G.B. Cohen and D.D. Oprian Nature 367 (1994), pp. 639–642.
27. ^ N. al-Jandal, G.J. Farrar, A.S. Kiang, M.M. Humphries, N. Bannon, J.B. Findlay, P. Humphries and P.F. Kenna Hum. Mutat. 13 (1999), pp. 75–81.
28. ^ T.P. Dryja, E.L. Berson, V.R. Rao and D.D. Oprian Nat. Genet. 4 (1993), pp. 280–283.
29. ^ P.A. Sieving, J.E. Richards, F. Naarendorp, E.L. Bingham, K. Scott and M. Alpern Proc. Natl. Acad. Sci. USA 92 (1995), pp. 880–884.
## External links[edit]
Classification
D
* ICD-10: H53.6
* ICD-9-CM: 368.61
* OMIM: 310500 300071
* DiseasesDB: 32689
External resources
* MedlinePlus: 003039
* GeneReview/NCBI/NIH/UW entry on X-Linked Congenital Stationary Night Blindness
* v
* t
* e
Diseases of ion channels
Calcium channel
Voltage-gated
* CACNA1A
* Familial hemiplegic migraine 1
* Episodic ataxia 2
* Spinocerebellar ataxia type-6
* CACNA1C
* Timothy syndrome
* Brugada syndrome 3
* Long QT syndrome 8
* CACNA1F
* Ocular albinism 2
* CSNB2A
* CACNA1S
* Hypokalemic periodic paralysis 1
* Thyrotoxic periodic paralysis 1
* CACNB2
* Brugada syndrome 4
Ligand gated
* RYR1
* Malignant hyperthermia
* Central core disease
* RYR2
* CPVT1
* ARVD2
Sodium channel
Voltage-gated
* SCN1A
* Familial hemiplegic migraine 3
* GEFS+ 2
* Febrile seizure 3A
* SCN1B
* Brugada syndrome 6
* GEFS+ 1
* SCN4A
* Hypokalemic periodic paralysis 2
* Hyperkalemic periodic paralysis
* Paramyotonia congenita
* Potassium-aggravated myotonia
* SCN4B
* Long QT syndrome 10
* SCN5A
* Brugada syndrome 1
* Long QT syndrome 3
* SCN9A
* Erythromelalgia
* Febrile seizure 3B
* Paroxysmal extreme pain disorder
* Congenital insensitivity to pain
Constitutively active
* SCNN1B/SCNN1G
* Liddle's syndrome
* SCNN1A/SCNN1B/SCNN1G
* Pseudohypoaldosteronism 1AR
Potassium channel
Voltage-gated
* KCNA1
* Episodic ataxia 1
* KCNA5
* Familial atrial fibrillation 7
* KCNC3
* Spinocerebellar ataxia type-13
* KCNE1
* Jervell and Lange-Nielsen syndrome
* Long QT syndrome 5
* KCNE2
* Long QT syndrome 6
* KCNE3
* Brugada syndrome 5
* KCNH2
* Short QT syndrome
* KCNQ1
* Jervell and Lange-Nielsen syndrome
* Romano–Ward syndrome
* Short QT syndrome
* Long QT syndrome 1
* Familial atrial fibrillation 3
* KCNQ2
* BFNS1
Inward-rectifier
* KCNJ1
* Bartter syndrome 2
* KCNJ2
* Andersen–Tawil syndrome
* Long QT syndrome 7
* Short QT syndrome
* KCNJ11
* TNDM3
* KCNJ18
* Thyrotoxic periodic paralysis 2
Chloride channel
* CFTR
* Cystic fibrosis
* Congenital absence of the vas deferens
* CLCN1
* Thomsen disease
* Myotonia congenita
* CLCN5
* Dent's disease
* CLCN7
* Osteopetrosis A2, B4
* BEST1
* Vitelliform macular dystrophy
* CLCNKB
* Bartter syndrome 3
TRP channel
* TRPC6
* FSGS2
* TRPML1
* Mucolipidosis type IV
Connexin
* GJA1
* Oculodentodigital dysplasia
* Hallermann–Streiff syndrome
* Hypoplastic left heart syndrome
* GJB1
* Charcot–Marie–Tooth disease X1
* GJB2
* Keratitis–ichthyosis–deafness syndrome
* Ichthyosis hystrix
* Bart–Pumphrey syndrome
* Vohwinkel syndrome)
* GJB3/GJB4
* Erythrokeratodermia variabilis
* Progressive symmetric erythrokeratodermia
* GJB6
* Clouston's hidrotic ectodermal dysplasia
Porin
* AQP2
* Nephrogenic diabetes insipidus 2
See also: ion channels
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Congenital stationary night blindness
|
c0339535
| 8,538 |
wikipedia
|
https://en.wikipedia.org/wiki/Congenital_stationary_night_blindness
| 2021-01-18T19:03:44 |
{"gard": ["3995"], "mesh": ["C536122"], "icd-9": ["368.61"], "icd-10": ["H53.6"], "wikidata": ["Q8041552"]}
|
A number sign (#) is used with this entry because of evidence that cognitive impairment with or without cerebellar ataxia is caused by heterozygous mutation in the SCN8A gene (600702) on chromosome 12q13.
Clinical Features
Trudeau et al. (2006) reported a family of Swedish and Norwegian origin with highly variable neurologic deficits. The proband was a 9-year-old boy with markedly delayed psychomotor development, attention deficit disorder, and cerebellar ataxia. Features included ataxic wide-based gait, dysmetria in the upper limbs, and dysarthria, with normal strength, tone, and reflexes. He also had esophoria, amblyopia, and gaze-evoked nystagmus. Brain MRI showed moderate pancerebellar atrophy, accentuated in the vermal and parasagittal regions, as well as optic nerve hypoplasia. There were no cerebral abnormalities. His mother and maternal aunt had a history of emotional instability and mild cognitive impairment, and a first cousin had attention deficit-hyperactivity disorder (ADHD; 143465). A brother of the proband was noted to have impaired cognition and another cousin was noted to have ADHD, but they were not studied at the molecular level. In addition, none of the family members besides the proband was available for formal clinical evaluation or brain imaging studies. The proband was ascertained during a study of 151 patients with ataxia who were screened specifically for mutations in the SCN8A gene.
Wagnon et al. (2017) reported 2 unrelated children, a 7-year-old girl and a 10-year-old boy, with global developmental delay and impaired intellectual development (IQ of 73 and 56, respectively). The girl had delayed language, hypotonia that resolved with time, and ADHD; she was able to attend a special school. The boy had severe speech delay, temper tantrums, and a history of unsteady gait. Neither patient had seizures, and brain imaging performed in 1 patient was normal.
Inheritance
The transmission pattern of CIAT in the family reported by Trudeau et al. (2006) was consistent with autosomal dominant inheritance with variable expressivity.
Molecular Genetics
Trudeau et al. (2006) screened the 26 coding exons of SCN8A in 151 patients with inherited or sporadic ataxia and no mutations in known ataxia-related genes. The SCN8A gene was chosen for study because it is widely expressed in neurons of the central and peripheral nervous systems, and because mutations in the mouse ortholog result in ataxia and other movement disorders. A heterozygous 2-bp deletion in exon 24 (600702.0001) was identified in 1 patient, a 9-year-old boy with mental retardation, pancerebellar atrophy, and ataxia. Three additional family members who were heterozygous for the mutation exhibited milder cognitive behavioral deficits including ADHD. However, Trudeau et al. (2006) noted that it was unclear whether the relatives of the proband had a milder version of the neurologic abnormalities seen in the proband due to haploinsufficiency for SCN8A, or if the proband's symptoms were caused by an unrelated developmental disorder.
In 2 unrelated children with CIAT, Wagnon et al. (2017) identified de novo heterozygous missense mutations in the SCN8A gene (G964R, 600702.0013 and E1218K, 600702.0014). The mutations, which were found by exome sequencing, occurred at highly conserved residues in transmembrane domains. Neither mutation was present in the ExAC database. The mutation occurred de novo in 1 patient; it was not found in the unaffected mother in the other patient, but DNA from the father was not available. In vitro functional expression studies in transfected cells showed that both mutations caused a complete loss of channel activity. Wagnon et al. (2017) suggested that loss of neuronal activity due to the mutation may alter the dynamics of synaptic plasticity during maturation and lead to aberrant cerebral circuitry and impaired intellectual development.
INHERITANCE \- Autosomal dominant HEAD & NECK Eyes \- Optic nerve hypoplasia (1 patient) \- Gaze-evoked nystagmus (1 patient) \- Esophoria (1 patient) \- Amblyopia (1 patient) MUSCLE, SOFT TISSUES \- Hypotonia (in some patients) NEUROLOGIC Central Nervous System \- Global developmental delay \- Impaired intellectual development \- Ataxia (in some patients) \- Language delay \- Dysmetria (1 patient) \- Dysarthria (1 patient) \- Cerebellar atrophy seen on MRI (1 patient) Behavioral Psychiatric Manifestations \- Attention deficit-hyperactivity disorder \- Emotional lability MOLECULAR BASIS \- Caused by mutation in the voltage-gated sodium channel, type VIII, alpha subunit gene (SCN8A, 600702.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
COGNITIVE IMPAIRMENT WITH OR WITHOUT CEREBELLAR ATAXIA
|
c3280415
| 8,539 |
omim
|
https://www.omim.org/entry/614306
| 2019-09-22T15:55:43 |
{"omim": ["614306"], "genereviews": ["NBK379665"]}
|
Chédiak-Higashi syndrome (CHS) is a rare severe genetic disorder generally characterized by partial oculocutaneous albinism (OCA, see this term), severe immunodeficiency, mild bleeding, neurological dysfunction and lymphoproliferative disorder. A classic, early-onset form and an attenuated, later-onset form (Atypical CHS; see this term) have been described.
## Epidemiology
Exact prevalence is difficult to determine; fewer than 500 cases have been reported. Many patients likely remain undiagnosed because of variability in clinical signs. No gender or ethnic predilection has been found.
## Clinical description
Patients with CHS mostly have partial OCA involving the hair, skin, and eyes. Reduced iris pigmentation may be associated with nystagmus, and visual acuity may be impaired. Infections that are predominantly bacterial, but also of viral or fungal origin, begin to occur in infancy and may be severe, affecting primarily the skin and upper respiratory tract. Periodontitis has often been reported. Manifestations of increased bleeding tendency are generally mild and include epistaxis, gum bleeding and easy bruising. Cognitive deficits are often noted in childhood. Most patients develop neurological features by early adulthood as the disease progresses including ataxia, tremor, absent deep-tendon reflexes, and peripheral neuropathy. Some patients have Parkinsonian features with bradykinesia and rigidity. About 85% of CHS patients develop the accelerated phase, a lymphoproliferative disorder which involves fever, anemia, neutropenia, and occasionally thrombocytopenia, as well as lymphadenopathy and hepatosplenomegaly.
## Etiology
Loss-of-function mutations in the LYST lysosomal trafficking regulator gene (1q42.1-q42.2) are associated with the severe, childhood-onset form of CHS. Missense mutations appear to underlie the atypical form.
## Diagnostic methods
Diagnosis is suspected in individuals with partial OCA, a history of severe or frequent infections, and minor bleeding tendency. The main criterion is peroxidase-positive giant inclusions in white blood cells identified on the peripheral blood smear. Deficiency of platelet-dense bodies found via whole-mount electron microscopy is also characteristic. Molecular genetic testing supports diagnosis.
## Differential diagnosis
Differential diagnoses include oculocutaneous albinism, Hermansky Pudlak syndrome (specifically HPS-2 caused by mutations in AP3B1), Cross syndrome and Griscelli disease (see these terms).
## Antenatal diagnosis
Prenatal diagnosis of CHS is available clinically by amniocentesis or chorionic villus sampling and requires prior identification of the genetic mutation in the family.
## Genetic counseling
CHS follows an autosomal recessive pattern of inheritance. Genetic counseling should be provided to asymptomatic carriers and to affected adults.
## Management and treatment
The hematological and immunological manifestations can be treated by allogenic hematopoietic stem cell transplantation (HSCT) upon diagnosis. HSCT is more successful when performed before the accelerated phase, but does not alter progression of neurological dysfunction. Management of the acceleration phase involves combination therapy with etoposide, dexamethasone, and cyclosporine (the same as for familial hemophagocytic lymphohistiocytosis (HLH); see this term). Infections should be treated promptly with antibiotics or antivirals and exposure to infectious agents avoided. Desmopressin can be used for bleeding prophylaxis. Standard therapeutic measures should be adopted to improve visual acuity and to manage neurological manifestations. Patients should use sunscreen and wear protective UV sunglasses.
## Prognosis
Without treatment, prognosis is very poor. Primary causes of mortality in the first 10 years of life are development of the accelerated phase and overwhelming infection. Neurologic manifestations occur in individuals despite bone marrow transplantation.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Chédiak-Higashi syndrome
|
c0007965
| 8,540 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=167
| 2021-01-23T18:07:10 |
{"gard": ["6035"], "mesh": ["D002609"], "omim": ["214500"], "umls": ["C0007965"], "icd-10": ["E70.3"], "synonyms": ["Chédiak-Higashi disease", "Chédiak-Higashi-Steinbrink syndrome"]}
|
Benign infantile focal epilepsy with midline spikes and waves during sleep is a rare infantile epilepsy syndrome characterized by age of onset between 4 and 30 months, partial sporadic seizures presenting with motion arrest, staring, cyanosis and, less common, automatisms and lateralizing signs, and characteristic interictal sleep EEG changes consisting of a spike followed by a bell-shaped slow wave in the midline region.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Benign infantile focal epilepsy with midline spikes and waves during sleep
|
None
| 8,541 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=166308
| 2021-01-23T19:01:57 |
{"synonyms": ["BIMSE"]}
|
A rare autosomal recessive primary immunodeficiency characterized by Epstein-Barr virus (EBV)-triggered lymphoprolipherative disorders such as malignant B-cell proliferation, Hodgkin lymphoma, B-cell lymphoma and EBV-driven hemophagocytic lymphohistiocytosis (HLH). Aplastic anemia and inflammatory disorders such as uveitis and oral ulcers are also observed.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Combined immunodeficiency due to CD27 deficiency
|
c3554540
| 8,542 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=238505
| 2021-01-23T18:40:01 |
{"omim": ["615122"], "icd-10": ["D47.9"], "synonyms": ["Autosomal recessive lymphoproliferative disease due to CD27 deficiency", "CD27 deficiency"]}
|
Transient neonatal diabetes mellitus (TNDM) is a genetically heterogeneous form of neonatal diabetes (NDM, see this term) characterized by hyperglycemia presenting in the neonatal period that remits during infancy but recurs in later life in most patients.
## Epidemiology
The prevalence of neonatal diabetes is estimated to be between 1/95,000 to 1/400,000 live births. About 50% of NDM cases are transient (TNDM) and 50% permanent (PNDM, see this term). The condition has been reported in all ethnic groups and affects male and female infants equally.
## Clinical description
Cardinal clinical manifestations include severe intrauterine growth retardation, hyperglycemia (within the first week of life beginning in the neonatal period and resolving usually by 18 months of age), and dehydration. The most commonly reported congenital abnormalities are macroglossia and umbilical hernia. A wide range of different associated clinical signs including, facial dysmorphism, deafness and neurological (as a rule no epilepsy), cardiac, metabolic, kidney or urinary tract anomalies are reported. Affected infants usually require insulin initially, but the need for insulin gradually declines with time. Developmental delay and learning difficulties may also be observed. Women who have had TNDM as infants are at risk for relapse during pregnancy. Ketoacidosis is generally absent (except in patients with KCNJ11 and ABCC8 mutations).
## Etiology
TNDM is caused by 6q24 alterations consisting of paternal uniparental disomy, partial duplication of paternal origin, or relaxation of maternal imprinting in 6q24. All these alterations induce overexpression of imprinted genes at the 6q24 locus, most likely PLAGL1 (6q24-q25) and HYMAI (6q24.2). Heterozygous mutations in the KCNJ11 (11p15.1) and ABCC8 (11p15.1) genes account for 26% of cases. Homozygous or compound heterozygous ZFP57 (6p22.1) mutations have also been reported to cause TNDM.
## Diagnostic methods
Diagnosis is based on the clinical signs of TNDM and hyperglycemia and is confirmed by laboratory findings showing abnormal plasma insulin concentrations and by molecular genetic testing.
## Differential diagnosis
Differential diagnoses include permanent NDM, DEND syndrome (epilepsy, hypotonia, and developmental delay in addition to diabetes mellitus), intermediate DEND, and Wolcott-Rallison syndrome (see these terms) as well as all other syndromic forms of neonatal diabetes mellitus.
## Antenatal diagnosis
Prenatal diagnosis requires identification of a specific genetic defect in the family and is available clinically on a limited basis.
## Genetic counseling
The family tree may be indicative of an imprinting disorder. Sporadic cases with de novo mutations have been reported, as well as autosomal recessive and autosomal dominant patterns of inheritance, complicating genetic counseling. In the case of (partial) uniparental disomy, the recurrence risk is probably close to zero. In partial duplication, there is a risk of recurrence.
## Management and treatment
Early diagnosis and appropriate treatment are crucial. Initial treatment mainly involves rehydration and intravenous insulin. Some infants however do not require insulin therapy. Insulin can rapidly be switched to the subcutaneous route or to continuous insulin pump therapy and discontinued once blood glucose levels have stabilized. During relapse of DM, which is poorly characterized, some patients can be treated with diet alone but others require oral sulfonylurea or insulin.
## Prognosis
Rapid catch-up growth is normally achieved through insulin treatment and normal height and weight is often reached by two years of age. Diabetes may recur in childhood, during puberty, or later in adulthood in about 85% of patients. Prognosis is generally good but is dependent on timely rehydration and adequate control of potential complications.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Transient neonatal diabetes mellitus
|
c1832386
| 8,543 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=99886
| 2021-01-23T17:32:19 |
{"gard": ["1839"], "mesh": ["C563322"], "omim": ["601410", "610374", "610582"], "umls": ["C1832386"], "icd-10": ["P70.2"], "synonyms": ["TNDM"]}
|
This article may require cleanup to meet Wikipedia's quality standards. No cleanup reason has been specified. Please help improve this article if you can. (December 2009) (Learn how and when to remove this template message)
Neuroendocrine carcinoma of the cervix is best defined separately:Neuroendocrine: Of, relating to, or involving the interaction between the nervous system and the hormones of the endocrine glands.Carcinoma: An invasive malignant tumor derived from epithelial tissue that tends to metastasize to other areas of the body.
## Contents
* 1 Types
* 1.1 Small-cell carcinoma (SCC)
* 1.2 Large-cell carcinoma (LCC)
* 2 Causes
* 3 Diagnosis
* 3.1 Classification
* 4 Prognosis
* 5 References
## Types[edit]
There are two types of neuroendocrine carcinomas of the cervix: small-cell and large-cell.
### Small-cell carcinoma (SCC)[edit]
Small-cell carcinoma (SCC) of the cervix is an exceptional member of the neuroendocrine group of cervical carcinomas that is frequently intermixed with a non-SCC component in the form of an adenocarcinoma (ADC) or squamous carcinoma. SCC is an aggressive tumor that spreads very quickly early on; this leads to a fatal clinical course and minimal chances of survival for the patients. It resembles small-cell cancer of the lungs and accounts for less than 3% of all cervical cancers. Like small-cell cancer in the lungs, the lymph nodes play a major role in spreading the cancer throughout the body. SCC begins in the inner part of the cervix and is very hard to diagnose. Due to the involvement of the lymph nodes, in its late and fatal stages, it can spread beyond the pelvic region to other organs. The prevalence of the lymph nodes involvement and that systemic metastasis is much higher in SCC than in non-SCC, thus more complex treatments are required for SCC. “Because of the distinct natural history of small cell carcinoma of the uterine cervix, and because patients with this condition are considered to have a systemic disease, the treatment strategies for this disease are different from those of other carcinomas” (ajronline.org). According to a report (Yang, et al. 2003), multi-agent chemotherapy and pelvic radiotherapy before surgery (radical hysterectomy) followed by chemotherapy after surgery produce better outcomes for its patients. Unfortunately, Pap smears alone are not adequate for the diagnosis of SCC; patients may be misdiagnosed with non-SCC on the basis of Pap smear results alone. Imaging studies are necessary for proper diagnosis; it has been proposed that MRI is the highest standard for the imaging evaluation of uterine cervical cancer. The major problem with early accurate diagnosis of SCC is the limitation of routine screening, namely the Pap smear.
### Large-cell carcinoma (LCC)[edit]
Large-cell carcinoma (LCC), like small-cell carcinoma (SCC) is very rare and only accounts for about 5% of all cervical cancers. Early-stage LCC are extremely aggressive and difficult to diagnose due to the sub-mucosal location of the tumor and intact overlying mucosa. As with SCC, in LCC early cases are asymptomatic. Later stages present with irregular bleeding, vaginal spotting, discharge, and pelvic pain. The basis for treatment of LCC tumors is derived from therapy used for SCC; when diagnosed, multimodal therapy should be considered just as with SCC.
## Causes[edit]
It has been observed that HPV18 is the most prevalent type in Small cell cervical cancer. Like other types of cervical cancer it seems to be associated with high-risk (e.g. 16, 18, 31) HPV Infection.[1]
## Diagnosis[edit]
### Classification[edit]
Neuroendocrine carcinoma affects many different parts of the body.[2][3][4]
In the cervix, it is a rare, but very aggressive form of cervical cancer. In its early stages, neuroendocrine carcinoma is asymptomatic (not showing or producing indications of a disease or other medical condition). In more advanced stages, symptoms of Neuroendocrine carcinoma of the cervix are: abnormal vaginal bleeding, increased vaginal discharge, and pelvic pain, painful urination, pain during sex, tiredness, leg swelling, and backache. When left untreated, metastasis or even death may occur.
## Prognosis[edit]
Cervical cancers can recur with symptoms of vaginal bleeding and/or discharge, pelvic pain, pain in the back and legs, leg swelling (edema), chronic cough and weight loss. It can recur in the vagina, pelvis, lymph nodes, lung, or liver. “If radiation was not given previously, recurrences that are confined to the pelvis may be treated with external beam radiation with chemotherapy and intracavitary or interstitial radiation therapy. If radiation therapy was already given, the only option is the removal of the vagina, uterus, and the bladder and/or rectum with the creation of an artificial bladder-a pelvic exenteration. The five-year survival rate after a pelvic exenteration is about 50 percent.” (womenscancercenter.com) Chemotherapy is useful in women with recurrent tumors which cannot be removed surgically or in women with metastatic diseases. Chances of survival of chemotherapy, if diagnosed in early stage, is greater than 50%.[5]
## References[edit]
1. ^ Atienza-Amores, Maria. "Small cell carcinoma of the gynecologic tract: A multifaceted spectrum of lesions". Gynecologic Oncology. Elsevier. 134: 410–418. doi:10.1016/j.ygyno.2014.05.017.
2. ^ http://www.wrongdiagnosis.com/n/neuroendocrine_carcinoma_of_the_cervix/intro.htm
3. ^ Neuroendocrine system
4. ^ "MRI of Small Cell Carcinoma of the Uterine Cervix with Pathologic Correlation". American Journal of Roentgenology. 182: 1255–1258. doi:10.2214/ajr.182.5.1821255.
5. ^ "Top cancer hospitals in India : Best treatment for cancer". Trendingtop5. 2015-07-19. Retrieved 2017-09-20.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Neuroendocrine carcinoma of the cervix
|
None
| 8,544 |
wikipedia
|
https://en.wikipedia.org/wiki/Neuroendocrine_carcinoma_of_the_cervix
| 2021-01-18T18:57:24 |
{"gard": ["7189"], "wikidata": ["Q16254348"]}
|
A rare bone sarcoma characterized by a usually benign space-occupying lesion, which is nevertheless locally aggressive and massively damaging to surrounding bone tissue. The tumor is composed of giant multinucleated cells (osteoclast-like cells), mononuclear macrophages, and mononuclear stromal cells which secrete pro-myeloid and pro-osteoclastic factors. Metastasis and malignant transformation are rare, but the recurrence rate is high.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Giant cell tumor of bone
|
c0206638
| 8,545 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=363976
| 2021-01-23T18:58:32 |
{"mesh": ["D018212"], "umls": ["C0206638"], "icd-10": ["D48.0"], "synonyms": ["GCT of bone", "Osteoclastoma"]}
|
Not to be confused with PDNOS or Persistent Depressive Disorder.
Pervasive developmental disorder not otherwise specified (PDD-NOS), (including atypical autism)
SpecialtyClinical psychology, psychiatry, pediatrics, occupational medicine
A pervasive developmental disorder not otherwise specified (Including atypical autism) (PDD-NOS)[1] is one of the four autistic disorders (AD) in the DSM-5[2] and also was one of the five disorders classified as a pervasive developmental disorder (PDD) in the DSM-IV[3] According to the DSM-4, PDD-NOS is a diagnosis that is used for "severe and pervasive impairment in the development of reciprocal social interaction or verbal and nonverbal communication skills, or when stereotyped behavior, interests, and activities are present, but the criteria are not met for a specific PDD" or for several other disorders.[4] PDD-NOS includes atypical autism,[5] because the criteria for autistic disorder are not met, for instance because of late age of onset, atypical symptomatology, or subthreshold symptomatology, or all of these.[4] Even though PDD-NOS is considered milder than typical autism, this is not always true. While some characteristics may be milder, others may be more severe.[6]
## Contents
* 1 Signs and symptoms
* 2 Diagnosis
* 2.1 Subgroups
* 3 Treatment
* 4 References
* 5 External links
## Signs and symptoms[edit]
It is common for individuals with PDD-NOS to have more intact social skills and a lower level of intellectual deficit than individuals with other PDDs.[3] Characteristics of many individuals with PDD-NOS are:
* Communication difficulties (e.g., using and understanding language)[7]
* Difficulty with social behavior
* Difficulty with changes in routines or environments
* Uneven skill development (strengths in some areas and delays in others)
* Unusual play with toys and other objects
* Repetitive body movements or behavior patterns
* Preoccupation with fantasy, such as imaginary friends in childhood
## Diagnosis[edit]
PDD-NOS is an old diagnostic category. It is not included as an option for an Autism Spectrum Disorder and is not part of the DSM-5, but is included in the ICD-10, as either "atypical autism" or "pervasive developmental disorder, unspecified".[8]
The diagnosis of a pervasive developmental disorder not otherwise specified is given to individuals with difficulties in the areas of social interaction, communication, and/or stereotypic behavior patterns or interests, but who do not meet the full DSM-4 criteria for autism or another PDD. This does not necessarily mean that PDD-NOS is a milder disability than the other PDDs. It only means that individuals who receive this diagnosis do not meet the diagnostic criteria of the other PDDs, but that there is still a pervasive developmental disorder that affects the individual in the areas of communication, socialization, and behavior.[3]
As for the other pervasive developmental disorders, the diagnosis of PDD-NOS requires the involvement of a team of specialists. The individual needs to undergo a full diagnostic evaluation, including a thorough medical, social, adaptive, motor skills and communication history.[3] Other parts of an assessment can be behavioral rating scales, direct behavioral observations, psychological assessment, educational assessment, communication assessment, and occupational assessment.[9]
Description of PDD-NOS merely as a "subthreshold" category without a more specific case definition poses methodological problems for research regarding the relatively heterogeneous group of people who receive this diagnosis. While it's true that children diagnosed with PDD-NOS, as a whole, show fewer intellectual deficits and are higher-functioning than autistic children, many others who fit the criteria for PDD-NOS have some autistic features but also have intellectual deficits that are so severe that it's difficult or impossible to tell whether some of the deficits come from the autism or from the severe to profound degree of intellectual disability itself. Furthermore, some others who fit the criteria for PDD-NOS come to professional attention at a later age, compared to those diagnosed with autism.[10] [11]
### Subgroups[edit]
Studies suggest that persons with PDD-NOS belong to one of three very different subgroups:[12]
* A high-functioning group (around 25 percent) whose symptoms largely overlap with that of Asperger syndrome, while also not meeting the criteria for autistic disorder, but who differ from those with Asperger syndrome in terms of having a lag in language development and/or mild cognitive impairment.[12] (The criteria for Asperger syndrome excludes a speech delay or a cognitive delay in early life.[13])
* Another group (around 25 percent) whose symptoms more closely resemble those of autistic disorder, but do not fully meet all its diagnostic signs and symptoms. This is because either the symptoms were recognized at a later age or because they were too young or have cognitive deficits that are too severe to properly identify all the symptoms of autism that they may have.[12][14]
* The biggest group (around 50 percent) consists of those who meet all the diagnostic criteria for autistic disorder but whose stereotypical and repetitive behaviors are noticeably mild.[12]
## Treatment[edit]
There is no known "cure" for PDD-NOS, but there are interventions that can have a positive influence. Early and intensive implementation of evidence-based practices and interventions are generally believed to improve outcomes. Most of these are individualised special education strategies rather than medical or pharmaceutical treatment; the best outcomes are achieved when a team approach among supporting individuals is used.
Some of the more common therapies and services include:[3]
* Visual and environmental supports, visual schedules
* Applied behavior analysis (including discrete trial training, pivotal response treatment, and positive behavior support)
* Social stories and comic strip conversations
* Speech therapy
* Physical and occupational therapy[3]
## References[edit]
1. ^ Diagnostic and statistical manual of mental disorders : DSM-IV-TR (4th, text revision ed.). Washington, DC: American Psychiatric Association. 2000. pp. 14, 84. ISBN 0-89042-024-6. `|access-date=` requires `|url=` (help)
2. ^ "Autism spectrum disorder fact sheet" (PDF). DSM5.org. American Psychiatric Publishing. 2013. Archived from the original (PDF) on October 6, 2013. Retrieved October 13, 2013.
3. ^ a b c d e f "Autism spectrum fact sheet from Illinois" (PDF). pbisillinois.org. Retrieved 3 April 2018.
4. ^ a b "First signs". firstsigns.org. Retrieved 3 April 2018.
5. ^ "What are the PDD-NOS Symptoms?". Staying Healthy. 2009-11-11. Retrieved November 27, 2010.
6. ^ "PDD-NOS Signs, Symptoms and Treatment". National Autism Resources.
7. ^ Robison, John Elder (2019). "Autism prevalence and outcomes in older adults". Autism Research. 12 (3): 370–374. doi:10.1002/aur.2080. ISSN 1939-3806. PMID 30803153. S2CID 73503042.
8. ^ Smith, Isaac C.; Reichow, Brian; Volkmar, Fred R. (2015). "The Effects of DSM-5 Criteria on Number of Individuals Diagnosed with Autism Spectrum Disorder: A Systematic Review". Journal of Autism and Developmental Disorders. 45 (8): 2541–2552. doi:10.1007/s10803-015-2423-8. ISSN 0162-3257. PMID 25796195. S2CID 24217012.
9. ^ "briefing paper of the National Dissemination Center for Children with Disabilities" (PDF). nichcy.org. Retrieved 3 April 2018.
10. ^ "Autism and Neurodevelopment". Child Study Center: Research. Yale School of Medicine. Retrieved 3 April 2018.
11. ^ "ICD-10, Mental and behavioural disorders (F00-F99)".
12. ^ a b c d Walker DR, Thompson A, Zwaigenbaum L, Goldberg J, Bryson SE, Mahoney WJ, Strawbridge CP, Szatmari P (Feb 2004). "Specifying PDD-NOS: a comparison of PDD-NOS, Asperger syndrome, and autism". J Am Acad Child Adolesc Psychiatry. 43 (2): 172–80. doi:10.1097/00004583-200402000-00012. PMID 14726723.CS1 maint: multiple names: authors list (link)
13. ^ American Psychiatric Association (2000). "Diagnostic criteria for 299.80 Asperger's Disorder (AD)". Diagnostic and Statistical Manual of Mental Disorders (4th, text revision (DSM-IV-TR) ed.). ISBN 0-89042-025-4. Archived from the original on 2007-06-07. Retrieved 2007-06-28.
14. ^ Bergman, Joel (Oct 29, 2019). The Textbook of Autism Spectrum Disorders. American Psychiatric Pub. p. 91. ISBN 9781585623419. ISBN 1585623415
## External links[edit]
Classification
D
* ICD-10: F84.9
* ICD-9-CM: 299.9299.80
* v
* t
* e
Pervasive developmental disorders and autism spectrum
Main
* Causes
* Comorbid conditions
* Epidemiology
* Heritability
* Societal and cultural aspects
* Medical model
* Therapies
Diagnoses
* Autism spectrum (High-functioning autism
* Classic autism
* Asperger syndrome
* Pervasive developmental disorder not otherwise specified
* Childhood disintegrative disorder
* Rett syndrome)
Related conditions
* Alexithymia
* Attention deficit hyperactivity disorder
* Anxiety disorder (obsessive–compulsive disorder)
* Late talker
* Epilepsy
* Fragile X syndrome
* Hyperlexia
* Savant syndrome
* Sensory processing disorder
* Intellectual disability
* Developmental coordination disorder
* Multiple complex developmental disorder
Controversies
* Autism rights movement
* Autistic enterocolitis
* Facilitated communication
* MMR vaccine
* Rapid prompting method
* Thiomersal (Chelation)
Diagnostic scales
* Gilliam Asperger's disorder scale
* Autism Diagnostic Observation Schedule
* Autism Diagnostic Interview
* Autism-spectrum quotient
* Childhood Autism Rating Scale
Lists
* Autism-related topics
* Fictional characters
* Schools
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Pervasive developmental disorder not otherwise specified
|
None
| 8,546 |
wikipedia
|
https://en.wikipedia.org/wiki/Pervasive_developmental_disorder_not_otherwise_specified
| 2021-01-18T18:47:44 |
{"icd-9": ["299.9"], "icd-10": ["F84.9"], "wikidata": ["Q3288122"]}
|
This article needs additional citations for verification. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed.
Find sources: "Phoenix abscess" – news · newspapers · books · scholar · JSTOR (May 2014) (Learn how and when to remove this template message)
A phoenix abscess is an acute exacerbation of a chronic periapical lesion. It is a dental abscess that can occur immediately following root canal treatment. Another cause is due to untreated necrotic pulp (chronic apical periodontitis).[1] It is also the result of inadequate debridement during the endodontic procedure. Risk of occurrence of a phoenix abscess is minimised by correct identification and instrumentation of the entire root canal, ensuring no missed anatomy.
Treatment involves repeating the endodontic treatment with improved debridement, or tooth extraction. Antibiotics might be indicated to control a spreading or systemic infection.
## Contents
* 1 Causes
* 2 Signs & Symptoms
* 2.1 Clinical Features
* 2.2 Radiographic Features
* 3 Treatment
* 3.1 1) Further Endodontic Treatment
* 3.2 2) Medications
* 3.2.1 i) Antibiotics
* 3.2.2 ii) Analgesics
* 3.3 3) Extraction
* 3.4 4) Bite Adjustment
* 4 References
## Causes[edit]
Phoenix abscesses are believed to be due to a changing internal environment of the root canal system during the instrumentation stage of root canal treatment, causing a sudden worsening of the symptoms of chronic periradicular periodontitis.[1] This instrumentation is thought to stimulate the residual microbes in the root canal space to cause an inflammatory reaction. These microbes are predominantly facultative anaerobic gram-positive bacteria, such as Streptococcus, Enterococcus and Actinomyces species.[2] Another cause of a phoenix abscess is a decrease in a patient's resistance to these bacteria and their products.[1]
## Signs & Symptoms[edit]
### Clinical Features[edit]
* Pain
A common clinical feature is exacerbated and exaggerated pain. There may or may not be associated with pus & suppuration.[3] The signs & symptoms are similar to that of an acute periradicular abscess, but with a periradicular radiolucency present as well.[4][5][3]
* Loss of Vitality
The problematic tooth will have a non-vital pulp with no previous symptoms.[6] Vitality of teeth can be assessed through various means. Common tests would include ethyl chloride test or electric pulp test. Other examples of tests would be laser doppler flowmetry (LDF), pulse oximetry etc.
* Tender to Touch
The tooth is extremely tender to touch, and it may be high on occlusion as it may be extruded from the socket.
* Mobile
Mobility may be observed.[3]
### Radiographic Features[edit]
Radiographically, there will be a periapical lesion associated with the tooth. This lesion is normally existent prior to this episode. Widened periodontal ligament (PDL) space is visible.[4]
## Treatment[edit]
For most situations urgent treatment is required to eliminate the pain and swelling.[7][6]
### 1) Further Endodontic Treatment[edit]
Further root canal treatment is often the best option.[7][8] Firstly, the tooth should be accessed and thoroughly irrigated using sodium hypochlorite. Following this the canals should be dried using paper points.[3] The tooth should then be debrided, and drainage established.[3]
### 2) Medications[edit]
#### i) Antibiotics[edit]
In certain circumstances it may be necessary to provide an antibiotic.[3][7] These circumstances include the presence of a diffuse swelling or cellulitis, when immediate drainage cannot be achieved, or the patient has systemic involvement.[9]
#### ii) Analgesics[edit]
Analgesics may also be advised for pain control.
### 3) Extraction[edit]
If the tooth is unrestorable then extraction may also be an option.[7][8]
### 4) Bite Adjustment[edit]
Adjusting the bite may provide some relief but this will not be a permanent solution to the problem.[7]
## References[edit]
1. ^ a b c "Classification of Pulpal and Periradicular Pathoses « UCLA School of Dentistry Clinic Guide". Retrieved 2012-08-22.
2. ^ Sakko, Marjut; Tjäderhane, Leo; Rautemaa-Richardson, Riina (2016-05-01). "Microbiology of Root Canal Infections". Primary Dental Journal. 5 (2): 84–89. doi:10.1308/205016816819304231. ISSN 2050-1684. PMID 28826437. S2CID 21567336.
3. ^ a b c d e f Carrotte, P (September 2004). "Endodontics: Part 3 Treatment of endodontic emergencies" (PDF). British Dental Journal. 197 (6): 299–305. doi:10.1038/sj.bdj.4811641. PMID 15454989. S2CID 205672369.
4. ^ a b McClanahan, Scott B (2002). "Pulpal and Periradicular Diagnostic Terminology" (PDF). Clinical Update. 24.
5. ^ Shetty, Neeta. "Mid Treatment Flareups in Endodontics" (PDF). Endodontology.
6. ^ a b "NBDE Part II Endodontics Terminology". 2012.
7. ^ a b c d e "Phoenix Abscess - ToothIQ". ToothIQ. Retrieved 2018-11-19.
8. ^ a b Nikhade, Pradnya P. (2018-05-30). Conservative Dentistry and Endodontics: Manual for Undergraduates. Educreation Publishing.
9. ^ "SDCEP-Drug Prescribing for Dentistry 3rd edition" (PDF). SDCEP.
* v
* t
* e
Endodontology
Tests
* Dental radiography
* Dental pulp test
Procedures
Non-surgical
* Root canal treatment
* Pulp capping
* Pulpotomy
* Apexification
* Pulp regeneration
* Internal bleaching
Surgical
* Periradicular surgery
* Apicoectomy
* Root resection
* Tooth hemisection
Tools
* Dental dam
* Apex locator
* Electronic apex locator
* Files and reamers
* Nickel titanium rotary file
* Operating microscope
* Silverpoints
Materials
* Amalgam
* EDTA
* Eucalyptol
* Gutta-percha
* Saline
* Sodium hypochlorite
* v
* t
* e
Dentistry
Specialties
* Endodontics
* Oral and maxillofacial pathology
* Oral and maxillofacial radiology
* Oral and maxillofacial surgery
* Orthodontics and dentofacial orthopedics
* Pediatric dentistry
* Periodontics
* Prosthodontics
* Dental public health
* Cosmetic dentistry
* Dental implantology
* Geriatric dentistry
* Restorative dentistry
* Forensic odontology
* Dental traumatology
* Holistic dentistry
Dental surgery
* Dental extraction
* Tooth filling
* Root canal therapy
* Root end surgery
* Scaling and root planing
* Teeth cleaning
* Dental bonding
* Tooth polishing
* Tooth bleaching
* Socket preservation
* Dental implant
Organisations
* American Association of Orthodontists
* British Dental Association
* British Dental Health Foundation
* British Orthodontic Society
* Canadian Association of Orthodontists
* Dental Technologists Association
* General Dental Council
* Indian Dental Association
* National Health Service
See also
* Index of oral health and dental articles
* Outline of dentistry and oral health
* Dental fear
* Dental instruments
* Dental material
* History of dental treatments
* Infant oral mutilation
* Mouth assessment
* Oral hygiene
* v
* t
* e
Acquired tooth disease
Hard tissues
* Caries (tooth decay)
* Attrition
* Abrasion
* Erosion
* Hypercementosis
* tooth resorption (External resorption, Internal resorption, Root resorption)
Pulp/periapical (Endodontal)
Pulpal
* External resorption
* Internal resorption
* Irreversible pulpitis
* Reversible pulpitis
* Pulp necrosis
* Pink tooth of Mummery
Periapical
* Acute apical periodontitis
* Chronic apical periodontitis
* Combined periodontic-endodontic lesions
* Fistula
* Periapical abscess
* Phoenix abscess
* Vertical root fracture
Ungrouped
* Pulpitis
* Radicular cyst
* Periapical abscess
Gingiva/periodontal
(Periodontal)
* Gingivitis
* Periodontitis (Chronic periodontitis)
* Periodontal disease
Bone cyst
* Dentigerous cyst
* Calcifying odontogenic cyst
* Glandular odontogenic cyst
Other
* Cracked tooth syndrome
To be grouped
from periodontology
Diagnoses
* Chronic periodontitis
* Localized aggressive periodontitis
* Generalized aggressive periodontitis
* Periodontitis as a manifestation of systemic disease
* Necrotizing periodontal diseases
* Abscesses of the periodontium
* Combined periodontic-endodontic lesions
Pathogenesis
* A. actinomycetemcomitans
* Capnocytophaga sp.
* F. nucleatum
* P. gingivalis
* P. intermedia
* T. forsythia
* T. denticola
Pathologic entities
* Calculus
* Edentulism
* Fremitus
* Furcation defect
* Gingival enlargement
* Gingival pocket
* Gingivitis
* Horizontal bony defect
* Linear gingival erythema
* Occlusal trauma
* Periodontal pocket
* Periodontal disease
* Periodontitis
* Plaque
* Recession
* Vertical bony defect
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Phoenix abscess
|
c1290649
| 8,547 |
wikipedia
|
https://en.wikipedia.org/wiki/Phoenix_abscess
| 2021-01-18T18:44:15 |
{"umls": ["C1290649"], "wikidata": ["Q7187021"]}
|
A number sign (#) is used with this entry because of evidence that X-linked recessive chondrodysplasia punctata (CDPX1) is caused by mutation in the arylsulfatase E gene (ARSE; 300180) on chromosome Xp22.
For a general phenotypic description and a discussion of genetic heterogeneity of CDP, see CDPX2 (302960).
Clinical Features
Sheffield et al. (1976) reported 23 patients who presented in infancy with failure to thrive, apparent mental retardation, and atypical facies. Diagnosis was confirmed by finding punctate calcifications in radiographs of the feet and other sites. Seventeen patients were male, and Sheffield et al. (1976) suggested an X-linked recessive inheritance. Four of their patients showed hypoplasia of the distal phalanges, which was ascribed to Dilantin in 2 cases in which the mothers had a history of use of that drug during gestation.
Curry (1979) observed a kindred with 2 affected brothers and 1 of their maternal uncles. She suggested that hypoplasia of the distal phalanges is a distinctive feature. One of the brothers was stillborn and showed nasal hypoplasia and distal phalangeal hypoplasia. The uncle required bilateral choanal tubes during the first weeks of life because of severely hypoplastic nose. At birth the skin was bright red with generalized scales which desquamated in large sheets. The skin lesions subsequently had the appearance of ichthyosis. He was retarded (in the educable range) and deaf. In the family of Curry (1979), the presumed carrier females showed no radiologic abnormality, thus suggesting an X-linked recessive form.
Maroteaux (1989) described 4 cases of chondrodysplasia punctata with hypoplasia of the distal phalanges of the fingers. He designated the disorder brachytelephalangic chondrodysplasia punctata. Growth disturbance was moderate without asymmetry of the limbs, and the facial dysmorphism was similar to that in a condition Maroteaux (1989) referred to as 'Binder's maxillo-facial dysostosis.' Generalized involvement of the vertebral bodies with calcifications was never seen. The cases represented a benign form of chondrodysplasia punctata. The phalangeal anomaly is important to the diagnosis after the second and third years of life, when the epiphyseal stippling is no longer present. Maroteaux (1989) pointed out that the facial features and even the distal phalangeal hypoplasia are similar to those reported by Curry et al. (1984) in cases with a deletion of terminal Xp, and suggested that the affected patients, all males, may have their disorder on the basis of an isolated mutation of the same gene on Xp.
Petit et al. (1990) described a 4-generation family in which chondrodysplasia punctata was found in a boy and one of his maternal uncles. These 2 patients also had short stature, as did all the female members of the family. Petit et al. (1990) emphasized and illustrated the occurrence of short distal phalanges in this condition, especially in the 25-year-old uncle.
Elcioglu and Hall (1998) reported 2 sibs with features consistent with a diagnosis of either chondrodysplasia punctata, metacarpal type or chondrodysplasia, brachytelephalangic type, one of whom was stillborn at 36 weeks and one of whom miscarried at 24 weeks, from a mother with systemic lupus erythematosus (SLE; 152700). Austin-Ward et al. (1998) reported a child with chondrodysplasia punctata (118651) and other congenital anomalies resembling those associated with the use of oral anticoagulants, but with no history of exposure, who was born to a mother with systemic lupus erythematosus. Both Elcioglu and Hall (1998) and Austin-Ward et al. (1998), as well as Toriello (1998) in a commentary on these 2 papers, concluded that there was an association between chondrodysplasia punctata and maternal systemic lupus erythematosus. Kozlowski et al. (2004) described 2 brothers with chondrodysplasia punctata, whose mother had longstanding lupus erythematosus and epilepsy, for which she had been treated with chloroquine and other therapeutic agents during both pregnancies. Kozlowski et al. (2004) pointed to 7 previously reported instances of the association between chondrodysplasia punctata and maternal SLE.
Cytogenetics
Curry et al. (1982) concluded that X-linked chondrodysplasia punctata may be determined by a locus at Xp22.32. Two families were studied, each with 2 affected males. Because atypical ichthyosis was a feature, the steroid sulfatase system was investigated. All 4 had greatly elevated cholesterol sulfate; this measure was normal in carrier females. In both of the males studied, cultured fibroblasts showed steroid sulfatase deficiency. High-resolution cytogenetics showed a small deletion at Xp22.32 in all 4 affected males, their carrier mothers, and several potential carrier females. Curry et al. (1984) reported that the steroid sulfatase (STS; 300747), XG (300879), and MIC2X (313470) loci were also deleted. The women carrying the deletion had normal gonadal function and fertility but were shorter of stature than noncarriers in their families (p less than 0.00001). The skin lesions resembled those of X-linked ichthyosis (308100). The deletion in the family reported by Bick et al. (1989) was larger than that described by Curry et al. (1984) and included the Kallmann gene (KAL1; 300836).
By a study of cases of various deletions of Xp, Ballabio et al. (1989) concluded that CPXR is located just proximal to MIC2 in the most distal portion of Xp, which is pseudoautosomal. Ballabio et al. (1991) described a male infant with short stature, chondrodysplasia punctata, and ichthyosis due to steroid sulfatase deficiency. Deletion of the distal short arm of the X chromosome had been inherited from the mother who had a balanced reciprocal translocation between 9p and Xp. This was evidence of close situation of the STS locus and the CDPX1 locus.
Wulfsberg et al. (1992) described X-linked recessive chondrodysplasia punctata as part of a contiguous Xp gene deletion syndrome including the CDPX1 gene, a nonspecific X-linked mental retardation gene, the STS gene, and the Kallmann syndrome gene.
Agematsu et al. (1988) described mother and son who were carrying an extra piece on the short arm of the X chromosome, identified as having derived from the long arm of the Y chromosome by means of in situ hybridization with a Y-chromosome-specific DNA probe. The son had punctate epiphyseal calcifications, mildly short limbs, flattened nasal bridge, and mental retardation. The mother was somewhat short of stature and was said to have mildly short arms but no punctate calcifications. It is difficult to suggest that the mother was affected. During the early weeks of life, the son suffered from severe respiratory distress attributed to the small nasal airway and laryngomalacia with stippling of the laryngeal cartilages.
Maroteaux (1989) reported that DNA molecular analysis of pseudoautosomal and Xp22.3-specific loci showed an interstitial deletion that cosegregated with the phenotypic abnormalities. The deletion lay at the boundary of the pseudoautosomal region. The fact that the patients had neither ichthyosis nor Kallmann syndrome indicates that these loci are located more proximally.
Seidel et al. (2001) described an 8-year-old male with mesomelic shortening of forearms and legs, brachytelephalangy, and ichthyotic skin lesions. Chromosomal analysis showed an X;Y translocation involving the short arm of the X chromosome. Fluorescence in situ hybridization and molecular studies localized the breakpoints on Xp22.3 in the immediate vicinity of the KAL gene and demonstrated deletions of steroid sulfatase, arylsulfatase E, and short stature homeobox (SHOX; 312865) genes. It was suspected that the patient was suffering from chondrodysplasia punctata because of a loss of the ARSE gene; however, no stippled epiphyses were seen in the neonatal radiograph. Brachytelephalangy was the only result of ARSE gene deletion in this patient. The patient's mother had dwarfism and showed Madelung deformity of the forearms. She was shown to be a carrier of the same aberrant X chromosome. Her son did not show Madelung deformity, demonstrating that the Leri-Weill syndrome phenotype may be incomplete in children with SHOX gene deletion.
Mapping
Van Maldergem et al. (1991) confirmed the assignment of the CDPX1 gene to Xp22.3 by demonstrating the existence of a reciprocal X-Y translocation involving the region distal to Xp22.3. Weil et al. (1993) studied a 13-year-old male with a 45,X karyotype and many stigmata of Turner syndrome. Y-chromosome material had been transposed to the X chromosome, which was partially deleted. The deletions on the X and Y chromosomes allowed Weil et al. (1993) to map the genes responsible for most features of the Turner syndrome to the segment between DXS432 and Xqter. Since the patient had no clinical or radiographic signs of chondrodysplasia punctata, they concluded from the molecular analysis that this locus can be narrowed to an interval of 1.5 Mb between DXS432 and DXS31.
Molecular Genetics
Franco et al. (1995) cloned the genomic region within Xp22.3 where the gene related to CDPX is located and isolated 3 adjacent genes showing highly significant homology to the sulfatase gene family: arylsulfatase D (300002), arylsulfatase E (ARSE), and arylsulfatase F (300003). Point mutations in ARSE were identified in 5 patients with CDPX (300180.0001-300180.0005). Expression of the gene in COS cells resulted in a heat-labile arylsulfatase activity that is inhibited by warfarin. Franco et al. (1995) demonstrated a deficiency of a heat-labile arylsulfatase activity in patients with deletions spanning the CDPX region. Thus, Franco et al. (1995) determined that CDPX is caused by an inherited deficiency of a novel sulfatase. It is likely that warfarin embryopathy involves drug-induced inhibition of the same enzyme. ARSD lies telomeric to ARSE and both are transcribed toward the telomere. The authors noted that ancient duplications may be responsible for the contiguous location of genes of closely similar sequence and structure. Franco et al. (1995) granted the possibility that mutations in the ARSD or ARSF genes may also cause CDPX. Another member of the arylsulfatase family, ARSC, also known as steroid sulfatase, is deficient in X-linked ichthyosis. ARSA (607574) is deficient in metachromatic leukodystrophy (250100); ARSB (611542) is deficient in mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome; 253200).
Sheffield et al. (1998) reported mutation analysis on 16 males and 2 females with what they classified as the symmetric type of chondrodysplasia punctata, including individuals from 3 multigeneration families. Mutations in ARSE were found in 3 males. No mutations were detected in the ARSD gene. Family studies showed segregation of the mutations with phenotype, establishing X-linked inheritance in the families. Asymptomatic females and males were found in these studies. Sheffield et al. (1998) concluded that clinical presentation varied not only between unrelated affected males but also between affected males within the same family, and that the clinical diagnosis of chondrodysplasia punctata in adults can be difficult. Sheffield et al. (1998) also discussed the nosology of the chondrodysplasia punctata group.
In 16 male patients with CDPX1, Brunetti-Pierri et al. (2003) performed direct sequencing of the ARSE gene and identified mutations in 12 of them (see 300180.0007-300180.0008). Clinical variability was observed among the patients, including severe presentation with early lethality in one, and unusual features such as cataracts, sensorineural deafness, and respiratory distress.
Nino et al. (2008) evaluated the ARSE gene in 11 patients with a suspected clinical diagnosis of CDPX1 based on the diagnostic criteria of male sex, nasomaxillary hypoplasia, brachytelephalangy, and radiologic evidence of chondrodysplasia punctata. Mutations were identified in 7. Three of the remaining 4 individuals had underlying maternal conditions, including maternal pancreatitis and autoimmune disease involving several organs, that further expand the phenocopy group. Nino et al. (2008) compared the clinical features of 31 patients with documented ARSE deficiency and 27 patients with presumed phenocopies of CDPX1. Distinguishing features included the increased occurrence of maternal complications, preterm delivery, and infant demise in the phenocopy group.
Matos-Miranda et al. (2013) reported the results of a Collaboration Education and Test Translation (CETT) program for CDPX1 from 2008 to 2010. Of 29 male probands identified, 17 had ARSE mutations (58%) including 10 novel missense alleles and 1 single-codon deletion. All mutant alleles had negligible ARSE activity, and there were no obvious genotype-phenotype correlations. Maternal etiologies were not reported in most patients.
INHERITANCE \- X-linked recessive GROWTH Height \- Short stature HEAD & NECK Head \- Microcephaly Ears \- Hearing loss Eyes \- Cataracts Nose \- Nasal hypoplasia \- Depressed nasal bridge \- Short nasal septum GENITOURINARY External Genitalia (Male) \- Hypogonadism (in contiguous gene syndrome patients) SKELETAL Spine \- Paravertebral stippling Limbs \- Epiphyseal stippling Hands \- Distal phalangeal hypoplasia SKIN, NAILS, & HAIR Skin \- Ichthyosis (in contiguous gene syndrome patients) NEUROLOGIC Central Nervous System \- Developmental delay \- Anosmia (in contiguous gene syndrome patients) MISCELLANEOUS \- Some patients have a contiguous gene syndrome due to loss of adjacent genes (STS, 308100 and KAL1, 300836 ) on Xp22.3 via deletions and translocations MOLECULAR BASIS \- Caused by mutation in the arylsulfatase E gene (ARSE, 300180.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
CHONDRODYSPLASIA PUNCTATA 1, X-LINKED RECESSIVE
|
c1844853
| 8,548 |
omim
|
https://www.omim.org/entry/302950
| 2019-09-22T16:18:42 |
{"doid": ["0060292"], "mesh": ["C535941"], "omim": ["302950"], "orphanet": ["79345"], "synonyms": ["Alternative titles", "CPXR", "CHONDRODYSPLASIA PUNCTATA, BRACHYTELEPHALANGIC"], "genereviews": ["NBK1544"]}
|
Porokeratotic eccrine ostial and dermal duct nevus is a skin lesion that resembles a comedonal nevus, but it occurs on the palms and soles where pilosebaceous follicles are normally absent.[1] It is probably transmitted by paradominant transmission.[2]
## See also[edit]
* Prominent inferior labial artery
* List of cutaneous conditions
## References[edit]
1. ^ Rapini, Ronald P.; Bolognia, Jean L.; Jorizzo, Joseph L. (2007). Dermatology: 2-Volume Set. St. Louis: Mosby. ISBN 978-1-4160-2999-1.
2. ^ Masferrer E, Vicente MA, Bassas-Vila J, Rovira C, González-Enseñat MA (Jul 2010). "Porokeratotic eccrine ostial and dermal duct naevus: report of 10 cases". J Eur Acad Dermatol Venereol. 24 (7): 847–51. doi:10.1111/j.1468-3083.2009.03498.x. PMID 19925595.
This dermatology article is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Porokeratotic eccrine ostial and dermal duct nevus
|
c0473579
| 8,549 |
wikipedia
|
https://en.wikipedia.org/wiki/Porokeratotic_eccrine_ostial_and_dermal_duct_nevus
| 2021-01-18T18:39:55 |
{"umls": ["C0473579"], "wikidata": ["Q7230265"]}
|
Fleck corneal dystrophy
Appearance of the cornea by slit-lamp biomicroscopy (left image) and by confocal microscopy (right image) (Courtesy Dr. Charles N. McGhee)
SpecialtyOphthalmology
Fleck corneal dystrophy, also known as Francois-Neetens speckled corneal dystrophy, is a rare form of corneal dystrophy. It is caused by mutations in PIKFYVE gene. Small opacities, some of which resemble "flecks", are scattered in the stroma of the patients. Other opacities look more like snowflakes or clouds. The disease is non-progressive and in most cases asymptomatic, with mild photophobia reported by some patients. In a single case report, a corneal transplantation was performed for concurrent keratoconus, and at 10 years follow-up there was still no evidence of the inclusions in the stroma.[1]
## References[edit]
1. ^ Klintworth GK (2009). "Corneal dystrophies". Orphanet J Rare Dis. 4: 7. doi:10.1186/1750-1172-4-7. PMC 2695576. PMID 19236704.
## External links[edit]
Classification
D
* OMIM: 121850
* MeSH: C563256 C563256, C563256
* SNOMED CT: 417183007
External resources
* Orphanet: 98970
* v
* t
* e
Types of corneal dystrophy
Epithelial and subepithelial
* Epithelial basement membrane dystrophy
* Gelatinous drop-like corneal dystrophy
* Lisch epithelial corneal dystrophy
* Meesmann corneal dystrophy
* Subepithelial mucinous corneal dystrophy
Bowman's membrane
* Reis–Bucklers corneal dystrophy
* Thiel-Behnke dystrophy
Stroma
* Congenital stromal corneal dystrophy
* Fleck corneal dystrophy
* Granular corneal dystrophy
* Lattice corneal dystrophy
* Macular corneal dystrophy
* Posterior amorphous corneal dystrophy
* Schnyder crystalline corneal dystrophy
Descemet's membrane and
endothelial
* Congenital hereditary endothelial dystrophy
* Fuchs' dystrophy
* Posterior polymorphous corneal dystrophy
* X-linked endothelial corneal dystrophy
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Fleck corneal dystrophy
|
c1562113
| 8,550 |
wikipedia
|
https://en.wikipedia.org/wiki/Fleck_corneal_dystrophy
| 2021-01-18T18:28:08 |
{"mesh": ["C563256"], "umls": ["C1562113"], "orphanet": ["98970"], "wikidata": ["Q4237691"]}
|
Acute bronchitis
Other namesChest cold
Figure A shows the location of the lungs and bronchial tubes. Figure B is an enlarged view of a normal bronchial tube. Figure C is an enlarged view of a bronchial tube with bronchitis.
SpecialtyPulmonology
SymptomsCough with sputum, wheezing, shortness of breath, fever, chest discomfort[1][2]
DurationUp to 6 weeks[3]
CausesTypically viral infection[1]
Risk factorsTobacco smoke, dust, air pollution[2]
Diagnostic methodBased on symptoms[4]
Differential diagnosisAsthma, pneumonia, bronchiolitis, bronchiectasis, COPD[1]
PreventionAvoiding air pollution, handwashing[5]
TreatmentRest, paracetamol (acetaminophen), NSAIDs[3][6]
Frequency~5% one or more episodes a year[7][8]
Acute bronchitis, also known as a chest cold, is short-term bronchitis – inflammation of the bronchi (large and medium-sized airways) of the lungs.[2][1] The most common symptom is a cough.[1] Other symptoms include coughing up mucus, wheezing, shortness of breath, fever, and chest discomfort.[2] The infection may last from a few to ten days.[2] The cough may persist for several weeks afterward with the total duration of symptoms usually around three weeks.[2][1] Some have symptoms for up to six weeks.[3]
In more than 90% of cases, the cause is a viral infection.[1] These viruses may be spread through the air when people cough or by direct contact.[2] Risk factors include exposure to tobacco smoke, dust, and other air pollution.[2] A small number of cases are due to high levels of air pollution or bacteria such as Mycoplasma pneumoniae or Bordetella pertussis.[1][9] Diagnosis is typically based on a person's signs and symptom.[4] The color of the sputum does not indicate if the infection is viral or bacterial.[1] Determining the underlying organism is typically not needed.[1] Other causes of similar symptoms include asthma, pneumonia, bronchiolitis, bronchiectasis, and COPD.[1][7] A chest X-ray may be useful to detect pneumonia.[1]
Prevention is by not smoking and avoiding other lung irritants.[5] Frequent hand washing and flu vaccination may also be protective.[5][10] Treatment of acute bronchitis typically involves rest, paracetamol (acetaminophen), and NSAIDs to help with the fever.[3][6] Cough medicine has little support for its use and is not recommended in children less than six years of age.[1][11] Antibiotics should generally not be used.[12] An exception is when acute bronchitis is due to pertussis.[1] Tentative evidence supports honey and pelargonium to help with symptoms.[1]
Acute bronchitis is one of the most common diseases.[3][13] About 5% of adults are affected and about 6% of children have at least one episode a year.[7][8] It occurs more often in the winter.[7] More than 10 million people in the United States visit a doctor each year for this condition with approximately 70% receiving antibiotics, most of which are not needed.[3] There are efforts to decrease the use of antibiotics in acute bronchitis.[13]
## Contents
* 1 Signs and symptoms
* 2 Cause
* 3 Diagnosis
* 4 Prevention
* 5 Treatment
* 5.1 Antibiotics
* 5.2 Smoking cessation
* 5.3 Alternative therapeutic approaches
* 6 Prognosis
* 7 Epidemiology
* 8 References
* 9 External links
## Signs and symptoms[edit]
The primary symptom is cough with sputum that may be purulent. The illness may also have shortness of breath or wheezing. Upper respiratory tract infections often precede acute bronchitis, with overlapping symptoms including headache, nasal congestion, sore throat. Fever and other systemic symptoms are rare in acute bronchitis; their presence raises suspicion for influenza or pneumonia.[14][15]
## Cause[edit]
Acute bronchitis can be caused by contagious pathogens, most commonly viruses. Typical viruses include respiratory syncytial virus, rhinovirus, influenza, and others. Bacteria are uncommon pathogens but may include Mycoplasma pneumoniae, Chlamydophila pneumoniae, Bordetella pertussis, Streptococcus pneumoniae, and Haemophilus influenzae.[16]
* Damage caused by irritation of the airways leads to inflammation and leads to neutrophils infiltrating the lung tissue.
* Mucosal hypersecretion is promoted by a substance released by neutrophils.
* Further obstruction to the airways is caused by more goblet cells in the small airways. This is typical of chronic bronchitis.
* Although infection is not the reason or cause of chronic bronchitis, it is seen to aid in sustaining the bronchitis.
## Diagnosis[edit]
Mild peri hilar cuffing as seen in viral bronchitis
A physical examination will often reveal decreased intensity of breath sounds, wheezing, rhonchi, and prolonged expiration. Most physicians rely on the presence of a persistent dry or wet cough as evidence of bronchitis.[citation needed]
A variety of tests may be performed in people presenting with cough and shortness of breath:[citation needed]
* A chest X-ray is useful to exclude pneumonia which is more common in those with a fever, fast heart rate, fast respiratory rate, or who are old.[7]
* A sputum sample showing neutrophil granulocytes (inflammatory white blood cells) and culture showing that has pathogenic microorganisms such as Streptococcus species.
* A blood test would indicate inflammation (as indicated by a raised white blood cell count and elevated C-reactive protein).
Decreased breath sounds, crackles, wheezing, and rhonchi that clears with coughs may be heard in the chest. Dullness to percussion and pleural rub suggest disease extension beyond the bronchi such as seen with pneumonia.[14][15] Paroxysms of cough followed by inspiratory whoop and vomiting suggests pertussis.[17]
## Prevention[edit]
Prevention is by not smoking and avoiding other lung irritants.[5] Frequent hand washing may also be protective.[5] Furthermore, an oral whole cell nontypeable Haemophilus influenzae vaccine given in the fall has demonstrated short term effectiveness in reducing the frequency and severity of the disease during the winter.[18]
## Treatment[edit]
Most cases are self-limited and resolve themselves in a few weeks. Pain medications may help with symptoms.[19] Other recommendations may include rest and keeping well hydrated.[citation needed]
### Antibiotics[edit]
Evidence does not support the general use of antibiotics in acute bronchitis.[12] A systematic review found antibiotics reduced cough by an average of 12 hours (out of a total average of about 14–28 days). Antibiotics caused more side effects such as nausea and diarrhoea, and also may promote antibiotic-resistant bacteria. It is possible they are useful in susceptible groups such as the frail and elderly but there was not enough research information to determine this.[20]
Calling acute bronchitis with benign-sounding labels such as chest cold or viral infections may reduce antibiotic usage by improving patients satisfaction when antibiotics are not prescribed.[21]
### Smoking cessation[edit]
Further information: Smoking cessation
To help the bronchial tree heal faster and not make bronchitis worse, smokers should quit smoking completely.[citation needed]
### Alternative therapeutic approaches[edit]
Salbutamol is not effective in children with an acute cough who do not have restricted airways.[22] There is weak evidence that salbutamol may be useful in adults with wheezing due to a restricted airway; however, it may result in nervousness, shakiness or a tremor.[1][22]
## Prognosis[edit]
Acute bronchitis usually lasts a few days or weeks.[23] It may accompany or closely follow a cold or the flu, or may occur on its own. Bronchitis usually begins with a dry cough, including waking the sufferer at night. After a few days, it progresses to a wetter or productive cough, which may be accompanied by fever, fatigue, and headache. The fever, fatigue, and malaise may last only a few days, but the wet cough may last up to several weeks.[citation needed]
Coughing up mucus tinged with blood, needs medical advice. In rare cases, physicians may conduct tests to see whether the cause of the bloody sputum is a serious condition such as tuberculosis or lung cancer.[citation needed]
## Epidemiology[edit]
Acute bronchitis is one of the most common diseases.[3][13] About 5% of adults are affected and about 6% of children have at least one episode a year.[7][8] It occurs more often in the winter.[7]
In infants under one year of age, acute bronchitis was the most common reason for admission to the hospital after an emergency department visit in the US in 2011.[24]
## References[edit]
1. ^ a b c d e f g h i j k l m n o p Albert, RH (1 December 2010). "Diagnosis and treatment of acute bronchitis". American Family Physician. 82 (11): 1345–50. PMID 21121518.
2. ^ a b c d e f g h "What Is Bronchitis?". August 4, 2011. Archived from the original on 2 April 2015. Retrieved 1 April 2015.
3. ^ a b c d e f g Tackett, KL; Atkins, A (December 2012). "Evidence-based acute bronchitis therapy". Journal of Pharmacy Practice. 25 (6): 586–90. doi:10.1177/0897190012460826. PMID 23076965. S2CID 37651935.
4. ^ a b "How Is Bronchitis Diagnosed?". August 4, 2011. Archived from the original on 2 April 2015. Retrieved 1 April 2015.
5. ^ a b c d e "How Can Bronchitis Be Prevented?". August 4, 2011. Archived from the original on 2 April 2015. Retrieved 1 April 2015.
6. ^ a b "How Is Bronchitis Treated?". August 4, 2011. Archived from the original on 2 April 2015. Retrieved 1 April 2015.
7. ^ a b c d e f g Wenzel, RP; Fowler AA, 3rd (16 November 2006). "Clinical practice. Acute bronchitis". The New England Journal of Medicine. 355 (20): 2125–30. doi:10.1056/nejmcp061493. PMID 17108344.
8. ^ a b c Fleming, DM; Elliot, AJ (March 2007). "The management of acute bronchitis in children". Expert Opinion on Pharmacotherapy. 8 (4): 415–26. doi:10.1517/14656566.8.4.415. PMID 17309336. S2CID 46247982.
9. ^ "What Causes Bronchitis?". August 4, 2011. Archived from the original on 2 April 2015. Retrieved 1 April 2015.
10. ^ Singh, Anumeha; Zahn, Elise (2018). Acute Bronchitis. StatPearls Publishing. Retrieved 23 January 2019.
11. ^ Smith, SM; Schroeder, K; Fahey, T (24 November 2014). "Over-the-counter (OTC) medications for acute cough in children and adults in community settings". The Cochrane Database of Systematic Reviews. 11 (11): CD001831. doi:10.1002/14651858.CD001831.pub5. PMC 7061814. PMID 25420096.
12. ^ a b Smith, SM; Fahey, T; Smucny, J; Becker, LA (19 Jun 2017). "Antibiotics for acute bronchitis". The Cochrane Database of Systematic Reviews. 6: CD000245. doi:10.1002/14651858.CD000245.pub4. PMC 6481481. PMID 28626858.
13. ^ a b c Braman, SS (January 2006). "Chronic cough due to acute bronchitis: ACCP evidence-based clinical practice guidelines". Chest. 129 (1 Suppl): 95S–103S. doi:10.1378/chest.129.1_suppl.95S. PMC 7094612. PMID 16428698.
14. ^ a b Wenzel, Richard P.; Fowler, Alpha A. (2006-11-16). "Clinical practice. Acute bronchitis". The New England Journal of Medicine. 355 (20): 2125–2130. doi:10.1056/NEJMcp061493. ISSN 1533-4406. PMID 17108344.
15. ^ a b Ebell, Mark H.; Lundgren, Jerold; Youngpairoj, Surasak (2013). "How long does a cough last? Comparing patients' expectations with data from a systematic review of the literature". Annals of Family Medicine. 11 (1): 5–13. doi:10.1370/afm.1430. ISSN 1544-1717. PMC 3596033. PMID 23319500.
16. ^ Chang, Anne B.; Upham, John W.; Masters, I. Brent; Redding, Gregory R.; Gibson, Peter G.; Marchant, Julie M.; Grimwood, Keith (March 2016). "Protracted bacterial bronchitis: The last decade and the road ahead". Pediatric Pulmonology. 51 (3): 225–242. doi:10.1002/ppul.23351. ISSN 1099-0496. PMC 7167774. PMID 26636654.
17. ^ Ward, Joel I.; Cherry, James D.; Chang, Swei-Ju; Partridge, Susan; Lee, Hang; Treanor, John; Greenberg, David P.; Keitel, Wendy; Barenkamp, Stephen (2005-10-13). "Efficacy of an acellular pertussis vaccine among adolescents and adults". The New England Journal of Medicine. 353 (15): 1555–1563. doi:10.1056/NEJMoa050824. ISSN 1533-4406. PMID 16221778.
18. ^ Foxwell, A. R.; Cripps, A. W.; Dear, K. B. G. (2003). Foxwell, Ruth (ed.). "Haemophilus influenzae oral whole cell vaccination for preventing acute exacerbations of chronic bronchitis". The Cochrane Database of Systematic Reviews (3): CD001958. doi:10.1002/14651858.CD001958. hdl:10072/136658. ISSN 1469-493X. PMID 12917917.
19. ^ "Diagnosing and treating acute bronchitis". American Lung Association. Retrieved 24 January 2019.
20. ^ Smith, Susan M.; Fahey, Tom; Smucny, John; Becker, Lorne A. (19 June 2017). "Antibiotics for acute bronchitis". The Cochrane Database of Systematic Reviews. 6: CD000245. doi:10.1002/14651858.CD000245.pub4. ISSN 1469-493X. PMC 6481481. PMID 28626858.
21. ^ Phillips, T. Grant; Hickner, John (November 2005). "Calling acute bronchitis a chest cold may improve patient satisfaction with appropriate antibiotic use" (PDF). The Journal of the American Board of Family Practice. 18 (6): 459–463. doi:10.3122/jabfm.18.6.459. ISSN 0893-8652. PMID 16322409. Archived from the original on 2020-10-27.
22. ^ a b Becker, Lorne A.; Hom, Jeffrey; Villasis-Keever, Miguel; van der Wouden, Johannes C. (2015-09-03). "Beta2-agonists for acute cough or a clinical diagnosis of acute bronchitis". The Cochrane Database of Systematic Reviews (9): CD001726. doi:10.1002/14651858.CD001726.pub5. ISSN 1469-493X. PMC 7078572. PMID 26333656.
23. ^ "Bronchitis". Mayo Foundation for Medical Education and Research. 2007-04-20. Archived from the original on 2008-03-25. Retrieved 2008-05-30. Cite journal requires `|journal=` (help)
24. ^ Weiss, A.J.; Wier, L.M.; Stocks, C.; Blanchard, J. (June 2014). "Overview of Emergency Department Visits in the United States, 2011". HCUP Statistical Brief #174. Rockville, MD: Agency for Healthcare Research and Quality. Archived from the original on 2014-08-03.
## External links[edit]
Classification
D
* ICD-10: J20-J21
* ICD-9-CM: 466
* MeSH: D001991
External resources
* MedlinePlus: 001087
* eMedicine: article/297108
Wikisource has the text of the 1911 Encyclopædia Britannica article Bronchitis.
* Acute Bronchitis FamilyDoctor.org (American Academy of Family Physicians)
* "Acute Bronchitis". MedlinePlus. U.S. National Library of Medicine.
* v
* t
* e
Diseases of the respiratory system
Upper RT
(including URTIs,
common cold)
Head
sinuses
Sinusitis
nose
Rhinitis
Vasomotor rhinitis
Atrophic rhinitis
Hay fever
Nasal polyp
Rhinorrhea
nasal septum
Nasal septum deviation
Nasal septum perforation
Nasal septal hematoma
tonsil
Tonsillitis
Adenoid hypertrophy
Peritonsillar abscess
Neck
pharynx
Pharyngitis
Strep throat
Laryngopharyngeal reflux (LPR)
Retropharyngeal abscess
larynx
Croup
Laryngomalacia
Laryngeal cyst
Laryngitis
Laryngopharyngeal reflux (LPR)
Laryngospasm
vocal cords
Laryngopharyngeal reflux (LPR)
Vocal fold nodule
Vocal fold paresis
Vocal cord dysfunction
epiglottis
Epiglottitis
trachea
Tracheitis
Laryngotracheal stenosis
Lower RT/lung disease
(including LRTIs)
Bronchial/
obstructive
acute
Acute bronchitis
chronic
COPD
Chronic bronchitis
Acute exacerbation of COPD)
Asthma (Status asthmaticus
Aspirin-induced
Exercise-induced
Bronchiectasis
Cystic fibrosis
unspecified
Bronchitis
Bronchiolitis
Bronchiolitis obliterans
Diffuse panbronchiolitis
Interstitial/
restrictive
(fibrosis)
External agents/
occupational
lung disease
Pneumoconiosis
Aluminosis
Asbestosis
Baritosis
Bauxite fibrosis
Berylliosis
Caplan's syndrome
Chalicosis
Coalworker's pneumoconiosis
Siderosis
Silicosis
Talcosis
Byssinosis
Hypersensitivity pneumonitis
Bagassosis
Bird fancier's lung
Farmer's lung
Lycoperdonosis
Other
* ARDS
* Combined pulmonary fibrosis and emphysema
* Pulmonary edema
* Löffler's syndrome/Eosinophilic pneumonia
* Respiratory hypersensitivity
* Allergic bronchopulmonary aspergillosis
* Hamman-Rich syndrome
* Idiopathic pulmonary fibrosis
* Sarcoidosis
* Vaping-associated pulmonary injury
Obstructive / Restrictive
Pneumonia/
pneumonitis
By pathogen
* Viral
* Bacterial
* Pneumococcal
* Klebsiella
* Atypical bacterial
* Mycoplasma
* Legionnaires' disease
* Chlamydiae
* Fungal
* Pneumocystis
* Parasitic
* noninfectious
* Chemical/Mendelson's syndrome
* Aspiration/Lipid
By vector/route
* Community-acquired
* Healthcare-associated
* Hospital-acquired
By distribution
* Broncho-
* Lobar
IIP
* UIP
* DIP
* BOOP-COP
* NSIP
* RB
Other
* Atelectasis
* circulatory
* Pulmonary hypertension
* Pulmonary embolism
* Lung abscess
Pleural cavity/
mediastinum
Pleural disease
* Pleuritis/pleurisy
* Pneumothorax/Hemopneumothorax
Pleural effusion
Hemothorax
Hydrothorax
Chylothorax
Empyema/pyothorax
Malignant
Fibrothorax
Mediastinal disease
* Mediastinitis
* Mediastinal emphysema
Other/general
* Respiratory failure
* Influenza
* Common cold
* SARS
* Coronavirus disease 2019
* Idiopathic pulmonary haemosiderosis
* Pulmonary alveolar proteinosis
* v
* t
* e
Common cold
Viruses
* Adenovirus
* Coronavirus
* Enterovirus
* Rhinovirus
Symptoms
* Cough
* Fatigue
* Fever
* Headache
* Loss of appetite
* Malaise
* Muscle aches
* Nasal congestion
* Rhinorrhea
* Sneezing
* Sore throat
* Weakness
Complications
* Acute bronchitis
* Bronchiolitis
* Croup
* Otitis media
* Pharyngitis
* Pneumonia
* Sinusitis
* Strep throat
Drugs
* Antiviral drugs
* Pleconaril (experimental)
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Acute bronchitis
|
c0149514
| 8,551 |
wikipedia
|
https://en.wikipedia.org/wiki/Acute_bronchitis
| 2021-01-18T18:56:50 |
{"icd-9": ["466"], "icd-10": ["J21", "J20"], "wikidata": ["Q1900400"]}
|
Erythromelalgia (EM) is a rare condition characterized by episodes of burning pain, warmth, swelling and redness in parts of the body, particularly the hands and feet. This condition may occur spontaneously (primary EM) or secondary to neurological diseases, autoimmune diseases, or myeloproliferative disorders (secondary EM). Episodes may be triggered by increased body temperature, alcohol, and eating spicy foods. About 15% of cases are caused by mutations in the SCN9A gene and are inherited in an autosomal dominant manner. Other cases may be caused by unidentified genes or by non-genetic factors. Treatment depends on the underlying cause and may include topical and/or oral medications. In some cases, the condition goes away without treatment.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Erythromelalgia
|
c0014805
| 8,552 |
gard
|
https://rarediseases.info.nih.gov/diseases/6377/erythromelalgia
| 2021-01-18T18:00:39 |
{"mesh": ["D004916"], "omim": ["133020"], "orphanet": ["90026"], "synonyms": ["Primary erythermalgia", "Mitchell disease (formerly)", "Primary erythromelalgia"]}
|
A rare acquired skin disease characterized by a benign, etiologically variable lymphoproliferative process of the skin mimicking cutaneous lymphoma clinically and/or histologically, while not fulfilling criteria for the diagnosis of a specific disease. Depending on the predominant cell type in the infiltrate, T- and B-cell pseudolymphomas can be distinguished.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Cutaneous pseudolymphoma
|
c0311220
| 8,553 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=451607
| 2021-01-23T16:55:20 |
{"umls": ["C0311220"], "icd-10": ["L98.6"]}
|
Generalized peeling skin syndrome (PSS) is a form of PSS (see this term) presenting with a generalized distribution. It comprises two sub-types: the non-inflammatory (PSS type A) and the inflammatory (PSS type B) form (see these terms). PSS type A is characterized by generalized white scaling with superficial peeling of the skin, while PSS type B is characterized by superficial patchy peeling of the entire skin with underlying erythroderma, associated with pruritus, and atopy.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Generalized peeling skin syndrome
|
c1849193
| 8,554 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=263543
| 2021-01-23T18:54:44 |
{"gard": ["12862"], "mesh": ["C564818"], "omim": ["270300", "616265"], "icd-10": ["Q80.8"], "synonyms": ["Generalized PSS", "Generalized deciduous skin"]}
|
Adams-Oliver syndrome (AOS) is a rare disease characterized by an abnormality of skin development (areas of missing skin on the scalp called aplasia cutis congenita) and malformations of the hands and feet (terminal transverse limbs defects). The aplasia cutis may involve only the skin or include the skull under the skin. The terminal transverse limb defects may include webbed fingers or toes (syndactyly) and short or missing fingers or toes (brachydactyly or oligodactyly, respectively). Other signs and symptoms may include additional skeletal abnormalities of the limbs; cutis marmorata telangiectatica congenita (a blood vessel disorder); pulmonary hypertension; heart defects; and neurological problems. Severity can vary greatly among people with the syndrome and may be lethal in some cases. AOS is caused by mutations in any of six known genes. It may be inherited in an autosomal dominant or autosomal recessive manner, depending on the genetic cause. In some cases, the genetic cause is unknown. Treatment depends on the severity and specific features in each person, and often involves a team of specialists.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Adams-Oliver syndrome
|
c0265268
| 8,555 |
gard
|
https://rarediseases.info.nih.gov/diseases/5739/adams-oliver-syndrome
| 2021-01-18T18:02:17 |
{"omim": ["100300"], "umls": ["C0265268"], "orphanet": ["974"], "synonyms": ["Limb scalp and skull defects", "AOS", "Congenital scalp defects with distal limb anomalies", "Congenital scalp defects with distal limb reduction anomalies", "Limb, scalp and skull defects", "Adams Oliver syndrome"]}
|
Mesoamerican nephropathy
Other namesCreatinina
SpecialtyNephrology
Mesoamerican nephropathy (MeN) is a currently unexplained epidemic of chronic kidney disease of unknown origin (CKDu),[1] prevalent in the Pacific Ocean coastal low lands of the Mesoamerican region, including southern Mexico, Guatemala, El Salvador, Nicaragua, Honduras and Costa Rica. In rural areas of Nicaragua the disease is colloquially called creatinina.[2]
This CKD epidemic in Central America spans along a nearly 1000 kilometer stretch of the Pacific coast. In El Salvador and Nicaragua alone, the reported number of men dying from this painful disease has risen five-fold in the last 20 years, although some researchers believe hidden cases have always been there and this increment in official data could be partially due to the recent increase in reports and improved case search, pushed by the growing social and political interest in the disease. In El Salvador, the disease has become the second leading cause of death among adult men, and according to a recent editorial,[3] it has been estimated that this largely unknown epidemic has caused the premature death of at least 20,000 men in the region.[4] Science Magazine reports: "In El Salvador alone, PAHO's latest figures say CKD of all causes kills at least 2,500 people in the country each year".[5][6]
The people affected by the epidemic are mainly young and middle-aged male laborers in the agricultural sector,[7][8] particularly sugarcane workers.[9][10] The disease has also been found to be prevalent in other occupations with a high risk of heat stress, implying strenuous work (miners, construction, port and transportation workers)[9][10][11][12][13] in the high temperatures of the coastlands. The epidemic appears to affect particular Pacific coastal regions of Nicaragua,[9][11][13] El Salvador,[7][10][14] Costa Rica,[15][16] and Guatemala.
## Contents
* 1 Causes
* 1.1 Multifactorial disease
* 1.2 Alcoholism and self-medication
* 1.3 Clinical manifestations
* 1.4 Heatstress and dehydration
* 1.5 Agrochemicals
* 2 Diagnosis
* 2.1 Summary of current scientific evidence
* 3 History
* 4 See also
* 5 References
## Causes[edit]
The cause of MeN is unclear, but it is certainly not explained by conventional causes such as diabetes mellitus or hypertension.[1][7] The cause of MeN is uncertain but many risk factors have been proposed, including repeated episodes of heat stress, dehydration, and long hours of work labor. [17]
### Multifactorial disease[edit]
The above-mentioned declaration produced by the April 2013 International Conference which took place in San Salvador said that:[citation needed]
“While there is consensus that this is a multifactorial disease, some of the main factors include exposure to agrochemicals, either through direct prolonged exposure over time or through residual long-standing contamination of the soil, water sources, and crops, compounded by difficult working conditions; exposure to high temperatures; and insufficient water intake, among others factors.”
The nature of multifactorial problems is, that the observed disease can be caused from regionally different sets of risk factors, e.g. agrochemicals and heavy metals are ubiquitous in endemic and non-endemic areas, feature proteinuria, or have not been related previously to CKD but only to acute kidney injury. Mesoamerican volcanic soils, for instance, are rich in arsenic and cadmium (e.g. CKDu miners).
### Alcoholism and self-medication[edit]
Alcoholism and self-medication are also common features in these populations. NSAIDs self-prescription is particularly widespread,[18][19] possibly due to frequent agricultural work posture-related pains, and dysuria is commonly treated with aminoglycosides, often not related to urinary tract infections but perhaps associated with dehydration itself.[18]
### Clinical manifestations[edit]
Clinical manifestations,[10][14][20][21][22] and biopsy findings[21][23] suggest MeN could be a new form of CKD, a new pathologic entity related to repeated heat stress, dehydration, salt depletion, and possibly other contributing factors, like NSAIDs abuse.[1][3][4][12][20][21][24][25][26][27][28][29][30][31][excessive citations] A recent study[32] with Wild-type mice exposed to recurrent dehydration induced by heat stress produced a similar pattern of kidney injury, thus providing a potential mechanism for MeN, by activation of the polyol pathway, via metabolism by fructokinase, resulting in generation of endogenous fructose and uric acid in the kidney that subsequently induces renal injury.[citation needed]
### Heatstress and dehydration[edit]
The same position supported by the authors of one study developed in El Salvador,[19] but the El Salvadoran study did not find an increased odds ratio for CKD in people exposed to agrochemical products, or direct evidence linking it to pesticides. Other studies from Sri Lanka have showed that chronic exposure of people in agrochemically laden fields to low levels of cadmium through the food chain and also to pesticides could be responsible for significantly higher urinary excretion of cadmium in individuals with CKDu,[33] but urinary cadmium excretion is increased in all forms of CKD, and cadmium nephropathy is highly proteinuric while MeN is not. Based on that hypothetical possibility, Sri Lanka has banned many of these chemicals, and El Salvador has similar legislation pending,[34] waiting for direct evidence linking the disease to the use of agrochemicals in the Mesoamerican region. A large (nearly 38,000 workers, 5 year follow up) prospective study from Thailand in 2012[35] found a 5-fold increased risk (adjusted odds ratio) for CKD in heat stress exposed workers with physical jobs, so the disease could be more prevalent around the globe than first thought, and needs a closer look. The heat stress hypothesis needs to be more deeply considered and examined.[citation needed]
Published evidence in 2016 suggest heat stress and strenuous activity-induced cyclic uricosuria and crystalluria as a possible mechanism for the tubular lesion.[20][24][25]
### Agrochemicals[edit]
A relationship between CKDu and people working in agriculture can be found in El Salvador in areas with high pesticide use.[36] The study did not find a direct cause for the etiology, but nephrotoxic environmental factors cannot be ruled out. In a rural area in Sri Lanca a possible association between CKD and a long term low- level exposure to OP pesticides was detected.[37] In a Latin American country high creatinine levels of workers can likely be attributed to the use of the nematicide DBCP.[38] Also a relationship between increased blood levels of certain organochlorine pesticides and the occurrence of chronic kidney disease was observed in India.[39] In Nicaragua a non significant relation between pesticide use and the occurrence of CKDu was observed. The occurrence of CKDu was higher in person groups exposed to pesticides than in the control group.[40]
The import and production of agrochemicals can be quantified. In addition to the amount of agrochemicals the workflow in which agrochemicals are applied are relevant for the exposure of workers to agrochemical (application with tractor or manual work or application of self-protection measures). CKDu has not been reported among workers laboring under supposedly similar heat stress in other tropical areas of the world, such as Brazil, Cuba or Jamaica, where the same pesticides may not have been used in the same fashion or quantities as in Mesoamerica. However, heat stress measurements have not been assessed in these countries and cannot be compared, and CKD cases could be underreported, just like in the Mesoamerican region before the first description of the disease back in 2002. In any case, there are important differences between these Caribbean and Atlantic countries and the Mesoamerican Pacific coastlands, differences including[citation needed]
* level of agroindustrial mechanization,
* working conditions (access to drinking water and rest in shady spots),
* easy access to NSAIDs without prescription,
* and healthcare accessibility, and
* marked ethnic differences - because the Mesoamerican Pacific Ocean coastland has little or no black ethnicity influence, being mainly Native American "mestizos".
A large (nearly 38,000 workers, 5 year follow up) prospective study of occupational heat stress and Kidney Disease from Thailand in 2012[35] found a 5-fold increased risk (adjusted odds ratio) for CKD in heat stress exposed workers with physical jobs, so the disease could be more prevalent around the globe than first thought, and needs a closer look. The heat stress hypothesis needs to be more deeply considered and examined as contributing risk factor.[citation needed]
## Diagnosis[edit]
A comprehensive review of the disease and its characteristics was published in the American Journal of Kidney Diseases in January 2014, describing it as "a medical enigma yet to be solved".[1]
MeN is silent during initial stages but appears to progress quite fast to end-stage renal disease; it is mainly prevalent in young and middle aged men, with rates varying from 1:3 to 1:10 when compared to women,[7][9][10] and has not been described in children. Only dysuria has been reported as an occasional early symptom of the disease.
The disease is only prevalent in the Pacific Ocean's coastal lowlands, absent from coffee plantations at higher grounds.[10][41] Also, agricultural communities located at sea level in the coastlands have an 8 to 10 times greater risk (odds ratio) for presenting the disease, when compared to other agricultural communities working the same type of crops, but located at higher altitudes, away from the coastal low lands.[10][14][20]
Clinically, MeN presents as a tubular-interstitial disease: patients have low-range or no proteinuria,[9][10][11][13][14] electrolyte abnormalities -mainly low serum potassium and sodium-, and high levels of uric acid, but no hypertension.[7][10][14][21][20][42] Also, many patients show uricosuria, and urate crystals are seen on fresh urine samples.[20][24]
Histopathological findings of the disease include tubular atrophy, interstitial fibrosis, and global glomerulosclerosis, a curious finding considering the absence of important proteinuria.[21][23]
### Summary of current scientific evidence[edit]
To date, CKDu (MeN) causes remain undetermined and debatable; nevertheless the number of cases could lead to the application of a precautionary principles from a humanitarian perspective. Due to the fact that the Mesoamerican nephropathy is regarded as a multifactorial disease the experimental design of comparative study should take following logical setting into account. Multifactorial problem. Assume that a disease is definitely caused by A, B, C and this example has no irrelevant risk factor for the disease. The disease will develop if at least 2 risk factors are present in a certain region.[citation needed]
* ∅ {\displaystyle \emptyset } no prevalence of disease in region 1
* A no prevalence of disease in region 2
* B no prevalence of disease in region 3
* C no prevalence of disease in region 4
* A, B prevalence of disease in region 5
* B, C prevalence of disease in region 6
* C, A prevalence of disease in region 7
* A, B, C prevalence of disease in region 8
Removing the risk factor A in the experimental group in comparison to control group will lead to changes in the outbreak of the disease in only 2 of 8 combinatorically possible regions, even if we define A as a relevant risk factor in this theoretical setting. The same is true if the experimental design adds in a comparative study the risk factor A to the regions in the experimental group in comparison to the control group. Because of the nature of a multifactorial disease, a single factor experimental design (e.g. "C") for one of the mentioned risk factors A, B and C will create a systematic underestimation of the risk for a single risk factor (e.g. "C") in this deterministic setting with relevant risk factors A, B and C only. Therefore the exclusion of a risk factor (e.g. "C") by not finding the evidence in the single factor experimental design cannot be performed even in a non-deterministic setting with uncertainties and irrelevant risk factors for the considered disease.[citation needed]
If the difference in experimental and control are 2 risk factors (adding or removing two risk factor e.g. A, B in the control group), then 4 regions will show a differences in prevalence of the disease, with the disadvantage that the experimental design cannot clarify if one or both risk factors A and B are contributing to the progression and prevalence of the disease. The precautionary principles could lead to risk mitigation strategies for risk factor A and B until the etiology is clarified.[citation needed]
Beside this logical analysis of a multifactorial setting there is space for further investigation, e.g.: Leptospirosis has been suggested as a possible contributing factor[1][43][44] and oceanic nephrotoxic algae.
Risk factors associated with agents need evidence for the nephrotoxicity of the agent and evidence for the exposure assessment of a cohort to the risk factor. Assessment of the mentioned risk factors and their possible synergism will depend on more and better research.[citation needed]
## History[edit]
The real timeline of the disease is unknown since most of the aforementioned countries did not have or still lack renal disease registries, and the affected regions are mainly poor farm lands. Nicaraguan health authorities have commented that they have been noting an increase of CKD cases in the Pacific Ocean coastal regions since the 80s, but it was not until 2002 that a scientific paper from an El Salvadoran reference hospital[7] first communicated and described the existence of an important group of CKDu patients with a particular epidemiological pattern. In January 2005, a second scientific paper,[14] also from El Salvador, reported some field efforts on trying to identify the cause of the disease, and confirmed its curious epidemiological pattern.
In April 2013, a high-level meeting with regional health ministries, nongovernmental organizations, aid agencies, clinical specialists and researchers was held in San Salvador city, El Salvador, leading the Panamerican Health Organization (PAHO) to finally declare CKDu "a pressing and extremely serious health problem in the region". The Declaration described CKD as having “catastrophic effects associated with toxic-environmental and occupational factors, dehydration and behaviors harmful to renal health". In it, the Ministers of Health of the Central American Integration System [SICA, the Spanish acronym] declared their commitment to address CKDu comprehensively and to “strengthening scientific research in the framework of the prevention and control of chronic non-communicable diseases.”[45] This Declaration was subsequently endorsed by PAHO through the Resolution CD52.R1, adopted during the 52nd Directing Council, 65th Session of the Regional Committee of WHO for the Americas, in October 2013.[46]
In November 2015, a second CENCAM workshop was held in San Jose, Costa Rica. A statement and a report are under the works.[citation needed]
## See also[edit]
* Precautionary Principle
## References[edit]
1. ^ a b c d e Correa-Rotter R, Wesseling C, Johnson RJ (March 2014). "CKD of unknown origin in Central America: the case for a Mesoamerican nephropathy". Am J Kidney Dis. 63 (3): 506–20. doi:10.1053/j.ajkd.2013.10.062. PMC 7115712. PMID 24412050.
2. ^ Landau, Elizabeth (June 11, 2014). "Mysterious kidney disease plagues Central America". CNN. Retrieved 13 June 2014.
3. ^ a b Wesseling C, Crowe J, Hogstedt C, Jakobsson K, Lucas R, Wegman DH (November 2013). "The epidemic of chronic kidney disease of unknown etiology in Mesoamerica: a call for interdisciplinary research and action". Am J Public Health. 103 (11): 1927–30. doi:10.2105/AJPH.2013.301594. PMC 3828726. PMID 24028232.
4. ^ a b Ramirez-Rubio O, McClean MD, Amador JJ, Brooks DR (January 2013). "An epidemic of chronic kidney disease in Central America: an overview". J Epidemiol Community Health. 67 (1): 1–3. doi:10.1136/jech-2012-201141. PMID 23002432.
5. ^ Cohen, J. (April 2014). "Mesoamerica's Mystery Killer". Science. 344 (6180): 143–47. doi:10.1126/science.344.6180.143. PMID 24723592.
6. ^ Phelan M, Linton M (April 2014). "Science Magazine: Researchers Hunt Origin of an Enigmatic Kidney Disease". Cite journal requires `|journal=` (help)
7. ^ a b c d e f García-Trabanino R, Aguilar R, Reyes Silva C, Ortiz Mercado M, Leiva Merino R (September 2002). "[End-stage renal disease among patients in a referral hospital in El Salvador]". Rev Panam Salud Publica. 12 (3): 202–06. doi:10.1590/s1020-49892002000900009. PMID 12396639.
8. ^ Sanoff SL, Callejas L, Alonso CD, Hu Y, Colindres RE, Chin H, Morgan DR, Hogan SL (2010). "Positive association of renal insufficiency with agriculture employment and unregulated alcohol consumption in Nicaragua". Ren Fail. 32 (7): 766–77. doi:10.3109/0886022X.2010.494333. PMC 3699859. PMID 20662688.
9. ^ a b c d e Torres C, Aragón A, González M, López I, Jakobsson K, Elinder CG, Lundberg I, Wesseling C (March 2010). "Decreased kidney function of unknown cause in Nicaragua: a community-based survey". Am J Kidney Dis. 55 (3): 485–96. doi:10.1053/j.ajkd.2009.12.012. PMID 20116154.
10. ^ a b c d e f g h i Peraza S, Wesseling C, Aragon A, Leiva R, Garcia-Trabanino R, Torres C, Jakobsson K, Elinder CG, Hogstedt C (April 2012). "Decreased kidney function among agricultural workers in El Salvador". Am J Kidney Dis. 59 (4): 531–40. doi:10.1053/j.ajkd.2011.11.039. PMID 22300650.
11. ^ a b c O'Donnell JK, Tobey M, Weiner DE, Stevens LA, Johnson S, Stringham P, Cohen B, Brooks DR (September 2011). "Prevalence of and risk factors for chronic kidney disease in rural Nicaragua". Nephrol Dial Transplant. 26 (9): 2798–805. doi:10.1093/ndt/gfq385. PMC 4592358. PMID 20615905.
12. ^ a b Brooks DR, Ramirez-Rubio O, Amador JJ (April 2012). "CKD in Central America: a hot issue". Am J Kidney Dis. 59 (4): 481–84. doi:10.1053/j.ajkd.2012.01.005. PMID 22444491.
13. ^ a b c McClean MD, Amador J, Laws R, et al. (2012). "Biological sampling report: Investigating biomarkers of kidney injury and chronic kidney disease among workers in Western Nicaragua" (PDF). Cite journal requires `|journal=` (help)
14. ^ a b c d e f García-Trabanino R, Domínguez J, Jansà JM, Oliver A (January 2005). "[Proteinuria and chronic renal failure in the coast of El Salvador: detection with low cost methods and associated factors]". Nefrologia. 25 (1): 31–8. PMID 15789534.
15. ^ Cerdas M. (August 2005). "Chronic kidney disease in Costa Rica". Kidney Int Suppl. 97 (S): 31–35. doi:10.1111/j.1523-1755.2005.09705.x. PMID 16014096.
16. ^ Wesseling C. (June 2014). "Mesoamerican nephropathy in Costa Rica: Geographical distribution and time trends of chronic kidney disease mortality between 1970 and 2012" (PDF). Occup Environ Med. 72 (10): 714–21. doi:10.1136/oemed-2014-102799. PMID 26199395.
17. ^ Peraza, S., et al.(2012). Decreased Kidney Function Among Agricultural Workers in El Salvador. American Journal of Kidney Diseases, DOI: 10.1053/j.ajkd.2011.11.039
18. ^ a b Ramirez-Rubio O, Brooks DR, Amador JJ, Kaufman JS, Weiner DE, Scammell MK (April 2013). "Chronic kidney disease in Nicaragua: a qualitative analysis of semi-structured interviews with physicians and pharmacists". BMC Public Health. 13 (1): 350. doi:10.1186/1471-2458-13-350. PMC 3637184. PMID 23590528.
19. ^ a b Orantes CM, Herrera R, Almaguer M, et al. (October 2011). "Chronic kidney disease and associated risk factors in the Bajo Lempa region of El Salvador: Nefrolempa study, 2009" (PDF). MEDICC Rev. 13 (4): 14–22. PMID 22143603.
20. ^ a b c d e f García-Trabanino R, Jarquín E, Wesseling C, Johnson RJ, González-Quiroz M, Weiss I, Glaser J, Vindell JJ, Stockfelt L, Roncal C, Harra T, Barregard L (October 2015). "Heat stress, dehydration, and kidney function in sugarcane cutters in El Salvador – a cross-shift study of workers at risk of Mesoamerican nephropathy". Environ Res. 142 (1): 746–55. Bibcode:2015ER....142..746G. doi:10.1016/j.envres.2015.07.007. PMID 26209462.
21. ^ a b c d e Wijkström J, Leiva R, Elinder CG, Leiva S, Trujillo Z, Trujillo L, Söderberg M, Hultenby K, Wernerson A (November 2013). "Clinical and Pathological Characterization of Mesoamerican Nephropathy: A New Kidney Disease in Central America". Am J Kidney Dis. 62 (5): 908–18. doi:10.1053/j.ajkd.2013.05.019. PMID 23850447.
22. ^ Trujillo L, Cruz Z, Leiva R, Lazo S, Cruz V. Clinical characteristics and 3 year follow-up of patient with chronic kidney disease who live in Santa Clara sugarcane cooperative, department of La Paz, El Salvador. In: Wesseling C, Crowe J, Hogstedt C, Jakobsson K, Lucas R, Wegman D, eds. Mesoamerican Nephropathy: Report From the First International Research Workshop on MeN. Heredia, Costa Rica: SALTRA/IRET-UNA; 2013:209–10. http://www.saltra.una.ac.cr/index.php/sst-vol-10. Accessed April 13, 2014.
23. ^ a b Lopez-Marin L, Chavez Y, Garcia XA, Flores WM, Garcia YM, Herrera R, Almaguer M, Orantes CM, Calero D, Bayarre HD, Amaya JC, Magana S, Espinoza PA, Serpas L (April 2014). "Histopathology of chronic kidney disease of unknown etiology in Salvadoran agricultural communities". MEDICC Rev. 16 (2): 49–54. PMID 24878649.
24. ^ a b c Roncal-Jimenez C, García-Trabanino R, Barregard L, Lanaspa MA, Wesseling C, Harra T, Aragon A, Grases F, Jarquin ER, González MA, Weiss I, Glaser J, Sánchez-Lozada LG, Johnson RJ (January 2016). "Heat Stress Nephropathy From Exercise-Induced Uric Acid Crystalluria: A Perspective on Mesoamerican Nephropathy". Am J Kidney Dis. 67 (1): 20–30. doi:10.1053/j.ajkd.2015.08.021. PMID 26455995.
25. ^ a b Roncal-Jimenez CA, García-Trabanino R, Wesseling C, Johnson RJ (January 2016). "Mesoamerican Nephropathy or Global Warming Nephropathy?". Blood Purif. 41 (1–3): 135–38. doi:10.1159/000441265. PMID 26766409.
26. ^ Tangri N (29 July 2013). "MesoAmerican Nephropathy: A New Entity". eAJKD. National Kidney Foundation.
27. ^ Johnson RJ, Sánchez-Lozada LG (October 2013). "Chronic kidney disease: Mesoamerican nephropathy – new clues to the cause". Nat Rev Nephrol. 9 (10): 560–61. doi:10.1038/nrneph.2013.174. PMID 23999393.
28. ^ Wesseling C, Crowe J, Hogstedt C, Jakobsson K, Lucas R, Wegman DH; on behalf of the participants of the First International Research Workshop on the Mesoamerican Nephropathy. (March 2014). "Resolving the Enigma of the Mesoamerican Nephropathy: A Research Workshop Summary". Am J Kidney Dis. 63 (3): 396–404. doi:10.1053/j.ajkd.2013.08.014. PMID 24140367.CS1 maint: multiple names: authors list (link)
29. ^ Weiner DE, McClean MD, Kaufman JS, Brooks DR (March 2013). "The Central American Epidemic of CKD". Clin J Am Soc Nephrol. 8 (3): 504–11. doi:10.2215/CJN.05050512. PMID 23099656.
30. ^ Wernerson A, Wijkström J, Elinder CG (May 2014). "Update on endemic nephropathies". Curr Opin Nephrol Hypertens. 23 (3): 232–38. doi:10.1097/01.mnh.0000444911.32794.e7. PMID 24717833.
31. ^ Lucas RA, Bodin T, García-Trabanino R, Wesseling C, Glaser J, Weiss I, Jarquin E, Jakobsson K, Wegman DH (2015). "Heat stress and workload associated with sugarcane cutting – an excessively strenuous occupation!". Extrem Physiol Med. 4 (Suppl 1): A23. doi:10.1186/2046-7648-4-S1-A23. PMC 4580831.
32. ^ Roncal Jimenez CA, Ishimoto T, Lanaspa MA, Rivard CJ, Nakagawa T, Ejaz AA, Cicerchi C, Inaba S, Le M, Miyazaki M, Glaser J, Correa-Rotter R, González MA, Aragón A, Wesseling C, Sánchez-Lozada LG, Johnson RJ (December 2013). "Fructokinase activity mediates dehydration-induced renal injury". Kidney Int. 86 (2): 294–302. doi:10.1038/ki.2013.492. PMC 4120672. PMID 24336030.
33. ^ Jayatilake, Nihal; Mendis, Shanthi; Maheepala, Palitha; Mehta, Firdosi R (2013). "Chronic kidney disease of uncertain aetiology: prevalence and causative factors in a developing country". BMC Nephrology. 14 (1): 180. doi:10.1186/1471-2369-14-180. PMC 3765913. PMID 23981540.
34. ^ Sasha Chavkin (11 April 2014). "Herbicide ban on hold in Sri Lanka, as source of deadly kidney disease remains elusive". The Center for Public Integrity. Retrieved 3 September 2014.
35. ^ a b Benjawan Tawatsupa, Lynette L-Y Lim, Tord Kjellstrom, Sam-ang Seubsman, Adrian Sleigh, and the Thai Cohort Study Team (May 2012). "Association Between Occupational Heat Stress and Kidney Disease Among 37 816 Workers in the Thai Cohort Study (TCS)". J Epidemiol. 22 (3): 251–60. doi:10.2188/jea.JE20110082. PMC 3798627. PMID 22343327.CS1 maint: multiple names: authors list (link)
36. ^ Orantes, C. M., Herrera, R., Almaguer, M., Brizuela, E. G., Hernández, C. E., Bayarre, H., ... & Velázquez, M. E. (2011). Chronic kidney disease and associated risk factors in the Bajo Lempa region of El Salvador: Nefrolempa study, 2009. MEDICC review, 13, 14-22.
37. ^ Peiris-John, R., Wanigasuriya, J. K. P., Wickremasinghe, A. R., Dissanayake, W. P., & Hittarage, A. (2006). Exposure to acetylcholinesterase-inhibiting pesticides and chronic renal failure.
38. ^ Yearout, R., Game, X., Krumpe, K., & McKenzie, C. (2008). Impacts of DBCP on participants in the agricultural industry in a third world nation (an industrial health, safety case study of a village at risk). International Journal of Industrial Ergonomics, 38(2), 127-134.
39. ^ Ghosh, R., Siddarth, M., Singh, N., Tyagi, V., Kare, P. K., Banerjee, B. D., ... & Tripathi, A. K. (2017). Organochlorine pesticide level in patients with chronic kidney disease of unknown etiology and its association with renal function. Environmental health and preventive medicine, 22(1), 49.
40. ^ Sanoff, S. L., Callejas, L., Alonso, C. D., Hu, Y., Colindres, R. E., Chin, H., ... & Hogan, S. L. (2010). Positive association of renal insufficiency with agriculture employment and unregulated alcohol consumption in Nicaragua. Renal failure, 32(7), 766-777.
41. ^ Laux TS, Bert PJ, Barreto Ruiz GM, González M, Unruh M, Aragon A, Torres Lacourt C (July 2012). "Nicaragua revisited: evidence of lower prevalence of chronic kidney disease in a high-altitude, coffee-growing village". J Nephrol. 25 (4): 533–40. doi:10.5301/jn.5000028. PMC 4405255. PMID 21956767.
42. ^ Herrera R, Orantes CM, Almaguer M, Alfonso P, Bayarre HD, Leiva IM, Smith MJ, Cubias RA, Torres CG, Almendarez WO, Cubias FR, Morales FE, Magana S, Amaya JC, Perdomo E, Ventura MC, Villatoro JF, Vela XF, Zelaya SM, Granados DV, Vela E, Orellana P, Hevia R, Fuentes EJ, Manalich R, Bacallao R, Ugarte M, Arias MI, Chavez J, Flores NE, Aparicio CE (April 2014). "Clinical characteristics of chronic kidney disease of nontraditional causes in Salvadoran farming communities". MEDICC Rev. 16 (1): 39–48. PMID 24878648.
43. ^ Yang HY, Hung CC, Liu SH, Guo YG, Chen YC, Ko YC, Huang CT, Chou LF, Tian YC, Chang MY, Hsu HH, Lin MY, Hwang SJ, Yang CW (October 2015). "Overlooked Risk for Chronic Kidney Disease after Leptospiral Infection: A Population-Based Survey and Epidemiological Cohort Evidence". PLOS Neglected Tropical Diseases. 9 (10): e0004105. doi:10.1371/journal.pntd.0004105. PMC 4599860. PMID 26452161.
44. ^ Murray KO, Fischer RS, Chavarria D, Duttmann C, Garcia MN, Gorchakov R, Hotez PJ, Jiron W, Leibler JH, Lopez JE, Mandayam S, Marin A, Sheleby J (October 2015). "Mesoamerican nephropathy: a neglected tropical disease with an infectious etiology?". Microbes and Infection. 17 (10): 671–75. doi:10.1016/j.micinf.2015.08.005. PMID 26320026.
45. ^ Declaración de San Salvador. Abordaje integral de la enfermedad renal túbulo-intersticial crónica de Centroamérica (ERTCC) que afecta predominantemente a las comunidades agrícolas. Available in: "Archived copy" (PDF). Archived from the original (PDF) on 2013-09-19. Retrieved 2014-04-04.CS1 maint: archived copy as title (link) Accessed March 2, 2014.
46. ^ Pan American Health Organization. Resolution CD52.R1. Chronic kidney disease in agricultural communities in Central America. Washington, DC. 2013. Available at: http://www.paho.org/hq/index.php?option=com_content&view=article&id=8833&Itemid=40033&lang=en Accessed June 13, 2013
* v
* t
* e
Kidney disease
Glomerular disease
* See Template:Glomerular disease
Tubules
* Renal tubular acidosis
* proximal
* distal
* Acute tubular necrosis
* Genetic
* Fanconi syndrome
* Bartter syndrome
* Gitelman syndrome
* Liddle's syndrome
Interstitium
* Interstitial nephritis
* Pyelonephritis
* Balkan endemic nephropathy
Vascular
* Renal artery stenosis
* Renal ischemia
* Hypertensive nephropathy
* Renovascular hypertension
* Renal cortical necrosis
General syndromes
* Nephritis
* Nephrosis
* Renal failure
* Acute renal failure
* Chronic kidney disease
* Uremia
Other
* Analgesic nephropathy
* Renal osteodystrophy
* Nephroptosis
* Abderhalden–Kaufmann–Lignac syndrome
* Diabetes insipidus
* Nephrogenic
* Renal papilla
* Renal papillary necrosis
* Major calyx/pelvis
* Hydronephrosis
* Pyonephrosis
* Reflux nephropathy
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Mesoamerican nephropathy
|
None
| 8,556 |
wikipedia
|
https://en.wikipedia.org/wiki/Mesoamerican_nephropathy
| 2021-01-18T19:07:06 |
{"wikidata": ["Q17163917"]}
|
Levin et al. (1973) described monozygotic female twins with a syndrome of hypoplasia or interruption of the transverse aortic arch, facial weakness involving particularly the depressor anguli oris, and bilateral retinal coloboma. Marden and Venters (1966) described macular coloboma and coarctation of the aorta in a single patient who also had the linear nevus sebaceous syndrome. Whether this is a genuine syndrome and, if so, whether it is mendelian is not clear.
Cardiac \- Hypoplastic/atretic transverse aortic arch \- Coarctation of aorta Eyes \- Bilateral retinal coloboma \- Macular coloboma Inheritance \- ? Autosomal dominant Neuro \- Facial weakness, esp. depressor anguli oris Skin \- Linear nevus sebaceous syndrome ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
AORTIC ARCH INTERRUPTION, FACIAL PALSY, AND RETINAL COLOBOMA
|
c1862681
| 8,557 |
omim
|
https://www.omim.org/entry/107550
| 2019-09-22T16:44:57 |
{"mesh": ["C566271"], "omim": ["107550"]}
|
A number sign (#) is used with this entry because of evidence that postaxial polydactyly type A7 (PAPA7) is caused by homozygous mutation in the IQCE gene (617631) on chromosome 7p22. One such family has been reported.
Description
PAPA7 is characterized by postaxial polydactyly restricted to the feet, with well-developed nails present on the extra digits and attachment of both the fifth and sixth toes to a broad 2-headed fifth metatarsal (Umair et al., 2017).
For a discussion of genetic heterogeneity of postaxial polydactyly, see 174200.
Clinical Features
Umair et al. (2017) studied a large consanguineous family of Pakistani origin in which 5 individuals in 2 sibships had postaxial polydactyly of the feet. Examination of 4 affected individuals showed well-developed nails in the extra toes, and radiography revealed that both the fifth and sixth toes were attached to a 2-headed thick broad fifth metatarsal. Phenotypic variability was observed among the patients, including unilateral involvement in 1 patient, brachymetatarsia of the fifth right toe in 1 patient, and bilateral cutaneous syndactyly of the second and third toes in 1 patient. In addition, x-rays showed radial varus deviation of the fourth and fifth toes bilaterally in 2 patients, whereas another patient had valgus deviation of the right fifth metatarsal with cubitus varus deviation of the right fifth and sixth toes.
Molecular Genetics
In a large consanguineous family of Pakistani origin segregating autosomal recessive postaxial polydactyly of the feet, Umair et al. (2017) performed whole-exome sequencing and identified a homozygous splice site variant in the IQCE gene (617631.0001) that segregated with disease.
INHERITANCE \- Autosomal recessive SKELETAL Feet \- Postaxial polydactyly, unilateral or bilateral \- Thick, broad, 2-headed fifth metatarsal \- Cutaneous 2-3 toe syndactyly (in 1 patient) \- Brachymetatarsia of fifth toe (in 1 patient) SKIN, NAILS, & HAIR Nails \- Well-developed nails in the extra toes MISCELLANEOUS \- Based on report of 1 family (last curated August 2017) \- Phenotypic variability among affected individuals in the family MOLECULAR BASIS \- Caused by mutation in the IQ domain-containing protein E gene (IQCE, 617631.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
POLYDACTYLY, POSTAXIAL, TYPE A7
|
c4539976
| 8,558 |
omim
|
https://www.omim.org/entry/617642
| 2019-09-22T15:45:17 |
{"omim": ["617642"]}
|
Nephrotoxicity is toxicity in the kidneys. It is a poisonous effect of some substances, both toxic chemicals and medications, on kidney function.[1] There are various forms,[2] and some drugs may affect kidney function in more than one way. Nephrotoxins are substances displaying nephrotoxicity.
Nephrotoxicity should not be confused with the fact that some medications are predominantly excreted by the kidneys and need their dose adjusted for the decreased kidney function (e.g., heparin, lithium).
The nephrotoxic effect of most drugs is more profound in patients already suffering from kidney failure.
## Contents
* 1 Types of toxicity
* 1.1 Cardiovascular
* 1.2 Direct tubular effect
* 1.3 Acute interstitial nephritis
* 1.4 Chronic interstitial nephritis
* 1.5 Acute glomerulonephritis
* 1.6 Causes of diabetes insipidus
* 1.7 Other nephrotoxins
* 2 Diagnosis
* 3 Etymology
* 4 See also
* 5 References
* 6 Further reading
## Types of toxicity[edit]
### Cardiovascular[edit]
* General: diuretics, β-blockers, vasodilator agents
* Local: ACE inhibitors, ciclosporin,[3] tacrolimus.[3]
### Direct tubular effect[edit]
* Proximal convoluted tubule: Aminoglycoside antibiotics (e.g., gentamicin), amphotericin B, cisplatin, radiocontrast media, immunoglobulins, mannitol
* Distal tubule: NSAIDs (e.g. aspirin, ibuprofen, diclofenac), ACE inhibitors, ciclosporin, lithium salts, cyclophosphamide, amphotericin B
* Tubular obstruction: sulphonamides, methotrexate, aciclovir, diethylene glycol, triamterene.
### Acute interstitial nephritis[edit]
Main article : Acute interstitial nephritis
* β-lactam antibiotics, vancomycin, rifampicin, sulphonamides, ciprofloxacin, NSAIDs, ranitidine, cimetidine, furosemide, thiazides, phenytoin.
### Chronic interstitial nephritis[edit]
* Lithium salts
* Ciclosporin[4]
### Acute glomerulonephritis[edit]
Drug-induced glomerular disease is not common but there are a few drugs that have been implicated. Glomerular lesions occur primarily through immune-mediated pathways rather than through direct drug toxicity.
* Heroin and Pamidronate are known to cause focal segmental glomerulosclerosis
* Gold salts therapy can cause membranous nephropathy[4]
* Penicillamine
### Causes of diabetes insipidus[edit]
* Lithium salts
* Amphotericin B—reversible at low doses, irreversible at high doses
* Fluoride
* Demeclocycline
* Foscarnet
### Other nephrotoxins[edit]
* Lead, mercury and cadmium salts[1]
* Aristolochic acid, found in some plants and in some herbal supplements derived from those plants, has been shown to have nephrotoxic effects on humans.
* Rhubarb contains some nephrotoxins which can cause inflammation of the kidneys in some people.
* Fumaric acid, aka food additive E297
* Orellanine
## Diagnosis[edit]
Nephrotoxicity is usually monitored through a simple blood test. A decreased creatinine clearance indicates poor kidney function. Normal creatinine level is between 80 - 120 μmol/L. In interventional radiology, a patient's creatinine clearance levels are all checked prior to a procedure.
Serum creatinine is another measure of kidney function, which may be more useful clinically when dealing with patients with early kidney disease.
## Etymology[edit]
The word nephrotoxicity (/ˌnɛfroʊtɒkˈsɪsɪti/) uses combining forms of nephro- \+ tox- \+ -icity, yielding "kidney poisoning".
## See also[edit]
* Contrast-induced nephropathy
* Toxicity
* Neurotoxicity
* Ototoxicity
* Onconephrology
## References[edit]
1. ^ a b Abyar, Selda; Khandar, Ali Akbar; Salehi, Roya; Abolfazl Hosseini-Yazdi, Seyed; Alizadeh, Effat; Mahkam, Mehrdad; Jamalpoor, Amer; White, Jonathan M.; Shojaei, Motahhareh; Aizpurua-Olaizola, O.; Masereeuw, Rosalinde (December 2019). "In vitro nephrotoxicity and anticancer potency of newly synthesized cadmium complexes". Scientific Reports. 9 (1): 14686. doi:10.1038/s41598-019-51109-9. ISSN 2045-2322. PMC 6789105. PMID 31604983.
2. ^ Galley HF (2000). "Can acute renal failure be prevented". J R Coll Surg Edinb. 45 (1): 44–50. PMID 10815380. Archived from the original on 2005-10-18.
3. ^ a b Naesens M, Kuypers DR, Sarwal M (2009). "Calcineurin inhibitor nephrotoxicity". Clin. J. Am. Soc. Nephrol. 4 (2): 481–509. doi:10.2215/CJN.04800908. PMID 19218475.
4. ^ a b USMLE WORLD QBanks 2009, Step1, Pharmacology, Q74
## Further reading[edit]
* Choudhury, Devasmita; Ahmed, Ziauddin (2006). "Drug-associated renal dysfunction and injury". Nature Clinical Practice Nephrology. 2 (2): 80–91. doi:10.1038/ncpneph0076. PMID 16932399. S2CID 42733127.
* Szeto, CC; Chow, KM (2005). "Nephrotoxicity related to new therapeutic compounds". Renal Failure. 27 (3): 329–33. doi:10.1081/jdi-56595. PMID 15957551. S2CID 6111262.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Nephrotoxicity
|
c0595916
| 8,559 |
wikipedia
|
https://en.wikipedia.org/wiki/Nephrotoxicity
| 2021-01-18T19:02:37 |
{"umls": ["C0595916"], "icd-10": ["N14"], "wikidata": ["Q1468324"]}
|
Papular xanthoma is a form of non-Langerhans cell histiocytosis characterized by cutaneous presentation of solitary or disseminated yellow to orange-brown papular or papulonodular, noncoalescent, asymptomatic skin lesions located predominantly on the head, neck, trunk and extremities (rarely on oral mucosa), in the presence of normolipidemia. Microscopically, the lesions consist of monomorphous infiltrate of xanthomatized macrophages and numerous Touton giant cells, with scant or absent inflammatory infiltrate. It is usually not associated with systemic disease.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Papular xanthoma
|
c4707373
| 8,560 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=158008
| 2021-01-23T17:59:17 |
{"icd-10": ["D76.3"]}
|
## Mapping
Eriksson et al. (2006) studied whether either of 2 polymorphisms in the promoter of the SHBG gene on chromosome 17p13, a (TAAAA)n microsatellite and the rs1799941 SNP, are associated with serum levels of SHBG, sex steroids, or bone mineral density (BMD) in men. In both cohorts, (TAAAA)n and rs1799941 genotypes were associated with serum levels of SHBG (P less than 0.001), dihydrotestosterone (P less than 0.05), and 5-alpha-androstane-3-alpha,17-beta-diol glucuronides (P less than 0.05). In the elderly men, they were also associated with testosterone and BMD at all hip bone sites. Eriksson et al. (2006) concluded that polymorphisms in the SHBG promoter predict serum levels of SHBG, androgens, and glucuronidated androgen metabolites, and hip BMD in men.
In the NCI-Breast and Prostate Cancer Cohort Consortium using 874 SNPs in 37 candidate genes in the sex steroid hormone pathway, Ahn et al. (2009) identified a G-A variant (rs1799941) located 67 bp upstream from the transcription start site of the SHBG gene as associated with increased mean circulating levels of SHBG in 4,720 Caucasian men (p = 4.52 x 10(-21); 26.9% increase in AA homozygotes vs wildtype homozygotes). The relationship between rs1799941 was consistent across the 5 cohorts in the study, age, BMI, and case-control status. Additionally, rs1799941 was also strongly associated with increased mean circulating levels of testosterone in 4,678 Caucasian men (p = 7.54 x 10(-15); 14.3% increase in AA homozygotes vs wildtype homozygotes). Since clearance and bioavailability of testosterone are related to SHBG levels, Ahn et al. (2009) used regression analysis to show that rs1799941 also tended to predict SHBG adjusted-testosterone levels (p = 1.33 x 10(-3)).
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
SEX HORMONE-BINDING GLOBULIN CIRCULATING LEVEL QUANTITATIVE TRAIT LOCUS
|
c3150748
| 8,561 |
omim
|
https://www.omim.org/entry/613498
| 2019-09-22T15:58:32 |
{"omim": ["613498"], "synonyms": ["Alternative titles", "TESTOSTERONE CIRCULATING LEVEL QUANTITATIVE TRAIT LOCUS, DUE TO SEX HORMONE-BINDING GLOBULIN"]}
|
A rare non-Langerhans cell histiocytosis characterized by rapid onset of crops of asymptomatic small red to brown papules, typically distributed symmetrically over the face, trunk, and proximal extremities, occasionally with mucous membrane involvement. The lesions resolve spontaneously without scarring after a variable time span and do not recur in most cases. Histopathology reveals diffuse, uniform dermal infiltration with non-xanthomatous histiocytes staining positive for CD68 and Ki-M1p. Multinucleate giant cells may occasionally be found.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Generalized eruptive histiocytosis
|
c0347404
| 8,562 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=157991
| 2021-01-23T18:54:19 |
{"icd-10": ["D76.3"], "synonyms": ["Generalized eruptive histiocytoma"]}
|
A sacrococcygeal teratoma is a tumor that grows at the base of the spine in a developing fetus. It occurs in one in 40,000 newborns and girls are four times more likely to be affected than boys. Though it is usually benign, there is a possibility that the teratoma could become malignant. As such, the recommended treatment of a teratoma is complete removal of the tumor by surgery, performed soon after the birth. If not all of the tumor is removed during the initial surgery, the teratoma may grow back (recur) and additional surgeries may be needed. Studies have found that sacrococcygeal teratomas recur in up to 22% of cases.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Sacrococcygeal Teratoma
|
c0559459
| 8,563 |
gard
|
https://rarediseases.info.nih.gov/diseases/319/sacrococcygeal-teratoma
| 2021-01-18T17:57:50 |
{"umls": ["C0559459"], "synonyms": []}
|
Cytochrome C oxidase deficiency (COX deficiency) is a condition that can affect several parts of the body including the skeletal muscles, heart, brain and liver. There are four types of COX deficiency differentiated by symptoms and age of onset: benign infantile mitochondrial type, French-Canadian type, infantile mitochondrial myopathy type, and Leigh syndrome. The range and severity of signs and symptoms can vary widely among affected individuals (even within the same subtype and same family) and depend on the form of the condition present. Features in mildly affected individuals may include muscle weakness and hypotonia; in more severely affected individuals, brain dysfunction; heart problems; an enlarged liver; lactic acidosis; and/or a specific group of features known as Leigh syndrome may also be present. COX deficiency is caused by mutations in any of at least 14 genes; the inheritance pattern depends on the gene involved. The condition is frequently fatal in childhood, but mildly affected individuals may survive into adolescence or adulthood.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Cytochrome c oxidase deficiency
|
c0268237
| 8,564 |
gard
|
https://rarediseases.info.nih.gov/diseases/48/cytochrome-c-oxidase-deficiency
| 2021-01-18T18:00:59 |
{"mesh": ["D030401"], "omim": ["220110"], "umls": ["C0268237"], "synonyms": ["Mitochondrial complex IV deficiency", "Complex 4 mitochondrial respiratory chain deficiency", "Deficiency of mitochondrial respiratory chain complex4", "COX deficiency", "Complex IV deficiency"]}
|
Congenital factor V deficiency is an inherited bleeding disorder due to reduced plasma levels of factor V (FV) and characterized by mild to severe bleeding symptoms.
## Epidemiology
Prevalence of homozygous forms is estimated at 1/1,000,000. Both sexes are equally affected.
## Clinical description
Congenital FV deficiency can manifest at any age, with the most severe forms manifesting early in life. Common clinical signs include epistaxis, bruising, mucosal bleeding, soft tissue bleeding, and hemarthrosis. Excessive and prolonged bleeding during or following surgery, delivery or trauma are frequent. Women may present with menorrhagia. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels.
## Etiology
Congenital FV deficiency is caused by mutations in the F5 gene (1q23) controlling the production of plasma FV.
## Diagnostic methods
Diagnosis is based on prolonged prothrombin and activated partial thromboplastin times (PT, aPTT) and on low FV levels measured using a PT based assay. The bleeding time (BT) may be prolonged. Molecular testing is available, but unnecessary for diagnosis.
## Differential diagnosis
Differential diagnoses include factor VIII deficiency, and combined deficiency of factor V and factor VIII (see these terms).
## Genetic counseling
Transmission is autosomal recessive.
## Management and treatment
Fresh frozen plasma (FFP) is the only treatment as FV concentrates are not available. In acute cases of severe bleeding, the addition of platelet concentrates may be helpful.
## Prognosis
Prognosis is good with early diagnosis and adequate treatment.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Congenital factor V deficiency
|
c0015499
| 8,565 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=326
| 2021-01-23T17:59:12 |
{"gard": ["2237"], "mesh": ["D005166"], "omim": ["227400"], "umls": ["C0015499"], "icd-10": ["D68.2"], "synonyms": ["Owren disease", "Parahemophilia", "Proaccelerin deficiency"]}
|
## Description
Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty (summary by Delatycki et al., 2000).
For a general phenotypic description of Friedreich ataxia (FRDA), see FRDA1 (229300), which is caused by mutation in the FXN gene (606829) on chromosome 9q13.
Clinical Features
Smeyers et al. (1996) reported a nonconsanguineous Spanish family in which 2 adult sibs, a male and a female, had a phenotype consistent with Friedreich ataxia, but linkage excluded the FRDA1 locus on chromosome 9q. The patients had onset of progressive ataxia at ages 10 and 14 years, respectively. Both had areflexia, dysarthria, abnormal sense of joint position, and axonal sensory peripheral neuropathy. Both had pes cavus and one had scoliosis. Neither had evidence of cardiac involvement, and serum vitamin E deficiency was ruled out.
Kostrzewa et al. (1997) reported 2 unrelated families, each with 2 sibs with FRDA. Although the patients studied had typical FRDA, 1 sib pair had the uncommon symptom of retained tendon reflexes. In these families, Kostrzewa et al. (1997) excluded mutations in the FXN gene (606829), and haplotype analysis of the FXN locus on chromosome 9 excluded involvement of this locus. These results provided strong evidence of a second FRDA locus, which the authors termed FRDA2.
Mapping
In a large consanguineous family from Turkey segregating Friedreich ataxia, Christodoulou et al. (2001) found linkage of the disorder to chromosome 9p23-p11. Multipoint linkage analysis resulted in a maximum lod score of 3.2 at locus D9S43.
Neuro \- Cerebellar ataxia \- Dysarthria \- Nystagmus \- Incoordination of limb movements \- Diminished or absent tendon reflexes \- Retained tendon reflexes uncommon \- Babinski sign \- Impaired position sense \- Impaired vibratory sense \- Hypoactive knee and ankle jerks Metabolic \- Diabetes mellitus \- Diabetic ketosis Inheritance \- Autosomal recessive Misc \- Onset before adolescence Lab \- Abnormal motor and sensory nerve conduction \- Abnormal spinocerebellar tracts, dorsal columns, pyramidal tracts, cerebellum and medulla \- Abnormal EKG \- Abnormal echocardiogram \- Low pyruvate carboxylase activity in liver and cultured fibroblasts \- Mitochondrial malic enzyme reduced Skel \- Pes cavus \- Scoliosis \- Hammer toe Cardiac \- Symmetric, concentric, hypertrophic cardiomyopathy \- Congestive heart failure \- Muscular subaortic stenosis ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
FRIEDREICH ATAXIA 2
|
c0016719
| 8,566 |
omim
|
https://www.omim.org/entry/601992
| 2019-09-22T16:14:06 |
{"doid": ["12705", "0111219"], "mesh": ["D005621"], "omim": ["601992"], "orphanet": ["95"]}
|
Bone development disease
For other uses, see Clubfoot (disambiguation).
Clubfoot
Other namesClubfeet, congenital talipes equinovarus (CTEV)[1]
Bilateral clubfeet
SpecialtyOrthopedics, podiatry
SymptomsFoot that is rotated inwards and downwards[2]
Usual onsetDuring early pregnancy[1]
CausesUnknown[1]
Risk factorsGenetics, mother who smokes cigarettes, males[1]Ethnicity
Diagnostic methodPhysical examination, ultrasound during pregnancy[1][3]
Differential diagnosisMetatarsus adductus[4]
TreatmentPonseti method (manipulation, casting, cutting the Achilles tendon, braces), French method, surgery[1][3]
PrognosisGood with proper treatment[3]
Frequency1 to 4 in 1,000[3]
Clubfoot is a birth defect where one or both feet are rotated inward and downward.[1][2] The affected foot and leg may be smaller in size compared to the other.[1] Approximately 50% of cases of clubfoot affect both feet.[1][5] Most of the time, it is not associated with other problems.[1] Without treatment, the foot remains deformed, and people walk on the sides of their feet.[3] This may lead to pain and difficulty walking.[6]
The exact cause is usually not identified.[1][3] Both genetic and environmental factors are believed to be involved.[1][3] If one identical twin is affected, there is a 33% chance the other one will be as well.[1] The underlying mechanism involves disruption of the muscles or connective tissue of the lower leg, leading to joint contracture.[1][7] Other abnormalities are associated 20% of the time, with the most common being distal arthrogryposis and myelomeningocele.[1][3] The diagnosis may be made at birth by examination or before birth during an ultrasound exam.[1][3]
Initial treatment is most often with the Ponseti method.[1] This involves moving the foot into an improved position followed by casting, which is repeated at weekly intervals.[1] Once the inward bending is improved, the Achilles tendon is often cut, and braces are worn until the age of four.[1] Initially, the brace is worn nearly continuously and then just at night.[1] In about 20% of cases, further surgery is required.[1] Treatment can be carried out by a range of healthcare providers and can generally be achieved in the developing world with few resources.[1]
Clubfoot occurs in 1 to 4 of every 1,000 live births, making it one of the most common birth defects affecting the legs.[5][3][6] About 80% of cases occurring in developing countries where there is limited access to care.[5] Clubfoot is more common in firstborn children and males.[1][5][6] It is more common among Māori people, and less common among Chinese people.[3]
## Contents
* 1 Signs and symptoms
* 2 Cause
* 2.1 Genetics
* 3 Diagnosis
* 4 Treatment
* 4.1 Ponseti method
* 4.2 French method
* 4.3 Surgery
* 4.4 Developing world
* 5 Epidemiology
* 6 History
* 7 Cultural references
* 8 References
* 9 External links
## Signs and symptoms[edit]
In clubfoot, feet are rotated inward and downward.[1][2] The affected foot and leg may be smaller than the other, while in about half of cases, clubfoot affects both feet.[1][5][6] Most of the time clubfoot is not associated with other problems.[1]
Without treatment the foot remains deformed and people walk on the sides or tops of their feet, which can cause calluses, foot infections, trouble fitting into shoes, pain, difficulty walking, and disability.[6][3]
## Cause[edit]
Hypotheses about the precise cause of clubfoot vary, but genetics, environmental factors or a combination of both are involved. Research has not yet pinpointed the root cause, but many findings agree that "it is likely there is more than one different cause and at least in some cases the phenotype may occur as a result of a threshold effect of different factors acting together."[8] The most commonly associated conditions are distal arthrogryposis or myelomeningocele.[3]
Some researchers hypothesize, from the early development stages of humans, that clubfoot is formed by a malfunction during gestation. Early amniocentesis (11–13 wks) is believed to increase the rate of clubfoot because there is an increase in potential amniotic leakage from the procedure.[citation needed] Underdevelopment of the bones and muscles of the embryonic foot may be another underlying cause. In the early 1900s, it was thought that constriction of the foot by the uterus contributed to the occurrence of clubfoot.[citation needed]
Underdevelopment of the bones also affects the muscles and tissues of the foot. Abnormality in the connective tissue causes "the presence of increased fibrous tissue in muscles, fascia, ligaments and tendon sheaths".[8]
### Genetics[edit]
If one identical twin is affected, there is a 33% chance the other one will be as well.[1]
Mutations in genes involved in muscle development are risk factors for clubfoot, specifically those encoding the muscle contractile complex (MYH3, TPM2, TNNT3, TNNI2 and MYH8). These can cause congenital contractures, including clubfoot, in distal arthrogryposis (DA) syndromes.[9] Clubfoot can also be present in people with genetic conditions such as Loeys–Dietz syndrome and Ehlers-Danlos syndrome.[10]
Genetic mapping and the development of models of the disease have improved understanding of developmental processes. Its inheritance pattern is explained as a heterogenous disorder using a polygenic threshold model. The PITX1-TBX4 transcriptional pathway has become key to the study of clubfoot. PITX1 and TBX4 are uniquely expressed in the hind limb.[11]
## Diagnosis[edit]
Clubfoot is diagnosed through physical examination. Typically, babies are examined from head-to-toe shortly after they are born. There are four components of the clubfoot deformity:
1 Cavus: the foot has a high arch, or a caved appearance.
2 Adductus: the forefoot curves inwards toward the big toe.
3 Varus: the heel is inverted, or turned in, forcing one to walk on the outside of the foot. This is a natural motion but in clubfoot the foot is fixed in this position.
4 Equinus: the foot is pointed downward, forcing one to walk on tiptoe. This motion occurs naturally, but in clubfoot the foot is fixed in this position. This is because the Achilles tendon is tight and pulls the foot downwards.
Factors used to assess severity include the stiffness of the deformity (how much it can be corrected by manually manipulating the foot), the presence of skin creases at the arch and heel, and poor muscle consistency.
Sometimes, it is possible to detect clubfoot before birth using ultrasound. Prenatal diagnosis by ultrasound can allow parents to learn more about this condition and plan ahead for treatment after their baby is born.[12]
More testing and imaging is typically not needed, unless there is concern for other associated conditions.
## Treatment[edit]
Clubfeet in the course of correction
Treatment is usually with some combination of the Ponseti method and French method.[3] The Ponseti method involves a combination of casting, Achilles tendon release, and bracing. It is widely used and highly effective under the age of two.[13] The French method involves realignment, taping, and long-term home exercises and night splinting.[3] It is also effective but outcomes vary and rely on heavy involvement of caregivers.[3] Generally, the Ponseti method is preferred.[3][14] Another technique, the Kite method, does not appear to be as effective.[14] In about 20% of cases, additional surgery is required after initial treatment.[1]
### Ponseti method[edit]
A foot abduction brace type Denis Browne bar. Various types of foot-abduction braces are used to hold the child's feet in the desired position.
Main article: Ponseti method
The Ponseti method corrects clubfoot over the course of several stages.
* Serial casting: First, the foot is manually manipulated into an improved position and held in place with a long leg cast which extends from the toes up to the thigh. After a week this cast is removed, the foot is re-manipulated, and placed into a new cast. This process repeats and the foot is gradually reshaped over the course of 4-6 serial casts, although some feet may require additional casts.
* The goal of the initial cast is to align the forefoot with the hindfoot. Ponseti describes the forefoot as pronated in relation to the hindfoot, so supinating the forefoot and elevating the first metatarsal improves this alignment.
* Subsequent casts are applied after stretching the foot with a focus on abducting the forefoot with lateral pressure at the talus, to bring the navicular laterally and improve the alignment of the talonavicular joint. In contrast to the Kite method of casting, it is important to avoid constraining the calcanocuboid joint. With each additional cast, the abduction is increased and this moves the hindfoot from varus into valgus. It is important to leave the ankle in equinus until the forefoot and hindfoot are corrected.
* The final stage of casting, is to correct the equinus. After fully abducting the forefoot with spontaneous correction of the hindfoot, an attempt is made to bring the ankle up and into dorsiflexion.
* Achilles tendon release: At the end of the serial casting, most children have corrected cavus, adductus and varus deformities, but continue to have equinus deformity. To correct this, a procedure called an Achilles tendon release (also called Achilles tenotomy) is performed. Before the procedure, many centers place the child under sedation or monitored anesthesia care, although Ponseti recommended using local anesthetic alone. Next, the area around the heel is cleansed and numbed, and a small scalpel is used to cut the Achilles tendon. The incision is small so there is minimal bleeding and no need for stitches. The skin is covered with a small dressing, and the foot is placed into a final long leg cast in a fully corrected position. This cast is typically left in place for three weeks. During this time, the Achilles tendon will regrow in a lengthened position.
* Bracing: After successful correction is achieved through serial casting and Achilles tenotomy, the foot must be kept in a brace to prevent it from returning back to the deformed position over the first few years of a child's life. The brace is made up of two shoes or boots that are connected to each other by a bar. This device is also called a foot abduction brace (FAB). At first, the brace is worn full-time (23 hours per day) on both feet, regardless of whether the clubfoot affects one or two feet. After several months, or once the child starts pulling to stand, the brace is worn less frequently, mostly while sleeping at night and during naps. This part-time bracing phase continues until four years of age. Bracing prevents recurrence of the deformity and is a major determinant of a child's long-term outcome.[15]
The Ponseti Method is highly effective with short-term success rates of 90%.[15] However, anywhere from 14% to 41% of children experience a recurrence of the deformity.[16] The most common reason for this is inadequate adherence to bracing, such as not wearing the brace properly, not keeping it on for the recommended length of time, or not using it every day. Children who do not follow proper bracing protocol have up to 7 times higher recurrence rates than those who follow bracing protocol, as the muscles around the foot can pull it back into the abnormal position.[16] Recurrence is more common when there is poor compliance with the bracing, because the muscles around the foot can pull it back into the abnormal position. Low parental education level and failure to understand the importance of bracing is a major contributor to non-adherence.[15] Relapses are managed by repeating the casting process. Relapsed feet may also require additional, more extensive surgeries and have a reduced chance of achieving subsequent correction.[15]
Another reason for recurrence is a congenital muscle imbalance between the muscles that invert the ankle (tibialis posterior and tibialis anterior muscles) and the muscles that evert the ankle (peroneal muscles). This imbalance is present in approximately 20% of infants successfully treated with the Ponseti casting method, and makes them more prone to recurrence. After 18 months of age, this can be addressed with a surgery to transfer the tibialis anterior tendon from its medial attachment (on the navicula) to a more lateral position (on the lateral cuneiform). The surgery requires general anesthesia and subsequent casting while the tendon heals, but it is a relatively minor surgery that rebalances the muscles of the foot without disturbing any joints.
### French method[edit]
The French method is a conservative, non-operative method of clubfoot treatment that involves daily physical therapy for the first two months followed by thrice-weekly physical therapy for the next four months and continued home exercises following the conclusion of formal physical therapy. During each physical therapy session the feet are manipulated, stretched, then taped to maintain any gains made to the feet's range of motion. Exercises may focus on strengthening the peroneal muscles, which is thought to contribute to long-term correction. After the two month mark, the frequency of physical therapy sessions can be weaned down to three times a week instead of daily, until the child reaches six months. After the conclusion of the physical therapy program, caregivers must continue performing exercises at home and splinting at night in order to maintain long-term correction.
Compared to the Ponseti method which uses rigid casts and braces, the French method uses tape which allows for some motion in the feet. Despite its goal to avoid surgery, the success rate varies and surgery may still be necessary. The Ponseti method is generally preferred over the French method.[3]
### Surgery[edit]
This section needs additional citations for verification. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed. (December 2009) (Learn how and when to remove this template message)
If non-operative treatments are unsuccessful or achieve incomplete correction of the deformity, surgery is sometimes needed. Surgery was more common prior to the widespread acceptance of the Ponseti Method. The extent of surgery depends on the severity of the deformity. Usually, surgery is done at 9 to 12 months of age and the goal is to correct all the components of the clubfoot deformity at the time of surgery.
For feet with the typical components of deformity (cavus, forefoot adductus, hindfoot varus, and ankle equinus), the typical procedure is a Posteromedial Release (PMR) surgery. This is done through an incision across the medial side of the foot and ankle, that extends posteriorly, and sometimes around to the lateral side of the foot. In this procedure, it is typically necessary to release (cut) or lengthen the plantar fascia, several tendons, and joint capsules/ligaments. Typically, the important structures are exposed and then sequentially released until the foot can be brought to an appropriate plantigrade position. Specifically, it is important to bring the ankle to neutral, the heel into neutral, the midfoot aligned with the hindfoot (navicula aligned with the talus, and the cuboid aligned with the calcaneus). Once these joints can be aligned, thin wires are usually placed across these joints to hold them in the corrected position. These wires are temporary and left out through the skin for removal after 3–4 weeks. Once the joints are aligned, tendons (typically the Achilles, posterior tibialis, and flexor halluces longus) are repaired at an appropriate length. The incision (or incisions) are closed with dissolvable sutures. The foot is then casted in the corrected position for 6–8 weeks. It is common to do a cast change with anesthesia after 3–4 weeks, so that pins can be removed and a mold can be made to fabricate a custom AFO brace. The new cast is left in place until the AFO is available. When the cast is removed, the AFO is worn to prevent the foot from returning to the old position.[12]
For feet with partial correction of deformity with non-operative treatment, surgery may be less extensive and may involve only the posterior part of the foot and ankle. This might be called a posterior release. This is done through a smaller incision and may involve releasing only the posterior capsule of the ankle and subtalar joints, along with lengthening the Achilles tendon.
Surgery leaves residual scar tissue and typically there is more stiffness and weakness than with nonsurgical treatment. As the foot grows, there is potential for asymmetric growth that can result in recurrence of foot deformity that can affect the forefoot, midfoot, or hindfoot. Many patients do fine, but some require orthotics or additional surgeries. Long-term studies of adults with post-surgical clubfeet, especially those needing multiple surgeries, show that they may not fare as well in the long term.[17] Some people may require additional surgeries as they age, though there is some dispute as to the effectiveness of such surgeries, in light of the prevalence of scar tissue present from earlier surgeries.
### Developing world[edit]
Despite effective treatments, children in LMICs face many barriers such as limited access to equipment (specifically casting materials and abduction braces), shortages of healthcare professionals, and low education levels and socioeconomic status amongst caregivers and families.[18] These factors make it difficult to detect and diagnose children with clubfoot, connect them to care, and train their caregivers to follow the proper treatment and return for follow-up visits. It is estimated that only 15% of those diagnosed with clubfoot receive treatment.[19]
In an effort to reduce the burden of clubfoot in LMICs, there have been initiatives to improve early diagnosis, organize high-volume Ponseti casting centers, utilize mid-level practitioners and non-physician health workers, engage families in care, and provide local follow-up in the person’s community.[20]
## Epidemiology[edit]
Club foot occurs in 1 to 4 of every 1,000 live births.[5][6][3] It is one of the most common birth defects affecting the legs.[3] Clubfoot is more common in firstborn children and males, who are twice as likely to be affected as females.[5][6][1] It is more common among Māori people, and less common among Chinese people.[3]
Clubfoot disproportionally affects those in low and middle-income countries (LMICs). About 80% of those with clubfoot, or approximately 100,000 children per year as of 2018, are born in LMICs.[5][19]
## History[edit]
Pharaohs Siptah and Tutankhamun had clubfoot, and the condition appeared in Egyptian paintings.[21] Indian texts (c. 1000 BC) and Hippocrates (c. 400 BC) described treatment.[22]
## Cultural references[edit]
A well-known storyteller from Lapland, Juho "Nätti-Jussi" Nätti (surname can be translated as 'pretty') (1890–1964), was known for his stories but also his untreated left clubfoot. A story tells that "not even the devil himself could tell which way Nätti has gone" from footprints of snow.
* The main character, Philip Carey, in W. Somerset Maugham's novel Of Human Bondage, has clubfoot, a central theme in the work.
* The main character of Alan E. Nourse's The Bladerunner has clubfoot.
* Hippolyte Tautain, the stableman at the Lion D'Or public house in Gustave Flaubert's novel Madame Bovary is unsuccessfully treated for clubfoot by Charles Bovary, leading to the eventual amputation of his leg.
* Charlie Wilcox, the main character in Sharon McKay's novel Charlie Wilcox had a clubfoot.
* In Yukio Mishima's novel The Temple of the Golden Pavilion the character Kashiwagi has clubfoot which parallels the stutter of the main character, Mizoguchi.
* In David Eddings' Malloreon series, Senji the sorcerer has a clubfoot.
* In Caroline Lawrence's Roman Mysteries series, a character called Vulcan the blacksmith appears in the book "The Secrets of Vesuvius". He reveals that he gained the nickname because of his clubfoot.
* In Bernard Cornwell's The Warlord Chronicles Mordred, King of Dumnonia, has clubfoot that is often used as a symbol for his ugliness and weakness as a ruler.
* In Daniel Keyes's Flowers for Algernon Gimpy, one of Charlie's co-workers at the bakery, has clubfoot.
* In the 1941 film High Sierra, the character Velma has clubfoot, which is successfully treated with surgery.
* In Perfume: The Story of a Murderer, the main character is born with clubfoot and is described as having a limp throughout the novel.
* In Flannery O'Connor's short story "The Lame Shall Enter First", the character Johnson has clubfoot, a major symbol of the story.
* Kwai Geuk-Chat, played by Hung Yan-yan, was the former antagonist and later new student of Wong Fei-hung in the Once Upon a Time in China franchise was nicknamed "Clubfoot Seven Chiu-Tsat" due to the shape of the disability and deformation of his feet as he is the seventh member of wealthy rival martial artist, Chiu Tin-bak's apprentices, disciples, and henchmen.
## References[edit]
1. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac Gibbons, PJ; Gray, K (September 2013). "Update on clubfoot". Journal of Paediatrics and Child Health. 49 (9): E434–7. doi:10.1111/jpc.12167. PMID 23586398.
2. ^ a b c "Talipes equinovarus". Genetic and Rare Diseases Information Center (GARD). 2017. Archived from the original on 15 October 2017. Retrieved 15 October 2017.
3. ^ a b c d e f g h i j k l m n o p q r s t u Dobbs, Matthew B.; Gurnett, Christina A. (18 February 2009). "Update on clubfoot: etiology and treatment". Clinical Orthopaedics and Related Research. 467 (5): 1146–1153. doi:10.1007/s11999-009-0734-9. ISSN 1528-1132. PMC 2664438. PMID 19224303.
4. ^ Moses, Scott. "Clubfoot". www.fpnotebook.com. Archived from the original on 15 October 2017. Retrieved 15 October 2017.
5. ^ a b c d e f g h Smythe, Tracey; Kuper, Hannah; Macleod, David; Foster, Allen; Lavy, Christopher (March 2017). "Birth prevalence of congenital talipes equinovarus in low- and middle-income countries: a systematic review and meta-analysis". Tropical Medicine & International Health: TM & IH. 22 (3): 269–285. doi:10.1111/tmi.12833. ISSN 1365-3156. PMID 28000394.
6. ^ a b c d e f g O'Shea, Ryan M.; Sabatini, Coleen S. (December 2016). "What is new in idiopathic clubfoot?". Current Reviews in Musculoskeletal Medicine. 9 (4): 470–477. doi:10.1007/s12178-016-9375-2. ISSN 1935-973X. PMC 5127955. PMID 27696325.
7. ^ Cummings, R. Jay; Davidson, Richard S.; Armstrong, Peter F.; Lehman, Wallace B. (February 2002). "Congenital Clubfoot". The Journal of Bone and Joint Surgery. American Volume. 84 (2): 290–308. doi:10.2106/00004623-200202000-00018. ISSN 0021-9355. PMID 11861737.
8. ^ a b Miedzybrodzka, Z (January 2003). "Congenital talipes equinovarus (clubfoot): a disorder of the foot but not the hand". Journal of Anatomy. 202 (1): 37–42. doi:10.1046/j.1469-7580.2003.00147.x. PMC 1571059. PMID 12587918.
9. ^ Weymouth, KS; Blanton, SH; Bamshad, MJ; Beck, AE; Alvarez, C; Richards, S; Gurnett, CA; Dobbs, MB; Barnes, D; Mitchell, LE; Hecht, JT (September 2011). "Variants in genes that encode muscle contractile proteins influence risk for isolated clubfoot". American Journal of Medical Genetics Part A. 155A (9): 2170–9. doi:10.1002/ajmg.a.34167. PMC 3158831. PMID 21834041.
10. ^ Byers, Peter H. (2019). Vascular Ehlers-Danlos Syndrome. University of Washington, Seattle.
11. ^ Dobbs, MB; Gurnett, CA (January 2012). "Genetics of clubfoot". Journal of Pediatric Orthopedics. Part B. 21 (1): 7–9. doi:10.1097/BPB.0b013e328349927c. PMC 3229717. PMID 21817922.
12. ^ a b AskMayoExpert & et al. Can clubfoot be diagnosed in utero? Rochester, Minn.: Mayo Foundation for Medical Education and Research; 2012. "Archived copy". Archived from the original on 2014-07-08. Retrieved 2014-08-13.CS1 maint: archived copy as title (link)
13. ^ Ganesan, B; Luximon, A; Al-Jumaily, A; Balasankar, SK; Naik, GR (2017). "Ponseti method in the management of clubfoot under 2 years of age: A systematic review". PLOS ONE. 12 (6): e0178299. Bibcode:2017PLoSO..1278299G. doi:10.1371/journal.pone.0178299. PMC 5478104. PMID 28632733.
14. ^ a b Bina, Shadi; Pacey, Verity; Barnes, Elizabeth H.; Burns, Joshua; Gray, Kelly (15 May 2020). "Interventions for congenital talipes equinovarus (clubfoot)". The Cochrane Database of Systematic Reviews. 5: CD008602. doi:10.1002/14651858.CD008602.pub4. ISSN 1469-493X. PMC 7265154. PMID 32412098.
15. ^ a b c d Radler, Christof (September 2013). "The Ponseti method for the treatment of congenital club foot: review of the current literature and treatment recommendations". International Orthopaedics. 37 (9): 1747–1753. doi:10.1007/s00264-013-2031-1. ISSN 1432-5195. PMC 3764299. PMID 23928728.
16. ^ a b Zionts, Lewis E.; Dietz, Frederick R. (August 2010). "Bracing following correction of idiopathic clubfoot using the Ponseti method". The Journal of the American Academy of Orthopaedic Surgeons. 18 (8): 486–493. doi:10.5435/00124635-201008000-00005. ISSN 1067-151X. PMID 20675641. S2CID 7317959.
17. ^ Dobbs, Matthew B.; Nunley, R; Schoenecker, PL (May 2006). "Long-Term Follow-up of Patients with Clubfeet Treated with Extensive Soft-Tissue Release". The Journal of Bone and Joint Surgery. American Volume. 88 (5): 986–96. doi:10.2106/JBJS.E.00114. PMID 16651573.
18. ^ Owen, Rosalind; Capper, Beth; Lavy, Christopher (2018). "Clubfoot treatment in 2015: a global perspective". BMJ Global Health. 3 (4): e000852. doi:10.1136/bmjgh-2018-000852. PMC 6135438. PMID 30233830.
19. ^ a b Drew, Sarah; Gooberman-Hill, Rachael; Lavy, Christopher (2 March 2018). "What factors impact on the implementation of clubfoot treatment services in low and middle-income countries?: a narrative synthesis of existing qualitative studies". BMC Musculoskeletal Disorders. 19 (72): 72. doi:10.1186/s12891-018-1984-z. PMC 5834880. PMID 29499667.
20. ^ Harmer, Luke; Rhatigan, Joseph (2014). "Clubfoot Care in Low-Income and Middle-Income Countries: From Clinical Innovation to a Public Health Program". World Journal of Surgery. 38 (4): 839–48. doi:10.1007/s00268-013-2318-9. PMID 24213946.
21. ^ Matuszewski L, Gil L, Karski J (2012). "Early results of treatment for congenital clubfoot using the Ponseti method". Eur J Orthop Surg Traumatol. 22 (5): 403–406. doi:10.1007/s00590-011-0860-4. PMC 3376778. PMID 22754429.CS1 maint: multiple names: authors list (link)
22. ^ Dobbs, Matthew B; Morcuende, José A; Gurnett, Christina A; Ponseti, Ignacio V (2000). "Treatment of Idiopathic Clubfoot". The Iowa Orthopaedic Journal. 20: 59–64. ISSN 1541-5457. PMC 1888755. PMID 10934626.
## External links[edit]
Classification
D
* ICD-10: M21.5, Q66.8
* ICD-9-CM: 736.71, 754.5-754.7
* OMIM: 119800
* MeSH: D003025
* DiseasesDB: 29395
External resources
* MedlinePlus: 001228
* eMedicine: radio/177 orthoped/598
* Patient UK: Clubfoot
* v
* t
* e
Acquired musculoskeletal deformities
Upper limb
shoulder
* Winged scapula
* Adhesive capsulitis
* Rotator cuff tear
* Subacromial bursitis
elbow
* Cubitus valgus
* Cubitus varus
hand deformity
* Wrist drop
* Boutonniere deformity
* Swan neck deformity
* Mallet finger
Lower limb
hip
* Protrusio acetabuli
* Coxa valga
* Coxa vara
leg
* Unequal leg length
patella
* Luxating patella
* Chondromalacia patellae
* Patella baja
* Patella alta
foot deformity
* Bunion/hallux valgus
* Hallux varus
* Hallux rigidus
* Hammer toe
* Foot drop
* Flat feet
* Club foot
knee
* Genu recurvatum
Head
* Cauliflower ear
General terms
* Valgus deformity/Varus deformity
* Joint stiffness
* Ligamentous laxity
* v
* t
* e
Congenital malformations and deformations of musculoskeletal system / musculoskeletal abnormality
Appendicular
limb / dysmelia
Arms
clavicle / shoulder
* Cleidocranial dysostosis
* Sprengel's deformity
* Wallis–Zieff–Goldblatt syndrome
hand deformity
* Madelung's deformity
* Clinodactyly
* Oligodactyly
* Polydactyly
Leg
hip
* Hip dislocation / Hip dysplasia
* Upington disease
* Coxa valga
* Coxa vara
knee
* Genu valgum
* Genu varum
* Genu recurvatum
* Discoid meniscus
* Congenital patellar dislocation
* Congenital knee dislocation
foot deformity
* varus
* Club foot
* Pigeon toe
* valgus
* Flat feet
* Pes cavus
* Rocker bottom foot
* Hammer toe
Either / both
fingers and toes
* Polydactyly / Syndactyly
* Webbed toes
* Arachnodactyly
* Cenani–Lenz syndactylism
* Ectrodactyly
* Brachydactyly
* Stub thumb
reduction deficits / limb
* Acheiropodia
* Ectromelia
* Phocomelia
* Amelia
* Hemimelia
multiple joints
* Arthrogryposis
* Larsen syndrome
* RAPADILINO syndrome
Axial
Skull and face
Craniosynostosis
* Scaphocephaly
* Oxycephaly
* Trigonocephaly
Craniofacial dysostosis
* Crouzon syndrome
* Hypertelorism
* Hallermann–Streiff syndrome
* Treacher Collins syndrome
other
* Macrocephaly
* Platybasia
* Craniodiaphyseal dysplasia
* Dolichocephaly
* Greig cephalopolysyndactyly syndrome
* Plagiocephaly
* Saddle nose
Vertebral column
* Spinal curvature
* Scoliosis
* Klippel–Feil syndrome
* Spondylolisthesis
* Spina bifida occulta
* Sacralization
Thoracic skeleton
ribs:
* Cervical
* Bifid
sternum:
* Pectus excavatum
* Pectus carinatum
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Clubfoot
|
c0009081
| 8,567 |
wikipedia
|
https://en.wikipedia.org/wiki/Clubfoot
| 2021-01-18T18:50:44 |
{"gard": ["5112"], "mesh": ["D003025"], "umls": ["C0009081"], "orphanet": ["199315", "293150", "293144"], "wikidata": ["Q1162164"]}
|
Soemmering ring
SpecialtyOphthalmology
Soemmering ring is an annular swelling of the periphery of the lens capsule.[1] In 1928, Samuel Sömmerring observed posterior capsule opacification and then described Soemmering's ring as deposits of retained equatorial lens epithelial cells which continue to proliferate and form new cortical fibers which eventually form a ring of cortical fibers between the posterior capsule and the edges of the anterior capsule remnant.[2]
## References[edit]
1. ^ "Soemmering's ring". Retrieved 25 March 2018.
2. ^ Bhattacharjee H, Deshmukh S (December 2017). "Soemmering's ring". Indian Journal of Ophthalmology. 65 (12): 1489. doi:10.4103/ijo.IJO_913_17. PMC 5742989. PMID 29208841.
This article about an ophthalmic disease is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Soemmering ring
|
c0152260
| 8,568 |
wikipedia
|
https://en.wikipedia.org/wiki/Soemmering_ring
| 2021-01-18T18:38:54 |
{"umls": ["C0152260"], "wikidata": ["Q50936730"]}
|
Cherubism is a disorder characterized by abnormal bone tissue in the jaw. Beginning in early childhood, both the lower jaw (the mandible) and the upper jaw (the maxilla) become enlarged as bone is replaced with painless, cyst-like growths. These growths give the cheeks a swollen, rounded appearance and often interfere with normal tooth development. In some people the condition is so mild that it may not be noticeable, while other cases are severe enough to cause problems with vision, breathing, speech, and swallowing. Enlargement of the jaw usually continues throughout childhood and stabilizes during puberty. The abnormal growths are gradually replaced with normal bone in early adulthood. As a result, many affected adults have a normal facial appearance.
Most people with cherubism have few, if any, signs and symptoms affecting other parts of the body. Rarely, however, this condition occurs as part of another genetic disorder. For example, cherubism can occur with Ramon syndrome, which also involves short stature, intellectual disability, and overgrowth of the gums (gingival fibrosis). Additionally, cherubism has been reported in rare cases of Noonan syndrome (a developmental disorder characterized by unusual facial characteristics, short stature, and heart defects) and fragile X syndrome (a condition primarily affecting males that causes learning disabilities and cognitive impairment).
## Frequency
The incidence of cherubism is unknown. At least 250 cases have been reported worldwide.
## Causes
Mutations in the SH3BP2 gene have been identified in about 80 percent of people with cherubism. In most of the remaining cases, the genetic cause of the condition is unknown.
The SH3BP2 gene provides instructions for making a protein that plays a role in transmitting chemical signals within cells. the SH3BP2 protein is particularly important for the function of cells involved in the replacement of old bone tissue with new bone (bone remodeling) and certain immune system cells.
Mutations in the SH3BP2 gene lead to production of an abnormal protein that does not get broken down when it is no longer needed. Too much SH3BP2 protein likely increases signaling in certain cells, causing an immune reaction (inflammation) in the jaw bones and also triggering the production of osteoclasts, which are cells that break down bone tissue during bone remodeling. An excess of these bone-destroying cells contributes to the destruction of bone in the upper and lower jaws. A combination of bone loss and inflammation likely underlies the cyst-like growths characteristic of cherubism.
When cherubism occurs as a feature of a genetic syndrome, it is caused by the same genetic alteration that causes the syndrome.
### Learn more about the gene associated with Cherubism
* SH3BP2
## Inheritance Pattern
This condition is inherited in an autosomal dominant pattern, which means one copy of the altered gene in each cell is sufficient to cause the disorder.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Cherubism
|
c0008029
| 8,569 |
medlineplus
|
https://medlineplus.gov/genetics/condition/cherubism/
| 2021-01-27T08:25:32 |
{"gard": ["6036"], "mesh": ["D002636"], "omim": ["118400"], "synonyms": []}
|
A number sign (#) is used with this entry because Li-Fraumeni syndrome is caused by heterozygous mutation in the p53 gene (TP53; 191170) on chromosome 17p13.
Description
Li-Fraumeni syndrome (LFS) is a clinically and genetically heterogeneous inherited cancer syndrome. LFS is characterized by autosomal dominant inheritance and early onset of tumors, multiple tumors within an individual, and multiple affected family members. In contrast to other inherited cancer syndromes, which are predominantly characterized by site-specific cancers, LFS presents with a variety of tumor types. The most common types are soft tissue sarcomas and osteosarcomas, breast cancer, brain tumors, leukemia, and adrenocortical carcinoma. Classic LFS is defined as a proband with a sarcoma before the age of 45 years and a first-degree relative with any cancer before the age of 45 years and 1 additional first- or second-degree relative in the same lineage with any cancer before the age of 45 years or a sarcoma at any age (Li et al., 1988). Li-Fraumeni-like syndrome (LFL) is defined as a proband with any childhood cancer, or a sarcoma, brain tumor, or adrenocortical tumor before the age of 45 years, plus a first- or second-degree relative in the same lineage with a typical LFS tumor at any age, and an additional first- or second-degree relative in the same lineage with any cancer before the age of 60 years (Birch et al., 1994). A less restrictive definition of LFL is 2 different LFS-related tumors in first- or second-degree relatives at any age (Eeles, 1995). Approximately 70% of LFS cases and 40% of LFL cases contain germline mutations in the p53 gene on chromosome 17p13.1 (Bachinski et al., 2005).
### Genetic Heterogeneity of Li-Fraumeni Syndrome
A second form of Li-Fraumeni syndrome (LFS2; 609265) is caused by mutation in the CHEK2 gene (604373).
Clinical Features
In reviewing medical records and death certificates of 648 childhood rhabdomyosarcoma patients, Li and Fraumeni (1969) identified 4 families in which sibs or cousins had a childhood sarcoma. These 4 families also had striking histories of breast cancer and other neoplasms, suggesting a new familial cancer syndrome of diverse tumors. Subsequent prospective studies confirmed the high risk in family members of the tumor types that comprise LFS (Li and Fraumeni, 1982). Studies in other geographic and ethnic groups by Birch et al. (1984, 1990) corroborated the syndrome. The spectrum of cancers in the syndrome was shown to include, in addition to breast cancer and soft tissue sarcomas, brain tumors, osteosarcoma, leukemia, and adrenocortical carcinoma.
Fraumeni et al. (1975) described a kindred in which in 1 sibship of 9 adults, 4 died of lymphocytic or histiocytic lymphomas and 1, a male, of Waldenstrom macroglobulinemia complicated by adenocarcinoma of the lung. In the next generation, 1 person died of Hodgkin disease; 4 of 9 healthy persons had impaired lymphocyte transformation with phytohemagglutinin, and 3 of these had polyclonal elevation of IgM. Subsequent to the studies, adenocarcinoma of the lung developed in 1 of those with an immune defect, a woman, and her 3-year-old grandson developed lymphocytic leukemia. This was the first suggestion of a genetic or immunologic basis of lung adenocarcinoma.
Pearson et al. (1982) reported 2 families resembling that reported by Li and Fraumeni (1969). In 1, the mother had breast cancer and 3 of her 4 children had adrenocortical carcinoma, medulloblastoma, and rhabdomyosarcoma; in the other, the mother had breast cancer and 2 of her 3 children had adrenocortical carcinoma and rhabdomyosarcoma.
Mulvihill (1982) used the designation sarcoma family syndrome of Li and Fraumeni for the familial association of breast cancer, soft tissue sarcoma, and other tumors. Hartley et al. (1987) referred to this as the SBLA syndrome, a designation derived from the tumors that occur in this cancer family syndrome: sarcoma, breast and brain tumors, leukemia, laryngeal and lung cancer, and adrenal cortical carcinoma (Lynch et al., 1978).
Possible component tumors of LFS are melanoma, gonadal germ cell tumors, and carcinomas of the lung, pancreas, and prostate (Strong et al., 1987; Li et al., 1988). The diverse tumor types in family members characteristically develop at unusually early ages, and multiple primary tumors are frequent. By segregation analysis, Strong et al. (1987) demonstrated that the observed cancer distribution in families best fit a rare autosomal dominant gene model. The model also predicted that in families at risk the probability of developing any invasive cancer (excluding carcinomas of the skin) reaches almost 50% by age 30, when only 1% of the general population has developed cancer. More than 90% of the gene carriers would develop cancer by age 70 (review by Malkin et al., 1990).
Hisada et al. (1998) quantified the incidence of second and third primary cancers in individuals from 24 LFS families originally diagnosed with cancer between 1968 and 1986. Among 200 LFS family members diagnosed with cancer, 30 (15%) developed a second cancer. Eight individuals (4%) had a third cancer, while 4 (2%) eventually developed a fourth cancer. Overall, the relative risk of occurrence of a second cancer was 5.3, with a cumulated probability of second cancer occurrence of 57% at 30 years after diagnosis of a first cancer. Relative risks of second cancers occurring in families with this syndrome were 83.0, 9.7, and 1.5 for individuals with a first cancer at ages 0 to 19 years, 20 to 44 years, and 45 years or more, respectively. Thirty (71%) of 42 subsequent cancers in this group were component cancers of LFS.
Masciari et al. (2011) reviewed 62 TP53 mutation-positive families for gastric cancer. There were 429 cancer-affected individuals. In the 62 families gastric cancer was the diagnosis in the lineages of 21 (4.9%) subjects from 14 families (22.6%). The mean and median ages at gastric cancer diagnosis were 43 and 36 years, respectively (range: 24-74 years), significantly younger compared with the median age at diagnosis in the general population based on Surveillance Epidemiology and End Results data (71 years). Five (8.1%) families reported 2 or more cases of gastric cancer, and 6 (9.7%) families had cases of both colorectal and gastric cancers. No association was seen between phenotype and type/location of the TP53 mutations. Pathology review of the available tumors revealed both intestinal and diffuse histologies. Masciari et al. (2011) concluded that early-onset gastric cancer seems to be a component of Li-Fraumeni syndrome, suggesting the need for early and regular endoscopic screening in individuals with germline TP53 mutations, particularly among those with a family history of gastric cancer.
Inheritance
Li-Fraumeni syndrome shows autosomal dominant inheritance. The lifetime penetrance is high: by age 50, women have an overall higher risk (93%) of developing cancer compared to men (68%), as well as an earlier age at onset (29 years in women vs 40 years in men). Gonzalez et al. (2009) identified TP53 mutations in 75 of 341 patients with early-onset cancer sent for TP53 testing. Family history was available for all 341 patients. Five (7%) of 75 patients with TP53 mutations were confirmed to have de novo mutations, and 4 (80%) of the 5 patients with de novo mutations had multiple primary cancers. Ten of 75 patients with TP53 mutations likely had de novo germline mutations by family history. Gonzalez et al. (2009) estimated that the frequency of de novo TP53 mutations resulting in Li-Fraumeni syndrome may be as high as 20% (15 of 75).
Clinical Management
Villani et al. (2016) introduced a clinical surveillance program (The Toronto Protocol) using physical examination and frequent biochemical and imaging studies (consisting of whole body MRI, brain MRI, breast MRI, mammography, abdominal and pelvic ultrasound, and colonoscopy) at 3 tertiary care centers in Canada and the USA on January 1, 2004, for carriers of TP53 pathogenic variants. After confirmation of TP53 mutation, participants either chose to undergo surveillance or chose not to undergo surveillance. Patients could cross over between groups at any time. The primary outcome measure was detection of symptomatic tumors by surveillance investigations. The secondary outcome measure was 5-year overall survival established from a tumor diagnosed symptomatically (in the nonsurveillance group) versus one diagnosed by surveillance. Villani et al. (2016) completed survival analyses using an as-treated approach. Between January 1, 2004 and July 1, 2015, Villani et al. (2016) identified 89 carriers of TP53 pathogenic mutations in 39 unrelated families, of whom 40 (45%) agreed to surveillance and 49 (55%) declined surveillance. Nineteen patients (21%) crossed over from nonsurveillance to the surveillance group, giving a total of 59 individuals (66%) undergoing surveillance for a median of 32 months (IQR 12-87). Forty asymptomatic tumors have been detected in 19 (32%) of 59 patients who underwent surveillance. Two additional cancers were diagnosed between surveillance assessments (false negatives) and 2 biopsied lesions were nonneoplastic entities on pathologic review (false positives). Among the 49 individuals who initially declined surveillance, 61 symptomatic tumors were diagnosed in 43 patients (88%). Twenty-one (49%) of the 43 individuals not on surveillance who developed cancer were alive compared with 16 (84%) of the 19 individuals undergoing surveillance who developed cancer (p = 0.012) after a median follow-up of 46 months for those not on surveillance and 38 months for those on surveillance. Five-year overall survival was 88.8% (95% CI 78.7-100) in the surveillance group and 59.6% (47.2-75.2) in the nonsurveillance group (p = 0.0132). Based on these findings, Villani et al. (2016) concluded that long-term compliance with a comprehensive surveillance protocol for early tumor detection in individuals with pathogenic TP53 variants is feasible and that early tumor detection through surveillance is associated with improved long-term survival. The authors suggested incorporation of this approach into clinical management of these patients.
Mapping
LFS1 results from mutation in the TP53 gene, which maps to chromosome 17p13.1.
To data on a set of kindreds with Li-Fraumeni syndrome, Shete et al. (2002) applied a method they developed to incorporate individual-specific liability classes into linkage analysis. The approach yielded higher lod scores and more accurate estimates of the recombination fraction in the families showing linkage.
Molecular Genetics
Because tumor suppressor genes had been found to be associated with familial neoplasms, Malkin et al. (1990) suspected mutation in this type of gene in LFS. The RB1 gene (614041) was an unlikely candidate for a germline mutation in LFS because retinoblastoma (180200) had not been observed in these families. On the other hand, the TP53 gene was a more likely candidate because inactivating mutations therein had been associated with sporadic osteosarcomas, soft tissue sarcomas, brain tumors, leukemias, and carcinomas of the lung and breast. Furthermore, transgenic mice carrying a mutant p53 gene have an increased incidence of osteosarcomas, soft tissue sarcomas, adenocarcinomas of the lung, and adrenal and lymphoid tumors--all tumors that occur as part of LFS. Such was the basis for the successful search for p53 mutations in this disorder (see 191170.0001).
To determine the frequency and distribution of germline p53 mutations in LFS families, Frebourg et al. (1995) sequenced the 10 coding exons of TP53 in lymphocytes and fibroblast cell lines derived from 15 families with the syndrome. Germline mutations were observed in 8 such families; of these, 6 were missense mutations located between exons 5 and 8. One mutation was a nonsense mutation in exon 6 and one was a splicing mutation in intron 4; each of these mutations generated aberrantly short p53 RNAs. The study indicated that most germline p53 mutations in LFS are located between exons 5 and 8 and that approximately 50% of patients with LFS have no germline mutations in the coding region of the p53 gene. Significantly, in 3 families, a mutation of the p53 gene was observed in a fibroblast cell line derived from the proband, but the mutation was not found in affected relatives in 2 families or in the blood from 1 of the probands. This indicated that the mutation probably occurred during cell culture; thus, it is necessary that analysis for germline p53 mutations be performed on cells that have not been grown in vitro.
Varley et al. (1997) stated that more than 50 families had been identified with LFS caused by germline TP53 mutations. LFS is defined by strict clinical criteria, described by Li et al. (1988). This definition has been relaxed to include Li-Fraumeni-like (LFL) cases (Birch et al., 1994). Varley et al. (1997) detected mutations in TP53 in approximately 70% of LFS and 20% of LFL families, when all exons, including noncoding regions, were sequenced.
Chompret et al. (2001) reported a family study of 2,691 children with a history of solid tumor before the age of 18. A subgroup of 239 children had in addition a family history of at least 1 cancer affecting a first- or second-degree relative before the age of 46 or multiple primary cancers in the proband. Among these 239, 211 had at least 1 first- or second-degree relative affected, 16 had at least 2 primary tumors, and 12 fulfilled both criteria. They performed genotyping of p53 and found mutations in 9 individuals from the first group, 1 in the second, and 5 in the third. Chompret et al. (2001) calculated sensitivity and predictive value of p53 mutation testing using various degrees of stringency of selection criteria and concluded that p53 mutation testing should be considered in families where there is (1) a proband affected by a narrow spectrum cancer (sarcoma, brain tumor, breast cancer, adrenocortical tumor) before 36 years, and at least 1 first- or second-degree relative affected by a narrow spectrum tumor (other than breast cancer if the proband is affected by breast cancer) before the age of 46, or by multiple primary tumors; (2) a proband with multiple primary tumors, 2 of which belong to the narrow spectrum and the first of which occurred before 36 years, whatever the family history; (3) a proband with adrenocortical carcinoma, whatever the age of onset or family history. Using such criteria, they expected to find a mutation in 20% of cases and to miss 20% of mutations that would be detected by the least stringent criteria.
Hwang et al. (2003) stated that germline mutations in the p53 gene had been identified in 50 to 70% of families with LFS. To characterize cancer risk in heterozygous p53 mutation carriers, they analyzed cancer incidence in 56 germline p53 mutation carriers and 3,201 noncarriers from 107 kindreds ascertained through patients with childhood soft tissue sarcoma. Members of these kindreds were systematically followed for more than 20 years for cancer incidence and their p53 gene status was evaluated. Hwang et al. (2003) identified 7 kindreds with germline p53 mutations that included missense and truncation mutation types. A significantly higher cancer risk was found in female carriers than in male carriers, a difference not explained by an excess of sex-specific cancer. The calculated standardized incidence ratio (SIR) showed that mutation carriers had a risk for all types of cancer that was much higher than that for the general population, whereas noncarriers had a risk for all types of cancer that was similar to that in the general population. The calculated SIRs showed a higher risk by more than 100-fold for sarcoma, female breast cancer, and hematologic malignancy for the p53 mutation carriers and agreed with the findings of an earlier segregation analysis based on the same cohort (Kleihues et al., 1997).
Varley (2003) reviewed the findings of Birch et al. (2001), who studied the distribution of cancers in carriers of germline TP53 mutations from 28 families in which all cancers were verified and the ages of all family members, affected and unaffected, were known. They found a highly significant difference from the expected cancer distribution in the general population. The tumors originally identified as being components of Li-Fraumeni syndrome were found to be strongly associated with a germline TP53 mutation, with the exception of leukemia, which was not found to be a major component. However, Wilms tumor and malignant phyllode tumors of the breast were found at significantly higher frequency. (Phyllode is a term applied to tumors that on section show a lobulated, leaf-like appearance.) The increased cancer risk was most marked at younger ages and decreased with age. The only common adult epithelial tumor apart from breast that could be found at an increased frequency was pancreas, with no increased risk of lung, ovary, bladder, bowel, or head and neck tumors. The latter observation was particularly interesting because somatic TP53 mutations are found in approximately 60% of sporadic tumors at these sites (Soussi et al., 2000). The tissue-cell specificity associated with inheritance of a germline TP53 mutation is very striking.
Bendig et al. (2004) sought to identify germline mutations in the TP53 gene in 5 index cases of German and Swiss origin with cancers typical of Li-Fraumeni syndrome. They identified 5 mutations, of which 3 were found in families with a strong history of LFS in several generations and 2 seemingly arose de novo. Bendig et al. (2004) concluded that the frequent identification of de novo germline mutations emphasizes the importance of mutation analyses of the TP53 gene in young patients with malignancies typical for LFS but without a positive family history of this tumor syndrome.
Wang et al. (2013) reported on members of families with Li-Fraumeni syndrome who carried germline mutations in the TP53 gene. As compared with family members who are not carriers and with healthy volunteers, family members with these mutations have increased oxidative phosphorylation of skeletal muscle. Basic experimental studies of tissue samples from patients with the Li-Fraumeni syndrome and a mouse model of the syndrome supported this in vivo finding of increased mitochondrial function. Wang et al. (2013) concluded that their results suggested that p53 regulates bioenergetic homeostasis in humans.
### Other Genetic Abnormalities
Shlien et al. (2008) found that patients with TP53 mutations had significantly higher numbers of germline copy number variation (CNV) compared to controls. A microarray analysis counting CNVs on autosomal chromosomes comprising of 2 or more SNP probes identified 3,884 CNVs in genomic DNA from 770 healthy individuals. The median number of CNVs detected per control individual was 3, with 75% of the population having 4 or fewer CNVs. In individuals from 11 LFS families with TP53 mutations, the CNV mean was 12.19 per person, with 75% having 10 or fewer CNVs. The difference from controls was statistically significant (p = 0.01). The majority of specific CNVs observed in LFS families were acquired and not found in either parent. There was also a correlation between increased CNV number and cancer development among the LFS families, and analysis of tumor samples showed somatic increases in CNV. Shlien et al. (2008) suggested that CNVs represent regions of genomic instability and early neoplastic transformation.
Shlien et al. (2010) screened 4,524 patients with diverse clinical phenotypes for DNA dosage changes via array CGH or MLPA and identified 8 probands with a microdeletion on chromosome 17p13.1, at the TP53 (191170) locus. In 4 of the patients, who had childhood cancer and pedigrees consistent with Li-Fraumeni syndrome, deletions limited to the TP53 gene were found which deleted between 1 and 10 of the 11 exons. Another 4 patients, with a noncancer neurocognitive phenotype (613776), had larger deletions at 17p13.1, encompassing the entire TP53 gene and 26 to 85 other fully deleted genes. Shlien et al. (2010) demonstrated that mRNA expression levels of TP53 and TP53-dependent genes were altered in patients with partial, but not complete, deletions, which was consistent with mutant TP53-initiated tumorigenesis in the former group but not in the latter. The authors stated that their data supported a model in which partial deletions lead to the expression of a truncated protein, rather than the complete absence of it due to nonsense-mediated decay. Truncated and wildtype protein would oligomerize to form a defective TP53 tetramer, leading to a dominant-negative or gain-of-function effect similar to that observed with certain missense mutations, resulting in inhibition of wildtype TP53 function.
Genotype/Phenotype Correlations
Olivier et al. (2003) described a database for collecting information on families carrying a germline mutation in the TP53 gene and on families affected with Li-Fraumeni syndromes, both Li-Fraumeni and Li-Fraumeni-like syndromes. Data from the published literature was included. They described analysis of 265 families/individuals with LFS/LFL. In classic LFS families with a germline TP53 mutation (83 families), the mean age of onset of breast cancer was significantly lower than in LFS families (16 families) without a TP53 mutation (34.6 vs. 42.5 years; P = 0.0035). In individuals with a TP53 mutation, a correlation between the genotype and phenotype was found: brain tumors were associated with missense TP53 mutations located in the DNA-binding loop that contact the minor groove of DNA (P = 0.01), whereas adrenal gland carcinomas were associated with missense mutations located in the loops opposing the protein-DNA contact surface (P = 0.003). Finally, mutations likely to result in a null phenotype (absence of the protein or loss of function) were associated with earlier onset brain tumors (P = 0.004). These observations were considered to have clinical implications for genetic testing and tumor surveillance in LFS/LFL families.
Capponcelli et al. (2005) identified a mutation in the TP53 gene (Y220S; 191170.0039) in a mother and her 3 children with Li-Fraumeni syndrome. All affected family members had a very aggressive clinical phenotype associated with resistance to doxorubicin and early death from cancer. In vitro studies showed that the mutation conferred increased cellular resistance to doxorubicin treatment, perhaps by inducing expression of peroxiredoxin II (PRDX2; 600538) and thioredoxin (TXN; 187700), both of which reduce reactive oxygen species.
Other Features
### Choriocarcinoma
Patrier-Sallebert et al. (2015) reported a gestational choriocarcinoma (CC) that developed in a female partner of a male patient with LFS; the CC carried a germline TP53 (191170) mutation initially detected in this LFS patient. The authors then identified 78 fathers who were carriers of a germline TP53 mutation. Among the 213 corresponding pregnancies, Patrier-Sallebert et al. (2015) found 2 other cases of gestational CC in the female partners, and estimated that gestational CC occurs in approximately 1% of the deliveries in female partners of TP53 mutation carriers.
Heterogeneity
Mutations in p53 had not been detected in approximately 30% of LFS families. To address the possibility either that TP53 mutations were missed or that another predisposing gene is altered in LFS, Evans et al. (1998) used a variety of methods to determine the TP53 status in a large LFS kindred. A transcriptional activation assay on exons 4 to 10 of TP53 excluded a mutation within the DNA-binding domain. SSCP analysis, using intronic primers and sequencing of all the coding exons and intron/exon junctions, also yielded no mutations. Finally, linkage analysis excluded potential mutations in the noncoding regions of TP53. The family had been ascertained through systematic surveys of cancer in relatives of 382 childhood osteosarcoma patients. Classic LFS was defined as the diagnosis of a sarcoma in an individual before 45 years of age, having 2 first-degree relatives with cancer before the age of 45 years. In the LFS kindred studied, in addition to osteosarcoma in the proband, a sister had osteosarcoma and the mother had breast cancer before the age of 45 years. There was also lung cancer in the family as well as cancers of the ovary, thyroid, tongue, and kidney. Thirteen members were affected in 7 sibships in 3 generations.
Lynch et al. (2000) reported extensive follow-up of the family described by Lynch et al. (1978); a remarkable excess of brain tumors became evident in the update. One patient in the direct genetic lineage had a rhabdomyosarcoma of the eyelid at age 29 months and, at age 14 years, was diagnosed with lymphoblastic lymphoma/acute lymphoblastic leukemia. This same patient also had Sturge-Weber syndrome (185300), which seemingly had not previously been identified in Li-Fraumeni syndrome. No p53 germline mutation was identified in any affected members of this family.
In affected members of a large pedigree with tumors suggestive of a Li-Fraumeni-like syndrome, in which mutation in the TP53 gene had been excluded, Evans et al. (2008) identified a deletion of exons 14 to 16 in the BRCA2 gene by multiplex ligation-dependent probe amplification (MLPA) assay. Noting that other BRCA2 families have been reported with LFS spectrum sarcomas, the authors concluded that BRCA2 clearly accounts for a proportion of LFS/LFL families negative for TP53 mutations, but that it is likely that TP53 is the only LF-specific gene and that TP53-negative families are due to mutations in a variety of other, mostly known, genes.
### Exclusion Studies
In a Turkish family with Li-Fraumeni syndrome, Guran et al. (1999) demonstrated that the propositus with seminoma and his daughter with medulloblastoma had a hereditary TP53 mutation, lys292 to ile (K292I; 191170.0034), but also in analyses of tumor tissues had an ala94-to-glu missense mutation of the CDKN2A gene. Full blood analysis in the 2 cases revealed no CDKN2A mutation. This was the first time that a mutation in CDKN2A had been observed in Li-Fraumeni syndrome. Burt et al. (1999) excluded CDKN2A (600160) on chromosome 9 and PTEN (601728) on chromosome 10 as the cause of either LFS or LFL.
Animal Model
The heterogeneity in the tumor spectrum and latency in patients with LFS due to inherited mutations in p53 suggest risk modifiers at loci other than the major gene. Evans et al. (2004) developed a mouse model to investigate these risk modifiers. Inbred CE/J mice, which succumbed to multiple types of tumors similar to those found in LFS, were crossed with the p53 null mouse. In this cross, the authors found evidence for a genetic modifier of p53, Mop1, based on an unexpected mix of genotypes in the F2 progeny. A model in which a recessive CE/J allele in combination with p53 heterozygosity or homozygosity results in lethality most closely fitted the data. Using simple sequence length polymorphism analysis of the entire genome, Evans et al. (2004) identified a putative chromosomal region for this modifier of p53 on mouse chromosome 11 centromeric to p53.
History
Bachinski et al. (2005) studied a series of LFS kindreds with no p53 or CHEK2 (604373) mutations. Using a genomewide scan for linkage with complementing parametric and nonparametric analysis methods, they mapped a novel locus, previously designated Li-Fraumeni syndrome-3 (LFS3), to a 4-cM region on chromosome 1q23.
INHERITANCE \- Autosomal dominant NEOPLASIA \- Breast cancer \- Soft tissue sarcomas \- Osteosarcomas \- Brain tumors \- Acute leukemias \- Adrenocortical carcinomas \- Lung adenocarcinoma \- Colon cancer \- Pancreatic cancer \- Prostate cancer \- Wilms tumor \- Phyllodes tumor \- Choriocarcinoma, gestational MISCELLANEOUS \- Increased risk of developing multiple primary cancers \- Early age of onset \- Penetrance by age 50 is 93% in female mutation carriers and 68% in male mutation carriers \- Female mutation carriers have earlier age at onset compared to male mutation carriers \- Gestational choriocarcinoma is seen in female partners of LFS patients after parental-fetal transmission of germline TP53 mutation from male carriers MOLECULAR BASIS \- Caused by mutation in tumor protein p53 (TP53, 191170.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
LI-FRAUMENI SYNDROME
|
c0085390
| 8,570 |
omim
|
https://www.omim.org/entry/151623
| 2019-09-22T16:38:51 |
{"doid": ["3012"], "mesh": ["D016864"], "omim": ["151623"], "orphanet": ["524"], "synonyms": ["Alternative titles", "SARCOMA FAMILY SYNDROME OF LI AND FRAUMENI", "SBLA SYNDROME"], "genereviews": ["NBK1294", "NBK1311"]}
|
"Agyria" redirects here. It is not to be confused with Argyria.
This article needs additional citations for verification. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed.
Find sources: "Lissencephaly" – news · newspapers · books · scholar · JSTOR (July 2009) (Learn how and when to remove this template message)
Lissencephaly
Lissencephalic brain of a human, lacking surface convolutions (Gyrification)
SpecialtyMedical genetics, neurology
Lissencephaly (meaning "smooth brain")[1] is a set of rare brain disorders where the whole or parts of the surface of the brain appear smooth.[2] It is caused by defective neuronal migration during the 12th to 24th weeks of gestation resulting in a lack of development of brain folds (gyri) and grooves (sulci).[3] It is a form of cephalic disorder. Terms such as agyria (no gyri) and pachygyria (broad gyri) are used to describe the appearance of the surface of the brain.
Children with lissencephaly generally have significant developmental delays, but these vary greatly from child to child depending on the degree of brain malformation and seizure control. Life expectancy can be shortened, generally due to respiratory problems.
## Contents
* 1 Symptoms
* 2 Causes
* 2.1 Neural migration
* 2.1.1 LIS1
* 2.1.2 DCX
* 2.1.3 ARX
* 2.1.4 RELN
* 2.2 Viral Infection
* 3 Diagnosis
* 3.1 Classification
* 4 Treatment
* 5 Prognosis
* 6 See also
* 7 References
* 8 External links
## Symptoms[edit]
MRI scan showing the characteristic smooth brain of an individual with lissencephaly
Affected children display severe psychomotor impairment, failure to thrive, seizures, and muscle spasticity or hypotonia.[4] Other symptoms of the disorder may include unusual facial appearance, difficulty swallowing, and anomalies of the hands, fingers, or toes.
Symptoms of lissencephaly are detected via ultrasound at about twenty-three weeks and require confirmation from a prenatal MRI. It is characterised by absence or reduction of the sulci and gyri of the cerebral surface and a thickened cortex.[5]
There are anatomical symptoms that differ across the two main types of lissencephaly, Classical (Type I) and Cobble Stone (Type 2). In Classical lissencephaly the cortex becomes thickened and can be identified by four layers of the cerebral cortex rather than six.[5]
Cobblestone lissencephaly is named after the pebbled or cobblestone appearance of the cortical surface. This uneven cortical surface is due to incomplete organogenesis which leads to no distinguishable layers in the cerebral cortex. Cobblestone lissencephaly shows a reduction and abnormalities in the grey matter of the cerebral cortex.[5]
## Causes[edit]
Causes of lissencephaly can include viral infections of the uterus or the fetus during the first trimester,[6] or insufficient blood supply to the fetal brain early in pregnancy. There are also a number of genetic causes of lissencephaly, including mutation of the reelin gene (on chromosome 7),[7] as well as other genes on the X chromosome and on chromosome 17. Genetic counseling is usually offered if there is a risk of lissencephaly, coupled with genetic testing.
### Neural migration[edit]
Folding of the cerebral cortex is important in the development of overall brain function and cognitive abilities.[8] Neuronal migration is the process by which neurons migrate to the final position in the brain during the development of the nervous system.[9] This development of the nervous system occurs between 12 and 16 weeks of gestation.[9] The neurons are created at the ventricular zone.[8] The neurons then extend along the radial glia to reach the cortical zone. It is the disruption of the radial and tangential migration that causes reduced or absence gyri that is known as lissencephaly.[10]
The lack of gyri causing a smooth appearance of the cerebral cortex is due to abnormal neuronal migration in the developmental stages of the nervous system. The cause of lissencephaly has been linked to both genetic and non-genetic factors.[11] Three main types of lissencephaly have been identified and although all types display the similar symptoms the pathogenesis of each type varies.[10]
The genes associated with lissencephaly are still being discovered however due to advances in genetics individual genes are being identified as the cause of lissencephaly.[12] Mutations in LIS1, DCX (doublecortin), ARX(aristaless related homeobox), RELN have all been identified to cause lissencephaly.[13] Viral infections can also cause lissencephaly.[14]
The known genetic and viral mutation causes are listed below:
#### LIS1[edit]
LIS1 (also known as PAFAH1B1) is the most widely studied. LIS1 is located on chromosome 17p13.3.[10] LIS1 is integral in regulating the motor protein dynein which plays an important role in the movement of neuronal nuclei along microtubules.[11] The mutation or deletion involving LIS1 is associated with both Isolated Lissencephaly Syndrome and Miller–Dieker syndrome.[15] Miller-Dieker syndrome however, has additional deletions of adjacent genes on chromosome 17 causing facial and other congenital abnormalities and defects.[15] This mutation full or deletion of chromosome 17p13.3 leads to inadequate neuronal migration due to LIS1 encoding for an enzyme that interacts with the microtubule protein dynein.[11] LIS1 mutation or deletion is not inherited from a parent and thus recurrence is unlikely.[10]
A Chinese family with an autosomal dominant inheritance pattern and a mutation in this gene has been reported.[16]
#### DCX[edit]
DCX or doublecortin encodes for the doublecortin protein which is similar to LIS1 as it encodes a microtubule associated protein that is related to microtubule function and transport in developing neuronal processes.[12] DCX mutation causes the disorganisation of neocortical layering in the cerebral cortex leading to a reduced folding.[17] DCX is localised to the X chromosome and thus this mutation may be inherited however it still can appear randomly. As it is an X chromosome linked abnormality males who inherit the gene are more likely to be severely affected. Females who inherit the DCX mutation have a more mild version of the syndrome.[11]
#### ARX[edit]
The ARX gene encodes for the aristaless related homeobox genes which are active in the early embryonic development to control formation of many tissues and structure. ARX is involved in the development of the embryonic forebrain, migration and communication of neurons as well as migration and proliferation of interneurons.[13] As ARX is expressed in the ganglionic eminences and the neocortical ventricular zone it can affect both radial and tangential migration. Similar to DCX, ARX is an X chromosome linked gene and is linked with other symptoms such as absence of portions of the brain, abnormal genitalia and severe epilepsy.[13]
#### RELN[edit]
Reelin (RELN) is an extracellular matrix glycoproteins that is secreted to help with the regulation of neuronal migration. Lack of RELN in mice has shown deficiencies in migrating neurons. In reported cases, lissencephaly caused by RELN deficiency has been more severe in anterior brain regions with a very small cerebellum.[18]
### Viral Infection[edit]
Lissencephaly has been recorded to have been caused by viruses and insufficient blood supply to the developing fetal brain. Cytomegalovirus (CMV) is a herpes related virus that can cause congenital defects.[14] CMV has a high affinity for the developing germinal matrix of the brain. The severity of the infection is proportional to the time in gestation that the fetus was infected. It is early infection that leads to lissencephaly.[14] This is because early infection disrupts the migration and development of neurons.[14]
## Diagnosis[edit]
The diagnosis of lissencephaly is usually made at birth or soon after by ultrasound,[19] computed tomography (CT), or magnetic resonance imaging (MRI).[20] However, these results should be interpreted cautiously since even experienced radiologists can misdiagnose polymicrogyria, a different developmental malformation of the brain, as lissencephaly.
Before birth, complex ultrasounds performed routinely during pregnancy may indicate the presence of cerebral abnormality, but this method of diagnosis should be complemented by other methods, such as genetic studies and NMR, and the examination is not recommended as part of routine ultrasound examinations, unless family medical history or other reasons for suspecting brain malformation are present. The earliest point during gestation when it is possible to observe abnormal development of the brain surface is approximately in week 20, although ultrasound examinations in week 25–30 are more common.[21] Up to this time, the fetal brain normally has a smooth appearance.[22] If lissencephaly is suspected, chorionic villus sampling can test for some lissencephaly variants, but only those with a known genetic mutation.
### Classification[edit]
The spectrum of lissencephaly is only now becoming more defined as neuroimaging and genetics have provided more insights into migration disorders. There are around 20 types of lissencephaly which make up the spectrum. Other causes which have not yet been identified are likely as well.
Different systems for classifying lissencephaly exist. One major distinction is "classic" (type I) vs. "cobblestone" (type II),[23] but some systems add additional forms that fit into neither of these categories.
Some types of lissencephaly are described below (OMIM numbers are included where available):
Category Types
Classic (or Type 1) lissencephaly – 607432
* LIS1: lissencephaly due to PAFAH1B1 gene mutation, which subdivides into:
* type 1 isolated lissencephaly ( 601545)
* Miller–Dieker syndrome[24] ( 247200)
* LISX1: lissencephaly due to doublecortin (DCX) gene mutation ( 300121)
* lissencephaly, type 1, isolated, without other known genetic defects
*
Cobblestone (or Type 2) lissencephaly
* Walker–Warburg syndrome ( 236670), also called HARD(E) syndrome
* Fukuyama syndrome ( 253800)
* Muscle-eye-brain disease (MEB) ( 253280)
Other types
* LIS2: Norman-Roberts syndrome[25] (mutation of reelin gene, 257320)
* LIS3: TUBA1A, 611603
* LISX2: ARX, 300215
* Microlissencephaly (lissencephaly and microcephaly)[26]
## Treatment[edit]
Treatment for those with lissencephaly is symptomatic and depends on the severity and locations of the brain malformations. Treatment is tailored towards the symptoms of the individual. Therapies for lissencephaly are to deal with the symptoms as the syndrome is congenital. Supportive care may be needed to help with comfort and nursing needs. Seizures may be controlled with medication and hydrocephalus may require shunting. If feeding becomes difficult, a gastrostomy tube may be considered.
There are a number of organisations that raise awareness and funding for rare disabilities such as lissencephaly. They also seek to increase the quality of life for individuals living with related disabilities. In the United States, these organization include Arc of the United States, National Organization for Rare Disorders, and March of Dimes.
## Prognosis[edit]
The prognosis for children with lissencephaly varies depending on the malformation and severity of the syndrome. Many individuals remain in a 3–5 month developmental level. Life expectancy is short and many children with lissencephaly will die before the age of 10. Some children with lissencephaly will be able to roll over, sit, reach for objects, and smile socially. Aspiration and respiratory disease are the most common causes of illness or death.[27] In the past, life expectancy was said to be around two years of age. However, with advances in seizure control, and treatments for respiratory illness, most children live well beyond that age. With other advances in therapy, and the broader availability of services and equipment, some children with lissencephaly are able to walk with varying degrees of assistance and to perform other functions once thought too advanced.
## See also[edit]
* Gyrification
* CEP85L \- gene associated with posterior predominant lissencephaly in a 2020 study
## References[edit]
1. ^ "Lissencephaly Information Page". National Institute of Neurological Disorders and Stroke. Retrieved 2019-10-31.
2. ^ Toy, Eugene; Simpson, Ericka; Tinter, Ron (2013). Case Files. Neurology (2nd ed.). McGraw Hill. p. 421. ISBN 978-0-07-176170-3.
3. ^ Dobyns WB (1987). "Developmental aspects of lissencephaly and the lissencephaly syndromes". Birth Defects Original Article Series. 23 (1): 225–41. PMID 3472611.
4. ^ Jones, KL (2006). Smith's Recognizable Patterns of Human Malformation (6th ed.). Philadelphia: Elsevier Saunders.
5. ^ a b c Fong KW, Ghai S, Toi A, Blaser S, Winsor EJ, Chitayat D (December 2004). "Prenatal ultrasound findings of lissencephaly associated with Miller-Dieker syndrome and comparison with pre- and postnatal magnetic resonance imaging". Ultrasound in Obstetrics & Gynecology. 24 (7): 716–23. doi:10.1002/uog.1777. PMID 15586369.
6. ^ Joseph LD, Kuruvilla S (2008). "Cytomegalovirus infection with lissencephaly". Indian Journal of Pathology & Microbiology. 51 (3): 402–4. doi:10.4103/0377-4929.42534. PMID 18723971.
7. ^ Hong SE, Shugart YY, Huang DT, Shahwan SA, Grant PE, Hourihane JO, Martin ND, Walsh CA (September 2000). "Autosomal recessive lissencephaly with cerebellar hypoplasia is associated with human RELN mutations". Nature Genetics. 26 (1): 93–6. doi:10.1038/79246. PMID 10973257. S2CID 67748801.
8. ^ a b Fernández V, Llinares-Benadero C, Borrell V (May 2016). "Cerebral cortex expansion and folding: what have we learned?". The EMBO Journal. 35 (10): 1021–44. doi:10.15252/embj.201593701. PMC 4868950. PMID 27056680.
9. ^ a b Setty Y, Chen CC, Secrier M, Skoblov N, Kalamatianos D, Emmott S (September 2011). "How neurons migrate: a dynamic in-silico model of neuronal migration in the developing cortex". BMC Systems Biology. 5: 154. doi:10.1186/1752-0509-5-154. PMC 3198702. PMID 21962057.
10. ^ a b c d Mochida GH (September 2009). "Genetics and biology of microcephaly and lissencephaly". Seminars in Pediatric Neurology. 16 (3): 120–6. doi:10.1016/j.spen.2009.07.001. PMC 3565221. PMID 19778709.
11. ^ a b c d "Lissencephaly". National Organisation for Rare Diseases (NORD). NORD Rare Disease Database. 2018. Retrieved 20 May 2018.
12. ^ a b Liu, J. S.; Schubert, C. R.; Walsh, C. A. (2012). "Rare genetic causes of lissencephaly may implicate microtubule-based transport in the pathogenesis of cortical dysplasias". In Noebels, J. L.; Avoli, M.; Rogawski, M. A.; Olsen, R. W.; Delgado-Escueta, A. V. (eds.). Jasper's Basic Mechanisms of the Epilepsies (4th ed.). Bethesda: National Center for Biotechnology Information. PMID 22787614.
13. ^ a b c Kato M, Dobyns WB (April 2003). "Lissencephaly and the molecular basis of neuronal migration". Human Molecular Genetics. 12 (1): R89–R96. doi:10.1093/hmg/ddg086. PMID 12668601.
14. ^ a b c d Joseph LD, Pushpalatha, Kuruvilla S (2008). "Cytomegalovirus infection with lissencephaly". Indian Journal of Pathology & Microbiology. 51 (3): 402–404. doi:10.4103/0377-4929.42534. PMID 18723971.
15. ^ a b Cardoso C, Leventer RJ, Ward HL, Toyo-Oka K, Chung J, Gross A, Martin CL, Allanson J, Pilz DT, Olney AH, Mutchinick OM, Hirotsune S, Wynshaw-Boris A, Dobyns WB, Ledbetter DH (April 2003). "Refinement of a 400-kb critical region allows genotypic differentiation between isolated lissencephaly, Miller-Dieker syndrome, and other phenotypes secondary to deletions of 17p13.3". American Journal of Human Genetics. 72 (4): 918–30. doi:10.1086/374320. PMC 1180354. PMID 12621583.
16. ^ Shi CH, Zhang S, Yang ZH, Li YS, Liu YT, Li Z, Hu ZW, Xu YM (August 2018). "Identification of a novel PAFAH1B1 missense mutation as a cause of mild lissencephaly with basal ganglia calcification". Brain & Development. 41 (1): 29–35. doi:10.1016/j.braindev.2018.07.009. PMID 30100227. S2CID 51967262.
17. ^ Deuel TA, Liu JS, Corbo JC, Yoo SY, Rorke-Adams LB, Walsh CA (January 2006). "Genetic interactions between doublecortin and doublecortin-like kinase in neuronal migration and axon outgrowth". Neuron. 49 (1): 41–53. doi:10.1016/j.neuron.2005.10.038. PMID 16387638. S2CID 15362872.
18. ^ Nishikawa S, Goto S, Yamada K, Hamasaki T, Ushio Y (June 2003). "Lack of Reelin causes malpositioning of nigral dopaminergic neurons: evidence from comparison of normal and Reln(rl) mutant mice". The Journal of Comparative Neurology. 461 (2): 166–73. doi:10.1002/cne.10610. PMID 12724835.
19. ^ Aslan H, Gungorduk K, Yildirim D, Aslan O, Yildirim G, Ceylan Y (May 2009). "Prenatal diagnosis of lissencephaly: a case report". Journal of Clinical Ultrasound. 37 (4): 245–8. doi:10.1002/jcu.20572. PMID 19260111.
20. ^ Cordes M, Cordes I, Sander B, Sperner J, Hedde JP (May 1988). "Lissencephaly: diagnosis by computed tomography and magnetic resonance imaging". European Journal of Radiology. 8 (2): 131–3. PMID 3383858.
21. ^ Ghai S, Fong KW, Toi A, Chitayat D, Pantazi S, Blaser S (2006). "Prenatal US and MR imaging findings of lissencephaly: review of fetal cerebral sulcal development". Radiographics. 26 (2): 389–405. doi:10.1148/rg.262055059. PMID 16549605.
22. ^ Dorovini-Zis K, Dolman CL (April 1977). "Gestational development of brain". Archives of Pathology & Laboratory Medicine. 101 (4): 192–5. PMID 576786.
23. ^ Forman MS, Squier W, Dobyns WB, Golden JA (October 2005). "Genotypically defined lissencephalies show distinct pathologies". Journal of Neuropathology and Experimental Neurology. 64 (10): 847–57. doi:10.1097/01.jnen.0000182978.56612.41. PMID 16215456.
24. ^ Chong SS, Pack SD, Roschke AV, Tanigami A, Carrozzo R, Smith AC, Dobyns WB, Ledbetter DH (February 1997). "A revision of the lissencephaly and Miller-Dieker syndrome critical regions in chromosome 17p13.3". Human Molecular Genetics. 6 (2): 147–55. doi:10.1093/hmg/6.2.147. PMID 9063734.
25. ^ Norman MG, Roberts M, Sirois J, Tremblay LJ (February 1976). "Lissencephaly". The Canadian Journal of Neurological Sciences. 3 (1): 39–46. doi:10.1017/S0317167100025981. PMID 175907.
26. ^ Microlissencephaly
27. ^ Baker, Lisa. "Lissencephaly". The Resource Foundation for Children with Challenges. Archived from the original on 2 June 2013. Retrieved 10 May 2013.
## External links[edit]
Classification
D
* ICD-10: Q04.3
* ICD-9-CM: 742.2
* OMIM: 607432 601545 247200 300121 236670 253800 253280 257320 611603 300215
* MeSH: D054082
* DiseasesDB: 29492
External resources
* GeneReviews: DCX-Related Disorders
* Orphanet: 48471
* Scholia: Q1544416
Wikimedia Commons has media related to Lissencephaly.
* Lissencephaly at NINDS
* GeneReviews/NCBI/NIH/UW entry on DCX-Related Disorders
* OMIM entries on DCX-Related Disorders
* GeneReview/NIH/UW entry on LIS1 Lissencephaly
* v
* t
* e
Congenital malformations and deformations of nervous system
Brain
Neural tube defect
* Anencephaly
* Acephaly
* Acrania
* Acalvaria
* Iniencephaly
* Encephalocele
* Chiari malformation
Other
* Microcephaly
* Congenital hydrocephalus
* Dandy–Walker syndrome
* other reduction deformities
* Holoprosencephaly
* Lissencephaly
* Microlissencephaly
* Pachygyria
* Hydranencephaly
* Septo-optic dysplasia
* Megalencephaly
* Hemimegalencephaly
* CNS cyst
* Porencephaly
* Schizencephaly
* Polymicrogyria
* Bilateral frontoparietal polymicrogyria
Spinal cord
Neural tube defect
* Spina bifida
* Rachischisis
Other
* Currarino syndrome
* Diastomatomyelia
* Syringomyelia
* v
* t
* e
Genetic disorders relating to deficiencies of transcription factor or coregulators
(1) Basic domains
1.2
* Feingold syndrome
* Saethre–Chotzen syndrome
1.3
* Tietz syndrome
(2) Zinc finger
DNA-binding domains
2.1
* (Intracellular receptor): Thyroid hormone resistance
* Androgen insensitivity syndrome
* PAIS
* MAIS
* CAIS
* Kennedy's disease
* PHA1AD pseudohypoaldosteronism
* Estrogen insensitivity syndrome
* X-linked adrenal hypoplasia congenita
* MODY 1
* Familial partial lipodystrophy 3
* SF1 XY gonadal dysgenesis
2.2
* Barakat syndrome
* Tricho–rhino–phalangeal syndrome
2.3
* Greig cephalopolysyndactyly syndrome/Pallister–Hall syndrome
* Denys–Drash syndrome
* Duane-radial ray syndrome
* MODY 7
* MRX 89
* Townes–Brocks syndrome
* Acrocallosal syndrome
* Myotonic dystrophy 2
2.5
* Autoimmune polyendocrine syndrome type 1
(3) Helix-turn-helix domains
3.1
* ARX
* Ohtahara syndrome
* Lissencephaly X2
* MNX1
* Currarino syndrome
* HOXD13
* SPD1 synpolydactyly
* PDX1
* MODY 4
* LMX1B
* Nail–patella syndrome
* MSX1
* Tooth and nail syndrome
* OFC5
* PITX2
* Axenfeld syndrome 1
* POU4F3
* DFNA15
* POU3F4
* DFNX2
* ZEB1
* Posterior polymorphous corneal dystrophy
* Fuchs' dystrophy 3
* ZEB2
* Mowat–Wilson syndrome
3.2
* PAX2
* Papillorenal syndrome
* PAX3
* Waardenburg syndrome 1&3
* PAX4
* MODY 9
* PAX6
* Gillespie syndrome
* Coloboma of optic nerve
* PAX8
* Congenital hypothyroidism 2
* PAX9
* STHAG3
3.3
* FOXC1
* Axenfeld syndrome 3
* Iridogoniodysgenesis, dominant type
* FOXC2
* Lymphedema–distichiasis syndrome
* FOXE1
* Bamforth–Lazarus syndrome
* FOXE3
* Anterior segment mesenchymal dysgenesis
* FOXF1
* ACD/MPV
* FOXI1
* Enlarged vestibular aqueduct
* FOXL2
* Premature ovarian failure 3
* FOXP3
* IPEX
3.5
* IRF6
* Van der Woude syndrome
* Popliteal pterygium syndrome
(4) β-Scaffold factors
with minor groove contacts
4.2
* Hyperimmunoglobulin E syndrome
4.3
* Holt–Oram syndrome
* Li–Fraumeni syndrome
* Ulnar–mammary syndrome
4.7
* Campomelic dysplasia
* MODY 3
* MODY 5
* SF1
* SRY XY gonadal dysgenesis
* Premature ovarian failure 7
* SOX10
* Waardenburg syndrome 4c
* Yemenite deaf-blind hypopigmentation syndrome
4.11
* Cleidocranial dysostosis
(0) Other transcription factors
0.6
* Kabuki syndrome
Ungrouped
* TCF4
* Pitt–Hopkins syndrome
* ZFP57
* TNDM1
* TP63
* Rapp–Hodgkin syndrome/Hay–Wells syndrome/Ectrodactyly–ectodermal dysplasia–cleft syndrome 3/Limb–mammary syndrome/OFC8
Transcription coregulators
Coactivator:
* CREBBP
* Rubinstein–Taybi syndrome
Corepressor:
* HR (Atrichia with papular lesions)
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Lissencephaly
|
c0266463
| 8,571 |
wikipedia
|
https://en.wikipedia.org/wiki/Lissencephaly
| 2021-01-18T19:06:25 |
{"gard": ["12291"], "mesh": ["D054082"], "umls": ["C0266463", "C1879312", "C0266483"], "orphanet": ["102009", "48471"], "wikidata": ["Q1544416"]}
|
Osteopetrosis refers to a group of rare, inherited skeletal disorders characterized by increased bone density and abnormal bone growth. Symptoms and severity can vary greatly, ranging from neonatal onset with life-threatening complications (such as bone marrow failure) to the incidental finding of osteopetrosis on X-ray. Depending on severity and age of onset, features may include fractures, short stature, compressive neuropathies (pressure on the nerves), hypocalcemia with attendant tetanic seizures, and life-threatening pancytopenia. In rare cases, there may be neurological impairment or involvement of other body systems. Osteopetrosis may be caused by mutations in at least 10 genes. Inheritance can be autosomal recessive, autosomal dominant, or X-linked recessive with the most severe forms being autosomal recessive. Management depends on the specific symptoms and severity and may include vitamin D supplements, various medications, and/or surgery. Adult osteopetrosis requires no treatment by itself, but complications may require intervention.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Osteopetrosis autosomal recessive 3
|
c0345407
| 8,572 |
gard
|
https://rarediseases.info.nih.gov/diseases/4154/osteopetrosis-autosomal-recessive-3
| 2021-01-18T17:58:31 |
{"mesh": ["C536058"], "omim": ["259730"], "umls": ["C0345407"], "orphanet": ["2785"], "synonyms": ["OPTB3", "Autosomal recessive osteopetrosis type 3", "Osteopetrosis with renal tubular acidosis", "Guibaud Vainsel syndrome", "Marble brain disease", "Carbonic anhydrase 2 deficiency"]}
|
Macular edema
Other namesMacular oedema,[1] familial macular edema
A 61-year-old man with medical history of type 2 diabetes that presents a macular edema, evidenced by an OCT (the edema marked with arrows). The central image is a 3D reconstruction of the retinal thickness (the edema is coloured in red).
SpecialtyOphthalmology
Diabetic macular edema, with hard exudates surrounding the blood vessels.
Macular edema occurs when fluid and protein deposits collect on or under the macula of the eye (a yellow central area of the retina) and causes it to thicken and swell (edema). The swelling may distort a person's central vision, because the macula holds tightly packed cones that provide sharp, clear, central vision to enable a person to see detail, form, and color that is directly in the centre of the field of view.
## Contents
* 1 Cause
* 2 Diagnosis
* 2.1 Classification
* 3 Treatment
* 4 Research
* 5 See also
* 6 References
* 7 External links
## Cause[edit]
The causes of macular edema are numerous and different causes may be inter-related.
* It is commonly associated with diabetes. Chronic or uncontrolled diabetes type 2 can affect peripheral blood vessels including those of the retina which may leak fluid, blood and occasionally fats into the retina causing it to swell.[2]
* Age-related macular degeneration may cause macular edema. As individuals age there may be a natural deterioration in the macula which can lead to the depositing of drusen under the retina sometimes with the formation of abnormal blood vessels.[3]
* Replacement of the lens as treatment for cataract can cause pseudophakic macular edema. (‘pseudophakia’ means ‘replacement lens’) also known as Irvine-Gass syndrome The surgery involved sometimes irritates the retina (and other parts of the eye) causing the capillaries in the retina to dilate and leak fluid into the retina. Less common today with modern lens replacement techniques.[4]
* Chronic uveitis and intermediate uveitis can be a cause.[5]
* Blockage of a vein in the retina can cause engorgement of the other retinal veins causing them to leak fluid under or into the retina. The blockage may be caused, among other things, by atherosclerosis, high blood pressure and glaucoma.[6]
* A number of drugs can cause changes in the retina that can lead to macular edema. The effect of each drug is variable and some drugs have a lesser role in causation. The principal medication known to affect the retina are:- latanoprost, epinephrine, rosiglitazone, timolol and thiazolidinediones among others.[7][8]
* A few congenital diseases are known to be associated with macular edema for example retinitis pigmentosa and retinoschisis.[2]
## Diagnosis[edit]
### Classification[edit]
Cystoid macular edema (CME). There are intraretinal cystoid spaces
Cystoid macular edema (CME) involves fluid accumulation in the outer plexiform layer secondary to abnormal perifoveal retinal capillary permeability. The edema is termed "cystoid" as it appears cystic; however, lacking an epithelial coating, it is not truly cystic. The cause for CME can be remembered with the mnemonic "DEPRIVEN" (diabetes, epinepherine, pars planitis, retinitis pigmentosa, Irvine-Gass syndrome, venous occlusion, E2-prostaglandin analogues, nicotinic acid/niacin).
Diabetic macular edema (DME) is similarly caused by leaking macular capillaries. DME is the most common cause of visual loss in both proliferative, and non-proliferative diabetic retinopathy.[9]
## Treatment[edit]
Macular edema sometimes occurs for a few days or weeks after cataract surgery, but most such cases can be successfully treated with NSAID or cortisone eye drops. Prophylactic use of Nonsteroidal anti-inflammatory drugs has been reported to reduce the risk of macular edema to some extent.[10]
Diabetic macular edema may be treated with laser photocoagulation, reducing the chance of vision loss. [11]
In 2010, the US FDA approved the use of Lucentis intravitreal injections for macular edema.[12]
Iluvien, a sustained release intravitreal implant developed by Alimera Sciences, has been approved in Austria, Portugal and the U.K. for the treatment of vision impairment associated with chronic diabetic macular edema (DME) considered insufficiently responsive to available therapies. Additional EU country approvals are anticipated.[13]
In 2013 Lucentis by intravitreal injection was approved by the National Institute for Health and Care Excellence in the UK for the treatment of macular edema caused by diabetes[14] and/or retinal vein occlusion.[15]
On July 29, 2014, Eylea (aflibercept), an intravitreal injection produced by Regeneron Pharmaceuticals Inc., was approved to treat DME in the United States.[16]
## Research[edit]
In 2005, steroids were investigated for the treatment of macular edema due to retinal blood vessel blockage such as CRVO and BRVO.[17]
A 2014 Cochrane Systematic Review studied the effectiveness of two anti-VEGF treatments, ranibizumab and pegaptanib, on patients suffering from macular edema caused by CRVO.[18] Participants on both treatment groups showed a reduction in macular edema symptoms over six months.[18]
Another Cochrane Review examined the effectiveness and safety of two intravitreal steroid treatments, triamcinolone acetonide and dexamethasone, for patients with from CRVO-ME.[19] The results from one trial showed that patients treated with triamcinolone acetonide were significantly more likely to show improvements in visual acuity than those in the control group, though outcome data was missing for a large proportion of the control group. The second trial showed that patients treated with dexamethasone implants did not show improvements in visual acuity, compared to patients in the control group.
Intravitreal injections and implantation of steroids inside the eye may result in a small improvement of vision for people with chronic or refractory diabetic macular edema.[20] There is low certainty evidence that there does not appear to be any additional benefit of combining anti-VEGF and intravitreal steroids when compared to either treatment alone.[21]
Anti‐tumour necrosis factor agents have been proposed as a treatment for macular oedema due to uveitis but a Cochrane Review published in 2018 found no relevant randomised controlled trials.[22]
## See also[edit]
* Diabetic retinopathy
* Fuchs spot
* Intermediate uveitis
* Macular telangiectasia
## References[edit]
1. ^ 'Oedema' is the standard form defined in the Concise Oxford English Dictionary (2011), with the precision that the spelling in the United States is 'edema'.
2. ^ a b "What Causes Macular Edema". American Academy of Ophthalmology. Retrieved 30 January 2016.
3. ^ "What is Age-Related Macular Degeneration?". American Academy of Ophthalmology. Retrieved 30 January 2016.
4. ^ Laly DR (5 March 2014). "Pseudophakic Cystoid Macular Edema". Review of Ophthalmology. Retrieved 30 January 2016.
5. ^ "Complications of Uveitis". Her Majesty's Government, UK. 27 January 2015. Retrieved 30 January 2016.
6. ^ Lusby FW (8 May 2014). "Retinal Vein Occlusion". Medline Plus. US Library of Medicine. Retrieved 30 January 2016.
7. ^ Abaasi O (11 June 2009). "Common Medications That May Be Toxic To The Retina". Review of Ophthalmology. Retrieved 30 January 2016.
8. ^ "Medication Cautions in Macular Degeneration". American Macular Degeneration Foundation. Retrieved 30 January 2016.
9. ^ Varma R, Bressler NM, Doan QV, Gleeson M, Danese M, Bower JK, et al. (November 2014). "Prevalence of and risk factors for diabetic macular edema in the United States". JAMA Ophthalmology. 132 (11): 1334–40. doi:10.1001/jamaophthalmol.2014.2854. PMC 4576994. PMID 25125075.
10. ^ Lim BX, Lim CH, Lim DK, Evans JR, Bunce C, Wormald R (November 2016). "Prophylactic non-steroidal anti-inflammatory drugs for the prevention of macular oedema after cataract surgery". The Cochrane Database of Systematic Reviews. 11: CD006683. doi:10.1002/14651858.CD006683.pub3. PMC 6464900. PMID 27801522.
11. ^ Jorge, Eliane C; Jorge, Edson N; Botelho, Mayra; Farat, Joyce G; Virgili, Gianni; El Dib, Regina (2018-10-15). Cochrane Eyes and Vision Group (ed.). "Monotherapy laser photocoagulation for diabetic macular oedema". Cochrane Database of Systematic Reviews. 10: CD010859. doi:10.1002/14651858.CD010859.pub2. PMC 6516994. PMID 30320466.
12. ^ "GEN | News Highlights: FDA Green-Lights Genentech's Lucentis for Macular Edema following Retinal Vein Occlusion". Genengnews.com. Retrieved 2012-12-15.
13. ^ "Iluvien gains marketing authorization in Portugal for chronic DME". OSN SuperSite, June 7, 2012. Retrieved June 20, 2012
14. ^ "Ranibizumab for treating diabetic macular oedema". NICE Guidance. NICE. February 2013.
15. ^ "Ranibizumab for treating visual impairment caused by macular oedema secondary to retinal vein occlusion". NICE Guidance. NICE. May 2013. Retrieved 30 January 2016.
16. ^ "Archived copy" (PDF). Archived from the original (PDF) on 2014-08-08. Retrieved 2014-07-30.CS1 maint: archived copy as title (link)
17. ^ "Steroid Injections vs. Standard Treatment for Macular Edema Due to Retinal Blood Vessel Blockage - Full Text View". ClinicalTrials.gov. Retrieved 2012-12-15.
18. ^ a b Braithwaite T, Nanji AA, Lindsley K, Greenberg PB (May 2014). "Anti-vascular endothelial growth factor for macular oedema secondary to central retinal vein occlusion". The Cochrane Database of Systematic Reviews (5): CD007325. doi:10.1002/14651858.CD007325.pub3. PMC 4292843. PMID 24788977.
19. ^ Gewaily D, Muthuswamy K, Greenberg PB (September 2015). "Intravitreal steroids versus observation for macular edema secondary to central retinal vein occlusion". The Cochrane Database of Systematic Reviews. 9 (9): CD007324. doi:10.1002/14651858.CD007324.pub3. PMC 4733851. PMID 26352007.
20. ^ Rittiphairoj, Thanitsara; Mir, Tahreem A.; Li, Tianjing; Virgili, Gianni (November 17, 2020). "Intravitreal steroids for macular edema in diabetes". The Cochrane Database of Systematic Reviews. 11: CD005656. doi:10.1002/14651858.CD005656.pub3. ISSN 1469-493X. PMID 33206392.
21. ^ Mehta, Hemal; Hennings, Charles; Gillies, Mark C; Nguyen, Vuong; Campain, Anna; Fraser-Bell, Samantha (2018-04-18). "Anti-vascular endothelial growth factor combined with intravitreal steroids for diabetic macular oedema". Cochrane Database of Systematic Reviews. 4: CD011599. doi:10.1002/14651858.cd011599.pub2. ISSN 1465-1858. PMC 6494419. PMID 29669176.
22. ^ Barry RJ, Tallouzi MO, Bucknall N, Mathers JM, Murray PI, Calvert MJ, et al. (Cochrane Eyes and Vision Group) (December 2018). "Anti-tumour necrosis factor biological therapies for the treatment of uveitic macular oedema (UMO) for non-infectious uveitis". The Cochrane Database of Systematic Reviews. 12: CD012577. doi:10.1002/14651858.CD012577.pub2. PMC 6516996. PMID 30562409.
## External links[edit]
Classification
D
* ICD-10: H35.8
* ICD-9-CM: 362.01, 362.53
* OMIM: 153880
* MeSH: D008269
* SNOMED CT: 37231002
External resources
* Orphanet: 75381
* v
* t
* e
* Diseases of the human eye
Adnexa
Eyelid
Inflammation
* Stye
* Chalazion
* Blepharitis
* Entropion
* Ectropion
* Lagophthalmos
* Blepharochalasis
* Ptosis
* Blepharophimosis
* Xanthelasma
* Ankyloblepharon
Eyelash
* Trichiasis
* Madarosis
Lacrimal apparatus
* Dacryoadenitis
* Epiphora
* Dacryocystitis
* Xerophthalmia
Orbit
* Exophthalmos
* Enophthalmos
* Orbital cellulitis
* Orbital lymphoma
* Periorbital cellulitis
Conjunctiva
* Conjunctivitis
* allergic
* Pterygium
* Pseudopterygium
* Pinguecula
* Subconjunctival hemorrhage
Globe
Fibrous tunic
Sclera
* Scleritis
* Episcleritis
Cornea
* Keratitis
* herpetic
* acanthamoebic
* fungal
* Exposure
* Photokeratitis
* Corneal ulcer
* Thygeson's superficial punctate keratopathy
* Corneal dystrophy
* Fuchs'
* Meesmann
* Corneal ectasia
* Keratoconus
* Pellucid marginal degeneration
* Keratoglobus
* Terrien's marginal degeneration
* Post-LASIK ectasia
* Keratoconjunctivitis
* sicca
* Corneal opacity
* Corneal neovascularization
* Kayser–Fleischer ring
* Haab's striae
* Arcus senilis
* Band keratopathy
Vascular tunic
* Iris
* Ciliary body
* Uveitis
* Intermediate uveitis
* Hyphema
* Rubeosis iridis
* Persistent pupillary membrane
* Iridodialysis
* Synechia
Choroid
* Choroideremia
* Choroiditis
* Chorioretinitis
Lens
* Cataract
* Congenital cataract
* Childhood cataract
* Aphakia
* Ectopia lentis
Retina
* Retinitis
* Chorioretinitis
* Cytomegalovirus retinitis
* Retinal detachment
* Retinoschisis
* Ocular ischemic syndrome / Central retinal vein occlusion
* Central retinal artery occlusion
* Branch retinal artery occlusion
* Retinopathy
* diabetic
* hypertensive
* Purtscher's
* of prematurity
* Bietti's crystalline dystrophy
* Coats' disease
* Sickle cell
* Macular degeneration
* Retinitis pigmentosa
* Retinal haemorrhage
* Central serous retinopathy
* Macular edema
* Epiretinal membrane (Macular pucker)
* Vitelliform macular dystrophy
* Leber's congenital amaurosis
* Birdshot chorioretinopathy
Other
* Glaucoma / Ocular hypertension / Primary juvenile glaucoma
* Floater
* Leber's hereditary optic neuropathy
* Red eye
* Globe rupture
* Keratomycosis
* Phthisis bulbi
* Persistent fetal vasculature / Persistent hyperplastic primary vitreous
* Persistent tunica vasculosa lentis
* Familial exudative vitreoretinopathy
Pathways
Optic nerve
Optic disc
* Optic neuritis
* optic papillitis
* Papilledema
* Foster Kennedy syndrome
* Optic atrophy
* Optic disc drusen
Optic neuropathy
* Ischemic
* anterior (AION)
* posterior (PION)
* Kjer's
* Leber's hereditary
* Toxic and nutritional
Strabismus
Extraocular muscles
Binocular vision
Accommodation
Paralytic strabismus
* Ophthalmoparesis
* Chronic progressive external ophthalmoplegia
* Kearns–Sayre syndrome
palsies
* Oculomotor (III)
* Fourth-nerve (IV)
* Sixth-nerve (VI)
Other strabismus
* Esotropia / Exotropia
* Hypertropia
* Heterophoria
* Esophoria
* Exophoria
* Cyclotropia
* Brown's syndrome
* Duane syndrome
Other binocular
* Conjugate gaze palsy
* Convergence insufficiency
* Internuclear ophthalmoplegia
* One and a half syndrome
Refraction
* Refractive error
* Hyperopia
* Myopia
* Astigmatism
* Anisometropia / Aniseikonia
* Presbyopia
Vision disorders
Blindness
* Amblyopia
* Leber's congenital amaurosis
* Diplopia
* Scotoma
* Color blindness
* Achromatopsia
* Dichromacy
* Monochromacy
* Nyctalopia
* Oguchi disease
* Blindness / Vision loss / Visual impairment
Anopsia
* Hemianopsia
* binasal
* bitemporal
* homonymous
* Quadrantanopia
subjective
* Asthenopia
* Hemeralopia
* Photophobia
* Scintillating scotoma
Pupil
* Anisocoria
* Argyll Robertson pupil
* Marcus Gunn pupil
* Adie syndrome
* Miosis
* Mydriasis
* Cycloplegia
* Parinaud's syndrome
Other
* Nystagmus
* Childhood blindness
Infections
* Trachoma
* Onchocerciasis
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Macular edema
|
c0271051
| 8,573 |
wikipedia
|
https://en.wikipedia.org/wiki/Macular_edema
| 2021-01-18T19:04:27 |
{"mesh": ["D008269"], "umls": ["C0271051"], "icd-9": ["362.01", "362.53"], "icd-10": ["H35.8"], "wikidata": ["Q1813737"]}
|
Eye disease in which high intraocular pressure damages the optic nerve
Glaucoma
Acute angle closure glaucoma of the person's right eye (shown at left). Note the mid-sized pupil, which was non-reactive to light, and redness of the white part of the eye.
SpecialtyOphthalmology, Optometry
SymptomsVision loss, eye pain, mid-dilated pupil, redness of the eye, nausea[1][2]
Usual onsetGradual, or sudden[2]
Risk factorsIncreased pressure in the eye, family history, high blood pressure[1]
Diagnostic methodDilated eye examination[1]
Differential diagnosisUveitis, trauma, keratitis, conjunctivitis[3]
TreatmentMedication, laser, surgery[1]
Frequency6–67 million[2][4]
Glaucoma is a group of eye diseases which result in damage to the optic nerve and cause vision loss.[1] The most common type is open-angle (wide angle, chronic simple) glaucoma, in which the drainage angle for fluid within the eye remains open, with less common types including closed-angle (narrow angle, acute congestive) glaucoma and normal-tension glaucoma.[1] Open-angle glaucoma develops slowly over time and there is no pain.[1] Peripheral vision may begin to decrease, followed by central vision, resulting in blindness if not treated.[1] Closed-angle glaucoma can present gradually or suddenly.[2] The sudden presentation may involve severe eye pain, blurred vision, mid-dilated pupil, redness of the eye, and nausea.[1][2] Vision loss from glaucoma, once it has occurred, is permanent.[1] Eyes affected by glaucoma are referred to as being glaucomatous.
Risk factors for glaucoma include increasing age, high pressure in the eye, a family history of glaucoma, and use of steroid medication.[1] For eye pressures, a value of greater than 21 mmHg or 2.8 kPa is often used, with higher pressures leading to a greater risk.[2][5] However, some may have high eye pressure for years and never develop damage.[2] Conversely, optic nerve damage may occur with normal pressure, known as normal-tension glaucoma.[6] The mechanism of open-angle glaucoma is believed to be slow exit of aqueous humor through the trabecular meshwork, while in closed-angle glaucoma the iris blocks the trabecular meshwork.[2] Diagnosis is by a dilated eye examination.[1] Often, the optic nerve shows an abnormal amount of cupping.[2]
If treated early, it is possible to slow or stop the progression of disease with medication, laser treatment, or surgery.[1][7] The goal of these treatments is to decrease eye pressure.[2] A number of different classes of glaucoma medication are available.[2] Laser treatments may be effective in both open-angle and closed-angle glaucoma.[2] A number of types of glaucoma surgeries may be used in people who do not respond sufficiently to other measures.[2] Treatment of closed-angle glaucoma is a medical emergency.[1]
About 70 million people have glaucoma globally.[2][4] The disease affects about 2 million people in the United States.[2] It occurs more commonly among older people.[1] Closed-angle glaucoma is more common in women.[2] Glaucoma has been called the "silent thief of sight," because the loss of vision usually occurs slowly over a long period of time.[8] Worldwide, glaucoma is the second-leading cause of blindness after cataracts.[2][9] Cataracts caused 51% of blindness in 2010, while glaucoma caused 8%.[10] The word "glaucoma" is from Ancient Greek glaukos, which means "shimmering."[11] In English, the word was used as early as 1587 but did not become commonly used until after 1850, when the development of the ophthalmoscope allowed people to see the optic nerve damage.[12]
## Contents
* 1 Signs and symptoms
* 2 Causes
* 2.1 Dietary
* 2.2 Ethnicity
* 2.3 Genetics
* 2.4 Other
* 3 Pathophysiology
* 4 Diagnosis
* 4.1 Primary glaucoma and its variants
* 4.2 Developmental glaucoma
* 4.3 Secondary glaucoma
* 4.4 Absolute glaucoma
* 4.5 Types
* 5 Visual field defects in glaucoma
* 6 Screening
* 7 Treatment
* 7.1 Medication
* 7.2 Laser
* 7.3 Surgery
* 7.3.1 Canaloplasty
* 7.3.2 Trabeculectomy
* 7.3.3 Glaucoma drainage implants
* 7.3.4 Laser-assisted nonpenetrating deep sclerectomy
* 8 Prognosis
* 9 Epidemiology
* 10 History
* 10.1 Etymology
* 11 Research
* 11.1 Rho kinase inhibitors
* 11.2 Neuroprotective agents
* 11.3 Cannabis
* 12 References
* 13 External links
## Signs and symptoms[edit]
Photo showing conjunctival vessels dilated at the corneal edge (ciliary flush, circumcorneal flush) and hazy cornea characteristic of acute angle closure glaucoma
Open-angle glaucoma is usually painless with no symptoms early in the disease process, thus screening via regular eye check-ups is important. The only signs are gradually progressive visual field loss, and optic nerve changes (increased cup-to-disc ratio on fundoscopic examination).
About 10% of people with closed angles present with acute angle closure characterized by sudden ocular pain, seeing halos around lights, red eye, very high intraocular pressure (>30 mmHg), nausea and vomiting, suddenly decreased vision, and a fixed, mid-dilated pupil. It is also associated with an oval pupil in some cases. Acute angle closure is an emergency.
Opaque specks may occur in the lens in glaucoma, known as glaukomflecken.[13]
## Causes[edit]
A normal range of vision
The same view with advanced vision loss from glaucoma
Of the several causes for glaucoma, ocular hypertension (increased pressure within the eye) is the most important risk factor in most glaucomas, but in some populations, only 50% of people with primary open-angle glaucoma actually have elevated ocular pressure.[14] Ocular hypertension—an intraocular pressure above the traditional threshold of 21 mm Hg or even above 24 mm Hg—is not necessarily a pathological condition but it increases the risk of developing glaucoma. One study found a conversion rate of 18% within 5 years, meaning less than 1 in 5 people with an elevated intraocular pressure will develop glaucomatous visual field loss over that period of time.[15] It is a matter of debate whether every person with an elevated intraocular pressure should receive glaucoma therapy; currently most ophthalmologists favor treatment of people with additional risk factors.[16]
Open-angle glaucoma accounts for 90% of glaucoma cases in the United States. Closed-angle glaucoma accounts for less than 10% of glaucoma cases in the United States, but as many as half of glaucoma cases in other nations (particularly East Asian countries).
### Dietary[edit]
No clear evidence indicates that vitamin deficiencies cause glaucoma in humans. It follows, then, that oral vitamin supplementation is not a recommended treatment for glaucoma.[17] Caffeine increases intraocular pressure in those with glaucoma, but does not appear to affect normal individuals.[18]
### Ethnicity[edit]
Many people of East Asian descent are prone to developing angle closure glaucoma due to shallower anterior chamber depths, with the majority of cases of glaucoma in this population consisting of some form of angle closure.[19] Higher rates of glaucoma have also been reported for Inuit populations, compared to White populations, in Canada and Greenland.[20]
### Genetics[edit]
Positive family history is a risk factor for glaucoma. The relative risk of having primary open-angle glaucoma (P.O.A.G.) is increased about two- to four-fold for people who have a sibling with glaucoma.[21] Glaucoma, particularly primary open-angle glaucoma, is associated with mutations in several genes, including MYOC, ASB10, WDR36, NTF4, TBK1,[22] and RPGRIP1,[23] although most cases of glaucoma do not involve these genetic mutations. Normal-tension glaucoma, which comprises one-third of POAG, is also associated with genetic mutations (including OPA1 and OPTN genes).[24]
Various rare congenital/genetic eye malformations are associated with glaucoma. Occasionally, failure of the normal third-trimester gestational atrophy of the hyaloid canal and the tunica vasculosa lentis is associated with other anomalies. Angle closure-induced ocular hypertension and glaucomatous optic neuropathy may also occur with these anomalies,[25][26][27] and has been modelled in mice.[28]
### Other[edit]
Other factors can cause glaucoma, known as "secondary glaucoma", including prolonged use of steroids (steroid-induced glaucoma); conditions that severely restrict blood flow to the eye, such as severe diabetic retinopathy and central retinal vein occlusion (neovascular glaucoma); ocular trauma (angle-recession glaucoma); and inflammation of the middle layer of the pigmented vascular eye structure (uveitis), known as uveitic glaucoma.
Laser Doppler imaging reveals arterial blood flow reversal in neovascular glaucoma. The color change of the Doppler image in the central retinal artery during the cardiac cycle indicates arterial flow reversal.[29]
## Pathophysiology[edit]
Human eye cross-sectional view
The underlying cause of open-angle glaucoma remains unclear. Several theories exist on its exact etiology. However, the major risk factor for most glaucomas and the focus of treatment is increased intraocular pressure. Intraocular pressure is a function of production of liquid aqueous humor by the ciliary processes of the eye, and its drainage through the trabecular meshwork. Aqueous humor flows from the ciliary processes into the posterior chamber, bounded posteriorly by the lens and the zonules of Zinn, and anteriorly by the iris. It then flows through the pupil of the iris into the anterior chamber, bounded posteriorly by the iris and anteriorly by the cornea. From here, the trabecular meshwork drains aqueous humor via the scleral venous sinus (Schlemm's canal) into scleral plexuses and general blood circulation.[30]
In open/wide-angle glaucoma, flow is reduced through the trabecular meshwork, due to the degeneration and obstruction of the trabecular meshwork, whose original function is to absorb the aqueous humor. Loss of aqueous humor absorption leads to increased resistance and thus a chronic, painless buildup of pressure in the eye.[31]
In close/narrow-angle, the iridocorneal angle is completely closed because of forward displacement of the final roll and root of the iris against the cornea, resulting in the inability of the aqueous fluid to flow from the posterior to the anterior chamber and then out of the trabecular network. This accumulation of aqueous humor causes an acute increase in pressure and pain.
Degeneration of axons of the retinal ganglion cells (the optic nerve) is a hallmark of glaucoma.[32] The inconsistent relationship of glaucomatous optic neuropathy with increased intraocular pressure has provoked hypotheses and studies on anatomic structure, eye development, nerve compression trauma, optic nerve blood flow, excitatory neurotransmitter, trophic factor, retinal ganglion cell/axon degeneration, glial support cell, immune system, aging mechanisms of neuron loss, and severing of the nerve fibers at the scleral edge.[33][34][35][36][37][38][39][40][41][42][43]
## Diagnosis[edit]
Optic nerve in advanced glaucoma disease
Screening for glaucoma is usually performed as part of a standard eye examination performed by optometrists and ophthalmologists. Testing for glaucoma should include measurements of the intraocular pressure via tonometry,[44] anterior chamber angle examination or gonioscopy, and examination of the optic nerve to look for any visible damage to it, or change in the cup-to-disc ratio and also rim appearance and vascular change. A formal visual field test should be performed. The retinal nerve fiber layer can be assessed with imaging techniques such as optical coherence tomography, scanning laser polarimetry, and/or scanning laser ophthalmoscopy (Heidelberg retinal tomogram).[45][46][47] Visual field loss is the most specific sign of the condition; however, it occurs later in the condition.[48]
Owing to the sensitivity of all methods of tonometry to corneal thickness, methods such as Goldmann tonometry should be augmented with pachymetry to measure the central corneal thickness (CCT). A thicker-than-average cornea can result in a pressure reading higher than the 'true' pressure whereas a thinner-than-average cornea can produce a pressure reading lower than the 'true' pressure.
Because pressure measurement error can be caused by more than just CCT (i.e., corneal hydration, elastic properties, etc.), it is impossible to 'adjust' pressure measurements based only on CCT measurements. The frequency doubling illusion can also be used to detect glaucoma with the use of a frequency doubling technology perimeter.[49]
Examination for glaucoma also could be assessed with more attention given to sex, race, history of drug use, refraction, inheritance and family history.[45]
Glaucoma tests[50][51] What the test examines Eye drops used Physical contact with the eye Procedure
Tonometry Inner eye pressure Maybe Maybe Eye drops may be used to numb the eye. The examiner then uses a tonometer to measure the inner pressure of the eye through pressure applied by a puff of warm air or a tiny tool.
Ophthalmoscopy (dilated eye examination) Shape and color of the optic nerve Yes No Eye drops are used to dilate the pupil. Using a small magnification device with a light on the end, the examiner can examine the magnified optic nerve.
Perimetry (visual field test) Complete field of vision No No The patient looks straight ahead and is asked to indicate when light passes the patient's peripheral field of vision. This allows the examiner to map the patient's field of vision.
Gonioscopy Angle in the eye where the iris meets the cornea Yes Yes Eye drops are used to numb the eye. A hand-held contact lens with a mirror is placed gently on the eye to allow the examiner to see the angle between the cornea and the iris.
Pachymetry Thickness of the cornea No Yes The examiner places a pachymeter gently on the front of the eye to measure its thickness.
Nerve fiber analysis Thickness of the nerve fiber layer Maybe Maybe Using one of several techniques,[clarification needed] the nerve fibers are examined.
Glaucoma has been classified into specific types:[52]
### Primary glaucoma and its variants[edit]
Primary glaucoma (H40.1-H40.2)
* Primary open-angle glaucoma, also known as chronic open-angle glaucoma, chronic simple glaucoma, glaucoma simplex
* High-tension glaucoma
* Low-tension glaucoma
* Primary angle closure glaucoma, also known as primary closed-angle glaucoma, narrow-angle glaucoma, pupil-block glaucoma, acute congestive glaucoma
* Acute angle closure glaucoma (aka AACG)[53]
* Chronic angle closure glaucoma
* Intermittent angle closure glaucoma
* Superimposed on chronic open-angle closure glaucoma ("combined mechanism" – uncommon)
Variants of primary glaucoma
* Pigmentary glaucoma
* Exfoliation glaucoma, also known as pseudoexfoliative glaucoma or glaucoma capsulare
* Primary juvenile glaucoma
Primary angle closure glaucoma is caused by contact between the iris and trabecular meshwork, which in turn obstructs outflow of the aqueous humor from the eye. This contact between iris and trabecular meshwork (TM) may gradually damage the function of the meshwork until it fails to keep pace with aqueous production, and the pressure rises. In over half of all cases, prolonged contact between iris and TM causes the formation of synechiae (effectively "scars").
These cause permanent obstruction of aqueous outflow. In some cases, pressure may rapidly build up in the eye, causing pain and redness (symptomatic, or so-called "acute" angle closure). In this situation, the vision may become blurred, and halos may be seen around bright lights. Accompanying symptoms may include a headache and vomiting.
Diagnosis is made from physical signs and symptoms: pupils mid-dilated and unresponsive to light, cornea edematous (cloudy), reduced vision, redness, and pain. However, the majority of cases are asymptomatic. Prior to the very severe loss of vision, these cases can only be identified by examination, generally by an eye care professional.
Once any symptoms have been controlled, the first line (and often definitive) treatment is laser iridotomy. This may be performed using either Nd:YAG or argon lasers, or in some cases by conventional incisional surgery. The goal of treatment is to reverse and prevent contact between the iris and trabecular meshwork. In early to moderately advanced cases, iridotomy is successful in opening the angle in around 75% of cases. In the other 25%, laser iridoplasty, medication (pilocarpine) or incisional surgery may be required.
Primary open-angle glaucoma is when optic nerve damage results in a progressive loss of the visual field.[54] This is associated with increased pressure in the eye. Not all people with primary open-angle glaucoma have eye pressure that is elevated beyond normal, but decreasing the eye pressure further has been shown to stop progression even in these cases.
The increased pressure is caused by trabecular meshwork blockage. Because the microscopic passageways are blocked, the pressure builds up in the eye and causes imperceptible very gradual vision loss. Peripheral vision is affected first, but eventually the entire vision will be lost if not treated.
Diagnosis is made by looking for cupping of the optic nerve. Prostaglandin agonists work by opening uveoscleral passageways. Beta-blockers, such as timolol, work by decreasing aqueous formation. Carbonic anhydrase inhibitors decrease bicarbonate formation from ciliary processes in the eye, thus decreasing the formation of aqueous humor. Parasympathetic analogs are drugs that work on the trabecular outflow by opening up the passageway and constricting the pupil. Alpha 2 agonists (brimonidine, apraclonidine) both decrease fluid production (via inhibition of AC) and increase drainage.
### Developmental glaucoma[edit]
Developmental glaucoma (Q15.0)
* Primary congenital glaucoma
* Infantile glaucoma
* Glaucoma associated with hereditary or familial diseases
### Secondary glaucoma[edit]
Secondary glaucoma (H40.3-H40.6)
* Inflammatory glaucoma
* Uveitis of all types
* Fuchs heterochromic iridocyclitis
* Phacogenic glaucoma
* Angle-closure glaucoma with mature cataract
* Phacoanaphylactic glaucoma secondary to rupture of lens capsule
* Phacolytic glaucoma due to phacotoxic meshwork blockage
* Subluxation of lens
* Glaucoma secondary to intraocular hemorrhage
* Hyphema
* Hemolytic glaucoma, also known as erythroclastic glaucoma
* Traumatic glaucoma
* Angle recession glaucoma: Traumatic recession on anterior chamber angle
* Postsurgical glaucoma
* Aphakic pupillary block
* Ciliary block glaucoma
* Neovascular glaucoma (see below for more details)
* Drug-induced glaucoma
* Corticosteroid induced glaucoma
* Alpha-chymotrypsin glaucoma. Postoperative ocular hypertension from use of alpha chymotrypsin.
* Glaucoma of miscellaneous origin
* Associated with intraocular tumors
* Associated with retinal detachments
* Secondary to severe chemical burns of the eye
* Associated with essential iris atrophy
* Toxic glaucoma
Neovascular glaucoma, an uncommon type of glaucoma, is difficult or nearly impossible to treat, and is often caused by proliferative diabetic retinopathy (PDR) or central retinal vein occlusion (CRVO). It may also be triggered by other conditions that result in ischemia of the retina or ciliary body. Individuals with poor blood flow to the eye are highly at risk for this condition.
Neovascular glaucoma results when new, abnormal vessels begin developing in the angle of the eye that begin blocking the drainage. Patients with such condition begin to rapidly lose their eyesight. Sometimes, the disease appears very rapidly, especially after cataract surgery procedures. A new treatment for this disease, as first reported by Kahook and colleagues, involves the use of a novel group of medications known as anti-VEGF agents. These injectable medications can lead to a dramatic decrease in new vessel formation and, if injected early enough in the disease process, may lead to normalization of intraocular pressure. Currently, there are no high-quality controlled trials demonstrating a beneficial effect of anti-VEGF treatments in lowering IOP in people with neovascular glaucoma.[55]
Toxic glaucoma is open-angle glaucoma with an unexplained significant rise of intraocular pressure following unknown pathogenesis. Intraocular pressure can sometimes reach 80 mmHg (11 kPa). It characteristically manifests as ciliary body inflammation and massive trabecular oedema that sometimes extends to Schlemm's canal. This condition is differentiated from malignant glaucoma by the presence of a deep and clear anterior chamber and a lack of aqueous misdirection. Also, the corneal appearance is not as hazy. A reduction in visual acuity can occur followed neuroretinal breakdown.
Associated factors include inflammation, drugs, trauma and intraocular surgery, including cataract surgery and vitrectomy procedures. Gede Pardianto (2005) reported on four patients who had toxic glaucoma. One of them underwent phacoemulsification with small particle nucleus drops. Some cases can be resolved with some medication, vitrectomy procedures or trabeculectomy. Valving procedures can give some relief, but further research is required.[56]
### Absolute glaucoma[edit]
Absolute glaucoma (H44.5) is the end stage of all types of glaucoma. The eye has no vision, absence of pupillary light reflex and pupillary response, and has a stony appearance. Severe pain is present in the eye. The treatment of absolute glaucoma is a destructive procedure like cyclocryoapplication, cyclophotocoagulation, or injection of 99% alcohol.
### Types[edit]
This section needs additional citations for verification. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed. (August 2015) (Learn how and when to remove this template message)
Glaucoma is an umbrella term for eye conditions which damage the optic nerve, and which can lead to a loss of vision.[57] The main cause of damage to the optic nerve is intraocular pressure (IOP), excessive fluid pressure within the eye, which can be due to various reasons including blockage of drainage ducts, and narrowing or closure of the angle between the iris and cornea.
The primary division in categorizing different types of glaucoma is open-angle and closed-angle (or angle-closure) glaucoma. In open angle glaucoma, the iris meets the cornea normally, allowing the fluid from inside the eye to drain, thus relieving the internal pressure. Where this angle is narrowed or closed, pressure increases over time, causing damage to the optic nerve, leading to blindness.
Primary open-angle glaucoma (also, primary glaucoma, chronic glaucoma) refers to slow clogging of the drainage canals resulting in increased eye pressure which causes progressive optic nerve damage. This manifests as a gradual loss of the visual field, starting with a loss of peripheral vision, but eventually the entire vision will be lost if not treated.[54] This is the most common type of glaucoma, accounting for 90% of cases in the United States, but fewer in Asian countries. Onset is slow and painless, and loss of vision is gradual and irreversible.
In narrow-angle glaucoma (also closed-angle glaucoma) the iris bows forward, narrowing the angle that drains the eye, increasing pressure within the eye. If untreated, it can lead to the medical emergency of angle-closure glaucoma.
In angle-closure glaucoma (also closed-angle glaucoma, primary angle-closure glaucoma, acute glaucoma) the iris bows forward and causes physical contact between the iris and trabecular meshwork, which blocks the outflow of aqueous humor from within the eye. This contact may gradually damage the draining function of the meshwork until it fails to keep pace with aqueous production, and the intraocular pressure rises. The onset of symptoms is sudden and causes pain and other symptoms that are noticeable; it is treated as a medical emergency. Unlike open-angle glaucoma, angle-closure glaucoma is a result of the angle between the iris and cornea closing. This tends to occur in the far-sighted, who have smaller-than-normal anterior chambers, making physical contact between the iris and trabecular meshwork more likely. There are a variety of tests to detect people at risk of angle-closure.[58]
Normal-tension glaucoma (also NTG, low-tension glaucoma, normal-pressure glaucoma) is a condition where the optic nerve is damaged although intraocular pressure (IOP) is in the normal range (12-22mm Hg). Individuals with a family history of NTG, those of Japanese ancestry, those with a history of systemic heart disease, and those with Flammer syndrome are at a higher than average risk of developing NTG. The cause of NTG is unknown.
Secondary glaucoma refers to any case in which another disease, trauma, drug or procedure causes increased eye pressure, resulting in optic nerve damage and vision loss, and may be mild or severe. It can be due to an eye injury, inflammation, a tumor, or advanced cases of cataracts or diabetes. It can also be caused by certain drugs such as steroids. Treatment depends on whether it is open-angle or angle-closure glaucoma.
In pseudoexfoliation glaucoma (also, PEX, exfoliation glaucoma) the pressure is due to the accumulation of microscopic granular protein fibers, which can block normal drainage of the aqueous humor. PEX is prevalent in Scandinavia, primarily in those over 70, and more commonly in women.
Pigmentary glaucoma (also, pigmentary dispersion syndrome) is caused by pigment cells sloughing off from the back of the iris and floating around in the aqueous humor. Over time, these pigment cells can accumulate in the anterior chamber in such a way that it can begin to clog the trabecular meshwork. It is a rare condition that occurs mostly among Caucasians, mostly males in their mid-20s to 40s, and most are nearsighted.
Primary juvenile glaucoma is a neonate or juvenile abnormality where ocular hypertension is evident at birth or shortly thereafter and is caused by abnormalities in the anterior chamber angle development that blocks the outflow of the aqueous humor.
Uveitic glaucoma is due to uveitis, the swelling and inflammation of the uvea, the middle layer of the eye. The uvea provides most of the blood supply to the retina. Increased eye pressure in uveitis can result from the inflammation itself or from the steroids used to treat it.[59]
## Visual field defects in glaucoma[edit]
See also: Visual field
Bjerrums area and types of scotomas on the visual field
In glaucoma visual field defects result from damage to the retinal nerve fiber layer. Field defects are seen mainly in primary open angle glaucoma. Because of the unique anatomy of the RNFL, many noticeable patterns are seen in the visual field. Most of the early glaucomatous changes are seen within the central visual field, mainly in Bjerrum's area, 10-20° from fixation.[60]
Following are the common glaucomatous field defects:
* Generalized depression: Generalized depression is seen in early stages of glaucoma and many other conditions. Mild constriction of central and peripheral visual field due to isopter contraction comes under generalized depression. If all the isopters show similar depression to the same point, it is then called a contraction of visual field. Relative paracentral scotomas are the areas where smaller and dimmer targets are not visualized by the patient.[60] Larger and brighter targets can be seen. Small paracentral depressions, mainly superonasal are seen in normal tension glaucoma (NTG).[61] The generalized depression of the entire field may be seen in cataract also.[62]
* Baring of blind spot: Baring of blind spot means Exclusion of blind spot from the central field due to inward curve of the outer boundary of 30° central field.[63] It is only an early non-specific visual field change, without much diagnostic value in glaucoma.[63]
* Small wing-shaped Paracentral scotoma: Small wing-shaped Paracentral scotoma within Bjerrum's area is the earliest clinically significant field defect seen in glaucoma. It may also be associated with nasal steps. Scotoma may be seen above or below blind spot.[63]
* Siedel's sickle-shaped scotoma: Paracentral scotoma joins with the blind spot to form the Seidel sign.
* Arcuate or Bjerrum's scotoma:
Arcuate scotoma
It is formed at later stages of glaucoma by extension of Seidel's scotoma in an area either above or below the fixation point to reach the horizontal line. Peripheral breakthrough may occur due to damage of nerve fibers.[63]
* Ring or Double arcuate scotoma: Two arcuate scotomas join together to form a Ring or Double arcuate scotoma. This defect is seen in advanced stages of glaucoma.
* Roenne's central nasal step: It is created when two arcuate scotomas run in different arcs to form a right angled defect. This is also seen in advanced stages of glaucoma.
* Peripheral field defects: Peripheral field defects may occur in early or late stages of glaucoma. Roenne's peripheral nasal steps occur due to contraction of peripheral isopter.[63]
* Tubular vision:
Tubular vision
Since macular fibers are the most resistant to glaucomatous damage, the central vision remains unaffected until end stages of glaucoma. Tubular vision or Tunnel vision is the loss of peripheral vision with retention of central vision, resulting in a constricted circular tunnel-like field of vision. It is seen in the end stages of glaucoma. Retinitis pigmentosa, is another disease that causes tubular vision.[64]
* Temporal island of vision: It is also seen in end stages of glaucoma. The temporal islands lie outside of the central 24 to 30° visual field,[65] so it may not be visible with standard central field measurements done in glaucoma.
## Screening[edit]
The United States Preventive Services Task Force stated, as of 2013, that there was insufficient evidence to recommend for or against screening for glaucoma.[66] Therefore, there is no national screening program in the US. Screening, however, is recommended starting at age 40 by the American Academy of Ophthalmology.[2]
There is a glaucoma screening program in the UK. Those at risk are advised to have a dilated eye examination at least once a year.[67]
## Treatment[edit]
The modern goals of glaucoma management are to avoid glaucomatous damage and nerve damage, and preserve visual field and total quality of life for patients, with minimal side-effects.[68][69] This requires appropriate diagnostic techniques and follow-up examinations, and judicious selection of treatments for the individual patient. Although intraocular pressure (IOP) is only one of the major risk factors for glaucoma, lowering it via various pharmaceuticals and/or surgical techniques is currently the mainstay of glaucoma treatment. A review of people with primary open-angle glaucoma and ocular hypertension concluded that medical IOP-lowering treatment slowed down the progression of visual field loss.[7]
Vascular flow and neurodegenerative theories of glaucomatous optic neuropathy have prompted studies on various neuroprotective therapeutic strategies, including nutritional compounds, some of which may be regarded by clinicians as safe for use now, while others are on trial.[citation needed]
### Medication[edit]
Main article: Glaucoma medication
Intraocular pressure can be lowered with medication, usually eye drops. Several classes of medications are used to treat glaucoma, with several medications in each class.
Each of these medicines may have local and systemic side effects. Adherence to medication protocol can be confusing and expensive; if side effects occur, the patient must be willing either to tolerate them or to communicate with the treating physician to improve the drug regimen. Initially, glaucoma drops may reasonably be started in either one or in both eyes.[70] Wiping the eye with an absorbent pad after the administration of eye drops may result in fewer adverse effects, like the growth of eyelashes and hyperpigmentation in the eyelid.[71]
Poor compliance with medications and follow-up visits is a major reason for vision loss in glaucoma patients. A 2003 study of patients in an HMO found half failed to fill their prescriptions the first time, and one-quarter failed to refill their prescriptions a second time.[72] Patient education and communication must be ongoing to sustain successful treatment plans for this lifelong disease with no early symptoms.
The possible neuroprotective effects of various topical and systemic medications are also being investigated.[17][73][74][75]
* Prostaglandin analogs, such as latanoprost, bimatoprost and travoprost, increase uveoscleral outflow of aqueous humor. Bimatoprost also increases trabecular outflow.
* Topical beta-adrenergic receptor antagonists, such as timolol, levobunolol, and betaxolol, decrease aqueous humor production by the epithelium of the ciliary body.
* Alpha2-adrenergic agonists, such as brimonidine and apraclonidine, work by a dual mechanism, decreasing aqueous humor production and increasing uveoscleral outflow.
* Less-selective alpha agonists, such as epinephrine, decrease aqueous humor production through vasoconstriction of ciliary body blood vessels, useful only in open-angle glaucoma. Epinephrine's mydriatic effect, however, renders it unsuitable for closed-angle glaucoma due to further narrowing of the uveoscleral outflow (i.e. further closure of trabecular meshwork, which is responsible for absorption of aqueous humor).
* Miotic agents (parasympathomimetics), such as pilocarpine, work by contraction of the ciliary muscle, opening the trabecular meshwork and allowing increased outflow of the aqueous humour. Echothiophate, an acetylcholinesterase inhibitor, is used in chronic glaucoma.
* Carbonic anhydrase inhibitors, such as dorzolamide, brinzolamide, and acetazolamide, lower secretion of aqueous humor by inhibiting carbonic anhydrase in the ciliary body.
### Laser[edit]
Argon laser trabeculoplasty (ALT) may be used to treat open-angle glaucoma, but this is a temporary solution, not a cure. A 50-μm argon laser spot is aimed at the trabecular meshwork to stimulate the opening of the mesh to allow more outflow of aqueous fluid. Usually, half of the angle is treated at a time. Traditional laser trabeculoplasty uses a thermal argon laser in an argon laser trabeculoplasty procedure.
Nd:YAG laser peripheral iridotomy (LPI) may be used in patients susceptible to or affected by angle closure glaucoma or pigment dispersion syndrome. During laser iridotomy, laser energy is used to make a small, full-thickness opening in the iris to equalize the pressure between the front and back of the iris, thus correcting any abnormal bulging of the iris. In people with narrow angles, this can uncover the trabecular meshwork. In some cases of intermittent or short-term angle closure, this may lower the eye pressure. Laser iridotomy reduces the risk of developing an attack of acute angle closure. In most cases, it also reduces the risk of developing chronic angle closure or of adhesions of the iris to the trabecular meshwork.
Diode laser cycloablation lowers IOP by reducing aqueous secretion by destroying secretory ciliary epithelium.[45]
### Surgery[edit]
Conventional surgery to treat glaucoma makes a new opening in the trabecular meshwork, which helps fluid to leave the eye and lowers intraocular pressure.
Main article: Glaucoma surgery
Both laser and conventional surgeries are performed to treat glaucoma. Surgery is the primary therapy for those with congenital glaucoma.[76] Generally, these operations are a temporary solution, as there is not yet a cure for glaucoma.
#### Canaloplasty[edit]
Canaloplasty is a nonpenetrating procedure using microcatheter technology. To perform a canaloplasty, an incision is made into the eye to gain access to the Schlemm's canal in a similar fashion to a viscocanalostomy. A microcatheter will circumnavigate the canal around the iris, enlarging the main drainage channel and its smaller collector channels through the injection of a sterile, gel-like material called viscoelastic. The catheter is then removed and a suture is placed within the canal and tightened.
By opening the canal, the pressure inside the eye may be relieved, although the reason is unclear, since the canal (of Schlemm) does not have any significant fluid resistance in glaucoma or healthy eyes. Long-term results are not available.[77][78]
#### Trabeculectomy[edit]
The most common conventional surgery performed for glaucoma is the trabeculectomy. Here, a partial thickness flap is made in the scleral wall of the eye, and a window opening is made under the flap to remove a portion of the trabecular meshwork. The scleral flap is then sutured loosely back in place to allow fluid to flow out of the eye through this opening, resulting in lowered intraocular pressure and the formation of a bleb or fluid bubble on the surface of the eye.
Scarring can occur around or over the flap opening, causing it to become less effective or lose effectiveness altogether. Traditionally, chemotherapeutic adjuvants, such as mitomycin C (MMC) or 5-fluorouracil (5-FU), are applied with soaked sponges on the wound bed to prevent filtering blebs from scarring by inhibiting fibroblast proliferation. Contemporary alternatives to prevent the scarring of the meshwork opening include the sole or combinative implementation of nonchemotherapeutic adjuvants such as the Ologen collagen matrix, which has been clinically shown to increase the success rates of surgical treatment.[79][80][81][82]
Collagen matrix prevents scarring by randomizing and modulating fibroblast proliferation in addition to mechanically preventing wound contraction and adhesion.
#### Glaucoma drainage implants[edit]
Main article: Glaucoma valve
The first glaucoma drainage implant was developed in 1966.[83] Since then, several types of implants have followed on from the original: the Baerveldt tube shunt, or the valved implants, such as the Ahmed glaucoma valve implant or the ExPress Mini Shunt and the later generation pressure ridge Molteno implants. These are indicated for glaucoma patients not responding to maximal medical therapy, with previous failed guarded filtering surgery (trabeculectomy). The flow tube is inserted into the anterior chamber of the eye, and the plate is implanted underneath the conjunctiva to allow a flow of aqueous fluid out of the eye into a chamber called a bleb.
* The first-generation Molteno and other nonvalved implants sometimes require the ligation of the tube until the bleb formed is mildly fibrosed and water-tight.[84] This is done to reduce postoperative hypotony—sudden drops in postoperative intraocular pressure.
* Valved implants, such as the Ahmed glaucoma valve, attempt to control postoperative hypotony by using a mechanical valve.
* Ab interno implants, such as the Xen Gel Stent, are transscleral implants by an ab interno procedure to channel aqueous humor into the non-dissected Tenon's space, creating a subconjunctival drainage area similar to a bleb.[85][86] The implants are transscleral and different from other ab interno implants that do not create a transscleral drainage, such as iStent, CyPass, or Hydrus.[87][88]
The ongoing scarring over the conjunctival dissipation segment of the shunt may become too thick for the aqueous humor to filter through. This may require preventive measures using antifibrotic medications, such as 5-fluorouracil or mitomycin-C (during the procedure), or other nonantifibrotic medication methods, such as collagen matrix implant,[89][90] or biodegradable spacer, or later on create a necessity for revision surgery with the sole or combinative use of donor patch grafts or collagen matrix implant.[90] And for glaucomatous painful blind eye and some cases of glaucoma, cyclocryotherapy for ciliary body ablation could be considered to be performed.[45]
#### Laser-assisted nonpenetrating deep sclerectomy[edit]
The most common surgical approach currently used for the treatment of glaucoma is trabeculectomy, in which the sclera is punctured to alleviate intraocular pressure.
Nonpenetrating deep sclerectomy (NPDS) surgery is a similar, but modified, procedure, in which instead of puncturing the scleral bed and trabecular meshwork under a scleral flap, a second deep scleral flap is created, excised, with further procedures of deroofing the Schlemm's canal, upon which, percolation of liquid from the inner eye is achieved and thus alleviating intraocular pressure, without penetrating the eye. NPDS is demonstrated to have significantly fewer side effects than trabeculectomy.[91] However, NPDS is performed manually and requires higher level of skills that may be assisted with instruments.[citation needed] In order to prevent wound adhesion after deep scleral excision and to maintain good filtering results, NPDS as with other non-penetrating procedures is sometimes performed with a variety of biocompatible spacers or devices, such as the Aquaflow collagen wick,[92] ologen Collagen Matrix,[81][93][94] or Xenoplast glaucoma implant.[95]
Laser-assisted NPDS is performed with the use of a CO2 laser system. The laser-based system is self-terminating once the required scleral thickness and adequate drainage of the intraocular fluid have been achieved. This self-regulation effect is achieved as the CO2 laser essentially stops ablating as soon as it comes in contact with the intraocular percolated liquid, which occurs as soon as the laser reaches the optimal residual intact layer thickness.
## Prognosis[edit]
In open-angle glaucoma, the typical progression from normal vision to complete blindness takes about 25 years to 70 years without treatment, depending on the method of estimation used.[96] The intraocular pressure can also have an effect, with higher pressures reducing the time until blindness.[97]
## Epidemiology[edit]
Disability-adjusted life year for glaucoma per 100,000 inhabitants in 2004[98]
no data
fewer than 20
20–43
43–66
66–89
89–112
112–135
135–158
158–181
181–204
204–227
227–250
more than 250
As of 2010, there were 44.7 million people in the world with open angle glaucoma.[99] The same year, there were 2.8 million people in the United States with open angle glaucoma.[99] By 2020, the prevalence is projected to increase to 58.6 million worldwide and 3.4 million in the United States.[99]
Both internationally and in the United States, glaucoma is the second-leading cause of blindness.[2] Globally, cataracts are a more common cause. Glaucoma is also the leading cause of blindness in African Americans, who have higher rates of primary open-angle glaucoma.[100][101] Bilateral vision loss can negatively affect mobility and interfere with driving.[102]
A meta-analysis published in 2009 found that people with primary open angle glaucoma do not have increased mortality rates, or increased risk of cardiovascular death.[103]
## History[edit]
The association of elevated intraocular pressure (IOP) and glaucoma was first described by Englishman Richard Bannister in 1622: "...that the Eye be grown more solid and hard, then naturally it should be...".[104] Angle-closure glaucoma was treated with cataract extraction by John Collins Warren in Boston as early as 1806.[105] The invention of the ophthalmoscope by Hermann Helmholtz in 1851 enabled ophthalmologists for the first time to identify the pathological hallmark of glaucoma, the excavation of the optic nerve head due to retinal ganglion cell loss. The first reliable instrument to measure intraocular pressure was invented by Norwegian ophthalmologist Hjalmar August Schiøtz in 1905. About half a century later, Hans Goldmann in Berne, Switzerland, developed his applanation tonometer which still today - despite numerous new innovations in diagnostics - is considered the gold standard of determining this crucial pathogenic factor. In the late 20th century, further pathomechanisms beyond elevated IOP were discovered and became the subject of research like insufficient blood supply – often associated with low or irregular blood pressure – to the retina and optic nerve head.[106] The first drug to reduce IOP, pilocarpine, was introduced in the 1870s; other major innovations in pharmacological glaucoma therapy were the introduction of beta blocker eye drops in the 1970s and of prostaglandin analogues and topical (locally administered) carbonic anhydrase inhibitors in the mid-1990s.. Early surgical techniques like iridectomy and fistulating methods have recently been supplemented by less invasive procedures like small implants, a range of options now widely called MIGS (micro-invasive glaucoma surgery).
### Etymology[edit]
The word "glaucoma" comes from the Ancient Greek γλαύκωμα,[107] a derivative of γλαυκóς,[108] which commonly described the color of eyes which were not dark (i.e. blue, green, light gray). Eyes described as γλαυκóς due to disease might have had a gray cataract in the Hippocratic era, or, in the early Common Era, the greenish pupillary hue sometimes seen in angle-closure glaucoma.[109][110]
## Research[edit]
Play media
Scientists track eye movements in glaucoma patients to check vision impairment while driving
### Rho kinase inhibitors[edit]
Rho kinase inhibitors, such as ripasudil, work by inhibition of the actin cytoskeleton, resulting in the morphological changes in the trabecular meshwork and increased aqueous outflow. More compounds in this class are being investigated in phase 2 and phase 3 trials.[111]
### Neuroprotective agents[edit]
A 2013 Cochrane Systematic Review compared the effect of brimonidine and timolol in slowing the progression of open angle glaucoma in adult participants.[112] The results showed that participants assigned to brimonidine showed less visual field progression than those assigned to timolol, though the results were not significant, given the heavy loss-to-followup and limited evidence.[112] The mean intraocular pressures for both groups were similar. Participants in the brimonidine group had a higher occurrence of side effects caused by medication than participants in the timolol group.[112]
### Cannabis[edit]
Studies in the 1970s reported that the use of cannabis may lower intraocular pressure.[113][114] In an effort to determine whether marijuana, or drugs derived from it, might be effective as a glaucoma treatment, the US National Eye Institute supported research studies from 1978 to 1984. These studies demonstrated some derivatives of marijuana lowered intraocular pressure when administered orally, intravenously, or by smoking, but not when topically applied to the eye.
In 2003, the American Academy of Ophthalmology released a position statement stating that cannabis was not more effective than prescription medications. Furthermore, no scientific evidence has been found that demonstrates increased benefits and/or diminished risks of cannabis use to treat glaucoma compared with the wide variety of pharmaceutical agents now available.[114][115]
In 2010 the American Glaucoma Society published a position paper discrediting the use of cannabis as a legitimate treatment for elevated intraocular pressure, for reasons including short duration of action and side effects that limit many activities of daily living.[116]
## References[edit]
1. ^ a b c d e f g h i j k l m n o "Facts About Glaucoma". National Eye Institute. Archived from the original on 28 March 2016. Retrieved 29 March 2016.
2. ^ a b c d e f g h i j k l m n o p q r s Mantravadi AV, Vadhar N (September 2015). "Glaucoma". Primary Care. 42 (3): 437–49. doi:10.1016/j.pop.2015.05.008. PMID 26319348.
3. ^ Ferri FF (2010). Ferri's differential diagnosis : a practical guide to the differential diagnosis of symptoms, signs, and clinical disorders (2nd ed.). Philadelphia, PA: Elsevier/Mosby. p. Chapter G. ISBN 978-0323076999.
4. ^ a b Vos, Theo; Allen, Christine; Arora, Megha; Barber, Ryan M.; Bhutta, Zulfiqar A.; Brown, Alexandria; Carter, Austin; Casey, Daniel C.; Charlson, Fiona J.; Chen, Alan Z.; Coggeshall, Megan; Cornaby, Leslie; Dandona, Lalit; Dicker, Daniel J.; Dilegge, Tina; Erskine, Holly E.; Ferrari, Alize J.; Fitzmaurice, Christina; Fleming, Tom; Forouzanfar, Mohammad H.; Fullman, Nancy; Gething, Peter W.; Goldberg, Ellen M.; Graetz, Nicholas; Haagsma, Juanita A.; Hay, Simon I.; Johnson, Catherine O.; Kassebaum, Nicholas J.; Kawashima, Toana; et al. (October 2016). "Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015". Lancet. 388 (10053): 1545–1602. doi:10.1016/S0140-6736(16)31678-6. PMC 5055577. PMID 27733282.
5. ^ Rhee DJ (2012). Glaucoma (2 ed.). Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins. p. 180. ISBN 9781609133375. OCLC 744299538.
6. ^ Mi XS, Yuan TF, So KF (16 September 2014). "The current research status of normal tension glaucoma". Clinical Interventions in Aging. 9: 1563–71. doi:10.2147/CIA.S67263. PMC 4172068. PMID 25258525.
7. ^ a b Vass C, Hirn C, Sycha T, Findl O, Bauer P, Schmetterer L (October 2007). "Medical interventions for primary open angle glaucoma and ocular hypertension". The Cochrane Database of Systematic Reviews (4): CD003167. doi:10.1002/14651858.CD003167.pub3. PMC 6768994. PMID 17943780.
8. ^ "Glaucoma: The 'silent thief' begins to tell its secrets" (Press release). National Eye Institute. 21 January 2014. Archived from the original on 23 July 2015.
9. ^ Resnikoff S, Pascolini D, Etya'ale D, Kocur I, Pararajasegaram R, Pokharel GP, Mariotti SP (November 2004). "Global data on visual impairment in the year 2002". Bulletin of the World Health Organization. 82 (11): 844–51. doi:10.1590/S0042-96862004001100009 (inactive 12 January 2021). PMC 2623053. PMID 15640920. Archived from the original on 12 December 2013.CS1 maint: DOI inactive as of January 2021 (link)
10. ^ GLOBAL DATA ON VISUAL IMPAIRMENTS 2010 (PDF). World Health Organization. 2010. p. 3.
11. ^ "Greek Dictionary Headword Search Results". www.perseus.tufts.edu. Retrieved 31 March 2020.
12. ^ Leffler CT, Schwartz SG, Stackhouse R, Davenport B, Spetzler K (December 2013). "Evolution and impact of eye and vision terms in written English". JAMA Ophthalmology. 131 (12): 1625–31. doi:10.1001/jamaophthalmol.2013.917. PMID 24337558. Archived from the original on 23 December 2014.
13. ^ Friedman NJ, Kaiser PK, II RP (2014). The Massachusetts Eye and Ear Infirmary Illustrated Manual of Ophthalmology E-Book. Elsevier Health Sciences. p. 234. ISBN 9780323225274.
14. ^ Sommer A, Tielsch JM, Katz J, Quigley HA, Gottsch JD, Javitt J, Singh K (August 1991). "Relationship between intraocular pressure and primary open angle glaucoma among white and black Americans. The Baltimore Eye Survey". Archives of Ophthalmology. 109 (8): 1090–5. doi:10.1001/archopht.1991.01080080050026. PMID 1867550.
15. ^ Kelly SR, Khawaja AP, Bryan SR, Azuara-Blanco A, Sparrow JM, Crabb DP (October 2020). "Progression from ocular hypertension to visual field loss in the English hospital eye service". The British Journal of Ophthalmology. 104 (10): 1406–1411. doi:10.1136/bjophthalmol-2019-315052. PMID 32217541.
16. ^ Gordon MO, Kass MA (May 2018). "What We Have Learned From the Ocular Hypertension Treatment Study". American Journal of Ophthalmology. 189: xxiv–xxvii. doi:10.1016/j.ajo.2018.02.016. PMC 5915899. PMID 29501371.
17. ^ a b Rhee DJ, Katz LJ, Spaeth GL, Myers JS (2001). "Complementary and alternative medicine for glaucoma". Survey of Ophthalmology. 46 (1): 43–55. doi:10.1016/S0039-6257(01)00233-8. PMID 11525790.
18. ^ Li M, Wang M, Guo W, Wang J, Sun X (March 2011). "The effect of caffeine on intraocular pressure: a systematic review and meta-analysis". Graefe's Archive for Clinical and Experimental Ophthalmology = Albrecht von Graefes Archiv für Klinische und Experimentelle Ophthalmologie. 249 (3): 435–42. doi:10.1007/s00417-010-1455-1. PMID 20706731. S2CID 668498.
19. ^ Wang N, Wu H, Fan Z (November 2002). "Primary angle closure glaucoma in Chinese and Western populations". Chinese Medical Journal. 115 (11): 1706–15. PMID 12609093. Archived from the original on 21 December 2016.
20. ^ Friedman DS, Vedula SS (July 2006). "Lens extraction for chronic angle-closure glaucoma". The Cochrane Database of Systematic Reviews. 3 (3): CD005555. doi:10.1002/14651858.CD005555.pub2. PMC 4438535. PMID 16856103.
21. ^ Yanoff M, Duker JS (2009). Ophthalmology (3rd ed.). Mosby Elsevier. p. 1096. ISBN 9780323043328.
22. ^ Online Mendelian Inheritance in Man (OMIM): Glaucoma, Primary Open Angle; POAG - 137760
23. ^ Fernández-Martínez L, Letteboer S, Mardin CY, Weisschuh N, Gramer E, Weber BH, et al. (April 2011). "Evidence for RPGRIP1 gene as risk factor for primary open angle glaucoma". European Journal of Human Genetics. 19 (4): 445–51. doi:10.1038/ejhg.2010.217. PMC 3060327. PMID 21224891.
24. ^ Online Mendelian Inheritance in Man (OMIM): Glaucoma, Normal Tension, Susceptibility to - 606657
25. ^ Pardianto G, et al. (2005). "Aqueous Flow and the Glaucoma". Mimbar Ilmiah Oftalmologi Indonesia. 2: 12–15.
26. ^ Chaum E, et al. "A 5-year-old girl who failed her school vision screening. Case presentation of Persistent fetal vasculature (PFV), also called persistent hyperplastic primary vitreous (PHPV)". Digital Journal of Ophthalmology. Archived from the original on 11 January 2009.
27. ^ Hunt A, Rowe N, Lam A, Martin F (July 2005). "Outcomes in persistent hyperplastic primary vitreous". The British Journal of Ophthalmology. 89 (7): 859–63. doi:10.1136/bjo.2004.053595. PMC 1772745. PMID 15965167.
28. ^ Chang B, Smith RS, Peters M, Savinova OV, Hawes NL, Zabaleta A, et al. (2001). "Haploinsufficient Bmp4 ocular phenotypes include anterior segment dysgenesis with elevated intraocular pressure". BMC Genetics. 2: 18. doi:10.1186/1471-2156-2-18. PMC 59999. PMID 11722794.
29. ^ Leo Puyo, Michel Paques, Michael Atlan (2020). "Retinal blood flow reversal in out-of-plane vessels imaged with laser Doppler holography". arXiv:2008.09813 [physics.med-ph].CS1 maint: uses authors parameter (link)
30. ^ Alguire P (1990). "The Eye Chapter 118 Tonometry>Basic Science". In Walker HK, Hall WD, Hurst JW (eds.). Clinical methods: the history, physical, and laboratory examinations (3rd ed.). London: Butterworths. ISBN 978-0-409-90077-4.
31. ^ Mozaffarieh M, Grieshaber MC, Flammer J (January 2008). "Oxygen and blood flow: players in the pathogenesis of glaucoma". Molecular Vision. 14: 224–33. PMC 2267728. PMID 18334938. Archived from the original on 9 June 2008.
32. ^ Jadeja RN, Thounaojam MC, Martin PM (2020). "Implications of NAD + Metabolism in the Aging Retina and Retinal Degeneration". Oxidative Medicine and Cellular Longevity. 2020: 2692794. doi:10.1155/2020/2692794. PMC 7238357. PMID 32454935.
33. ^ Osborne NN, Wood JP, Chidlow G, Bae JH, Melena J, Nash MS (August 1999). "Ganglion cell death in glaucoma: what do we really know?". The British Journal of Ophthalmology. 83 (8): 980–6. doi:10.1136/bjo.83.8.980. PMC 1723166. PMID 10413706.
34. ^ Levin LA, Peeples P (February 2008). "History of neuroprotection and rationale as a therapy for glaucoma". The American Journal of Managed Care. 14 (1 Suppl): S11-4. PMID 18284310. Archived from the original on 7 April 2012.
35. ^ Varma R, Peeples P, Walt JG, Bramley TJ (February 2008). "Disease progression and the need for neuroprotection in glaucoma management". The American Journal of Managed Care. 14 (1 Suppl): S15-9. PMID 18284311. Archived from the original on 7 April 2012.
36. ^ Hernández M, Urcola JH, Vecino E (May 2008). "Retinal ganglion cell neuroprotection in a rat model of glaucoma following brimonidine, latanoprost or combined treatments". Experimental Eye Research. 86 (5): 798–806. doi:10.1016/j.exer.2008.02.008. PMID 18394603.
37. ^ Cantor LB (December 2006). "Brimonidine in the treatment of glaucoma and ocular hypertension". Therapeutics and Clinical Risk Management. 2 (4): 337–46. doi:10.2147/tcrm.2006.2.4.337. PMC 1936355. PMID 18360646.
38. ^ Schwartz M (June 2007). "Modulating the immune system: a vaccine for glaucoma?". Canadian Journal of Ophthalmology. 42 (3): 439–41. doi:10.3129/I07-050. PMID 17508041.
39. ^ Morrison JC (2006). "Integrins in the optic nerve head: potential roles in glaucomatous optic neuropathy (an American Ophthalmological Society thesis)". Transactions of the American Ophthalmological Society. 104: 453–77. PMC 1809896. PMID 17471356.
40. ^ Knox DL, Eagle RC, Green WR (March 2007). "Optic nerve hydropic axonal degeneration and blocked retrograde axoplasmic transport: histopathologic features in human high-pressure secondary glaucoma". Archives of Ophthalmology. 125 (3): 347–53. doi:10.1001/archopht.125.3.347. PMID 17353405.
41. ^ Tezel G, Luo C, Yang X (March 2007). "Accelerated aging in glaucoma: immunohistochemical assessment of advanced glycation end products in the human retina and optic nerve head". Investigative Ophthalmology & Visual Science. 48 (3): 1201–11. doi:10.1167/iovs.06-0737. PMC 2492883. PMID 17325164.
42. ^ Berry FB, Mirzayans F, Walter MA (April 2006). "Regulation of FOXC1 stability and transcriptional activity by an epidermal growth factor-activated mitogen-activated protein kinase signaling cascade". The Journal of Biological Chemistry. 281 (15): 10098–104. doi:10.1074/jbc.M513629200. PMID 16492674.
43. ^ "Issue on neuroprotection". Can. J. Ophthalmol. 42 (3). June 2007. ISSN 1715-3360. Archived from the original on 12 May 2007.
44. ^ Farandos NM, Yetisen AK, Monteiro MJ, Lowe CR, Yun SH (April 2015). "Contact lens sensors in ocular diagnostics". Advanced Healthcare Materials. 4 (6): 792–810. doi:10.1002/adhm.201400504. PMID 25400274.
45. ^ a b c d Pardianto G, et al. (2006). "Some difficulties on Glaucoma". Mimbar Ilmiah Oftalmologi Indonesia. 3: 49–50.
46. ^ Thomas R, Parikh RS (September 2006). "How to assess a patient for glaucoma". Community Eye Health. 19 (59): 36–7. PMC 1705629. PMID 17491713.
47. ^ Michelessi M, Lucenteforte E, Oddone F, Brazzelli M, Parravano M, Franchi S, et al. (November 2015). "Optic nerve head and fibre layer imaging for diagnosing glaucoma". The Cochrane Database of Systematic Reviews. 11 (11): CD008803. doi:10.1002/14651858.CD008803.pub2. PMC 4732281. PMID 26618332.
48. ^ Thylefors B, Négrel AD (1994). "The global impact of glaucoma". Bulletin of the World Health Organization. 72 (3): 323–6. PMC 2486713. PMID 8062393.
49. ^ Johnson, Chris A. The use of a visual illusion to detect glaucoma. In Visual Perception: The Influence of H. W. Leibowitz, eds. Andre, J., Owens, D. A., and Harvey, Jr., L. O. (2003); 45–56. Washington, D.C.: The American Psychological Association.
50. ^ Foundation, G. R. (n.d.). "Five common Glaucoma Tests". Glaucoma.org. Archived from the original on 8 September 2017. Retrieved 20 February 2014.
51. ^ "Nerve Fiber Analysis". Glaucoma Associates of Texas. White Rabbit Communications, Inc. 2010. Archived from the original on 26 March 2013. Retrieved 9 December 2012.
52. ^ Paton D, Craig JA (1976). "Glaucomas. Diagnosis and management". Clinical Symposia. 28 (2): 1–47. PMID 1053095.
53. ^ Logan CM, Rice MK (1987). Logan's Medical and Scientific Abbreviations. Philadelphia: J. B. Lippincott Company. p. 3. ISBN 978-0-397-54589-6.
54. ^ a b "Primary Open-Angle Glaucoma: Glaucoma: Merck Manual Professional". Merck.com. Archived from the original on 28 November 2010. Retrieved 24 January 2011.
55. ^ Simha A, Aziz K, Braganza A, Abraham L, Samuel P, Lindsley KB (February 2020). "Anti-vascular endothelial growth factor for neovascular glaucoma". The Cochrane Database of Systematic Reviews. 2 (2): CD007920. doi:10.1002/14651858.CD007920.pub3. PMC 7003996. PMID 32027392.
56. ^ Pardianto G (2006). "Difficulties on glaucoma". Mimbar Ilmiah Oftalmologi Indonesia. 3: 48–9.
57. ^ Sit AJ (23 April 2006). "Many types of glaucoma, one kind of damage to optic nerve". Chicago Tribune. Archived from the original on 6 October 2012. Retrieved 18 August 2015. "Glaucoma is a broad term for a number of different conditions that damage the optic nerve, the 'cable' that carries visual information from the eye to the brain, thereby causing changes in vision."
58. ^ Jindal A, Ctori I, Virgili G, Lucenteforte E, Lawrenson JG (May 2020). "Non-contact tests for identifying people at risk of primary angle closure glaucoma". The Cochrane Database of Systematic Reviews. 5: CD012947. doi:10.1002/14651858.cd012947.pub2. PMC 7390269. PMID 32468576.
59. ^ "Types of Glaucoma | National Eye Institute". www.nei.nih.gov. Retrieved 25 October 2020.
60. ^ a b "Glaucoma". Parsons' diseases of the eye (22 ed.). Elsevier. 15 July 2015. pp. 288–295. ISBN 978-81-312-3818-9.
61. ^ John F S. "Glaucoma". Kanski's Clinical ophthalmology (9 ed.). Elsevier. pp. 362–365.
62. ^ Carroll JN, Johnson CA (22 August 2013). "Visual Field Testing: From One Medical Student to Another".
63. ^ a b c d e Khurana (31 August 2015). "Glaucoma". Comprehensive ophthalmology (6th ed.). Jaypee, The Health Sciences Publisher. pp. 223–224. ISBN 978-93-5152-657-5.
64. ^ "Retinitis pigmentosa". Genetics Home Reference.
65. ^ Themes UF (11 July 2016). "Visual Fields in Glaucoma". Ento Key.
66. ^ "Summaries for patients. Screening for glaucoma: U.S. Preventive Services Task Force recommendation statement". Annals of Internal Medicine. 159 (7): I-28. October 2013. doi:10.7326/0003-4819-159-6-201309170-00685. PMID 23836133.
67. ^ "Glaucoma – National Institutes of Health". Nihseniorhealth.gov. Archived from the original on 25 December 2010. Retrieved 24 January 2011.
68. ^ Noecker RJ (June 2006). "The management of glaucoma and intraocular hypertension: current approaches and recent advances". Therapeutics and Clinical Risk Management. 2 (2): 193–206. doi:10.2147/tcrm.2006.2.2.193. PMC 1661659. PMID 18360593.
69. ^ Parikh RS, Parikh SR, Navin S, Arun E, Thomas R (1 May 2008). "Practical approach to medical management of glaucoma". Indian Journal of Ophthalmology. 56 (3): 223–30. doi:10.4103/0301-4738.40362. PMC 2636120. PMID 18417824.
70. ^ Leffler CT, Amini L (October 2007). "Interpretation of uniocular and binocular trials of glaucoma medications: an observational case series". BMC Ophthalmology. 7: 17. doi:10.1186/1471-2415-7-17. PMC 2093925. PMID 17916260.
71. ^ Xu L, Wang X, Wu M (February 2017). "Topical medication instillation techniques for glaucoma". The Cochrane Database of Systematic Reviews. 2: CD010520. doi:10.1002/14651858.CD010520.pub2. PMC 5419432. PMID 28218404.
72. ^ Jaret P. "A New Understanding of Glaucoma". The New York Times. NYTimes.com. Archived from the original on 10 March 2014. Retrieved 20 February 2014.
73. ^ Ritch R (June 2007). "Natural compounds: evidence for a protective role in eye disease". Canadian Journal of Ophthalmology. 42 (3): 425–38. doi:10.3129/I07-044. PMID 17508040.
74. ^ Tsai JC, Song BJ, Wu L, Forbes M (September 2007). "Erythropoietin: a candidate neuroprotective agent in the treatment of glaucoma". Journal of Glaucoma. 16 (6): 567–71. doi:10.1097/IJG.0b013e318156a556. PMID 17873720. S2CID 27407031.
75. ^ Mozaffarieh M, Flammer J (November 2007). "Is there more to glaucoma treatment than lowering IOP?". Survey of Ophthalmology. 52 Suppl 2 (Suppl 2): S174-9. doi:10.1016/j.survophthal.2007.08.013. PMID 17998043.
76. ^ Online Mendelian Inheritance in Man (OMIM): Glaucoma, Congenital: GLC3 Buphthalmos - 231300
77. ^ Shingleton B, Tetz M, Korber N (March 2008). "Circumferential viscodilation and tensioning of Schlemm canal (canaloplasty) with temporal clear corneal phacoemulsification cataract surgery for open-angle glaucoma and visually significant cataract: one-year results". Journal of Cataract and Refractive Surgery. 34 (3): 433–40. doi:10.1016/j.jcrs.2007.11.029. PMID 18299068. S2CID 23904366.
78. ^ Lewis RA, von Wolff K, Tetz M, Korber N, Kearney JR, Shingleton B, Samuelson TW (July 2007). "Canaloplasty: circumferential viscodilation and tensioning of Schlemm's canal using a flexible microcatheter for the treatment of open-angle glaucoma in adults: interim clinical study analysis". Journal of Cataract and Refractive Surgery. 33 (7): 1217–26. doi:10.1016/j.jcrs.2007.03.051. PMID 17586378. S2CID 36397585.
79. ^ Dada T, Sharma R, Sinha G, Angmo D, Temkar S (2016). "Cyclodialysis-enhanced trabeculectomy with triple Ologen implantation". European Journal of Ophthalmology. 26 (1): 95–7. doi:10.5301/ejo.5000633. PMID 26044372. S2CID 83593.
80. ^ Yuan F, Li L, Chen X, Yan X, Wang L (2015). "Biodegradable 3D-Porous Collagen Matrix (Ologen) Compared with Mitomycin C for Treatment of Primary Open-Angle Glaucoma: Results at 5 Years". Journal of Ophthalmology. 2015 (637537): 637537. doi:10.1155/2015/637537. PMC 4452460. PMID 26078875.
81. ^ a b Tanuj D, Amit S, Saptorshi M, Meenakshi G (July 2013). "Combined subconjunctival and subscleral ologen implant insertion in trabeculectomy". Eye. 27 (7): 889. doi:10.1038/eye.2013.76. PMC 3709396. PMID 23640614.
82. ^ Cillino S, Casuccio A, Di Pace F, Cagini C, Ferraro LL, Cillino G (March 2016). "Biodegradable collagen matrix implant versus mitomycin-C in trabeculectomy: five-year follow-up". BMC Ophthalmology. 16 (24): 24. doi:10.1186/s12886-016-0198-0. PMC 4779569. PMID 26946419.
83. ^ "Eyelights Newsletter: About Glaucoma New Zealand" (PDF). Glaucoma.org. Archived (PDF) from the original on 13 January 2015. Retrieved 20 February 2014.
84. ^ Molteno AC, Polkinghorne PJ, Bowbyes JA (November 1986). "The vicryl tie technique for inserting a draining implant in the treatment of secondary glaucoma". Australian and New Zealand Journal of Ophthalmology. 14 (4): 343–54. doi:10.1111/j.1442-9071.1986.tb00470.x. PMID 3814422.
85. ^ Lewis RA (August 2014). "Ab interno approach to the subconjunctival space using a collagen glaucoma stent". Journal of Cataract and Refractive Surgery. 40 (8): 1301–6. doi:10.1016/j.jcrs.2014.01.032. PMID 24943904.
86. ^ "Xen Gel Stent". AqueSys. AqueSys. Archived from the original on 29 June 2015. Retrieved 27 June 2015.
87. ^ "Advances in Glaucoma Filtration Surgery". Glaucoma Today. Archived from the original on 29 June 2015. Retrieved 27 June 2015.
88. ^ Otarola F, Virgili G, Shah A, Hu K, Bunce C, Gazzard G (March 2020). "Ab interno trabecular bypass surgery with Schlemm´s canal microstent (Hydrus) for open angle glaucoma". The Cochrane Database of Systematic Reviews. 3: CD012740. doi:10.1002/14651858.cd012740.pub2. PMC 7061024. PMID 32147807.
89. ^ Rosentreter A, Schild AM, Dinslage S, Dietlein TS (February 2012). "Biodegradable implant for tissue repair after glaucoma drainage device surgery". Journal of Glaucoma. 21 (2): 76–8. doi:10.1097/IJG.0b013e3182027ab0. PMID 21278584. S2CID 40206358.
90. ^ a b Rosentreter A, Mellein AC, Konen WW, Dietlein TS (September 2010). "Capsule excision and Ologen implantation for revision after glaucoma drainage device surgery". Graefe's Archive for Clinical and Experimental Ophthalmology = Albrecht von Graefes Archiv für Klinische und Experimentelle Ophthalmologie. 248 (9): 1319–24. doi:10.1007/s00417-010-1385-y. PMID 20405139. S2CID 10384646.
91. ^ Chiselita D (April 2001). "Non-penetrating deep sclerectomy versus trabeculectomy in primary open-angle glaucoma surgery". Eye. 15 (Pt 2): 197–201. doi:10.1038/eye.2001.60. PMID 11339590.
92. ^ Ahmed IK (1 September 2005). "Making the Case for Nonpenetrating Surgery". Review of Ophthamology. 12 (9). Archived from the original on 11 October 2007.
93. ^ Aptel F, Dumas S, Denis P (2009). "Ultrasound biomicroscopy and optical coherence tomography imaging of filtering blebs after deep sclerectomy with new collagen implant". European Journal of Ophthalmology. 19 (2): 223–30. doi:10.1177/112067210901900208. PMID 19253238. S2CID 22594085.
94. ^ Matthew SJ, Sarkisian S, Nathan B, James MR (2012). "Initial experience using a collagen matrix implant (ologen) as a wound modulator with canaloplasty: 12 month results". Ft. Lauderdale: ARVO Congress.
95. ^ Anisimova SY, Anisimova SI, Larionov EV (2012). "Biological drainage – Xenoplast in glaucoma surgery (experimental and 10-year of clinical follow-up)" (PDF). Copenhagen: EGS Congress. Archived (PDF) from the original on 17 October 2013.
96. ^ Heijl A, Bengtsson B, Hyman L, Leske MC (December 2009). "Natural history of open-angle glaucoma". Ophthalmology (Submitted manuscript). 116 (12): 2271–6. doi:10.1016/j.ophtha.2009.06.042. PMID 19854514.
97. ^ "Glaucoma". Coopereyecare.com. 25 July 2013. Archived from the original on 13 December 2013. Retrieved 20 February 2014.
98. ^ "Death and DALY estimates for 2004 by cause for WHO Member States" (xls). World Health Organization. 2004. Archived from the original on 27 January 2012.
99. ^ a b c Quigley HA, Broman AT (March 2006). "The number of people with glaucoma worldwide in 2010 and 2020". The British Journal of Ophthalmology. 90 (3): 262–7. doi:10.1136/bjo.2005.081224. PMC 1856963. PMID 16488940.
100. ^ Sommer A, Tielsch JM, Katz J, Quigley HA, Gottsch JD, Javitt JC, et al. (November 1991). "Racial differences in the cause-specific prevalence of blindness in east Baltimore". The New England Journal of Medicine. 325 (20): 1412–7. doi:10.1056/NEJM199111143252004. PMID 1922252.
101. ^ "Glaucoma and Marijuana use". National Eye Institute. 21 June 2005. Archived from the original on 27 December 2009.
102. ^ Ramulu P (March 2009). "Glaucoma and disability: which tasks are affected, and at what stage of disease?". Current Opinion in Ophthalmology. 20 (2): 92–8. doi:10.1097/ICU.0b013e32832401a9. PMC 2692230. PMID 19240541.
103. ^ Akbari M, Akbari S, Pasquale LR (February 2009). "The association of primary open-angle glaucoma with mortality: a meta-analysis of observational studies". Archives of Ophthalmology. 127 (2): 204–10. doi:10.1001/archophthalmol.2008.571. PMID 19204241.
104. ^ Bannister R (1622). Treatise of One Hundred and Thirteen Diseases of the Eyes and Eyelids. London.
105. ^ Leffler CT, Schwartz SG, Wainsztein RD, Pflugrath A, Peterson E (2017). "Ophthalmology in North America: Early Stories (1491-1801)". Ophthalmology and Eye Diseases. 9: 1179172117721902. doi:10.1177/1179172117721902. PMC 5533269. PMID 28804247.
106. ^ Albert D, Edwards D (1996). The History of Ophthalmologist. Cambridge, Mass.
107. ^ Harper, Douglas. "glaucoma". Online Etymology Dictionary.
108. ^ γλαυκός in Liddell and Scott.
109. ^ Leffler CT, Schwartz SG, Giliberti FM, Young MT, Bermudez D (2015). "What was Glaucoma Called Before the 20th Century?". Ophthalmology and Eye Diseases. 7: 21–33. doi:10.4137/OED.S32004. PMC 4601337. PMID 26483611. Archived from the original on 23 April 2016.
110. ^ Leffler CT, Schwartz SG, Hadi TM, Salman A, Vasuki V (2015). "The early history of glaucoma: the glaucous eye (800 BC to 1050 AD)". Clinical Ophthalmology. 9: 207–15. doi:10.2147/OPTH.S77471. PMC 4321651. PMID 25673972. Archived from the original on 26 February 2015.
111. ^ Wang SK, Chang RT (2014). "An emerging treatment option for glaucoma: Rho kinase inhibitors". Clinical Ophthalmology. 8: 883–90. doi:10.2147/OPTH.S41000. PMC 4025933. PMID 24872673.
112. ^ a b c Sena DF, Lindsley K (January 2017). "Neuroprotection for treatment of glaucoma in adults". The Cochrane Database of Systematic Reviews. 1: CD006539. doi:10.1002/14651858.CD006539.pub4. PMC 5370094. PMID 28122126.
113. ^ Joy JE, Watson Jr SJ, Benson Jr JA (1999). Joy JE, Watson SJ Jr, Benson JA (eds.). Marijuana and Medicine: Assessing the Science Base. Nap.edu. doi:10.17226/6376. ISBN 978-0-309-07155-0. PMID 25101425. Retrieved 20 February 2014.
114. ^ a b "Complementary Therapy Assessment: Marijuana in the Treatment of Glaucoma". American Academy of Ophthalmology. Retrieved 4 May 2011.
115. ^ "Complementary Therapy Assessments : American Academy of Ophthalmology". One.aao.org. Retrieved 24 January 2011.
116. ^ Jampel H (February 2010). "American glaucoma society position statement: marijuana and the treatment of glaucoma". Journal of Glaucoma. 19 (2): 75–6. doi:10.1097/IJG.0b013e3181d12e39. PMID 20160576. S2CID 40362575.
## External links[edit]
* Medicine portal
* Glaucoma at Curlie
* GeneReview/NCBI/NIH/UW entry on Primary Congenital Glaucoma
Classification
D
* ICD-10: H40-H42
* ICD-9-CM: 365
* MeSH: D005901
* DiseasesDB: 5226
External resources
* MedlinePlus: 001620
* eMedicine: oph/578
* v
* t
* e
* Diseases of the human eye
Adnexa
Eyelid
Inflammation
* Stye
* Chalazion
* Blepharitis
* Entropion
* Ectropion
* Lagophthalmos
* Blepharochalasis
* Ptosis
* Blepharophimosis
* Xanthelasma
* Ankyloblepharon
Eyelash
* Trichiasis
* Madarosis
Lacrimal apparatus
* Dacryoadenitis
* Epiphora
* Dacryocystitis
* Xerophthalmia
Orbit
* Exophthalmos
* Enophthalmos
* Orbital cellulitis
* Orbital lymphoma
* Periorbital cellulitis
Conjunctiva
* Conjunctivitis
* allergic
* Pterygium
* Pseudopterygium
* Pinguecula
* Subconjunctival hemorrhage
Globe
Fibrous tunic
Sclera
* Scleritis
* Episcleritis
Cornea
* Keratitis
* herpetic
* acanthamoebic
* fungal
* Exposure
* Photokeratitis
* Corneal ulcer
* Thygeson's superficial punctate keratopathy
* Corneal dystrophy
* Fuchs'
* Meesmann
* Corneal ectasia
* Keratoconus
* Pellucid marginal degeneration
* Keratoglobus
* Terrien's marginal degeneration
* Post-LASIK ectasia
* Keratoconjunctivitis
* sicca
* Corneal opacity
* Corneal neovascularization
* Kayser–Fleischer ring
* Haab's striae
* Arcus senilis
* Band keratopathy
Vascular tunic
* Iris
* Ciliary body
* Uveitis
* Intermediate uveitis
* Hyphema
* Rubeosis iridis
* Persistent pupillary membrane
* Iridodialysis
* Synechia
Choroid
* Choroideremia
* Choroiditis
* Chorioretinitis
Lens
* Cataract
* Congenital cataract
* Childhood cataract
* Aphakia
* Ectopia lentis
Retina
* Retinitis
* Chorioretinitis
* Cytomegalovirus retinitis
* Retinal detachment
* Retinoschisis
* Ocular ischemic syndrome / Central retinal vein occlusion
* Central retinal artery occlusion
* Branch retinal artery occlusion
* Retinopathy
* diabetic
* hypertensive
* Purtscher's
* of prematurity
* Bietti's crystalline dystrophy
* Coats' disease
* Sickle cell
* Macular degeneration
* Retinitis pigmentosa
* Retinal haemorrhage
* Central serous retinopathy
* Macular edema
* Epiretinal membrane (Macular pucker)
* Vitelliform macular dystrophy
* Leber's congenital amaurosis
* Birdshot chorioretinopathy
Other
* Glaucoma / Ocular hypertension / Primary juvenile glaucoma
* Floater
* Leber's hereditary optic neuropathy
* Red eye
* Globe rupture
* Keratomycosis
* Phthisis bulbi
* Persistent fetal vasculature / Persistent hyperplastic primary vitreous
* Persistent tunica vasculosa lentis
* Familial exudative vitreoretinopathy
Pathways
Optic nerve
Optic disc
* Optic neuritis
* optic papillitis
* Papilledema
* Foster Kennedy syndrome
* Optic atrophy
* Optic disc drusen
Optic neuropathy
* Ischemic
* anterior (AION)
* posterior (PION)
* Kjer's
* Leber's hereditary
* Toxic and nutritional
Strabismus
Extraocular muscles
Binocular vision
Accommodation
Paralytic strabismus
* Ophthalmoparesis
* Chronic progressive external ophthalmoplegia
* Kearns–Sayre syndrome
palsies
* Oculomotor (III)
* Fourth-nerve (IV)
* Sixth-nerve (VI)
Other strabismus
* Esotropia / Exotropia
* Hypertropia
* Heterophoria
* Esophoria
* Exophoria
* Cyclotropia
* Brown's syndrome
* Duane syndrome
Other binocular
* Conjugate gaze palsy
* Convergence insufficiency
* Internuclear ophthalmoplegia
* One and a half syndrome
Refraction
* Refractive error
* Hyperopia
* Myopia
* Astigmatism
* Anisometropia / Aniseikonia
* Presbyopia
Vision disorders
Blindness
* Amblyopia
* Leber's congenital amaurosis
* Diplopia
* Scotoma
* Color blindness
* Achromatopsia
* Dichromacy
* Monochromacy
* Nyctalopia
* Oguchi disease
* Blindness / Vision loss / Visual impairment
Anopsia
* Hemianopsia
* binasal
* bitemporal
* homonymous
* Quadrantanopia
subjective
* Asthenopia
* Hemeralopia
* Photophobia
* Scintillating scotoma
Pupil
* Anisocoria
* Argyll Robertson pupil
* Marcus Gunn pupil
* Adie syndrome
* Miosis
* Mydriasis
* Cycloplegia
* Parinaud's syndrome
Other
* Nystagmus
* Childhood blindness
Infections
* Trachoma
* Onchocerciasis
Authority control
* BNE: XX529246
* BNF: cb11935553n (data)
* GND: 4021210-5
* LCCN: sh85055227
* NDL: 00569850
* NSK: 000103201
* SUDOC: 027278808
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
|
Glaucoma
|
c0017601
| 8,574 |
wikipedia
|
https://en.wikipedia.org/wiki/Glaucoma
| 2021-01-18T18:58:33 |
{"mesh": ["D005901"], "umls": ["C0017601"], "icd-9": ["365365"], "icd-10": ["H4040.-H4242."], "wikidata": ["Q159701"]}
|
Cancer of the myeloid line of blood cells
Acute myeloid leukemia
Other namesAcute myelogenous leukemia, acute nonlymphocytic leukemia (ANLL), acute myeloblastic leukemia, acute granulocytic leukemia[1]
Bone marrow aspirate showing acute myeloid leukemia, arrows indicate Auer rods
SpecialtyHematology, oncology
SymptomsFeeling tired, shortness of breath, easy bruising and bleeding, increased risk of infection[1]
Usual onsetAll ages, most frequently ~65–75 years old[2]
Risk factorsSmoking, previous chemotherapy or radiation therapy, myelodysplastic syndrome, benzene[1]
Diagnostic methodBone marrow aspiration, blood test[3]
TreatmentChemotherapy, radiation therapy, stem cell transplant[1][3]
PrognosisFive-year survival ~27% (US)[2]
Frequency1 million (2015)[4]
Deaths147,100 (2015)[5]
Acute myeloid leukemia (AML) is a cancer of the myeloid line of blood cells, characterized by the rapid growth of abnormal cells that build up in the bone marrow and blood and interfere with normal blood cell production.[1] Symptoms may include feeling tired, shortness of breath, easy bruising and bleeding, and increased risk of infection.[1] Occasionally, spread may occur to the brain, skin, or gums.[1] As an acute leukemia, AML progresses rapidly and is typically fatal within weeks or months if left untreated.[1][6]
Risk factors include smoking, previous chemotherapy or radiation therapy, myelodysplastic syndrome, and exposure to the chemical benzene.[1] The underlying mechanism involves replacement of normal bone marrow with leukemia cells, which results in a drop in red blood cells, platelets, and normal white blood cells.[1] Diagnosis is generally based on bone marrow aspiration and specific blood tests.[3] AML has several subtypes for which treatments and outcomes may vary.[1]
AML typically is initially treated with chemotherapy, with the aim of inducing remission.[1] People may then go on to receive additional chemotherapy, radiation therapy, or a stem cell transplant.[1][3] The specific genetic mutations present within the cancer cells may guide therapy, as well as determine how long that person is likely to survive.[3]
In 2015, AML affected about one million people and resulted in 147,000 deaths globally.[4][5] It most commonly occurs in older adults.[2] Males are affected more often than females.[2] The five-year survival rate is about 35% in people under 60 years old and 10% in people over 60 years old.[3] Older people whose health is too poor for intensive chemotherapy have a typical survival of five to ten months.[3] It accounts for roughly 1.8% of cancer deaths in the United States.[2]
## Contents
* 1 Signs and symptoms
* 2 Risk factors
* 2.1 Other blood disorders
* 2.2 Chemical exposure
* 2.3 Radiation
* 2.4 Genetics
* 3 Diagnosis
* 3.1 World Health Organization
* 3.2 French-American-British
* 4 Pathophysiology
* 5 Treatment
* 5.1 Induction
* 5.2 Consolidation
* 5.3 Relapsed AML
* 5.4 Supportive treatment
* 5.5 Side effects
* 6 Prognosis
* 6.1 Cytogenetics
* 6.2 Myelodysplastic syndrome
* 6.3 Other prognostic markers
* 6.3.1 Genotype
* 6.4 Expectation of cure
* 6.5 Relapse
* 7 Epidemiology
* 8 History
* 9 Pregnancy
* 10 References
* 11 External links
## Signs and symptoms[edit]
Diffusely swollen gums due to infiltration by leukemic cells in a person with AML
Most signs and symptoms of AML are caused by the replacement of normal blood cells with leukemic cells. A lack of normal white blood cell production makes people more susceptible to infections; while the leukemic cells themselves are derived from white blood cell precursors, they have no infection-fighting capacity.[7] A drop in red blood cell count (anemia) can cause fatigue, paleness, and shortness of breath. A lack of platelets can lead to easy bruising or bleeding with minor trauma.
The early signs of AML are often vague and nonspecific, and may be similar to those of influenza or other common illnesses. Some generalized symptoms include fever, fatigue, weight loss or loss of appetite, shortness of breath, anemia, easy bruising or bleeding, petechiae (flat, pin-head sized spots under the skin caused by bleeding), bone and joint pain, and persistent or frequent infections.[7]
Enlargement of the spleen may occur in AML, but it is typically mild and asymptomatic. Lymph node swelling is rare in AML, in contrast to acute lymphoblastic leukemia. The skin is involved about 10% of the time in the form of leukemia cutis. Rarely, Sweet's syndrome, a paraneoplastic inflammation of the skin, can occur with AML.[7]
Some people with AML may experience swelling of the gums because of infiltration of leukemic cells into the gum tissue. Rarely, the first sign of leukemia may be the development of a solid leukemic mass or tumor outside of the bone marrow, called a chloroma. Occasionally, a person may show no symptoms, and the leukemia may be discovered incidentally during a routine blood test.[8]
## Risk factors[edit]
A number of risk factors for developing AML have been identified, including: other blood disorders, chemical exposures, ionizing radiation, and genetics.
### Other blood disorders[edit]
"Preleukemic" blood disorders, such as myelodysplastic syndrome (MDS) or myeloproliferative neoplasms (MPN), can evolve into AML; the exact risk depends on the type of MDS/MPN.[9] The presence of asymptomatic clonal hematopoiesis also raises the risk of transformation into AML to 0.5–1.0% per year.[10]
### Chemical exposure[edit]
Exposure to anticancer chemotherapy, in particular alkylating agents, can increase the risk of subsequently developing AML. The risk is highest about three to five years after chemotherapy.[11] Other chemotherapy agents, specifically epipodophyllotoxins and anthracyclines, have also been associated with treatment-related leukemias, which are often associated with specific chromosomal abnormalities in the leukemic cells.[12]
Occupational chemical exposure to benzene and other aromatic organic solvents is controversial as a cause of AML. Benzene and many of its derivatives are known to be carcinogenic in vitro. While some studies have suggested a link between occupational exposure to benzene and increased risk of AML,[13] others have suggested the attributable risk, if any, is slight.[14]
### Radiation[edit]
High amounts of ionizing radiation exposure can increase the risk of AML. Survivors of the atomic bombings of Hiroshima and Nagasaki had an increased rate of AML,[15] as did radiologists exposed to high levels of X-rays prior to the adoption of modern radiation safety practices.[16] People treated with ionizing radiation after treatment for prostate cancer, non-Hodgkin lymphoma, lung cancer, and breast cancer have the highest chance of acquiring AML, but this increased risk returns to the background risk observed in the general population after 12 years.[17]
### Genetics[edit]
A hereditary risk for AML appears to exist. Multiple cases of AML developing in a family at a rate higher than predicted by chance alone have been reported.[18][19][20][21] Several congenital conditions may increase the risk of leukemia; the most common is probably Down syndrome, which is associated with a 10- to 18-fold increase in the risk of AML.[22] In a second example, inactivating mutations in one of the two parental GATA2 genes lead to a reduction, i.e. a haploinsufficiency, in the cellular levels of the gene's product, the GATA2 transcription factor, and thereby to a rare autosomal dominant genetic disease, GATA2 deficiency. This disease is associated with a highly variable set of disorders including an exceedingly high risk of developing AML.[23][24] The specific genetic abnormalities causing AML usually vary between those who develop the disease as a child versus an adult.[25] However, GATA2 deficiency-induced AML may first appear in children or adults.[24]
## Diagnosis[edit]
Bone marrow: myeloblasts with Auer rods seen in AML
The first clue to a diagnosis of AML is typically an abnormal result on a complete blood count. While an excess of abnormal white blood cells (leukocytosis) is a common finding with the leukemia, and leukemic blasts are sometimes seen, AML can also present with isolated decreases in platelets, red blood cells, or even with a low white blood cell count (leukopenia).[26] While a presumptive diagnosis of AML can be made by examination of the peripheral blood smear when there are circulating leukemic blasts, a definitive diagnosis usually requires an adequate bone marrow aspiration and biopsy as well as ruling out pernicious anemia (Vitamin B12 deficiency), folic acid deficiency and copper deficiency.[27][28][29][30]
Marrow or blood is examined under light microscopy, as well as flow cytometry, to diagnose the presence of leukemia, to differentiate AML from other types of leukemia (e.g. acute lymphoblastic leukemia – ALL), and to classify the subtype of disease. A sample of marrow or blood is typically also tested for chromosomal abnormalities by routine cytogenetics or fluorescent in situ hybridization. Genetic studies may also be performed to look for specific mutations in genes such as FLT3, nucleophosmin, and KIT, which may influence the outcome of the disease.[31]
Cytochemical stains on blood and bone marrow smears are helpful in the distinction of AML from ALL, and in subclassification of AML. The combination of a myeloperoxidase or Sudan black stain and a nonspecific esterase stain will provide the desired information in most cases. The myeloperoxidase or Sudan black reactions are most useful in establishing the identity of AML and distinguishing it from ALL. The nonspecific esterase stain is used to identify a monocytic component in AMLs and to distinguish a poorly differentiated monoblastic leukemia from ALL.[32]
The diagnosis and classification of AML can be challenging, and should be performed by a qualified hematopathologist or hematologist. In straightforward cases, the presence of certain morphologic features (such as Auer rods) or specific flow cytometry results can distinguish AML from other leukemias; however, in the absence of such features, diagnosis may be more difficult.[33]
The two most commonly used classification schemata for AML are the older French-American-British (FAB) system and the newer World Health Organization (WHO) system. According to the widely used WHO criteria, the diagnosis of AML is established by demonstrating involvement of more than 20% of the blood and/or bone marrow by leukemic myeloblasts, except in the three best prognosis forms of acute myeloid leukemia with recurrent genetic abnormalities (t(8;21), inv(16), and t(15;17)) in which the presence of the genetic abnormality is diagnostic irrespective of blast percent.[34][35] The FAB classification is a bit more stringent, requiring a blast percentage of at least 30% in bone marrow or peripheral blood for the diagnosis of AML.[36] AML must be carefully differentiated from "preleukemic" conditions such as myelodysplastic or myeloproliferative syndromes, which are treated differently.
Because acute promyelocytic leukemia (APL) has the highest curability and requires a unique form of treatment, it is important to quickly establish or exclude the diagnosis of this subtype of leukemia. Fluorescent in situ hybridization performed on blood or bone marrow is often used for this purpose, as it readily identifies the chromosomal translocation [t(15;17)(q22;q12);] that characterizes APL. There is also a need to molecularly detect the presence of PML/RARA fusion protein, which is an oncogenic product of that translocation.[37]
### World Health Organization[edit]
The WHO 2008 classification of AML attempts to be more clinically useful and to produce more meaningful prognostic information than the FAB criteria. Each of the WHO categories contains numerous descriptive subcategories of interest to the hematopathologist and oncologist; however, most of the clinically significant information in the WHO schema is communicated via categorization into one of the subtypes listed below.
The WHO subtypes of AML are:[38]
Name Description ICD-O
Acute myeloid leukemia with recurrent genetic abnormalities Includes:
* AML with translocations between chromosome 8 and 21 – [t(8;21)(q22;q22);] RUNX1/RUNX1T1; (ICD-O 9896/3);
* AML with inversions in chromosome 16 – [inv(16)(p13.1q22)] or internal translocations in it – [t(16;16)(p13.1;q22);] CBFB/MYH11; (ICD-O 9871/3);
* Acute promyelocytic leukemia with translocations between chromosome 15 and 17 – [t(15;17)(q22;q12);] RARA/PML; (ICD-O 9866/3);
* AML with translocations between chromosome 9 and 11 – [t(9;11)(p22;q23);] MLLT3/MLL;
* AML with translocations between chromosome 6 and 9 – [t(6;9)(p23;q34);] DEK/NUP214;
* AML with inversions in chromosome 3 – [inv(3)(q21q26.2)] or internal translocations in it – [t(3;3)(q21;q26.2);] RPN1/EVI1;
* Megakaryoblastic AML with translocations between chromosome 1 and 22 – [t(1;22)(p13;q13);] RBM15/MKL1;
* AML with mutated NPM1
* AML with mutated CEBPA
Multiple
AML with myelodysplasia-related changes This category includes people who have had a prior documented myelodysplastic syndrome (MDS) or myeloproliferative disease (MPD) that then has transformed into AML, or who have cytogenetic abnormalities characteristic for this type of AML (with previous history of MDS or MPD that has gone unnoticed in the past, but the cytogenetics is still suggestive of MDS/MPD history). This category of AML occurs most often in elderly people and often has a worse prognosis. Includes:
* AML with complex karyotype
* Unbalanced abnormalities
* AML with deletions of chromosome 7 – [del(7q);]
* AML with deletions of chromosome 5 – [del(5q);]
* AML with unbalanced chromosomal aberrations in chromosome 17 – [i(17q)/t(17p);]
* AML with deletions of chromosome 13 – [del(13q);]
* AML with deletions of chromosome 11 – [del(11q);]
* AML with unbalanced chromosomal aberrations in chromosome 12 – [del(12p)/t(12p);]
* AML with deletions of chromosome 9 – [del(9q);]
* AML with aberrations in chromosome X – [idic(X)(q13);]
* Balanced abnormalities
* AML with translocations between chromosome 11 and 16 – [t(11;16)(q23;q13.3);], unrelated to previous chemotherapy or ionizing radiation
* AML with translocations between chromosome 3 and 21 – [t(3;21)(q26.2;q22.1);], unrelated to previous chemotherapy or ionizing radiation
* AML with translocations between chromosome 1 and 3 – [t(1;3)(p36.3;q21.1);]
* AML with translocations between chromosome 2 and 11 – [t(2;11)(p21;q23);], unrelated to previous chemotherapy or ionizing radiation
* AML with translocations between chromosome 5 and 12 – [t(5;12)(q33;p12);]
* AML with translocations between chromosome 5 and 7 – [t(5;7)(q33;q11.2);]
* AML with translocations between chromosome 5 and 17 – [t(5;17)(q33;p13);]
* AML with translocations between chromosome 5 and 10 – [t(5;10)(q33;q21);]
* AML with translocations between chromosome 3 and 5 – [t(3;5)(q25;q34);]
M9895/3
Therapy-related myeloid neoplasms This category includes people who have had prior chemotherapy and/or radiation and subsequently develop AML or MDS. These leukemias may be characterized by specific chromosomal abnormalities, and often carry a worse prognosis. M9920/3
Myeloid sarcoma This category includes myeloid sarcoma.
Myeloid proliferations related to Down syndrome This category includes so-called "transient abnormal myelopoiesis" and "myeloid leukemia associated with Down syndrome"
Blastic plasmacytoid dendritic cell neoplasm This category includes so-called "blastic plasmacytoid dendritic cell neoplasm"
AML not otherwise categorized Includes subtypes of AML that do not fall into the above categories
* AML with minimal differentiation
* AML without maturation
* AML with maturation
* Acute myelomonocytic leukemia
* Acute monoblastic and monocytic leukemia
* Acute erythroid leukemia
* Acute megakaryoblastic leukemia
* Acute basophilic leukemia
* Acute panmyelosis with myelofibrosis
M9861/3
Acute leukemias of ambiguous lineage (also known as mixed phenotype or biphenotypic acute leukemia) occur when the leukemic cells can not be classified as either myeloid or lymphoid cells, or where both types of cells are present.
### French-American-British[edit]
The French-American-British (FAB) classification system divides AML into eight subtypes, M0 through to M7, based on the type of cell from which the leukemia developed and its degree of maturity. AML of types M0 to M2 may be called acute myeloblastic leukemia. Classification is done by examining the appearance of the malignant cells with light microscopy and/or by using cytogenetics to characterize any underlying chromosomal abnormalities. The subtypes have varying prognoses and responses to therapy. Although the WHO classification (see above) may be more useful, the FAB system is still widely used.
Six FAB subtypes (M1 through to M6) were initially proposed in 1976,[39] although later revisions added M7 in 1985[40] and M0 in 1987.[41]
Type Name Cytogenetics Percentage of adults with AML Immunophenotype[42]
CD14 CD15 CD33 HLA-DR Other
M0 acute myeloblastic leukemia, minimally differentiated 5%[43] − [44] − [44] \+ [44] \+ [44] MPO − [45]
M1 acute myeloblastic leukemia, without maturation 15%[43] − − \+ \+ MPO \+ [45]
M2 acute myeloblastic leukemia, with granulocytic maturation t(8;21)(q22;q22), t(6;9) 25%[43] − \+ \+ \+
M3 promyelocytic, or acute promyelocytic leukemia (APL) t(15;17) 10%[43] − \+ \+ −
M4 acute myelomonocytic leukemia inv(16)(p13q22), del(16q) 20%[43] <45% \+ \+ \+
M4eo myelomonocytic together with bone marrow eosinophilia inv(16), t(16;16) 5%[43] +/− [46] \+ [47] \+ [47] CD2\+ [47]
M5 acute monoblastic leukemia (M5a) or acute monocytic leukemia (M5b) del (11q), t(9;11), t(11;19) 10%[43] >55% \+ \+ \+
M6 acute erythroid leukemias, including erythroleukemia (M6a) and very rare pure erythroid leukemia (M6b) 5%[43] − +/− +/− +/− Glycophorin \+
M7 acute megakaryoblastic leukemia t(1;22) 5%[43] − − \+ +/− CD41/CD61\+
The morphologic subtypes of AML also include rare types not included in the FAB system, such as acute basophilic leukemia, which was proposed as a ninth subtype, M8, in 1999.[48]
## Pathophysiology[edit]
Diagram showing the cells where AML develops.
The malignant cell in AML is the myeloblast. In normal hematopoiesis, the myeloblast is an immature precursor of myeloid white blood cells; a normal myeloblast will gradually mature into a mature white blood cell. In AML, though, a single myeloblast accumulates genetic changes which "freeze" the cell in its immature state and prevent differentiation.[49] Such a mutation alone does not cause leukemia; however, when such a "differentiation arrest" is combined with other mutations which disrupt genes controlling proliferation, the result is the uncontrolled growth of an immature clone of cells, leading to the clinical entity of AML.[50]
Much of the diversity and heterogeneity of AML is because leukemic transformation can occur at a number of different steps along the differentiation pathway.[51] Modern classification schemes for AML recognize that the characteristics and behavior of the leukemic cell (and the leukemia) may depend on the stage at which differentiation was halted.
Specific cytogenetic abnormalities can be found in many people with AML; the types of chromosomal abnormalities often have prognostic significance.[52] The chromosomal translocations encode abnormal fusion proteins, usually transcription factors whose altered properties may cause the "differentiation arrest".[53] For example, in APL, the t(15;17) translocation produces a PML-RARA fusion protein which binds to the retinoic acid receptor element in the promoters of several myeloid-specific genes and inhibits myeloid differentiation.[54]
The clinical signs and symptoms of AML result from the growth of leukemic clone cells, which tends to interfere with the development of normal blood cells in the bone marrow.[55] This leads to neutropenia, anemia, and thrombocytopenia. The symptoms of AML are, in turn, often due to the low numbers of these normal blood elements. In rare cases, people with AML can develop a chloroma, or solid tumor of leukemic cells outside the bone marrow, which can cause various symptoms depending on its location.[7]
An important pathophysiological mechanism of leukemogenesis in AML is the epigenetic induction of dedifferentiation by genetic mutations that alter the function of epigenetic enzymes, such as the DNA demethylase TET2 and the metabolic enzymes IDH1 and IDH2,[56] which lead to the generation of a novel oncometabolite, D-2-hydroxyglutarate, which inhibits the activity of epigenetic enzymes such as TET2.[57] The hypothesis is that such epigenetic mutations lead to the silencing of tumor suppressor genes and/or the activation of proto-oncogenes.[58]
## Treatment[edit]
First-line treatment of AML consists primarily of chemotherapy, and is divided into two phases: induction and postremission (or consolidation) therapy. The goal of induction therapy is to achieve a complete remission by reducing the number of leukemic cells to an undetectable level; the goal of consolidation therapy is to eliminate any residual undetectable disease and achieve a cure.[59] Hematopoietic stem cell transplantation is usually considered if induction chemotherapy fails or after a person relapses, although transplantation is also sometimes used as front-line therapy for people with high-risk disease. Efforts to use tyrosine kinase inhibitors in AML continue.[60]
### Induction[edit]
All FAB subtypes except M3 are usually given induction chemotherapy with cytarabine (ara-C) and an anthracycline (most often daunorubicin).[61] This induction chemotherapy regimen is known as "7+3" (or "3+7"), because the cytarabine is given as a continuous IV infusion for seven consecutive days while the anthracycline is given for three consecutive days as an IV push. Up to 70% of people with AML will achieve a remission with this protocol.[62] Other alternative induction regimens, including high-dose cytarabine alone, FLAG-like regimens or investigational agents, may also be used.[63][64] Because of the toxic effects of therapy, including myelosuppression and an increased risk of infection, induction chemotherapy may not be offered to the very elderly, and the options may include less intense chemotherapy or palliative care.
The M3 subtype of AML, also known as acute promyelocytic leukemia (APL), is treated with either arsenic trioxide (ATO) monotherapy,[65][66] or the drug all-trans-retinoic acid (ATRA) in addition to induction chemotherapy, usually an anthracycline.[67][68][69] Care must be taken to prevent disseminated intravascular coagulation (DIC), complicating the treatment of APL when the promyelocytes release the contents of their granules into the peripheral circulation. APL is eminently curable, with well-documented treatment protocols.
The goal of the induction phase is to reach a complete remission. Complete remission does not mean the disease has been cured; rather, it signifies no disease can be detected with available diagnostic methods.[61] Complete remission is obtained in about 50%–75% of newly diagnosed adults, although this may vary based on the prognostic factors described above.[70] The length of remission depends on the prognostic features of the original leukemia. In general, all remissions will fail without additional consolidation therapy.[71]
There is insufficient evidence to determine if prescribing all-trans retinoic acid (ATRA) in addition to chemotherapy to adults that suffer from acute myeloid leukaemia is helpful.[72]
### Consolidation[edit]
Even after complete remission is achieved, leukemic cells likely remain in numbers too small to be detected with current diagnostic techniques. If no further postremission or consolidation therapy is given, almost all people with AML will eventually relapse.[71] Therefore, more therapy is necessary to eliminate nondetectable disease and prevent relapse – that is, to achieve a cure.
The specific type of postremission therapy is individualized based on a person's prognostic factors (see above) and general health. For good-prognosis leukemias (i.e. inv(16), t(8;21), and t(15;17)), people will typically undergo an additional three to five courses of intensive chemotherapy, known as consolidation chemotherapy.[73][74] For people at high risk of relapse (e.g. those with high-risk cytogenetics, underlying MDS, or therapy-related AML), allogeneic stem cell transplantation is usually recommended if the person is able to tolerate a transplant and has a suitable donor. The best postremission therapy for intermediate-risk AML (normal cytogenetics or cytogenetic changes not falling into good-risk or high-risk groups) is less clear and depends on the specific situation, including the age and overall health of the person, the person's values, and whether a suitable stem cell donor is available.[74]
For people who are not eligible for a stem cell transplant, immunotherapy with a combination of histamine dihydrochloride (Ceplene) and interleukin 2 (Proleukin) after the completion of consolidation has been shown to reduce the absolute relapse risk by 14%, translating to a 50% increase in the likelihood of maintained remission.[75]
### Relapsed AML[edit]
For people with relapsed AML, the only proven potentially curative therapy is a hematopoietic stem cell transplant, if one has not already been performed.[76][77][78] In 2000, the monoclonal antibody-linked cytotoxic agent gemtuzumab ozogamicin (Mylotarg) was approved in the United States for people aged more than 60 years with relapsed AML who are not candidates for high-dose chemotherapy.[79] This drug was voluntarily withdrawn from the market by its manufacturer, Pfizer in 2010, but newer data aided its reintroduction in 2017.[80][81]
Since treatment options for relapsed AML are so limited, palliative care or enrollment in a clinical trial may be offered.
### Supportive treatment[edit]
Adding aerobic physical exercises to the standard of care may result in little to no difference in the mortality, in the quality of life and in the physical functioning. These exercises may result in a slight reduction in depression. Furthermore, aerobic physical exercises probably reduce fatigue.[82]
### Side effects[edit]
Treatments for AML like chemotherapy or stem cell transplant can trigger side effects. People that receive a stem cell transplant are at risk for developing a graft-versus-host disease,[83] and suffer from bleeding events that may require platelet transfusions.[84][85]
## Prognosis[edit]
Expected survival upon diagnosis of acute myeloid leukemia in the United States
Chromosomal translocation (9;11), associated with AML
AML is a curable disease. The chance of cure for a specific person depends on a number of prognostic factors.[86]
### Cytogenetics[edit]
The single most important prognostic factor in AML is cytogenetics, or the chromosomal structure of the leukemic cell. Certain cytogenetic abnormalities are associated with very good outcomes (for example, the (15;17) translocation in APL). About half of people with AML have "normal" cytogenetics; they fall into an intermediate risk group. A number of other cytogenetic abnormalities are known to associate with a poor prognosis and a high risk of relapse after treatment.[87][88][89]
The first publication to address cytogenetics and prognosis was the MRC trial of 1998:[90]
Risk Category Abnormality Five-year survival Relapse rate
Good t(8;21), t(15;17), inv(16) 70% 33%
Intermediate Normal, +8, +21, +22, del(7q), del(9q), Abnormal 11q23, all other structural or numerical changes 48% 50%
Poor −5, −7, del(5q), Abnormal 3q, Complex cytogenetics 15% 78%
Later, the Southwest Oncology Group and Eastern Cooperative Oncology Group[91] and, later still, Cancer and Leukemia Group B published other, mostly overlapping lists of cytogenetics prognostication in leukemia.[89]
### Myelodysplastic syndrome[edit]
AML arising from a pre-existing myelodysplastic syndrome (MDS) or myeloproliferative disease (so-called secondary AML) has a worse prognosis, as does treatment-related AML arising after chemotherapy for another previous malignancy. Both of these entities are associated with a high rate of unfavorable cytogenetic abnormalities.[92][93][94]
### Other prognostic markers[edit]
In some studies, age >60 years and elevated lactate dehydrogenase level were also associated with poorer outcomes.[95] As with most forms of cancer, performance status (i.e. the general physical condition and activity level of the person) plays a major role in prognosis as well.
The five-year survival rate is about 25% overall. Age plays a significant role: 40% of people under the age of 60, but just 10% of those over it, live five years after diagnosis.[96]
#### Genotype[edit]
A large number of molecular alterations are under study for their prognostic impact in AML. However, only FLT3-ITD, NPM1, CEBPA and c-KIT are currently included in validated international risk stratification schema. These are expected to increase rapidly in the near future.[3] FLT3 internal tandem duplications (ITDs) have been shown to confer a poorer prognosis in AML with normal cytogenetics. Several FLT3 inhibitors have undergone clinical trials, with mixed results. Two other mutations – NPM1 and biallelic CEBPA are associated with improved outcomes, especially in people with normal cytogenetics and are used in current risk stratification algorithms.[3]
Researchers are investigating the clinical significance of c-KIT mutations in AML. These are prevalent, and potentially clinically relevant because of the availability of tyrosine kinase inhibitors, such as imatinib and sunitinib that can block the activity of c-KIT pharmacologically.[3] It is expected that additional markers (e.g., RUNX1, ASXL1, and TP53) that have consistently been associated with an inferior outcome will soon be included in these recommendations. The prognostic importance of other mutated genes (e.g., DNMT3A, IDH1, IDH2) is less clear.[3][56]
### Expectation of cure[edit]
Cure rates in clinical trials have ranged from 20 to 45%;[97][98] although clinical trials often include only younger people and those able to tolerate aggressive therapies. The overall cure rate for all people with AML (including the elderly and those unable to tolerate aggressive therapy) is likely lower. Cure rates for APL can be as high as 98%.[99]
### Relapse[edit]
Relapse is common, and the prognosis is poor.[96] Long-term survival after a relapse is so rare that the only known case was submitted to the Catholic Church as evidence of a miracle attributed to Marie-Marguerite d'Youville.[100]
## Epidemiology[edit]
AML is a relatively rare cancer. There are approximately 10,500 new cases each year in the United States, and the incidence rate has remained stable from 1995 through 2005. AML accounts for 1.2% of all cancer deaths in the United States.[101]
The incidence of AML increases with age; the median age at diagnosis is 63 years. AML accounts for about 90% of all acute leukemias in adults, but is rare in children.[101] The rate of therapy-related AML (that is, AML caused by previous chemotherapy) is rising; therapy-related disease currently accounts for about 10–20% of all cases of AML.[102] AML is slightly more common in men, with a male-to-female ratio of 1.3:1.[103]
There is some geographic variation in the incidence of AML. In adults, the highest rates are seen in North America, Europe, and Oceania, while adult AML is rarer in Asia and Latin America.[104][105] In contrast, childhood AML is less common in North America and India than in other parts of Asia.[106] These differences may be due to population genetics, environmental factors, or a combination of the two.
AML accounts for 34% of all leukemia cases in the UK, and around 2,900 people were diagnosed with the disease in 2011.[107]
## History[edit]
Alfred Velpeau
The first published description of a case of leukemia in medical literature dates to 1827 when French physician Alfred-Armand-Louis-Marie Velpeau described a 63-year-old florist who developed an illness characterized by fever, weakness, urinary stones, and substantial enlargement of the liver and spleen. Velpeau noted the blood of this person had a consistency "like gruel", and speculated the appearance of the blood was due to white corpuscles.[7]:1071 In 1845, a series of people who died with enlarged spleens and changes in the "colors and consistencies of their blood" was reported by the Edinburgh-based pathologist J.H. Bennett; he used the term "leucocythemia" to describe this pathological condition.[108]
The term "leukemia" was coined by Rudolf Virchow, the renowned German pathologist, in 1856. As a pioneer in the use of the light microscope in pathology, Virchow was the first to describe the abnormal excess of white blood cells in people with the clinical syndrome described by Velpeau and Bennett. As Virchow was uncertain of the etiology of the white blood cell excess, he used the purely descriptive term "leukemia" (Greek: "white blood") to refer to the condition.[109]
Further advances in the understanding of AML occurred rapidly with the development of new technology. In 1877, Paul Ehrlich developed a technique of staining blood films which allowed him to describe in detail normal and abnormal white blood cells. Wilhelm Ebstein introduced the term "acute leukemia" in 1889 to differentiate rapidly progressive and fatal leukemias from the more indolent chronic leukemias.[110] The term "myeloid" was coined by Franz Ernst Christian Neumann in 1869, as he was the first to recognize white blood cells were made in the bone marrow (Greek: μυєλός, myelos, lit. '(bone) marrow') as opposed to the spleen. The technique of bone marrow examination to diagnose leukemia was first described in 1879 by Mosler.[111] Finally, in 1900, the myeloblast, which is the malignant cell in AML, was characterized by Otto Naegeli, who divided the leukemias into myeloid and lymphocytic.[112][113]
In 2008, AML became the first cancer genome to be fully sequenced. DNA extracted from leukemic cells were compared to unaffected skin.[114] The leukemic cells contained acquired mutations in several genes that had not previously been associated with the disease.
## Pregnancy[edit]
Leukemia is rarely associated with pregnancy, affecting only about 1 in 10,000 pregnant women.[115] How it is handled depends primarily on the type of leukemia. Acute leukemias normally require prompt, aggressive treatment, despite significant risks of pregnancy loss and birth defects, especially if chemotherapy is given during the developmentally sensitive first trimester.[115]
## References[edit]
1. ^ a b c d e f g h i j k l m "Adult Acute Myeloid Leukemia Treatment". National Cancer Institute. 6 March 2017. Retrieved 19 December 2017.
2. ^ a b c d e "Acute Myeloid Leukemia – Cancer Stat Facts". NCI. Retrieved 10 May 2017.
3. ^ a b c d e f g h i j k Döhner H, Weisdorf DJ, Bloomfield CD (September 2015). "Acute Myeloid Leukemia". The New England Journal of Medicine. 373 (12): 1136–52. doi:10.1056/NEJMra1406184. PMID 26376137. S2CID 40314260.
4. ^ a b Vos T, Allen C, Arora M, et al. (October 2016). "Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015". Lancet. 388 (10053): 1545–1602. doi:10.1016/S0140-6736(16)31678-6. PMC 5055577. PMID 27733282.
5. ^ a b Wang H, Naghavi M, Allen C, et al. (October 2016). "Global, regional, and national life expectancy, all-cause mortality, and cause-specific mortality for 249 causes of death, 1980-2015: a systematic analysis for the Global Burden of Disease Study 2015". Lancet. 388 (10053): 1459–1544. doi:10.1016/S0140-6736(16)31012-1. PMC 5388903. PMID 27733281.
6. ^ Marino BS, Fine KS (2013). Blueprints Pediatrics. Lippincott Williams & Wilkins. p. 205. ISBN 9781451116045.
7. ^ a b c d e Hoffman R (2005). Hematology: Basic Principles and Practice (4th ed.). St. Louis, Mo.: Elsevier Churchill Livingstone. pp. 1074–75. ISBN 978-0-443-06629-0.
8. ^ Abeloff M (2004). Clinical Oncology (3rd ed.). St. Louis, Mo.: Elsevier Churchill Livingstone. p. 2834. ISBN 978-0-443-06629-0.
9. ^ Sanz GF, Sanz MA, Vallespí T, et al. (July 1989). "Two regression models and a scoring system for predicting survival and planning treatment in myelodysplastic syndromes: a multivariate analysis of prognostic factors in 370 patients". Blood. 74 (1): 395–408. doi:10.1182/blood.V74.1.395.395. PMID 2752119.
10. ^ Jaiswal S, Fontanillas P, Flannick J, et al. (December 2014). "Age-related clonal hematopoiesis associated with adverse outcomes". The New England Journal of Medicine. 371 (26): 2488–98. doi:10.1056/NEJMoa1408617. PMC 4306669. PMID 25426837.
11. ^ Le Beau MM, Albain KS, Larson RA, et al. (March 1986). "Clinical and cytogenetic correlations in 63 patients with therapy-related myelodysplastic syndromes and acute nonlymphocytic leukemia: further evidence for characteristic abnormalities of chromosomes no. 5 and 7". Journal of Clinical Oncology. 4 (3): 325–45. doi:10.1200/JCO.1986.4.3.325. PMID 3950675.
12. ^ Thirman MJ, Gill HJ, Burnett RC, et al. (September 1993). "Rearrangement of the MLL gene in acute lymphoblastic and acute myeloid leukemias with 11q23 chromosomal translocations". The New England Journal of Medicine. 329 (13): 909–14. doi:10.1056/NEJM199309233291302. PMID 8361504.
13. ^ Austin H, Delzell E, Cole P (March 1988). "Benzene and leukemia. A review of the literature and a risk assessment". American Journal of Epidemiology. 127 (3): 419–39. doi:10.1093/oxfordjournals.aje.a114820. PMID 3277397.
14. ^ Linet MS (1985). The Leukemias: Epidemiologic Aspects. New York: Oxford University Press.
15. ^ Bizzozero OJ, Johnson KG, Ciocco A (May 1966). "Radiation-related leukemia in Hiroshima and Nagasaki, 1946-1964. I. Distribution, incidence and appearance time". The New England Journal of Medicine. 274 (20): 1095–101. doi:10.1056/NEJM196605192742001. PMID 5932020.
16. ^ Yoshinaga S, Mabuchi K, Sigurdson AJ, Doody MM, Ron E (November 2004). "Cancer risks among radiologists and radiologic technologists: review of epidemiologic studies". Radiology. 233 (2): 313–21. doi:10.1148/radiol.2332031119. PMID 15375227. S2CID 20643232.
17. ^ Radivoyevitch T, Sachs RK, Gale RP, et al. (February 2016). "Defining AML and MDS second cancer risk dynamics after diagnoses of first cancers treated or not with radiation". Leukemia. 30 (2): 285–94. doi:10.1038/leu.2015.258. PMID 26460209. S2CID 22100511.
18. ^ Taylor GM, Birch JM (1996). "The hereditary basis of human leukemia". In Henderson ES, Lister TA, Greaves MF (eds.). Leukemia (6th ed.). Philadelphia: WB Saunders. p. 210. ISBN 978-0-7216-5381-5.
19. ^ Horwitz M, Goode EL, Jarvik GP (November 1996). "Anticipation in familial leukemia". American Journal of Human Genetics. 59 (5): 990–8. PMC 1914843. PMID 8900225.
20. ^ Crittenden LB (June 1961). "An interpretation of familial aggregation based on multiple genetic and environmental factors". Annals of the New York Academy of Sciences. 91 (3): 769–80. Bibcode:1961NYASA..91..769C. doi:10.1111/j.1749-6632.1961.tb31106.x. PMID 13696504. S2CID 6441908.
21. ^ Horwitz M (August 1997). "The genetics of familial leukemia". Leukemia. 11 (8): 1347–59. doi:10.1038/sj.leu.2400707. PMID 9264391.
22. ^ Evans DI, Steward JK (December 1972). "Down's syndrome and leukaemia". Lancet. 2 (7790): 1322. doi:10.1016/S0140-6736(72)92704-3. PMID 4117858.
23. ^ Crispino JD, Horwitz MS (April 2017). "GATA factor mutations in hematologic disease". Blood. 129 (15): 2103–2110. doi:10.1182/blood-2016-09-687889. PMC 5391620. PMID 28179280.
24. ^ a b Hirabayashi S, Wlodarski MW, Kozyra E, Niemeyer CM (August 2017). "Heterogeneity of GATA2-related myeloid neoplasms". International Journal of Hematology. 106 (2): 175–182. doi:10.1007/s12185-017-2285-2. PMID 28643018.
25. ^ Bolouri H, Farrar JE, Triche T, et al. (January 2018). "The molecular landscape of pediatric acute myeloid leukemia reveals recurrent structural alterations and age-specific mutational interactions". Nature Medicine. 24 (1): 103–112. doi:10.1038/nm.4439. PMC 5907936. PMID 29227476.
26. ^ Abeloff, Martin et al. (2004), p. 2834.
27. ^ Dokal IS, Cox TM, Galton DA (May 1990). "Vitamin B-12 and folate deficiency presenting as leukaemia". BMJ. 300 (6734): 1263–4. doi:10.1136/bmj.300.6734.1263. PMC 1662842. PMID 2354298.
28. ^ Aitelli C, Wasson L, Page R (March 2004). "Pernicious anemia: presentations mimicking acute leukemia". Southern Medical Journal. 97 (3): 295–7. doi:10.1097/01.SMJ.0000082003.98003.88. PMID 15043340. S2CID 25941380.
29. ^ Zuo Z, Polski JM, Kasyan A, Medeiros LJ (September 2010). "Acute erythroid leukemia". Archives of Pathology & Laboratory Medicine. 134 (9): 1261–70. doi:10.1043/2009-0350-RA.1 (inactive 17 January 2021). PMID 20807044.CS1 maint: DOI inactive as of January 2021 (link)
30. ^ Barzi A, Sekeres MA (January 2010). "Myelodysplastic syndromes: a practical approach to diagnosis and treatment". Cleveland Clinic Journal of Medicine. 77 (1): 37–44. doi:10.3949/ccjm.77a.09069. PMID 20048028. S2CID 207413787.
31. ^ Baldus CD, Mrózek K, Marcucci G, Bloomfield CD (June 2007). "Clinical outcome of de novo acute myeloid leukaemia patients with normal cytogenetics is affected by molecular genetic alterations: a concise review". British Journal of Haematology. 137 (5): 387–400. doi:10.1111/j.1365-2141.2007.06566.x. PMID 17488484. S2CID 30419482.
32. ^ Vardiman JW, Harris NL, Brunning RD (October 2002). "The World Health Organization (WHO) classification of the myeloid neoplasms". Blood. 100 (7): 2292–302. doi:10.1182/blood-2002-04-1199. PMID 12239137. S2CID 9413654.
33. ^ Abeloff, Martin et al. (2004), p. 2835.
34. ^ Harris NL, Jaffe ES, Diebold J, et al. (December 1999). "The World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues. Report of the Clinical Advisory Committee meeting, Airlie House, Virginia, November, 1997". Annals of Oncology. 10 (12): 1419–32. doi:10.1023/A:1008375931236. PMID 10643532.
35. ^ Foucar K. "Bone Marrow Pathology" (PDF) (3rd ed.). ASCP. Archived from the original (PDF) on 19 March 2013. Retrieved 18 March 2016.
36. ^ Amin HM, Yang Y, Shen Y, et al. (September 2005). "Having a higher blast percentage in circulation than bone marrow: clinical implications in myelodysplastic syndrome and acute lymphoid and myeloid leukemias". Leukemia. 19 (9): 1567–72. doi:10.1038/sj.leu.2403876. PMID 16049515.
37. ^ Grimwade D, Howe K, Langabeer S, et al. (September 1996). "Establishing the presence of the t(15;17) in suspected acute promyelocytic leukaemia: cytogenetic, molecular and PML immunofluorescence assessment of patients entered into the M.R.C. ATRA trial. M.R.C. Adult Leukaemia Working Party". British Journal of Haematology. 94 (3): 557–73. doi:10.1046/j.1365-2141.1996.d01-1004.x (inactive 17 January 2021). PMID 8790159.CS1 maint: DOI inactive as of January 2021 (link)
38. ^ Falini B, Tiacci E, Martelli MP, Ascani S, Pileri SA (October 2010). "New classification of acute myeloid leukemia and precursor-related neoplasms: changes and unsolved issues". Discovery Medicine. 10 (53): 281–92. PMID 21034669.
39. ^ Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C (August 1976). "Proposals for the classification of the acute leukaemias. French-American-British (FAB) co-operative group". British Journal of Haematology. 33 (4): 451–8. doi:10.1111/j.1365-2141.1976.tb03563.x. PMID 188440. S2CID 9985915.
40. ^ Bloomfield CD, Brunning RD (September 1985). "FAB M7: acute megakaryoblastic leukemia--beyond morphology". Annals of Internal Medicine. 103 (3): 450–2. doi:10.7326/0003-4819-103-3-450. PMID 4040724.
41. ^ Lee EJ, Pollak A, Leavitt RD, Testa JR, Schiffer CA (November 1987). "Minimally differentiated acute nonlymphocytic leukemia: a distinct entity". Blood. 70 (5): 1400–6. doi:10.1182/blood.v70.5.1400.bloodjournal7051400. PMID 3663939.
42. ^ Unless otherwise specified in boxes, reference is: Page 97 in: Sun T (2008). Flow cytometry and immunohistochemistry for hematologic neoplasms. Philadelphia: Lippincott Williams & Wilkins. ISBN 978-0-7817-8400-9. OCLC 85862340.
43. ^ a b c d e f g h i Seiter K, Jules EH (20 May 2011). "Acute Myeloid Leukemia Staging". Retrieved 26 August 2011.
44. ^ a b c d Mihova D. "Leukemia acute - Acute myeloid leukemia with minimal differentiation (FAB AML M0)". Pathology Outlines. Topic Completed: 1 March 2013. Minor changes: 19 November 2019}}
45. ^ a b Salem DA, Abd El-Aziz SM (June 2012). "Flowcytometric immunophenotypic profile of acute leukemia: mansoura experience". Indian Journal of Hematology & Blood Transfusion. 28 (2): 89–96. doi:10.1007/s12288-011-0110-2. PMC 3332273. PMID 23730015.
46. ^ Partial expression: Adriaansen HJ, te Boekhorst PA, Hagemeijer AM, van der Schoot CE, Delwel HR, van Dongen JJ (June 1993). "Acute myeloid leukemia M4 with bone marrow eosinophilia (M4Eo) and inv(16)(p13q22) exhibits a specific immunophenotype with CD2 expression". Blood. 81 (11): 3043–51. doi:10.1182/blood.V81.11.3043.bloodjournal81113043. PMID 8098967.
47. ^ a b c Page 99 in: Sun T (2009). Atlas of hematologic neoplasms. Dordrecht New York: Springer. ISBN 978-0-387-89848-3. OCLC 432709321.
48. ^ Duchayne E, Demur C, Rubie H, Robert A, Dastugue N (January 1999). "Diagnosis of acute basophilic leukemia". Leukemia & Lymphoma. 32 (3–4): 269–78. doi:10.3109/10428199909167387. PMID 10037024.
49. ^ Fialkow PJ (October 1976). "Clonal origin of human tumors". Biochimica et Biophysica Acta (BBA) - Reviews on Cancer. 458 (3): 283–321. doi:10.1016/0304-419X(76)90003-2. PMID 1067873.
50. ^ Fialkow PJ, Janssen JW, Bartram CR (April 1991). "Clonal remissions in acute nonlymphocytic leukemia: evidence for a multistep pathogenesis of the malignancy". Blood. 77 (7): 1415–7. doi:10.1182/blood.V77.7.1415.1415. PMID 2009365.
51. ^ Bonnet D, Dick JE (July 1997). "Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell". Nature Medicine. 3 (7): 730–7. doi:10.1038/nm0797-730. PMID 9212098. S2CID 205381050.
52. ^ Abeloff, Martin et al. (2004), pp. 2831–32.
53. ^ Greer JP, Foerster J, Lukens JN, Rogers GM, Paraskevas F, Glader BE, eds. (2004). Wintrobe's Clinical Hematology (11th ed.). Philadelphia: Lippincott, Williams, and Wilkins. pp. 2045–2062. ISBN 978-0-7817-3650-3.
54. ^ Melnick A, Licht JD (May 1999). "Deconstructing a disease: RARalpha, its fusion partners, and their roles in the pathogenesis of acute promyelocytic leukemia". Blood. 93 (10): 3167–215. doi:10.1182/blood.V93.10.3167.410k44_3167_3215. PMID 10233871.
55. ^ Abeloff, Martin et al. (2004), p. 2828.
56. ^ a b Molenaar RJ, Thota S, Nagata Y, et al. (November 2015). "Clinical and biological implications of ancestral and non-ancestral IDH1 and IDH2 mutations in myeloid neoplasms". Leukemia. 29 (11): 2134–42. doi:10.1038/leu.2015.91. PMC 5821256. PMID 25836588.
57. ^ Molenaar RJ, Radivoyevitch T, Maciejewski JP, van Noorden CJ, Bleeker FE (December 2014). "The driver and passenger effects of isocitrate dehydrogenase 1 and 2 mutations in oncogenesis and survival prolongation". Biochimica et Biophysica Acta (BBA) - Reviews on Cancer. 1846 (2): 326–41. doi:10.1016/j.bbcan.2014.05.004. PMID 24880135.
58. ^ Sharma S, Kelly TK, Jones PA (January 2010). "Epigenetics in cancer". Carcinogenesis. 31 (1): 27–36. doi:10.1093/carcin/bgp220. PMC 2802667. PMID 19752007.
59. ^ "Acute myeloid leukemia". The Mount Sinai Hospital. September 2011. Archived from the original on 7 August 2012.
60. ^ Kayser S, Levis MJ (February 2014). "FLT3 tyrosine kinase inhibitors in acute myeloid leukemia: clinical implications and limitations". Leukemia & Lymphoma. 55 (2): 243–55. doi:10.3109/10428194.2013.800198. PMC 4333682. PMID 23631653.
61. ^ a b Abeloff, Martin et al. (2004), pp. 2835–39.
62. ^ Bishop JF (February 1997). "The treatment of adult acute myeloid leukemia". Seminars in Oncology. 24 (1): 57–69. PMID 9045305.
63. ^ Weick JK, Kopecky KJ, Appelbaum FR, et al. (October 1996). "A randomized investigation of high-dose versus standard-dose cytosine arabinoside with daunorubicin in patients with previously untreated acute myeloid leukemia: a Southwest Oncology Group study". Blood. 88 (8): 2841–51. doi:10.1182/blood.V88.8.2841.bloodjournal8882841. PMID 8874180.
64. ^ Bishop JF, Matthews JP, Young GA, et al. (March 1996). "A randomized study of high-dose cytarabine in induction in acute myeloid leukemia". Blood. 87 (5): 1710–7. doi:10.1182/blood.V87.5.1710.1710. PMID 8634416.
65. ^ Iland HJ, Seymour JF (June 2013). "Role of arsenic trioxide in acute promyelocytic leukemia". Current Treatment Options in Oncology. 14 (2): 170–84. doi:10.1007/s11864-012-0223-3. hdl:11343/219801. PMID 23322117. S2CID 1930831.
66. ^ Alimoghaddam K (July 2014). "A review of arsenic trioxide and acute promyelocytic leukemia". International Journal of Hematology-Oncology and Stem Cell Research. 8 (3): 44–54. PMC 4305381. PMID 25642308.
67. ^ Huang ME, Ye YC, Chen SR, et al. (August 1988). "Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia". Blood. 72 (2): 567–72. doi:10.1182/blood.V72.2.567.567. PMID 3165295.
68. ^ Tallman MS, Andersen JW, Schiffer CA, et al. (October 1997). "All-trans-retinoic acid in acute promyelocytic leukemia". The New England Journal of Medicine. 337 (15): 1021–8. doi:10.1056/NEJM199710093371501. PMID 9321529.
69. ^ Fenaux P, Chastang C, Chevret S, et al. (August 1999). "A randomized comparison of all transretinoic acid (ATRA) followed by chemotherapy and ATRA plus chemotherapy and the role of maintenance therapy in newly diagnosed acute promyelocytic leukemia. The European APL Group". Blood. 94 (4): 1192–200. doi:10.1182/blood.V94.4.1192. PMID 10438706.
70. ^ Estey EH (March 2002). "Treatment of acute myelogenous leukemia". Oncology. 16 (3): 343–52, 355–6, discussion 357, 362, 365–6. PMID 15046392.
71. ^ a b Cassileth PA, Harrington DP, Hines JD, et al. (April 1988). "Maintenance chemotherapy prolongs remission duration in adult acute nonlymphocytic leukemia". Journal of Clinical Oncology. 6 (4): 583–7. doi:10.1200/JCO.1988.6.4.583. PMID 3282032.
72. ^ Küley-Bagheri Y, Kreuzer KA, Monsef I, Lübbert M, Skoetz N, et al. (Cochrane Haematological Malignancies Group) (August 2018). "Effects of all-trans retinoic acid (ATRA) in addition to chemotherapy for adults with acute myeloid leukaemia (AML) (non-acute promyelocytic leukaemia (non-APL))". The Cochrane Database of Systematic Reviews. 8: CD011960. doi:10.1002/14651858.CD011960.pub2. PMC 6513628. PMID 30080246.
73. ^ Mayer RJ, Davis RB, Schiffer CA, et al. (October 1994). "Intensive postremission chemotherapy in adults with acute myeloid leukemia. Cancer and Leukemia Group B". The New England Journal of Medicine. 331 (14): 896–903. doi:10.1056/NEJM199410063311402. PMID 8078551.
74. ^ a b Appelbaum FR, Baer MR, Carabasi MH, et al. (November 2000). "NCCN Practice Guidelines for Acute Myelogenous Leukemia". Oncology. 14 (11A): 53–61. PMID 11195419.
75. ^ Brune M, Castaigne S, Catalano J, et al. (July 2006). "Improved leukemia-free survival after postconsolidation immunotherapy with histamine dihydrochloride and interleukin-2 in acute myeloid leukemia: results of a randomized phase 3 trial". Blood. 108 (1): 88–96. doi:10.1182/blood-2005-10-4073. PMID 16556892.
76. ^ Abeloff, Martin et al. (2004), pp. 2840–41.
77. ^ Appelbaum FR (April 2001). "Who should be transplanted for AML?". Leukemia. 15 (4): 680–2. doi:10.1038/sj/leu/2402074. PMID 11368380.
78. ^ Appelbaum FR (February 2002). "Hematopoietic cell transplantation beyond first remission". Leukemia. 16 (2): 157–9. doi:10.1038/sj.leu.2402345. PMID 11840278.
79. ^ Sievers EL, Larson RA, Stadtmauer EA, et al. (July 2001). "Efficacy and safety of gemtuzumab ozogamicin in patients with CD33-positive acute myeloid leukemia in first relapse". Journal of Clinical Oncology. 19 (13): 3244–54. doi:10.1200/JCO.2001.19.13.3244. PMID 11432892.
80. ^ http://www.pfizer.com/files/products/mylotarg_hcp_letter.pdf
81. ^ "Press Announcements - FDA approves Mylotarg for treatment of acute myeloid leukemia". 30 November 2018.
82. ^ Knips L, Bergenthal N, Streckmann F, Monsef I, Elter T, Skoetz N, et al. (Cochrane Haematological Malignancies Group) (January 2019). "Aerobic physical exercise for adult patients with haematological malignancies". The Cochrane Database of Systematic Reviews. 1: CD009075. doi:10.1002/14651858.CD009075.pub3. PMC 6354325. PMID 30702150.
83. ^ Fisher SA, Cutler A, Doree C, Brunskill SJ, Stanworth SJ, Navarrete C, Girdlestone J, et al. (Cochrane Haematological Malignancies Group) (January 2019). "Mesenchymal stromal cells as treatment or prophylaxis for acute or chronic graft-versus-host disease in haematopoietic stem cell transplant (HSCT) recipients with a haematological condition". The Cochrane Database of Systematic Reviews. 1: CD009768. doi:10.1002/14651858.CD009768.pub2. PMC 6353308. PMID 30697701.
84. ^ Estcourt L, Stanworth S, Doree C, Hopewell S, Murphy MF, Tinmouth A, Heddle N, et al. (Cochrane Haematological Malignancies Group) (May 2012). "Prophylactic platelet transfusion for prevention of bleeding in patients with haematological disorders after chemotherapy and stem cell transplantation". The Cochrane Database of Systematic Reviews (5): CD004269. doi:10.1002/14651858.CD004269.pub3. PMID 22592695.
85. ^ Estcourt LJ, Stanworth SJ, Doree C, Hopewell S, Trivella M, Murphy MF, et al. (Cochrane Haematological Malignancies Group) (November 2015). "Comparison of different platelet count thresholds to guide administration of prophylactic platelet transfusion for preventing bleeding in people with haematological disorders after myelosuppressive chemotherapy or stem cell transplantation". The Cochrane Database of Systematic Reviews (11): CD010983. doi:10.1002/14651858.CD010983.pub2. PMC 4717525. PMID 26576687.
86. ^ Estey EH (April 2001). "Prognostic factors in acute myelogenous leukemia". Leukemia. 15 (4): 670–2. doi:10.1038/sj/leu/2402057. PMID 11368376.
87. ^ Wheatley K, Burnett AK, Goldstone AH, et al. (October 1999). "A simple, robust, validated and highly predictive index for the determination of risk-directed therapy in acute myeloid leukaemia derived from the MRC AML 10 trial. United Kingdom Medical Research Council's Adult and Childhood Leukaemia Working Parties". British Journal of Haematology. 107 (1): 69–79. doi:10.1046/j.1365-2141.1999.01684.x. PMID 10520026. S2CID 27266593.
88. ^ Slovak ML, Kopecky KJ, Cassileth PA, et al. (December 2000). "Karyotypic analysis predicts outcome of preremission and postremission therapy in adult acute myeloid leukemia: a Southwest Oncology Group/Eastern Cooperative Oncology Group Study". Blood. 96 (13): 4075–83. doi:10.1182/blood.V96.13.4075. PMID 11110676.
89. ^ a b Byrd JC, Mrózek K, Dodge RK, et al. (December 2002). "Pretreatment cytogenetic abnormalities are predictive of induction success, cumulative incidence of relapse, and overall survival in adult patients with de novo acute myeloid leukemia: results from Cancer and Leukemia Group B (CALGB 8461)". Blood. 100 (13): 4325–36. doi:10.1182/blood-2002-03-0772. PMID 12393746. S2CID 16003833.
90. ^ Grimwade D, Walker H, Oliver F, et al. (October 1998). "The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. The Medical Research Council Adult and Children's Leukaemia Working Parties". Blood. 92 (7): 2322–33. doi:10.1182/blood.V92.7.2322. PMID 9746770.
91. ^ Slovak ML, Kopecky KJ, Cassileth PA, et al. (December 2000). "Karyotypic analysis predicts outcome of preremission and postremission therapy in adult acute myeloid leukemia: a Southwest Oncology Group/Eastern Cooperative Oncology Group Study". Blood. 96 (13): 4075–83. doi:10.1182/blood.V96.13.4075. PMID 11110676.
92. ^ Thirman MJ, Larson RA (April 1996). "Therapy-related myeloid leukemia". Hematology/Oncology Clinics of North America. 10 (2): 293–320. doi:10.1016/S0889-8588(05)70340-3. PMID 8707757.
93. ^ Rowley JD, Golomb HM, Vardiman JW (October 1981). "Nonrandom chromosome abnormalities in acute leukemia and dysmyelopoietic syndromes in patients with previously treated malignant disease". Blood. 58 (4): 759–67. doi:10.1182/blood.V58.4.759.759. PMID 7272506.
94. ^ Pedersen-Bjergaard J, Andersen MK, Christiansen DH, Nerlov C (March 2002). "Genetic pathways in therapy-related myelodysplasia and acute myeloid leukemia". Blood. 99 (6): 1909–12. doi:10.1182/blood.V99.6.1909. PMID 11877259. S2CID 15397577.
95. ^ Haferlach T, Schoch C, Löffler H, et al. (January 2003). "Morphologic dysplasia in de novo acute myeloid leukemia (AML) is related to unfavorable cytogenetics but has no independent prognostic relevance under the conditions of intensive induction therapy: results of a multiparameter analysis from the German AML Cooperative Group studies". Journal of Clinical Oncology. 21 (2): 256–65. doi:10.1200/JCO.2003.08.005. PMID 12525517.
96. ^ a b Chabner BA, Lynch TJ, Longo DL (22 March 2014). Harrisons Manual of Oncology 2/E. McGraw Hill Professional. p. 294. ISBN 9780071793261.
97. ^ Cassileth PA, Harrington DP, Appelbaum FR, et al. (December 1998). "Chemotherapy compared with autologous or allogeneic bone marrow transplantation in the management of acute myeloid leukemia in first remission". The New England Journal of Medicine. 339 (23): 1649–56. doi:10.1056/NEJM199812033392301. PMID 9834301.
98. ^ Matthews JP, Bishop JF, Young GA, et al. (June 2001). "Patterns of failure with increasing intensification of induction chemotherapy for acute myeloid leukaemia". British Journal of Haematology. 113 (3): 727–36. doi:10.1046/j.1365-2141.2001.02756.x. PMID 11380464. S2CID 34233226.
99. ^ Sanz MA, Lo Coco F, Martín G, et al. (August 2000). "Definition of relapse risk and role of nonanthracycline drugs for consolidation in patients with acute promyelocytic leukemia: a joint study of the PETHEMA and GIMEMA cooperative groups". Blood. 96 (4): 1247–53. PMID 10942364. Archived from the original on 27 May 2010. Retrieved 17 March 2008.
100. ^ Duffin J (5 September 2016). "Pondering Miracles, Medical and Religious". The New York Times. ISSN 0362-4331. Retrieved 12 March 2018.
101. ^ a b Jemal A, Thomas A, Murray T, Thun M (2002). "Cancer statistics, 2002". Ca. 52 (1): 23–47. doi:10.3322/canjclin.52.1.23. PMID 11814064. S2CID 5659023.
102. ^ Leone G, Mele L, Pulsoni A, Equitani F, Pagano L (October 1999). "The incidence of secondary leukemias". Haematologica. 84 (10): 937–45. PMID 10509043.
103. ^ Greenlee RT, Hill-Harmon MB, Murray T, Thun M (2001). "Cancer statistics, 2001". Ca. 51 (1): 15–36. doi:10.3322/canjclin.51.1.15. PMID 11577478. S2CID 22441565.
104. ^ Linet MS (1985). "The leukemias: Epidemiologic aspects.". In Lilienfeld AM (ed.). Monographs in Epidemiology and Biostatistics. New York: Oxford University Press. p. I. ISBN 978-0-19-503448-6.
105. ^ Aoki K, Kurihars M, Hayakawa N (1992). Death Rates for Malignant Neoplasms for Selected Sites by Sex and Five-Year Age Group in 33 Countries 1953–57 to 1983–87. Nagoya, Japan: University of Nagoya Press, International Union Against Cancer.
106. ^ Bhatia S, Neglia JP (May 1995). "Epidemiology of childhood acute myelogenous leukemia". Journal of Pediatric Hematology/Oncology. 17 (2): 94–100. doi:10.1097/00043426-199505000-00002. PMID 7749772.
107. ^ "Acute myeloid leukaemia (AML) statistics". Cancer Research UK. Retrieved 27 October 2014.
108. ^ Bennett JH (1845). "Two cases of hypertrophy of the spleen and liver, in which death took place from suppuration of blood". Edinburgh Med Surg J. 64: 413.
109. ^ Virchow R (1856). "Die Leukämie". In Virchow R (ed.). Gesammelte Abhandlungen zur Wissenschaftlichen Medizin (in German). Frankfurt: Meidinger. p. 190.
110. ^ Ebstein W (1889). "Über die acute Leukämie und Pseudoleukämie". Deutsch Arch Klin Med. 44: 343.
111. ^ Mosler F (1876). "Klinische Symptome und Therapie der medullären Leukämie". Berl Klin Wochenschr. 13: 702.
112. ^ Naegeli O (1900). "Über rothes Knochenmark und Myeloblasten". Deutsche Medizinische Wochenschrift. 26 (18): 287–290. doi:10.1055/s-0029-1203820.
113. ^ Wang ZY (2003). "Ham-Wasserman lecture: treatment of acute leukemia by inducing differentiation and apoptosis". Hematology. American Society of Hematology. Education Program. 2003 (1): 1–13. doi:10.1182/asheducation-2003.1.1. PMID 14633774.
114. ^ Ley TJ, Mardis ER, Ding L, et al. (November 2008). "DNA sequencing of a cytogenetically normal acute myeloid leukaemia genome". Nature. 456 (7218): 66–72. Bibcode:2008Natur.456...66L. doi:10.1038/nature07485. PMC 2603574. PMID 18987736.
115. ^ a b Shapira T, Pereg D, Lishner M (September 2008). "How I treat acute and chronic leukemia in pregnancy". Blood Reviews. 22 (5): 247–59. doi:10.1016/j.blre.2008.03.006. PMID 18472198.
## External links[edit]
Classification
D
* ICD-10: C92.0
* ICD-9-CM: 205.0
* ICD-O: M9861/3
* OMIM: 602439
* MeSH: D015470
* DiseasesDB: 203
External resources
* MedlinePlus: 000542
* eMedicine: med/34
* Patient UK: Acute myeloid leukemia
* Acute myeloid leukemia at Curlie
* GeneReviews/NIH/NCBI/UW entry on Familial Acute Myeloid Leukemia (AML) with Mutated CEBPA
* PDQ statement on AML for health professionals at National Cancer Institute
* v
* t
* e
Myeloid-related hematological malignancy
CFU-GM/
and other granulocytes
CFU-GM
Myelocyte
AML:
* Acute myeloblastic leukemia
* M0
* M1
* M2
* APL/M3
MP
* Chronic neutrophilic leukemia
Monocyte
AML
* AMoL/M5
* Myeloid dendritic cell leukemia
CML
* Philadelphia chromosome
* Accelerated phase chronic myelogenous leukemia
Myelomonocyte
AML
* M4
MD-MP
* Juvenile myelomonocytic leukemia
* Chronic myelomonocytic leukemia
Other
* Histiocytosis
CFU-Baso
AML
* Acute basophilic
CFU-Eos
AML
* Acute eosinophilic
MP
* Chronic eosinophilic leukemia/Hypereosinophilic syndrome
MEP
CFU-Meg
MP
* Essential thrombocytosis
* Acute megakaryoblastic leukemia
CFU-E
AML
* Erythroleukemia/M6
MP
* Polycythemia vera
MD
* Refractory anemia
* Refractory anemia with excess of blasts
* Chromosome 5q deletion syndrome
* Sideroblastic anemia
* Paroxysmal nocturnal hemoglobinuria
* Refractory cytopenia with multilineage dysplasia
CFU-Mast
Mastocytoma
* Mast cell leukemia
* Mast cell sarcoma
* Systemic mastocytosis
Mastocytosis:
* Diffuse cutaneous mastocytosis
* Erythrodermic mastocytosis
* Adult type of generalized eruption of cutaneous mastocytosis
* Urticaria pigmentosa
* Mast cell sarcoma
* Solitary mastocytoma
Systemic mastocytosis
* Xanthelasmoidal mastocytosis
Multiple/unknown
AML
* Acute panmyelosis with myelofibrosis
* Myeloid sarcoma
MP
* Myelofibrosis
* Acute biphenotypic leukaemia
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Acute myeloid leukemia
|
c1879321
| 8,575 |
wikipedia
|
https://en.wikipedia.org/wiki/Acute_myeloid_leukemia
| 2021-01-18T18:43:16 |
{"gard": ["537", "12757"], "mesh": ["D015470"], "umls": ["C1879321"], "orphanet": ["519"], "wikidata": ["Q264118"]}
|
A rare, aggressive form of advanced systemic mastocytosis (advSM) characterized by massive infiltration of mast cells (MC) in different tissues and presence of extracutaneous organ dysfunction, but without evidence of mast cell leukemia or another hematologic neoplasm.
## Epidemiology
It represents less than 10% of all SM cases and the global prevalence is estimated in the order of between 1/250,000-400,000.
## Clinical description
Aggressive systemic mastocytosis (ASM) may occur at any age, occurring predominantly in adults and very rarely in pediatric patients. Presentation is with organ dysfunction related to mast cell invasion (C-findings) and the intense release of mediators including syncope, recurrent flushing, diarrhea, pain, organomegaly. C-findings include bone marrow (BM) dysfunction, palpable hepatomegaly with impairment of liver function, ascites, and/or portal hypertension, skeletal involvement with large osteolytic lesions and/or pathological fractures, palpable splenomegaly with hypersplenism and malabsorption with ascites. Patients do not show signs of non-mast cell hematological disease. Cutaneous involvement is slightly less frequent than in indolent SM. The most serious complications include potentially fatal anaphylactic shock and transformation to mast cell leukemia (MCL). Disease progression can be either slow or rapid. In patients with rapid progression, serum tryptase levels increase rapidly, multi-organ damage occurs (or worsens) within a short time, and rapid progression to MCL is frequent. Due to the latter, ASM with >5% MC in BM smears is termed ASM in transformation.
## Etiology
The etiology is not well understood but there is evidence of an activating mutation of KIT, usually D816V, in the mast cells and sometimes in non-MC hematopoietic lineages. Additional and recurrent somatic mutations of other genes have been reported in ASM; the genes most frequently affected includeTET2, SRSF2, ASXL1, RUNX1, JAK2, N/KRAS, and CBL and, less frequently,EZH2, IDH2, ETV6, U2AF, or SF3B1. These defects contribute to aggressiveness of the disease, particularly in multi-mutated patients.
## Diagnostic methods
Diagnosis of SM is established using the WHO (World Health Organization) consensus criteria. The disease is then categorized according to the presence of B- and C-findings. The characteristics of ASM includes BM smear with <20% MC, and one or more C-findings. In rapidly progressive cases, the percentage of MC in the BM smears is of major prognostic significance and is usually elevated substantially (>5%).
## Differential diagnosis
Differential diagnoses include all causes of cytopenias (myelofibrosis, myelodysplasia and other hematological malignancies) and other abnormal types of mutation in JAK2, that are excluded by the detection of bone marrow infiltration by neoplastic mast cells with an activation mutation of KIT.
## Management and treatment
Treatment is constant with non-targeted or targeted cytoreductive therapy. Non-targeted therapies include interferon-(IFNalpha), which may be effective in a subset of patients, and cladribine (2CdA) which provides high, and sometimes long lasting, response rates. Allogeneic stem cell transplantation (allo-SCT) is rarely used and reserved for fit patients with a suitable donor. However, when applicable, allo-SCT provides frequently good response rates and complete remission. Targeted therapy is with KIT tyrosine kinase inhibitors (KIT TKIs) Midostaurin which inhibits the D816V mutant (approved in Europe and the USA), is regarded as the standard first-line therapy in ASM. Whilst it is efficacious, it does not induce complete hematologic remissions. Midostaurin may also be useful for patients who need debulking prior to allo-SCT or those who fail treatment with 2CdA or IFNalpha. Other TKIs included imatinib mesylate or masitinib and may be indicated for the few patients without the KITD816V mutation. Symptomatic treatment is mainly with antihistamines (anti-H1 and anti-H2). The use of iodinated contrast agents should be limited.
## Prognosis
The prognosis is usually poor with a median survival of 2 to 4 years. Due to rapid progression to MCL, ASM patients with a MC count in the BM smears >5% have a worse outcome with reduced survival and progression-free survival compared to patients with <5%. Furthermore, the presence of mutations in other critical target genes, in particular SRSF2, ASXL1, RUNX1, is associated with progression and poor outcome.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Aggressive systemic mastocytosis
|
c1112486
| 8,576 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=98850
| 2021-01-23T18:05:11 |
{"mesh": ["D034721"], "umls": ["C1112486"], "icd-10": ["C96.2"]}
|
Idiopathic craniofacial erythema is a medical condition characterised by severe, uncontrollable, and frequently unprovoked, facial blushing.
Blushing can occur at any time and is frequently triggered by even mundane events, such as, talking to friends, paying for goods in a shop, asking for directions or even simply making eye contact with another person.
For many years, the cause of the condition was thought to be an anxiety problem, caused by a mental health disorder. However, in recent years experts in the field of the disorder believe it to be caused by an overactive sympathetic nervous system, an automatic response which sufferers have no mental control over. It is related to focal hyperhidrosis, more commonly known as excessive sweating, as it is caused by the same overactive nerves which cause excessive sweating. Sufferers of severe facial blushing commonly experience focal hyperhidrosis. Studies have also shown that patients with severe facial blushing or focal hyperhidrosis commonly have family members with one or both of the related disorders.
## In popular culture[edit]
* In Grey's Anatomy Season 2, Episode 3, a patient is diagnosed with idiopathic craniofacial erythema.
* The female protagonist in the South Korean drama Heart to Heart suffers from uncontrollable blushing, that leaves her sociophobic.
## Treatment[edit]
A number of treatments are available. The most successful non-invasive procedure is cognitive behavioural therapy (CBT), which attempts to alleviate the anxiety felt by sufferers.
In extreme cases a surgical procedure known as endoscopic transthoracic sympathicotomy (ETS) is available. Pioneered by surgeons in Sweden, this procedure has recently become increasingly controversial due to its many potential adverse effects. Patients who have undergone the procedure frequently complain of compensatory sweating and fatigue, with around 5% reconsidering getting the treatment. ETS is now normally only considered in extreme cases where other treatments have been ineffective.
## External links[edit]
* The New Yorker \- CRIMSON TIDE - What is blushing?, No one knows for sure, but it can ruin your life by Atul Gawande.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Idiopathic craniofacial erythema
|
None
| 8,577 |
wikipedia
|
https://en.wikipedia.org/wiki/Idiopathic_craniofacial_erythema
| 2021-01-18T18:35:01 |
{"wikidata": ["Q5988870"]}
|
A number sign (#) is used with this entry because Dent disease-2 is caused by mutation in the OCRL gene (300535) on chromosome Xq26.
For a phenotypic description and a discussion of genetic heterogeneity of Dent disease, see 300009.
See also Lowe oculocerebrorenal syndrome (OCRL; 309000), an allelic disorder with a more severe phenotype including extrarenal manifestations.
Clinical Features
Hoopes et al. (2005) reported 5 families with Dent disease with mutations in the OCRL1 gene. PIP(2) 5-phosphatase activity was markedly reduced in skin fibroblasts cultured from the probands, and protein expression, measured by Western blot analysis, was reduced or absent. Slit-lamp examinations performed in childhood or adulthood for all 5 probands showed normal results. None of these patients had metabolic acidosis. Three of the 5 probands had mild mental retardation, whereas 2 had no developmental delay or behavioral disturbance.
Bockenhauer et al. (2012) reported 8 boys from 6 families with Dent disease-2. All had low molecular weight proteinuria and hypercalciuria, but none had renal tubular acidosis. About half had nephrocalcinosis. Two of the 8 patients had impaired cognitive function, 1 of whom also had early ocular nuclear densities. Other more variable extrarenal features among the patients included increased lactate dehydrogenase, increased creatine kinase, short stature, and umbilical hernia, some of which were reminiscent of Lowe syndrome. Bockenhauer et al. (2012) concluded that there is a broad phenotypic spectrum of OCRL mutations, suggesting that Dent disease-2 may be a mild variant of Lowe syndrome (Levin-Iaina and Dinour, 2012).
Molecular Genetics
Hoopes et al. (2005) reported affected members of 13 families with Dent disease in whom mutations in the CLCN5 gene (300008) were excluded, indicating genetic heterogeneity. In 5 of these 13 families, they identified mutations in the OCRL gene (see, e.g., 300535.0005 and 300535.0006).
Bockenhauer et al. (2012) identified 6 different mutations in the OCRL gene (see, e.g., 300535.0006-300535.0009) in 8 boys from 6 of 12 families with a phenotype resembling Dent disease who did not have mutations in the CLCN5 gene. Combined with other reports, the authors stated that OCRL mutations had been found in 43 (59.7%) of 72 families with a Dent disease phenotype.
INHERITANCE \- X-linked recessive GROWTH Height \- Short stature (in some patients) HEAD & NECK Eyes \- Mild ocular nuclear density (uncommon) ABDOMEN External Features \- Umbilical hernia (in some patients) GENITOURINARY Kidneys \- Proximal renal tubule defect \- Nephrocalcinosis (in some patients) \- Renal insufficiency, progressive NEUROLOGIC Central Nervous System \- Developmental delay, mild (in some patients) \- Cognitive impairment (in some patients) LABORATORY ABNORMALITIES \- Low-molecular-weight proteinuria \- Hypercalciuria \- Aminoaciduria, mild (in some patients) \- Increased creatine kinase \- Increased lactate dehydrogenase MISCELLANEOUS \- Onset in early childhood MOLECULAR BASIS \- Caused by mutation in the phosphatidylinositol polyphosphate 5-phosphatase gene (OCRL, 300535.0005 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
DENT DISEASE 2
|
c1839874
| 8,578 |
omim
|
https://www.omim.org/entry/300555
| 2019-09-22T16:20:07 |
{"doid": ["0050699"], "mesh": ["C545036"], "omim": ["300555"], "orphanet": ["1652", "93623"], "genereviews": ["NBK99494"]}
|
Diabetic myonecrosis is a complication of diabetes. It is caused by infarcted muscle tissue, usually in the thigh.[1]
## Contents
* 1 Epidemiology
* 2 Investigations and diagnosis
* 3 Treatment
* 4 Pathophysiology
* 5 Differential Diagnosis
* 6 References
* 7 Footnotes
## Epidemiology[edit]
The mean age at presentation is thirty-seven years with a reported range of nineteen to sixty-four years. The mean age of onset since diagnosis of diabetes is fifteen years. The female:male ratio is 1.3:1. Other diabetic complications such as nephropathy, neuropathy, retinopathy and hypertension are usually present. Its major symptom is the acute onset muscle pain, usually in the thigh, in the absence of trauma. Signs include exquisite muscle tenderness and swelling.
## Investigations and diagnosis[edit]
Tissue biopsy is the gold standard. Macroscopically this reveals pale muscle tissue. Microscopically infarcted patches of myocytes. Necrotic muscle fibers are swollen and eosinophilic and lack striations and nuclei. Small-vessel walls are thickened and hyalinized, with luminal narrowing or complete occlusion. Biopsy cultures for bacteria, fungi, acid-fast bacilli and stains are negative in simple myonecrosis.
Creatine kinase may be normal or increased probably depending upon the stage of the condition when sampling is undertaken. ESR is elevated. Planar X-ray reveals soft tissue swelling and may potentially show gas within necrotic muscle, Bone scan may show non specific uptake later in the course. CT shows muscle oedema with preserved tissue planes (non-contrast enhancing). MRI is the exam of choice and shows increased signal on T2 weighted images within areas of muscle oedema. Contrast enhancement is helpful but must be weighed against the risk of Nephrogenic Systemic Fibrosis as many diabetics have underlying chronic kidney disease. Arteriography reveals large and medium vessel arteriosclerosis occasionally with dye within the area of tissue infarction. Electromyography shows non specific focal changes.
Coronal fat suppressed STIR image demonstrating enlargement and increased signal in the left adductor muscle group with associated subcutaneous edema in a patient with diabetic myonecrosis.
Axial fat suppressed T2 weighted MRI image showing hyperintense signal and enlargement of the left thigh adductor muscle group in diabetic myonecrosis.
Axial fat suppressed post gadolinium contrast enhancement MRI image showing absent enhancement in the left thigh adductor muscles centrally indicating necrosis in diabetic myonecrosis.
## Treatment[edit]
Treatment includes supportive care with analgesics and anti-inflammatory agents. Exercise should be limited as it increases pain and extends the area of infarction. Symptoms usually resolve in weeks to months, but fifty percent of sufferers will experience relapse in either leg.
## Pathophysiology[edit]
The pathogenesis of this disease is unclear. Arteriosclerosis obliterans has been postulated as the cause, along with errors of the clotting and fibrinolytic pathways such as antiphospholipid syndrome.[2]
## Differential Diagnosis[edit]
A large number of conditions may cause symptoms and signs similar to diabetic myonecrosis and include: deep vein thrombosis, thrombophlebitis, cellulitis, fasciitis, abscess, haematoma, myositis, pseudothrombophlebitis (ruptured synovial cyst), pyomyositis, parasitic myositis, osteomyelitis, calcific myonecrosis, myositis ossificans, diabetic myotrophy, muscle strain or rupture, bursitis, vasculitis, arterial occlusion, haemangioma, lymphoedema, sarcoidosis, tuberculosis, cat-scratch disease, amyloidosis, as well as tumours of lipoma, chondroma, fibroma, leiomyoma, and sarcoma.
## References[edit]
* Wintz R, Pimstone K, Nelson S (Sep–Oct 2006). "Detection of diabetic myonecrosis. Complication is often-missed sign of underlying disease". Postgrad Med. 119 (3): 66–9. PMID 17128647. – Case report
* Mousa A, Hussein S, Daggett P, Coates P (7–9 November 2005). "Spontaneous non-traumatic muscle pain in diabetes" (abstract page). Endocrine Abstracts. 10: DP12. – Poster Presentation, 196th Meeting of the Society for Endocrinology, London, UK
* Subbiah V, Raina R, Kaelber D, Chung-Park M, Halle D, Mansour D, Perzy H (2004). "Diabetic Myonecrosis (Rare And Ominous Complication Of A Common Disease)" (PDF). American Medical Association Research Symposium. Archived from the original (PDF) on 2006-09-26. Retrieved 2006-08-24. – Poster presentation
## Footnotes[edit]
1. ^ Bhasin R, Ghobrial I (2013). "Diabetic myonecrosis: a diagnostic challenge in patients with long-standing diabetes". 3 (1). Journal of Community Hospital Internal Medicine Perspectives. doi:10.3402/jchimp.v3i1.20494. PMID 23882392. Retrieved 10 Oct 2020. Cite journal requires `|journal=` (help)
2. ^ Reyes-Balaguer J, Solaz-Moreno E, Morata-Aldea C, Elorza-Montesinos P (April 2005). "Spontaneous diabetic myonecrosis". Diabetes Care. 28 (4): 980–1. doi:10.2337/diacare.28.4.980-a. PMID 15793211.
* v
* t
* e
Diabetes
Types
* Type 1
* Type 2
* LADA
* Gestational diabetes
* Diabetes and pregnancy
* Prediabetes
* Impaired fasting glucose
* Impaired glucose tolerance
* Insulin resistance
* KPD
* MODY
* Neonatal
* Transient
* Permanent
* Type 3c (pancreatogenic)
* Type 3
Blood tests
* Blood sugar level
* Glycosylated hemoglobin
* Glucose tolerance test
* Postprandial glucose test
* Fructosamine
* Glucose test
* C-peptide
* Noninvasive glucose monitor
* Insulin tolerance test
Management
* Diabetic diet
* Anti-diabetic drugs
* Insulin therapy
* intensive
* conventional
* pulsatile
* Cure
* Embryonic stem cells
* Artificial pancreas
* Other
* Gastric bypass surgery
Complications
* Diabetic comas
* Hypoglycemia
* Ketoacidosis
* Hyperosmolar hyperglycemic state
* Diabetic foot
* ulcer
* Neuropathic arthropathy
* Organs in diabetes
* Blood vessels
* Muscle
* Kidney
* Nerves
* Retina
* Heart
* Diabetic skin disease
* Diabetic dermopathy
* Diabetic bulla
* Diabetic cheiroarthropathy
* Neuropathic ulcer
* Hyperglycemia
* Hypoglycemia
Other
* Glossary of diabetes
* History of diabetes
* Notable people with type 1 diabetes
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Diabetic myonecrosis
|
None
| 8,579 |
wikipedia
|
https://en.wikipedia.org/wiki/Diabetic_myonecrosis
| 2021-01-18T18:28:19 |
{"wikidata": ["Q5270136"]}
|
Renal vein thrombosis
Other namesBlood clot in the renal vein[1]
The anterior surfaces of the kidneys, showing the areas of contact of neighboring viscera.
SpecialtyNephrology
Renal vein thrombosis (RVT) is the formation of a clot in the vein that drains blood from the kidneys, ultimately leading to a reduction in the drainage of one or both kidneys and the possible migration of the clot to other parts of the body.[1] First described by German pathologist Friedrich Daniel von Recklinghausen in 1861, RVT most commonly affects two subpopulations: newly born infants with blood clotting abnormalities or dehydration and adults with nephrotic syndrome.[2]
Nephrotic syndrome, a kidney disorder, causes excessive loss of protein in the urine, low levels of albumin in the blood, a high level of cholesterol in the blood and swelling, triggering a hypercoagulable state and increasing chances of clot formation. Other less common causes include hypercoagulable state, cancer, kidney transplantation, Behcet syndrome, antiphospholipid antibody syndrome or blunt trauma to the back or abdomen.[3]
Treatment of RVT mainly focuses on preventing further blood clots in the kidneys and maintaining stable kidney function. The use of anticoagulants has become the standard treatment in treating this abnormality.[2] Membranous glomerulonephritis, the most common cause for nephrotic syndrome in adults, peaks in people ages 40–60 years old and it is twice as likely to occur in men than in women. Since nephrotic syndrome is the most common cause of RVT, people over 40 years old and men are most at risk to develop a renal vein thrombosis.[3]
## Contents
* 1 Signs and symptoms
* 2 Mechanism
* 2.1 Vein tissue damage
* 2.2 Decreased blood flow
* 2.3 Hypercoagulability
* 2.4 Membranous glomerulonephritis
* 3 Diagnosis
* 4 Treatment
* 5 Research
* 6 See also
* 7 References
* 8 External links
## Signs and symptoms[edit]
Aside from the occasional flank or lower back pain caused by a sudden clot in the major veins to the kidneys, RVT produces few symptoms. Some patients may not display any symptoms while other patients may experience bloody urine, decrease in urine output, edema and worsening proteinuria. Usually the diagnoses of RVT is first made when a nephrotic syndrome patient experiences a pulmonary embolism or a sudden decrease in kidney function or kidney failure. These symptoms may vary in duration since a blood clot can resolve itself, but precautions should be taken to prevent the migration of the clot to other parts of the body. The most severe complication of RVT is a pulmonary embolism, caused by a clot, also called a thrombus, that originates from the renal vein or any other vein in the body and migrates to the pulmonary artery. A pulmonary embolism is a serious condition because; it can damage the lungs due to pulmonary hypertension and cause low blood oxygen, damaging other organs in the body. This condition can cause death if left untreated; about 30% percent of patients who have a pulmonary embolism will die, usually within one hour.[4][5]
Infants and young children experiencing dehydration induced RVT, may experience dehydration symptoms (dry mouth, low urine output, loss of skin turgidity) as while as vomiting, nausea and fever, and the usual RVT symptoms like flank pain, blood in the urine, anaemia, edema, enlarged kidneys and kidney failure.[6]
## Mechanism[edit]
The mechanism behind RVT is no different from other types of blood clots in other parts of the body. Rudolf Virchow, was the first to describe the physiological mechanism behind venous thrombosis (blood clots) using three related factors, known as Virchow's Triad; damage to the blood vessel (endothelial damage), decrease in blood flow (stasis) and increased coagulability of the blood (thrombophilia or hypercoagulability). it is possible for one of these factors alone to cause a blood clot, but in most cases, a combination or all of these factors induce the formation of a blood clot. Decreased urine output or kidney function may be the only observable symptoms caused by a blood clot renal vein. Other less common causes include hypercoagulable state, invasion by renal cell carcinoma, kidney transplantation, Behcet syndrome, antiphospholipid antibody syndrome or blunt trauma to the back or abdomen.[3]
### Vein tissue damage[edit]
Damage to the endothelial tissue of the vein can be caused by blunt damage, trauma during venography, a renal transplant, tumors, acute rejection, vasculitis or spontaneous micro-trauma to the endothelium due to homocystinuria.[6] Cystathionine beta synthase deficiency, also known as homocystinuria, is an autosomal recessive inherited disorder in which the body is not able to process certain building blocks of proteins correctly due to a mutation to the CBS gene. This mutation causes the amino acid homocystine not to be used properly thus high levels build up in the blood, damaging the endothelial tissue and increasing the likelihood of RVT.[7]
### Decreased blood flow[edit]
The most common cause of RVT in infants is dehydration. Dehydration may be caused by reduction in both volume and circulatory blood volume due to water depleting abnormalities like diarrhea or vomiting. The decrease in blood volume due to dehydration will cause blood flow to be diverted away from the kidneys to other organs, resulting in slower blood flow to the kidneys, increasing chances of a blood clot occurrence. "RVT is known to occur in the absence of clinically obvious shock e.g. following neonatal distress and placement of central venous catheters." RVT can also be induced by post transplant distortion or physical distortion or compression of the renal vein, which depending on the shape distortion can affect the rate of flow through the vein.[6]
### Hypercoagulability[edit]
Hypercoagulability is an abnormality of the blood that increases the risk of the formation blood clots. Nephrotic syndrome patients have a higher risk of RVT development due to hypercoagulability caused by proteinuria. The increased loss of proteins in the urine caused by nephrotic syndrome results in lower osmotic pressure. Reduced osmotic pressure will trigger the liver to produce more proteins like fibrinogen and beta-thromboglobulin, which promote blood clotting. Other than nephrotic syndrome, there are many other factors that can promote hypercoagulability. Hypercoagulability can be promoted by increased platelet count, enhanced platelet aggregation, increased protein S count, and a decrease in coagulation inhibiters like antithrombin.[6] Hypercoagulability can be inherited and/or acquired. Hyperhomocysteinemia, a condition known to promote clots, can be caused by a combination of genetic factors and vitamin B6, vitamin B12 and folic acid deficiency.[8] Factor V Leidan and mutations of the prothrombin gene are the two most common genetic causes of hypercoagulability. About 5% of the general population have these heterozygous mutations and in the thrombophilic population, 45–63% have these mutations.[6]
### Membranous glomerulonephritis[edit]
The incidence of RVT in people with Nephrotic syndrome ranges from 5% to 65%. Nephrotic syndrome is caused by membranous glomerulonephritis,[6] minimal change disease, and focal segmental glomerulosclerosis.
## Diagnosis[edit]
CT showing dilatation and thrombosis of the left renal vein in a patient with nutcracker syndrome
There are no laboratory tests used to diagnose RVT.
Observing the patient's symptoms, medical history and imaging remain the fundamental source for diagnosing RVT. Imaging is used to detect the presence of a blood clot. In an abnormal kidney with RVT, a blood clot is present in the renal vein. In cases where the renal vein is suddenly and/or fully blocked, the kidneys will enlarge, reaching its maximum size within a week. An ultrasound imaging can be used to observe and track the size of the kidneys in RVT patients. Ultrasound is not efficient for use in detecting blood flow in the renal veins and artery. Instead a color doppler ultrasound may be used to detect renal blood flow. It is most commonly used to detect RVT in patients who have undergone renal transplantation. CT angiography is currently the top choice in diagnosing RVT. It is non-invasive, relatively cheap and fast with high accuracy. CT scanning can be used to detect renal enlargement, renal tumors, blood flow and other renal pathologies. An alternative is magnetic resonance angiography or MRA. It is non-invasive, fast and avoids radiation (unlike a CT scan) but it is relatively expensive. MRA produces detailed images of the renal blood flow, vesicle walls, the kidneys and any surrounding tissue. An inferior venocavography with selective venography can be used to rule out the diagnoses of RVT.[6]
## Treatment[edit]
Surgery to remove the clot is possible, but rarely performed. In the past, surgical removal of the renal vein clot was the primary treatment but it is very invasive and many complications can occur. In the past decades, treatment has shifted its focus from surgical intervention to medical treatments that include intravenous and oral anticoagulants. The use of anticoagulants may improve kidney function in RVT cases by removing the clot in the vein and preventing further clots from occurring. Patients already suffering from nephrotic syndrome may not need to take anticoagulants. In this case, patients should keep an eye out and maintain reduced level of proteinuria by reducing salt and excess protein, and intaking diuretics and statins. Depending on the severity of RVT, patients may be on anticoagulants from a year up to a lifetime. As long as the albumen levels in the bloodstream are below 2.5g/L, it is recommended that RVT patients continue taking anticoagulants. Main anticoagulants that can be used to treat RVT include warfarin and low molecular weight heparin. Heparin has become very popular, because of its low risk of complications, its availability and because it can easily be administered. Warfarin is known to interact with many other drugs, so careful monitoring is required.[6] If a nephrotic syndrome patient experiences any of the RVT symptoms (flank or back pain, blood in the urine or decreased kidney function), he or she should immediately see a doctor to avoid further complications.
The main side effect of anticoagulants is the risk of excessive bleeding. Other side effects include: blood in the urine or feces, severe bruising, prolonged nosebleeds (lasting longer than 10 minutes), bleeding gum, blood in your vomit or coughing up blood, unusual headaches, sudden severe back pain, difficulty breathing or chest pain, in women, heavy or increased bleeding during the period, or any other bleeding from the vagina. Warfarin can cause rashes, diarrhea, nausea (feeling sick) or vomiting, and hair loss. Heparin can cause hair loss (alopecia) thrombocytopenia – a sudden drop in the number of platelets in the blood.[9]
It has been reported in a case study of 27 patients with nephrotic syndrome caused RVT, there was a 40% mortality rate, mostly due to hemorrhagic complications and sepsis. In 75% of the remaining surviving patients, the RVT was resolved and kidney function returned to normal. It has been concluded that age is not a factor on the survival of RVT patients, although older patient (55 and older) are more likely to develop kidney failure. Heparin is crucial in returning normal kidney function; in patients that did not take heparin, long term kidney damage was observed in 100%. In patients that did take heparin, kidney damage was observed in about 33%. By quickly treating, and receiving the correct medications, patients should increase their chances of survival and reduce the risk of the renal vein clot from migrating to another part of the body.[6]
## Research[edit]
It is known that diabetes causes changes to factors associated with coagulation and clotting, however not much is known of the risk of thromboembolism, or clots, in diabetic patients. There are some studies that show that diabetes increases the risk of thromboembolism; other studies show that diabetes does not increase the risk of thromboembolism. A study conducted in the Umeå University Hospital, in Sweden, observed patients that were hospitalized due to an thromboembolism from 1997 to 1999. The researchers had access to patient information including age, sex, vein thromboembolism diagnosis, diagnostic methods, diabetes type and medical history. This study concluded that there is, in fact, an increased risk of thromboembolism development in diabetic patients, possibly due to factors associated with diabetes or diabetes itself. Diabetic patients are twice as likely to develop a thromboembolism than are non-diabetic patient. The exact mechanism of how diabetes increases the risk of clot formation remains unclear and could possibly be a future direction for study.[10]
From previous studies, it is known that long distance air travel is associated with high risk of venous thrombosis. Long periods of inactivity in a limited amount of space may be a reason for the increased risk of blood clot formation. In addition, bent knees compresses the vein behind the knee (the popliteal vein) and the low humidity, low oxygen, high cabin pressure and consumption of alcohol concentrate the blood.[11] A recent study, published in the British Journal of Haematology in 2014, determined which groups of people, are most at risk for developing a clot during or after a long flight. The study focused on 8755 frequent flying employees from international companies and organizations. It found that travelers who have recently undergone a surgical procedure or who have a malignant disease such as cancer or who are pregnant are most at risk. Preventative measures before flying may be taken in these at-risk groups as a solution.[12]
Patients who have undergone kidney transplant have a high risk of developing RVT (about 0.4% to 6%). RVT is known to account for a large proportion of transplanted kidney failures due to technical problems (damage to the renal vein), clotting disorders, diabetes, consumption of ciclosporin or an unknown problem. Patients who have undergone a kidney transplant are commonly prescribed ciclosporin, an immunosuppressant drug which is known to reduce renal blood flow, increase platelet aggregation in the blood and cause damage to the endothelial tissue of the veins. In a clinical study conducted by the Nuffield Department of Surgery at the Oxford Transplant Centre, UK, transplant patients were given low doses of aspirin, which has a some anti-platelet activity. There is risk of bleeding in transplant patients when using anticoagulants like warfarin and herapin. Low dosage of aspirin was used as an alternative. The study concluded that a routine low-dose of aspirin in kidney transplant patients who are also taking ciclosporin significantly reduces the risk of RVT development.[13]
## See also[edit]
* Nephrotic syndrome
## References[edit]
1. ^ a b "Renal vein thrombosis: MedlinePlus Medical Encyclopedia". medlineplus.gov. Retrieved 27 May 2019.
2. ^ a b Wessels, Hunter; McAninch, Jack W., eds. (2005). Handbook of Urological Emergencies: A Practical Guide. Totowa, N.J.: Humana Press. pp. 171–180. ISBN 978-1-58829-256-8.
3. ^ a b c Laskowski, Igor. "Renal Vein Thrombosis". Archived from the original on 31 March 2014. Retrieved 30 March 2014.
4. ^ "What is a Pulmonary Embolism". National Heart, Lung and Blood Institute. NIH. Retrieved 1 April 2014.
5. ^ Harrington, John T; Jerome Kassirer (1982). "Renal Vein Thrombosis". Annual Review of Medicine. 33: 255–62. doi:10.1146/annurev.me.33.020182.001351. PMID 7081962.
6. ^ a b c d e f g h i Asghar, M.; Ahmed, K.; Shah, S.S.; Siddique, M.K.; Dasgupta, P.; Khan, M.S. (August 2007). "Renal Vein Thrombosis". European Journal of Vascular and Endovascular Surgery. 34 (2): 217–223. doi:10.1016/j.ejvs.2007.02.017. PMID 17543556.
7. ^ "Homocystinuria". Genetics Home Reference. National Institute of Health. Retrieved 30 March 2014.
8. ^ Deitcher, Seven. "Hypercoagulable States". Disease Management Project. Cleveland Clinic Center for Continuing Education. Retrieved 31 March 2014.
9. ^ "Anticoagulant medicines - Side effects". NHS Choices. NHS. Retrieved 1 April 2014.
10. ^ Petrauskiene, V.; Falk, M.; Waernbaum, I.; Norberg, M.; Eriksson, J. W. (19 March 2005). "The risk of venous thromboembolism is markedly elevated in patients with diabetes". Diabetologia. 48 (5): 1017–1021. doi:10.1007/s00125-005-1715-5. PMID 15778859.
11. ^ Kos, Cynthia. "Air Travel and Deep Vein Thrombosis DVT". Stop the Clot Alliance. Retrieved 29 April 2014.
12. ^ Kuipers, Saskia; Venemans, Annemarie; Middeldorp, Saskia; Büller, Harry R.; Cannegieter, Suzanne C.; Rosendaal, Frits R. (May 2014). "The risk of venous thrombosis after air travel: contribution of clinical risk factors". British Journal of Haematology. 165 (3): 412–413. doi:10.1111/bjh.12724. PMID 24428564.
13. ^ Robertson, Amanda; Vinod Nargund; Derek W.R. Gray; Peter J. Morris (2000). "Low dose aspirin as prophylaxis against renal-vein thrombosis renal-transplant recipients". Nephrology Dialysis Transplantation. 15 (11): 1865–1868. doi:10.1093/ndt/15.11.1865. PMID 11071979.
## External links[edit]
Classification
D
* ICD-10: I82.3
* ICD-9-CM: 453.3
* DiseasesDB: 11359
External resources
* MedlinePlus: 000513
* eMedicine: med/2005 radio/887
* v
* t
* e
Disorders of bleeding and clotting
Coagulation · coagulopathy · Bleeding diathesis
Clotting
By cause
* Clotting factors
* Antithrombin III deficiency
* Protein C deficiency
* Activated protein C resistance
* Protein S deficiency
* Factor V Leiden
* Prothrombin G20210A
* Platelets
* Sticky platelet syndrome
* Thrombocytosis
* Essential thrombocythemia
* DIC
* Purpura fulminans
* Antiphospholipid syndrome
Clots
* Thrombophilia
* Thrombus
* Thrombosis
* Virchow's triad
* Trousseau sign of malignancy
By site
* Deep vein thrombosis
* Bancroft's sign
* Homans sign
* Lisker's sign
* Louvel's sign
* Lowenberg's sign
* Peabody's sign
* Pratt's sign
* Rose's sign
* Pulmonary embolism
* Renal vein thrombosis
Bleeding
By cause
Thrombocytopenia
* Thrombocytopenic purpura: ITP
* Evans syndrome
* TM
* TTP
* Upshaw–Schulman syndrome
* Heparin-induced thrombocytopenia
* May–Hegglin anomaly
Platelet function
* adhesion
* Bernard–Soulier syndrome
* aggregation
* Glanzmann's thrombasthenia
* platelet storage pool deficiency
* Hermansky–Pudlak syndrome
* Gray platelet syndrome
Clotting factor
* Hemophilia
* A/VIII
* B/IX
* C/XI
* von Willebrand disease
* Hypoprothrombinemia/II
* Factor VII deficiency
* Factor X deficiency
* Factor XII deficiency
* Factor XIII deficiency
* Dysfibrinogenemia
* Congenital afibrinogenemia
Signs and symptoms
* Bleeding
* Bruise
* Hematoma
* Petechia
* Purpura
* Nonthrombocytopenic purpura
By site
* head
* Epistaxis
* Hemoptysis
* Intracranial hemorrhage
* Hyphema
* Subconjunctival hemorrhage
* torso
* Hemothorax
* Hemopericardium
* Pulmonary hematoma
* abdomen
* Gastrointestinal bleeding
* Hemobilia
* Hemoperitoneum
* Hematocele
* Hematosalpinx
* joint
* Hemarthrosis
* v
* t
* e
Cardiovascular disease (vessels)
Arteries, arterioles
and capillaries
Inflammation
* Arteritis
* Aortitis
* Buerger's disease
Peripheral artery disease
Arteriosclerosis
* Atherosclerosis
* Foam cell
* Fatty streak
* Atheroma
* Intermittent claudication
* Critical limb ischemia
* Monckeberg's arteriosclerosis
* Arteriolosclerosis
* Hyaline
* Hyperplastic
* Cholesterol
* LDL
* Oxycholesterol
* Trans fat
Stenosis
* Carotid artery stenosis
* Renal artery stenosis
Other
* Aortoiliac occlusive disease
* Degos disease
* Erythromelalgia
* Fibromuscular dysplasia
* Raynaud's phenomenon
Aneurysm / dissection /
pseudoaneurysm
* torso: Aortic aneurysm
* Abdominal aortic aneurysm
* Thoracic aortic aneurysm
* Aneurysm of sinus of Valsalva
* Aortic dissection
* Aortic rupture
* Coronary artery aneurysm
* head / neck
* Intracranial aneurysm
* Intracranial berry aneurysm
* Carotid artery dissection
* Vertebral artery dissection
* Familial aortic dissection
Vascular malformation
* Arteriovenous fistula
* Arteriovenous malformation
* Telangiectasia
* Hereditary hemorrhagic telangiectasia
Vascular nevus
* Cherry hemangioma
* Halo nevus
* Spider angioma
Veins
Inflammation
* Phlebitis
Venous thrombosis /
Thrombophlebitis
* primarily lower limb
* Deep vein thrombosis
* abdomen
* Hepatic veno-occlusive disease
* Budd–Chiari syndrome
* May–Thurner syndrome
* Portal vein thrombosis
* Renal vein thrombosis
* upper limb / torso
* Mondor's disease
* Paget–Schroetter disease
* head
* Cerebral venous sinus thrombosis
* Post-thrombotic syndrome
Varicose veins
* Gastric varices
* Portacaval anastomosis
* Caput medusae
* Esophageal varices
* Hemorrhoid
* Varicocele
Other
* Chronic venous insufficiency
* Chronic cerebrospinal venous insufficiency
* Superior vena cava syndrome
* Inferior vena cava syndrome
* Venous ulcer
Arteries or veins
* Angiopathy
* Macroangiopathy
* Microangiopathy
* Embolism
* Pulmonary embolism
* Cholesterol embolism
* Paradoxical embolism
* Thrombosis
* Vasculitis
Blood pressure
Hypertension
* Hypertensive heart disease
* Hypertensive emergency
* Hypertensive nephropathy
* Essential hypertension
* Secondary hypertension
* Renovascular hypertension
* Benign hypertension
* Pulmonary hypertension
* Systolic hypertension
* White coat hypertension
Hypotension
* Orthostatic hypotension
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Renal vein thrombosis
|
c0238457
| 8,580 |
wikipedia
|
https://en.wikipedia.org/wiki/Renal_vein_thrombosis
| 2021-01-18T18:36:05 |
{"umls": ["C0238457"], "icd-9": ["453.3"], "icd-10": ["I82.3"], "wikidata": ["Q546176"]}
|
Arsenical keratosis
SpecialtyDermatology
An arsenical keratosis is a growth of keratin on the skin caused by arsenic,[1]:725 which occurs naturally in the earth's crust and is widely distributed in the environment,[2] Arsenical compounds are used in industrial, agricultural, and medicinal substances. Arsenic is also found to be an environmental contaminant in drinking water (well water) and an occupational hazard for miners and glass workers.[3]:640 Arsenic may also causes other conditions including: Bowen's disease,[4] cardiovascular diseases, developmental abnormalities, neurologic and neurobehavioral disorders, diabetes, hearing loss, hematologic disorders, and various types of cancer.[5] Arsenical keratoses may persist indefinitely, and some may develop into invasive squamous cell carcinoma. Metastatic arsenic squamous cell carcinoma and arsenic-induced malignancies in internal organs such as the bladder, kidney, skin, liver, and colon, may result in death.[5]
## Contents
* 1 Signs/symptoms
* 2 Pathophysiology
* 3 Diagnosis
* 4 Treatment
* 5 References
## Signs/symptoms[edit]
Books talk about diffuse ketarosic neoformations in palms and plants, which can evolve into basal cell carcinoma. These neoformations are usually yellowish.
## Pathophysiology[edit]
Arsenite impairs nucleotide excision repair,[6] and it may also affect gene expression by increasing or decreasing DNA methylation. The high affinity of arsenic for sulfhydryl groups makes keratin-rich cells (e.g., epidermal keratinocytes) a sensitive target for arsenic-induced toxicity. Arsenic has been shown to alter epidermal keratinocyte differentiation processes,[7] induce overexpression of growth factors,[8] and enhance proliferation of human keratinocytes.
## Diagnosis[edit]
This section is empty. You can help by adding to it. (March 2017)
## Treatment[edit]
* A chelating agent (e.g., dimercaprol) may be helpful to correct acute arsenic exposure, but it has minimal or no effect for patients who had arsenic exposure a long time ago.
* Oral retinoids (e.g., acitretin,[4][9][10] etretinate[11]) may be helpful in treating arsenic-induced cutaneous lesions and in reducing the risk of cutaneous and internal malignancy formation, especially in Bowman's disease.
* Topical 5-fluorouracil cream[10] or 5% imiquimod cream[12] may be useful in treating arsenical keratoses and Bowen's disease.
## References[edit]
1. ^ Freedberg, et al. (2003). Fitzpatrick's Dermatology in General Medicine. (6th ed.). McGraw-Hill. ISBN 0-07-138076-0.
2. ^ Duker AA, Carranza EJ, Hale M (July 2005). "Arsenic geochemistry and health". Environ Int. 31 (5): 631–41. doi:10.1016/j.envint.2004.10.020. PMID 15910959.
3. ^ James, William D.; Berger, Timothy G.; et al. (2006). Andrews' Diseases of the Skin: clinical Dermatology. Saunders Elsevier. ISBN 0-7216-2921-0.
4. ^ a b Yerebakan O, Ermis O, Yilmaz E, Basaran E (February 2002). "Treatment of arsenical keratosis and Bowen's disease with acitretin". Int. J. Dermatol. 41 (2): 84–7. doi:10.1046/j.1365-4362.2002.01372.x. PMID 11982642.
5. ^ a b Tchounwou PB, Centeno JA, Patlolla AK (January 2004). "Arsenic toxicity, mutagenesis, and carcinogenesis--a health risk assessment and management approach" (PDF). Mol. Cell. Biochem. 255 (1–2): 47–55. doi:10.1023/B:MCBI.0000007260.32981.b9. PMID 14971645.
6. ^ Hartwig A, Groblinghoff UD, Beyersmann D, Natarajan AT, Filon R, Mullenders LH (February 1997). "Interaction of arsenic(III) with nucleotide excision repair in UV-irradiated human fibroblasts". Carcinogenesis. 18 (2): 399–405. doi:10.1093/carcin/18.2.399. PMID 9054635.
7. ^ Kachinskas DJ, Phillips MA, Qin Q, Stokes JD, Rice RH (November 1994). "Arsenate perturbation of human keratinocyte differentiation". Cell Growth Differ. 5 (11): 1235–41. PMID 7848924.
8. ^ Germolec DR, Yoshida T, Gaido K, et al. (November 1996). "Arsenic induces overexpression of growth factors in human keratinocytes". Toxicol. Appl. Pharmacol. 141 (1): 308–18. doi:10.1006/taap.1996.0288. PMID 8917704.
9. ^ Son SB, Song HJ, Son SW (March 2008). "Successful treatment of palmoplantar arsenical keratosis with a combination of keratolytics and low-dose acitretin". Clin. Exp. Dermatol. 33 (2): 202–4. doi:10.1111/j.1365-2230.2007.02596.x. PMID 18039342. Archived from the original on 2013-01-05.
10. ^ a b Khandpur S, Sharma VK (October 2003). "Successful treatment of multiple premalignant and malignant lesions in arsenical keratosis with a combination of acitretin and intralesional 5-fluorouracil". J. Dermatol. 30 (10): 730–4. doi:10.1111/j.1346-8138.2003.tb00468.x. PMID 14684956. Archived from the original on 2011-07-22.
11. ^ Sharma SC, Simpson NB (1983). "Treatment of arsenical keratosis with etretinate". Acta Derm. Venereol. 63 (5): 449–52. PMID 6197851.
12. ^ Boonchai W (April 2006). "Treatment of precancerous and cancerous lesions of chronic arsenicism with 5% imiquimod cream". Arch Dermatol. 142 (4): 531–2. doi:10.1001/archderm.142.4.531. PMID 16618886.[permanent dead link]
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Arsenical keratosis
|
c0854707
| 8,581 |
wikipedia
|
https://en.wikipedia.org/wiki/Arsenical_keratosis
| 2021-01-18T18:42:37 |
{"umls": ["C0854707"], "wikidata": ["Q4796468"]}
|
Schinzel and Bernasconi (1990) reported the cases of a 13-year-old boy and his 28-year-old sister who had short stature, obesity, and a pattern of minor anomalies including a sloping, narrow forehead; small ears; narrow nose with prominent bridge and long septum; receding mandible; and short limbs with brachydactyly and clinodactyly of the fifth fingers. Intelligence was normal. The parents were normal but remotely consanguineous. Both had hypermetropia. The sister was 138 cm tall and managed the family's butchery. At age 22, the brother had reached the height of 142 cm.
HEENT \- Sloping, narrow forehead \- Small ears \- Narrow nose \- Prominent nasal bridge \- Long nasal septum \- Micrognathia Limbs \- Short limbs \- Brachydactyly \- Fifth finger clinodactyly Growth \- Short stature \- Obesity Inheritance \- Autosomal recessive ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
SHORT STATURE-OBESITY SYNDROME
|
c1849235
| 8,582 |
omim
|
https://www.omim.org/entry/269870
| 2019-09-22T16:22:28 |
{"mesh": ["C564821"], "omim": ["269870"]}
|
## Clinical Features
Braddock et al. (1993) reported 4 cases of sagittal craniosynostosis and the Dandy-Walker malformation (posterior fossa cyst, hypoplasia of the cerebellar vermis and often hydrocephalus) and suggested that they represented an autosomal dominant multiple malformation syndrome distinct from other disorders in which either craniosynostosis or the Dandy-Walker malformation is present. A mother and her 2 sons were affected. The 2 sons had developmental delay, and the mother had had difficulties in school. A fourth unrelated boy was similarly affected. (Cohen (1993) referred to this as Jones syndrome. Not unexpectedly, at least one other disorder had been referred to as Jones syndrome (135550).)
Basel-Vanagaite et al. (2010) reported a nonconsanguineous family of Moroccan-Jewish origin with variable expression of ventriculomegaly or hydrocephalus and posterior fossa abnormalities. Two brothers had ventriculomegaly detected on brain imaging at ages 16 and 8 years, respectively. One also had a midline cyst in the trigeminal cistern and compressing the tectum, as well as a megacisterna magna with minimal vermian hypoplasia. He was asymptomatic and had normal neurologic development. The other boy had enlargement of all the ventricles and colpocephaly, as well as an enlarged posterior fossa with megacisterna magna, but no cyst. The massa intermedia was large and malformed, and he had partial absence of the septum pellucidum. He had recurrent headaches and underwent ventriculoperitoneal shunting. Otherwise he had normal development. The healthy mother had a history of 2 pregnancy terminations due to severe fetal hydrocephalus developing late in pregnancy; both were males. Her brain MRI showed enlargement of the lateral ventricles with mild colpocephaly, a midline cyst, an enlarged massa intermedia, and an enlarged posterior fossa with a megacisterna magna and minimal vermian hypoplasia. She had no neurologic abnormalities. The maternal grandmother had ventriculomegaly and recurrent headaches. She also had dysmetria of the upper limbs, abnormal tandem gait, and memory loss. Brain MRI of 2 clinically unaffected sisters of the probands showed mildly enlarged posterior fossa without ventricular dilatation. Basel-Vanagaite et al. (2010) noted that the Dandy-Walker malformation and megacisterna magna seem to represent a continuum of developmental anomalies of the posterior fossa, and that abnormalities of the posterior fossa predispose to the development of hydrocephalus.
Inheritance
Braddock et al. (1993) suggested autosomal dominant inheritance of sagittal craniosynostosis and Dandy-Walker malformation in the 4 cases they reported.
The transmission pattern of ventriculomegaly or hydrocephalus and posterior fossa abnormalities in the family reported by Basel-Vanagaite et al. (2010) was consistent with either autosomal dominant or X-linked inheritance.
Mapping
Vincent et al. (1994) described a contiguous gene syndrome resulting from deletion of 8q12.2-q21.2 (600257) and characterized by a combination of hydrocephalus with branchiootorenal (BOR) syndrome (113650), Duane syndrome (126800), and aplasia of the trapezius muscle. They suggested that a gene responsible for a dominant form of hydrocephalus maps within this region.
Neuro \- Posterior fossa cyst \- Cerebellar vermis hypoplasia \- Hydrocephalus Skull \- Sagittal craniosynostosis Inheritance \- Autosomal dominant ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
HYDROCEPHALUS, AUTOSOMAL DOMINANT
|
c1838347
| 8,583 |
omim
|
https://www.omim.org/entry/123155
| 2019-09-22T16:42:43 |
{"doid": ["10908"], "mesh": ["C563973"], "omim": ["123155"], "orphanet": ["1538"], "synonyms": ["Braddock-Jones-Superneau syndrome"]}
|
Paris-Trousseau thrombocytopenia (TCPT) is a contiguous gene syndrome characterized by mild bleeding tendency, variable thrombocytopenia (THC), dysmorphic facies, abnormal giant alpha-granules in platelets and dysmegakaryopoiesis.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Paris-Trousseau thrombocytopenia
|
c1956093
| 8,584 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=851
| 2021-01-23T17:55:01 |
{"gard": ["4224"], "mesh": ["D054868", "C538617"], "omim": ["188025", "617443"], "umls": ["C1861178", "C1956093"], "icd-10": ["D69.4"]}
|
Aagenaes syndrome
Other namesAagenæs syndrome, Cholestasis-lymphedema syndrome
Aagenaes syndrome is inherited in an autosomal recessive manner
Aagenaes syndrome is a syndrome characterised by congenital hypoplasia of lymph vessels, which causes lymphedema of the legs and recurrent cholestasis in infancy, and slow progress to hepatic cirrhosis and giant cell hepatitis with fibrosis of the portal tracts.[1][2]
The genetic cause is unknown, but it is autosomal recessively inherited and the gene is located to chromosome 15q1,2. A common feature of the condition is a generalised lymphatic anomaly, which may be indicative of the defect being lymphangiogenetic in origin1. The condition is particularly frequent in southern Norway, where more than half the cases are reported from, but is found in patients in other parts of Europe and the United States.[3] It is named after Øystein Aagenæs, a Norwegian paediatrician.[4] It is also called cholestasis-lymphedema syndrome (CLS).[5]
## See also[edit]
* Lymphedema-distichiasis syndrome
* Lymphedema praecox
* Blueberry muffin baby
## References[edit]
1. ^ Rapini, Ronald P.; Bolognia, Jean L.; Jorizzo, Joseph L. (2007). Dermatology: 2-Volume Set. St. Louis: Mosby. ISBN 978-1-4160-2999-1.
2. ^ Bull LN, Roche E, Song EJ, Pedersen J, Knisely AS, van Der Hagen CB, Eiklid K, Aagenaes O, Freimer NB (Oct 2000). "Mapping of the locus for cholestasis-lymphedema syndrome (Aagenaes syndrome) to a 6.6-cM interval on chromosome 15q". Am J Hum Genet. 67 (4): 994–9. doi:10.1086/303080. PMC 1287903. PMID 10968776.
3. ^ Heiberg A (May 2001). "Aagenaes syndrome: lymphedema and intrahepatic cholestasis". Tidsskr Nor Laegeforen. 121 (14): 1718–9. PMID 11446017.
4. ^ "Øystein Aagenæs".
5. ^ Frühwirth, M.; et al. (Apr 2003). "Evidence for genetic heterogeneity in lymphedema-cholestasis syndrome". Journal of Pediatrics. 142 (4): 441–447. doi:10.1067/mpd.2003.148. PMID 12712065.
## External links[edit]
Classification
D
* ICD-10: Q82.0
* OMIM: 214900
* MeSH: C535330 C535330, C535330
* DiseasesDB: 32129
External resources
* Orphanet: 1414
This immunology article is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Aagenaes syndrome
|
c0268314
| 8,585 |
wikipedia
|
https://en.wikipedia.org/wiki/Aagenaes_syndrome
| 2021-01-18T18:28:29 |
{"gard": ["370"], "mesh": ["C535330"], "umls": ["C0268314"], "orphanet": ["1414"], "wikidata": ["Q300801"]}
|
Fournier et al. (1963) observed a family in which 4 of 5 children had clinical and/or autopsy evidence of pulmonary stenosis and congenital nephrotic syndrome.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
PULMONIC STENOSIS AND CONGENITAL NEPHROSIS
|
c0403552
| 8,586 |
omim
|
https://www.omim.org/entry/265600
| 2019-09-22T16:23:00 |
{"mesh": ["C562895"], "omim": ["265600"]}
|
Shashi-Pena syndrome is a rare neurologic disease characterized by delayed psychologic and motor development, variable intellectual disability, and poor muscle tone (hypotonia). Described features include tall stature, a large head (macrocephaly), deep palmar creases, and distinct facial features. These features include a port-wine birthmark on the forehead (glabellar nevus flammeus), widely spaced eyes (hypertelorism), arched eyebrows, prominent eyes, a broad nasal tip and minor ear abnormalities. Some patients may also have heart abnormalities (such as atrial septal defect), feeding difficulties, changes in bone mineral density, advanced bone age, aggressive and/or autistic behavior and/or seizures. MRI of the brain may show a loss of neuronal cells (cerebral atrophy). Blood exams may show episodes of low sugar (hypoglycemia), and in some cases, elevated liver enzymes (transaminases), high levels of insulin (hyperinsulinemia), and high fat levels (hyperlipidemia). Shashi-Pena syndrome is caused by variations (mutations) in the ASXL2 gene, which is important for neurologic and bone development, heart function, and glucose and lipid metabolism. Treatment depends on the symptoms and may include medication and behavioral therapy, as well as surgical procedures if needed.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Shashi-Pena syndrome
|
c4310672
| 8,587 |
gard
|
https://rarediseases.info.nih.gov/diseases/13495/shashi-pena-syndrome
| 2021-01-18T17:57:44 |
{"omim": ["617190"], "synonyms": ["ASXL2/Shashi-Pena Syndrome"]}
|
Pain asymbolia, also called pain dissociation, is a condition in which pain is experienced without unpleasantness. This usually results from injury to the brain, lobotomy, cingulotomy or morphine analgesia. Preexisting lesions of the insula may abolish the aversive quality of painful stimuli while preserving the location and intensity aspects. Typically, patients report that they have pain but are not bothered by it; they recognize the sensation of pain but are mostly or completely immune to suffering from it. The pathophysiology of this disease revolves around a disconnect between the insular cortex secondary to damage and the limbic system, specifically the cingulate gyrus whose prime response to the pain perceived by insular cortex is to tether it with an agonizing emotional response thus signalling the individual of its propensity to inflict actual harm. A disconnect however is not the only prime causative factor, damage to these aforementioned cortical structures also results in the same symptomology. [1][2][3]
## References[edit]
1. ^ Neuroscience: With STUDENT CONSULT Online Access. Philadelphia: Saunders. 2006. ISBN 1-4160-3445-5.
2. ^ Nikola Grahek, Feeling pain and being in pain, Oldenburg, 2001. ISBN 3-8142-0780-7
3. ^ Phantoms in the Brain by VS Ramachandran — Page 208
This medical symptom article is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
http://www.archipel.uqam.ca/2996/1/Frak.PDF
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Pain asymbolia
|
c0563625
| 8,588 |
wikipedia
|
https://en.wikipedia.org/wiki/Pain_asymbolia
| 2021-01-18T18:39:17 |
{"mesh": ["D000377"], "umls": ["C0563625"], "wikidata": ["Q2868696"]}
|
CLIPPERS is a rare neuroinflammatory disorder characterized by brainstem-predominant encephalomyelitis which typically presents with cerebellar and cranial nerve manifestations (gait ataxia, dysarthria, visual disorders, parasthesias), as well as brainstem, myelopathy and cognitive findings, that respond to steroid treatment. Punctate curvilinear post-gadolinium contrast enhancement predominantly in the pons and cerebellum is observed on brain MRI and prominent, perivascular, CD3+ T-cell predominantly lymphocytic inflammation in neuropathology.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
CLIPPERS
|
c3854437
| 8,589 |
orphanet
|
https://www.orpha.net/consor/cgi-bin/OC_Exp.php?lng=EN&Expert=284448
| 2021-01-23T17:48:01 |
{"gard": ["10779"], "umls": ["C3854437"], "synonyms": ["Chronic lymphocytic inflammation with pontine perivascular enhancement responsive to steroids"]}
|
Wobbly hedgehog syndrome (WHS) is a progressive, degenerative, neurological disease of the African pygmy hedgehog.[1][2] The cause is believed to be genetic.[3] Nearly 10 percent of pet African pygmy hedgehogs are affected,[2] due to their limited bloodlines.[4]
## Symptoms[edit]
The disease slowly degrades the hedgehog's muscle control. This first appears as a wobble while the hedgehog is attempting to stand still. Over time, the hedgehog will lose control of all muscles from the rear of its body to the front. A tentative diagnosis can be based purely on the clinical signs, but definitive diagnosis is only possible from post-mortem examination of spinal cord and brain tissues.[1]
The hedgehog's health will deteriorate over the course of weeks or months, and in the advanced stages of this disease, they become completely immobilized, making euthanasia a recommended consideration.[1] Most animals die within two years of diagnosis.[5]
Symptoms usually begin in hedgehogs before they reach two years old, but can occur at any age.[6]
## Treatment[edit]
There is no known cure for WHS, which has been compared to human multiple sclerosis.[5] Various vitamin supplements, antibiotic and steroid treatments have been used; some appear to temporarily improve the signs or slow the progression of the disease, but as signs of WHS wax and wane, it is difficult to assess the benefit of treatments.[2] No treatment has been shown to prevent the progression of paralysis.[2]
## References[edit]
1. ^ a b c Axelson, Rick. "Wobbly hedgehog syndrome". VCA Animal Hospitals. Retrieved 5 June 2014.
2. ^ a b c d Graesser, Donnasue; Spraker, Terry R.; Dressen, Priscilla; Garner, Michael M.; Raymond, James T.; Terwilliger, Gordon; Kim, Jung; Madri, Joseph A. (January 2006). "Wobbly hedgehog syndrome in African pygmy hedgehogs (Atelerix spp.)". Journal of Exotic Pet Medicine. 15 (1): 59–65. doi:10.1053/j.jepm.2005.11.010.
3. ^ Storm, Pat; Graesser, Donnasue (July 2007). "Wobbly hedgehog syndrome: A genetic disease?" (PDF). The Hedgehog Welfare Society Newsletter. Vol. 28. p. 2–4.
4. ^ Warwick, Hugh (11 December 2009). "The craze for pet hedgehogs will be a disaster". The Daily Telegraph. London. Retrieved 15 June 2017.
5. ^ a b Inglis, Joe (16 May 2012). "What helps with wobbly hedgehog syndrome? Joe Inglis explains". Metro. London. Retrieved 15 June 2017.
6. ^ McLaughlin, Alicia; Strunk, Anneliese (May 2016). "Common emergencies in small rodents, hedgehogs, and sugar gliders". Veterinary Clinics of North America: Exotic Animal Practice. 19 (2): 465–499. doi:10.1016/j.cvex.2016.01.008. PMID 27131160.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Wobbly hedgehog syndrome
|
None
| 8,590 |
wikipedia
|
https://en.wikipedia.org/wiki/Wobbly_hedgehog_syndrome
| 2021-01-18T18:45:32 |
{"wikidata": ["Q8028961"]}
|
## Description
Macroglossia is an abnormal enlargement of the tongue. It is commonly observed with type 2 glycogen storage disease (232300), neurofibromatosis (162200), congenital hypothyroidism, and the Beckwith-Wiedemann syndrome (130650).
Inheritance
Macroglossia was reported as an isolated hereditary trait, apparently for the first time, by Reynoso et al. (1986). In 1 family, 15 persons in 6 sibships in 3 generations were affected in an autosomal dominant pedigree pattern. There were 2 instances of father-to-son transmission. In another family, the father and a son and daughter were affected. In each of the 2 families, the proband was a baby born with big tongue, leading to the diagnosis of congenital hypothyroidism or atypical Down syndrome. Reynoso et al. (1994) described 2 additional families with isolated autosomal dominant macroglossia. In 1 family, 2 sisters and 3 of their 4 children (2 sons and a daughter) were affected; in the other family, a father and daughter were affected.
Mouth \- Isolated macroglossia Inheritance \- Autosomal dominant ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
MACROGLOSSIA
|
c0009677
| 8,591 |
omim
|
https://www.omim.org/entry/153630
| 2019-09-22T16:38:38 |
{"mesh": ["C531735"], "omim": ["153630"], "icd-10": ["K14.8"], "orphanet": ["2430"]}
|
Enthesitis
Typical joint showing the entheses
SpecialtyRheumatology
This section needs additional citations for verification. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed. (October 2019) (Learn how and when to remove this template message)
Enthesitis is inflammation of the entheses, the sites where tendons or ligaments insert into the bone.[1][2] It is an enthesopathy, a pathologic condition of the entheses. Early clinical manifestations are an aching sensation akin to "working out too much", and it gets better with activity. It is worse in the morning (after sleeping and not moving). The muscle insertion hurts very focally as it joins into the bone, but there is little to no pain at all with passive motion. While it is typically associated with other autoimmune diseases, like spondyloarthropaties and psoriasis (thought to often precede psoriatic arthritis). A common autoimmune enthesitis is at the heel, where the Achilles tendon attaches to the calcaneus. There are some cases of isolated, primary enthesitis which are very poorly studied and understood.
It is associated with HLA B27 arthropathies, such as ankylosing spondylitis, psoriatic arthritis, and reactive arthritis.[3][4] Symptoms include multiple points of tenderness at the heel, tibial tuberosity, iliac crest, and other tendon insertion sites.
## Contents
* 1 Images
* 2 Related conditions
* 3 See also
* 4 References
* 5 External links
## Images[edit]
Sagittal magnetic resonance images of ankle region: psoriatic arthritis. (a) Short tau inversion recovery (STIR) image, showing high signal intensity at the Achilles tendon insertion (enthesitis, thick arrow) and in the synovium of the ankle joint (synovitis, long thin arrow). Bone marrow oedema is seen at the tendon insertion (short thin arrow). (b, c) T1 weighted images of a different section of the same patient, before (panel b) and after (panel c) intravenous contrast injection, confirm inflammation (large arrow) at the enthesis and reveal bone erosion at tendon insertion (short thin arrows).
## Related conditions[edit]
Anatomically close but separate conditions are:
* Apophysitis, inflammation of the bony attachment, generally associated with overuse among growing children.[5][6][7]
* Tendinopathy is a disorder of the tendon, and is associated with direct injury or repetitive activities.[8]
## See also[edit]
* Enthesis (plural: Entheses)
## References[edit]
1. ^ Maria Antonietta D'Agostino, MD; Ignazio Olivieri, MD (June 2006). "Enthesitis". Best Practice & Research Clinical Rheumatology. Clinical Rheumatology. 20 (3): 473–86. doi:10.1016/j.berh.2006.03.007. PMID 16777577.
2. ^ The Free Dictionary (2009). "Enthesitis". Retrieved 2010-11-27.
3. ^ Schett, G; Lories, RJ; D'Agostino, MA; Elewaut, D; Kirkham, B; Soriano, ER; McGonagle, D (November 2017). "Enthesitis: from pathophysiology to treatment". Nature Reviews Rheumatology (Review). 13 (12): 731–41. doi:10.1038/nrrheum.2017.188. PMID 29158573.
4. ^ Schmitt, SK (June 2017). "Reactive Arthritis". Infectious Disease Clinics of North America (Review). 31 (2): 265–77. doi:10.1016/j.idc.2017.01.002. PMID 28292540.
5. ^ "OrthoKids - Osgood-Schlatter's Disease".
6. ^ "Sever's Disease". Kidshealth.org. Retrieved 2014-04-29.
7. ^ Hendrix CL (2005). "Calcaneal apophysitis (Sever disease)". Clinics in Podiatric Medicine and Surgery. 22 (1): 55–62, vi. doi:10.1016/j.cpm.2004.08.011. PMID 15555843.
8. ^ "Tendinitis". National Institute of Arthritis and Musculoskeletal and Skin Diseases. 12 April 2017. Retrieved 18 November 2018.
## External links[edit]
Classification
D
* DiseasesDB: 18256
* SNOMED CT: 359643005
* v
* t
* e
Soft tissue disorders
Capsular joint
Synoviopathy
* Synovitis/Tenosynovitis
* Calcific tendinitis
* Stenosing tenosynovitis
* Trigger finger
* De Quervain syndrome
* Transient synovitis
* Ganglion cyst
* osteochondromatosis
* Synovial osteochondromatosis
* Plica syndrome
* villonodular synovitis
* Giant-cell tumor of the tendon sheath
Bursopathy
* Bursitis
* Olecranon
* Prepatellar
* Trochanteric
* Subacromial
* Achilles
* Retrocalcaneal
* Ischial
* Iliopsoas
* Synovial cyst
* Baker's cyst
* Calcific bursitis
Noncapsular joint
Symptoms
* Ligamentous laxity
* Hypermobility
Enthesopathy/Enthesitis/Tendinopathy
upper limb
* Adhesive capsulitis of shoulder
* Impingement syndrome
* Rotator cuff tear
* Golfer's elbow
* Tennis elbow
lower limb
* Iliotibial band syndrome
* Patellar tendinitis
* Achilles tendinitis
* Calcaneal spur
* Metatarsalgia
* Bone spur
other/general:
* Tendinitis/Tendinosis
Nonjoint
Fasciopathy
* Fasciitis: Plantar
* Nodular
* Necrotizing
* Eosinophilic
Fibromatosis/contracture
* Dupuytren's contracture
* Plantar fibromatosis
* Aggressive fibromatosis
* Knuckle pads
This human musculoskeletal system article is a stub. You can help Wikipedia by expanding it.
* v
* t
* e
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Enthesitis
|
c1282952
| 8,592 |
wikipedia
|
https://en.wikipedia.org/wiki/Enthesitis
| 2021-01-18T18:50:05 |
{"umls": ["C1282952"], "wikidata": ["Q3055079"]}
|
A number sign (#) is used with this entry because of evidence that autoimmune interstitial lung, joint, and kidney disease (AILJK) is caused by heterozygous mutation in the COPA gene (601924) on chromosome 1q23.
Description
Autoimmune interstitial lung, joint, and kidney disease is an autosomal dominant systemic autoimmune disorder characterized by interstitial lung disease, inflammatory arthritis, and immune complex-mediated renal disease. Laboratory studies show high-titer autoantibodies. Symptoms appear in the first 2 decades of life, but there is incomplete penetrance (summary by Watkin et al., 2015).
Clinical Features
Watkin et al. (2015) reported 5 unrelated families in which a total of 21 individuals had an autoimmune disorder affecting the lungs and joints, and, in some patients, the kidney. The features of 9 patients from 5 families were reported in detail. The patients presented between 6 months and 7 years, mainly with joint pain, shortness of breath, or cough. All had interstitial lung disease, manifest as pulmonary hemorrhage, obstruction, restriction, or a diffusion capacity defect. Joint disease included nonerosive arthritis; 1 patient had avascular necrosis of distal femur and a pathologic fracture. Four patients had renal biopsies that showed immune complex crescentic glomerulonephritis with mesangial expansion, hypercellularity, and antibody deposition, and 1 patient required a renal transplant. Laboratory studies showed evidence of systemic inflammation, with increased C-reactive protein (CRP; 123260) and erythrocyte sedimentation rate. All patients were on long-term immunosuppressive medical therapy.
Inheritance
The transmission pattern of AILJK in the families reported by Watkin et al. (2015) was consistent with autosomal dominant inheritance with incomplete penetrance.
Molecular Genetics
In 30 individuals from 5 unrelated families with AILJK, Watkin et al. (2015) identified 4 different heterozygous missense mutations in the COPA gene (601924.0001-601924.0004). All mutations affected the WD40 domain. Nine mutation carriers were clinically unaffected, consistent with incomplete penetrance. Mutations in 4 of the families were found by whole-exome sequencing. In vitro studies of 2 COPA mutations (E241K, 601924.0003 and K230N, 601924.0004) showed that the mutant variants had impaired binding to proteins targeted for retrograde transport from the Golgi to the endoplasmic reticulum (ER). Patient-derived cells showed evidence of increased ER stress, and cellular expression of mutant COPA in HEK cells caused increased ER stress in a dominant-negative manner. Patient cells and transfected cells also showed a defect in autophagic function, which may have been due to impaired early endosomal function. Transfected cells showed upregulation of cytokines priming for a T- helper type 17 (Th-17) response, and patient-derived CD4+ T cells showed skewing toward a Th-17 phenotype implicated in autoimmunity. The findings suggested a link between a vesicular transport protein and an autoimmune syndrome manifest mainly as lung and joint disease.
INHERITANCE \- Autosomal dominant RESPIRATORY \- Shortness of breath \- Cough \- Tachypnea Lung \- Interstitial lung disease \- Pulmonary hemorrhage \- Lymphocytic interstitial infiltration \- Ground-glass opacities on radiographs GENITOURINARY Kidneys \- Renal disease \- Crescentic glomerulonephritis \- Immune complex deposition \- Fibrosis SKELETAL \- Arthritis, inflammatory \- Joint pain IMMUNOLOGY \- Autoantibodies LABORATORY ABNORMALITIES \- Increased C-reactive protein \- Increased erythrocyte sedimentation rate MISCELLANEOUS \- Onset in the first or second decade \- Incomplete penetrance MOLECULAR BASIS \- Caused by mutation in the coatomer protein complex, subunit alpha gene (COPA, 601924.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
AUTOIMMUNE INTERSTITIAL LUNG, JOINT, AND KIDNEY DISEASE
|
c4225334
| 8,593 |
omim
|
https://www.omim.org/entry/616414
| 2019-09-22T15:48:56 |
{"omim": ["616414"], "orphanet": ["444092"], "synonyms": ["COPA syndrome"]}
|
From their own experience and from the literature, Griffiths et al. (1983) collected 3 patients with duodenal carcinoid tumor in association with neurofibromatosis and pheochromocytoma and 4 patients with duodenal carcinoid with either von Recklinghausen disease or pheochromocytoma. The duodenal carcinoids had an unusual morphology. They reacted only weakly to normal silver impregnation techniques and had an unusual glandular pattern, and 3 of them contained psammoma bodies. Three were strongly positive on immunolocalization with an antibody to somatostatin (which stains normal pancreatic D cells). Griffiths et al. (1983) suggested that neurofibromatosis, pheochromocytoma, and duodenal carcinoid constitute a distinct and specific multiple endocrine neoplasia syndrome. They suggested that it might be termed MEN IIIa, with MEN IIIb being assigned to the von Hippel-Lindau syndrome (193300) with pheochromocytoma and islet cell tumors. In only 1 of the cases was the neurofibromatosis familial. It appears that the cutaneous involvement was typical of von Recklinghausen disease (162200) in all the cases. Obstructive jaundice (due to the duodenal carcinoid) was the manner of clinical presentation in 2 of the cases. Symptoms of somatostatin secretion by the carcinoid were not observed.
Oncology \- Duodenal carcinoid tumor \- Neurofibromatosis \- Pheochromocytoma Inheritance \- Autosomal dominant Skin \- Obstructive jaundice ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
NEUROFIBROMATOSIS-PHEOCHROMOCYTOMA-DUODENAL CARCINOID SYNDROME
|
c1834232
| 8,594 |
omim
|
https://www.omim.org/entry/162240
| 2019-09-22T16:37:36 |
{"mesh": ["C563522"], "omim": ["162240"], "synonyms": ["Alternative titles", "NPDC SYNDROME", "DUODENAL CARCINOID SYNDROME"]}
|
A number sign (#) is used with this entry because of evidence that Bardet-Biedl syndrome-13 (BBS13) is caused by compound heterozygous mutation in the MKS1 gene (609883) on chromosome 17q22.
Description
BBS13 is an autosomal recessive ciliopathy with features of obesity, polydactyly, and retinitis pigmentosa (Leitch et al., 2008; Xing et al., 2014).
For a general phenotypic description and a discussion of genetic heterogeneity of Bardet-Biedl syndrome, see BBS1 (209900).
Clinical Features
Xing et al. (2014) reported a Chinese boy with BBS13. Although clinical details were not provided, the child was noted to have typical symptoms, such as retinitis pigmentosa, obesity, and polydactyly. Ophthalmologic examination showed bone-spicule hyperpigmentation and attenuated arteries.
Molecular Genetics
In a 2-year-old patient of Turkish descent with Bardet-Biedl syndrome, Leitch et al. (2008) identified compound heterozygosity for mutations in the MKS1 gene: a missense mutation (C492W; 609883.0006) and a 3-bp in-frame deletion resulting in deletion of phenylalanine (F371del; 609883.0007). Functional studies in zebrafish demonstrated that the missense mutation results in a hypomorphic allele and the deletion in a functionally null allele. The authors also detected heterozygous mutations in MKS1 in 5 families; 2 of these families also carried mutations in BBS10 (610148), 1 in heterozygosity and 1 in homozygosity, and a third family carried a homozygous mutation in BBS1 (209901). Leitch et al. (2008) concluded that their data extended the genetic stratification of ciliopathies and suggested that BBS and Meckel syndrome (see 609883), although distinct clinically, are allelic forms of the same molecular spectrum.
In a Chinese boy with BBS13, Xing et al. (2014) identified compound heterozygous missense mutations in the MKS1 gene (Y461C, 609883.0008; and R534Q, 609883.0009). The mutations were identified by high-throughput targeted exome sequencing of 144 known genes responsible for inherited retinal diseases. Functional studies of the variants were not performed.
INHERITANCE \- Autosomal recessive GROWTH Weight \- Obesity HEAD & NECK Eyes \- Retinitis pigmentosa SKELETAL Hands \- Polydactyly Feet \- Polydactyly NEUROLOGIC Central Nervous System \- Delayed development \- Mental retardation MISCELLANEOUS \- Limited clinical information provided for patients with MKS1 mutations (last curated October 2014) MOLECULAR BASIS \- Caused by mutation in the MKS1 gene (MKS1, 609883.0006 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
BARDET-BIEDL SYNDROME 13
|
c0752166
| 8,595 |
omim
|
https://www.omim.org/entry/615990
| 2019-09-22T15:50:19 |
{"doid": ["0110135"], "mesh": ["D020788"], "omim": ["615990"], "orphanet": ["110"]}
|
Cone-rod dystrophy 2 (CORD2) is an inherited eye disorder that affects the rod and cone cells in the retina. These cells process light and allow people to see the accurate shape and color of objects. Initial signs and symptoms of CORD2 usually occur in early childhood or late adolescence and include decreased sharpness of vision (visual acuity) and increased sensitivity to light (photophobia). Severity of symptoms and rate of disease progression may vary; however, most individuals experience impaired color vision, blind spots, loss of peripheral vision, and night blindness by adulthood. CORD2 is caused by mutations in the CRX gene and is inherited in an autosomal dominant manner. Though future treatment options such as gene therapy show promise in research studies; management currently focuses on slowing down the disease process, treating the complications and helping individuals to cope with the social and psychological impact of blindness.
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Cone-rod dystrophy 2
|
c0035334
| 8,596 |
gard
|
https://rarediseases.info.nih.gov/diseases/6145/cone-rod-dystrophy-2
| 2021-01-18T18:01:12 |
{"mesh": ["D012174"], "omim": ["120970"], "umls": ["C0035334"], "synonyms": ["CORD2", "Cone-rod retinal dystrophy 2", "CRD2", "Retinal cone-rod dystrophy 2", "RCRD2"]}
|
Rachitic rosary
Rachitic rosary on chest radiograph
The prominent knobs of bone at the costochondral joints of rickets patients are known as a rachitic rosary or beading of the ribs. The knobs create the appearance of large beads under the skin of the rib cage, hence the name by analogy with the beads of a Catholic Christian rosary.[1]
## Contents
* 1 Causes
* 2 Pathophysiology
* 3 Diagnosis
* 4 Management
* 5 References
## Causes[edit]
Causes include:[2]
* Rickets : Nodularity at costochondral junction (rachitic rosary).
* Scurvy : More angular costochondral junction with a sharper step-off (scorbutic rosary) and depressed sternum.
* Chondrodystrophy
## Pathophysiology[edit]
Rachitic rosary is due to a deficiency of calcium resulting in lack of mineralization and an overgrowth of costochondral joint cartilage. The calcium deficiency may be caused by rickets or other causes of calcium deficiency such as hypoparathyroidism.[citation needed]
## Diagnosis[edit]
This section is empty. You can help by adding to it. (December 2017)
## Management[edit]
This section is empty. You can help by adding to it. (December 2017)
## References[edit]
1. ^ John Little Morris; W.F. Waugh; W.C. Abbott (1900). "Rickets". The Alkaloidal Clinic. Clinic Publishing Company. 7 (1). "The earliest bone lesion that we find in incipient rickets is the beading of the ribs, the so-called rachitic rosary. This is due to an enlargement of the osteo chondric articulations, and hence its name because of fancied resemblance to the rosary used by the Catholic worshiper."
\- "Rachitic rosary". TheFreeDictionary. Retrieved 12 August 2013.
2. ^ von Schulthess, Gustav K.; Ch.L. Zollikofer, eds. (2005). Musculoskeletal diseases : diagnostic imaging and interventional techniques. 37th International Diagnostic Course in Davos (IDKD) Davos, April 2-8, 2005 : including the Pediatric Satellite course "Kangaroo" Davos, April 2-3, 2005. Milan: Springer. ISBN 8847003180.
\- Ebel, Klaus-Dietrich; et al., eds. (1999). Differential diagnosis in pediatric radiology. Stuttgart: Thieme. ISBN 9783131081315.
\- Ebel, Klaus-Dietrich; et al., eds. (1999). Differential diagnosis in pediatric radiology. Stuttgart: Thieme. ISBN 3131081317.
* v
* t
* e
Symptoms and signs relating to movement and gait
Gait
* Gait abnormality
* CNS
* Scissor gait
* Cerebellar ataxia
* Festinating gait
* Marche à petit pas
* Propulsive gait
* Stomping gait
* Spastic gait
* Magnetic gait
* Truncal ataxia
* Muscular
* Myopathic gait
* Trendelenburg gait
* Pigeon gait
* Steppage gait
* Antalgic gait
Coordination
* Ataxia
* Cerebellar ataxia
* Dysmetria
* Dysdiadochokinesia
* Pronator drift
* Dyssynergia
* Sensory ataxia
* Asterixis
Abnormal movement
* Athetosis
* Tremor
* Fasciculation
* Fibrillation
Posturing
* Abnormal posturing
* Opisthotonus
* Spasm
* Trismus
* Cramp
* Tetany
* Myokymia
* Joint locking
Paralysis
* Flaccid paralysis
* Spastic paraplegia
* Spastic diplegia
* Spastic paraplegia
* Syndromes
* Monoplegia
* Diplegia / Paraplegia
* Hemiplegia
* Triplegia
* Tetraplegia / Quadruplegia
* General causes
* Upper motor neuron lesion
* Lower motor neuron lesion
Weakness
* Hemiparesis
Other
* Rachitic rosary
* Hyperreflexia
* Clasp-knife response
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Rachitic rosary
|
c0426824
| 8,597 |
wikipedia
|
https://en.wikipedia.org/wiki/Rachitic_rosary
| 2021-01-18T18:39:26 |
{"umls": ["C0426824"], "wikidata": ["Q7279537"]}
|
"Angiomyxoma" redirects here. For the tumor sometimes called "Angiomyoma", see Angioleiomyoma.
Angiomyxoma
Micrograph of an aggressive angiomyxoma. Core biopsy. H&E stain.
SpecialtyVascular system
Angiomyxoma is a myxoid tumor involving the blood vessels.
It can affect the vulva[1] and other parts of the pelvis. The characteristic feature of this tumor is its frequent local recurrence and it is currently regarded as a non-metastasizing benign tumor.[2]
## Contents
* 1 Genetics
* 2 Pathology
* 2.1 Microscopy
* 2.2 Microscopical views
* 2.3 Immunochemistry
* 3 Diagnosis
* 3.1 Differential diagnosis
* 4 Treatment
* 5 Prognosis
* 6 History
* 7 See also
* 8 References
* 9 External links
## Genetics[edit]
* HMGA2 rearrangement
* by translocation t(12;21)(q15;q21.1)[3][4]
* by translocation t(11;12)(q23;q15)[5]
* by translocation t(8;12)(p12;q15)[6]
* t(5;8)(p15;q22)[7]
## Pathology[edit]
### Microscopy[edit]
* Vascular appearance of tumor[8]
* Hypocellular mesenchymal lesion
* Spindled and stellate cells with an ill-defined cytoplasm
* Cells loosely scattered in a myxoid stroma
* No evidence of nuclear atypia and mitosis
* Numerous, thin-to-thick wall vessels of different sizes
* Myxoid, hypocellular background
* Bland cytological appearance of spindle cells
### Microscopical views[edit]
* * * * *
### Immunochemistry[edit]
Immunohistochemical studies show strong staining for desmin, estrogen receptors, and progesterone receptors. Staining for actin, CD34 and smooth muscle actin are intermediate. Staining for S-100 protein is negative.
## Diagnosis[edit]
### Differential diagnosis[edit]
* myxoid tumors
* Angiomyofibroblastoma
## Treatment[edit]
This section is empty. You can help by adding to it. (October 2017)
## Prognosis[edit]
Although it is a benign tumour and does not invade neighbouring tissues, it has a tendency to recur after surgical excision so it is termed "aggressive". Recurrence can occur as early as six months from initial resection. Patients frequently present at tertiary medical centers with a history of labial mass (sometimes misdiagnosed as Gartner's cyst), with multiple surgical excisions from several surgeons. There is no standard medical therapy; agents reported to be effective in case reports include systemic hormonal therapy with SERMs such as Tamoxifen or LHRH agonists (Leuprolide), and cytotoxic ("traditional") chemotherapy, as well as radiation therapy especially for recurrent disease.
## History[edit]
Aggressive angiomyxoma was originally described in 1983,[9] but the term "angiomyxoma" dates back to at least 1952.[10]
## See also[edit]
* Myxoma
* Cutaneous myxoma (Superficial angiomyxoma)
## References[edit]
1. ^ Mandal S, Dhingra K, Roy S, Khurana N (2008). "Aggressive angiomyxoma of the vulva presenting as a pedunculated swelling". Indian J Pathol Microbiol. 51 (2): 259–60. doi:10.4103/0377-4929.41677. PMID 18603701.
2. ^ Mathieson A, Chandrakanth S, Yousef G, Wadden P (June 2007). "Aggressive angiomyxoma of the pelvis: a case report" (PDF). Can J Surg. 50 (3): 228–9. PMC 2384290. PMID 17568501. Archived from the original (PDF) on 2016-08-05. Retrieved 2008-08-24.
3. ^ Rawlinson, N. J.; West, W. W.; Nelson, M; Bridge, J. A. (2008). "Aggressive angiomyxoma with t(12;21) and HMGA2 rearrangement: Report of a case and review of the literature". Cancer Genetics and Cytogenetics. 181 (2): 119–24. doi:10.1016/j.cancergencyto.2007.11.008. PMC 2396496. PMID 18295664.
4. ^ Medeiros, F; Erickson-Johnson, M. R.; Keeney, G. L.; Clayton, A. C.; Nascimento, A. G.; Wang, X; Oliveira, A. M. (2007). "Frequency and characterization of HMGA2 and HMGA1 rearrangements in mesenchymal tumors of the lower genital tract". Genes, Chromosomes and Cancer. 46 (11): 981–90. doi:10.1002/gcc.20483. PMID 17654722.
5. ^ Micci, F; Panagopoulos, I; Bjerkehagen, B; Heim, S (2006). "Deregulation of HMGA2 in an aggressive angiomyxoma with t(11;12)(q23;q15)". Virchows Archiv. 448 (6): 838–42. doi:10.1007/s00428-006-0186-5. PMID 16568309.
6. ^ Nucci, M. R.; Weremowicz, S; Neskey, D. M.; Sornberger, K; Tallini, G; Morton, C. C.; Quade, B. J. (2001). "Chromosomal translocation t(8;12) induces aberrant HMGIC expression in aggressive angiomyxoma of the vulva". Genes, Chromosomes and Cancer. 32 (2): 172–6. doi:10.1002/gcc.1179. PMID 11550285.
7. ^ Nucci, M. R.; Weremowicz, S; Neskey, D. M.; Sornberger, K; Tallini, G; Morton, C. C.; Quade, B. J. (2001). "Chromosomal translocation t(8;12) induces aberrant HMGIC expression in aggressive angiomyxoma of the vulva". Genes, Chromosomes and Cancer. 32 (2): 172–6. doi:10.1002/gcc.1179. PMID 11550285.
8. ^ Geng, J; Cao, B; Wang, L (2012). "Aggressive angiomyxoma: An unusual presentation". Korean Journal of Radiology. 13 (1): 90–3. doi:10.3348/kjr.2012.13.1.90. PMC 3253408. PMID 22247641.
9. ^ Adwan H, Patel B, Kamel D, Glazer G (November 2004). "A solitary encapsulated pelvic aggressive angiomyxoma". Ann R Coll Surg Engl. 86 (6): W1–3. doi:10.1308/14787080465. PMC 1964274. PMID 16749950.
10. ^ RAEBURN C (November 1952). "The histogenesis of four cases of angiomyxoma of the auricle". J. Clin. Pathol. 5 (4): 339–44. doi:10.1136/jcp.5.4.339. PMC 1023673. PMID 13011222.
## External links[edit]
Classification
D
* ICD-O: 8841/1
* v
* t
* e
Connective/soft tissue tumors and sarcomas
Not otherwise specified
* Soft-tissue sarcoma
* Desmoplastic small-round-cell tumor
Connective tissue neoplasm
Fibromatous
Fibroma/fibrosarcoma:
* Dermatofibrosarcoma protuberans
* Desmoplastic fibroma
Fibroma/fibromatosis:
* Aggressive infantile fibromatosis
* Aponeurotic fibroma
* Collagenous fibroma
* Diffuse infantile fibromatosis
* Familial myxovascular fibromas
* Fibroma of tendon sheath
* Fibromatosis colli
* Infantile digital fibromatosis
* Juvenile hyaline fibromatosis
* Plantar fibromatosis
* Pleomorphic fibroma
* Oral submucous fibrosis
Histiocytoma/histiocytic sarcoma:
* Benign fibrous histiocytoma
* Malignant fibrous histiocytoma
* Atypical fibroxanthoma
* Solitary fibrous tumor
Myxomatous
* Myxoma/myxosarcoma
* Cutaneous myxoma
* Superficial acral fibromyxoma
* Angiomyxoma
* Ossifying fibromyxoid tumour
Fibroepithelial
* Brenner tumour
* Fibroadenoma
* Phyllodes tumor
Synovial-like
* Synovial sarcoma
* Clear-cell sarcoma
Lipomatous
* Lipoma/liposarcoma
* Myelolipoma
* Myxoid liposarcoma
* PEComa
* Angiomyolipoma
* Chondroid lipoma
* Intradermal spindle cell lipoma
* Pleomorphic lipoma
* Lipoblastomatosis
* Spindle cell lipoma
* Hibernoma
Myomatous
general:
* Myoma/myosarcoma
smooth muscle:
* Leiomyoma/leiomyosarcoma
skeletal muscle:
* Rhabdomyoma/rhabdomyosarcoma: Embryonal rhabdomyosarcoma
* Sarcoma botryoides
* Alveolar rhabdomyosarcoma
* Leiomyoma
* Angioleiomyoma
* Angiolipoleiomyoma
* Genital leiomyoma
* Leiomyosarcoma
* Multiple cutaneous and uterine leiomyomatosis syndrome
* Multiple cutaneous leiomyoma
* Neural fibrolipoma
* Solitary cutaneous leiomyoma
* STUMP
Complex mixed and stromal
* Adenomyoma
* Pleomorphic adenoma
* Mixed Müllerian tumor
* Mesoblastic nephroma
* Wilms' tumor
* Malignant rhabdoid tumour
* Clear-cell sarcoma of the kidney
* Hepatoblastoma
* Pancreatoblastoma
* Carcinosarcoma
Mesothelial
* Mesothelioma
* Adenomatoid tumor
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
Aggressive angiomyxoma
|
c1306242
| 8,598 |
wikipedia
|
https://en.wikipedia.org/wiki/Aggressive_angiomyxoma
| 2021-01-18T18:43:19 |
{"umls": ["CL329980"], "icd-9": ["215.6"], "icd-10": ["D17.5"], "wikidata": ["Q3617384"]}
|
A number sign (#) is used with this entry because Cornelia de Lange syndrome-4 (CDLS4) is caused by heterozygous mutation in the RAD21 gene (606462), which encodes a component of the cohesin complex, on chromosome 8q24.
For a phenotypic description and a discussion of genetic heterogeneity of Cornelia de Lange syndrome, see CDLS (122470).
Clinical Features
Deardorff et al. (2012) reported 2 unrelated patients, a boy and a girl, with a phenotype suggestive of Cornelia de Lange syndrome. Both had microcephaly and a characteristic facial appearance, with thick, bushy, arched eyebrows, synophrys, long or prominent eyelashes, broad nasal bridge, smooth philtrum, and thin upper lip. The boy had ptosis and an upturned nasal tip, whereas the girl had upslanted palpebral fissures and a short nose. The boy had a number of additional congenital anomalies, including poor dental enamel, submucosal cleft palate, stapes fixation, thin fingers, left radioulnar synostosis, delayed skeletal age, vertebral clefting, pectus carinatum, short femoral neck, tetralogy of Fallot, intestinal malrotation, and gastroesophageal reflux. He also had severe cognitive delay and attention deficit-hyperactivity disorder. The girl had short fingers, fifth finger clinodactyly, small prominent first toe, long fourth metacarpal, cutis marmorata, and mild neurodevelopmental defects.
Cytogenetics
Deardorff et al. (2012) reported 4 unrelated patients with a complex phenotype most reminiscent of Cornelia de Lange syndrome associated with a heterozygous deletion of chromosome 8q24. Two of the patients had previously been reported by Wuyts et al. (2002) and McBrien et al. (2008), respectively. The patient reported by Wuyts et al. (2002) had mild mental retardation, complex partial seizures, multiple exostoses, hypertrichosis, and striking facial features, including small head, thick eyebrows with synophrys, telecanthus, downward slanting palpebral fissures, broad nose, long philtrum, and thin upper lip. FISH and SNP analysis detected a de novo interstitial deletion of 8q24 including the EXT1 gene (608177), but not the TRPS1 gene (190350). The patient reported by McBrien et al. (2008) had low birth weight, talipes calcaneovalgus, persistent fetal toe pads, microcephaly, and bifid scrotum. He was dysmorphic, with microcephaly, prominent eyebrows, long eyelashes, thin upper lip, and sparse, fine scalp hair. Other features included cutis marmorata, hemivertebrae, exostoses, and borderline developmental delay. Oligoarray CGH showed a 1.46-Mb deletion of 8q24.11 including the EXT1 gene, but not the TRPS1 gene. The phenotype in both of these patients was suggestive of Langer-Giedion syndrome (150230). The 2 patients first reported by Deardorff et al. (2012) had short stature, microcephaly, thick eyebrows, long eyelashes, wide nasal bridge, and exostoses. One patient had additional features, such as cutis marmorata, coxa vara, long fourth metacarpal, cleft palate, and micrognathia, but normal cognition. The other patient had delayed development. Both patients had interstitial deletions of 8q24 encompassing several genes, including RAD21.
Molecular Genetics
In 2 unrelated patients with Cornelia de Lange syndrome-4, Deardorff et al. (2012) identified different de novo heterozygous mutations in the RAD21 gene (P376R; 606462.0001 and C585R; 606462.0002). These mutations were identified by screening of the RAD21 gene in 258 individuals with a CDLS-like phenotype after genomewide copy-number analysis had identified a different patient with a de novo deletion of chromosome 8q24.1 that included RAD21. In vitro studies showed that the P376R mutation resulted in altered activity of the mutant protein rather than a loss of function. Patient cells showed decreased sister chromatid separation, increased aneuploidy, and defective DNA repair, as well as abnormal transcriptional activity in a zebrafish model. The boy with the P376R mutation had a more severe phenotype than the girl with the C585R mutation. Functional studies of the C585R mutation suggested a loss of function, similar to patients with deletion of the RAD21 gene. Deardorff et al. (2012) concluded that dominant RAD21 mutations result in more severe functional defects and a worse phenotype than loss-of-function mutations or deletions. Deardorff et al. (2012) also noted that RAD21 lies between TRPS1 and EXT1, and would thus be deleted in persons with Langer-Giedion syndrome. The mild facial and cognitive involvement seen in individuals with RAD21 heterozygous loss-of-function mutations may cause many individuals to go clinically unnoticed.
INHERITANCE \- Autosomal dominant GROWTH Height \- Short stature HEAD & NECK Head \- Microcephaly Face \- Long philtrum \- Smooth philtrum Eyes \- Thick eyebrows \- Synophrys \- Arched eyebrows \- Long lashes Nose \- Wide nasal bridge \- Broad nasal bridge Mouth \- Thin upper lip \- Cleft palate (less common) ABDOMEN Gastrointestinal \- Gastroesophageal reflux (less common) SKELETAL Spine \- Vertebral clefting (in some patients) \- Hemivertebrae (in some patients) Limbs \- Exostoses (in patients with larger deletions involving the EXT1 gene) \- Radioulnar abnormalities (in some patients) Hands \- Brachydactyly (in some patients) \- Syndactyly (in some patients) SKIN, NAILS, & HAIR Skin \- Cutis marmorata (in some) Hair \- Thick eyebrows \- Synophrys \- Arched eyebrows \- Long lashes NEUROLOGIC Central Nervous System \- Cognitive delay, mild to severe MISCELLANEOUS \- Variable phenotype \- Patients with contiguous gene deletion of 8q24 have more severe features \- Two patients with point mutations in RAD21 have been reported (last curated July 2012) MOLECULAR BASIS \- Caused by mutation in the homolog of the S. Pombe RAD21 gene (RAD21, 606462.0001 ) ▲ Close
*[v]: View this template
*[t]: Discuss this template
*[e]: Edit this template
*[c.]: circa
*[AA]: Adrenergic agonist
*[AD]: Acetaldehyde dehydrogenase
*[HAART]: highly active antiretroviral therapy
*[Ki]: Inhibitor constant
*[nM]: nanomolars
*[MOR]: μ-opioid receptor
*[DOR]: δ-opioid receptor
*[KOR]: κ-opioid receptor
*[SERT]: Serotonin transporter
*[NET]: Norepinephrine transporter
*[NMDAR]: N-Methyl-D-aspartate receptor
*[M:D:K]: μ-receptor:δ-receptor:κ-receptor
*[ND]: No data
*[NOP]: Nociceptin receptor
*[BMI]: body mass index
*[OCD]: Obsessive-compulsive disorder
*[SSRIs]: Selective serotonin reuptake inhibitors
*[SNRIs]: Serotonin–norepinephrine reuptake inhibitor
*[TCAs]: Tricyclic antidepressants
*[MAOIs]: Monoamine oxidase inhibitors
*[MSNs]: medium spiny neurons
*[CREB]: cAMP response element-binding protein
*[NC]: neurogenic claudication
*[LSS]: lumbar spinal stenosis
*[DDD]: degenerative disc disease
*[CI]: confidence interval
*[E2]: estradiol
*[CEEs]: conjugated estrogens
*[Diff]: Difference
*[7d avg]: Average of the last 7 days
*[per 100k pop]: Deaths per 100,000 population using 10.12 Million as Sweden's total population
*[Cases per 100k]: Cases per 100,000 county population
*[Deaths per 100k]: Deaths per 100,000 county population
*[Percent]: Percent of total in category
*[Rate]: ICU-care cases per confirmed cases in each category
*[GER]: Germany
*[FRA]: France
*[ITA]: Italy
*[ESP]: Spain
*[DEN]: Denmark
*[SUI]: Switzerland
*[USA]: United States
*[COL]: Colombia
*[KAZ]: Kazakhstan
*[NED]: Netherlands
*[LIT]: Lithuania
*[POR]: Portugal
*[AUT]: Austria
*[AUS]: Australia
*[RUS]: Russia
*[LUX]: Luxembourg
*[UKR]: Ukraine
*[SLO]: Slovenia
*[GBR]: Great Britain
*[CZE]: Czech Republic
*[BEL]: Belgium
*[CAN]: Canada
*[DHT]: dihydrotestosterone
*[IM]: intramuscular injection
*[SC]: subcutaneous injection
*[MRIs]: monoamine reuptake inhibitors
*[GHB]: γ-hydroxybutyric acid
*[pop.]: population
*[et al.]: et alia (and others)
*[a.k.a.]: also known as
*[mRNA]: messenger RNA
*[kDa]: kilodalton
*[EPC]: Early Prostate Cancer
*[LAPC]: locally advanced prostate cancer
*[NSAAs]: nonsteroidal antiandrogens
*[NSAA]: nonsteroidal antiandrogen
*[GnRH]: gonadotropin-releasing hormone
*[ADT]: androgen deprivation therapy
*[LH]: luteinizing hormone
*[AR]: androgen receptor
*[CAB]: combined androgen blockade
*[LPC]: localized prostate cancer
*[CPA]: cyproterone acetate
*[U.S.]: United States
*[FDA]: Food and Drug Administration
*[lit.]: literal translation
|
CORNELIA DE LANGE SYNDROME 4
|
c0270972
| 8,599 |
omim
|
https://www.omim.org/entry/614701
| 2019-09-22T15:54:29 |
{"doid": ["0080508"], "mesh": ["D003635"], "omim": ["614701"], "orphanet": ["199"], "genereviews": ["NBK1104"]}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.