channel_count
int64 1
1
| characteristics_ch1
stringlengths 6
9.77k
| contact_address
stringlengths 1
229
| contact_city
stringlengths 1
47
| contact_country
stringclasses 71
values | contact_institute
stringlengths 2
128
| contact_name
stringlengths 4
74
| contact_zip
stringclasses 1
value | data_processing
stringlengths 4
10.6k
| extract_protocol_ch1
stringlengths 6
14.3k
| geo_accession
stringlengths 9
10
| instrument_model
stringclasses 13
values | last_update_date
stringlengths 11
11
| library_selection
stringclasses 6
values | library_source
stringclasses 5
values | library_strategy
stringclasses 1
value | molecule_ch1
stringclasses 7
values | organism_ch1
stringclasses 1
value | platform_id
stringclasses 13
values | relation
stringlengths 0
2.61k
| sample
stringlengths 9
10
| series_id
stringlengths 8
29
| singlecellprobability
float64 0
1
| source_name_ch1
stringlengths 1
253
| status
stringlengths 21
21
| submission_date
stringlengths 11
11
| taxid_ch1
stringclasses 1
value | title
stringlengths 1
120
| type
stringclasses 1
value | sra
stringlengths 47
49
⌀ | biosample
stringlengths 51
51
⌀ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | datatype: Cage,datatype description: CAGE 5' RNA Tags,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 050WC,049WC,050WC,049WC,labexpid: CThi10032,CThi10033,CThi10033,CThi10032,readtype: 1x50,readtype description: Single 50 nt reads,replicate: 1,2,cell sex: F,localization: cell,localization description: Whole cell,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 049WC,labexpid: CThi10032,readtype: 1x50,readtype description: Single 50 nt reads,replicate: 1 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeRikenCage | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeRikenCage | GSM979662 | Illumina HiSeq 2000 | May 15 2019 | CAGE | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX172639,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096399,Named Annotation: NA000017016.1 (GSM979662_hg19_wgEncodeRikenCageNhdfCellPapMinusRawRep1.bigWig),Named Annotation: NA000017017.1 (GSM979662_hg19_wgEncodeRikenCageNhdfCellPapMinusRawRep2.bigWig),Named Annotation: NA000017018.1 (GSM979662_hg19_wgEncodeRikenCageNhdfCellPapPlusRawRep1.bigWig),Named Annotation: NA000017019.1 (GSM979662_hg19_wgEncodeRikenCageNhdfCellPapPlusRawRep2.bigWig) | GSM979662 | GSE34448 | 0.100437 | NHDF | Public on Aug 01 2012 | Aug 01 2012 | 9606 | RIKEN_Cage_NHDF_cell_longPolyA | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX172639 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096399 |
|
1 | datatype: Cage,datatype description: CAGE 5' RNA Tags,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 081WC,081WC,082WC,082WC,labexpid: CThi10102CTT,CThi10055,CThi10055,CThi10102CTT,readtype: 1x50,readtype description: Single 50 nt reads,replicate: 1,2,cell sex: M,localization: cell,localization description: Whole cell,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 081WC,labexpid: CThi10102CTT,readtype: 1x50,readtype description: Single 50 nt reads,replicate: 1 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeRikenCage | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeRikenCage | GSM979663 | Illumina HiSeq 2000 | May 15 2019 | CAGE | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX172640,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096400,Named Annotation: NA000017020.1 (GSM979663_hg19_wgEncodeRikenCageNhemfm2CellPapMinusRawRep1.bigWig),Named Annotation: NA000017021.1 (GSM979663_hg19_wgEncodeRikenCageNhemfm2CellPapMinusRawRep2.bigWig),Named Annotation: NA000017022.1 (GSM979663_hg19_wgEncodeRikenCageNhemfm2CellPapPlusRawRep1.bigWig),Named Annotation: NA000017023.1 (GSM979663_hg19_wgEncodeRikenCageNhemfm2CellPapPlusRawRep2.bigWig) | GSM979663 | GSE34448 | 0.007413 | NHEM.f_M2 | Public on Aug 01 2012 | Aug 01 2012 | 9606 | RIKEN_Cage_NHEM.f_M2_cell_longPolyA | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX172640 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096400 |
|
1 | cell line: H1 hESCs,passages: 42-45,cell type: TRA-1-60+ FACS sort | 621 Charles E Young Dr S | Los Angeles | USA | UCLA | Sofia,,Gkountela | Illumina Casava1.7 software used for basecalling.,After filtering reads with low quality and reads containing sequencing adapters, we mapped raw reads to the human reference genome (assembly hg19) with the gapped aligner Tophat,Expression levels of gene and transcript were quantified by Cufflinks in the FPKM unit together with confidence intervals.,Genome_build: UCSC hg19,Supplementary_files_format_and_content: A tab-delimited text file include raw read counts for all samples. | Cells were sorted directly in 75ul RLT buffer (Qiagen) and RNA was extracted using the RNeasy Micro Kit (Qiagen) according to manufacturerâs instructions. RNA was amplified and converted to ssDNA using the WT-Ovation RNA Amplification System (Nugen). dsDNA was generated from ssDNA using the WT-Ovation Exon Module (Nugen) according to the manufactures instructions. dsDNA was sonicated to DNA fragments within a 200-500bp range. Subsequently the libraries were generated starting from 30ng DNA using the TruSeq DNA Sample Preparation Kit (Illumina) according to manufacturers instructions. | GSM979873 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX172972,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096644 | GSM979873 | GSE39821 | 0.1964 | H1 hESCs | Public on Aug 03 2012 | Aug 01 2012 | 9606 | H1 TRA-1-60+ RNA Seq Rep3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX172972 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096644 |
|
1 | source tissue: Brain,tissue: germ cell tumor | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980244 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173089,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096815 | GSM980244 | GSE39841 | 0.560146 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | germ cell tumor A19 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173089 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096815 |
|
1 | source tissue: Brain,tissue: germ cell tumor | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980245 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173090,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096816 | GSM980245 | GSE39841 | 0.353728 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | germ cell tumor A20 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173090 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096816 |
|
1 | source tissue: Brain,tissue: germ cell tumor | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980246 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173091,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096817 | GSM980246 | GSE39841 | 0.305541 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | germ cell tumor A21 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173091 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096817 |
|
1 | source tissue: Brain,tissue: germ cell tumor | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980247 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173092,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096818 | GSM980247 | GSE39841 | 0.495049 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | germ cell tumor A22 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173092 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096818 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980249 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173094,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096820 | GSM980249 | GSE39841 | 0.224218 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A56 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173094 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096820 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980250 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173095,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096821 | GSM980250 | GSE39841 | 0.405655 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A57 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173095 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096821 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980251 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173096,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096822 | GSM980251 | GSE39841 | 0.234221 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A58 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173096 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096822 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980252 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173097,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096823 | GSM980252 | GSE39841 | 0.426498 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A59 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173097 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096823 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980253 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173098,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096824 | GSM980253 | GSE39841 | 0.252057 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A60 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173098 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096824 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980254 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173099,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096825 | GSM980254 | GSE39841 | 0.40802 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A61 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173099 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096825 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980255 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173100,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096826 | GSM980255 | GSE39841 | 0.157107 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A50 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173100 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096826 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980256 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173101,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096827 | GSM980256 | GSE39841 | 0.309622 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A51 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173101 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096827 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980257 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173102,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096828 | GSM980257 | GSE39841 | 0.356196 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A52 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173102 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096828 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980258 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173103,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096829 | GSM980258 | GSE39841 | 0.060445 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A53 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173103 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096829 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980259 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173104,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096830 | GSM980259 | GSE39841 | 0.334261 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A54 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173104 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096830 |
|
1 | source tissue: Brain,tissue: glioma | adqwerqr ew | hsinchu | Taiwan | NTHU | wei-chung,,cheng | 3â adaptors of the FASTQ raw data were trimmed, and trimmed data were collapsed by the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit).,For all datasets, reads that shorter than 17 nt or longer than 30 nt were filtered out.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM value of mature miRNA across 34 samples | TruSeq Small RNA Sample Prep Kit (Cat# RS-200-0012) was used with 1 ug of total RNA for the construction of sequencing libraries. | GSM980260 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173105,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096831 | GSM980260 | GSE39841 | 0.302835 | Brain | Public on Dec 03 2012 | Aug 02 2012 | 9606 | glioma A55 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173105 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096831 |
|
1 | cell type: B-cells,individual: GM12004,assay: global run-on | 210 washtenaw ave | Ann Arbor | USA | HHMI/University of Michigan | Isabel,Xiaorong,Wang | Sequence analysis-The GRO-seq and PRO-seq samples were sequenced using HiSeq 2000 instrument and 100-200 million 100-nt reads per sample were generated. Low-quality bases as designated by Illumina were trimmed from the 3â end of reads, and reads shorter than 35bp were removed. The resulting reads were aligned to an index comprising the human reference genome (hg18) and the Epstein-Barr virus genome (NC_009334.1) using GSNAP (version 2012-04-10). A list of SNP sites in the CEU population from Hapmap (release #28) and 1000 Genomes (pilot project) was used to allow for SNP-tolerant alignments. The following parameters were used: Mismatches â¤[(read length+2)/12-2]; Mapping score â¥20; Soft-clipping on (-trim-mismatch-score=-3); Known exon-exon junctions (defined by RefSeq (downloaded March 7, 2011) and Gencode (version 3c)) and novel junctions (defined by GSNAP) were accepted. SNP sites in the CEU population from Hapmap (release #28) and 1000 Genomes (pilot project) were included for SNP-tolerant alignments. Only reads that aligned to one genomic location (uniquely mapped reads) were used in further analyses.,RNA-DNA differences-To identify RDDs, we compared RNA sequence to its corresponding DNA sequence. Low-quality bases (Phred quality score < 20) in both the RNA and DNA were removed from consideration. To be included as RDD sites in the final lists, the following criteria have to be met: 1) a minimum of 10 total RNA-seq reads covering that site; 2) a minimum of 10 total DNA-seq reads covering that site; 3) DNA sequence at this site is 100% concordant, without any DNA-seq reads containing alternative alleles; 4) level of RDD (# of RNA-seq reads containing non-DNA allele/# all RNA-seq reads covering a given site) is â¥10% (a minimum of two RNA-seq reads containing RDD). To ensure the accuracy of the RDD sites, additional filtering steps were performed using two additional mapping algorithms. First, we removed all the sites that reside in repetitive genome regions annotated by repeat masker (RepeatMasker version 3.2.7). Second, local sequences around each RDD site were aligned to the human reference genome to rule out misalignments to paralogous sequences or remaining pseudogenes. Specifically, for each RDD event, genomic sequences comprising sequences of length 25 bp, 50 bp, and 75 bp upstream and downstream of each site along with either the DNA variant or RNA variant were aligned to an index containing human reference genome (hg18) and sequences in hg19 but not present in hg18 using BLAT(5) (Stand-alone, v. 34x11). The settings '-stepSize=5' and 'repMatch=2253' were used to increase sensitivity. RDD events were removed if any of the 6 corresponding sequences aligned to another genomic location with â¤n mismatches (n=(read length + 2)/12â2) and with sequences that explain the RDD call (that is if the genomic sequences match the RNA sequence). Lastly, to avoid potential misalignment of spliced reads in GSNAP due to its high gap penalty algorithm, we re-aligned all the RNA-seq reads that contain putative RDD alleles using BLAT (Stand-alone, v. 34x11). Human genome sequences in hg19 that are not present in hg18 were included in our index in addition to sequences in hg18. Here, a low gap penalty was applied during BLAT alignment in order to compensate for high gap penalty of GSNAP alignment of spliced reads. Only RDD sites that are supported by both GSNAP and BLAT are retained for downstream analysis.,Genome_build: HG18,Supplementary_files_format_and_content: Text files that contain 1) sites and types of RNA-DNA differences; 2) FPKM values | Libraries were prepared following Illumina Directional mRNA-seq sample preparation protocol. | GSM980644 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Reanalyzed by: GSE67540,Reanalyzed by: GSE85747,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX173216,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01096957 | GSM980644 | GSE39878 | 0.083417 | B-cells | Public on Feb 21 2014 | Aug 03 2012 | 9606 | GM12004_GROseq | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX173216 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01096957 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 045WC,045WC,046WC,046WC,labexpid: LID45238,LID45239,LID45239,LID45238,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist14,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 045WC,046WC,labexpid: LID45238,LID45239,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981243 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE90257,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174312,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103813,Named Annotation: NA000017024.1 (GSM981243_hg19_wgEncodeCshlLongRnaSeqImr90CellTotalMinusRep1.bigWig),Named Annotation: NA000017025.1 (GSM981243_hg19_wgEncodeCshlLongRnaSeqImr90CellTotalMinusRep2.bigWig),Named Annotation: NA000017026.1 (GSM981243_hg19_wgEncodeCshlLongRnaSeqImr90CellTotalPlusRep1.bigWig),Named Annotation: NA000017027.1 (GSM981243_hg19_wgEncodeCshlLongRnaSeqImr90CellTotalPlusRep2.bigWig) | GSM981243 | GSE26284,GSE30567 | 0.018304 | IMR90 | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_IMR90_cell_total (superseded by GSE90257) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174312 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103813 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 045C,046C,046C,046C,045C,045C,labexpid: LID45612,LID45611,LID45612,LID45612,LID45611,LID45611,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist14,localization description: The fluid between the cells outer membrane and the nucleus,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 045C,046C,labexpid: LID45611,LID45612,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981244 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | Superseded by: GSE90260,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174313,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103814,Named Annotation: NA000017028.1 (GSM981244_hg19_wgEncodeCshlLongRnaSeqImr90CytosolPapMinusRep1.bigWig),Named Annotation: NA000017029.1 (GSM981244_hg19_wgEncodeCshlLongRnaSeqImr90CytosolPapMinusRep2.bigWig),Named Annotation: NA000017030.1 (GSM981244_hg19_wgEncodeCshlLongRnaSeqImr90CytosolPapPlusRep1.bigWig),Named Annotation: NA000017031.1 (GSM981244_hg19_wgEncodeCshlLongRnaSeqImr90CytosolPapPlusRep2.bigWig) | GSM981244 | GSE26284,GSE30567 | 0.021467 | IMR90 | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_IMR90_cytosol_longPolyA (superseded by GSE90260) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174313 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103814 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 090N,089N,090N,089N,090N,089N,labexpid: LID46860,LID46859,LID46859,LID46860,LID46859,LID46860,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 3,4,spikeinpool: Nist14,localization description: Large membrane bound part of cell containing chromosomes and the bulk of the cell's DNA,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 089N,090N,labexpid: LID46859,LID46860,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981245 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | Superseded by: GSE90261,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174314,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103815,Named Annotation: NA000017032.1 (GSM981245_hg19_wgEncodeCshlLongRnaSeqMcf7NucleusPapMinusRep3.bigWig),Named Annotation: NA000017033.1 (GSM981245_hg19_wgEncodeCshlLongRnaSeqMcf7NucleusPapMinusRep4.bigWig),Named Annotation: NA000017034.1 (GSM981245_hg19_wgEncodeCshlLongRnaSeqMcf7NucleusPapPlusRep3.bigWig),Named Annotation: NA000017035.1 (GSM981245_hg19_wgEncodeCshlLongRnaSeqMcf7NucleusPapPlusRep4.bigWig) | GSM981245 | GSE26284,GSE30567 | 0.114281 | MCF-7 | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_MCF-7_nucleus_longPolyA (superseded by GSE90261) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174314 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103815 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 087C,087C,088C,088C,labexpid: LID45898,LID45897,LID45897,LID45898,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 3,4,spikeinpool: Nist14,localization description: The fluid between the cells outer membrane and the nucleus,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 087C,088C,labexpid: LID45897,LID45898,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981246 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | Superseded by: GSE90258,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174315,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103816,Named Annotation: NA000017036.1 (GSM981246_hg19_wgEncodeCshlLongRnaSeqA549CytosolPapMinusRep3.bigWig),Named Annotation: NA000017037.1 (GSM981246_hg19_wgEncodeCshlLongRnaSeqA549CytosolPapMinusRep4.bigWig),Named Annotation: NA000017038.1 (GSM981246_hg19_wgEncodeCshlLongRnaSeqA549CytosolPapPlusRep3.bigWig),Named Annotation: NA000017039.1 (GSM981246_hg19_wgEncodeCshlLongRnaSeqA549CytosolPapPlusRep4.bigWig) | GSM981246 | GSE26284,GSE30567 | 0.088534 | A549 | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_A549_cytosol_longPolyA (superseded by GSE90258) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174315 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103816 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 088N,087N,087N,088N,088N,087N,labexpid: LID45900,LID45899,LID45899,LID45899,LID45900,LID45900,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 3,4,spikeinpool: Nist14,localization description: Large membrane bound part of cell containing chromosomes and the bulk of the cell's DNA,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 087N,088N,labexpid: LID45899,LID45900,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981247 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | Superseded by: GSE90259,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174316,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103817,Named Annotation: NA000017040.1 (GSM981247_hg19_wgEncodeCshlLongRnaSeqA549NucleusPapMinusRep3.bigWig),Named Annotation: NA000017041.1 (GSM981247_hg19_wgEncodeCshlLongRnaSeqA549NucleusPapMinusRep4.bigWig),Named Annotation: NA000017042.1 (GSM981247_hg19_wgEncodeCshlLongRnaSeqA549NucleusPapPlusRep3.bigWig),Named Annotation: NA000017043.1 (GSM981247_hg19_wgEncodeCshlLongRnaSeqA549NucleusPapPlusRep4.bigWig) | GSM981247 | GSE26284,GSE30567 | 0 | A549 | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_A549_nucleus_longPolyA (superseded by GSE90259) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174316 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103817 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 046N,045N,045N,046N,045N,046N,labexpid: LID45613,LID45635,LID45613,LID45635,LID45613,LID45635,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist14,localization description: Large membrane bound part of cell containing chromosomes and the bulk of the cell's DNA,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 046N,045N,labexpid: LID45635,LID45613,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981248 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | Superseded by: GSE90262,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174317,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103818,Named Annotation: NA000017044.1 (GSM981248_hg19_wgEncodeCshlLongRnaSeqImr90NucleusPapMinusRep1.bigWig),Named Annotation: NA000017045.1 (GSM981248_hg19_wgEncodeCshlLongRnaSeqImr90NucleusPapMinusRep2.bigWig),Named Annotation: NA000017046.1 (GSM981248_hg19_wgEncodeCshlLongRnaSeqImr90NucleusPapPlusRep1.bigWig),Named Annotation: NA000017047.1 (GSM981248_hg19_wgEncodeCshlLongRnaSeqImr90NucleusPapPlusRep2.bigWig) | GSM981248 | GSE26284,GSE30567 | 0.064364 | IMR90 | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_IMR90_nucleus_longPolyA (superseded by GSE90262) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174317 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103818 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 046WC,045WC,045WC,045WC,046WC,046WC,labexpid: LID45017,LID45016,LID45017,LID45016,LID45017,LID45016,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist14,localization description: Whole cell,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 045WC,046WC,labexpid: LID45016,LID45017,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981249 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | Superseded by: GSE90263,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174318,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103819,Named Annotation: NA000017048.1 (GSM981249_hg19_wgEncodeCshlLongRnaSeqImr90CellPapMinusRep1.bigWig),Named Annotation: NA000017049.1 (GSM981249_hg19_wgEncodeCshlLongRnaSeqImr90CellPapMinusRep2.bigWig),Named Annotation: NA000017050.1 (GSM981249_hg19_wgEncodeCshlLongRnaSeqImr90CellPapPlusRep1.bigWig),Named Annotation: NA000017051.1 (GSM981249_hg19_wgEncodeCshlLongRnaSeqImr90CellPapPlusRep2.bigWig) | GSM981249 | GSE26284,GSE30567,GSE49417 | 0.004746 | IMR90 | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_IMR90_cell_longPolyA (superseded by GSE90263) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174318 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103819 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 086N,085N,086N,085N,085N,086N,labexpid: LID46597,LID46596,LID46597,LID46596,LID46597,LID46596,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 3,4,spikeinpool: Nist14,localization description: Large membrane bound part of cell containing chromosomes and the bulk of the cell's DNA,rnaextract: longPolyA,rnaextract description: Poly(A)+ RNA longer than 200 nt,biorep: 085N,086N,labexpid: LID46596,LID46597,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist14 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981250 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | Superseded by: GSE90265,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174319,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103820,Named Annotation: NA000017052.1 (GSM981250_hg19_wgEncodeCshlLongRnaSeqSknshNucleusPapMinusRep3.bigWig),Named Annotation: NA000017053.1 (GSM981250_hg19_wgEncodeCshlLongRnaSeqSknshNucleusPapMinusRep4.bigWig),Named Annotation: NA000017054.1 (GSM981250_hg19_wgEncodeCshlLongRnaSeqSknshNucleusPapPlusRep3.bigWig),Named Annotation: NA000017055.1 (GSM981250_hg19_wgEncodeCshlLongRnaSeqSknshNucleusPapPlusRep4.bigWig) | GSM981250 | GSE26284,GSE30567 | 0.052359 | SK-N-SH | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_SK-N-SH_nucleus_longPolyA (superseded by GSE90265) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174319 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103820 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 071WC,072WC,072WC,071WC,072WC,071WC,labexpid: LID47301,LID47104,LID47104,LID47301,LID47301,LID47104,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 071WC,072WC,labexpid: LID47301,LID47104,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981255 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78604,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174324,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103825,Named Annotation: NA000017072.1 (GSM981255_hg19_wgEncodeCshlLongRnaSeqHpcplCellTotalMinusRep1.bigWig),Named Annotation: NA000017073.1 (GSM981255_hg19_wgEncodeCshlLongRnaSeqHpcplCellTotalMinusRep2.bigWig),Named Annotation: NA000017074.1 (GSM981255_hg19_wgEncodeCshlLongRnaSeqHpcplCellTotalPlusRep1.bigWig),Named Annotation: NA000017075.1 (GSM981255_hg19_wgEncodeCshlLongRnaSeqHpcplCellTotalPlusRep2.bigWig) | GSM981255 | GSE26284,GSE30567 | 0.023272 | HPC-PL | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_HPC-PL_cell_total (superseded by GSE78604) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174324 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103825 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 061WC,062WC,062WC,061WC,labexpid: LID47094,LID47095,LID47095,LID47094,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 062WC,labexpid: LID47095,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 2,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM981258 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78606,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX174327,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01103828,Named Annotation: NA000017082.1 (GSM981258_hg19_wgEncodeCshlLongRnaSeqHfdpc01005032CellTotalMinusRep2.bigWig),Named Annotation: NA000017083.1 (GSM981258_hg19_wgEncodeCshlLongRnaSeqHfdpc01005032CellTotalPlusRep2.bigWig),Named Annotation: NA000017084.1 (GSM981258_hg19_wgEncodeCshlLongRnaSeqHfdpc01027033CellTotalMinusRep1.bigWig),Named Annotation: NA000017085.1 (GSM981258_hg19_wgEncodeCshlLongRnaSeqHfdpc01027033CellTotalPlusRep1.bigWig) | GSM981258 | GSE26284,GSE30567 | 0.002533 | HFDPC | Public on Aug 07 2012 | Aug 06 2012 | 9606 | CSHL_RnaSeq_HFDPC_cell_total (superseded by GSE78606) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX174327 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01103828 |
|
1 | cell line: C4-2B,chip antibody: none,chip antibody manufacturer: none,chip antibody lot #: none,chip antibody catalog #: none,treatment: EtOH vehicle treated | 660 S. Euclid Ave, Campus Box 8220 | St. Louis | USA | Washington University School of Medicine | Keith,F,Decker | bedGraph file: wigples were split according to barcode and barcodes were removed from fastq files. RNA-seq reads were mapped to the human genome (hg18) using Tophat v. 1.3.3. Aligned reads were filtered to eliminate reads that mapped to rRNA and RNA repeats (snRNA, scRNA, srpRNA, tRNA and RNA).,gene expression count table: Aligned reads were filtered to eliminate reads that mapped to rRNA and RNA repeats (snRNA, scRNA, srpRNA, tRNA and RNA). Htseq-count (http://www-huber.embl.de/users/anders/HTSeq/doc/count.html) was used to obtain raw read counts based on Ensembl gene annotations (hg18 v54) using the union method.,Genome Build:,RNASEQ.C42B_VEHICLE_2.692.s_2.TGTTTGT.bedGraph: hg18 | For RNA-seq, 10 ug of total RNA was oligo(dT) selected using the Dynabeads mRNA purification kit (Invitrogen) or depleted of ribosomal RNA (rRNA) using the RiboMinus kit (Invitrogen), and subsequently fragmented using RNA Fragmentation Reagents (Ambion). The fragmented RNA was randomly primed with hexamers and reverse-transcribed using the Just cDNA Double-stranded cDNA Synthesis kit (Stratagene). After second-strand synthesis, the cDNA was end-repaired, ligated to barcoded adaptors, size selected on agrose gel (150-300 bp) and PCR amplified for 14 cycles using Phusion polymerase (Finnzymes). Ligation of 4 base adapters resulted in fragments consisting of the 4 base barcode followed by the sequence. The libraries were sequenced in the Genome Analyzer IIx system according to the manufacturerâs instruction. | GSM984369 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176037,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01112593 | GSM984369 | GSE40050 | 0.008655 | prostate cancer cells | Public on Oct 02 2012 | Aug 10 2012 | 9606 | C42B vehicle 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176037 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01112593 |
|
1 | cell line: C4-2B,chip antibody: none,chip antibody manufacturer: none,chip antibody lot #: none,chip antibody catalog #: none,treatment: DHT treated (16h) | 660 S. Euclid Ave, Campus Box 8220 | St. Louis | USA | Washington University School of Medicine | Keith,F,Decker | bedGraph file: wigples were split according to barcode and barcodes were removed from fastq files. RNA-seq reads were mapped to the human genome (hg18) using Tophat v. 1.3.3. Aligned reads were filtered to eliminate reads that mapped to rRNA and RNA repeats (snRNA, scRNA, srpRNA, tRNA and RNA).,gene expression count table: Aligned reads were filtered to eliminate reads that mapped to rRNA and RNA repeats (snRNA, scRNA, srpRNA, tRNA and RNA). Htseq-count (http://www-huber.embl.de/users/anders/HTSeq/doc/count.html) was used to obtain raw read counts based on Ensembl gene annotations (hg18 v54) using the union method.,Genome Build:,RNASEQ.C42B_TREATED_2.692.s_2.TACATGG.bedGraph: hg18 | For RNA-seq, 10 ug of total RNA was oligo(dT) selected using the Dynabeads mRNA purification kit (Invitrogen) or depleted of ribosomal RNA (rRNA) using the RiboMinus kit (Invitrogen), and subsequently fragmented using RNA Fragmentation Reagents (Ambion). The fragmented RNA was randomly primed with hexamers and reverse-transcribed using the Just cDNA Double-stranded cDNA Synthesis kit (Stratagene). After second-strand synthesis, the cDNA was end-repaired, ligated to barcoded adaptors, size selected on agrose gel (150-300 bp) and PCR amplified for 14 cycles using Phusion polymerase (Finnzymes). Ligation of 4 base adapters resulted in fragments consisting of the 4 base barcode followed by the sequence. The libraries were sequenced in the Genome Analyzer IIx system according to the manufacturerâs instruction. | GSM984371 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176039,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01112595 | GSM984371 | GSE40050 | 0.008857 | prostate cancer cells | Public on Oct 02 2012 | Aug 10 2012 | 9606 | C42B treated 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176039 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01112595 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 073WC,074WC,073WC,074WC,labexpid: LID47253,LID47105,LID47253,LID47105,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 073WC,074WC,labexpid: LID47105,LID47253,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984604 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78617,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179429,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121023,Named Annotation: NA000017094.1 (GSM984604_hg19_wgEncodeCshlLongRnaSeqHpiepcCellTotalMinusRep1.bigWig),Named Annotation: NA000017095.1 (GSM984604_hg19_wgEncodeCshlLongRnaSeqHpiepcCellTotalMinusRep2.bigWig),Named Annotation: NA000017096.1 (GSM984604_hg19_wgEncodeCshlLongRnaSeqHpiepcCellTotalPlusRep1.bigWig),Named Annotation: NA000017097.1 (GSM984604_hg19_wgEncodeCshlLongRnaSeqHpiepcCellTotalPlusRep2.bigWig) | GSM984604 | GSE30567 | 0.039847 | HPIEpC | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_HPIEpC_cell_total (superseded by GSE78617) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179429 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121023 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 077WC,labexpid: LID47807,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 077WC,labexpid: LID47807,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984606 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE90275,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179431,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121025,Named Annotation: NA000017102.1 (GSM984606_hg19_wgEncodeCshlLongRnaSeqHmncpbCellTotalMinusRep1.bigWig),Named Annotation: NA000017103.1 (GSM984606_hg19_wgEncodeCshlLongRnaSeqHmncpbCellTotalMinusSignalRep1V2.bigWig),Named Annotation: NA000017104.1 (GSM984606_hg19_wgEncodeCshlLongRnaSeqHmncpbCellTotalPlusRep1.bigWig),Named Annotation: NA000017105.1 (GSM984606_hg19_wgEncodeCshlLongRnaSeqHmncpbCellTotalPlusSignalRep1V2.bigWig) | GSM984606 | GSE30567 | 0.00076 | hMNC-PB | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_hMNC-PB_cell_total (superseded by GSE90275) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179431 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121025 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 069WC,069WC,070WC,070WC,labexpid: LID47299,LID47300,LID47300,LID47299,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 069WC,labexpid: LID47299,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984607 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE90274,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179432,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121026,Named Annotation: NA000017106.1 (GSM984607_hg19_wgEncodeCshlLongRnaSeqHmscuc00525017CellTotalMinusRep1.bigWig),Named Annotation: NA000017107.1 (GSM984607_hg19_wgEncodeCshlLongRnaSeqHmscuc00525017CellTotalPlusRep1.bigWig),Named Annotation: NA000017108.1 (GSM984607_hg19_wgEncodeCshlLongRnaSeqHmscuc00811017CellTotalMinusRep2.bigWig),Named Annotation: NA000017109.1 (GSM984607_hg19_wgEncodeCshlLongRnaSeqHmscuc00811017CellTotalPlusRep2.bigWig) | GSM984607 | GSE30567 | 0.032393 | hMSC-UC | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_hMSC-UC_cell_total (superseded by GSE90274) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179432 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121026 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 067WC,068WC,068WC,067WC,labexpid: LID47100,LID47099,LID47099,LID47100,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 068WC,labexpid: LID47100,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 2,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984608 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE90273,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179433,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121027,Named Annotation: NA000017110.1 (GSM984608_hg19_wgEncodeCshlLongRnaSeqHmscbm005060211CellTotalMinusRep2.bigWig),Named Annotation: NA000017111.1 (GSM984608_hg19_wgEncodeCshlLongRnaSeqHmscbm005060211CellTotalPlusRep2.bigWig),Named Annotation: NA000017112.1 (GSM984608_hg19_wgEncodeCshlLongRnaSeqHmscbm005110511CellTotalMinusRep1.bigWig),Named Annotation: NA000017113.1 (GSM984608_hg19_wgEncodeCshlLongRnaSeqHmscbm005110511CellTotalPlusRep1.bigWig) | GSM984608 | GSE30567 | 0.168464 | hMSC-BM | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_hMSC-BM_cell_total (superseded by GSE90273) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179433 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121027 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 053WC,054WC,054WC,053WC,labexpid: LID47251,LID47252,LID47251,LID47252,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 054WC,labexpid: LID47252,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 2,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984610 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78608,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179435,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121029,Named Annotation: NA000017118.1 (GSM984610_hg19_wgEncodeCshlLongRnaSeqHob00902021CellTotalMinusRep2.bigWig),Named Annotation: NA000017119.1 (GSM984610_hg19_wgEncodeCshlLongRnaSeqHob00902021CellTotalPlusRep2.bigWig),Named Annotation: NA000017120.1 (GSM984610_hg19_wgEncodeCshlLongRnaSeqHob0091301CellTotalMinusRep1.bigWig),Named Annotation: NA000017121.1 (GSM984610_hg19_wgEncodeCshlLongRnaSeqHob0091301CellTotalPlusRep1.bigWig) | GSM984610 | GSE30567 | 0.095989 | HOB | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_HOB_cell_total (superseded by GSE78608) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179435 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121029 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 059WC,060WC,059WC,059WC,060WC,060WC,labexpid: LID47024,LID47025,LID47024,LID47025,LID47025,LID47024,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 059WC,labexpid: LID47024,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984611 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78607,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179436,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121030,Named Annotation: NA000017122.1 (GSM984611_hg19_wgEncodeCshlLongRnaSeqHch00113082pCellTotalMinusRep1.bigWig),Named Annotation: NA000017123.1 (GSM984611_hg19_wgEncodeCshlLongRnaSeqHch00113082pCellTotalPlusRep1.bigWig),Named Annotation: NA000017124.1 (GSM984611_hg19_wgEncodeCshlLongRnaSeqHch81008082CellTotalMinusRep2.bigWig),Named Annotation: NA000017125.1 (GSM984611_hg19_wgEncodeCshlLongRnaSeqHch81008082CellTotalPlusRep2.bigWig) | GSM984611 | GSE30567 | 0.003561 | HCH | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_HCH_cell_total (superseded by GSE78607) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179436 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121030 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 050WC,050WC,049WC,049WC,050WC,049WC,labexpid: LID47247,LID47248,LID47247,LID47247,LID47248,LID47248,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 050WC,labexpid: LID47248,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 2,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984612 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78610,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179437,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121031,Named Annotation: NA000017126.1 (GSM984612_hg19_wgEncodeCshlLongRnaSeqNhdf00608013CellTotalMinusRep2.bigWig),Named Annotation: NA000017127.1 (GSM984612_hg19_wgEncodeCshlLongRnaSeqNhdf00608013CellTotalPlusRep2.bigWig),Named Annotation: NA000017128.1 (GSM984612_hg19_wgEncodeCshlLongRnaSeqNhdf70717012CellTotalMinusRep1.bigWig),Named Annotation: NA000017129.1 (GSM984612_hg19_wgEncodeCshlLongRnaSeqNhdf70717012CellTotalPlusRep1.bigWig) | GSM984612 | GSE30567 | 0.088771 | NHDF | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_NHDF_cell_total (superseded by GSE78610) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179437 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121031 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 094WC,093WC,094WC,093WC,093WC,094WC,labexpid: LID47260,LID47261,LID47260,LID47261,LID47261,LID47260,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 094WC,093WC,labexpid: LID47261,LID47260,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984613 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78609,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179438,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121032,Named Annotation: NA000017130.1 (GSM984613_hg19_wgEncodeCshlLongRnaSeqHsavecCellTotalMinusRep1.bigWig),Named Annotation: NA000017131.1 (GSM984613_hg19_wgEncodeCshlLongRnaSeqHsavecCellTotalMinusRep2.bigWig),Named Annotation: NA000017132.1 (GSM984613_hg19_wgEncodeCshlLongRnaSeqHsavecCellTotalPlusRep1.bigWig),Named Annotation: NA000017133.1 (GSM984613_hg19_wgEncodeCshlLongRnaSeqHsavecCellTotalPlusRep2.bigWig) | GSM984613 | GSE30567 | 0.001807 | HSaVEC | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_HSaVEC_cell_total (superseded by GSE78609) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179438 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121032 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 081WC,081WC,082WC,082WC,labexpid: LID47256,LID47257,LID47257,LID47256,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 082WC,labexpid: LID47257,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 2,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984616 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78618,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179441,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121035,Named Annotation: NA000017142.1 (GSM984616_hg19_wgEncodeCshlLongRnaSeqNhemfm250713022CellTotalMinusRep2.bigWig),Named Annotation: NA000017143.1 (GSM984616_hg19_wgEncodeCshlLongRnaSeqNhemfm250713022CellTotalPlusRep2.bigWig),Named Annotation: NA000017144.1 (GSM984616_hg19_wgEncodeCshlLongRnaSeqNhemfm26022001CellTotalMinusRep1.bigWig),Named Annotation: NA000017145.1 (GSM984616_hg19_wgEncodeCshlLongRnaSeqNhemfm26022001CellTotalPlusRep1.bigWig) | GSM984616 | GSE30567 | 0.063031 | NHEM.f_M2 | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_NHEM.f_M2_cell_total (superseded by GSE78618) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179441 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121035 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 083WC,084WC,083WC,084WC,labexpid: LID47259,LID47258,LID47258,LID47259,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 084WC,labexpid: LID47259,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 2,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984617 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78619,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179442,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121036,Named Annotation: NA000017146.1 (GSM984617_hg19_wgEncodeCshlLongRnaSeqNhemm270110012CellTotalMinusRep2.bigWig),Named Annotation: NA000017147.1 (GSM984617_hg19_wgEncodeCshlLongRnaSeqNhemm270110012CellTotalPlusRep2.bigWig),Named Annotation: NA000017148.1 (GSM984617_hg19_wgEncodeCshlLongRnaSeqNhemm27012303CellTotalMinusRep1.bigWig),Named Annotation: NA000017149.1 (GSM984617_hg19_wgEncodeCshlLongRnaSeqNhemm27012303CellTotalPlusRep1.bigWig) | GSM984617 | GSE30567 | 0.011798 | NHEM_M2 | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_NHEM_M2_cell_total (superseded by GSE78619) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179442 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121036 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 058WC,057WC,058WC,057WC,057WC,058WC,labexpid: LID47022,LID47023,LID47022,LID47023,LID47023,LID47022,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 057WC,labexpid: LID47022,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984618 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78613,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179443,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121037,Named Annotation: NA000017150.1 (GSM984618_hg19_wgEncodeCshlLongRnaSeqHaoec70717061CellTotalMinusRep1.bigWig),Named Annotation: NA000017151.1 (GSM984618_hg19_wgEncodeCshlLongRnaSeqHaoec70717061CellTotalPlusRep1.bigWig),Named Annotation: NA000017152.1 (GSM984618_hg19_wgEncodeCshlLongRnaSeqHaoecCellTotalMinusRep2.bigWig),Named Annotation: NA000017153.1 (GSM984618_hg19_wgEncodeCshlLongRnaSeqHaoecCellTotalPlusRep2.bigWig) | GSM984618 | GSE30567 | 0.021881 | HAoEC | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_HAoEC_cell_total (superseded by GSE78613) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179443 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121037 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 080WC,079WC,080WC,080WC,079WC,079WC,labexpid: LID47255,LID47254,LID47254,LID47255,LID47255,LID47254,labversion: iIDR,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 1,2,spikeinpool: Nist13,localization description: Whole cell,rnaextract: total,rnaextract description: Total RNA extract (longer than 200 nt),biorep: 080WC,labexpid: LID47255,readtype: 2x101D,readtype description: Paired 101 nt directed reads,replicate: 2,spikeinpool: Nist13 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlLongRnaSeq | GSM984620 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Superseded by: GSE78615,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179445,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121039,Named Annotation: NA000017158.1 (GSM984620_hg19_wgEncodeCshlLongRnaSeqHwp0092205CellTotalMinusRep2.bigWig),Named Annotation: NA000017159.1 (GSM984620_hg19_wgEncodeCshlLongRnaSeqHwp0092205CellTotalPlusRep2.bigWig),Named Annotation: NA000017160.1 (GSM984620_hg19_wgEncodeCshlLongRnaSeqHwp81202015CellTotalMinusRep1.bigWig),Named Annotation: NA000017161.1 (GSM984620_hg19_wgEncodeCshlLongRnaSeqHwp81202015CellTotalPlusRep1.bigWig) | GSM984620 | GSE30567 | 0.006394 | HWP | Public on Aug 14 2012 | Aug 13 2012 | 9606 | CSHL_RnaSeq_HWP_cell_total (superseded by GSE78615) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179445 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121039 |
|
1 | cell line: HT1080,clone: m6A-Tracer-VP16,treatment protocol: Doxycycline -/ Shield + | Plesmanlaan 121 | Amsterdam | Netherlands | Netherlands Cancer Institute | Bas,,van Steensel | Basecalling and filtering were performed using standard software of the Illumina HiSeq 2000.,Reads were aligned to the human genome, GRCh37, using TopHat (version 1.4.0) and Bowtie (version 0.12.7), using default settings and a model annotation file (GTF version 66).,Supplementary_files_format_and_content: absolute_genecounts.txt: readcounts per gene, generated by htseq-count | Total RNA was extracted using Trizol. Sequencing libraries were constructed using Illumina TruSeq RNA PART# 15008136 REVISION A. | GSM985104 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176611,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01113242 | GSM985104 | GSE40111,GSE40112 | 0.003739 | m6ATracer-VP16+/DamLaminB1+ | Public on Jan 31 2013 | Aug 14 2012 | 9606 | 12_CTTGTAA | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176611 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01113242 |
|
1 | antibody: none,agent: 25mM sodium bicarbonate,cell line: HeLa | 615 Charles E Young Dr South | Los Angeles | USA | UCLA | Siavash,K,Kurdistani | Alignment of mRNA-seq reads was performed using default parameters of Tophat.,Aligned reads were converted to sam format and SAMMate software6 was used to determine the transcript RPKM (reads per kilobase of exon per million of reads).,Genome_build: hg19,Supplementary_files_format_and_content: bed, RPKM.txt | Total RNA was extracted from HeLa cells grown in 25 or 3 mM sodium bicarbonate using Qiagen easy RNA kit. Maximum amount of RNA was used to start the library preparation according to the manufacturer's instructions (Illumina). Libraries were sequenced using Illumina HIseq-2000 to obtain 50 bp-long reads. Nugen Ovation Ultralow Library system | GSM985138 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176646,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01113278 | GSM985138 | GSE40114 | 0.004028 | mRNA 25mM sodium bicarbonate | Public on Nov 04 2012 | Aug 14 2012 | 9606 | mRNA 25mM sodium bicarbonate | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176646 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01113278 |
|
1 | antibody: none,agent: 3mM sodium bicarbonate,cell line: HeLa | 615 Charles E Young Dr South | Los Angeles | USA | UCLA | Siavash,K,Kurdistani | Alignment of mRNA-seq reads was performed using default parameters of Tophat.,Aligned reads were converted to sam format and SAMMate software6 was used to determine the transcript RPKM (reads per kilobase of exon per million of reads).,Genome_build: hg19,Supplementary_files_format_and_content: bed, RPKM.txt | Total RNA was extracted from HeLa cells grown in 25 or 3 mM sodium bicarbonate using Qiagen easy RNA kit. Maximum amount of RNA was used to start the library preparation according to the manufacturer's instructions (Illumina). Libraries were sequenced using Illumina HIseq-2000 to obtain 50 bp-long reads. Nugen Ovation Ultralow Library system | GSM985139 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176647,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01113279 | GSM985139 | GSE40114 | 0.001257 | mRNA 3mM sodium bicarbonate | Public on Nov 04 2012 | Aug 14 2012 | 9606 | mRNA 3mM sodium bicarbonate | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176647 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01113279 |
|
1 | passages: 10-15,cell line: HeLa,treatment: siControl | 5801 South Ellis Avenue | Chicago | USA | University of Chicago | zhike,,lu | Illumina Casava 1.8.2 software used for basecalling.,Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to hg19 and mm9 whole genome using tophat with -n 2 -g 1,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using cuffdiff,Genome_build: hg19,mm9,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total | GSM986109 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176913,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01113364 | GSM986109 | GSE40132 | 0.016904 | HeLa cells | Public on Feb 15 2013 | Aug 15 2012 | 9606 | HeLa siControl RNASeq | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176913 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01113364 |
|
1 | passages: 10-15,cell line: HeLa,treatment: siALKB5 | 5801 South Ellis Avenue | Chicago | USA | University of Chicago | zhike,,lu | Illumina Casava 1.8.2 software used for basecalling.,Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to hg19 and mm9 whole genome using tophat with -n 2 -g 1,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using cuffdiff,Genome_build: hg19,mm9,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total | GSM986110 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176914,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01113365 | GSM986110 | GSE40132 | 0.004324 | HeLa cells | Public on Feb 15 2013 | Aug 15 2012 | 9606 | HeLa siALKB5 RNASeq | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176914 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01113365 |
|
1 | cell line: HEK293,sirna: none,fragmentation: alkaline hydrolysis | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide or alkaline hydrolysis. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM986133 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176925,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120122 | GSM986133 | GSE40137 | 0.172662 | HEK293 | Public on Oct 30 2012 | Aug 15 2012 | 9606 | A-seq NO siRNA | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176925 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120122 |
|
1 | cell line: HEK293,sirna: scrambled-A,fragmentation: alkaline hydrolysis | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide or alkaline hydrolysis. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM986134 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176926,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120123 | GSM986134 | GSE40137 | 0.206447 | HEK293 | Public on Oct 30 2012 | Aug 15 2012 | 9606 | A-seq siRNA Control | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176926 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120123 |
|
1 | cell line: HEK293,sirna: Ambion S224836,fragmentation: alkaline hydrolysis | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide or alkaline hydrolysis. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM986135 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176927,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120124 | GSM986135 | GSE40137 | 0.075751 | HEK293 | Public on Oct 30 2012 | Aug 15 2012 | 9606 | A-seq siRNA CF Im25 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176927 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120124 |
|
1 | cell line: HEK293,sirna: Ambion S21772,fragmentation: alkaline hydrolysis | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide or alkaline hydrolysis. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM986136 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176928,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120125 | GSM986136 | GSE40137 | 0.104335 | HEK293 | Public on Oct 30 2012 | Aug 15 2012 | 9606 | A-seq siRNA CF Im59 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176928 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120125 |
|
1 | cell line: HEK293,sirna: scrambled-A,fragmentation: RNase I digestion | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide or alkaline hydrolysis. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM986137 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176929,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120126 | GSM986137 | GSE40137 | 0.083065 | HEK293 | Public on Oct 30 2012 | Aug 15 2012 | 9606 | A-seq siRNA Ctrl for CF Im68 KD | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176929 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120126 |
|
1 | cell line: HEK293,sirna: 5'-NNGACCGAGA UUACAUGGAUA-3' dsRNA oligo from Dharmacon,fragmentation: RNase I digestion | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide or alkaline hydrolysis. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM986138 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX176930,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120127 | GSM986138 | GSE40137 | 0.116439 | HEK293 | Public on Oct 30 2012 | Aug 15 2012 | 9606 | A-seq siRNA CF Im68 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX176930 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120127 |
|
1 | cell line: CG-SH | 2950 Chemin Polytechnique | Montreal | Canada | University of Montreal | Brian,,Wilhelm | Illumina Casava1.7 software used for basecalling.,Eland2 was used (through Casava 1.7) for mapping to the human reference genome,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using a protocol from Chepelev et al., Nucleic Acids Research, 2009.,Genome Build: hg19,supplementary files format and content: tab-delimited text files include RPKM values for each Sample. | Total RNA was extracted from Trizol (invitrogen) according the manufacturers guidelines. rRNA was removed through ribominus kit (Invitrogen) according to manufacturers protocol. Remaining RNA was converted into strand specific paired-end cDNA libraries using Illumina RNA-seq kit according to manufacturers protocols. | GSM988217 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179257,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120802 | GSM988217 | GSE40199 | 0.003217 | acute myeloid leukemia | Public on Dec 31 2013 | Aug 17 2012 | 9606 | CG-SH RNA | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179257 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120802 |
|
1 | cell line: A549 | 1200 EAST CALIFORNIA BOULEVARD | PASADENA | USA | CalTech | Jevgenij,A.,Raskatov | Bowtie mapping to hg19+mm9 transcriptome, then eXpress, then DESeq | Experiments were performed in female SCID-beige mice (Charles River) between 8 and 12 weeks of age. Cells were injected into the left flank area of the animals as suspensions of 25 x 106 mL-1 in RPMI, 200 µL per injection. Treatment and tumor proliferation monitoring. Mice were treated following the schedule delineated in Supporting Information (Table S1). Tumor proliferation was monitored using the XENOGEN imaging device. The animals were anesthetized with 2 5 % isoflurane and subsequently transferred to the imaging chamber, whereupon the isoflurane levels were reduced to 1-2.5 %. The floor of the imager was heated to +37 ºC to avoid hypothermia. Breathing frequency was monitored and not allowed to drop below 1 s-1, adjusting the isoflurane levels accordingly at all times. Endpoint criteria and euthanasia. Animal endpoint criteria encompassed weight loss of over 15 %, restriction of motor function by the engrafted tumor, dehydration of over 10 % and moribund behavior. Where appropriate, the animals were euthanized by asphyxiation in a CO2 chamber. Tumor tissue harvest. Animals were resected and tumors excised using standard forceps, scissors and surgical blades. The tumors were combined into one sample per condition and mechanically sheared in TRIZOL, employing a specialized device (tissue tearer, model 985370). Total RNA workup was performed following the standard TRIZOL procedure, followed by a DNAse digest, double poly-A select; libraries prepared using standard Illumina reagents and protocols | GSM988513 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179409,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01120998 | GSM988513 | GSE40218 | 0 | control_A549 | Public on Oct 02 2012 | Aug 20 2012 | 9606 | control_A549 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179409 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01120998 |
|
1 | cell line: HeLa,sirna: siLuc,treatment: transfected with 42nM of siLuciferase | Building 203 Room 525, School of Biological Sciences, Seoul National University, 1 Gwanak-ro, Gwanak-gu | Seoul | South Korea | Seoul National University | Hyeshik,,Chang | Reads were mapped, measured and quantifed by cufflinks v2.0.0, tophat v2.0.0 and bowtie v2.0.0-beta5 with --library-type fr-secondstrand and other default options. The gene annotations for cufflinks were retrieved from Illumina iGenome repository as of Sep 11, 2011.,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include FPKM values and log2 fold changes between samples | To prepare mRNA libraries, mRNAs were purified from total RNAs using Dynabeads mRNA Purification Kit (Invitrogen, 61011). Purified mRNAs were fragmented by RNA Fragmentation Reagents (Ambion, AM8740). After fragmentation, phosphate group at 3â² end was removed by Antarctic phosphatase (NEB, M0289L), and RNAs were 5â² phosphorylated by T4 PNK (NEB). Directional and multiplexed mRNA libraries were generated using TruSeq Small RNA Sample Preparation Kit (Illumina, RS-200â0012). The mRNA libraries were sequenced using Illumina HiSeq 2000. | GSM988637 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179484,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121067 | GSM988637 | GSE40228,GSE40236 | 0.003088 | Cervical cancer cells transfected with siRNA against luciferase two times over a 5 day period. | Public on Oct 16 2012 | Aug 20 2012 | 9606 | HeLa-siLuc (RNA-seq) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179484 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121067 |
|
1 | cell line: HeLa,sirna: siTUTs,treatment: transfected with 14nM of each siTUT7 | Building 203 Room 525, School of Biological Sciences, Seoul National University, 1 Gwanak-ro, Gwanak-gu | Seoul | South Korea | Seoul National University | Hyeshik,,Chang | Reads were mapped, measured and quantifed by cufflinks v2.0.0, tophat v2.0.0 and bowtie v2.0.0-beta5 with --library-type fr-secondstrand and other default options. The gene annotations for cufflinks were retrieved from Illumina iGenome repository as of Sep 11, 2011.,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include FPKM values and log2 fold changes between samples | To prepare mRNA libraries, mRNAs were purified from total RNAs using Dynabeads mRNA Purification Kit (Invitrogen, 61011). Purified mRNAs were fragmented by RNA Fragmentation Reagents (Ambion, AM8740). After fragmentation, phosphate group at 3â² end was removed by Antarctic phosphatase (NEB, M0289L), and RNAs were 5â² phosphorylated by T4 PNK (NEB). Directional and multiplexed mRNA libraries were generated using TruSeq Small RNA Sample Preparation Kit (Illumina, RS-200â0012). The mRNA libraries were sequenced using Illumina HiSeq 2000. | GSM988638 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX179485,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01121068 | GSM988638 | GSE40228,GSE40236 | 0.006011 | Cervical cancer cells transfected with siRNA against luciferase two times over a 5 day period. | Public on Oct 16 2012 | Aug 20 2012 | 9606 | HeLa-siTUTs (RNA-seq) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX179485 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01121068 |
|
1 | cell type: rAC-VEC | 1305 York Avenue | New York | USA | WEILL MEDICAL COLLEGE OF CORNELL UNIV | Olivier,,Elemento | Illumina Casava1.8 software used for basecalling.,Sequence reads were aligned to hg18 using TopHat with default parameters,FPKM were obtained using CuffLinks with upper-quartile and GC normalization,Genome_build: hg18,Supplementary_files_format_and_content: tab-delimited FPKM values for each Refseq transcript | Illumina TruSeq, PE 51x2 | GSM990765 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183776,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162361 | GSM990765 | GSE40291 | 0.003317 | rAC-VEC | Public on Oct 30 2012 | Aug 22 2012 | 9606 | rAC-VECs 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183776 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162361 |
|
1 | cell type: rAC-VEC | 1305 York Avenue | New York | USA | WEILL MEDICAL COLLEGE OF CORNELL UNIV | Olivier,,Elemento | Illumina Casava1.8 software used for basecalling.,Sequence reads were aligned to hg18 using TopHat with default parameters,FPKM were obtained using CuffLinks with upper-quartile and GC normalization,Genome_build: hg18,Supplementary_files_format_and_content: tab-delimited FPKM values for each Refseq transcript | Illumina TruSeq, PE 51x2 | GSM990766 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183777,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162362 | GSM990766 | GSE40291 | 0.00767 | rAC-VEC | Public on Oct 30 2012 | Aug 22 2012 | 9606 | rAC-VECs 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183777 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162362 |
|
1 | cell type: rAC-VEC | 1305 York Avenue | New York | USA | WEILL MEDICAL COLLEGE OF CORNELL UNIV | Olivier,,Elemento | Illumina Casava1.8 software used for basecalling.,Sequence reads were aligned to hg18 using TopHat with default parameters,FPKM were obtained using CuffLinks with upper-quartile and GC normalization,Genome_build: hg18,Supplementary_files_format_and_content: tab-delimited FPKM values for each Refseq transcript | Illumina TruSeq, PE 51x2 | GSM990768 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183779,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162364 | GSM990768 | GSE40291 | 0.003317 | rAC-VEC | Public on Oct 30 2012 | Aug 22 2012 | 9606 | rAC-VEC clone 4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183779 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162364 |
|
1 | cell type: CD34+/Lin- | 1305 York Avenue | New York | USA | WEILL MEDICAL COLLEGE OF CORNELL UNIV | Olivier,,Elemento | Illumina Casava1.8 software used for basecalling.,Sequence reads were aligned to hg18 using TopHat with default parameters,FPKM were obtained using CuffLinks with upper-quartile and GC normalization,Genome_build: hg18,Supplementary_files_format_and_content: tab-delimited FPKM values for each Refseq transcript | Illumina TruSeq, PE 51x2 | GSM990773 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183784,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162369 | GSM990773 | GSE40291 | 0.010525 | CD34+ | Public on Oct 30 2012 | Aug 22 2012 | 9606 | CD34+ | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183784 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162369 |
|
1 | cell line: HT,treatment: DMSO | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994755 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181465,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141436 | GSM994755 | GSE40475,GSE40476 | 0.010339 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | HT DMSO D4 R1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181465 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141436 |
|
1 | cell line: HT,treatment: iEZH | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994756 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181466,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141437 | GSM994756 | GSE40475,GSE40476 | 0 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | HT iEZH D4 R1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181466 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141437 |
|
1 | cell line: SUDHL6,treatment: DMSO | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994757 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181467,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141438 | GSM994757 | GSE40475,GSE40476 | 0.034441 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | SUDHL6 DMSO D4 R1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181467 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141438 |
|
1 | cell line: SUDHL6,treatment: iEZH | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994758 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181468,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141439 | GSM994758 | GSE40475,GSE40476 | 0 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | SUDHL6 iEZH D4 R1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181468 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141439 |
|
1 | cell line: HT,treatment: DMSO | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994759 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181469,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141440 | GSM994759 | GSE40475,GSE40476 | 0.007739 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | HT DMSO D4 R2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181469 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141440 |
|
1 | cell line: HT,treatment: iEZH | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994760 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181470,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141441 | GSM994760 | GSE40475,GSE40476 | 0 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | HT iEZH D4 R2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181470 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141441 |
|
1 | cell line: SUDHL6,treatment: DMSO | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994761 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181471,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141442 | GSM994761 | GSE40475,GSE40476 | 0.010486 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | SUDHL6 DMSO D4 R2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181471 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141442 |
|
1 | cell line: SUDHL6,treatment: iEZH | 215 First Street | Cambridge | USA | Constellation Pharmaceuticals | Barbara,M,Bryant | Sequencing was performed on the HiSeq 2000.,Tophat 1.4.1 was used to perform sequence alignment, with UCSC human (hg19) as the reference genome.,The Normalized counts of sequence reads (FPKM) mapped to annotated UCSC genes were determined using Cufflinks software.,The data was filtered to keep genes with at least one sample above a 50-read threshold. Samples with fewer than 10 reads FPKM are replaced with the average across samples of 10 reads FPKM, to generate the final gene counts for each sample and gene.,Data processing was performed by Ocean Ridge Biosystems.,Genome_build: hg19 | RNA-seq | GSM994762 | Illumina HiSeq 2000 | Dec 01 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX181472,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01141443 | GSM994762 | GSE40475,GSE40476 | 0.00453 | Diffuse large B cell lymphoma | Public on Dec 01 2020 | Aug 29 2012 | 9606 | SUDHL6 iEZH D4 R2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX181472 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01141443 |
|
1 | Sex: male,age: 58,treatment: incubated for 1h with GM-CSF (5 ng/mL) | 6 West Derby Street | Liverpool | United Kingdom | University of Liverpool | Helen,Louise,Wright | Reads were mapped to the human genome (hg19) using TopHat (v1.4.1).,Illumina libraries:default TopHat parameters were used with the addition of the -g / --max-multi-hits option set as 1, to report only uniquely mapping reads.,SOLiD libraries: preliminary analysis of read quality scores showed a decrease in quality of SOLiD reads towards the 3â end of the read, and consequently reads were trimmed by 10 bases from the 3â end and first mapped to the human genome using Bowtie (v0.12.7). Reads not uniquely mapped by Bowtie were then mapped using TopHat and the two datasets merged.,Gene annotation and calculation of RPKM values was carried out using Cufflinks (v1.3.0) with the provision of a GTF annotation file (hg19).,Genome_build: hg19,Supplementary_files_format_and_content: Files were created using cuffdiff applying a 5% false discovery rate and with the provision of a reference GTF (hg19) | RNA was isolated using TRIzol-chloroform precipitation, followed by clean-up with the Rneasy kit (Qiagen) including DNA digestion. RNAseq was carried out using standard SOLiD and Illumina protocols. mRNA was enriched by ribosomal depletion (SOLiD) or poly-A selection (Illumina). | GSM996202 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX182676,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01161899 | GSM996202 | GSE40548 | 0 | Neutrophil | Public on Mar 06 2013 | Aug 31 2012 | 9606 | Illumina2-GMCSF | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX182676 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01161899 |
|
1 | cell line: breast cancer cell line MCF-7/S0.5,genotype: tamoxifen sensitive | The Bartholin Building | Aarhus | Denmark | Aarhus University | Jian,,Li | Basecalling was performed in BGI-Shenzhen.,A command line tool FASTX-Toolkit implemented in Perl was used to trim the adaptor sequence. The trimmed tags were subjected to quality filtering, so that only tags with sequencing quality higher than 30 for more than 80% of the nucleotides were used for subsequent analysis. For MMSDK tag mapping, we generated a simulated reference library, i.e., BssHII reference library, by in silico enzyme digestion of the human genome (hg19, UCSC) regardless of the methylation state. This library was used as reference for subsequent mapping of the tags in the MMSDK analysis. In the DGE analysis, refMrna (hg19, UCSC) was used as reference for mapping cDNA tags. Subsequently, the BurrowsâWheeler Aligner (BWA) procedure for aligning the MMSDK and DGE tags to the simulated BssHII reference library and refMrna reference library, respectively, was applied.,Genome_build: UCSC hg19,Supplementary_files_format_and_content: Tab-delimited text files (linked as supplementary files on the Series record) include gene expression values (normalized tag number) and DNA unmethylation values (normalized tag number) for each Sample . | DNA was isolated from the cell lines using DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturerâs protocol. Genomic DNA was digested with BssHII followed by ligation to biotinylated linkers and fragmented by NlaIII (New England BioLabs) cleavage. Because BssHII only cuts unmethylated regions, binding of DNA fragments to streptavidin-conjugated magnetic beads allow separation of the unmethylated and methylated fragments. Bound DNA was ligated to another linker (N) containing the MmeI restriction enzyme recognition site, and then digested with MmeI (New England Biolabs) that generates short sequence tags (20-21 bp, due to enzyme cut floating). The resulting tags were ligated with another linker P7 and amplified by PCR with primers N and P7 for 18 cycles.,Total RNA was extracted from the cell lines with TRI Reagent (Sigma) according to the manufacturerâs protocol. The integrity of the extracted RNA was checked by agarose gel electrophoresis, and the concentration of RNA was estimated by spectrophotometry. Then, mRNA is separated from total RNA by poly-T coated beads and converted to cDNA. The cDNA is isolated and subjected to NlaIII digestion followed by N-ligation, MmeI digestion P7-ligation and PCR to prepare a DEG library in a way analogous to that in MMSDK. | GSM998958 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183871,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162380 | GSM998958 | GSE40665 | 0.339514 | Breast cancer cell line | Public on Feb 03 2014 | Sep 06 2012 | 9606 | MCF-7/S0.5-DGE analysis | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183871 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162380 |
|
1 | cell line: breast cancer cell line MCF-7/TAMR-1,genotype: tamoxifen resistant | The Bartholin Building | Aarhus | Denmark | Aarhus University | Jian,,Li | Basecalling was performed in BGI-Shenzhen.,A command line tool FASTX-Toolkit implemented in Perl was used to trim the adaptor sequence. The trimmed tags were subjected to quality filtering, so that only tags with sequencing quality higher than 30 for more than 80% of the nucleotides were used for subsequent analysis. For MMSDK tag mapping, we generated a simulated reference library, i.e., BssHII reference library, by in silico enzyme digestion of the human genome (hg19, UCSC) regardless of the methylation state. This library was used as reference for subsequent mapping of the tags in the MMSDK analysis. In the DGE analysis, refMrna (hg19, UCSC) was used as reference for mapping cDNA tags. Subsequently, the BurrowsâWheeler Aligner (BWA) procedure for aligning the MMSDK and DGE tags to the simulated BssHII reference library and refMrna reference library, respectively, was applied.,Genome_build: UCSC hg19,Supplementary_files_format_and_content: Tab-delimited text files (linked as supplementary files on the Series record) include gene expression values (normalized tag number) and DNA unmethylation values (normalized tag number) for each Sample . | DNA was isolated from the cell lines using DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturerâs protocol. Genomic DNA was digested with BssHII followed by ligation to biotinylated linkers and fragmented by NlaIII (New England BioLabs) cleavage. Because BssHII only cuts unmethylated regions, binding of DNA fragments to streptavidin-conjugated magnetic beads allow separation of the unmethylated and methylated fragments. Bound DNA was ligated to another linker (N) containing the MmeI restriction enzyme recognition site, and then digested with MmeI (New England Biolabs) that generates short sequence tags (20-21 bp, due to enzyme cut floating). The resulting tags were ligated with another linker P7 and amplified by PCR with primers N and P7 for 18 cycles.,Total RNA was extracted from the cell lines with TRI Reagent (Sigma) according to the manufacturerâs protocol. The integrity of the extracted RNA was checked by agarose gel electrophoresis, and the concentration of RNA was estimated by spectrophotometry. Then, mRNA is separated from total RNA by poly-T coated beads and converted to cDNA. The cDNA is isolated and subjected to NlaIII digestion followed by N-ligation, MmeI digestion P7-ligation and PCR to prepare a DEG library in a way analogous to that in MMSDK. | GSM998959 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183872,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162381 | GSM998959 | GSE40665 | 0.4394 | Breast cancer cell line | Public on Feb 03 2014 | Sep 06 2012 | 9606 | TMAR 1-DGE analysis | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183872 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162381 |
|
1 | cell line: breast cancer cell line MCF-7/TAMR-4,genotype: tamoxifen resistant | The Bartholin Building | Aarhus | Denmark | Aarhus University | Jian,,Li | Basecalling was performed in BGI-Shenzhen.,A command line tool FASTX-Toolkit implemented in Perl was used to trim the adaptor sequence. The trimmed tags were subjected to quality filtering, so that only tags with sequencing quality higher than 30 for more than 80% of the nucleotides were used for subsequent analysis. For MMSDK tag mapping, we generated a simulated reference library, i.e., BssHII reference library, by in silico enzyme digestion of the human genome (hg19, UCSC) regardless of the methylation state. This library was used as reference for subsequent mapping of the tags in the MMSDK analysis. In the DGE analysis, refMrna (hg19, UCSC) was used as reference for mapping cDNA tags. Subsequently, the BurrowsâWheeler Aligner (BWA) procedure for aligning the MMSDK and DGE tags to the simulated BssHII reference library and refMrna reference library, respectively, was applied.,Genome_build: UCSC hg19,Supplementary_files_format_and_content: Tab-delimited text files (linked as supplementary files on the Series record) include gene expression values (normalized tag number) and DNA unmethylation values (normalized tag number) for each Sample . | DNA was isolated from the cell lines using DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturerâs protocol. Genomic DNA was digested with BssHII followed by ligation to biotinylated linkers and fragmented by NlaIII (New England BioLabs) cleavage. Because BssHII only cuts unmethylated regions, binding of DNA fragments to streptavidin-conjugated magnetic beads allow separation of the unmethylated and methylated fragments. Bound DNA was ligated to another linker (N) containing the MmeI restriction enzyme recognition site, and then digested with MmeI (New England Biolabs) that generates short sequence tags (20-21 bp, due to enzyme cut floating). The resulting tags were ligated with another linker P7 and amplified by PCR with primers N and P7 for 18 cycles.,Total RNA was extracted from the cell lines with TRI Reagent (Sigma) according to the manufacturerâs protocol. The integrity of the extracted RNA was checked by agarose gel electrophoresis, and the concentration of RNA was estimated by spectrophotometry. Then, mRNA is separated from total RNA by poly-T coated beads and converted to cDNA. The cDNA is isolated and subjected to NlaIII digestion followed by N-ligation, MmeI digestion P7-ligation and PCR to prepare a DEG library in a way analogous to that in MMSDK. | GSM998960 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183873,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162382 | GSM998960 | GSE40665 | 0.287947 | Breast cancer cell line | Public on Feb 03 2014 | Sep 06 2012 | 9606 | TMAR 4-DGE analysis | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183873 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162382 |
|
1 | cell line: breast cancer cell line MCF-7/TAMR-7,genotype: tamoxifen resistant | The Bartholin Building | Aarhus | Denmark | Aarhus University | Jian,,Li | Basecalling was performed in BGI-Shenzhen.,A command line tool FASTX-Toolkit implemented in Perl was used to trim the adaptor sequence. The trimmed tags were subjected to quality filtering, so that only tags with sequencing quality higher than 30 for more than 80% of the nucleotides were used for subsequent analysis. For MMSDK tag mapping, we generated a simulated reference library, i.e., BssHII reference library, by in silico enzyme digestion of the human genome (hg19, UCSC) regardless of the methylation state. This library was used as reference for subsequent mapping of the tags in the MMSDK analysis. In the DGE analysis, refMrna (hg19, UCSC) was used as reference for mapping cDNA tags. Subsequently, the BurrowsâWheeler Aligner (BWA) procedure for aligning the MMSDK and DGE tags to the simulated BssHII reference library and refMrna reference library, respectively, was applied.,Genome_build: UCSC hg19,Supplementary_files_format_and_content: Tab-delimited text files (linked as supplementary files on the Series record) include gene expression values (normalized tag number) and DNA unmethylation values (normalized tag number) for each Sample . | DNA was isolated from the cell lines using DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturerâs protocol. Genomic DNA was digested with BssHII followed by ligation to biotinylated linkers and fragmented by NlaIII (New England BioLabs) cleavage. Because BssHII only cuts unmethylated regions, binding of DNA fragments to streptavidin-conjugated magnetic beads allow separation of the unmethylated and methylated fragments. Bound DNA was ligated to another linker (N) containing the MmeI restriction enzyme recognition site, and then digested with MmeI (New England Biolabs) that generates short sequence tags (20-21 bp, due to enzyme cut floating). The resulting tags were ligated with another linker P7 and amplified by PCR with primers N and P7 for 18 cycles.,Total RNA was extracted from the cell lines with TRI Reagent (Sigma) according to the manufacturerâs protocol. The integrity of the extracted RNA was checked by agarose gel electrophoresis, and the concentration of RNA was estimated by spectrophotometry. Then, mRNA is separated from total RNA by poly-T coated beads and converted to cDNA. The cDNA is isolated and subjected to NlaIII digestion followed by N-ligation, MmeI digestion P7-ligation and PCR to prepare a DEG library in a way analogous to that in MMSDK. | GSM998961 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183874,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162383 | GSM998961 | GSE40665 | 0.42908 | Breast cancer cell line | Public on Feb 03 2014 | Sep 06 2012 | 9606 | TMAR 7-DGE analysis | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183874 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162383 |
|
1 | cell line: breast cancer cell line MCF-7/TAMR-8,genotype: tamoxifen resistant | The Bartholin Building | Aarhus | Denmark | Aarhus University | Jian,,Li | Basecalling was performed in BGI-Shenzhen.,A command line tool FASTX-Toolkit implemented in Perl was used to trim the adaptor sequence. The trimmed tags were subjected to quality filtering, so that only tags with sequencing quality higher than 30 for more than 80% of the nucleotides were used for subsequent analysis. For MMSDK tag mapping, we generated a simulated reference library, i.e., BssHII reference library, by in silico enzyme digestion of the human genome (hg19, UCSC) regardless of the methylation state. This library was used as reference for subsequent mapping of the tags in the MMSDK analysis. In the DGE analysis, refMrna (hg19, UCSC) was used as reference for mapping cDNA tags. Subsequently, the BurrowsâWheeler Aligner (BWA) procedure for aligning the MMSDK and DGE tags to the simulated BssHII reference library and refMrna reference library, respectively, was applied.,Genome_build: UCSC hg19,Supplementary_files_format_and_content: Tab-delimited text files (linked as supplementary files on the Series record) include gene expression values (normalized tag number) and DNA unmethylation values (normalized tag number) for each Sample . | DNA was isolated from the cell lines using DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturerâs protocol. Genomic DNA was digested with BssHII followed by ligation to biotinylated linkers and fragmented by NlaIII (New England BioLabs) cleavage. Because BssHII only cuts unmethylated regions, binding of DNA fragments to streptavidin-conjugated magnetic beads allow separation of the unmethylated and methylated fragments. Bound DNA was ligated to another linker (N) containing the MmeI restriction enzyme recognition site, and then digested with MmeI (New England Biolabs) that generates short sequence tags (20-21 bp, due to enzyme cut floating). The resulting tags were ligated with another linker P7 and amplified by PCR with primers N and P7 for 18 cycles.,Total RNA was extracted from the cell lines with TRI Reagent (Sigma) according to the manufacturerâs protocol. The integrity of the extracted RNA was checked by agarose gel electrophoresis, and the concentration of RNA was estimated by spectrophotometry. Then, mRNA is separated from total RNA by poly-T coated beads and converted to cDNA. The cDNA is isolated and subjected to NlaIII digestion followed by N-ligation, MmeI digestion P7-ligation and PCR to prepare a DEG library in a way analogous to that in MMSDK. | GSM998962 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX183875,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01162384 | GSM998962 | GSE40665 | 0.438228 | Breast cancer cell line | Public on Feb 03 2014 | Sep 06 2012 | 9606 | TMAR 8-DGE analysis | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX183875 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01162384 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1000 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999527_DSN-lite.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999527_DSN-lite.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Standard without PCR followed by DSN treatment | GSM999527 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185041,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163395 | GSM999527 | GSE40705 | 0.00199 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | DSN-lite | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185041 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163395 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1000 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999528_DSN-lite_PCR.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999528_DSN-lite_PCR.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Standard followed by DSN treatment | GSM999528 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185046,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163396 | GSM999528 | GSE40705 | 0.008112 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | DSN-lite PCR | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185046 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163396 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1000 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999529_RNase_H.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999529_RNase_H.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: RNase H rRNA-depletion (Morlan et al. PLOS One, 2012) | GSM999529 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185051,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163397 | GSM999529 | GSE40705 | 0.023261 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | RNase H | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185051 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163397 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1000 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999530_RNase_H_NS.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999530_RNase_H_NS.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: RNase H rRNA-depletion (Morlan et al. PLOS One, 2012) | GSM999530 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185056,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163398 | GSM999530 | GSE40705 | 0.025947 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | RNase H NS | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185056 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163398 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1000 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999531_Ribo-Zero.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999531_Ribo-Zero.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Ribo-Zero (Epicentre) | GSM999531 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185061,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163399 | GSM999531 | GSE40705 | 0.028163 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | Ribo-Zero | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185061 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163399 |
|
1 | cell line: K-562,cell type: CML,total rna input: 100 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999532_NuGEN_100f.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999532_NuGEN_100f.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Ovation RNA-Seq (NuGEN) | GSM999532 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185066,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163400 | GSM999532 | GSE40705 | 0.006056 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | NuGEN 100f | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185066 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163400 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1000 ng (10 ng polyA+),rna state: intact | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999533_PolyA.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999533_PolyA.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Oligo (dT) Dynabeads (Invitrogen) | GSM999533 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185071,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163401 | GSM999533 | GSE40705 | 0.01093 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | PolyA | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185071 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163401 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1000 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999534_Total.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999534_Total.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Standard | GSM999534 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185076,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163402 | GSM999534 | GSE40705 | 0.005265 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | Total | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185076 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163402 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1 ng,rna state: intact | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999535_TruSeq.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999535_TruSeq.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: TruSeq RNA-Seq (Illumina) | GSM999535 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185083,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163403 | GSM999535 | GSE40705 | 0.012309 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | TruSeq | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185083 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163403 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1 ng,rna state: intact | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999536_NuGEN_1i.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999536_NuGEN_1i.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Ovation RNA-Seq (NuGEN) | GSM999536 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185088,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163404 | GSM999536 | GSE40705 | 0.020572 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | NuGEN 1i | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185088 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163404 |
|
1 | cell line: K-562,cell type: CML,total rna input: 1 ng,rna state: fragmented | 320 Charles Street | Cambridge | USA | Broad Institute of MIT & Harvard | Joshua,Z,Levin | **********************************************************************,,PROCESSED DATA FILE NAME: GSM999537_NuGEN_1f.genes.results.txt.gz,PROCESSED DATA FILE NAME: GSM999537_NuGEN_1f.isoforms.results.txt.gz,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,Reads where neither mate aligned to rRNA were extracted using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the USCS transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the USCS transcriptome using bowtie version 0.12.7 allowing for one multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quantified using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: rsem sample_name.genes.results and sample_name.isoforms.results documentation on these file formats can be found at http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html,,**********************************************************************,,PROCESSED DATA FILE NAME: GSE40705_K562_Isoform.txt,PROCESSED DATA FILE NAME: GSE40705_K562_gene.txt,Removed rRNA reads by aligning reads to rRNA transcripts using BWA version 0.6.1 using default parameters,We created a set of reads that did not map to rRNA to be used for further processing. To do this, reads where at least one mate did not align to rRNA were extracted for further use using samtools 0.1.9 using the following commands: samtools view -S -b -f 4 -F 264 rRNA.sam > rRNA.1.bam; samtools view -S -b -f 8 -F 260 rRNA.sam > rRNA.2.bam; samtools view -S -b -f 12 -F 256 rRNA.sam > rRNA.3.bam,Output bam files were merged and reads were extracted using Picard,These reads were aligned to the UCSC transcriptome twice. The first alignment was done to create a set of uniquely mapped reads so that they could be downsampled to a fixed number of reads which are known to map to the transcriptome. This was done using bowtie version 0.12.7 allowing for one hit per read. The following parameters were used: -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 16 -k 1 -m 200,This alignment was then downsampled to a fixed number of reads using Picard,The downsampled portion of the reads were then aligned to the UCSC transcriptome using bowtie version 0.12.7 allowing for multiple hits per read. This was the second, final alignment. The following parameters were used: bowtie -q --phred33-quals -v 2 -e 99999999 -l 25 -I 1 -X 1000 -p 15 -a -m 200,Transcripts and genes were quanitifed using RSEM version 1.1.17 run with default settings using the final Bowtie alignment,genome build: UCSC Genome Browser17 knownGene transcript dataset (version 05-Feb-2012),processed data files format and content: Processed data files are tab-delimited files that consist of the transcripts per million (TPM) expression level values as calculated by RSEM. Results are calculated at the gene (sample_gene.txt) and isoform (sample_isoform.txt) file. Each file contains TPM values calculated for each of the protocols listed. | Library construction method: Ovation RNA-Seq (NuGEN) | GSM999537 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185093,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163405 | GSM999537 | GSE40705 | 0.024308 | human CML cell line K-562 grown in tissue culture (Ambion) | Public on May 15 2013 | Sep 07 2012 | 9606 | NuGEN 1f | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185093 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163405 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: F,age at death (y): 67 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999559 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185220,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163599 | GSM999559 | GSE40710 | 0.169624 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185220 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163599 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 49 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999560 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185221,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163600 | GSM999560 | GSE40710 | 0.121795 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185221 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163600 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 87 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999561 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185222,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163601 | GSM999561 | GSE40710 | 0.284243 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185222 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163601 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 78 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999562 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185223,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163602 | GSM999562 | GSE40710 | 0.071031 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185223 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163602 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: F,age at death (y): 52 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999563 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185224,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163603 | GSM999563 | GSE40710 | 0.177607 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 5 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185224 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163603 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 74 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999564 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185225,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163604 | GSM999564 | GSE40710 | 0.059297 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 6 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185225 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163604 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 57 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999565 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185226,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163605 | GSM999565 | GSE40710 | 0.202792 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 7 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185226 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163605 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 89 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999566 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185227,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163606 | GSM999566 | GSE40710 | 0.057619 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 8 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185227 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163606 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 89 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999567 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185228,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163607 | GSM999567 | GSE40710 | 0.068168 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 9 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185228 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163607 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: F,age at death (y): 76 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999568 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185229,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163608 | GSM999568 | GSE40710 | 0.023321 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 10 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185229 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163608 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: F,age at death (y): 80 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999569 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185230,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163609 | GSM999569 | GSE40710 | 0.41487 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 11 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185230 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163609 |
|
1 | tissue: Human brain cortex (BA9),disease state: Control,gender: M,age at death (y): 74 | 650 W. 168th. St. | New York | USA | Columbia University | Herve,,RHINN | Illumina reads were converted to FASTQ Sanger format using FASTQ Groomer (Galaxy),The first 27 bp at their 5âends of the reads were trimmed using FASTQ Trimmer to remove the polyA and adapters sequences,The reads were mapped to human hg19 genome using Burrows-Wheeler Alignment tools with Galaxyâs default settings allowing 4% of missing alignments.,Genome_build: hg19,Supplementary_files_format_and_content: Processed files contain the quantification for each sample of the 5 3'UTR isoforms detected for alpha-synuclein | RNA was extracted from frozen brain tissue using miRNeasy kits (Qiagen) and quantified using a Nanodrop (Thermo). First-strand cDNA was synthesized from 1 μg of RNA per biological sample using SuperScript III (Invitrogen) following manufacturerâs instructions and using the pdT-FS oligonucleotide to prime the reverse transcription. Barcoded first-strand samples from different samples were then pooled and treated with RNase H (Invitrogen) at 37°C for 20 minutes followed by 15 minutes at 75°C to degrade RNA template. First-stand cDNA was then purified using QIAquick PCR Purification kit (Qiagen) in a total volume of 30uL. Second-strand cDNA was synthesized from 25uL of first-strand cDNA template by adding 10 μl 10x buffer 2 (NEB), 5 μl 10 mM dNTPs, 20 U Klenow Fragment (3â â 5âexo-; NEB), 10 μl of 100 μM tagged 2nd strand primer (R-SS oligonucleotide: 5â-TCCGATCTGANNNNNNN-3â with N=A,C,T,G mix) and 46 μl water. The reaction mix was incubated at 37°C for 30 minutes, followed by 10 minutes at 75°C then cooled down at 4°C. Double-stranded cDNA was purified using PureLink PCR micro columns (Invitrogen) in a 30uL volume. Illumina-compatible libraries were then generated by PCR from 25uL of double-stranded cDNA template using Accuprime Pfx polymerase (Invitrogen) following manufacturerâs instruction with NNSR forward (5â-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT-3â) and NNSR reverse (5â-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA-3â) primers. Thermo-cycling conditions were 2 min at 94 °C followed by 2 cycles of 94 °C for 10 s, 40 °C for 2 min, 68 °C for 1 min; 8 cycles of 94 °C for 10 s, 60 °C for 30 s, 68 °C for 1 min; 15 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 1 min with an additional 10 s added at each cycle; and 68 °C for 5 min before cooling to 4 °C. Amplified libraries were purified using PureLink PCR micro columns (Invitrogen) and directly used to generate clusters for sequencing-by-synthesis using the Illumina HiSeq 2000 platform. 100bp single-end reads were obtained by sequencing to generate more than 300 million reads for the 34 samples. | GSM999570 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX185231,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01163610 | GSM999570 | GSE40710 | 0.044569 | Brain cortex | Public on Oct 04 2012 | Sep 08 2012 | 9606 | Control Und. 12 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX185231 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01163610 |